WO2017219062A1 - Methods for differentiating cells into cells with a muller cell phenotype, cells produced by the methods, and methods for using the cells - Google Patents
Methods for differentiating cells into cells with a muller cell phenotype, cells produced by the methods, and methods for using the cells Download PDFInfo
- Publication number
- WO2017219062A1 WO2017219062A1 PCT/AU2017/000138 AU2017000138W WO2017219062A1 WO 2017219062 A1 WO2017219062 A1 WO 2017219062A1 AU 2017000138 W AU2017000138 W AU 2017000138W WO 2017219062 A1 WO2017219062 A1 WO 2017219062A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- population
- cell
- notch
- retinal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0618—Cells of the nervous system
- C12N5/062—Sensory transducers, e.g. photoreceptors; Sensory neurons, e.g. for hearing, taste, smell, pH, touch, temperature, pain
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/30—Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/40—Regulators of development
- C12N2501/42—Notch; Delta; Jagged; Serrate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/08—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from cells of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- This invention relates to compositions and methods for directed differentiation of cells towards a Muller cell phenotype.
- Cells produced using the compositions and methods may be used in the study of retinal diseases and disorders, for drug screening and for therapeutic purposes.
- Muller glial cells the principal glial cells in the retina, play an important role in maintaining retinal homeostasis. They provide metabolic supports to the surrounding neurons, produce neuroactive and vasoactive substances, and regulate retinal ion, water content and pH. Dysfunction of Muller cells is associated with different retinal diseases including diabetic retinopathy and Macular Telangiectasia Type 2.
- Macular Telangiectasia Type 2 (MacTel2) is a macular degenerative disease, which affects the central vision. Recent studies have suggested that dysfunction of Muller glial cells, the major supporting cells in the retina, may contribute to the pathogenesis of the disease. Its cause is unknown so far, and its effective treatment has not yet been developed.
- retinal cells such as retinal pigmented epithelial cells and photoreceptors, Muller cell differentiation from human stem cells, and their transplantation in animal models of retinal diseases have to date not been demonstrated.
- the present invention relates generally to the field of stem and progenitor cell biology, more specifically the directed differentiation of stem and progenitor cells using novel culture conditions.
- a method for producing cells having a Miiller cell phenotype from a population of retinal progenitor cells comprising cultunng the population of cells for a time and under conditions sufficient for inducing Notch signalling in said population of cells to thereby differentiate the population of cells into the cells having a Miiller cell phenotype.
- inducing Notch signalling is effected by contacting the cells with one or more of: a Notch ligand, Notch intracellular domain (N1CD), HES l , HES5, DNA-binding protein RBPJ, or deltex.
- a Notch ligand Notch intracellular domain (N1CD)
- HES l Notch intracellular domain
- HES5 DNA-binding protein RBPJ
- deltex deltex
- Notch ligand is selected from the group consisting of Delta like ligand (DLL)-l, Delta like ligand-3, Delta like ligand-4, Jagged (JAG)-l and Jagged-2.
- DLL Delta like ligand
- JAG Jagged
- Jagged-2 Jagged
- said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (N1CD), HES l, HES5, DNA-binding protein RBPJ, and deltex.
- nucleic acid construct is a viral vector.
- the population of retinal progenitor cells are derived from a human. 18. The method according to any one of the preceding statements, wherein the population of retinal progenitor cells are derived from a cell or population of cells selected from the group consisting of stem cells, progenitor cells and de-differentiated cells.
- stem cell is an Embryonic Stem Cell (ESC) or an induced Pluripotent stem cell (iPSC).
- ESC Embryonic Stem Cell
- iPSC induced Pluripotent stem cell
- a method for producing cells having a Miiller cell phenotype from a population of stem cells comprising: i) differentiating a population of stem cells to produce a population of cells having a retinal progenitor cell phenotype and ii) culturing the population of cells having a retinal progenitor phenotype produced by step i) for a time and under conditions sufficient for inducing Notch signalling in the population of cells having a retinal progenitor phenotype and thereby differentiate them into cells having a Miiller cell phenotype.
- step i) differentiating the population of cells in step i) is effected by culturing said population of stem cells in a neural differentiation medium.
- the neural differentiation medium comprises DK -1, IGF-1 and Noggin.
- Notch ligand is selected from the group consisting of Delta like ligand- 1, Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2.
- said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (NICD), HES 1, HES5, DNA-binding protein RBPJ, and deltex.
- nucleic acid construct is a viral vector.
- step i) The method according to any one of statements 20 to 32 wherein said differentiating in step i) is effected for about 3 to 4 weeks.
- step ii) The method according to any one of statements 20 to 33 wherein said culturing the population of cells in step ii) is effected for from about 1 week to about 6 weeks.
- step ii) The method according to any one of statements 20 to 33 wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 2 weeks.
- step ii) The method according to any one of statements 20 to 33 wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 1 week.
- the population of iPSCs is derived from a subject having macular degeneration, diabetic retinopathy or Macular Telangiectasia Type 2, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma or retinopathy of prematurity.
- the cells with a Miiller cell phenotype express one or more markers selected from the group consisting of GFAP, GS, VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1.
- retinal disease or disorder is associated with or arises at least in part from dysfunction, injury and/or loss of Miiller cells in the subject.
- a pharmaceutical composition comprising the cells having a Miiller cell phenotype according to statement 48.
- a kit for producing cells having a Miiller cell phenotype comprising one or more agents capable of inducing Notch signalling in a population of cells.
- kits according to statement 54 wherein said one or more agents comprises a Notch ligand, Notch intracellular domain (NICD), HES l , HES5, DNA-binding protein RBPJ, and deltex.
- said one or more agents comprises at least two Notch ligands.
- Notch ligand is selected from the group consisting of Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
- kit comprising a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling.
- kits according to statement 59 wherein said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (NICD), HES l , HES5, DNA-binding protein BPJ, and deltex.
- Notch receptor Notch intracellular domain
- HES l Notch intracellular domain
- HES5 DNA-binding protein BPJ
- deltex deltex
- kits according to any one of statements 59 to 61 wherein said polynucleotide or polynucleotides encode/s one or more of NICD, HES l and/or HES5.
- kit according to any one of statements 54 to 62 further comprising a cell selected from the group consisting of a stem cell, progenitor cell, a dedifferentiated cell, or retinal progenitor cell.
- kit according to any one of statements 54 to 63, further comprising an agent for detecting expression of one or more markers indicative of the Miiller cell phenotype.
- kit according to any one of statements 54 to 64, further comprising a cell culture medium.
- culture medium comprises a base medium of DMEM/F12 and B27 and N2 supplements, penicillin and streptomycin.
- culture medium comprises a base medium of DMEM/F12 and B27 and N2 supplements, penicillin and streptomycin.
- a medium for producing cells having a Miiller cell phenotype wherein the medium comprises one or more of: a Notch ligand, Notch intracellular domain (NICD), HES1, HES5, DNA-binding protein RBPJ, and/or deltex.
- a Notch ligand Notch intracellular domain (NICD)
- HES1 Notch intracellular domain
- HES5 DNA-binding protein RBPJ
- deltex deltex
- Notch ligand is selected from the group consisting of Delta like ligand-1 , Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
- the medium according to statement 71 comprising about 5ng/ml to about 100 ng/ml DLL4 and about 5ng/ml to about 100 ng/ml JAGl .
- the medium according to statement 72 comprising about 50 ng/ml DLL4 and about 50 ng/ml JAGl .
- the medium according to any one of statements 68 to 73 further comprising one or more of DKK-1, IGF-1 and/or Noggin.
- a method of identification of an agent useful for the prevention or treatment of a retinal disease or di sorder in a subject or regeneration or repair of the retina comprising: (a) contacting cells having a Miiller cell phenotype according to statement 48 with an agent; and (b) detecting an increase or decrease in a parameter relative to a control, wherein the control is a cell or population of cells according to statement 48 not contacted with the agent; wherein said increase or decrease in the parameter is indicative of a capacity to exert a therapeutic effect in the subject or the retina; and wherein an agent that effects said increase or decrease in the parameter is identified as being useful for the treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina.
- a method for the treatment or prevention of a retinal disease or disorder comprising administering cells having a Muller cell phenotype according to statement 48 or the
- composition according to statement 53 to a subject in need thereof to thereby treat or prevent the retinal disease or disorder.
- a method for the regeneration or repair of the retina in a subject in need thereof comprising administering a cells having a Muller cell phenotype according to statement 48 or the pharmaceutical composition according to statement 53 to said subject.
- any one of statements 49, 50, 52 a method according to any one of statements 75 to77, or cells having a Miiller cell phenotype according to any one of statements 79 to 81, wherein the retinal disease or disorder is selected from the group consisting of Diabetic retinopathy, Macular Telangiectasia Type 2, Age-related macular degeneration, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma and retinopathy of prematurity.
- the retinal disease or disorder is selected from the group consisting of Diabetic retinopathy, Macular Telangiectasia Type 2, Age-related macular degeneration, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma and retinopathy
- retinal disease is selected from the group consisting of Diabetic retinopathy, Macular Telangiectasia Type 2, and Age-related macular degeneration.
- retinal disease is Macular Telangiectasia Type 2.
- the parameter is one or more of the following: i) expression of one or more of GFAP, GS, VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1 ; ii) extracellular concentration of a neuroactive substance including K+, glutamate, GABA and/or H+; and/or iii) expression or secretion of one or more cytokines.
- Figure 1 shows light microscopic analysis of the differentiation of ESCs contacted with DKK-1 + Noggin+ IGF-1 induction (lng/ml, respectively) into retinal progenitors from day 0 to day 4, and PCR analysis of retinal progenitor marker expression at day 3.
- Figure 2 shows light microscopic analysis of the differentiation of ESCs contacted with DKK-1 + Noggin+ IGF-1 induction (10 ng/ml, respectively) into retinal progenitors from day 5 to day 10 and PCR analysis of retinal progenitor marker expression at days 7 and 10.
- Figure 3 shows l ight microscopic analysis of the differentiation of ESCs contacted with DKK-1 + Noggin+ IGF-1 induction (10 ng/ml, respectively) into retinal progenitors from day 12 to day 15 and PCR analysis of retinal progenitor marker expression at day 12.
- Figure 4 shows light microscopic analysis of the differentiation of iPSCs into retinal progenitors after 10 days (A) and 13 days (B), and immunocytochemical analysis of retinal progenitor markers and (C - E).
- Figure 5 shows immunocytochemical analysis of retinal progenitor markers following differentiation of ESCs after 21 days.
- Figure 7 shows qRT-PCR analysis confirming Notch signalling activation 9 days after Notch ligand Jagged- 1 and DLL4 treatment (50ng/ml) in retinal progenitor differentiation.
- Figure 9 shows immunocytochemical analysis highlighting that cells are positively labelled with Miiller cell markers 4 weeks after Notch ligand treatment.
- Figure 10 shows immunocytochemical analysis highlighting that cells are positively labelled with Miiller cell markers 6 weeks after Notch ligand treatment.
- Figure 11 shows qRT-PCR analysis of Retinal Progenitors 4 weeks after Notch l igand treatment.
- FIG 13 shows fluorescence-activated cell sorting (FACS) analysis demonstrating an increased number of cells positively labelled for the Muller cell marker GFAP following treatment of hESCs-derived retinal progenitor cells ( PCs) with Notch ligand DLL4 and Jagged- 1 (50ng/ml) after 4 weeks (A) and 6 weeks (B).
- AF488 AlexFluor 488) indicates GFAP+ cells.
- Figure 14 shows the generation of hiPSCs from MacTel2 patient-derived fibroblasts (A); Microscopic analysis of an established MacTel2-hiPSC colony expressing stem cell markers Oct4 and TRA-1 -60 (B-D). White arrows in A and B indicate iPSC colonies. Scale bar: 100 ⁇ .
- the term "cell” refers to a single cell as well as to a population of (i.e., more than one) cells.
- the population may be a pure population comprising one cell type, such as a population of cells with a Muller cell phenotype or a population of undifferentiated stem cells.
- the population may comprise more than one cell type, for example a mixed cell population. It is not meant to limit the number of cells in a population, for example, a mixed population of cells may comprise at least one differentiated cell. In one embodiment a mixed population may comprise at least one differentiated. In the present invention, there is no limit on the number of cell types that a cell population may comprise.
- differentiate refers to the process by which cells transition from one cell type (e.g., a multipotent, totipotent or pluripotent differentiable cell) to another cell type such as a target differentiated cell.
- cell differentiation refers to a specialization process or a pathway by which a less specialized cell (e.g. stem cell) develops or matures to possess a more distinct form and function (i.e. more specialized).
- “differentiating” or inducing “differentiation” refers to changing the default cell type (genotype and/or phenotype) to a non-default cell type (genotype and/or phenotype).
- “inducing retinal differentiation in a cell” includes inducing a cell to have characteristics of retinal cells or retinal progenitor cells, or inducing a cell to divide into progeny cells with retinal characteristics, that are different from the original identity of the cell, such as genotype (i.e. change in gene expression as determined by genetic analysis such as a PC or microarray) and/or phenotype (i.e. change in morphology, function and/or expression of a protein.
- the term "Miiller cell differentiation” refers to inducing, or the induction of a cell to have a Miiller cell phenotype, or inducing a cell to di vide into progeny cells with M iiller cell characteristics, that are different from the ori ginal identity of the cell, such as genotype (i.e. change in gene expression as determined by genetic analysis such as a PGR or microarray) and/or phenotype (i.e. change in morphology, function and/or expression of a protein.
- genotype i.e. change in gene expression as determined by genetic analysis such as a PGR or microarray
- phenotype i.e. change in morphology, function and/or expression of a protein.
- dedifferentiation refers to a process wherein a more specialized cell having a more distinct form and function, and/or limited self-renewal and/or proliferative capacity becomes less specialized and acquires a greater self-renewal and/or proliferative capacity or differentiation capacity (e.g. multipotent, pluripotent etc.).
- An induced Pluripotent Stem Cell (iPSC) is an example of a dedifferentiated cell. Accordingly, dedifferentiation can refer to a process of cellular
- the term "Miiller cell phenotype" refers to a differentiated, lineage committed cell of the glial lineage that exhibits the functional and/or phenotypical
- the term "Miiller cell phenotype” refers to a cell which expresses Glial Fibrillary Acidic Protein (GFAP). Cells with a Miiller cell phenotype can also express one or more of the following markers:, Glutamine Synthase (GS), VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1. As used herein the term “Miiller cell phenotype” also refers to a cell which expresses GFAP, GS and VIMENTIN. As used herein the term “Miiller cell phenotype” refers to a cell which expresses GFAP, GS, VIMENTIN and CRALBP.
- Miiller cells or cells with a Miiller cell phenotype may additionally be characterised by the cell's ability to enzymatically convert glutamate to glutamine via expression of (GS) and/or the activity of GLAST which mediates the transport of glutamic and aspartic acid from the extracellular space.
- GS glutamate to glutamine
- GLAST GLAST which mediates the transport of glutamic and aspartic acid from the extracellular space.
- Progenitor cells refers to cells, including those produced during differentiation of a stem cell, that have some, but not all, of the characteristics of their terminally-differentiated progeny.
- retinal progenitor cell refers to a cell which may give rise to various retinal cell subtypes including retinal pigment epithelial cells, photoreceptors, ganglion cells, bipolar cells, horizontal cells and Muller cells.
- Retinal progenitor cells may be characterized by the expression of a panel of eyefield markers including ChxlO, Lhx, Pax9, RAX and Six6. The isolation, identification and methods for the generation of retinal progenitor cells from pluripotent stem cells has been described previously (see e.g. Meyer, J.
- contacting cells with a compound as defined by the present inventions refers to placing the compound in a location that will allow it to touch the cell in order to produce "contacted" cells.
- the contacting may be accomplished using any suitable method. For example, in one embodiment, contacting is by adding the compound to a container (e.g. tube, vial or culture flask or culture dish etc.) of cells. Contacting may also be
- stem cell refers to a cell that is totipotent or pluripotent or multipotent and are capable of differentiating into one or more different cell types, such as embryonic stems cells, stem cells isolated from various tissues, for example, bone marrow derived stem cells (BMSCs).
- BMSCs bone marrow derived stem cells
- adult stem cell refers to a stem cell derived from an organism after birth.
- pluripotent refers to a cell line capable of differentiating into any (or multiple) differentiated cell type (s).
- iPSCs Induced pluripotent stem cells
- iPS cells iPS cells
- iPS cells iPS cells
- IPS cells have been derived using modifications of an approach originally discovered in 2006 (Yamanaka, S. et al, Cell Stem Cell, 1 :39-49 (2007)). For example, in one instance, to create IPS cells, scientists started with skin cells that were then modified by a standard laboratory technique using retroviruses to insert genes into the cellular DNA.
- the inserted genes were Oct4, Sox2, Lif4, and c-myc, known to act together as natural regulators to keep cells in an embryonic stem celllike state. These cells have been described in the literature. See, for example, Wernig et al, PNAS, 105:5856-5861(2008); Jaenisch et al., Cell, 132:567-582 (2008); Hanna et al, Cell, 133:250-264 (2008); and Brambrink et al, Cell Stem Cell, 2: 151-159 (2008). It is also possible that such cells can be created by specific culture conditions (exposure to specific agents), as is described in the Examples in this application. These references are all incorporated by reference for teaching IPSCs and methods for producing them.
- IPS cells have many characteristic features of embryonic stem cells. For example, they have the ability to create chimeras with germ line transmission and tetraploid complementation and they can also form teratomas containing various cell types from the three embryonic germ layers. On the other hand, they may not be identical as some reports demonstrate. See, for example, Chin et al. , Cell Stem Cell 5: 1 1 1 -123 (2009) showing that induced pluripotent stem cells and embryonic stem cells can be distinguished by gene expression signatures.
- multipotent refers to a cell line capable of differentiating into at least two differentiated cell types.
- primary cell is a cell that is directly obtained from a tissue (e.g. blood) or organ of an animal in the absence of culture. Typically, though not necessarily, a primary cell is capable of undergoing ten or fewer passages in vitro before senescence and/or cessation of proliferation.
- cell culture refers to any in vitro culture of cells.
- the term “culturing” refers to the process of growing and/or maintaining and/or manipulating a cell. Included within this term are continuous cell lines (e.g., with an immortal phenotype), primary cell cultures, finite cell lines (e.g., non-transformed cells), and any other cell population maintained in vitro, including oocytes and embryos.
- the terms "primary cell culture,” and “primary culture,” refer to cell cultures that have been directly obtained from cells in vivo, such as from a tissue specimen or biopsy from an animal or human. These cultures may be derived from adults as well as fetal tissue.
- medium refers to media that are suitable to support the growth of cells in vitro (i.e., cell cultures, cell lines, etc.). It is not intended that the term be limited to any particular culture medium. For example, it is intended that the definition encompass maintenance media as well as other media for the differentiation or specialization of cells. Indeed, it is intended that the term encompass any culture medium suitable for the growth of the cell cultures and cells of interest.
- kits refers to any delivery system for delivering materials.
- a kit may refer to a combination of materials for contacting stem cells, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., compounds, proteins, detection agents (such as probes or antibodies), etc. in the appropriate containers (such as tubes, etc.) and/or supporting materials (e.g., buffers, written instructions for performing cell differentiation, etc.) from one location to another.
- reaction reagents e.g., compounds, proteins, detection agents (such as probes or antibodies), etc. in the appropriate containers (such as tubes, etc.) and/or supporting materials (e.g., buffers, written instructions for performing cell differentiation, etc.) from one location to another.
- kits include one or more enclosures (e.g., boxes, or bags, and the like) containing the relevant reaction reagents (such as Notch ligands (e.g. Delta serrate lag2 (DSL) ligands such as DLLl
- the term “ « vitro” refers to an artificial environment and to processes or reactions that occur within an artificial environment.
- vilro environments can consist of, but are not limited to, test tubes and cell cultures.
- the term “/ ? vivo” refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.
- the term "marker” or "cell marker” refers to o any phenotypic feature of a cell that can be used to characterize it or discriminate it from other cell types.
- a marker may be a protein (including secreted, cell surface, or internal proteins; either synthesized or taken up by the cell); a nucleic acid (such as an mRNA, or enzymatically active nucleic acid molecule) or a polysaccharide. Included are determinants of any such cell components that are detectable by antibody, lectin, probe or nucleic acid amplification reaction that are specific for the marker of the cell type of interest.
