WO2017177191A1 - Sf3b1 suppression as a therapy for tumors harboring sf3b1 copy loss - Google Patents
Sf3b1 suppression as a therapy for tumors harboring sf3b1 copy loss Download PDFInfo
- Publication number
- WO2017177191A1 WO2017177191A1 PCT/US2017/026693 US2017026693W WO2017177191A1 WO 2017177191 A1 WO2017177191 A1 WO 2017177191A1 US 2017026693 W US2017026693 W US 2017026693W WO 2017177191 A1 WO2017177191 A1 WO 2017177191A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sf3b1
- sample
- subject
- cancer
- carcinoma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G06—COMPUTING OR CALCULATING; COUNTING
- G06F—ELECTRIC DIGITAL DATA PROCESSING
- G06F17/00—Digital computing or data processing equipment or methods, specially adapted for specific functions
- G06F17/10—Complex mathematical operations
- G06F17/18—Complex mathematical operations for evaluating statistical data, e.g. average values, frequency distributions, probability functions, regression analysis
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/10—Ploidy or copy number detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
- G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
- G16H50/20—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
- G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
- G16H50/30—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indices; for individual health risk assessment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- SCNA-related dependencies can be categorized into four classes.
- copy gain may be associated with dependencies on genes outside the amplicon.
- Fourth, copy loss may be associated with dependencies on genes outside the deletion, as has been described for pairs of paralogs such as ENOl and EN02. The relative frequency of each of the four classes and their general features is largely unknown.
- the present invention used a genome-scale shRNA viability screen to perform an unbiased analysis of copy-number associated gene-dependency interactions.
- the most highly enriched subclass were "CYCLOPS" genes, whose hemizygous loss sensitizes cells to their further suppression.
- the invention identified a splicing factor SF3B1 as a CYCLOPS gene and revealed the underlying mechanism.
- the present disclosure provides a method for determining the likelihood that a subject with cancer responds to an SF3B1 suppression treatment, comprising measuring the copy number of SF3B1 in a sample comprising cells from the subject, wherein the likelihood is increased if the copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample.
- the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer. In some embodiments, the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma,
- cholangiocarcinoma chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma,
- the sample comprises a cancerous lesion.
- the sample comprises circulating tumor cells.
- measuring the copy number of SF3B1 comprises comparative genomic hybridization (CGH). In some embodiments, measuring the copy number of SF3B1 comprises fluorescence in situ hybridization (FISH). In some embodiments, measuring the copy number of SF3B1 comprises amplifying a genomic sequence comprising at least 20 nucleotides of SF3B1.
- measuring the copy number of SF3B1 comprises DNA sequencing.
- DNA sequencing comprises whole-genome sequencing. In another embodiment, DNA sequencing comprises whole-exome sequencing.
- the copy number of SF3B1 in the sample is an average copy number if the sample is heterogeneous.
- the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the average copy number of SF3B1 in the sample from the subject is at least smaller than the ploidy of the cells in the sample by at least 25%.
- the subjected is treated with an SF3B1 suppression treatment if the likelihood that the subject response is increased.
- the present disclosure also provides a method for determining the likelihood that a subject with cancer responds to an SF3B1 suppression treatment, comprising measuring expression level of SF3B1 in a sample from the subject and comparing the measured expression level of SF3B1 in the sample from the subject to the expression level of SF3B1 in a control sample, wherein the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample.
- the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer. In some embodiments, the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma,
- cholangiocarcinoma chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma,
- the sample comprises a cancerous lesion.
- the sample comprises circulating tumor cells.
- the control sample comprises one or more samples selected from the group consisting of a normal tissue, a tumor known to have the same ploidy as the sample from the subject, and a cell known to have the same ploidy as the sample from the subject.
- the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample by at least 25%.
- the expression level of SF3B1 in the sample from the subject is an mRNA level. In some embodiments, the SF3B1 mRNA level in the sample from the subject is measured by a method comprising quantitative PCR. In some embodiments, the SF3B1 mRNA level in the sample from the subject is measured by a method comprising RNA sequencing. In one embodiment, the RNA sequencing comprises whole-transcriptome sequencing.
- the expression level of SF3B1 in the sample from the subject is a protein level.
- the protein level of SF3B1 in the sample from the subject is measured by a method comprising immunohistochemistry.
- the protein level of SF3B1 in the sample from the subject is measured by a method comprising enzyme-linked immunosorbent assay (ELISA).
- ELISA enzyme-linked immunosorbent assay
- the protein level of SF3B1 in the sample from the subject is measured by a method comprising quantitative mass spectrometry.
- the subject is treated with an SF3B1 suppression treatment if the likelihood that the subject response is increased.
- the SF3B1 suppression treatment comprises reducing the amount of SF3B1 mRNA.
- reducing the amount of SF3B1 mRNA comprises RNA interference.
- the RNA interference targets one or more of the sequences selected from SEQ ID NOs 8, 9, 16, 17, 18 and 19.
- reducing the amount of SF3B1 mRNA comprises inhibiting one or more transcription cofactors that control SF3B1 transcription.
- the one or more transcription cofactors that control SF3B1 transcription comprise bromodomain containing 1 (BRD1), bromodomain containing 2 (BRD2), bromodomain containing 3 (BRD3), bromodomain containing 4 (BRD4), or a combination thereof.
- the SF3B1 suppression treatment comprises reducing the amount or activity of SF3B1 protein. In one embodiment, reducing the amount of SF3B1 protein comprises increasing the rate of SF3B1 protein degradation. In a specific
- increasing the rate of SF3B1 protein degradation comprises inhibiting the activity of one or more deubiquitinating enzymes.
- reducing the activity of SF3B1 protein comprises inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex.
- reducing the activity of SF3B1 protein comprises inhibiting the interaction between the SF3B complex and 15S U2 snRNP or 17S U2 snRNP.
- reducing the activity of SF3B1 protein comprises inhibiting the incorporation of SF3B1 into 15S U2 snRNP or 17S U2 snRNP.
- the response to an SF3B1 suppression treatment comprises a reduced tumor load, a longer progression-free survival, a longer overall survival, or a combination thereof.
- the present disclosure also provides a method for treating a subject with cancer, comprising providing an SF3B1 suppression treatment, thereby treating the cancer in the subject.
- the present disclosure provides a method for treating a subject with cancer, comprising measuring the copy number of SF3B1 in a sample comprising cells from the subject and providing an SF3B1 suppression treatment if the copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample, thereby treating the cancer in the subject.
- the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer.
- the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadeno
- the sample comprises a cancerous lesion.
- the sample comprises circulating tumor cells.
- measuring the copy number of SF3B1 comprises comparative genomic hybridization (CGH). In some embodiments, measuring the copy number of SF3B1 comprises fluorescence in situ hybridization (FISH). In some embodiments, measuring the copy number of SF3B1 comprises amplifying a genomic sequence comprising at least 20 nucleotides of SF3B1.
- measuring the copy number of SF3B1 comprises DNA sequencing.
- DNA sequencing comprises whole-genome sequencing. In another embodiment, DNA sequencing comprises whole-exome sequencing.
- the copy number of SF3B1 in the sample is an average copy number if the sample is heterogeneous.
- an SF3B1 suppression treatment is provided to the subject if the average copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample by at least 25%.
- the present disclosure also provides a method for treating a subject with cancer, comprising measuring expression level of SF3B1 in a sample from the subject, comparing the measured expression level of SF3B1 in the sample from the subject to the expression level of SF3B1 in a control sample, and providing an SF3B1 suppression treatment if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample, thereby treating the cancer in the subject.
- the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer.
- the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadeno
- the sample comprises a cancerous lesion.
- the sample comprises circulating tumor cells.
- the control sample comprises one or more samples selected from the group consisting of a normal tissue, a tumor known to have the same ploidy as the sample from the subject, and a cell known to have the same ploidy as the sample from the subject.
- an SF3B1 suppression treatment is provided to the subject if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample by at least 25%.
- the expression level of SF3B1 in the sample from the subject is an mRNA level.
- the SF3B1 mRNA level in the sample from the subject is measured by a method comprising quantitative PCR.
- the SF3B1 mRNA level in the sample from the subject is measured by a method comprising RNA sequencing.
- the RNA sequencing comprises whole- transcriptome sequencing.
- the expression level of SF3B1 in the sample from the subject is a protein level.
- the protein level of SF3B1 in the sample from the subject is measured by a method comprising immunohistochemistry.
- the protein level of SF3B1 in the sample from the subject is measured by a method comprising enzyme-linked immunosorbent assay (ELISA).
- ELISA enzyme-linked immunosorbent assay
- the protein level of SF3B1 in the sample from the subject is measured by a method comprising quantitative mass spectrometry.
- the SF3B1 suppression treatment comprises reducing the amount of SF3B1 mRNA.
- reducing the amount of SF3B1 mRNA comprises RNA interference.
- the RNA interference targets one or more of the sequences selected from SEQ ID NOs 8, 9, 16, 17, 18 and 19.
- reducing the amount of SF3B1 mRNA comprises inhibiting one or more transcription cofactors that control SF3B1 transcription.
- the one or more transcription cofactors that control SF3B1 transcription comprise bromodomain containing 1 (BRDl), bromodomain containing 2 (BRD2), bromodomain containing 3 (BRD3), bromodomain containing 4 (BRD4), or a combination thereof.
- the SF3B1 suppression treatment comprises reducing the expression or activity of SF3B1 protein. In one embodiment, reducing the amount of SF3B1 protein comprises increasing the rate of SF3B1 protein degradation. In a specific
- increasing the rate of SF3B1 protein degradation comprises inhibiting the activity of one or more deubiquitinating enzymes.
- reducing the activity of SF3B1 protein comprises inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex.
- reducing the activity of SF3B1 protein comprises inhibiting the interaction between the SF3B complex and 15S U2 snRNP.
- reducing the activity of SF3B1 protein comprises inhibiting the incorporation of SF3B1 into 15S U2 snRNP or 17S U2 snRNP.
- the present disclosure also provides a kit comprising a reagent for reverse transcription of an RNA molecule, two or more primers, wherein a first primer comprises a polynucleotide comprising SEQ ID NO: 24, and a second primer comprises a polynucleotide comprising SEQ ID NO: 25, and a reagent for amplification of a DNA sequence.
- kits comprising an antibody that is capable of binding SF3B1 and a reagent for the detection of the antibody.
- Figure 1A is a series of graphs showing growth of breast cancer cell lines (SF3Bl neutral : “Cal 51”, “HMC 1-8", “Hs578T”, “Cal51 CRISPR neutral “, SF3Bl loss : “HCC1954", “BT549”, “T47D”, “Cal51 C RISPR frameshift”loss "), expressing shRNAs targeting lacZ ("shLacZ”) or SF3B1 ("shSF3Bl #3", “shSF3Bl #4”) measured as changes in CellTiterGlo luminescence relative to one day post-infection.
- Figure IB is a graph showing quantification of SF3B1 expression from the indicated cell lines ("HMC 1-8", “Cal-51”, “Hs578T”, “MCF7”, “MCF10A”, “HMEC”, “HCC1954", “T47D”, “BT549”, “SKBR3”) expressing shRNAs targeting lacZ ("shLacZ,” left bar for each cell line) or SF3B1 ("shSF3Bl #3,” middle bar for each cell line; or “shSF3Bl #4,” right bar for each cell line) by quantitative RT-PCR.
- Figure 1C is a graph showing relative growth of Cal 51 CRISPR copy"loss cells and Cal 51 CRISPR neutral 2 cells after treatment with siRNAs targeting LacZ ("siLacZ”) or SF3B1 ("siSF3Bl #3").
- Figure 2A is a graph showing ratio of cells expressing an SF3B1 shRNA coupled with GFP ("shSF3Bl-GFP+”) relative to uninfected controls, normalized to the ratio of cells expressing an LacZ shRNA coupled with GFP (“shLacZ-GFP+”) relative to uninfected controls.
- Figure 2B is a series of graphs showing ratio of cells expressing an LacZ shRNA coupled with GFP ("shLacZ-GFP") or an SF3B1 shRNA coupled with GFP ("shSF3Bl#4-GFP”) to uninfected controls in SF3Bl neutral and SF3Bl loss breast cell lines (SF3Bl neutral : “HMC 1-8", “Cal51”, “Hs578T”, “MCF10A”; SF3Bl loss : “HCC1954", “T47D”, “BT549”, SKBR3”) and hematopoetic cell lines (SF3Bl neutral : “Raji”, “Jurkat", “HT”; SF3Bl loss : “Toledo", “Hut78”).
- Figure 3A is a graph showing viability of cells ("SF3Bl neutral “, “SF3Bl loss ”) expressing doxycycline (Dox)-activated SF3B1 shRNAs (TR-shSF3Bl#3 and TR-shSF3Bl#5), cultured in the presence (“+ Dox”) or absence (“- Dox”) of doxycycline, relative to viability three days post Dox treatment.
- Figure 3B is a series of graphs showing quantification of SF3B1 expression without ("- Dox,” left bar for each cell line) or with ("+ Dox,” right bar for each cell line) Dox-induced shSF3Bl ("TR-shSF3Bl #3", “TR-shSF3Bl #5") expression by quantitative RT-PCR.
- Figure 3C is a series of graphs showing growth of breast cancer cell lines without ("- Dox") or with ("+ Dox”) Dox-induced SF3B1 shRNAs ("TR-shSF3Bl#3", “TR-shSF3Bl#5") expression, measured as changes in CellTiterGlo luminescence relative to day 1 of Dox treatment.
- Figure 4A is a series of graphs showing cell cycle distribution in SF3Bl neu ra and SF3B1 oss cells incubated for four days without ("- Dox,” left bar for each cell line) or with ("+ Dox,” right bar for each cell line) Dox-induced expression of shSF3Bl .
- Figure 4B is a series of graphs showing the fraction of apoptotic cells five days after incubation without ("- Dox,” left bar for each cell line) or with ("+ Dox,” right bar for each cell line) Dox-induced expression of shSF3Bl, as determined by Annexin V/prodium iodide flow cytometry.
- Figure 4C is a graph showing viability of cells expressing shRNAs targeting LacZ
- shLacZ shLacZ
- TR-shSF3Bl an average of replicates performed using independent shRNAs “shSF3Bl #3” and “shSF3Bl #4", measured as fractions of cells excluding propidium iodide, relative to viability of these cells four days post infection.
- Figure 5A is a series of graphs showing quantification of GFP fluorescence from cells expressing SF3B1-IRES-GFP without ("-dox,” left four bars in each panel) or with ("+dox,” right four bars in each panel) Dox-induced SF3B1 shRNA expression.
- Figure 5B is a graph showing ratio of cells expressing SF3B1-GFP ("+SF3B1") relative to uninfected (“control”) SF3Bl neutral cells (“Cal51”) and SF3Bl loss cells (“HCC1954").
- Figure 5C is a graph showing ratio of cells expressing SF3B1-GFP ("+SF3B1") relative to uninfected SF3Bl neutral cells (“Cal51”) and SF3Bl loss cells (“HCC1954") expressing an shRNA targeting SF3B1 (“shSF3Bl”).
- Figure 6A is an immunoblot of SF3B1 from HCC1954 cells expressing LacZ or SF3B1.
- Figure 6B is a graph showing growth of SF3Bl loss cells expressing LacZ or SF3B1 upon Dox-induced expression of SF3B1 shRNA ("TR shSF3Bl#5"), measured as changes in CellTiter-Glo luminescence.
- Figure 7A is a graph showing SF3B1 expression from 777 TCGA breast adenocarcinomas segregated by SF3B1 copy number. Whiskers represent min/max values and boxes represent upper and lower quartile ranges. Width of plots represents relative sample density.
- Figure 7B is a graph showing SF3B1 expression from 974 cell lines from the Cancer Cell
- Figure 8A is a graph showing SF3B1 expression in SF3Bl neutral and SF3Bl loss breast cancer cell lines measured by quantitative RT-PCR. Data points represent individual cell lines, and horizontal lines indicate means.
- Figure 8B is a graph showing SF3B1 mRNA expression from control cells and those with CRISPR-induced copy-loss.
- Figure 9A is an immunoblot showing SF3B1 protein levels in breast cancer cell lines (SF3Bl neutral : “Cal51”, “Hs578T”, “MCF7”; SF3Bl loss : “BT549", “HCC1954", “ZR-75-30”).
