WO2017214471A1

WO2017214471A1 - Methods for detecting structural variants in neurodegenerative disease

Info

Publication number: WO2017214471A1
Application number: PCT/US2017/036682
Authority: WO
Inventors: Allen D. Roses
Original assignee: Saunders, Ann M.
Priority date: 2016-06-10
Filing date: 2017-06-09
Publication date: 2017-12-14
Also published as: AU2017277929A1; EP3469093A1; US11001893B2; EP3469093A4; US20190256914A1; CA3026103A1

Abstract

Provided herein according to some embodiments is a method for detecting a short tandem repeat (STR) variant in the SOD1, TARDBP or C9orf72 gene region comprising measuring the length of the STR variant. In some embodiments, the method includes obtaining a biological sample containing genomic DNA from a subject, optionally isolating the genomic DNA from the sample. Also provided is a method for determining a diagnosis or a prognosis for a neurodegenerative disease, including: measuring a length of a short tandem repeat (STR) variant in the SOD1, TARDBP or C9orf72 gene region, and determining the diagnosis or prognosis based upon the length. Further provided is a method of treatment for a neurodegenerative disease including: administering a therapeutic agent to a subject based upon a length of a short tandem repeat (STR) variant in the SOD1, TARDBP or C9orf72 gene region in the subject. Also provided is a kit for detecting a (STR) variant in the SOD1, TARDBP or C9orf72 gene region.

Description

Methods for Detecting Structural Variants

in Neurodegenerative Disease

BACKGROUND

Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease in which motor neurons controlling voluntary movements are adversely affected. In some cases, the disease is associated with inherited genetic mutations (familial ALS or fALS). In other cases in which there is no family history of the disease and it presents as an isolated case, the disease is considered to be sporadic (sALS). However, genetic disposition may be involved in sALS cases.

On a genetic level, ALS is a complex disease with a great deal of inter-individual and intra-familial phenotypic variability. See, e.g., Chio et al. (201 1) J Neurol Neurosurg Psychiatry 82( 7): 740-746; Andersen et al. (1997) Brain 120:1723-1737. There are multiple uncommon single nucleotide polymorphisms (SNPs) assigned as specific "mutations" for each of several ALS genes. More than 150 separate SNP variants within the gene encoding Cu/Zn superoxide dismutase (SOD1) have been proposed as associated with ALS to date.

SUMMARY

Provided herein according to some embodiments is a method for detecting a short tandem repeat (STR) variant in the SOD1, TARDBP or C9orf72 gene region comprising measuring the length of the STR variant. In some embodiments, the method includes obtaining a biological sample containing genomic DNA from a subject, optionally isolating the genomic DNA from the sample.

Also provided is a method for determining a diagnosis for a neurodegenerative disease, including: measuring a length of a short tandem repeat (STR) variant in the SOD1 , TARDBP or C9orf72 gene region, and determining the diagnosis based upon the length.

Further provided is a method for determining a prognosis for a neurodegenerative disease, including: measuring a length of a short tandem repeat (STR) variant in the SOD1, TARDBP or C9orf72 gene region, and determining the prognosis based upon the length.

Still further provided is a method of treatment for a neurodegenerative disease including: administering a therapeutic agent to a subject based upon a length of a short tandem repeat (STR) variant in the SOD1 , TARDBP or C9orl72 gene region. Also provided is the use or preparation of a medicament or therapeutic agent as taught herein for the treatment of a neurodegenerative disease in a subject based upon a length of a short tandem repeat (STR) variant in the SOD1, TARDBP or C9orf72 gene region.

Further provided is a method of stratifying a subject in a clinical trial for treatment of a neurodegenerative disease comprising: administering the treatment to a subject based upon a length of a short tandem repeat (STR) variant in the SOD1, TARDBP or C9orf72 gene region.

Still further provided is an in vitro stem cell and/or transgenic animal (e.g., a non-human primate (e.g. , lemur such as mouse or dwarf lemur), or a rodent such as rat or mouse)) model of neurodegenerative diseases, wherein the cells of said model comprise a short tandem repeat (STR) variant as taught herein.

Also provided is a kit for detecting a (STR) variant in the SOD1, TARDBP or C9orf72 gene region, comprising at least one reagent that specifically detects the STR variant. In some embodiments, the kit is for detecting the variant in a subject having or suspected to have ALS.

In some embodiments of any of the above methods, use, model or kit, the STR variant includes a simple sequence repeat (SSR) of at least 8, 9, 10, 11, 12, 13 or 14 consecutive bases.

In some embodiments of any of the above methods, use, model or kit, the STR includes at least three, four or five length variants.

In some embodiments of any of the above methods, use, model or kit, the STR variant is a poly-T or a poly-A SSR variant.

In some embodiments of any of the above methods, use, model or kit, the measuring includes Sanger DNA sequencing, a size -based assay (e.g. , gel or capillary electrophoresis), or both.

In some embodiments of any of the above methods, use or model, the measuring comprises nested PGR.

In some embodiments of any of the above methods, use, model or kit, the STR variant is a poly-T or poly-A SSR variant between the SOD1 gene and the SCAF4 gene in chromosome 21 (position chr21 :33,043,422-33,043,440 of the Genome Reference Consortium Human Genome Assembly Release CiRCh37.pl 3 ). In some embodiments, the variant has 14, 15, 16, 17 or 18 poly-T or poly-A residues. In some embodiments, the variant has 14, 15 or 16 poly-T or poly-A residues. In some embodiments, the variant has 17 or 18 poly-T or poly-A residues. In some embodiments, the variant has 18 poly-T or poly-A residues.

In some embodiments of any of the above methods, use, model or kit, the method includes genotyping by measuring the length of the STR variant at each allele (phased or unphased). In some embodiments of any of the above methods, use, model or kit, a poly-T or poly-A length of 18 indicates a diagnosis and/or more rapid progression of the neurodegenerative disease.

In some embodiments of any of the above methods, use, model or kit, the subject carries a SOD1 mutation and/or a fALS-C9orf72 mutation.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 presents a diagram of the relative location of SVl in the SOD1 region on Chromosome 21. SVl is downstream (3') of the SOD1 gene, and also downstream (3') of another gene, SCAF4, which is encoded on the other (minus) strand of the Chromosome 21. On the plus strand where SOD1 is encoded, SVl is a poly-A; on the minus strand where SCAF4 is encoded, SVl is its compliment, i.e. , a poly-T.

