WO2017223409A1 - Diagnostic and therapeutic methods related to inflammatory bowel diseases - Google Patents

Diagnostic and therapeutic methods related to inflammatory bowel diseases Download PDF

Info

Publication number
WO2017223409A1
WO2017223409A1 PCT/US2017/038950 US2017038950W WO2017223409A1 WO 2017223409 A1 WO2017223409 A1 WO 2017223409A1 US 2017038950 W US2017038950 W US 2017038950W WO 2017223409 A1 WO2017223409 A1 WO 2017223409A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
mdr1
cell
effector
mdrl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/038950
Other languages
French (fr)
Inventor
Mark S. Sundrud
Amber DELMAS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scripps Research Institute
Original Assignee
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scripps Research Institute filed Critical Scripps Research Institute
Publication of WO2017223409A1 publication Critical patent/WO2017223409A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966Animal cells
    • G01N33/56972White blood cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70596Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/06Gastro-intestinal diseases
    • G01N2800/065Bowel diseases, e.g. Crohn, ulcerative colitis, IBS

Definitions

  • IBD inflammatory bowel disease
  • the invention provides methods for quantifying MDR1 activity in T cells of a human subject.
  • the methods entail (a) assaying MDR1 function in at least one MDR1 -expressing effector T cell subsets in a biological sample obtained from the subject, and (b) comparing the assayed MDR1 function to a background MDR1 function determined with at least one control T cell subset that does not express MDR1. This allows a quantitative measurement of MDR1 activity in T cells of the human subject.
  • the MDR1 -expressing effector T cell subset is elected from the group consisting of (i) CD4 + effector/memory T cells (CD4 + Teff, CD4 + CD25 CD45RO + CCR7 l0 ); (ii) CD8 + naive T cells (CD4 CD25 CD45RO CCR7 hi ); (iii) CD8 + effector/memory T cells (CD8 + Teff, CD4 CD25 " CD45RO + CCR7'°); and (iv) CD8 + short-lived effector/memory T cells (CD8 + Temra, CD4" CD25 CD45RO CCR7 10 ).
  • CD4 + effector/memory T cells CD4 + Teff, CD4 + CD25 CD45RO + CCR7 l0
  • CD8 + naive T cells CD4 CD25 CD45RO CCR7 hi
  • CD8 + effector/memory T cells CD8 + Teff, CD4 CD25 " CD45RO +
  • the biological sample contains peripheral blood mononuclear cells from the subject.
  • MDR1 function is assayed via determining the frequency of MDR1 + cells in each T cell subset. In some of these methods, the assayed MDR1 function is the combined MDR1 + cell frequency from the at least one MDR1- expressing effector T cell subsets. In some of these methods, the assayed MDR1 function is the combined MDR1 + cell frequency from effector T cell subsets (i) to (iv). In some methods of the invention, the employed control T cell subset is (i) CD4 + naive T cells (Tnaive,
  • CD4 + CD25 CD45RO CCR7 hi or (ii) regulatory T cells (Treg, CD4 + CD25 hi ) that are present in the same biological sample from the subject.
  • the effector T cell subsets from the biological sample are separated via fluorescence- activated cell sorting (FACS).
  • FACS fluorescence- activated cell sorting
  • MDR1 + cells are determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells of the effector T cell subsets.
  • Some methods of the invention further involve determining MDR1 + activity in cells of the MDR1 -expressing effector T cell subsets that are treated with a MDR1 inhibitor.
  • Some methods of the invention utilize a biological sample that contain cryopreserved peripheral blood mononuclear cells.
  • the determined MDR1 + cell frequency is the combined MDR1 cell frequency from all four effector T cell subsets (i) to (iv) noted above, and MDR1 + cell is determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells in each of the effector T cell subsets.
  • Some methods of the invention are directed to quantifying or monitoring MDR1 + activity in a subject that is afflicted with an inflammatory bowel disease (IBD). In some of these methods, the IBD is Crohn's disease or ulcerative colitis.
  • IBD inflammatory bowel disease
  • the invention provides methods for identifying a human patient with an inflammatory bowel disease (IBD) for treatment with bile acid sequestration therapies. These methods involve (a) obtaining a biological sample containing CD3 + T cells from a candidate IBD patient and from at least one healthy control subject, (b) determining the combined MDR1 + cell frequency in two or more effector T cell subsets in the biological sample consisting of (i) CD4 + effector/memory T cells (CD4 + Teff, CD4 + CD25 CD45RO + CCR7 l0 );
  • CD8 + naive T cells CD4 CD25 CD45RO CCR7 hi
  • CD8 + effector/memory T cells CD8 + Teff, CD4 CD25 CD45RO + CCR7'°
  • CD8 + short-lived effector/memory T cells CD8 + Temra, CD4 CD25 CD45RO CCR7 10
  • the candidate IBD subject is a Crohn's disease patient.
  • the combined MDR1 + cell frequency is combined MDR1 + cell frequency of all effector T cell subsets (i) to (iv).
  • determining the combined MDR1+ cell frequency additionally includes quantifying a baseline MDR1 + cell frequency in at least one control T cell subset that does not express MDR1.
  • the control T cell subset can be (i) CD4 + naive T cells (Tnaive, CD4 + CD25 CD45RO CCR7 hi ) or (ii) regulatory T cells (Treg, CD4 + CD25 hi ) present in the same biological sample.
  • the employed biological sample contains peripheral blood mononuclear cells from the patient.
  • the effector T cell subsets from the biological sample are separated via
  • MDR1 + cell is determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells of the effector T cell subsets.
  • the invention provides methods for treating an inflammatory bowel disease (IBD) in a human patient.
  • the methods entail (a) detecting MDR1 loss-of-function in a candidate IBD patient, and (b) administering to the patient a pharmaceutical composition comprising a therapeutically effective amount of a bile acid sequestrant. This allows treatment of the inflammatory bowel disease in the patient.
  • IBD inflammatory bowel disease
  • MDR1 loss-of-function is detected by (a) obtaining a biological sample containing CD3 + T cells from the candidate patient, (b) determining the combined MDR1 + cell frequency in two or more effector T cell subsets in the biological sample consisting of (i) CD4 + effector/memory (CD4 + Teff, CD4 + CD25 CD45RO + CCR7'°); (ii) CD8 + naive (CD4 CD25 CD45RO CCR7 hi );
  • CD8 + effector/memory CD8 + Teff, CD4-CD25 CD45RO + CCR7' 0
  • CD8 + shortlived effector/memory CD8 + Temra, CD4 " CD25 CD45 RO " CCR7'°
  • FIG. 1 shows Rhl23 efflux as a method for visualizing expression/function of the xenobiotic membrane transporter, MDR1.
  • MDR1 xenobiotic membrane transporter
  • Rhl23 is a membrane permeant vital dye that labels mitochondria. Labeled cells are washed to remove excess dye, and moved to a 37°C incubator to active the MDR1 pump. Cells that express MDR1 efflux Rhl23, and thus lose fluorescence as determined by FACS analysis.
  • FIG. 2 shows discrimination of T cell subsets by flow cytometry. Frozen PBMC from a representative healthy adult donor was thawed and stained with FACS antibodies to discriminate T cell subsets after (1 ) gating on lymphocytes; (2) excluding doublets; and (3) gating on viable CD3+ T cells (exclusion of a membrane impermeant viability dye). 6 T cell subsets are identified: (1) CD4 + naive (Tnaive, CD4 + CD25 CD45RCrCCR7 hi ); (2) regulatory T cells (Treg, CD4 + CD25 hi ); (3) CD4 + effector/memory (CD4 + Teff, CD4 + CD25"
  • CD8 + naive CD4 CD25-CD45RO CCR7 hi
  • CD8 + short-lived effector/memory CD8 + Temra, CD4 CD25 CD45RO CCR7 10
  • FIG 3 shows MDR1 -dependent Rhl23 efflux in human CD3 + T cell subsets.
  • Rhl23 efflux in the 6 T cell subsets as identified as in Figure 2 from a pooled stock of healthy adult PBMC was determined by FACS analysis. Percentage of MDR1 -expressing cells are shown based on background staining in elacridar-treated cells (shaded peaks).
  • the combined frequency of Rhl23 l0 (MDR1 + ) cells in the latter four subsets (CD4 + Teff, CD8 + naive, CD8 + Teff, and CD8 + Temra), calculated as the "cumulative MDR1 score," was used to indicate MDR1 function (expression and activity) in a given PMBC sample.
  • Figure 4 demonstrates assay stability. Cumulative MDR1 score (blue) and percentage of MDR1 + (Rhl23'°) CD4 + Teff cells (red) from 11 independent staining experiments on the same stock PBMC as in Figure 3. Coefficient of variation (CV) is indicated.
  • Figure 5 shows MDR1 function in human subjects.
  • A MDR1 function in male (left) and female (right) human adult controls and IBD patients.
  • B Correlation between MDR1 function and age within healthy human adults (left), UC patients (middle), and CD patients (right). Pearson correlation (r) values are shown for each plot.
  • FIG. 6 shows Rhl23 efflux in mice Teff cells and MDR1 function in human peripheral blood T cell subsets.
  • A MDR1 -dependent Rhl23 efflux in Teff cells (gated as in Fig. 2) from tissues of SAMPl/YitFc, or MHC-matched wild type (WT, AKR) mice.
  • FIG 7 shows MDR1 -dependent Rhl23 efflux in T cell subsets from healthy donor PBMC or the indicated MDR1 10 CD patients identified in Figure 6B analyzed on the same day. Background Rhl23 efflux in healthy control T cell subsets treated with elacridar is shown (shaded peaks).
  • Figure 8 shows age and medication history information of human subjects examined for MDR1 function.
  • A medication history (medications) of UC and CD patients in this cohort.
  • B Age of disease onset of UC and CD patients in this cohort.
  • C MDR1 function in healthy adults, UC patients, and CD patients with or without ileitis that have or have not required surgery.
  • D-F MDRl' 0 CD patients identified in (B) are highlighted blue. * P ⁇ .05, *** P ⁇ .001, **** P ⁇ .0001, one-way ANOVA.
  • IBD Inflammatory Bowel Disease
  • MDR1 gerraline-encoded xenobiotic transporter
  • CBAs conjugated bile acids
  • CBAs are cytotoxic digestive metabolites produced in the liver that recycle through the ileal lamina intestinal during enterohepatic circulation; this involves active reabsorption of luminal CBAs by ileocytes, and is blocked by bile acid sequestrants, such as cholestyramine. Accordingly, bile acid sequestration restores MDR1 -deficient T cell homeostasis in the small intestine and attenuates ileitis. Further, it was found that spontaneous MDR1 loss-of-function is associated with Crohn's disease-like ileitis in SAMPl/YitFc mice, which is also reduced by bile acid sequestration. Thus, immune homeostasis in the ileum involves coordinated, draggable, and tissue-specific interactions between mucosal T cells and circulating bile acids.
  • the inventors further developed a cell-based screen to identify IBD patients that are suitable for bile acid sequestration therapies.
  • the cell-based screen enables identification of subsets of IBD patients displaying loss of MDR1 expression/function.
  • IBD patients displaying MDR1 loss-of-function are predicted to be effectively treatable with bile acid sequestrants, e.g., cholestyramine (CME) or other similar therapeutic modalities that interfere with intestinal bile acid reabsorption.
  • CME cholestyramine
  • the invention accordingly provides diagnostic methods that allow stratification of IBD patients based on MDR1 function as defined in this cell-based assay.
  • the invention additionally provides therapeutic methods that integrate bile acid sequestration therapies with the patient profiling strategy disclosed herein. A more detailed guidance for practicing methods of the invention is provided below.
  • Bile acid sequestrants are a group of resins used to bind certain components of bile in the gastrointestinal tract. They bind to the major bile acids to form an insoluble complex that prevents reabsorption and leads to fecal excretion. Moreover, the depletion of bile acid stores promotes increased bile acid synthesis which reduces the pool of intracellular cholesterol, thereby helping to maintain a lower cholesterol level. Appreciation for the effects of bile acid sequestrants has led to the use of these agents for several other clinical applications, particularly diarrhea of various etiologies.
  • Bile acid sequestration or bile acid sequestration therapy refers to therapeutic use of bile acid sequestrants in patients to bind bile acids in the intestine and increase the excretion of bile acids in the stool. Due to the fact that bile acid sequestrants exert their pharmacologic effect almost exclusively in the GI tract with very little systemic absorption, these agents are generally well tolerated.
  • the therapies were initially developed for the treatment of hypercholesterolemia. The most important role of bile acid sequestrants in the control of GI- related disorders has stemmed from its value in the control of diarrhea related to bile acid malabsorption. This condition has numerous etiologies, including Crohn's disease,
  • cholecystectomy cholecystectomy, ileal resection, vagotomy, and celiac disease.
  • contacting has its normal meaning and refers to combining two or more agents (e.g., polypeptides or small molecule compounds) or combining agents and cells.
  • Contacting can occur in vitro, e.g., combining two or more agents or combining an agent and a cell or a cell lysate in a test tube or other container. Contacting can also occur in a cell or in situ, e.g., contacting two polypeptides in a cell by coexpression in the cell of recombinant polynucleotides encoding the two polypeptides, or in a cell lysate. Contacting can also occur inside the body of a subject, e.g., by administering to the subject an agent which then interacts with the intended target (e.g., a tissue or a cell).
  • the intended target e.g., a tissue or a cell.
  • Inflammation or "inflammatory response” refers to an innate immune response that occurs when tissues are injured by bacteria, trauma, toxins, heat, or any other cause. The damaged tissue releases compounds including histamine, bradykinin, and serotonin.
  • Inflammation refers to both acute responses (i.e., responses in which the inflammatory processes are active) and chronic responses (i.e., responses marked by slow progression and formation of new connective tissue).
  • Acute and chronic inflammation can be distinguished by the cell types involved. Acute inflammation often involves polymorphonuclear neutrophils; whereas chronic inflammation is normally characterized by a lymphohistiocytic and/or granulomatous response.
  • Inflammation includes reactions of both the specific and non-specific defense systems.
  • a specific defense system reaction is a specific immune system reaction response to an antigen (possibly including an autoantigen).
  • a non-specific defense system reaction is an inflammatory response mediated by leukocytes incapable of
  • immunological memory Such cells include granulocytes, macrophages, neutrophils and eosinophils.
  • IBD Inflammatory bowel disease
  • Crohn's disease refers to a group of inflammatory conditions of the colon and small intestine, including Crohn's disease, ulcerative colitis, Behcet's disease, collagenous colitis, diversion colitis, ischemic colitis, and lymphocytic colitis.
  • Crohn's disease (CD) and ulcerative colitis (UC) are the principal types of inflammatory bowel disease.
  • the first clue in the diagnosis of IBD is the symptom such as unrelenting diarrhea, blood or mucus in the stool (more common with ulcerative colitis than Crohn's disease), fever and abdominal pain. However, some of these symptoms may also be present with a parasitic infection, diverticulitis, celiac disease, colon cancer, or other less common conditions.
  • IBDs are diagnosed only after ruling out other possible causes for the symptoms, including ischemic colitis, infection, irritable bowel syndrome (IBS), diverticulitis and colon cancer.
  • IBS irritable bowel syndrome
  • a combination of tests and procedures can be used. These include blood tests for anemia or infection, fecal occult blood test, endoscopic procedures (such as colonoscopy, flexible sigmoidoscopy, upper endoscopy, capsule endoscopy, and double-balloon endoscopy) , and imaging procedures (such as X-ray, CT scan, magnetic resonance imaging (MRI) and small bowel imaging.
  • endoscopic procedures such as colonoscopy, flexible sigmoidoscopy, upper endoscopy, capsule endoscopy, and double-balloon endoscopy
  • imaging procedures such as X-ray, CT scan, magnetic resonance imaging (MRI) and small bowel imaging.
  • CD Crohn disease
  • idiopathic chronic enteritis of unknown origin, and is a disease with non-specific inflammatory symptoms extended from the small intestine to the large intestine. Signs and symptoms often include abdominal pain, diarrhea (which may be bloody if inflammation is severe), fever, and weight loss. Other complications may occur outside the gastrointestinal tract and include anemia, skin rashes, arthritis, inflammation of the eye, and feeling tired. The skin rashes may be due to infections as well as pyoderma gangrenosum or erythema nodosum. Bowel obstruction also commonly occurs and those with the disease are at greater risk of bowel cancer. Diagnosis is based on a number of findings including biopsy and appearance of the bowel wall, medical imaging and description of the disease.
  • Ulcerative colitis is a diffuse non-specific inflammatory disease that mainly invades the mucosa or submucosa of large intestine, frequently forming erosion or ulcer therein.
  • the main symptom of active disease is diarrhea mixed with blood.
  • Ulcerative colitis has much in common with Crohn's disease, but what sets it apart from Crohn's disease is that ulcerative colitis only affects the colon and rectum, rather than the whole GI tract. Ulcerative colitis is an intermittent disease, with periods of exacerbated symptoms, and periods that are relatively symptom-free. Although the symptoms of ulcerative colitis can sometimes diminish on their own, the disease usually requires treatment to go into remission. Although UC has no known cause, there is a presumed genetic risk.
  • the disease may be triggered in a susceptible person by environmental factors. Dietary modification may reduce the discomfort of a person with the disease.
  • Treatment of UC is with anti-inflammatory drugs, immunosuppression, and biological therapy targeting specific components of the immune response. Examples include salazosulfapyridine, adrenocortical steroids, immunosuppressants, and 5-aminosaIicyclic acid (5-ASA).
  • Colectomy (partial or total removal of the large bowel through surgery) is occasionally necessary if the disease is severe, does not respond to treatment, or if significant complications develop.
  • a total proctocolectomy (removal of the entirety of the large bowel and rectum) can cure ulcerative colitis as the disease only affects the large bowel and rectum and does not recur after removal of the latter.
  • Multidrug resistance protein 1 (MDR1), aka P-glycoprotein (permeability
  • glycoprotein 1 P-gp
  • ABSB1 ATP-binding cassette sub-family B member 1
  • CD243 cluster of differentiation 243
  • MDR1 is extensively distributed and expressed in the intestinal epithelium where it pumps xenobiotics (such as toxins or drugs) back into the intestinal lumen, in liver cells where it pumps them into bile ducts, in the cells of the proximal tubule of the kidney where it pumps them into urine-conducting ducts, and in the capillary endothelial cells composing the blood-brain barrier and blood-testis barrier, where it pumps them back into the capillaries.
  • MDR1 is a glycoprotein that in humans is encoded by the ABCB1 gene.
  • T lymphocytes recognize antigens as peptides bound to major histocompatibility complex (MHC) molecules.
  • MHC major histocompatibility complex
  • TCR T-cell receptor
  • Most T lymphocytes express the TCR a- ⁇ and either CD4 or CD8 molecules. These molecules stabilize the TCR-peptide/MHC interaction, are essential for intrathymic selection, and contribute to transmembrane signaling, with important roles in the development and activation of helper and cytotoxic T cells. All T cells originate from haematopoietic stem cells in the bone marrow.
  • Haematopoietic progenitors derived from haematopoietic stem cells populate the thymus and expand by cell division to generate a large population of immature thymocytes.
  • the earliest thymocytes express neither CD4 nor CD8.
  • CD4 + CD8* double-positive thymocytes
  • CD4 + CD8 ⁇ or CD4 " CD8 + ) thymocytes that are then released from the thymus to peripheral tissues.
  • CD4 + CD8* double-positive thymocytes
  • CD4 + CD8 ⁇ or CD4 " CD8 + ) thymocytes that are then released from the thymus to peripheral tissues.
  • T helper (Th) cells assist other white blood cells in immunologic processes, including maturation of B cells into plasma cells and activation of cytotoxic T cells and macrophages, among other functions. These cells are also known as CD4 + T cells because they express the CD4 protein on their surface. Helper T cells become activated when they are presented with peptide antigens by MHC class II molecules that are expressed on the surface of Antigen Presenting Cells (APCs). Once activated, they divide rapidly and secrete small proteins called cytokines that regulate or assist in the active immune response. These cells can differentiate into one of several subtypes, including TH1 , TH2, TH3, TH17, or TFH, which secrete different cytokines to facilitate a different type of immune response. The mechanism by which T cells are directed into a particular subtype is poorly understood, though signaling patterns from the APC are thought to play an important role.
  • Cytotoxic T cells destroy virally infected cells and tumor cells, and are also implicated in transplant rejection. These cells are also known as CD8 + T cells since they express the CD8 glycoprotein at their surface. These cells recognize their targets by binding to antigen associated with MHC class I, which is present on the surface of nearly every cell of the body. Through IL-10, adenosine and other molecules secreted by regulatory T cells, the CD8 + cells can be inactivated to an anergic state, which prevent autoimmune diseases such as experimental autoimmune encephalomyelitis. Memory T cells are a subset of antigen-specific T cells that persist long-term after an infection has resolved.
  • Memory T cells comprise two subtypes: central memory T cells (TCM cells) and effector memory T cells (TEM cells). Memory cells may be either CD4 + or CD8 + .
  • Memory T cells typically express the cell surface protein CD45RO.
  • subject for purposes of diagnosis or treatment refers to any animal classified as a mammal, e.g., human and non-human mammals. Examples of non-human animals include dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, and etc. Unless otherwise noted, the terms "patient” or “subject” are used herein interchangeably. Preferably, the subject is human. Unless otherwise noted, human patient and human subject are used interchangeably herein.
  • treating includes the administration of compounds or agents to a subject to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease (e.g., an inflammatory disorder such as IBD), alleviating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder.
  • a disease e.g., an inflammatory disorder such as IBD
  • Subjects in need of treatment include those already suffering from the disease or disorder as well as those being at risk of developing the disorder.
  • Treatment may be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease.
  • a therapeutic agent may directly decrease the pathology of the disease, or render the disease more susceptible to treatment by other therapeutic agents.
  • the invention provides methods for monitoring or quantifying MDR1 activity (or MDR1 expression/function) in human subjects.
  • the methods can be used to monitor MDR1 activity in human IBD patients such as ulcerative colitis (UC) patients and Crohn's disease (CD) patients.
  • the MDR1 activity to be monitored in the methods of the invention refers to the net efflux pump activity of the MDR1 protein in a target cell or a population of cells (e.g., a population of an effector T cell subset).
  • a modified MDR1 activity can be the result of altered expression or cellular level of the protein and/or the biochemical function of the protein.
  • quantifying MDR1 activity in IBD patients can allow the clinician to identify patients with MDR1 loss-of- function that are suitable for bile acid directed therapies.
  • monitoring MDR1 activity in IBD patients undergoing treatment can enable assessment of efficacy of the treatment.
  • MDR1+ cells are determined via contacting or labeling the cells with a probe or MDR1 substrate which can pumped out of the cell by a functional MDRl protein.
  • the effector T cells are typically isolated from a biological sample obtained from the patient.
  • the biological sample can be mononuclear cells from a peripheral blood sample from the patient as exemplified herein.
  • the MDRl -expressing effector T cell subsets for assessing frequency of MDRl + cells include (1) CD4+
  • effector/memory T cells (Teff, CD4+CD25-CD45RO+CCR71o), (2) CD8+ naive T cells (CD8+CD25-CD45RO-CCR7hi), (3) CD8+ effector/memory T cells (Teff, CD8+CD25- CD45RO+CCR7lo), and (4) CD8+ short-lived effector T cells (Temra, CD8+CD25- CD45RO-CCR71o).
  • the different T cell subsets can be readily separated with appropriate antibodies against the various surface markers and flow
  • the frequency of MDRl + cells in at least 2 of these MDRl -expressing effector T cell subsets is determined. In some other embodiments, the frequency of MDR1 + cells in at least 3 of the MDRl -expressing effector T cell subsets is determined. In some preferred embodiments, the frequency of MDRl + cells in all 4 of the MDRl -expressing effector T cell subsets is determined. In various embodiments, the determined MDRl activity in the biological sample (e.g., PMBC sample) is based on the combined MDR1 + cell frequency (or "cumulative MDRl score") in the examined effector T cell subsets.
