WO2017184844A1 - Fatty acid synthase inhibitors - Google Patents

Abstract

The present disclosure relates to a method for inhibiting Fatty Acid. Synthase (FASN) with, a FASN inhibitor, methods for treating cancer and viral infections with a FASN inhibitor, and compounds and compositions inhibiting FASN,

Description

FATTY ACID SYNTHASE INHIBITORS

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 2/325.887. tiled April. 21, 201 , the entirety of which is hereby incorporated by reference.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR

DEVELOPMENT

This invention was made with Government Support under Grant Nos. AI090644 and I RGl-AI 089526-04 awarded by the National nstitutes of Health. The Government has certain rights in the invention. FIELD OF TH E IN VENTION

The present disclosure provides a potent and selective fatty acid synthase (FASN) inhibitor, HS- 106. Further disclosed is that HS-106 has potent anti-tumor activity in various breast cancer cell lines. Further disclosed is that FASN is a novel host antiviral target, and that HS-106 inhibits HIV replication with minimal host eel! toxicity.

BACKGROUND OF THE INVENTION

Fatty acid synthase I (FASN) catalyzes the final steps leading to the synthesis of long chain fatty acids in vivo, FASN is a 270 kDa, multifunctional, cytosolic enzyme that uses NADPH to condense acetyl -Co A and malonyl-CoA into palmitate (Liu et L, 2010). FASN is considered an attractive target for cancer therapy due to the selective dependence of many tumors on tie novo fatty acid synthesis. Many tumors are dependent on de novo fatty acid synthesis as a source of long chain fatty acids to maintain growth and interdicting at key steps in this pathway may have therapeutic benefit. FASN up-regulation is correlated with tumor aggressiveness. FAS is upreguiated in numerous cancers, including breast cancer, melanoma, and hepatocellular carcinoma (Menendez et ,, 2007). Like many essentia! metabolic pathways under complex homeostatic regulation, the consequences and adaptive responses of acute or chronic inhibition of essential enzymes such as FAS in vivo are not fully understood. Owing to its low level expression and its association with both cancer and enveloped virus replication, FASN is an attractive therapeutic target. Cellular FASN expression is highly regulated, and in response to physiological stresses such as starvation, lactation or pathological states, its expression can change dramatically (SuS et al, 1998), Although studies in mice indicate that FASN is required for embryonic development (Chirala et al, 2003), liver or maerophage- specific FASN knockout mice are viable (Cbakra v th et al, 2005; Schneider et al, 2010).

In humans, de novo fatty acid synthesis is active in a limited number of tissues such as liver, adipose, cycling endometrium and lactating mammary gland. This contrasts with the other bodily tissues which largely meet their fatty acid requirements from dietary sources (Brusselmans and Swinnen, 2009) (Iwanaga et al_t 2009) (Swinnen et al, 2006). However, some pathological conditions promote cells to become dependent on de novo fatty acid synthesis including solid tumors, leukemic cells and host cells of certain viruses (Ameer et al., 2014).

FASN catalyzes the complete synthesis of palmitate from aeetyl-CoA and malonyl-CoA into long-chain saturated fatty acids (FAs), FASN is a multifunctional enzyme that synthesizes FA chains two-carbons at a time, each donated from malonyl-CoA. The active form of FASN is composed of a homo-dimer where each monomer has seven different catalytic domains. These domains include the acyl. carrier (ACP) protein which is responsible substrate channeling from one domain to another, the ketoacyl synthetase domain ( AS) which catalyze the condensation step, the ketoacyl reductase ( R) and eno l reductase (ER) which both are responsible for saturating the acyl chain, the dehydratase (DH) domain which is responsible for removing a water molecule from the acyl chain between the two reduction steps, Malonylacetyl transferase (MAT) domain which catalyze the transfer of both malony-CoA and acetyl CoA, and the tMoesterase domain (TE), which clips the palmitate off the enzyme after reaching the desired aeyS-chain length ( aier et al, 2008). Palmitic acid (16:0) can be metabolized further by β- oxidation into myristic acid (14:0), or other long chain FAs (Liu et al, 2010), Long chain FAs are essential components of lipid bilayers, store energy liberated by β-oxidation, and FAs can be covalem^'ly attached to proteins as a means to control protein subcellular localization (Wakil, 1989). The human purinome consists of -1,500 proteins that bind and use purines such as ATP, NADH, and NADPH (Fadden et al., 20.10). Almost all synthetic processes within the cell, including transcription, protein folding, and metabolite synthesis, require purine-utilizing proteins, By virtue of their purine binding pockets, purinome proteins are highly draggable, and many existing drugs target purine-using enzymes (e.g. methotrexate, warfarin, statins, protein kinase inhibitors, antiretrovirals) (Haystead, 2006). FAS has seven sequential catalytic activities and uses two co-factors, NADPH and co-enzyme A, to transfer two carbon units to a growing FA chain (Wakil, 1989) until the final product, palmitic acid (.16:0) is released. Three of the FASN enzymatic activities (ketoacyl reductase, enoyl reductase and malonyi/acetyl transferase) use purine-eontainkig co-factors in the form of NADPH, acetyl CoA and malonyl CoA. Importantly, inhibitors targeting purine-utilizing enzymes are generally not lipophilic and have formed the basis of many drugs in clinical use from reverse transcriptase inhibitors to the newer cutting edge inhibitors targeting protein kinases or heat shock proteins (Felder et al., 2012; Kay stead, 2006; Knapp et al., 2006; Murray and Bussiere, 2009). In the last two decades, FASN has been considered a potential therapeutic target for the treatment of metabolic syndrome and numerous malignancies (Puig et al., 2011; Yoshii et aL, 2013).

One of the common themes amongst current FASN inhibitors is a mechanism of action favoring competition with substrate intermediates over co factor binding. Even in the case of GSK2194069, despite acting on β-ketoacyl reductase step, the triazolone is only competitive with trans-1 -decalone binding and uncompetitive with NADPH (Hardwicke et al., 20.14). inhibitors targeting the FASN co-factor domain therefore remain largely unexplored. Targeting of the substrate domains may in part explain the toxicities and lack of efficacy in. vivo of the majority of FASN inhibitors, since in order to act competitively the molecules are lipid like in nature, A second concern relates to the broader physiological consequences of selectively inhibiting FASN in vivo_> either acutely or chronically. The de novo fatty aeid synthesis pathway is highly regulated at several steps and therefore highly prone to compensatory adaptive responses that would potentially mitigate the efficacy of any selective FASN inhibitor in vivo. Likely compensations could include increased over expression of FASN itself, increased uptake of exogenous dietary lipids, alteration in expression of enzymes regulating malonyl CoA levels, such as acetyl CoA carboxylase or malonyl CoA decarboxylase or even switching of the cell to a glycolytic phenofype. In breast cancer, the level of FASN expression is correlated with tumor progression, where high FASN expression leads to more tumor aggressiveness and poor prognostic outcome (A.!o et ai., 1996). Inhibiting FASN activity in vitro by pharmacological means or the message level siRNA has been shown to stop cancer eel! growth and induce apoptosis. As a consequence, many research groups have tried to exploit FASN as a target for cancer by developing inhibitors including C75, C93, epigallocatech n gall ate (EGCG). G28UCM, orlistat, GS 2194069 and GSK.837149A (Kuhajda et al, 2000) (Thupaii et ai., 2002) McFadden et ai., 2005; Orita et aL, 2007: Ueda et a/., 2009; Zhou et ai.,. 2007). (Tian, 2006; Wang and Tian, 2001 (Landis-Pi. owar et aL, 2007; Oliveras et aL, 2010; Puig et aL, 2009; Turrado et aL, 2012) (Puig et ai.. 201 1) (Hardwicke et ai.... 2014; Vazquez et aL, 2008). Despite these eftbrts, however, the majority of FASN inhibitors have failed to even advance to animal efficacy studies largely due selectivity issues in vivo resulting in unexpected toxicities. Current anti-FASN scaffolds include C75 (Kuhadja, 2000) and Cerulenm (Funabashi et aL, 1989), which are Sipid-likc and contain reactive epoxides, or are based on natural products such as Epigallocatechin gallate (EECG). These scaffolds are not in clinical use because they are either unselective (Liu et aL, 2010) or with low bioavailability (Kridel et ai., 2004). The only FASN inhibitor advanced to clinical trial for the treatment of advanced solid rumors to date is the FASN inhibitor TV.B-2640. This molecule is based on a potent imidazopyridine scaffold and also has anti-hepatitis C virus (HCV) activity (Oslob et aL, 2013). Therefore, a need remains for additional selective FASN inhibitors for the treatment of cancer .

Viruses repurpose host cellular machinery to produce progeny. The development of €CR5-based antiviral therapy and the results of several siRNA-based screens that identified host proteins required for HIV replication highlight both the utility and the potential to drag host proteins (Dorr et aL, 2005, Bushman et aL, 2009). HlV-1 relies on host systems to replicate, and intracellular host proteins represent an underdeveloped poof of therapeutic targets that, do not evolve as rapidly as viral proteins. Drugging host proteins could have several advantages over viral targets, including a high barrier to drug resistance (human proteins evolve at slower rates than viral proteins), and the potential to develop a pan-antiviral drug (if several viruses require the same host pathway). The challenge is to identify a pathway that is dispensable to the host but critical for viral replication. Therefore, a need exists for identification of such pathways and their inhibitors for the development of new antiviral drags. SUMMARY OF THE INVENTION

Herein is disclosed thai the and-neoplastic activity of HS-106 is due to the induction of apoptosis resulting from CPT-I inhibition, cerarmdc accumulation, and changes in lipid raft composition, all of which can be rescued by ACC inhibition rather than exogenous palmitate supplementation, which is deviated into neutral lipids instead of phospholipids.

Accordingly, in one aspect the invention relates to a method of inhibiting Fatty Acid Synthase (F ASN) with a FAS inhibitor that binds to the F ASN purine-binding cotactor domain, the method comprising contacting cells that express FASN with an mhibitor that binds to the FASN purine-binding cofactor domain,

in another aspect the invention relates to a method of promoting apoptosis in a cancer cell dependent on FASN activity, the method comprising contacting the cells with an inhibitor that binds to the FASN purine-binding cofactor domain.

In another aspect, the invention relates to method of treating cancer in a subject, the method comprising administering to the subject in need thereof a therapeutically effective amount of a FASN inhibitor that binds to the FASN purine- binding cofactor domain.

In another aspect, the invention relates to method of inhibiting viral replication in cells dependent on FAS expression, the method comprising contacting the cells with an inhibitor that binds to the FASN purine-binding cofactor domain,

hi another aspect, the invention relates to method of treating a viral infection in a subject, the method comprising administering to the subject in need thereof, a therapeutically effective amount of a FASN inhibitor that binds to the FASN purine-binding cofactor domain.

In another aspect, the invention relates to pharmaceutical composition comprising (N-(l- henzyipyrroSidm~3~y!)~5,6~dim or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

In another aspect, the invention relates to the compound (R)-(N-(l-ben2ylpyrrolidin-3- yl)-5,6-diraethyl1hi.eno[2,3-d]pyrimidin-4-aniine or a pharmaceutically acceptable salt thereof

In another aspect, the invention relates to the compound (S)-( -0 -benzylpyrro idin-3- yl)-5,6-o^methylthieno[2,3Hllpyrimidm-4-amme or a pharmaceutically acceptable salt thereof, The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing aspects and other features of the disclosure are explained in the following description, taken in connection with the accompanying drawings, herein:

FIGURE 1 is a cartoon illustration of the discovery of the FASN inhibitor HS-106. The ability of cibacron blue sepharose to bind FASN was utilized in screening for compounds that can bind FASN, fluorescein labeled FASN was used to quantify the ability of the compounds to elate FASN from the resin then the eluents with high fluorescence is ran on SDS-FAGE were the elated proteins was identified by mass spectrometry. (A). Cibacron blue Sepharose was incubated with porcine lactating mammary gland extracts (a rich source of FASN), washed, and bound proteins were labeled with fluorescein. A small molecule library of druggable molecules with structural similarity to any purine or known purine analog scaffold was assembled and tested for the ability of each molecule to compete fluorescein labeled proteins off cibacron blue resin, proteins from the eluents that had high fluorescence intensity were separated by SDS- PAGE and silver stained then proteins were identified by MS. (B). The screen of 3,379 purine- based compounds identified 247 hits with high fluorescent signal Of the 247 Slits, 155 were selected by virtue of both a high FASN-intensity and a low number of non- FASN protein bands. The 20 most selective compounds were tested for anii-FASN activity in a ^~T1 glucose incorporation assay and the molecule with the highest activity (US- 106) was selected for further profiling,

FIGURE 2 as a graphic illustration of the structures and activities of HS-1 6 and related compounds. (A). HS-106 inhibited the incorporation of both tritiated acetate (IC_¾ 147 nM) and tritiated glucose (IC5₀ 213 nM) into lipids in HepG2. (B), HS-106 inhibited the human purified FAS activity of ^l4C Makmyl CoA incorporation into lipids with an IC50 3.71 μΜ. (C), Structures of analog HS-102 and enantiomers of HS-106 (ES-79 and HS-80). (D). HS-106 and its enantiomers, HS-79 and HS-80, inhibit the incorporation of tritiated acetate into lipids. FIGURE 3 is a graphical illustration of the selectivity of HS- 106 and library compounds, individual compounds were assayed for their ability to e!oie proteins from Cibacron blue resin. Blue-red color spectrum indicates protein concentration, as measure by fluorescence (see FLECS methods), SDS-PAGE and mass spectrometry analysis showed that HS-106 selectively eluies FASN compared with strong (HS-206160) and weak (HS-202889) hits. Bottom (red graph). Compound library was screened for inhibitory activity against the following enz mes: ACC, ZipK, ΑΜΡΚα, ΑΜΡΚγ, TRAPi, H.SP70, NS5, and IRAK 2; HS-106 was a potent inhibitor of FASN (only). FIGURE 4 graphically illustrates the ariti-proliferative activit of HS-106 (A-E), Based on the DNA content measured by staining with Hoechst, treating various types of breast cancer cell lines with, one dose of 50nmol/ml of HS-106 {green circle) was able to inhibit cells proliferation with similar potency of 50nmoi/ml C75 (red triangle) except for the non~ tumorigenic cell line MCF OA when compared to control (blue squares) (F). Cell cycle analysis for BT474 cells treated with different concentrations of HS-106 for 24 hours shows an increase in the Sub 2N population. (G). Treating breast cancer cell lines with 10 nmol ml of HS-106 for 24 hours did not have any effect on the expression of FASN.