FIG. 2 provides a histogram illustrating poly T variability of SVl amongst A I S cases vs. controls. Alleles represented in each histogram 16T: 22 case, controls 174; 17T 251 case, control 713; 18T 55 case, 18 control; The histogram above shows the distribution of alleles for SVl amongst cases and controls, the 18T allele in significantly enriched for ALS cases in particular for the A4V ALS cases.

FIG. 3 presents a graph of a one-way analysis of duration in months by SVl allele length. The pattern of longer length being associated with a worse outcome is confirmed by these data. Mean duration decreases with increasing allele length. One caution is that the group sizes are different. This result is for Caucasians, FALS-SOD1 diagnosis.

FIG. 4 presents a histogram illustrating diagnosis of fALS-SOD compared to control. This plot shows the proportional distribution of individuals affected with ALS compared to controls stratified by SVl allele length. The four columns in the plot represent SVl allele length classifications. The key at the right side of the plot shows the coding for affected with ALS (shaded) versus control (no shading). The height of the shaded block in each column corresponds to the proportion of the stratified sample affected with ALS. The scale of the y-axis (far left) shows the proportions for the disease stratification with the entire subset of individuals in each SVl length category corresponding to 1 . The width of each column is proportional to the number of individuals in the four SVl allele length classifications.

FIG. 5 presents a contingency analysis of the relationship by T18 Carriage Mosaic Plot. This plot shows the proportional distribution of individuals affected with ALS compared to controls stratified by carriage of at least one T18 SVl allele. The two columns in the plot reflect either carriage of at least one SVl T18 allele (T18) or no carriage of a T18 allele (N). The key at the right side of the plot shows the coding for affected with ALS (shaded) versus control (no shading). The height of the shaded block in each column corresponds to the proportion of the stratified sample affected with ALS. The scale of the y-axis (far left) shows the proportions for the disease stratification with the entire subset of individuals in each SV1 length category corresponding to 1. The width of each column is proportional to the number of individuals in the two T18 carriage classifications.

DETAILED DESCRIPTION OF EMBODIMENTS

The present invention is explained in greater detail below. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all of the features that may be added. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure which do not depart from the instant invention. Hence, the following specification is intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.

As used in the description of the invention and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Also, as used herein, "and/or" refers to and encompasses any and all possible combinations of one or more of the Hsted items, as well as the lack of combinations when interpreted in the alternative ("or").

Included in the disclosures herein is an SSR found to be highly associated with a quantitative phenotype of ALS, and replicated using 32 of the more than 150 proposed SNP mutations for SOD1 in ALS. In addition, this SSR also identified other cases of ALS previously not localized to the SOD1 region that were classified as so-called sporadic disease. Furthermore, several ALS cases classified at other familial ALS locations on the genome were also identified in non-SODl disease controls (Normal Controls - 3/459; sporadic 3/32, C90RF72 2/1 , and T R DBF 1/15). This suggests that the SSR may be present in additional genetic disease loci in a greater frequency than normal controls and may indicate that the 18T is a common factor at other ALS gene regions, or that additional similar SSRs may be in other disease loci regions. This is also supported by finding similar frequencies in cases without a known gene at the time of patient selection— so-calied "sporadic." SSRs have been postulated to affect gene expression, both quantitative amount and alternative splicing, which is involved in human disease. See, e.g., Smith et al. 2000 TIBS 25:381-388; Caceres et al. 2002 TRENDS in Genetics 18(4): 186- 193. Involved in this process is a localized organelle called the spliceosome.

Thus, and without wishing to be bound by theory, the SSR may implicate the spliceosome for involvement in the pathogenesis mechanism for ALS by its cis-localized location in the SOD1 gene region. The spliceosome is the functional local micro-organelle to direct alternative splicing of transcripts across the genome. These constituent factors are found throughout the genome and expressed in a finely-coordinated and finely- structured organelle that splice out introns that are located in transcribed pre-mRNA and control the reattachment of selected exon sequences, resulting in alternatively spliced forms of the structural gene. Aberrant splicing of mRNA or decreased products of functional species can result from SSR sequences that are within introns of the gene or nearby in cis-regulatory regions of the chromosomal strand.

This suggests that control elements may alter the structure and/or amount of functional mRNA and affect necessary functions and interactions of the gene.

Highley et al. (2014 Neuropathology and Applied Neurobiology 40:670-685) reported with respect to TDP-43, a transcriptional repressor/splicing factor encoded by TARDBP and associated with forms of motor neuron disease at the TDP-43 locus, that a loss of nuclear TDP- 43 function was associated with RNA processing abnormalities in ALS motor neurons in a small number of ALS- DP-43 patients' autopsied microdissected neuronal tissue. Thus, they found that key functional pathways affected included those central to RNA metabolism.

As reported in the data presented herein, it was found that other patients characterized with another disease gene-associated loci, different from SOD1 , carry the uncommon SOD1 T18 variant at SV1 , suggesting a multi-locus combination affecting gene splicing and contributing to disease progression.

In fact, it may be that many of the numerous known genetic mutations associated with ALS (e.g., SOD SNPs) may be on the backbone of an I R variant as taught herein.

The biological activity of the SOD gene may be affected by the STR in the SOD1 gene region. For example, inheritance of particular STR variants may differentially affect SOD expression (e.g. , expression level and/or differential splicing).

Functional effects of structural variants is not without precedent. The age of onset of Alzheimer's disease has been shown to be dependent on TOMM40 '523-APOE cis-haplotypes, which are length difference variations of an informative S I R located within a highly associated region of the genome, with varying cis-haplotypes across ethnic groups including, but not limited to, Caucasians, African-Americans, West Africans, and Japanese according to allele frequency studies. Additionally, the variants effect expression levels of both genes. See, e.g. , Linnertz et al. (2014) Alzheimers Dement. 10(5):541 -551.

As taught herein, it has been found that a particular STR in the SOD gene region is associated with a form of ALS associated with the shortest duration until death of an ALS patient.

"Structural variants" or "SV" are all genomic insertions, deletions, inversion and microsatellites. There are currently over 7 million SVs in the human genome, with more than 1 million associated with a long simple sequence repeat (SSR) or short tandem repeat (STR) (Roses et al., Expert Opinion of Drug Metabolism & Toxicology 2016).

A "short tandem repeat" or "STR" as used herein is a place in the genome where one base, or a short stretch of bases (e.g. , 2, 3, 4, 5 or 6 consecutive bases) are repeated in tandem. A particular form of a polymorphic STR, e.g. , a particular length, is a "variant" thereof.

As used herein, a "simple sequence repeat" or "SSR" is a form of STR in which there is one repeated (consecutive) base (i.e. , A, T, C or G in genomic DNA). Examples of known polymorphic SSRs include, for example, the poly-T variant SSR at human locus rsl 0524523 (TOMM40 '523).

