WO2017205674A1 - Oncolytic vaccinia virus mutants and using same for cancer treatment - Google Patents

Oncolytic vaccinia virus mutants and using same for cancer treatment Download PDF

Info

Publication number
WO2017205674A1
WO2017205674A1 PCT/US2017/034552 US2017034552W WO2017205674A1 WO 2017205674 A1 WO2017205674 A1 WO 2017205674A1 US 2017034552 W US2017034552 W US 2017034552W WO 2017205674 A1 WO2017205674 A1 WO 2017205674A1
Authority
WO
WIPO (PCT)
Prior art keywords
mutation
gene
vacv
virus
tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/034552
Other languages
French (fr)
Inventor
Bertram Jacobs
Heather KOEHLER
William Arndt
Karen Kibler
Kelly TRAINOR
Chandra Mitnik
Jeffrey Langland
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Arizona State University ASU
Arizona State University Downtown Phoenix campus
Original Assignee
Arizona State University ASU
Arizona State University Downtown Phoenix campus
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arizona State University ASU, Arizona State University Downtown Phoenix campus filed Critical Arizona State University ASU
Priority to US16/304,564 priority Critical patent/US10842835B2/en
Publication of WO2017205674A1 publication Critical patent/WO2017205674A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/768Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24121Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24132Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent

Definitions

  • Oncolytic viruses are mutants of viruses that have been engineered to replicate in and destroy cancerous cells. Oncolytic viruses can be used to selectively infect and destroy cancerous cells, leaving the normal non-cancerous cell unharmed. This is possible because many tumors arise through genetic mutations that result in a loss of function in cellular proteins and signaling pathways such as the interferon (IFN) system. These mutations commonly result in a dysregulation of cellular anti -proliferative checkpoints, as well as defects in programmed cell death pathways, thereby allowing for unregulated cellular growth.
  • IFN interferon
  • Vaccinia virus is a member of the orthopoxvirus genus that contains a large double-stranded DNA (dsDNA) genome that encodes for numerous immune evasion proteins.
  • dsDNA double-stranded DNA
  • the large dsDNA allows for manipulation of the virus to express tumor-specific antigens or to decrease any potential side effects associated with treatment.
  • the present disclosure relates to mutant oncolytic vaccinia viruses and the use of such viruses alone and in combination with different chemotherapeutic agents for destruction of cancer cells.
  • VACV anti-viral immune response
  • VACV E3L gene product is important for inhibiting the cellular anti-viral immune response.
  • mutations within this gene lead to severe virus attenuation.
  • vaccinia virus with such mutations can selectively replicate in and destroy cancerous cells while leaving normal cells unharmed.
  • the embodiments of the present disclosure describe a method of inducing lysis of cancer cells that are deficient in an ability to activate a programmed cell death pathway.
  • the method comprises contacting said cancer cells with a vaccinia virus (VACV) having a mutation in an E3L gene of said virus, wherein said cancer cells have less than normal protein levels of one or more of a receptor-interacting protein kinase (KIP) 3, a D ' NA-dependent activator of interferon regulatory factor (DAI), and a lineage kinase domain-like protein (MLKL).
  • VACV vaccinia virus
  • embodiments are directed to a method of inducing oncolysis in a subject having a tumor, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a vaccinia virus (VAC V) having a mutation in an E3L gene of said virus. Further, the method comprising administering to the subject at least one chemotherapeutic agent.
  • a pharmaceutical composition comprising a vaccinia virus (VAC V) having a mutation in an E3L gene of said virus.
  • VAC V vaccinia virus
  • compositions for treating a cancer comprising a vaccinia vims (VACV) having a mutation in an E3L gene of said virus and a pharmaceutically acceptable carrier.
  • VACV vaccinia vims
  • the composition further comprises at least one chemotherapeutic agent.
  • Figure 1 The diagram describes deletion mutants of E3L in vaccinia virus and their PKR inhibitory, ras-dependency, and Z-NA binding characteristics.
  • Figures 2A-2D Truncation of the N-terminus of E3 results in IFN sensitivity and leads to reduced plaquing efficiency, global protein loss, loss of membrane integrity and a rapid cell death which is atypical for classical apoptosis.
  • (2B) Total cellular protein stained with coomassie blue demonstrates a global loss of protein in type-1 IFN treated cells which were subsequently infected with an E3 N-terminus truncated mutant.
  • Figures 3A-3G The Z-NA binding domain of VACV E3 functions to inhibit an IFN primed and virally induced necroptosis.
  • IFN primed necroptosis is responsible for the attenuation of E3 N- terminal mutations and is dependent on both RIP3 and DAI (ZBP-l).
  • 4A Western blot demonstrating that DAI is up-regulated by type- 1 IFN treatment.
  • 4B qPCR indicating that other necroptosis proteins are not up-regulated by pre-treatment of type-1 IFN in L929 cells.
  • 4C Virally induced death is rescued in non-necroptosis sensitive HEK293T cells co-transfected with both RIP3 and DAI but not RIP3 alone, indicating the requirement of both proteins in VACV-induced necroptosis.
  • 4D Pathogenesis of E3 N-terminal mutants is rescued in both RIP3-A mice and ZBP-l-/- (DAI-/-) mice;
  • FIGS 5A-5D 4T1 syngeneic tumors were induced in each hind flank of BALB/c mice.
  • 5 A The right side tumors only were treated three times with either PBS or with 1x10 ' pfu of VACV-E3LA54N.
  • 5B The images were taken three weeks post-treatment.
  • 5C Where the treatment was PBS (no virus), there is no brown precipitate visible in the injected tumor (top panel). The bottom right panel shows the virus presence, as expected, in the injected tumor. However, the same virus presence can be seen in the bottom left panel, showing the uninjected left tumor.
  • 5D The bottom panels indicate the presence of virus in the left side tumors (uninjected). In both types of tumors, syngeneic and xenograft, the vims spread to the uninjected left side tumor from the injected right side tumor;
  • FIG. 6 A and 6B Loss of MLKL (the executioner for the necroptosis pathway) rescues replication of VACV-E3LA83N in Interferon-treated mice.
  • A Wild type C57 mice were infected with VACV-E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. Interferon induces the necroptotic pathway, killing the virus and reducing clinical symptoms in the treated mice compared to mice not treated with interferon.
  • (B) Transgenic C57 mice with the MLKL gene knocked out were infected with VACV- E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. In the absence of MLKL, there is no necroptosis; the vims is able to replicate and cause disease even in the presence of interferon treatment, and
  • Figure 7 Melanoma cell lines screened for replication of viruses expressing a modified N-terminus of the E3 protein.
  • Melanoma cell lines were screened to identify those that will support replication of VACV-E3LA54N and VACV-E3LA83N.
  • Cell lines 952, 1 113, and 1093 support replication of both mutant viruses, while 3093 is permissive for VACV-E3LA83N only.
  • Replication of the mutant viruses indicates that the necroptotic pathway is disabled in these melanoma cell lines, and therefore these lines are good candidates for testing vims-induced regression of tumors in mice.
  • These four cell lines will be used to inoculate the flank tissue of mice: following visible tumor growth, the tumors will be treated with one of the two viruses and monitored for regression. We hypothesize that in the absence of necroptosis, the virus will replicate in the cancer cells, resulting in tumor regression. In normal (non-cancerous) ceils, the necroptosis pathway is intact, and the virus will not spread
  • Vaccinia viruses offer a promising alternative to current anti-cancer therapies, especially mutant vaccinia viruses that are interferon-sensitive.
  • Other oncolytic viruses including herpesvirus, adenovirus, and wild-type vaccinia virus constructs can still harm healthy cells.
  • the Vaccinia viruses selectively kill cancer cells, leaving healthy cells unharmed. Further, the virus is able to infect cancer cells that have a disrupted programmed cell-death pathway necessary for a defense against viruses: without an intact programmed cell- death pathway, mutant viruses are able to replicate and spread in the cancer cells. However, these same mutant viruses are blocked from replicating in normal healthy cells, which have an intact anti-viral pathway,
  • Embodiments herein relate to the mutant oncolytic vaccinia viruses and the use of such viruses alone and in combination with different chemotherapeutic agents for destruction of cancer cell s.
  • the type I interferons are a group of related proteins that are produced and secreted by mammalian cells in response to various inducers, such as double-stranded (ds)RNA and viral infection. IFNs bind to specific receptors on cells and induce an antiviral state. Cells in the antiviral state are resistant to infection by many viruses. At least two IF -induced enzymatic pathways are involved in establishment of the antiviral state.
  • IFN-induced enzymes Protein kinase RNA-activated, al so known as protein kinase R (PKR); ititerferon-induced, doubl e- stranded RNA-activated protein kinase; or eukaryotic translation initiation factor 2-aipha kinase 2 (EIF2A 2) which is an enzyme that in humans is encoded by the EIF2A 2 gene.
  • PKI protein kinase R
  • EIF2A 2 eukaryotic translation initiation factor 2-aipha kinase 2
  • Phosphorylation of e 11 - - 2 on its a subunit alters its interaction with ⁇ -2 ⁇ , leading to inhibition of initiation of translation of viral genes.
  • viruses including vaccinia virus have been shown to induce inhibitors of the Pl/eIF-2a kinase.
  • Vaccinia vims-infected mouse L cells are resistant to IFN treatment and the vaccinia virus inhibitor of the IFN-induced protein kinase is responsible for IFN resistance of vaccinia virus.
  • the vaccinia virus kinase inhibitors p25 and ⁇ 20 which are encoded by vaccinia virus open reading frame (ORF) E3L, has been reported to be a protein that interacts in a stoichiometric manner with dsRNA.
  • the E3L gene products act as inhibitors of the dsRNA-dependent Pl/eIF ⁇ 2a kinase.
  • RIP kinases are a group of threonine/serine protein kinases with a relatively conserved kinase domain but distinct non-kinase regions.
  • TNF-a tumor necrosis factor alpha
  • RIP3 is comprised of an N-terminal kinase domain similar to that found in other RIP kinases, an RHIM domain and a unique C-terminal domain that differs from all known protein domains. Overexpression of RIP3 could induce apoptosis and NF- ⁇ activation in some cell lines. TNF-a induces apoptosis in many types of cells, which can be blocked by the pan caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp(OMe)-fluoromethylketone (zVAD), but TNF-a can still trigger some cell lines to undergo necrosis when the activities of caspases are inhibited by zVAD treatment. The kinase activity of RIP3 is required for this caspase-independent cell death.
  • the mixed lineage kinase domain-like protein MLKL is a functional RIP3 substrate that binds to RIP3 through its kinase-like domain but lacks kinase activity of its own.
  • RIP3 phosphorylates MLKL at the T357 and S358 sites.
  • the phosphorylated MLKL forms an oligomer that binds to phosphatidylinositol lipids and cardiolipin. This property allows MLKL to move from the cytosoi to the plasma and intracellular membranes, where it directly disrupts membrane integrity, resulting in necrotic death.
  • DNA-dependent activator of interferon-regulatory factors functions as a cytoplasmic DNA sensor that activates the innate immune system and is implicated in antiviral responses to some DNA viruses.
  • necroptosis the level of RIP3 protein in the signaling cascade for the programmed cell death pathway known as necroptosis. Mutations in the N-terminus of the E3L protein result in the inability to suppress the necroptosis pathway. Induction of necroptosis results in inhibition of viral replication and spread in cells that retain functional necroptosis pathways.
  • the reduction in RIP3 protein levels that is common in cancer cells makes possible the selective viral replication in cancerous cells and the normal levels of RIP3 protein in non-cancerous ceils restricts the spread in healthy cells.
  • the E3L gene product of the vaccinia virus is a 190 amino acid polypeptide.
  • the E3L gene codes for several functions including a dsRNA-binding protein, a Z-DNA binding protein, and dimerization. Amino acids II 8-190 have been implicated in dsRNA binding, Amino acid numbering as used herein is adopted from Goebel et al., 1990, Virology 179:247-66, 577-63.
  • a VACV comprises a mutated E3L gene wherein at least one nucleic acid required to encode all 190 amino acids is not present.
  • a VACV comprises a mutated E3L gene wherein a fragment (VACV-E3LA83N) of the E3L gene defined by SEQ ID NO: 1 (ATGGGCCCCATAATAGATGATGTATCCCGCGAAAAATCAATGAGAGAGGATCATAA GTCTTTTGATGATGTTATTCCGGCTAAAAAAATTATTGATTGGAAAGGTGCTAACCC TGTCACCGTTATTAATGAGTACTGCCAAATTACTAGGAGAGATTGGTCTTTTCGTATT GAATCAGTGGGGCCTAGTAACTCTCCTACATTTTATGCCTGTGTAGACATCGACGGA AGAGTATTCGATAAGGCAGATGGAAAATCTAAACGAGATGCTAAAAATAATGCAGC TAAATTGGCAGTAGATAAACTTCTTGGTTACGTCATCATTAGATTCTGA) is not present.
  • a VACV A comprises a mutated E3L gene wherein a fragment of the E3L gene is at least 90% conserved of the sequenced defined by SEQ ID NO: 1 is not present.
  • a VACV comprises a mutated E3L gene wherein a fragment (VACV- E3LA54N) of the E3L gene defined by SEQ ID NO: 2 (ATGGTGTACAGCTCCGACGATATTCCTCCTCGTTGGTTTATGACAACGGAGGCGGAT AAGCCGGATGCTGATGCTGACGTCATAATAGATGATGTATCCCGCGAAAA ATCAATGAGAGAGGATCATAAGTCTTTTGATGATGTTATTCCGGCTAAAAAAATTAT TGATTGGAAAGATGCTAACCCTGTCACCATTATTAATGAGTACTGCCAAATAACTAA GAGAGATTGGTCTTTTCGTATTGAATCAGTTGGGCCTAGTAACTCTCCTACATTTTAT GCCTGTGTAGACATCGACGGAAGAGT
  • the recombinant vaccinia virus was constructed using homologous recombination, which utilizes transfection with DNA fragments or plasmids containing sequences homologous to viral DNA and infection with wild-type or recombinant vaccinia virus to achieve recombination in infected host cells.
  • marker rescue techniques were used to identify recombinant vaccinia virus. Representative methods for production of recombinant vaccinia virus by homologous
  • a method for constructing the recombinant vaccinia vims includes a step of infecting host cells with vaccinia virus from which the E3L gene has been deleted (i.e., a non-naturally occurring, mutated form of vaccinia virus).