- Figure 9B is an immunoblot showing SF3B1 expression from control Cal51 cells ("control- 1" and "control-2"), Cal51 cells containing a frameshift mutation inactivating one SF3B1 allele (“Loss-1"), and Cal51 cells having deletion of one copy of the SF3B1 locus (“Loss-2”).
- the Loss-1 and Loss-2 cells were generated by CRISPR technology.
- Figure 10 is an immunoblot of SF3Bl neutral cells ("Cal51”, “Hs578T”, “MCF7") and SF3Bl l0SS cells ("BT549", “HCC1954") without and with Dox-induced expression of shSF3Bl#5.
- Figure 11 is a graph showing differences in proliferation (measured by CellTiter-Glo;
- Figure 12 is a diagram of U2 snRNP assembly.
- Figure 13A is a graph showing sedimentation of mass standards in 10-30% glycerol gradients.
- Figure 13B is a graph showing elution profiles of mass standards in gel filtration
- Figure 14A is an immunoblot showing input for glycerol gradient fractionation of native whole-cell lysates of breast cancer cell lines (SF3Bl neutral : “Cal51”, “Hs578T”; SF3Bl loss : “BT549”, “HCC1954").
- Figure 14B is an immunoblot showing fractions from glycerol gradient fractionation of native whole-cell lysates of breast cancer cell lines (SF3Bl neutral : "Cal51", “Hs578T”;
- Figure 15A is an immunoblot showing input for glycerol gradient fractionation of native whole-cell lysates of isogenic cells generated by CRISPR ("neutral#l", “frameshift-loss”).
- Figure 15B is an immunoblot showing fractions from glycerol gradient fractionation of native whole-cell lysates of isogenic cells generated by CRISPR ("neutral#l", “frameshift- loss”).
- Figure 16A is an immunoblot showing the amount of SF3B1 in pooled glycerol gradient fractions ("4-6", “12-14", “25") of breast cancer cell lines (SF3Bl neutral : “Cal51”, “Hs578T”; SF3Bl l0SS : “BT549”, “HCC1954") in serial dilution.
- Figure 16B is an immunoblot of indicated gel filtration fractions.
- GAPDH and SNRPB2 represent markers for complexes ⁇ 700 kDa and spliceosome precursors respectively.
- Figure 17A is (left) an immunoblot showing SF3B1 Native PAGE of pooled glycerol gradient fractions 4-6 and (right) a denaturing silver stain of total protein from the same pooled fractions as loading control.
- Figure 17B is an immunoblot after SF3B1 immunoprecipitation from pooled glycerol gradient fractions 4-6.
- Figure 18 is an immunoblot after SF3B1 immunoprecipitation from pooled glycerol gradient fractions 24-25.
- Figure 19B is a representative radiologic image of a native agarose gel of U2 snRNP complexes visualized with radiolabeled 2' O-methyl oligonucleotides complementary to the U2 snRNA.
- Nuclear extracts were generated from control Cal51 cells ("control-1” and "control-2"), Cal51 cells containing a frameshift mutation inactivating one SF3B1 allele (“Loss-1”), and Cal51 cells having deletion of one copy of the SF3B1 locus (“Loss-2").
- HeLa cell nuclear extracts (“Hela NE) in the absence of presence of ATP were used as controls.
- Figure 19C is a graph showing densitometric quantification of 17S U2 snRNP bands in Figure 19B, presented as fold change relative to the control Cal51 cells. Data are from three replicate experiments.
- Figure 20 is a diagram showing a model for changes to U2 snRNP assembly associated with SF3B1 copy-loss.
- Figure 21A is an immunoblot showing input for glycerol gradient fractionation of lysates of breast cancer cell lines (SF3Bl neutral : “Cal51”, “Hs578T”; SF3Bl loss : “BT549”, “HCC1954") without and with Dox-induced SF3B1 suppression.
- Figure 2 IB is an immunoblot showing fraction 25 (protein complexes >650 kDa) from glycerol gradient fractionation of ly sates of breast cancer cell lines (SF3Bl neutral : “Cal51”, “Hs578T”; SF3Bl loss : “BT549”, “HCC1954") without and with Dox-induced F3B1 suppression.
- Figure 22A is an immunoblot showing input for gel filtration chromatography of ly sates of breast cancer cell lines (SF3Bl neutral : “Cal51”; SF3Bl loss : “HCC1954") without and with Dox- induced SF3B1 suppression.
- Figure 22B is an immunoblot showing fractions 18-26 (protein complexes >650kDa) from gel filtration chromatography of ly sates of breast cancer cell lines (SF3Bl neutral : "Cal51”; SF3Bl l0SS : "HCC1954") without and with Dox-induced SF3B1 suppression.
- Figure 22C is a silver stain of gel filtration inputs for Figure 22B.
- Figure 23 is a graph showing quantification of U2 snRNA expression in breast cancer cell lines (SF3Bl neutral : “Cal51”, “Hs578T”; SF3Bl loss : “BT549”, “HCC1954") without ("- Dox,” left bar for each cell line) or with ("+ Dox,” right bar for each cell line) Dox-induced F3B1 suppression by quantitative RT-PCR.
- Figure 24 is an immunoblot of pooled glycerol gradient fractions 4-6 (protein complexes -150-450 kDa) from lysates of breast cancer cell lines (SF3Bl neutral : “Cal51”, “Hs578T”; SF3Bl l0SS : “BT549”, “HCC1954") without and with Dox-induced SF3B1 suppression.
- Figure 25 is an immunoblot of glycerol gradient fractions 3-6 from SF3Bl neutral cells ("Cal51”, “Hs578T”) and SF3Bl loss cells ("HCC1954") without and with Dox-induced SF3B1 suppression.
- Figure 26A is a series of graphs showing drug sensitivity curves for indicated splicing inhibitors ("NSC-95397”, “pladienolide B”, “spliceostatin A”) in cells (“Hs578T”, “Cal51”) without and with SF3B1 suppression.
- Figure 26B is an immunoblot from cells used in Figure 26A.
- Figure 27A is a graph showing relative levels of SF3B1 expression (assessed by qPCR; y- axis) in SF3Bl neutral (left) or SF3Bl loss (right) cells without doxycycline (origins of arrows) or with doxycycline (ends of arrows), wherein the cells were used in the RNA sequencing analysis as described in Figure 28. Origins with multiple arrows represent cell lines subject to more than one SF3B1 shRNA. Each data point represents the mean from at least two replicate experiments.
- Figure 27B is a graph showing relative levels of SF3B1 expression in CRISPR neutral 1 and CRISPR frameshift"l0SS presented as described in Figure 27A.
- Figure 28A is a graph showing statistical significance of intron retention across all exon- intron junctions (dots) in SF3Bl neutral (left) and SF3Bl loss cells (right) after SF3B1 suppression.
- the horizontal dashed line represents the significance threshold (q ⁇ 0.01) and the vertical dashed line segregates intron-exon junctions more likely to be altered in SF3Bl neutral or SF3Bl l0SS cells.
- Figure 28C is a graph showing statistical significance of alternative 3' splice site selection across 3' splice junctions (dots) in SF3Bl neutral (left) and SF3Bl loss cells (right) after SF3B1 suppression.
- the horizontal dashed line represents the significance threshold (q ⁇ 0.01) and the vertical dashed line segregates 3' splicing more likely to be altered in SF3Bl neutral or SF3Bl l0SS cells.
- Figure 29A is a diagram showing a method for measuring intron retention. Arrowheads indicate primer locations used in Figure 29B. Numbers represent exons of indicated genes.
- Figure 29B is an image of DNA electrophoresis following RT-PCR for RPS18 and CALR in cells (SF3Bl neutral : “Cal51”, “Hs578T”; SF3Bl loss : “HCC1954", "BT549") without and with shSF3Bl induction by doxycycline. Arrows indicate PCR products corresponding to retained introns.
- Figure 30A is an image of DNA electrophoresis following a representative RT-PCR from SF3B 1 neutrai ( « Cal51 » ) md SF 3 B l loss ("HCC 1954") cells after SF3B1 knockdown, "c” represents LacZ control hairpins, “sh” represents shSF3Bl#4 hairpins. Arrows represent product sizes for MCL-L and MCL-S.
- Figure 30B is a graph showing densitometric quantification of the ratio of MCL1-S:MCL1-L in cells expressing shSF3Bl (right bar for SF3Bl neutral cells and for SF3Bl loss cells) relative to shLacZ-expressing controls (left bar for SF3Bl neutral cells and for SF3Bl loss cells) (mean +/- SD from three biological replicates of at least 3 cell lines per group).
- Figure 31B is a series of graphs showing quantification of number of nuclear speckles (upper) and speckle area (lower) per cell across at least 100 nuclei in cells without ("- Dox,” left bar for each cell line) or with ("+ Dox,” right bar for each cell line) shSF3Bl induction by doxycycline.
- Figure 32 is a diagram depicting a number of differentially expressed genes upon SF3B1 suppression (q ⁇ 0.1) and the number of enriched KEGG pathways amongst indicated gene set (q ⁇ 0.05).
- Figure 33 is a heatmap of False Discovery Rate q-values indicating the significance of associations between copy numbers of SF3b complex members (rows) and sensitivity of those cells to suppression of SF3b complex members by shRNA (columns).
- Figure 34 is a graph showing luminescent quantification of xenograft growth from
- Figure 35A is a graph showing luminescent quantification of xenograft growth from
- Figure 35B is a series of photographs of animals overlaid with heat maps from
- Dashed circle represents region where established tumor was detected prior to doxycycline treatment.
- Figure 35C is a series of representative Ki67 immunohistochemistry images of xenografts.
- Figure 37 is an immunoblot showing SF3B1 expression in Cal51 cells treated with de- ubiquitinase (DUB) inhibitors ("PR-619", “b-AP15", “SJB3-019A”) for 4 or 24 hours.
- DRB de- ubiquitinase
- the present disclosure identifies SF3B1 as a CYCLOPS gene, wherein the copy- number of SF3B1 is associated with the dependency of cell growth on the remaining expression of SF3B1. Cancer cells that have lost at least one copy of SF3B1 from the genome are more sensitive to SF3B1 suppression than cells having the normal complement of SF3B1 copies. While suppression of SF3B1 in SF3B1 copy-loss cells can reduce the amount of SF3B1 below the threshold level for maintaining cell proliferation, two copies of SF3B1 in a normal cell's genome provide an excess reservoir to render the cells insensitive to SF3B1 suppression.
- SF3B1 suppression in SF3B1 copy-loss cells substantially decreases levels of U2 snRNP precursor and leads to spicing defects.
- Tumors from SF3B1 copy -loss genetic backgrounds regress or grow more slowly when SF3B1 is suppressed in a xenograft model in mice.
- the copy number SF3B1 is measured in a tumor for diagnosis and therapy selection.
- a tumor with SF3B1 copy loss is predicted to be sensitive to an SF3B1 suppression treatment.
- non-tumorous cells with both copies of SF3B1 intact are more resistant to SF3B1 suppression, thereby providing a therapeutic window to selectively suppress the tumor.
- an SF3B1 suppression treatment is not selected for treating a tumor without SF3B1 copy loss because these tumor cells have a larger reservoir of SF3B1 and are thus not as sensitive to SF3B1 suppression.
- the expression level of SF3B1 is measured in a tumor for diagnosis and therapy selection.
- a tumor with lower SF3B1 expression level is predicted to be sensitive to an SF3B1 suppression treatment.
- non- tumorous cells, to which the SF3B1 expression level in the tumor may be compared are more resistant to SF3B1 suppression, thereby providing a therapeutic window to selectively suppress the tumor.
- the differential expression of SF3B1 in tumor cells may be caused by various reasons, such as epigenetic alteration, genetic alteration of one or more factors that regulates SF3B1 expression, alteration of the expression of one or more factors that regulates SF3B1 expression.
- an SF3B1 suppression treatment is not selected for treating a tumor without lower SF3B1 expression level because these tumor cells have a larger reservoir of SF3B1 and are thus not as sensitive to SF3B1 suppression.
- SF3B1 suppression is provided as a treatment for cancer. In one embodiment, this treatment is provided if the cancer is diagnosed to have an SF3B1 copy loss. In another embodiment, this treatment is provided if the cancer is diagnosed to have a lower SF3B1 expression.
- SF3B1 suppression is provided by reducing the effective amount of SF3B1 mRNA or protein.
- the effective amount of SF3B1 mRNA is the amount of SF3B1 mRNA or a functional form thereof.
- a functional form of SF3B1 mRNA encompasses, but is not limited to, mature SF3B1 mRNA, SF3B1 mRNA under active translation, SF3B1 mRNA in the cytosol, SF3B1 mRNA in a polysome, SF3B1 mRNA not bound by an siRNA, shRNA or microRNA.
- the effective amount of SF3B1 protein is the amount of SF3B1 protein or a functional form thereof.
- a functional form of SF3B1 protein encompasses, but is not limited to, SF3B1 protein in a cell nucleus, SF3B1 protein in a nuclear speckle, SF3B1 protein in an SF3B complex, SF3B1 protein in a U2 snRNP, SF3B1 protein having a post-translational modification that correlates with the activity of a complex comprising SF3B1.
- a subject encompasses, but is not limited to, a mammal, e.g. a human, a domestic animal or a livestock including a cat, a dog, a cattle and a horse.
- An SF3B1 suppression treatment encompasses, but is not limited to, (1) a treatment that reduces the amount of SF3B1 mRNA or a functional form thereof by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%, (2) a treatment that reduces the amount of SF3B1 protein or a functional form thereof by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%, and (3) a treatment that reduces the activity of a complex comprising SF3B1 by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%.
- a functional form of SF3B1 mRNA encompasses, but is not limited to, mature SF3B1 mRNA, SF3B1 mRNA under active translation, SF3B1 mRNA in the cytosol, SF3B1 mRNA in a polysome, SF3B1 mRNA not bound by an siRNA, shRNA or microRNA.
- a functional form of SF3B1 protein encompasses, but is not limited to, mature SF3B1 mRNA, SF3B1 mRNA under active translation, SF3B1 mRNA in the cytosol, SF3B1 mRNA in a polysome, SF3B1 mRNA not bound by an siRNA, shRNA or microRNA.
- a complex comprising SF3B1 encompasses, but is not limited to, monomeric SF3B1, an SF3B complex, a 15S U2 snRNP complex, a 17S U2 snRNP complex, and poly comb repressor complex.
- Copy number of SF3B1 encompasses, but is not limited to, the numbers of copies of SF3B1 in the genome of a cell, tissue, or organ. In most somatic cells of a diploid subject, the copy number of SF3B1 is 2.
- Measuring the copy number of SF3B1 encompasses, but is not limited to, measuring the copy number of SF3B1 by a laboratory method, and obtaining data from an agency that examines the copy number of SF3B1.
- the laboratory method of measurement encompasses, but is not limited to, comparative genomic hybridization (CGH), fluorescence in situ hybridization (FISH), DNA amplification and DNA sequencing.
- a sample comprising cells encompasses, but is not limited to, a sample comprising cells from a tumor lesion, a sample from a cancer draining lymph node, a body fluid such as blood, serum, plasma, urine, semen, lymph, and peritoneal fluid.
- the ploidy of the cells in the sample refers to the number of sets of chromosomes of the cells in the sample. In some embodiments, the cells have aneuploidy and "the ploidy” refers to the number of sets of at least 50%, 60%, 70%, 80%, 90% or 95% of all
- the ploidy is measured by a cytogenetic method, such as karyotyping and fluorescence in situ hybridization (FISH). In one embodiment, the ploidy of the cells is 2.
- “Smaller than the ploidy of the cells” encompasses, but is not limited to, at least 1%, 5%, 10%, 20%, 30%, 40% or 50% smaller than the ploidy of the cells.
- Breast cancer is a tumor and/or a cancer that originate from a cell of the breast.
- Breast cancer Common types include but are not limited to ductal carcinoma, lobular carcinoma, tubular carcinoma, medullary carcinoma, mucinous carcinoma, papillary carcinoma, cribriform carcinoma, sarcoma, inflammatory breast cancer, male breast cancer, Paget's disease of the breast, phyllodes tumor.
- Breast cancer herein also includes primary, recurrent and metastatic breast cancer.
- Hematopoietic cancer is a tumor and/or cancer that originate in a hematopoietic tissue. Hematopoietic tissues include but are not limited to lymphoid and myeloid tissues. Examples of lymphoid cancers include acute lymphocytic leukemia (ALL), Hodgkin's lymphoma, and non-Hodgkin's lymphoma. ALL includes but is not limited to T cell ALL, pro-B cell ALL, pre-B cell ALL, and naive B cell ALL.
