WO2018009809A1 - Extrachromosomal switching auxotrophies progressively by integration (eswap-in) for assembly of dna sequences in yeast - Google Patents

Extrachromosomal switching auxotrophies progressively by integration (eswap-in) for assembly of dna sequences in yeast Download PDF

Info

Publication number
WO2018009809A1
WO2018009809A1 PCT/US2017/041117 US2017041117W WO2018009809A1 WO 2018009809 A1 WO2018009809 A1 WO 2018009809A1 US 2017041117 W US2017041117 W US 2017041117W WO 2018009809 A1 WO2018009809 A1 WO 2018009809A1
Authority
WO
WIPO (PCT)
Prior art keywords
yeast
vector
sequence
seq
selectable marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/041117
Other languages
French (fr)
Inventor
Jef D. Boeke
Leslie A. MITCHELL
Neta Agmon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
New York University NYU
Original Assignee
New York University NYU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New York University NYU filed Critical New York University NYU
Priority to US16/315,844 priority Critical patent/US11814644B2/en
Publication of WO2018009809A1 publication Critical patent/WO2018009809A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/905Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome

Definitions

  • Extrachromosomal Switching yluxotrophies Progressively by integration eSwAP-In
  • eSwAP-In Extrachromosomal Switching yluxotrophies Progressively by integration
  • the disclosure generally relates to enhanced recombinant molecular biological approaches to manipulating genetic content. More particularly the disclosure generally relates to the assembly of multiple large segments of DNA by homologous recombination in yeast assembly of multiple large segments of DNA. BACKGROUND
  • the present disclosure provides compositions and methods for introducing large segments of DNA into yeast by in part taking advantage of the capability of yeast to perform homologous recombination.
  • the segments are assembled in a stepwise fashion using DNA segments that can be homologous recombined in yeast in an order and manner dictated in part by having terminal ends that have homology to one another, but not to the yeast genome in which homologous recombination of the segments occurs, and not to a vector component that is used to circularize the assembled segments and accordingly facilitate their maintenance in yeast as extrachromosomal elements.
  • the invention utilizes consecutive rounds of homologous recombination to introduce additional DNA segments, and to iteratively replace an introduced selectable marker. This allows marker recycling over successive steps as the length of assembled DNA construct becomes progressively longer.
  • the disclosure provides a method as shown in Figure 2, wherein the BAC component is optional, and wherein the LEU2, URA3, and KANr markers are non-limiting illustrations of selectable markers that can be substituted with other auxotrophic or otherwise selectable markers, as will be apparent to those skilled in the art from the present disclosure.
  • the disclosure provides vectors that are depicted in Figure 6, wherein the BAC component is optional, and wherein the particular labeled genetic elements provide non-limiting illustrations of selectable markers and other genetic elements.
  • the disclosure involves use of sequences that are orthogonal to the yeast genome, and are moreover orthogonal to the DNA segments that are recombined in the yeast.
  • the orthogonal sequences are characterized by not being present in the yeast genome in which recombination takes place, and also by having about 45-55% GC content over at least 40bp segment, such as a sliding 40bp window across the length of the segment, which can be up to 200bp, or longer.
  • the orthogonal sequences may also have no homopolymer segments that are longer than 5bp, no instances of
  • a vector and/or a DNA segment(s) that is recombined into a vector in yeast as comprises at least one sequence of at least 40 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:4, or 40 consecutive nucleotides of a sequence that is from 80%-99% similar to at least one of these sequences, provided the sequences remain orthogonal to the yeast genome, and to the DNA segments that are recombined.
  • FIG. 1 SwAP-In (Fig. 1A and IB) compared to eSwAP-In (Fig. 1C and ID).
  • Figure 2 eSwAP-In schematic.
  • FIG. 3 Schematic depicting eSwAP-In to assemble the human de novo purine biosynthetic pathway for expression in yeast.
  • the schematic shows a preassembled construct encoding three transcription units (TU1-TU3) of the de novo purine biosynthetic pathway, a gene to render the pathway essential (SUP61) and one marker cassette (KanMX) in a yeast shuttle vector (marked with LEU2) is expanded by eSwAP-IN using multiple preassembled transcription units (HIS3, TU4-TU7).
  • TUs for eSwAP-IN are flanked by 70bp terminal homology between adjacent parts to enable homologous recombination in yeast (white rectangles with various hatch marks).
  • the left most TU (HIS3) encodes homology to the left of LEU2 on the vector and the right most TU (TU7) is homologous to the right of LEU2.
  • Co- transformation of TUs and vector into yeast followed by selection on medium lacking histidine enable assembly of the 7-gene pathway.
  • Yeast cells are now unable to grow on medium lacking leucine and able to grow on medium lacking histidine as well as media supplemented with G418 (resistance encoded by KanMX).
  • FIG. 4 Schematic depicting eSwAP-In to assembly the ⁇ 100kb human FIPRT gene locus in yeast.
  • Fig. 4A Regulatory elements including CTCF binding sites and DNase hypersensitive elements are shown. Tiling of ⁇ 3 kb amphcons across locus indicated.
  • Fig. 4B 38 X ⁇ 3kb PGR amplicons spanning the lOOkb HPRT locus generated from genomic DNA from HEK293T ceils. Amplicons overlap each other by a minimum of 80bp so as to be compatible with eSwAP-In assembly in yeast. Missing/faint amplicons were generated in a separate experiment using optimized PGR conditions. (Fig. 4A) Regulatory elements including CTCF binding sites and DNase hypersensitive elements are shown. Tiling of ⁇ 3 kb amphcons across locus indicated.
  • Fig. 4B 38 X ⁇ 3kb PGR amplicons spanning the lOOkb HPRT locus generated from genomic DNA from HE
  • step 4C Strategy to assemble HPRT in 3 steps of eSwAP-In.
  • step 4D After each assembly step (steps 1-3), the resulting DNA constructs from yeast were recovered into E. coll. Constructs (step 1 pLM718; step 2 pLM747; step 3 pLM750) were prepped and digested with Pad restriction enzyme. Field inversion gel electrophoresis (FIGE) was used to separate the resulting which ran exactly as predicted (step 1 : 31kb, 16 kb; step 2: 43kb, 24kb, 16kb: step 3 : 46kb, 24kb, 19kb, 16kb, 7kb) .
  • FIGE Field inversion gel electrophoresis
  • FIG. 5A Schematic of the mouse alpha globin locus. Thirty-two ⁇ 4kb PCR amplicons were produced from a previously existing BAC template. Four synthetic modules were designed to delete specific enhancer elements (Aenhl-4) were produced by fusion PCR.
  • Fig. 5B In three steps of eSwAP-In the two loci were assembled. The 5' end of each construct encodes a loxP site (triangle), half of the selectable HPRT gene (3' HPRT) and a FLP site (half triangle left of 3 'HPRT).
  • each construct encodes a thymidine kinase gene (TK) and a heterotypic lox site (triangle). These flanking sequences enable deliver to a pre-existing 'landing pad' sequence in a mouse embryonic stem cell.
  • TK thymidine kinase gene
  • Fig. 5C Predicted Swal digestion patterns for the wild type (WT), synthetic (SYN) and parental B AC sequences.
  • Fig. D Field inversion gel electrophoresis Swal digestion patterns of two independent isolates of WT and SYN alpha globin constructs compared to the parental BAC. Marker sizes are indicated in kilobases (kb).
  • Figure 6A, 6B, and 6C depict genetic parts for maintenance in E. coli which include a kanamycin resistance (KanR) gene plus a bacterial artificial chromosome (BAC) sequence for low copy number maintenance.
  • KanR kanamycin resistance
  • BAC bacterial artificial chromosome
  • the vectors encode a selectable marker (LEU2 as a non-limiting example, but any yeast selectable marker can be used) plus a centromere and autonomously replicating sequence (CEN/ARS).
