WO2017186739A1 - Oligonucleotides to treat eye disease - Google Patents

Oligonucleotides to treat eye disease Download PDF

Info

Publication number
WO2017186739A1
WO2017186739A1 PCT/EP2017/059830 EP2017059830W WO2017186739A1 WO 2017186739 A1 WO2017186739 A1 WO 2017186739A1 EP 2017059830 W EP2017059830 W EP 2017059830W WO 2017186739 A1 WO2017186739 A1 WO 2017186739A1
Authority
WO
WIPO (PCT)
Prior art keywords
aon
ush2a
mrna
seq
aons
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/059830
Other languages
English (en)
French (fr)
Inventor
Hester Catharina VAN DIEPEN
Hee Lam Chan
Janne Juha TURUNEN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ProQR Therapeutics II BV
Original Assignee
ProQR Therapeutics II BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020187031243A priority Critical patent/KR102368920B1/ko
Priority to EA201892431A priority patent/EA201892431A1/ru
Priority to CA3021899A priority patent/CA3021899A1/en
Priority to EP17721984.7A priority patent/EP3448999B1/en
Priority to AU2017257292A priority patent/AU2017257292A1/en
Priority to US16/096,038 priority patent/US10617707B2/en
Priority to PL17721984T priority patent/PL3448999T3/pl
Priority to JP2019506546A priority patent/JP7043082B2/ja
Priority to MX2018013003A priority patent/MX2018013003A/es
Priority to CN201780025611.3A priority patent/CN109072239A/zh
Priority to DK17721984.7T priority patent/DK3448999T3/da
Priority to ES17721984T priority patent/ES2801823T3/es
Application filed by ProQR Therapeutics II BV filed Critical ProQR Therapeutics II BV
Publication of WO2017186739A1 publication Critical patent/WO2017186739A1/en
Priority to ZA2018/06628A priority patent/ZA201806628B/en
Priority to IL262199A priority patent/IL262199B/en
Anticipated expiration legal-status Critical
Priority to US16/811,848 priority patent/US11123360B2/en
Priority to US17/475,795 priority patent/US20210401871A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/333Modified A
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • the invention relates to the fields of medicine and immunology.
  • it relates to novel antisense oligonucleotides for the treatment, prevention and/or delay of Usher Syndrome type II and/or USH2A-associated non syndromic retina degeneration.
  • USH Usher Syndrome
  • NSRP non-syndromic retinitis pigmentosa
  • USH is clinically and genetically heterogeneous and by far the most common type of inherited deaf-blindness in humans.
  • the hearing impairment in USH patients is mostly stable and congenital and can be partly compensated by hearing aids or cochlear implants.
  • NSRP is more prevalent than USH, occurring in 1 per 4,000 individuals.
  • the degeneration of photoreceptor cells in USH and NSRP is progressive and often leads to complete blindness between the third and fourth decade of life, thereby leaving time for therapeutic intervention. Mutations in the USH2A gene are the most frequent cause of both disorders.
  • the range of mutations is spread throughout all 72 USH2A exons and their flanking intron sequences, and contains nonsense and missense mutations, deletions, duplications, large rearrangements, and splicing variants.
  • the by far most frequently mutated exon is exon 13, which contains two founder mutations (c.2299delG (p.E767SfsX21 ) in Usher Syndrome type II (USH2) patients and c.2276G>T (p.C759F) in NSRP patients).
  • AON antisense oligonucleotide
  • this methodology can be used in two ways: a) to redirect normal splicing of genes in which mutations activate cryptic splice sites and b) to skip exons that carry (protein-truncating) mutations in such a way, that the reading frame of the mRNA remains intact and a (partially) functional protein is made.
  • a) to redirect normal splicing of genes in which mutations activate cryptic splice sites and b) to skip exons that carry (protein-truncating) mutations in such a way, that the reading frame of the mRNA remains intact and a (partially) functional protein is made.
  • 28 of the 72 exons can potentially be skipped without disturbing the overall reading frame of the transcript.
  • Both AON- based methods are being successfully applied in patients with severe genetic disorders. Liquori et al. (2016.
  • Hum Mutat 37: 184-193 showed that an AON could prevent the inclusion of a 155 bp pseudo exon 50 (PE 50), caused by the c.9959.4159A>G mutation in intron 50, in the mRNA of the USH2A gene.
  • PE 50 pseudo exon 50
  • the present invention relates to an antisense oligonucleotide (AON) that is able to induce skipping of pseudo exon 40 (PE40) from human USH2A pre-mRNA, wherein the inclusion of the pseudo exon is due to the c.7595-2144A>G in the USH2A gene, and wherein said AON comprises a sequence selected from any of the following groups of sequences: (i) SEQ ID NO:6, 4, 8, 23, 30, 31 , 32, 37; (ii) SEQ ID NO:3, 5, 7, 19, 24, 25, 26, 34, 35, 36; and (iii) SEQ ID NO:21 , 27, 28, 29.
  • AON antisense oligonucleotide
  • the invention in another embodiment, also relates to an AON that is capable to inducing skipping of PE40 from human USH2A pre-mRNA, wherein said AON comprises a sequence that is complementary to at least 18, 19, 20, 21 , 22, 23, or 24 consecutive nucleotides of SEQ ID NO:45, 46 or 47.
  • the AON of the present invention has a length of 18 to 143 nucleotides, preferably 18 to 40 nucleotides, more preferably 18 to 30 nucleotides, even more preferably 18 to 24 nucleotides, and most preferably consists of a sequence selected from the group consisting of SEQ ID NO:6, 3, 4, 5, 7, 8, 19, 21 , 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 34, 35, 36, and 37, preferably selected from SEQ ID NO:6, 3, 4, 5, 7, 8, 26, 34, 35, and 37, more preferably selected from SEQ ID NO:6, 3, 4, 5, 7, 8, 26, and 35.
  • the AON according to the invention comprises a 2'-0-alkyl phosphorothioate antisense oligonucleotide, such as 2'-0-methyl modified ribose (RNA), 2'-0- ethyl modified ribose, 2'-0-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives.
  • RNA 2'-0-methyl modified ribose
  • ethyl modified ribose 2'-0-propyl modified ribose
  • substituted derivatives of these modifications such as halogenated derivatives.
  • One or more nucleotides within the AON of the present invention may be modified by a 2'-0-methoxyethyl modification.
  • the invention further relates to a set of AONs comprising at least two AONs as claimed herein.
  • the invention also relates to a viral vector expressing an AON according to the invention, when placed under conditions conducive to expression of the AON.
  • the invention relates to a pharmaceutical composition comprising an AON according to the invention, or a set of AONs according to the invention, or a viral vector according to the invention, and a pharmaceutically acceptable excipient.
  • the invention further relates to an AON, a set, a vector or a composition according to the invention, for use in the treatment of a USH2A related disease or condition, such as Usher Syndrome type II, requiring modulating splicing of USH2A pre- mRNA.
  • Figure 1 shows the reverse transcriptase results of the initial screening of seven alternative antisense oligonucleotides that were compared for PE40 exon skipping efficiency in comparison with two known antisense oligonucleotides from the art (AON1 and AON2: R1 and R2 respectively) and an unrelated control oligonucleotide (ctrl), using a reporter construct in HEK293 cells, showing a clear increase in signal after administering USH2a-PE40-3, -5 and -7.
  • the lower panel shows the approximate positions of the different AONs in respect of the PE40 sequence.
  • Figure 2 shows the PE40 sequence (bold and underlined, and split in two parts) from 5' to 3', and the binding sites for the different AONs tested herein.
  • the SEQ ID NO of each tested AON is given between brackets, names are given in Table 1.
  • the first nucleotide downstream of the PE40 sequence is a guanosine (G) which represents the c.7595-2144A>G mutation.
  • Positions for AON1 (1 ) and AON2 (2) are given directly below the PE40 sequence. Italic sequences are up- and downstream sequences of PE40.
  • USH2a-PE40-3 SEQ ID NO: 19, bold
  • USH2a- PE40-5 SEQ ID NO:21 , bold
  • USH2a-PE40-7 SEQ ID NO:23, bold
  • Figure 3 shows the reverse transcriptase results of the PE40 skip screening of a set of oligonucleotides that were based on USH2a-PE40-3, -5 and -7, shown in Figure 1 and 2.
  • AONs USH2a-PE40-8 and -11 (based on USH2a-PE40-3) and USH2a-PE40-17 (based on USH2a-PE40-7) showed a further increased intensity, suggesting a further improvement over the known oligonucleotides from the art.
  • Figure 4 shows the reverse transcriptase results of the PE40 skip screening of a set of oligonucleotides that were taken one step further and were based on USH2a-PE40-8, -1 1 , and - 17. Short means shorter than the original.
  • 5mC means 5-methyl-cytosine (see also Table 1 ).
  • DAP means 2, 6-diaminopurine.
  • Figure 5 shows a bar diagram representing the number of droplets expressing PE40 (left bars for each AON) as compared to wild type products (right bars for each AON), corrected for beta- glucuronidase expression from the GUSB gene (housekeeping gene) as a standard, and as frequently used as such by the person skilled in the art, in USH2 patient fibroblasts, treated with eight different oligonucleotides, as outlined in example 1.
  • Figure 6 shows the results of an immunogenicity and immunotoxicity assessment of the indicated USH2a-PE40 AONs in human PBMCs.
  • A Heat map depicting the fold changes and significance levels of cytokine concentrations in culture supernatant after 24 h stimulation of human PBMCs with oligonucleotides as disclosed herein, or the positive controls LPS (100 ng/ml) and R848 (1 ⁇ ) compared to saline-treated human PBMCs. Every square shows the fold change per treatment condition for each measured cytokine.
  • B Heat map depicting the fold changes and significance levels of cytokine concentrations in culture supernatant after 24 h stimulation of human PBMCs with oligonucleotides as disclosed herein, or the positive controls LPS (100 ng/ml) and R848 (1 ⁇ ) compared to saline-treated human PBMCs. Every square shows the fold change per treatment condition for each measured cytokine.