- the markers can also be identified by a biochemical or enzyme assay or biological response that depends on the function of the gene product. Associated with each marker is the gene that encodes the transcript, and the events that lead to marker expression.
- a marker is said to be preferentially expressed in an undifferentiated or differentiated cell population, if it is expressed at a level that is at least 50% higher (in terms of total gene product measured in an antibody or PCR assay) or 30% more frequently (in terms of positive cells in the population) than an acceptable control such as actin or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Markers that are expressed 2, 10, 100, or 10,000 times higher or more frequently are increasingly more preferred.
- a marker for a cell may not be limited to one marker; markers may refer to a "pattern" of markers such that a designated group of markers may identify a cell or cell type from another cell or cell type.
- markers may refer to a "pattern" of markers such that a designated group of markers may identify a cell or cell type from another cell or cell type.
- cells obtained according to the methods of the present invention express one or more markers that distinguish a cell having a Muller cell phenotype such as GFAP, GS, VIMENTIN and CRALBP.
- the term "derived from” or “established from” or “differentiated from” when made in reference to any cell disclosed herein refers to a cell that was obtained from (e.g., isolated, purified, etc.) a parent cell in a cell line, tissue, or fluids using any manipulation, including single cell isolation, in vitro culture, treatment and/or mutagenesis using for example proteins, chemicals, radiation, infection with virus, transfection with DNA sequences, such as with a morphagen, etc., selection (such as by serial culture) of any cell that is contained in cultured parent cells.
- a derived cell can be selected from a mixed population by virtue of response to a growth factor, cytokine, selected progression of cytokine treatments, adhesiveness, lack of adhesiveness, sorting procedure, and the like.
- the terms "treating,” “treatment” and the like are used herein to mean obtaining a desired pharmacologic and/or physiologic effect.
- the effect can be prophylactic in tenns of completely or partially preventing a disorder or sign or symptom thereof, and/or can be therapeutic in tenns of a partial or complete cure for a disorder and/or adverse effect attributable to the disorder.
- treatment examples include but are not limited to: preventing a disorder from occumng in a subject that may be predisposed to a disorder, but has not yet been diagnosed as having it; inhibiting a disorder, i.e., arresting its development; and/or relieving or ameliorating the symptoms of disorder, e.g., macular degeneration.
- treatment can include systemic amelioration of the symptoms associated with the pathology and/or a delay in onset of symptoms such as chest pain. Clinical and subclinical evidence of "treatment” will vary with the pathology, the individual and the treatment.
- Miiller glial cells the principal glial cells in the retina, play an important role in maintaining retinal homeostasis. They provide metabolic supports to the surrounding neurons, produce neuroactive and vasoactive substances, and regulate retinal ion, water contents and pH. In certain eye diseases and disorders of, e.g., the retina and the macula, degeneration or dysfunction of Miiller cells ultimately leads to visual loss and even blindness. Transplantation of Miiller cells to replace and support the failing host cells represents a possible therapeutic intervention. However, the mechanisms and methods for the generation of human Miiller glial cells from retinal stem/progenitor cells including those derived from human embryonic stem cells, iPSCs or de-differentiated cells remain to be elucidated.
- the Notch signalling pathway is a highly conserved pathway in embryogenesis. It regulates cell-fate decisions such as self-renewal and survival, and cellular differentiation in various organs including central and peripheral nervous systems.
- the Notch signalling pathway is known to promote gliogenesis in retinal development. Previous animal studies revealed that misexpression of Notch related genes such as Notchl, Hesl and Hes5, in retinal progenitors promoted glial phenotype. However, little is known about its role in human retinal progenitors and retinal gliogenesis.
- a method for producing cells with a Miiller cell phenotype from a population of retinal progenitor cells comprising culturing the population of cells for a time and under conditions sufficient for inducing Notch signalling in said population of cells sufficient to differentiate the population of cells into cells having a Miiller cell phenotype.
- the population of retinal progenitor cells is cultured for a time and under conditions sufficient for inducing Notch signalling sufficient to differentiate the population of cells into cells having a Miiller cell phenotype, by contacting the population of cells with one or more agents which induce Notch signalling.
- the one or more agents are selected canonical ligands for the Notch receptor.
- the Notch ligands are selected from the group consisting Delta like ligand (DLL)-l, Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2. Even more preferably, the Notch ligands are DLL4 and JAG1.
- the agents capable of inducing Notch signalling pathway in a cell are selected from non-canonical ligands of Notch receptor.
- the concentrations of Notch ligands which may be employed to effect induction of Notch signalling in a population of retinal progenitor cells sufficient to differentiate the population of cells into cells having a Miiller cell phenotype, may be determined by the skilled addressee according to the methods described herein.
- the population of retinal progenitor cells are cultured in a cell culture medium comprising a Notch ligand present at a concentration of about, 1 ng/ml to about 1000 ng/ml.
- a Notch ligand may be present at a concentration of about 5ng/ml to about 100 ng/ml. More preferably, a Notch ligand may be present at a concentration of about 10 ng/ml to about 80 ng/ml. Even more preferably, a Notch ligand may be present at a concentration of about 50 ng/ml.
- the one or more agents which induce Notch signalling are selected from other agents shown to interact with and modulate Notch signalling, including the Notch intracellular domain (NICD), HES l, HES5, DNA-binding protein RBPJ, and deltex.
- Notch intracellular domain NBD
- HES l HES5
- HES5 DNA-binding protein RBPJ
- deltex deltex
- the population of retinal progeni tor cells is transfected with a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HESl and HES5.
- the nucleic acid construct may be, for example, an expression vector, a plasmid vector, a viral vector, a phosmid, a cosmid, a recombinant virus or any other vector construct suitable for the insertion of foreign sequences, introduction into cells and subsequent expression of the introduced sequences.
- the population of retinal progenitor cells is cultured for a time and under conditions sufficient for inducing Notch signalling sufficient to
- the vectors also contain sequences encoding one or more selectable markers such as a drug resistance marker (e.g. resistance to G418) and/or green fluorescent protein (GFP).
- a drug resistance marker e.g. resistance to G418
- GFP green fluorescent protein
- two vectors one containing one or more polynucleotides encoding an activator of Notch signalling, including one or more of: full length Notch receptor, Notch intracellular domain (NICD), HESl , and HES5, and the other containing sequences encoding a selectable marker, e.g. drug resistance marker and/or GFP, are used for transduction of retinal progenitors.
- selection is achieved, after transduction of a cell culture with the vector or vectors, by adding a selective agent (e.g., G418) to the cell culture in an amount sufficient to kill cells that do not comprise the vector but not kill cells that do, or by sorting and collecting GFP positive cells.
- a selective agent e.g., G418
- the population of retinal progenitor cells is transduced with a viral vector comprising a polynucleotide encoding NICD.
- the population of retinal progenitor cells is transduced with one or more viral vectors comprising one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HES l, HES5, prior to contacting the population of cells with one or more agents which induce Notch signalling, such as Notch ligands selected from the group consisting Delta like ligand-1 , Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
- Notch ligands selected from the group consisting Delta like ligand-1 , Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
- the population of retinal progenitor cells is transduced with one or more viral vectors comprising one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length N otch receptor, Notch intracellular domain (NICD), HES l, HES5, after the population of cells has been contacted with one or more agents which induce Notch signalling, such as Notch ligands selected from the group consisting Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
- Notch ligands selected from the group consisting Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
- Retinal stem or progenitor cells for use in the methods of producing cells with a Miiller cell phenotype may be provided or prepared according to known methods.
- the present invention provides a method for producing cells with a Miiller cell phenotype from a population of stem cells, the method comprising: i) differentiating a population of stem cells to produce a population of cells having a retinal progenitor cell phenotype and ii) culturing one or more cells of the population of cells produced by step i) for a time and under conditions sufficient for inducing Notch signalling in the population of cells sufficient to differentiate the population of cells into cells having a Miiller cell phenotype
- the stem cells in step i) are differentiated into cells having a retinal progenitor cell phenotype, in accordance with published methods.
- embryoid bodies from a population of pluripotent stem cells are generated from colonies of stem cells by culturing them in a neural induction medium containing recombinant human proteins including DKK 1 , Noggin and IGF-1 for a first culture period.
- the embryoid bodies are cultured in the neural induction medium for a duration of about 3 days.
- the recombinant human proteins are present in the neural induction medium at the following concentrations: DK 1 (lng/ml), Noggin (lng/ml) and IGF- 1 (5ng/ml).
- DK 1 lng/ml
- Noggin lng/ml
- IGF- 1 5ng/ml
- the matrix coated surface is a cell culture plate coated with matrigel.
- the concentration of DKK l , Noggin and IGF-1 for the second culture period is 1 Ong/ml of each protein.
- the duration of the second culture period is about 3 weeks.
- the retinal progenitors are differentiated into cells with a Miiller cell phenotype in step ii) by culturing the population of progenitor cells obtained from step i) for a time and under conditions sufficient for inducing Notch signalling sufficient to differentiate the population of cells into cells having a Miiller cell phenotype in accordance with the embodiments described above.
- the present invention also provides a cell culture medium for directing the
- a cell culture medium includes a source of carbon as energy substrate, such as glucose, galactose or sodium pyruvate; essential amino acids; vitamins, such as biotin, folic acid, B12; at least a purine and a pyrimidine as nucleic acid precursors; and inorganic salts.
- a source of carbon as energy substrate such as glucose, galactose or sodium pyruvate
- essential amino acids such as glucose, galactose or sodium pyruvate
- vitamins such as biotin, folic acid, B12
- at least a purine and a pyrimidine as nucleic acid precursors
- inorganic salts such as inorganic salts.
- Non-limiting examples of commercially available basic media that may be utilized in accordance with the invention comprise NeurobasalTM (Thermo Fisher Scientific), O-DMEM, DMEM, DMEM/F12, CellgroTM Stem Cell Growth Medium (CellGenix), or X-VivoTM (Lonza).
- the basic medium may be supplemented with a variety of agents as known in the art dealing with cell cultures.
- the culture medium may also optionally include other supplements selected from the group including but not limited to antibiotics, antimycotics, growth factors, inhibitors, epigenetic modifiers, mRNA and miRNA.
- serum or with a serum replacement containing medium such as, without being limited thereto, knock out serum replacement (KOSR), Nutridoma-CS, TCHTM (MPBIO) , N2, N2 derivative, or B27 or a combination
- a serum replacement containing medium such as, without being limited thereto, knock out serum replacement (KOSR), Nutridoma-CS, TCHTM (MPBIO) , N2, N2 derivative, or B27 or a combination
- ECM extracellular matrix
- an antibacterial agent such as, without being limited thereto, penicillin and streptomycin
- NEAA non-essential amino acids
- neuortrophins which are known to play a role in promoting the survival of SCs in culture, such as, without being limited thereto, BDNF, NT3, NT4.
- the invention provides a cell culture medium for producing cells with a Muller cell phenotype, comprising one or more agents which induce Notch signalling in a cell.
- the medium preferably also comprises other growth factors, cytokines and other recombinant human proteins associated with neural differentiation including DKK1, Noggin and IGF-1.
- the invention provides a cell culture medium for producing cells with a Muller cell phenotype, comprising one or more Notch ligands.
- the medium comprises at least two Notch ligands.
- the agents which induce Notch signalling are selected canonical ligands for the Notch receptor. More preferably, the Notch ligands are selected from the group consisting Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2. In another embodiment, the agents capable of inducing Notch signalling in a cell are selected from non-canonical ligands of Notch receptor. In one embodiment, one or more agents are selected from the group consisting of Notch intracellular domain (NICD), HES 1, HES5, DNA-binding protein RBPJ, and deltex.
- TMD Notch intracellular domain
- HES 1 HES 1
- HES5 DNA-binding protein RBPJ
- deltex deltex
- the culture medium of the invention comprises DLL4 and JAG1.
- the culture medium of the invention i s free of serum and free of serum extract.
- the culture medium of the invention is free of animal - derived substances.
- the culture medium of the invention consists essentially of synthetic compounds, compounds of human origin and water.
- said culture medium can be used for culturing cells according to good manufacturing practices (under "GMP" conditions).
- kits of the present invention may further comprise one or more of the following: a culture medium (such as the cell culture medium described herein), at least one cell culture medium supplement, an agent for inhibiting or increasing expression of one or more gene products, and at least one agent for detecting expression of a marker of a Muller cell phenotype.
- a culture medium such as the cell culture medium described herein
- at least one cell culture medium supplement such as the cell culture medium described herein
- an agent for inhibiting or increasing expression of one or more gene products such as the cell culture medium described herein
- at least one agent for detecting expression of a marker of a Muller cell phenotype such as the cell culture medium described herein
- the invention provides a kit for producing cells with a Muller cell phenotype, comprising one or more Notch ligands.
- the medium comprises at least two Notch ligands.
- the agents which induce Notch signalling are selected canonical ligands for the Notch receptor. More preferably, the Notch ligands are selected from the group consisting Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2. In another embodiment, the agents capable of inducing Notch signalling in a cell are selected from non-canonical li gands of Notch receptor. In one embodiment, one or more agents are selected from the group consisting of Notch intracellular domain (NICD), HES l , HES5, DNA-binding protein BPJ, and deltex.
- TMD Notch intracellular domain
- HES l HES5
- deltex DNA-binding protein BPJ
- the kit of the invention comprises DLL4 and JAG1.
- the kit comprises a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HES1, HES5.
- the nucleic acid construct may be, for example, an expression vector, a plasmid vector, a viral vector, a phosmid, a cosmid, a recombinant virus or any other vector construct suitable for the insertion of foreign sequences, introduction into cells and subsequent expression of the introduced sequences.
- the kit comprises one or more viral vectors comprising one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HES l , HES5.
- Notch signalling including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HES l , HES5.
- the vectors also contain sequences encoding one or more selectable markers such as a drug resistance marker (e.g. resistance to G418) and/or green fluorescent protein (GFP).
- the kit may comprise two vectors, one containing one or more polynucleotides encoding an activator of Notch signalling, including one or more of: full length Notch receptor, Notch intracellular domain (NICD), HES 1 , and HES5, and the other containing sequences encoding a selectable marker, e.g. drug resistance marker and/or GRP.
- the kit further comprises a cell selected from the group consisting of a stem cell, progenitor cell, a dedifferentiated cell, a neural precursor cell or a retinal progenitor cell.
- the methods and cells produced according to the methods of this invention are also of interest in identifying expression patterns of transcripts and newly synthesized proteins that are characteristic for Miiller cells and may assist in directing the differentiation pathway or facilitating interaction between cells.
- Expression patterns of the differentiated cells are obtained and compared with the cells from which they have been differentiated (e.g. retinal stem or progenitor cells) or control other control cells.
- Suitable methods for comparing expression at the protein level include the
- Suitable methods for comparing expression at the level of transcription are well known to those of skill in the art and can include methods of differential display of mRNA (Liang, Peng, et al, Cancer Res. 52:6966, 1 92), whole-scale sequencing of cDNA libraries, and matrix array expression systems.
- Identifying expression products for use in characterizing and effecting Miiller differentiation of cells of this invention involves analysing the expression level of RNA, protein, or other gene product in a first cell type, such as a retinal stem or progenitor cell, or a cell capable of differentiating along the Miiller or glial pathway; then analysing the expression level of the same product in a control cell type; comparing the relative expression level between the two cell types, (typically normalized by total protein or RNA in the sample, or in comparison with another gene product expected to be expressed at a similar level in both cell types, such as a house-keeping gene); and then identifying products of interest based on the comparative expression level.
- a first cell type such as a retinal stem or progenitor cell, or a cell capable of differentiating along the Miiller or glial pathway
- the effects of a gene product of interest may be identified by subjecting a cell to the differentiation method of the present invention wherein the expression of a gene product of interest in the cell has been modified.
- the expression of the gene product of interest may be inhibited or impaired (e.g. the gene product is non-functional or has impaired or reduced function) or increased or overexpressed or expression of a gene product of interest having enhanced function.
- the effects of a gene product of interest on Miiller cell function may be identified by modifying the expression of the gene product in a cell produced according to the methods of the invention produced according the present inventi on.
- a cell with a Miiller cell phenotype produced according to the methods of the invention may be used as a model of retinal disease wherein the cell is modified such that the expression of a gene product of interest is inhibited, impaired or modified such as by knock-down, knock in, over- expression or gene editing to reduce, increase or modify the expression of a gene product of interest.
- a cell subjected to the differentiation process of the invention may be obtained from a subject who has inhibited, impaired or increased expression of a gene product of interest (such as through a gene mutation) which is associated with a retinal disease or disorder.
- a cell subjected to the differentiation process of the present invention may be derived from a healthy subject not characterized as having a retinal disease or disorder, wherein expression of a functional gene product of interest in the cell manipulated such that expression is impaired, inhibited or silenced, such as through the use of an inhibitory molecule (e.g. siRNA, miRNA etc.) or the introduction of a mutation, or the expression may be enhanced or increased.
- an inhibitory molecule e.g. siRNA, miRNA etc.
- the effects of the expression of the gene product of interest on Miiller cell differentiation and function may then be identified via comparison to control cells.
- the present invention provides a method for identifying an effect of a gene product on Miiller cell differentiation or function, comprising inducing Notch signalling in a cell and measuring differentiation and/or function, wherein the cell is a retinal stem or progenitor cell obtained or derived from a subject who has a retinal disease or disorder, wherein the retinal stem or progenitor cell displays one or more of the following: i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
- the present invention provides a method for identifying an effect of a gene product on Miiller cell differentiation, comprising inducing Notch signalling in a cell and measuring differentiation, wherein the cell is a retinal stem or progenitor cell obtained from a healthy subject, and wherein the cell has been modified to display one or more of the following: i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
- a candidate gene product on Miiller cell differentiation performed according to the methods disclosed herein is typically compared to a corresponding control cell (e.g. a cell which does not display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function).
- a corresponding control cell e.g. a cell which does not display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
- Drug Screening [00095] The methods and cells produced according to the methods disclosed herein can be used to screen for agents (such as solvents, small molecule drugs, peptides, polynucleotides) or environmental conditions (such as culture conditions or manipulation) that affect Miiller cell differentiation, cell viability or function.
- agents such as solvents, small molecule drugs, peptides, polynucleotides
- environmental conditions such as culture conditions or manipulation
- a stem cell, progenitor cell, a dedifferentiated cell or retinal progenitor cell is used to produce a cell or population of cells having a Miiller cell phenotype to screen candidate agents for their effect on Miiller cell function (e.g. therapeutic or protective). Screening may be done either because the agent is designed to have a therapeutic effect on Miiller cells, or because a compound designed to have effects elsewhere may have unintended side effects on the Miiller cells.
- candidate agents are tested by adding them to one or more cells in different wells, and then determining any change in the expression of a gene product of interest and/or any phenotypic change that results, according to desirable criteria.
- the screening can be conducted using any cells produced according to the methods disclosed herein.
- the invention provides a method of identification of an agent useful for the prevention or treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina comprising: (a) contacting cells having a M iiller cell phenotype produced according to the methods described herein with an agent; and (b) detecting an increase or decrease in a parameter relative to a control, wherein the control is a cell or population of cells produced according to the methods described herein not contacted with the agent; wherein said increase or decrease in the parameter is indicative of a capacity to exert a therapeutic effect in the subject or the retina; and wherein an agent that effects said increase or decrease in the parameter is identified as being useful for the treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina.
- the phenotypic change or parameter is one or more of the following: i) expression of one or more of GFAP, GS, VIM EN TIN, CRALBP, SOX9, GLAST and Kir4.1 ; ii) extracellular concentration of a neuroactive substance including K+, glutamate, GABA and/or H+; or iii) expression of one or more cytokines.
- screening of candidate agents is performed using one or more cells produced according to the methods disclosed herein wherein the cells are derived from a retinal stem or progenitor cell obtained or derived from iPSCs generated from a subject who has a retinal disease or disorder.
- screening of candidate agents is performed using one or more cells produced according to the methods disclosed herein wherein the cells are derived from a retinal stem or progenitor cell obtained or derived from iPSCs generated from a healthy subject who does not have a retinal disease or disorder.
- screening of candidate agents is perfomied using one or more cells produced according to the methods disclosed herein, wherein the cells are derived from a retinal stem or progenitor cell obtained or derived from iPSCs generated from a healthy subject or a subject who has a retinal disease or disorder, wherein the retinal stem or progenitor cell is manipulated to display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
- Candidate agents which may also be used in the discovery and development of a therapeutic compound for the treatment of a retinal disease or disorder include small molecules, peptides, peptide mimetics, polypeptides, and nucleic acid molecules.