FIGURE 5 graphically illustrates the effects of HS-106 on the Lipidome. BT474 cells were treated with 10 nmol/ml of HS-106 for two hours and then lipids were extracted and subjected to LC MS. More than 3000 lipid features were quantified using both ESI and ESI- analyses. (A). Each point represents one of the lipid molecules that were quantified, aggregated for ESI+ and ES1-. The color of each dot represents how significant is the difference in the abundance between the control and treatment (B), The quantified lipids with more than two fold change and p-va!ue < 0.01 were examined and identified with endogenous standards or given putative identifications based on retention time, accurate mass, and fragmentation where available (e.g. diacylglycerols, Ceramides, and glyeerophospholipids). Of the lipids that were identified, many were diacylglycerols. Ceramides and fatty acids were found to increase over the control (*p < 0.01, #p < 0.05, n = 5) (mean ± SEM). (C). BT474 ceils were treated with different concentrations of Fasnall for 1 hr and lipids were separated by aminopropyl. cartridges after incubating the cells with [3H]aeetate for 2 hr. Fasnall was able to inhibit the incorporation of acetate into the different types of lipids, especially the more abundant phosphoiipids. A similar experiment was done with. [14C]patmitate, which showed a dose-dependent increase in palmitate sequestering into free fatty acids and reduction in its incorporation into phospholipids. Similar to free fatty acids, neutral lipids increased except for at 50 mM Fasnall, when the decreased, (mean ± SEM). (D). Treatment of BT474 cells with different concentrations of Fasnall under 10% FBS conditions induce the formation of lipid droplets as shown by oil red O staining, indicating an increase in neutral lipids formation when compared with 1% FBS.

FIGURE 6 is a tabular view of the quantified lipids with more than two-fold change. The quantified lipids with more than two fold change and p-value < 0.01 were examined and identified with endogenous standards or given putative identifications based on retention time, accurate mass, and fragmentation where available (e.g. diacylglycerois, Ceramides, and giyeerophospholipkls). FIGURE 7 graphically illustrates thai HS-106 induces apopiosis in HER2+ breast cancer cells, (A) The indicated cells were treated with different concentrations of HS-106 or C75 for 24 hours then the Caspase 3/7 activity was assayed using the fluorogenic substrate (DE VD }?-r 1 10. (B) Cells were pretreated for one hour with Ι ΟΟμΜ palmitate (PA) made as part of mixture of 1 :2 palmitate oleate in complex with 0.1% BSA or 15μ TO FA or both (TOFA-t-PA). All the treatments contained the exact amount of BSA and DMSO. Then, cells were treated with different concentrations of S IS- 106 or C75 for 24 hours and Caspase 3/7 activity was assayed.

FIGURE 8 graphically illustrates HS-106 activity in MMTV-Neu mice, (A) HS-106 dose not induce weight change. Mice were assessed weekly, treated BIW with an IP injection of different concentrations of HS-106 made in 1 : 1 DMSO/saline. (B,C) combination of HS-106 and Carboplatin significantly reduce tumor volume (t-test, P v«/«e=0.014). (D) HS-106 increases the median survival of the mice from 29 to 63 days with a log-rank P value of 0.049,

FIGURE 9 illustrates the top screening hits and their activit in glucose incorporation into lipids and elution profile. From the 155 hits with highest FAS band intensity and low number of non- FAS bands, 20 molecules were selected and only 13 selected for purchase. These molecules were tested for their ability to inhibit the incorporation of tri dated glucose into lipids.

FIGURE 10 illustrates the ekuion of fluorescein labeled proteins. Labeled proteins can be elute from Cibacron Blue Sepharose with Adenine Nucleotides. Laeiating pig mammary gland homogenate where applied to blue Sepharose resin then washed with buffer and labeled with the Thiol-Reactive probe Fluorescein-5-nm!einiide. Then, the resin was washed with 5mM NAD solution to remove dehydrogenases and excess Fluorescein. The bonded proteins were eluted with different Adenine Nucleotides. ( A, B and C) the eluted proteins separated by SDS-PAGE and stained with silver. These proteins were identified with mass spectrometry: 1 -Fatty acid synthase 2-ATP citrate Lyase 3-Eukaryotic translation elongation factor 1 alpha 1. 4- L-lactate dehydrogenase. 5~Nucleoside diphosphate kinase B. (D) Fluorescence of the eluted proteins, showing a concentration dependent increase in the fluorescence signal.

FIGURE 1 1 illustrates the effect of HS-106 on the incorporation of Acetate and Palmitate into the different groups of lipids, (A). BT474 cel ls were treated with different concentrations of HS- 106 for 1 hour then lipids were separated by aminopropyi cartridges after incubating the cells with Ή acetate for two hours. HS-106 was able to inhibit the incorporation of acetate into the different types of lipids, especially the more abundant phospholipids, B). A similar experiment was done with ^l C palmitate which showed a dose dependent increase in pahnitate sequestering into free fatty acids and reduction in its incorporation into phospholipids. Similar to .free fatty acids neutral lipids increase except for at > 50μΜ HS-106 where they decrease.

FIGURE 12 graphically illustrates the blue Sepharose elution profile of HS-106 enantiomers and their easpase 3/7 activity. (A) Cibacron blue Sepharose was incubated with porcine iactating mammary gland extracts and bound proteins were Iabeled with fluorescein, the Iabeled proteins were eluted with different concentrations of Fasna!l enantiomers and different concentrations of NADPH and ATP were used as controls, the eluted proteins fluorescence were measured. (B) the eluted proteins were separated by SDS-PAGE and proteins were identified by MS (* FASN). (C) The ability of Fasnall enantiomers to induce apoptosis was assessed by performing easpase 3/7 assay. FIGURE 13 illustrates the characterization of purified FASN and Fasnali. elution of ATP Sepharose. (A) Purit of FASN from BT474 cells was assessed by SDS-PAGE, lane 1 and 2 is lOug and 20ug of loaded protein respectively, estimating the purity to he around 85%. (B) Purified FASN shows a dose response increase in the activity of [ C]-MaSonyI CoA incorporation into lipids. (C) Inhibitory activity of C75 in the same assay. (D) Increased concentrations of Fasnali (DMSO, 1, 2.5, 5 and I GmM lane 1-5 respectively) does not elute any proteins more than DMSO of ATP Sepharose loaded with BT474 cells lysate. Lane 6 and 7 are IGmM Staurosporine and 50mM ATP, respectively, as positive controls. FIGURE 14 illustrates the effect of FASN knockdown on Fasnali induced toxicity. (A) BT474 cells were treated with different concentrations of FASN smartpool siRNA, 85% of reduction in FASN expression was observed. (B) FASN siRNA were t und to induce apoptosis and inhibit cell proliferation in BT474 cells. BT474 cells were treated with different Fasnali concentrations after FASN siRNA transfection; FASN siRNA transfection was able to reduce Fasnali ability to (C) induce Caspase 3/7 activity, (D) inhibit cells proliferation and (E) viability.

FIGURE 15 illustrates that Fasnali induces apoptosis in BT474 ceils that can be partially reversed by the SPT-1 inhibitor Myrioem. (A) BT474 cells were treated with Fasnali for 24 hours and apopiotic cells quantified by flow cytometry through quantifying Amiexin V and Sytox Red stained cells. (B) BT474 cells were treated with different concentrations of the pan PKC inhibitor Staurosporine with or without TOFA. Staurosporine induction of apoptosis was not reversible by TOP A. (C) Several ceramide synthesis inhibitors were used to rescue BT474 ceils from apoptosis, the schematic shows the positions of the enzymes targeted by these inhibitors in the de novo and salvage pathways. (D) BT474 cells were pretreated with ΙΟμΜ of each cerarnide synthesis inhibitor then with increasing concentrations of Fasnali, caspase 3/7 assay was performed after 24 hours and only Myriocin was able to modestly rescue the cells,

FIGURE 16 illustrates the effects of HS-106 on mice liver and kidney functions. FVB J mice were treated with two doses of HS-106 for a week. After that, the mice were sacrificed and blood was collected. The samples were assayed for blood cell count (A, B and C), electrolytes (D, E and F), liver functions (G, H and I), kidney functions (J, K and L) and hemoglobin (M) and packed eel! volume (N).

FIGURE 17 illustrates the pharmacokinetics of FasnalL (A). After one IP dose of 15mg kg (30 pmol/kg) of US- 106, FVB/J Ne mice were sacrificed at different time points and tissues were collected and assayed for Fasnall concentration by LC/MS. (B). Tl/2 was calculated for each one of the tissues.

FIGURE 18 illustrates the effects of Fasnall on tumor volume in TNBC C3Tag mice. IP treatment of C3Tag mice with a combination of Carboplatki and Fasnall significantly reduce rumor volume after 21 days,

FIGURE 19 is a graphical summary of the screening process, identification of HS-106 and in vitro and in vivo profiling activities.

FIGURE 2.0 is a cartoon illustration graphically depicting the activity of HS-106 in the FASN cascade.

FIGURE 21 illustrates that HIV replication regulates FASN and that FAS activity is required for HIV replication. (A) TZM-bl cells were HIV-infected and the TZM-bi purinome was captured 48-hours post-infection. Proteins that remained bound to the resin after a high ionic wash were competed off the resin with 25mM ATP. Proteins were resolved by one-dimensional SDS-PAGE, visualized with silver stain, and identified with MALDI-TOF sequencing as the following: 1. Ubiquitin carboxyl terminal hydrolase (Q9Y4E8), 2. ATP-dependent R.NA heiiease DHX8 (Q14562), 3. Fatty acid synthase (P49327), 4. HSP90-beta (P08238), 5, GDP-L- fucose synthetase (Q .13630), 6. L-lactate dehydrogenase (P07.1 5) and pvridoxal kinase (O00764 , 7. Argininosuccinate synthase (P00966), 8. Nucleoside diphosphate kinase- A ( I 5531) and, 9, Nucleoside diphosphate kinase— B ( P22392). (B) Western blot analysis of FASN protein shows HIV-induced protein redistribation to a NP40-soluble fractions (h.p.L ^:::: hours post infection). (C) HIV-induced .tatty acid production in TZM-bl cells, (D) siRNA-based knockdown of FASN significantly reduces HIV p24 secretion (compared to a non-targeting control). ^indicates p <0M, **indicates pO.0001 (student's Rest), Poly-polymer control, NT=non~ targeting siRNA (control), NV.P=40 n nevirapinc. (E) FASN mRNA levels, normalized to 18S rRNA levels, following infection with HIV-1 NL 3 for the indicated number of ^'hours. Normalized mR^'NA levels at 4 h post infection are not significantly different than normalized mRNA levels at rime 0. p-0.2. student's t-test. Data are representative of two independent experiments.

FIGURE 22 illustrates the effect of HS-106 treatment on healthy mice. HS-106 treatment delivered IP at indicated doses on day 0 and 3. Blood drawn on day 4 indicates no change in (A) white blood cell counts, (B) hemoglobin levels, (C) aspartate aminotransferase (AST) levels, or (D) creatine levels. (B) Female FVB/J mice treated with HS-106 twice weekly did not show any signs of weight loss over a period of 60 days. During the daily assessment, the mice also did not show any symptoms of toxicity or stress such as guarded posture and labored breathing

FIGURE 23 demonstrates that incubation of TZM-bl cells with HlV-1 increases intensity of

FASN staining but does not change FASN subcellular localization, in all panels, FASN is labeled green and the nucleus is colored blue (DAPI), Red color denotes (A) lysosome (CD63), (B) mitochondria (Mitotracker), (C) endoplasmic reticulum (calreticulin). Data are representative of two independent experiments.

FIGURE 24 illustrates Fasnall inhibition of HIV- 1 replication. (A) Extracellular p24 levels in TZM-bl cells 48 h post infection (black dots ± SD, n=3, black line), without significant effects on TZM-bl cell viability (i.e. mean ΜΊ -activity; open circles, n^:==3) (B) Fasnall and C^'?5 significantly reduce HIV-1 replication in primary PBMC, as measured by p24 production. The data presented are mean values (± SD) from three independent experiments. ** Indicates

pO.0001 , treatment versus DMSO-treated control (Students /-test). (C) PBMC viability after treatment with Fasnall as measured by propidium iodide staining (dotted line drawn at 85%). FIGURE 25 demonstrates that FAS knockdown reduces HIV-1 particle production without affecting intracellular Gag production, (A) FASN immunoblot eonfirais .reduction in endogenous FASN levels in TZM-bl cells. (B) Extracellular (left) and intracellular (right) p24 levels

following siRNA-mediated FASN knockdown in TZM-bl cells infected with HIV-1 for 48 h. Bars represent mean p24 ± SD, quantified using a commercial ELISA, n= 3. p- values generated with student's /-test. ((.^") anti-Gag western blot of lysates from HIV-infected cells with or without FASN knockdown. Molecular weight markers (kD) indicated in right margin. Poly= polymer (transfection) control, NT^!!!nontargetkig siRNA (siRNA control), FASN ^::: FAS -targeted siRNAs, NVP =0.4 μ.Μ nevirapine. FIGURE 26 demonstrates that FAS inhibitio disrupts a late step in the HIV-1 replication cycle. (A) TZM-bl cells were Irans.feeted with p L4-3 provirus plasmid for 48 h in the presence or absence of 10 μ.Μ Fasna!f or C75 or DMSO (0.01%). Intracellular expression of H.IV-1 proteins was monitored by HIVIG-western blot, and β-actin was used as loading control. (B) Supernatant associated virion production was monitored using a p24 ELISA. (C) 48 hours post- transfection, cell collirfe superaatants were removed and incubated with fresh TZM-bl (indicator) cells for an additional 48 hrs. Values expressed as the mean ± standard deviation, and are representative of three independent experiments, p- values were generated with student's t-test. Molecular weight markers (kD) indicated in right margin.

FIGURE 27 is a graphical illustration of the potential mechanisms linking F ASN activity to

HiV-1 replication. 1 ) provision of fatty acids used for ATP production and energy homeostasis, 2) creation of lipid micro domains (rails) favoring OJV- 1 budding, 3) generation of fatty-acyl adducts (e.g. pa!nutate or myristate) for post-translational modification (PTM) of Env, Gag, ef, or host proteins, 4) homeostatic replenishment of membrane Sip ids lost during viral budding.

DETAILED DESCRIPTION OF THE INVENTION

For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to preferred embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended, such alteration ant! further modifications of the disclosure as illustrated herein, being contemplated as would, normally occur to one skilled, in the art to which the disclosure relates.