- ALL acute lymphocytic leukemia
- ALL Hodgkin's lymphoma
- non-Hodgkin's lymphoma non-Hodgkin's lymphoma.
- ALL includes but is not limited to T cell ALL, pro-B cell ALL, pre-B cell ALL, and naive B cell ALL.
- Non-Hodgkin's lymphoma includes but is not limited to follicular lymphoma (FL), chronic lymphocytic leukemia (CLL), Burkitt's Lymphoma, diffuse large B cell lymphoma (DLBCL), and mantle cell lymphoma (MCL).
- myeloid cancers include acute myeloid leukemias (AML), acute monocytic leukemia (AMoL), myelodysplastic syndromes (MDS), chronic myeloid leukemia (CML) and other myeloproliferative diseases (e.g., osteomyelofibrosis, polycythemia vera and essential thrombocythemia).
- AML acute myeloid leukemias
- AoL acute monocytic leukemia
- MDS myelodysplastic syndromes
- CML chronic myeloid leukemia
- Hematopoietic cancer herein also includes primary, recurrent and metastatic hematopoietic cancer
- Bladder cancer is a tumor and/or cancer that originate from a bladder cell. It encompasses, but is not limited to, superficial bladder cancer (often urothelial carcinoma), muscle invasive bladder cancer, small cell carcinoma, squamous carcinoma, adenocarcinoma, and leiomyosarcoma. "Bladder cancer” herein also includes primary, recurrent and metastatic bladder cancer.
- Kiddney cancer is a tumor and/or cancer that originate in the kidney. It encompasses, but is not limited to, renal cell carcinoma, transitional cell cancer, nephroblastoma, renal sarcoma, and benign kidney tumors (e.g. renal adenoma, oncocytoma, angiomyolipoma).
- a cancerous lesion encompasses, but is not limited to, a tissue, organ or structure where cancer locates. It may be at a primary site or a metastatic site.
- “Circulating tumor cells” encompass, but are not limited to, cells with a tumor origin in the circulating blood stream. In certain embodiments, the circulating tumor cells are enriched from the blood.
- CGH Combinative genomic hybridization
- FISH Fluorescence in situ hybridization
- a FISH probe herein for measuring the copy number of SF3B1 encompasses, but is not limited to, a nucleic acid conjugated to a fluorescent moiety capable of hybridizing to SEQ ID NO. 1 or a genomic sequence within 5 kb, 10 kb, 20 kb, 50 kb or 100 kb away from either terminus of the genomic location of SEQ ID NO. 1.
- a genomic sequence comprising at least 20 nucleotides of SF3B1 encompasses, but is not limited to, (1) a polynucleotide comprising at least 20 nucleotides from SEQ ID NO. 1 or a genomic sequence within 5 kb, 10 kb, 20 kb, 50 kb or 100 kb away from either terminus of the genomic location of SEQ ID NO. 1, and (2) a sequence complementary to the polynucleotide of (1).
- “Amplifying a genomic sequence” encompasses, but is not limited to, amplifying a target genomic sequence by polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- a probe conjugated to a detectable moiety that hybridizes to the amplified sequence is included in the PCR reaction for quantification of the target genomic sequence.
- Whole-exome sequencing encompasses, but is not limited to, sequencing of all protein coding genes in a genome. In one aspect, quantitative information is obtained from the sequencing.
- the sample is heterogeneous means the sample contains cells that are not identical in genetic, epigenetic and/or gene expression status. In one aspect, the sample contains cells from different cell types or origins. In one aspect, the sample contains tumor cells and non- tumor cells. In one aspect, the sample comprises tumor cells wherein some, but not all, of the tumor cells harbor a mutation (e.g. a copy number variation, a transcriptional or epigenetic alteration).
- a mutation e.g. a copy number variation, a transcriptional or epigenetic alteration
- Average copy number of a gene in a heterogeneous sample is the average number of copies of the gene. In one aspect, it is measured by CGH directly. In another aspect, copy numbers of the gene in individual cells are measured by FISH and the average copy number is calculated therefrom.
- “Expression level of SF3B1” encompasses, but is not limited to, the amount of SF3B1 mRNA or a functional form thereof, and the amount of SF3B1 protein or a functional form thereof.
- a functional form of SF3B1 mRNA encompasses, but is not limited to, mature SF3B1 mRNA, SF3B1 mRNA under active translation, SF3B1 mRNA in the cytosol, SF3B1 mRNA in a polysome, SF3B1 mRNA not bound by an siRNA, shRNA or microRNA.
- a functional form of SF3B1 protein encompasses, but is not limited to, SF3B1 protein in a cell nucleus, SF3B1 protein in a nuclear speckle, SF3B1 protein in an SF3B complex, SF3B1 protein in a U2 snRNP, SF3B1 protein having a post-translational modification that correlates with the activity of a complex comprising SF3B1.
- a control sample encompasses, but is not limited to, a normal tissue, a tumor known to have 2 copies of SF3B1 genomic DNA, and a cell known to have 2 copies of SF3B1 genomic DNA, wherein the cell may be a primary cell or an immortalized cell.
- the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample means the amount of SF3B1 mRNA or a functional form thereof, or an SF3B1 protein or a functional form thereof is lower than 95%, 90%, 80%, 70%, 60%, 50%, 40%, or 30% of the corresponding expression level of SF3B1 in the control sample.
- RNA sequencing encompasses, but is not limited to, sequencing of at least one RNA molecule, and sequencing of at least one nucleic acid molecule that is synthesized to be complementary to at least one RNA molecule, wherein the at least one nucleic acid molecule includes, but is not limited to, at least one DNA molecule. In one aspect, quantitative information is obtained from the sequencing.
- “Whole-transcriptome sequencing” encompasses, but is not limited to, RNA sequencing of all detectable RNA molecules, all detectable messenger RNA molecules, all detectable pre-messenger RNA molecules, all detectable small RNA molecules, and a combination thereof.
- Immunohistochemistry encompasses, but is not limited to, a process of detecting an antigen (e.g. SF3B1) in cells of a tissue section using an antibody capable of binding to the antigen (e.g. SF3B1).
- an antigen e.g. SF3B1
- an antibody capable of binding to the antigen e.g. SF3B1.
- an antibody that is capable of binding to SF3B1 encompasses, but is not limited to, an anti-SF3Bl antiserum, an anti-SF3Bl polyclonal antibody, an anti-SF3Bl monoclonal antibody, an antigen-binding fragment of an anti-SF3Bl antibody, a protein comprising a heavy chain variable domain that binds to SF3B1, a protein comprising a light chain variable domain that binds to SF3B1, and a protein that binds to SF3B1 with a Kd lower than about 1 x 10 "6 M (e.g, 1 x 10 "7 M, 1 x 10 "8 M, 1 x 10 "9 M, 1 x 10 "10 M, 1 x 10 "11 M, 1 x 10 "12 M, or lower).
- 1 x 10 "6 M e.g, 1 x 10 "7 M, 1 x 10 "8 M, 1 x 10 "9 M, 1 x 10 "10 M, 1 x
- Quantitative mass spectrometry is an analytical chemistry technique for determining the amount of one or more proteins in a sample by mass spectrometry.
- One or more processes for protein purification, enrichment and/or separation may precede the mass spectrometry step.
- RNA interference encompasses, but is not limited to, reducing the amount or activity of a first messenger RNA (mRNA) molecule by introducing a second RNA molecule that hybridizes to the first mRNA, or by introducing a DNA molecule that is transcribed and/or processed into the second RNA.
- the activity of a messenger RNA hereby refers to the efficiency that the messenger RNA is translated into a polypeptide.
- RNA interference technologies include, but are not limited to, microRNA, small interfering RNA (siRNA) and small hairpin RNA (shRNA).
- Transcription cofactors that control SF3B1 transcription encompasses, but is not limited to, histone binding proteins such as BET bromodomain proteins (BRD1-4), and histone modifying enzymes such as histone deacetylases, histone methylases and histone kinases.
- the transcription cofactor can be inhibited, e.g. , by suppressing its expression and/or activity, thereby reducing the activity of the transcription cofactor and SF3B1 transcription.
- SF3B1 protein degradation encompasses, but is not limited to, proteolysis of SF3B1 and depletion of SF3B1 from a cellular compartment where the protein is assembled into a complex or exerts its function.
- Proteolysis of SF3B1 includes but is not limited to direct protein cleavage by a protease, ubiquitin-mediated proteolysis by the proteasome, and autophagy -mediated proteolysis in the lysosome (e.g. through macro-autophagy, through chaperone-mediated autophagy).
- Depletion of SF3B1 from a cellular compartment includes but is not limited to translocation of SF3B1 to a different cellular or extracellular compartment.
- “Inhibiting the activity of one or more deubiquitinating enzymes” encompasses, but is not limited to, reducing the amount and/or activity of at least one deubiquitinating enzymes, which leads to increased ubiquitination of an SF3B1 protein and increased degradation of the protein.
- Reducing the activity of SF3B1 protein encompasses, but is not limited to, reducing the activity of a complex comprising SF3B1 by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%.
- Subunits of the SF3B complex encompass, but are not limited to, SF3B1, SF3B2, SF3B3, SF3B4, SF3B5 (SF3B10), SF3B14 (SF3B14a), PHF5A (SF3B14b), DDX42, and a pre-mRNA.
- “Inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex” encompasses, but is not limited to, inhibiting the physical binding between SF3B1 protein and one or more subunits of the SF3B1 complex, and inhibiting the expression of one or more subunits of the SF3B1 complex.
- the physical binding is inhibited by a chemical compound, a peptide, a modified peptide or a protein that interferes with protein-protein binding in the SF3B complex.
- the physical binding is inhibited by an RNA molecule, a modified RNA molecule, a chemical compound (e.g.
- the expression of one or more subunits of the SF3B1 complex is inhibited at the transcriptional, translational, or post-translational (e.g. protein modification, protein degradation) level.
- “Inhibiting the interaction between the SF3B complex and 15S U2 snRNP” can be achieved by preventing the protein: protein binding interactions between SF3B complex members and 15S U2 snRNP during U2 snRNP assembly. It also can be achieved by preventing the protein:RNA binding interactions between SF3b complex and the U2 snRNA (another component of the U2 snRNP). Agents that inhibit the interactions include, but are not limited to, small molecule compounds, peptides, nucleic acids, and a combination or conjugate thereof.
- Tuor load encompasses, but is not limited to, the number of cancer cells, the size of a tumor, and/or the amount of cancer in the subject. The tumor load may be determined by measuring the tumor size or by measuring a tumor marker or antigen.
- Treatment-free survival encompasses, but is not limited to, the length of time during and after the treatment of a disease, such as cancer, that a patient lives with the disease but it does not get worse.
- “Overall survival” encompasses, but is not limited to, the length of time from either the date of diagnosis or the start of treatment for a disease, such as cancer, that patients diagnosed with the disease are still alive.
- Example 1 SF3B1 was frequently lost in cancer.
- the TCGA PanCan dataset was analyzed to search for cancer-associated genes. It was found that SF3B1 was partially lost in 11% of the 10,570 cancers from more than 30 tumor types. Losses were most frequent in invasive breast adenocarcinoma (20%), urothelial bladder carcinoma (32%) and chromophobe kidney carcinoma (71%).
- Examples of types of cancer wherein an SF3B1 copy loss was identified included, acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and para
- Genomic deletions of SF3B1 usually affected most of the chromosome arm (81% of losses) and were never homozygous (0/10,570 cancers), consistent with characterization of SF3B1 as an essential gene. In contrast, 85% of genes were homozygously deleted at least once. Similarly, analysis of copy number alterations from 1042 cancer cell lines in the CCLE indicated 24% of cell lines harbor hemizygous SF3B1 deletion, including 16/61 (26%) of breast cancer cell lines, but never homozygous loss (0/1042 cell lines).
- Example 2 SF3B1 suppression led to growth defect of cells with SF3B1 copy-loss.
- CYCLOPS CYCLOPS genes were identified using a bioinformatics approach. These genes underwent partial copy loss in cancer, and cells with copy loss of a CYCLOPS gene were more sensitive to suppression of the gene than cells without copy loss.
- SF3B1 was among the most significant candidate genes in our CYCLOPS analysis.
- Cells without SF3B1 copy loss (SF3Bl neutral cells) including Cal 51, HMC 1-8 and Hs578T, and cells with SF3B1 copy loss (SF3Bl l0SS cells) including HCC1954, BT549 and T47D were obtained. BT549 and T47D have a ploidy of -3.2, while the average copy number of SF3B1 in these cells is about 2.
- SF3Bl l0SS cells underwent significantly slower growth than SF3Bl neutral cells ( Figure 1A).
- the vulnerability of the SF3Bl loss cells to SF3B1 suppression was confirmed using a GFP-competition assay in which the proliferation rate of uninfected cells co-cultured with cells infected with a vector that co-expressed GFP and an shRNA targeting either LacZ or SF3B1 was compared.
- the expression of LacZ or SF3B1 shRNAs did not result in significant changes in proliferation of SF3Bl neutral cells in seven cell lines.
- SF3Bl loss cells expressing SF3B1 shRNAs did not survive in long-term culture ( Figures 2A, 2B).
- SF3Bl neutral cells and SF3Bl loss cells express hairpins targeting Luciferase or SF3B1 upon doxycycline treatment. Consistent with stable SF3B1 knockdown, inducible SF3B1 knockdown inhibits the growth of SF3Bl loss cells but not SF3Bl neutral cells ( Figures 3A, 3B, 3C).
- Example 3 SF3B1 suppression led to cell cycle arrest and cell death of cells with SF3B1 copy loss.
- SF3Bl loss cells had significantly increased proportions of cells in G2/M phase after SF3B1 knockdown, which did not occur in SF3B 1 neutrai cellg ( Figure 4A )
- SF3Bl loss cells exhibited a significant induction in cell death following SF3B1 knockdown. They underwent apoptosis as determined by increased number of AnnexinV-positive/propidium iodide (Pl)-positive cells and AnnexinV-positive/PI-negative cells, which did not occur in SF3Bl neutral cells ( Figure 4B).
- the fraction of viable cells significantly decreases only in SF3Bl loss cells expressing SF3B1 shRNA (“shSF3Bl”), not in SF3Bl neutral cells expressing SF3B1 shRNA (“shSF3Bl”) or SF3Bl l0SS cells expressing LacZ shRNA (“shLacZ”) ( Figure 4C).
- Example 4 Complementation of SF3B1 expression rescued the growth of SF3Bl loss cells with SF3B1 suppression.
- a lenti viral construct was used to confirm the specificity of the SF3B1 -targeting shRNAs.
- the construct expressed a codon-optimized SF3B1 ORF, which is resistant to shRNA suppression, fused to an IRES GFP sequence (SF3B1WT-IRES-GFP).
- the expression level of SF3B1WT-IRES-GFP did not change during Dox induction of SF3B1 shRNA in SF3Bl neutral cells, but increased by over 20 fold in SF3Bl loss cells upon Dox- induced expression of SF3B1 shRNA (Figure 5A).
- SF3B1-IRES-GFP was more highly expressed in SF3Bl loss cells after SF3B1 knockdown than in SF3Bl neutral cells.
- SF3B1WT-IRES-GFP maintained constant ratios over 10 days ( Figure 5B), suggesting that short-term expression of SF3B1 does not alter cellular fitness in either SF3Bl neutral or SF3Bl loss cells.
- endogenous SF3B1 was knocked down in all cells and expressed SF3B 1 WT-IRES-GFP in -50% of cells.
- SF3Bl loss cells expressing an SF3B1 shRNA failed to survive in long-term culture.
- SF3Bl loss cells expressing both an SF3B1 shRNA and SF3B1WT-IRES-GFP persisted in long-term culture ( Figure 5C), indicating that complementary expression of SF3B1 was sufficient to prevent cell death.
- Example 5 SF3Bl neutral cells contained excess SF3B1 beyond the requirement for survival.
- SF3B1 expression was suppressed using shRNAs with different potency to generate a range of SF3B1 suppression in SF3Bl neutral and SF3Bl loss cells. Although similar reductions in
- SF3B1 expression were obtained in SF3Bl neutral and SF3Bl loss lines, the elevated basal levels of SF3B1 expression in SF3 B 1 neutral Hnes enabled them to retain su ff lc i e nt SF3B1 for proliferation despite shRNA expression.
- Example 6 SF3B1 copy-loss selectively reduced the abundance of the SF3b complex.
- SF3B1 is a component of the seven-member SF3b sub-complex of the U2 snRNP.