- the encoded protein upon expression, can be used as a target for the screening of drugs.
- the DNA sequences encoding the amino terminal regions of the encoded protein or Shine-Delgarno or other translation facilitating sequences of the respecti ve mRNA can be used to construct sequences that promote the expression of the coding sequence of interest. Such sequences may be isolated by standard techniques.
- Small molecules of the invention preferably have a molecular weight below 2,000 daltons, more preferably between 300 and 1,000 daltons, and most preferably between 400 and 700 daltons. It is preferred that these small molecules are organic molecules.
- candidate agents are identified from large libraries of both natural product or synthetic (or semi -synthetic) extracts or chemical libraries or from polypeptide or nucleic acid libraries, according to methods known in the art.
- Agents used in screens may include known agents (for example, known therapeutics used for other diseases or disorders).
- agents for example, known therapeutics used for other diseases or disorders.
- virtually any number of unknown chemical extracts or agent can be screened using the methods described herein. Examples of such extracts or agents include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic agents, as well as modification of existing agents.
- libraries of natural agents in the fonn of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceanographic Institute (Ft. Pierce, Fla.), and PharmaMar, U.S.A. (Cambridge, Mass.).
- natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al., Proc. Natl. Acad. Sci. U.S.A.
- any library or compound is readily modified using standard chemical, physical, or biochemical methods.
- Libraries of agents may be presented in solution (e.g., Houghten, Biotechniques 13:412-421. 1992), or on beads (Lam, Nature 354:82-84, 1991), chips (Fodor, Nature 364:555- 556, 1993), bacteria (Ladner, U.S. Patent No. 5,223,409), spores (Ladner U.S. Patent No.
- compositions or agents identified using the methods disclosed herein may be administered systemically, for example, formulated in a pharmaceutically-acceptable carrier.
- routes of administration include, for example, topical, oral, subcutaneous, intravenous, intraperitoneally, intramuscular, or intradermal injections that provide continuous, sustained levels of the drug in the patient.
- Treatment of human patients or other animals will be carried out using a therapeutically effective amount of a candidate agent in a physiologically-acceptable carri er.
- Suitable carriers and their formulation are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin.
- the amount of the therapeutic agent to be administered varies depending upon the manner of administration, the age and body weight of the patient, and the clinical symptoms. Generally, amounts will be in the range of those used for other agents used in the prevention or treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina in a subject, although in certain instances lower amounts may be needed because of the increased specificity of the compound.
- a compound is administered at a dosage that controls the clinical or physiological symptoms as determined by a diagnostic method known to one skilled in the art, or using any assay that measures the transcriptional activation of a gene associated with a retinal disease or disorder in a subject or regeneration or repair of the in a subject.
- the present invention also provides a pharmaceutical composition
- a pharmaceutical composition comprising a cell with a Miiller cell phenotype produced according to the methods disclosed herein or a population of cells according to the invention or a population comprising a combination of a cells with a Miiller cell phenotype of the invention and the precursor from which the Miiller cell may be derived, such as a retinal progenitor.
- the pharmaceutical composition may generally include one or more pharmaceutically acceptable and/or approved carriers, additives, antibiotics, preservatives, adjuvants, diluents and/or stabilizers.
- Such auxiliary substances can be water, saline, glycerol, ethanol, wetting or emulsifying agents, pH buffering substances, or the like.
- Suitable carriers are typically large, slowly metabolized molecules such as proteins,
- This pharmaceutical composition can contain additional additives such as mannitol, dextran, sugar, glycine, lactose or polyvinylpyrrolidone or other additives such as antioxidants or inert gas, stabilizers or recombinant proteins (e. g. human serum albumin) suitable for in vivo administration.
- additional additives such as mannitol, dextran, sugar, glycine, lactose or polyvinylpyrrolidone or other additives such as antioxidants or inert gas, stabilizers or recombinant proteins (e. g. human serum albumin) suitable for in vivo administration.
- the term "pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate.
- a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
- Another aspect of the invention rel ates to a population of cells with a Miiller cel l phenotype of the invention as described herein, for use in treating a retinal disease or disorder or an injury to, or degeneration of, the retina.
- the invention also relates to a method for treating a retinal disease or disorder or an injury to the retina comprising the step of administering a pharmaceutically effective amount of a population of cells with a Miiller cell phenotype as described above optionally together with of a population of retinal progenitor cells to a subject in need thereof.
- a method of transplanting cells with a Miiller cell phenotype into a subject's eye comprises (i) providing a cell culture comprising retinal progenitor cells; (ii) culturing cells for a time and under conditions sufficient for inducing Notch signalling whereby the cells are promoted to differentiate into cells having a Miiller cell phenotype; (iii) harvesting cells having a Miiller cell phenotype from said cell culture; and (iv) transplanting said differentiated cells into said subject's eye.
- Harvesting of the cells may be performed by various methods known in the art. Non- limiting examples include mechanical dissection and dissociation with enzymatic agents. Other methods known in the art are also applicable.
- the cells produced according to the present invention may be administered to various target sites within a subject's eye according to methods familiar to those skilled in the art. Modes of administration may include subretinal or intravitreal injection.
- the sclera posterior to the limbus in the eye, may be punctured with a 35 gauge needle, and the cells injected either subretinally or into the vitreous cavity with a 35 gauge needle
- the cells produced according to the methods described herein may be transplanted in various forms.
- the cells may be introduced into the target site in the form of cell suspension, or adhered onto a matrix, extracellular matrix or substrate such as a biodegradable polymer or a combination or within a semipermeable compartment.
- the cells may also be transplanted together (co-transplantation) with other retinal cells, such as with retinal pigment epithelia cells or photoreceptors.
- the invention also pertains to a composition comprising stem/progenitor cell-derived cells with a Muller cell phenotype obtained by the methods of the invention.
- Various eye conditions may be treated or prevented by the introduction of the cells with a Muller cell phenotype obtained by the method of the invention to a subject's eye.
- the eye conditions may include retinal diseases or disorders generally associated with retinal dysfunction, retinal injury, and/or dysfunction, injury and/or loss Miiller cells.
- a non-limiting list of conditions which may be treated in accordance with the invention comprises: Diabetic retinopathy, Macular Telangiectasia Type 2, and Age-related macular degeneration, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma and retinopathy of prematurity.
- treating refers to a method that is aimed at delaying or preventing the onset of a pathology, at reversing, alleviating, inhibiting, slowing down or stopping the progression, aggravation or deterioration of the symptoms of the pathology, at bringing about ameliorations of the symptom s of the pathology, and/or at curing the pathology.
- treatment may include prevention of further deterioration in visual acuity and the degree of retinal disease, restoration of normal retinal structure or improvement in visual acuity.
- the term "pharmaceutically effective amount” refers to any amount of cells according to the invention (or a population thereof or a pharmaceutical composition thereof) that is sufficient to achieve the intended purpose. Effective dosages and administration regimens can be readily determined by good medical practice based on the nature of the pathology of the subject, and will depend on a number of factors including, but not limited to, the extent of the symptoms of the pathology and extent of damage or degeneration of the tissue or organ of interest, and characteristics of the subject (e.g., age, body weight, gender, general health, and the like).
- cells with a Miiller cell phenotype produced according to the method described herein and combinations of cells produced according to the invention and retinal progenitors, and pharmaceutical compositions according to the invention may be administered via any appropriate route.
- the dose and the number of administrations can be optimized by those skilled in the art in a known manner.
- dosage amounts can vary from about 100; 500; 1,000; 2,500; 5,000; 10, 000; 20,000; 50,000; 100,000; 500,000; 1 ,000,000; 5,000,000 to 10,000,000 cells or more (or any integral value therebetween); with a frequency of administration of, e.g., once per day, twice per week, once per week, twice per month, once per month, depending upon, e.g., body weight, route of administration, severity of disease, etc.
- the preferred dose is 50 microliters (2,500,000 cells)/eye.
- physiologically compatible carrier refers to a carrier that is compatible with the other ingredients of the formulation and not deleteri ous to the recipient thereof.
- suitable carriers include cell culture medium (e.g., Eagle's minimal essential medium), phosphate buffered saline, Hank's balanced salt solution+/-glucose (HBSS), and multiple electrolyte solutions such as Plasma-LyteTM A (Baxter).
- H9 human ESCs were firstly differentiated into retinal progenitors using a published method with minor modifications. Briefly, embryoid bodies were generated from
- undifferentiated H9 ESC colonies by culturing them in a neural induction medium ( M; DMEM/F12, 10% knockout serum replacement, and B27 supplement) containing recombinant human proteins including DKKl (lng/ml, Wnt signalling pathway inhibitor), Noggin (lng/ml, bone morphogenic pathway antagonist) and IGF-1 (5ng/ml) for 3 days.
- a neural induction medium M; DMEM/F12, 10% knockout serum replacement, and B27 supplement
- recombinant human proteins including DKKl (lng/ml, Wnt signalling pathway inhibitor), Noggin (lng/ml, bone morphogenic pathway antagonist) and IGF-1 (5ng/ml) for 3 days.
- DKKl lng/ml, Wnt signalling pathway inhibitor
- Noggin lng/ml, bone morphogenic pathway antagonist
- IGF-1 5ng/ml
- GGCGACACAGGACAATCTTTA (SEQ ID No. 3), reverse; TTCCGGCAGCTCCGTTTTC (SEQ ID No. 4)), RAX (forward; AGCGAAACTGTCAGAGGAGGAACA (SEQ ID No. 5), reverse; TCATGCAGCTGGTACGTGGTGAAA (SEQ ID No. 6)) and LHX2 (forward;
- CAAGATCTCGGACCGCTACT (SEQ ID No. 7), reverse; CCGTGGTCAGCATCTTGTTA (SEQ ID No. 8)).
- the PCR cycling was denaturing at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds (40 cycles).
- Notch signalling was performed by treating the retinal progenitors with recombinant Notch ligands, Delta serrate lag2 peptides.
- Notch ligands DLL4 and Jagged-1 R&D systems, 50ng/ml
- the combination of Notch ligands DLL4 and Jagged-1 was added freshly to NIM when changing the media.
- the culture was maintained in the media for 6 weeks, and characterization of Muller cell differentiation was performed every 2 weeks with qRT-PCR and immunocytochemistry using a panel of Muller cell Markers including GFAP (forward primer; CTGCGGCTCGATCAACTCA (SEQ ID No. 9), reverse primer; TCCAGCGACTCAATCTTCCTC (SEQ ID No.
- Results are expressed as mean ⁇ SEM. Data were analysed using Student t-test. A p value ⁇ 0.05 was regarded as statistically significant.
- FACS fluorescence-activated cell sorting
- xl permeabilization buffer eBioscience, 833356
- GFAP antibody 1 :500, Dako, Z0334
- secondary antibody AF488 1: 1000, Invitrogen, A21206
- FACS was performed with LX Fortessa X-20 (BD), and data was analysed with FloJo software.
- Retinal progenitors were treated with Notch ligands DLL4 and Jagged- 1 at 50ng/ml.
- Notch downstream effector genes Hesl and Hes5
- Retinal progenitors were treated with Notch ligands, DLL4 and Jagged- 1 at 50ng/ml for 4 and 6 weeks. qPCR analysis found that all the Miiller cell markers were upregulated.
- Miiller cells can express GFAP and a number of other markers including, glutamine synthetase (GS), cellular retinaldehyde binding protein (CRALBP), vimentin, and Sox9. These other markers can be expressed by other types of cells (e.g. retinal pigmented epithelial cells express GS and CRALBP, and retinal progenitor cells express SOX9).
- GS glutamine synthetase
- CRALBP cellular retinaldehyde binding protein
- SOX9 retinal progenitor cells
- Another type of retinal glial cell, astrocytes also expresses GFAP. However, astrocytes differentiate from glial progenitor cells in the central nervous system (e.g.
- Miiller cells are differentiated from retinal progenitor cells (Watanabe and Raff, 1988. "Retinal Astrocytes Are Immigrants From The Optic Nerve", Nature, 332, 834-837; Belecky-Adams et al., 2013, “Reactive Miiller Glila As Potential Retinal Progenitors", Intech Neural Stem cells - New Perspectives, 73-1 16).
- the GFAP positive cells are derived from retinal progenitor cells differentiated from hESCs, and are thus retinal Miiller glial cells.
- the results also suggest that GFAP represents the most specific Miiller cell marker for cells are differentiated from retinal progenitor cells and cultured in a heterogeneous population.
- FACS analysis revealed an increased number of cells positively labelled for the most distinctive Muller cell marker in retinal progenitor-derived cells, GFAP, following treatment of hESCs-derived retinal progenitor cells (RPCs) with Notch ligand DLL4 and Jagged- 1 (50ng/ml) after 4 weeks and 6 weeks ( Figure 13 A and B, respectively).
- RPCs retinal progenitor-derived retinal progenitor cells
- Notch activation may also be achieved by transduction of cells using viral vectors expressing Notch related genes to produce cells with a Muller cell phenotype.
- any polynucleotide e.g., vector
- an agent which activates Notch signalling in a cell including the Notch intracellular domain or a target of Notch (e.g. HES 1 or HES5)
- a target of Notch e.g. HES 1 or HES5
- retinal progenitors are transfected with a vector containing sequences encoding a Notch intracellular domain or a target of Notch and also containing sequences encoding a drug resistance marker (e.g. resistance to G418) and/or green fluorescent protein (GFP).
- a drug resistance marker e.g. resistance to G418) and/or green fluorescent protein (GFP).
- GFP green fluorescent protein
- two vectors are used for transduction of retinal progenitors.
- selection is achieved, after transduction of a cell culture with the vector or vectors, by adding a selective agent (e.g., G418) to the cell culture in an amount sufficient to kill cells that do not comprise the vector but not kill cells that do. Absence of selection entails removal of said selective agent or reduction of its concentration to a level that does not kill cells that do not comprise the vector. Following selection (e.g., for seven days) the selective agent is removed and the cells may be further cultured (e.g., for two passages). Alternatively, cells expressing GFP may be isolated using known fluorescence based cell-sorting methods. [000153] Promoting Miiller cell phenotype by misexpression of notch related genes.
- the cells will be infected with lentiviral vectors expressing Notch related genes.
- the vectors e.g. lentiviral
- the vectors will carry either the intracellular domain of notch (NICD), Notch target gene HES l or HES5 together with green fluorescence protein (GFP) under a promoter (e.g. CMV).
- a vector carrying the GFP gene may be used as a control for comparison.
- Titration of the viral vectors and their transduction efficiencies will be determined in vitro with flow cytometry analysis. The transduction efficiency is expected to be approximately 50-70% and the gene expression is known to persist for more than a month.
- Viral vector transduction will be performed in retinal progenitors for 3 days and then the medium will be replaced the standard NIM until in vitro characterisation as described above.
- Miiller cells are mostly absent or unhealthy in retinas affected by MacTel2, the Miiller cell differentiation protocols described herein are useful for modelling other retinal diseases associated with Miil ler cell dysfunction and will assist in potential identification of causal genes for MacTel2.
- Cells produced according to the methods described herein will then be derived from both MacTel2-iPSCs and control iPSCs.
- GFAP+ cells with a Miiller cell phenotype will be washed, permeablised and labelled with GFAP antibody followed by a secondary antibody AlexFluor 488.
- the GFAP+ cells will be sorted by FACSAria (BD bioscience) using FACSDiva software. GFAP+ gating will be set with reference to negative controls (both IgG control and non-stained cells) and the sorting speed will be adjusted to ensure sorting efficiency above 90%.
- GFAP+ cells will be collected and RNA will be extracted, such as with a micro RNAeasy kit (Qiagen), and RNA quality and quantity will be assessed with a bioanalyser (Agilent).
- RNA-seq is a high throughput cDNA sequencing technique that maps and quantifies transcriptomes including mRNA, non-coding RNAs and small RNAs.
- Total RNA extracted from the differentiated and sorted Miiller cells will be used for the cDNA library preparation and sequencing which will be performed by Illumina NextSeq500.
- the generated raw data will be analysed with Tophat2 or STAR mapping tools and Bioconductor packages including edgeR and DESeq2.
- Hierarchical clustering and differential gene expression analysis will be undertaken. Genes with false discovery rate p ⁇ 0.01 and a two-fold change between samples and controls will be chosen for further study. Functional enrichment and pathway analysis will be performed with gene ontology and KEGG pathway analysis to gi ve a biological mean to the identified transcriptomes.
- the top candidate differentially expressed genes will be validated by qRT-PCR.
- Example 3 Transplantation Study - Misexpression of Notch related genes in Retinal progenitors
- Cells produced according to the methods described herein may be transplanted into the eyes of Mice with a retinal disease or disorder or with Miiller cell dysfunction or deficiency.
- Cells will be collected by FACS (fluorescence activated cell sorting system with either GFP or combination of Miiller cell markers) on the day of the transplantation according to established methods (Lamba, D., et al, 2008, Cell Stem Cell) and resuspended in balanced salt solution (BSS).
- FACS fluorescence activated cell sorting system with either GFP or combination of Miiller cell markers
- BSS balanced salt solution
- Cells produced according to the methods of the invention may be transduced with a viral vector (e.g.
- AAV or lentiviral vector possessing either intracellular domain of notch (NICD), Hesl or Hes5 together with green fluorescence protein (GFP) under CMV promoter.
- NBD intracellular domain of notch
- GFP green fluorescence protein
- Cells prepared in this manner may be sorted according to known cell sorting methods on the basis of GFP expression which will indicate expression of a Notch gene for activation of the Notch signalling pathway.
- the cells transduced with viruses will be grafted into the subretinal space of MacTel2 mouse retinae 1 week after Miiller cell ablation (50,000 cells/ul).
- the sclera, posterior to the limbus in the eye will be punctured with a 35 gauge needle, and the cells will be injected subretinally with a Hamilton syringe (50,000 cells/ ⁇ /eye.
- Control groups are a) non- transplanted retinas b) cells transduced with AAV-Empty-GFP, c) human fibroblasts (unrelated cells, negative controls) and d) sham surgery with vehicle only (e.g. BSS injection). Mice will receive Cyclosporine A (l Omg/kg/day) to suppress the potential immune response to the transplanted human cells.
- Retinas will be collected at 1, 2, 4 and 6 weeks after transplantation. Retina samples will be fixed with 4% paraformaldehyde for lhr and then embedded in optimal cutting temperature for frozen sectioning or flatmounted for immunofluorescence staining to study the migration and integration of the grafted cells. The cells will be identified by co-labelling of human nuclear antigen antibody (millipore, MAB 1281 ) and Miiller cell markers CRALBP, GS and GFAP, and with TUNEL to evaluate cell viability after transplantation.
- MAB 1281 human nuclear antigen antibody
- Miiller cell markers CRALBP, GS and GFAP TUNEL
- photoreceptors by measuring neural responses to light stimuli in photopic (light) and scotopic (dark) conditions. The responses will be interpreted from the signal's amplitude and implicit time with the a-wave derived from photoreceptors and the b-wave from the inner retina. Mice will be kept in the dark overnight before scotopic ERG. Subsequently, light stimuli of varying intensities will be given to the animal, and responses will be recorded as the oscillation and amplitude of each wave. ERG will also be performed in photopic conditions to evaluate cone photoreceptor function. Following OCT and ERG assessment, the Mice may be humanely euthanized and histological and immunohi stochemical analyses of the eyes may be perfonned according to methods well known to the skilled addressee.
- Cells produced according to the methods described herein may be transplanted into the eyes of a subject in need thereof in accordance with the methods described below.
- Patient-derived cells may be reprogramed into induced Pluripotent Stem Cells (iPSCs) according to known methods including those described above.
- Patient derived cells may include dermal fibroblasts from skin biopsies, peripheral blood derived mononuclear cells (e.g.
- iPSCs may be generated through known methods including plastnid transduction to introduce reprogramming factors. These factors may include OCT4, SOX2, KLF4 and c-MYC, LIN28 and shRNA for p53.
- Patient derived cells may be transfected with non-integrating episomal plasmids containing 6 reprogramming factors including L-myc, KLF4, OCT4, SOX2.
- DNA vectors for example, 4 DNA vectors; pCXLE-eGFP, pCXLE-hOCT4-shP53, pCXLE- hSOX2- lf4, and pCXLE-Lmyc-lin28 (addgene) may be employed to reprogram patient cells.