  • MDRl is an ATP-dependent efflux pump with broad substrate specificity. Any xenobiotic compounds or agents that are transported by MDRl across the cell membrane may be used in the methods of the invention for detecting MDR1 + cells.
  • the substrate used for monitoring MDRl activity is a labeled probe or detectable agent.
  • the cells can be labeled with fluorescent dyes such as Rhodaminel23 (Rhl23) or MitoTracker under conditions (e.g., low temperature such as 4°C) that MDRl is inactive. After washing the cells to remove excess dye, MDRl activity can then be determined by quantifying MDR1 + cells under conditions (e.g., high temperature such as 37°C) that MDR1 is active.
  • MDR1 + cells will display little or significantly diminished fluorescence signal (Rhl23 " or Rhl23'°) as the substrate is pumped out by active MDR1 protein. Similar to the sorting of the different T cell subsets from the biological sample obtained from the IBD patients, MDR1 + (Rhl23 ⁇ ) cells in the T cell subsets can also be readily determined and quantified via fluorescence-activated cell sorting (FACS) as exemplified herein.
  • FACS fluorescence-activated cell sorting
  • the methods can also include one or more T cell subsets that do not express MDR1.
  • the methods of the invention can also include
  • control T cell subsets are obtained from the same subject.
  • the control cells are isolated from the same biological sample (e.g., PMBC sample) from which the MDR1 -expressing effector T cell subsets are isolated.
  • baseline or background MDR1 activity may be additionally controlled with the same MDR1 - expressing effector T cells in the presence of a MDR1 inhibitor.
  • background efflux of a fluorescent MDR1 substrate can be quantified using MDR1- expressing cells treated with MDR1 antagonist elacridar.
  • Some methods of the invention are intended for use in identifying human subjects with MDR1 loss-of-function in the MDR1 -expressing T cells. Some of these methods are directed to screening IBD patients for bile acid sequestration therapies.
  • MDR1 activity (cumulative MDR1 score) determined with MDR1 -expressing cells from the subject is compared to that of a positive control value.
  • the positive control value is the determined value with the sample biological sample (e.g., PMBC cells) from one or more healthy subjects via the same assay.
  • the mean MDR1 activity determined from a group of healthy subjects is used as the positive control value.
  • one or more MDR1 ' T cell subsets from the candidate IBD patient and the healthy control can be included in the assay to determine baseline MDR1 activity.
  • the methods can further include assaying MDR1 activity in the same MDR1 -expressing T cell subsets that are treated with a MDR1 antagonist. Once the cumulative MDR1 score of the MDR1 -expressing T cell subsets from the candidate patient is determined, it is compared to the control cumulative MDR1 score determined with the MDR1 -expressing T cell subsets from the healthy control subjects.
  • some methods of the invention also include determination of the mean value and standard deviation ("s.d.") of the cumulative MDR1 scores of the healthy control subjects.
  • a substantial departure or statistically significant deviation means at least 1.5 x s.d. below the mean value of the healthy control subjects.
  • a substantial departure means at least 2 x s.d. or 2.5 x s.d. below the mean control value.
  • a substantial departure means at least 3 x s.d. or 3.5 x s.d. below the mean control value.
  • a substantial departure means at least 4 x s.d. or more below the control value. If the MDR1 activity (cumulative MDR1 score) in an IBD patient (e.g., a CD patient) substantially departs from that of the control subjects, the patient is identified as having MDR1 loss-of-function relative to that of the healthy control subjects.
  • the invention provides therapeutic methods for treating a subset of IBD patients that have impaired or diminished MDR1 activity (or MDR1 loss-of- function).
  • MDR1 loss-of- function combined the diagnostic methods described herein and bile acid sequestration therapies.
  • IBD patients can be first screened for MDR1 activity in effector T cell subsets as described herein. Patients who are determined to have MDR1 loss-of-function are then subject to treatment with a bile acid sequestration therapy. The patients are typically administered with a pharmaceutical composition that contains a therapeutically effective amount of a bile acid sequestrant.
  • Several well-known bile acid sequestrants can be readily employed in the therapeutic regimen for the subject.
  • bile acid sequestrants examples include cholestyramine (CME) (Questran, Prevalite), colestipol (Colestid, Flavored Colestid), and colesevelam (Welchol).
  • CME cholestyramine
  • Clinical protocols for using bile acid sequestrants have been developed in the treatment of a number of gastrointestinal diseases or disorders. See, e.g., Taylor et al., J. Infect. Dis. 1980;141 :92-7, 1980; Fromm and Malavolti, Clin. Gastroenterol. 15:567-82, 1986; Pusl et al., Clin. Rev. Allergy Immunol. 28:147-57, 2005; Puleston et al., Gut. 54:441-2, 2005; Westergaard et al., Curr. Treat.
  • CD Crohn's disease
  • Crohn's disease is a disease of chronic inflammation that can involve any part of the gastrointestinal tract. Commonly, the distal portion of the small intestine, i.e., the ileum, and the cecum are affected. In other cases, the disease is confined to the small intestine, colon, or anorectal region. CD occasionally involves the duodenum and stomach, and more rarely the esophagus and oral cavity. Several features are characteristic of the pathology of CD. The inflammation associated with CD, known as transmural inflammation, involves all layers of the bowel wall.
  • Thickening and edema typically also appear throughout the bowel wall, with fibrosis present in long-standing forms of the disease.
  • the inflammation characteristic of CD is discontinuous in that segments of inflamed tissue, known as "skip lesions," are separated by apparently normal intestine.
  • linear ulcerations, edema, and inflammation of the intervening tissue lead to a "cobblestone" appearance of the intestinal mucosa, which is distinctive of CD.
  • CD Crohn's disease
  • the diagnostic and/or therapeutic methods of the invention are directed to patients with ulcerative colitis (UC).
  • Ulcerative colitis is a disease of the large intestine characterized by chronic diarrhea with cramping, abdominal pain, rectal bleeding, loose discharges of blood, pus, and mucus.
  • the manifestations of UC vary widely.
  • a pattern of exacerbations and remissions typifies the clinical course for about 70% of UC patients, although continuous symptoms without remission are present in some patients with UC.
  • UC ulcerative colitis
  • left-sided colitis describes an inflammation that involves the distal portion of the colon, extending as far as the splenic flexure. Sparing of the rectum or involvement of the right side ⁇ proximal portion) of the colon alone is unusual in UC.
  • the inflammatory process of UC is limited to the colon and does not involve, for example, the small intestine, stomach, or esophagus.
  • UC is distinguished by a superficial inflammation of the mucosa that generally spares the deeper layers of the bowel wall. Crypt abscesses, in which degenerated intestinal crypts are filled with neutrophils, are also typical of UC.
  • UC ulcerative colitis
  • Indeterminate colitis is another clinical subtype of IBD that includes both features of CD and UC. Such an overlap in the symptoms of both diseases can occur temporarily (e.g., in the early stages of the disease) or persistently (e.g., throughout the progression of the disease) in patients with IC.
  • Clinically, IC is characterized by abdominal pain and diarrhea with or without rectal bleeding. For example, colitis with intermittent multiple ulcerations separated by normal mucosa is found in patients with the disease.
  • kits or pharmaceutical combinations for carrying out the methods described herein.
  • the kits can be readily used in profiling IBD patients for those that are suitable for bile acid sequestration therapies.
  • the kits of the invention typically contain reagents for determining MDR1 activity in a biological sample, e.g., via Rhl23 efflux assay as described herein.
  • kits can include reagents for collecting a biological sample (e.g., PMBC cells) from patients, an agent for labeling the cells in the biological sample for determining MDR1 function via a suitable assay (e.g., fluorescent label RJhl23 for Rh 123 efflux assay), and monoclonal antibodies for gating the different T cell subsets in flow cytometry analysis.
  • a suitable assay e.g., fluorescent label RJhl23 for Rh 123 efflux assay
  • monoclonal antibodies for gating the different T cell subsets in flow cytometry analysis.
  • the kits can optionally include control biological samples (e.g., PMBC cells) that are obtained from healthy subjects.
  • the diagnostic kits can further include packaging material for packaging the reagents and a notification in or on the packaging material.
  • the kits can additionally include appropriate instructions for use and labels indicating the intended use of the contents of the kits. The instructions can be present on any written material or recorded material supplied on or with the kit or which otherwise accomp
  • Mdrl -dependent dye efflux and a novel CRISPR-generated reporter mouse show that Mdrl is also expressed in mouse Thl 7 and Thl cells in vivo, where it is increased in the small intestine lamina intestinal, highest in the ileum, and induced by CD 103* dendritic cells (DCs)
  • Immune competency requires naive CD4 + TH cell differentiation into functionally distinct subsets of cytokine-secreting effector (Teff) cells (Nakayamada et al., 2012). These subsets, which include IFNy-producing Thl cells and IL- 17-secreting Thl 7 cells, also down- regulate lymphoid homing receptors and up-regulate tissue homing chemokine receptors and integrins, which drives egress out of secondary lymphoid organs and migration into inflamed peripheral tissues. Unlike most non-lymphoid tissues, mucosal tissues such as the intestine are continuously exposed to potentially pathogenic stimuli. As such, Teff cells circulate in and out of the intestinal lamina limbal at steady state (Morton et al., 2014).
  • Teff cells Presence of pro-inflammatory Teff cells in the intestinal mucosa is potentially deleterious, and exaggerated cytokine expression by Thl 7 and Thl cells is associated with pathogenesis of inflammatory bowel diseases (IBDs) (Kaser et al., 2010). Accordingly, numerous mechanisms are deployed to actively suppress Teff cell function in the gut, the vast majority of which involve symbiotic interactions with commensal bacteria (Huttenhower et al., 2014; Longman et al., 2013).
  • IBDs inflammatory bowel diseases
  • commensal microbes restrict trafficking of intestinal CX 3 CR1 + phagocytes to mesenteric lymph nodes to prevent TH cell priming against enteric antigens (Diehl et al., 2013).
  • commensal species produce short-chain fatty acids (e.g., butyrate) or polysaccharide A to stimulate peripheral development of Foxp3 + T regulatory (pTreg) cells and IL- 10-expression (Arpaia et al., 2013; Mazmanian et al., 2008; Round and Mazmanian, 2010).
  • Microbiota also direct conversion of intestinal pTregs into CD4 + CD8aa + intraepithelial lymphocytes (CD4IEL) for additional control over mucosal immune homeostasis (Sujino et al., 2016).
  • Still other enteric bacteria have pro-inflammatory functions.
  • Segmented filamentous bacteria (SFB) for example, promote Thl7 cell development and induce IL-17 expression by these cells in the ileum (Atarashi et al., 2015; Ivanov et al., 2009; Sano et al., 2015).
  • SFB colonization in mice is associated with pathogenesis of both intestinal and systemic inflammatory diseases (Kriegel et al., 201 1 ; Stepankova et al., 2007; Teng et al., 2016; Wang et al., 2015).
  • major translational initiatives are now underway to characterize the human microbiome in both healthy individuals and patient cohorts, and to test the efficacy of microbiota-directed therapies (e.g., fecal transplantation) in human inflammatory diseases.
  • BAs bile acids
  • Chofmann and Hagey 2014
  • BAs are stored in the gall bladder and deposited into the duodenum in response to food intake, where they aid in digestion by emulsifying cholesterol and other insoluble dietary lipids (Hofmann and Hagey, 2014).
  • BAs and in particular those conjugated to the amino acid glycine or taurine, are actively reabsorbed in the terminal ileum by specialized enterocytes expressing the apical bile acid transporter, Asbt (gene symbol SlclOal) (Dawson et al., 2003; Dawson et al., 2009). Actively recycled BAs accumulate in the ileal mucosa and ultimately transit into portal veins for re-circulation back to the liver. This enterohepatic circulation of BAs— first described in the 1960's - establishes that the ileal mucosa is the only mammalian tissue exposed to high extracellular
  • MDR1 ATP-binding cassette (ABC)-containing xenobiotic transporter
  • ABSCB1 ATP-binding cassette
  • Thl7 and Thl cells ATP-binding cassettes
  • MDR1 is a plasma membrane- associated ATP-dependent efflux pump best known for expression in drug-resistant tumor cells, where it effluxes structurally unrelated chemotherapeutic compounds (Gottesman et al., 2002).
  • mice lacking Mdrla are prone to spontaneous colitis (Panwala et al., 1998), which has been ascribed to defects in both epithelial and hematopoietic compartments (Maxwell et al., 2015; Staley et al., 201 1).
  • polymorphisms in the gene encoding human MDR1 (ABCB1) have been sporadically associated with IBDs (Annese et al., 2006).
  • MDR1 remains widely regarded as a dedicated "drug handler" (Borst and Schinkel, 2013; Schinkel, 1997).
  • orthologs of MDR1 are present in bacteria, suggesting that this transporter has broader and more fundamental functions in cell biology beyond interfacing with 20 th century pharmaceuticals.
  • Mdrl regulates Thl 7 and Thl cell function selectively in the ileum; TH cells lacking Mdrl— due to germline ablation (Abcb la/lb ' ' ) or shRNAmir-mediated knockdown— transfer Crohn's disease-like ileitis in Rag] ' ' ' hosts and overexpress several pro-inflammatory cytokines in the ileum, most notably TNFa and IFNy.
  • both increased expression and selective function of Mdrl in the ileum is independent of microbiota, as judged by experiments in germ free wild type mice and antibiotic-treated Ragl ⁇ ' ⁇ mice.
  • Mdrl acts specifically in the presence of conjugated BAs to suppress Thl 7 and Thl cell cytokine expression and enforce survival. Accordingly, mucosal homeostasis of Mdrl -deficient Thl 7 and Thl cells in vivo is rescued by either genetic ablation of the ileal BA transporter, Asbt, or dietary administration of the BA sequestrant, cholestryramine, both of which prevent active reabsorption of luminal BAs into the ileal mucosa. Finally, we show overt MDR1 loss-of-function in both ileitis-prone (SAMPl/YitFc) mice and a subset of patients with ileal Crohn's disease. Thus, in addition to interacting with local microflora, lymphocytes employ specialized functions in the ileum to prevent potentially pathogenic interaction with mucosa-associated BAs.
  • Mdrl is preferentially expressed by Thl 7 and Thl cells in the ileum
  • MDR1 function in vivo involves complex interaction with unknown metabolites, we sought to interrogate the immunologic function of this transporter using in vivo mouse models rather than human cell culture systems.
  • Mdrl expression in mouse lymphocyte is both poorly characterized and important to understand when considering function.
  • efflux of the fluorescent Mdrl substrate rhodamine 123 (Rhl23) (Ludescher et al., 1992) as a surrogate for expression, we found that - as in humans (Ramesh et al., 2014) - Mdrl is expressed in a portion of endogenous mouse Teff cells at steady state.
  • Rhl 23 efflux in Teff cells is due to Mdrl , and not related transporters, as: (/ * ) Rhl23 efflux is abolished by treatment with the Mdrl antagonist, elacridar (Hyafil et al., 1993), (//) Rhl23 efflux is absent in Teff cells from Mdrl -deficient (FVB.
  • Rhl23 efflux is still an indirect measure of Mdrl expression.
  • commercial antibodies are neither suitable for flow cytometry nor specific for mouse Mdrl over related transporters. Therefore, to enable direct and specific tracking of Mdrl expression in mouse lymphocytes, we employed CRISPR/Cas9 genome editing in wild type C57B1/6 (B6) zygotes (Wang et al., 2013; Yang et al., 2013) to generate an Mdrl fluorescent reporter mouse.
  • ametrine expression in splenic TH cells from reporter mice is largely restricted to CD44 hl Teff cells, and faithfully discriminates those with high-level Mdrl transport (Rhl23 efflux) activity and Abcbla gene expression.
  • Mdrl is increased markedly in Teff cells from small intestine lamina basement (siLP) compared with counterparts from colon lamina basement (cLP) or other tissues, including spleen and mesenteric lymph nodes (MLN), or bone marrow, lung, liver, and skin (data not shown).
  • Mdrl expression in small intestinal Teff cells is evident in wild type mice of several genetic backgrounds (e.g., B6, FVB, BALB/c) (data not shown), and in Ragl " mice injected with wild type or Mdrl -reporter naive TH cells.
  • Teff cell expression of Mdrl increases in a gradient fashion from proximal to distal, with highest expression observed in the ileum.
  • Teff cells e.g., Thl, Th2, Thl 7
  • DCs intestinal dendritic cells
  • Mdrl expression in ex vrvo-sorted Mdrl' Teff cells is induced in vitro upon co-culture with small intestinal CD1 lc + DCs, but not small intestinal CD1 lb + CDl lc " macrophages or CD1 lc + DCs from spleen.
  • Intestinal DCs that induce Mdrl expression in Teff cells in vitro are heterogeneous for expression of CD 103 and CX3CRI .
  • only purified CD103 + DCs, and not CX3CR1 + phagocytes induce Mdrl in co-cultured Teff cells.
  • Mdrl expression in Teff cells in vivo is independent of microbiota; high-level Teff cell expression of Mdrl is evident in siLP from germ free (GF) mice, as well as mice lacking toll-like receptor (Myd88 ⁇ ' ⁇ ) or inflammasome (Asc 1 ' ⁇ signaling components. Accordingly, intestinal DCs from both specific pathogen-free (SPF) and GF mice induce Mdrl expression in co-cultured Teff cells. Thus, Mdrl expression is a locally acquired and prominent trait of Thl7 and Thl cells infiltrating the ileum.
  • Mdrl selectively regulates T cell junction and inflammation in the ileum
  • Naive TH cells lacking Mdrl induce more aggressive weight loss upon transfer into Rag] ' ' mice than wild type counterparts. Inflammation in this transfer model is generally restricted to the colon (Ostanin et al., 2009), and indeed, both wild type and Mdrl -deficient TH cells induce severe colitis. However, Mdrl -deficient T H cells also induce marked ileitis, whereas wild type TH cells do not.
  • ileitogenic function of Mdrl -deficient TH cells is independent of microbiota; depletion of enteric bacteria with broad- spectrum antibiotics has little impact on weight loss in Ragl''' mice transplanted with Mdrl -deficient TH cells, and these mice still display ileitis. Accordingly, ileitis transferred by Mdrl -deficient TH cells in untreated Ragl " mice is not transmissible by co- housing, and is not associated with dysbiosis, as judged by 16S rDNA sequencing. By contrast, antibiotics strongly attenuate weight loss and colitis in Ragl" ' mice injected with wild type TH cells. Importantly, shRNAmir-mediated knockdown (Fellmann et al., 2013) of Mdrl in wild type TH cells also leads to increased weight loss and ileitis in transferred Ragl' 1 ' mice.
  • Mdrl -deficient RORyt + (Thl 7) and RORyt " (mostly Thl) Teff cells recovered from siLP of transferred Rag1 -/- mice display pronounced over-expression of TNFa and IFNy vs. wild type counterparts.
  • Mdrl -deficient Thl 7 cells in siLP also display increased IL-17A production compared with wild type Thl 7 cells.
  • cytokine expression in Mdrl -deficient vs. wild type Thl 7 and Thl cells is specific to the small intestine and occurs irrespective of antibiotic treatment.
  • TNFa over-expression in Mdrl -deficient vs. wild type Thl 7 and Thl cells is most conspicuous in the distal small intestine (i.e., ileum).
  • shRNAmir-mediated Mdrl knockdown in wild type Teff cells also triggers TNFa and IFNy over-expression in siLP of transferred Ragl ⁇ ' ⁇ mice, compared with those expressing a control shRNAmir against Cd8a (shCD8).
  • Mdrl intrinsically regulates Tefif cell homeostasis in siLP, as judged by congenic transfer experiments where Rag1 -/- mice are transplanted with mixtures of untransduced, shCD8 -expressing, and shMdrl -expressing cells discriminated by different retroviral reporters (e.g., GFP, ametrine). Compared with bystander control cells, Mdrl knockdown drives increased Teff cell expression of TNFa and IFNy, but only in siLP.
  • retroviral reporters e.g., GFP, ametrine
  • TH cell functional parameters are not impacted by Mdrl -deficiency in vivo, including development of RORyt + Thl7 cells and Foxp3 + pTregs, expression of tissue-homing chemokine receptors (CCR6, CXCR3, CCR9), and integrins ( ⁇ 4 ⁇ 7), and expression of IL- 10 and IL-22, cytokines involved in suppressing intestinal inflammation and enforcing epithelial barrier function, respectively (Davidson et al., 1996; Dudakov et al., 2015).
  • Mdrl expression enforces mucosal Thl 7 and Thl cell homeostasis in the ileum and suppresses inflammation.
  • Mdrl interacts with conjugated bile acids
  • metabolites that interact with Mdrl could be of host or bacterial origin.
  • Mdrl a.k.a., bile salts
  • BAs a.k.a., bile salts
  • bile acids are an abundant class of lipophilic detergents synthesized by hepatocytes in the liver and restricted to the small intestine due to active reabsorption in the ileum (Dawson et al., 2009).
  • BAs are also cytotoxic to cells at high extracellular concentrations, as in the case of cholestatic liver diseases where BA accumulation in the liver leads to hepatocellular necrosis, inflammation, and liver failure (Poupon et al., 2000). Indeed, siLC from wild type mice— but not cLC— is cytotoxic to cultured TH cells. Two results confirm that BAs are the principal Mdrl -interacting metabolites within siLC. First, BA levels are equivalent in siLC from GF and SPF mice, and both GF and SPF siLC interact with Mdrl .
  • cholic acid CA
  • chenodeoxycholic acid DAA
  • lithocholic acid LCA
  • BA conjugation decreases cytotoxicity and membrane permeability, whilst enabling Asbt-dependent reabsorption in the ileum (Dawson et al., 2003; Dawson et al., 2009;
  • CBAs modulate Mdrl function reversibly, without affecting mRNA (Abcbla, Abcblb) or protein expression (data not shown).
  • both mouse siLC and synthetic CBAs interact with human MDR1 - whether ectopically expressed in Mdrl " mouse embryonic fibroblasts, or endogenously expressed in primary human CD4 + Teff cells.
  • CBAs interact with Mdrl indirectly; they are neither direct transport substrates nor inhibitors. CBAs do not compete for Mdrl binding with established chemotherapeutic substrates (e.g., vinblastine, verapamil), and do not stimulate Mdrl ATPase activity in vitro (Swartz et al., 2013). At the same time, Mdrl transport activity is required for Teff cell homeostasis in the presence of CBAs (see below), indicating that CBAs are not Mdrl antagonists.
  • chemotherapeutic substrates e.g., vinblastine, verapamil
  • Mdrl transport activity is required for Teff cell homeostasis in the presence of CBAs (see below), indicating that CBAs are not Mdrl antagonists.
  • Mdrl regulates T cell homeostasis in the presence of conjugated bile acids
  • CBAs suppress pro-inflammatory cytokine expression in Teff cells via Mdrl.
  • glycine- and taurine-conjugated CBAs e.g., CDCA
  • both glycine- and taurine-conjugated CBAs acutely inhibit TNFy expression in ex vivo- stimulated Teff cells in dose- and Mdrl -dependent manners.
  • unconjugated B As suppress TNFa expression in both wild type and Mdrl -deficient Teff cells consistent with the fact that only CBAs interact with Mdrl .
  • Mdrl transport function is important for TNF ⁇ regulation in Teff cells exposed to CBAs.
  • inhibiting Mdrl transport activity with elacridar in wild type Teff cells increases TNFa expression in the presence - but not absence — of CBAs.
  • EL4 requires ectopic expression of transport-competent human MDR1 (hMDRl); CBAs do not repress TNFa expression in parental EL4 cells, EL4 cells expressing an empty retrovirus, or EL4 cells expressing a transport-deficient human MDR1 mutant (AMDRl ; Y401 A/Y1044A) (Kim et al., 2006). EL4 cells were used for these experiments because ectopic expression of mouse or human MDR1 is not tolerated in primary TH cells.
  • hMDRl transport-competent human MDR1
  • AMDRl transport-deficient human MDR1 mutant
  • Teff cells do not express the known cell surface CBA receptor, Tgr5 (Pols et al., 2011), and unlike Mdrl, Teff cell expression of TNFa in the presence of CBAs in vitro or in the small intestine in vivo is not influenced by Tgr5-deficiency.
  • MDR1 transport activity also enforces Teff cell survival in the face of more chronic CBA exposure.
  • the basic Rhl 23 efflux assay is schematically depicted in Figure 1.
  • PBMCs peripheral blood mononuclear cells
  • the screen uses cryopreserved (frozen) peripheral blood mononuclear cells (PBMCs) from healthy donors or IBD patients. It was found that the process of freezing and thawing PBMC does not affect the assay (data not shown).
  • the screen measures the combined frequency of MDR1 + cells within all MDR1- expressing human CD4 + and CD8 + T cell subsets to better reflect germline- encoded function.
  • CD4+ naive T cells CD4+CD25-CD45RO-CCR7hi
  • CD4+ regulatory T cells Treg, CD4+CD25hi
  • CD4+ effector/memory T cells Teff, CD4+CD25-CD45RO+CCR71o
  • CD8+ naive T cells CD8+CD25-CD4SRO-CCR7hi
  • CD8+ effector/memory T cells CD8+CD25-CD4SRO-CCR7hi
  • CD8+ effector/memory T cells Teff, CD8+CD25- CD45RO+CCR71o
  • CD8+ short-lived effector T cells Temra, CD8+CD25- CD45RO-CCR71o
  • each healthy control or IBD patient sample is split into 2 equal parts after Rhl 23 labeling and prior to Rhl 23 efflux at 37°C.