- Example 7 SF3B1 suppression selectively reduced U2 snRNP abundance in SF3Bl loss cells.
- DUB inhibitors may be capable of killing
- Example 8 SF3B1 suppression resulted in splicing defects in SF3Blloss cells.
- SF3B1 is well-established as a splicing factor, as demonstrated by intron retention upon treatment of cells with SF3B1 inhibitors and in patients harboring SF3B1 mutations.
- RNA sequencing was performed to quantify the extent of splicing disruption upon SF3B1 suppression in SF3Bl neutral and SF3Bl loss cells ( Figures 27A, 27B), and juncBase and a novel statistical framework were used to analyze 50,600 splice junctions for intron retention from the RNA sequencing data. All cells showed evidence of increased intron retention following SF3B1 suppression (p ⁇ 10 "5 ), but splicing was significantly more affected in SF3Bl loss cells.
- Spliceosome components including SF3B1 are thought to assemble and function in sub-nuclear compartments known as nuclear speckles. Inhibition of splicing or transcription has been shown to induce formation of enlarged 'mega-speckles'.
- SF3Bl neutral cells did not display chan ges in SC-35 speckles after SF3B1 suppression, but SF3Bl loss nuclei contained significantly fewer speckles and increased speckle area ( Figures 31A, 31B).
- the presence of defective alternative splicing, intron retention and formation of mega-speckles uniquely in SF3Bl loss cells after SF3B1 suppression further supported the gross defects in splicing observed by RNA sequencing.
- Example 9 Suppression of other SF3B complex subunits did not lead to increased vulnerability of SF3Bl loss cells.
- SF3b subunits Six of seven SF3b subunits were analyzed (SF3B1, SF3B3-5, SF3B14 and PHF5A), and no associations between susceptibility to suppression of any of these genes and copy numbers of other SF3b subunits including SF3B1 was observed.
- Example 10 Suppression of SF3B1 reduces tumor growth in SF3Bl loss xenografts.
- RNA sequencing data were downloaded from the GTEX database
- RNAs targeting the first constitutively expressed coding exon of SF3B1 were designed with the aid of a web-based application (http://crispr.mit.edu/).
- Sense and anti-sense oligonucelotides were annealed and cloned into Bbsl site of pX458 (Addgene) and verified by Sanger sequencing.
- Single GFP+ cells were sorted by FACS and plated at low density for single cell cloning.
- CRISPR neutral 1 cells were processed identically, but did not have inactivating SF3B1 mutations.
- Oligonucleotide sequences for C RISPR frameshift"loss were as follows: 5'-
- pX458 was transfected with LipoD293 (SignaGen) into the diploid breast cancer cell line, Cal51.
- 19 monoclonal cell lines were genotyped for Cas-9 induced mutations by Sanger sequencing cloned PCR products. All monocolonal lines had either no mutations or harbored biallelic mutations in SF3B1.
- the genotypes of the Cal51 CRISPR cell lines used from this method of generation were:
- CRISPR copy loss cells
- a Cas9 construct co-expressing two sgRNAs and GFP was used to delete a 57 kb region encoding SF3B1.
- the guide RNA targeting the 5' upstream of SF3B1 used a mismatch from a heterozygous SNP (rs3849362) in Cal51 to bias towards mono-allelic deletion of SF3B1.
- Single GFP+ cells were plated as described above and expanded. One of these was validated by PCR to harbor a 57 kb deletion encoding SF3B1. This was designated “CRISPR copy” oss " for subsequent experiments. Another one of these was found by PCR not to harbor this deletion and was designated as the control cell line for subsequent experiments ("CRISPR neutral 2 ").
- cR!SpRframeshift-ioss in pX45 g BbgI overhangs ) xhe sequ ences are as follows : For the 5 ' guide targeting SNP, 5 '-CACCGCGCATTATAGATTATGGCCC (forward) and 5'- AAAC GGGCC ATAATCT AT AATGC GC (reverse). For the 3' targeting guide: 5'- CACCGCGGAGTTTCATCCGTTACAC (forward), 5'- AA AC GTGT A AC GGATGA A AC TC C GC (reverse) were used.
- Human cancer cell lines were maintained in RPMI-1640 supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin and were assayed to be free of
- Non-transformed MCF10A and HMEC cells were cultured in Mammary Epithelial Growth Medium (CC-3150, Lonza).
- Mammary Epithelial Growth Medium CC-3150, Lonza.
- tetracycline-regulated shRNAs tetracycline-approved fetal bovine serum (Clonetech) was used.
- Sense and anti-sense oligonucleotides were annealed and cloned into the Agel and EcoRI restriction sites of the pLKO-Tet-puro vector (Addgene, plasmid #21915).
- the oligonucleotide sequences were: shRNA Sequence
- LacZ (anti-sense) AATTCAAAAAATGTTCGCATTATCCGAACCATCTCGAGATGG
- TR-shSF3Bl#3 CCGGCAACTCCTTATGGTATCGAATCTCGAGATTCGATACC (sense) ATAAGGAGTTGTTTTTG (SEQ ID NO: 12)
- TR-shSF3Bl#3 AATTCAAAAAACAACTCCTTATGGTATCGAATCTCGAGATTC (anti-sense) GAT AC C AT AAGGAGTTG (SEQ ID NO: 13)
- TR-shSF3Bl#5 CCGGCCTCGATTCTACAGGTTATTACTCGAGTAATAACCTG (sense) TAGAATCGAGGTTTTTG (SEQ ID NO: 14)
- TR-shSF3Bl#5 AATTCAAAAAACCTCGATTCTACAGGTTATTACTCGAGTAAT (anti-sense) AACCTGTAGAATCGAGG (SEQ ID NO: 15)
- Cells were plated in 96 well plates at 1000 cells per well. Cell number was inferred by ATPdependent luminescence by Cell Titer Glo (Promega) and normalized to the relative luminescence on the day of plating. For short-term lentiviral infections, cells were infected 24 hours prior to plating.
- Oligonucleotides encoding LacZ or SF3B1 shRNA#4 hairpin sequences were annealed and cloned into the pLKO. l derivative vector TRC047 (pLK0.3pgw) and verified by Sanger sequencing. Cells were infected with serial dilutions of virus to achieve -50%
- GFP-positive cells Cells with approximately equivalent ratios of GFP-positive -and negative cells were assayed by flow cytometry 3 days post infection and at subsequent time-points. The fold change in GFP+ cells was normalized to the percentage present 3 days after infection.
- expression of a human codon-optimized SF3B1 by lentivirus was utilized. Cells were infected as described above and treated with doxycycline two days after infection.
- Cells were treated with either short-term lentiviral infection or tetracycline-inducible SF3B1 shRNAs. After treatment, cells were trypsinized and pelleted including any cells in suspension. Cells were resuspended in propidium iodide viability staining solution (lx PBS, 1% BSA, 2.5 ug/mL propidium iodide) and quantified by live-cell flow cytometry. The change in viability was normalized to the percent of viable cells quantified on the first day of the assay.
- propidium iodide viability staining solution lx PBS, 1% BSA, 2.5 ug/mL propidium iodide
- Cellular apoptosis was quantified by live-cell flow cytometry using Alexa-Fluor 488 conjugated Annexin-V (Life Technologies) and propidium iodide.
- Cells were incubated in Annexin binding buffer containing propidium iodide (10 mM Hepes, 140 mM NaCl, 2.5 mM CaC12, 2.5 ug/mL propdium iodide) for 15 min, washed and resuspended in FACS buffer (lx PBS, 1% BSA and 50 mM EDTA).
- Determination of the stage of apoptosis by gating was as follows: viable cells (Annexin-V -/PI-), early apoptosis (Annexin-V +/PI-), late apoptosis (Annexin-V+/PI+), and dead cells (Annexin-V -/PI+).
- Glycerol gradient sedimentation was performed as previously described (Klaus Hartmuth, 2012) with slight modifications for use with whole-cell lysates. Briefly, 10-30% glycerol gradients were formed by layering 10% glycerol gradient buffer (20 mM Hepes- KOH (pH 7.9), 150 mM NaCl, 1.5 mM MgC12 10% glycerol) on top of a 30% glycerol buffer with identical salt concentrations. Gradients were formed using a Gradient Station (Biocomp Instruments). Cells were lysed in "IP lysis buffer" (50mM Tris, 150 mM NaCl and 1% Triton X-100). 400 uL containing 1-3 mg of crude lysate was loaded per gradient in
- Sephacryl S-500 (17-0613-05, GE Healthcare) columns were packed into a 50 x 1.5 cm column and equilibrated with column buffer (10 mM Tris, 60 mM KC1, 25 mM EDTA, 1% Triton X-100 and 0.1% sodium azide).
- Whole-cell lysates were collected in IP lysis buffer as described above and incubated with 0.5 mM ATP, 3.2 mM MgC12 and 20 mM creatine phosphate (di-Tris salt) for 20 min at 30C to dissociate multi-snRNP spliceosomal complexes. 2 mL of lysate containing 5 mg of protein was loaded on columns and 90 1.5 mL fractions were collected overnight at 4C.
- lx RIPA buffer lOmM Tris-Cl Ph 8.0, 1 mM EDTA, 1% Triton X-100, 0.1% SDS and 140 mM NaCl
- Lysates were sonicated in a bioruptor (Diagenode) for 5 minutes (medium intensity) and cleared by centrifugation at 15000 x g for 15 min at 4C. Proteins were electrophoresed on polyacrylamide gradient gels (Life Technologies) and detected by chemiluminescence.
- RNA was extracted using the RNeasy extraction kit (Qiagen) and subjected to on- column DNase treatment.
- cDNA was synthesized with the Superscript II Reverse
- SF3B1 qPCR primer sequences (forward) 5'-ccaaagattgcagaccggga-3' (SEQ ID NO: 24), (reverse) 5'-tcaggggttttcctccatc-3' (SEQ ID NO: 25). These primers detect all three splicing variants of SF3B1 (SEQ ID NOs: 2-4). Library preparation and RNA-sequencing
- FASTQ files were aligned using TOPHAT vl .4 with parameters "--mateinner-dist 300—mate-std-dev 500 ⁇ no-sort-bam ⁇ no-convert-bam -p 4".
- juncBase was used to identify read counts at splice junctions.
- the spliced in/spliced out counts at each junction were used to create an estimate of the risk of retaining an intron for each cell line.
- the distribution of this statistic was calculated for each cell line in each condition (with and without SF3B1 suppression) using a beta binomial distribution in which spliced in and spliced out read counts were the a and ⁇ terms, respectively.
- the distribution over relative risk of intron retention upon SF3B1 suppression was calculated as follows. For every quintile of the beta binomial distribution for the SF3B1 suppressed state, the ratio of the two beta-binomial distributions for each cell line was calculated. The posterior distributions over the relative risk of intron retention were combined for cell lines of the same genotype (i.e. SF3Bl neutral or SF3Bl loss ) by obtaining the product of their distributions. P-values were obtained by calculating the overlap in the distributions over the relative risk of intron retention in each of the genotypes.
- Cells were plated on 35 mm glass bottom dishes with #1.5 cover glass (D35-14-1.5-N, In Vitro Scientific). Cells were fixed and stained with anti-SC-35 antibody (S4045, Sigma- Aldrich) at 1 : 1000 dilution and detected with Alexafluor488 secondary antibody at 1 : 1000 (Life Technologies). Nuclei were counterstained with Hoescht dye. Monochromatic images were captured under identical conditions and pseudo-colored using Photoshop. A custom image analysis pipeline was empirically adapted from a preexisting pipeline designed for detecting H2AX foci using CellProfiler (Kamentsky et al, 2011). Measurements of nuclear speckles were generated from at least 15 random microscopic fields. A minimum of 100 nuclei identified by CellProfiler were used for quantitation per treatment.
- Relative copy number and ATARiS gene dependency scores were determined after knockdown of each SF3b complex member across the same 179 cell lines used in the
- CYCLOPS analysis Linear regression analysis was performed for copy number of each SF3b complex gene with knockdown of every SF3b component. One-sided p-values were calculated for association of sensitivity to suppression with gene loss for all intra-SF3b complex comparisons. Samples were excluded if they harbored co-deletion of the two genes used to generate the correlation.
- a custom image analysis pipeline was used to systematically quantify Ki67+ cells from tumor xenografts using CellProfilier.
- SEQ ID NO: 1 - human SF3B1 genomic sequence (NG_032903.2 nucleotide 4955..48074) SEQ ID NO: 2 - human SF3B1 mRNA sequence, transcript variant 1 (NM_012433.3) SEQ ID NO: 3 - human SF3B1 mRNA sequence, transcript variant 2 (NM_001005526.2) SEQ ID NO: 4 - human SF3B1 mRNA sequence, transcript variant 3 (NM_001308824.1) SEQ ID NO: 5 - human SF3B1 protein sequence, isoform 1 (NP_036565.2)
- SEQ ID NO: 6 human SF3B1 protein sequence, isoform 2 (NP_001005526.1)
- SEQ ID NO: 8 target sequence of TR-shSF3Bl#3 on human SF3B1 mRNA
- SEQ ID NO: 24 forward primer for amplifying human SF3B1 mRNA or cDNA ccaaagattgcagaccggga
- SEQ ID NO: 25 reverse primer for amplifying human SF3B1 mRNA or cDNA tcaggggttttccctccatc
Landscapes
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medical Informatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Data Mining & Analysis (AREA)
- Theoretical Computer Science (AREA)
- Public Health (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Biomedical Technology (AREA)
- Databases & Information Systems (AREA)
- Evolutionary Biology (AREA)
- General Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Primary Health Care (AREA)
- Mathematical Analysis (AREA)
- Mathematical Physics (AREA)
- Pure & Applied Mathematics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Epidemiology (AREA)
- Computational Mathematics (AREA)
- Mathematical Optimization (AREA)
- Hospice & Palliative Care (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
Abstract
The present invention provides an association between copy loss of SF3B1 in cancer and sensitivity to SF3B1 suppression. Cancer cells harboring partial SF3B1 copy-loss are more sensitive because they lack a reservoir of SF3b complex that protects cells with normal SF3B1 copy number from cell death upon SF3B1 suppression. The invention also provides methods for treating cancer, especially cancer with SF3B1 copy loss, by suppressing the expression or activity of SF3B1.
Description
SF3B1 SUPPRESSION AS A THERAPY FOR TUMORS HARBORING
SF3B1 COPY LOSS
RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No.: 62/319,490, filed April 7, 2016, which is incorporated by reference herein in its entirety.
GOVERNMENT RIGHTS This invention was made with government support under grant numbers R01
CAl 88228, F32 CAl 80653 and F30 CA192725 awarded by the National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND
Genomic instability is a hallmark of cancer resulting in widespread somatic copy number alterations (SCNAs), which affect large fractions of the genome. SCNA-related dependencies can be categorized into four classes. First, cells may be dependent upon amplified genes, as has been noted with several amplified oncogenes. Second, cells may be dependent on genes that have undergone partial copy loss. This "CYCLOPS" (Copy -number alterations Yielding Cancer Liabilities Owing to Partial losS) phenotype has been validated for three genes: PSMC2, POLR2A, and CSNKIAI. Third, copy gain may be associated with dependencies on genes outside the amplicon. Fourth, copy loss may be associated with dependencies on genes outside the deletion, as has been described for pairs of paralogs such as ENOl and EN02. The relative frequency of each of the four classes and their general features is largely unknown.
The present invention used a genome-scale shRNA viability screen to perform an unbiased analysis of copy-number associated gene-dependency interactions. Among all copy- number associated dependencies, the most highly enriched subclass were "CYCLOPS" genes, whose hemizygous loss sensitizes cells to their further suppression. The invention identified a splicing factor SF3B1 as a CYCLOPS gene and revealed the underlying mechanism.
SUMMARY
The present disclosure provides a method for determining the likelihood that a subject
with cancer responds to an SF3B1 suppression treatment, comprising measuring the copy number of SF3B1 in a sample comprising cells from the subject, wherein the likelihood is increased if the copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample.
In some embodiments, the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer. In some embodiments, the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma,
cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
In some embodiments, the sample comprises a cancerous lesion. In some
embodiments, the sample comprises circulating tumor cells.
In some embodiments, measuring the copy number of SF3B1 comprises comparative genomic hybridization (CGH). In some embodiments, measuring the copy number of SF3B1 comprises fluorescence in situ hybridization (FISH). In some embodiments, measuring the copy number of SF3B1 comprises amplifying a genomic sequence comprising at least 20 nucleotides of SF3B1.