  • B Heat map depicting the fold changes
  • Relative number of viable PBMCs expressed as fold change of Resorufin fluorescence compared to saline treated PBMCs after 24 h exposure to four different USH2a-PE40 antisense oligonucleotides of the present invention, or the positive controls.
  • Viable cell assessment was performed using the CellTiter-Blue ® kit (Promega) using the protocols of the manufacturer. For all individual biological replicates, fold changes were calculated by normalizing measured RFU against geometric mean of corresponding triplicate saline control. Results are shown per individual donor as the mean ⁇ SEM of the triplicate fold change, normalized against the mean of its corresponding saline control (dotted line). Repeated measures One-way ANOVA with Dunnett test for multiple corrections (compared to saline) was performed.
  • Figure 7 shows the results of PE40 skipping in USH2A pre-mRNA in optic cups generated from fibroblasts obtained from a heterozygous USH2 patient after treatment with USH2a-PE40-24.
  • the four left lanes show the results in optic cups generated from fibroblasts from a healthy donor, and the subsequent three lanes show the results with optic cups from the USH2 patient fibroblasts.
  • the control oligonucleotide is an unrelated oligonucleotide not complementary to USH2A pre-mRNA.
  • the negative control on the right does not contain nucleic acid material.
  • the control lane 5 shows two dominant bands, the upper band representing the mRNA comprising the PE40 sequence and the lower fat band representing the mRNA lacking the PE40 sequence.
  • Treatment with USH2a-PE40-24 results in complete skipping of PE40 from the pre-mRNA as no upper bands were detectable.
  • the terms "the inclusion of aberrant pseudo exon”, “the inclusion of aberrant pseudo exon 40” or “the inclusion of aberrant 152 bp nucleotide pseudo exon” are considered to be synonymous, and considered to mean the inclusion of pseudo exon 40 (PE40) of the USH2A gene into the mRNA, or the inclusion of a part thereof or a sequence comprising 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100% of that sequence into the USH2A mRNA.
  • exon skipping is herein defined as inducing, producing or increasing production within a cell of a mature mRNA that does not contain a particular exon that would be present in the mature mRNA without exon skipping. Exon skipping is achieved by providing a cell expressing the pre-mRNA of said mature mRNA with a molecule capable of interfering with sequences such as, for example, the (cryptic) splice donor or (cryptic) splice acceptor sequence required for allowing the enzymatic process of splicing, or with a molecule that is capable of interfering with an exon inclusion signal required for recognition of a stretch of nucleotides as an exon to be included in the mature mRNA; such molecules are herein referred to as exon skipping molecules.
  • exon skipping relates to skipping PE40.
  • pre-mRNA refers to a non-processed or partly processed precursor mRNA that is synthesized from a DNA template of a cell by transcription, such as in the nucleus.
  • exon retention relates to the production within a cell of a mature mRNA that includes a particular exon when no exon skipping of that exon has taken place while processing the pre- mRNA through the splicing reaction.
  • PE40 that is normally not present in the mature mRNA from the human USH2A gene when it is wild type, retains in the mature mRNA from the human USH2A gene when a particular mutation makes that the PE40 is not spliced out from the pre-mRNA, as occurs in the presence of the c.7595-2144A>G mutation as discussed in detail herein.
  • the aim of the present invention is to prevent, inhibit, or reduce exon retention of PE40 in the human USH2A mRNA, thereby preventing, delaying and/or treating Usher Syndrome type II.
  • antisense oligonucleotide is understood to refer to a nucleotide sequence that is substantially complementary to a target nucleotide sequence in a pre-mRNA molecule, heterogeneous nuclear RNA (hnRNA) or mRNA molecule.
  • the target sequences of the oligonucleotides of the present invention are provided herein.
  • the degree of complementarity (or substantial complementarity) of the antisense sequence is preferably such that a molecule comprising the antisense sequence can form a stable hybrid with the target nucleotide sequence in the RNA molecule under physiological conditions.
  • antisense oligonucleotide its abbreviation “AON” and the term “oligonucleotide” are used interchangeably herein and are understood to refer to an oligonucleotide comprising an antisense sequence.
  • the antisense oligonucleotide is preferably single-stranded and preferably does not self-anneal, either to itself or another AON of the same kind.
  • substantially complementary used in the context of the invention indicates that some mismatches in the antisense sequence are allowed as long as the functionality, i.e. inducing skipping of PE40 is still acceptable.
  • proliferative exon skipping is herein defined as inducing, stimulating, causing, enhancing, producing or increasing production within a cell of a mature mRNA that does not contain a particular intronic region or pseudo exon that would be present in the mature mRNA without pseudo exon skipping.
  • Pseudo exon skipping is achieved by providing a cell expressing the pre- mRNA of said mature mRNA with a molecule capable of interfering with sequences such as, for example, the (cryptic) splice donor or (cryptic) splice acceptor sequence required for allowing the enzymatic process of splicing, or with a molecule that is capable of interfering with a pseudo exon inclusion signal required for recognition of a stretch of nucleotides as a pseudo exon to be included in the mature mRNA; such molecules are herein referred to as pseudo exon skipping molecules.
  • sequences such as, for example, the (cryptic) splice donor or (cryptic) splice acceptor sequence required for allowing the enzymatic process of splicing, or with a molecule that is capable of interfering with a pseudo exon inclusion signal required for recognition of a stretch of nucleotides as a pseudo exon to be included in the mature mRNA; such molecules
  • the complementarity is from 90% to 100%. In general this allows for 1 or 2 mismatches in an oligonucleotide of 20 nucleotides or 1 , 2, 3 or 4 mismatches in an oligonucleotide of 40 nucleotides, or 1 , 2, 3, 4, 5 or 6 mismatches in an oligonucleotide of 60 nucleotides, etc.
  • an exon skipping AON as defined herein can be a compound that binds and/or is complementary to a specified sequence.
  • Methods for screening AONs that bind specific nucleotide sequences are, for example, disclosed in WO 2002/024906, US 6,875,736 and WO 2016/005514, which are herein incorporated by reference. Binding to specified sequences, preferably in the context of the aberrant 152 nucleotide USH2A pseudo exon 40 (PE40), may be assessed via techniques known to the skilled person.
  • a preferred technique is gel mobility shift assay as described in EP1619249.
  • a (pseudo) exon skipping AON is said to bind as soon as a binding of said molecule to a labeled sequence is detectable in a gel mobility shift assay.
  • a "(pseudo) exon skipping molecule” is an AON.
  • Designing an AON for the purpose of the present invention is of particular relevance.
  • at least one of the following aspects has to be taken into account for designing, improving said exon skipping molecule: (1 ) the AON preferably does not contain a CpG or a stretch of CpG motifs; and (2) the AON has acceptable RNA binding kinetics and/or thermodynamic properties.
  • the presence of CpG or a stretch of CpG motifs in an oligonucleotide is usually associated with an increased immunogenicity of said oligonucleotide.
  • Immunogenicity may be assessed in an animal model by assessing the presence of CD4+ and/or CD8+ cells and/or inflammatory mononucleocyte infiltration. It may also be assessed in blood of an animal or of a human being treated with an oligonucleotide of the invention by detecting the presence of a neutralizing antibody and/or an antibody recognizing said oligonucleotide using a standard immunoassay known to the skilled person.
  • An inflammatory reaction, type l-like interferon production, IL-12 production and/or an increase in immunogenicity may be assessed by detecting the presence or an increasing amount of a neutralizing antibody or an antibody recognizing said oligonucleotide using a standard immunoassay.
  • the invention relates to an AON with acceptable RNA binding kinetics and/or thermodynamic properties.
  • the RNA binding kinetics and/or thermodynamic properties are at least in part determined by the melting temperature of an oligonucleotide (Tm; calculated with the oligonucleotide properties calculator (www. unc. edu/-cail/biotool/oligo/index. html) for single stranded RNA using the basic Tm and the nearest neighbor model), and/or the free energy of the AON-target exon complex (using RNA structure version 4.5).
  • Tm oligonucleotide
  • An acceptable Tm and free energy depend on the sequence of the oligonucleotide. Therefore, it is difficult to give preferred ranges for each of these parameters.
  • An acceptable Tm may be ranged between 35 and 70 °C and an acceptable free energy may be ranged between 15 and 45 kcal/mol.
  • an AON is said to induce skipping of the aberrant 152 nucleotide USH2A pseudo exon 40 (SEQ ID NO:5 in WO 2016/005514), when the aberrant 152 nucleotide USH2A pseudo exon 40 skipping percentage as measured by real-time quantitative RT-PCR analysis is at least 30%, or at least 35%, or at least 40%, or at least 45%, or at least 50%, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100%.
  • Preferred assays to determine exon skipping and/or exon retention are described in the examples herein.
  • an AON according to the invention comprises a sequence that is complementary or substantially complementary to a nucleotide sequence of PE40 (SEQ ID NO:9 herein), or part thereof such that the (substantially) complementary part is at least 50% of the length of the oligonucleotide according to the invention, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90% or even more preferably at least 95%, or even more preferably 98% or even more preferably at least 99%, or even more preferably 100%.