Articles "a" and "an" are used herein to refer to one or to more than one (i.e. at least one) of the grammatical object of the article. By way of example, "an element" means at least one element and can include more than one element. "About" is used to provide flexibility to id numerical range endpoint by providing that a given value may be "slightly above" or "slightly below" the endpoint without affecting the desired result.

As used herein, the terms "HS-106" and "Fasnall" are interchangeable, both referring to the compound N-(l-henzylpyrrol.idin-3-yI)-5,6-d™

Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

Identification of FASN inhibitors

To specifically identify inhibitors of FASN targeting its nucleotide binding pockets

Cibacron blue Sepharose was utilized. This medium has been used previously to purify NAD and NADP binding proteins from crude tissues extracts (Miyaguchi et /., 2011; Muratsubaki et a/., 1994), FASN enriched extract from lactating pig mammary gland was bound to the resin and labeled with cysteine reactive fluorescein. Having established that labeled FASN could be competitively released from the resin with adenine nucleotides (Figure 10), a subsequent screen of the bound enzyme against single concentration of an in-house small molecule library comprising compounds with structural similarity to any purine or known purine analog scaffold (Carlson et ai., 2013) was performed. Of the 3 ,379 compounds screened, 247 were found to yield a fluorescent signal at 488nm»_;;</522nm_KTiS (Figure 1 ). One hundred and fifty-five of the molecules selectively elute FASN from the resin, and 20 potential lead compounds were progressed according to their FASN selectivity (assessed, with SDS-PAGE, silver staining and mass spectrometry), These twenty compounds were reduced to 13 based on the absence of any- obvious chemical liabilities. Next, the molecules were tested for their ability to inhibit FASN activity in a HepG2 cell based assay that measured the incorporation of ^JH glucose into lipids (Figure IB and Figure 9).

Of the 13 molecules tested, MS-106 was the most potent inhibitor. In more detailed cell based assays, HS-106 potently blocked both acetate and glucose incorporation into total lipids, with ICso values of 147 nM and 213 nM, respectively in HepG2 cells and about ! .50μ with Acetate and glucose (1.66 μΜ) as a tracers in the HER2 - BT474 breast cancer cell line (Figure 2A and 2E). Subsequently, direct inhibition of FASN was confirmed using the purified human enzyme isolated from the BT474 cell line (ICso - 3.71 μΜ, Figure IB). To confirm selectivity of HS-106, data derived from prior screens against the house library (Carlson et aL, 2013; Figure 3) was analyzed. Non of the previously screened proteins (ACC, Hsp90, Hsp70, TRAP-1 , DAP kinase 3(ZIP ), IRAK 2, A P alpha and gamma subunits, NEK9, dengue nonstructural protein 5 (NS5) malarial kinase PfPK9, and HSF-1) were targeted by HS-106.

HS-106 an tineoplastic activity

in liver and breast tumor cells, HS-106 was able to inhibit both acetate and glucose incorporation into lipids. The sensitivity of breast cancer cell lines to inhibition of glucose incorporation into lipids by HS- 106 was shown to vary based on the expression level of FASN as well as other enzymes directly involved in fatty acid synthesis. Consistent with a dependency of aggressive breast cancer cell lines on oxidative metabolism, HS-106 inhibited cell proliferation in triple negative, ER. positive and Her2 positive breast tumor cells lines. In contrast, antiproliferative activity of HS -106 was lower in the non-tumori enie cell line MCF10A, which also has lower dependence on FASN activity (Yang et at, 2002). Global lipodomic studies with HS- 106 showed selective inhibition of FAS profoundly alters cellular lipid profiles, sharply increasing ceramides, diacy!glycerols and unsaturated, fatty acids as well increasing exogenous palmitate uptake and neutral lipid formation. Whereas uptake of the latter lipids may represent compensatory responses to maintain cellular growth rates, the induction of ceramides promotes growth arrest and cell death. Consistent with this mechanism of action HS-106 showed potent anti-tumor activity in the M TV eu model of HER2+ breast cancer, particularly when combined with Carboplatin.

Meehamstic eyd

Lipidomics data analysis combined with the rescue experiments provided insights into the mechanism by which FASN inhibition may induce tumor cell apopiosis. HS-106 treatment was found to induce an increase in ceramides, diacyiglycerols and saturated fatty acids. Ceramide accumulation is consistent with an inhibition of CPT-1 and induction of sphingomyelinase activity. Accumulation of cexamide reflects an increase in malonyl CoA concentration which inhibits CPT-1 activity (Pi¾er et at, 2000) while induction of sphingomyelinase indicates a translocation of sphingomyelin to the inner leaflet of the plasma membrane. There are two main pathways by which diaeyl glycerols can be formed; by de novo synthesis from glycerol and fatty acids, which increases when there are !arge quantities of these precursors; and from the lipolysis of ΡΪΡ2. While not wishing to be bound by theory, but based on the present characterization of HS-106, the .former pathway would be favored since inhibitio of the fatty acid synthesis pathway in general leads to the glucose being diverted into the synthesis of glycerol (Haystead ei /., 1 89). When combined with the uptake of fatty acids from the media and the inhibition of CPT- 1, these conditions favor an increase in diaeylglyeerois abundance. The palmitate uptake experiment confirms the previous finding by showing the partitioning of palmitate into neutral lipids rather than phospholipids, which explains the inability of palmitate to completely rescue HS-106 induced apoptosis in contrast to inhibiting ACC by TOFA which stops malonyS CoA accumulation and prevents CPT-1 inhibition. Collectively these data therefore suggest a mechanism by which FASN inhibition can induce anti-pro !iferative activity in vivo in spite of the fatty acids provided from circulation.

This ability of HS- 106 to induce apoptosis was confirmed by Annexin V assay. When combining this assay results with the accumulation of Ceraraides, HS-106 inhibition of de novo fatty acid synthesis and the uptake of different types of polyunsaturated fatty acids from the media induces changes in the plasma membrane composition that leads to the translocation of phosphatidyiserine and phosphatidvicholme from the inside of the membrane to the outside while sphingomyelin is internalized. This event, is noteworthy due to its effect on lipid raft structures which can alter the representation of receptor tyrosine kinases on the cell surface, especially HER2 in the case of BT474 cells.

In viyo evaluation of HS- 106

in contrast to most FASN inhibitors, HS- 06 is well, tolerated in mice and does not induce any overt weight loss or any change in feeding behavior. Even on a conservative twice weekly dosing regimen, HS-106 reduced tumor size in both the MMTV Neu and C3Tag models, and had a profound effect on median survival. Moreover, combining HS-106 with Carboplatin synergistically reduced tumor volumes and impacted survival over the first 40 days of combination treatment. Although, overall survival was not extended beyond HS-106 alone, the dramatic early response to the combination has clinical relevance. Normally, Carboplatin treatment is restricted to 21 days in patients due to its toxicity and tendency to develop resistant tumors when used over the longer term. The disclosed pharmacokinetic study shows that there is room to increase HS- 106 dosing io improve its performance in vivo. The compound is rapidly cleared from plasma and tissues which indicates thai it's possible to increase the dosing schedule from twice weekly to at least a daily regimen, i IS- 106 may therefore enable significant reduction of the Carbopl tin dose. This may increase the combined, drugs' efficacy while reducing the toxicity of the latter compound.

Evaluation of purine-binding proteins regulated by H.lV-1

The disclosed protein affinity media, using the purine-binding pocket to capture the entire purmome enabling it to be screened against chemical libraries en masse (Graves et ai, 2002), was utilized to define purine- binding proteins regulated by HlV-1 infection. HeLa-derived TZM-bl cells were HIV-infected, and 48 hours later lysed, and incubated with the purinome-affinity media. After competing bound proteins off the resin with ATP, it was noted that HiV~infection increased the recovery of several human proteins to the purinome-binding resin, including fatty acid synthase (FASN), heat-shock protein 90 (HSP90), and others (Figure 21 A). Although all of the proteins identified are potential therapeutic targets, owing to its specialized, well-defined cellular (unction (de novo fatty acid synthesis) and limited cellular expression, FASN was focused on. Other targets such as ATP-dependent RNA helicase and nucleoside diphosphate kinase have either broader or less well defined functions in cells, and therefore may be more of a challenge in terms of future drag development. Heat shock protein 90 (FIsp90) is a validated cancer target^' with a role i HIV replication. To validate the mass spectrometry data, FASN expression was assayed in TZM-bl. cells 24, 28, or 72 hours post HIV infection. Western blotting with FASN-spceific antibodies confirmed that HIV increased FASN levels in the detergent soluble fraction of cellular lysates as soon as 12 hours post infection ( Figure 2 I B), To determine if HIV-infection regulates FASN activity, intracellular fatty acid (FA) levels were quantified in TZM-bl ceils with or without HIV infection. Forty-eight hours post mfection, HIV, in a dose dependent manner, increased intracellular palmitic, oleic, and stearic acid levels (Figur 21C). These in vitro results complement a previous report that demonstrated HIV-positive patients have elevated serum FASN levels compared to ilV-negative individuals; specifically, a study of 191 people living with HIV-1 showed that, people living with HIV-1 not taking antiretroviral therapy (ART) had elevated serum FASN levels compared, to both HJ V-negaiive people and people living with HIV-1 on ART (Aragones et ai., 2010). Thus, this result is consistent with previous in vitro and in vivo studies that correlated HIV- 1 infection with increased FASN levels.

In TZM-bl cells, FASN raRNA levels, normalized to 1 SS rRNA, did not change following HIV- 1 infection, suggesting FASN regulation in TZM-bl cells occurs posi- transcriptionally (Figure 2 IE). Western blotting with a FASN-specific antibody confirmed that HIV-1 infection increases FASN levels as early as 24 h post infection (Figure 2 IB).

To determine if productive H3V replication requires FASN activity, TZM-bl cells were treated with FASN-specific siRNA, which compared to control (non-targeted, NT) siRNA, reduced HIV p24 production by 77% (Figure 2 I D). Despite this decrease in culture supernatant p24 levels, siRNA-mediated FASN knockdown did not significantly reduce intracellular p24 levels, measured by ELISA (Figure 25B), suggesting that HIV-1 replication uses FASN activity during a late step in HIV-1 replication (e.g. protein trafficking, virion assembly, or virion release from the cell). Anti-Gag western blot of HIV-infected, PASN-knockdown cells indicates similar levels of intracellular p55 and p24 (figure 25C).

The molecular mechanism by which increased FA biosynthesis promotes HIV replication is currently unknown, but plausible mechanisms include the following (Figure 27): 1) provision of FA's used for ATP production and energy homeostasis, 2) replenishment of lipid bilayers lost daring viral budding (Lorizate et ah, 2013) or creation of lipid micro domains that favor viral budding (Ono et ah, 2001), 3) generation of fatt -acyl adducts (e.g. pa!mitate or rnyristate) for post-lranslational modification (PTM) of Env, Gag, Nef, (Resii, 1999) or host proteins required for HIV-1 replication, 4) replenishment of phospholipids to regenerate the lipid bilayer lost during viral budding, increased mitochondi'iai capacity through activation of β oxidation (Smith, 1994), or any combination of these activities.

It has been shown that viral infections can change subcellular localization of FASN; for example. Dengue (Heaton et ah, 2010) infection causes FASN to reloealize to a perinuclear space. Vaccinia virus infection has been shown to cause FASN to reloealize to mitochondria, likely for energy homeostasis (i.e., Figure 27, mechanism 1 ; Greseth et ah, 20.14). FASN previously reported association with flavMrus replication (Heaton et ah 2010; Huang et ah, 2013: Martin-Acebes et ah, 2011). F!aviviruses such as HCV and Dengue virus likely use FASN/FA to rearrange intracellular membranes to replicate their genomes on membranous webs (Heaton et ah, 2010; Huang et ah, 2013). To determine if HIV-1 infection also causes FASN rclocalization, an immunofluorescence assay was used to monitor FAS distribution in HIV-1 infected TZM-bl cells. Although the intensity of FAS slaimng increased following MiV-l infection, redistribution of FASN to a perinuclear space, lysosornes ( Figure 23A), mitochondria (Figure 23B), or the endoplasmic reticulum (Figure 23C) was not observed, Thus, similar to HCV (Yang et aL, 2008), HIV-I infection does not cause intracellular FASN redistribution.

When FAS activity is inhibited in the context of HIV-1 infection, HIV-1 Gag is produced but viral particles are not released into the culture supernatant. Based on this observation, we expect hypothesized mechanisms 2 and 3 (above) offer the most plausible mechanism by which HIV-1 leverages FASN activity; to generate FA to create cholesterol-rich lipid micro domains that promote viral budding (Ono et aL, 2001 ), or to generate fatty-acyl adduets required for viral protein function (Bryant et aL, 1990; Li et /,, 2007; Lindwasser et aL, 2002; Pal et aL, 1988). Despite the requirement of FASN for nascent virion production, FASN activit is not required for intracellular Gag protein production, indicating that PASN-dependent de novo fatty add biosynthesis contributes to a late step of HI V-1 replication.

Dependency of HIV replication on FASN activity is consistent with other studies of enveloped viruses, including hepatitis C (HCV), Dengue (DENY), Epstem-Barr, and West Nile virus, which also require host FASN activit (Huang et l, 2013; Heaton et L, 2010; Li et at, 2004; Wilsky et aL_f 2012; Martin- cebes et aL, 2011 ). The finding that HIV both regulates and requires FASN activity suggested efforts to identify a small molecule inhibitor targeting the FASN purine-binding pocket. Purinome mining to define the Hsp90 inhibitor S X5422 has been previously reported (Fadden et a/., 2010). SNX5422 targets the HSP 0 purine-binding pocket. To simplify the identification of novel FASN inhibitors, a variation of proteome mining technology, called fluorescence linked enzymatic ehemoproteomic strategy (FLECS) was employed, A 3,379-member small molecule library comprising compounds with structural similarity to any purine or known purine analog scaffold (Hughes et al, 2012) was assembled. Cibacron Blue Sepharose was used to capture native FASN from lactating pig mammary gland extract, then labeled bound proteins with thiol-reactive fluorescein, and screened for molecules that competitively release fluor-labeled proteins (Carlson et «/, 2013) (Figure 19), Cibacron blue resin has been used by others to enrich NAD and NADP binding proteins from tissues extracts and FASN is highly induced in lactating tissues (Miyaguchi ei al., 20.1 1 ; Muratsubaki et a 1994). The screen identified several molecules that elated FASN with varying degrees of selectivity and potency (Figures 1 and 3). Active molecules were subsequently categorized by their ability to block FAS activit in a HepG2-based FASN assay. MS- 106 (Figure 9) was further evaluated due to its potent cellular blockade of both acetate and glucose incorporation into total lipids, with EC₅o values of 147 n (95% C.I, 92 - 236 nM) and 213 nM (95% C.I. 144 - 316 nM), respectively (Figure 2A.B.D) without affecting the cell viability (Figure 22C). Because several pathways are represented in the glucose and acetate assays, purified FASN was used to confirm that HS-.106 potently inhibits native, human FASN (JC$e ^::: 46 rsM, 95% C.I. 30 - 70 nM, Figure 2E). HS-106 was also discriminated from other screening hits based on its selectivity profile within the compound library. Figure 3 shows the results of repeated FLECS screens of the library across multiple enzyme classes within the purmome, including several protein kinases, heat shock proteins and metabolic enzymes (Carlson et ah, 2013), These data suggest that the HS-106 scaffold has unique specificity towards FASN.