  • the vaccinia virus used as a starting point for preparing the recombinant vaccinia virus of the invention is a naturally occurring strain.
  • the vaccinia virus used as a starting point for preparing the recombinant vaccinia virus is a non-naturally occurring or engineered strain.
  • engineered deletion mutants of Copenhagen strain are used.
  • the nucleic acid sequences of the vaccinia virus E3L gene and the left and right flanking arms are found in Earl et al., 1993, in Genetic Maps: locus maps of complex genomes, O'Brien, ed., Cold Spring Harbor Laboratory Press, 1. 1 5 7 and Goebel et al., 1990, which is hereby incorporated by reference in its entirety.
  • the amino acid numbering used herein is adopted from Goebel et al., 1990, which is hereby incorporated by reference in its entirety.
  • the vaccinia virus used for recombination may comprise other deletions, inactivations, or exogenous DNA.
  • generation of VACV with E3L N- terminal mutations results in a VACV mutant that (1) allows for selective growth and replication in cancerous cells where RIP3 protein levels are between 0% and about 50% of the protein levels for the given protein expressed in non-cancerous cells of the same type, and (2) does not tend to replicate and spread in healthy (non-cancerous ceils) due to the inability to suppress necroptosis.
  • the cancerous cells have less than normal protein levels of RIP3. Cancerous cells that have less than normal RIP3 protein levels do not undergo necroptosis when infected with specific VACV mutants, thereby allowing the VACV mutants to replicate and kill the cancer cells.
  • the VACV mutants are vaccinia viral vectors comprising one or more described E3L gene mutations. As described herein, "about” means a difference of plus or minus 1.0% in protein expression levels.
  • the present disclosure presents a method of inducing lysis of cancer ceils that are deficient in activating a programmed cell death pathway.
  • the method comprises contacting said cancer ceils with the VACV mutants.
  • VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal DAI protein levels.
  • the DAI protein levels are also between 0% and about 50% of the protein levels for the given protein expressed in non-cancerous cells of the same type.
  • VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal MLKL protein levels.
  • the MLKL protein levels are also between 0% and about 50% of the protein levels for the given protein expressed in non-cancerous ceils of the same type.
  • VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal RIP3 protein levels and DAI protein levels. In other embodiments, VAC Vs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal RIP3 protein levels and MLKL protein levels. In yet other embodiments, VAC Vs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal DAI protein levels and MLKL protein levels. In yet another embodiment, VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal RIP3 protein levels, less than normal DAI protein levels, and less than normal MLKL protein levels (or any combination thereof).
  • the present disclosure further provides a pharmaceutical composition comprising VACV mutants and a method of inducing oncolysis in a subject having a tumor by administering such composition to the subject.
  • the pharmaceutical composition for treating a cancer comprises at least one chemotherapeutic agent and a pharmaceutically acceptable carrier.
  • Traditional chemotherapeutic agents are cytotoxic, for example, by interfering with cell division (mitosis) but cancer cells van,' widely in their susceptibility to these agents. To a large extent, chemotherapy can be thought of as a way to damage or stress cells, which may then lead to ceil death if apoptosis is initiated.
  • Such agents can include, (for example, actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cispiatin,
  • this combination therapy attacks both RJP3- and REP3+ cancer cells.
  • this combination therapy attacks both RJP3- and DAI- cancer cells and RIP3+ and DAI+ cancer ceils.
  • the combination therapy can be administered in any known way and with any known pharmaceutically acceptable additives. Moreover, amounts can be based on those used for the chemotherapeutic agents and/or oncolytic vaccinia vims.
  • compositions of the invention can be prepared in liquid forms, lyophilized forms or aerosolized forms. Other optional components, e.g., stabilizers, buffers, preservatives, flavorings, excipients and the like can be added.
  • administering includes any route of introducing or delivering to a subject a compound to perform its intended function.
  • a composition comprising a peptide-tetrahedron- drug nanoparticle as provided herein is administered to a subject by any method that achieves the intended purpose or is deemed appropriate by those of skill in the art. For example, a
  • composition of the present invention can be administered as a pharmaceutical , and may be administered systemicaily or locally via oral or parenteral administration.
  • administration includes oral and parenteral administration.
  • Oral administration includes, for example, administration of oral agents.
  • Such oral agents include, for example, granules, powders, tablets, capsules, solutions, emulsions, and suspensions.
  • Parenteral administration includes, for example, administration of injections.
  • injections include, for example, subcutaneous injections, intramuscular injections, intratumoral injection, and intraperitoneal injection.
  • intravenous injections such as drip infusions, intramuscular injections, intraperitoneal injections, subcutaneous injections, suppositories, enemas, oral enteric tablets, or the like can be selected.
  • compositions can be administered to a subject in need thereof in dosage unit form where each discrete dosage unit contains a predetermined quantity of an active ingredient or compound that was calculated to elicit a desirable therapeutic effect when administered with, in some cases, a pharmaceutically acceptable carrier.
  • a therapeutically effective dose relates to the amount of a compound which is sufficient to improve the symptoms, for example a treatment, healing, prevention or
  • an "effective amount" of the pharmaceutical composition is defined herein as that amount sufficient to induce oncolysis, the disruption or lysis of a cancer cell, as well as slowing, inhibition or reduction in the growth or size of a tumor and includes the eradication of the tumor in certain instances.
  • An effective amount can also encompass an amount that results in systemic dissemination of the therapeutic virus to tumors indirectly, e.g., infection of non-injected tumors.
  • it can be advantageous to assess toxicity and therapeutic efficacy of a compound in ceil cultures or in experimental animals.
  • the LDso i.e. , the dose lethal to 50% of the population
  • EDso i.e. , the dose therapeutically effective in 50% of the population
  • oncolysis is induced in more than 90% of cells in tumors. In other embodiments, oncolysis is induced in more than 80% of ceils in tumors. In yet other embodiments, oncolysis is induced in more than 70% of cells in tumors,
  • the subject is administered one or more doses of infectious viral particles or plaque forming units (pfu), each dose containing at least 1 ⁇ 10 2 to 1 ⁇ 10 i0 or more infectious viral particles or plaque forming units (pfu), including the various values and ranges therebetween.
  • the subject may be administered one or more doses of between about 1 * 10 2 and 1 ⁇ 10 4 , between about 1 * 10 4 and 1 ⁇ 10 ⁇ , between about 1 ⁇ 10 ⁇ and 1 x 10 s or between 1 10 8 and 1 x 10 i0 pfu of virus.
  • the plaque efficiency which was measured in plaque-forming unit (PFU) ⁇ a measure of the number of particles capable of forming plaques per unit volume- was reduced 50% with mutant vaccinia virus infection compared to with wild type vaccinia virus infection in L929 cells with intact programmed cell death pathways, which were pretreated with type I interferon (IFN) between 3 and 10 U/ml for 18 hours.
  • the type of mutant vaccinia viruses used in this exemplary embodiment is an E3 N-terminus truncated mutant (VACV-E3LA83N). In other words, the ability of the mutant vaccinia viruses to replicate in L929 cells was severely attenuated compared to wild type vaccinia virus.
  • the VACV-E3LA83N-infected L929 cells were able to turn on their programmed cell death pathways and stop the replication of infecting viruses, whereas, the wild type control vaccinia virus was able to evade programmed cell death pathways in infected L929 cells and continued to replicate.
  • the L929 cells infected with wild type vaccinia viruses and VACV-E3LA83N were pretreated with type 1 [FN, RIP1 inhibitor necrostatin-1 , and pan- caspase inhibitor ZVAD-FMK, which is known to inhibit pyroptosis. Pyroptosis is uniquely dependent on caspase-1, which is not involved in apoptotic cell death and caspase-1 deficient cells respond normally to most apoptotic signals.
  • type 1 FN, RIP1 inhibitor necrostatin-1
  • pan- caspase inhibitor ZVAD-FMK pan- caspase inhibitor
  • type 1 IFN-induced plaque reduction in VACV-E3LA83N-infected 1.929 cells was inhibited by the treatment of necrostatin-1, but not by the treatment with pan-caspase inhibitor ZVAD-FMK.
  • ZVAD-FMK pan-caspase inhibitor
  • the commassie blue stained protein gel illustrates a global loss of protein in VACV-E3LA83N-infected cells is rescued by treatment with necrostatin-1.
  • the live imaging of L929 cells 6 HPI demonstrated that a drastic reduction in membrane integrity and moiphological changes in VACV-E3LA83N-infected cells is rescued by treatment with necrostatin-1.
  • the Sytox inclusion viability assay showed that a significant reduction of viability in VACV-E3LA83N-infected L929 cells at 5 HPI is rescued by the treatment with necrostatin-1.
  • FIGS. 4A and 4B DAI is upregulated by [FN treatment, which induces necroptosis in cells.
  • FIG. 4C demonstrated in this example that normal expression or upregulation of both RIP3 and DAI levels were required to induce plaque reduction and reduce cell viability in VACV-E3LA83N-infected cells after IFN treatment.
  • FIG. 4D demonstrates that in RIP3-/- mice or DAI-/- mice, VACV-E3LA83N- was able to evade the necroptotic pathway and cause disease in the animals.
  • the following symptoms were assigned a value to determine a clinical score: weight loss, sneezing, ruffled coat, lethargy or slow movement, labored breathing, and ocular infections.
  • the mutant vaccinia viruses in the present disclosure are able to selectively reproduce in RIPS -deficient, DAI-deficient, or RIP3- and DAI- deficient cells to evade the necroptotic pathway, replicate, and eventually lead to host cell lysis.
  • N -terminal mutations in a VACV essential immune- evasion protein can render VACV dependent on dvsregulated antiviral signaling pathways for replication, thus allowing for selective lysis of the cancerous cells and leaving healthy ceils unaffected.
  • VAC V-E3L N-terminal mutants were capable of spreading from the treated tumors to the untreated tumors in both a xenograph and a syngenetic mouse model.
  • 4T1 syngeneic tumors were induced in each hind flank of BALB/c mice.
  • the right side tumors only were treated three times with either PBS (A) or with lxlO 7 pfu of VACV-E3LA54N (B).
  • the images were taken three weeks post-treatment. Additionally, tissue was harvested from both syngeneic and xenograft tumors and sections were stained for VACV (indicated by- brown precipitate).
  • FIG. 5C where the treatment was PBS (no virus), there is no brown precipitate visible in the injected tumor (top panel).
  • the bottom right panel shows the virus presence, as expected, in the injected tumor. However, the same virus presence can be seen in the bottom left panel, showing the uninjected left tumor.
  • the bottom panels indicate the presence of virus in the left side tumors (uninjected). In both types of tumors, syngeneic and xenograft, the virus spread to the uninjected left side tumor from the injected right side tumor.
  • wild type C57 mice were infected with VACV- E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. Interferon induces the necroptotic pathway, killing the virus and reducing clinical symptoms in the treated mice compared to mice not treated with interferon.
  • Transgenic C57 mice with the MLKL gene knocked out were infected with VACV-E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. In the absence of MLKL, there is no necroptosis; the virus is able to replicate and cause disease even in the presence of interferon treatment.
  • mice are inoculated with the melanoma cells lines 952, 11 13, 1093, or 3093. After the tumor growth in each group of mice inoculated with one of the aforementioned melanoma cell lines, the disclosed composition comprising VACV-E3LA83 ' N is directly injected into the tumor. Subsequent regression of the injected tumor and non-injected tumor is monitored and studied.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Dermatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Methods utilizing vaccinia virus with mutations in E3L to infect and cause lysis of cancer cells with less than normal protein levels of RIP3 and/or DAI. Further, the disclosed vaccinia viruses with mutations in E3L cannot replicate well in cells with normal expression or upregulation of RIP3, DAI, and/or MLKL.