The biological effects of SSRs, and more generally STRs, are understudied. Many STRs existing in the genome have never been identified because, in the rush to sequence the whole genome rapidly and less expensively, the field has turned to next generation sequencing (NGS). But, unfortunately, currently available NGS methods do not identify more than 8-10 nucleotides accurately for assay purposes, thus missing differentiation of larger polymorphic length STRs.

"Polymorphism" as used herein refers to the existence of two or more different nucleotide sequences at a particular locus in the DNA of the genome. Polymorphisms can serve as genetic markers and may also be referred to as genetic variants. Polymorphisms include nucleotide substitutions, insertions, deletions and microsatellites, e.g. , STRs, and may in some instances result in detectable differences in gene expression or protein function. A polymorphic site is a nucleotide position within a locus at which the nucleotide sequence varies from a reference sequence in at least one individual in a population.

"Haplotype" as used herein refers to a genetic variant or combination of variants carried on at least one chromosome in an individual. A cis-haplotype in some embodiments includes multiple polymorphic loci on the same copy of a chromosome or haploid DNA molecule. Absent evidence to the contrary, a cis-haplotype is presumed to represent a combination of multiple loci that are likely to be transmitted together during meiosis. Each human carries a pair of haplotypes for any given genetic locus, consisting of sequences inherited on the homologous chromosomes from two parents. These haplotypes may be identical or may represent two different genetic variants for the given locus. Haplotyping is a process for determining one or more haplotypes in an individual. Haplotype determination may include use of family pedigrees, molecular techniques and/or statistical inference.

A "variant" or "genetic variant" as used herein, refers to a specific isoform of a haplotype found in a population, the specific form differing from other forms of the same haplotype in the sequence of at least one, and frequently more than one, variant sites or nucleotides within the sequence of the gene. "Variants" include isoforms having single nucleotide polymorphisms (SNPs) and STRs. Reference to the presence of a variant means a particular variant, i.e. , particular nucleotides or STR pattern/length at particular polymorphic sites, rather than just the presence of any variance in the gene locus.

"Isoform" as used herein means a particular form of a gene, mRNA, cDNA or the protein encoded thereby, distinguished from other forms by its particular sequence and/or structure. For example, the ApoE 4 isoform of apolipoprotein E as opposed to the ApoE2 or ApoE 3 isoforms.

The term "genotype" in the context of this invention refers to the particular allelic form of a gene, which can be defined by the particular nucleotide(s) present in a nucleic acid sequence at a particular site(s). Genotype may also indicate the pair of alleles present at one or more polymorphic loci. For diploid organisms, such as humans, two haplotypes make up a genotype. Genotyping is any process for determining a genotype of an individual, e.g. , by nucleic acid amplification, antibody binding, or other chemical analysis. The resulting genotype may in some embodiments be unphased, meaning that the sequences found are not known to be derived from one parental chromosome or the other.

"Linkage disequilibrium" as used herein means the non-random association of alleles at two or more loci. Linkage disequilibrium describes a situation in which some combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies. Non-random associations between polymorphisms at different loci are measured by the degree of linkage disequilibrium.

A "subject" according to some embodiments is an individual whose genotype(s) or haplotype(s) are or have been determined, and may have been recorded in conjunction with the individual's condition (i. e., disease or disorder status, including, but not limited to, the disease risk status, age of onset prediction, progression prognosis, etc.). Subjects are preferably, but not limited to, human subjects. The subjects may be male or female and may be of any race or ethnicity, including, but not limited to, Caucasian, African- American, African, Asian, Hispanic, Indian, etc. The subjects may be of any age, including newborn, neonate, infant, child, adolescent, adult, and geriatric, but in some embodiments adult or geriatric subjects are preferred. In some embodiments, subjects are at least 20, 30, or 40 years of age. Subjects may also include animal subjects, particularly mammalian subjects such as canines, felines, bovines, caprines, equines, ovines, porcines, rodents (e.g. , rats and mice), lagomorphs, primates (including non-human primates such as mouse or dwarf lemurs), etc., screened for veterinary medicine or pharmaceutical drug development purposes.

In some embodiments, the subject has or is suspected to have ALS. In some embodiments, the subject has one or more SOD1 mutations, including, but not limited to, the A4V mutation and/or G100K mutation. In some embodiments, the subject has a C9orf72 mutation. See Saeed et al. (2009) Neurology 72:1634-1639.

"Treat," "treating," or "treatment" as used herein refers to any type of measure that imparts a benefit to a subject afflicted with or at risk for developing a disease, including improvement in the condition of the subject (e.g., in one or more symptoms), delay in the onset or progression of the disease, etc. Treatment may include any drug, procedure, lifestyle change, or other adjustment introduced in attempt to effect a change in a particular aspect of a subject's health (i.e., directed to a particular disease, disorder, or condition). In some embodiments as taught herein, treatment is for a neurodegenerative disease such as amyotrophic lateral sclerosis (ALS), Alzheimer's Disease (AD), Lewy Body dementia (LBD), trontotemporal dementia (FTD), etc.

"Biological sample" as used herein refers to a material containing a nucleic acid or protein of interest. Biological samples containing DNA include hair, skin, cheek swab, and biological fluids such as blood, serum, plasma, sputum, lymphatic fluid, semen, vaginal mucus, feces, urine, spinal fluid, and the like. Isolation of nucleic acid from such samples is well known to those skilled in the art.

"Gene" as used herein means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that may control expression.

"Genetic locus" or "locus" as used herein means a location on a chromosome or DNA molecule, often corresponding to a gene region or a physical or phenotypic feature or to a particular nucleotide or stretch of nucleotides. Loci is the plural form of locus. As noted, disclosed herein is a genetic locus in the SOD1 gene region between the SOD1 gene and the SCAF4 gene in chromosome 21 (at position chr21 :33, 043,422-33,043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3) that shows strong association with an aggressive form of ALS. This multi-allelic microsatellite, which is referred to as "SV1 " in the data herein, is currently unnamed in the public databases. Variants of 14A, 15 A, 16A, 17A, and 18A were present in the genotyping cohort reported herein.

A variant named rs71 714698 in the gene SCAF4 (just downstream from SOD1) was previously listed in an older version (build 138) of dbSNP, with a variation described as an "AA" insertion (if combined with flanking As, this would be 17A or 19A). In more recent builds of dbSNP, rs71714698 is no longer listed. There is currently a single-base "A" insertion named rs5731 16164 in the region. If combined with flanking As, it would be 17A or 18A. Due to these inconsistencies in description in the public databases, the variable poly-A or poly-T at position chr21 :33,043,422-33,043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3 described herein (which also includes 14A, 15A and 16A as variants) is termed SV1.