  • the vectors can be linearized by digestion with I-Scel, which will release the yeast selectable marker and expose left and right assembly arm sequences that are orthogonal in sequence to the yeast genome and to the DNA that is being assembled.
  • I-Scel A puromycin cassette
  • PURO allows for selection in mammalian cells.
  • Fig. 6C The self-replicating viral-based Epstein-Barr cassette
  • compositions of matter including but not necessarily limited to vectors, cloning intermediates, cells, cell cultures, etc.
  • eSwAP-In comprises several features as described further herein.
  • One is the iterative use of two different auxotrophic markers embedded near the right most ends of DNA segments that are designed for stepwise assembly. Each successive round of assembly in yeast overwrites the previously introduced selectable marker, enabling marker recycling as the length of assembled DNA construct becomes progressively longer.
  • a second feature of eSwAP-In is that the DNA of interest is assembled extrachromosomally and thus replicates and segregates independently of the sixteen native yeast chromosomes.
  • eSwAP-In improves upon a previously available approach termed SwAP-In (Dymond et al., 2011; Mitchell et al., 2017; Richardson et al., 2017).
  • a comparison of the SwAP-In approach is generally illustrated in Figure 1, panel A and B, while eSwAP-In is generally illustrated in Figure 1, panel C and D and more specifically in Figure 2.
  • Figure 1 panel A and panel B illustrate SwAP-In to assemble synthetic yeast chromosomes by replacing native chromosomes in a step-wise process with segments of synthetic DNA.
  • megachunks composed of 3-4 smaller DNA segments (i.e., “chunks") each with terminal, non-palindromic, unique restriction sites, are first assembled by in vitro ligation and then transformed into yeast to replace the
  • each megachunk encodes as selectable marker for primary selection and the leftmost chunk overwrites a pre-existing marker (e.g. KanMX in (Fig. 1 panel B)).
  • Chromosomes may be assembled from left to right in sequential steps, alternating between URA3 and LEU2.
  • panels C and D demonstrate the eSwAP-In extrachromosomal aspect of the disclosure, features of which are further illustrated by reference to Figure 1.
  • Step 1 shows a linearized eSwAP-In assembly vector (further details of which are provided in Figure 6) encoding parts for replication and segregation in yeast (centromere, CEN; autonomously replicating sequence, ARS) and E.
  • coli kanamycin resistance, KANr; an optional bacterial artificial chromosome (BAC) sequence
  • BAC bacterial artificial chromosome
  • the leftmost segment encodes terminal sequence homology to an arm of the assembly vector (white box) and the rightmost segment encodes a yeast selectable marker (URA3) plus terminal sequence homology to the other end of the linear assembly vector (hatched box).
  • the terminal sequence homology sequences are orthogonal to the yeast genome, meaning the sequences of the terminal sequences do not occur in the yeast in which the homologous recombination occurs.
  • the terminal homology sequences are also orthogonal to the DNA segments that are assembled using the method of this disclosure, thus the sequence of the terminal homology sequences do not appear in the yeast genome or the DNA segments that are recombined as outlined in Figure 2.
  • Step lb is an alternative to Sept la and allows for the assembly vector to be already present at the start of the process.
  • assembly vectors of this disclosure can be used in intact or linearized form, either of which may be introduced into yeast. In either case, assembly occurs by homologous recombination in yeast with selection on SC-Ura plates, although any other auxotrophic marker could be used instead of Ura.
  • Step 2 the next set of DNA segments for assembly are co-transformed into yeast carrying the assembled construct from Step 1.
  • the left most segment of the incoming DNA in step 2 matches sequence pre-existing from the previous assembly and the right most segment encodes a second selectable marker (LEU2 in this example) plus terminal sequence homology to the eSwAP-IN assembly vector (hatched box). Assembly occurs by homologous recombination in yeast with selection on SC-Leu plates.
  • Step 3 which is similar to Step 2, the next set of DNA segments are co-transformed into yeast but the marker on the left most fragment is switched to URA3. This process can be repeated, switching between URA3 and LEU2 selection markers (or any other distinct marker pairs) until the desired DNA construct is assembled in its entirety.
  • the assembled molecule can be recovered into E. coli or any other bacteria that are known in the art to be suitable for DNA vector propagation.
  • yeast are any species, type or strain of Saccharomyces, including but not limited to
  • Saccharomyces cerevisiae Other yeast or fungi include but are not limited to species in the following genera: Pichia, Candida, Saccharomycopsis, Schizosaccharomyces, Hansenula, Torula, Ashbya, Neurospora, Aspergillus, Penicillium, and Cryptococcus.
  • the disclosure is not particularly limited to any size of DNA that can be made into an extrachromosomal element using the compositions and methods of this disclosure, as depicted in Figure 2, nor is it limited to any particular number of DNA segments that can be recombined using one or more steps of the process.
  • DNA double stranded segments are combined into a vector, wherein such segments can comprise, for example, a first set of linear double stranded DNA segments comprising a first DNA segment, interior DNA segments, and a first terminal DNA segment.
  • from 2-20 double stranded DNA fragments are used.
  • 10-20 double stranded DNA fragments are used.
  • the DNA segments that are recombined comprise from lkb to 100 kb, inclusive, and including all numbers of nucleotides there between. In embodiments, the DNA segments that are recombined having an approximate size of about 3kb-10kb. Further, other than a requirement for genetic elements described herein to make and propagate the recombined vectors as extrachromosomal elements, the sequence of the DNA to the approach is not limiting. In embodiments, the DNA segments comprise RNA polymerase templates, including but not necessarily limited RNA Polymerase II templates.
  • the DNA segments encode mRNA (i.e., protein coding sequences) and can encode any fragment of a protein, a full-length protein, or a combination of proteins and/or peptides, whether or not the combination is intended to function in a combination, or individually.
  • the DNA segments comprise promoters or other genetic regulatory elements, including but not necessarily limited to enhancer elements, and/or elements that have one or more functions that are inducible by applying a stimulus, including but not necessarily limited to a chemical agent such as a drug or other test compound, or a change in nutrients, or an enzymatic substrate, etc., or a detectable marker, such as a protein that produced a visually detectable signal, including but not limited to a fluorescent signal.
  • yeast modified according to the methods of this disclosure can produce useful proteins, and the proteins can moreover participate in the production of nonprotein compounds, such as by enzymatic activity.
  • the DNA segments that in vectors of this disclosure comprise left end and right end sequences that are orthogonal to yeast genome, wherein recombination of the linearized vector and assembled DNA segments takes place as generally shown in Figure 2.
  • the orthogonal sequence is from 40-200 nucleotides in length, inclusive, and including all integers and ranges of integers there between, but longer lengths can be used.
  • a vector and/or a DNA segment described herein can comprise or consist of 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127
  • DNA segments of this disclosure i.e., the assembly arms
  • DNA segments of this disclosure are determined according to the following parameters:
  • sequences do not exist in the yeast genome in which recombination takes place; (ii) the sequences have -45-55% GC content, which can be determined in for example, a 40bp sliding windows across the length of, for example, a 200bp sequence or other length of sequence described herein;