Description

[0001] This application claims priority to U.S. Provisional Patent Application No.
62/3 1,450 filed on May 25, 2016, the disclosure of which is incorporated herein by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under R01 AI095394 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND
[0003] Numerous advances have been made in cancer therapies. Despite the significant improvements in the field of oncology, the number of cancer-related deaths continues to rise. With annual increases in the number of cancer diagnoses, it is urgent to identify and develop new cancer therapies. The conventional therapies are generally effective initially but tumors continue to reoccur and/or become resistant to the initial therapies.
[0004] Oncolytic viruses are mutants of viruses that have been engineered to replicate in and destroy cancerous cells. Oncolytic viruses can be used to selectively infect and destroy cancerous cells, leaving the normal non-cancerous cell unharmed. This is possible because many tumors arise through genetic mutations that result in a loss of function in cellular proteins and signaling pathways such as the interferon (IFN) system. These mutations commonly result in a dysregulation of cellular anti -proliferative checkpoints, as well as defects in programmed cell death pathways, thereby allowing for unregulated cellular growth.
[0005] Vaccinia virus (VACV) is a member of the orthopoxvirus genus that contains a large double-stranded DNA (dsDNA) genome that encodes for numerous immune evasion proteins. The large dsDNA allows for manipulation of the virus to express tumor-specific antigens or to decrease any potential side effects associated with treatment. SUMMARY
[0006] The present disclosure relates to mutant oncolytic vaccinia viruses and the use of such viruses alone and in combination with different chemotherapeutic agents for destruction of cancer cells.
[0007] Host organisms have evolved multiple mechanisms to defend against a viral infection and parallel viruses have evolved multiple methods to subvert the host's anti -viral immune response. VACV is known to contain numerous proteins involved in blocking the cellular antiviral immune response. For example, the VACV E3L gene product is important for inhibiting the cellular anti-viral immune response. Thus, mutations within this gene lead to severe virus attenuation. However, vaccinia virus with such mutations can selectively replicate in and destroy cancerous cells while leaving normal cells unharmed.
[0008] The embodiments of the present disclosure describe a method of inducing lysis of cancer cells that are deficient in an ability to activate a programmed cell death pathway. The method comprises contacting said cancer cells with a vaccinia virus (VACV) having a mutation in an E3L gene of said virus, wherein said cancer cells have less than normal protein levels of one or more of a receptor-interacting protein kinase (KIP) 3, a D'NA-dependent activator of interferon regulatory factor (DAI), and a lineage kinase domain-like protein (MLKL).
[0009] Moreover, embodiments are directed to a method of inducing oncolysis in a subject having a tumor, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a vaccinia virus (VAC V) having a mutation in an E3L gene of said virus. Further, the method comprising administering to the subject at least one chemotherapeutic agent.
[0010] Furthermore, embodiments are directed to a pharmaceutical composition for treating a cancer, the composition comprising a vaccinia vims (VACV) having a mutation in an E3L gene of said virus and a pharmaceutically acceptable carrier. The composition further comprises at least one chemotherapeutic agent.
? BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 : The diagram describes deletion mutants of E3L in vaccinia virus and their PKR inhibitory, ras-dependency, and Z-NA binding characteristics.
[0012] Figures 2A-2D: Truncation of the N-terminus of E3 results in IFN sensitivity and leads to reduced plaquing efficiency, global protein loss, loss of membrane integrity and a rapid cell death which is atypical for classical apoptosis. (2A) Pretreatment for 18 hours with type-1 IFN resulted in a 50% reduction of plaguing efficiency of VAC V with an N-terminal truncated E3 protein at a dose between 3 and lOU/ml. (2B) Total cellular protein stained with coomassie blue demonstrates a global loss of protein in type-1 IFN treated cells which were subsequently infected with an E3 N-terminus truncated mutant. (2C) Live imaging of cells at 6 hours post infection (HP I) stained with Hoechst nuclear stain demonstrate a drastic reduction in membrane integrity and morphological changes. (2D) Sytox inclusion viability assay preformed on ceils at 5 HPI demonstrates a significant reduction of viability that is specific to cells pretreated with type- 1 IFN and infected with E3 N-terminal truncations.
[0013] Figures 3A-3G: The Z-NA binding domain of VACV E3 functions to inhibit an IFN primed and virally induced necroptosis. (3 A) Type-1 IFN induced plaque reduction is inhibited by the treatment of necrostatin-1 which acts on necroptotic proteins but is not inhibited by the pan-caspase inhibitor ZVAD-FMK, which is known to inhibit pyroptosis. (3B) Global protein loss in type-1 IFN treated cells which are subsequently infected with an E3 N-terminus truncated mutant is rescued by an inhibitor of necroptosis. (3C) Loss of membrane integrity and morphological changes in live imaging is inhibited by a necroptosis inhibitor. (3D) Loss of viability demonstrated by Sytox inclusion viability at 5 HPI was rescued by Necrostatin-1. (3E) MLKL aggregation under non-reducing conditions suggests activation of MLKL following induction of necroptosis. (3F) MLKL phosphorylation demonstrated by Western blot indicated that necroptic death is induced as early as 3 HPI. (3G) Cell titer glow cell viability assay confirms that L929 cells pretreated with type-1 IFN and infected with E3 N-terminal mutations undergo necroptosis due to inhibition of death when treated with GSK 872, which is a specific inhibitor of the kinase domain. |Ό014| Figures 4A-4D: IFN primed necroptosis is responsible for the attenuation of E3 N- terminal mutations and is dependent on both RIP3 and DAI (ZBP-l). (4A) Western blot demonstrating that DAI is up-regulated by type- 1 IFN treatment. (4B) qPCR indicating that other necroptosis proteins are not up-regulated by pre-treatment of type-1 IFN in L929 cells. (4C) Virally induced death is rescued in non-necroptosis sensitive HEK293T cells co-transfected with both RIP3 and DAI but not RIP3 alone, indicating the requirement of both proteins in VACV-induced necroptosis. (4D) Pathogenesis of E3 N-terminal mutants is rescued in both RIP3-A mice and ZBP-l-/- (DAI-/-) mice;
[0015] Figures 5A-5D: 4T1 syngeneic tumors were induced in each hind flank of BALB/c mice. (5 A) The right side tumors only were treated three times with either PBS or with 1x10 ' pfu of VACV-E3LA54N. (5B) The images were taken three weeks post-treatment.
Additionally, tissue was harvested from both syngeneic and xenograft tumors and sections were stained for VACV. (5C) Where the treatment was PBS (no virus), there is no brown precipitate visible in the injected tumor (top panel). The bottom right panel shows the virus presence, as expected, in the injected tumor. However, the same virus presence can be seen in the bottom left panel, showing the uninjected left tumor. (5D) The bottom panels indicate the presence of virus in the left side tumors (uninjected). In both types of tumors, syngeneic and xenograft, the vims spread to the uninjected left side tumor from the injected right side tumor;
[0016] Figures 6 A and 6B: Loss of MLKL (the executioner for the necroptosis pathway) rescues replication of VACV-E3LA83N in Interferon-treated mice. (A) Wild type C57 mice were infected with VACV-E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. Interferon induces the necroptotic pathway, killing the virus and reducing clinical symptoms in the treated mice compared to mice not treated with interferon. (B) Transgenic C57 mice with the MLKL gene knocked out were infected with VACV- E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. In the absence of MLKL, there is no necroptosis; the vims is able to replicate and cause disease even in the presence of interferon treatment, and
[0017] Figure 7: Melanoma cell lines screened for replication of viruses expressing a modified N-terminus of the E3 protein. Melanoma cell lines were screened to identify those that will support replication of VACV-E3LA54N and VACV-E3LA83N. Cell lines 952, 1 113, and 1093 support replication of both mutant viruses, while 3093 is permissive for VACV-E3LA83N only. Replication of the mutant viruses indicates that the necroptotic pathway is disabled in these melanoma cell lines, and therefore these lines are good candidates for testing vims-induced regression of tumors in mice. These four cell lines will be used to inoculate the flank tissue of mice: following visible tumor growth, the tumors will be treated with one of the two viruses and monitored for regression. We hypothesize that in the absence of necroptosis, the virus will replicate in the cancer cells, resulting in tumor regression. In normal (non-cancerous) ceils, the necroptosis pathway is intact, and the virus will not spread among normal cells.
DETAILED DESCRIPTION
[0018] This technology disclosed herein is described in one or more exemplary embodiments in the following description with reference to the Figures, in which like numbers represent the same or similar elements. Reference throughout this specification to "one embodiment," "an embodiment," or similar language means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present technology disclosed herein. Thus, appearances of the phrases "in one embodiment," "in an embodiment," and similar language throughout this specification may, but do not necessarily, all refer to the same embodiment.
[0019] The described features, structures, or characteristics of the technology disclosed herein may be combined in any suitable manner in one or more embodiments. In the following description, numerous specific details are recited to provide a thorough understanding of embodiments of the technology disclosed herein. One skilled in the relevant art will recognize, however, that the technology disclosed herein may be practiced without one or more of the specific details, or with other methods, components, materials, and so forth. In other instances, well-known staictures, materials, or operations are not shown or described in detail to avoid obscuring aspects of the technology disclosed herein.
[0020] Vaccinia viruses offer a promising alternative to current anti-cancer therapies, especially mutant vaccinia viruses that are interferon-sensitive. Other oncolytic viruses, including herpesvirus, adenovirus, and wild-type vaccinia virus constructs can still harm healthy cells. In certain embodiments, the Vaccinia viruses selectively kill cancer cells, leaving healthy cells unharmed. Further, the virus is able to infect cancer cells that have a disrupted programmed cell-death pathway necessary for a defense against viruses: without an intact programmed cell- death pathway, mutant viruses are able to replicate and spread in the cancer cells. However, these same mutant viruses are blocked from replicating in normal healthy cells, which have an intact anti-viral pathway,
[0021] Embodiments herein relate to the mutant oncolytic vaccinia viruses and the use of such viruses alone and in combination with different chemotherapeutic agents for destruction of cancer cell s. The type I interferons (IFNs) are a group of related proteins that are produced and secreted by mammalian cells in response to various inducers, such as double-stranded (ds)RNA and viral infection. IFNs bind to specific receptors on cells and induce an antiviral state. Cells in the antiviral state are resistant to infection by many viruses. At least two IF -induced enzymatic pathways are involved in establishment of the antiviral state. One of the IFN-induced enzymes is Protein kinase RNA-activated, al so known as protein kinase R (PKR); ititerferon-induced, doubl e- stranded RNA-activated protein kinase; or eukaryotic translation initiation factor 2-aipha kinase 2 (EIF2A 2) which is an enzyme that in humans is encoded by the EIF2A 2 gene. Once active, PKR is able to phosphorylate the eukaryotic translation initiation factor eIF-2a.