- retinal progenitors cells may be obtained according to the methods described above in Example 1.
- Induction of Notch signalling in the patient-derived retinal progenitor cells can then be performed according to the methods described above.
- patient-derived retinal progenitors may be contacted with one or more Notch ligands at a concentration and for a time sufficient to induce Notch signalling.
- Induction of Notch may also be effected by transduction of viral vectors designed to express Notch intracellular domain, or targets of Notch (including HES l and HES5).
- Induction of Notch signalling may be effected by a combination of exposure to Notch ligands and viral vectors directing expression of Notch intracellular domain or targets of Notch .
- Cells may then be sorted and collected according to known methods and resuspended in a physiologically compatible carrier for transplantation at a desired concentration (e.g. 50 microliters (2,500,000 cells/eye). Cells may then be injected either subretinally or into the vitreous cavity.
- a physiologically compatible carrier for transplantation at a desired concentration (e.g. 50 microliters (2,500,000 cells/eye). Cells may then be injected either subretinally or into the vitreous cavity.
- Patients may be monitored periodically after the intervention by assessment of visual acuity and biomicroscopic clinical examination together with retinal imaging including optical coherence tomography, fundus fluorescein angiography, autofluorescence and other retinal imaging techniques.
- Optical Coherence Tomography OCT
- Therapeutically effective treatment may be marked by one or more of prevention of further deterioration in visual acuity and the degree of retinal disease, restoration of normal retinal structure and improvement in visual acuity.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Cell Biology (AREA)
- Neurology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Neurosurgery (AREA)
- Developmental Biology & Embryology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Ophthalmology & Optometry (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Acoustics & Sound (AREA)
- Analytical Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
This invention relates to compositions and methods for directed differentiation of cells towards a Müller cell phenotype. Cells produced using the compositions and methods may be used in the study of retinal diseases and disorders, for drug screening and for therapeutic purposes.
Description
METHODS FOR DIFFERENTIATING CELLS INTO CELLS WITH A MULLER CELL PHENOTYPE, CELLS PRODUCED BY THE METHODS, AND METHODS FOR USING THE CELLS
Field
[0001 ] This invention relates to compositions and methods for directed differentiation of cells towards a Muller cell phenotype. Cells produced using the compositions and methods may be used in the study of retinal diseases and disorders, for drug screening and for therapeutic purposes.
Background
[0002] Muller glial cells, the principal glial cells in the retina, play an important role in maintaining retinal homeostasis. They provide metabolic supports to the surrounding neurons, produce neuroactive and vasoactive substances, and regulate retinal ion, water content and pH. Dysfunction of Muller cells is associated with different retinal diseases including diabetic retinopathy and Macular Telangiectasia Type 2.
[0003] Macular Telangiectasia Type 2 (MacTel2) is a macular degenerative disease, which affects the central vision. Recent studies have suggested that dysfunction of Muller glial cells, the major supporting cells in the retina, may contribute to the pathogenesis of the disease. Its cause is unknown so far, and its effective treatment has not yet been developed.
[0004] Despite advances in stem cell technologies for the treatment of retinal diseases using retinal cells, such as retinal pigmented epithelial cells and photoreceptors, Muller cell differentiation from human stem cells, and their transplantation in animal models of retinal diseases have to date not been demonstrated.
[0005] Obtaining cells with a Muller cell phenotype suitable for transplantation and screening of candidate therapeutic agents will have great use in the treatment of retinal diseases including macular degeneration, diabetic retinopathy and MacTel2.
Summary of Invention
[0006] The present invention relates generally to the field of stem and progenitor cell biology, more specifically the directed differentiation of stem and progenitor cells using novel culture conditions.
[0007] Numbered statements of the invention are as follows.
1. A method for producing cells having a Miiller cell phenotype from a population of retinal progenitor cells, the method comprising cultunng the population of cells for a time and under conditions sufficient for inducing Notch signalling in said population of cells to thereby differentiate the population of cells into the cells having a Miiller cell phenotype.
2. The method according to statement 1 , wherein inducing Notch signalling is effected by contacting the cells with one or more of: a Notch ligand, Notch intracellular domain (N1CD), HES l , HES5, DNA-binding protein RBPJ, or deltex.
3. The method according to statement 1 or 2, wherein inducing Notch signalling is effected by culturing the cells with a medium supplemented with at least two Notch ligands
4. The method according to statement 2 or 3, wherein the Notch ligand is selected from the group consisting of Delta like ligand (DLL)-l, Delta like ligand-3, Delta like ligand-4, Jagged (JAG)-l and Jagged-2.
5. The method according to statement 3 or 4, wherein the Notch ligands are DLL4 and JAG1.
6. The method according to statement 5 wherein the population of cells are cultured with a medium comprising about 5ng/ml to about 100 ng/ml DLL4 and about 5ng/ml to about 100 ng/ml JAG1.
7. The method according to statement 6 wherein the population of cells are cultured with a medium comprising about 50 ng/ml DLL4 and about 50 ng/ml JAG1.
8. The method according to any one of the preceding statements wherein inducing Notch signalling is effected by transfecting one or more cells of the population of retinal progenitor cells with a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling.
9. The method according to statement 8, wherein said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (N1CD), HES l, HES5, DNA-binding protein RBPJ, and deltex.
10. The method according to statement 8 or 9, wherein said nucleic acid construct is a viral vector.
11. The method according to any one of statements 8 to 10 wherein said polynucleotide or polynucleotides encode/s one or more of NICD, HES l and/or HES5.
12. The method according to any one of the preceding statements wherein said culturing the population of cells is effected for from about 1 week to about 6 weeks.
13. The method according to any one of the preceding statements wherein said culturing the population of cells is effected for about 6 weeks
14. The method according to any one of statements 1 to 12 wherein said culturing the population of cells is effected for about 4 weeks.
15. The method according to any one of statements 1 to 12 wherein said culturing the population of cells is effected for about 2 weeks.
16. The method according to any one of statements 1 to 12 wherein said culturing the population of cells is effected for about 1 week.
17. The method according to any one of the preceding statements, wherein the population of retinal progenitor cells are derived from a human.
18. The method according to any one of the preceding statements, wherein the population of retinal progenitor cells are derived from a cell or population of cells selected from the group consisting of stem cells, progenitor cells and de-differentiated cells.
19. The method according to statement 18, wherein the stem cell is an Embryonic Stem Cell (ESC) or an induced Pluripotent stem cell (iPSC).
20. A method for producing cells having a Miiller cell phenotype from a population of stem cells, the method comprising: i) differentiating a population of stem cells to produce a population of cells having a retinal progenitor cell phenotype and ii) culturing the population of cells having a retinal progenitor phenotype produced by step i) for a time and under conditions sufficient for inducing Notch signalling in the population of cells having a retinal progenitor phenotype and thereby differentiate them into cells having a Miiller cell phenotype.
21. The method according to statement 20 wherein differentiating the population of cells in step i) is effected by culturing said population of stem cells in a neural differentiation medium.
22. The method according to statement 21 , wherein the neural differentiation medium comprises DK -1, IGF-1 and Noggin.
23. The method according to any one of statements 20 to 22, wherein inducing Notch signalling is effected by contacting the population of cells having a retinal progenitor phenotype with one or more of: a Notch ligand, Notch intracellular domain (NICD), HESl, HES5, DNA- binding protein RBPJ, and/or deltex.
24. The method according to statement 23, wherein inducing Notch signalling is effected by contacting the cells having a retinal progenitor phenotype with at least two Notch ligands.
25. The method according to statement 23 or 24, wherein the Notch ligand is selected from the group consisting of Delta like ligand- 1, Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2.
26. The method according to statement 24 or 25, wherein the Notch ligands are DLL4 and JAG1.
27. The method according to statement 26, wherein the population of cells having a retinal progenitor phenotype are cultured in a medium comprising about 5ng/ml to about 100 ng/ml DLL4 and about 5ng/ml to about 100 ng/ml JAG1.
28. The method according to statement 27, wherein the population of cells having a retinal progenitor phenotype are cultured in a medium comprising about 50 ng/ml DLL4 and about 50 ng/ml JAG1.
29. The method according to any one of the statements 20 to 28, wherein inducing Notch signalling is effected by transfecting one or more cells of the population of cells having a retinal progenitor phenotype with a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling.
30. The method according to statement 29, wherein said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (NICD), HES 1, HES5, DNA-binding protein RBPJ, and deltex.
31. The method according to statement 29 or 30, wherein said nucleic acid construct is a viral vector.
32. The method according to any one of statements 29 to 31 wherein said polynucleotide or polynucleotides encode/s one or more of NICD, HES 1 and/or HES5.
33. The method according to any one of statements 20 to 32 wherein said differentiating in step i) is effected for about 3 to 4 weeks.
34. The method according to any one of statements 20 to 33 wherein said culturing the population of cells in step ii) is effected for from about 1 week to about 6 weeks.
35. The method according to any one of statements 20 to 33 wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 6 weeks.
36. The method according to any one of statements 20 to 33 wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 4 weeks.
37. The method according to any one of statements 20 to 33 wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 2 weeks.
38. The method according to any one of statements 20 to 33 wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 1 week.
39. The method according to any one of statements 20 to 38, wherein the population of stem cells is derived from a human.
40. The method according to any one of statements 20 to 39, wherein the population of stem cells is a population of ESCs or iPSCs.
41. The method according to statement 40 wherein the population of iPSCs is derived from a subject having a retinal disease or disorder.
42. The method according to statement 41 wherein the population of iPSCs is derived from a subject having macular degeneration, diabetic retinopathy or Macular Telangiectasia Type 2, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma or retinopathy of prematurity.
43. The method according to any one of the preceding statements further comprising the step of isolating cells with a Miiller cell phenotype.
44. The method according to any one of the preceding statements wherein the cells with a Miiller cell phenotype express one or more markers selected from the group consisting of GFAP, GS, VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1.
45. The method according to any one of the preceding statements wherein the cells with a Miiller cell phenotype express GFAP.
46. The method according to any one of the preceding statements wherein the cells with a Miiller cell phenotype express GFAP, GS and VIMENTIN.
47. The method according to any one of the preceding statements wherein the cel ls wi th a Miiller cell phenotype express GFAP, GS, VIMENTIN, and CRALBP.
48. Cells having a Miiller cell phenotype produced according to the method of any one of statements 1 to 47.
49. Use of the cells having a Miiller cell phenotype according to statement 48 in the manufacture of a medicament for the prevention or treatment of a retinal disease or disorder in a subject.
50. The use according to statement 49 wherein said retinal disease or disorder is associated with or arises at least in part from dysfunction, injury and/or loss of Miiller cells in the subject.
51. Use of the cells having a Miiller cell phenotype according to statement 48 in the manufacture of a medicament for the regeneration or repair of the retina in a subject in need thereof.
52. Use of the cells having a Miiller cell phenotype according to statement 48 in a method of screening or identification of a pharmaceutical agent or an agent useful for the prevention or treatment of a retinal disease or disorder in a subject.
53. A pharmaceutical composition comprising the cells having a Miiller cell phenotype according to statement 48.
54. A kit for producing cells having a Miiller cell phenotype, comprising one or more agents capable of inducing Notch signalling in a population of cells.
55. The kit according to statement 54, wherein said one or more agents comprises a Notch ligand, Notch intracellular domain (NICD), HES l , HES5, DNA-binding protein RBPJ, and deltex.
56. The kit according to statement 54, wherein said one or more agents comprises at least two Notch ligands.
57. The kit according to statement 55 or 56, wherein the Notch ligand is selected from the group consisting of Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
58. The kit according to statement 56 or 57, wherein the Notch ligands are DLL4 and JAG1.
59. The kit according to any one of statements 54 to 58, comprising a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling.
60. The kit according to statement 59, wherein said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (NICD), HES l , HES5, DNA-binding protein BPJ, and deltex.
61. The kit according to statement 59 or 60, wherein said nucleic acid construct is a viral vector.
62. The kit according to any one of statements 59 to 61 wherein said polynucleotide or polynucleotides encode/s one or more of NICD, HES l and/or HES5.
63. The kit according to any one of statements 54 to 62 further comprising a cell selected from the group consisting of a stem cell, progenitor cell, a dedifferentiated cell, or retinal progenitor cell.
64. The kit according to any one of statements 54 to 63, further comprising an agent for detecting expression of one or more markers indicative of the Miiller cell phenotype.
65. The kit according to any one of statements 54 to 64, further comprising a cell culture medium.
66. The kit according to statement 65, wherein culture medium comprises a base medium of DMEM/F12 and B27 and N2 supplements, penicillin and streptomycin.
67. The kit according to any one of statements 54 to 66, further comprising one or more of DK -1, IGF-1 and Noggin.
68. A medium for producing cells having a Miiller cell phenotype wherein the medium comprises one or more of: a Notch ligand, Notch intracellular domain (NICD), HES1, HES5, DNA-binding protein RBPJ, and/or deltex.
69. The medium according to statement 68, wherein the medium comprises at least two Notch ligands.
70. The medium according to statement 68 or 69, wherein the Notch ligand is selected from the group consisting of Delta like ligand-1 , Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
71. The medium according to statement 69 or 70, wherein the Notch ligands are DLL4 and JAG 1.
72. The medium according to statement 71 comprising about 5ng/ml to about 100 ng/ml DLL4 and about 5ng/ml to about 100 ng/ml JAGl .
73. The medium according to statement 72 comprising about 50 ng/ml DLL4 and about 50 ng/ml JAGl .
74. The medium according to any one of statements 68 to 73 further comprising one or more of DKK-1, IGF-1 and/or Noggin.
75. The medium according to any one of statements 68 to 74, wherein the medium comprises a base medium of DMEM/F12 and B27 and N2 supplements, penicillin and streptomycin.
76. A method of identification of an agent useful for the prevention or treatment of a retinal disease or di sorder in a subject or regeneration or repair of the retina comprising: (a) contacting cells having a Miiller cell phenotype according to statement 48 with an agent; and (b) detecting an increase or decrease in a parameter relative to a control, wherein the control is a cell or population of cells according to statement 48 not contacted with the agent; wherein said increase or decrease in the parameter is indicative of a capacity to exert a therapeutic effect in
the subject or the retina; and wherein an agent that effects said increase or decrease in the parameter is identified as being useful for the treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina.
77. A method for the treatment or prevention of a retinal disease or disorder comprising administering cells having a Muller cell phenotype according to statement 48 or the
pharmaceutical composition according to statement 53 to a subject in need thereof to thereby treat or prevent the retinal disease or disorder.
78. The method according to statement 77 wherein said retinal disease or disorder is associated with dysfunction, injury and/or loss of Muller cells in the subject.
79. A method for the regeneration or repair of the retina in a subject in need thereof comprising administering a cells having a Muller cell phenotype according to statement 48 or the pharmaceutical composition according to statement 53 to said subject.
80. Cells having a Muller cell phenotype according to statement 48 or the pharmaceutical composition according to statement 53 for the prevention or treatment of a retinal disease or disorder in a subject in need thereof.
81. The cells according to statement 80 wherein said retinal disease or disorder is associated with dysfunction, injury and/or loss of Muller cells in a subject.
82. Cells having a Muller cell phenotype according to statement 48 or the pharmaceutical composition according to statement 53 for the regeneration or repair of the retina in a subject in need thereof.
83. The use according to any one of statements 49 to 52, the method according to any one of statements 76 to 79, or cells having a Muller cell phenotype according to any one of statements 80 to 82, wherein the cells having a Muller cell phenotype are manipulated to display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
84. The use according to any one of statements 49, 50, 52, a method according to any one of statements 75 to77, or cells having a Miiller cell phenotype according to any one of statements 79 to 81, wherein the retinal disease or disorder is selected from the group consisting of Diabetic retinopathy, Macular Telangiectasia Type 2, Age-related macular degeneration, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma and retinopathy of prematurity.
85. The use, method or of cells according to statement 84, wherein the retinal disease is selected from the group consisting of Diabetic retinopathy, Macular Telangiectasia Type 2, and Age-related macular degeneration.
86. The use, method or cells according to statement 84 or 85, wherein the retinal disease is Macular Telangiectasia Type 2.
87. The use, method or cells according to any one of statements 84 to86, wherein the cells having a Miiller cell phenotype are manipulated to display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function .
88. The kit according to any one of statements 54 to 67 or medium according to any one of statements 71 to 75 for use in the method of any one of statements 1 to 47.
89. The kit according to any one of statements 54 to 67 or medium according to any one of statements 71 to 75 when used in the method of any one of statements 1 to 47.
90. The method according to statement 76, wherein the parameter is one or more of the following: i) expression of one or more of GFAP, GS, VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1 ; ii) extracellular concentration of a neuroactive substance including K+, glutamate, GABA and/or H+; and/or iii) expression or secretion of one or more cytokines.
Brief Description of Drawings
[0008] Figure 1 shows light microscopic analysis of the differentiation of ESCs contacted with DKK-1 + Noggin+ IGF-1 induction (lng/ml, respectively) into retinal progenitors from day 0 to day 4, and PCR analysis of retinal progenitor marker expression at day 3.
[0009] Figure 2 shows light microscopic analysis of the differentiation of ESCs contacted with DKK-1 + Noggin+ IGF-1 induction (10 ng/ml, respectively) into retinal progenitors from day 5 to day 10 and PCR analysis of retinal progenitor marker expression at days 7 and 10.
[00010] Figure 3 shows l ight microscopic analysis of the differentiation of ESCs contacted with DKK-1 + Noggin+ IGF-1 induction (10 ng/ml, respectively) into retinal progenitors from day 12 to day 15 and PCR analysis of retinal progenitor marker expression at day 12.
[0001 1 ] Figure 4 shows light microscopic analysis of the differentiation of iPSCs into retinal progenitors after 10 days (A) and 13 days (B), and immunocytochemical analysis of retinal progenitor markers and (C - E).
[00012] Figure 5 shows immunocytochemical analysis of retinal progenitor markers following differentiation of ESCs after 21 days.
[00013] Figure 6 shows qRT-PCR analysis demonstrating retinal progenitor differentiation from H9 ESCs (n=3, Represents p<0.05).
[00014] Figure 7 shows qRT-PCR analysis confirming Notch signalling activation 9 days after Notch ligand Jagged- 1 and DLL4 treatment (50ng/ml) in retinal progenitor differentiation.
[00015] Figure 8 shows qRT-PCR analysis demonstrating significantly upregulated expression of Miiller cell markers 4 and 6 weeks after Notch ligand treatment (n=4, Represents p<0.05).
[00016] Figure 9 shows immunocytochemical analysis highlighting that cells are positively labelled with Miiller cell markers 4 weeks after Notch ligand treatment.
[00017] Figure 10 shows immunocytochemical analysis highlighting that cells are positively labelled with Miiller cell markers 6 weeks after Notch ligand treatment.
[00018] Figure 11 shows qRT-PCR analysis of Retinal Progenitors 4 weeks after Notch l igand treatment.
[00019] Figure 12 shows Western blot analysis demonstrating increased protein expression of Muller cell markers in cells treated with Notch ligands for 6 weeks compared with untreated retinal progenitors (n=3-4, "represents p<0.05).
[00020] Figure 13 shows fluorescence-activated cell sorting (FACS) analysis demonstrating an increased number of cells positively labelled for the Muller cell marker GFAP following treatment of hESCs-derived retinal progenitor cells ( PCs) with Notch ligand DLL4 and Jagged- 1 (50ng/ml) after 4 weeks (A) and 6 weeks (B). AF488 (AlexFluor 488) indicates GFAP+ cells.
[00021 ] Figure 14 shows the generation of hiPSCs from MacTel2 patient-derived fibroblasts (A); Microscopic analysis of an established MacTel2-hiPSC colony expressing stem cell markers Oct4 and TRA-1 -60 (B-D). White arrows in A and B indicate iPSC colonies. Scale bar: 100 μιη.
Description of Embodiments
[00022] Definitions
[00023] As used herein, the term "cell" refers to a single cell as well as to a population of (i.e., more than one) cells. The population may be a pure population comprising one cell type, such as a population of cells with a Muller cell phenotype or a population of undifferentiated stem cells. Alternatively, the population may comprise more than one cell type, for example a mixed cell population. It is not meant to limit the number of cells in a population, for example, a mixed population of cells may comprise at least one differentiated cell. In one embodiment a mixed population may comprise at least one differentiated. In the present invention, there is no limit on the number of cell types that a cell population may comprise.