Analysis of SV1 reveals that it is downstream (3') of the SOD1 gene, and also downstream (3') of another gene, SCAF4, which is encoded on the other (minus) strand of the chromosome, as illustrated in FIG. 1. On the plus strand where SOD1 is encoded, SV1 is a poly- A; on the minus strand where SCAF4 is encoded, SV1 is its compliment, i.e., a poly-T.

Interestingly, SV1 is flanked on both sides with binding sites for the transcription factor polymerase (RNA) II subunit A (POLR2A). POLR2A is the largest subunit of RNA polymerase II, and responsible for synthesizing messenger RNA in eukaryotes.

"Cu/Zn superoxide dismutase", "superoxide dismutase", "SOD" and "SODl " are used herein interchangeably to refer to an enzyme encoded by the SODl gene in humans, or to the gene itself (depending on context), located on chromosome 21. One of three human superoxide dismutases, SODl has been implicated in apoptosis and amyotrophic lateral sclerosis.

"SCAF4" or "SR-Related CTD-Associated Factor 4" located on the minus strand of chromosome 21 encodes a member of the arginine/serine-rich splicing factor family involved in transcription and/or pre-mRNA splicing. Thus, aberrant splicing may be involved on multiple levels due to structural variants in this region due to possible effects on expression of SCAF4.

"Associated with" as used herein means the occurrence together of two or more characteristics more often than would be expected by chance alone. An example of association involves a feature on the surface of white blood cells called HLA (HLA stands for human leukocyte antigen). A particular HLA type, HLA type B-27, is associated with an increased risk for a number of diseases including ankylosing spondylitis. Ankylosing spondylitis is 87 times more likely to occur in people with HLA B-27 than in the general population.

"Drug" as used herein refers to a chemical entity or biological product, or combination of chemical entities or biological products, administered to a person to treat, including prevent, delay the onset or control (e.g., delay the progression), of a disease or condition. The term "drug" as used herein is synonymous with the terms "medicine," "medicament," "therapeutic intervention," or "pharmaceutical product." In some embodiments, the drug may be approved by a government agency for treatment of at least one specific disease or condition.

While not wishing to be bound by theory, STRs or SSRs found in non-coding regions of genes may exert their functional effects directly, or tag or otherwise be in linkage disequilibrium with causal variants, which may, e.g., modulate the expression of genes involved in a disease or condition. For example, the effects may occur through alternative splicing of the subsequent exon or through modulation of expression level, with such altered gene expression determining disease state, susceptibility, course, and/or drug efficacy or likelihood of adverse events.

Supporting this, a genome -wide analysis of expression with multi-allelic STR or SSR genotypes reported significant associations of STR variations and expression profiles, explaining on average about 22% of the cis-heritability of the expression levels of the genes after controlling for nearby SNPs. Gymrek et al., Genome- Wide Analysis of Expression Short Tandem Repeats, Abstract at the 2014 meeting of the American Society of Human Genetics. See also Willems et al., The landscape of human STR variation, Genome Research 24:1894-1904 (2014).

Determining the length of a STR or SSR variant in a SOD gene region as taught herein may be combined with other genetic and/or medical history determinations to reach a prognosis of disease course.

Measuring the length of a STR variant

Measuring the length of a STR or SSR as taught herein may be carried out by direct sequencing of the genomic DNA region of interest, with an oligonucleotide probe labeled with a suitable detectable group, and/or by means of an amplification reaction such as a polymerase chain reaction or ligase chain reaction (the product of which amplification reaction may then be detected with a labeled oligonucleotide probe or a number of other techniques, including sequencing). In some embodiments, the measuring is carried out in vitro after obtaining a biological sample having genomic DNA from a subject. In some embodiments, the genomic DNA is isolated from the sample.

Sequencing methods include, for example, dideoxynucleotide chain termination techniques, such as those described by Sanger et al. (1977) Proc. Natl. Acad. Sci. U.S.A. 74(12), 5463-5467. As noted above, current "next-generation" sequencing may not be able to accurately measure an STR/SSR longer than 8-10 nucleotides in length.

It will be appreciated that determining the length of a genomic STR/SSR, for example a poly-T or a poly- A stretch, may be complicated by the "stuttering" of DNA polymerase in, for example, sequencing reactions utilizing PGR techniques. See, e.g., Fazekas et al. (2010) BioTechniques 48:277-285. This stuttering of the DNA polymerase can result in the generation of PGR products of various lengths, which may reduce the quality of the sequence data after a mononucleotide repeat of 10 or more bases, often to the point where the sequence data becomes difficult to interpret or even unreadable.

In some embodiments, the methods include the use of nested per, in which a second set of primers is used to amplify a region within the region amplified by a first set of primers, thereby increasing accuracy/specificity.

Detection can also be performed by making use of assays that detect the relative length of the relevant portion of genomic DNA (e.g. , by gel filtration, gel electrophoresis, capillary electrophoresis, etc. of an amplified portion of the region).

In some embodiments, the methods may include long-range PGR and/or DNA cloning into plasmids.

In some embodiments, the methods may include at least two methods (e.g. , 2 or 3 methods) to determine the length of an S I R variant.

In some embodiments, the methods may include genotyping by measuring the length of the STR variant at each allele (phased or unphased).

For example, genotyping of, analysis of the length of, and/or sequencing of STR variants may be performed as described in Roses et al. Alzheimer's & Dementia (2014) 1-10, in which nested PCR and Sanger sequencing were performed in duplicate (method 1), and PGR product size was determined using electrophoresis, and comparison with results of subcloned DNA fragments with a known number of residues (method 2).

Further, the detecting step may include the step of detecting whether the subject is heterozygous or homozygous at the loci of interest. Some embodiments of the present invention may include steps implemented by a computer and/or computer program products, including analog and/or digital hardware, and/or computer program instructions. These computer program instructions may be provided to a processor of a general purpose computer, special purpose computer, Application Specific Integrated Circuits (ASIC), and/or other programmable data processing apparatus, such that the instructions, which execute via the processor of the computer and/or other programmable data processing apparatus, create means for implementing the functions/acts specified. Other software, such as an operating system, also may be included. It will be further appreciated that the functionality of the sequencing module, genotyping module, multiple sequence alignment module, mapping module and/or other modules described herein may be embodied, at least in part, using discrete hardware components, one or more ASIC and/or one or more special purpose digital processors and/or computers.