[0022] Phosphorylation of e 11 - - 2 on its a subunit alters its interaction with εΙΡ-2β, leading to inhibition of initiation of translation of viral genes. A number of viruses, including vaccinia virus have been shown to induce inhibitors of the Pl/eIF-2a kinase. Vaccinia vims-infected mouse L cells are resistant to IFN treatment and the vaccinia virus inhibitor of the IFN-induced protein kinase is responsible for IFN resistance of vaccinia virus. The vaccinia virus kinase inhibitors p25 and ρ20, which are encoded by vaccinia virus open reading frame (ORF) E3L, has been reported to be a protein that interacts in a stoichiometric manner with dsRNA. The E3L gene products act as inhibitors of the dsRNA-dependent Pl/eIF~2a kinase.
[0023] The receptor-interacting protein (RIP) kinase family members have emerged as essential sensors of intracellular and extracellular stresses. RIP kinases are a group of threonine/serine protein kinases with a relatively conserved kinase domain but distinct non-kinase regions. Programmed necrotic cell death induced by the tumor necrosis factor alpha (TNF-a) family of cytokines is dependent on a kinase cascade consisting of receptor-interacting kinases RIP1 and RIP3. RIP3 is comprised of an N-terminal kinase domain similar to that found in other RIP kinases, an RHIM domain and a unique C-terminal domain that differs from all known protein domains. Overexpression of RIP3 could induce apoptosis and NF-κΒ activation in some cell lines. TNF-a induces apoptosis in many types of cells, which can be blocked by the pan caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp(OMe)-fluoromethylketone (zVAD), but TNF-a can still trigger some cell lines to undergo necrosis when the activities of caspases are inhibited by zVAD treatment. The kinase activity of RIP3 is required for this caspase-independent cell death.
[0024] Further, the mixed lineage kinase domain-like protein MLKL is a functional RIP3 substrate that binds to RIP3 through its kinase-like domain but lacks kinase activity of its own. RIP3 phosphorylates MLKL at the T357 and S358 sites. The phosphorylated MLKL forms an oligomer that binds to phosphatidylinositol lipids and cardiolipin. This property allows MLKL to move from the cytosoi to the plasma and intracellular membranes, where it directly disrupts membrane integrity, resulting in necrotic death.
[0025] Moreover, DNA-dependent activator of interferon-regulatory factors (DAI) functions as a cytoplasmic DNA sensor that activates the innate immune system and is implicated in antiviral responses to some DNA viruses.
[0026] Recent studies have shown that many common cancers have an inherent reduction in the level of RIP3 protein in the signaling cascade for the programmed cell death pathway known as necroptosis. Mutations in the N-terminus of the E3L protein result in the inability to suppress the necroptosis pathway. Induction of necroptosis results in inhibition of viral replication and spread in cells that retain functional necroptosis pathways. The reduction in RIP3 protein levels that is common in cancer cells makes possible the selective viral replication in cancerous cells and the normal levels of RIP3 protein in non-cancerous ceils restricts the spread in healthy cells.
[0027] Mutation of the E3L gene from VACV reduced function of the protein's N-terminus and resulted in a virus that was highly debilitated for replication in normal cells (non-cancerous). Referring to FIG. 1, the E3L gene product of the vaccinia virus is a 190 amino acid polypeptide.
"7 The E3L gene codes for several functions including a dsRNA-binding protein, a Z-DNA binding protein, and dimerization. Amino acids II 8-190 have been implicated in dsRNA binding, Amino acid numbering as used herein is adopted from Goebel et al., 1990, Virology 179:247-66, 577-63. In some embodiments, a VACV comprises a mutated E3L gene wherein at least one nucleic acid required to encode all 190 amino acids is not present. In other embodiments, a VACV comprises a mutated E3L gene wherein a fragment (VACV-E3LA83N) of the E3L gene defined by SEQ ID NO: 1 (ATGGGCCCCATAATAGATGATGTATCCCGCGAAAAATCAATGAGAGAGGATCATAA GTCTTTTGATGATGTTATTCCGGCTAAAAAAATTATTGATTGGAAAGGTGCTAACCC TGTCACCGTTATTAATGAGTACTGCCAAATTACTAGGAGAGATTGGTCTTTTCGTATT GAATCAGTGGGGCCTAGTAACTCTCCTACATTTTATGCCTGTGTAGACATCGACGGA AGAGTATTCGATAAGGCAGATGGAAAATCTAAACGAGATGCTAAAAATAATGCAGC TAAATTGGCAGTAGATAAACTTCTTGGTTACGTCATCATTAGATTCTGA) is not present. In yet other embodiments, a VACV A comprises a mutated E3L gene wherein a fragment of the E3L gene is at least 90% conserved of the sequenced defined by SEQ ID NO: 1 is not present. In yet another embodiment, a VACV comprises a mutated E3L gene wherein a fragment (VACV- E3LA54N) of the E3L gene defined by SEQ ID NO: 2 (ATGGTGTACAGCTCCGACGATATTCCTCCTCGTTGGTTTATGACAACGGAGGCGGAT AAGCCGGATGCTGATGCTATGGCTGACGTCATAATAGATGATGTATCCCGCGAAAA ATCAATGAGAGAGGATCATAAGTCTTTTGATGATGTTATTCCGGCTAAAAAAATTAT TGATTGGAAAGATGCTAACCCTGTCACCATTATTAATGAGTACTGCCAAATAACTAA GAGAGATTGGTCTTTTCGTATTGAATCAGTTGGGCCTAGTAACTCTCCTACATTTTAT GCCTGTGTAGACATCGACGGAAGAGTATTCGATAAGGCAGATGGAAAATCTAAACG AGATGCTAAAAATAATGCAGCTAAATTGGCAGTAGATAAACTTCTTGGTTACGTCAT CATTAGATTCTGA). In yet another embodiment, a VACV A comprises a mutated E3L gene wherein a fragment of the E3L gene is at least 90% conserved of the sequenced defined by SEQ ID NO: 2 is not present.
[0028] In certain embodiments, the recombinant vaccinia virus was constructed using homologous recombination, which utilizes transfection with DNA fragments or plasmids containing sequences homologous to viral DNA and infection with wild-type or recombinant vaccinia virus to achieve recombination in infected host cells.
[0029] Further, marker rescue techniques were used to identify recombinant vaccinia virus. Representative methods for production of recombinant vaccinia virus by homologous
recombination are disclosed by Piecini et al., 1987, Methods in Enzymoiogy 153 :545, which is hereby incorporated by reference in its entirety. For example, in certain embodiments, a method for constructing the recombinant vaccinia vims includes a step of infecting host cells with vaccinia virus from which the E3L gene has been deleted (i.e., a non-naturally occurring, mutated form of vaccinia virus). In some embodiments, the vaccinia virus used as a starting point for preparing the recombinant vaccinia virus of the invention is a naturally occurring strain. In some embodiments, the vaccinia virus used as a starting point for preparing the recombinant vaccinia virus is a non-naturally occurring or engineered strain. In certain embodiment, engineered deletion mutants of Copenhagen strain are used.
[0030] In some embodiments, when generating recombination plasmids, the nucleic acid sequences of the vaccinia virus E3L gene and the left and right flanking arms are found in Earl et al., 1993, in Genetic Maps: locus maps of complex genomes, O'Brien, ed., Cold Spring Harbor Laboratory Press, 1. 1 5 7 and Goebel et al., 1990, which is hereby incorporated by reference in its entirety. The amino acid numbering used herein is adopted from Goebel et al., 1990, which is hereby incorporated by reference in its entirety. The vaccinia virus used for recombination may comprise other deletions, inactivations, or exogenous DNA.
[0031] In certain embodiments, generation of VACV with E3L N- terminal mutations results in a VACV mutant that (1) allows for selective growth and replication in cancerous cells where RIP3 protein levels are between 0% and about 50% of the protein levels for the given protein expressed in non-cancerous cells of the same type, and (2) does not tend to replicate and spread in healthy (non-cancerous ceils) due to the inability to suppress necroptosis. In other words, the cancerous cells have less than normal protein levels of RIP3. Cancerous cells that have less than normal RIP3 protein levels do not undergo necroptosis when infected with specific VACV mutants, thereby allowing the VACV mutants to replicate and kill the cancer cells. These same mutants are severely attenuated in healthy cells, which respond to the infection by induction of necroptosis, preventing the virus from replicating or spreading. In certain embodiments, the VACV mutants are vaccinia viral vectors comprising one or more described E3L gene mutations. As described herein, "about" means a difference of plus or minus 1.0% in protein expression levels.
[0032] The present disclosure presents a method of inducing lysis of cancer ceils that are deficient in activating a programmed cell death pathway. In certain embodiments, the method comprises contacting said cancer ceils with the VACV mutants. In certain embodiments, VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal DAI protein levels. The DAI protein levels are also between 0% and about 50% of the protein levels for the given protein expressed in non-cancerous cells of the same type. Further, in certain embodiments, VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal MLKL protein levels. The MLKL protein levels are also between 0% and about 50% of the protein levels for the given protein expressed in non-cancerous ceils of the same type.
[0033] Additionally, in certain embodiments, VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal RIP3 protein levels and DAI protein levels. In other embodiments, VAC Vs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal RIP3 protein levels and MLKL protein levels. In yet other embodiments, VAC Vs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal DAI protein levels and MLKL protein levels. In yet another embodiment, VACVs with E3L mutations allow for selective growth and replication in cancerous cells that have less than normal RIP3 protein levels, less than normal DAI protein levels, and less than normal MLKL protein levels (or any combination thereof).
[0034] The present disclosure further provides a pharmaceutical composition comprising VACV mutants and a method of inducing oncolysis in a subject having a tumor by administering such composition to the subject. Further, the pharmaceutical composition for treating a cancer comprises at least one chemotherapeutic agent and a pharmaceutically acceptable carrier. [0035] Traditional chemotherapeutic agents are cytotoxic, for example, by interfering with cell division (mitosis) but cancer cells van,' widely in their susceptibility to these agents. To a large extent, chemotherapy can be thought of as a way to damage or stress cells, which may then lead to ceil death if apoptosis is initiated. Many of the side effects of chemotherapy can be traced to damage to normal cells that divide rapidly and are thus sensitive to anti-mitotic drugs: ceils in the bone marrow, digestive tract, and hair follicles. This results in the most common side-effects of chemotherapy: myelosuppression (decreased production of blood cells, hence also immunosuppression), mucositis (inflammation of the lining of the digestive tract), and alopecia (hair loss). Because of the effect on immune cells (especially lymphocytes), chemotherapy drugs often find use in a host of diseases that result from harmful overactivity of the immune system against self (so-called autoimmunity). These include Rheumatoid arthritis, Systemic lupus erythematosus, Multiple sclerosis, Vasculitis, and many others.
[0036] Such agents can include, (for example, actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cispiatin,
chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxel, doxifluridine,
doxorubicin, epirubicin, epothiione, etoposide, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, mechlorethamine, mercaptopunne, methotrexate, mitoxantrone, oxaiiplatin, paciitaxei, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vinblastine, vincristine, vindesine, and vinorelbine). In certain embodiments, this combination therapy attacks both RJP3- and REP3+ cancer cells. Further, this combination therapy attacks both RJP3- and DAI- cancer cells and RIP3+ and DAI+ cancer ceils. The combination therapy can be administered in any known way and with any known pharmaceutically acceptable additives. Moreover, amounts can be based on those used for the chemotherapeutic agents and/or oncolytic vaccinia vims.