  • the first half of cells have nothing added (i.e., media alone), whereas the second half of cells are treated with the selective MDR1 antagonist, elacridar (Hyafil et al., Cancer Res. 1993 Oct l ;53(I 9):4595-602).
  • elacridar the selective MDR1 antagonist
  • SAMP1 /YitFc mice are one of the only pre-clinical models of spontaneous Crohn's disease-like ileitis.
  • SAMP Teff cells are MDRl-null (Fig. 6A).
  • MDR1 function is reduced in both male and female CD patients (Fig. 5A), and decreases with age in CD and UC patients, but not in healthy adults (Fig. 5B).
  • MDR1 function is not influenced by IBD-related surgeries (e.g., bowel resections), or medication history.
  • MDRl function is lowest among CD patients with treatment-refractory ileitis (i.e., have required surgical intervention) (Fig. 8C), including two of the three MDRl 10 CD patients; the third was only recently diagnosed. Together, these data suggest that MDR1 function influences CD susceptibility and disease severity.
  • Example 3 MDR1 regulates T cell homeostasis in the presence of conjugated bile acids
  • MDR1 interacts with small intestinal CBAs
  • loss or knockdown of MDR1 in Teff cells leads to increased TNFa and IFNy expression in the small intestine
  • CBAs suppress pro-inflammatory cytokine expression via MDR1.
  • both glycine- and taurine-conjugated CDCA acutely inhibit TNFa expression in ex vzw-stimulated Teff cells in dose- and MDR1 -dependent manners.
  • Teff cells do not express Tgr5 in vivo, and neither germline ablation nor shRNA-mediated knockdown of Tgr5 affects Teff cell TNFa expression in the presence of CBAs in vitro or in the small intestine in vivo.
  • MDR1 transport activity is important for CBA-dependent TNFa suppression.
  • inhibition of MDR1 function in wild type Teff cells via elacridar increases TNFa expression in the presence, but not absence, of tauro-chenodeoxycholic acid (tCDCA).
  • tCDCA tauro-chenodeoxycholic acid
  • tCDCA-mediated inhibition of TNFa expression in the MDR1 " mouse T cell lymphoma line EL4 requires ectopic expression of transport-competent human MDR1 (hMDRl); tCDCA does not repress TNFa expression in parental EL4 cells, EL4 cells expressing an empty retrovirus, or EL4 cells expressing a transport-deficient MDR1 mutant. EL4 cells were used for these experiments because constitutive MDR1 expression is not tolerated in primary TH cells. Finally, tCDCA down-regulates Tnf mRNA expression in an MDR1 -dependent manner, indicating regulation of gene expression.
  • MDR1 transport activity also enforces ⁇ cell survival in the face of more chronic CBA exposure, consistent with the fact that loss or knockdown of MDR1 results in impaired Teff cell persistence in vivo.
  • tCDCA kills 80-90% of ex v/vo-isolated wild type TH cells after 18-24 hours.
  • the surviving 10-20% of tCDCA-treated TH cells are uniformly MDR1 + Teff cells, judged either by Rhl23 efflux in wild type cells, or ametrine expression in MDRl-reporter cells.
  • MDR1 transport activity by elacridar abolishes wild type Teff cell survival in the presence of long-term tCDCA treatment, but has no effect on survival in the absence of tCDCA.
  • MDR1 -deficient TH cells do not survive chronic tCDCA exposure, even in the absence of elacridar.
  • Prolonged survival of EL4 cells in the presence of tCDCA also requires ectopic expression of transport- competent hMDRl .
  • Example 4 Bile acid sequestration remedies MDR1 -deficient TH cell dysfunction in vivo
  • CME treatment (0 suppresses ileitis; (it) increases MDR1 -deficient Teff cell persistence in small intestine; and (Hi) reduces TNFa and ⁇ expression by MDR1 -deficient Thl and Thl7 cells in the small intestine.
  • Bile acid sequestration can have systemic effects on metabolism, confounding analysis of weight loss; reduced BA recirculation to the liver stimulates de novo BA biosynthesis by hepatocytes, reduces cholesterol, and shows metabolic benefit in animal models of obesity and diabetes.
  • CME does not impact T H cell- induced colitis, and has no effect on Teff cell function outside of the small intestine.
  • bile acid sequestrants such as cholestyramine (CME) (Arnold et al., 2014) - that bind CBAs in the intestinal lumen and prevent their reabsorption into the ileal lamina intestinal - could be pharmacologically useful to limit mucosal dysfunction of Mdrl -deficient Teff cells and reduce associated ileitis without inducing systemic immune suppression.
  • CME cholestyramine
  • CME does not attenuate colitis in this model, CME has only modest effects on weight loss, albeit more so in Ragl _/ " mice transplanted with Mdrl -deficient TH cells where ileitis is reduced. CME also normalizes TNFa and IFNy expression between wild type and Mdrl -deficient Thl7 and Thl cells in siLP without influencing Teff cell cytokine expression outside of the small intestine.
  • BA sequestration can have broader effects on host metabolism in the liver (Bhat et al., 2003; Fan et al., 2014; Hofmann and Hagey, 2014), these results are consistent with the notion that BA sequestration also acts locally in the ileum to prevent pathogenic interactions between mucosa-associated CBAs and Mdrl -deficient Teff cells.
  • SAMP1 /YitFc (SAMP) mouse is one of the only pre-clinical models of spontaneous Crohn's disease -like ileitis (Pizarro et al., 2003). SAMP ileitis occurs with 100% penetrance by 30 weeks of age, and displays histologic similarity to CD ⁇ Rodriguez-Palacios et al., 2015).
  • SAMP Teff cells display increased TNFa and IFNy expression in siLP, and transfer ileitis in SCID recipients (Kosiewicz et al., 2001 ; Marini et al., 2003). SAMP ileitis also develops under germ free conditions, indicating disease pathogenesis does not require enteric bacteria (Barnes et al., 2007). Using Rhl23 efflux as a measure of Mdrl function, we found that SAMP Teff cells are indeed Mdrl -null.
  • Mdrl loss-of-function in SAMP mice parallels expression of an altered Abcbl a transcript that is present at reduced levels compared to MHC-matched wild type (AKR) mice and that lacks exon 23 by sequence alignment ( Figure 7B).
  • Exclusion of exon 23 from SAMP Abcbl a mRNA is not due to a genomic deletion (Rodriguez-Palacios et al., 2014), which is consistent with a previously reported retroviral insertion found near the 5' boundary of Abcbl a exon 23 in other SAMP-related strains (Zhang et al., 2008).
  • MDR1 function is also reduced in circulating T cells from Crohn's disease (CD) patients compared to either healthy adults or ulcerative colitis (UC) patients.
  • This measure of MDR1 function incorporates the combined frequency of Rhl 23'° (MDR1 + ) cells within all MDR1 -expressing human CD4 + and CD8 + T cell subsets to better reflect germline-encoded function (CD4 + Teff cells, CD8 + naive T cells, CD45RO + and CD45RO " CD8 + Teff cells).
  • MDR1 loss-of- function i.e., cumulative MDR1 function scores ⁇ 3 standard deviations below the healthy donor mean.
  • MDR1 10 CD patients show impaired transport activity in all MDR1 -expressing T cell lineages; they also show atypically low MDR1 function relative to other patients of similar age, and have unique medication histories.
  • all three MDR1 lo CD patients were diagnosed at an earlier than average age, and two of these patients have a history of aggressive small bowel disease requiring surgical intervention; the third MDRl '° patient was only recently diagnosed upon presenting with ileitis. That deficiencies in MDR1 function are observed in humans and enriched for within ileal CD patients is both predicted by our animal studies, and supportive of the notion that MDR1 has unique functions that safeguard immune homeostasis in the ileum.
  • Thl 7 and Thl cells adapt upon migration into the lamina intestinal tract. Ileal adaptation involves upregulation of the xenobiotic membrane transporter, Mdrl , and permits homeostasis in the presence of locally recycled bile acids.
  • CD4 + effector/memory (Teff) lineages particularly Thl 7 cells, are recognized for displaying functional plasticity following initial differentiation; plasticity referring to instances where Teff cells of one lineage (e.g., IL-17A + Thl 7 cells) modify effector cytokine expression to take on characteristics of another lineage (e.g., IFNg expression) (Nakayamada et al., 2012).
  • Tregs upregulate expression of the nuclear receptor, PPARg, to suppress diabetogenic inflammation (Cipolletta et al., 2012).
  • Tregs in skeletal muscle and lung upregulate amphiregulin (Areg) to facilitate tissue-repair following injury (Arpaia et al., 2015; Burzyn et al., 2013).
  • Tregs upregulate expression of ST2, a component of the IL-33 receptor, to suppress colitogenic Teff cell function (Schiering et al., 2014).
  • Mucida and colleagues showed that Tregs adapt to the intestinal epithelium by converting to CD4 4 CD8aa + intraepithelial lymphocytes (Sujino et al., 2016).
  • Our results suggest that adaptation within non-lymphoid tissues is a common feature of circulating lymphocytes, which highlights the impact of the tissue microenvironment on lymphocyte function, raises important new concepts in the pathogenesis of tissue-specific inflammatory diseases, and predicts that tissue-specific immune modulation is possible in patients.
  • a defining feature of enterohepatic CBA circulation is active reabsorption in the ileum by specialized enterocytes expressing the CBA transporters Asbt—that mediates transport of luminal CBAs across the apical membrane of enterocytes - and OSTa/b, which drives basolateral CBA transport from the enterocyte cytoplasm into the lamina intestinal (Dawson et al., 2009). Because of their fundamental activities in digestion and nutrient absorption, CBAs have evolved to be synthesized in the liver and reabsorbed in the ileum independent of microbiota (Hofmann and Hagey, 2014).
  • CBAs e.g., taurine- or glycine-conju gated chenodeoxycholic acid
  • taurine-conjugated chenodeoxycholic acid (tCDCA) in our in vitro experiments because it is both a hydrophobic primary BA
  • CBAs are membrane impermeant detergents that influence cell physiology primarily by disrupting plasma membrane architecture (Jean- Louis et al., 2006; Zhou et al., 2009; Zhou et al., 2013).
  • Mdrl is a broad-specificity "lipid flippase", capable of transporting diverse phospholipid species from the inner to outer membrane leaflet (Sharom et al., 2005).
  • the closest homologue of human MDR1 is ABCB4, a dedicated phosphatidylcholine (PC) transporter that secretes PC into bile in a manner that is indirectly stimulated by CBAs (Morita and Terada, 2014; Vasiliou et al., 2009).
  • Mdrl regulates ileitis in a manner that depends on genetic context is also evident in mice.
  • Mdrl -deficiency in T H cells
  • Ragl -deficiency to promote ileitis on the FVB background.
  • spontaneous ileitis has not been reported in FVB Abcbla ' ' ' mice that instead are prone to colitis (Panwala et al., 1998; Staley et al., 201 1).
  • mice Wild type C57B1/6 (B6; stock no. 000664), B6.Ragl " (stock no. 002216), IU 7a Cre (stock no. 016879), SAMP 1 /YitFc (stock no. 009355), and AKR/J (stock no.
  • mice were purchased from The Jackson Laboratory.
  • ROSA26 ACD2 transgenic mice were generously provided by Dr. Klaus Rajewsky (Max Delbruck Center for Molecular Medicine, Berlin, Germany).
  • Ill 7a Cre mice were crossed with ⁇ R.OSA26 hCD2 transgenic animals to produce lll7a +/Cre ROSA26 + ' 1,CD2 Thl 7 fate-mapping reporter mice.
  • Wild type FVB/N (FVB; model no. FVB) and FVB Abcbla/lb '1' (model no. 1487) mice were purchased from Taconic.
  • FVB.Ragl ⁇ ' ⁇ mice were provided by Dr. Allan Bieber (Mayo Clinic, Rochester, MN).
  • BALB/c mice were from CLEA (Japan) and maintained under specific pathogen-free (SPF) or germ-free (GF) conditions at Osaka University.
  • mice were generated as described in Takeuchi et al., Immunity 1 1, 443-451 , 1999; and Yoshida et al., Immunity 15, 569-578, 2001. The mice were maintained at Osaka University. Tgr5 knockout (Gpbarl '-/-) mice were generously provided by Dr.
  • mice were generated at Rodent Genetic Engineering Core (RGEC) at New York University (NYU) (see below). All mice were housed, bred, used in experiments, and sacrificed in accordance with protocols approved by the Institutional Animal Care and Use Committees of Scripps Florida, Osaka University, or NYU Medical Center.
  • RGEC Rodent Genetic Engineering Core
  • NYU New York University
  • mice were generated using the Cas9-cleavase system in wild type C57B1/6 zygotes. Briefly, two guide RNAs (gRNAs) were identified using a publically available CRISPR design tool (http://cri spr.mit. edu) . These gRNAs are predicted to introduce single- stranded nicks on opposite DNA strands 22 bp upstream and 10 bp downstream of the
  • HDR homology-directed DNA repair
  • AOHs were then assembled into an ampicillin-resistant cloning vector (pSTBlue-1, Novagen) together with bicistronic reporter elements in the following order: 5' AOH (no Abcbla stop codon)— glycine-serine-glycine (GSG) linker (in-frame, 5 * - GG ATCCCGA-3 ' ) -P2A peptide (in-frame, 5'- GCCACGAACTTCTCTCTGTTAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTC CT-3')— ametrine open reading frame (in-frame, with stop codon)— 3 * AOH. Correct assembly was confirmed by sequencing, and the linear HDR template was excised from pSTBlue-1 (Pmel and Notl), and gel purified for zygote injections.
  • Approximately 150 C57B1/6 zygotes were generated by in vitro fertilization (1VF), and micro-injected with gRNAs (10 ⁇ g each), linearized HDR template (10 Dg), and Cas9- cleavase mRNA (10 ⁇ g).
  • 76 zygotes were gown to the 400-cell blastocyst stage and implanted into 8-week old female surrogate mothers; live pups were analyzed for transgene insertion using 5' (5 '-AGTTTAACGTGTCTGCAGCTGG-3') and 3' (5'- AGCCTGC AGG ATCTGTCTG-3 ') genotyping primers that anneal outside of the targeted region.
  • 19 live pups were recovered from the targeting; one female founder pup showed targeted transgene insertion by genotyping.
  • mice Mouse single mononuclear cell suspensions were prepared from spleen, peripheral lymph nodes, or mesenteric lymph nodes (MLN) as described in Uhlig et al. J. Immunol. 177, 5852-5860, 2006.
  • CD4 + CD25 " T cells were magnetically isolated total splenocytes using an EasySep T cell negative isolation kit (Stem Cell Technologies, Inc.).
  • CD4 + CD25 ⁇ T cells from spleens of donor mice were magnetically enriched as above, and then FACS-sorted to obtain pure naive T cells (CD3 + CD4 + CD25-CD62L hi CD44'°).
  • mononuclear cells were isolated by 70/30% percoll gradient centrifugation (Sigma-Aldrich). Mononuclear cells were washed twice in complete T cell medium (see cell culture below), counted, and resuspended for FACS analysis or sorting.
  • mononuclear cells from spleen or small intestinal lamina basement were recovered as previously described s ", incubated with blocking antibodies (anti-CD 16/32) for 5 min at 4°C, stained with antibodies against CD45, CD1 lb, and CD1 lc, and sorted based on differential CD1 lb/CD 1 l c expression with the CD45 + gate. Splenic dendritic cells were sorted as CD45 + CD1 lc + CDl lb " . Rhl23 hi (MDR1 ) or Rhl23 10 (MDR1 4 ) Teff cells
  • T cell transfer colitis For T cell transfer experiments using wild type FVB or FVB Abcb la/lb '1' mice, 0.5-1 x 10 6 naive CD4 + T cells (FACS-sorted as above) were injected (i.p.) into syngeneic WQ.Ragl ' ' ' mice.
  • FACS-sorted as above For transfers of shCD8- or shMdrl - expressing T cells, magnetically isolated FVB wild type CD4 + CD25 " T cells were transduced in vitro (see below), FACS-sorted as live (viability dye " ) ametrine + cells on day 5 post- activation, and 0.5-1 x 10 6 cells were injected (i.p.) into syngeneic FVB.
  • mice For shRNA mixture experiments, transduced T cells were FACS-sorted on day 5 as live (viability dye " ) ametrine " GFP ⁇ cells (for untransduced cells), or ametrine + or GFP + cells (for transduced cells). Sorted cells were counted, mixed at 1 : 1 : 1 ratios (untransduced:GFP + :ametrine + ), and checked by FACS to confirm equimolar ratios. 0.3-0.6 x 10 6 total mixed cells were injected (i.p.) into syngeneic mice. For all experiments, Rag1 -/- mice were weighed
  • mice were weighed twice weekly for the duration of the experiments, and euthanized if > 20% baseline weight loss was reached.
  • Morbidity indexes shown throughout, are calculated by dividing the maximum percentage of body weight loss by the number of days weight loss occurred in (e.g., 20% body weight loss/45 days).
  • Rag1 -/- mice injected with different donor T cells i.e., wild type vs. Mdrl -deficient T cells; shCD8- vs. shMdrl -expressing T cells
  • mice were separated into groups receiving water alone, or water containing antibiotics: ampicillin (1 M), vancomycin (0.5 M), metronidazole (1 M), neomycin (1 M), streptomycin (2 M) (all from Sigma- Aldrich).
  • Antibiotic treatment began ⁇ 3-4 weeks post-transfer (upon onset of weight loss); water (+/-antibiotics) was replaced twice weekly during assessment of weights.
  • CME cholestyramine
  • Standard chow pellets were ground to a fine powder using a Vitamix Professional Series 200 food processor (VitaMix), and separated, weighed, and supplemented with 2% CME resin (w:w) as necessary.
  • solid food was removed and replaced with covered feeding containers (Ancare Corporation) containing powder food (+/- CME), which were placed inside the cages and exchanged for cleaning at least weekly.
  • RNA Assay protocol was followed per manufacturer's instructions without deviation; following fixation/perm eabilization, cells were stained with alexa fluor 647-conjugated (type 1) and alexa fluor 488 -conjugated (type 4) target probes against mouse Tnf (NM_013693) and beta actin (Actb, NM 007393), respectively.
  • Rhl23 efflux To determine background Rhl23 efflux, the MDR1 antagonist, elacridar (0.1 ⁇ ), was added to Rhl 23-labelled cells immediately prior to efflux at 37°C.
  • elacridar 0.1 ⁇
  • intestinal content small intestine luminal content (SILC)
  • colon luminal content CLC
  • synthetic bile acids Rhl23-labelled cells were treated with additives prior to efflux in place of elacridar.
  • Anti-mouse antibodies used for FACS analysis include: Alexa700- CD45, BV650-CD3, BV71 1 -CD4, BV605-CD25, Percp-Cy5.5-CD44, BV605-CD62L, APC- IFNy, APC-F4/80, APC-CD4, FITC-IL-17A, Percp-Cy5.5-IL- 17A, PE-Cy7-TNFa, PE-IL-4, PE-CD45, PE-CD63, PE-CX3CRI , Pacific Blue-CDl lb (all from Biolegend); mouse Fc Block (purified anti-CD16/32), PE-CF594-CD25 and PE-CF594-RORyt, PE-Siglec-F, PE- Ly-6G, FITC-Ly-6C, FITC-CD103, APC-CDl l c, APC-CD45 (from BD); and e450-Foxp3, FITC-I
  • Anti-human antibodies used for FACS analysis were: BV605-CD3, BV421-CD4, PE- Cy7-CD45RO, Percp-Cy5.5-CCR7 (from Biolegend); and PE-CF594-CD25 (from BD).
  • Vital dyes include: fixable viability dyes eFluor® 450, eFluor® 506, and eFluor® 660
  • Rhl 23 and elacridar were purchased from Sigma- Aldrich.
  • CD4 + T cells were cultured in complete T cell media described in Carlson et al., J. Immunol. 192, 2167-2176, 2014.
  • magnetically isolated CD4 + CD25 ' T cells from spleen were activated by anti-CD3/anti-CD28 antibodies (non-polarizing conditions; ThN) or polarized to Thl , Th2, iTreg, or non-pathogenic Thl 7 cells as described in Sundrud et al., Science 324, 1334- 1338, 2009. Pathogenic Thl7 cells were polarized as in Lee et al., Nat. Immunol.13, 991-999, 2012.
  • MDRl expression was analyzed on day 4 post-stimulation by staining cultures with 7-AAD and anti- CD4 antibodies following Rhl23 efflux assay.
  • Retroviral plasmids and transductions shRNAs against mouse CD 8 (Cd8a), Mdrl (Abcbla, Abcblb), and Tgr5 (Gpbarl) were purchased from TransOMIC Technologies.
  • shRNAs were PCR amplified and cloned into GFP- or ametrine-expressing murine retroviral vectors (LMPd) containing a modified/enhanced miR-30 expression cassette.
  • LMPd murine retroviral vectors
  • HA-tagged human MDRl (ABCB1) was purchased from Addgene (plasmid 10957).
  • Full-length ABCB1 was PCR-amplified without the H A-tag, and cloned into an ametrine-expressing LMPd vector without the miR-30 expression cassette.
  • An empty LMPd.ametrine vector was generated by cutting out ABCB1 from the modified vector, blunting the restriction sites, and re-ligating.
  • Transport-defective mutant MDRl (AMDRl; Y401 A/Y 1044A) was generated using a QuickChange site-directed mutagenesis kit (Agilent Technologies). All retroviral constructs were confirmed by sequencing prior to use in cell culture experiments. Retroviral particles were produced in Platinum E cells (PlatE cells; gift of Dr. Matthew Pipkin, Scripps Florida), and supernatants were used to transduce anti-CD3/anti-CD28-stimualted
  • T cells (at 24 hr post-activation) (Sundrud et al., 2009), or NIH/3T3 fibroblasts.
  • Transduced T cells were removed from anti-CD3/anti-CD28-coated wells at 48 hr post- activation, expanded in T cell media containing recombinant human 1L-2, and analyzed or sorted via flow cytometry on day 5.
  • Mouse intestinal contents For isolation of sterile, soluble intestinal contents - small intestine luminal content (SILC), colon luminal content (CLC) - fecal contents from colon or small intestine of mice were collected into 15 mL conical tubes, weighed, and diluted in T cell media (2 parts media: 1 part fecal content). Contents were mixed thoroughly by vortexing for 2 min, and solid fecal matter was pelleted by centrifugation (1,000 x g; 10 min; room temperature). Supernatants transferred to fresh eppindorf tubes were further cleared of debris by another round of high-speed centrifugation (13,000 x g; 20 min; room temperature).
  • SILC was treated for 1 hr with PBS, or a slurry of PBS containing 50 ⁇ g/mL cholestyramine (CME). Following incubation, CME- bound material was pelleted by centrifugation (1 min; 13,000 x g; room temperature), and unbound SILC supernatant was collected and used in Rhl23 efflux experiments as above.
  • CME cholestyramine
  • Bile acids Synthetic bile acids: cholic acid (CA), glyco-cholic acid (gCA), tauro- cholic acid (tCA), deoxycholic acid (DCA), glyco-deoxycholic acid (gDCA), tauro- deoxycholic acid (tDCA), chenodeoxycholic acid (CDCA), glyco-chenodeoxycholic acid (gCDCA), or tauro-chenodeoxycholic acid (tCDCA) (all from Sigma-Aldrich) were reconstituted in PBS, aliquoted, and stored at 4°C. Bile acid concentrations used in cell culture experiments are indicated throughout.
  • Rhl23 efflux MDR1 transport activity
  • titrating concentrations of bile acids were added to Rhl23- labelled mouse CD4 + T cells, human CD4 + T cells, or MDR1 -expressing NIH/3T3 fibroblasts immediately prior to Rhl23 efflux.
  • wild type or MDR1 -deficient splenocytes, or mouse EL4 cells were pre- treated +/- glyco-CDCA or tauro-CDCA (tCDCA) for 4 hr prior to PMA/ionomycin stimulation, without washing.
  • tCDCA was added to wild type splenocytes alone, or together with elacridar (0.1 ⁇ ) for 4 hr prior to stimulation and staining.
  • wild type or MDR1 -deficient splenocytes, or EL4 cells were treated +/- titrating concentrations of tCDCA in the presence or absence of elacridar (0.1 ⁇ ) for 20-24 hr, prior to viability dye and anti-CD4 staining.
  • splenocytes were treated +/- tCDCA (1.2 mM) for 20-24 hr as above, and then washed twice with media to remove tCDC A. After washing, splenocytes were cultured in T cell media alone for another 6 hr, and then subjected to FACS-staining and Rhl23 efflux. Bile acid levels in feces (for CME treatment experiments) or small intestine luminal content (SILC) were quantified using a Total Bile Acids Assay Kit (Diazyme Laboratories). For fecal bile acid analysis, bile acids were extracted from feces with t-Butanol (Amresco) as described in Bhat et al., J. Lipid Res. 44, 1614-1621, 2003.
  • Mdrla binding assays Recombinant C-terminal hexa-histidine (his)-tagged mouse Mdrla used for in vitro binding experiments was expressed in and purified from P. pastoris as previously described (Aller et al., 2009).
  • Bound Mdrla was then eluted with 200 ⁇ of binding buffer containing 250 mM imidazole, and Mdrla-bound BFV was measured. All fluorescence measurements were carried out at least in duplicates, each representing 4 independent measurements, on an Infinite M200pro (Tecan), reading emission at 520 nm after excitation at 480 nm.
  • RNA-sequencing Next-generation RNA-sequencing (RNA-seq.) was performed on FACS-sorted Rhl23 hi (Mdrl ) and Rhl23'° (Mdrl + ) effector/memory T cells (Teff cells: viability dye-CD45 + CD3 + CD4 + CD25 CD44 1,i ) from mesenteric lymph nodes of FVB.Ragl " ' " mice injected 6-8 weeks prior with wild type naive T cells as above.
  • Total RNA was isolated from triplicate Mdrl+/- Teff samples - in 3 independent transfer experiments - using RNeasy columns (Qiagen), with on-column DNase treatment. 500 ng of total RNA was used for analysis. Library preparation was performed using TrueSeq total RNA-Seq (Illumina), according to manufacturer's instructions. Resulting libraries were quantified using
  • NextSeq500 instrument (Illumina).
  • the sequencing reads (fastq files) were mapped to the mm9 genome using TopHat (Trapnell et al., 2009).
  • the number of reads falling into each gene defined by RefSeq gene annotations were quantified using HTSeq-count.
  • Nanostring Cell pellets (10-30k cells/condition) were lysed in 5 DL RLT buffer containing fresh 2-mercaptoethanol (Qiagen). Frozen lysates were sent to Nanostring
  • Raw data were normalized using nSolver software (Nanostring Technologies) and exported as raw transcript counts (normalized to housekeeper control genes) for presentation.
  • Taqman qPCR was performed on a StepOnePlus real time PCR instrument (Life Technologies).
  • 16S rDNA metagenomics microbiome analyses: Genomic DNA from mouse (cecal) stool was purified by QIAamp DNA Stool Mini Kit Stool (Qiagen) according to manufacturer's protocol. Bacterial species were identified by 16S ribosomal DNA
  • cDNA sequence analysis Cloned cDNA sequences from AKR and SAMPl/YitFc RT-PCR reactions were aligned using MegAlign Pro (DNASTAR).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention provides methods and compositions for monitoring MDR1 transporter function in human IBD patients. Also provided in the invention are methods for stratification of IBD patients for bile acid directed therapies, and therapeutic methods that integrate the patient stratification with bile acid sequestration therapies.