  • an AON according to the invention comprises or consists of a sequence that is complementary to a part of SEQ ID NO:9, shown below:
  • an AON may comprise a sequence that is complementary to part of SEQ ID NO:9 and additional flanking sequences, especially the splice site at the 3' end of PE40.
  • the length of said complementary part of said AON is of at least 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 1 15, 120, 125, 130, 135, 140, 141 , 142 or 143 nucleotides.
  • flanking sequences may be used to modify the binding, or to modify a thermodynamic property of the AON, more preferably to modify target RNA binding affinity.
  • the skilled person knows that it is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing the AON one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may, to some extent, be allowed, if under the circumstances in the cell, the stretch of nucleotides is sufficiently capable of hybridizing to the complementary part.
  • "sufficiently” preferably means that using a gel mobility shift assay as described in example 1 of EP1619249, binding of an AON is detectable.
  • said AON may further be tested by transfection into fibroblasts or retina cells of patients. Skipping of a targeted exon may be assessed by RT-PCR (such as e.g. described in EP1619249).
  • the complementary regions are preferably designed such that, when combined, they are specific for the exon in the pre-mRNA. Such specificity may be created with various lengths of complementary regions as this depends on the actual sequences in other (pre) mRNA molecules in the system. The risk that the AON also will be able to hybridize to one or more other pre-mRNA molecules decreases with increasing size of the AON.
  • AONs comprising mismatches in the region of complementarity but that retain the capacity to hybridize and/or bind to the targeted region(s) in the pre-mRNA, can be used in the invention.
  • at least the complementary parts do not comprise such mismatches as AONs lacking mismatches in the complementary part typically have a higher efficiency and a higher specificity, than AONs having such mismatches in one or more complementary regions.
  • higher hybridization strengths i.e. increasing number of interactions with the opposing strand
  • the complementarity is from 90% to 100%.
  • a pseudo exon skipping AON of the invention is preferably in an isolated form.
  • a preferred pseudo exon skipping AON according to the invention has a length from 18 to 143 nucleotides, more preferred from 18 to 60, more preferred 18 to 40 nucleotides, more preferred from 18 to 30 nucleotides, more preferred from 18 to 24 nucleotides, most preferred 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, or 24 nucleotides.
  • the AON of the invention consists of from 18 to 143 nucleotides, more preferred from 18 to 40 nucleotides, more preferred from 18 to 30 nucleotides, more preferred from 18 to 20 nucleotides, or preferably consists of 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 1 15, 120, 125, 130, 135, 140, 141 , 142 or 143 nucleotides.
  • an exon skipping AON of the invention comprises one or more residues that are modified to increase nuclease resistance, and/or to increase the affinity of the AON for the target sequence. Therefore, in a preferred embodiment, the AON sequence comprises at least one nucleotide analogue or equivalent, wherein a nucleotide analogue or equivalent is defined as a residue having a modified base, and/or a modified backbone, and/or a non-natural internucleoside linkage, or a combination of these modifications.
  • the nucleotide analogue or equivalent comprises a modified backbone.
  • backbones are provided by morpholino backbones, carbamate backbones, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl backbones, riboacetyl backbones, alkene containing backbones, sulfamate, sulfonate and sulfonamide backbones, methyleneimino and methylenehydrazino backbones, and amide backbones.
  • Phosphorodiamidate morpholino oligomers are modified backbone oligonucleotides that have previously been investigated as antisense agents.
  • Morpholino oligonucleotides have an uncharged backbone in which the deoxyribose sugar of DNA is replaced by a six membered ring and the phosphodiester linkage is replaced by a phosphorodiamidate linkage.
  • Morpholino oligonucleotides are resistant to enzymatic degradation and appear to function as antisense agents by arresting translation or interfering with pre-mRNA splicing rather than by activating RNaseH.
  • Morpholino oligonucleotides have been successfully delivered to tissue culture cells by methods that physically disrupt the cell membrane, and one study comparing several of these methods found that scrape loading was the most efficient method of delivery; however, because the morpholino backbone is uncharged, cationic lipids are not effective mediators of morpholino oligonucleotide uptake in cells. A recent report demonstrated triplex formation by a morpholino oligonucleotide and, because of the non-ionic backbone, these studies showed that the morpholino oligonucleotide was capable of triplex formation in the absence of magnesium.
  • the linkage between the residues in a backbone do not include a phosphorus atom, such as a linkage that is formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • a preferred nucleotide analogue or equivalent comprises a Peptide Nucleic Acid (PNA), having a modified polyamide backbone. PNA-based molecules are true mimics of DNA molecules in terms of base-pair recognition.
  • the backbone of the PNA is composed of N-(2-aminoethyl)-glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds.
  • An alternative backbone comprises a one-carbon extended pyrrolidine PNA monomer. Since the backbone of a PNA molecule contains no charged phosphate groups, PNA-RNA hybrids are usually more stable than RNA-RNA or RNA-DNA hybrids, respectively.
  • a further preferred backbone comprises a morpholino nucleotide analog or equivalent, in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring.
  • a most preferred nucleotide analog or equivalent comprises a phosphorodiamidate morpholino oligomer (PMO), in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring, and the anionic phosphodiester linkage between adjacent morpholino rings is replaced by a non-ionic phosphorodiamidate linkage.
  • PMO phosphorodiamidate morpholino oligomer
  • a nucleotide analogue or equivalent of the invention comprises a substitution of one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes base-pairing but adds significant resistance to nuclease degradation.
  • a preferred nucleotide analogue or equivalent comprises phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, H- phosphonate, methyl and other alkyl phosphonate including 3'-alkylene phosphonate, 5'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate.
  • a further preferred nucleotide analogue or equivalent of the invention comprises one or more sugar moieties that are mono- or disubstituted at the 2', 3' and/or 5' position such as a -OH; -F; substituted or unsubstituted, linear or branched lower (CI-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S-or N-alkynyl; 0-, S-, or N- allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; methoxyethoxy; dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy.
  • a sugar moieties that are mono- or disubstitute
  • the sugar moiety can be a pyranose or derivative thereof, or a deoxypyranose or derivative thereof, preferably ribose or derivative thereof, or deoxyribose or derivative of.
  • a preferred derivatized sugar moiety comprises a Locked Nucleic Acid (LNA), in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.
  • LNA Locked Nucleic Acid
  • a preferred LNA comprises 2'-0, 4'-C-ethylene-bridged nucleic acid. These substitutions render the nucleotide analogue or equivalent RNase H and nuclease resistant and increase the affinity for the target RNA.
  • a nucleotide analogue or equivalent of the invention comprises one or more base modifications or substitutions.
  • Modified bases comprise synthetic and natural bases such as inosine, xanthine, hypoxanthine and other -aza, deaza, -hydroxy, -halo, -thio, thiol, -alkyl, - alkenyl, -alkynyl, thioalkyl derivatives of pyrimidine and purine bases that are or will be known in the art. It is understood by a skilled person that it is not necessary for all positions in an AON to be modified uniformly.
  • an AON of the invention has at least two different types of analogues or equivalents.
  • a preferred pseudo exon skipping AON according to the invention is a 2'-0 alkyl phosphorothioate AON, such as 2'-0-methyl modified ribose (RNA), 2'-0-ethyl modified ribose, 2'-0-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives.
  • An effective AON according to the invention comprises a 2'- O-methyl ribose with a phosphorothioate backbone.
  • AONs can be combined for efficiently skipping of the aberrant 152 nucleotide pseudo exon of USH2A.
  • a combination (or set) of at least 2, 3, 4, 5 or 6 AONs are used in a method of the invention.
  • An AON can be linked to a moiety that enhances uptake of the AON in cells, preferably retina cells.
  • moieties are cholesterols, carbohydrates, vitamins, biotin, lipids, phospholipids, cell-penetrating peptides including but not limited to antennapedia, TAT, transportan and positively charged amino acids such as oligoarginine, poly-arginine, oligolysine or polylysine, antigen-binding domains such as provided by an antibody, a Fab fragment of an antibody, or a single chain antigen binding domain such as a cameloid single domain antigen- binding domain.
  • An AON according to the invention may be indirectly administrated using suitable means known in the art. It may for example be provided to an individual or a cell, tissue or organ of said individual in the form of an expression vector wherein the expression vector encodes a transcript comprising said AON.
  • the expression vector is preferably introduced into a cell, tissue, organ or individual via a gene delivery vehicle.