[0037] The term "carrier" as used herein includes any and all solvents, diluents, dispersion media, antibacterial and antifungal agents, microcapsules, liposomes, cationic lipid carriers, isotonic and absorption delaying agents, and the like. Suitable carriers are known to those of ordinary skill in the art. In certain embodiments, the compositions of the invention can be prepared in liquid forms, lyophilized forms or aerosolized forms. Other optional components, e.g., stabilizers, buffers, preservatives, flavorings, excipients and the like can be added. [0038] The term "administering" includes any route of introducing or delivering to a subject a compound to perform its intended function. A composition comprising a peptide-tetrahedron- drug nanoparticle as provided herein is administered to a subject by any method that achieves the intended purpose or is deemed appropriate by those of skill in the art. For example, a
composition of the present invention can be administered as a pharmaceutical , and may be administered systemicaily or locally via oral or parenteral administration. As used herein, the term "administration" includes oral and parenteral administration. Oral administration includes, for example, administration of oral agents. Such oral agents include, for example, granules, powders, tablets, capsules, solutions, emulsions, and suspensions. Parenteral administration includes, for example, administration of injections. Such injections include, for example, subcutaneous injections, intramuscular injections, intratumoral injection, and intraperitoneal injection. In some cases, intravenous injections such as drip infusions, intramuscular injections, intraperitoneal injections, subcutaneous injections, suppositories, enemas, oral enteric tablets, or the like can be selected.
[0039] Appropriate modes of administration can be determined based on the physical location of a tumor or tumors in the subject's body. Compositions can be administered to a subject in need thereof in dosage unit form where each discrete dosage unit contains a predetermined quantity of an active ingredient or compound that was calculated to elicit a desirable therapeutic effect when administered with, in some cases, a pharmaceutically acceptable carrier.
[0040] A therapeutically effective dose relates to the amount of a compound which is sufficient to improve the symptoms, for example a treatment, healing, prevention or
improvement of such conditions. An "effective amount" of the pharmaceutical composition is defined herein as that amount sufficient to induce oncolysis, the disruption or lysis of a cancer cell, as well as slowing, inhibition or reduction in the growth or size of a tumor and includes the eradication of the tumor in certain instances. An effective amount can also encompass an amount that results in systemic dissemination of the therapeutic virus to tumors indirectly, e.g., infection of non-injected tumors. For dosage determinations, it can be advantageous to assess toxicity and therapeutic efficacy of a compound in ceil cultures or in experimental animals. For example, the LDso (i.e. , the dose lethal to 50% of the population ) and EDso (i.e. , the dose therapeutically effective in 50% of the population) can be determined. From these calculations, dosage ranges for use in humans can be formulated. Dosage ranges can vary depending on factors such as mode of administration.
[0041] In certain embodiments, oncolysis is induced in more than 90% of cells in tumors. In other embodiments, oncolysis is induced in more than 80% of ceils in tumors. In yet other embodiments, oncolysis is induced in more than 70% of cells in tumors,
[0042] In certain embodiments, the subject is administered one or more doses of infectious viral particles or plaque forming units (pfu), each dose containing at least 1 χ 102 to 1 χ 10i0 or more infectious viral particles or plaque forming units (pfu), including the various values and ranges therebetween. For example, the subject may be administered one or more doses of between about 1 * 102 and 1 χ 104, between about 1 * 104 and 1 χ 10ϋ, between about 1 χ 10ϋ and 1 x 10s or between 1 108 and 1 x 10i0 pfu of virus.
Examples
[0043] Referring to FIGS, 2A, the plaque efficiency, which was measured in plaque-forming unit (PFU) ~ a measure of the number of particles capable of forming plaques per unit volume- was reduced 50% with mutant vaccinia virus infection compared to with wild type vaccinia virus infection in L929 cells with intact programmed cell death pathways, which were pretreated with type I interferon (IFN) between 3 and 10 U/ml for 18 hours. The type of mutant vaccinia viruses used in this exemplary embodiment is an E3 N-terminus truncated mutant (VACV-E3LA83N). In other words, the ability of the mutant vaccinia viruses to replicate in L929 cells was severely attenuated compared to wild type vaccinia virus.
[0044] Similarly, comparing L929 cells pretreated with type 1 IFN and subsequently infected with VACV-E3LA83N to ceils pretreated with type 1 IFN and infected with either wild type vaccinia viruses or mock-infected cells (control, cells are "infected" with only Tris, the virus diluent, and no virus), the live imaging of L929 cells 6 HP I demonstrated a drastic reduction in membrane integrity and morphological changes (FIG. 2C), the Sytox inclusion viability assay showed that L929 cells at 5 HP! have a significant reduction of viability (FIG. 2D); and the commassie blue stained protein gel illustrated a global loss of protein (FIG. 2B). In conclusion, the VACV-E3LA83N-infected L929 cells were able to turn on their programmed cell death pathways and stop the replication of infecting viruses, whereas, the wild type control vaccinia virus was able to evade programmed cell death pathways in infected L929 cells and continued to replicate.
[0045] Referring to FIG. 3A-3G, the L929 cells infected with wild type vaccinia viruses and VACV-E3LA83N were pretreated with type 1 [FN, RIP1 inhibitor necrostatin-1 , and pan- caspase inhibitor ZVAD-FMK, which is known to inhibit pyroptosis. Pyroptosis is uniquely dependent on caspase-1, which is not involved in apoptotic cell death and caspase-1 deficient cells respond normally to most apoptotic signals. Referring to FIG. 3 A, type 1 IFN-induced plaque reduction in VACV-E3LA83N-infected 1.929 cells was inhibited by the treatment of necrostatin-1, but not by the treatment with pan-caspase inhibitor ZVAD-FMK. This result demonstrates that by inhibiting RIPl in L929 cells, VACV-E3LA83N was able to evade the necroptotic pathways and form plaques. Further, pyroptotic pathwa inhibition did not affect the ability of VACV-E3LA83N to form plaques.
[0046] Referring to FIG. 3B, the commassie blue stained protein gel illustrates a global loss of protein in VACV-E3LA83N-infected cells is rescued by treatment with necrostatin-1.
Further, referring to FIG. 3C, the live imaging of L929 cells 6 HPI demonstrated that a drastic reduction in membrane integrity and moiphological changes in VACV-E3LA83N-infected cells is rescued by treatment with necrostatin-1. Moreover, referring to FIG. 3D, the Sytox inclusion viability assay showed that a significant reduction of viability in VACV-E3LA83N-infected L929 cells at 5 HPI is rescued by the treatment with necrostatin-1.
[0047] Now referring to FIGS. 4A and 4B, DAI is upregulated by [FN treatment, which induces necroptosis in cells. Further, FIG. 4C demonstrated in this example that normal expression or upregulation of both RIP3 and DAI levels were required to induce plaque reduction and reduce cell viability in VACV-E3LA83N-infected cells after IFN treatment.
Moreover. FIG. 4D demonstrates that in RIP3-/- mice or DAI-/- mice, VACV-E3LA83N- was able to evade the necroptotic pathway and cause disease in the animals. The following symptoms were assigned a value to determine a clinical score: weight loss, sneezing, ruffled coat, lethargy or slow movement, labored breathing, and ocular infections. [0048] Based on the above demonstration, the mutant vaccinia viruses in the present disclosure are able to selectively reproduce in RIPS -deficient, DAI-deficient, or RIP3- and DAI- deficient cells to evade the necroptotic pathway, replicate, and eventually lead to host cell lysis. Many cancerous tumors possess mutations in one or more of the cellular anti-viral signaling pathways that modify cellular growth; N -terminal mutations in a VACV essential immune- evasion protein (the product of the E3L gene) can render VACV dependent on dvsregulated antiviral signaling pathways for replication, thus allowing for selective lysis of the cancerous cells and leaving healthy ceils unaffected.
[0049] VAC V-E3L N-terminal mutants were capable of spreading from the treated tumors to the untreated tumors in both a xenograph and a syngenetic mouse model. Referring to FIGS. 5A -51), 4T1 syngeneic tumors were induced in each hind flank of BALB/c mice. The right side tumors only were treated three times with either PBS (A) or with lxlO7 pfu of VACV-E3LA54N (B). The images were taken three weeks post-treatment. Additionally, tissue was harvested from both syngeneic and xenograft tumors and sections were stained for VACV (indicated by- brown precipitate). In FIG. 5C, where the treatment was PBS (no virus), there is no brown precipitate visible in the injected tumor (top panel). The bottom right panel shows the virus presence, as expected, in the injected tumor. However, the same virus presence can be seen in the bottom left panel, showing the uninjected left tumor. Similarly, in FIG. 5D, the bottom panels indicate the presence of virus in the left side tumors (uninjected). In both types of tumors, syngeneic and xenograft, the virus spread to the uninjected left side tumor from the injected right side tumor. These data suggested that VACV- E3L N-terminal mutants could be effective oncolytic viruses for the treatment of cancer.
[0050] Referring to FIGS, 6 A and 6B, wild type C57 mice were infected with VACV- E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. Interferon induces the necroptotic pathway, killing the virus and reducing clinical symptoms in the treated mice compared to mice not treated with interferon. (B)
Transgenic C57 mice with the MLKL gene knocked out were infected with VACV-E3LA83N, either treated or not treated with interferon, and monitored daily for clinical symptoms of disease. In the absence of MLKL, there is no necroptosis; the virus is able to replicate and cause disease even in the presence of interferon treatment.
5 [0051] Referring to FIG. 7, Melanoma cell lines were screened to identify those that will support replication of VACV-E3LA54N and VACV-E3LA83N. Cell lines 952, 11 13, and 1093 support replication of both mutant viruses, while 3093 is permissive for VACV-E3LA83N only. Replication of the mutant viruses indicates that the necroptotic pathway is disabled in these melanoma cell lines, and therefore these lines are good candidates for testing virus-induced regression of tumors in mice. These four cell lines will be used to inoculate the flank tissue of mice; following visible tumor growth, the tumors will be treated with one of the two viruses and monitored for regression. We hypothesize that in the absence of necroptosis, the virus will replicate in the cancer cells, resulting in tumor regression. In normal (non-cancerous) cells, the necroptosis pathway is intact, and the virus will not spread among normal cells.
[0052] Mice are inoculated with the melanoma cells lines 952, 11 13, 1093, or 3093. After the tumor growth in each group of mice inoculated with one of the aforementioned melanoma cell lines, the disclosed composition comprising VACV-E3LA83'N is directly injected into the tumor. Subsequent regression of the injected tumor and non-injected tumor is monitored and studied.
[0053] While exemplary embodiments of the present invention have been described and illustrated in detail, it should be apparent to those of ordinary skill in the art that modification and adaptations to those embodiments may occur without departing from the scope of the present invention.