It will be appreciated that the use of a computer and/or computer program products may be used in conjunction with sequencing protocols to analyze and refine sequencing data obtained from such protocols. In some embodiments, electropherograms obtained using Sanger sequencing techniques may be further refined and analyzed using such computer and/or computer program products. For example, commercially available computer software products for genetic analysis running on a computer, such as, but not limited to, SEQUENCHER® (Gene Codes Corp., Ann Arbor MI), GeneMarker® (SoftGenetics, LLC, State College, PA) DNASTAR® (DNASTAR, Inc. Madison, WI) and the like, as well as other proprietary software packages used by sequencing vendors, may be used to assist in the analysis of and determination of the precise length of an STR or SSR, for example, a poly-T or poly-A tract, within a region of DNA sequence.

Targeted Therapy

Genetic variants as described herein may be used in practical application to determine the course of treatment of a subject afflicted with or at increased risk of developing a condition (e.g. , a neurodegenerative disease and/or a condition associated with one or more variants of SOD). This may include, e.g. , determining which active agent and/or course of treatment and/or dosage to administer and/or timing of treatment based upon the presence or absence of the genetic variant or variants and/or proceeding to administer an appropriate treatment based thereon.

The genetic variant or variants as described herein may also be used to establish or confirm a diagnosis of a particular disease or condition (e.g., a neurodegenerative disease such as ALS) in order to determine the need for treatment and the appropriate course of intervention. The genetic variant or variants as described herein may also be used for stratifying/enrichment in a clinical trial to investigate the efficacy of new treatments for a specific patient population.

Riluzole is a medication approved for treatment of ALS in the United States by the Food and Drug Administration. It slows the progression of ALS, thought to be by reducing levels of glutamate in the brain. Riluzole can cause significant side effects, though, such as dizziness, gastrointestinal conditions and changes in liver function. However, upon determining a more aggressive form of ALS by detecting the length of a poly-T or poly- A variant in the SOD1 gene region, it may be desirable to proceed with treatment with riluzole or another neuronal excitability modulating agent.

Other known neuronal excitability modulating agents include, but are not limited to, NMDA antagonists such as remacemide (investigated for treatment of Huntington's disease), mematine (used to treat dementia and Alzheimer's disease), and budipine; and anti-seizure drugs such as lamotrigine, gabapentin and retigabine. See also US 2015/0190363 to Woolf et al.

Other therapies for ALS may include administration of copper-based agents such as copper-ATSM (copper chelated with diacetylbis(4-methyl-thiosemicarbazone)). See Williams et al, Neurobiol Dis. 2016 May;89:l-9.

Edaravone (3-methyl-l-phenyl-2-pyrazolin-5-one) is also an approved medication in the United States for treatment of ALS. Edaravone is a member of the substituted 2-pyrazolin-5-one class of free radical scavengers. Though one of the few approved options for treatment of ALS, edaravone is an expensive intravenous infusion and can cause significant side effects, such as hives, swelling, and shortness of breath. However, upon determining a more aggressive form of ALS by detecting the length of a poly-T or poly-A variant in the SOD1 gene region, it may be desirable to proceed with treatment with edaravone.

Still other agents that may be use for treatment of neurodegenerative disease such as ALS include tyrosine kinase inhibitors, such as inhibitors of the tyrosine kinases Src and c-Abl. See Imamura et al., Set. Transl. Med. 2017 May 24;9:391. Examples include, but are not limited to, bosutinib, masitinib, nilotinib, etc.

Without wishing to be bound by theory, it is thought that inhibition of Src and c-Abl may stimulate autophagy. Thus, other agents that boost autophagy may also be used for treatment of ALS. Examples of agents that boost autophagy include, but are not limited to, rapamycin, [ - NAME (N-L-arginine methyl ester), imidazoline receptor agonists such as clonidine and rilmenidine, etc. See Rubinsztein et al., Nat. Rev. Drug Discov. 2012 September; 1 1(9):7()9-730. Models of Neurodegenerative Disease

STR variants as taught herein may be provided in in vitro stem cell models and/or transgenic animal {e.g. , a non-human primate such as a mouse or dwarf lemur, or a rodent such as rat or mouse) models of neurodegenerative diseases such as ALS, which are useful for, e.g., research and/or drug screening and development purposes. See, e.g., US 2014/0322237 to Eggan et al.: US 2010/0028931 to Eggan et al.: US 2002/0062493 to Eggan et al., which are incorporated by reference herein.

The present invention is described in more detail in the following non-limiting examples.

EXAMPLES

To discover genetic structural variants (SVs) that are linked to ALS phenotypic differences, both familial ALS (fALS) and sporadic ALS (sALS) cases were incorporated into a discovery case-control study. Forty-four families were included, which allowed both assessment of allele transmission and variant length variability compared to phenotypes such as age of onset and duration, not only between individual cases, but also within families. See Laird et al. (2006) Nat Rev Genet 7(5):385-394.

There is increasing evidence that the genetics in the regions surrounding SOD1 is a tightly-linked disease modifying factor that affects the mode of inheritance as well as phenotype for various ALS SOD1 mutations such as A4V. See Saeed et al. (2009) Neurology 72: 1634- 1639. Once identified, these factors could shed light on the pathogenic mechanism for ALS and be used to guide decisions for treatment or drug development.

Table 1: Structural variation investigated in ALS eases and Controls

rsl 13627607 1 11,095,586 SSR 9ATC TARDBP rs576496603 1 1 1,102,454 SSR 1 1TGGA TARDBP

21 33,028,704 SSR 13A SODl rs36232192 21 33,030,349 deletion 50bp SODl

rsl 0 1740 21 33,040,162 SNP C/T SODl

rs354971 5 21 33,040,164 insertion -/C SODl

SV1 21 33,043,422 SSR 17A SODl rsl 435 1967 9 27,573,522 deletion -/GCCCG C9orf72 rs34524354 9 27,549,775 SSR 16A C9orf72 rs3S184194 9 27,555,557 SSR 19T C9orf72 rs71492752 9 27,564,155 SSR 23A C9orf72

Structural variants were selected in and surrounding the SODl, TARBDP and C90RF72 gene regions (Table 1) and investigated in an ALS case-control cohort consisting of 81 1 subjects in total. The cohort included 234 ALS cases: 200 fALS cases (171 SODl, 19 TARDBP and 10 C90RF72 patients), 34 sALS; and 577 age-matched controls not known to have any neurodegenerative disease at the time of their assessment.