  • a viral-based expression vector comprising an expression cassette or a transcription cassette that drives expression or transcription of an exon skipping molecule as identified herein. Accordingly, the invention provides a viral vector expressing an AON according to the invention when placed under conditions conducive to expression of the AON.
  • a cell can be provided with an AON capable of interfering with essential sequences that result in highly efficient skipping of the aberrant 152 nucleotide USH2A pseudo exon by plasmid-derived AON expression or viral expression provided by adenovirus- or adeno-associated virus-based vectors. Expression may be driven by a polymerase ll-promoter (Pol II) such as a U7 promoter or a polymerase III (Pol III) promoter, such as a U6 RNA promoter.
  • a preferred delivery vehicle is a viral vector such as an adeno-associated virus vector (AAV), or a retroviral vector such as a lentivirus vector and the like, all as described in detail in WO 2016/005514.
  • plasmids, artificial chromosomes, plasmids usable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of an oligonucleotide as defined herein.
  • Preferred for the current invention are those vectors wherein transcription is driven from Pol-Ill promoters, and/or wherein transcripts are in the form fusions with U1 or U7 transcripts, which yield good results for delivering small transcripts. It is within the skill of the artisan to design suitable transcripts.
  • the AON according to the invention may be delivered as such. However, the AON may also be encoded by the viral vector. Typically, this is in the form of an RNA transcript that comprises the sequence of an AON according to the invention in a part of the transcript.
  • An AON according to the invention can be delivered as is to an individual, a cell, tissue or organ of said individual.
  • the molecule is dissolved in a solution that is compatible with the delivery method.
  • Retina or inner ear cells can be provided with a plasmid for AON expression by providing the plasmid in an aqueous solution or thorough a viral vector or nanoparticles, all as described in detail in WO 2016/005514.
  • Preferably viral vectors or nanoparticles are delivered to retina or inner ear cells.
  • the skilled person may select and adapt any of the known and/or other commercially available alternative excipients and delivery systems to package and deliver an AON for use in the current invention to deliver it for the prevention, treatment or delay of a USH2A related disease or condition.
  • "Prevention, treatment or delay of a USH2A related disease or condition” is herein preferably defined as preventing, halting, ceasing the progression of, or reversing partial or complete visual impairment or blindness, as well as preventing, halting, ceasing the progression of or reversing partial or complete auditory impairment or deafness that is caused by a genetic defect in the USH2A gene.
  • an AON according to the invention is formulated in a composition or a medicament or a composition, which is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device thereof to a cell and/or enhancing its intracellular delivery.
  • compositions may not be formulated in one single combination or composition or preparation. Depending on their identity, the skilled person will know which type of formulation is the most appropriate for each constituent as defined herein.
  • an AON according to the invention or a vector, preferably a viral vector, expressing an AON according to the invention can be incorporated into a pharmaceutically active mixture by adding a pharmaceutically acceptable carrier.
  • the invention also provides a composition, preferably a pharmaceutical composition, comprising an AON according to the invention, or a viral vector according to the invention and a pharmaceutically acceptable excipient.
  • a composition may comprise a single AON or viral vector according to the invention, but may also comprise multiple, distinct AONs or viral vectors according to the invention.
  • a pharmaceutical composition may comprise any pharmaceutically acceptable excipient, including a carrier, filler, preservative, adjuvant, solubilizer and/or diluent.
  • a preferred route of administration is through intravitreal injection of an aqueous solution or specially adapted formulation for intraocular administration.
  • EP2425814 discloses an oil in water emulsion especially adapted for intraocular (intravitreal) administration of peptide or nucleic acid drugs. This emulsion is less dense than the vitreous fluid, so that the emulsion floats on top of the vitreous, avoiding that the injected drug impairs vision.
  • concentration or dose defined herein may refer to the total concentration or dose of all oligonucleotides used or the concentration or dose of each exon skipping molecule used or added. Therefore in one embodiment, there is provided a composition wherein each or the total amount of AONs according to the invention used is dosed in an amount ranged from 0.01 and 20 mg/kg, preferably from 0.05 to 20 mg/kg.
  • a suitable intravitreal dose would be between about 0.05 and about 5 mg, preferably between about 0.1 and about 1 mg per eye, such as about per eye: 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 mg.
  • a preferred AON according to the invention is for the treatment of a USH2A related disease or condition of an individual.
  • the term "treatment” is understood to include the prevention and/or delay of the USH2A related disease or condition.
  • An individual, which may be treated using an AON according to the invention may already have been diagnosed as having a USH2A related disease or condition.
  • an individual which may be treated using an AON according to the invention may not have yet been diagnosed as having a USH2A related disease or condition but may be an individual having an increased risk of developing a USH2A related disease or condition in the future given his or her genetic background.
  • a preferred individual is a human being.
  • the USH2A related disease or condition is Usher Syndrome type II.
  • the invention further provides an AON according to the invention, or a viral vector according to the invention, or a composition according to the invention for use as a medicament, for treating a USH2A related disease or condition requiring modulating splicing of USH2A pre-mRNA and for use as a medicament for the prevention, treatment or delay of a USH2A related disease or condition.
  • the invention further provides the use of an AON according to the invention, or of a viral vector according to the invention, or a composition according to the invention for the preparation of a medicament, for the preparation of a medicament for treating a USH2A related disease or condition requiring modulating splicing of USH2A pre-mRNA and for the preparation of a medicament for the prevention, treatment or delay of a USH2A related disease or condition.
  • an AON, viral vector or composition as defined herein for the preparation of a medicament, for the preparation of a medicament for treating a condition requiring modulating splicing of USH2A pre-mRNA and for the preparation of a medicament for the prevention, treatment or delay of a USH2A related disease or condition.
  • a treatment in a use or in a method according to the invention is at least once, lasts one week, one month, several months, one year, 2, 3, 4, 5, 6 years or longer, such as lifelong.
  • Each AON as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals already affected or at risk of developing USH2A related disease or condition, and may be administered directly in vivo, ex vivo or in vitro.
  • the frequency of administration of an AON, composition, compound or adjunct compound of the invention may depend on several parameters such as the severity of the disease, the age of the patient, the mutation of the patient, the number of AONs (i.e. dose), the formulation of said molecule, the route of administration and so forth.
  • the frequency may vary between daily, weekly, at least once in two weeks, or three weeks or four weeks or five weeks or a longer time period.
  • Dose ranges of an AON according to the invention are preferably designed on the basis of rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist.
  • An AON as defined herein may be used at a dose which is ranged from 0.01 and 20 mg/kg, preferably from 0.05 and 20 mg/kg.
  • a suitable intravitreal dose would be between 0.05 mg and 5mg, preferably between 0.1 and 1 mg per eye, such as about per eye: 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 mg.
  • a concentration of an AON as defined herein, which is ranged from 0.1 nM and 1 ⁇ is used.
  • this range is for in vitro use in a cellular model such as retina cells or retinal tissue. More preferably, the concentration used is ranged from 1 to 400 nM, even more preferably from 10 to 200 nM, even more preferably from 50 to 100 nM. If several AONs are used, this concentration or dose may refer to the total concentration or dose of AONs or the concentration or dose of each AON added.
  • a viral vector preferably an AAV vector as described earlier herein, as delivery vehicle for a molecule according to the invention, is administered in a dose ranging from 1x10 9 — 1x10 17 virus particles per injection, more preferably from 1x10 10 — 1x10 12 virus particles per injection.
  • concentration or dose of AONs as given above are preferred concentrations or doses for in vivo, in vitro or ex vivo uses.
  • concentration or dose of AON used may further vary and may need to be optimized any further.
  • the invention further provides a method for modulating splicing of USH2A pre-mRNA in a cell comprising contacting the cell, preferably a retina cell, with an AON according to the invention, or a viral vector according to the invention, or a composition according to the invention.
  • the features of this aspect are preferably those defined earlier herein.
  • Contacting the cell with an AON according to the invention, or a viral vector according to the invention, or a composition according to the invention may be performed by any method known by the person skilled in the art. Use of the methods for delivery of AONs, viral vectors and compositions described herein is included. Contacting may be directly or indirectly and may be in vivo, ex vivo or in vitro.