  • the vector and/or a DNA segment that is recombined into a vector in yeast as described herein comprise, for example in assembly arms, at least one sequence that comprises or consists of at least 40 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:4, or a sequence that is from 80%-99% similar to these sequences, provided the sequences remain orthogonal to the yeast genome, and to the DNA segments that are recombined.
  • the sequences are at least 90, 91, 92, 93, 94, or 95% identical to the SEQ ID Nos of this disclosure.
  • the left assembly arm sequence e.g., the white box depicted in Figure 2, on the DNA segments and/or the assembly vector, comprises at least 40 consecutive nucleotides of either:
  • the right assembly arm sequence (e.g., the hatched box depicted in
  • Figure 2 on the DNA segments and/or the assembly vector, comprises at least 40 consecutive nucleotides of either:
  • these orthogonal sequences can be present on a vector (whether circular or linearized) and serve as first and second recombination sequences that are non-homologous to the yeast genome.
  • These orthogonal sequences can also be present in a first set of linear double stranded DNA segments comprising a first DNA segment, interior DNA segments, and a first terminal DNA segment, wherein the first DNA segment comprises at its left end a sequence homologous to the first recombination sequence in the vector (i.e., the white box of Figure 2) and at its right end a sequence that is homologous to a left end of a first interior DNA segment (i.e., the hatched box of Figure 2) such that recombination between linearly recombined DNA segments shown in Figure 2 are recombined appropriately with the homologous sequences in the vector, also depicted in
  • the disclosure comprises assembling DNA segments using the eSwAP-In approach as described herein to obtain yeast that comprise the recombined extrachromosomal elements produced using the method depicted in Figure 2.
  • the disclosure further comprises yeast comprising the recombined
  • the disclosure comprises liquid cell cultures and/or culture plates comprising such modified yeasts.
  • the yeast are cryopreserved, or are subjected to increased temperatures to, for example, analyze temperature sensitive genetic elements.
  • the disclosure comprises cell culture media in which yeasts modified by the eSwAP-In approach are grown. The disclosure includes separating one or more compounds or other substances synthesized by the yeast from the cell culture media, and/or from yeast lysates, and optionally purifying any such compound to any desired degree of purity.
  • the disclosure comprises subjecting yeast made using the eSwAP- In approach as described herein to a stimulus, and determining whether or not the stimulus produces an effect in the yeast that is attributable to the extrachromosomal element.
  • this screening approach is amenable to high-throughput screening, such as by providing a plurality of yeasts in separate reaction chambers, wherein each chamber comprises yeast with distinct extrachromosomal elements assembled by eSwAP-In, and adding one or more distinct test agents to the separate chambers to determine if, for example, a test agent has a particular effect.
  • the disclosure thus comprises determining which of a plurality of DNA segments assembled using eSwAP-In may contribute to or be responsible for a response elicited by a test compound.
  • eSwAP-In in non-limiting illustrations applied to a two-step assembly of a metabolic pathway for expression in yeast ( Figure 3) as well as a three step assembly of a ⁇ 100kb human genomic sequence ( Figure 4) and assembly of wild-type and synthetic versions of the mouse alpha globin locus ( Figure 5).
  • eSwAP-In as described above includes an assembly vector(s) encoding unique sequences to serve as landing pads for assembly plus genetic features that support replication and segregation in both yeast and E. coli.
  • DNA segments of this disclosure comprise landing pads that are used as assembly arms having the sequences described above.
  • This Example demonstrates cloning and assembly of human de novo purine biosynthetic pathway in yeast.
  • This pathway includes 7 transcription units (TUs), each comprised of a human coding sequence (CDS), codon optimized for yeast expression and flanked by the orthologous yeast regulatory sequences.
  • TUs 7 transcription units
  • CDS human coding sequence
  • KanMX one marker cassette
  • HPRTl is a conserved gene with a role in purine biosynthesis. It is well-studied since it can conveniently be selected for (in HAT medium) or against in (6-thioguanine medium), making the presence/absence of functional protein product. Mutation(s) in the HPRTl gene, which is encoded on the human X-chromosome, lead to Lesch Nyhan disorder and gout in humans.
  • Figure 4A With an aim of delivering the -100 kb HPRTl gene to mammalian cells to study regulatory elements associated with the human HPRTl locus (Figure 4A), we devised a strategy to assembly it in yeast using eSwAP-In.
  • This Example demonstrates cloning and assembly of wild-type and synthetic versions of the mouse alpha globin locus.
  • e-SwAP-In to assemble two versions of the -90 kb mouse alpha globin locus in yeast, specifically a wild-type and synthetic mouse alpha globin locus ( Figure 5A).
  • the two x ⁇ 90kb constructs were assembled in parallel from a total of 32 PCR amplicons or synthetic DNA fragments derived from a pre-existing BAC construct or fusion PCR ( Figure 5B).
  • the two constructs are designed for delivery to a previously described locus in a mouse ES cell engineered for 'recombination-mediated genomic exchange' to be compatible with site-specific recombination sequences and selectable/counter-selectable markers in the mouse alpha globin loci built here (Wallace et al., 2007).
  • the synthetic locus is distinct from the wild-type locus as it encodes the deletion of four enhancer elements.
  • the two constructs were assembled in yeast using 3 steps of eSwAP-In ( Figure 5B) and then recovered into . coli and digestion verified (Figure 5C).
  • This Example provides a description of vectors of this disclosure. Specifically, we designed and constructed three eSwAP-In assembly vectors that encode genetic parts for maintenance in both yeast and E. coli ( Figure 6). The three vectors are distinguished by additional parts including a mammalian selection marker (puromycin) and the self-replicating viral-based Epstein-Barr cassette (OriP/EBNA), which allows for long-term episomal persi stance in human cells ( Figure 6B and 6C). All three assembly vectors are further customized specifically for 'inyeasto assembly and encode ⁇ 200bp terminal landing pad sequences, also known as assembly arms, orthogonal in sequence to the yeast genome, and separated from each other another by a yeast selectable marker flanked by l-Scel sites.
  • a mammalian selection marker puromycin
  • OriP/EBNA self-replicating viral-based Epstein-Barr cassette
  • All three assembly vectors are further customized specifically for 'inyeasto assembly and encode ⁇ 200bp terminal landing
  • Digestion with 1-Scel linearizes the eSwAP-In assembly vectors, exposing the terminal landing pads for inyeasto assembly of arbitrary sequence where the right-most fragment encodes a different selectable marker and the termini of the DNA fragments being assembled encode homology to the landing pads.
  • the landing pad sequences in Figure 6 are the same as described above in connection with Figure 2, and thus can comprise any 40-200 or longer DNA sequence that is orthogonal to the yeast genome where
  • the vector sequences comprise or consist of a sequence that is orthogonal to at least one yeast genome, and/or is selected based on the parameters described above, or is at least 40 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or sequences having from 80%-99% similarity thereto, provided the sequences remain orthogonal to the yeast genome.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Compositions, methods and kits are provided. The compositions, methods and kits are for assembly of series of DNA segments in yeast using homologous recombination. The assembled DNA segments are maintained episomally. Yeast made using the methods are included, as are methods of using the yeast to express proteins, and for screening test agents that can affect yeast that are modified to include the assembled DNA segments.