[00024] The terms "differentiate" "differentiating" and "differentiation" as used herein with respect to cells (e.g. in a differentiating cell system) refer to the process by which cells transition from one cell type (e.g., a multipotent, totipotent or pluripotent differentiable cell) to another cell type such as a target differentiated cell. Accordingly, the term "cell differentiation" as used herein, refers to a specialization process or a pathway by which a less specialized cell (e.g. stem cell) develops or matures to possess a more distinct form and function (i.e. more specialized). In the context of the present disclosure "differentiating" or inducing "differentiation" refers to changing the default cell type (genotype and/or phenotype) to a non-default cell type (genotype
and/or phenotype). Thus "inducing retinal differentiation in a cell" includes inducing a cell to have characteristics of retinal cells or retinal progenitor cells, or inducing a cell to divide into progeny cells with retinal characteristics, that are different from the original identity of the cell, such as genotype (i.e. change in gene expression as determined by genetic analysis such as a PC or microarray) and/or phenotype (i.e. change in morphology, function and/or expression of a protein.
[00025] As used herein, the term "Miiller cell differentiation" refers to inducing, or the induction of a cell to have a Miiller cell phenotype, or inducing a cell to di vide into progeny cells with M iiller cell characteristics, that are different from the ori ginal identity of the cell, such as genotype (i.e. change in gene expression as determined by genetic analysis such as a PGR or microarray) and/or phenotype (i.e. change in morphology, function and/or expression of a protein.
[00026] As used herein, the term "dedifferentiation" or "dedifferentiated" as used with respect to cells, refers to a process wherein a more specialized cell having a more distinct form and function, and/or limited self-renewal and/or proliferative capacity becomes less specialized and acquires a greater self-renewal and/or proliferative capacity or differentiation capacity (e.g. multipotent, pluripotent etc.). An induced Pluripotent Stem Cell (iPSC) is an example of a dedifferentiated cell. Accordingly, dedifferentiation can refer to a process of cellular
reprogramming.
[00027] As used herein, the term "Miiller cell phenotype" refers to a differentiated, lineage committed cell of the glial lineage that exhibits the functional and/or phenotypical
characteristics of a Miiller cell. As used herein the term "Miiller cell phenotype" refers to a cell which expresses Glial Fibrillary Acidic Protein (GFAP). Cells with a Miiller cell phenotype can also express one or more of the following markers:, Glutamine Synthase (GS), VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1. As used herein the term "Miiller cell phenotype" also refers to a cell which expresses GFAP, GS and VIMENTIN. As used herein the term "Miiller cell phenotype" refers to a cell which expresses GFAP, GS, VIMENTIN and CRALBP. In addition to the foregoing markers, Miiller cells or cells with a Miiller cell phenotype may additionally be characterised by the cell's ability to enzymatically convert glutamate to glutamine via expression of (GS) and/or the activity of GLAST which mediates the transport of glutamic and aspartic acid from the extracellular space.
[00028] As used herein, the term "Progenitor cells" refers to cells, including those produced during differentiation of a stem cell, that have some, but not all, of the characteristics of their terminally-differentiated progeny. As used herein, the term "retinal progenitor cell" refers to a cell which may give rise to various retinal cell subtypes including retinal pigment epithelial cells, photoreceptors, ganglion cells, bipolar cells, horizontal cells and Muller cells.. Retinal progenitor cells may be characterized by the expression of a panel of eyefield markers including ChxlO, Lhx, Pax9, RAX and Six6. The isolation, identification and methods for the generation of retinal progenitor cells from pluripotent stem cells has been described previously (see e.g. Meyer, J. et al (2009) Proc Natl Acad Sci 106(39): 16698-1670; and Lamba, DA et al (2010) PLoS ONE (5)1 : e8763, the contents of each of which are incorporated herein by reference).
[00029] As used herein, the term "contacting" cells with a compound as defined by the present inventions refers to placing the compound in a location that will allow it to touch the cell in order to produce "contacted" cells. The contacting may be accomplished using any suitable method. For example, in one embodiment, contacting is by adding the compound to a container (e.g. tube, vial or culture flask or culture dish etc.) of cells. Contacting may also be
accomplished by adding the compound to a culture of the cells.
[00030] As used herein, the term "stem cell" refers to a cell that is totipotent or pluripotent or multipotent and are capable of differentiating into one or more different cell types, such as embryonic stems cells, stem cells isolated from various tissues, for example, bone marrow derived stem cells (BMSCs). As used herein, the term "adult stem cell" refers to a stem cell derived from an organism after birth.
[00031 ] As used herein, the term "pluripotent" refers to a cell line capable of differentiating into any (or multiple) differentiated cell type (s).
[00032] "Induced pluripotent stem cells (iPSCs) or (iPS cells)" is a designation that pertains to somatic cells that have been reprogrammed or "de-differentiated", for example, by introducing exogenous genes that confer on the somatic cell a less differentiated phenotype. These cells can then be induced to differentiate into less differentiated progeny. IPS cells have been derived using modifications of an approach originally discovered in 2006 (Yamanaka, S. et al, Cell Stem Cell, 1 :39-49 (2007)). For example, in one instance, to create IPS cells, scientists started with skin cells that were then modified by a standard laboratory technique using retroviruses to
insert genes into the cellular DNA. In one instance, the inserted genes were Oct4, Sox2, Lif4, and c-myc, known to act together as natural regulators to keep cells in an embryonic stem celllike state. These cells have been described in the literature. See, for example, Wernig et al, PNAS, 105:5856-5861(2008); Jaenisch et al., Cell, 132:567-582 (2008); Hanna et al, Cell, 133:250-264 (2008); and Brambrink et al, Cell Stem Cell, 2: 151-159 (2008). It is also possible that such cells can be created by specific culture conditions (exposure to specific agents), as is described in the Examples in this application. These references are all incorporated by reference for teaching IPSCs and methods for producing them.
[00033] IPS cells have many characteristic features of embryonic stem cells. For example, they have the ability to create chimeras with germ line transmission and tetraploid complementation and they can also form teratomas containing various cell types from the three embryonic germ layers. On the other hand, they may not be identical as some reports demonstrate. See, for example, Chin et al. , Cell Stem Cell 5: 1 1 1 -123 (2009) showing that induced pluripotent stem cells and embryonic stem cells can be distinguished by gene expression signatures.
[00034] As used herein, the term "multipotent" refers to a cell line capable of differentiating into at least two differentiated cell types.
[00035] As used herein, the term "primary cell" is a cell that is directly obtained from a tissue (e.g. blood) or organ of an animal in the absence of culture. Typically, though not necessarily, a primary cell is capable of undergoing ten or fewer passages in vitro before senescence and/or cessation of proliferation.
[00036] As used herein, the term "cell culture" refers to any in vitro culture of cells. The term "culturing" refers to the process of growing and/or maintaining and/or manipulating a cell. Included within this term are continuous cell lines (e.g., with an immortal phenotype), primary cell cultures, finite cell lines (e.g., non-transformed cells), and any other cell population maintained in vitro, including oocytes and embryos. As used herein, the terms "primary cell culture," and "primary culture," refer to cell cultures that have been directly obtained from cells in vivo, such as from a tissue specimen or biopsy from an animal or human. These cultures may be derived from adults as well as fetal tissue.
[00037] As used herein, the terms "medium" "culture medium," and "cell culture medium," refer to media that are suitable to support the growth of cells in vitro (i.e., cell cultures, cell
lines, etc.). It is not intended that the term be limited to any particular culture medium. For example, it is intended that the definition encompass maintenance media as well as other media for the differentiation or specialization of cells. Indeed, it is intended that the term encompass any culture medium suitable for the growth of the cell cultures and cells of interest.
[00038] As used herein, the term "kit" refers to any delivery system for delivering materials. In the context of cell differentiation, a kit may refer to a combination of materials for contacting stem cells, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., compounds, proteins, detection agents (such as probes or antibodies), etc. in the appropriate containers (such as tubes, etc.) and/or supporting materials (e.g., buffers, written instructions for performing cell differentiation, etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes, or bags, and the like) containing the relevant reaction reagents (such as Notch ligands (e.g. Delta serrate lag2 (DSL) ligands such as DLLl , DLL3, DLL4, JAGl and JAG2) or viral vectors expressing Notch related genes) and/or supporting materials.
[00039] As used herein, the term " « vitro" refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vilro environments can consist of, but are not limited to, test tubes and cell cultures. The term "/ ? vivo" refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.
[00040] As used herein, the term "marker" or "cell marker" refers to o any phenotypic feature of a cell that can be used to characterize it or discriminate it from other cell types. A marker may be a protein (including secreted, cell surface, or internal proteins; either synthesized or taken up by the cell); a nucleic acid (such as an mRNA, or enzymatically active nucleic acid molecule) or a polysaccharide. Included are determinants of any such cell components that are detectable by antibody, lectin, probe or nucleic acid amplification reaction that are specific for the marker of the cell type of interest. The markers can also be identified by a biochemical or enzyme assay or biological response that depends on the function of the gene product. Associated with each marker is the gene that encodes the transcript, and the events that lead to marker expression. A marker is said to be preferentially expressed in an undifferentiated or differentiated cell population, if it is expressed at a level that is at least 50% higher (in terms of total gene product measured in an antibody or PCR assay) or 30% more frequently (in terms of positive cells in the
population) than an acceptable control such as actin or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Markers that are expressed 2, 10, 100, or 10,000 times higher or more frequently are increasingly more preferred. A marker for a cell may not be limited to one marker; markers may refer to a "pattern" of markers such that a designated group of markers may identify a cell or cell type from another cell or cell type. For example, cells obtained according to the methods of the present invention express one or more markers that distinguish a cell having a Muller cell phenotype such as GFAP, GS, VIMENTIN and CRALBP.
[00041 ] The term "derived from" or "established from" or "differentiated from" when made in reference to any cell disclosed herein refers to a cell that was obtained from (e.g., isolated, purified, etc.) a parent cell in a cell line, tissue, or fluids using any manipulation, including single cell isolation, in vitro culture, treatment and/or mutagenesis using for example proteins, chemicals, radiation, infection with virus, transfection with DNA sequences, such as with a morphagen, etc., selection (such as by serial culture) of any cell that is contained in cultured parent cells. A derived cell can be selected from a mixed population by virtue of response to a growth factor, cytokine, selected progression of cytokine treatments, adhesiveness, lack of adhesiveness, sorting procedure, and the like.
[00042] As used herein, the terms "treating," "treatment" and the like are used herein to mean obtaining a desired pharmacologic and/or physiologic effect. The effect can be prophylactic in tenns of completely or partially preventing a disorder or sign or symptom thereof, and/or can be therapeutic in tenns of a partial or complete cure for a disorder and/or adverse effect attributable to the disorder. Examples of "treatment" include but are not limited to: preventing a disorder from occumng in a subject that may be predisposed to a disorder, but has not yet been diagnosed as having it; inhibiting a disorder, i.e., arresting its development; and/or relieving or ameliorating the symptoms of disorder, e.g., macular degeneration. As is understood by those skilled in the art, "treatment" can include systemic amelioration of the symptoms associated with the pathology and/or a delay in onset of symptoms such as chest pain. Clinical and subclinical evidence of "treatment" will vary with the pathology, the individual and the treatment.
[00043] As will be understood by one skilled in the art, for any and all purposes, particularly in tenns of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at
least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as "up to," "at least," "greater than," "less than," and the like include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above.
[00044] Where the terms "comprise", "comprises", "comprised" or "comprising" are used in this specification (including the claims) they are to be interpreted as specifying the presence of the stated features, integers, steps or components, but not precluding the presence of one or more other features, integers, steps or components, or group thereof.
[00045] A reference herein to a patent document or other matter which is given as prior art is not to be taken as an admission that that document or matter was known or that the information it contains was part of the common general knowledge as at the priority date of any of the claims.
[00046] Differentiation of Retinal Stem and Progenitor Cells
[00047] Because of the potential of differentiated cells derived from stem cells in countless therapeutic applications, directing or promoting the differentiation of stem cells in culture toward a specific somatic cell fate is of great interest.
[00048] Human stem cells offer great promise for cell -replacement therapies and cell screening for therapeutics. Recent advances in somatic cell reprogramming to induced pluripotent stem cells (iPSCs) has opened the door to generating patient-specific cells for regenerative medicine and disease modelling. However to realize the full potential of these approaches for diseases and disorders of the retina, improved differentiation protocols that yield the desired cell type for cell therapy or drug screening are required. Accordingly, understanding and manipulating the signalling pathways involved in the differentiation of stem cells and retinal progenitor or retinal stem cells is critical.
[00049] Miiller glial cells, the principal glial cells in the retina, play an important role in maintaining retinal homeostasis. They provide metabolic supports to the surrounding neurons, produce neuroactive and vasoactive substances, and regulate retinal ion, water contents and pH. In certain eye diseases and disorders of, e.g., the retina and the macula, degeneration or
dysfunction of Miiller cells ultimately leads to visual loss and even blindness. Transplantation of Miiller cells to replace and support the failing host cells represents a possible therapeutic intervention. However, the mechanisms and methods for the generation of human Miiller glial cells from retinal stem/progenitor cells including those derived from human embryonic stem cells, iPSCs or de-differentiated cells remain to be elucidated.
[00050] The Notch signalling pathway is a highly conserved pathway in embryogenesis. It regulates cell-fate decisions such as self-renewal and survival, and cellular differentiation in various organs including central and peripheral nervous systems. The Notch signalling pathway is known to promote gliogenesis in retinal development. Previous animal studies revealed that misexpression of Notch related genes such as Notchl, Hesl and Hes5, in retinal progenitors promoted glial phenotype. However, little is known about its role in human retinal progenitors and retinal gliogenesis.
[00051 ] It has now been surprisingly found that contacting retinal progenitor cells with agents which activate the Notch signalling pathway, promotes differentiation of human retinal progenitor cells towards a Miiller glial cell fate. In other words, these factors which induce Notch signalling induce or direct the differentiation of retinal progenitor cells towards a Miiller cell phenotype. Thus, the use of factors which augment Notch signalling for the preparation of a culture system for inducing differentiation of retinal progenitor cells, has thus been envisaged.
[00052] Therefore, according to one aspect of the invention, there is provided a method for producing cells with a Miiller cell phenotype from a population of retinal progenitor cells, the method comprising culturing the population of cells for a time and under conditions sufficient for inducing Notch signalling in said population of cells sufficient to differentiate the population of cells into cells having a Miiller cell phenotype.
[00053] While a number of agents which induce Notch signalling within cells are known, according to a preferred embodiment, the population of retinal progenitor cells is cultured for a time and under conditions sufficient for inducing Notch signalling sufficient to differentiate the population of cells into cells having a Miiller cell phenotype, by contacting the population of cells with one or more agents which induce Notch signalling. Preferably, the one or more agents are selected canonical ligands for the Notch receptor. More preferably, the Notch ligands are selected from the group consisting Delta like ligand (DLL)-l, Delta like ligand-3, Delta like
ligand-4, Jagged-1 and Jagged-2. Even more preferably, the Notch ligands are DLL4 and JAG1. In another embodiment, the agents capable of inducing Notch signalling pathway in a cell are selected from non-canonical ligands of Notch receptor.
[00054] The concentrations of Notch ligands which may be employed to effect induction of Notch signalling in a population of retinal progenitor cells sufficient to differentiate the population of cells into cells having a Miiller cell phenotype, may be determined by the skilled addressee according to the methods described herein. In one embodiment, the population of retinal progenitor cells are cultured in a cell culture medium comprising a Notch ligand present at a concentration of about, 1 ng/ml to about 1000 ng/ml. In another embodiment, a Notch ligand may be present at a concentration of about 5ng/ml to about 100 ng/ml. More preferably, a Notch ligand may be present at a concentration of about 10 ng/ml to about 80 ng/ml. Even more preferably, a Notch ligand may be present at a concentration of about 50 ng/ml.
[00055] In another embodiment, the one or more agents which induce Notch signalling are selected from other agents shown to interact with and modulate Notch signalling, including the Notch intracellular domain (NICD), HES l, HES5, DNA-binding protein RBPJ, and deltex.
[00056] According to another embodiment, the population of retinal progeni tor cells is transfected with a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HESl and HES5. The nucleic acid construct may be, for example, an expression vector, a plasmid vector, a viral vector, a phosmid, a cosmid, a recombinant virus or any other vector construct suitable for the insertion of foreign sequences, introduction into cells and subsequent expression of the introduced sequences.
[00057] According to another embodiment, the population of retinal progenitor cells is cultured for a time and under conditions sufficient for inducing Notch signalling sufficient to
differentiate the population of cells into cells having a Miiller cell phenotype, by transduction of the cells with one or more viral vectors comprising one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HESl, HES5. According to one embodiment, the vectors also contain sequences encoding one or more selectable markers such as a drug resistance marker (e.g. resistance to G418) and/or green fluorescent protein (GFP). In additional
embodiments, two vectors, one containing one or more polynucleotides encoding an activator of Notch signalling, including one or more of: full length Notch receptor, Notch intracellular domain (NICD), HESl , and HES5, and the other containing sequences encoding a selectable marker, e.g. drug resistance marker and/or GFP, are used for transduction of retinal progenitors. In these embodiments, selection is achieved, after transduction of a cell culture with the vector or vectors, by adding a selective agent (e.g., G418) to the cell culture in an amount sufficient to kill cells that do not comprise the vector but not kill cells that do, or by sorting and collecting GFP positive cells.
[00058] In a preferred embodiment, the population of retinal progenitor cells is transduced with a viral vector comprising a polynucleotide encoding NICD.
[00059] According to another embodiment, the population of retinal progenitor cells is transduced with one or more viral vectors comprising one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HES l, HES5, prior to contacting the population of cells with one or more agents which induce Notch signalling, such as Notch ligands selected from the group consisting Delta like ligand-1 , Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
[00060] According to another embodiment, the population of retinal progenitor cells is transduced with one or more viral vectors comprising one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length N otch receptor, Notch intracellular domain (NICD), HES l, HES5, after the population of cells has been contacted with one or more agents which induce Notch signalling, such as Notch ligands selected from the group consisting Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
[00061 ] Retinal stem or progenitor cells for use in the methods of producing cells with a Miiller cell phenotype may be provided or prepared according to known methods.
[00062] In one aspect, the present invention provides a method for producing cells with a Miiller cell phenotype from a population of stem cells, the method comprising: i) differentiating a population of stem cells to produce a population of cells having a retinal progenitor cell phenotype and ii) culturing one or more cells of the population of cells produced by step i) for a
time and under conditions sufficient for inducing Notch signalling in the population of cells sufficient to differentiate the population of cells into cells having a Miiller cell phenotype
[00063] In one embodiment, the stem cells in step i) are differentiated into cells having a retinal progenitor cell phenotype, in accordance with published methods. In another embodiment, in step i), embryoid bodies from a population of pluripotent stem cells are generated from colonies of stem cells by culturing them in a neural induction medium containing recombinant human proteins including DKK 1 , Noggin and IGF-1 for a first culture period. Preferably, for the first culture period the embryoid bodies are cultured in the neural induction medium for a duration of about 3 days. Preferably, the recombinant human proteins are present in the neural induction medium at the following concentrations: DK 1 (lng/ml), Noggin (lng/ml) and IGF- 1 (5ng/ml). Following the first culture period, the embryoid bodies are plated onto a matrix coated cell- culture surface and cultured for a second culture period in the same medium as used for the first period with N2 supplement and an increased concentration of the recombinant proteins.
Preferably, the matrix coated surface is a cell culture plate coated with matrigel. Preferably, the concentration of DKK l , Noggin and IGF-1 for the second culture period is 1 Ong/ml of each protein. Preferably, the duration of the second culture period is about 3 weeks.
[00064] In another embodiment of the foregoing aspect, the retinal progenitors are differentiated into cells with a Miiller cell phenotype in step ii) by culturing the population of progenitor cells obtained from step i) for a time and under conditions sufficient for inducing Notch signalling sufficient to differentiate the population of cells into cells having a Miiller cell phenotype in accordance with the embodiments described above.
[00065] Cell culture medium
[00066] The present invention also provides a cell culture medium for directing the
differentiation of stem cells and retinal progenitor cells towards a Miiller cell phenotype.
Typically, a cell culture medium includes a source of carbon as energy substrate, such as glucose, galactose or sodium pyruvate; essential amino acids; vitamins, such as biotin, folic acid, B12; at least a purine and a pyrimidine as nucleic acid precursors; and inorganic salts.