In some embodiments, measuring the copy number of SF3B1 comprises DNA sequencing. In one embodiment, DNA sequencing comprises whole-genome sequencing. In another embodiment, DNA sequencing comprises whole-exome sequencing.
In some embodiments, the copy number of SF3B1 in the sample is an average copy number if the sample is heterogeneous. In some embodiments, the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the average copy number of SF3B1 in the sample from the subject is at least smaller than the ploidy of the cells in the sample by at least 25%.
In some embodiments, the subjected is treated with an SF3B1 suppression treatment if the likelihood that the subject response is increased.
The present disclosure also provides a method for determining the likelihood that a subject with cancer responds to an SF3B1 suppression treatment, comprising measuring expression level of SF3B1 in a sample from the subject and comparing the measured expression level of SF3B1 in the sample from the subject to the expression level of SF3B1 in a control sample, wherein the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample.
In some embodiments, the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer. In some embodiments, the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma,
cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
In some embodiments, the sample comprises a cancerous lesion. In some
embodiments, the sample comprises circulating tumor cells. In some embodiments, the control sample comprises one or more samples selected from the group consisting of a normal tissue, a tumor known to have the same ploidy as the sample from the subject, and a cell known to have the same ploidy as the sample from the subject.
In some embodiments, the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample by at least 25%.
In some embodiments, the expression level of SF3B1 in the sample from the subject is an mRNA level. In some embodiments, the SF3B1 mRNA level in the sample from the subject is measured by a method comprising quantitative PCR. In some embodiments, the
SF3B1 mRNA level in the sample from the subject is measured by a method comprising RNA sequencing. In one embodiment, the RNA sequencing comprises whole-transcriptome sequencing.
In some embodiments, the expression level of SF3B1 in the sample from the subject is a protein level. In one embodiment, the protein level of SF3B1 in the sample from the subject is measured by a method comprising immunohistochemistry. In another embodiment, the protein level of SF3B1 in the sample from the subject is measured by a method comprising enzyme-linked immunosorbent assay (ELISA). In yet another embodiment, the protein level of SF3B1 in the sample from the subject is measured by a method comprising quantitative mass spectrometry.
In some embodiments, the subject is treated with an SF3B1 suppression treatment if the likelihood that the subject response is increased.
In some embodiments, the SF3B1 suppression treatment comprises reducing the amount of SF3B1 mRNA. In one embodiment, reducing the amount of SF3B1 mRNA comprises RNA interference. In a specific embodiment, the RNA interference targets one or more of the sequences selected from SEQ ID NOs 8, 9, 16, 17, 18 and 19. In another embodiment, reducing the amount of SF3B1 mRNA comprises inhibiting one or more transcription cofactors that control SF3B1 transcription. In a specific embodiment, the one or more transcription cofactors that control SF3B1 transcription comprise bromodomain containing 1 (BRD1), bromodomain containing 2 (BRD2), bromodomain containing 3 (BRD3), bromodomain containing 4 (BRD4), or a combination thereof.
In some embodiments, the SF3B1 suppression treatment comprises reducing the amount or activity of SF3B1 protein. In one embodiment, reducing the amount of SF3B1 protein comprises increasing the rate of SF3B1 protein degradation. In a specific
embodiment, increasing the rate of SF3B1 protein degradation comprises inhibiting the activity of one or more deubiquitinating enzymes. In another embodiment, reducing the activity of SF3B1 protein comprises inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex. In a specific embodiment, reducing the activity of SF3B1 protein comprises inhibiting the interaction between the SF3B complex and 15S U2 snRNP or 17S U2 snRNP. In another embodiment, reducing the activity of SF3B1 protein comprises inhibiting the incorporation of SF3B1 into 15S U2 snRNP or 17S U2 snRNP.
In some embodiments, the response to an SF3B1 suppression treatment comprises a reduced tumor load, a longer progression-free survival, a longer overall survival, or a combination thereof.
The present disclosure also provides a method for treating a subject with cancer, comprising providing an SF3B1 suppression treatment, thereby treating the cancer in the subject.
In addition, the present disclosure provides a method for treating a subject with cancer, comprising measuring the copy number of SF3B1 in a sample comprising cells from the subject and providing an SF3B1 suppression treatment if the copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample, thereby treating the cancer in the subject.
In some embodiments, the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer. In some embodiments, the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
In some embodiments, the sample comprises a cancerous lesion. In some
embodiments, the sample comprises circulating tumor cells.
In some embodiments, measuring the copy number of SF3B1 comprises comparative genomic hybridization (CGH). In some embodiments, measuring the copy number of SF3B1 comprises fluorescence in situ hybridization (FISH). In some embodiments, measuring the copy number of SF3B1 comprises amplifying a genomic sequence comprising at least 20 nucleotides of SF3B1.
In some embodiments, measuring the copy number of SF3B1 comprises DNA sequencing. In one embodiment, DNA sequencing comprises whole-genome sequencing. In another embodiment, DNA sequencing comprises whole-exome sequencing.
In some embodiments, the copy number of SF3B1 in the sample is an average copy number if the sample is heterogeneous. In some embodiments, an SF3B1 suppression
treatment is provided to the subject if the average copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample by at least 25%.
The present disclosure also provides a method for treating a subject with cancer, comprising measuring expression level of SF3B1 in a sample from the subject, comparing the measured expression level of SF3B1 in the sample from the subject to the expression level of SF3B1 in a control sample, and providing an SF3B1 suppression treatment if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample, thereby treating the cancer in the subject.
In some embodiments, the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer. In some embodiments, the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
In some embodiments, the sample comprises a cancerous lesion. In some
embodiments, the sample comprises circulating tumor cells. In some embodiments, the control sample comprises one or more samples selected from the group consisting of a normal tissue, a tumor known to have the same ploidy as the sample from the subject, and a cell known to have the same ploidy as the sample from the subject. In some embodiments, an SF3B1 suppression treatment is provided to the subject if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample by at least 25%.
In some embodiments, the expression level of SF3B1 in the sample from the subject is an mRNA level. In one embodiment, the SF3B1 mRNA level in the sample from the subject is measured by a method comprising quantitative PCR. In another embodiment, the SF3B1 mRNA level in the sample from the subject is measured by a method comprising
RNA sequencing. In a specific embodiment, the RNA sequencing comprises whole- transcriptome sequencing.
In some embodiments, the expression level of SF3B1 in the sample from the subject is a protein level. In one embodiment, the protein level of SF3B1 in the sample from the subject is measured by a method comprising immunohistochemistry. In another embodiment, the protein level of SF3B1 in the sample from the subject is measured by a method comprising enzyme-linked immunosorbent assay (ELISA). In yet another embodiment, the protein level of SF3B1 in the sample from the subject is measured by a method comprising quantitative mass spectrometry.
In some embodiments, the SF3B1 suppression treatment comprises reducing the amount of SF3B1 mRNA. In one embodiment, reducing the amount of SF3B1 mRNA comprises RNA interference. In a specific embodiment, the RNA interference targets one or more of the sequences selected from SEQ ID NOs 8, 9, 16, 17, 18 and 19. In another embodiment, reducing the amount of SF3B1 mRNA comprises inhibiting one or more transcription cofactors that control SF3B1 transcription. In a specific embodiment, the one or more transcription cofactors that control SF3B1 transcription comprise bromodomain containing 1 (BRDl), bromodomain containing 2 (BRD2), bromodomain containing 3 (BRD3), bromodomain containing 4 (BRD4), or a combination thereof.
In some embodiments, the SF3B1 suppression treatment comprises reducing the expression or activity of SF3B1 protein. In one embodiment, reducing the amount of SF3B1 protein comprises increasing the rate of SF3B1 protein degradation. In a specific
embodiment, increasing the rate of SF3B1 protein degradation comprises inhibiting the activity of one or more deubiquitinating enzymes. In another embodiment, reducing the activity of SF3B1 protein comprises inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex. In another embodiment, reducing the activity of SF3B1 protein comprises inhibiting the interaction between the SF3B complex and 15S U2 snRNP. In yet another embodiment, reducing the activity of SF3B1 protein comprises inhibiting the incorporation of SF3B1 into 15S U2 snRNP or 17S U2 snRNP.
The present disclosure also provides a kit comprising a reagent for reverse transcription of an RNA molecule, two or more primers, wherein a first primer comprises a polynucleotide comprising SEQ ID NO: 24, and a second primer comprises a polynucleotide comprising SEQ ID NO: 25, and a reagent for amplification of a DNA sequence.
In addition, the present disclosure provides a kit comprising an antibody that is capable of binding SF3B1 and a reagent for the detection of the antibody.
BRIEF DESCRIPTION OF DRAWINGS
Figure 1A is a series of graphs showing growth of breast cancer cell lines (SF3Blneutral: "Cal 51", "HMC 1-8", "Hs578T", "Cal51 CRISPRneutral", SF3Blloss: "HCC1954", "BT549", "T47D", "Cal51 CRISPRframeshift"loss"), expressing shRNAs targeting lacZ ("shLacZ") or SF3B1 ("shSF3Bl #3", "shSF3Bl #4") measured as changes in CellTiterGlo luminescence relative to one day post-infection.
Figure IB is a graph showing quantification of SF3B1 expression from the indicated cell lines ("HMC 1-8", "Cal-51", "Hs578T", "MCF7", "MCF10A", "HMEC", "HCC1954", "T47D", "BT549", "SKBR3") expressing shRNAs targeting lacZ ("shLacZ," left bar for each cell line) or SF3B1 ("shSF3Bl #3," middle bar for each cell line; or "shSF3Bl #4," right bar for each cell line) by quantitative RT-PCR.
Figure 1C is a graph showing relative growth of Cal 51 CRISPRcopy"loss cells and Cal 51 CRISPRneutral 2 cells after treatment with siRNAs targeting LacZ ("siLacZ") or SF3B1 ("siSF3Bl #3").
Figure 2A is a graph showing ratio of cells expressing an SF3B1 shRNA coupled with GFP ("shSF3Bl-GFP+") relative to uninfected controls, normalized to the ratio of cells expressing an LacZ shRNA coupled with GFP ("shLacZ-GFP+") relative to uninfected controls.
Figure 2B is a series of graphs showing ratio of cells expressing an LacZ shRNA coupled with GFP ("shLacZ-GFP") or an SF3B1 shRNA coupled with GFP ("shSF3Bl#4-GFP") to uninfected controls in SF3Blneutral and SF3Blloss breast cell lines (SF3Blneutral: "HMC 1-8", "Cal51", "Hs578T", "MCF10A"; SF3Blloss: "HCC1954", "T47D", "BT549", SKBR3") and hematopoetic cell lines (SF3Blneutral: "Raji", "Jurkat", "HT"; SF3Blloss: "Toledo", "Hut78"). Figure 3A is a graph showing viability of cells ("SF3Blneutral", "SF3Blloss") expressing doxycycline (Dox)-activated SF3B1 shRNAs (TR-shSF3Bl#3 and TR-shSF3Bl#5), cultured in the presence ("+ Dox") or absence ("- Dox") of doxycycline, relative to viability three days post Dox treatment.
Figure 3B is a series of graphs showing quantification of SF3B1 expression without ("- Dox," left bar for each cell line) or with ("+ Dox," right bar for each cell line) Dox-induced shSF3Bl ("TR-shSF3Bl #3", "TR-shSF3Bl #5") expression by quantitative RT-PCR.
Figure 3C is a series of graphs showing growth of breast cancer cell lines without ("- Dox") or with ("+ Dox") Dox-induced SF3B1 shRNAs ("TR-shSF3Bl#3", "TR-shSF3Bl#5") expression, measured as changes in CellTiterGlo luminescence relative to day 1 of Dox treatment.
Figure 4A is a series of graphs showing cell cycle distribution in SF3Blneu ra and SF3B1 oss cells incubated for four days without ("- Dox," left bar for each cell line) or with ("+ Dox," right bar for each cell line) Dox-induced expression of shSF3Bl .
Figure 4B is a series of graphs showing the fraction of apoptotic cells five days after incubation without ("- Dox," left bar for each cell line) or with ("+ Dox," right bar for each cell line) Dox-induced expression of shSF3Bl, as determined by Annexin V/prodium iodide flow cytometry.
Figure 4C is a graph showing viability of cells expressing shRNAs targeting LacZ
("shLacZ") or SF3B1 ("TR-shSF3Bl": an average of replicates performed using independent shRNAs "shSF3Bl #3" and "shSF3Bl #4"), measured as fractions of cells excluding propidium iodide, relative to viability of these cells four days post infection.
Figure 5A is a series of graphs showing quantification of GFP fluorescence from cells expressing SF3B1-IRES-GFP without ("-dox," left four bars in each panel) or with ("+dox," right four bars in each panel) Dox-induced SF3B1 shRNA expression.
Figure 5B is a graph showing ratio of cells expressing SF3B1-GFP ("+SF3B1") relative to uninfected ("control") SF3Blneutral cells ("Cal51") and SF3Blloss cells ("HCC1954").
Figure 5C is a graph showing ratio of cells expressing SF3B1-GFP ("+SF3B1") relative to uninfected SF3Blneutral cells ("Cal51") and SF3Blloss cells ("HCC1954") expressing an shRNA targeting SF3B1 ("shSF3Bl").
Figure 6A is an immunoblot of SF3B1 from HCC1954 cells expressing LacZ or SF3B1. Figure 6B is a graph showing growth of SF3Blloss cells expressing LacZ or SF3B1 upon Dox-induced expression of SF3B1 shRNA ("TR shSF3Bl#5"), measured as changes in CellTiter-Glo luminescence.
Figure 7A is a graph showing SF3B1 expression from 777 TCGA breast adenocarcinomas segregated by SF3B1 copy number. Whiskers represent min/max values and boxes represent upper and lower quartile ranges. Width of plots represents relative sample density.
Figure 7B is a graph showing SF3B1 expression from 974 cell lines from the Cancer Cell
Line Encyclopedia (CCLE) classified by SF3B1 copy -number status. Boxes represent the upper and lower quartiles, and whiskers represent the 5-95th percentiles. *p<0.0001.
Figure 8A is a graph showing SF3B1 expression in SF3Blneutral and SF3Blloss breast cancer cell lines measured by quantitative RT-PCR. Data points represent individual cell lines, and horizontal lines indicate means.
Figure 8B is a graph showing SF3B1 mRNA expression from control cells and those with CRISPR-induced copy-loss.
Figure 9A is an immunoblot showing SF3B1 protein levels in breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T", "MCF7"; SF3Blloss: "BT549", "HCC1954", "ZR-75-30"). Figure 9B is an immunoblot showing SF3B1 expression from control Cal51 cells ("control- 1" and "control-2"), Cal51 cells containing a frameshift mutation inactivating one SF3B1 allele ("Loss-1"), and Cal51 cells having deletion of one copy of the SF3B1 locus ("Loss-2"). The Loss-1 and Loss-2 cells were generated by CRISPR technology.
Figure 9C is a scatterplot of SF3B1 mRNA and protein expression relative to diploid cell line Cal51 after normalization to actin in a panel of breast cancer cell lines (p=0.0018, R2 = 0.772, regression line slope = 0.789).
Figure 10 is an immunoblot of SF3Blneutral cells ("Cal51", "Hs578T", "MCF7") and SF3Bll0SS cells ("BT549", "HCC1954") without and with Dox-induced expression of shSF3Bl#5.
Figure 11 is a graph showing differences in proliferation (measured by CellTiter-Glo;
red=high, blue=low) against relative level of SF3B1 expression (assessed by qPCR; y-axis) in F3B ineutral and SF3Blloss cells expressing either shLacZ (origins of arrows) or shSF3Bl (ends of arrows). Origins with multiple arrows represent cell lines subject to more than one SF3B1 shRNA. Each data point represents the mean from at least two replicate experiments. The dashed line represents the estimated minimum threshold of SF3B1 expression required for survival.
Figure 12 is a diagram of U2 snRNP assembly.
Figure 13A is a graph showing sedimentation of mass standards in 10-30% glycerol gradients.
Figure 13B is a graph showing elution profiles of mass standards in gel filtration
chromatography columns.
Figure 14A is an immunoblot showing input for glycerol gradient fractionation of native whole-cell lysates of breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T"; SF3Blloss: "BT549", "HCC1954").
Figure 14B is an immunoblot showing fractions from glycerol gradient fractionation of native whole-cell lysates of breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T";
SF3Bll0SS: "BT549", "HCC1954").