Description

Diagnostic and Therapeutic Methods Related to Inflammatory Bowel
Diseases
CROSS-REFERENCE TO RELATED APPLICATION This application claims the priority of U.S. Provisional patent application serial number 62/353,914, filed June 23, 2016, the disclosure of which is incorporated by reference herein in its entirety.
STATEMENT OF GOVERNMENT SUPPORT
This invention was made with government support under All 19728 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
The mechanisms underlying chronic intestinal inflammation in inflammatory bowel disease (IBD) patients are unknown, and likely vary depending on individual patient genetics. For example, different portions of the intestinal tract are affected by the two common forms of inflammatory bowel diseases, ulcerative colitis (UC; the colon) and Crohn's disease (CD; the ileum). Unlike bona fide autoimmune diseases (e.g., type 1 diabetes, multiple sclerosis), IBDs are not driven by conspicuous auto-antigens. As a result, treatments for inflammatory diseases (IBDs) such as ulcerative colitis and Crohn's disease remain non-specific and ineffective. In large part, this is because the mechanisms underlying chronic intestinal inflammation in IBD patients are unknown, and likely vary depending on individual patient genetics.
Therefore, it has become increasingly evident that future advances in IBD therapy will require a more personalized approach, where therapies are aligned with individual patient genetics. The present invention is directed to this and other unmet needs in the art.
SUMMARY OF THE INVENTION
In one aspect, the invention provides methods for quantifying MDR1 activity in T cells of a human subject. The methods entail (a) assaying MDR1 function in at least one MDR1 -expressing effector T cell subsets in a biological sample obtained from the subject, and (b) comparing the assayed MDR1 function to a background MDR1 function determined with at least one control T cell subset that does not express MDR1. This allows a quantitative measurement of MDR1 activity in T cells of the human subject. In these methods, the MDR1 -expressing effector T cell subset is elected from the group consisting of (i) CD4+ effector/memory T cells (CD4+Teff, CD4+CD25 CD45RO+CCR7l0); (ii) CD8+ naive T cells (CD4 CD25 CD45RO CCR7hi); (iii) CD8+ effector/memory T cells (CD8+Teff, CD4 CD25" CD45RO+CCR7'°); and (iv) CD8+ short-lived effector/memory T cells (CD8+ Temra, CD4" CD25 CD45RO CCR710).
In some of the methods, the biological sample contains peripheral blood mononuclear cells from the subject. In some methods, MDR1 function is assayed via determining the frequency of MDR1+ cells in each T cell subset. In some of these methods, the assayed MDR1 function is the combined MDR1 + cell frequency from the at least one MDR1- expressing effector T cell subsets. In some of these methods, the assayed MDR1 function is the combined MDR1+ cell frequency from effector T cell subsets (i) to (iv). In some methods of the invention, the employed control T cell subset is (i) CD4+ naive T cells (Tnaive,
CD4+CD25 CD45RO CCR7hi) or (ii) regulatory T cells (Treg, CD4+CD25hi) that are present in the same biological sample from the subject. In some methods, the effector T cell subsets from the biological sample are separated via fluorescence- activated cell sorting (FACS). In some of these methods, MDR1+ cells are determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells of the effector T cell subsets.
Some methods of the invention further involve determining MDR1+ activity in cells of the MDR1 -expressing effector T cell subsets that are treated with a MDR1 inhibitor.
Some methods of the invention utilize a biological sample that contain cryopreserved peripheral blood mononuclear cells. In some of these methods, the determined MDR1+ cell frequency is the combined MDR1 cell frequency from all four effector T cell subsets (i) to (iv) noted above, and MDR1+ cell is determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells in each of the effector T cell subsets. Some methods of the invention are directed to quantifying or monitoring MDR1+ activity in a subject that is afflicted with an inflammatory bowel disease (IBD). In some of these methods, the IBD is Crohn's disease or ulcerative colitis.
In another aspect, the invention provides methods for identifying a human patient with an inflammatory bowel disease (IBD) for treatment with bile acid sequestration therapies. These methods involve (a) obtaining a biological sample containing CD3+ T cells from a candidate IBD patient and from at least one healthy control subject, (b) determining the combined MDR1+ cell frequency in two or more effector T cell subsets in the biological sample consisting of (i) CD4+ effector/memory T cells (CD4+ Teff, CD4+CD25 CD45RO+CCR7l0);
(ii) CD8+ naive T cells (CD4 CD25 CD45RO CCR7hi); (iii) CD8+ effector/memory T cells (CD8+Teff, CD4 CD25 CD45RO+CCR7'°); and (iv) CD8+ short-lived effector/memory T cells (CD8+ Temra, CD4 CD25 CD45RO CCR710), and (c) comparing the combined MDR1+ cell frequency of the candidate IBD patient to the combined MDR1 + cell frequency of the control subject. If there is a substantive decrease of the combined MDR1+ cell frequency of the candidate IBD patient from the combined MDR1+ cell frequency of the control subject, the candidate IBD patient is identified as one suitable for treatment with bile acid
sequestration therapies.
In some methods, the candidate IBD subject is a Crohn's disease patient. In some of these methods, the combined MDR1+ cell frequency is combined MDR1+ cell frequency of all effector T cell subsets (i) to (iv). In some methods, determining the combined MDR1+ cell frequency additionally includes quantifying a baseline MDR1+ cell frequency in at least one control T cell subset that does not express MDR1. For example, the control T cell subset can be (i) CD4+ naive T cells (Tnaive, CD4+CD25 CD45RO CCR7hi) or (ii) regulatory T cells (Treg, CD4+CD25hi) present in the same biological sample. In some methods, the employed biological sample contains peripheral blood mononuclear cells from the patient. In some methods, the effector T cell subsets from the biological sample are separated via
fluorescence-activated cell sorting (FACS). In some of these methods, MDR1 + cell is determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells of the effector T cell subsets.
In another aspect, the invention provides methods for treating an inflammatory bowel disease (IBD) in a human patient. The methods entail (a) detecting MDR1 loss-of-function in a candidate IBD patient, and (b) administering to the patient a pharmaceutical composition comprising a therapeutically effective amount of a bile acid sequestrant. This allows treatment of the inflammatory bowel disease in the patient. In some of these methods, MDR1 loss-of-function is detected by (a) obtaining a biological sample containing CD3+ T cells from the candidate patient, (b) determining the combined MDR1+ cell frequency in two or more effector T cell subsets in the biological sample consisting of (i) CD4+ effector/memory (CD4+Teff, CD4+CD25 CD45RO+CCR7'°); (ii) CD8+ naive (CD4 CD25 CD45RO CCR7hi);
(iii) CD8+ effector/memory (CD8+ Teff, CD4-CD25 CD45RO+CCR7'0); and (iv) CD8+ shortlived effector/memory (CD8+ Temra, CD4"CD25 CD45 RO"CCR7'°), and (c) comparing the combined MDR1+ cell frequency of the candidate IBD patient to combined MDR1+ cell frequency in the same biological sample from one or more healthy control subjects. Some of the therapeutic methods of the invention are directed to treating patients suffering from Crohn's disease.
A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims.
DESCRIPTION OF THE DRAWINGS
Figure 1 shows Rhl23 efflux as a method for visualizing expression/function of the xenobiotic membrane transporter, MDR1. Cells are labeled with the fluorescent MDR1 substrate, rhodamine 123 (Rhl23) at 4°C, where MDR1 is inactive. Rhl23 is a membrane permeant vital dye that labels mitochondria. Labeled cells are washed to remove excess dye, and moved to a 37°C incubator to active the MDR1 pump. Cells that express MDR1 efflux Rhl23, and thus lose fluorescence as determined by FACS analysis.
Figure 2 shows discrimination of T cell subsets by flow cytometry. Frozen PBMC from a representative healthy adult donor was thawed and stained with FACS antibodies to discriminate T cell subsets after (1 ) gating on lymphocytes; (2) excluding doublets; and (3) gating on viable CD3+ T cells (exclusion of a membrane impermeant viability dye). 6 T cell subsets are identified: (1) CD4+ naive (Tnaive, CD4+CD25 CD45RCrCCR7hi); (2) regulatory T cells (Treg, CD4+CD25hi); (3) CD4+ effector/memory (CD4+Teff, CD4+CD25"
CD45RO+CCR7'°); (4) CD8+ naive (CD4 CD25-CD45RO CCR7hi); (5) CD8+
effector/memory (CD8+ Teff, CD4-CD25'CD45RO+CCR7It>); and (6) CD8+ short-lived effector/memory (CD8+ Temra, CD4 CD25 CD45RO CCR710). Representative of more than 100 FACS staining experiments performed on healthy control and IBD patient samples.
Figure 3 shows MDR1 -dependent Rhl23 efflux in human CD3+ T cell subsets. Rhl23 efflux in the 6 T cell subsets as identified as in Figure 2 from a pooled stock of healthy adult PBMC was determined by FACS analysis. Percentage of MDR1 -expressing cells are shown based on background staining in elacridar-treated cells (shaded peaks). The combined frequency of Rhl23l0 (MDR1+) cells in the latter four subsets (CD4+ Teff, CD8+ naive, CD8+ Teff, and CD8+ Temra), calculated as the "cumulative MDR1 score," was used to indicate MDR1 function (expression and activity) in a given PMBC sample.
Figure 4 demonstrates assay stability. Cumulative MDR1 score (blue) and percentage of MDR1+ (Rhl23'°) CD4+ Teff cells (red) from 11 independent staining experiments on the same stock PBMC as in Figure 3. Coefficient of variation (CV) is indicated. Figure 5 shows MDR1 function in human subjects. (A) MDR1 function in male (left) and female (right) human adult controls and IBD patients. (B) Correlation between MDR1 function and age within healthy human adults (left), UC patients (middle), and CD patients (right). Pearson correlation (r) values are shown for each plot.
Figure 6 shows Rhl23 efflux in mice Teff cells and MDR1 function in human peripheral blood T cell subsets. (A) MDR1 -dependent Rhl23 efflux in Teff cells (gated as in Fig. 2) from tissues of SAMPl/YitFc, or MHC-matched wild type (WT, AKR) mice.
Background Rhl23 efflux shown in elacridar-treated cells (shaded peaks). Representative of 3 experiments. (B) MDR1 function (calculated as in Fig. 5B) in peripheral blood T cell subsets from healthy adult donors (n = 49), ulcerative colitis (UC) patients (n = 53), and Crohn's disease (CD) patients (n = 56). Solid red lines indicate means of each group; hatched red line indicates mean MDR1 function of healthy donors. 3 standard deviations below the healthy donor mean (-3x SD) is indicated by hatched grey line. Three CD patients display MDR1 function less than the -3x SD value of all healthy donors (blue highlights).
Figure 7 shows MDR1 -dependent Rhl23 efflux in T cell subsets from healthy donor PBMC or the indicated MDR110 CD patients identified in Figure 6B analyzed on the same day. Background Rhl23 efflux in healthy control T cell subsets treated with elacridar is shown (shaded peaks).
Figure 8 shows age and medication history information of human subjects examined for MDR1 function. (A) medication history (medications) of UC and CD patients in this cohort. (B) Age of disease onset of UC and CD patients in this cohort. (C) MDR1 function in healthy adults, UC patients, and CD patients with or without ileitis that have or have not required surgery. (D-F) MDRl'0 CD patients identified in (B) are highlighted blue. * P < .05, *** P < .001, **** P < .0001, one-way ANOVA.
DETAILED DESCRIPTION OF THE INVENTION
1. Overview
Current approaches to characterize Inflammatory Bowel Disease (IBD) patients involve whole-genome/whole-exome DNA sequencing. However, information obtained from the analysis cannot be used to dictate clinical decisions in IBD therapy. The present invention is predicated in part on the discovery by the present inventors of a fundamentally new mechanism that regulates T cell-mediated inflammation in the ileum, a specialized portion of the distal small intestine that is overwhelmingly targeted in IBD patients, esp. Crohn's disease. It was found that pro-inflammatory subsets of CD4+ T cells, namely IL-17A-producing Thl7 cells and IFNy-secreting Thl cells, upregulate expression of a gerraline-encoded xenobiotic transporter, MDR1 (ABCB1 ; P-glycoprotein). Once expressed, MDR1 interacts with conjugated bile acids (CBAs) to enforce Thl 7 and Thl cell persistence, limit inflammatory cytokine expression (TNFa, IFNy), and suppress ileitis. CBAs are cytotoxic digestive metabolites produced in the liver that recycle through the ileal lamina propria during enterohepatic circulation; this involves active reabsorption of luminal CBAs by ileocytes, and is blocked by bile acid sequestrants, such as cholestyramine. Accordingly, bile acid sequestration restores MDR1 -deficient T cell homeostasis in the small intestine and attenuates ileitis. Further, it was found that spontaneous MDR1 loss-of-function is associated with Crohn's disease-like ileitis in SAMPl/YitFc mice, which is also reduced by bile acid sequestration. Thus, immune homeostasis in the ileum involves coordinated, draggable, and tissue-specific interactions between mucosal T cells and circulating bile acids.
The inventors further developed a cell-based screen to identify IBD patients that are suitable for bile acid sequestration therapies. Specifically, the cell-based screen enables identification of subsets of IBD patients displaying loss of MDR1 expression/function. As noted above, IBD patients displaying MDR1 loss-of-function are predicted to be effectively treatable with bile acid sequestrants, e.g., cholestyramine (CME) or other similar therapeutic modalities that interfere with intestinal bile acid reabsorption. The invention accordingly provides diagnostic methods that allow stratification of IBD patients based on MDR1 function as defined in this cell-based assay. The invention additionally provides therapeutic methods that integrate bile acid sequestration therapies with the patient profiling strategy disclosed herein. A more detailed guidance for practicing methods of the invention is provided below.
II. Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Academic Press Dictionary of Science and Technology, Morris (Ed.), Academic Press (1st ed., 1992); Oxford Dictionary of Biochemistry and
Molecular Biology, Smith et al. (Eds.), Oxford University Press (revised ed., 2000);
Encyclopaedic Dictionary of Chemistry, Kumar (Ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (Eds.), John Wiley & Sons (3rd ed., 2002); Dictionary of Chemistry, Hunt (Ed.), Routledge (1st ed., 1999);
Dictionary of Pharmaceutical Medicine, Nahler (Ed.), Springer- Verlag Telos (1994);
Dictionary of Organic Chemistry, Kumar and Anandand (Eds.), Anmol Publications Pvt. Ltd. (2002); and A Dictionary of Biology (Oxford Paperback Reference), Martin and Hine (Eds.), Oxford University Press (4th ed., 2000). In addition, the following definitions are provided to assist the reader in the practice of the invention.
Bile acid sequestrants are a group of resins used to bind certain components of bile in the gastrointestinal tract. They bind to the major bile acids to form an insoluble complex that prevents reabsorption and leads to fecal excretion. Moreover, the depletion of bile acid stores promotes increased bile acid synthesis which reduces the pool of intracellular cholesterol, thereby helping to maintain a lower cholesterol level. Appreciation for the effects of bile acid sequestrants has led to the use of these agents for several other clinical applications, particularly diarrhea of various etiologies.
Bile acid sequestration or bile acid sequestration therapy refers to therapeutic use of bile acid sequestrants in patients to bind bile acids in the intestine and increase the excretion of bile acids in the stool. Due to the fact that bile acid sequestrants exert their pharmacologic effect almost exclusively in the GI tract with very little systemic absorption, these agents are generally well tolerated. The therapies were initially developed for the treatment of hypercholesterolemia. The most important role of bile acid sequestrants in the control of GI- related disorders has stemmed from its value in the control of diarrhea related to bile acid malabsorption. This condition has numerous etiologies, including Crohn's disease,
cholecystectomy, ileal resection, vagotomy, and celiac disease.
The term "contacting" has its normal meaning and refers to combining two or more agents (e.g., polypeptides or small molecule compounds) or combining agents and cells.
Contacting can occur in vitro, e.g., combining two or more agents or combining an agent and a cell or a cell lysate in a test tube or other container. Contacting can also occur in a cell or in situ, e.g., contacting two polypeptides in a cell by coexpression in the cell of recombinant polynucleotides encoding the two polypeptides, or in a cell lysate. Contacting can also occur inside the body of a subject, e.g., by administering to the subject an agent which then interacts with the intended target (e.g., a tissue or a cell).
"Inflammation" or "inflammatory response" refers to an innate immune response that occurs when tissues are injured by bacteria, trauma, toxins, heat, or any other cause. The damaged tissue releases compounds including histamine, bradykinin, and serotonin.
Inflammation refers to both acute responses (i.e., responses in which the inflammatory processes are active) and chronic responses (i.e., responses marked by slow progression and formation of new connective tissue). Acute and chronic inflammation can be distinguished by the cell types involved. Acute inflammation often involves polymorphonuclear neutrophils; whereas chronic inflammation is normally characterized by a lymphohistiocytic and/or granulomatous response. Inflammation includes reactions of both the specific and non-specific defense systems. A specific defense system reaction is a specific immune system reaction response to an antigen (possibly including an autoantigen). A non-specific defense system reaction is an inflammatory response mediated by leukocytes incapable of
immunological memory. Such cells include granulocytes, macrophages, neutrophils and eosinophils.
Inflammatory bowel disease (IBD) refers to a group of inflammatory conditions of the colon and small intestine, including Crohn's disease, ulcerative colitis, Behcet's disease, collagenous colitis, diversion colitis, ischemic colitis, and lymphocytic colitis. Crohn's disease (CD) and ulcerative colitis (UC) are the principal types of inflammatory bowel disease. The first clue in the diagnosis of IBD is the symptom such as unrelenting diarrhea, blood or mucus in the stool (more common with ulcerative colitis than Crohn's disease), fever and abdominal pain. However, some of these symptoms may also be present with a parasitic infection, diverticulitis, celiac disease, colon cancer, or other less common conditions. Therefore, often IBDs are diagnosed only after ruling out other possible causes for the symptoms, including ischemic colitis, infection, irritable bowel syndrome (IBS), diverticulitis and colon cancer. To help confirm a diagnosis of IBD, a combination of tests and procedures can be used. These include blood tests for anemia or infection, fecal occult blood test, endoscopic procedures (such as colonoscopy, flexible sigmoidoscopy, upper endoscopy, capsule endoscopy, and double-balloon endoscopy) , and imaging procedures (such as X-ray, CT scan, magnetic resonance imaging (MRI) and small bowel imaging.
Crohn disease (CD) is idiopathic chronic enteritis of unknown origin, and is a disease with non-specific inflammatory symptoms extended from the small intestine to the large intestine. Signs and symptoms often include abdominal pain, diarrhea (which may be bloody if inflammation is severe), fever, and weight loss. Other complications may occur outside the gastrointestinal tract and include anemia, skin rashes, arthritis, inflammation of the eye, and feeling tired. The skin rashes may be due to infections as well as pyoderma gangrenosum or erythema nodosum. Bowel obstruction also commonly occurs and those with the disease are at greater risk of bowel cancer. Diagnosis is based on a number of findings including biopsy and appearance of the bowel wall, medical imaging and description of the disease. There are no medications or surgical procedures that can cure Crohn's disease. Treatment options can only help with symptoms, maintain remission, and prevent relapse. For example, high calorie fluid or enteral nutrition therapy has been used as a long-term treatment in improving nutritional status. For treatment based on medications, salazosulfapyridine, metronidazole, adrenocortical steroids, immunosuppressants, 5-aminosalicylic acid (5-ASA) and the like are typically used.
Ulcerative colitis is a diffuse non-specific inflammatory disease that mainly invades the mucosa or submucosa of large intestine, frequently forming erosion or ulcer therein. The main symptom of active disease is diarrhea mixed with blood. Ulcerative colitis has much in common with Crohn's disease, but what sets it apart from Crohn's disease is that ulcerative colitis only affects the colon and rectum, rather than the whole GI tract. Ulcerative colitis is an intermittent disease, with periods of exacerbated symptoms, and periods that are relatively symptom-free. Although the symptoms of ulcerative colitis can sometimes diminish on their own, the disease usually requires treatment to go into remission. Although UC has no known cause, there is a presumed genetic risk. The disease may be triggered in a susceptible person by environmental factors. Dietary modification may reduce the discomfort of a person with the disease. Treatment of UC is with anti-inflammatory drugs, immunosuppression, and biological therapy targeting specific components of the immune response. Examples include salazosulfapyridine, adrenocortical steroids, immunosuppressants, and 5-aminosaIicyclic acid (5-ASA). Colectomy (partial or total removal of the large bowel through surgery) is occasionally necessary if the disease is severe, does not respond to treatment, or if significant complications develop. A total proctocolectomy (removal of the entirety of the large bowel and rectum) can cure ulcerative colitis as the disease only affects the large bowel and rectum and does not recur after removal of the latter.
Multidrug resistance protein 1 (MDR1), aka P-glycoprotein (permeability
glycoprotein 1 ; P-gp), ATP-binding cassette sub-family B member 1 (ABCB1) or cluster of differentiation 243 (CD243), is an important protein of the cell membrane that pumps many foreign substances out of cells. More formally, it is an ATP-dependent efflux pump with broad substrate specificity. It exists in animals, fungi and bacteria and likely evolved as a defense mechanism against harmful substances. MDR1 is extensively distributed and expressed in the intestinal epithelium where it pumps xenobiotics (such as toxins or drugs) back into the intestinal lumen, in liver cells where it pumps them into bile ducts, in the cells of the proximal tubule of the kidney where it pumps them into urine-conducting ducts, and in the capillary endothelial cells composing the blood-brain barrier and blood-testis barrier, where it pumps them back into the capillaries. MDR1 is a glycoprotein that in humans is encoded by the ABCB1 gene.
T lymphocytes recognize antigens as peptides bound to major histocompatibility complex (MHC) molecules. The fine specificity of the T cell is defined by the T-cell receptor (TCR). Most T lymphocytes express the TCR a-β and either CD4 or CD8 molecules. These molecules stabilize the TCR-peptide/MHC interaction, are essential for intrathymic selection, and contribute to transmembrane signaling, with important roles in the development and activation of helper and cytotoxic T cells. All T cells originate from haematopoietic stem cells in the bone marrow. Haematopoietic progenitors derived from haematopoietic stem cells populate the thymus and expand by cell division to generate a large population of immature thymocytes. The earliest thymocytes express neither CD4 nor CD8. As they progress through their development they become double-positive thymocytes (CD4+CD8*), and finally mature to single-positive (CD4+CD8~ or CD4"CD8+) thymocytes that are then released from the thymus to peripheral tissues. These precursor cells then differentiate into various type of mature or effector T cells which can be CD4+ T cells, CD8+ T cells, or CD4 CD8- double negative (DN) T cells.
T helper (Th) cells assist other white blood cells in immunologic processes, including maturation of B cells into plasma cells and activation of cytotoxic T cells and macrophages, among other functions. These cells are also known as CD4+ T cells because they express the CD4 protein on their surface. Helper T cells become activated when they are presented with peptide antigens by MHC class II molecules that are expressed on the surface of Antigen Presenting Cells (APCs). Once activated, they divide rapidly and secrete small proteins called cytokines that regulate or assist in the active immune response. These cells can differentiate into one of several subtypes, including TH1 , TH2, TH3, TH17, or TFH, which secrete different cytokines to facilitate a different type of immune response. The mechanism by which T cells are directed into a particular subtype is poorly understood, though signaling patterns from the APC are thought to play an important role.
Cytotoxic T cells (TC cells, or CTLs) destroy virally infected cells and tumor cells, and are also implicated in transplant rejection. These cells are also known as CD8+ T cells since they express the CD8 glycoprotein at their surface. These cells recognize their targets by binding to antigen associated with MHC class I, which is present on the surface of nearly every cell of the body. Through IL-10, adenosine and other molecules secreted by regulatory T cells, the CD8+ cells can be inactivated to an anergic state, which prevent autoimmune diseases such as experimental autoimmune encephalomyelitis. Memory T cells are a subset of antigen-specific T cells that persist long-term after an infection has resolved. They quickly expand to large numbers of effector T cells upon re- exposure to their cognate antigen, thus providing the immune system with "memory" against past infections. Memory T cells comprise two subtypes: central memory T cells (TCM cells) and effector memory T cells (TEM cells). Memory cells may be either CD4+ or CD8+.
Memory T cells typically express the cell surface protein CD45RO.
The term "subject" for purposes of diagnosis or treatment refers to any animal classified as a mammal, e.g., human and non-human mammals. Examples of non-human animals include dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, and etc. Unless otherwise noted, the terms "patient" or "subject" are used herein interchangeably. Preferably, the subject is human. Unless otherwise noted, human patient and human subject are used interchangeably herein.
The term "treating" or "alleviating" includes the administration of compounds or agents to a subject to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease (e.g., an inflammatory disorder such as IBD), alleviating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder. Subjects in need of treatment include those already suffering from the disease or disorder as well as those being at risk of developing the disorder. Treatment may be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease. In the treatment of a disease or disorder associated with or mediated by systemic autoimmunity or neuroinflammation, a therapeutic agent may directly decrease the pathology of the disease, or render the disease more susceptible to treatment by other therapeutic agents.
III. Assays for monitoring MDR1 activity
The invention provides methods for monitoring or quantifying MDR1 activity (or MDR1 expression/function) in human subjects. In some embodiments, the methods can be used to monitor MDR1 activity in human IBD patients such as ulcerative colitis (UC) patients and Crohn's disease (CD) patients. Unless otherwise noted, the MDR1 activity to be monitored in the methods of the invention refers to the net efflux pump activity of the MDR1 protein in a target cell or a population of cells (e.g., a population of an effector T cell subset). Thus, a modified MDR1 activity can be the result of altered expression or cellular level of the protein and/or the biochemical function of the protein. As detailed below, quantifying MDR1 activity in IBD patients can allow the clinician to identify patients with MDR1 loss-of- function that are suitable for bile acid directed therapies. In some embodiments, monitoring MDR1 activity in IBD patients undergoing treatment can enable assessment of efficacy of the treatment.