MS- 1.06 anti-HIV activity in vitro and in vivo Because HS-106 is a potent FASN inhibitor, and the results disclosed indicate thai HIV replication requires FASN activity, HS-106 was evaluated for anti-HIV activity. TZM-bl cells were infected with HlV-i and 48 hours post infection, extracellular p24 levels were measured as a surrogate measure of HIV- 1. replication. In this model, Fasnail potently inhibited HIV-1 p24 production with an. EQ,, of 213 nM (95% C.I. 93 - 487 nM; Figure 24A) and an estimated cellular toxicity (TC50) of 10 μΜ (Figure 24C), resulting in an antiviral index (TCso ECso) of 47. To determine if Fasnail blocked HIV- 1 in activated T-cells, p 4 production from HIV-1 infected primary PBMCs was measured in the presence or absence of 1.0 μΜ Fasnail In this physiological relevant model of HIV- 1 replication, HS-106 reduced HIV-1 p24 production approximately 10-fold (Figure 24B), demonstrating dose-dependent anti-HIV activity (reduced by 87% at Ι ΟμΜ and 96% at 50μΜ), with negligible effects on cell viability (Figure 24C). Moreover, when PBMCs were treated with C75, a commercially available FASN inhibitor, similar reductions in extracellular p24 levels were observed (Figure 24B),

To test further the hypothesis that HIV-1 replication requires FASN activity during the late stages of viral replication, TZM-bl or SupTl (data not shown) cells were transfected with a HIV-1 provirus (pNL43) in the presence or absence of Fasnail or C75. Similar to siRNA-based. FASN knockdown, Fasnall-based inhibition of FASN did not reduce intracellular Gag levels (Figures 25 and 26) but did significantly reduce HI V- 1 p24 particle deposition into culture medium, as measured b p24 production (Figure 26B). Fasnall and C75 similarly reduced the number of infectious HIV-1 particles (Figure 26C). Thus, FASN inhibition reduces nascent HIV-

1 virion production without reducing HlV-1 protein synthesis,

To test if HS-106 is toxic to mice, two animal studies were initiated. In an acute toxicity study, mice received 80, 20, or 5 mg/kg HS-106 IP on day I and 3, and blood was collected on day 4. HS-106 was acutely toxic at 80 rag/kg but at 5 and 20 mg kg, HS-106 did not affect white blood cell count, hemoglobin levels, kidney, or liver function (Figure 22). In a chronic exposure study, mice received biweekly fP injections of 5, 10, or 15 mg kg HS-106 and none of the doses showed signs of toxicity or stress (Figure 22), Thus, HS-1 6 is a chemically tractable molecule, with potent ex vivo anti-Hi V activity, which is well tolerated in mice.

Accordingly, in one aspect, the invention relates to a method of inhibiting Fatt Acid

Synthase (FASN) with a FASN inhibitor that binds to the FASN purine-binding cofactor domain. the method comprising contacting cells that express FASN with an inhibitor that binds to the FASN purine-binding cofactor domain.

In one embodiment, the inhibitor does not bind to the substrate domain.

in one embodiment, the inhibitor inhibits both acetate and glucose incorporation into total lipids. In one embodiment, the inhibitor inhibits both acetate and glucose incorporation into lipids in the HepG2 cell line with an IC50 value below about 300 nM.

In one embodiment, the inhibitor possesses a thiophenopyrimidine scaffold. In one embodiment, the inhibitor possesses a thieno[2,3~d]pyiimidine scaffold. In one embodiment, the compound is (N«( 1 -benzyipyTrolidin-3-yi)-5,6-dimetliyhbieno[2,3-d]pyri or a pharmaceutically acceptable salt thereof.

In another aspect, the invention relates to a method of promoting apoptosis in a cancer cell dependent on FASN activity, the method comprising contacting the ceils with an inhibitor that binds to the FASN purine-binding cofactor domain.

in one embodiment, the inhibitor does not bind to the substrate domain, in one embodiment, the inhibitor possesses a thiophenopyrimidine scaffold. In one embodiment, the inhibitor possesses a thieno[2,3-d]pyrimidine scaffold. In one embodiment, the compound is (N- (1 -benzylpyTrolidin-3-yi)-5,6-dimethyIthieno[2,3-d]pyri or a pharmaceutically acceptable salt thereof. In another aspect, the invention relates to a method of treating cancer in a subject, the method comprising administering to the subject in need thereof, a therapeutically effective amount of a FASN inhibitor that binds to the FASN purine-binding eotactor domain.

In one embodiment, the inhibitor does not bind to the substrate domain,

In one embodiment, the cancer is selected from the group consisting of HER2-positi e brea-St cancer, triple negative breast cancer, melanoma, hepatocellular carcinoma, and leukemia. hi one embodiment, the inhibitor possesses a thiophenopyrimidine scaffold. In one embodiment, die inhibitor possesses a fhieoo[2,3~d]pyrimidine scaffold. In one embodiment, the compound is (N-( 1 -benzylpyrrolidm-3-yl)-5,6-^^ or a pharmaceutically acceptable salt thereof.

In one embodiment, the inhibitor is co-administered with a platinum-based antineoplastic compound, in one embodiment, the inhibitor is co-administered with earbop!aiin or dsplatin. In one embodiment, the inhibitor is co -administered with carboplatin. in one embodiment, the dosage of platinum-based antineoplastic compound is less than that required when administered in the absence of a FASN inhibitor.

In another aspect, the invention relates to a method of inhibiting viral replication in cells dependent on FASN expression, the method comprising contacting the cells with an inhibitor that binds to the FASN purine-binding cofactor domain.

in one embodiment, the inhibitor does not bind to the substrate domain.

In one embodiment, the inhibitor inhibits HIV viral replication in a TZM-bl model of

HIV replication with an EC50 value below about 500 iiM. in one embodiment, inhibition of FASN reduces HIV- 1 particle production without affecting intracellular Gag production. In one embodiment, the inhibitor attenuates I I IV replication during a late stage of its replication cycle. In one embodiment, nascent HIV- 1 virion production is inhibited without reducing HIV-1 protein synthesis.

in one embodiment, the inhibitor possesses a thiophenopyrimidine scaffold. In one embodiment, the inhibitor possesses a thieno[2,3-d]pyrimidiiie scaffold. In one embodiment, the compound is (N-(i-beiiz>4pymilidin-3-yl)-5,( dimeth or a pharmaceutically acceptable salt thereof. In another aspect, the invention relates to a method of treating a viral infection in a subject, the method comprising administering to the subject in need thereof, a therapeutically effective amount of a FAS inhibitor that binds to the FASN purine-bindiog cofactor domain.

In one embodiment, the viral load is reduced. In one embodiment, the viral infection is infection by an enveloped virus. In one embodiment, the viral, infection Is infection by a virus selected from the group consisting of human immunodeficiency virus, cytomegalovirus, Dengue, hepatitis B, hepatitis C, Epstein-Barr, influenza vims, respiratory syncytial virus and West Nile vims. In one embodiment, the virus is human immunodeficiency virus. In one embodiment, lipid dysregulation-based morbidities are reduced. In one embodiment, the inhibitor possesses a thiophenopyrimidine scaffold.

In one embodiment, the inhibitor possesses a thieno[2,3-d]pyrimidine scaffold, in one embodiment, the compound is (N-{ I -benzy lpyrrolidin-3 -yl)-5,6-dimethylmieno[2 ,3~d]pyHmidin- 4-amine, or a pharmaceutically acceptable salt thereof. In one embodiment, treating a viral infection further comprises co-administration of an additional anti-reteoviral compound.

In another aspect, the invention relates to a pharmaceutical composition comprising (N-

( 1 -benzySpym>lidin-3-yI)-5,6-dra or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

In another aspect, the invention relates to the compound (R)-(N-( 1 -ben2ylpyrrolidin-3- ! S^-climeth lthie o ^- l yrimidi ^-amine or a pharmaceutically acceptable salt thereof.

In another aspect, the invention relates to the compound (S}-( ~(l-be.iizylpyrrolidin~3- yI)~5,6-dimethylthieno[2,3-d]pyrimidin« -amine or a pharmaceutically acceptable salt thereof.

EXAMPLES

The following examples are provided as illustration and not by way of limitation.

Materials and Methods

ATP, NAD, NADPIt acetyl CoA, raalonyl CoA, Propidiura iodide, Hoechst 33258, Rnase A, Cibacron blue sepharose and Resazurin were obtained from Sigma-Aldrich (St Louis, MO, USA). { i] Acetate, 3-[3H] D-Glucose, 2- ^wC] malonyl CoA, and MicroScint-E were bought from PerkiiiElrner (Waltham, MA, USA). Fiiiorescein-5-maleiniide was bought from Invitrogen (Carlsbad, CA, USA). Hum.ulin R insulin was bought from Lilly (Indianapolis, IN, USA). Sephacryl S-300 HR was bought from GE health, care (Little ChaJfont, Buckinghamshire, UK). Cells were obtained from ATCC (Manassas, Virginia, USA). Cell culture media were bought from Gibco life technologies (Carlsbad. CA, USA), TZM-hl cells were obtained from the N1H AIDS Research and Reference Reagent Program maintained, in DM EM supplemented with. 10% fetal bovine serum (FBS).

FLECS screen

Porcine mammary glands were collected from lactating pigs as previously described (Hughes et aL, 2012). Tissues were homogenized in lysis buffer A (lOO M sodium fluoride, 5m EDTA, iraM DTT and 5% glycerol made in ! OmM sodium phosphate buffer pi! 7.5) in a ratio of 3ml of buffer per each gram of tissue, After removing cell debris by centrifuge at 142,000 x g for 45 minutes and filtering through glass wool, the homogenate was applied to Cibacron blue sepharose prc-equilibrated with buffer B (lOOmM sodium fluoride, 5mM EDTA, Im DTT and 50mM sodium citrate made in lOmM sodium phosphate buffer pH 7.5) in a ratio of 4,5 g of tissue to each mi of settled resin. To remove dehydrogenases and reduce the amount of ATP binding proteins bounded to resin, the resin was washed with 1.0 bed volumes of buffer B then with one bed volume of 5mM NAD made in buffer B followed by one bed volume of buffer B, After that, the resin was washed with one bed volume of ! OmM ATP. To label the FASN attached to the resin, to each ml of resin, I ml of I OniM sodium phosphate buffer (pH 7.5) containing 50p.g of fl.uorescein-5-maieimide (pre-dissoived in DM.F) was added to the resin and incubated overnight at 4°C with slow rotation. The resin was then washed with 20 bed volumes of buffer B to remove any excess fluorescein. The resin was suspended in buffer B (1: 1, v/v) and distributed in 96 well filter plates (50μ1Λνβ11). Fluorescein labeled proteins were eluted from the resin by an in-house library of 3,379 purine-based compounds. For each well, 50μ1 of each compound was added (1 mM made in buffer B with 10% DM SO). Different concentrations of ATP were used as a control. The eluents were collected in 96 well black plates by centrifugation at 1 ,260 x g for 5 minutes. Fluorescence in each well was measured at Εχ Em; 485/535nm. Eluents with the highest fluorescent intensity were run on SDS PAGE. After silver staining, proteins in each band were identified by (MALDI-TOF/TOF) MS as described, previously (Carlson et a!,, 2 13).

[^JFj] G| aepse and acetate hieprppr tipn in l iepG2 cells Incorporation of radiolabeled glucose or acetate in total lipids was measured according to published methods (Haystead and Mardie, 1986). HepG2 ceils (80% confluent in 12 wells plates) were starved overnight in MEM Alpha, the medium was then changed with DMEM medium containing 0.1 g L glucose 10% FBS and 5μΜ insulin and 1 μθί 3-[^JH] D-glucose or i μ€ [¾J- acetate in addition to different concentrations of each compound. After incubation for 1 hour at 37°C, 5% COi, the cells were washed with ice cold PBS and detached by treating with 100 μΐ trypsin for 10 mm then 1 ml of ice cold PBS was added. The cells suspension was then sonicated for 3 times in 30 seconds intervals and kept on ice. From each well 1 ml of cell iysate was added to a 4 ml scintillation vial and 2 ml of MicroScint-E was added. The vials were mixed thoroughly then centrifuged for 30 min at 3000 rpm and the ¾ radioactivity was measured by liquid scintillation counting,

FASN activity assay

Human FASN activity was measured by monitoring the incorporation of 2-[^{f 4}Cj malonyl CoA into fatty acids using liquid scintillation counting by a method similar to the one described by Richardson ei al (Richardson and Smith, 2007). FASN .iO g/ml of PBS containing ImM DTT and ImM EDTA) was pre-incubated with different concentrations of HS-106 (final DMSO concentration 1 %) at 37°C for 30 minutes, then substrates were added (20 μΜ acetyl CoA and 200 μΜ NADPH) in a total reaction volume of 1 0 μΐ The reaction was initiated by adding 10 μΐ of 50 μΜ malonyl CoA spiked with 0.05 θ of 2-[ⁱ⁴C] malonyl CoA. After incubation for 30 minutes at 37°C, lipids were extracted 3 times with 150 μ (2:1, v v) ehioroform:metlianol. Then, to the pooled organic phases, 1 ml of toluene containing 25 g L Butyi-PBD was added and radioactivity was measured by liquid scintillation counting.