Description

Extrachromosomal Switching yluxotrophies Progressively by integration (eSwAP-In) for Assembly of DNA Sequences in Yeast
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
This invention was made with government support under Grant Number MCB- 1441866 awarded by the National Science Foundation. The government has certain rights in the invention.
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. provisional application no. 62/359,264, filed July 7, 2016, the disclosure of which is incorporated herein by reference. FIELD OF THE DISCLOSURE
The disclosure generally relates to enhanced recombinant molecular biological approaches to manipulating genetic content. More particularly the disclosure generally relates to the assembly of multiple large segments of DNA by homologous recombination in yeast assembly of multiple large segments of DNA. BACKGROUND
There is an ongoing and unmet need to provide compositions and methods for producing large segments of DNA that are useful for a wide variety of applications. The present disclosure is pertinent to this need.
SUMMARY OF THE DISCLOSURE The present disclosure provides compositions and methods for introducing large segments of DNA into yeast by in part taking advantage of the capability of yeast to perform homologous recombination. The segments are assembled in a stepwise fashion using DNA segments that can be homologous recombined in yeast in an order and manner dictated in part by having terminal ends that have homology to one another, but not to the yeast genome in which homologous recombination of the segments occurs, and not to a vector component that is used to circularize the assembled segments and accordingly facilitate their maintenance in yeast as extrachromosomal elements. Thus, the invention utilizes consecutive rounds of homologous recombination to introduce additional DNA segments, and to iteratively replace an introduced selectable marker. This allows marker recycling over successive steps as the length of assembled DNA construct becomes progressively longer.
In certain embodiments the disclosure provides a method as shown in Figure 2, wherein the BAC component is optional, and wherein the LEU2, URA3, and KANr markers are non-limiting illustrations of selectable markers that can be substituted with other auxotrophic or otherwise selectable markers, as will be apparent to those skilled in the art from the present disclosure. In certain embodiments the disclosure provides vectors that are depicted in Figure 6, wherein the BAC component is optional, and wherein the particular labeled genetic elements provide non-limiting illustrations of selectable markers and other genetic elements.
In certain approaches the disclosure involves use of sequences that are orthogonal to the yeast genome, and are moreover orthogonal to the DNA segments that are recombined in the yeast. In embodiments the orthogonal sequences are characterized by not being present in the yeast genome in which recombination takes place, and also by having about 45-55% GC content over at least 40bp segment, such as a sliding 40bp window across the length of the segment, which can be up to 200bp, or longer. The orthogonal sequences may also have no homopolymer segments that are longer than 5bp, no instances of
BsaI:AarI:BceAI:SalI:XhoI:BsmBI:NotI:I-SceI sites, and none of the orthogonal sequences are the same as each other, i.e., the sequences do not fully align to each other. In
embodiments, a vector and/or a DNA segment(s) that is recombined into a vector in yeast as comprises at least one sequence of at least 40 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:4, or 40 consecutive nucleotides of a sequence that is from 80%-99% similar to at least one of these sequences, provided the sequences remain orthogonal to the yeast genome, and to the DNA segments that are recombined.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 : SwAP-In (Fig. 1A and IB) compared to eSwAP-In (Fig. 1C and ID). Figure 2: eSwAP-In schematic.
Figure 3 : Schematic depicting eSwAP-In to assemble the human de novo purine biosynthetic pathway for expression in yeast. The schematic shows a preassembled construct encoding three transcription units (TU1-TU3) of the de novo purine biosynthetic pathway, a gene to render the pathway essential (SUP61) and one marker cassette (KanMX) in a yeast shuttle vector (marked with LEU2) is expanded by eSwAP-IN using multiple preassembled transcription units (HIS3, TU4-TU7). TUs for eSwAP-IN are flanked by 70bp terminal homology between adjacent parts to enable homologous recombination in yeast (white rectangles with various hatch marks). The left most TU (HIS3) encodes homology to the left of LEU2 on the vector and the right most TU (TU7) is homologous to the right of LEU2. Co- transformation of TUs and vector into yeast followed by selection on medium lacking histidine enable assembly of the 7-gene pathway. Yeast cells are now unable to grow on medium lacking leucine and able to grow on medium lacking histidine as well as media supplemented with G418 (resistance encoded by KanMX).
Figure 4: Schematic depicting eSwAP-In to assembly the ~100kb human FIPRT gene locus in yeast. (Fig. 4A) Regulatory elements including CTCF binding sites and DNase hypersensitive elements are shown. Tiling of ~3 kb amphcons across locus indicated. (Fig. 4B) 38 X ~3kb PGR amplicons spanning the lOOkb HPRT locus generated from genomic DNA from HEK293T ceils. Amplicons overlap each other by a minimum of 80bp so as to be compatible with eSwAP-In assembly in yeast. Missing/faint amplicons were generated in a separate experiment using optimized PGR conditions. (Fig. 4C) Strategy to assemble HPRT in 3 steps of eSwAP-In. (Fig. 4D) After each assembly step (steps 1-3), the resulting DNA constructs from yeast were recovered into E. coll. Constructs (step 1 pLM718; step 2 pLM747; step 3 pLM750) were prepped and digested with Pad restriction enzyme. Field inversion gel electrophoresis (FIGE) was used to separate the resulting which ran exactly as predicted (step 1 : 31kb, 16 kb; step 2: 43kb, 24kb, 16kb: step 3 : 46kb, 24kb, 19kb, 16kb, 7kb) . (Fig. 4E) Strategy to screen yeast colonies derived from assembly experiments, focusing on those with the correct genotype (e.g. Leu+/Ura- or Ura+/Leu-). Primers (red arrows) spanning assembly junctions are used to test for presence/absence of amplicons in many independent yeast colonies. (Fig. 4F) One yeast colony from HPRT eSwAP-In step 3
(Ura+/Leu-) was tested with primers for all indicated assembly junctions. Ail expected amplicons are present.
Figure 5. eSwAP-In to assembly wild-type and synthetic versions of the mouse alpha globin locus. (Fig. 5A) Schematic of the mouse alpha globin locus. Thirty-two ~4kb PCR amplicons were produced from a previously existing BAC template. Four synthetic modules were designed to delete specific enhancer elements (Aenhl-4) were produced by fusion PCR. (Fig. 5B) In three steps of eSwAP-In the two loci were assembled. The 5' end of each construct encodes a loxP site (triangle), half of the selectable HPRT gene (3' HPRT) and a FLP site (half triangle left of 3 'HPRT). The 3' end of each construct encodes a thymidine kinase gene (TK) and a heterotypic lox site (triangle). These flanking sequences enable deliver to a pre-existing 'landing pad' sequence in a mouse embryonic stem cell. (Fig. 5C) Predicted Swal digestion patterns for the wild type (WT), synthetic (SYN) and parental B AC sequences. (Fig. D) Field inversion gel electrophoresis Swal digestion patterns of two independent isolates of WT and SYN alpha globin constructs compared to the parental BAC. Marker sizes are indicated in kilobases (kb).