Figure 15A is an immunoblot showing input for glycerol gradient fractionation of native whole-cell lysates of isogenic cells generated by CRISPR ("neutral#l", "frameshift-loss").
Figure 15B is an immunoblot showing fractions from glycerol gradient fractionation of native whole-cell lysates of isogenic cells generated by CRISPR ("neutral#l", "frameshift- loss").
Figure 15C is a graph showing quantification of SF3B1 from immunoblots of samples from glycerol gradient fractions 3-8, relative to fraction 3 (n = 3 for each group).
Figure 16A is an immunoblot showing the amount of SF3B1 in pooled glycerol gradient fractions ("4-6", "12-14", "25") of breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T"; SF3Bll0SS: "BT549", "HCC1954") in serial dilution.
Figure 16B is an immunoblot of indicated gel filtration fractions. GAPDH and SNRPB2 represent markers for complexes <700 kDa and spliceosome precursors respectively.
Figure 17A is (left) an immunoblot showing SF3B1 Native PAGE of pooled glycerol gradient fractions 4-6 and (right) a denaturing silver stain of total protein from the same pooled fractions as loading control.
Figure 17B is an immunoblot after SF3B1 immunoprecipitation from pooled glycerol gradient fractions 4-6.
Figure 18 is an immunoblot after SF3B1 immunoprecipitation from pooled glycerol gradient fractions 24-25.
Figure 19A is a quantification of U2 snRNA expression in three SF3Blneutral and three SF3Bll0SS breast cancer cell lines quantitative RT-PCR. ns=not significant.
Figure 19B is a representative radiologic image of a native agarose gel of U2 snRNP complexes visualized with radiolabeled 2' O-methyl oligonucleotides complementary to the U2 snRNA. Nuclear extracts were generated from control Cal51 cells ("control-1" and "control-2"), Cal51 cells containing a frameshift mutation inactivating one SF3B1 allele ("Loss-1"), and Cal51 cells having deletion of one copy of the SF3B1 locus ("Loss-2"). HeLa cell nuclear extracts ("Hela NE") in the absence of presence of ATP were used as controls.
Figure 19C is a graph showing densitometric quantification of 17S U2 snRNP bands in Figure 19B, presented as fold change relative to the control Cal51 cells. Data are from three replicate experiments.
Figure 20 is a diagram showing a model for changes to U2 snRNP assembly associated with SF3B1 copy-loss.
Figure 21A is an immunoblot showing input for glycerol gradient fractionation of lysates of breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T"; SF3Blloss: "BT549", "HCC1954") without and with Dox-induced SF3B1 suppression.
Figure 2 IB is an immunoblot showing fraction 25 (protein complexes >650 kDa) from glycerol gradient fractionation of ly sates of breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T"; SF3Blloss: "BT549", "HCC1954") without and with Dox-induced F3B1 suppression.
Figure 22A is an immunoblot showing input for gel filtration chromatography of ly sates of breast cancer cell lines (SF3Blneutral: "Cal51"; SF3Blloss: "HCC1954") without and with Dox- induced SF3B1 suppression.
Figure 22B is an immunoblot showing fractions 18-26 (protein complexes >650kDa) from gel filtration chromatography of ly sates of breast cancer cell lines (SF3Blneutral: "Cal51"; SF3Bll0SS: "HCC1954") without and with Dox-induced SF3B1 suppression.
Figure 22C is a silver stain of gel filtration inputs for Figure 22B.
Figure 23 is a graph showing quantification of U2 snRNA expression in breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T"; SF3Blloss: "BT549", "HCC1954") without ("- Dox," left bar for each cell line) or with ("+ Dox," right bar for each cell line) Dox-induced F3B1 suppression by quantitative RT-PCR.
Figure 24 is an immunoblot of pooled glycerol gradient fractions 4-6 (protein complexes -150-450 kDa) from lysates of breast cancer cell lines (SF3Blneutral: "Cal51", "Hs578T"; SF3Bll0SS: "BT549", "HCC1954") without and with Dox-induced SF3B1 suppression.
Figure 25 is an immunoblot of glycerol gradient fractions 3-6 from SF3Blneutral cells ("Cal51", "Hs578T") and SF3Blloss cells ("HCC1954") without and with Dox-induced SF3B1 suppression.
Figure 26A is a series of graphs showing drug sensitivity curves for indicated splicing inhibitors ("NSC-95397", "pladienolide B", "spliceostatin A") in cells ("Hs578T", "Cal51") without and with SF3B1 suppression.
Figure 26B is an immunoblot from cells used in Figure 26A.
Figure 27A is a graph showing relative levels of SF3B1 expression (assessed by qPCR; y- axis) in SF3Blneutral (left) or SF3Blloss (right) cells without doxycycline (origins of arrows) or with doxycycline (ends of arrows), wherein the cells were used in the RNA sequencing analysis as described in Figure 28. Origins with multiple arrows represent cell lines subject to more than one SF3B1 shRNA. Each data point represents the mean from at least two replicate experiments.
Figure 27B is a graph showing relative levels of SF3B1 expression in CRISPRneutral 1 and CRISPRframeshift"l0SS presented as described in Figure 27A.
Figure 28A is a graph showing statistical significance of intron retention across all exon- intron junctions (dots) in SF3Blneutral (left) and SF3Blloss cells (right) after SF3B1 suppression. The horizontal dashed line represents the significance threshold (q<0.01) and the vertical dashed line segregates intron-exon junctions more likely to be altered in SF3Blneutral or SF3Bll0SS cells.
Figure 28B is a graph showing qPCR for a single intron within the indicated genes (" AARS," "CalR," "DNAJB1," "MKNK2," "MYH9," "RPS8," and "RPS18") without ("- Dox," left bar for each cell line) or with ("+ Dox," right bar for each cell line) shSF3Bl induction by doxycycline (SF3Blneutral n = 3, SF3Blloss n = 3, averaged from TR-shSF3Bl#3 and
TRshSF3Bl#5.
Figure 28C is a graph showing statistical significance of alternative 3' splice site selection across 3' splice junctions (dots) in SF3Blneutral (left) and SF3Blloss cells (right) after SF3B1 suppression. The horizontal dashed line represents the significance threshold (q<0.01) and the vertical dashed line segregates 3' splicing more likely to be altered in SF3Blneutral or SF3Bll0SS cells.
Figure 29A is a diagram showing a method for measuring intron retention. Arrowheads indicate primer locations used in Figure 29B. Numbers represent exons of indicated genes. Figure 29B is an image of DNA electrophoresis following RT-PCR for RPS18 and CALR in cells (SF3Blneutral: "Cal51", "Hs578T"; SF3Blloss: "HCC1954", "BT549") without and with shSF3Bl induction by doxycycline. Arrows indicate PCR products corresponding to retained introns.
Figure 30A is an image of DNA electrophoresis following a representative RT-PCR from SF3B 1neutrai ( « Cal51 ») md SF3Blloss ("HCC 1954") cells after SF3B1 knockdown, "c" represents LacZ control hairpins, "sh" represents shSF3Bl#4 hairpins. Arrows represent product sizes for MCL-L and MCL-S.
Figure 30B is a graph showing densitometric quantification of the ratio of MCL1-S:MCL1-L in cells expressing shSF3Bl (right bar for SF3Blneutral cells and for SF3Blloss cells) relative to shLacZ-expressing controls (left bar for SF3Blneutral cells and for SF3Blloss cells) (mean +/- SD from three biological replicates of at least 3 cell lines per group).
Figure 31A is a series of immunofluorescent images of nuclear speckles by anti-SC35 (SRSF2) staining. Scale bar = 5 uM.
Figure 31B is a series of graphs showing quantification of number of nuclear speckles (upper) and speckle area (lower) per cell across at least 100 nuclei in cells without ("- Dox,"
left bar for each cell line) or with ("+ Dox," right bar for each cell line) shSF3Bl induction by doxycycline.
Figure 32 is a diagram depicting a number of differentially expressed genes upon SF3B1 suppression (q<0.1) and the number of enriched KEGG pathways amongst indicated gene set (q<0.05).
Figure 33 is a heatmap of False Discovery Rate q-values indicating the significance of associations between copy numbers of SF3b complex members (rows) and sensitivity of those cells to suppression of SF3b complex members by shRNA (columns).
Figure 34 is a graph showing luminescent quantification of xenograft growth from
CRISPRneutral 1 and CRISPRframeshift"loss tumors without doxycycline administration to the mice (n=4).
Figure 35A is a graph showing luminescent quantification of xenograft growth from
CRISPRneutral 1 and CRlSPRframeshift"loss tumors with doxycycline administration to the mice (n=17).
Figure 35B is a series of photographs of animals overlaid with heat maps from
bioluminescent tumor detection. Dashed circle represents region where established tumor was detected prior to doxycycline treatment.
Figure 35C is a series of representative Ki67 immunohistochemistry images of xenografts. Figure 35D is a graph showing quantification of Ki67+ cells from xenografts in Figure 35C using CellProfiler. The bars on the left represent the ratio of Ki67+ cells in the xenograft from CRISPRneutral 1 tumors, and the bars on the right represent the ratio of Ki67+ cells in the xenograft from CRlSPRframeshift"loss tumors. A minimum of 2,440 nuclei were scored for each tumor, >= 3 tumors per group.
Figure 35E is a graph showing quantification of SF3B1 expression from xenograft tumors without ("- Dox," bars on the left for each cell line) or with ("+ Dox," bars on the right for each cell line) doxycycline-induced shSF3Bl expression (n>= 4 for each group) by quantitative RT-PCR.
Figure 36A is a graph showing growth of established tumors for Cal51 xenografts without doxycycline ("-Dox", n = 13) or with doxycycline ("+Dox", n = 12) using TR-shSF3Bl #3. Figure 36B is a graph showing growth of established tumors for HCC1954 xenografts without doxycycline ("-Dox", n = 13) or with doxycycline ("+Dox", n = 12) using TR- shSF3Bl #3. ***p<0.001.
Figure 37 is an immunoblot showing SF3B1 expression in Cal51 cells treated with de- ubiquitinase (DUB) inhibitors ("PR-619", "b-AP15", "SJB3-019A") for 4 or 24 hours.
For all figures, *p<0.05, **p<0.01, ***p<0.001 unless otherwise indicated, and error bars represent +/- standard deviation.
DETAILED DESCRIPTION
The present disclosure identifies SF3B1 as a CYCLOPS gene, wherein the copy- number of SF3B1 is associated with the dependency of cell growth on the remaining expression of SF3B1. Cancer cells that have lost at least one copy of SF3B1 from the genome are more sensitive to SF3B1 suppression than cells having the normal complement of SF3B1 copies. While suppression of SF3B1 in SF3B1 copy-loss cells can reduce the amount of SF3B1 below the threshold level for maintaining cell proliferation, two copies of SF3B1 in a normal cell's genome provide an excess reservoir to render the cells insensitive to SF3B1 suppression. SF3B1 suppression in SF3B1 copy-loss cells substantially decreases levels of U2 snRNP precursor and leads to spicing defects. Tumors from SF3B1 copy -loss genetic backgrounds regress or grow more slowly when SF3B1 is suppressed in a xenograft model in mice.
In certain embodiments, the copy number SF3B1 is measured in a tumor for diagnosis and therapy selection. In one embodiment, a tumor with SF3B1 copy loss is predicted to be sensitive to an SF3B1 suppression treatment. At the same time, non-tumorous cells with both copies of SF3B1 intact are more resistant to SF3B1 suppression, thereby providing a therapeutic window to selectively suppress the tumor. In another embodiment, an SF3B1 suppression treatment is not selected for treating a tumor without SF3B1 copy loss because these tumor cells have a larger reservoir of SF3B1 and are thus not as sensitive to SF3B1 suppression.
In certain embodiments, the expression level of SF3B1 is measured in a tumor for diagnosis and therapy selection. In one embodiment, a tumor with lower SF3B1 expression level is predicted to be sensitive to an SF3B1 suppression treatment. At the same time, non- tumorous cells, to which the SF3B1 expression level in the tumor may be compared, are more resistant to SF3B1 suppression, thereby providing a therapeutic window to selectively suppress the tumor. The differential expression of SF3B1 in tumor cells may be caused by various reasons, such as epigenetic alteration, genetic alteration of one or more factors that regulates SF3B1 expression, alteration of the expression of one or more factors that regulates SF3B1 expression. In another embodiment, an SF3B1 suppression treatment is not selected
for treating a tumor without lower SF3B1 expression level because these tumor cells have a larger reservoir of SF3B1 and are thus not as sensitive to SF3B1 suppression.
In certain embodiments, SF3B1 suppression is provided as a treatment for cancer. In one embodiment, this treatment is provided if the cancer is diagnosed to have an SF3B1 copy loss. In another embodiment, this treatment is provided if the cancer is diagnosed to have a lower SF3B1 expression.
In certain embodiments, SF3B1 suppression is provided by reducing the effective amount of SF3B1 mRNA or protein. In one embodiment, the effective amount of SF3B1 mRNA is the amount of SF3B1 mRNA or a functional form thereof. A functional form of SF3B1 mRNA encompasses, but is not limited to, mature SF3B1 mRNA, SF3B1 mRNA under active translation, SF3B1 mRNA in the cytosol, SF3B1 mRNA in a polysome, SF3B1 mRNA not bound by an siRNA, shRNA or microRNA. In another embodiment, the effective amount of SF3B1 protein is the amount of SF3B1 protein or a functional form thereof. A functional form of SF3B1 protein encompasses, but is not limited to, SF3B1 protein in a cell nucleus, SF3B1 protein in a nuclear speckle, SF3B1 protein in an SF3B complex, SF3B1 protein in a U2 snRNP, SF3B1 protein having a post-translational modification that correlates with the activity of a complex comprising SF3B1.
As used herein, "a subject" encompasses, but is not limited to, a mammal, e.g. a human, a domestic animal or a livestock including a cat, a dog, a cattle and a horse.
"An SF3B1 suppression treatment" encompasses, but is not limited to, (1) a treatment that reduces the amount of SF3B1 mRNA or a functional form thereof by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%, (2) a treatment that reduces the amount of SF3B1 protein or a functional form thereof by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%, and (3) a treatment that reduces the activity of a complex comprising SF3B1 by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%. As used herein, a functional form of SF3B1 mRNA encompasses, but is not limited to, mature SF3B1 mRNA, SF3B1 mRNA under active translation, SF3B1 mRNA in the cytosol, SF3B1 mRNA in a polysome, SF3B1 mRNA not bound by an siRNA, shRNA or microRNA. A functional form of SF3B1 protein
encompasses, but is not limited to, SF3B1 protein in a cell nucleus, SF3B1 protein in a nuclear speckle, SF3B1 protein in an SF3B complex, SF3B1 protein in a U2 snRNP, SF3B1 protein having a post-translational modification that correlates with the activity of a complex comprising SF3B1. A complex comprising SF3B1 encompasses, but is not limited to, monomeric SF3B1, an SF3B complex, a 15S U2 snRNP complex, a 17S U2 snRNP complex, and poly comb repressor complex.
"Copy number of SF3B1" encompasses, but is not limited to, the numbers of copies of SF3B1 in the genome of a cell, tissue, or organ. In most somatic cells of a diploid subject, the copy number of SF3B1 is 2.
"Measuring the copy number of SF3B1" encompasses, but is not limited to, measuring the copy number of SF3B1 by a laboratory method, and obtaining data from an agency that examines the copy number of SF3B1. The laboratory method of measurement encompasses, but is not limited to, comparative genomic hybridization (CGH), fluorescence in situ hybridization (FISH), DNA amplification and DNA sequencing.
"A sample comprising cells" encompasses, but is not limited to, a sample comprising cells from a tumor lesion, a sample from a cancer draining lymph node, a body fluid such as blood, serum, plasma, urine, semen, lymph, and peritoneal fluid.
"The ploidy" of the cells in the sample refers to the number of sets of chromosomes of the cells in the sample. In some embodiments, the cells have aneuploidy and "the ploidy" refers to the number of sets of at least 50%, 60%, 70%, 80%, 90% or 95% of all
chromosomes in the organism from which the sample is obtained. In some embodiments, the ploidy is measured by a cytogenetic method, such as karyotyping and fluorescence in situ hybridization (FISH). In one embodiment, the ploidy of the cells is 2.
"Smaller than the ploidy of the cells" encompasses, but is not limited to, at least 1%, 5%, 10%, 20%, 30%, 40% or 50% smaller than the ploidy of the cells.
"Breast cancer" is a tumor and/or a cancer that originate from a cell of the breast.