Proliferation assay

CF10A (5,000 cells/well), MCF7 (7,500 ceils/well), MDA-MB-468 (5,000 cells/well),

BT474 (7,500 cells/well), and SKBR3 (5,000 cells/well) were seeded in 96 well plates with 10% FBS 4 g/L glucose DMEM media except for MCF10A which was DMEM/F12 media. After 24 hours, cells were treated with different concentration of HS-106 or C75. Every 24 hours for five days, media from one of the plates was removed and plate was frozen at -80^oC, After collecting all the time points, to each well ΙΟΟμΙ dd¾0 was add and the plates were frozen again. Then .ΙΟΟμϊ of Hoechst 33258 solution made in TNE buffer (Ί μΐ from Hoechst stock (1 mg/ml in 1 :4 DMSO:H20) in 1 mi of TINE (which contains I OmM Tris, 2M NaCl and ImM Na₂EDTA) and fluorescence was measured at Ex/Em: 355/460.

Cell.c^cje andysis

After treating BT474 cells with different concentrations of HS-106 for 24 hours, ceils were collected and fixed with 70% cthanol, washed with PBS then treated with 20 mg ml Rnase A. Then cells were stained with 50 ug/ml Propidiura iodide and DMA content for each cell was quantified using a BD Accuri C6 flow cyiometer (BD), and data were analyzed using the C low Plus software (BD),

Western blot analysis

Cell iysaie from cell treated for 24 hour with 10 μΜ of HS-106 or DMSO were loaded (28 g/weli) and run on Criterion XT Tris-HCl Gel (4-15% gradient) (Bio-Rad) according to manufacture instructions, then the proteins were transferred to PVDF membrane overnight using 25 volt at 4°C. After that, membranes were blocked and blotted for FASN (Ceil signaling antibody number 3180) and GAPDH (Cell signaling antibody number 5174).

Ca^pase.3/7 activity .assay

The assay was performed using a similar protocol to the one described by Fritz et ai (Fritz et ai., 2001 ). Cells were seeded at a density of ! 0,000 cells/well and treated with different concentrations of HS-106 or€75. After 24 hours, to each well, 50 μΐ of Caspase assay/lysi buffer (50mM HEPES pH 7.5, lOOm C1, 5mM EDTA, I OmM MgC12, IOmM CHAPS, 20% Sucrose, IOmM DTT, 10 μ.Μ of (Z-DEVD)2-Rhl 10 (Santa Cruz Biotech) and complete protease inhibitor (Roche»was added. After 6 hours of incubation at 37°C, fluorescence was measured at Ex/Em: 485/535nm. ics sample Preparation

BT474 cell pellets (5 vehicle and 5 treated with 10μΜ HS- 1 6 for 2 hours) were separatel thawed on ice, and 100 μΐ of ammonium bicarbonate, pH 8, was added to each. Pellets were then probe sonicated at power level 3 for 3 bursts of 5 seconds each burst, cooling on ice between bursts. Bradford assay was performed on each solubilized pellet using lOx diluted material, Ϊ nig from each was taken out and normalized to 137 μΐ total with AmBic in a 96-weiI plate. To each sample well. 200 μΐ, of methanol was added followed by the addition of 600 ΐ. of MTBE. The plate was capped and mixed at 800 rpm at room temperature for I hour, Plate was then cenirifuged at 2000 rpm at room temperature for 10 mm and 400 pL of the MTBE/MeOH layer was pipetted out and transferred to another plate. Then the extract was dried under nitrogen gas and samples were reconstituted in 100 pL of 2: 1 : 1 IPA:ACN:H20. A pool was made by taking an equal volume from all 10 samples.

Mass Spectrometry Lipid Profiling

Each sample was analyzed twice using Ultra Performance Liquid ChromatographyElectrospray lonization Tandem Mass Spectrometry (UPLC/ESI/MS/MS) i positive ion mode (3 uL) and negati e ion mode (10 pL). UPLC separation was performed using a binary gradient separation on a Acquity UPLC (Waters Corporation, lford, MA) using a Acquity 2.1 mm x 10 mm 1.7 pm CSH CI. column. Mobile phase A contained 60/40/0.1 v/v/v MeCN/waier/forrme acid with 10 niM ammonium formate, and mobile phase B contained 90/10/0.1 v/v/v isopropanol/MeCN/formic acid. Lipid separation was performed at 0.6niL/mm and 60°C column temperature, using a complex gradient program as follows: initial conditions 40% B, ramp to 43% B at 1.3 minutes, ramp to 50% B at 1.4 minutes, ramp to 54% B at 8 minutes, ramp to 70% B at 8.2 minutes, ramp to 99% B at 12.2 minutes, ramp to initial condition 40% B at 12.3 minutes, then hold at 40% B for re-equilibration until 14 minutes. Via electrospray ionization, the LC eluent was introduced into a G2 Synapt (Waters and data was collected between 50-1200 m/2 in 0.3 seconds; MS/MS was collected at a scan rate of 0,2 sec for peaks above a threshold of 3000 intensity/sec for positive ion and 1000 intensity/sec for negative ion. Source parameters are as follows for positive/negative ion respectively: capillary at 2,7 kV / 2.3 kV, cone voltage of 30 V, 500C desolvation temperature, 700 L/hr desolvation gas. 150 L hr cone gas, and a source temperature of 100°C. Lockmass calibration was performed every thirty seconds using a soiution of 500 fmol uL Leucine-Enkephalin in positive (556.2771 m/z) or negative mode (554,2615), Quantitative data were analyzed in Progenesis QI (Nonlinear Dynamics. Ltd Waters Corporation). Quantitative data including accurate mass, charge state, retention time and intensity were exported for additional statistical analysis (h ttp : //di seovery , genome.d«ke du expi¾ss/resources/3745/3745__IDandStats__HvsD __Progenesis Qi 062514. isx ). Putative identifications were made by searching against compiled LipidMaps databases with theoretical fragmentation where available, using 10 ppm precursor km tolerance. Putative identifications were confirmed based on accurate mass and retention time using standards for fatty acids myristic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, and !inoleic acid using endogenous standards purchased from TCI America, Sigma Aldrich, and Ultra Scientific.

Purinome capture

ATP sepharose was synthesized as described (Haystead el al. 1993). TZM-bl cells were obtained from the Nl^'H AIDS Reagent Program (submitted by Dr. John C. Kappes, Dr. Xiaoyun Wu and Tranzyme Inc.). HiV-1 pseudovirions consisting of pNLCHS. l backbone and pJRFL envelope were produced in 293 T cells according to standard protocols (Russell et a/., 201 1). 48 hours post infection, TZM-bl cells were lysed at 4°C in lysis buffer (20 mM Siepcs pH 7.4, ix complete protease inhibitors without EDTA (Roche), 120 mM NaCl, 20 mM MgClj, 1 mM DTT, 0.1% P-40), centrifuges at 16,000 x g for 10 minutes at 4⁰C_e and the supernatant was loaded onto !OOpL ATP sepharose. ATP-sepharose was incubated with cell lysate for ihr. at 4°C, washed 3x with low salt buffer (50 mM ho es pH 7.4,120 mM ael, 20mM MgCl₂, 1 mM. DTT), then washed 2x with high salt buffer (Sow salt buffer with 300 mM NaCl [final]), then washed 2x with low salt buffer. Proteins were competed off the resin with 25mM ATP dissolved in low salt buffer. Eiuenis were dialyzed to remove ATP, mixed with Laemli Sample buffer, and visualized by 1-D SDS PAGE. Gels were fixed and silver stained according to published protocols (Graves et a/., 2002). Individual proteins were excised from th gel manually and cut into 1 mm x 1mm pieces, washed alternately with 25mM ammonium bicarbonate (x3), and acetonitrile (x3), then fully dehydrated »n acetonitrile. Acetonitrile was removed, 30,uL of porcine trypsin (20 pg mL, Promega) was added on ice, then incubated for 15 minutes. The gel pieces were then incubated at 37°C for 12- 16 hours, then the supernatant was transferred to a second tube, and acetonitrile was added to the gel pieces to complete the extraction of digested peptides. This extract was pooled, frozen and lyophilized. The peptides were resiispended in 5pL of 1: 1 acetonitrile: 0.25% Trif!uoroaceiic acid and immediately spotted on the MALDI target. For M ALDI analysis, the matrix solution consisted of a!pha-cyano-4-hydroxycinnamic acid (Aldrich Chemical Co. Milwaukee, Wi) saturating a solution of 1 1:0.02 acetonitrile: 25mM ammonium citrate in watcntrifuoroacetic acid. Approximately 0,15 _tuL of peptide solution was spotted on the ALDI target immediately followed by 0.15 μί., of the matrix solution. This combined solution was allowed to dry at room temperature. MALDI MS and MS/MS data was then acquired using the AB Sciex 5800 TOFTOF Mass Spectrometer (AB Sciex, Framingham, MA). Resultant peptide mass fingerprint and peptide sequence data was submitted to the SPROT(UNIPROT) or NCBI database using the Mascot search engine to which relevance is calculated and scores are displayed.

FASN visualization.

pNL4,3 was obtained through the N1H AIDS Reagent Program from Dr. Malcolm Martin

(Adaehi et ί,, 1986), NL4-3 was produced in 293T ceils according to standard protocols (Russell et a/., 2011) and quantified with a commercial p24 ELISA assay kit (Zeptometix). At various times post--pNL4--3infection, TZM-bl cells were washed with PBS, and iysed {as above), Cleared superaatants were obtained by centrifogaiion at 14,00Gg for 15 min at 4°C. Protein concentration was estimated with BCA assay and equal amounts of protein were boiled in I X SDS Laernmii buffer for 10 min. Proteins were subjected to 8% SDS-PAGE then transferred to nitrocellulose membranes. Membranes were blocked with 5% (W/V) nonfat dry milk in TBST and incubated overnight with anti-FASN (Abeam, ab99258) at 4°C, washed in "FBS-T, incubated with HRP-conjugated anti rabbit secondary antibody (Abeam, ab6721 ) in TBS-T for 1 nr., washed, then visualized with ECL detectio reagent (GE Biosciences). Membrane was stripped and probed with anti-actiri (Cell signaling, 4970) to verif protein loading. For immunofluorescence experiments, !x 10* TZM-bl cells were plated on sterilized coverslips, infected with 10 rig/ml NL43 virus for various times. Cells were washed twice with PBS, fixed with 4% paraformaldehyde for 30 min at 4°C, washed thrice with PBS, permeabilized with chilled methanol for 15 min at 4°C, washed thrice with PBS, blocked with PBS+1% BSA for 1 h, then incubated with anti-FASN primary antibody (Abeam: ab99358, 1 :200) diluted in PBS+1% BSA for 1 hr at RT, Cells were rinsed three times with PBS, incubated with Alexa fluor 488-anti rabbit IgG ( Abeam 1 : 400), followed by three additional washes with PBS, Coverslips were mounted on slides using prolong gold DAP1 mounting medium and observed on FLUOViEW Olympus microscope using immersion oil. Si N A knockdown of FASN

ON-TA GET plus SMART pool siRNA. targeted against human FASN (FASN) (L- 003954-00-0005) and ON-TARGET plus non-targeting (NT) control siRNA ( -001810-01.-05) was purchased from Dharmacon. TZM-bi cells were transfected either with 200 nM FAS- targeting siRNA or 200 nM NT siRNA using Trans-IT transfection regent (Mirus Bio LLC) according to the manufacturer's protocol. After 48 hours, cells were infected with 3 ng/ml p24 NL4.3 and incubated for an additional 24 hours. Media was replenished with fresh media after 24 hours and incubated with fresh media for additional 24 hours. Supernatants were collected for HIV p24 ELISA and cells were washed with RBS and saved for Western blotting.

Primary ceil infection

.Primary cell experiments were approved by the Ohio State University institutional Review Board, protocol ft- 2014H0001 . Peripheral blood mononuclear cells (PBMC) were isolated from healthy donor by Fieoll-Paque eenirifogaiion, stimulated in complete RPMI 1640 medium (Gibco, Carlsbad, CA) containing 10% FBS, 100 pg/mL penicillin/streptomycin and supplemented with 5 ^½Τ phytohemaglutinin (PHA; Gibco) for 48 h, and maintained thereafter in complete RPMI medium supplemented with 20U/mL of mterleukm-2 (Gibco). PBMCs were seeded in 24- well, plate (2 x 10^:" cells/well) and triplicate wells were treated with 10 or 50μ.Μ C75, HS-106, or with DMSO and subsequently infected with lOng/mL p24 equivalents of H.1V- 1 L«CR-T2A virus, which is derived from L4-3 (Edmonds et /., 2010). Cells were washed 24 h post infection. Supernatants were collected 4 days post infection and p24 content analyzed by quantitative ELISA (Zeptometrix).

Fatty acid analysis and quantification

An equivalent number of TZM-bi cells were infected with NL.4-3 virus at 0, 20, or 40 ng

(p24) /mL. Cells were collected at 48 h and 72 h post infection. Total fatty acids were extracted using a modified version of the Bligh and Dyer protocol (Bligh and Dyer, 1959). This consisted of sequential extractions with (2: 1.) Chloroform:meth.ano1, (1: 1) chloroform :methanol, ( 1 :2) chloro:form:methanol, and (10:10:3) c-hloroform:methanol:wa.ter. Fatty acid methyl, esters were generated by methanolysis with 3N methanolic HC1 (85°C overnight) followed by trimethylsilylation with Tri-Sil reagent (Thermo scientific), Heptadecanoic acid (17:0) was used as an internal standard. Samples were dissolved in hexane prior to injection on a Thermo scientific Trace GC ULTRA with a Rtx-SMS column (30 m x 0.25 mm internal diameter, 0.25 μπτ film thickness, Restek Corporation, Bellefonte, PA), following of mass spectrometer, DSQH. Instrument settings included an internal temperature of 150°C for 3 mm, increasing to 200°C at 2°C/min and to 250°C at 40°C/min holding for 4 rain.

HepG2 cell viability

HepG2 cells were seeded in 96 well plates and after reaching 80% coiifluency, the cells were treated with different concentrations of HS-106 for 4 hours. At the end of the treatment time, 10 μΐ of 700 μΜ Resazurin (prepared with PBS) were added to each well. After 3 hours, the Resorufin fluorescence was measured at Ex/Em: 540/590nm,

Purification of Human FASN

Confluent BT474 cells grown in high glucose DMEM with 10% FBS, were scraped and washed two times with ice cold PBS. Then, the cells (2,26g) were homogenized using potter homo gem zer for 5mins in 40ml of buffer A. The homogenate was centrifiiged. at 35000rpm for 45 min then filtered through glass wool resulting in a volume of 27ml . To the 27ml of homogenate, 6.37 ml of saturated ammonium sulfate (final saturation 20%) was added and mixed slowly for 20min then incubated for 1 hour on ice. After spinning the lysate at ISOOOrpm for 20 min, the pellet was discarded and to the supernatant (26 ml) 70ml saturated ammonium sulfate was added (final saturation 35%). After repeating the same procedure in the previous step, the supernatant was discarded and the pellet was collected and dissolved in 20 ml of buffer A and added to 150K. MWCO Pierce Protein Concentrators from Thermo Fisher Scientific (Wakham, Massachusetts, USA) then centrifuged for 30min at 3000rpm. The resulting volume on the filter (1.5 ml) was added to a Sephaeryi S-300 HR column (lXlOOcm) pre-equilibrated with PBS, The column was eluted with PBS containing ImM DTT at a flow rate of 0.2ml/min, 2 ml fractions were collected and peaks fractions were am on SDS-PAGE and the ones with FASN band (identified by ( ALDI-TOF-TOF) mass spectrometry) were pooled and concentrated using Pierce Protein Concentrators.