Figure 6. eSwAP-IN assembly vectors. Figure 6A, 6B, and 6C depict genetic parts for maintenance in E. coli which include a kanamycin resistance (KanR) gene plus a bacterial artificial chromosome (BAC) sequence for low copy number maintenance. For replication and segregation in yeast the vectors encode a selectable marker (LEU2 as a non-limiting example, but any yeast selectable marker can be used) plus a centromere and autonomously replicating sequence (CEN/ARS). The vectors can be linearized by digestion with I-Scel, which will release the yeast selectable marker and expose left and right assembly arm sequences that are orthogonal in sequence to the yeast genome and to the DNA that is being assembled. (Fig. 6B and 6C) A puromycin cassette (PURO) allows for selection in mammalian cells. (Fig. 6C) The self-replicating viral-based Epstein-Barr cassette
(OriP/EBNA) enables long-term episomal persistance in human cells.
DESCRIPTION OF THE INVENTION
Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein.
The disclosure includes all steps and compositions of matter described herein in the text and figures of this disclosure, including all such steps individually and in all
combinations thereof, and includes all compositions of matter including but not necessarily limited to vectors, cloning intermediates, cells, cell cultures, etc.
The terms "rightmost" and "right" end, and "leftmost" and "left" end are for convenience of reference and pertain to the figures and embodiments of this disclosure. It will be recognized that the sequences presented herein are given in the 5 '-3' direction, but because the sequences are typically double stranded during operation of the invention they have a complementary sequence that is in the 3 '-5- direction, and such complementary sequences are encompassed by this disclosure. The inherent capacity of S. cerevisiae to perform homologous recombination (HR) can be harnessed for the process of DNA assembly. With a minimum of 40 base pairs of terminal sequence homology encoded by adjacent parts, S. cerevisiae can act as a cloning vehicle and stitch together arbitrary DNA sequences of interest. The present disclosure takes advantage of the HR mechanism to provide, in certain embodiments, processes for assembly of DNA in yeast referred to herein as "eSwAP-In", standing for extrachromosomal Switching v4uxotrophies Progressively by integration.
eSwAP-In comprises several features as described further herein. One is the iterative use of two different auxotrophic markers embedded near the right most ends of DNA segments that are designed for stepwise assembly. Each successive round of assembly in yeast overwrites the previously introduced selectable marker, enabling marker recycling as the length of assembled DNA construct becomes progressively longer. A second feature of eSwAP-In is that the DNA of interest is assembled extrachromosomally and thus replicates and segregates independently of the sixteen native yeast chromosomes.
eSwAP-In improves upon a previously available approach termed SwAP-In (Dymond et al., 2011; Mitchell et al., 2017; Richardson et al., 2017). A comparison of the SwAP-In approach is generally illustrated in Figure 1, panel A and B, while eSwAP-In is generally illustrated in Figure 1, panel C and D and more specifically in Figure 2. In particular, Figure 1 panel A and panel B illustrate SwAP-In to assemble synthetic yeast chromosomes by replacing native chromosomes in a step-wise process with segments of synthetic DNA. Large segments of DNA, referred to herein as "megachunks" composed of 3-4 smaller DNA segments (i.e., "chunks") each with terminal, non-palindromic, unique restriction sites, are first assembled by in vitro ligation and then transformed into yeast to replace the
corresponding native segment (black line in Figure 1, panel A and B) by homologous recombination (represented by the large X in Figure 2 panel A and panel B). The right-most chunk of each megachunk encodes as selectable marker for primary selection and the leftmost chunk overwrites a pre-existing marker (e.g. KanMX in (Fig. 1 panel B)).
Chromosomes may be assembled from left to right in sequential steps, alternating between URA3 and LEU2. Figure 1, panels C and D demonstrate the eSwAP-In extrachromosomal aspect of the disclosure, features of which are further illustrated by reference to Figure 1.
Thus, in contrast to SwAP-In, which modifies native yeast chromosomes, eSwAP-In is used to assemble extrachromosomal constructs that replicate and segregate alongside the native yeast chromosomes. In this regard, Figure 2 provides a non-limiting illustration of an embodiment of the eSwAP-In approach of this disclosure via three Steps. Step 1 shows a linearized eSwAP-In assembly vector (further details of which are provided in Figure 6) encoding parts for replication and segregation in yeast (centromere, CEN; autonomously replicating sequence, ARS) and E. coli (kanamycin resistance, KANr; an optional bacterial artificial chromosome (BAC) sequence) which is co-transformed with multiple overlapping segments of DNA for assembly. The leftmost segment encodes terminal sequence homology to an arm of the assembly vector (white box) and the rightmost segment encodes a yeast selectable marker (URA3) plus terminal sequence homology to the other end of the linear assembly vector (hatched box). The terminal sequence homology sequences are orthogonal to the yeast genome, meaning the sequences of the terminal sequences do not occur in the yeast in which the homologous recombination occurs. The terminal homology sequences are also orthogonal to the DNA segments that are assembled using the method of this disclosure, thus the sequence of the terminal homology sequences do not appear in the yeast genome or the DNA segments that are recombined as outlined in Figure 2. Step lb is an alternative to Sept la and allows for the assembly vector to be already present at the start of the process. Thus, assembly vectors of this disclosure can be used in intact or linearized form, either of which may be introduced into yeast. In either case, assembly occurs by homologous recombination in yeast with selection on SC-Ura plates, although any other auxotrophic marker could be used instead of Ura. In Step 2 the next set of DNA segments for assembly are co-transformed into yeast carrying the assembled construct from Step 1. The left most segment of the incoming DNA in step 2 matches sequence pre-existing from the previous assembly and the right most segment encodes a second selectable marker (LEU2 in this example) plus terminal sequence homology to the eSwAP-IN assembly vector (hatched box). Assembly occurs by homologous recombination in yeast with selection on SC-Leu plates. In Step 3, which is similar to Step 2, the next set of DNA segments are co-transformed into yeast but the marker on the left most fragment is switched to URA3. This process can be repeated, switching between URA3 and LEU2 selection markers (or any other distinct marker pairs) until the desired DNA construct is assembled in its entirety. By assembling DNA sequence extrachromosomally, and in particular in a circular format using eSwAP-In, the assembled molecule can be recovered into E. coli or any other bacteria that are known in the art to be suitable for DNA vector propagation.
The disclosure is not particularly limited to any type of yeast. In embodiments, the yeast are any species, type or strain of Saccharomyces, including but not limited to
Saccharomyces cerevisiae. Other yeast or fungi include but are not limited to species in the following genera: Pichia, Candida, Saccharomycopsis, Schizosaccharomyces, Hansenula, Torula, Ashbya, Neurospora, Aspergillus, Penicillium, and Cryptococcus.