Common types of breast cancer include but are not limited to ductal carcinoma, lobular carcinoma, tubular carcinoma, medullary carcinoma, mucinous carcinoma, papillary carcinoma, cribriform carcinoma, sarcoma, inflammatory breast cancer, male breast cancer, Paget's disease of the breast, phyllodes tumor. "Breast cancer" herein also includes primary, recurrent and metastatic breast cancer.
"Hematopoietic cancer" is a tumor and/or cancer that originate in a hematopoietic tissue. Hematopoietic tissues include but are not limited to lymphoid and myeloid tissues. Examples of lymphoid cancers include acute lymphocytic leukemia (ALL), Hodgkin's lymphoma, and non-Hodgkin's lymphoma. ALL includes but is not limited to T cell ALL, pro-B cell ALL, pre-B cell ALL, and naive B cell ALL. Non-Hodgkin's lymphoma includes but is not limited to follicular lymphoma (FL), chronic lymphocytic leukemia (CLL), Burkitt's Lymphoma, diffuse large B cell lymphoma (DLBCL), and mantle cell lymphoma (MCL). Examples of myeloid cancers include acute myeloid leukemias (AML), acute monocytic leukemia (AMoL), myelodysplastic syndromes (MDS), chronic myeloid leukemia
(CML) and other myeloproliferative diseases (e.g., osteomyelofibrosis, polycythemia vera and essential thrombocythemia). "Hematopoietic cancer" herein also includes primary, recurrent and metastatic hematopoietic cancer.
"Bladder cancer" is a tumor and/or cancer that originate from a bladder cell. It encompasses, but is not limited to, superficial bladder cancer (often urothelial carcinoma), muscle invasive bladder cancer, small cell carcinoma, squamous carcinoma, adenocarcinoma, and leiomyosarcoma. "Bladder cancer" herein also includes primary, recurrent and metastatic bladder cancer.
"Kidney cancer" is a tumor and/or cancer that originate in the kidney. It encompasses, but is not limited to, renal cell carcinoma, transitional cell cancer, nephroblastoma, renal sarcoma, and benign kidney tumors (e.g. renal adenoma, oncocytoma, angiomyolipoma).
"A cancerous lesion" encompasses, but is not limited to, a tissue, organ or structure where cancer locates. It may be at a primary site or a metastatic site.
"Circulating tumor cells" encompass, but are not limited to, cells with a tumor origin in the circulating blood stream. In certain embodiments, the circulating tumor cells are enriched from the blood.
"Comparative genomic hybridization (CGH)" encompasses, but is not limited to, a cytogenetic method for analyzing copy number variations relative to ploidy levels in a DNA sample by hybridizing sample DNA with probe DNA. Wherein the probe DNA molecules are provided in an array, CGH can be referred to as array CGH.
"Fluorescence in situ hybridization (FISH)" encompasses, but is not limited to, a cytogenetic technique for detecting and locating a DNA sequence of interest on a
chromosome, wherein at least one probe conjugated to a fluorescent moiety is hybridized to the DNA sequence of interest. A FISH probe herein for measuring the copy number of SF3B1 encompasses, but is not limited to, a nucleic acid conjugated to a fluorescent moiety capable of hybridizing to SEQ ID NO. 1 or a genomic sequence within 5 kb, 10 kb, 20 kb, 50 kb or 100 kb away from either terminus of the genomic location of SEQ ID NO. 1.
"A genomic sequence comprising at least 20 nucleotides of SF3B1" encompasses, but is not limited to, (1) a polynucleotide comprising at least 20 nucleotides from SEQ ID NO. 1 or a genomic sequence within 5 kb, 10 kb, 20 kb, 50 kb or 100 kb away from either terminus of the genomic location of SEQ ID NO. 1, and (2) a sequence complementary to the polynucleotide of (1).
"Amplifying a genomic sequence" encompasses, but is not limited to, amplifying a target genomic sequence by polymerase chain reaction (PCR). In one aspect, a probe
conjugated to a detectable moiety that hybridizes to the amplified sequence is included in the PCR reaction for quantification of the target genomic sequence.
"Whole-exome sequencing" encompasses, but is not limited to, sequencing of all protein coding genes in a genome. In one aspect, quantitative information is obtained from the sequencing.
"The sample is heterogeneous" means the sample contains cells that are not identical in genetic, epigenetic and/or gene expression status. In one aspect, the sample contains cells from different cell types or origins. In one aspect, the sample contains tumor cells and non- tumor cells. In one aspect, the sample comprises tumor cells wherein some, but not all, of the tumor cells harbor a mutation (e.g. a copy number variation, a transcriptional or epigenetic alteration).
"Average copy number" of a gene in a heterogeneous sample is the average number of copies of the gene. In one aspect, it is measured by CGH directly. In another aspect, copy numbers of the gene in individual cells are measured by FISH and the average copy number is calculated therefrom.
"Expression level of SF3B1" encompasses, but is not limited to, the amount of SF3B1 mRNA or a functional form thereof, and the amount of SF3B1 protein or a functional form thereof. A functional form of SF3B1 mRNA encompasses, but is not limited to, mature SF3B1 mRNA, SF3B1 mRNA under active translation, SF3B1 mRNA in the cytosol, SF3B1 mRNA in a polysome, SF3B1 mRNA not bound by an siRNA, shRNA or microRNA. A functional form of SF3B1 protein encompasses, but is not limited to, SF3B1 protein in a cell nucleus, SF3B1 protein in a nuclear speckle, SF3B1 protein in an SF3B complex, SF3B1 protein in a U2 snRNP, SF3B1 protein having a post-translational modification that correlates with the activity of a complex comprising SF3B1.
"A control sample" encompasses, but is not limited to, a normal tissue, a tumor known to have 2 copies of SF3B1 genomic DNA, and a cell known to have 2 copies of SF3B1 genomic DNA, wherein the cell may be a primary cell or an immortalized cell.
"The expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample" means the amount of SF3B1 mRNA or a functional form thereof, or an SF3B1 protein or a functional form thereof is lower than 95%, 90%, 80%, 70%, 60%, 50%, 40%, or 30% of the corresponding expression level of SF3B1 in the control sample.
"RNA sequencing" encompasses, but is not limited to, sequencing of at least one RNA molecule, and sequencing of at least one nucleic acid molecule that is synthesized to be
complementary to at least one RNA molecule, wherein the at least one nucleic acid molecule includes, but is not limited to, at least one DNA molecule. In one aspect, quantitative information is obtained from the sequencing.
"Whole-transcriptome sequencing" encompasses, but is not limited to, RNA sequencing of all detectable RNA molecules, all detectable messenger RNA molecules, all detectable pre-messenger RNA molecules, all detectable small RNA molecules, and a combination thereof.
"Immunohistochemistry" encompasses, but is not limited to, a process of detecting an antigen (e.g. SF3B1) in cells of a tissue section using an antibody capable of binding to the antigen (e.g. SF3B1). As used in this disclosure, an antibody that is capable of binding to SF3B1 encompasses, but is not limited to, an anti-SF3Bl antiserum, an anti-SF3Bl polyclonal antibody, an anti-SF3Bl monoclonal antibody, an antigen-binding fragment of an anti-SF3Bl antibody, a protein comprising a heavy chain variable domain that binds to SF3B1, a protein comprising a light chain variable domain that binds to SF3B1, and a protein that binds to SF3B1 with a Kd lower than about 1 x 10"6 M (e.g, 1 x 10"7 M, 1 x 10"8 M, 1 x 10"9 M, 1 x 10"10 M, 1 x 10"11 M, 1 x 10"12 M, or lower).
"Quantitative mass spectrometry" is an analytical chemistry technique for determining the amount of one or more proteins in a sample by mass spectrometry. One or more processes for protein purification, enrichment and/or separation may precede the mass spectrometry step.
"RNA interference" encompasses, but is not limited to, reducing the amount or activity of a first messenger RNA (mRNA) molecule by introducing a second RNA molecule that hybridizes to the first mRNA, or by introducing a DNA molecule that is transcribed and/or processed into the second RNA. The activity of a messenger RNA hereby refers to the efficiency that the messenger RNA is translated into a polypeptide. Commonly used RNA interference technologies include, but are not limited to, microRNA, small interfering RNA (siRNA) and small hairpin RNA (shRNA).
"Transcription cofactors that control SF3B1 transcription" encompasses, but is not limited to, histone binding proteins such as BET bromodomain proteins (BRD1-4), and histone modifying enzymes such as histone deacetylases, histone methylases and histone kinases. The transcription cofactor can be inhibited, e.g. , by suppressing its expression and/or activity, thereby reducing the activity of the transcription cofactor and SF3B1 transcription.
"SF3B1 protein degradation" encompasses, but is not limited to, proteolysis of SF3B1 and depletion of SF3B1 from a cellular compartment where the protein is assembled into a
complex or exerts its function. Proteolysis of SF3B1 includes but is not limited to direct protein cleavage by a protease, ubiquitin-mediated proteolysis by the proteasome, and autophagy -mediated proteolysis in the lysosome (e.g. through macro-autophagy, through chaperone-mediated autophagy). Depletion of SF3B1 from a cellular compartment includes but is not limited to translocation of SF3B1 to a different cellular or extracellular compartment.
"Inhibiting the activity of one or more deubiquitinating enzymes" encompasses, but is not limited to, reducing the amount and/or activity of at least one deubiquitinating enzymes, which leads to increased ubiquitination of an SF3B1 protein and increased degradation of the protein.
"Reducing the activity of SF3B1 protein" encompasses, but is not limited to, reducing the activity of a complex comprising SF3B1 by at least 10%, 20%, 30%, 40%, 50%, 60% or 70%.
"Subunits of the SF3B complex" encompass, but are not limited to, SF3B1, SF3B2, SF3B3, SF3B4, SF3B5 (SF3B10), SF3B14 (SF3B14a), PHF5A (SF3B14b), DDX42, and a pre-mRNA.
"Inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex" encompasses, but is not limited to, inhibiting the physical binding between SF3B1 protein and one or more subunits of the SF3B1 complex, and inhibiting the expression of one or more subunits of the SF3B1 complex. In one aspect, the physical binding is inhibited by a chemical compound, a peptide, a modified peptide or a protein that interferes with protein-protein binding in the SF3B complex. In another aspect, the physical binding is inhibited by an RNA molecule, a modified RNA molecule, a chemical compound (e.g. one that mimicks the structure of an RNA molecule), a peptide, a modified peptide or a protein that interferes with protein-RNA binding in the SF3B complex. In yet another aspect, the expression of one or more subunits of the SF3B1 complex is inhibited at the transcriptional, translational, or post-translational (e.g. protein modification, protein degradation) level.
"Inhibiting the interaction between the SF3B complex and 15S U2 snRNP" can be achieved by preventing the protein: protein binding interactions between SF3B complex members and 15S U2 snRNP during U2 snRNP assembly. It also can be achieved by preventing the protein:RNA binding interactions between SF3b complex and the U2 snRNA (another component of the U2 snRNP). Agents that inhibit the interactions include, but are not limited to, small molecule compounds, peptides, nucleic acids, and a combination or conjugate thereof.
"Tumor load" encompasses, but is not limited to, the number of cancer cells, the size of a tumor, and/or the amount of cancer in the subject. The tumor load may be determined by measuring the tumor size or by measuring a tumor marker or antigen.
"Progression-free survival" encompasses, but is not limited to, the length of time during and after the treatment of a disease, such as cancer, that a patient lives with the disease but it does not get worse.
"Overall survival" encompasses, but is not limited to, the length of time from either the date of diagnosis or the start of treatment for a disease, such as cancer, that patients diagnosed with the disease are still alive.
Furthermore, in accordance with the present disclosure there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al, 1989"); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985);
Oligonucleotide Synthesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J.Higgins eds. (1985)]; Transcription And Translation [B.D. Hames & S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); F.M.
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc.
(1994).
The following examples are provided to further elucidate the advantages and features of the present application, but are not intended to limit the scope of the application. The examples are for illustrative purposes only. EXAMPLES
Example 1: SF3B1 was frequently lost in cancer.
The TCGA PanCan dataset was analyzed to search for cancer-associated genes. It was found that SF3B1 was partially lost in 11% of the 10,570 cancers from more than 30 tumor types. Losses were most frequent in invasive breast adenocarcinoma (20%), urothelial bladder carcinoma (32%) and chromophobe kidney carcinoma (71%). Examples of types of cancer wherein an SF3B1 copy loss was identified included, acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma,
cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma. Genomic deletions of SF3B1 usually affected most of the chromosome arm (81% of losses) and were never homozygous (0/10,570 cancers), consistent with characterization of SF3B1 as an essential gene. In contrast, 85% of genes were homozygously deleted at least once. Similarly, analysis of copy number alterations from 1042 cancer cell lines in the CCLE indicated 24% of cell lines harbor hemizygous SF3B1 deletion, including 16/61 (26%) of breast cancer cell lines, but never homozygous loss (0/1042 cell lines).
Example 2: SF3B1 suppression led to growth defect of cells with SF3B1 copy-loss.
Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS
(CYCLOPS) genes were identified using a bioinformatics approach. These genes underwent partial copy loss in cancer, and cells with copy loss of a CYCLOPS gene were more sensitive to suppression of the gene than cells without copy loss. SF3B1 was among the most significant candidate genes in our CYCLOPS analysis. Cells without SF3B1 copy loss (SF3Blneutral cells) including Cal 51, HMC 1-8 and Hs578T, and cells with SF3B1 copy loss (SF3Bll0SS cells) including HCC1954, BT549 and T47D were obtained. BT549 and T47D have a ploidy of -3.2, while the average copy number of SF3B1 in these cells is about 2. With similar levels of SF3B1 knockdown by two shRNAs targeting SF3B1 (Figure IB), SF3Bll0SS cells underwent significantly slower growth than SF3Blneutral cells (Figure 1A).
Similar results were generated in isogenic SF3Bll0SS cells derived from the
SF3B 1neutral ^ ^ g^g frameshift-loss ^ wefe generated using a CPJSPR method causing a frameshift mutation inactivating one SF3B1 allele (CRlSPRframeshifWoss). The Cal 51 CRI SPRframeshift-ioss ceUs werg more sensitive to SF3B1 suppression than the cells that were generated in parallel but did not produce inactivating alleles (CRISPRneutral cells) (Figure 1A). In addition, a second Cal 51 cell line with deletion of one copy of the SF3B1 locus (CRISPRcopy"loss) generated by CRISPR using two sgRNAs - one upstream targeting a heterozygous SNP, one downstream of SF3B1 - showed significantly slower growth upon
SF3B1 suppression compared to Cal 51 CRISPRneutral 2 cells generated in parallel without SF3B1 copy loss (Figure 1C).
The vulnerability of the SF3Blloss cells to SF3B1 suppression was confirmed using a GFP-competition assay in which the proliferation rate of uninfected cells co-cultured with cells infected with a vector that co-expressed GFP and an shRNA targeting either LacZ or SF3B1 was compared. The expression of LacZ or SF3B1 shRNAs did not result in significant changes in proliferation of SF3Blneutral cells in seven cell lines. In contrast, SF3Blloss cells expressing SF3B1 shRNAs did not survive in long-term culture (Figures 2A, 2B).
In order to separate the step of infection of virus carrying shRNAs and the step of SF3B1 suppression, cell cultures containing a tetracycline inducible system were generated. SF3Blneutral cells and SF3Blloss cells express hairpins targeting Luciferase or SF3B1 upon doxycycline treatment. Consistent with stable SF3B1 knockdown, inducible SF3B1 knockdown inhibits the growth of SF3Blloss cells but not SF3Blneutral cells (Figures 3A, 3B, 3C).
Example 3: SF3B1 suppression led to cell cycle arrest and cell death of cells with SF3B1 copy loss.
From a cell cycle analysis, it was found that SF3Blloss cells had significantly increased proportions of cells in G2/M phase after SF3B1 knockdown, which did not occur in SF3B 1neutrai cellg (Figure 4A) In addition to the aberrant cell cycle progression, SF3Blloss cells exhibited a significant induction in cell death following SF3B1 knockdown. They underwent apoptosis as determined by increased number of AnnexinV-positive/propidium iodide (Pl)-positive cells and AnnexinV-positive/PI-negative cells, which did not occur in SF3Blneutral cells (Figure 4B). Similarly, the fraction of viable cells, as determined by the exclusion of propidium iodide, significantly decreases only in SF3Blloss cells expressing SF3B1 shRNA ("shSF3Bl"), not in SF3Blneutral cells expressing SF3B1 shRNA ("shSF3Bl") or SF3Bll0SS cells expressing LacZ shRNA ("shLacZ") (Figure 4C).