IBD patients can be clinically diagnosed with standard procedures described herein which are routinely employed in the art, e.g., endoscopy and histology examination. To assess or monitor the MDR1 activity (i.e., net outcome from MDR1 expression and pump function) in an IBD patient, the frequency of MDR1+ cells in one or more MDR1 -expressing effector T cell subsets is determined. MDR1+ cells are determined via contacting or labeling the cells with a probe or MDR1 substrate which can pumped out of the cell by a functional MDRl protein. The effector T cells are typically isolated from a biological sample obtained from the patient. For example, the biological sample can be mononuclear cells from a peripheral blood sample from the patient as exemplified herein. The MDRl -expressing effector T cell subsets for assessing frequency of MDRl + cells include (1) CD4+
effector/memory T cells (Teff, CD4+CD25-CD45RO+CCR71o), (2) CD8+ naive T cells (CD8+CD25-CD45RO-CCR7hi), (3) CD8+ effector/memory T cells (Teff, CD8+CD25- CD45RO+CCR7lo), and (4) CD8+ short-lived effector T cells (Temra, CD8+CD25- CD45RO-CCR71o). As exemplified herein, the different T cell subsets can be readily separated with appropriate antibodies against the various surface markers and flow
cytometric analysis. In some embodiments, the frequency of MDRl + cells in at least 2 of these MDRl -expressing effector T cell subsets is determined. In some other embodiments, the frequency of MDR1+ cells in at least 3 of the MDRl -expressing effector T cell subsets is determined. In some preferred embodiments, the frequency of MDRl + cells in all 4 of the MDRl -expressing effector T cell subsets is determined. In various embodiments, the determined MDRl activity in the biological sample (e.g., PMBC sample) is based on the combined MDR1+ cell frequency (or "cumulative MDRl score") in the examined effector T cell subsets.
MDRl is an ATP-dependent efflux pump with broad substrate specificity. Any xenobiotic compounds or agents that are transported by MDRl across the cell membrane may be used in the methods of the invention for detecting MDR1+ cells. Typically, the substrate used for monitoring MDRl activity is a labeled probe or detectable agent. For example, the cells can be labeled with fluorescent dyes such as Rhodaminel23 (Rhl23) or MitoTracker under conditions (e.g., low temperature such as 4°C) that MDRl is inactive. After washing the cells to remove excess dye, MDRl activity can then be determined by quantifying MDR1+ cells under conditions (e.g., high temperature such as 37°C) that MDR1 is active. Using Rhl23 as an example, MDR1+ cells will display little or significantly diminished fluorescence signal (Rhl23" or Rhl23'°) as the substrate is pumped out by active MDR1 protein. Similar to the sorting of the different T cell subsets from the biological sample obtained from the IBD patients, MDR1+ (Rhl23~) cells in the T cell subsets can also be readily determined and quantified via fluorescence-activated cell sorting (FACS) as exemplified herein.
To control for background signal, the methods can also include one or more T cell subsets that do not express MDR1. For example, in addition to the 4 MDR1 -expressing effector T cell subsets noted above, the methods of the invention can also include
determination of MDR1+ cell frequency in CD4+ naive T cells (CD4+CD25-CD45RO- CCR7hi) and/or CD4+ regulatory T cells (Treg, CD4+CD25hi). Typically, these control T cell subsets are obtained from the same subject. In some preferred embodiments, the control cells are isolated from the same biological sample (e.g., PMBC sample) from which the MDR1 -expressing effector T cell subsets are isolated. In some other embodiments, baseline or background MDR1 activity may be additionally controlled with the same MDR1 - expressing effector T cells in the presence of a MDR1 inhibitor. For example, as exemplified herein, background efflux of a fluorescent MDR1 substrate can be quantified using MDR1- expressing cells treated with MDR1 antagonist elacridar.
IV. Diagnostic and therapeutic applications
Some methods of the invention are intended for use in identifying human subjects with MDR1 loss-of-function in the MDR1 -expressing T cells. Some of these methods are directed to screening IBD patients for bile acid sequestration therapies. To determine whether there is MDR1 loss-of-function in a subject (e.g., an IBD patient), MDR1 activity (cumulative MDR1 score) determined with MDR1 -expressing cells from the subject is compared to that of a positive control value. Typically, the positive control value is the determined value with the sample biological sample (e.g., PMBC cells) from one or more healthy subjects via the same assay. In some embodiments, the mean MDR1 activity determined from a group of healthy subjects is used as the positive control value. As noted above, one or more MDR1' T cell subsets from the candidate IBD patient and the healthy control can be included in the assay to determine baseline MDR1 activity. As a further control for background signal, the methods can further include assaying MDR1 activity in the same MDR1 -expressing T cell subsets that are treated with a MDR1 antagonist. Once the cumulative MDR1 score of the MDR1 -expressing T cell subsets from the candidate patient is determined, it is compared to the control cumulative MDR1 score determined with the MDR1 -expressing T cell subsets from the healthy control subjects. If the MDR1 activity of the candidate subject (e.g., an IBD patient) substantially departs, or deviates with statistical significance, from the control value, the candidate subject is identified as one who has MDR1 loss-of- function. Thus, some methods of the invention also include determination of the mean value and standard deviation ("s.d.") of the cumulative MDR1 scores of the healthy control subjects. A substantial departure or statistically significant deviation means at least 1.5 x s.d. below the mean value of the healthy control subjects. In some embodiments, a substantial departure means at least 2 x s.d. or 2.5 x s.d. below the mean control value. In some embodiments, a substantial departure means at least 3 x s.d. or 3.5 x s.d. below the mean control value. In some other embodiments, a substantial departure means at least 4 x s.d. or more below the control value. If the MDR1 activity (cumulative MDR1 score) in an IBD patient (e.g., a CD patient) substantially departs from that of the control subjects, the patient is identified as having MDR1 loss-of-function relative to that of the healthy control subjects.
In some embodiments, the invention provides therapeutic methods for treating a subset of IBD patients that have impaired or diminished MDR1 activity (or MDR1 loss-of- function). These therapeutic applications combine the diagnostic methods described herein and bile acid sequestration therapies. Thus, IBD patients can be first screened for MDR1 activity in effector T cell subsets as described herein. Patients who are determined to have MDR1 loss-of-function are then subject to treatment with a bile acid sequestration therapy. The patients are typically administered with a pharmaceutical composition that contains a therapeutically effective amount of a bile acid sequestrant. Several well-known bile acid sequestrants can be readily employed in the therapeutic regimen for the subject. Examples of suitable bile acid sequestrants include cholestyramine (CME) (Questran, Prevalite), colestipol (Colestid, Flavored Colestid), and colesevelam (Welchol). Clinical protocols for using bile acid sequestrants have been developed in the treatment of a number of gastrointestinal diseases or disorders. See, e.g., Taylor et al., J. Infect. Dis. 1980;141 :92-7, 1980; Fromm and Malavolti, Clin. Gastroenterol. 15:567-82, 1986; Pusl et al., Clin. Rev. Allergy Immunol. 28:147-57, 2005; Puleston et al., Gut. 54:441-2, 2005; Westergaard et al., Curr. Treat.
Options Gastroenterol. 10:28-33, 2007; Wedlake et al., Gut 58:A1 17-A117, 2009; Odunsi- Shiyanbade et al., Clin. Gastroenterol. Hepatol. 8:159-65, 2010; and Reiner et al., Fundam. Clin. Pharmacol. 24:19-28, 2010. These protocols can be readied modified in the therapeutic methods of the invention for treating IBD patients.
Subjects with various clinical subtypes of IBD may be suitable for the methods of the invention. Some methods of the invention are directed to patients with Crohn's disease (CD). Crohn's disease is a disease of chronic inflammation that can involve any part of the gastrointestinal tract. Commonly, the distal portion of the small intestine, i.e., the ileum, and the cecum are affected. In other cases, the disease is confined to the small intestine, colon, or anorectal region. CD occasionally involves the duodenum and stomach, and more rarely the esophagus and oral cavity. Several features are characteristic of the pathology of CD. The inflammation associated with CD, known as transmural inflammation, involves all layers of the bowel wall. Thickening and edema, for example, typically also appear throughout the bowel wall, with fibrosis present in long-standing forms of the disease. The inflammation characteristic of CD is discontinuous in that segments of inflamed tissue, known as "skip lesions," are separated by apparently normal intestine. Furthermore, linear ulcerations, edema, and inflammation of the intervening tissue lead to a "cobblestone" appearance of the intestinal mucosa, which is distinctive of CD.
A hallmark of CD is the presence of discrete aggregations of inflammatory cells, known as granulomas, which are generally found in the submucosa. Some CD cases display typical discrete granulomas, while others show a diffuse granulomatous reaction or a nonspecific transmural inflammation. As a result, the presence of discrete granulomas is indicative of CD, although the absence of granulomas is also consistent with the disease. Thus, transmural or discontinuous inflammation, rather than the presence of granulomas, is a preferred diagnostic indicator of CD. Quantifying MDR1 activity or function in CD patients would help the clinician to devise appropriate treatment and/or to monitor progresses of an ongoing treatment.
In some embodiments, the diagnostic and/or therapeutic methods of the invention are directed to patients with ulcerative colitis (UC). Ulcerative colitis is a disease of the large intestine characterized by chronic diarrhea with cramping, abdominal pain, rectal bleeding, loose discharges of blood, pus, and mucus. The manifestations of UC vary widely. A pattern of exacerbations and remissions typifies the clinical course for about 70% of UC patients, although continuous symptoms without remission are present in some patients with UC.
Local and systemic complications of UC include arthritis, eye inflammation such as uveitis, skin ulcers, and liver disease. In addition, UC, and especially the long-standing, extensive form of the disease is associated with an increased risk of colon carcinoma. UC is a diffuse disease that usually extends from the most distal part of the rectum for a variable distance proximally. The term "left-sided colitis" describes an inflammation that involves the distal portion of the colon, extending as far as the splenic flexure. Sparing of the rectum or involvement of the right side {proximal portion) of the colon alone is unusual in UC. The inflammatory process of UC is limited to the colon and does not involve, for example, the small intestine, stomach, or esophagus. In addition, UC is distinguished by a superficial inflammation of the mucosa that generally spares the deeper layers of the bowel wall. Crypt abscesses, in which degenerated intestinal crypts are filled with neutrophils, are also typical of UC.
In comparison with CD, which is a patchy disease with frequent sparing of the rectum, UC is characterized by a continuous inflammation of the colon that usually is more severe distally than proximally. The inflammation in UC is superficial in that it is usually limited to the mucosal layer and is characterized by an acute inflammatory infiltrate with neutrophils and crypt abscesses. Monitoring and quantifying MDR1 function in UC patients can also provide valuable information that can be helpful to determining a suitable course of therapeutic intervention.
Indeterminate colitis (IC) is another clinical subtype of IBD that includes both features of CD and UC. Such an overlap in the symptoms of both diseases can occur temporarily (e.g., in the early stages of the disease) or persistently (e.g., throughout the progression of the disease) in patients with IC. Clinically, IC is characterized by abdominal pain and diarrhea with or without rectal bleeding. For example, colitis with intermittent multiple ulcerations separated by normal mucosa is found in patients with the disease.
Histologically, there is a pattern of severe ulceration with transmural inflammation. The rectum is typically free of the disease and the lymphoid inflammatory cells do not show aggregation. Although deep slit-like fissures are observed with foci of myocytolysis, the intervening mucosa is typically minimally congested with the preservation of goblet cells in patients with IC. Like CD and UC patients, subjects with IC can also be examined for MDR1 function via the methods of the invention.
In addition to the diagnostic and therapeutic methods, the invention further provides kits or pharmaceutical combinations for carrying out the methods described herein. The kits can be readily used in profiling IBD patients for those that are suitable for bile acid sequestration therapies. The kits of the invention typically contain reagents for determining MDR1 activity in a biological sample, e.g., via Rhl23 efflux assay as described herein. In various embodiments, the kits can include reagents for collecting a biological sample (e.g., PMBC cells) from patients, an agent for labeling the cells in the biological sample for determining MDR1 function via a suitable assay (e.g., fluorescent label RJhl23 for Rh 123 efflux assay), and monoclonal antibodies for gating the different T cell subsets in flow cytometry analysis. In some embodiments, the kits can optionally include control biological samples (e.g., PMBC cells) that are obtained from healthy subjects. The diagnostic kits can further include packaging material for packaging the reagents and a notification in or on the packaging material. The kits can additionally include appropriate instructions for use and labels indicating the intended use of the contents of the kits. The instructions can be present on any written material or recorded material supplied on or with the kit or which otherwise accompanies the kit.
Mdrl -dependent dye efflux and a novel CRISPR-generated reporter mouse show that Mdrl is also expressed in mouse Thl 7 and Thl cells in vivo, where it is increased in the small intestine lamina propria, highest in the ileum, and induced by CD 103* dendritic cells (DCs)
Immune competency requires naive CD4+ TH cell differentiation into functionally distinct subsets of cytokine-secreting effector (Teff) cells (Nakayamada et al., 2012). These subsets, which include IFNy-producing Thl cells and IL- 17-secreting Thl 7 cells, also down- regulate lymphoid homing receptors and up-regulate tissue homing chemokine receptors and integrins, which drives egress out of secondary lymphoid organs and migration into inflamed peripheral tissues. Unlike most non-lymphoid tissues, mucosal tissues such as the intestine are continuously exposed to potentially pathogenic stimuli. As such, Teff cells circulate in and out of the intestinal lamina propria at steady state (Morton et al., 2014).
Presence of pro-inflammatory Teff cells in the intestinal mucosa is potentially deleterious, and exaggerated cytokine expression by Thl 7 and Thl cells is associated with pathogenesis of inflammatory bowel diseases (IBDs) (Kaser et al., 2010). Accordingly, numerous mechanisms are deployed to actively suppress Teff cell function in the gut, the vast majority of which involve symbiotic interactions with commensal bacteria (Huttenhower et al., 2014; Longman et al., 2013). In addition to restricting colonization by intestinal pathogens (Lee et al., 2013), commensal microbes restrict trafficking of intestinal CX3CR1+ phagocytes to mesenteric lymph nodes to prevent TH cell priming against enteric antigens (Diehl et al., 2013). In addition, several commensal species produce short-chain fatty acids (e.g., butyrate) or polysaccharide A to stimulate peripheral development of Foxp3+ T regulatory (pTreg) cells and IL- 10-expression (Arpaia et al., 2013; Mazmanian et al., 2008; Round and Mazmanian, 2010). Microbiota also direct conversion of intestinal pTregs into CD4+CD8aa+ intraepithelial lymphocytes (CD4IEL) for additional control over mucosal immune homeostasis (Sujino et al., 2016). Still other enteric bacteria have pro-inflammatory functions. Segmented filamentous bacteria (SFB), for example, promote Thl7 cell development and induce IL-17 expression by these cells in the ileum (Atarashi et al., 2015; Ivanov et al., 2009; Sano et al., 2015). Accordingly, SFB colonization in mice is associated with pathogenesis of both intestinal and systemic inflammatory diseases (Kriegel et al., 201 1 ; Stepankova et al., 2007; Teng et al., 2016; Wang et al., 2015). Based on these and many other findings, major translational initiatives are now underway to characterize the human microbiome in both healthy individuals and patient cohorts, and to test the efficacy of microbiota-directed therapies (e.g., fecal transplantation) in human inflammatory diseases.
Far less is known about how the mucosal immune system interacts with non- microbial intestinal products. For example, bile acids (BAs) are a fundamental class of amphipathic intestinal detergents synthesized from cholesterol in the liver (Hofmann and Hagey, 2014). BAs are stored in the gall bladder and deposited into the duodenum in response to food intake, where they aid in digestion by emulsifying cholesterol and other insoluble dietary lipids (Hofmann and Hagey, 2014). Intriguingly, BAs, and in particular those conjugated to the amino acid glycine or taurine, are actively reabsorbed in the terminal ileum by specialized enterocytes expressing the apical bile acid transporter, Asbt (gene symbol SlclOal) (Dawson et al., 2003; Dawson et al., 2009). Actively recycled BAs accumulate in the ileal mucosa and ultimately transit into portal veins for re-circulation back to the liver. This enterohepatic circulation of BAs— first described in the 1960's - establishes that the ileal mucosa is the only mammalian tissue exposed to high extracellular
concentrations of conjugated BAs (Hofmann and Hagey, 2014). Yet still, the immunologic consequences of mucosa-associated BAs in the ileum remain unknown.
We previously identified the ATP-binding cassette (ABC)-containing xenobiotic transporter, MDR1 (ABCB1 , P-glycoprotein) as preferentially expressed in intestinal vs. circulating human Thl7 and Thl cells (Ramesh et al., 2014). MDR1 is a plasma membrane- associated ATP-dependent efflux pump best known for expression in drug-resistant tumor cells, where it effluxes structurally unrelated chemotherapeutic compounds (Gottesman et al., 2002). Intriguingly, mice lacking Mdrla (Abcbld) are prone to spontaneous colitis (Panwala et al., 1998), which has been ascribed to defects in both epithelial and hematopoietic compartments (Maxwell et al., 2015; Staley et al., 201 1). Further, polymorphisms in the gene encoding human MDR1 (ABCB1) have been sporadically associated with IBDs (Annese et al., 2006). Yet despite these data suggesting important physiologic functions, MDR1 remains widely regarded as a dedicated "drug handler" (Borst and Schinkel, 2013; Schinkel, 1997). However, orthologs of MDR1 are present in bacteria, suggesting that this transporter has broader and more fundamental functions in cell biology beyond interfacing with 20th century pharmaceuticals.
Here we use both Mdrl -dependent dye efflux and a novel CRISPR-generated reporter mouse to show that Mdrl is also expressed in mouse Thl7 and Thl cells in vivo, where it is increased in the small intestine lamina propria, highest in the ileum, and induced by CD103+ dendritic cells (DCs). Consistent with this pattern of expression, Mdrl regulates Thl 7 and Thl cell function selectively in the ileum; TH cells lacking Mdrl— due to germline ablation (Abcb la/lb' ') or shRNAmir-mediated knockdown— transfer Crohn's disease-like ileitis in Rag]''' hosts and overexpress several pro-inflammatory cytokines in the ileum, most notably TNFa and IFNy. Importantly, both increased expression and selective function of Mdrl in the ileum is independent of microbiota, as judged by experiments in germ free wild type mice and antibiotic-treated Ragl~'~ mice. Mdrl acts specifically in the presence of conjugated BAs to suppress Thl 7 and Thl cell cytokine expression and enforce survival. Accordingly, mucosal homeostasis of Mdrl -deficient Thl 7 and Thl cells in vivo is rescued by either genetic ablation of the ileal BA transporter, Asbt, or dietary administration of the BA sequestrant, cholestryramine, both of which prevent active reabsorption of luminal BAs into the ileal mucosa. Finally, we show overt MDR1 loss-of-function in both ileitis-prone (SAMPl/YitFc) mice and a subset of patients with ileal Crohn's disease. Thus, in addition to interacting with local microflora, lymphocytes employ specialized functions in the ileum to prevent potentially pathogenic interaction with mucosa-associated BAs.
Mdrl is preferentially expressed by Thl 7 and Thl cells in the ileum
Appreciating that MDR1 function in vivo involves complex interaction with unknown metabolites, we sought to interrogate the immunologic function of this transporter using in vivo mouse models rather than human cell culture systems. However, Mdrl expression in mouse lymphocyte is both poorly characterized and important to understand when considering function. Using efflux of the fluorescent Mdrl substrate rhodamine 123 (Rhl23) (Ludescher et al., 1992) as a surrogate for expression, we found that - as in humans (Ramesh et al., 2014) - Mdrl is expressed in a portion of endogenous mouse Teff cells at steady state. Rhl 23 efflux in Teff cells is due to Mdrl , and not related transporters, as: (/*) Rhl23 efflux is abolished by treatment with the Mdrl antagonist, elacridar (Hyafil et al., 1993), (//) Rhl23 efflux is absent in Teff cells from Mdrl -deficient (FVB. Abcb la/lb") mice (Schinkel et al., 1997), and (iii) wild type Teff cells FACS-sorted based on Rhl 23 efflux are enriched for expression of Abcbla - the mouse oitholog of human ABCBI - but not other multidrug transporter mRNAs (e.g., Abccl, Abcc3, Abcgl). Also as in humans, Mdrl is absent in mouse naive TH cells, higher in Teff cells vs. Tregs, and expressed in both Thl7 and non-Thl7 (mostly Thl) Teff cells, the latter judged by Rhl23 efflux experiments in cells from Thl 7 fate-mapping reporter mice.
However useful, Rhl23 efflux is still an indirect measure of Mdrl expression. Moreover, commercial antibodies are neither suitable for flow cytometry nor specific for mouse Mdrl over related transporters. Therefore, to enable direct and specific tracking of Mdrl expression in mouse lymphocytes, we employed CRISPR/Cas9 genome editing in wild type C57B1/6 (B6) zygotes (Wang et al., 2013; Yang et al., 2013) to generate an Mdrl fluorescent reporter mouse. We replaced the stop codon of Abcbla with a reporter cassette containing a self-cleaving P2A peptide and the fluorescent reporter, ametrine (, to facilitate stoichiometric translation of independent Mdrl and ametrine proteins from a single bi- cistronic mRNA. Although our founder reporter mouse carried a small (9-nucleotide) in- frame deletion near the 3' terminal end of Abcbla in the reporter allele, this has no bearing on Mdrl transport function. Further, ametrine expression in splenic TH cells from reporter mice is largely restricted to CD44hl Teff cells, and faithfully discriminates those with high-level Mdrl transport (Rhl23 efflux) activity and Abcbla gene expression.
Whether judged by Rhl23 efflux in wild type TH cells or ametrine expression in Mdrl -reporter TH cells, we found that Mdrl is increased markedly in Teff cells from small intestine lamina propria (siLP) compared with counterparts from colon lamina propria (cLP) or other tissues, including spleen and mesenteric lymph nodes (MLN), or bone marrow, lung, liver, and skin (data not shown). Increased Mdrl expression in small intestinal Teff cells is evident in wild type mice of several genetic backgrounds (e.g., B6, FVB, BALB/c) (data not shown), and in Ragl" mice injected with wild type or Mdrl -reporter naive TH cells. Within siLP, Teff cell expression of Mdrl increases in a gradient fashion from proximal to distal, with highest expression observed in the ileum.
Increased Mdrl expression in small intestinal Teff cells could be due to selective survival or local upregulation. In support of the latter, we found that Mdrl expression in Teff cells is transient, and induced locally by intestinal dendritic cells (DCs). First, Teff cells (e.g., Thl, Th2, Thl 7) generated in vitro from naive TH cells do not express Mdrl . Second, ex vivo- sorted Mdrl+ Teff cells lose Mdrl expression rapidly upon in vitro culture. Third, ex vivo- sorted Mdrl " Teff cells acquire Mdrl expression upon transfer into Ragl~f~ mice, and Mdrl expression here again is highest in siLP. Fourth, Mdrl expression in ex vrvo-sorted Mdrl' Teff cells is induced in vitro upon co-culture with small intestinal CD1 lc+ DCs, but not small intestinal CD1 lb+CDl lc" macrophages or CD1 lc+ DCs from spleen. Intestinal DCs that induce Mdrl expression in Teff cells in vitro are heterogeneous for expression of CD 103 and CX3CRI . However, only purified CD103+ DCs, and not CX3CR1+ phagocytes, induce Mdrl in co-cultured Teff cells. Finally, Mdrl expression in Teff cells in vivo is independent of microbiota; high-level Teff cell expression of Mdrl is evident in siLP from germ free (GF) mice, as well as mice lacking toll-like receptor (Myd88~'~) or inflammasome (Asc 1'} signaling components. Accordingly, intestinal DCs from both specific pathogen-free (SPF) and GF mice induce Mdrl expression in co-cultured Teff cells. Thus, Mdrl expression is a locally acquired and prominent trait of Thl7 and Thl cells infiltrating the ileum.
Mdrl selectively regulates T cell junction and inflammation in the ileum
Naive TH cells lacking Mdrl (FVB-Abcbla/lb * ) induce more aggressive weight loss upon transfer into Rag]' ' mice than wild type counterparts. Inflammation in this transfer model is generally restricted to the colon (Ostanin et al., 2009), and indeed, both wild type and Mdrl -deficient TH cells induce severe colitis. However, Mdrl -deficient TH cells also induce marked ileitis, whereas wild type TH cells do not. Like Mdrl expression, ileitogenic function of Mdrl -deficient TH cells is independent of microbiota; depletion of enteric bacteria with broad- spectrum antibiotics has little impact on weight loss in Ragl''' mice transplanted with Mdrl -deficient TH cells, and these mice still display ileitis. Accordingly, ileitis transferred by Mdrl -deficient TH cells in untreated Ragl " mice is not transmissible by co- housing, and is not associated with dysbiosis, as judged by 16S rDNA sequencing. By contrast, antibiotics strongly attenuate weight loss and colitis in Ragl"' mice injected with wild type TH cells. Importantly, shRNAmir-mediated knockdown (Fellmann et al., 2013) of Mdrl in wild type TH cells also leads to increased weight loss and ileitis in transferred Ragl'1' mice.
Consistent with small bowel pathology, Mdrl -deficient RORyt+ (Thl 7) and RORyt" (mostly Thl) Teff cells recovered from siLP of transferred Rag1-/- mice display pronounced over-expression of TNFa and IFNy vs. wild type counterparts. Mdrl -deficient Thl 7 cells in siLP also display increased IL-17A production compared with wild type Thl 7 cells.
Importantly, elevated cytokine expression in Mdrl -deficient vs. wild type Thl 7 and Thl cells is specific to the small intestine and occurs irrespective of antibiotic treatment. As with Mdrl expression, TNFa over-expression in Mdrl -deficient vs. wild type Thl 7 and Thl cells is most conspicuous in the distal small intestine (i.e., ileum). shRNAmir-mediated Mdrl knockdown in wild type Teff cells also triggers TNFa and IFNy over-expression in siLP of transferred Ragl~'~ mice, compared with those expressing a control shRNAmir against Cd8a (shCD8). Further, Mdrl intrinsically regulates Tefif cell homeostasis in siLP, as judged by congenic transfer experiments where Rag1-/- mice are transplanted with mixtures of untransduced, shCD8 -expressing, and shMdrl -expressing cells discriminated by different retroviral reporters (e.g., GFP, ametrine). Compared with bystander control cells, Mdrl knockdown drives increased Teff cell expression of TNFa and IFNy, but only in siLP. Other TH cell functional parameters are not impacted by Mdrl -deficiency in vivo, including development of RORyt+ Thl7 cells and Foxp3+ pTregs, expression of tissue-homing chemokine receptors (CCR6, CXCR3, CCR9), and integrins (α4β7), and expression of IL- 10 and IL-22, cytokines involved in suppressing intestinal inflammation and enforcing epithelial barrier function, respectively (Davidson et al., 1996; Dudakov et al., 2015). Thus, locally acquired Mdrl expression enforces mucosal Thl 7 and Thl cell homeostasis in the ileum and suppresses inflammation.