The disclosure is not particularly limited to any size of DNA that can be made into an extrachromosomal element using the compositions and methods of this disclosure, as depicted in Figure 2, nor is it limited to any particular number of DNA segments that can be recombined using one or more steps of the process. In certain embodiments, from 1-100 DNA double stranded segments are combined into a vector, wherein such segments can comprise, for example, a first set of linear double stranded DNA segments comprising a first DNA segment, interior DNA segments, and a first terminal DNA segment. In embodiments, from 2-20 double stranded DNA fragments are used. In embodiments, 10-20 double stranded DNA fragments are used. In embodiments, the DNA segments that are recombined comprise from lkb to 100 kb, inclusive, and including all numbers of nucleotides there between. In embodiments, the DNA segments that are recombined having an approximate size of about 3kb-10kb. Further, other than a requirement for genetic elements described herein to make and propagate the recombined vectors as extrachromosomal elements, the sequence of the DNA to the approach is not limiting. In embodiments, the DNA segments comprise RNA polymerase templates, including but not necessarily limited RNA Polymerase II templates. In embodiments, the DNA segments encode mRNA (i.e., protein coding sequences) and can encode any fragment of a protein, a full-length protein, or a combination of proteins and/or peptides, whether or not the combination is intended to function in a combination, or individually. In embodiments, the DNA segments comprise promoters or other genetic regulatory elements, including but not necessarily limited to enhancer elements, and/or elements that have one or more functions that are inducible by applying a stimulus, including but not necessarily limited to a chemical agent such as a drug or other test compound, or a change in nutrients, or an enzymatic substrate, etc., or a detectable marker, such as a protein that produced a visually detectable signal, including but not limited to a fluorescent signal. Thus, in embodiments, yeast modified according to the methods of this disclosure can produce useful proteins, and the proteins can moreover participate in the production of nonprotein compounds, such as by enzymatic activity.
In certain embodiments, the DNA segments that in vectors of this disclosure comprise left end and right end sequences that are orthogonal to yeast genome, wherein recombination of the linearized vector and assembled DNA segments takes place as generally shown in Figure 2. In embodiments, the orthogonal sequence is from 40-200 nucleotides in length, inclusive, and including all integers and ranges of integers there between, but longer lengths can be used. Thus, in certain embodiments, a vector and/or a DNA segment described herein can comprise or consist of 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200 or more nucleotides in length.
In certain embodiments, DNA segments of this disclosure (i.e., the assembly arms) that are orthogonal to the yeast genome (and to the DNA segments that are recombined) are determined according to the following parameters:
(i) the sequences do not exist in the yeast genome in which recombination takes place; (ii) the sequences have -45-55% GC content, which can be determined in for example, a 40bp sliding windows across the length of, for example, a 200bp sequence or other length of sequence described herein;
(iii) no homopolymer segments that are longer than 5bp
(iv) no instances of BsaI:AarI:BceAI:SalI:XhoI:BsmBI:NotI:I-SceI sites
(v) the sequences for use in the method do not fully align to each other.
In non-limiting embodiments, the vector and/or a DNA segment that is recombined into a vector in yeast as described herein comprise, for example in assembly arms, at least one sequence that comprises or consists of at least 40 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:4, or a sequence that is from 80%-99% similar to these sequences, provided the sequences remain orthogonal to the yeast genome, and to the DNA segments that are recombined. In an embodiments, the sequences are at least 90, 91, 92, 93, 94, or 95% identical to the SEQ ID Nos of this disclosure. In embodiments, the left assembly arm sequence (e.g., the white box depicted in Figure 2, on the DNA segments and/or the assembly vector, comprises at least 40 consecutive nucleotides of either:
TAAGGTAGCTACCAATATTTAGTTTCTAAGCCTTGCGACAGACCTCCCACTTAGA TTGCCACGCATAGAGCTAGCGAGTCAGCGAAAAGCATGACGCGCTTTCAAGCGT GGCGAGTATGTGAACCAAGGCTTCGGACAGGACTATATACTTAGGTTTGATCTCG
CCCCGAGAACTGTAAACCTCAACATTTATAGATTAT (SEQ ID NO: l)
or:
CCCCTTAGGTTGCAAATGCTCCGTCGACGGGATCTGTCCTTCTCTGCCGGCGATC GTGGAGGTACTGGCCTAGCGTCGTGGCCCGGGAGAGACAGTTTAGTAGTGACTC GCGGCTCCGGATCCCTTTCGGTCCATATAGCGGATTTCCATAGACGTAGACCGCG CCAATGTGATTAAGGGGCATACCGTGCCTATCCTGGTAATTGTGTAGGCTACCTG TCTGTATACGCGTACTGGCC (SEQ ID NO:2) In embodiments, the right assembly arm sequence (e.g., the hatched box depicted in
Figure 2, on the DNA segments and/or the assembly vector, comprises at least 40 consecutive nucleotides of either:
TTTAGGGTAGCATCAGGAATCTGAACCCTCAGAAAGTGGGGATCCCGGGTATAG ACCTTTATCTGCGGTTCAAGTTAGGC ATAAGGCTGCATGCTACCTTGTC ACACCT ACACTGCTCGAAGTAAATATGGGAAGCGTGCGACCTGGCTCCAGGCGTTCCGCG CCGCCACGTGTTCGTTAACTGTTGATTGGTGGCACAT (SEQ ID NO:3)
or:
TGACGCTTGGATGCGTGACCCCGTACGTCATGACCCGTCATGGGTATGTAAGCGA AGTTGGCGTTAATTGTAGCTTATTTCCCGCCCTGTGATTGAGGCGGGATGGTGTC CCCATGCACGGCGCTAGGTGTGATATCGTACACTTGGGAGAAGTCAGATACGATT GCGGCTTAGCGGCGCCGGGAAATCCAGCATATTCTCGCGGCCCTGAGCAGTAGG TGTCTCGGGGAGTCTACGTTACACCTGAACTCGCATGTCTGGGGTTGTGGTCAGG CCTTGTCAATT (SEQ ID NO:4)
It will be apparent from the foregoing that these orthogonal sequences can be present on a vector (whether circular or linearized) and serve as first and second recombination sequences that are non-homologous to the yeast genome. These orthogonal sequences can also be present in a first set of linear double stranded DNA segments comprising a first DNA segment, interior DNA segments, and a first terminal DNA segment, wherein the first DNA segment comprises at its left end a sequence homologous to the first recombination sequence in the vector (i.e., the white box of Figure 2) and at its right end a sequence that is homologous to a left end of a first interior DNA segment (i.e., the hatched box of Figure 2) such that recombination between linearly recombined DNA segments shown in Figure 2 are recombined appropriately with the homologous sequences in the vector, also depicted in
Figure 2, as well as in Figure 6.
In embodiments the disclosure comprises assembling DNA segments using the eSwAP-In approach as described herein to obtain yeast that comprise the recombined extrachromosomal elements produced using the method depicted in Figure 2. In
embodiments, the disclosure further comprises yeast comprising the recombined
extrachromosomal elements.
In embodiments, the disclosure comprises liquid cell cultures and/or culture plates comprising such modified yeasts. In embodiments, the yeast are cryopreserved, or are subjected to increased temperatures to, for example, analyze temperature sensitive genetic elements. In embodiments the disclosure comprises cell culture media in which yeasts modified by the eSwAP-In approach are grown. The disclosure includes separating one or more compounds or other substances synthesized by the yeast from the cell culture media, and/or from yeast lysates, and optionally purifying any such compound to any desired degree of purity.
In one embodiment the disclosure comprises subjecting yeast made using the eSwAP- In approach as described herein to a stimulus, and determining whether or not the stimulus produces an effect in the yeast that is attributable to the extrachromosomal element. In embodiments, this screening approach is amenable to high-throughput screening, such as by providing a plurality of yeasts in separate reaction chambers, wherein each chamber comprises yeast with distinct extrachromosomal elements assembled by eSwAP-In, and adding one or more distinct test agents to the separate chambers to determine if, for example, a test agent has a particular effect. The disclosure thus comprises determining which of a plurality of DNA segments assembled using eSwAP-In may contribute to or be responsible for a response elicited by a test compound.
In the Examples of the present disclosure we demonstrate eSwAP-In in non-limiting illustrations applied to a two-step assembly of a metabolic pathway for expression in yeast (Figure 3) as well as a three step assembly of a ~100kb human genomic sequence (Figure 4) and assembly of wild-type and synthetic versions of the mouse alpha globin locus (Figure 5). eSwAP-In as described above includes an assembly vector(s) encoding unique sequences to serve as landing pads for assembly plus genetic features that support replication and segregation in both yeast and E. coli. Thus, in embodiments, DNA segments of this disclosure comprise landing pads that are used as assembly arms having the sequences described above. The following Examples are intended to illustrate but not limit the disclosure.