Known mutations associated with ALS were also investigated in this study, including 32 SODl mutations distributed across the gene. Of the 32 mutations, the A4V mutation (n=28) and G100K mutation (n=l) were found with the 18T allele of SV1 , as discussed below.

Inclusion of sALS mutation negative patients allows preliminary examination of broader involvement of structural variants in ALS beyond SODl mutation positive cases. To explore the possibility that SVs in candidate ALS genes may be associated with ALS and related phenotypes, 9 TARBDP, 5 SODl and 3 C90RF72 SVs were investigated (Table 1). These candidate genes were selected based on prior evidence that disease causing mutations may be underpinned by structural variants, and underlying pathology may suggest evidence of protein/ RNA abnormal regulation. Structural variants within the genes had high impact scores based on our scoring algorithm dbSV.

Demographics (n= number of subjects in each category); cases and controls are represented as raw values (total 803: cases 234, controls 569). Average age of cases and controls 49.1 years (SD 12.6), controls 49.3 (SD 12.6); age of onset of cases 48.6 (SD 12.6). Duration 47.4 months ( SI) 54.4), unknown (n=8), still living (n=14). Gender 385 female, 418 male. Ethnicity, Caucasian n=742, Asian n=6, African American n ^"54. Structural variant SVl 1ST allele was associated with a greater number of ALS cases than controls. The population of ALS patients who carried at least one 18T allele included: 29 SOD1 cases (28 A4V, 1 G100K), 3 sALS cases, 1 TARDBP N325B case and 2 C90RF72 fALS cases compared to controls (p=l * 10 -^~12 , Likelihood ratio test, Table 2). In particular, the association appears to be driven by the SVl 18T allele (FIG. 2).

Table 2: Structural variants in a case/control study for ALS with p-values <0.05

Examination of the ALS patients who carry the SVl 18T allele reveals that of the 31 ALS cases who carry this allele, 27 are positive for the A4V mutation. The 27 A4V ALS patients are from 17 families. In order to determine if the association between SVl and ALS holds when taking into account family structures, generalized estimating equations were used to model the probability that individuals with specific SVl alleles would be affected. The model takes into account the correlation structure induced by the design of using individuals from families affected by ALS as cases and unrelated individuals as controls. The analysis showed an association (p=0.02) between SVl and ALS-SOD1.

Examination of the A4V and G100 ALS missense mutations reveals that they are 1 1327bp and 3790kb upstream from SVl , respectively. Examination of Caucasian Linkage disequilibrium (LD) of the SOD1 region where A4V and G100K reside and SVl suggests a modest LD, but it is possible that in ALS the SOI ) I gene region is in higher LD due to possible founder effects. See Saeed et al. (2009) Neurology 72:1634-1639.

Duration and age of onset was then examined for SVl in ALS cases, and it w^ras found that the 18T SVl variant was associated with the shortest duration until death of the patient when compared to the 17T or 16T variant (FIG. 3, p-value 0.0054). A4V patients when split into two groups: 18T (27), or not 18T (36 patients) had an average age of onset in years for 18T of 53.15 (SD 8.4) and not 18T of 48.6 (SD 12.5); for duration in months 18T 38.62 (SD 5.8) and not 18T 13.72 (SD 7). SVl associations with ALS and specifically duration will be tested at completion of the validation experiment.

In silico analysis of SVl reveals that it is flanked on both sides with binding sites for the transcription factor POLR2A. POLR2A is the largest subunit of RNA polymerase 11. and responsible for synthesizing messenger RNA in eukaryotes. The varying length of SVl may affect transcription of genes in the region, including SOD1. This observation supports the evidence of an ALS risk modifying factor raised in other studies such as that by Saeed et al. 2009.

Of the 526 controls that retuned genotyping data for SVl :

2 controls had a genotype of 14 A, 16A

13 controls had a genotype of 16A, 16A

2 controls had a genotype of 15 A, 17A

142 controls had a genotype of 16A, 17A

346 controls had a genotype of 17A, 17A

21 controls had a genotype of 1 7 A, 18A

In the ALS cases were 16A, 17A and 18A lengths. Specifically, of the 158 ALS patients that returned genotyping for SVl :

13 patients had a genotype of 16A, 17A

92 patients had a genotype of 17A,17A

50 patients had a genotype of 17 A, 18 A

3 had a genotype of 18 A, 18 A

Structural variant rs36232192 is a 50bp deletion polymorphism in the SOD1 promoter, 1 84 bp upstream of the ATG, and has been previously associated with an increased age of symptom onset in various populations of ALS patients. Broom et al. (2008) Amyotroph Lateral Scler 9(4):229-237. A recent study observed a similar trend with the 50bp deletion in homozygous sALS subjects. Milan, et al. (2012) J Neurol Sci 313(l -2):75-78.

In the present study, a delay of onset based on the 50bp deletion was not observed. However, the present study is predominantly composed of fALS subjects, compared to the two prior studies predominantly composed of sALS subjects. The functional consequence of the 50 bp deletion has been reported to be a reduction of SOD1 expression in vitro, and this may also be relevant to fALS. Overall in this case-control study we observed a p-value of 0.0014, with proportionally fewer cases displaying the 50bp deletion compared to controls. Preliminary examination of age of onset for this polymorphism between subjects who carry at least one deletion returned a value 47.8 years (SD 1 1.4), and those that are homozygous for the 50bp insertion is 48.9 years of age (SD 12.9). Survival for those patients who carry a 50bp deletion was 54.5 months (1 deletion) (SD 53) and 45.5 months (no deletions) (SD 54.9). Three subjects who were homozygous for the 5()bp deletion had onset ages of 72, 41 and 39. Disease durations for these three patients were 1 1 , 14 months, and still living, respectively.

Other structural variants were also tested. Those having a p-value of 0.1 or less calculated with likelihood ratio chi-square statistic overall ALS compared to control are presented in Table 3. SV1 had an overall p-value of 5* 10^"13.