Mdrl interacts with conjugated bile acids
Preferential expression and selective function of Mdrl in the ileum suggests local interaction with tissue-restricted metabolites. Indeed, soluble small intestine luminal content (siLC), but not colon luminal content (cLC), interacts with Mdrl, as judged by competitive, dose-dependent inhibition of Rhl23 efflux in wild type Teff cells. Small intestinal
metabolites that interact with Mdrl could be of host or bacterial origin. However, given high- level expression of Mdrl in Teff cells from GF mice and mucosal dysfunction of Mdrl - deficient Teff cells in antibiotic-treated Rag J''' mice, we hypothesized that Mdrl interacts principally with host metabolites. As detailed above, bile acids (BAs; a.k.a., bile salts) are an abundant class of lipophilic detergents synthesized by hepatocytes in the liver and restricted to the small intestine due to active reabsorption in the ileum (Dawson et al., 2009). Because of their detergent-like properties, BAs are also cytotoxic to cells at high extracellular concentrations, as in the case of cholestatic liver diseases where BA accumulation in the liver leads to hepatocellular necrosis, inflammation, and liver failure (Poupon et al., 2000). Indeed, siLC from wild type mice— but not cLC— is cytotoxic to cultured TH cells. Two results confirm that BAs are the principal Mdrl -interacting metabolites within siLC. First, BA levels are equivalent in siLC from GF and SPF mice, and both GF and SPF siLC interact with Mdrl . Second, depleting BAs from either GF or SPF siLC with the BA sequestering resin, cholestyramine (Arnold et al., 2014), abolishes both cytotoxicity and Mdrl interaction. BA levels in siLC from TH cell-transferred Rag]''' mice are also unaffected by antibiotic treatment, and siLC from both control and antibiotic-treated Ragl" mice is cytotoxic to cultured TH cells and interacts with Mdrl .
Five major BA species are found in mammals: cholic acid (CA), chenodeoxycholic acid (CDCA), and β-muricholic acid are primary BAs synthesized in the liver by hepatocytes; deoxycholic acid (DCA) and lithocholic acid (LCA) are secondary BAs generated by enteric bacteria (Hofrnann and Hagey, 2014). Each BA species can exist in a free/unconjugated form, or as conjugated to the amino acids taurine or (less frequently) glycine (Hofrnann and Hagey, 2014). BA conjugation decreases cytotoxicity and membrane permeability, whilst enabling Asbt-dependent reabsorption in the ileum (Dawson et al., 2003; Dawson et al., 2009;
Hofrnann and Hagey, 2014). Whereas LCA is largely insoluble in aqueous solution, CA, DCA, CDCA, and β-muricholic acid are all readily soluble; all are cytotoxic to cultured wild type TH cells at high concentrations (2.5-10 mM), and all modulate Mdrl transport activity in a dose-dependent manner at lower concentrations (0.5-2 mM). For each BA species, however, only glycine- or taurine-conjugated BAs (CBAs) interact with Mdrl . As only CBAs are actively recycled through the ileal mucosa, specific interaction between Mdrl and CBAs thus predicts - as observed above - that Mdrl -dependent phenotypes are amplified in the ileum.
CBAs modulate Mdrl function reversibly, without affecting mRNA (Abcbla, Abcblb) or protein expression (data not shown). In addition, both mouse siLC and synthetic CBAs interact with human MDR1 - whether ectopically expressed in Mdrl" mouse embryonic fibroblasts, or endogenously expressed in primary human CD4+ Teff cells.
Finally, CBAs interact with Mdrl indirectly; they are neither direct transport substrates nor inhibitors. CBAs do not compete for Mdrl binding with established chemotherapeutic substrates (e.g., vinblastine, verapamil), and do not stimulate Mdrl ATPase activity in vitro (Swartz et al., 2013). At the same time, Mdrl transport activity is required for Teff cell homeostasis in the presence of CBAs (see below), indicating that CBAs are not Mdrl antagonists.
Mdrl regulates T cell homeostasis in the presence of conjugated bile acids
Given the interaction between Mdrl and CBAs, and the fact that loss or knockdown of Mdrl prompts increased cytokine expression in mucosal Teff cells, we hypothesized that CBAs suppress pro-inflammatory cytokine expression in Teff cells via Mdrl. Indeed, both glycine- and taurine-conjugated CBAs (e.g., CDCA) acutely inhibit TNFy expression in ex vivo- stimulated Teff cells in dose- and Mdrl -dependent manners. By contrast, unconjugated B As suppress TNFa expression in both wild type and Mdrl -deficient Teff cells consistent with the fact that only CBAs interact with Mdrl .
Several results indicate that Mdrl transport function is important for TNF□ regulation in Teff cells exposed to CBAs. First, inhibiting Mdrl transport activity with elacridar in wild type Teff cells increases TNFa expression in the presence - but not absence — of CBAs. Second, CBA-mediated inhibition of TNFa expression in the Mdrl" mouse T cell lymphoma line EL4 requires ectopic expression of transport-competent human MDR1 (hMDRl); CBAs do not repress TNFa expression in parental EL4 cells, EL4 cells expressing an empty retrovirus, or EL4 cells expressing a transport-deficient human MDR1 mutant (AMDRl ; Y401 A/Y1044A) (Kim et al., 2006). EL4 cells were used for these experiments because ectopic expression of mouse or human MDR1 is not tolerated in primary TH cells. Finally, Teff cells do not express the known cell surface CBA receptor, Tgr5 (Pols et al., 2011), and unlike Mdrl, Teff cell expression of TNFa in the presence of CBAs in vitro or in the small intestine in vivo is not influenced by Tgr5-deficiency.
To confirm that actively recycled CBAs are responsible for the over-expression of pro-inflammatory cytokines by mucosal Mdrl -deficient Teff cells in vivo, we transferred congenic mixtures of untransduced, shCD8-expressing, and shMdrl -expressing cells into co- housed Rag1-/- mice that have or lack the ileal bile acid transporter, Asbt. Indeed, whereas shMdrl -expressing Teff cells display marked over-expression of TNFa relative to bystander controls in siLP from Asbt-sufficient Rag1-/- mice, there is no difference in TNFa expression between control and shMdrl -expressing Teff cells in siLP from Rag1-/- mice lacking Asbt.
MDR1 transport activity also enforces Teff cell survival in the face of more chronic CBA exposure. In our Rag1-/- transfer experiments, we observed that absolute numbers of Mdrl -deficient TH cells recovered from tissues of transferred Rag1-/- mice were modestly, but consistently, reduced vs. wild type TH cells, both in the presence and absence of antibiotics. To more carefully assess the role of Mdrl in Teff cell persistence in vivo, we again transferred congenic mixtures of untransduced, shCD8-expressing and shMdrl -expressing TH cells into Ragl" hosts. Compared to bystander controls expressing shCD8, Teff cells expressing shMdrl show reduced persistence in all tissues. Given extensive Teff cell circulation through the intestinal lamina propria (Morton et al., 2014), this phenotype might also reflect local dysfunction of Mdrl -deficient Teff cells in the presence of ileal CBAs. Indeed, tCDCA kills 80-90% of splenic wild type TH cells after 18-24 hours, and those that survive are uniformly Mdrl+ Teff cells, as judged by either Rhl23 efflux in wild type cells, or ametrine expression in Mdrl -reporter cells. Accordingly, neither elacridar-treated wild type Teff cells nor Teff cells lacking Mdrl (Abcbla/lb ' ) survive long-term tCDCA exposure. In addition, survival of Mdrl" EL4 cells treated overnight with tCDCA also requires ectopic expression of transport-competent hMDRl . Together, these results demonstrate that Mdrl is required for Teff cell homeostasis in the presence of locally recycled CBAs in the ileum.
EXAMPLES
The following examples are provided to further illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims.
Example 1 Cell-based screening of MDR1 loss-of-function via Rhl23 efflux assay
The basic Rhl 23 efflux assay is schematically depicted in Figure 1. To identify IBD patients displaying MDR1 loss-of-function, a robust and quantitative cell-based screening platform was developed. Specifically, the screen uses cryopreserved (frozen) peripheral blood mononuclear cells (PBMCs) from healthy donors or IBD patients. It was found that the process of freezing and thawing PBMC does not affect the assay (data not shown). In addition, the screen measures the combined frequency of MDR1+ cells within all MDR1- expressing human CD4+ and CD8+ T cell subsets to better reflect germline- encoded function. To this end, a panel of FACS antibodies were used in the assay to allow for visualization of MDR1 -dependent Rhl 23 efflux in 6 different viable CD3+ T cell subsets: (1) CD4+ naive T cells (CD4+CD25-CD45RO-CCR7hi); (2) CD4+ regulatory T cells (Treg, CD4+CD25hi); (3) CD4+ effector/memory T cells (Teff, CD4+CD25-CD45RO+CCR71o); (4) CD8+ naive T cells (CD8+CD25-CD4SRO-CCR7hi); (5) CD8+ effector/memory T cells (Teff, CD8+CD25- CD45RO+CCR71o); and (6) CD8+ short-lived effector T cells (Temra, CD8+CD25- CD45RO-CCR71o) (Figure 2). Whereas the first 2 subsets do not express MDR1, subsets 3-6 display MDR1 expression/function, the combined percentage of Rhl231o (MDR1+) cells in these 4 subsets enables calculation of a "cumulative MDR1 score" (Figure 3). This measurement is used to identify IBD patients displaying statistical MDR1 loss-of-function (see below).
The ability to simultaneously visualize MDR1 -dependent Rhl 23 efflux in multiple subsets is important for monitoring assay specificity, and for increasing the likelihood that significantly reduced MDR1 function in multiple MDR1 -expressing T cell lineages is due to genetic perturbation (as opposed to environmental effects). To enable quantitative analysis, each healthy control or IBD patient sample is split into 2 equal parts after Rhl 23 labeling and prior to Rhl 23 efflux at 37°C. The first half of cells have nothing added (i.e., media alone), whereas the second half of cells are treated with the selective MDR1 antagonist, elacridar (Hyafil et al., Cancer Res. 1993 Oct l ;53(I 9):4595-602). Inclusion of elacridar enables us to quantify the percentage of Rhl 23 lo (MDR1+) cells within each subset taking into account background Rhl23 fluorescence in inhibitor (elacridar)-treated cells (Figure 3).
Finally, to ensure that fluctuation in MDR1 activity between healthy control and IBD patient samples is due to biological but not technical variation, we thaw and analyze a control stock of frozen healthy adult donor PBMC along with up to 10 individual healthy control/lBD patient samples. Analyses of this control stock PBMC over 11 independent Rhl 23 efflux experiments shows an excellent coefficient of variation (CV) of 8.3% for the cumulative MDR1 score in our stock PBMC (Figure 4); current best practice for cell-based screens recommends CV's < 10%, and tolerates CV's < 20%.
Example 2 Examining MDR1 activity in ileitis-prone mice and human IBD patients
SAMP1 /YitFc (SAMP) mice are one of the only pre-clinical models of spontaneous Crohn's disease-like ileitis. We first assayed MDR1 -dependent Rhl 23 efflux from tissues of SAMP 1 /YitFc, or MHC-matched wild type (WT, AKR) mice. It was found that SAMP Teff cells are MDRl-null (Fig. 6A). By quantifying the cumulative MDR1 scores, we then analyzed MDR1 activities in CD4+ and CD8+ effector T cells from PMBC samples from healthy human adults, as well as human UC patients and CD patients with ileitis. As determined by the D'Agostino-Pearson omnibus normality test, normal distribution of MDR1 function scores were observed with all healthy adults (n = 49), ulcerative colitis (UC) patients (n = 53), and Crohn's disease (CD) patients (n - 56). The data indicate that MDR1 function is reduced in both male and female CD patients (Fig. 5A), and decreases with age in CD and UC patients, but not in healthy adults (Fig. 5B). Notably, MDR1 function is not influenced by IBD-related surgeries (e.g., bowel resections), or medication history.
Importantly, we found that three CD patients (1 male, 2 females) display statistical MDR1 loss-of-function (i.e., cumulative MDR1 function scores less than 3 standard deviations below the healthy donor mean) (Fig. 6B). Each of these MDRl'° CD patients display marked impairment in MDR1 transport activity in all T cell subsets analyzed (Fig. 7). They also show atypically low MDR1 function for their age (Fig. 5B), and have unique medication histories (Fig. 8 A). Clinically, all three MDRl10 CD patients were diagnosed at an earlier than average age (Fig. 8B), and have a history of aggressive small bowel disease. Indeed, MDRl function is lowest among CD patients with treatment-refractory ileitis (i.e., have required surgical intervention) (Fig. 8C), including two of the three MDRl10 CD patients; the third was only recently diagnosed. Together, these data suggest that MDR1 function influences CD susceptibility and disease severity.
Example 3 MDR1 regulates T cell homeostasis in the presence of conjugated bile acids Given that MDR1 interacts with small intestinal CBAs, and loss or knockdown of MDR1 in Teff cells leads to increased TNFa and IFNy expression in the small intestine, we hypothesized that CBAs suppress pro-inflammatory cytokine expression via MDR1. Indeed, it was found that both glycine- and taurine-conjugated CDCA acutely inhibit TNFa expression in ex vzw-stimulated Teff cells in dose- and MDR1 -dependent manners. By contrast, unconjugated CDCA suppresses TNFa expression in both wild type and MDR1- deficient Teff cells, consistent with the fact that only CBAs interact with MDR1. Elevated TNFa expression in CBA-treated MDR1 -deficient Teff cells is not recapitulated in the presence of other detergents (e.g., tween 20, NP-40, etc.), indicating that MDR1 does not generically regulate Teff cell function in the face of membrane damage. Further, unlike MDR1 , TNFa regulation by CBAs does not involve the cell surface BA receptor, Tgr5
(Gpbarl). Indeed, Teff cells do not express Tgr5 in vivo, and neither germline ablation nor shRNA-mediated knockdown of Tgr5 affects Teff cell TNFa expression in the presence of CBAs in vitro or in the small intestine in vivo.
MDR1 transport activity is important for CBA-dependent TNFa suppression. First, we observed that inhibition of MDR1 function in wild type Teff cells via elacridar increases TNFa expression in the presence, but not absence, of tauro-chenodeoxycholic acid (tCDCA). As expected, elacridar has no impact on TNFa expression in MDR1 -deficient Teff cells. Second, tCDCA-mediated inhibition of TNFa expression in the MDR1" mouse T cell lymphoma line EL4 requires ectopic expression of transport-competent human MDR1 (hMDRl); tCDCA does not repress TNFa expression in parental EL4 cells, EL4 cells expressing an empty retrovirus, or EL4 cells expressing a transport-deficient MDR1 mutant. EL4 cells were used for these experiments because constitutive MDR1 expression is not tolerated in primary TH cells. Finally, tCDCA down-regulates Tnf mRNA expression in an MDR1 -dependent manner, indicating regulation of gene expression.
MDR1 transport activity also enforces Τ cell survival in the face of more chronic CBA exposure, consistent with the fact that loss or knockdown of MDR1 results in impaired Teff cell persistence in vivo. First, we observed that tCDCA kills 80-90% of ex v/vo-isolated wild type TH cells after 18-24 hours. Second, the surviving 10-20% of tCDCA-treated TH cells are uniformly MDR1 + Teff cells, judged either by Rhl23 efflux in wild type cells, or ametrine expression in MDRl-reporter cells. Third, inhibition of MDR1 transport activity by elacridar abolishes wild type Teff cell survival in the presence of long-term tCDCA treatment, but has no effect on survival in the absence of tCDCA. Fourth, MDR1 -deficient TH cells do not survive chronic tCDCA exposure, even in the absence of elacridar. Prolonged survival of EL4 cells in the presence of tCDCA also requires ectopic expression of transport- competent hMDRl . In conclusion, these data indicate that MDR1 directly and specifically regulates Teff cell homeostasis in the presence of CBAs.
Example 4 Bile acid sequestration remedies MDR1 -deficient TH cell dysfunction in vivo
Our studies revealed that MDR1 directly and specifically regulates Teff cell homeostasis in the presence of conjugated bile acids (CBAs). We therefore hypothesized that BA sequestrants such as cholestyramine (CME), which bind CBAs in the lumen of the small intestine and prevent reabsorption through the ileal lamina propria, will correct MDR1- deficient TH cell dysfunction in vivo. After confirming CME treatment increases fecal bile acid excretion in Ragl " mice transplanted with MDR1 -deficient TH cells, indicative of reduced intestinal reabsorption, we found that CME treatment: (0 suppresses ileitis; (it) increases MDR1 -deficient Teff cell persistence in small intestine; and (Hi) reduces TNFa and ΙΡΝγ expression by MDR1 -deficient Thl and Thl7 cells in the small intestine.
Bile acid sequestration can have systemic effects on metabolism, confounding analysis of weight loss; reduced BA recirculation to the liver stimulates de novo BA biosynthesis by hepatocytes, reduces cholesterol, and shows metabolic benefit in animal models of obesity and diabetes. However, we observed that CME does not impact TH cell- induced colitis, and has no effect on Teff cell function outside of the small intestine.
Therefore, these data suggest that locally recycled CBAs interact with mucosal Teff cells in the ileum in vivo, where they promote pro-inflammatory Thl 7 and Thl cell dysfunction in the absence of MDR1.
If Teff cells infiltrating the ileum upregulate Mdrl expression to prevent potentially pathogenic interaction with locally recycled CBAs, then bile acid sequestrants such as cholestyramine (CME) (Arnold et al., 2014) - that bind CBAs in the intestinal lumen and prevent their reabsorption into the ileal lamina propria - could be pharmacologically useful to limit mucosal dysfunction of Mdrl -deficient Teff cells and reduce associated ileitis without inducing systemic immune suppression. To test this, we treated Ragl" " mice transplanted with wild type or Mdrl -deficient TH cells with or without CME upon onset of weight loss to assess therapeutic effects. We confirmed that CME -treated Ragl" " recipients display increased fecal BA excretion, indicative of reduced ileal BA reabsorption (Bhat et al., 2003; Dawson et al., 2003), and we found that CME selectively attenuates Mdrl-defcient TH cell- induced ileitis; CME has no impact on normal small bowel histology in Ragl"'" mice receiving wild type TH cells, and does not affect colitis induced by either wild type or Mdrl- deficient TH cells. In line with the fact that CME does not attenuate colitis in this model, CME has only modest effects on weight loss, albeit more so in Ragl _/" mice transplanted with Mdrl -deficient TH cells where ileitis is reduced. CME also normalizes TNFa and IFNy expression between wild type and Mdrl -deficient Thl7 and Thl cells in siLP without influencing Teff cell cytokine expression outside of the small intestine. Although BA sequestration can have broader effects on host metabolism in the liver (Bhat et al., 2003; Fan et al., 2014; Hofmann and Hagey, 2014), these results are consistent with the notion that BA sequestration also acts locally in the ileum to prevent pathogenic interactions between mucosa-associated CBAs and Mdrl -deficient Teff cells.
Given these results, we hypothesized that MDR1 loss-of-function might be evident in other clinical or pre-clinical instances of ileitis. The SAMP1 /YitFc (SAMP) mouse is one of the only pre-clinical models of spontaneous Crohn's disease -like ileitis (Pizarro et al., 2003). SAMP ileitis occurs with 100% penetrance by 30 weeks of age, and displays histologic similarity to CD {Rodriguez-Palacios et al., 2015). Like Mdrl -deficient cells, SAMP Teff cells display increased TNFa and IFNy expression in siLP, and transfer ileitis in SCID recipients (Kosiewicz et al., 2001 ; Marini et al., 2003). SAMP ileitis also develops under germ free conditions, indicating disease pathogenesis does not require enteric bacteria (Barnes et al., 2007). Using Rhl23 efflux as a measure of Mdrl function, we found that SAMP Teff cells are indeed Mdrl -null. Mdrl loss-of-function in SAMP mice parallels expression of an altered Abcbl a transcript that is present at reduced levels compared to MHC-matched wild type (AKR) mice and that lacks exon 23 by sequence alignment (Figure 7B). Exclusion of exon 23 from SAMP Abcbl a mRNA is not due to a genomic deletion (Rodriguez-Palacios et al., 2014), which is consistent with a previously reported retroviral insertion found near the 5' boundary of Abcbl a exon 23 in other SAMP-related strains (Zhang et al., 2008).
MDR1 function is also reduced in circulating T cells from Crohn's disease (CD) patients compared to either healthy adults or ulcerative colitis (UC) patients. This measure of MDR1 function incorporates the combined frequency of Rhl 23'° (MDR1+) cells within all MDR1 -expressing human CD4+ and CD8+ T cell subsets to better reflect germline-encoded function (CD4+ Teff cells, CD8+ naive T cells, CD45RO+ and CD45RO" CD8+ Teff cells). We ensured assay reliability over time by analyzing MDR1 function in a control stock of healthy donor PBMC in parallel with each independent batch of patient samples, and we confirmed that all data are normally distributed. MDR1 function is reduced in both male and female CD patients, and decreases with age in CD and UC patients, but not in healthy adults. Notably, MDR1 function in IBD patient PBMC is not genetically influenced by the number of bowel surgeries or medication history.
Three CD patients in particular (1 male, 2 females) display marked MDR1 loss-of- function (i.e., cumulative MDR1 function scores < 3 standard deviations below the healthy donor mean). Each of these MDR110 CD patients show impaired transport activity in all MDR1 -expressing T cell lineages; they also show atypically low MDR1 function relative to other patients of similar age, and have unique medication histories. Clinically, all three MDR1 lo CD patients were diagnosed at an earlier than average age, and two of these patients have a history of aggressive small bowel disease requiring surgical intervention; the third MDRl '° patient was only recently diagnosed upon presenting with ileitis. That deficiencies in MDR1 function are observed in humans and enriched for within ileal CD patients is both predicted by our animal studies, and supportive of the notion that MDR1 has unique functions that safeguard immune homeostasis in the ileum.
Here we show that Thl 7 and Thl cells "adapt" upon migration into the lamina propria of the ileum. Ileal adaptation involves upregulation of the xenobiotic membrane transporter, Mdrl , and permits homeostasis in the presence of locally recycled bile acids. CD4+ effector/memory (Teff) lineages, particularly Thl 7 cells, are recognized for displaying functional plasticity following initial differentiation; plasticity referring to instances where Teff cells of one lineage (e.g., IL-17A+ Thl 7 cells) modify effector cytokine expression to take on characteristics of another lineage (e.g., IFNg expression) (Nakayamada et al., 2012).
By contrast, adaptation occurs when Teff lineages acquire novel functions within discrete tissue microenvironments. Adaptation of Thl 7 and Thl cells shown here in the ileum is consistent with previous reports showing tissue-specific functions in Foxp3+ Tregs. In visceral adipose tissue, for example, Tregs upregulate expression of the nuclear receptor, PPARg, to suppress diabetogenic inflammation (Cipolletta et al., 2012). Tregs in skeletal muscle and lung upregulate amphiregulin (Areg) to facilitate tissue-repair following injury (Arpaia et al., 2015; Burzyn et al., 2013). And in colon lamina propria, Tregs upregulate expression of ST2, a component of the IL-33 receptor, to suppress colitogenic Teff cell function (Schiering et al., 2014). Most recently, Mucida and colleagues showed that Tregs adapt to the intestinal epithelium by converting to CD44CD8aa+ intraepithelial lymphocytes (Sujino et al., 2016). Our results suggest that adaptation within non-lymphoid tissues is a common feature of circulating lymphocytes, which highlights the impact of the tissue microenvironment on lymphocyte function, raises important new concepts in the pathogenesis of tissue-specific inflammatory diseases, and predicts that tissue-specific immune modulation is possible in patients.
Our results also show that steady-state circulation of conjugated bile acids (CBAs) through the ileal mucosa has direct and important consequences on mucosal Teff cell function; Teff cells lacking Mdrl display marked and specific mucosal dysfunction in the ileum that is rescued by either genetic ablation of the ileal bile acid transporter, Asbt, or dietary administration of the bile acid sequestrant, cholestyramine. Enterohepatic CBA circulation allows for maintenance of the intestinal CBA pool in vivo without the need for continual replenishment through biosynthesis. A defining feature of enterohepatic CBA circulation is active reabsorption in the ileum by specialized enterocytes expressing the CBA transporters Asbt— that mediates transport of luminal CBAs across the apical membrane of enterocytes - and OSTa/b, which drives basolateral CBA transport from the enterocyte cytoplasm into the lamina propria (Dawson et al., 2009). Because of their fundamental activities in digestion and nutrient absorption, CBAs have evolved to be synthesized in the liver and reabsorbed in the ileum independent of microbiota (Hofmann and Hagey, 2014). Indeed, we show that Mdrl is both highly expressed in small intestinal Teff cells from germ free mice, and required for mucosal Teff cell homeostasis in antibiotic-treated Rag]''' mice. Thus, in addition to interacting with microbiota, mucosal Teff cells have evolved mechanisms to interface directly with host-derived intestinal metabolites.
Surprisingly little is known about the concentration and composition of the mucosa- associated CBA pool in the ileum, though it is reasonable to expect that mucosa-associated CBAs are present in the ileum at micro-molar concentrations; between the well established concentrations of CBAs in the ileal lumen (1-10 mM) and those observed in the portal vein (~ 50 mM) (Dawson et al., 2009; Hofmann and Hagey, 2014). This estimate also assumes that CBA concentrations within the ileal lamina propria fluctuate throughout the day, increasing in response to food intake and decreasing during periods of fasting. In line with these estimated concentrations, we find that individual CBAs (e.g., taurine- or glycine-conju gated chenodeoxycholic acid), modulate Mdrl function, TNFa expression, and survival in cultured Teff cells starting at ~ 300 mM. Endogenous bile acids present in the small intestine lumen— whether from wild type, germ free, or antibiotic-treated mice - interact with Mdrl at even lower concentrations (25-100 mM). We used taurine-conjugated chenodeoxycholic acid (tCDCA) in our in vitro experiments because it is both a hydrophobic primary BA
synthesized by hepatocytes independent of microbiota and a high-affinity Asbt transport substrate (Craddock et al., 1998). Indeed, treating splenic wild type and Mdrl -deficient Teff cells with tCDCA recapitulates several aspects of Mdrl -deficient Teff cell mucosal dysfunction observed in small intestines of transferred Ragl '~ mice, namely increased TNFa expression and decreased persistence; these effects of tCDCA on cultured Teff cells are both time- and dose-dependent. Thus, a full appreciation of the complex interplay between mucosal Teff cells and mucosa-associated CBAs in vivo requires further insight into the size and composition of the intestinal CBA pool in vivo, the duration of Teff cell persistence in the ileum, and how these parameters change in the context of disease.