Example 1
This Example demonstrates cloning and assembly of human de novo purine biosynthetic pathway in yeast. This pathway includes 7 transcription units (TUs), each comprised of a human coding sequence (CDS), codon optimized for yeast expression and flanked by the orthologous yeast regulatory sequences. We first assembled 3 TUs, a gene to render the pathway essential (SUP61) and one marker cassette (KanMX) in a yeast shuttle vector marked with LEU2 by coupling two technologies we developed - yeast Golden Gate (yGG) (Agmon et al., 2015) and Versatile Genetic Assembly System (VEGAS) (Mitchell et al., 2015). Next we individually constructed the remaining four TUs and a marker cassettes (HIS3), each encoding -70 bp of terminal sequence homology between adjacent parts to direct assembly inyeasto (Figure 3). The sequences to the left of HIS3 marker cassette and to the right of KanMX cassette were designed to integrate on either side of the pre-existing LEU2 marker on the shuttle vector carrying the first five pathway TUs. Thus, by co- transforming these five parts into a strain already carrying the five TU construct marked with LEU2, the full nine-gene pathway was assembled (Figure 3). This was achieved by selection on medium lacking histidine and subsequently replica plating on medium lacking leucine to identify His+ colonies no longer capable of growing in the absence of leucine. While this particular and non-limiting example required only one round of eSwAP-In, additional steps could be performed to build pathways encoding any number of genes, as depicted in Figure 2.
Example 2
This Example demonstrates cloning and assembly of the ~100kb HPRTl human gene locus. HPRTl is a conserved gene with a role in purine biosynthesis. It is well-studied since it can conveniently be selected for (in HAT medium) or against in (6-thioguanine medium), making the presence/absence of functional protein product. Mutation(s) in the HPRTl gene, which is encoded on the human X-chromosome, lead to Lesch Nyhan disorder and gout in humans. With an aim of delivering the -100 kb HPRTl gene to mammalian cells to study regulatory elements associated with the human HPRTl locus (Figure 4A), we devised a strategy to assembly it in yeast using eSwAP-In. We generated 38 x -3 kb amplicons spanning the HPRTl locus (Figure 4 A) from human genomic DNA. In three sequential steps, each encompassing 12-13 individual fragments and switching between the Ura+/Leu- and Leu+/Ura- phenotypes (Figure 4B), we assembled HPRTl extrachromosomally in yeast (Figure 4C-F). The constructs resulting from all three assembly steps were recovered into E. coli in order to validate their structure by digestion (Figure 4D). For all three steps, we first screened yeast transformants for the correct auxotrophic marker phenotype (e.g. Ura+/Leu-) and subsequently tested for the presence/absence of correctly assembled constructs based on primers spanning assembly junctions (Figure 4E). The presence of all assembly junction amplicons suggests a correctly assembled clone. We identified an independent yeast colony that encodes the entire -100 kb HPRT1 locus based on assembly junction PCR analysis (Figure 4F).
Example 3
This Example demonstrates cloning and assembly of wild-type and synthetic versions of the mouse alpha globin locus.
In particular, we used e-SwAP-In to assemble two versions of the -90 kb mouse alpha globin locus in yeast, specifically a wild-type and synthetic mouse alpha globin locus (Figure 5A). In three steps of eSwAP-In, the two x ~90kb constructs were assembled in parallel from a total of 32 PCR amplicons or synthetic DNA fragments derived from a pre-existing BAC construct or fusion PCR (Figure 5B). The two constructs are designed for delivery to a previously described locus in a mouse ES cell engineered for 'recombination-mediated genomic exchange' to be compatible with site-specific recombination sequences and selectable/counter-selectable markers in the mouse alpha globin loci built here (Wallace et al., 2007). The synthetic locus is distinct from the wild-type locus as it encodes the deletion of four enhancer elements. The two constructs were assembled in yeast using 3 steps of eSwAP-In (Figure 5B) and then recovered into . coli and digestion verified (Figure 5C).
Example 4
This Example provides a description of vectors of this disclosure. Specifically, we designed and constructed three eSwAP-In assembly vectors that encode genetic parts for maintenance in both yeast and E. coli (Figure 6). The three vectors are distinguished by additional parts including a mammalian selection marker (puromycin) and the self-replicating viral-based Epstein-Barr cassette (OriP/EBNA), which allows for long-term episomal persi stance in human cells (Figure 6B and 6C). All three assembly vectors are further customized specifically for 'inyeasto assembly and encode ~200bp terminal landing pad sequences, also known as assembly arms, orthogonal in sequence to the yeast genome, and separated from each other another by a yeast selectable marker flanked by l-Scel sites. Digestion with 1-Scel linearizes the eSwAP-In assembly vectors, exposing the terminal landing pads for inyeasto assembly of arbitrary sequence where the right-most fragment encodes a different selectable marker and the termini of the DNA fragments being assembled encode homology to the landing pads. The landing pad sequences in Figure 6 (assembly arms) are the same as described above in connection with Figure 2, and thus can comprise any 40-200 or longer DNA sequence that is orthogonal to the yeast genome where
homologous recombination of the DNA segments and the vector takes place. In
embodiments, the vector sequences comprise or consist of a sequence that is orthogonal to at least one yeast genome, and/or is selected based on the parameters described above, or is at least 40 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or sequences having from 80%-99% similarity thereto, provided the sequences remain orthogonal to the yeast genome.
References:
Agmon, N., Mitchell, L.A., Cai, Y., Ikushima, S., Chuang, I, Zheng, A., Choi, W.J., Martin, J. A., Caravelli, K., Stracquadanio, G., et al. (2015). Yeast Golden Gate (yGG) for the Efficient Assembly of S. cerevisiae Transcription Units. ACS synthetic biology 4, 853-859.
Dymond, J.S., Richardson, S.M., Coombes, C.E., Babatz, T., Muller, H., Annaluru, N., Blake, W.J., Schwerzmann, J.W., Dai, J., Lindstrom, D.L., et al. (2011). Synthetic chromosome arms function in yeast and generate phenotypic diversity by design. Nature 477, 471-476.
Mitchell, L.A., Chuang, J., Agmon, N., Khunsriraksakul, C, Phillips, N.A., Cai, Y., Truong, D.M., Veerakumar, A., Wang, Y., Mayorga, M., et al. (2015). Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae. Nucleic acids research 43, 6620- 6630.
Mitchell, L.A., Wang, A., Stracquadanio, G, Kuang, Z., Wang, X., Yang, K., Richardson, S., Martin, J.A., Zhao, Y., Walker, R., et al. (2017). Synthesis, debugging, and effects of synthetic chromosome consolidation: synVI and beyond. Science 355.
Richardson, S.M., Mitchell, L.A., Stracquadanio, G, Yang, K., Dymond, J.S., DiCarlo, J.E., Lee, D., Huang, C.L., Chandrasegaran, S., Cai, Y., et al. (2017). Design of a synthetic yeast genome. Science 355, 1040-1044.
Wallace, H.A., Marques-Kranc, F., Richardson, M., Luna-Crespo, F., Sharpe, J.A., Hughes, J., Wood, W.G, Higgs, D.R., and Smith, A.J. (2007). Manipulating the mouse genome to engineer precise functional syntenic replacements with human sequence. Cell 128, 197-209. While the invention has been described through specific embodiments, routine modifications will be apparent to those skilled in the art and such modifications are intended to be within the scope of the present invention.