  • the invention further provides a method for the treatment of a USH2A related disease or condition requiring modulating splicing of USH2A pre-mRNA of an individual in need thereof (such as Usher Syndrome type II), said method comprising contacting a cell, preferably a retina cell, of said individual with an AON according to the invention, or a viral vector according to the invention, or a composition according to the invention.
  • a cell preferably a retina cell
  • AON preferably a retina cell with an AON according to the invention, or a viral vector according to the invention, or a composition according to the invention
  • Contacting may be performed by any method known by the person skilled in the art. Use of the methods for delivery of AONs, viral vectors and compositions described herein is included. Contacting may be directly or indirectly and may be in vivo, ex vivo or in vitro.
  • a preferred USH2A related disease or condition is Usher Syndrome type II. Unless otherwise indicated each embodiment as described herein may be combined with another embodiment as described herein
  • the present invention relates to an antisense oligonucleotide (AON) comprising a sequence selected from the group consisting of SEQ ID NO:6, 3, 4, 5, 7, 8, 19, 21 , 23, 24, 25, 26, 27, 28,
  • the AONs of the present invention are capable of inducing, stimulating or enhancing skipping of pseudo exon 40 (PE40) in the USH2A pre-mRNA, wherein the inclusion of PE40 is due or caused by the c.7595-2144A>G that is frequently found in USH2 patients.
  • PE40 pseudo exon 40
  • USH2a-PE40-8 SEQ ID NO:3
  • USH2a-PE40-1 1 SEQ ID NO:26
  • USH2a-PE40-20 SEQ ID NO:5
  • USH2a-PE40-22 SEQ ID NO:35
  • USH2a-PE40-28 SEQ ID NO:7
  • the AONs based on USH2a-PE40-5 are the AONs of SEQ ID NO:27, 28, and 29.
  • the AONs based on USH2a-PE40-7 are the AONs of SEQ ID NO:4, 6, 8, 30, 31 , 32, and 37, with USH2a-PE40-17 (SEQ ID NO:4), USH2a-PE40-24 (SEQ ID NO:6) and USH2a-PE40-29 (SEQ ID NO:8) performing best (see Figure 4 and 5), wherein even USH2a-PE40-17 and -24 outperform all other AONs.
  • the overlapping sequence that is present in the very effective AONs of SEQ ID NO:3, 5, 7, 19, 24, 25, 26, 34, 35, 36 is 5 -CGCUGC-3' (SEQ ID NO:43), wherein a Cytosine may be replaced with a 5-methyl-Cytosine (5mC).
  • the overlapping sequence that is present in the very effective AONs of SEQ ID NO:21 , 27, 28, 29 is 5 -AUUUCAAUUUCAUGAUUU-3' (SEQ ID NO:44), wherein a Cytosine may be replaced with a 5-methyl-Cytosine (5mC).
  • the invention therefore also relates to an AON comprising a sequence selected from the group consisting of SEQ ID NO:42, 43 and 44.
  • the target region of the very effective AONs of SEQ ID NO:6, 4, 8, 23, 30, 31 , 32, 37, which includes the splicing boundary at the 3' end of the PE40 sequence is 5'- UCCCAAGGUAAGAGAUCAUCUUUAAGAAAAGG-3' (SEQ ID NO:45).
  • the target region of the very effective AONs of SEQ ID NO:3, 5, 7, 19, 24, 25, 26, 34, 35, 36 is 5 -UCUGCAACAAGAGCAGCGAAUCUACUCAGC-3' (SEQ ID NO:46).
  • the target region of the very effective AONs of SEQ ID NO:21 , 27, 28, 29 is 5'- GG AAACAAAU CAU G AAAU U G AAAU U G AACA-3 ' (SEQ ID NO:47).
  • the shortest AON that targets any sequence of SEQ ID NO:45, 46 and 47 was 18 nucleotides long (USH2a-PE40-23 (SEQ ID NO:36).
  • the invention therefore also relates to an AON that is capable to inducing skipping of pseudo exon 40 (PE40) from human USH2A pre-mRNA, wherein said AON comprises a sequence that is complementary to at least 18, 19, 20, 21 , 22, 23, or 24 consecutive nucleotides of SEQ ID NO:45, 46 or 47.
  • an AON that is able to induce, cause, stimulate, and/or enhance skipping of PE40 from human USH2A pre-mRNA
  • said AON comprises or consists of a sequence selected from any of the following groups of sequences: (i) SEQ ID NO:6, 4, 8, 23, 30, 31 , 32, 37; (ii) SEQ ID NO:3, 5, 7, 19, 24, 25, 26, 34, 35, 36; and (iii) SEQ ID NO:21 , 27, 28, 29.
  • said AON comprises or consists of a sequence selected from any of the following groups of sequences: (i) SEQ ID NO:6, 4, 8; and (ii) SEQ ID NO:3, 5, 7, 26, 35.
  • said AON comprises or consists of a sequence selected from SEQ ID NO: 6 and 4.
  • the retention of PE40 in the USH2A pre-mRNA is due to the c.7595-2144A>G mutation in the USH2A gene, although it cannot be excluded that other (identified or thus far unidentified) mutations in the USH2A gene exist that also cause the presence of PE40 in the USH2A mRNA.
  • the AON of the present invention is an oligoribonucleotide (RNA oligonucleotide) that comprises at least one 2'-0 alkyl modification, such as a 2'-0-methyl (2'-0-Me), a 2'-0-ethyl, or a 2'-0-propyl. Another preferred modification is 2'-0-methoxyethyl (2'-0-MOE). In one preferred aspect, all nucleotides in the AON of the present invention are 2'-0-methyl modified.
  • the AON of the present invention has at least one phosphorothioate linkage, and more preferably, all sequential nucleotides within the AON of the present invention are interconnected by phosphorothioate linkages.
  • the AON of the present invention has a length of 18 to 143 nucleotides, preferably 18 to 40 nucleotides, more preferably 18 to 30 nucleotides, even more preferably 18 to 24 nucleotides.
  • the AON according to the invention comprises a 2'-0 alkyl phosphorothioate antisense oligonucleotide, such as 2'-0-methyl modified ribose (RNA), 2'-0-ethyl modified ribose, 2'-0-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives.
  • RNA 2'-0-methyl modified ribose
  • 2'-0-ethyl modified ribose 2'-0-propyl modified ribose
  • substituted derivatives of these modifications such as halogenated derivatives.
  • the invention relates to a set of AONs, said set comprising at least two AONs according to the invention.
  • the invention relates to a viral vector expressing an AON according to the present invention, when placed under conditions conducive to expression of the AON.
  • the invention also relates to a pharmaceutical composition comprising an AON, a set of AONs or a viral vector according to the invention, and a pharmaceutically acceptable excipient.
  • said pharmaceutical composition is for intravitreal administration and is dosed in an amount ranged from 0.05 mg and 5 mg of total AON per eye.
  • said pharmaceutical composition is for intravitreal administration and is dosed in an amount ranged from 0.1 and 1 mg of total AON per eye, such as about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 mg of total AONs per eye.
  • the invention relates to an AON according to the invention, a set of AONs according to the invention and as claimed herein, a vector according to the invention, or a composition according to the invention, for use as a medicament, preferably for use in the treatment or prevention of a USH2A related disease or condition requiring modulating splicing of USH2A pre-mRNA.
  • the invention relates to a use of an AON according to the invention, a set of AONs according to the invention, a vector according to the invention or a composition according to the invention, in the preparation of a medicament for treating a USH2A related disease or condition requiring modulating splicing of USH2A pre-mRNA.
  • the present invention further relates to a method for modulating splicing of USH2A pre-mRNA in a cell, said method comprising contacting said cell with an AON according to the invention, a set according to the invention, a vector according to the invention, or a composition according to the invention.
  • Said cell may be an in vitro cell, an ex vivo cell or an in vivo cell.
  • Said cell used in said method would preferably be present in the eye of, or obtained from, a (human) subject suffering from an USH2A related disorder or being at risk thereof.
  • the invention relates to a method for the treatment of a USH2A related disease or condition requiring modulating splicing of USH2A pre-mRNA, such as Usher Syndrome type II, in an individual suffering therefrom, said method comprising contacting a cell of said individual with an AON according to the invention, a set according to the invention, a vector according to the invention, or a composition according to the invention.
  • the invention relates to a pseudo exon skipping antisense oligonucleotide according to the invention, a use according to the invention, or a method according to the invention, wherein the USH2A related disease or condition requiring modulating splicing of USH2A is Usher Syndrome Type II.
  • the pseudo exon that is skipped by using the antisense oligonucleotides of the present invention is the pseudo exon 40 (PE40; SEQ ID NO:9) as disclosed herein.
  • sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases.
  • the skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors.
  • All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
  • Example 1 Selection of antisense oligonucleotides having improved exon skipping properties.
  • the intron USH2A mutation (c.7595-2144A>G) creates a cryptic splice donor site that results in the inclusion of an aberrant exon (PE40) into the USH2A mRNA (see Figure 1AB of WO 2016/005514).
  • Addition of AONs directed against the aberrant exon would prevent the insertion of this exon by preventing the binding of factors that are essential for splicing such as the U1- and U2 snRNP complexes, and serine-arginine rich proteins, thereby restoring normal USH2A splicing and protein synthesis ( Figure 1 C of WO 2016/005514).
  • AONs can target splice sites as well as exon sequences. It has been suggested that a positive correlation exists between the capability of AONs to induce exon skipping and the presence of predicted SC35 splice factor binding sites in the target sequence.
  • USH2A exon 152 nucleotides exon sequence plus 15 nucleotides of intron sequence on each side
  • ESE finder 3.0 program Within the aberrant exon, two regions with respectively three and two SC35-binding motifs were predicted (data not shown).
  • AON1 SEQ ID NO: 1
  • AON2 SEQ ID NO:2