Much remains to be learned about how CBAs interact with Mdrl , and how these interactions in turn dictate Teff cell survival and function. We show that CBAs acutely modulate Mdrl function without acting as either direct transport substrates or inhibitors. Rather, several lines of evidence suggest a model wherein Mdrl transports endogenous lipids upon CBA exposure to maintain plasma membrane integrity. First, CBAs are membrane impermeant detergents that influence cell physiology primarily by disrupting plasma membrane architecture (Jean- Louis et al., 2006; Zhou et al., 2009; Zhou et al., 2013). Second, Mdrl is a broad-specificity "lipid flippase", capable of transporting diverse phospholipid species from the inner to outer membrane leaflet (Sharom et al., 2005). Third, the closest homologue of human MDR1 is ABCB4, a dedicated phosphatidylcholine (PC) transporter that secretes PC into bile in a manner that is indirectly stimulated by CBAs (Morita and Terada, 2014; Vasiliou et al., 2009). This CBA-stimulated lipid transport model is consistent with our findings that CBA exposure leads to competitive inhibition Mdrl -dependent Rhl23 efflux without binding directly to Mdrl (Figure S6H), while at the same time modulating Teff cell survival and function in a manner that requires Mdrl transport activity. Membrane disorganization induced by CBAs in the absence of Mdrl could result in overt membrane damage, which we have not observed (data not shown), or lead to altered signaling due to disruption of spatially-organized plasma membrane microdomains, such as cholesterol-rich lipid rafts (Jean-Louis et al., 2006; Zhou et al., 2013). Indeed, our study opens new avenues for interrogating the endogenous substrates and functions of Mdrl, which our results suggest are critical for mucosal immune homeostasis in the ileum.
Our results also have important implications for the understanding and treatment of inflammatory diseases targeting the ileum, in particular Crohn's disease (CD). Ileitis is the most common and distinctive feature of CD, yet specific pathophysiologies underlying ileitis remain unclear and likely vary from patient-to-patient as a result of both individual genetic and environmental risk factors (Kaser et al., 2010). Indeed, we show that ileitis-prone (SAMP1 /YitFc) mice harbor a null mutation in the mouse ortholog of human MDR1
(Abcbla). In addition, we show overt MDR1 loss-of-function in a small group (~ 5%; 3 of 56) of ileal CD patients. Whether MDR1 loss-of-function in these patients is due to genetic mutations is not yet clear, though the fact that MDR1 function is markedly reduced in all major MDR1 -expressing T cell lineages is consistent with impaired germline-encoded function. Thus, whereas overt MDR1 loss-of-function is not a feature of all or even most ileal CD patients, these data suggest that impaired MDR1 function could contribute to ileitis in a subset of CD patients in a manner that involves interaction with additional susceptibility loci.
That Mdrl regulates ileitis in a manner that depends on genetic context is also evident in mice. In our experiments, for example, Mdrl -deficiency (in TH cells) interacts with Ragl -deficiency to promote ileitis on the FVB background. By contrast, spontaneous ileitis has not been reported in FVB Abcbla''' mice that instead are prone to colitis (Panwala et al., 1998; Staley et al., 201 1). Further, whereas the Abcbla null mutation in S AMP 1 /YitFc mice described here is associated with spontaneous ileitis, similar Abcb la mutations in other senescence-accelerated mouse (SAM) strains are only sporadically associated with ileitis (Zhang et al., 2008). Of course, Mdrl is widely expressed in vivo, and deficiency in Mdrl is thus likely to impact many cell types and tissues, most prominently intestinal epithelial cells (Maxwell et al., 2015). By contrast, our Rag1-/- transfer data demonstrate direct, cell-intrinsic regulation of mucosal Teff cell function by Mdrl, which is evident by both genetic ablation and shRN Amir-mediated knockdown on multiple genetic backgrounds (e.g., FVB, B6). Thus, we postulate that bile acid-driven dysfunction of Mdrl -deficient Teff cells in the ileum lays a pathogenic foundation for progression to overt ileitis following additional genetic lesions.
Whether rare or more common, our findings suggest that pharmacologic strategies targeting ileal bile acid reabsorption may be therapeutic in clinical settings where ileal CD is associated with overt MDR1 loss-of-function. Although BA sequestrants, such as
cholestyramine, colestipol, and colesevelam, have yet to be formally tested for efficacy in CD, a recent study found that cholestyramine induced marked endoscopic improvement and mucosal healing in a small cohort of IBD patients with associated primary sclerosing cholangitis (PSC) (Pavlidis et al., 2015). Our data suggest a mechanistic basis for this clinical result, and encourage expanded clinical efforts to test BA sequestrants in Crohn's disease. Example 5 Methods and materials
Mice: Wild type C57B1/6 (B6; stock no. 000664), B6.Ragl" (stock no. 002216), IU 7aCre (stock no. 016879), SAMP 1 /YitFc (stock no. 009355), and AKR/J (stock no.
000648) mice were purchased from The Jackson Laboratory. ROSA26ACD2 transgenic mice were generously provided by Dr. Klaus Rajewsky (Max Delbruck Center for Molecular Medicine, Berlin, Germany). Ill 7aCre mice were crossed with ~R.OSA26hCD2 transgenic animals to produce lll7a+/CreROSA26+'1,CD2 Thl 7 fate-mapping reporter mice. Wild type FVB/N (FVB; model no. FVB) and FVB Abcbla/lb'1' (model no. 1487) mice were purchased from Taconic. FVB.Ragl~'~ mice were provided by Dr. Allan Bieber (Mayo Clinic, Rochester, MN). BALB/c mice were from CLEA (Japan) and maintained under specific pathogen-free (SPF) or germ-free (GF) conditions at Osaka University.
Figure imgf000035_0001
knock-in (heterozygous) mice were generated as described in Takeuchi et al., Immunity 1 1, 443-451 , 1999; and Yoshida et al., Immunity 15, 569-578, 2001. The mice were maintained at Osaka University. Tgr5 knockout (Gpbarl'-/-) mice were generously provided by Dr.
Kristina Schoonjans (EPFL, Lausanne, Switzerland). MDR1 -reporter mice
Figure imgf000035_0002
were generated at Rodent Genetic Engineering Core (RGEC) at New York University (NYU) (see below). All mice were housed, bred, used in experiments, and sacrificed in accordance with protocols approved by the Institutional Animal Care and Use Committees of Scripps Florida, Osaka University, or NYU Medical Center.
CRISPR/Cas9-mediated generation of Abcblaametrine reporter mice: Mdrl -reporter {Abcblaame'""e) mice were generated using the Cas9-cleavase system in wild type C57B1/6 zygotes. Briefly, two guide RNAs (gRNAs) were identified using a publically available CRISPR design tool (http://cri spr.mit. edu) . These gRNAs are predicted to introduce single- stranded nicks on opposite DNA strands 22 bp upstream and 10 bp downstream of the
Abcbla stop codon; synthetic gRNAs were purchased (PNA Bio) and Cas9-dependent cleavage at the Abcbla locus was confirmed in vitro prior to zygote microinjection as previously described (Kim et al., 2014). gRNA sequences are shown below:
5' gRNA (upstream of Abcbla stop codon, protospacer in bold italics):
Figure imgf000035_0003
To facilitate reporter transgene insertion, we constructed a homology-directed DNA repair (HDR) template. 500 bp arms of homology (AOH; 5' and 3') were purchased (IDT); the 5' AOH contains sequences corresponding to all of Abcb J a exon 28 (204 bp) - minus the stop codon - plus 204 bp of intron 27-28; the V AOH contains the first 500 bp of the 3' untranslated region (UTR) downstream of the stop codon. Synonymous point mutations were introduced into both 5' and 3' AOH at the protospacer-adjacent motifs (PAMs) to remove Cas9-cleavase activity towards the HDR template. AOHs were then assembled into an ampicillin-resistant cloning vector (pSTBlue-1, Novagen) together with bicistronic reporter elements in the following order: 5' AOH (no Abcbla stop codon)— glycine-serine-glycine (GSG) linker (in-frame, 5*- GG ATCCCGA-3 ' ) -P2A peptide (in-frame, 5'- GCCACGAACTTCTCTCTGTTAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTC CT-3')— ametrine open reading frame (in-frame, with stop codon)— 3* AOH. Correct assembly was confirmed by sequencing, and the linear HDR template was excised from pSTBlue-1 (Pmel and Notl), and gel purified for zygote injections.
Approximately 150 C57B1/6 zygotes were generated by in vitro fertilization (1VF), and micro-injected with gRNAs (10 μg each), linearized HDR template (10 Dg), and Cas9- cleavase mRNA (10 μg). 76 zygotes were gown to the 400-cell blastocyst stage and implanted into 8-week old female surrogate mothers; live pups were analyzed for transgene insertion using 5' (5 '-AGTTTAACGTGTCTGCAGCTGG-3') and 3' (5'- AGCCTGC AGG ATCTGTCTG-3 ') genotyping primers that anneal outside of the targeted region. 19 live pups were recovered from the targeting; one female founder pup showed targeted transgene insertion by genotyping.
Human blood: All experiments using human blood were conducted in accordance with an IRB protocol (IRB- 14-6374) approved by the Scripps institutional review board. Buffy coats from healthy adult volunteers were purchased from OneBlood (Fort Lauderdale, FL), and peripheral blood mononuclear cells (PBMC) were isolated by Ficoll density gradient centrifugation. For profiling MDR1 function in healthy adult donors and IBD patients, frozen PBMC samples collected, prepared and stored at the UCLA Center for Inflammatory Bowel Diseases. Frozen PBMC vials, along with de-identified demographic and medical history information were sent to Scripps Florida for FACS analysis. 1 1 additional healthy donor frozen PBMC samples were graciously provided by Dr. Derya Unutmaz (The Jackson Laboratory, Farmington, CT).
Cell isolation: Mouse single mononuclear cell suspensions were prepared from spleen, peripheral lymph nodes, or mesenteric lymph nodes (MLN) as described in Uhlig et al. J. Immunol. 177, 5852-5860, 2006. For some experiments, CD4+CD25" T cells were magnetically isolated total splenocytes using an EasySep T cell negative isolation kit (Stem Cell Technologies, Inc.). For T cell transfer experiments into Ragl^' mice (see below), CD4+CD25~ T cells from spleens of donor mice were magnetically enriched as above, and then FACS-sorted to obtain pure naive T cells (CD3+CD4+CD25-CD62LhiCD44'°). For isolation of mononuclear cells from intestinal tissues, whole small intestines (duodenum to terminal ileum) or colons (cecum to anus) were removed, flushed with PBS to remove the fecal contents, and opened longitudinally to expose the epithelium. Peyers patches were excised from small intestines. Tissues were cut into small segments (~ 3 cm) and incubated for 30 min at room temperature in DMEM media (without phenol red; Life Technologies) plus 0.15% DTT (Sigma- Aldrich) to remove mucus. After washing with media, intestines were incubated for 30 min at room temperature in media containing 1 mM EDTA (Amresco) to remove the epithelium. After washing again with media, lamina propria was digested in media containing 0.25 mg/mL liberase TL and 10 U/raL RNase-free DNasel (both from Roche), with shaking in a bacterial incubator (Environ Shaker; Labline) for 15-25 min at 37°C. Single cell suspensions were passed through 70 μιη nylon filters (BD) and
mononuclear cells were isolated by 70/30% percoll gradient centrifugation (Sigma-Aldrich). Mononuclear cells were washed twice in complete T cell medium (see cell culture below), counted, and resuspended for FACS analysis or sorting. For isolation and analysis of antigen- presenting cells, mononuclear cells from spleen or small intestinal lamina propria were recovered as previously describeds", incubated with blocking antibodies (anti-CD 16/32) for 5 min at 4°C, stained with antibodies against CD45, CD1 lb, and CD1 lc, and sorted based on differential CD1 lb/CD 1 l c expression with the CD45+ gate. Splenic dendritic cells were sorted as CD45+CD1 lc+CDl lb". Rhl23hi (MDR1 ) or Rhl2310 (MDR14) Teff cells
(CD45+CD3+CD4+CD25 CD62LhiCD44'°) from mesenteric lymph nodes or small intestinal lamina propria as described in Ramesh et al. (J. Exp. Med. 211 : 89-104, 2014), following ex vivo Rhl23 efflux assays. Background Rhl23 efflux in cells treated with elacridar (0.1 μΜ) was used to set sorting gates.
T cell transfer colitis: For T cell transfer experiments using wild type FVB or FVB Abcb la/lb'1' mice, 0.5-1 x 106 naive CD4+ T cells (FACS-sorted as above) were injected (i.p.) into syngeneic WQ.Ragl''' mice. For transfers of shCD8- or shMdrl - expressing T cells, magnetically isolated FVB wild type CD4+CD25" T cells were transduced in vitro (see below), FACS-sorted as live (viability dye") ametrine+ cells on day 5 post- activation, and 0.5-1 x 106 cells were injected (i.p.) into syngeneic FVB. Rag J ~:~ mice. For shRNA mixture experiments, transduced T cells were FACS-sorted on day 5 as live (viability dye") ametrine"GFP~ cells (for untransduced cells), or ametrine+ or GFP+ cells (for transduced cells). Sorted cells were counted, mixed at 1 : 1 : 1 ratios (untransduced:GFP+:ametrine+), and checked by FACS to confirm equimolar ratios. 0.3-0.6 x 106 total mixed cells were injected (i.p.) into syngeneic mice. For all experiments, Rag1-/- mice were weighed
Figure imgf000038_0001
immediately prior to T cell transfer to determine baseline weight; mice were weighed twice weekly for the duration of the experiments, and euthanized if > 20% baseline weight loss was reached. Morbidity indexes, shown throughout, are calculated by dividing the maximum percentage of body weight loss by the number of days weight loss occurred in (e.g., 20% body weight loss/45 days). Rag1-/- mice injected with different donor T cells (i.e., wild type vs. Mdrl -deficient T cells; shCD8- vs. shMdrl -expressing T cells) were co-housed. For antibiotic treatment experiments, mice were separated into groups receiving water alone, or water containing antibiotics: ampicillin (1 M), vancomycin (0.5 M), metronidazole (1 M), neomycin (1 M), streptomycin (2 M) (all from Sigma- Aldrich). Antibiotic treatment began ~ 3-4 weeks post-transfer (upon onset of weight loss); water (+/-antibiotics) was replaced twice weekly during assessment of weights. For cholestyramine (CME) treatment experiments, mice were separated into groups receiving standard chow, or chow supplemented with 2% CME (Sigma-Aldrich), again ~* 3-4 weeks post-transfer. Standard chow pellets were ground to a fine powder using a Vitamix Professional Series 200 food processor (VitaMix), and separated, weighed, and supplemented with 2% CME resin (w:w) as necessary. During treatment, solid food was removed and replaced with covered feeding containers (Ancare Corporation) containing powder food (+/- CME), which were placed inside the cages and exchanged for cleaning at least weekly.
Histology: Colon (proximal, distal) or small intestine (proximal, mid, distal/ileum) sections (~ 1 cm) were cut from euthanized Rag1-/- mice ~ 6-8 weeks post-T cell transfer. In some experiments, larger, ~ 10 cm segments of distal small intestine and whole colon were dissected from mice and fixed intact. All tissues were fixed in 10% neutral buffered formalin, embedded into paraffin blocks, cut for slides, and stained with hematoxylin and eosin (H&E). H&E-stained sections were analyzed and scored blindly; colons as in (Wirtz et al., 2007), and small intestines/ilea as in (Kosiewicz et al., 2001).
Flow Cytometry: With the following exceptions (see below) surface and intracellular FACS staining was performed as described in Ramesh et al., J. Exp. Med. 21 1 : 89-104, 2014; and Atarashi et al., Nature 455: 808-812, 2008. FACS analysis of Rhl23 efflux was performed as in Ramesh et al., J. Exp. Med. 211 : 89-104, 2014. Intracellular FACS analyses: For intracellular stains including transcription factors (e.g., RORyt, Foxp3), cells were fixed and permeabilized using a Foxp3 intracellular staining kit (eBioscience). For all intracellular stains, cells were stimulated for 3-4 hr with phorbol 12- myristate 13-acetate (PMA) and ionomycin in the presence of brefeldin A (all from Sigma- Aldrich) prior to antibody staining. Simultaneous intracellular staining of TNFa protein and Tnf mRNA in PMA/ionomycin-stimulated cells was achieved using a mouse PrimeFlow™ RNA Assay kit (Affymetrix, Cat.#: 88-18001). The 96-well PrimeFlow™ RNA Assay protocol was followed per manufacturer's instructions without deviation; following fixation/perm eabilization, cells were stained with alexa fluor 647-conjugated (type 1) and alexa fluor 488 -conjugated (type 4) target probes against mouse Tnf (NM_013693) and beta actin (Actb, NM 007393), respectively. Following target probe signal amplification and detection, cells were stained with a PE-Cy7-conjugated anti-TNFa antibody (Biolegend), a fixable viability dye (e506, eBioscience), and a cocktail of antibodies against cell-surface antigens allowing for discrimination of effector/memory TH cells (see below for full list of antibodies).
FACS analyses of Rhl23 efflux: To determine background Rhl23 efflux, the MDR1 antagonist, elacridar (0.1 μΜ), was added to Rhl 23-labelled cells immediately prior to efflux at 37°C. For experiments using intestinal content— small intestine luminal content (SILC), colon luminal content (CLC) - or synthetic bile acids, Rhl23-labelled cells were treated with additives prior to efflux in place of elacridar.
FACS antibodies: Anti-mouse antibodies used for FACS analysis include: Alexa700- CD45, BV650-CD3, BV71 1 -CD4, BV605-CD25, Percp-Cy5.5-CD44, BV605-CD62L, APC- IFNy, APC-F4/80, APC-CD4, FITC-IL-17A, Percp-Cy5.5-IL- 17A, PE-Cy7-TNFa, PE-IL-4, PE-CD45, PE-CD63, PE-CX3CRI , Pacific Blue-CDl lb (all from Biolegend); mouse Fc Block (purified anti-CD16/32), PE-CF594-CD25 and PE-CF594-RORyt, PE-Siglec-F, PE- Ly-6G, FITC-Ly-6C, FITC-CD103, APC-CDl l c, APC-CD45 (from BD); and e450-Foxp3, FITC-I-A(b), and FITC-CD80 (from eBioscience).
Anti-human antibodies used for FACS analysis were: BV605-CD3, BV421-CD4, PE- Cy7-CD45RO, Percp-Cy5.5-CCR7 (from Biolegend); and PE-CF594-CD25 (from BD). Vital dyes include: fixable viability dyes eFluor® 450, eFluor® 506, and eFluor® 660
(eBioscience) and 7-AAD (Biolegend). Rhl 23 and elacridar were purchased from Sigma- Aldrich.
FACS instruments and analyses: All FACS data was acquired on LSRII or
FACSCantoII instruments (BD), and analyzed using FlowJo software (TreeStar, Inc.). For cell sorting, cells were filtered after staining, resuspended in DMEM media (see below) without serum, and sorted on a FACS Ariall machine (BD). For quantifying percentages of MDR1+ T cells, gates were set based on background Rhl23 efflux in elacridar-treated cells. In some experiments, MDR1 transport activity is quantified as the change (Δ) in Rhl23 mean fluorescence intensity (MFI) in elacridar- vs. medium-, SILC-, or synthetic bile acid-treated samples. Cytokine expression in T cells isolated from tissues of transferred Rag1-/- mice was analyzed between 5-8 weeks post-T cell transfer, depending on animal morbidity.
Cell culture: Mononuclear cells or purified CD4+ T cells were cultured in complete T cell media described in Carlson et al., J. Immunol. 192, 2167-2176, 2014. For in vitro T cell activation/polarization, magnetically isolated CD4+CD25' T cells from spleen were activated by anti-CD3/anti-CD28 antibodies (non-polarizing conditions; ThN) or polarized to Thl , Th2, iTreg, or non-pathogenic Thl 7 cells as described in Sundrud et al., Science 324, 1334- 1338, 2009. Pathogenic Thl7 cells were polarized as in Lee et al., Nat. Immunol.13, 991-999, 2012. For in vitro induction of MDR1 expression in CD4+ T cells by antigen-presenting cells (APCs), FACS-sorted Rhl23hl (MDRl") Teff cells from small intestinal lamina propria (see above) were co-cultured in U-bottom 96- well plates with APC subsets from small intestine or spleen at a 1 :2 ratio and stimulated with 1 μg/ml soluble anti-CD3 (BioLegend). MDRl expression was analyzed on day 4 post-stimulation by staining cultures with 7-AAD and anti- CD4 antibodies following Rhl23 efflux assay.
Retroviral plasmids and transductions: shRNAs against mouse CD 8 (Cd8a), Mdrl (Abcbla, Abcblb), and Tgr5 (Gpbarl) were purchased from TransOMIC Technologies.
shRNAs were PCR amplified and cloned into GFP- or ametrine-expressing murine retroviral vectors (LMPd) containing a modified/enhanced miR-30 expression cassette. HA-tagged human MDRl (ABCB1) was purchased from Addgene (plasmid 10957). Full-length ABCB1 was PCR-amplified without the H A-tag, and cloned into an ametrine-expressing LMPd vector without the miR-30 expression cassette. An empty LMPd.ametrine vector was generated by cutting out ABCB1 from the modified vector, blunting the restriction sites, and re-ligating. Transport-defective mutant MDRl (AMDRl; Y401 A/Y 1044A) was generated using a QuickChange site-directed mutagenesis kit (Agilent Technologies). All retroviral constructs were confirmed by sequencing prior to use in cell culture experiments. Retroviral particles were produced in Platinum E cells (PlatE cells; gift of Dr. Matthew Pipkin, Scripps Florida), and supernatants were used to transduce anti-CD3/anti-CD28-stimualted
CD4+CD25" T cells (at 24 hr post-activation) (Sundrud et al., 2009), or NIH/3T3 fibroblasts. Transduced T cells were removed from anti-CD3/anti-CD28-coated wells at 48 hr post- activation, expanded in T cell media containing recombinant human 1L-2, and analyzed or sorted via flow cytometry on day 5.
Mouse intestinal contents: For isolation of sterile, soluble intestinal contents - small intestine luminal content (SILC), colon luminal content (CLC) - fecal contents from colon or small intestine of mice were collected into 15 mL conical tubes, weighed, and diluted in T cell media (2 parts media: 1 part fecal content). Contents were mixed thoroughly by vortexing for 2 min, and solid fecal matter was pelleted by centrifugation (1,000 x g; 10 min; room temperature). Supernatants transferred to fresh eppindorf tubes were further cleared of debris by another round of high-speed centrifugation (13,000 x g; 20 min; room temperature). The resulting supernatants were collected, sterile-filtered through 0.2 μm syringe filters (VWR), aliquoted, and stored at -80°C. SILC or CLC was added to Rhl23-labelled splenocytes or purified CD4+CD25" T cells at dilutions ranging from 1 -16% (2-fold dilutions) of total culture volume (v:v). Unless otherwise stated, results show T cells treated with 4% or 8% SILC or CLC. In some experiments, SILC was depleted of bile acids by pre-treatment with cholestyramine (CME; from Sigma- Aldrich). Briefly, SILC was treated for 1 hr with PBS, or a slurry of PBS containing 50 μg/mL cholestyramine (CME). Following incubation, CME- bound material was pelleted by centrifugation (1 min; 13,000 x g; room temperature), and unbound SILC supernatant was collected and used in Rhl23 efflux experiments as above.
Bile acids: Synthetic bile acids: cholic acid (CA), glyco-cholic acid (gCA), tauro- cholic acid (tCA), deoxycholic acid (DCA), glyco-deoxycholic acid (gDCA), tauro- deoxycholic acid (tDCA), chenodeoxycholic acid (CDCA), glyco-chenodeoxycholic acid (gCDCA), or tauro-chenodeoxycholic acid (tCDCA) (all from Sigma-Aldrich) were reconstituted in PBS, aliquoted, and stored at 4°C. Bile acid concentrations used in cell culture experiments are indicated throughout. To test acute effects of bile acids on MDR1 transport (Rhl23 efflux) activity, titrating concentrations of bile acids were added to Rhl23- labelled mouse CD4+ T cells, human CD4+ T cells, or MDR1 -expressing NIH/3T3 fibroblasts immediately prior to Rhl23 efflux. For determining the effect of synthetic bile acids on cytokine expression, wild type or MDR1 -deficient splenocytes, or mouse EL4 cells were pre- treated +/- glyco-CDCA or tauro-CDCA (tCDCA) for 4 hr prior to PMA/ionomycin stimulation, without washing. In some experiments, tCDCA was added to wild type splenocytes alone, or together with elacridar (0.1 μΜ) for 4 hr prior to stimulation and staining. For long-term survival assays, wild type or MDR1 -deficient splenocytes, or EL4 cells, were treated +/- titrating concentrations of tCDCA in the presence or absence of elacridar (0.1 μΜ) for 20-24 hr, prior to viability dye and anti-CD4 staining. To analyze survival of MDR1+ Teff cells after tCDCA treatment, wild type splenocytes were treated +/- tCDCA (1.2 mM) for 20-24 hr as above, and then washed twice with media to remove tCDC A. After washing, splenocytes were cultured in T cell media alone for another 6 hr, and then subjected to FACS-staining and Rhl23 efflux. Bile acid levels in feces (for CME treatment experiments) or small intestine luminal content (SILC) were quantified using a Total Bile Acids Assay Kit (Diazyme Laboratories). For fecal bile acid analysis, bile acids were extracted from feces with t-Butanol (Amresco) as described in Bhat et al., J. Lipid Res. 44, 1614-1621, 2003.
Mdrla binding assays: Recombinant C-terminal hexa-histidine (his)-tagged mouse Mdrla used for in vitro binding experiments was expressed in and purified from P. pastoris as previously described (Aller et al., 2009). Briefly, 10 μg of purified His-tagged Mdrla in binding buffer (20 mM Hepes pH 8.0, 100 mM NaCl, 0.065% DDM and 0.2 mM TCEP) was incubated with 20-fold molar excess of BODIPY-FL vinblastine (BFV, Thermo Fisher) for 1 hr at 4 °C in presence or absence of 10-fold molar excess of verapamil (Sigma-Aldrich) or tCDCA. After binding, his-tagged Mdrla was immobilized to 25 μΐ of Ni-NTA resin at 4 "C for 30 min with gentle end-over-end mixing followed by washing three times with binding buffer to remove unbound or loosely bound fluorescent inhibitor. Bound Mdrla was then eluted with 200 μΐ of binding buffer containing 250 mM imidazole, and Mdrla-bound BFV was measured. All fluorescence measurements were carried out at least in duplicates, each representing 4 independent measurements, on an Infinite M200pro (Tecan), reading emission at 520 nm after excitation at 480 nm.
RNA-sequencing: Next-generation RNA-sequencing (RNA-seq.) was performed on FACS-sorted Rhl23hi (Mdrl ) and Rhl23'° (Mdrl+) effector/memory T cells (Teff cells: viability dye-CD45+CD3+CD4+CD25 CD441,i) from mesenteric lymph nodes of FVB.Ragl"'" mice injected 6-8 weeks prior with wild type naive T cells as above. Total RNA was isolated from triplicate Mdrl+/- Teff samples - in 3 independent transfer experiments - using RNeasy columns (Qiagen), with on-column DNase treatment. 500 ng of total RNA was used for analysis. Library preparation was performed using TrueSeq total RNA-Seq (Illumina), according to manufacturer's instructions. Resulting libraries were quantified using
Bioanalyzer (Agilent) and qPCR (Kappa Biosystems). Barcoded libraries from each sample were combined at equimolar amounts and the mixture was loaded and sequenced on a
NextSeq500 instrument (Illumina). The sequencing reads (fastq files) were mapped to the mm9 genome using TopHat (Trapnell et al., 2009). The number of reads falling into each gene defined by RefSeq gene annotations were quantified using HTSeq-count. DESeq software (Anders and Huber, 2010) was used to detect differentially expressed genes between samples. Normalized gene expression was analyzed using the GenePattern software suite (http://gen epattern.broadinstitute.org), and visualized using MultiPlot; only annotated genes displaying normalized expression (RPKM) values > 0.5 in all replicate samples were analyzed (n = 10,019).
Nanostring: Cell pellets (10-30k cells/condition) were lysed in 5 DL RLT buffer containing fresh 2-mercaptoethanol (Qiagen). Frozen lysates were sent to Nanostring
Technologies, Inc. (Seattle, WA) for analysis on the nCounter platform using a custom codeset. Raw data were normalized using nSolver software (Nanostring Technologies) and exported as raw transcript counts (normalized to housekeeper control genes) for presentation.
qPCR: RNA was isolated from cultured or ex vivo-isolated cells using RNeasy columns with on-column DNase treatment (Qiagen); this was used to synthesize cDNA via a high capacity cDNA reverse transcription kit (Life Technologies/ Applied Biosystems).
Taqman qPCR was performed on a StepOnePlus real time PCR instrument (Life
Technologies/Applied Biosystems) as previously described (Ramesh et al., 2014). The following taqman primer/probe sets (all from Life Technologies/Applied Biosystems) were used: Abcbla (assay ID: Mm00607939_sl); Abcblb (assay ID: Mm00440736_ml); Gapdh (assay ID: mm99999915_gl).
16S rDNA metagenomics (microbiome analyses): Genomic DNA from mouse (cecal) stool was purified by QIAamp DNA Stool Mini Kit Stool (Qiagen) according to manufacturer's protocol. Bacterial species were identified by 16S ribosomal DNA
sequencing using the Ion 16S Metagenomics kit (Life Technologies). Briefly, DNA was amplified utilizing two primer sets that selectively amplify the hypervariable regions against 16S rRNA gene V2-4-8 and V3-6, 7-9, respectively. Amplicons for each sample were pooled and adaptor ligated with barcoded adaptors specific for Ion Torrent platforms. Samples were then pooled at equimolar ratios and sequenced using 400 bp chemistry on Ion Torrent Personal Genome Machine using 316 and 318 chips. Data was analyzed with Ion Reporter software Ion 16S Metagenomics kit analysis module (Life Technologies).
cDNA sequence analysis: Cloned cDNA sequences from AKR and SAMPl/YitFc RT-PCR reactions were aligned using MegAlign Pro (DNASTAR).
Statistical analyses: Statistical analyses were performed using Prism (GraphPad). Paired or unpaired student's t tests, and one-way ANOVA were used as appropriate and are indicated throughout. Significance levels are specified in legends. ***
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
All publications, databases, GenBank sequences, patents, and patent applications cited in this specification are herein incorporated by reference as if each was specifically and individually indicated to be incorporated by reference.