[00067] Non-limiting examples of commercially available basic media that may be utilized in accordance with the invention comprise Neurobasal™ (Thermo Fisher Scientific), O-DMEM, DMEM, DMEM/F12, Cellgro™ Stem Cell Growth Medium (CellGenix), or X-Vivo™ (Lonza).
The basic medium may be supplemented with a variety of agents as known in the art dealing with cell cultures. The culture medium may also optionally include other supplements selected from the group including but not limited to antibiotics, antimycotics, growth factors, inhibitors, epigenetic modifiers, mRNA and miRNA. The following is a non-limiting reference to various supplements that may be included in the culture system to be used in accordance with the present disclosure: serum or with a serum replacement containing medium, such as, without being limited thereto, knock out serum replacement (KOSR), Nutridoma-CS, TCH™ (MPBIO) , N2, N2 derivative, or B27 or a combination; an extracellular matrix (ECM) component, such as, without being limited thereto, fibronectin, laminin and gelatin; an antibacterial agent, such as, without being limited thereto, penicillin and streptomycin; non-essential amino acids (NEAA); and neuortrophins which are known to play a role in promoting the survival of SCs in culture, such as, without being limited thereto, BDNF, NT3, NT4.
[00068] According to one embodiment, the invention provides a cell culture medium for producing cells with a Muller cell phenotype, comprising one or more agents which induce Notch signalling in a cell.
[00069] The medium preferably also comprises other growth factors, cytokines and other recombinant human proteins associated with neural differentiation including DKK1, Noggin and IGF-1.
[00070] According to one embodiment, the invention provides a cell culture medium for producing cells with a Muller cell phenotype, comprising one or more Notch ligands. In a preferred embodiment, the medium comprises at least two Notch ligands.
[00071 ] According to a preferred embodiment, the agents which induce Notch signalling are selected canonical ligands for the Notch receptor. More preferably, the Notch ligands are selected from the group consisting Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2. In another embodiment, the agents capable of inducing Notch signalling in a cell are selected from non-canonical ligands of Notch receptor. In one embodiment, one or more agents are selected from the group consisting of Notch intracellular domain (NICD), HES 1, HES5, DNA-binding protein RBPJ, and deltex.
[00072] In a preferred embodiment, the culture medium of the invention comprises DLL4 and JAG1.
[00073] Typical ly, the culture medium of the invention i s free of serum and free of serum extract.
[00074] In a preferred embodiment, the culture medium of the invention is free of animal - derived substances. In a preferred embodiment, the culture medium of the invention consists essentially of synthetic compounds, compounds of human origin and water. Advantageously, said culture medium can be used for culturing cells according to good manufacturing practices (under "GMP" conditions).
[00075] Kits
[00076] The present invention provides a kit for directing the differentiation of stem cells and retinal progenitor cells towards a Muller cell phenotype so as to produce a cell or population of cells having a Muller cell phenotype comprising one or more agents which induce Notch signalling in a cell. In addition to agents which induce Notch signalling, the kits of the present invention may further comprise one or more of the following: a culture medium (such as the cell culture medium described herein), at least one cell culture medium supplement, an agent for inhibiting or increasing expression of one or more gene products, and at least one agent for detecting expression of a marker of a Muller cell phenotype.
[00077] According to one embodiment, the invention provides a kit for producing cells with a Muller cell phenotype, comprising one or more Notch ligands. In a preferred embodiment, the medium comprises at least two Notch ligands.
[00078] According to a preferred embodiment, the agents which induce Notch signalling are selected canonical ligands for the Notch receptor. More preferably, the Notch ligands are selected from the group consisting Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2. In another embodiment, the agents capable of inducing Notch signalling in a cell are selected from non-canonical li gands of Notch receptor. In one embodiment, one or more agents are selected from the group consisting of Notch intracellular domain (NICD), HES l , HES5, DNA-binding protein BPJ, and deltex.
[00079] In a preferred embodiment, the kit of the invention comprises DLL4 and JAG1.
[00080] According to another embodiment the kit comprises a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HES1, HES5. The nucleic acid construct may be, for example, an expression vector, a plasmid vector, a viral vector, a phosmid, a cosmid, a recombinant virus or any other vector construct suitable for the insertion of foreign sequences, introduction into cells and subsequent expression of the introduced sequences.
[00081 ] In another embodiment, the kit comprises one or more viral vectors comprising one or more polynucleotides encoding one or more of activators of Notch signalling, including but not limited to full length Notch receptor, Notch intracellular domain (NICD), HES l , HES5.
According to a further embodiment, the vectors also contain sequences encoding one or more selectable markers such as a drug resistance marker (e.g. resistance to G418) and/or green fluorescent protein (GFP). In additional embodiments, the kit may comprise two vectors, one containing one or more polynucleotides encoding an activator of Notch signalling, including one or more of: full length Notch receptor, Notch intracellular domain (NICD), HES 1 , and HES5, and the other containing sequences encoding a selectable marker, e.g. drug resistance marker and/or GRP.
[00082] In another embodiment, the kit further comprises a cell selected from the group consisting of a stem cell, progenitor cell, a dedifferentiated cell, a neural precursor cell or a retinal progenitor cell.
[00083] Gene Expression Analysis
[00084] The methods and cells produced according to the methods of this invention are also of interest in identifying expression patterns of transcripts and newly synthesized proteins that are characteristic for Miiller cells and may assist in directing the differentiation pathway or facilitating interaction between cells. Expression patterns of the differentiated cells are obtained and compared with the cells from which they have been differentiated (e.g. retinal stem or progenitor cells) or control other control cells.
[00085] Suitable methods for comparing expression at the protein level include the
immunoassay or immunohistochemistry techniques described herein. Suitable methods for comparing expression at the level of transcription are well known to those of skill in the art and
can include methods of differential display of mRNA (Liang, Peng, et al, Cancer Res. 52:6966, 1 92), whole-scale sequencing of cDNA libraries, and matrix array expression systems.
[00086] Identifying expression products for use in characterizing and effecting Miiller differentiation of cells of this invention involves analysing the expression level of RNA, protein, or other gene product in a first cell type, such as a retinal stem or progenitor cell, or a cell capable of differentiating along the Miiller or glial pathway; then analysing the expression level of the same product in a control cell type; comparing the relative expression level between the two cell types, (typically normalized by total protein or RNA in the sample, or in comparison with another gene product expected to be expressed at a similar level in both cell types, such as a house-keeping gene); and then identifying products of interest based on the comparative expression level.
[00087] Alternatively, the effects of a gene product of interest may be identified by subjecting a cell to the differentiation method of the present invention wherein the expression of a gene product of interest in the cell has been modified. For example the expression of the gene product of interest may be inhibited or impaired (e.g. the gene product is non-functional or has impaired or reduced function) or increased or overexpressed or expression of a gene product of interest having enhanced function.
[00088] In another embodiment, the effects of a gene product of interest on Miiller cell function may be identified by modifying the expression of the gene product in a cell produced according to the methods of the invention produced according the present inventi on. For example, a cell with a Miiller cell phenotype produced according to the methods of the invention may be used as a model of retinal disease wherein the cell is modified such that the expression of a gene product of interest is inhibited, impaired or modified such as by knock-down, knock in, over- expression or gene editing to reduce, increase or modify the expression of a gene product of interest.
[00089] A cell subjected to the differentiation process of the invention may be obtained from a subject who has inhibited, impaired or increased expression of a gene product of interest (such as through a gene mutation) which is associated with a retinal disease or disorder. Alternatively, a cell subjected to the differentiation process of the present invention may be derived from a healthy subject not characterized as having a retinal disease or disorder, wherein expression of a
functional gene product of interest in the cell manipulated such that expression is impaired, inhibited or silenced, such as through the use of an inhibitory molecule (e.g. siRNA, miRNA etc.) or the introduction of a mutation, or the expression may be enhanced or increased. The effects of the expression of the gene product of interest on Miiller cell differentiation and function may then be identified via comparison to control cells.
[00090] The means for inhibiting, silencing (knock-down), introducing a mutation into (gene editing) or increasing (knock-in) or overexpressing a gene of interest will be known to the skilled addressee.
[00091 ] In one embodiment, the present invention provides a method for identifying an effect of a gene product on Miiller cell differentiation or function, comprising inducing Notch signalling in a cell and measuring differentiation and/or function, wherein the cell is a retinal stem or progenitor cell obtained or derived from a subject who has a retinal disease or disorder, wherein the retinal stem or progenitor cell displays one or more of the following: i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
[00092] In another embodiment, the present invention provides a method for identifying an effect of a gene product on Miiller cell differentiation, comprising inducing Notch signalling in a cell and measuring differentiation, wherein the cell is a retinal stem or progenitor cell obtained from a healthy subject, and wherein the cell has been modified to display one or more of the following: i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
[00093] One skilled in the art appreciates that the effects of a candidate gene product on Miiller cell differentiation performed according to the methods disclosed herein is typically compared to a corresponding control cell (e.g. a cell which does not display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function).
[00094] Drug Screening
[00095] The methods and cells produced according to the methods disclosed herein can be used to screen for agents (such as solvents, small molecule drugs, peptides, polynucleotides) or environmental conditions (such as culture conditions or manipulation) that affect Miiller cell differentiation, cell viability or function.
[00096] In some applications, a stem cell, progenitor cell, a dedifferentiated cell or retinal progenitor cell, is used to produce a cell or population of cells having a Miiller cell phenotype to screen candidate agents for their effect on Miiller cell function (e.g. therapeutic or protective). Screening may be done either because the agent is designed to have a therapeutic effect on Miiller cells, or because a compound designed to have effects elsewhere may have unintended side effects on the Miiller cells. For example, candidate agents are tested by adding them to one or more cells in different wells, and then determining any change in the expression of a gene product of interest and/or any phenotypic change that results, according to desirable criteria. The screening can be conducted using any cells produced according to the methods disclosed herein.
[00097] According to one aspect, the invention provides a method of identification of an agent useful for the prevention or treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina comprising: (a) contacting cells having a M iiller cell phenotype produced according to the methods described herein with an agent; and (b) detecting an increase or decrease in a parameter relative to a control, wherein the control is a cell or population of cells produced according to the methods described herein not contacted with the agent; wherein said increase or decrease in the parameter is indicative of a capacity to exert a therapeutic effect in the subject or the retina; and wherein an agent that effects said increase or decrease in the parameter is identified as being useful for the treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina.
[00098] In one embodiment, the phenotypic change or parameter is one or more of the following: i) expression of one or more of GFAP, GS, VIM EN TIN, CRALBP, SOX9, GLAST and Kir4.1 ; ii) extracellular concentration of a neuroactive substance including K+, glutamate, GABA and/or H+; or iii) expression of one or more cytokines.
[00099] In a preferred embodiment, screening of candidate agents is performed using one or more cells produced according to the methods disclosed herein wherein the cells are derived
from a retinal stem or progenitor cell obtained or derived from iPSCs generated from a subject who has a retinal disease or disorder.
[000100] In another embodiment, screening of candidate agents is performed using one or more cells produced according to the methods disclosed herein wherein the cells are derived from a retinal stem or progenitor cell obtained or derived from iPSCs generated from a healthy subject who does not have a retinal disease or disorder.
[000101 ] In another embodiment, screening of candidate agents is perfomied using one or more cells produced according to the methods disclosed herein, wherein the cells are derived from a retinal stem or progenitor cell obtained or derived from iPSCs generated from a healthy subject or a subject who has a retinal disease or disorder, wherein the retinal stem or progenitor cell is manipulated to display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
[000102] One skilled in the art appreciates that the effects of a candidate agent on a cell with a Miiller cell phenotype produced according to the methods disclosed herein is typically compared to a corresponding control cell in the absence of the candi date agent.
[000103] Candidate agents which may also be used in the discovery and development of a therapeutic compound for the treatment of a retinal disease or disorder include small molecules, peptides, peptide mimetics, polypeptides, and nucleic acid molecules. The encoded protein, upon expression, can be used as a target for the screening of drugs. Additionally, the DNA sequences encoding the amino terminal regions of the encoded protein or Shine-Delgarno or other translation facilitating sequences of the respecti ve mRNA can be used to construct sequences that promote the expression of the coding sequence of interest. Such sequences may be isolated by standard techniques. Small molecules of the invention preferably have a molecular weight below 2,000 daltons, more preferably between 300 and 1,000 daltons, and most preferably between 400 and 700 daltons. It is preferred that these small molecules are organic molecules.
[000104] In general, candidate agents are identified from large libraries of both natural product or synthetic (or semi -synthetic) extracts or chemical libraries or from polypeptide or nucleic acid libraries, according to methods known in the art. Those skilled in the field of drug discovery and
development will understand that the precise source of test extracts or agent is not critical to the screening procedure(s) of the invention. Agents used in screens may include known agents (for example, known therapeutics used for other diseases or disorders). Alternatively, virtually any number of unknown chemical extracts or agent can be screened using the methods described herein. Examples of such extracts or agents include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic agents, as well as modification of existing agents.
[000105] Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical agents, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based agent. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, N.H.) and Aldrich Chemical (Milwaukee, Wis.). Alternatively, a chemical agent to be used as candidate agent can be synthesized from readily available starting materials using standard synthetic techniques and methodologies known to those of ordinary skill in the art. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the agent identified by the methods described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH
Publishers (1989); T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.
[000106] Alternatively, libraries of natural agents in the fonn of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceanographic Institute (Ft. Pierce, Fla.), and PharmaMar, U.S.A. (Cambridge, Mass.). In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90:6909, 1993; Erb et al., Proc. Natl. Acad. Sci. USA 91 : 1 1422, 1994; Zuckermann et al., J. Med. Chem. 37:2678, 1994; Cho et al, Science 261 : 1303, 1993; Carrell et al, Angew. Chem. Int. Ed. Engl. 33:2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33:2061, 1994; and
Gallop et al., J. Med. Chem. 37: 1233, 1994. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.
[000107] Libraries of agents may be presented in solution (e.g., Houghten, Biotechniques 13:412-421. 1992), or on beads (Lam, Nature 354:82-84, 1991), chips (Fodor, Nature 364:555- 556, 1993), bacteria (Ladner, U.S. Patent No. 5,223,409), spores (Ladner U.S. Patent No.
5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci. USA 89: 1865- 1869, 1992) or on phage (Scott and Smith, Science 249:386-390, 1990; Devlin, Science 249:404-406, 1990; Cwirla et al., Proc. Natl. Acad. Sci. 87:6378- 6382, 1990; Felici, J. Mol. Biol. 222:301 -310, 1991 ; Ladner supra.).
[000108] In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological
dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their activity should be employed whenever possible.
[000109] When a crude extract of interest is i dentified, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract may be used for the prevention or treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina. Methods of fractionation and purification of such heterogeneous extracts are known in the art. If desired, agents shown to be useful as therapeutics for the prevention or treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina are chemically modi fied according to methods known in the art.
[0001 10] In another embodiment, a chemical entity discovered to have medicinal value using the methods described herein is useful as a drug or as information for structural modification of an existing agent, e.g., by rational drug design. For therapeutic uses, the compositions or agents identified using the methods disclosed herein may be administered systemically, for example, formulated in a pharmaceutically-acceptable carrier. Preferable routes of administration include, for example, topical, oral, subcutaneous, intravenous, intraperitoneally, intramuscular, or intradermal injections that provide continuous, sustained levels of the drug in the patient.
Treatment of human patients or other animals will be carried out using a therapeutically effective amount of a candidate agent in a physiologically-acceptable carri er. Suitable carriers and their formulation are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin. The amount of the therapeutic agent to be administered varies depending upon the manner of administration, the age and body weight of the patient, and the clinical symptoms. Generally, amounts will be in the range of those used for other agents used in the prevention or treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina in a subject, although in certain instances lower amounts may be needed because of the increased specificity of the compound. A compound is administered at a dosage that controls the clinical or physiological symptoms as determined by a diagnostic method known to one skilled in the art, or using any assay that measures the transcriptional activation of a gene associated with a retinal disease or disorder in a subject or regeneration or repair of the in a subject.
[0001 1 1 ] Pharmaceutical Compositions and Therapeutic Methods
[0001 12] The present invention also provides a pharmaceutical composition comprising a cell with a Miiller cell phenotype produced according to the methods disclosed herein or a population of cells according to the invention or a population comprising a combination of a cells with a Miiller cell phenotype of the invention and the precursor from which the Miiller cell may be derived, such as a retinal progenitor. The pharmaceutical composition may generally include one or more pharmaceutically acceptable and/or approved carriers, additives, antibiotics, preservatives, adjuvants, diluents and/or stabilizers. Such auxiliary substances can be water, saline, glycerol, ethanol, wetting or emulsifying agents, pH buffering substances, or the like. Suitable carriers are typically large, slowly metabolized molecules such as proteins,
polysaccharides, polylactic acids, polyglycollic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, or the like. This pharmaceutical composition can contain additional additives such as mannitol, dextran, sugar, glycine, lactose or polyvinylpyrrolidone or other additives such as antioxidants or inert gas, stabilizers or recombinant proteins (e. g. human serum albumin) suitable for in vivo administration.
[0001 13] As used herein, the term "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable
carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
[0001 14] Another aspect of the invention rel ates to a population of cells with a Miiller cel l phenotype of the invention as described herein, for use in treating a retinal disease or disorder or an injury to, or degeneration of, the retina. The invention also relates to a method for treating a retinal disease or disorder or an injury to the retina comprising the step of administering a pharmaceutically effective amount of a population of cells with a Miiller cell phenotype as described above optionally together with of a population of retinal progenitor cells to a subject in need thereof.
[0001 15] Thus, in accordance with a further aspect of the present invention there is provided a method of transplanting cells with a Miiller cell phenotype into a subject's eye, the method comprises (i) providing a cell culture comprising retinal progenitor cells; (ii) culturing cells for a time and under conditions sufficient for inducing Notch signalling whereby the cells are promoted to differentiate into cells having a Miiller cell phenotype; (iii) harvesting cells having a Miiller cell phenotype from said cell culture; and (iv) transplanting said differentiated cells into said subject's eye.
[0001 16] Harvesting of the cells may be performed by various methods known in the art. Non- limiting examples include mechanical dissection and dissociation with enzymatic agents. Other methods known in the art are also applicable.
[0001 17] The cells produced according to the present invention, optionally together with of a population of retinal progenitor cells, or the phannaceutical compositions of the invention comprising the cells produced according to the methods described herein, optionally including retinal progenitor cells, or optionally together with retinal progenitor cells, may be administered to various target sites within a subject's eye according to methods familiar to those skilled in the art. Modes of administration may include subretinal or intravitreal injection.
[0001 18] For example, the sclera, posterior to the limbus in the eye, may be punctured with a 35 gauge needle, and the cells injected either subretinally or into the vitreous cavity with a
Hamilton syringe.
[0001 19] The cells produced according to the methods described herein may be transplanted in various forms. For example, the cells may be introduced into the target site in the form of cell suspension, or adhered onto a matrix, extracellular matrix or substrate such as a biodegradable polymer or a combination or within a semipermeable compartment. The cells may also be transplanted together (co-transplantation) with other retinal cells, such as with retinal pigment epithelia cells or photoreceptors. Thus, the invention also pertains to a composition comprising stem/progenitor cell-derived cells with a Muller cell phenotype obtained by the methods of the invention.
[000120] Various eye conditions may be treated or prevented by the introduction of the cells with a Muller cell phenotype obtained by the method of the invention to a subject's eye. The eye conditions may include retinal diseases or disorders generally associated with retinal dysfunction, retinal injury, and/or dysfunction, injury and/or loss Miiller cells. A non-limiting list of conditions which may be treated in accordance with the invention comprises: Diabetic retinopathy, Macular Telangiectasia Type 2, and Age-related macular degeneration, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma and retinopathy of prematurity.
[000121 ] In the context of the invention, the term "treating" or "treatment" , as used herein, refers to a method that is aimed at delaying or preventing the onset of a pathology, at reversing, alleviating, inhibiting, slowing down or stopping the progression, aggravation or deterioration of the symptoms of the pathology, at bringing about ameliorations of the symptom s of the pathology, and/or at curing the pathology. By way of example only treatment may include prevention of further deterioration in visual acuity and the degree of retinal disease, restoration of normal retinal structure or improvement in visual acuity.