Table 3: ALS SV Analysis Results

Detection of variant length at SV1

The sequence of the 14A SV1 variant with +/- 25 bp flanking is:

TTTCACCGTTACCTTGTCTTAAATT[AAAAAAAAAAAAAA]TAGAGAGCACTTCTAAT TACGATTT (SEQ ID NO:l)

The sequence of the 15A SV1 variant with +/- 25 bp flanking is:

TTTCACCGTTACCTTGTCTTAAATT[AAAAAAAAAAAAAAA]TAGAGAGCACTTCTAA TTACGATTT (SEQ ID NO:2) The sequence of the 16A SV1 variant with +/- 25 bp flanking is:

TTTCACCGTTACCTTGTCTTAAATT[AAAAAAAAAAAAAAAA]TAGAGAGCACTTCTA ATTACGATTT (SEQ ID NO:3)

The sequence of the 17A SV1 variant with +/- 25 bp flanking is:

TTTCACCGTTACCTTGTCTTAAATT[AAAAAAAAAAAAAAAAA]TAGAGAGCACTTCT AATTACGATTT (SEQ ID NO:4)

The sequence of the 18A SV1 variant with +/- 25 bp flanking is:

TTTCACCGTTACCTTGTCTTAAATT[AAAAAAAAAAAAAAAAAA]TAGAGAGCACTTC ΤΑ/ΥΙΊ ACGATT (SEQ I NO:5)

The SV1 region was analyzed using 2-step PGR amplification. The primers for the first step were:

Forward primer step 1 : ATCAAAAGTATTACATATGAAAGTG (SEQ ID NO:6) Reverse primer step 1 : TGTAGAGC H GAGGTG (SEQ ID NO: 7)

Using the 17A SV1 variant as an example, this produced a 487 bp amplicon with the sequence (SEQ ID NO:8):

ATCAAAAGTATTACATATGAAAGTGAGAATAACTACATAAAATGTCTATTTTCATCA

AATAAGTCTAATTTAGACTCCAATACAGTATTAACAGCTCAAACTTTGACGGTGAAC

AATCCTTTTCCACCTTAATGCAGTGTAGGAAGAATAGCACACATTAAAGTTTGTTAC

GAAAATAGAGTTTATTAAAAACATCCCTATTGTTTTGAGGAGCTTTCACCGTTACCT

TGTCTTAAATTAAAAAAAAAAAAAAAAATAGAGAGCACTTCTAATTACGATTTGTA

AACTTTTTAAAGTCAAAACTTTTAAAAAGTTACAGCAAAAAGGGTAATATTTATTCA

TATTTTCAGTATTTTTTGTTATTTTGTGGCTATTTTTAAATAGAAGGGAAGCAATCAA

ATTGCTTACAGTTCCCCACCAGCTGGCGCGGGGCTGCAGTACAGCGGGAGCGGATA

TAATACAGCATCTGTACACCTCAAGCTCTACA

This product was then PCR-amplified with a second set of primers:

Forward primer step 2: TGAGAATAACTACATAAAATGTCTA (SEQ ID NO:9)

Reverse primer step 2: TGTACAGATGCTGTATTATATC (SEQ ID NO: 10)

Using the 17A SV1 variant as an example, this produced a 450 bp amplicon with sequence (SEQ I NO: 1 1 ):

TGAGAATAACTACATAAAATGTCTATTTTCATCAAATAAGTCTAATTTAGACTCCAA TACAGTATTAACAGCTCAAACTTTGACGGTGAACAATCCTTTTCCACCTTAATGCAG

TGTAGGAAGAATAGCACACATTAAAGTTTGTTACGAAAATAGAGTTTATTAAAAAC

ATCCCTATTGTTTTGAGGAGCTTTCACCGTTACCTTGTCTTAAATTAAAAAAAAAAA AAAAAATAGAGAGCACTTCTAATTACGATTTGTAAACTTTTTAAAGTCAAAACTTTT AAAAAGTTACAGCAAAAAGGGTAATATTTATTCATATTTTCAGTATTTTTTGTTATTT TGTGGCTATTTTTAAATAGAAGGGAAGCAATCAAATTGCTTACAGTTCCCCACCAGC TGGCGCGGGGCTGCAGTACAGCGGGAGCGGATATAATACAGCATCTGTACA

This amplicon was sequenced using Sanger sequencing, using the "Reverse primer step 2" as the sequencing primer.

Electropherograms resulting from this analysis were further refined by software analysis (Polymorphic DNA Technologies, Inc., Alameda, Cali ornia).

SVl DATA REPLICATION

The association of the SVl variant with ALS phenotypes was further investigated in an additional cohort of novel cases of both familial (fALS) and sporadic (sALS) cases in a case-control study. Thirty-seven families were included in this sample set, which allowed assessment of allele transmission and variation of SVl to a number of ALS phenotypes including age of onset and duration between unrelated cases and within families.

Demographics ( n number of subjects in each category): total 828: cases 207, controls 621. Average age of cases was 52.1 years (SD 14.9), and controls 51.2 years (SD 14.7); Duration 50.3 months (SD 51.7), unknown (n=8), still living (n=8). Gender: 407 female, 420 male (1 missing gender). Ethnicity: Caucasian n 823. Hispanic/white i . Other 3.

Age of onset

fALS-C9orf72 - 54 subjects - 57.4 years of age (yoa) (SD 11.3)

fALS-FUS - 33 subjects - 40.0 yoa (SD 16.5)

fALS-SODl - 60 subjects - 50.5 yoa (SD 1 1.8)

sALS 60 subjects - 56.05 yoa (SD 15.5)

Association between SVl and ALS

Overall, there is a statistically significant (p=0.0296, Likelihood Ratio test) association observed between carriage of the T18 al lele of SVl and fALS-SODl in comparison to controls. There is also a statistically significant (p=0.01 , Likelihood Ratio test) association observed between carriage of the T 17 or T18 allele of SVl and fALS-C9orf72 in comparison to controls. Comparing genotypes that contain T18 with genotypes that do not contain T18 gives a highly statistically significant difference between fALS-SODl and control, p = 0.017 (Likelihood ratio test).

Considering SVl genotypes, T18 carriage vs. no T18 carriage, the odds ratio comparing fALS-SODl with control determined in this study is 2.2 (95% CI 1 .2 - 4.3).

Note that there are about lOx as many controls as individuals in each diagnostic category. For the fALS-SODl individuals, the duration of the disease is shorter for carriers of T18 compared to the other allele lengths; however, the difference is not statistically significant (data not shown).

Generalized estimating equations were used to determine if the association between SVl and ALS holds when taking into account family structures. This approach takes into account the correlation structure induced by the design of using individuals from families affected by ALS as cases and unrelated individuals as controls. The analysis showed a statistically-significant association of (p=0.03) between SVl and fALS-SODl .

Table 4: Contingency Table

SVl By Relationship

Table 6:

fALS-SODl and Control

fALS-SODl

Comparison of individuals with SVl genotypes carrying T18 with individuals with SVl genotypes that do not carry T18. Comparison is between fALS-SODl cases and controls, p = 0.017 (Likelihood ratio test).

Table 7: Contingency Table

T18 Carriage By Relationship

Table 8: Tests

Table 9: Genotype data, comparing specific diagnosis with control (p value, likelihood ratio test) for T18 carriage

The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.