  • AON1 and AON2 exon-skipping potential was investigated in WO 2016/005514 (see Figure 2 therein).
  • the effect of the AONs was assayed by using a splicing reporter construct pCI-Neo-USH2a-PE40 (WO 2016/005514).
  • This construct contains the PE40 sequence surrounded by 500 nucleotides of intronic sequence, which has been inserted in an intron between exons 3 and 5 derived from the rhodopsin gene.
  • the reporter plasmids were transfected into HEK293 cells, followed by a separate AON transfection. Reporter plasmids were transfected using MaxPEI as transfection reagent, and the subsequent AON transfections were performed using the Lipofectamine 2000 reagent (Life Technologies).
  • Figure 1 shows the initial screening of USH2a-PE40-1 to -7, which was performed using the reporter construct in HEK293 cells, in comparison to a control oligonucleotide and the two known AONs from WO 2016/005514 (AON1 and AON2).
  • USH2a-PE40-1 , -2, -4, and -6 did not show an improvement over PE40 exon skipping as determined with AON1 and AON2 (given as R1 and R2 in this figure respectively).
  • USH2a-PE40-3, - 5, and -7 were found to be significantly more effective than AON1 and AON2, with USH2a-PE40- 7 being the most effective.
  • Figure 2 shows the sequence of PE40 (as RNAfrom 5' to 3') and the positions of complementarity of the AONs tested herein.
  • USH2a-PE40-1 SEQ ID NO: 17
  • USH2a-PE40-2 SEQ ID NO:18
  • USH2a-PE40-4 SEQ ID NO:20
  • AON1 SEQ ID NO:1
  • AON2 SEQ ID NO:2
  • USH2a-PE40-3 SEQ ID NO: 19
  • USH2a-PE40-5 SEQ ID NO:21
  • USH2a-PE40-7 SEQ ID NO:23
  • AONs were shortened, or shifted so that they would have less internal secondary structure.
  • AONs were further modified by including base changes known to enhance binding affinity: 5-methyl-Cytosine (5mC) instead of Cytosine, and 2, 6-diaminopurine (DAP) instead of Adenine, see Table 1.
  • the 5mC modification was also expected to improve the safety of the AON, as it has been implicated in lowering the immunogenicity of RNA and AONs.
  • USH2a- PE40-8, -9, -10, and -11 were based on USH2a-PE40-3.
  • USH2a-PE40-12, -13, and -14 were based on USH2a-PE40-5.
  • USH2a-PE40-15, -16, -17, and -18 were based on USH2a-PE40-7.
  • USH2a-PE40-20 and -21 were based on USH2a-PE40-8.
  • USH2a-PE40-22 and -23 were based on USH2a-PE40-1 1.
  • USH2a-PE40-25 was found to be slightly more effective than the original USH2a-PE40-17. Also, the two AONs that had been shortened by two nucleotides (USH2a-PE40-20 and -24, corresponding to -8 and -17, respectively) showed essentially the same effect as their original longer counterparts. Although not more effective than the original, longer AONs, the shortened versions were considered superior due to the fact that they are easier to synthesize and could potentially have better uptake.
  • PE40-AON1 1 GUGUGAUUCUGGAGAGGAAGCUG
  • PE40-AON2 2 CCCUUAAAAGCCAGCAUACA
  • USH2a-PE40-29 8 XUUAAAGAUGAUXUXUUAXX USH2a-PE40-8, -17, -20, -24, -28 and -29 (SEQ ID NO:3 to 8) were further tested for their effectiveness in exon skipping capabilities and immunogenicity in vitro.
  • the target nucleotide sequence for oligonucleotides USH2a-PE40-8, -20 and -28 (with which the oligonucleotides (partly) overlap) is as follows: 5'- TCTG CAAC AAG AGCAG CG AA -3' (SEQ ID NO: 10), located within PE40.
  • the target nucleotide sequence for oligonucleotides USH2a-PE40-17, -24 and -29 (with which the oligonucleotides (partly) overlap) is as follows: 5'- AGG*TAAGAGATCATCTTTAAGAA -3' (SEQ ID NO:1 1 ), located partly in PE40 (underlined AG) and its flanking region comprising the c.7595-2144A>G mutation (bold guanosine with asterisk). Fibroblasts were collected from an USH2 patient carrying the USH2A c.7595-2144A>G and c.2391_2392del compound heterozygous mutation.
  • Cells were kept at 37°C in DMEM AQ medium containing 20% FBS and 1 % NaPyr (Sigma Life Sciences). The cells were plated at a density of 1.0x10 6 cells/well. The AONs were complexed with Lipofectamine 2000 (Life Technologies, lot: 1699509) in OptiMem (lot: 1697387) for 30 min and then added to the fibroblasts at a concentration of 100 nM. Incubation lasted for a further 24 h. Cells were treated with cyclohexamide for 4 h at the end of the incubation period of 24 h to inhibit nonsense- mediated mRNA decay.
  • ddPCR droplet digital PCR
  • Figure 5 shows the number of droplets expressing PE40 versus wildtype corrected for GUSB expression levels in patient fibroblasts treated with the eight different AONs together with one non-treated (NT) sample.
  • NT non-treated
  • Gene specific primer were used for samples and Random Hexamers for GUSB housekeeping.
  • TLRs pattern recognition receptors
  • TLRs are a class of proteins that play a key role in the innate immune system. They are single, membrane- spanning, non-catalytic receptors that are usually expressed in macrophages and dendritic cells that recognize structurally-conserved molecules derived from microbes. TLRs that are activated by different types of nucleic acids are those located on endosomes: TLR3 recognizes double stranded RNA; TLR7/8 recognizes double and single stranded RNA.
  • TLR activation results in the activation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF- ⁇ ), Interferon regulatory factor 3 (IRF-3) and activator protein 1 (AP-1 ) (Kawasaki 2014. Front Immunol 25:461 ).
  • NF- ⁇ nuclear factor kappa-light-chain-enhancer of activated B cells
  • IRF-3 Interferon regulatory factor 3
  • AP-1 activator protein 1
  • PBMC peripheral blood mononuclear cells
  • Example 3 PE40 skipping in USH2A pre-mRNA in optic cups generated from an USH2 patient Retinas cannot be obtained from USH2 patients and used for in vitro studies for obvious reasons.
  • organoids that resemble such patient retina material, herein referred to as optic cups and sometimes also referred to as eye cups.
  • Fibroblasts from Usher Syndrome type II patients, having the USH2A c.7595-2144A>G (p.Lys2532Thrfs*56) and c.2299delG (p.Glu767Serfs*21 ) mutations in compound heterozygosity were used for optic cup generation.
  • Fibroblasts were reprogrammed using four lentiviruses expressing Oct3/4, Sox2, Klf4 and c-Myc and generously provided by the Radboud UMC Stem Cell Technology Center. Clones were cryopreserved around passage 6 and further analysed for expression of the pluripotent stem cell markers SSEA-4, NANOG, TRA1-81 and OCT3/4 by immunocytochemistry. In total 3 individual clones were generated and stored. These clones passed all defined quality controls (activation of stem cell markers (RT-qPCR) and expression of stem cell and pluripotency markers (IHC) (data not shown). The iPSC line was cultured into optic cups as described previously (Zhong et al 2014. Nature Comm 5:4047;1-12).
  • iPSCs were differentiated into small clumps and cultured in suspension with mTeSRI medium and 10 ⁇ Blebbistatin (Sigma) to induce aggregate formation. Aggregates were transitioned into neural-induction medium containing DMEM/F12, 1 % N2 supplement, 1 x minimum essential media-non-essential amino acids, 2 ⁇ g ml "1 heparin (Sigma). Aggregates were seeded onto Matrigel-coated dishes. The medium was changed daily.
  • neural retina domains were manually detached and cultured in suspension in DMEM/F12 medium supplemented with 2% B27, 1 x NEAA, and 1 % antibiotic-antimycotic, in a humidified incubator at 37 degrees Celcius.
  • the medium was changed twice a week. In the incubator they gradually formed 3D optic cups.
  • USH2A, LIN28A, OCT3/4, NANOG and SOX2 were subsequently amplified using forward and reverse primers.
  • the housekeeping gene GUSB was used as a reference.
  • GoTaq Promega A6001 was used to amplify USH2A, LIN28A, OCT3/4, NANOG, SOX2 and GUSB cDNA in triplicate in a qPCR machine.
  • Non-treated optic cups would reveal a wild-type band (900 bp) and a band containing the PE40 sequence (1052 bp), which is easily distinguished in gel.
  • the result as provided in Figure 7 shows that both concentrations (2 ⁇ and 10 ⁇ ) of oligonucleotide USH2a-PE40-24 (SEQ ID NO:6) when used on the optic cups generated from USH2 patient fibroblasts, were sufficient to induce the complete skipping of PE40, as no transcript could be detected comprising PE40. It is unclear what the ultimate upper non-specific faint band is in the ctrl lane.
  • an antisense oligonucleotide and in this particular case USH2a-PE40-24, is capable of efficiently skipping PE40 from USH2A pre-mRNA in organoids that resemble the retina of a (heterozygous PE40) patient suffering from Usher Syndrome type II.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/EP2017/059830 2016-04-25 2017-04-25 Oligonucleotides to treat eye disease Ceased WO2017186739A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
EA201892431A EA201892431A1 (ru) 2016-04-25 2017-04-25 Олигонуклеотиды для лечения заболевания глаз
CA3021899A CA3021899A1 (en) 2016-04-25 2017-04-25 Oligonucleotides to treat eye disease
EP17721984.7A EP3448999B1 (en) 2016-04-25 2017-04-25 Oligonucleotides to treat eye disease
AU2017257292A AU2017257292A1 (en) 2016-04-25 2017-04-25 Oligonucleotides to treat eye disease
US16/096,038 US10617707B2 (en) 2016-04-25 2017-04-25 Oligonucleotides to treat eye disease
PL17721984T PL3448999T3 (pl) 2016-04-25 2017-04-25 Oligonukleotydy do leczenia choroby oka
JP2019506546A JP7043082B2 (ja) 2016-04-25 2017-04-25 眼疾患を処置するオリゴヌクレオチド
CN201780025611.3A CN109072239A (zh) 2016-04-25 2017-04-25 治疗眼病的寡核苷酸
MX2018013003A MX2018013003A (es) 2016-04-25 2017-04-25 Oligonucleotidos para tratar una enfermedad ocular.
KR1020187031243A KR102368920B1 (ko) 2016-04-25 2017-04-25 안 질환 치료용 올리고뉴클레오타이드
ES17721984T ES2801823T3 (es) 2016-04-25 2017-04-25 Oligonucleótidos para tratar una enfermedad ocular
DK17721984.7T DK3448999T3 (da) 2016-04-25 2017-04-25 Oligonukleotider til behandling af øjensygdom
ZA2018/06628A ZA201806628B (en) 2016-04-25 2018-10-05 Oligonucleotides to treat eye disease
IL262199A IL262199B (en) 2016-04-25 2018-10-08 Oligonucleotides to treat eye disease
US16/811,848 US11123360B2 (en) 2016-04-25 2020-03-06 Oligonucleotides to treat eye disease
US17/475,795 US20210401871A1 (en) 2016-04-25 2021-09-15 Oligonucleotides to treat eye disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1607141.7 2016-04-25
GB201607141 2016-04-25