Claims

We claim: . A method of inducing lysis of cancer ceils that are deficient in an ability to activate a programmed cell death pathway, comprising contacting said cancer cells with a vaccinia virus (VACV) having a mutation in an E3L gene of said virus, wherein said cancer ceils have less than normal protein levels of at least one of a receptor-interacting protein kinase (RIP) 3, a DNA- dependent activator of interferon regulator}' factor (DAI), and a lineage kinase domain-like protein (MLKL).
2. The method of claim 1, wherein said cancer ceils have less than normal cell expression levels of both RIP3 and DAI.
3. The method of claim 1, wherein said cancer cells have less than normal cell expression levels of both RIP3 and MLKL.
4. The method of claim 1, wherein the mutation in said E3L gene is an inactivating mutation, and wherein the mutation is selected from a group consisting of a deletion mutation, a substitute mutation, and a missense mutation,
5. The method of claim 1, wherein the VACV has a mutation in the E3L gene of said virus represented by deleting a fragment of the E3L gene defined by SEQ ID NO: 1.
6. The method of claim 1, wherein the V ACV has a mutation in the E3L gene of said virus represented by deleting a fragment of the E3L gene, and the sequence of said fragment is at least 90% conserved with the sequence represented by SEQ ID NO: 1 .
7. The method of claim 1 , wherein the VAC V has a mutation in the E3L gene of said virus represented by deleting the entire E3L gene.
8. A method of inducing oncolysis in a subject having a tumor, comprising administering to the subject a therapeutic effective amount of a pharmaceutical composition comprising a vaccinia virus (VACV) having a mutation in an E3L gene of said vims.
9. The method of claim 8, wherein said tumor comprises one or more cancer cells having normal cell expression levels of a receptor-interacting protein kinase (RIP) 3, a DNA-dependent activator of interferon regulatory factor (DAI), or lineage kinase domain-like protein (ML L) and one or more cancer cells having less than normal cell expression levels of RIP3, DAI, or MLKL,
10. The method of claim 9, wherein said cancer cells have less than normal cell expression levels of both RIP3 and DAI.
1 1 . The method of claim 9, wherein said cancer cells have less than normal cell expression levels of both RIP3 and MLKL.
12. The method of claim 8, wherein the administering further comprises injection into the tumor, whereby oncolysis is induced in the tumor and in at least one tumor that is not injected with the VACV.
13. The method of claim 8, wherein the mutation in said E3L gene is an inactivating mutation, wherein the mutation is selected from the group consisting of a deletion mutation, a substitute mutation, and a missense mutation.
14. The method of claim 8, wherein the tumor is a melanoma tumor, a breast tumor, or a colon tumor.
15. The method of claim 8, further comprising administering to the subject a therapeutic effective amount of at least one chemotherapeutic agent.
6. A pharmaceutical composition of treating a cancer, comprising a vaccinia virus (VAC V) having a mutation in an E3L gene of said virus and a pharmaceutically acceptable carrier.
17. The composition of claim 16, wherein the mutation in said E3L gene is an inactivating mutation, wherein the mutation is in a gene selected from the group consisting of a deletion mutation, a substitute mutation, and a missense mutation.
18. The composition of claim 16, wherein the VACV has a mutation in the E3L gene of said virus represented by deleting a fragment of the E3L gene defined by SEQ ID NO: 1.
19. The composition of claim 16, wherein the VACV has a mutation in the E3L gene of said virus represented by deleting a fragment of the E3L gene, and the sequence of said fragment is at least 90% conserved with the sequence represented by SEQ ID NO: 1.
20. The composition of claim 16, further comprising at least one chemotherapeutic agent.
21. The composition of claim 20, wherein said at least one chemotherapeutic agent is selected from the group consisting of actinomycin, all-trans retinoic acid, azacitidine, azathioprine, bleomycin, bortezomib, carboplatin, capecitabine, cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, docetaxei, doxifluridine, doxorubicin, epirubicin, epothilone, etoposide, fiuorouracii, gemcitabine, hydroxyurea, idarubicin, imatinib, irmotecan, mechiorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaiiplatin, paclitaxei, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vinblastine, vincristine, vindesine, and vinoreibine.
PCT/US2017/034552 2016-05-25 2017-05-25 Oncolytic vaccinia virus mutants and using same for cancer treatment Ceased WO2017205674A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/304,564 US10842835B2 (en) 2016-05-25 2017-05-25 Oncolytic vaccinia virus mutants and using same for cancer treatment

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662341450P 2016-05-25 2016-05-25
US62/341,450 2016-05-25

Publications (1)

Publication Number Publication Date
WO2017205674A1 true WO2017205674A1 (en) 2017-11-30

Family

ID=60412621

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/034552 Ceased WO2017205674A1 (en) 2016-05-25 2017-05-25 Oncolytic vaccinia virus mutants and using same for cancer treatment

Country Status (2)

Country Link
US (1) US10842835B2 (en)
WO (1) WO2017205674A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10512662B2 (en) 2016-02-25 2019-12-24 Memorial Sloan Kettering Cancer Center Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy
US10548930B2 (en) 2015-04-17 2020-02-04 Memorial Sloan Kettering Cancer Center Use of MVA or MVAΔE3L as immunotherapeutic agents against solid tumors
US10639366B2 (en) 2015-02-25 2020-05-05 Memorial Sloan Kettering Cancer Center Use of inactivated nonreplicating modified vaccinia virus Ankara (MVA) as monoimmunotherapy or in combination with immune checkpoint blocking agents for solid tumors
US10736962B2 (en) 2016-02-25 2020-08-11 Memorial Sloan Kettering Cancer Center Recombinant MVA or MVADELE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors
US10842835B2 (en) 2016-05-25 2020-11-24 Arizona Board Of Regents On Behalf Of Arizona State University Oncolytic vaccinia virus mutants and using same for cancer treatment
WO2021040064A1 (en) * 2019-08-26 2021-03-04 주식회사 바이오녹스 Pharmaceutical composition comprising vaccinia virus and hydroxyurea as active ingredient for treatment of cancer
EP3760213A4 (en) * 2018-02-28 2021-12-01 Bionoxx Inc. PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING CANCER, CONSISTING OF ANTI-CANCER VIRUS AND HYDROXYUREA AS ACTIVE INGREDIENTS
US11242509B2 (en) 2017-05-12 2022-02-08 Memorial Sloan Kettering Cancer Center Vaccinia virus mutants useful for cancer immunotherapy
CN114630683A (en) * 2019-08-29 2022-06-14 拜耳诺克斯有限公司 Pharmaceutical composition for treating cancer comprising vaccinia virus and granulocytopoiesis inhibitor as active ingredients
US11458203B2 (en) 2017-05-08 2022-10-04 Arizona Board Of Regents On Behalf Of Arizona State University Pharmaceutical compositions comprising caffeic acid chelates
US12252702B2 (en) 2018-09-15 2025-03-18 Memorial Sloan Kettering Cancer Center Recombinant poxviruses for cancer immunotherapy

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050028226A1 (en) * 2001-09-11 2005-02-03 Volker Erfle Vaccinia virus mva-e3L-knockout-mutants and use thereof
US20060008470A1 (en) * 2002-07-24 2006-01-12 Bertram Jacobs Use of vaccinia virus deleted for the E3L gene as a vaccine vector
US20070036758A1 (en) * 2003-07-08 2007-02-15 Bertram Jacobs Mutants of vaccinia virus as oncolytic agents
US20100203147A1 (en) * 1999-11-12 2010-08-12 Oncolytics Biotech Inc. Viruses for the Treatment of Cellular Proliferative Disorders