Human FASN activity was measured by monitoring the incorporation of 2-[^! C] Malonyl CoA. into fatty acids using liquid semiitlation counting by a method similar to the one described by Richardson et al (Richardson et «/., 2008 ). The enzyme (M^g/ml of PBS containing I mM DTT and ImM EDTA) was incubated with different concentrations of HS-106 (final DMSO concentration 1%) at 37°C for 30 min. After that, substrates was added (20 μΜ Acetyl CoA and 200μΜ NADPH total reaction volume was ΙΟΟμΙ) the reaction as started by adding 100 of 70μΜ Malonyl CoA spiked with 0.03 θ; of 2-[ⁱ C| Malonyl CoA. After incubation for 30 min at 37°C, lipids were extracted 3 times with 1.50μΙ 2:1 Chloroform: Methanol using Fo!ch method (Bligh and Dyer. 1959). Then, to the pooled organic phase, 1 ml of Toluene containing 2g/L Butyl PBD was added and radioactivity was measured by scintillation counting.

_.Determination of B S- ,1.06 efficacy in vivo

Single-time parous female MMTV-NEU mice ( ackson Labs Strain 002376) were used to test the efficacy of MS 106 (30 pmol/ g_f IP, BI W) alone and in combination with Carboplatin (143 pmol/Kg, IP, QW). Mice were monitored for tumor development by palpating them weekly as per UNC Lineberger Mouse Phase 1 Unit protocol. Once tumors were observed, the mice were placed on treatment. The tumor-bearing mice were injected weekly with HS-106 and or Carboplatin, The solvent for HS-106 consists of 50% dimethyl sulfoxide (DMSO) and 50% saline (0.9% sodium chloride solution). Clinical grade Carboplatin was purchased from, the UNC Hospital pharmacy. Tumor volume was measured at. the time of injection by caliper and width (short diameter) and length (Song diameter) in millimeters (mm) were recorded. The volume was calculated using the formula: length x width2 x 0,5. At the time of injection, body composition was assessed and weight measurements (in grams) were recorded and used to determine toxicity . After three weeks, tumor progression was calculated using the formula: (21 day volume— initial volume)/imtial. volume x 100, This percent change in tumor volume, at 21 days, was used to asses the objective response rate of the therapies. Mice were treated and monitored until euthanized due predetermined humane endporais per UNC IACUC protocol 13-1 0, Overall survival was calculated by date of necropsy— initial treatment date. The same protocol was used for the assessment of HS-106 and HS-106 Carboplatin combo in the Triple-negative breast cancer GEMM, C3Tag mouse model

ITIV/TZM-M assays HS- 106 or C75 were dissolved in DMSO to achieve 10 mM stock concentration. The stock sohitioo. of each drug was serially diluted 3-fold with DMSO arid 2 μΐ, of each dilution was added to each well to achieve final concentration range from ΙΟμ to 4.6nM fixing final [DMSO] at ]%. HIVNL was added to 3x10⁴ TZM-bl cells at 10ng/ mi p24 equivalents in the presence of 15 fig/mL DEAE dextran. HIV-infected cells were incubated at 37 °C in 5% C<¾ for 24 hours, washed with PBS, fresh media was added, and ceil were incubated for another 24 hours. Supematants were collected and stored at -80°C until P24 ELISA assay. HIV-1 replication was assessed by quantitative p24 ELISA, Nevirapine (positive control) was obtained from the AIDS Reagent Repository and was used at OJmM (ECso) and 0.04 mM (EQKJ)- Real time polymerase chain reaction (RT-PCR),

TZM-b! cells infected with MIV-¾i i at 10 ng (p24)/mL were collected at intervals over 48 h of infection and total RNA was isolated using Qiagen RNeasv kit. Synthesis of cDNA was performed using oligo dT primer and Superscript Hi Reverse Transcriptase (Invitrogen,

Carlsbad. CA). Real time PCR using SYBR green kit was performed according to

manufacturer's instructions (BioRad. Hercules, CA). The FAS^'N primers (sense, 5 ' - CCCACCTACGTACTGGCCTA^■■■ 3' (SEQ JD NO.; l ); antisense, 5' - CTTGGCCTTGGGTGTGTACT - 3' ((SEQ ID NO.:2)) were used to synthesize the PCR products. The I Ss ribosonia! RNA subunit primers (sense, 5' - CAGCCACCCGAGATTGAGCA - 3' ((SEQ ID NO.;3)}; antisense, 5' - TAGTAGCGACGGGCGGTGTG --- 3' (SEQ ID NO.:4)) were used as controls to normalize

FASN samples. PCR was run for 40 cycles, with 1 cycle consisting of 30 s at 95°C, 30 s at 55°C, and 30 s at ?2°C.

PBMC viability

PBMCs were isolated by Ficoll-Paque centrifugation, stimulated in complete RPMT-1640 medium (Gibco, Carlsbad. CA) containing 10% FBS, 100 tg mL penicillin streptomycin and supplemented with 5 ^tg raL phytohe agglutinin (PHA; Gibco) for 48 h, arid maintained thereafter in complete RPMI-1640 medium supplemented with 20 U/mL of interleukin-2 (Gibco). PBMCs were seeded in 24-well plate (2 x 10" cells/well) and triplicate wells were treated with indicated concentrations of C75, HS-106, or with DMSO, and subsequently infected with 10 ng (p24)/mL equivalent^'s of HJV-INL^. Cells were washed 24 h post infection, and supernatant were collected and p24 content analyzed by quantitative EL1SA (Zeptometrix, Buffalo, NY). Unfixed PB Cs were exposed to drug for 48 hours, and PBMC viability was assessed by flow cytometry using propidium iodine (PI) exclusion ( BD Pharmingen) and Annexin V staining (BD Pharmingen). Viable cells are defined as cells that both exclude PI and are Annexin V negative.

Example L HS-106 inhibits proliferation in breast cancer ceil lines.

To evaluate the potential of HS-1 6 in breast cancer, we first tested its effects on proliferation across a pane! of no.n-tumo.ri genie (MCF1.0A) and aggressive tumor fonning breast cancer cell lines including ER+(MCF7), triple negative (MDA-MB-468) and HER2+ (BT474 and S BR3). HS-106 inhibited the proliferation of aggressive cell lines with similar potency to C75, but showed lower activity in the non-tu origenk cell line M.CF10A (Figure 4A-.E). The weaker effects of HS-106 in MCF IOA cells correlated with low expression of FASN in this cell line relative to the more aggressive lines, suggesting the former cells are less dependent on FASN for growth (Figure 40). HS-106 treatment of BT474 ceils did not induce cell cycle arrest except for an increase in the Sub 2N ceil population (Figure 4F).

Example 2, HS-106 alters the global cellular lipid profile of BT474 cells consistent with selective FASN inhibition.

To determine the effects of HS-106 on the whole cell lipid profile, we carried out lipidomic analysis by L€~MS~MS following 2 hours of exposure to ΙΟμΜ HS-106 in BT474 cells (Figure 5). Using ESR and ESI- profiling, more than 3000 lipids features can be simultaneously quantified and our analysis showed that HS-1 6 induced more than two fold change n abundance of 167 specific molecules (p < 0.01 relati ve to vehicle) , Most of the fatty acids identified to change were essential fatty acids (Figure 6). Notably HS-106 also induced a compensatory effect on oleic and palmitoleic acid uptake from the cell culture media. This was confirmed by a ^! C palmitate uptake assay where HS-106 treatment increased ^s4C labeling of free fatty acids (Figure J 1). Other lipids of particular note that increased many fold with HS-106 are ceramid.es, which are considered as pro-apoptotic lipids. The increase of ceramides would be expected due to maiony-CoA (the direct substrate of FASN) accumulation and its effects on CPT-1 inhibition (Bandyopadhyay t 2006). As a consequence, any free fatty acids (derived primarily from the extracellular media) are likely to be condensed to 3-keto dihydrosphingosine and on through a series of reduction and acylation steps to various eeramides such as dihydroceramide and ceramide. Diacylgiycerols were also found to increase significantly except for DCS (14:1 /18:2). which can indicate an overall increase in the lipolysis of Phosphatidylmositol 4,5-bisphosphate (PIP2) or an increase in de novo synthesis of diacylgiycerols. increase in diacylglycerol accumulation would be expected as a consequence of FASN inhibition, since this would be predicted to promote accumulation of glycerol, a precursor of triglyceride and diacylgiycerols. This is because flux of carbons normally supplied by glycolysis for de novo fatty acid is now blocked at the level of FASN itself causing accumulation of all upstream intermediates (Haystcad et a .. 1 89).

Example 3. Anti-proliferative activity of HS-106 is doe to the induction of apoptosis,

Inhibition of FASN in rapidly proliferating tumorigenic cells would be predicted to have two major effects; first, limit the oxidative capacity of the mitochondria through increasing malonyl CoA levels; second, trigger program cell death pathways via accumulation of ceramide. To investigate the latter mechanism, we examined Caspase 3 and 7 activation i response to HS- 106 and C75 (Figure 7A). Consistent with their iumo.rigen.ic capacities, SKBR3 and BT474 cells had 2 to 10 fold (respectively) higher caspase activity than CF10A cells in response to HS- 106 or C75 treatment. The ability of US- 1.06 to induce apoptosis was also confirmed by detecting the presence of phosphatidylserioe and phosphatidylcholine on the outer leaflet of the plasma membrane using fluorescently labeled Annexin V and flow cytometry (Figure 1.5 A). To further confirm that HS-106 induction of apoptosis is directly related to the inhibition of FASN, we tried to rescue the cells by pretreating them with different combinations of palmitate (the end product of FASN) and the (Acetyl CoA. Carboxylase) ACC inhibitor TO FA to prevent malonyl CoA accumulation (Figure 7C). However, in our hands, only TOFA treatment was able to completely reverse the effect, of HS-106 in BT474 cells which was not due to a general anti-apoptotic activity of TOFA (Figure 15B), while palmitate, or the combination of both palmitate and TOFA, did not fully reverse the effect of the inhibitor. In SKBR3 cells, TOFA, palmitate and the combination of both, was able to partially reverse the effect of HS-106. Exam pie 4. Toxicity and Pharmacokinetic studies in mice. In an acute toxicity study, FVB/J mice received 10, 40, or 160 pniol kg HS-106 via intraperitoneal injection (IP) on days 1 and 3, and blood was collected on day 4. HS-106 was toxic at 160 pmol/kg, but at 10 and 40 pmol/kg, HS-106 was we!! tolerated with no adverse effects on white blood cell counts, hemoglobin levels, kidney, or liver functions (Figure 16). To test for the long term effects of HS-l 06, mice received biweekly IP injections of 1 , 20, or 30 pmol/kg HS-106 for eight weeks. None of these doses induced any signs of toxicity, stress or any significant change m mice weight ( Figure 16). Next, we carried out pharmacokinetic (PK) studies to determine the uptake and bio-distribution of HS-106 in MMTV- eu mice by LC-MS (Figure 17). These studies showed HS-106 appears rapidly in the plasma within 5 minutes of the IP injection and is cleared rapidly ( i - 9.81 ±0.02 min

Similar uptake and clearance was also observed its liver and kidney (liver 9.84±0.09 min, n=3; kidney T_l;2= 9,90±0,01 min, n-3). Although the MS analysis focused primarily on the parent compound (amis 339Da), preliminary examination of the entire liquid chromatography profile following drug extraction of the tissues did not reveal any obvious HS-106 metabolites (data not shown). These findings suggest that HS- 1 6 is rapidly cleared through the kidney and liver in its parent ion state,

Example 3. MMTV- eu mice survival increases upo treatment with HS- 106,

Having determined that HS-106 was well tolerated in mice, it was next tested for efficacy on tumor progression in the Mouse Mammary Tumor Virus (MMTV)-Neu model of HER2+ breast cancer (Muller et a/., 1988) (Jackson Labs Strain 002376). Cohorts of MMTV Neu mice were treated with a biweekly IP injection of 30 pmol/kg HS-106 (Figure 8B and C). When given alone, HS-106 reduced tumor volume compared with vehicle treated animals (day 21 HS-106 treatment volume 436*. 21 mm n^:::7 SDM, control volume 628 ± 381mm n^:!!!9, p^::: 0.85). Significantly, HS-106 also increased the median survival of the MMTV Neu mice to 63 days ( - .049 compared with vehicle alone treated animals (Figure SD). Importantly, MS analysis of tumor tissue verified HS-106 uptake and also showed a significantly longer elimination time

min n-3) than all other tissues tested. The long duration of treatment in our studies suggest the dosing frequency of HS-106 can be greatly increased to achieve greater effects on survival and tumor volume. These findings are consistent with effects of HS-106 as an antt-proliferative agent in tumors. More dramatic acute tumor responses were observed when HS-106 was combined with 143 pmol/kg of the platinum-based chemotherapeutic agent Carboplatin administered weekly. Here, 88% of tumors achieved an objective response rate of stable disease or better compared to Carboplatin only at 25%, fisher's exact, p- value 0.01 , This response was not durable however as there was no long term benefit of the combination therapy at this dosing regimen (Figure 8D). As often seen in the clinic, tumors that are responsive initially will develop resistance which is likely the case here. These findings are consistent with the actions of two compounds acting independently of one another; in which, one anii-neoplastic develops resistance while the other maybe unaffected. Importantly, carboplatin is a front line chemotherapeutie agent for the treatment of breast cancer. Similar in action to eisplatin (Knox et aL, 1986), carboplatin stops tumor progression by binding to DNA and inducing a DNA damage response that leads to halt proliferation and acti vation of apoptosis (Chu, 1 94). Although Carboplatin is less toxic than the Cisplatin(Harland et aL, 1984), toxicity is still a major issue where the drag dose is determined based on the target area under the curve (AUC) and evaluated drug clearance(Eiienne ei aL, 2003), and in most cases is administered once every 4 weeks(Martin et ah, 1992). Due to the efficacy of HS-106 when combined with Carboplatin in the MMTV-Neu model, we tested a simi lar combination in the C3Tag mouse model of triple negative breast cancer (TNBC). Unlike HER2+- or ER- breast cancers, TNBC does not have any molecularly targeted drugs and platinum-based compounds are the most used chemotherapeutics for treatment. The combination of HS-106 and carboplatin was able to significantly reduce tumors volume in the C3Tag model (Figure 18). These data, combined with the studies in the Neu model, indicates a strong, well- tolerated synergism between a fatty acid synthase inhibitor and a front line chemotherapeutie agent that is extensively used for breast cancer therapy. Example 6 , Deterniinaiion o HS- 106 maximal tolerated dose .