Claims

WHAT IS CLAIMED IS:
1. A method for quantifying MDR 1 activity in T cells of a human subject, comprising (a) assaying MDR1 function in at least one MDR1 -expressing effector T cell subsets in a biological sample obtained from the subject, and (b) comparing the assayed MDR] function to a background MDR1 function determined with at least one control T cell subset that does not express MDR1, thereby quantifying MDR1 activity in T cells of the human subject; wherein the MDR 1 -expressing effector T cell subset is elected from the group consisting of (i) CD4" effector/memory (CD4* Teff, CD4*CD25 CD45RCTCCR710); (ii) CD8' naive (CD4 CD25 CD45RO CCR7hl); (iii) CD8" effector/memory (CD8"Teff, CD4 CD25' CD45ROXCR7to); and (iv) CD84 short-lived eiTcctotfrncmory (CD8+ Temra, CD4CD25" CD45RO CCR7'°).
2. The method of claim 1 , wherein the biological sample comprises peripheral blood mononuclear cells from the subject.
3. The method of claim 1 , wherein MDR1 function is assayed via
determining the frequency of MDR1 ' cells in each T cell subset.
4. The method of claim 3, wherein the assayed MDR1 function is the combined MDRT cell frequency from the at least one MDR 1 -expressing effector T cell subsets.
5. The method of claim 3, wherein the assayed MDR1 function is the combined MDR1 * cell frequency from effector T cell subsets (i) to (iv).
6. The method of claim 1 , wherein the control T cell subset is (i) CD4* naive T cells (Tnaive, CD4+CD25 CD45RO-CCR7h') or (ii) regulatory T cells (Treg, CD4'CD25,li) present in the same biological sample from the subject.
7. The method of claim 1 , wherein the effector T cell subsets from the biological sample are separated via fluorescence-activated cell sorting (FACS).
8. The method of claim 3, wherein MDR 1 ' cell is determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells of the effector T cell subsets.
9. The method of claim 8, further comprising determining MDRl + activity in cells of the MDR1 -expressing effector T cell subsets that are treated with a MDR1 inhibitor.
10. The method of claim 1, wherein the biological sample comprises cryopreserved peripheral blood mononuclear cells, wherein the determined MDRl * cell frequency is the combined MDRl cell frequency from effector T cell subsets (i) to (iv), and wherein MDR T cell is determined via labeling cells in the biological sample with rhodamine 123 (Ml 23) and flow cytometry analysis of Rhl23 efflux from cells in each of the effector T cell subsets.
11. The method of claim I , wherein the subject is afflicted with an inflammatory bowel disease (IBD).
12. The method of claim 11 , wherein the IBD is Crohn's disease or ulcerative colitis.
13. A method for identifying a human patient with an inflammatory bowel disease (IBD) for treatment with bile acid sequestration therapies, comprising (a) obtaining a biological sample containing CD3f T cells from a candidate IBD patient and from at least one healthy control subject, (b) determining the combined MDRl * cell frequency in two or more effector T cell subsets in the biological sample consisting of (i) CD4* effector/memory (CD4* Teff, CD4 CD25 CD45RO CCR7la); (ii) CD8~ naive (CD4 CD25 CD45RO CCR7hi); (iii) CD8~ effector/memory (CD8* Teff, CD4 CD25 CD45RO*CCR7l<>); and (iv) CD8' short-lived effector/memory (CD8 Tcmra, CD4 CD25-CD45RaCCR7k>), and (c) comparing the combined MDR l * cell frequency of the candidate IBD patient to the combined MDRl* cell frequency of the control subject; wherein a substantive decrease of the combined MDR l * cell frequency of the candidate IBD patient from the combined MDR l' cell frequency of the control subject identifies the candidate IBD patient as one suitable for treatment with bile acid sequestration therapies.
14. The method of claim 13, wherein the candidate IBD subject is a Crohn's disease patient.
15. The method of claim 13, wherein the combined MDRl* cell frequency is combined MDRl ' cell frequency of all effector T cell subsets (i) to (iv).
16. The method of claim 13, wherein determining the combined MDR1+ cell frequency further includes quantifying a baseline MDR1 ' cell frequency in at least one control T cell subset that docs not express MDR1.
17. The method of claim 16, wherein the control T cell subset is (i) CD44 naive T cells (Tnaivc, CD4'CD25 CD45RO CCR7hi) or (ii) regulatory T cells (Trcg, CD4*CD25h ) present in the same biological sample.
18. The method of claim 13, wherein the biological sample comprises peripheral blood mononuclear cells from the patient.
19. The method of claim 13, wherein the effector T cell subsets from the biological sample are separated via fluorescence-activated cell sorting (FACS).
20. The method of claim 13, wherein MDR 1 ' cell is determined via labeling cells in the biological sample with rhodamine 123 (Rhl23) and flow cytometry analysis of Rhl23 efflux from cells of the effector T cell subsets.
21. Λ method for treating an inflammatory bowel disease (IBD) in a human patient, comprising (a) detecting MDR1 loss-of-function in a candidate IBD patient, and (b) administering to the patient a pharmaceutical composition comprising a therapeutically effective amount of a bile acid sequestrant; thereby treating the inflammatory bowel disease in the patient.
22. The method of claim 21 , wherein MDR 1 loss-of-function is detected by (a) obtaining a biological sample containing CD3' T cells from the candidate patient, (b) determining the combined MDR1+ cell frequency in two or more effector T cell subsets in the biological sample consisting of (i) CD4* effector/memory (CD4' Tcff, CD4+CD25"
CD45ROXCR710); (ii) CD8* naive (CD4 CD25 CD45RO CCR7hi); (iii) CD8*
effector/memory (CD8" Teff, CD4"CD25-CD45RO+CCR7u>); and (iv) CD8' short-lived effector/memory (CD8* Temra, CD4 CD25 CD45RO CCR7*), and (c) comparing the combined MDR 1' cell frequency of (he candidate IBD patient to combined MDR14 cell frequency in the same biological sample from one or more healthy control subjects.
23. The method of claim 21, wherein the IBD is Crohn's disease.
PCT/US2017/038950 2016-06-23 2017-06-23 Diagnostic and therapeutic methods related to inflammatory bowel diseases Ceased WO2017223409A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662353914P 2016-06-23 2016-06-23
US62/353,914 2016-06-23

Publications (1)

Publication Number Publication Date
WO2017223409A1 true WO2017223409A1 (en) 2017-12-28

Family

ID=60783239

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/038950 Ceased WO2017223409A1 (en) 2016-06-23 2017-06-23 Diagnostic and therapeutic methods related to inflammatory bowel diseases

Country Status (1)

Country Link
WO (1) WO2017223409A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109536528A (en) * 2018-11-08 2019-03-29 武汉纤然生物科技有限公司 A method of animal tumor model is constructed using CRISPR-Cas9 gene editing technology
CN119857143A (en) * 2023-10-20 2025-04-22 天津济坤医药科技有限公司 Application of CD84 as therapeutic target in preparation of medicines for preventing and treating inflammatory bowel disease

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DONNENBERG, VS ET AL.: "P-glycoprotein (P-gp) is upregulated in peripheral T- cell subsets from solid organ transplant recipients", JOURNAL OF CLINICAL PHARMACOLOGY, vol. 41, no. 12, December 2001 (2001-12-01), pages 1271 - 1279, XP008138757 *
DUBOC, H ET AL.: "Increase in fecal primary bile acids and dysbiosis in patients with diarrhea-predominant irritable bowel syndrome", NEUROGASTROENTEROLOGY AND MOTILITY, vol. 24, no. 6, 22 February 2012 (2012-02-22), pages 513 - 520, XP055449792 *
JAHNEL, J ET AL.: "Inflammatory Bowel Disease Alters Intestinal Bile Acid Transporter Expression", DRUG METAB DISPOS, vol. 42, no. 9, 25 June 2014 (2014-06-25), pages 1423 - 1431, XP055449793 *
SUNDRUD, MS ET AL.: "The xenobiotic transporter Mdr1 permits T cell adaptation to mucosa-associated bile acids in the ileum", JOURNAL OF IMMUNOLOGY, vol. 198, no. 1, 1 May 2017 (2017-05-01) *
ZHANG, YJ ET AL.: "Multidrug resistance gene and its relationship to ulcerative colitis and immune status of ulcerative colitis", GENETICS AND MOLECULAR RESEARCH, vol. 13, no. 4, 19 December 2015 (2015-12-19), pages 10837 - 10851, XP055449789 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109536528A (en) * 2018-11-08 2019-03-29 武汉纤然生物科技有限公司 A method of animal tumor model is constructed using CRISPR-Cas9 gene editing technology
CN119857143A (en) * 2023-10-20 2025-04-22 天津济坤医药科技有限公司 Application of CD84 as therapeutic target in preparation of medicines for preventing and treating inflammatory bowel disease

Similar Documents

Publication Publication Date Title
Fidelle et al. A microbiota-modulated checkpoint directs immunosuppressive intestinal T cells into cancers
Abadie et al. IL-15, gluten and HLA-DQ8 drive tissue destruction in coeliac disease
Ge et al. MicroRNA-125a suppresses intestinal mucosal inflammation through targeting ETS-1 in patients with inflammatory bowel diseases
Matute et al. Intelectin-1 binds and alters the localization of the mucus barrier–modifying bacterium Akkermansia muciniphila
Chen et al. The short isoform of the CEACAM1 receptor in intestinal T cells regulates mucosal immunity and homeostasis via Tfh cell induction
He et al. ETS-1 facilitates Th1 cell-mediated mucosal inflammation in inflammatory bowel diseases through upregulating CIRBP
Tougaard et al. TL1A regulates TCRγδ+ intraepithelial lymphocytes and gut microbial composition
Young et al. Aberrant Muscle Antigen Exposure in Mice Is Sufficient to Cause Myositis in a Treg Cell–Deficient Milieu
Jimenez et al. The miR-181 family regulates colonic inflammation through its activity in the intestinal epithelium
Pu et al. Low‐Dose Chemotherapy Preferentially Shapes the Ileal Microbiome and Augments the Response to Immune Checkpoint Blockade by Activating AIM2 Inflammasome in Ileal Epithelial Cells
Jacobse et al. Distinct roles for interleukin-23 receptor signaling in regulatory T cells in sporadic and inflammation-associated carcinogenesis
Janarthanam et al. Bulk T‐cell receptor sequencing confirms clonality in pediatric eosinophilic esophagitis and identifies a food‐specific repertoire
Zheng et al. Laser capture microdissected mucosa versus whole tissue specimens for assessment of radiation-induced dynamic molecular and pathway changes in the small intestine
Rondeau et al. CXCR4 signaling determines the fate of hematopoietic multipotent progenitors by stimulating mTOR activity and mitochondrial metabolism
Keerthivasan et al. Wnt/β-catenin signaling in T-cells drives epigenetic imprinting of pro-inflammatory properties and promotes colitis and colon cancer
La Scaleia et al. Peripheral and intestinal CD4+ T cells with a regulatory phenotype in pediatric patients with inflammatory bowel disease
Liu et al. Reversing Immunosenescence with Senolytics to Enhance Tumor Immunotherapy
Yin et al. Type I interferon signaling promotes mucosal inflammation in murine models of colitis
Ito et al. ILC2s navigate tissue redistribution during infection using stage-specific S1P receptors
Aidarova et al. CARD14 signaling in intestinal epithelial cells induces intestinal inflammation and intestinal transit delay
EP4359795B1 (en) Methods for diagnosing a cancer- or antibiotics-induced dysbiosis and their use for improving cancer treatment by immunotherapy
Yoon et al. Is cyclosporine as effective in chronic ul cerative colitis as in severe ulcerative colitis?
Wang et al. BACH2 controls ILC3 function via PPARγ-dependent mitochondrial metabolism
Staley et al. Critical Role for P‐Glycoprotein Expression in Hematopoietic Cells in the FVB. Mdr1a−/− Model of Colitis
me Yoon Novel Immune Responses in Lung Injury and Fibrosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17816270

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17816270

Country of ref document: EP

Kind code of ref document: A1