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/096,038 A-371-Of-International US10617707B2 (en) 2016-04-25 2017-04-25 Oligonucleotides to treat eye disease
US16/811,848 Continuation US11123360B2 (en) 2016-04-25 2020-03-06 Oligonucleotides to treat eye disease

Publications (1)

Publication Number Publication Date
WO2017186739A1 true WO2017186739A1 (en) 2017-11-02

Family

ID=58672573

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/059830 Ceased WO2017186739A1 (en) 2016-04-25 2017-04-25 Oligonucleotides to treat eye disease

Country Status (15)

Country Link
US (3) US10617707B2 (https=)
EP (1) EP3448999B1 (https=)
JP (1) JP7043082B2 (https=)
KR (1) KR102368920B1 (https=)
CN (1) CN109072239A (https=)
AU (1) AU2017257292A1 (https=)
CA (1) CA3021899A1 (https=)
DK (1) DK3448999T3 (https=)
EA (1) EA201892431A1 (https=)
ES (1) ES2801823T3 (https=)
IL (1) IL262199B (https=)
MX (1) MX2018013003A (https=)
PL (1) PL3448999T3 (https=)
WO (1) WO2017186739A1 (https=)
ZA (1) ZA201806628B (https=)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019123429A1 (en) * 2017-12-21 2019-06-27 Casebia Therapeutics Llp Materials and methods for treatment of usher syndrome type 2a
US10617707B2 (en) 2016-04-25 2020-04-14 Proqr Therapeutics Ii B.V. Oligonucleotides to treat eye disease
WO2020157008A1 (en) 2019-01-28 2020-08-06 Proqr Therapeutics Ii B.V. Rna-editing oligonucleotides for the treatment of usher syndrome
WO2020165768A1 (en) * 2019-02-12 2020-08-20 Università Degli Studi Di Trento Cas12a guide rna molecules and uses thereof
WO2020201144A1 (en) 2019-04-02 2020-10-08 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for immunotherapy
WO2020212567A1 (en) 2019-04-18 2020-10-22 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of usher syndrome
WO2020254249A1 (en) 2019-06-21 2020-12-24 Proqr Therapeutics Ii B.V. Delivery of nucleic acids for the treatment of auditory disorders
WO2021018750A1 (en) 2019-07-26 2021-02-04 Proqr Therapeutics Ii B.V. Ophthalmic compositions comprising viscosifying polymers and nucleic acids
WO2021130313A1 (en) 2019-12-23 2021-07-01 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for nucleotide deamination in the treatment of stargardt disease
WO2021175904A1 (en) 2020-03-04 2021-09-10 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for use in the treatment of usher syndrome
US11118177B2 (en) 2017-12-21 2021-09-14 Crispr Therapeutics Ag Materials and methods for treatment of Usher syndrome type 2A and/or non-syndromic autosomal recessive retinitis pigmentosa (ARRP)
WO2022184888A2 (en) 2021-03-05 2022-09-09 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for use in the treatment of corneal dystrophies
US11661596B2 (en) 2019-07-12 2023-05-30 Peking University Targeted RNA editing by leveraging endogenous ADAR using engineered RNAs
US11702658B2 (en) 2019-04-15 2023-07-18 Edigene Therapeutics (Beijing) Inc. Methods and compositions for editing RNAs
WO2023152371A1 (en) 2022-02-14 2023-08-17 Proqr Therapeutics Ii B.V. Guide oligonucleotides for nucleic acid editing in the treatment of hypercholesterolemia
WO2024105063A1 (en) * 2022-11-15 2024-05-23 Stichting Radboud Universitair Medisch Centrum Antisense oligonucleotides for treatment of usher 2a. exons 39-40
US12018257B2 (en) 2016-06-22 2024-06-25 Proqr Therapeutics Ii B.V. Single-stranded RNA-editing oligonucleotides
US12180471B2 (en) 2017-04-13 2024-12-31 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of Stargardt disease
US12203072B2 (en) 2016-09-01 2025-01-21 Proqr Therapeutics Ii B.V. Chemically modified single-stranded rna-editing oligonucleotides
US12275937B2 (en) 2018-05-18 2025-04-15 Proqr Therapeutics Ii B.V. Stereospecific linkages in RNA editing oligonucleotides