[000122] As used herein, the term "pharmaceutically effective amount" refers to any amount of cells according to the invention (or a population thereof or a pharmaceutical composition thereof) that is sufficient to achieve the intended purpose. Effective dosages and administration regimens can be readily determined by good medical practice based on the nature of the pathology of the subject, and will depend on a number of factors including, but not limited to, the extent of the symptoms of the pathology and extent of damage or degeneration of the tissue or organ of interest, and characteristics of the subject (e.g., age, body weight, gender, general health, and the like).
[000123] For therapy, cells with a Miiller cell phenotype produced according to the method described herein and combinations of cells produced according to the invention and retinal progenitors, and pharmaceutical compositions according to the invention may be administered via any appropriate route. The dose and the number of administrations can be optimized by those skilled in the art in a known manner.
[000124] For example, dosage amounts can vary from about 100; 500; 1,000; 2,500; 5,000; 10, 000; 20,000; 50,000; 100,000; 500,000; 1 ,000,000; 5,000,000 to 10,000,000 cells or more (or any integral value therebetween); with a frequency of administration of, e.g., once per day, twice per week, once per week, twice per month, once per month, depending upon, e.g., body weight, route of administration, severity of disease, etc. In one embodiment, the preferred dose is 50 microliters (2,500,000 cells)/eye.
[000125] The cells described herein can be suspended in a physiologically compatible carrier for transplantation. As used herein, the term "physiologically compatible carrier" refers to a carrier that is compatible with the other ingredients of the formulation and not deleteri ous to the recipient thereof. Those of skill in the art are familiar with physiologically compatible carriers. Examples of suitable carriers include cell culture medium (e.g., Eagle's minimal essential medium), phosphate buffered saline, Hank's balanced salt solution+/-glucose (HBSS), and multiple electrolyte solutions such as Plasma-Lyte™ A (Baxter).
[000126] These and other aspects of the invention are illustrated by the following non-limiting examples. It should be appreciated that in some aspects one or more embodiments described in the examples may be generally applicable in combination with one or more embodiments described above.
Examples
Example 1. Retinal progenitor differentiation and Miiller cell differentiation method
[000127] Methods
[000128] H9 human ESCs were firstly differentiated into retinal progenitors using a published method with minor modifications. Briefly, embryoid bodies were generated from
undifferentiated H9 ESC colonies by culturing them in a neural induction medium ( M;
DMEM/F12, 10% knockout serum replacement, and B27 supplement) containing recombinant human proteins including DKKl (lng/ml, Wnt signalling pathway inhibitor), Noggin (lng/ml, bone morphogenic pathway antagonist) and IGF-1 (5ng/ml) for 3 days. On the 4th day, embryoid bodies were plated onto matrigel-coated 6 well plates. They were cultured in the same medium with N 2 supplement and increased concentration of the recombinant proteins (lOng/ml of each protein) for another 3 weeks. The medium was changed every 2-3 days and the differentiation were validated by qRT-PCR with a panel of eye field primers for PAX6
(forward; AACGATAACATACCAAGCGTGT (SEQ ID No. 1 ), reverse;
GGTCTGCCCGTTCAACATC (SEQ ID No. 2)), CHX10 (forward;
GGCGACACAGGACAATCTTTA (SEQ ID No. 3), reverse; TTCCGGCAGCTCCGTTTTC (SEQ ID No. 4)), RAX (forward; AGCGAAACTGTCAGAGGAGGAACA (SEQ ID No. 5), reverse; TCATGCAGCTGGTACGTGGTGAAA (SEQ ID No. 6)) and LHX2 (forward;
CAAGATCTCGGACCGCTACT (SEQ ID No. 7), reverse; CCGTGGTCAGCATCTTGTTA (SEQ ID No. 8)). The PCR cycling was denaturing at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds (40 cycles).
[000129] Induction of Notch signalling was performed by treating the retinal progenitors with recombinant Notch ligands, Delta serrate lag2 peptides. The combination of Notch ligands DLL4 and Jagged-1 (R&D systems, 50ng/ml) was added freshly to NIM when changing the media. The culture was maintained in the media for 6 weeks, and characterization of Muller cell differentiation was performed every 2 weeks with qRT-PCR and immunocytochemistry using a panel of Muller cell Markers including GFAP (forward primer; CTGCGGCTCGATCAACTCA (SEQ ID No. 9), reverse primer; TCCAGCGACTCAATCTTCCTC (SEQ ID No. 10), antibody; Dako Z0334), GS (forward primer; AAGAGTTGCCTGAGTGGAATTTC (SEQ ID No. 1 1), reverse primer; AGCTTGTTAGGGTCCTTACGG (SEQ ID No. 12), antibody; chemicon MAB302), VIMENTIN (forward primer; TGCCGTTGAAGCTGCTAACTA (SEQ ID No. 13), reverse primer; CCAGAGGGAGTGAATCCAGATTA (SEQ ID No. 14), antibody; santa cruz cs-7557 ), CRALBP (forward primer; TGCAGGCATATTGCTTCATCC (SEQ ID No. 15), reverse primer; GCTTGACCACATTGTAGGTCG (SEQ ID No. 16), antibody; abeam abl5015).
[000130] Results are expressed as mean ± SEM. Data were analysed using Student t-test. A p value <0.05 was regarded as statistically significant.
[000131 ] For analysis using fluorescence-activated cell sorting (FACS) hESC-derived retinal progenitor cells (generated as described herein) as described previously. The cells were treated with Notch ligand, DLL4 and Jagged- 1 (50ng/ml) for 4 to 6 weeks.
[000132] Cells were then collected with Accuatse (Sigma, A6964) for single cell suspension, washed with PBS 2 times, and labelled with Fixable Viability Dye eFluor 780 (eBioscience, 65- 0865) for 30 mins at 4 degrees. Cells were then washed 2 times with flow staining buffer, and fixed with 1C fixation buffer (eBioscience, 822249) at room temperature for 20 mins.
Subsequently, cells were washed 2 times with xl permeabilization buffer (eBioscience, 833356), blocked with 2% normal donkey serum for 15 mins at room temperature. Without washing, cells were labelled with GFAP antibody (1 :500, Dako, Z0334) for 1 hours at room temperature then washed 2 times with xl permeabilization buffer, and labelled with secondary antibody AF488 (1: 1000, Invitrogen, A21206) for 40 mins. Cells were then washed 2 times with flow staining buffer.
[000133] FACS was performed with LX Fortessa X-20 (BD), and data was analysed with FloJo software.
[000134] Results
[000135] Retinal Progenitor Differentiation from H9 ESCs:
[000136] Retinal progenitor differentiation was confirmed using qRT-PCR.
[000137] Eye Field/Retinal progenitor markers (Pax6, ChxlO, Rax and LhxlO) transcripts were significantly upregulated, whereas pluripotency markers, OCT4 and Nanog were downregulated after treating H9 ESCs with DK 1, Noggin and IGFl for 3 weeks (Figures 1 - 3, Figure 6).
[000138] Activation of the Notch Signalling Pathway in Retinal Progenitors using Notch ligands:
[000139] Retinal progenitors were treated with Notch ligands DLL4 and Jagged- 1 at 50ng/ml. Nine days after treatment, Notch downstream effector genes, Hesl and Hes5, were significantly upregulated compared with untreated retinal progenitors (p<0.05, n=3-4). However, glial cell markers remained unchanged (p<0.05, n=3-4) (Figure 7).
[000140] qRT-PCR analysis of retinal progenitors 4 weeks after Notch ligand treatment also demonstrated an increase in Notch 1 and Hes5 (p<0.05, n=3-4)(Figure 1 1).
[000141 ] Glial Phenotype Confirmation with qRT-PCR, Immunocytochemistry and Western Blot up to 6 Weeks After Notch Ligand Treatment in Retinal Progenitors:
[000142] Retinal progenitors were treated with Notch ligands, DLL4 and Jagged- 1 at 50ng/ml for 4 and 6 weeks. qPCR analysis found that all the Miiller cell markers were upregulated.
Interestingly, GF AP exhibited the most marked increase of all when compared with untreated retinal progenitors (p<0.05, n=3-4)(Figure 8).
[000143] As described herein, Miiller cells can express GFAP and a number of other markers including, glutamine synthetase (GS), cellular retinaldehyde binding protein (CRALBP), vimentin, and Sox9. These other markers can be expressed by other types of cells (e.g. retinal pigmented epithelial cells express GS and CRALBP, and retinal progenitor cells express SOX9). Another type of retinal glial cell, astrocytes, also expresses GFAP. However, astrocytes differentiate from glial progenitor cells in the central nervous system (e.g. Brain), and migrate to retina through the optic nerve, whereas Miiller cells are differentiated from retinal progenitor cells (Watanabe and Raff, 1988. "Retinal Astrocytes Are Immigrants From The Optic Nerve", Nature, 332, 834-837; Belecky-Adams et al., 2013, "Reactive Miiller Glila As Potential Retinal Progenitors", Intech Neural Stem cells - New Perspectives, 73-1 16).
[000144] As demonstrated herein, the GFAP positive cells are derived from retinal progenitor cells differentiated from hESCs, and are thus retinal Miiller glial cells. The results also suggest that GFAP represents the most specific Miiller cell marker for cells are differentiated from retinal progenitor cells and cultured in a heterogeneous population.
[000145] Immunocytochemistry, western blot and fluorescence-activated cell sorting (FACS) analyses was perfonned to confirm protein expression of Miiller cell markers up to 6 weeks after Notch ligand treatment.
[000146] Analyses from immunocytochemical assays revealed that cells were positively labelled with GFAP, CRALBP, GS and Vimentin (Figures 9 and 10).
[000147] The western blot analysis revealed that the amount of total protein of respective Muller cell markers was significantly higher in the cells treated with Notch ligands compared with untreated retinal progenitors (p<0.05, n=3-4) (Figure 12).
[000148] FACS analysis revealed an increased number of cells positively labelled for the most distinctive Muller cell marker in retinal progenitor-derived cells, GFAP, following treatment of hESCs-derived retinal progenitor cells (RPCs) with Notch ligand DLL4 and Jagged- 1 (50ng/ml) after 4 weeks and 6 weeks (Figure 13 A and B, respectively).
[000149] This study showed that the promotion of Notch signalling pathway in human retinal progenitors induces increased expression of Muller cell markers including GFAP, GS, CRALBP and Vimentin.
[000150] Activation of the Notch Si gnalling Pathway in Retinal Progenitors using viral vectors:
[000151 ] Notch activation may also be achieved by transduction of cells using viral vectors expressing Notch related genes to produce cells with a Muller cell phenotype.
[000152] In these methods, any polynucleotide (e.g., vector) encoding an agent which activates Notch signalling in a cell, including the Notch intracellular domain or a target of Notch (e.g. HES 1 or HES5), can be used, and any method for the selection and enrichment of transfected cells can be used. For example, in certain embodiments, retinal progenitors are transfected with a vector containing sequences encoding a Notch intracellular domain or a target of Notch and also containing sequences encoding a drug resistance marker (e.g. resistance to G418) and/or green fluorescent protein (GFP). In additional embodiments, two vectors, one containing sequences encoding a Notch intracellular domain and the other containing sequences encoding a drug resistance marker and/or GFP, are used for transduction of retinal progenitors. In these embodiments, selection is achieved, after transduction of a cell culture with the vector or vectors, by adding a selective agent (e.g., G418) to the cell culture in an amount sufficient to kill cells that do not comprise the vector but not kill cells that do. Absence of selection entails removal of said selective agent or reduction of its concentration to a level that does not kill cells that do not comprise the vector. Following selection (e.g., for seven days) the selective agent is removed and the cells may be further cultured (e.g., for two passages). Alternatively, cells expressing GFP may be isolated using known fluorescence based cell-sorting methods.
[000153] Promoting Miiller cell phenotype by misexpression of notch related genes.
[000154] Once retinal progenitor differentiation is confirmed, the cells will be infected with lentiviral vectors expressing Notch related genes. The vectors (e.g. lentiviral) will carry either the intracellular domain of notch (NICD), Notch target gene HES l or HES5 together with green fluorescence protein (GFP) under a promoter (e.g. CMV). A vector carrying the GFP gene may be used as a control for comparison. Titration of the viral vectors and their transduction efficiencies will be determined in vitro with flow cytometry analysis. The transduction efficiency is expected to be approximately 50-70% and the gene expression is known to persist for more than a month. Viral vector transduction will be performed in retinal progenitors for 3 days and then the medium will be replaced the standard NIM until in vitro characterisation as described above.
[000155] After viral vector transduction in retinal progenitors, the cells will be collected, and Miiller cell phenotype validations with qRT-PCR and immunocytochemistry will be performed as described above.
Example 2. Transcriptomic profiling to understand the mechanism of disease in Miiller cells-derived from MacTel2-hiPSCs
[000156] Since Miiller cells are mostly absent or unhealthy in retinas affected by MacTel2, the Miiller cell differentiation protocols described herein are useful for modelling other retinal diseases associated with Miil ler cell dysfunction and will assist in potential identification of causal genes for MacTel2.
[000157] Purified patient-derived cells with Miiller cell phenotype obtained using the methods described herein will be compared with controls using high throughput RNA-seq transcriptomic analysis. This approach has the advantage over studies of blood markers since it uses retinal -specific cells.
[000158] Using nucleofection technology (Lonza), cells obtained from dermal fibroblasts from skin biopsies of MacTel2 patients were transfected with episomal vectors containing OCT4, SOX2, KLF4, L-MYC, LIN28, shRNA against p53 and eGFP into the fibroblasts. One month after reprogramming, multiple MacTel2-iPSC clones were picked, expanded and collected for characterization (Figure 15, A). Immnunocytochemisty and fluorescence-activated cell sorting
(FACS) were used to validate pluripotency of the MacTel2-hiPSCs (Figure 15, B-D). All clones from MacTel2-hiPSCs expressed stem cell markers including OCT4 and TRA-1 -60. The clones were also capable of differentiating into three genn layers (endoderm, mesoderm and ectoderm), a key characteristic of pluripotent stem cells. Karyotype analyses were conducted to ensure the genomic stability of the derived hiPSCs. Control hiPSCs are gender and sex matched to MacTel2 patients.
[000159] Cells produced according to the methods described herein will then be derived from both MacTel2-iPSCs and control iPSCs.
[000160] Once cells with a Miiller cell phenotype are differentiated from their precursors, they will be washed, permeablised and labelled with GFAP antibody followed by a secondary antibody AlexFluor 488. The GFAP+ cells will be sorted by FACSAria (BD bioscience) using FACSDiva software. GFAP+ gating will be set with reference to negative controls (both IgG control and non-stained cells) and the sorting speed will be adjusted to ensure sorting efficiency above 90%. GFAP+ cells will be collected and RNA will be extracted, such as with a micro RNAeasy kit (Qiagen), and RNA quality and quantity will be assessed with a bioanalyser (Agilent).
[000161 ] RNA-seq is a high throughput cDNA sequencing technique that maps and quantifies transcriptomes including mRNA, non-coding RNAs and small RNAs. Total RNA extracted from the differentiated and sorted Miiller cells will be used for the cDNA library preparation and sequencing which will be performed by Illumina NextSeq500. The generated raw data will be analysed with Tophat2 or STAR mapping tools and Bioconductor packages including edgeR and DESeq2. Hierarchical clustering and differential gene expression analysis will be undertaken. Genes with false discovery rate p<0.01 and a two-fold change between samples and controls will be chosen for further study. Functional enrichment and pathway analysis will be performed with gene ontology and KEGG pathway analysis to gi ve a biological mean to the identified transcriptomes. The top candidate differentially expressed genes will be validated by qRT-PCR.
Example 3. Transplantation Study - Misexpression of Notch related genes in Retinal progenitors
[000162] Cells produced according to the methods described herein may be transplanted into the eyes of Mice with a retinal disease or disorder or with Miiller cell dysfunction or deficiency. Cells will be collected by FACS (fluorescence activated cell sorting system with either GFP or combination of Miiller cell markers) on the day of the transplantation according to established methods (Lamba, D., et al, 2008, Cell Stem Cell) and resuspended in balanced salt solution (BSS). Cells produced according to the methods of the invention may be transduced with a viral vector (e.g. AAV or lentiviral vector) possessing either intracellular domain of notch (NICD), Hesl or Hes5 together with green fluorescence protein (GFP) under CMV promoter. Cells prepared in this manner may be sorted according to known cell sorting methods on the basis of GFP expression which will indicate expression of a Notch gene for activation of the Notch signalling pathway.
[000163] The cells transduced with viruses will be grafted into the subretinal space of MacTel2 mouse retinae 1 week after Miiller cell ablation (50,000 cells/ul). The sclera, posterior to the limbus in the eye, will be punctured with a 35 gauge needle, and the cells will be injected subretinally with a Hamilton syringe (50,000 cells/ Ιμΐ/eye. Control groups are a) non- transplanted retinas b) cells transduced with AAV-Empty-GFP, c) human fibroblasts (unrelated cells, negative controls) and d) sham surgery with vehicle only (e.g. BSS injection). Mice will receive Cyclosporine A (l Omg/kg/day) to suppress the potential immune response to the transplanted human cells.
[000164] Retinas will be collected at 1, 2, 4 and 6 weeks after transplantation. Retina samples will be fixed with 4% paraformaldehyde for lhr and then embedded in optimal cutting temperature for frozen sectioning or flatmounted for immunofluorescence staining to study the migration and integration of the grafted cells. The cells will be identified by co-labelling of human nuclear antigen antibody (millipore, MAB 1281 ) and Miiller cell markers CRALBP, GS and GFAP, and with TUNEL to evaluate cell viability after transplantation.
[000165] In order to determine whether Miiller cell replacement can prevent photoreceptor degeneration caused by induced Miiller cell ablation, we will label flatmounted retinas with peanut agglutinin (PNA) to study changes in cone photoreceptor apical processes. Image analysis software will be used to quantitatively analyse the data obtained according to known methods.
[000166] Assessment of retinal function after transplantation may be performed via methods known to the skilled addressee including murine optical coherence tomography (OCT) and electroretinography (ERG). Full field ERG will measure the response of rod and cone
photoreceptors by measuring neural responses to light stimuli in photopic (light) and scotopic (dark) conditions. The responses will be interpreted from the signal's amplitude and implicit time with the a-wave derived from photoreceptors and the b-wave from the inner retina. Mice will be kept in the dark overnight before scotopic ERG. Subsequently, light stimuli of varying intensities will be given to the animal, and responses will be recorded as the oscillation and amplitude of each wave. ERG will also be performed in photopic conditions to evaluate cone photoreceptor function. Following OCT and ERG assessment, the Mice may be humanely euthanized and histological and immunohi stochemical analyses of the eyes may be perfonned according to methods well known to the skilled addressee.
Example 4. Human Transplant study
[000167] Cells produced according to the methods described herein may be transplanted into the eyes of a subject in need thereof in accordance with the methods described below.
[000168] Patient-derived cells may be reprogramed into induced Pluripotent Stem Cells (iPSCs) according to known methods including those described above. Patient derived cells may include dermal fibroblasts from skin biopsies, peripheral blood derived mononuclear cells (e.g.
monocytes), cells derived from adipose tissue, hair follicle-derived keratinocytes and renal epithelial cells in urine. iPSCs may be generated through known methods including plastnid transduction to introduce reprogramming factors. These factors may include OCT4, SOX2, KLF4 and c-MYC, LIN28 and shRNA for p53. Patient derived cells may be transfected with non-integrating episomal plasmids containing 6 reprogramming factors including L-myc, KLF4, OCT4, SOX2. For example, 4 DNA vectors; pCXLE-eGFP, pCXLE-hOCT4-shP53, pCXLE- hSOX2- lf4, and pCXLE-Lmyc-lin28 (addgene) may be employed to reprogram patient cells.
[000169] Once patient derived iPSCs have been obtained, retinal progenitors cells may be obtained according to the methods described above in Example 1. Induction of Notch signalling in the patient-derived retinal progenitor cells can then be performed according to the methods described above. For example patient-derived retinal progenitors may be contacted with one or more Notch ligands at a concentration and for a time sufficient to induce Notch signalling. Induction of Notch may also be effected by transduction of viral vectors designed to express
Notch intracellular domain, or targets of Notch (including HES l and HES5). Induction of Notch signalling may be effected by a combination of exposure to Notch ligands and viral vectors directing expression of Notch intracellular domain or targets of Notch .
[000170] Cells may then be sorted and collected according to known methods and resuspended in a physiologically compatible carrier for transplantation at a desired concentration (e.g. 50 microliters (2,500,000 cells/eye). Cells may then be injected either subretinally or into the vitreous cavity.