Claims

THAT WHICH IS CLAIMED IS:

1. A method for detecting a short tandem repeat (STR) variant in the SOD1 , TARDBP or C9orf72 gene region, wherein said STR variant comprises a simple sequence repeat (SSR) variant of at least 10 consecutive bases, and optionally wherein the STR includes at least three, four or five length variants, said method comprising:

obtaining a biological sample from a subject, said sample comprising genomic DNA, isolating said genomic DNA from said sample, and

measuring the length of the STR variant in the SOD1, TARDBP or C9orf72 gene region.

2. The method of claim 1, wherein the S I R variant is a poly- Γ or a poly-A SSR variant.

3. The method of claim 1 or claim 2, wherein said measuring comprises Sanger DNA sequencing, a size-based assay (e.g., gel or capillary electrophoresis), or both.

4. The method of claim 1 or claim 2, wherein said measuring comprises Sanger DNA sequencing.

5. The method of claim 1 or claim 2, wherein said measuring comprises a size-based assay.

6. The method of claim 1 or claim 2, wherein said measuring comprises both Sanger DNA sequencing and a size-based assay.

7. The method of any one of claims 3-6, wherein said measuring comprises nested

PGR.

8. The method of any one of claims 1-7, wherein said STR variant is a poly-T or poly-A SSR variant between the SOD ! gene and the SCAF4 gene in chromosome 21 (e.g., at position chr21 :33,043,422-33,043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3).

9. The method of claim 8, wherein said variant comprises 14, 15, 16, 17 or 18 poly- T or poly-A residues.

10. The method of claim 8, wherein said variant comprises 14, 15 or 16 poly-T or poly-A residues.

1 1. The method of claim 8, wherein said variant comprises 17 or 18 poly-T or poly-A residues.

12. The method of claim 8, wherein said variant comprises 18 poly-T or poly-A residues.

13. The method of any one of claims 1-12, wherein said method comprises genotyping by measuring the length of the STR variant in the SODl gene region at each allele (phased or unphased).

14. The method of any one of claims 1 -13, wherein said subject carries a SODl mutation and/or a fALS-C9orf72 mutation.

15. A method for determining a diagnosis or prognosis for a neurodegenerative disease such as amyotrophic lateral sclerosis (ALS), comprising:

measuring a length of a short tandem repeat (STR) variant in the SODl, TARDBP or C9orf72 gene region, wherein said STR variant comprises a simple sequence repeat (SSR) variant of at least 10 consecutive bases, and optionally wherein the STR includes at least three, four or five length variants, and

determining said diagnosis or prognosis based upon said length.

16. The method of claim 15, wherein said measuring comprises Sanger DNA sequencing, a size-based assay (e.g., gel or capillary electrophoresis), or both.

17. The method of claim 15, wherein said measuring comprises Sanger DNA sequencing.

18. The method of claim 15, wherein said measuring comprises a size-based assay.

19. The method of claim 15, wherein said measuring comprises both Sanger DNA sequencing and a size-based assay.

20. The method of any one of claims 15-19, wherein said STR variant is a poly-T variant or poly-A variant between the SODl gene and the SCAF4 gene in chromosome 21 (e.g., at position chr21 :33,043,422-33,043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3).

21. The method of claim 20, wherein a poly-T or poly-A length of 18 indicates a diagnosis and/or more rapid progression of the neurodegenerative disease.

22. A method of treatment for a neurodegenerative disease comprising: administering a therapeutic agent to a subject determined to have a poly-T or poly-A length of 18 between the SODl gene and the SCAF4 gene in chromosome 21 (e.g., at position chr21 :33,043,422-33,043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3).

23. The method of claim 22, wherein the subject has a diagnosis or prognosis determined by a method of any one of claims 15-21.

24. The method of claim 22 or claim 23, wherein the therapeutic agent comprises: riluzole, remacemide, mematine, budipine, lamotrigine, gabapentin, retigabine, or any combination thereof;

a copper-based agent such as copper-ATSM (copper chelated with diacetylbis(4- methylthiosemicarbazone));

edaravone;

a tyrosine kinase inhibitor or an agent that boosts autophagy; or

a combination of two or more thereof.

25. A method of stratifying a subject in a clinical trial for treatment of a

neurodegenerative disease comprising: administering the treatment to a subject determined to have a poly-T or poly-A length of 18 between the SODl gene and the SCAF4 gene in chromosome 21 (e.g., at position chr21 :33,043,422-33,043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3).

26. The method of claim 25, wherein the subject has a diagnosis or prognosis determined by a method of any one of claims 15-21.

27. The method of claim 25 or claim 26. wherein the treatment comprises administering:

riluzole, remacemide, mematine, budipine, lamotrigine, gabapentin, retigabine, or any combination thereof;

a copper-based agent such as copper- ATSM (copper chelated with diacetylbis(4- methylthiosemicarbazone)) ;

edaravone;

a tyrosine kinase inhibitor or an agent that boosts autophagy; or

a combination of two or more thereof.

28. An in vitro stem cell and/or transgenic animal {e.g. , rodent such as rat or mouse) model of neurodegenerative disease, wherein the cells of said model comprise a short tandem repeat (STR) variant in the SOD1 gene region between the SOD1 gene and the SCAF4 gene in chromosome 21 (e.g., at position chr21 :33, 043, 422-33, 043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3) associated with said

neurodegenerative disease.

29. A kit for detecting a short tandem repeat (STR) variant in the SOD1 , TARDBP or C9orf72 gene region, wherein said STR variant comprises a simple sequence repeat (SSR) variant of at least 10 consecutive bases, and optionally wherein the STR includes at least three, four or five length variants, said kit comprising:

at least one reagent that specifically detects said STR variant; and

instructions for use for detecting said STR variant and determining a length thereof.

30. The kit of claim 29, wherein said at least one reagent comprises a primer useful for DNA amplification (e.g., nested per) of a genomic region containing said STR variant.

3 1 . The kit of claim 29 or claim 30, wherein said kit is for detecting said STR variant by DNA amplification and/or a size -based assay (e.g., gel or capillary electrophoresis).

32. The kit of any one of claims 29-31 , wherein the STR variant is a poly-T or a poly- A SSR variant.

33. The kit o any one of claims 29-32, wherein said STR variant is a poly-T or poly- A SSR variant between the SODl gene and the SCAF4 gene in chromosome 21 (e.g., at position chr21 :33, 043 ,422-33,043, 440 of the Genome Reference Consortium Human Genome Assembly Release GRCh37.pl 3).