Claims

What is claimed is:
1. A method for producing an extrachromosomal element that is capable of assembly in yeast comprising:
a) providing a vector comprising a bacterial selectable marker, optionally a bacterial artificial chromosome sequence (BAC), and a first yeast selectable marker that is flanked by two restriction endonuclease digestion sites, and a centromere and an autonomously replicating sequence (CEN/ARS) that is functional in yeast, the vector comprising first and second recombination sequences that are non-homologous to the yeast genome and wherein the first and second recombination sequences flank the second selectable marker and the two restriction endonuclease sites when the vector is circular, the vector optionally further comprising a selectable marker that is functional in mammalian cells, and optionally further comprising a self-replicating element suitable for maintaining episomal persistence in human cells;
b) introducing into yeast a linearized vector of a) wherein the vector is linearized with a restriction endonuclease that excises the first yeast selectable marker:
a first set of linear double stranded DNA segments comprising a first DNA segment, a set of interior DNA segments, and a first terminal DNA segment, the first DNA segment comprising at its left end a sequence homologous to the first recombination sequence in the vector and at its right end a sequence that is homologous to a left end of a first interior DNA segment, the set of interior DNA segments having successive left end and right end homology to one another, and the terminal DNA segment having at its right end a sequence that comprises a second yeast selectable marker and a sequence that is homologous to the second recombination sequence in the vector, and
c) allowing homologous recombination of the linearized vector with the first DNA segment, the interior DNA segments and the terminal DNA segment such that the vector is circularized in the yeast by the homologous recombination to produce a first recombined vector that is selectable in the yeast using the second yeast selectable marker incorporated into the vector via the terminal DNA segment and further screening for the loss of the first selectable marker;
d) optionally introducing into the yeast comprising the circularized vector of c) a second set of linear double stranded DNA segments comprising interior DNA segments having successive left end and right end homology to one another, and a second terminal DNA segment having at its right end a sequence that comprises the first or a third yeast selectable marker such that the second set of linear double stranded DNA segments and the second terminal DNA segment are homologously recombined into the vector of c) to produce a second recombined vector that is selectable in the yeast by the first or third yeast selectable marker, and subsequently screening for the loss of the first or third selectable marker, and e) optionally repeating step d) with distinct linear double stranded DNA segments that are selectable by a yeast selectable marker not present in the vector of d).
2. The method of claim 1, further comprising performing step d).
3. The method of claim 2, further comprising performing step e).
4. The method of claim 1, wherein the first and second recombination sequences that are non-homologous to the yeast genome comprise at least 40 nucleotides, and wherein the first and second recombination sequences that are non-homologous to the yeast genome are characterized by:
(i) not being present in the yeast genome wherein the homologous recombination occurs;
(ii) have approximately 45-55% GC content in the at least 40 nucleotides;
(iii) contain no homopolymer segments greater than 5 nucleotides in length;
(iv) do not comprise Bsal, Aarl, BceAI, Sail, Xhol, BsmBI, Notl, or I-Scel restriction enzyme recognition sites;
(v) each having distinct sequences from one another.
5. The method of claim 1, wherein at least the first or the second recombination sequence that is non-homologous to the yeast genome comprises at least 40 contiguous nucleotides of a sequence that is at least 80% identical to SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
6. The method of claim 2, wherein at least the first or the second recombination sequence that is non-homologous to the yeast genome comprises at least 40 contiguous nucleotides of a sequence that is at least 80% identical to SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
7. The method of claim 3, wherein at least the first or the second recombination sequence that is non-homologous to the yeast genome comprises at least 40 contiguous nucleotides of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
8. A DNA vector comprising a bacterial selectable marker, optionally a bacterial artificial chromosome sequence (BAC), and a first yeast selectable marker that is flanked by two restriction endonuclease digestion sites, and a centromere and an autonomously replicating sequence (CEN/ARS) that is functional in yeast, the vector comprising first and second recombination sequences that are non-homologous to the yeast genome and wherein the first and second recombination sequences flank the second selectable marker and the two restriction endonuclease sites when the vector is circular, the vector optionally further comprising a selectable marker that is functional in mammalian cells, and optionally further comprising a self-replicating element suitable for maintaining episomal persistence in human cells.
9. The DNA vector of claim 7, wherein the first recombination sequence and/or the second recombination sequence comprises at least 40 contiguous nucleotides that is at least 80% identical to of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
10. A plurality of bacteria or yeast cells comprising a vector of claim 8 or claim 9.
11. A kit comprising the DNA vector of claim 8 or claim 9.
12. Yeast made according to the method of any one of claims 1-7.
13. Cell culture media comprising the yeast of claim 12.
14. A method comprising subjecting yeast of claim 12 to a test compound, and determining whether the test compound has an effect on the yeast.
PCT/US2017/041117 2016-07-07 2017-07-07 Extrachromosomal switching auxotrophies progressively by integration (eswap-in) for assembly of dna sequences in yeast Ceased WO2018009809A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/315,844 US11814644B2 (en) 2016-07-07 2017-07-07 Extrachromosomal switching auxotrophies progressively by integration (eSwAP-In) for assembly of DNA sequences in yeast

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662359264P 2016-07-07 2016-07-07
US62/359,264 2016-07-07

Publications (1)

Publication Number Publication Date
WO2018009809A1 true WO2018009809A1 (en) 2018-01-11

Family

ID=60901645

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/041117 Ceased WO2018009809A1 (en) 2016-07-07 2017-07-07 Extrachromosomal switching auxotrophies progressively by integration (eswap-in) for assembly of dna sequences in yeast

Country Status (2)

Country Link
US (1) US11814644B2 (en)
WO (1) WO2018009809A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240358008A1 (en) * 2021-08-31 2024-10-31 New York University COMPOSITIONS AND METHODS FOR SWITCHING ANTIBIOTIC RESISTANCE MARKERS PROGRESSIVELY FOR INTEGRATION (mSwAP-In)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050148062A1 (en) * 1999-07-01 2005-07-07 Contreras Roland H. Cell death related drug targets in yeast and fungi
US20160046972A1 (en) * 2014-06-17 2016-02-18 New York University Versatile genetic assembly system (vegas) to assemble pathways for expression

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050148062A1 (en) * 1999-07-01 2005-07-07 Contreras Roland H. Cell death related drug targets in yeast and fungi
US20160046972A1 (en) * 2014-06-17 2016-02-18 New York University Versatile genetic assembly system (vegas) to assemble pathways for expression
US20170226532A1 (en) * 2014-06-17 2017-08-10 New York University Versatile genetic assembly system (vegas) to assemble pathways for expression

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANNALURU, N ET AL.: "Total Synthesis of a Functional Designer Eukaryotic Chromosome", SCIENCE, vol. 344, no. 6179, 4 April 2014 (2014-04-04), pages 55 - 58, XP055262780 *
MITCHELL, LA ET AL.: "Versatile genetic assembly system (VEGAS) to assemble pathways for expression in S. cerevisiae", NUCLEIC ACID RESEARCH, vol. 43, no. 13, 8 May 2015 (2015-05-08), XP055343139 *

Also Published As

Publication number Publication date
US20190300909A1 (en) 2019-10-03
US11814644B2 (en) 2023-11-14

Similar Documents

Publication Publication Date Title
Watson et al. Gene tagging and gene replacement using recombinase-mediated cassette exchange in Schizosaccharomyces pombe
Alexander et al. Efficient engineering of marker-free synthetic allotetraploids of Saccharomyces
US20170088845A1 (en) Vectors and methods for fungal genome engineering by crispr-cas9
Puig et al. New constructs and strategies for efficient PCR‐based gene manipulations in yeast
EP2862933B1 (en) Bidirectional promoter
CN107858346A (en) A kind of method for knocking out S. cerevisiae chromosomal
US20240200103A1 (en) Synthetic yeast cells and methods of making and using the same
CN101903531A (en) Yeast strains for protein production
Klabunde et al. Single-step co-integration of multiple expressible heterologous genes into the ribosomal DNA of the methylotrophic yeast Hansenula polymorpha
US11814644B2 (en) Extrachromosomal switching auxotrophies progressively by integration (eSwAP-In) for assembly of DNA sequences in yeast
KR20130098150A (en) Method of generating gene mosaics
US20180179548A1 (en) Molecular biology tools for algal engineering
CN113151339B (en) A gene mutation expression cassette and its application
KR101328481B1 (en) Yeast Expression Vectors for Integration of Chromosome and Uses Thereof
KR20220098155A (en) Nonviral transcriptional activation domains and related methods and uses
CN114540356A (en) Rhodosporidium toruloides promoter and application thereof
CN113584064A (en) Rapid TALE expression vector construction method based on codon degeneracy
WO2020197518A1 (en) Tetrahymena thermophila artificial chromosome 2 (ttac2) and its use in the recombinant protein production
US20230183714A1 (en) Methods for transforming cyanobacteria
KR20130078034A (en) Stable episomal yeast expression vectors and uses thereof
US20080299616A1 (en) Malate Synthase Regulatory Sequences for Heterologous Gene Expression in Pichia
JP3921531B2 (en) Chromosome modification method
CN121204166A (en) Compositions for gene editing and their applications in gene editing
CN116926112A (en) Method for transforming large DNA fragments in physcomitrella patens
CN117230102A (en) Inter-yeast-species shuttle vector and preparation method thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17824986

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17824986

Country of ref document: EP

Kind code of ref document: A1