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69233158T2 (en) 1991-03-07 2004-05-13 Connaught Technology Corp., Greenville GENETICALLY MANUFACTURED STRAIN FOR VACCINES
US20030044384A1 (en) 1997-10-09 2003-03-06 Pro-Virus, Inc. Treatment of neoplasms with viruses
IL145899A0 (en) 1999-04-15 2002-07-25 Pro Virus Inc Treatment of neoplasms with viruses
WO2000073487A1 (en) 1999-05-27 2000-12-07 Arizona Board Of Regents Novel viral vectors having enhanced effectiveness with dramatically reduced virulence
US7306902B2 (en) 2002-06-28 2007-12-11 Oncolyties Biotech Inc. Oncolytic viruses as phenotyping agents for neoplasms
US6750043B2 (en) 2001-04-19 2004-06-15 Arizona Board Of Regents Viral vectors having reduced virulence
KR20080084528A (en) * 2007-03-15 2008-09-19 제네렉스 바이오테라퓨틱스 인크. Oncolytic Vaccinia Virus Cancer Treatment
WO2017205674A1 (en) 2016-05-25 2017-11-30 Arizona Board Of Regents On Behalf Of Arizona State University Oncolytic vaccinia virus mutants and using same for cancer treatment

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100203147A1 (en) * 1999-11-12 2010-08-12 Oncolytics Biotech Inc. Viruses for the Treatment of Cellular Proliferative Disorders
US20050028226A1 (en) * 2001-09-11 2005-02-03 Volker Erfle Vaccinia virus mva-e3L-knockout-mutants and use thereof
US20060008470A1 (en) * 2002-07-24 2006-01-12 Bertram Jacobs Use of vaccinia virus deleted for the E3L gene as a vaccine vector
US20070036758A1 (en) * 2003-07-08 2007-02-15 Bertram Jacobs Mutants of vaccinia virus as oncolytic agents

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LANGLAND ET AL.: "The role of the PKR-inhibitory genes, E3L and K3L, in determining vaccinia virus host range", VIROLOGY, vol. 299, no. 1, 20 July 2002 (2002-07-20), pages 133 - 141, XP004469509 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10639366B2 (en) 2015-02-25 2020-05-05 Memorial Sloan Kettering Cancer Center Use of inactivated nonreplicating modified vaccinia virus Ankara (MVA) as monoimmunotherapy or in combination with immune checkpoint blocking agents for solid tumors
US11426460B2 (en) 2015-02-25 2022-08-30 Memorial Sloan Kettering Cancer Center Use of inactivated nonreplicating modified vaccinia virus Ankara (MVA) as monoimmunotherapy or in combination with immune checkpoint blocking agents for solid tumors
US11253560B2 (en) 2015-04-17 2022-02-22 Memorial Sloan Kettering Cancer Center Use of MVA or MVAΔE3L as immunotherapeutic agents against solid tumors
US10548930B2 (en) 2015-04-17 2020-02-04 Memorial Sloan Kettering Cancer Center Use of MVA or MVAΔE3L as immunotherapeutic agents against solid tumors
US12397029B2 (en) 2015-04-17 2025-08-26 Memorial Sloan Kettering Cancer Center Use of MVA or MVADELTAE3L as immunotherapeutic agents against solid tumors
US11541087B2 (en) 2016-02-25 2023-01-03 Memorial Sloan Kettering Cancer Center Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy
US11986503B2 (en) 2016-02-25 2024-05-21 Memorial Sloan Kettering Cancer Center Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy
US12036279B2 (en) 2016-02-25 2024-07-16 Memorial Sloan Kettering Cancer Center Recombinant MVA or MVADELE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors
US10512662B2 (en) 2016-02-25 2019-12-24 Memorial Sloan Kettering Cancer Center Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy
US10736962B2 (en) 2016-02-25 2020-08-11 Memorial Sloan Kettering Cancer Center Recombinant MVA or MVADELE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors
US11285209B2 (en) 2016-02-25 2022-03-29 Memorial Sloan Kettering Cancer Center Recombinant MVA or MVAΔE3L expressing human FLT3L and use thereof as immuno-therapeutic agents against solid tumors
US10765711B2 (en) 2016-02-25 2020-09-08 Memorial Sloan Kettering Cancer Center Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human FLT3L or GM-CSF for cancer immunotherapy
US10842835B2 (en) 2016-05-25 2020-11-24 Arizona Board Of Regents On Behalf Of Arizona State University Oncolytic vaccinia virus mutants and using same for cancer treatment
US11458203B2 (en) 2017-05-08 2022-10-04 Arizona Board Of Regents On Behalf Of Arizona State University Pharmaceutical compositions comprising caffeic acid chelates
US11242509B2 (en) 2017-05-12 2022-02-08 Memorial Sloan Kettering Cancer Center Vaccinia virus mutants useful for cancer immunotherapy
US11884939B2 (en) 2017-05-12 2024-01-30 Memorial Sloan Kettering Cancer Center Vaccinia virus mutants useful for cancer immunotherapy
AU2019226906B2 (en) * 2018-02-28 2023-02-02 Bionoxx Inc. Pharmaceutical composition for preventing or treating cancer comprising anticancer virus and hydroxyurea as effective components
EP3760213A4 (en) * 2018-02-28 2021-12-01 Bionoxx Inc. PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING CANCER, CONSISTING OF ANTI-CANCER VIRUS AND HYDROXYUREA AS ACTIVE INGREDIENTS
EP4342985A3 (en) * 2018-02-28 2024-06-05 Bionoxx Inc. Pharmaceutical composition for preventing or treating cancer comprising anticancer virus and hydroxyurea as effective components
US12252702B2 (en) 2018-09-15 2025-03-18 Memorial Sloan Kettering Cancer Center Recombinant poxviruses for cancer immunotherapy
WO2021040064A1 (en) * 2019-08-26 2021-03-04 주식회사 바이오녹스 Pharmaceutical composition comprising vaccinia virus and hydroxyurea as active ingredient for treatment of cancer
JP7326663B2 (en) 2019-08-26 2023-08-16 バイオノックス インコーポレイテッド Pharmaceutical composition containing vaccinia virus and hydroxyurea as active ingredients for the treatment of cancer
AU2019463579B2 (en) * 2019-08-26 2024-08-08 Bionoxx Inc. Pharmaceutical composition comprising vaccinia virus and hydroxyurea as active ingredient for treatment of cancer
JP2022546798A (en) * 2019-08-26 2022-11-09 バイオノックス インコーポレイテッド Pharmaceutical composition containing vaccinia virus and hydroxyurea as active ingredients for the treatment of cancer
EP4023235A4 (en) * 2019-08-29 2023-03-29 Bionoxx Inc. Pharmaceutical composition for treating cancer, comprising vaccinia virus and granulopoiesis inhibitor as active ingredients
AU2020337054B9 (en) * 2019-08-29 2024-11-07 Bionoxx Inc. Pharmaceutical composition for treating cancer, comprising vaccinia virus and granulopoiesis inhibitor as active ingredients
CN114630683A (en) * 2019-08-29 2022-06-14 拜耳诺克斯有限公司 Pharmaceutical composition for treating cancer comprising vaccinia virus and granulocytopoiesis inhibitor as active ingredients

Also Published As

Publication number Publication date
US10842835B2 (en) 2020-11-24
US20190183947A1 (en) 2019-06-20

Similar Documents

Publication Publication Date Title
US10842835B2 (en) Oncolytic vaccinia virus mutants and using same for cancer treatment
Dixon et al. African swine fever virus evasion of host defences
Kim et al. Systemic armed oncolytic and immunologic therapy for cancer with JX-594, a targeted poxvirus expressing GM-CSF
Guo et al. Oncolytic immunotherapy: dying the right way is a key to eliciting potent antitumor immunity
US20230022757A1 (en) Modified vaccinia vectors
Kirn et al. Targeted and armed oncolytic poxviruses: a novel multi-mechanistic therapeutic class for cancer
KR102190326B1 (en) Recombinant vaccinia virus and uses thereof
KR100196204B1 (en) Paramutity Inducer Based on Combination of Foxvirus Ingredients, Method of Preparation thereof, and Use in Pharmaceutical Products
US20070036758A1 (en) Mutants of vaccinia virus as oncolytic agents
CA2494844A1 (en) Methods and compositions concerning poxviruses and cancer
CN102703389A (en) Poxviral oncolytic vectors
Lee et al. Generation of novel oncolytic vaccinia virus with improved intravenous efficacy through protection against complement-mediated lysis and evasion of neutralization by vaccinia virus-specific antibodies
Pelin et al. Engineering vaccinia virus as an immunotherapeutic battleship to overcome tumor heterogeneity
CN118871455A (en) Improved vaccinia virus vector
Garmaroudi et al. Therapeutic efficacy of oncolytic viruses in fighting cancer: recent advances and perspective
Friebe et al. Characterization of immunostimulatory components of orf virus (parapoxvirus ovis)
Ghose et al. Oncolytic herpes simplex virus infects myeloma cells in vitro and in vivo
Yang et al. Combinatory effects of vaccinia virus VG9 and the STAT3 inhibitor Stattic on cancer therapy: R. Yang et al.
Le Bœuf et al. United virus: the oncolytic tag-team against cancer!
US8613915B2 (en) Attenuated strain of myxoma virus for use as an oncolytic drug
Lettieri et al. Progress of oncolytic viruses in sarcomas
García et al. Antitumoral activity of oncolytic vaccinia virus expressing the interferon-induced ds-RNA dependent protein kinase PKR
HK40088421A (en) Modified vaccinia vectors
Ejaz et al. Oncolytic Virotherapy Against Breast Cancer
Subramanian Necroptosis: Role in Poxvirus Pathogenesis and Oncolytic Virotherapy

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17803619

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17803619

Country of ref document: EP

Kind code of ref document: A1