Female FVB/i mice aged to 10-12 weeks (Jackson Labs, Maine) were intraperitonealy injected with HS-106 at the described doses twice weekly. Mice were monitored for signs of toxicity by standard Mouse Phase 1 Unit (MPllJ; ht^s://www.med.imc.edu mousephasel) protocols and approved by UNC-CH lACUC. Prior to end of the study I SQu i of whole blood was drawn via submandibular bleed and used to determine hematology values, liver, and kidney functions. To determine the long term effects of HS-106 on mice weight, female FVB/j mice aged. 12-16 weeks were treated with the indicated concentrations of HS-106 twice weekly by intraperitoneal injection for 60 days. Mice body mass was assessed weekly and were observed every day for signs of toxicity such as labored breathing and hunched posture. E ainpie 7. Purification of Hurnart FASN

Confluent BT474 cells grown in high glucose DMEM with 10% FBS, were scraped and washed twice with ice cold PBS. Then, the cells (2.26g) were homogenized using potter homogenizer for 5 minutes in 40 ml of buffer A. The homogenate was centrifuged at 142,000 x g for 45 minutes then filtered, through glass wool resulting in a volume of 27m 1 , To the 2.7mi of homogenate, 6.37 ml of saturated ammonium sulfate (final saturation 20%) was added and mixed slowly for 20min then incubated for 1 hour on ice. After centrifuging the iysate at 26,000 x g for 20 minutes, the pellet was discarded and to the supernatant (26 ml) 7ml. saturated ammonium sulfate was added (final saturation 35%). After repeating the same procedure in the previous step, the supernatant was discarded and the pellet was collected and dissolved in 20 ml of buffer A and added to 150 KDa molecular mass cut off concentrator (Thermo Fisher Scientific, Waltham, Massachusetts) then centrifuged for 30 minutes at 1,600 x g. The resulting volume on the filter ( 1.5 mi) was added to a Sephacryl S-300 H column (1 x 1 0cm) pre- equilibrated with PBS. The column was elated with PBS containing I. mM DTT at a flow rate of 0.2ml/min, Fractions (2 ml) were collected and peak fractions were run on SDS-PAGE. Fractions with FASN (identified by (MALDI-TOF/TOF MS) were pooled and concentrated using 150 KDa cutoff concentrator.

Ex mple_.g._.Det^^

T474 cells were seeded in 6 well plates in 10% FBS 4.5 g/L glucose DMEM at a density of 400,000 cells /well. After 24 hours the media was changed with 0. 1 g/L glucose DMEM containing different concentrations of HS-106. After ihour, to each well, ΙΟμΟϊ of ^JH acetate or 0,5μΟ of ^{i 4}C palmitate (in complex with BSA) was added and incubated for 1 hour, Then, ceils were treated with 500μ1 trypsin.' well for 5 min and subsequently 500 ί of ice cold PBS was added to each well. Lipids were separated as previously described (Kaluzny et «/., 1985). Briefly, lipids were extracted three times with 700 μΐ of Chloroform and injected into Sep-PaK Aminopropyl cartridges contains 360 mg of resin (Waters) Pre-equiiibrated with 10 ml chloroform. The cartridges were then injected with 5 ml 2: 1 chloroformdsopropanol, 2% acetic acid in ether and methanol to e!ute neutral lipids, free fatty acids and phospholipids respectively. To each .fraction, 1 ml of 25g/'L Butyl PBD dissolved in. Toluene was added and radioactivity was measured b scintillation counting,

Example 9, Anncxin V apoptosis assay

After treating BT474 cells with different concentrations of HS-106 for 24 hours , the annexiii V assay was executed as previously described (Sail et !.,, 2014). Briefly, cells were collected and. stained with Alexa Fluor 488 Annexin V and Sytox Red according to the manufacturer's protocol. Annexin V-positive cells were considered apoptotic, and their percentage of the total number of cells was calculated. Ten thousand events were collected for each sample using a BD Aceuri C6 flow cytomefcer (BD), and data were analyzed using the CF!ow Plus program software (BD) and PCS express (De Novo Software). Example 10. Determination of HS-106 maximal tolerated dose

Female FVB/J mice aged to 10-12 weeks (Jackson Labs, Maine) were intraperitonealy (IP) injected twice weekly with HS-106 at the described doses. Mice were monitored for signs of toxicity by standard Mouse Phase 1 Unit (MIP.I U; httos://www .med.unc.edu/mousephasel) protocols and approved by UNC-CM IA.CUC. Prior to end of the study 150 μΐ of whole blood was drawn via submandibular bleed and used to determine hematology values, liver, and kidney fractions by HemaTrue Hematology Analyzer (HESKA, Loveland, CO,USA) and VITROS® 350 Chemistry System (J&j, New Brunswick, NJ) according to manufacturer protocols. To determine the long term effects of HS-106 on mice weight, female FVB/J mice aged 12-16 weeks were treated with the indicated concentrations of HS-106 twice weekly by IP injection for 60 days. Mice bod mass was assessed weekly, and mice were observed daily for signs of toxicity (e.g. labored breathing and hunched posture).

Example 1 1. HS-106 pharmacokinetics

HS-106 pharmacokinetics was done as previously described (Howe et αί,, 2014). Briefly, MMTV-NEU mice were IP mjected with I Smg/kg of HS-106. After different time points (0, 5mm, lhr, 4hr, 8hr and 24hr), tissues were collected, homogenized and assayed for HS- 06 concentration by LC S using a standard curve for HS-106 and an internal standard.

E m )e..l2..... S^fe

amine loluenesulfoimt ) IIS- 106

HS-106 was originally obtained from Enamiiie Ltd. (www.eiiamine.com, T5790201} but is no longer available from them, 4-C¾loro-5,6^iraethylthieno[2,3-d]pyrimidine (.1 .02 g, 5.13 mmo!) and l -benzyl-3-aminopyrolidine (1.09 g, 6.16 mrnol) were combined and treated with Hunig's base (1.33 g, 10.3 mmol) arid eihanoi (4 mL). The mixture was heated to 100 °C for 2 h, The mixture was concentrated to an oil and ehromatographed (silica gel 3.5 x 25 cm, ethyl acetate (250mL), then 9/1 ethyl acetate MeOH (400 mL). The product was dissolved in ethyl acetate and treated with toltienesuSfonic acid (1. g) in ethyl acetate and stirred vigorously. The crystalline solid was filtered off and aid dried to give N~0 -benzylpyrroHdin~3- i)-5,6- dimethyltliieno[2,3- l]pyri.niidin-4-amine toluene nlfonate (I IS- 106, 1.8 g, 70%) as a white powder. TLC R_f = 0.21 in ethyl acetate, Rf= 0,39 in 9/1 CH₂Cl₂ MeOH; LC/MS m z = 339.2; ¹ H NMR (CDjOD) 6 8.29 (s, IH), 7.68 (d, J - 7.8 Hz, 2H, TsOH), 7.53 (br m, 2H), 7.42 (in, 411), 7.15 (d, J - 7.8 Hz, 2H, TsOH), 4.9 (m, IH), 4.50 (d, J - 13 Hz, IH), 4.30 (d, J - 13 Hz, 1.H), 3.89 (m, IH), 3.55 (m, IH), 3.48 (dd, J = 4.3, 12 Hz, 1 ), 3.27 (M, 111), 2.68 (m, 1 H), 2.41 (s, 3H), 2.40 (s, 3H), 2.3-2.5 (m, 2H), 2.35 (s, 3H, TsOH).

Synthesis of HS-106 enantiomers: (^^N^T^beflzyl yrro idm^S^yl S^^dimethy hienopJ^d^') pyrimidin-4-amirie HS-79.

4-Chloro-5,6-dimeth thieno[23-d|pyrimidine (100 mg, 503 μηιο!) and (R)-(-)- 1 -benzyl - 3-aminopyrolidine (Aldrioh, 89 mg, 503 μηιοΐ) were combined, treated with Hunig's base (130 mg, .1 mmol) and ethanol (700 μΐ and heated to 1.00 ⁽¹C for 2 h. The reaction mixture was allowed to cool, diluted with DMSO (500 μϋ) and purified by pre IIPL (5 to 100% methanol with. 0.2% formic acid. 20 mL/m, Agilent C-l 8, 21.1 x 25 cm) to give the product, a formate salt (190 mg, 98%) as a clear glass. LC/MS showed pure product (m z - 339.3, [M+lf ) to be identical to the raeemic commercial sample. Synthesis o 1 iS^■ i 06 enani iotners: (S)- -{ i -benzylpyrr olidiii-3-yl)-5,6-diHicthy!t k pyttTnidin-4-aHvme HS-80.

4-Chloro-5_»6-diniethylthiei^'Jo[2,3- i]pyrim.idh^'ie (100 mg, 503 μτηοί) and (S )-(-)- 1-benzyl- 3~aniinopyrolidine (Aidrich, 89 mg, 503 μτηοΐ) were combined, treated with Hunig's base (130 rag, 1 mmoi) and ethanol (TOO μϊ.) and heated to .100 °C for 2 h. The reaction mixture was allowed to cooL diluted with DMSO (500pL) and purified by prep IIPLC (5 to 300% methanol with 0,2% formic acid, 20 mL/m, Agilent C-18, 21.1 x 25 cm) to give the product, a formate salt (150 mg, 78%) as a clear glass, LC/MS showed pure produc (m z = 339.3, [M+l ]^'*) to be identical to the racemic commercial sample,

Synthesis of HS-1.02

4~Chloro-5,6-dimethyithieiio[2,3-d]pyrimidine (100 mg, 503 μ^η οΐ) and l -BOC-3- aminopyrolidhie (103 mg, 554 umol) were combined aod treated with Hunig's base (130 mg, 1 ramol) and ethanol (700 μϊ„) aod heated to 70 °C for 18 h. The reaction mixture was concentrated to an oil and chromatographed (silica gel, 9/1 CftCI^/MeOH) to give the intermediate as a glass. The glass was dissolved in methylene chloride (~4 ml.) aod treated with TFA (~1 mL). After about 1 h, the reaction mixture was concentrated, dissolved in DMSO (~- 1 mL) and purified by prep HPLC (0 to 100% methanol, 20 inL m. Agilent C-18, 21.1 x 25 cm) to give the product ('-136 mg) as an oil. The oil was dissolved in ethanol and treated with 60 μΐ, of 12 N HCI, which caused a lot of solid formation. The mixture was heated to reflux, allowed to cool, and filtered off and air dried to give product (90 mg, 63%) as a white powder. LC/MS showed a pure product with an m/z ^:::: 249.1, [M- l]⁺,

References

Adaehi, A . et at., J. Virol, 59, 284 (. 986).

Alo, P. et aL (1996). Expression of fatly acid synthase (FAS) as a predictor of recurrence in stage I breast carcinoma patients. Cancer 77, 474-482.

Ameer, F. et aL (2014). De novo li oogenesis in health and disease. Metabolism: clinical and experimental 63, 895-902,

Aragones, G. ei ai, BMC Gastroenterol 10, 92 (2010).

Bandyopadh yay, S. et ai. (2006 }. Mechanism of apoptosis induced by the inhibition of fatty acid synthase in breast cancer cells. Cancer Res 66, 5934-5940.

B!igh, E; Dyer, W. J, Can J Biochem Physio! 37, 91 1 (1959),

Brussehnans, . et ai. (2009). The Lipogenic Switch in Cancer. In Mitochondria and Cancer (Springer New York), pp. 39-59.

Bryant M, Rat er L. Myristoylat.ion-depe.nde.nt replication and assembly of human immunodeficiency virus 1. Proc Nail Acad Sci U S A. 1990;87:523-527,

Bushman, F. et ai, PLoS Pathog. 5, e!000437 (2009).

Carlson, D. ei ai. (2013). Fluorescence linked enzyme chemoproteomic strateg for discovery of a potent and selective DAP 1 and ΖΪΡΚ inhibitor. ACS chemical biology 8, 2715-2723.

Chakravarthy, M. et ai. "New" hepatic tat activates PPARalpha to .maintain glucose, lipid, and cholesterol homeostasis. Cell Metah. 2005; 1 :309-322.

Chiraia, S. et ai. Fatty acid synthesis is essential, in embryonic development: fatly acid synthase null mutants and most of the heterozygotes die in utero. Proc Natl Acad Sci U S A, 2003;100:6358-6363.

Chu, G. ( 1994), Cellular responses to cisplatin. The role of DMA -binding proteins and DNA repair. The Journal of biological chemistry 269, 787-790.

Dorr, P. et at, Antimicroh. Agents Chemother. 49, 4721 (2005).

Edmonds, T. et L, Virology 40$, 1 (2010).

Eiienne, M. et ai. (2003). Pharmacokinetics of low-dose carbopSatm and applicability of a method of calculation for estimating individual drug clearance. Annals of oncology : official journal of the European Society for Medical Oncology ESMO 14, 643-647.

Fadden, P. a i,, Chem Bid 1.7, 686 (2010). Felder, E. et al. (2012), The generation of purinome-targeted libraries as means to diversify ATP-mimetic chemical classes for lead finding. Molecular diversity 16, 27-51.

Fritz, L. et al (2001). Rapid methods for identifying modifiers of cellular apoptosis activity (Google Patents),

Firaabashi, H. et ai, J. Biochem. 105, 751 (1989). Graves, P. et al., Mol Pharmacol 62, 1364 (2002).

Greseth D, Traktman P. De novo fatty acid biosynthesis contributes significantly to establishment of a bioenergetically favorable environment for vaccinia virus infection. PLoS Pathog. 2014; Ϊ 0:el004021. ^'

Hardwicke, M, et al, (2014). A human fatty acid synthase inhibitor binds beta-ketoaeyl reductase in the keto-substrate site. Nature chemical biology 10, 774-779,

Bartend, S. et l. (1984). Pharmacokinetics of cis-diammine- 1 , 1 -eyclobutane dicarboxylate platmum(II) in patients with normal and impaired renal function. Cancer Res 44„ 1693- 1697. Haystead, C. et al, Eur, J. Bioehem. 214, 459 (1993).