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220290154A1 (en) * 2019-08-08 2022-09-15 Stichting Radboud Universitair Medisch Centrum Antisense oligonucleotides rescue aberrant splicing of ABCA4
CN113122577A (zh) * 2019-12-30 2021-07-16 博雅辑因(北京)生物科技有限公司 一种治疗Usher综合征的方法和其组合物
BR112022012921A2 (pt) * 2019-12-30 2022-09-06 Edigene Therapeutics Beijing Inc Métodos para editar de forma alvejada ácido ribonucleico e para tratar a síndrome de usher tipo ii, ácido ribonucleico de recrutamento da adenosina desaminase, construto ou vetor de entrega, célula, e, uso do ácido ribonucleico de recrutamento da adenosina desaminase ou do construto ou vetor de entrega
TR2022001648A2 (tr) * 2022-02-09 2022-02-21 T C Ueskuedar Ueniversitesi Ush2a kaynaklı retinitis pigmentosa hastalığının genetik tedavisi için ekzon 13 atlama işlevi gören kseno nükleik asit antisens-oligonükleotit (xna-aso) dizileri.
EP4599060A1 (en) * 2022-10-06 2025-08-13 Stichting Radboud universitair medisch centrum Antisense oligonucleotides for treatment of usher 2a. exons 30-31
EP4599061A1 (en) * 2022-10-06 2025-08-13 Stichting Radboud universitair medisch centrum Antisense oligonucleotides for treatment of usher 2a. exon 68
EP4603585A1 (en) * 2022-10-11 2025-08-20 Guangzhou Reforgene Medicine Co., Ltd. Snrna nucleic acid molecule and application thereof
WO2025007937A1 (zh) * 2023-07-04 2025-01-09 广州瑞风生物科技有限公司 靶向USH2A pre-mRNA假外显子PE40的snRNA及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016005514A1 (en) * 2014-07-10 2016-01-14 Stichting Katholieke Universiteit Antisense oligonucleotides for the treatment of usher syndrome type 2

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60042338D1 (de) 1999-10-04 2009-07-16 Univ New Jersey Med TAR RNA bindende Peptide
EP1191097A1 (en) 2000-09-21 2002-03-27 Leids Universitair Medisch Centrum Induction of exon skipping in eukaryotic cells
US20100196889A1 (en) 2006-11-13 2010-08-05 Bankaitis-Davis Danute M Gene Expression Profiling for Identification, Monitoring and Treatment of Colorectal Cancer
US8093000B2 (en) 2008-05-09 2012-01-10 The Regents Of The University Of California Methods for predicting and treating tumors resistant to drug, immunotherapy, and radiation
US20110070582A1 (en) 2008-11-03 2011-03-24 Source Precision Medicine, Inc. d/b/d Source MDX Gene Expression Profiling for Predicting the Response to Immunotherapy and/or the Survivability of Melanoma Subjects
PT2425814E (pt) 2010-09-03 2013-09-02 Novagali Pharma Sa Emulsão de tipo água em óleo para tratamento de uma doença ocular
US9927034B2 (en) 2015-08-25 2018-03-27 Mueller International, Llc Valve seat stiffener
EP3359667A1 (en) 2015-10-05 2018-08-15 ProQR Therapeutics II B.V. Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion
JP7043082B2 (ja) 2016-04-25 2022-03-29 プロキューアール セラピューティクス ツー ベスローテン フェンノートシャップ 眼疾患を処置するオリゴヌクレオチド

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016005514A1 (en) * 2014-07-10 2016-01-14 Stichting Katholieke Universiteit Antisense oligonucleotides for the treatment of usher syndrome type 2

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11123360B2 (en) 2016-04-25 2021-09-21 Proqr Therapeutics Ii B.V. Oligonucleotides to treat eye disease
US10617707B2 (en) 2016-04-25 2020-04-14 Proqr Therapeutics Ii B.V. Oligonucleotides to treat eye disease
US12018257B2 (en) 2016-06-22 2024-06-25 Proqr Therapeutics Ii B.V. Single-stranded RNA-editing oligonucleotides
US12545911B2 (en) 2016-06-22 2026-02-10 Proqr Therapeutics Ii B.V. Single-stranded RNA-editing oligonucleotides
US12203072B2 (en) 2016-09-01 2025-01-21 Proqr Therapeutics Ii B.V. Chemically modified single-stranded rna-editing oligonucleotides
US12180471B2 (en) 2017-04-13 2024-12-31 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of Stargardt disease
US11072792B2 (en) 2017-12-21 2021-07-27 Bayer Healthcare Llc Materials and methods for treatment of usher syndrome type 2A
US12215316B2 (en) 2017-12-21 2025-02-04 Crispr Therapeutics Ag Materials and methods for treatment of usher syndrome type 2A
US12122998B2 (en) 2017-12-21 2024-10-22 Crispr Therapeutics Ag Materials and methods for treatment of usher syndrome type 2A and/or non-syndromic autosomal recessive retinitis pigmentosa (ARRP)
US11118177B2 (en) 2017-12-21 2021-09-14 Crispr Therapeutics Ag Materials and methods for treatment of Usher syndrome type 2A and/or non-syndromic autosomal recessive retinitis pigmentosa (ARRP)
WO2019123429A1 (en) * 2017-12-21 2019-06-27 Casebia Therapeutics Llp Materials and methods for treatment of usher syndrome type 2a
US12275937B2 (en) 2018-05-18 2025-04-15 Proqr Therapeutics Ii B.V. Stereospecific linkages in RNA editing oligonucleotides
US12398393B2 (en) 2019-01-28 2025-08-26 Proqr Therapeutics Ii B.V. RNA-editing oligonucleotides for the treatment of usher syndrome
WO2020157008A1 (en) 2019-01-28 2020-08-06 Proqr Therapeutics Ii B.V. Rna-editing oligonucleotides for the treatment of usher syndrome
WO2020165768A1 (en) * 2019-02-12 2020-08-20 Università Degli Studi Di Trento Cas12a guide rna molecules and uses thereof
WO2020201144A1 (en) 2019-04-02 2020-10-08 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for immunotherapy
US11702658B2 (en) 2019-04-15 2023-07-18 Edigene Therapeutics (Beijing) Inc. Methods and compositions for editing RNAs
WO2020212567A1 (en) 2019-04-18 2020-10-22 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for the treatment of usher syndrome
WO2020254249A1 (en) 2019-06-21 2020-12-24 Proqr Therapeutics Ii B.V. Delivery of nucleic acids for the treatment of auditory disorders
US11661596B2 (en) 2019-07-12 2023-05-30 Peking University Targeted RNA editing by leveraging endogenous ADAR using engineered RNAs
WO2021018750A1 (en) 2019-07-26 2021-02-04 Proqr Therapeutics Ii B.V. Ophthalmic compositions comprising viscosifying polymers and nucleic acids
WO2021130313A1 (en) 2019-12-23 2021-07-01 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for nucleotide deamination in the treatment of stargardt disease
WO2021175904A1 (en) 2020-03-04 2021-09-10 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for use in the treatment of usher syndrome
WO2022184888A2 (en) 2021-03-05 2022-09-09 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for use in the treatment of corneal dystrophies
WO2023152371A1 (en) 2022-02-14 2023-08-17 Proqr Therapeutics Ii B.V. Guide oligonucleotides for nucleic acid editing in the treatment of hypercholesterolemia
WO2024105063A1 (en) * 2022-11-15 2024-05-23 Stichting Radboud Universitair Medisch Centrum Antisense oligonucleotides for treatment of usher 2a. exons 39-40

Also Published As

Publication number Publication date
IL262199A (en) 2018-12-31
US10617707B2 (en) 2020-04-14
JP7043082B2 (ja) 2022-03-29
CN109072239A (zh) 2018-12-21
JP2019515688A (ja) 2019-06-13
KR102368920B1 (ko) 2022-02-28
IL262199B (en) 2022-03-01
US20210401871A1 (en) 2021-12-30
ES2801823T3 (es) 2021-01-14
US20190381089A1 (en) 2019-12-19
US11123360B2 (en) 2021-09-21
EA201892431A1 (ru) 2019-04-30
EP3448999B1 (en) 2020-05-13
DK3448999T3 (da) 2020-06-08
PL3448999T3 (pl) 2020-11-30
AU2017257292A1 (en) 2018-12-06
KR20180134931A (ko) 2018-12-19
MX2018013003A (es) 2019-01-28
CA3021899A1 (en) 2017-11-02
EP3448999A1 (en) 2019-03-06
ZA201806628B (en) 2019-07-31
US20200237802A1 (en) 2020-07-30

Similar Documents

Publication Publication Date Title
US11123360B2 (en) Oligonucleotides to treat eye disease
US11479771B2 (en) Antisense oligonucleotides for the treatment of eye disease
US11279933B2 (en) Antisense oligonucleotides for the treatment of leber congenital amaurosis
AU2016231067B2 (en) Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
HK40044776A (en) Oligonucleotides matching col7a1 exon 73 for epidermolysis bullosa therapy
NZ736083B2 (en) Oligonucleotides matching col7a1 exon 73 for epidermolysis bullosa therapy

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 3021899

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019506546

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20187031243

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017721984

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17721984

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017721984

Country of ref document: EP

Effective date: 20181126

ENP Entry into the national phase

Ref document number: 2017257292

Country of ref document: AU

Date of ref document: 20170425

Kind code of ref document: A