[000171 ] Patients may be monitored periodically after the intervention by assessment of visual acuity and biomicroscopic clinical examination together with retinal imaging including optical coherence tomography, fundus fluorescein angiography, autofluorescence and other retinal imaging techniques. Optical Coherence Tomography (OCT), Microperimetry and Adaptive Optics will be used. Therapeutically effective treatment may be marked by one or more of prevention of further deterioration in visual acuity and the degree of retinal disease, restoration of normal retinal structure and improvement in visual acuity.
Claims
1. A method for producing cells having a Miiller cell phenotype from a population of retinal progenitor cells, the method comprising culturing the population of cells for a time and under conditions sufficient for inducing Notch signalling in said population of cells to thereby differentiate the population of cells into the cells having a Miiller cell phenotype.
2. The method according to claim 1 , wherein inducing Notch signalling is effected by contacting the cells with one or more of: a Notch ligand, Notch intracellular domain (NICD), HES 1 , HES5, DNA-binding protein RBPJ, or deltex.
3. The method according to claim 1 or 2, wherein inducing Notch signalling is effected by culturing the cells with a medium supplemented with at least two Notch ligands
4. The method according to claim 2 or 3, wherein the Notch ligand is selected from the group consisting of Delta like ligand (DLL)-l, Delta like ligand-3, Delta like ligand-4, Jagged (JAG)-l and Jagged-2.
5. The method according to claim 3 or 4, wherein the Notch ligands are DLL4 and JAG1.
6. The method according to claim 5, wherein the population of cells are cultured with a medium comprising about 5ng/ml to about 100 ng/ml DLL4 and about 5ng/ml to about 100 ng/ml JAG1.
7. The method according to claim 6, wherein the population of cells are cultured with a medium comprising about 50 ng/ml DLL4 and about 50 ng/ml JAG1.
8. The method according to any one of the preceding claims, wherein inducing Notch signalling is effected by transfecting one or more cells of the population of retinal progenitor cells with a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling.
9. The method according to claim 8, wherein said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (NICD), HES l , HES5, DNA-binding protein RBPJ, and deltex.
10. The method according to claim 8 or 9, wherein said nucleic acid construct is a viral vector.
1 1. The method according to any one of claims 8 to 10, wherein said polynucleotide or polynucleotides encode/s one or more of NICD, HES l and/or HES5.
12. The method according to any one of the preceding claims, wherein said culturing the population of cells is effected for from about 1 week to about 6 weeks.
13. The method according to any one of the preceding claims, wherein said culturing the population of cells is effected for about 6 weeks
14. The method according to any one of claims 1 to 12, wherein said culturing the population of cells is effected for about 4 weeks.
15. The method according to any one of claims 1 to 12, wherein said culturing the population of cells is effected for about 2 weeks.
16. The method according to any one of claims 1 to 12, wherein said culturing the population of cells is effected for about 1 week.
17. The method according to any one of the preceding claims, wherein the population of retinal progenitor cells are derived from a human.
18. The method according to any one of the preceding claims, wherein the population of retinal progenitor cells is derived from a cell or population of cells selected from the group consisting of stem cells, progenitor cells and de-differentiated cells.
19. The method according to claim 18, wherein the stem cell is an Embryonic Stem Cell (ESC) or an induced Pluripotent stem cell (iPSC).
20. A method for producing cells having a Miiller cell phenotype from a population of stem cells, the method comprising: i) differentiating a population of stem cells to produce a population of cells having a retinal progenitor cell phenotype and ii) culturing the population of cells having a retinal progenitor phenotype produced by step i) for a time and under conditions sufficient for inducing Notch signalling in the population of cells having a retinal progenitor phenotype and thereby differentiate them into cells having a Miiller cell phenotype.
21. The method according to claim 20, wherein differentiating the population of cells in step i) is effected by culturing said population of stem cells in a neural differentiation medium.
22. The method according to claim 21 , wherein the neural differentiation medium comprises DKK-1, IGF-1 and Noggin.
23. The method according to any one of claims 20 to 22, wherein inducing Notch signalling is effected by contacting the population of cells having a retinal progenitor phenotype with one or more of: a Notch ligand, Notch intracellular domain (NICD), HES 1, HES5, DNA-binding protein RBPJ, and/or deltex.
24. The method according to claim 23, wherein inducing Notch signalling is effected by contacting the cells having a retinal progenitor phenotype with at least two Notch ligands.
25. The method according to claim 23 or 24, wherein the Notch ligand is selected from the group consisting of Delta like ligand- 1 , Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2.
26. The method according to claim 24 or 25, wherein the Notch ligands are DLL4 and JAGl .
27. The method according to claim 26, wherein the population of cells having a retinal progenitor phenotype are cultured in a medium comprising about 5ng/ml to about 100 ng/ml DLL4 and about 5ng/ml to about 100 ng/ml JAG l .
28. The method according to claim 27, wherein the population of cells having a retinal progenitor phenotype are cultured in a medium comprising about 50 ng/ml DLL4 and about 50 ng/ml JAGl .
29. The method according to any one of the claims 20 to 28, wherein inducing Notch signalling is effected by transfecting one or more cells of the population of cells having a retinal progenitor phenotype with a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling.
30. The method according to claim 29, wherein said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (NICD), HES 1, HES5, DNA-binding protein BPJ, and deltex.
31. The method according to claim 29 or 30, wherein said nucleic acid construct is a viral vector.
32. The method according to any one of claims 29 to 31 , wherein said polynucleotide or polynucleotides encode/s one or more of NICD, HES 1 and/or HES5.
33. The method according to any one of claims 20 to 32, wherein said differentiating in step i) is effected for about 3 to 4 weeks.
34. The method according to any one of claims 20 to 33, wherein said culturing the population of cells in step ii) is effected for from about lweek to about 6 weeks.
35. The method according to any one of claims 20 to 33, wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 6 weeks.
36. The method according to any one of claims 20 to 33, wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 4 weeks.
37. The method according to any one of claims 20 to 33, wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 2 weeks.
38. The method according to any one of claims 20 to 33, wherein said culturing the population of cells having a retinal progenitor phenotype in step ii) is effected for about 1 week.
39. The method according to any one of claims 20 to 38, wherein the population of stem cells is derived from a human.
40. The method according to any one of claims 20 to 39, wherein the population of stem cells is a population of ESCs or iPSCs.
41. The method according to claim 40, wherein the population of iPSCs is derived from a subject having a retinal disease or disorder.
42. The method according to claim 41, wherein the population of iPSCs is derived from a subject having macular degeneration, diabetic retinopathy or Macular Telangiectasia Type 2, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma or retinopathy of prematurity.
43. The method according to any one of the preceding claims, further comprising the step of isolating cells with a Muller cell phenotype.
44. The method according to any one of the preceding claims, wherein the cells with a Muller cell phenotype express one or more markers selected from the group consisting of GFAP, GS, VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1.
45. The method according to any one of the preceding claims, wherein the cells with a Muller cell phenotype express GFAP.
46. The method according to any one of the preceding claims, wherein the cells with a Muller cell phenotype express GFAP, GS and VIMENTIN.
47. The method according to any one of the preceding claims, wherein the cells with a Muller cell phenotype express GFAP, GS, VIMENTIN, and CRALBP.
48. Cells having a Muller cell phenotype produced according to the method of any one of claims 1 to 47.
49. Use of the cells having a Muller cell phenotype according to claim 48 in the manufacture of a medicament for the prevention or treatment of a retinal disease or disorder in a subject.
50. The use according to claim 49, wherein said retinal disease or disorder is associated with or arises at least in part from dysfunction, injury and/or loss of Muller cells in the subject.
51. Use of the cells having a Muller cell phenotype according to claim 48 in the manufacture of a medicament for the regeneration or repair of the retina in a subject in need thereof.
52. Use of the cells having a Muller cell phenotype according to claim 48 in a method of screening or identification of a pharmaceutical agent or an agent useful for the prevention or treatment of a retinal disease or disorder in a subject.
53. A pharmaceutical composition comprising the cells having a Muller cell phenotype according to claim 48.
54. A kit for producing cells having a Muller cell phenotype, comprising one or more agents capable of inducing Notch signalling in a population of cells.
55. The kit according to claim 54, wherein said one or more agents comprises a Notch ligand, Notch intracellular domain (NICD), HESl, HES5, DNA-binding protein RBPJ, and deltex.
56. The kit according to claim 54, wherein said one or more agents comprises at least two Notch ligands.
57. The kit according to claim 55 or 56, wherein the Notch ligand is selected from the group consisting of Delta like ligand-1, Delta like ligand-3, Delta like ligand-4, Jagged- 1 and Jagged-2.
58. The kit according to claim 56 or 57, wherein the Notch ligands are DLL4 and JAG 1.
59. The kit according to any one of claims 54 to 58, comprising a nucleic acid construct encoding one or more polynucleotides encoding one or more of activators of Notch signalling.
60. The kit according to claim 59, wherein said one or more polynucleotides is selected from the group consisting of full length Notch receptor, Notch intracellular domain (NICD), HES 1 , HES 5, DNA-binding protein RBPJ, and deltex.
61. The kit according to claim 59 or 60, wherein said nucleic acid construct is a viral vector.
62. The kit according to any one of claims 59 to 61 , wherein said polynucleotide or
polynucleotides encode/s one or more of NICD, HES l and/or HES5.
63. The kit according to any one of claims 54 to 62, further comprising a cell selected from the group consisting of a stem cell, progenitor cell, a dedifferentiated cell, or retinal progenitor cell.
64. The kit according to any one of claims 54 to 63, further comprising an agent for detecting expression of one or more markers indicative of the Miiller cell phenotype.
65. The kit according to any one of claims 54 to 64, further comprising a cell culture medium.
66. The kit according to claim 65, wherein culture medium comprises a base medium of DMEM/F12 and B27 and N2 supplements, penicillin and streptomycin.
67. The kit according to any one of claims 54 to 66, further comprising one or more of DKK-1 , IGF-1 and Noggin.
68. A medium for producing cells having a Miiller cell phenotype wherein the medium comprises one or more of: a Notch ligand, Notch intracellular domain (NICD), HESl, HES5, DNA-binding protein RBPJ, and/or deltex.
69. The medium according to claim 68, wherein the medium comprises at least two Notch ligands.
70. The medium according to claim 68 or 69, wherein the Notch ligand is selected from the group consisting of Delta like ligand-1 , Delta like ligand-3, Delta like ligand-4, Jagged-1 and Jagged-2.
71 . The medium according to claim 69 or 70, wherein the Notch ligands are DLL4 and JAG1.
72. The medium according to claim 71, comprising about 5ng/ml to about 100 ng/ml DLL4 and about 5ng/ml to about 100 ng/ml JAG1.
73. The medium according to claim 72, comprising about 50 ng/ml DLL4 and about 50 ng/ml JAG 1.
74. The medium according to any one of claims 68 to 73, further comprising one or more of DKK-1, lGF-1 and/or Noggin.
75. The medium according to any one of claims 68 to 74, wherein the medium comprises a base medium of DMEM/F12 and B27 and N2 supplements, penicillin and streptomycin.
76. A method of identification of an agent useful for the prevention or treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina comprising: (a) contacting cells having a Miiller cell phenotype according to claim 48 with an agent; and (b) detecting an increase or decrease in a parameter relative to a control, wherein the control is a cell or population of cells according to claim 48 not contacted with the agent; wherein said increase or decrease in the parameter is indicative of a capacity to exert a therapeutic effect in the subject or the retina; and wherein an agent that effects said increase or decrease in the parameter is identified as being useful for the treatment of a retinal disease or disorder in a subject or regeneration or repair of the retina.
77. A method for the treatment or prevention of a retinal disease or disorder comprising administering cells having a Miiller cell phenotype according to claim 48 or the pharmaceutical composition according to claim 53 to a subject in need thereof to thereby treat or prevent the retinal disease or disorder.
78. The method according to claim 77, wherein said retinal disease or disorder is associated with dysfunction, injury and/or loss of Miiller cells in the subject.
79. A method for the regeneration or repair of the retina in a subject in need thereof comprising administering a cells having a Miiller cell phenotype according to claim 48 or the pharmaceutical composition according to claim 53 to said subject.
80. Cells having a Miiller cell phenotype according to claim 48 or the pharmaceutical composition according to claim 53 for the prevention or treatment of a retinal disease or disorder in a subject in need thereof.
81. The cells according to claim 80, wherein said retinal disease or disorder is associated with dysfunction, inj ury and/or loss of Miiller cells in a subject.
82. Cells having a Miiller cell phenotype according to claim 48 or the pharmaceutical composition according to claim 53 for the regeneration or repair of the retina in a subject in need thereof.
83. The use according to any one of claims 49 to 52, the method according to any one of claims 76 to 79, or cells having a Miiller cell phenotype according to any one of claims 80 to 82, wherein the cells having a Miiller cell phenotype are manipulated to display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
84. The use according to any one of claims 49, 50, 52, a method according to any one of claims 76 to 78, or cells having a Miiller cell phenotype according to any one of claims 80 to 82, wherein the retinal disease or disorder is selected from the group consisting of Diabetic retinopathy, Macular Telangiectasia Type 2, Age-related macular degeneration, retinal vein occlusions, central serous retinopathy, macular oedema, macular hole, retinal dystrophies including retinitis pigmentosa, geographic atrophy, glaucoma and retinopathy of prematurity.
85. The use, method or of cells according to claim 84, wherein the retinal disease is selected from the group consisting of Diabetic retinopathy, Macular Telangiectasia Type 2, and Age- related macular degeneration.
86. The use, method or cells according to claim 84 or 85, wherein the retinal disease is Macular Telangiectasia Type 2.
87. The use, method or cells according to any one of claims 84 to 86, wherein the cells having a Miiller cell phenotype are manipulated to display i) inhibited expression of a gene product of interest, ii) expression of a gene product of interest with impaired function, iii) increased expression or overexpression of a gene product of interest or iv) expression of a gene product of interest with enhanced function.
88. The kit according to any one of claims 54 to 67, or the medium according to any one of claims 71 to 75, for use in the method of any one of claims 1 to 46.
89. The kit according to any one of claims 54 to 67, or the medium according to any one of claims 71 to 75, when used in the method of any one of claims 1 to 47.
90. The method according to claim 76, wherein the parameter is one or more of the following: i) expression of one or more of GFAP, GS, VIMENTIN, CRALBP, SOX9, GLAST and Kir4.1 ; ii) extracellular concentration of a neuroactive substance including K+, glutamate, GABA and/or H+; and/or iii) expression or secretion of one or more cytokines.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2016902470 | 2016-06-23 | ||
| AU2016902470A AU2016902470A0 (en) | 2016-06-23 | Methods for differentiating cells into cells with a Müller cell phenotype, cells produced by the methods, and methods for using the cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017219062A1 true WO2017219062A1 (en) | 2017-12-28 |
Family
ID=60783130
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2017/000138 Ceased WO2017219062A1 (en) | 2016-06-23 | 2017-06-23 | Methods for differentiating cells into cells with a muller cell phenotype, cells produced by the methods, and methods for using the cells |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017219062A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021133861A1 (en) * | 2019-12-23 | 2021-07-01 | Boston Medical Center Corporation | Human ipsc-based derivation of nk and t-cells using early notch induction |
| CN114231630A (en) * | 2021-12-13 | 2022-03-25 | 中山大学肿瘤防治中心(中山大学附属肿瘤医院、中山大学肿瘤研究所) | Application of EBF3 and/or Vimentin as nasopharyngeal carcinoma prognosis marker |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040023324A1 (en) * | 2000-08-25 | 2004-02-05 | Seiji Sakano | Stem cell culture medium and culture method by using the same |
| WO2012096705A1 (en) * | 2010-10-26 | 2012-07-19 | Case Western Reserve University | Differentiation methods for production of glial cell populations |
| WO2014104403A1 (en) * | 2012-12-26 | 2014-07-03 | Kyoto University | Method for Inducing Exocrine Pancreatic Cells |
| WO2014174492A1 (en) * | 2013-04-26 | 2014-10-30 | Universite Pierre Et Marie Curie (Paris 6) | Methods for obtaining retinal progenitors, retinal pigmented epithelial cells and neural retinal cells |
-
2017
- 2017-06-23 WO PCT/AU2017/000138 patent/WO2017219062A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040023324A1 (en) * | 2000-08-25 | 2004-02-05 | Seiji Sakano | Stem cell culture medium and culture method by using the same |
| WO2012096705A1 (en) * | 2010-10-26 | 2012-07-19 | Case Western Reserve University | Differentiation methods for production of glial cell populations |
| WO2014104403A1 (en) * | 2012-12-26 | 2014-07-03 | Kyoto University | Method for Inducing Exocrine Pancreatic Cells |
| WO2014174492A1 (en) * | 2013-04-26 | 2014-10-30 | Universite Pierre Et Marie Curie (Paris 6) | Methods for obtaining retinal progenitors, retinal pigmented epithelial cells and neural retinal cells |
Non-Patent Citations (5)
| Title |
|---|
| AHMAD, I. ET AL.: "Muller glia: a promising target for therapeutic regeneration", INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE, vol. 52, no. 8, 2011, pages 5758 - 5764, XP055443558 * |
| BENEDITO, R. ET AL.: "The notch ligands D114 and Jaggedl have opposing effects on angiogenesis", CELL, vol. 137, no. 6, 2009, pages 1124 - 1135, XP055008300 * |
| FURUKAWA, T. ET AL.: "rax, Hesl, and notchl promote the formation of Müller glia by postnatal retinal progenitor cells", NEURON, vol. 26, no. 2, 2000, pages 383 - 394, XP055443554 * |
| HOJO, M. ET AL.: "Glial cell fate specification modulated by the bHLH gene Hes5 in mouse retina", DEVELOPMENT, vol. 127, no. 12, 2000, pages 2515 - 2522, XP055443550 * |
| REICHMAN, S. ET AL.: "From confluent human iPS cells to self-forming neural retina and retinal pigmented epithelium", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 111, no. 23, 2014, pages 8518 - 8523, XP055443523 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021133861A1 (en) * | 2019-12-23 | 2021-07-01 | Boston Medical Center Corporation | Human ipsc-based derivation of nk and t-cells using early notch induction |
| US11788065B2 (en) | 2019-12-23 | 2023-10-17 | Boston Medical Center Corporation | Human iPSC-based derivation of NK and T-cells using early Notch induction |
| CN114231630A (en) * | 2021-12-13 | 2022-03-25 | 中山大学肿瘤防治中心(中山大学附属肿瘤医院、中山大学肿瘤研究所) | Application of EBF3 and/or Vimentin as nasopharyngeal carcinoma prognosis marker |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220333069A1 (en) | Three dimensional heterogeneously differentiated tissue culture | |
| US10746728B2 (en) | Human trophoblast stem cells and uses thereof | |
| JP7793137B2 (en) | Method for increasing cone or rod photoreceptors using a dorsalizing or ventralizing signal transduction substance | |
| AU2016250905B2 (en) | Generation of muscle-lineage cells from stem cells | |
| JP6316938B2 (en) | Method for preparing induced neural stem cells reprogrammed from non-neuronal cells using HMGA2 | |
| CN108350421A (en) | Method for preparing retinal pigment epithelial cells | |
| CN111094554A (en) | Preparation method of retinal tissue | |
| JP2020524504A (en) | A novel method for the generation and utilization of human induced neural border stem cells | |
| US20190322981A1 (en) | Means and methods for the generation of oligodendrocytes | |
| Bonilla-Pons et al. | Müller glia fused with adult stem cells undergo neural differentiation in human retinal models | |
| Li et al. | Transcriptional reactivation of OTX2, RX1 and SIX3 during reprogramming contributes to the generation of RPE cells from human iPSCs | |
| US20260002124A1 (en) | Enhancing neuronal differentiation of ventral midbrain neural progenitor cells | |
| WO2017219062A1 (en) | Methods for differentiating cells into cells with a muller cell phenotype, cells produced by the methods, and methods for using the cells | |
| US20230304994A1 (en) | Methods and assays for analyzing secretome-containing compositions | |
| Sabapathy | Optimisation of methods for the differentiation of human embryonic stem cells into retinal progenitor cells | |
| Chen et al. | Adult Limbal Neurosphere Cells: A Potential Autologous Cell Resource for Retinal Cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17814307 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17814307 Country of ref document: EP Kind code of ref document: A1 |