Hay stead, T. (2006). The purinome, a complex mix of drug and toxicity targets. Current; topics in medicinal chemistry 6, 1 1 17-1 127,

Haystead, T. et al (1986). Both insulin and epidermal growth factor stimulate lipogenesis and acetyl-CoA carboxylase activity in isolated adipocytes, importance of homogenization procedure in avoiding artefac ts in acetyl-CoA carboxylase assay. The Biochemical journal 234, 279-284.

Haystead, T, et al. ( 1989), Effects of the tumour promoter okadaic acid on intracellular protein phosphorylatio and metabolism. Nature 337, 78-81.

Heaton, N. et al, Proe. Natl Acad. Set USA .107, 17345 (2010).

Howe, M. et al (2014], Identification of an aiiosteric small-molecule inhibitor selective for the inducible form of heat shock protein 70. Chemistry & biology 22, 1648-1659,

Huang, i. et aL J. Virol. 87, 4994 (2013).

Huang IT, Tseng CP. Liao MH, Lu SC, Yell WZ, Sakamoto N et al Hepatitis C virus replication is modulated by the interaction of nonstructural protein NS5 B and fatty acid synthase. J. Virol. 2013: 87:4994-5004.

Hughes, P. et at. (2012), A highly selective Hsp90 affinity chromatography resin with a eleavabie linker, Bioorganic & medicinal chemistry 20, 3298-3305. lwanaga, T, et al. (2009). Dynamic protein pabnitoylation in cellular signaling. Progress in lipid research 1 17-127.

Kaluzny, . et al (1985), Rapid separation of lipid classes in high yield and purity using bonded phase columns. Journal of lipid research 26, 135-140,

Knapp, M. et al. (2006). Targeting cancer: the challenges and successes of structure-based drug design against the h man purinome. Current topics in medicinal chemistry 6, 1 129-1159.

Knox, R, et al. (1986), Mechanism of cytotoxicity of anticancer platinum drugs: evidence that cis-diamniinedichloroplatinmt (li) and ci s-diammme-( I , ί -cyclobutanedicarboxylato)plai^'inum(H) differ only in the kinetics of their interaction with D A. Cancer Res 46, 1972-1 79.

Kridel, ^'et al, Cancer Res. 64, 2070 (2004).

Kuhajda, F. et al. (2000). Synthesis and antitumor activity of an inhibitor of fatty acid synthase. Proceedings of the National Academy of Sciences of the United States of America 97, 3450- 3454.

Kuhajda, Nutrition 16, 202 (2000).

Landis-Pi o ar, K. et al. (2007). A novel prodrug of the green tea polyphenol (-)- epigailocatechin-3-gaiiate as a potential anticancer agent. Cancer Res 67, 4303-4310.

Li, IL, Dou J, Ding L, Spearman P. Myristoylation is required for human immunodeficiency virus type 1 Gag-Gag mulii erization in mammalian cells. I Virol. 2007;81:12899-12 10.

Li, Y. et al, J. irol. 78, 41 7 (2004).

Lindwasser OW, Resh MD. Myristoylation as a target for inhibiting HIV assembly; unsaturated fatty acids block viral budding. Proc Natl Acad Sei IJ S A. 2002;99: 13037- 1 042. ^"

Liu, H. et al., IniJ Biochem Mol Biol 1, 69 (2010).

Lorizate, M. et al, Ceil Microbiol 15, 292 (2013).

Maier, T. et al. (2008). The crystal structure of a mammalian fatty acid synthase. Science 321, 1315-1322.

Martin, M. et al. (1992). Carboplatin: an active drug in metastatic breast cancer, journal of clinical oncolog : official journal of the American Society of Clinical Oncolog 10, 433-437.

Martin-Acebes, M. et al, PLoS (ME 6, e24970 (201 1).

Menendez, J. et al,. Nat. Rev. Cancer 7, 763 (2007). Miyagaehi, Y. et al. (2011 ). Simple method for isolation of glycerakiehyde 3-phosphate dehydrogenase and the improvement of myofibril, gel properties. Animal science journal - Ninon chikiisan Galdcaiho 82, 136-143.

Muller, W, e! al. (1988), Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene. Cell 54, ! 05-115.

Muratsubaki, H. et al. (1994). Rapid purification of yeast, cytoplasmic fumarate reductase by affinity chromatography on blue sepharose CL-6B. Prep Biochem 24, 289-296.

Murray, J. et al. (2009). Targeting the purinome. Methods Mol Biol 575, 47-92.

OMveras, O. et al. (2010), Novel anti-fatty acid synthase compounds with anti-cancer activity in HER2+ breast cancer. Annals of me New York Academy of Sciences 1210, 86-92.

Ono, A. et al, Proc. Natl. Acad. Sci. USA 98, 13925 (2001 ),

Oslob, j. et al, (2013). imidazopyridine- Based Fatty Acid Synthase inhibitors That Show Anti- HCV Activity and in Vivo Target Modulation. ACS medicinal chemistry letters 4, 113-1 17,

Pal R, Gallo C, Sarngadharan MG. Processing of tlie structural proteins of huma immunodeficiency virus type 1 in the presence of monensm and ceralenin. Proc Natl Acad Sci U S A. 1988;85:9283-9286. ^"

Fixer, E. et al. (2000). Malonyl -coenzyme- A is a potential mediator of cytotoxicity induced by tatty-acid synthase inhibition in human breast cancer cells and xenografts. Cancer Res 60, 13- 218,

Puig, T. et al (2009), Novel Inhibitors of Fatty Acid Synthase with Anticancer Activity, Clinical cancer research : an official journal of the American Association for Cancer Research 15, 7608- 7615.

^"Puig, T. et al (201 1 ), A novel inhibitor of fatty acid synthase shows activity against HER2+ hreast cancer xenografts and is active in anti-HER2 drug-resistant cell lines. Breast cancer research : BCR 13, R 131.

Resh, M.₅ Biochim. Biophys. Acta 1451. i (1 99).

Richardson, R. et al. (2007). Novel antagonists of the thioesterase domain of human fatty acid synthase. Molecular cancer therapeutics 6, 2120-2126,

Richardson, R. et aL, J. Med Chem. 55 , 5285 (2008).

Russell, E. et al._.. J. Virol. 85, 8253 (201 i). Safi, . et al. (2014). Copper signaling axis as a target for prostate cancer therapeutics. Cancer Res 74, 5819-5831.

Schneider, J. et al Macrophage fatty-acid synthase deficiency decreases diet-induced atherosclerosis. J Biol Chem. 2010;285:23398-23409

Smith, S.. FASEB . 8. 1248 (1994).

Su!, H. et al., Anna. Rev. Nut 18, 331 (1998).

Swinnen, J. et al. (2006). Increased lipogenesis in cancer ceils: new players, novel targets. Current opinion in clinical nutrition and metabolic care 9, 358-365.

Thupari, ! et al (2002), C75 increases peripherai energy utilization and fatty acid oxidation in diet-induced obesity. Proceedings of the National Academy of Sciences of the United States of Americ 99, 9498-9502.

Turrado, C. et l. (2012). New synthetic inhibitors of fatty acid synthase with anticancer activity. Journal of medicinal chemistry 55, 5013 -5023.

Vazquez, M, et al. (2008), Discovery of GSK837149A, an inhibitor of human fatty acid synthase targeting the beta-ketoacyl reductase reaction. The FEBS journal 275, 1556-1567,

Wakil S., Biochemistry 28, 4523 (1 89).

Wakil, S. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry. 1 89:28:4523- 4530

Wilsky, S. et al, Arch Virol 1 7, 259 (2012).

Yang, Y. et al. (2002), Activation of fatty acid synthesis during neoplastic transformation: role of mitogen -activated protein kinase and phosphatidylinositol 3-kinase. Experimental cell research 279, 80-90.

Yang W, Hood BL, Chadwick SL, Liu S, Watkins SC, Luo G et a Fatty acid synthase is up- regulated during hepatitis C virus infection and regulates hepatitis C virus entry and production. Hematology. 2008;48: 1396- 1403.

Yoshii, Y. et al, PLoS ONE 8, e64570 (2013). It will be readily apparent to one of ordinary skill in the relevant arts that suitable modifications and adaptations to the compositions, methods, aad applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of the claimed embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in ail variations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof as noted, unless other statements of incorporation are specifically provided.

Claims

CLAIMS it is claimed is:

1. A method of inhibiting Fatty Acid Synthase (FASN) with a FASN inhibitor that binds to the FASN purme-binding cofactor domain, the method comprising contacting cells thai: express FASN with an inhibitor that binds to the FASN purine-bmdmg cofactor domain.

2. The method of claim 1, wherein the inhibitor does not bind to the substrate domain.

3. The method of claim 1 , wherein the inhibitor inhibits both acetate and glucose incorporation into total lipids.

4. The method of claim 3, wherein the inhibitor inhibits both acetate and glucose incorporation into Lipids in the HepG2 cell line with an ICso value below about 300 nM.

5. The method of claim 1, wherein the inhibitor possesses a thiophenopyrimidine scaffold.

6. The method of claim 1, wherein the inhibitor possesses a thieno[2₅3-d]pyrimidme scaffold.

7. The method of claim J, wherein the compound is (N~( l-benzylpyrrolidiii-3-yl)-5,6- dimethyithieno[2,3-d]pyrimidin-4-amine, or a pharmaceutically acceptable salt thereof.

8. A method of promoting apoptosis m a cancer cell dependent on FASN activity, the method comprismg contacting the cells with an inhibitor thai binds to the FASN purine- binding cofactor domain,

9. The method of claim 8, wherein the inhibitor does not bind to the substrate domain.

10. The method of claim S, w herein the inhibitor possesses a thiophenopyrimidine scaffold.

1 1. The method of claim 8, wherein the inhibitor possesses a. thieno[2,3-d]pyriniidir»e scaffold.

12. The method of claim 8, wherein the compound is (N-( 1 -benzylpyrrolidin-3-yl)-5,6- dimethylthieno[2,3-d¾ yrimidin-4-amine, or a pharmaceutically acceptable salt thereof.

13. A method of treating cancer in a subject, the method comprising administering to the subject in need thereof, a merapeuiically effective amount of a FASN inhibitor that binds to the FASN ptirine-bmding cofactor domain.

14. The method of claim 13, wherein the inhibitor does not bind to the substrate domain

15. The method of claim 13, wherein the cancer is selected from the group consisting of HER2-positive breast cancer, triple negative breast cancer, melanoma, hepatocellular carcinoma, and leukemia.

16. The method of claim 3, wherein the inhibitor possesses a thiophenopyrimidine scaffold.

17. The method of claim 13, wherein the iiihibitor possesses a thieno[2,3-d]pyrimidine scaffold.

18. The method of claim 13, wherein the compound is (N-(l-ben yipyrrolidin-3-yl)-5-6- dimethyithieno[2_?3-d^'jpyrimidin-4-amioe, or a pharmaceutically acceptable salt thereof

1 . The method of claim 13, wherein the inhibitor is co-administered with a platinum-based antineoplastic compound.

20. The method of claim 1 , wherein the inhibitor is co-administered with carboplatm or cisphuin.

21 , The method of claim 19, wherein the inhibitor is co-administered with carboplatin ,

22. The method of claim 19, wherein the dosage of platinum-based antineoplastic compound is less than that required when administered in the absence of a FASN inhibitor.

23. A method of inhibiting viral replication in cells dependent on FASN expression, the method comprising contacting the cells with an inhibitor that binds to the FASN purine- binding cefaclor domain,

24. The method of claim 23, wherein the inhibitor does not bind to the substrate domain

25. The method of claim 23, wherein the inhibitor inhibits HIV viral replication in a TZM-bl model of HIV replication with an EC_$© value below about 500 nM.

26. The method of claim 23, wherein inhibition of FASN reduces MlV-1 particle production without affecting intracellular Gag production.

27. The method of claim 23, wherein the inhibitor attenuates HIV replication during a late stage of its replication cycle.

28. The method of claim 23, wherein nascent I IIV- I virion production is inhibited without reducing IIIV-l protein synthesis.

29. The method of claim 23. wherein the inhibitor possesses a thiophenopyrimidine scaffold.

30. The method of claim 23, wherein the inhibitor possesses a thieno [2/3 -djpyrinu dine scaffold.

31. The method of claim 23, wherein the compound is ( -(l -beiizylpyrrolidm-3-yl)-5,6- dimethylthieno[2_}3-d]pyrimidin-4-amine, or a pharmaceutically acceptable salt thereof,

32. A method of treating a viral infection in a subject, the method comprising administering to the subject in need thereof, a therapeutically effecti ve amount of a FASN inhibitor that binds to the FASN pirrine-binding cofactor domain.

33. The method of claim 32, wherein the viral load is reduced.

34. The method of claim 32, wherein the viral infec tion is infection by an enveloped virus.

35. The method, of claim 32, wherein the viral infection is infection by a virus selected from the group consisting of human immunodeficiency virus, cytomegalovirus. Dengue, hepatitis B, hepatitis C, Epstein-Barr, influenza virus, respiratory syncytial virus and. West Nile virus.

36. The method of claim 32, wherein the virus is human immunodeficiency virus.

37. The method of claim 32, wherein lipid dysregulati n-based morbidities are reduced .

38. The method of claim 32, wherein the inhibitor possesses a thiophenopynmidrae scaffold.

39. The method of claim 32, wherein the inhibitor possesses a ihieno[2,3-d]pyrimidme scaffold.

40. The method of churn 32, wherein the compound is ( -(i-benzyip> rolidin-3-yl)-5,6- dimethylthIeiio[2,3-d]pyrimidin-4-amine, or a pharmaceutically acceptable salt thereof.

41. The method of claim 32, further comprising co-administration of an additional anti- retroviral compound.

42. A pharmaceutical composition comprising (N-{l ~benzyipyrrolidin-3-yl)-5,6- dimethy!thieno 2,3-d]pyrimidm-4-amine_J or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

43 , The compound (R)-(N-( I -ben¾y1pyrrolidin-3-yl)-5,6^imeihylthieno[2₅3^]pyrimidin^ amine or a pharmaceutically acceptable salt thereof,

44. The compound (S)-(N-(l-beozylp

amine or a pharmaceuticaiiy acceptable salt thereof.