Example 4: Complementation of SF3B1 expression rescued the growth of SF3Blloss cells with SF3B1 suppression.
A lenti viral construct was used to confirm the specificity of the SF3B1 -targeting shRNAs. The construct expressed a codon-optimized SF3B1 ORF, which is resistant to shRNA suppression, fused to an IRES GFP sequence (SF3B1WT-IRES-GFP). The expression level of SF3B1WT-IRES-GFP did not change during Dox induction of SF3B1 shRNA in SF3Blneutral cells, but increased by over 20 fold in SF3Blloss cells upon Dox- induced expression of SF3B1 shRNA (Figure 5A). Therefore, SF3B1-IRES-GFP was more
highly expressed in SF3Blloss cells after SF3B1 knockdown than in SF3Blneutral cells. When placed in competition, cells infected or not infected with SF3B1WT-IRES-GFP maintained constant ratios over 10 days (Figure 5B), suggesting that short-term expression of SF3B1 does not alter cellular fitness in either SF3Blneutral or SF3Blloss cells. Next, endogenous SF3B1 was knocked down in all cells and expressed SF3B 1 WT-IRES-GFP in -50% of cells. While SF3Blneutral cells were not affected by SF3B1 suppression, SF3Blloss cells expressing an SF3B1 shRNA failed to survive in long-term culture. Remarkably, SF3Blloss cells expressing both an SF3B1 shRNA and SF3B1WT-IRES-GFP persisted in long-term culture (Figure 5C), indicating that complementary expression of SF3B1 was sufficient to prevent cell death.
Cell lines with stable exogenous expression of LacZ or SF3B1 were also established. The expression of SF3B1 was sufficient to restore the proliferation of SF3Blloss cells expressing an SF3B1 -targeting shRNA (Figures 6A, 6B).
Example 5: SF3Blneutral cells contained excess SF3B1 beyond the requirement for survival.
Analyses of SF3B1 mRNA indicate that SF3Blneutral cells tolerate partial SF3B1 suppression because they express more SF3B1 than they require. In both TCGA breast adenocarcinoma data (777 samples) (Network, 2012) and the Cancer Cell Line Encyclopedia (CCLE; 947 cell lines), SF3Blneutral samples had significantly higher expression of SF3B1 mRNA relative to SF3Blloss samples (Figures 7A, 7B; TCGA Mann-Whitney p<lxl0"4,
CCLE Mann- Whitney p<lxl0"4), suggesting excess mRNA over requirements for survival. It was validated that SF3Blneutral breast cancer cell lines (n=7) express approximately twice as much SF3B1 mRNA as SF3Blloss cells (n=5) by quantitative PCR (Figure 8A; p<lxl0"4) and found similar SF3B1 expression changes between the CRISPRneutral and CRISPRloss lines; Figure 8B).
These differences in SF3B1 mRNA expression were recapitulated at the protein level. Among breast cancer lines, Western blots indicated increased SF3B1 protein expression in SF3B 1 neutral compared to SF3Blloss cells (Figure 9A) and these differences were recapitulated in CRISPRneutral vs. CRISPRloss cells (Figure 9B). A significant linear correlation between SF3B1 mRNA and protein expression was also found in a panel of breast cancer cell lines (Figure 9C, p = 0.0018, R2 =0.772).
These observations suggest that SF3Blneutral cells tolerate partial SF3B1 suppression because moderate SF3B1 suppression leaves them with sufficient residual protein for survival. Indeed, immunoblots of SF3Blneutral cells after SF3B1 suppression indicated
detectable SF3B1 levels, whereas no protein could be detected in SF3Blloss cells after SF3B1 suppression (Figure 10).
A systematic analysis of shRNA-induced mRNA suppression across SF3Blneutral and SF3Bll0SS lines indicated that SF3B1 mRNA levels can be reduced by -60% from SF3Blneutral cell basal levels before proliferation defects are apparent. As shown in Figure 11, loss of half of the copies of SF3B1 does not significantly compromised cell survival, but further reduction of SF3B1 expression by 10% or more, or reduction of SF3B1 expression from a cell having SF3B1 copy loss by 20% or more, substantially inhibited cell proliferation.
SF3B1 expression was suppressed using shRNAs with different potency to generate a range of SF3B1 suppression in SF3Blneutral and SF3Blloss cells. Although similar reductions in
SF3B1 expression were obtained in SF3Blneutral and SF3Blloss lines, the elevated basal levels of SF3B1 expression in SF3 B 1 neutral Hnes enabled them to retain sufflcient SF3B1 for proliferation despite shRNA expression.
Example 6: SF3B1 copy-loss selectively reduced the abundance of the SF3b complex.
SF3B1 is a component of the seven-member SF3b sub-complex of the U2 snRNP.
Incorporation of SF3b into the U2 snRNP 12S "core" forms the 15S U2 snRNP, which combines with SF3a to form the mature 17S U2 snRNP (Figure 12). The expression levels of native SF3B1 -containing complexes from whole-cell extracts were assessed by glycerol gradient sedimentation and gel filtration chromatography. Protein complexes from 29-650 kDa and 650-2,000 kDa were resolved using 10- 30% glycerol gradients and Sephacryl S-500 gel filtration chromatography, respectively (Figures 13 A, 13B). This enabled resolution of SF3B1 -containing complexes ranging from monomers (155 kDa) to the SF3b sub-complex (450 kDa) to the 15S and 17S U2 snRNPs (790 and 987 kDa, respectively).
The elution profiles between patient-derived and isogenic SF3Bll0SS and SF3Blneutral cells were compared. Substantially lower levels of SF3b were observed in the SF3Blloss cells. The largest decreases in SF3B1 -containing complexes in glycerol gradients were in fractions 4-6, corresponding to -29-450 kDa (Figures 14A, 14B, 15A, 15B), and fractions 12-14, corresponding to -450-650 kDa (Figure 16A). Similar decreases in gel filtration
chromatography fractions corresponding to complexes <650 kDa were observed (Figure 16B). Native western blotting from the pooled glycerol gradient fractions 4-6 indicated the loss of a single SF3B1 -containing complex of -450 kDa (Figure 17A). SF3B1
immunoprecipitation from these fractions resulted in the coprecipitation of SF3b components SF3B3 and SF3B4 in SF3Blneutral cells, but not of U2 snRNP components SNRPB2 and SF3A3 (Figure 17B).
Conversely, U2 snRNP levels were only modestly decreased in SF3Blloss lines. Levels of SF3B1 in glycerol gradient fraction 25 (corresponding to >650 kd and containing the U2 snRNP) were only slightly decreased in SF3Blloss relative to SF3Blneutral lines (Figure 16A). SF3B1 immunoprecipitation from fractions 24-25 resulted in co-precipitation of U2 snRNP components SNRPB2 and SF3A3 (Figure 18). U2 snRNA levels are known to track with U2 snRNP levels, and no significant difference in U2 snRNA abundance between SF3Blneutral and SF3Blloss lines was observed, although there was a trend towards lower expression in the SF3Blloss lines (Figure 19A; p=0.35, two-tailed t-test). Similarly, visualization of U2 snRNP complexes using radiolabeled oligonucleotides complementary to the U2 snRNA did not demonstrate differences in 17S U2 snRNP abundance in SF3Blloss cells (Figures 19B and 19C).
These data suggested that copy-loss of SF3B1 only modestly affected U2 snRNP abundance but substantially decreased levels of U2 snRNP precursor complexes under steady-state conditions (Figure 20).
Example 7: SF3B1 suppression selectively reduced U2 snRNP abundance in SF3Blloss cells.
Suppression of SF3B1 led to substantial reductions of U2 snRNP levels in SF3Blloss but not SF3Blneutral cells. Although such suppression resulted in reduced SF3B1 levels in both SF3Blloss and SF3Blneutral lines, only the SF3Blloss lines exhibited concomitant reductions in levels of U2 snRNP components SF3A3 and SNRPB2 (Figure 21 A). These decreases were observed in glycerol gradient fraction 25, corresponding to the U2 snRNP, only in SF3Blloss lines (Figure 21B). Furthermore, after SF3B1 suppression, both SF3B1 and SNRPB2 were detected in Sephacryl-S500 fractions containing >650 kd protein complexes in SF3B 1neutrai ceUs but nQt in S F3B 1ioss∞lls (Figures 22A, 22B, 22C). Quantitative PCR also indicated significantly reduced U2 snRNA expression after SF3B1 suppression in SF3Blloss cells but not in SF3Blneutral cells (Figure 23).
Conversely, suppression of SF3B1 in SF3Blneutral cells decreased levels of SF3b, but not the U2 snRNP. SF3B1 suppression did not reduce SF3B1 in fraction 25 (Figure 21B) but instead preferentially reduced SF3B1 from fractions 4-6 (Figure 24) in SF3Blneutral cells. Further, no changes in SF3A3 or SNRPB2 expression were observed in total protein from glycerol gradient inputs (Figure 21A) or U2 snRNA expression (Figure 23). SF3Blneutral cells with SF3B1 suppression reduced SF3b levels in glycerol gradient fractions 3-6 approximately to the levels observed in SF3Blloss cells (Figure 25), thereby phenocopying the reduced SF3b observed in unperturbed SF3Blloss cells. Taken together, these data suggested that the
elevated levels of the SF3b sub-complex in SF3Blneutrm cells relative to SF3B110SS cells buffered SF3Blneutral cells from reductions in viability following SF3B1 suppression.
The reduction of U2 snRNP levels specifically in SF3Blloss cells by SF3B1 suppression (Figures 16A, 19, 21B) suggested that existing SF3b inhibitors, which prevent U2 snRNP function or subsequent steps during splicing catalysis, might exploit the specific vulnerability exhibited by SF3Blloss cells. Indeed, Spliceostatin A, an SF3b-targeting compound, led to increased cell death of Hs578T breast cancer cells when suppression of SF3B1 expression is induced, whereas NSC95397, a compound reported to inhibit splicing activity by an SF3b-independent mechanism, failed to exhibit increased effects on cells with SF3B1 copy-loss or suppression (Figure 26A, 26B).
In addition to SF3B1 RNA interference and SF3B inhibition, SF3B1 suppression can be exerted by deubiquitinase (DUB) inhibition. Treatment of Cal51 cells by three different DUB inhibitors PR-619, b-AP15 and SJB3-019A each led to significant decrease of of SF3B1 expression (Figure 37). Therefore, DUB inhibitors may be capable of killing
SF3Bll0SS cells specifically.
Example 8: SF3B1 suppression resulted in splicing defects in SF3Blloss cells.
SF3B1 is well-established as a splicing factor, as demonstrated by intron retention upon treatment of cells with SF3B1 inhibitors and in patients harboring SF3B1 mutations. RNA sequencing was performed to quantify the extent of splicing disruption upon SF3B1 suppression in SF3Blneutral and SF3Blloss cells (Figures 27A, 27B), and juncBase and a novel statistical framework were used to analyze 50,600 splice junctions for intron retention from the RNA sequencing data. All cells showed evidence of increased intron retention following SF3B1 suppression (p<10"5), but splicing was significantly more affected in SF3Blloss cells. Upon SF3B1 suppression, 7038 transcripts in SF3Blloss cells showed evidence of significantly (q<0.01) increased intron retention relative to SF3Blneutral cells, whereas only 298 transcripts showed evidence of increased intron retention in the reverse direction (Figure 28, p<10"1667).
Alterations in splicing was confirmed by RT-PCR of two ubiquitously expressed genes (RPS18 and CALR) that flank short introns amenable to PCR detection if they are improperly retained (Figure 29A). Upon SF3B1 knockdown, SF3Blloss cells contained transcripts with retained introns that were not observed in SF3Blneutral cells (Figure 29B). Alterations in alternative splicing was also observed. Specifically, the ratio between alternative long and short isoforms of MCL1 (that respectively do or do not have anti- apoptotic functions) is known to be regulated by SF3B1. After SF3B1 suppression, this ratio
was significantly biased towards the short isoform in SF3Blloss cells relative to SF3Blneutral cells (Figures 30A, 30B).
Spliceosome components, including SF3B1, are thought to assemble and function in sub-nuclear compartments known as nuclear speckles. Inhibition of splicing or transcription has been shown to induce formation of enlarged 'mega-speckles'. An unbiased quantification of the number and size of nuclear speckles per nucleus, represented by immunostaining of nuclear speckle marker SC-35, was performed using a custom image analysis pipeline with CellProfiler software. SF3Blneutral cells did not display chan ges in SC-35 speckles after SF3B1 suppression, but SF3Blloss nuclei contained significantly fewer speckles and increased speckle area (Figures 31A, 31B). The presence of defective alternative splicing, intron retention and formation of mega-speckles uniquely in SF3Blloss cells after SF3B1 suppression further supported the gross defects in splicing observed by RNA sequencing.
Moreover, upon SF3B1 suppression, 513 genes were differentially expressed at a false discovery rate (FDR) <10% in SF3Blloss cells and only 306 genes were differentially expressed in SF3Blneutral cells (pO.0001 by Fischer's exact test). Gene set enrichment analysis revealed 24 KEGG pathways significantly enriched in SF3Blloss cells and only 9 pathways altered in SF3Blneutral cells (Figure 32). These data were consistent with our other data showing that SF3B1 suppression more severely impacts the transcriptome of SF3Blloss cells.
Example 9: Suppression of other SF3B complex subunits did not lead to increased vulnerability of SF3Blloss cells.
An extended CYCLOPS analysis was performed to interrogate whether suppression of other genes, especially those encoding proteins in the SF3B1 complex, may inhibit growth of SF3Bll0SS cells more efficiently than SF3Blneutral cells. It was found that copy number alterations of these genes did not confer susceptibility to SF3B1 suppression. The significance of associations between Achilles RNAi sensitivity data of each SF3b complex subunit and copy numbers of each SF3b complex member in SF3Blloss cells was calculated (Figure 33). Six of seven SF3b subunits were analyzed (SF3B1, SF3B3-5, SF3B14 and PHF5A), and no associations between susceptibility to suppression of any of these genes and copy numbers of other SF3b subunits including SF3B1 was observed.
Example 10: Suppression of SF3B1 reduces tumor growth in SF3Blloss xenografts.
To test the effects of SF3B1 suppression in vivo, xenografts were generated using luciferase-labeled cell lines from the cRlSPRframeshifWoss and CRISPRneutral 1 cells containing TR-shSF3Bl#3. Animals were placed on doxycycline upon detection of palpable tumors.
CRISPRframeshifWoss and CRISPRneutral 1 cells generated tumors of similar volume in the absence of doxycycline (Figure 34; p=0.7, repeated measures ANOVA). However, suppression of SF3B1 reduced the growth of tumor (Figures 35A, 35B,35E) and number of proliferative Ki67+ cells (Figures 35C, 35D) in xenografts from CRISPRframeshift"loss cells but not CRISPRneutral 1 cells (p=0.001 for both assays). Similarly, reduced tumor growth was observed in naturally occurring SF3Bll0SS HCC1954 xenografts (Figure 36B) and not in SF3Blneutral Cal51 xenografts (Figure 36A). Therefore, SF3B1 suppression specifically inhibited the progression of tumors with SF3B1 copy loss.
Example 11: Methods.
Analysis of genome-wide copy-number associated cancer dependencies
Gene-level relative copy -numbers were downloaded from the CCLE portal
(http://www.broadinstitute.org/ccle, data version 4/06/2012). Gene-level dependencies were obtained for 214 cell lines from Project Achilles (version 2.4.3). ATARiS gene dependency scores were used to estimate the effect of shRNA-induced gene suppression on cell viability (Shao et al, 2013). Pearson correlation coefficients and associated p-values were calculated for the association of viability after suppression of each gene with the copy number of all genes. P-values were corrected for multiple hypotheses using the Benjamini -Hochberg method (Benjamini and Hochberg, 1995). Associations between copy -numbers of every gene in the genome and dependencies of every gene with ATARiS scores were considered. Large copy -number events affecting many neighboring genes often generated identical significant copy -number: gene dependency associations for copy -numbers associated with multiple genes. These were considered to reflect a single gene whose copy-number was responsible for the association. When the gene dependency reflected the same gene contained within the copy -number altered region, that gene was nominated as the source of the association.
Likewise, if a gene dependency reflected a paralog of a gene within the copy -number altered region, its paralog was nominated.
Classification of length and amplitude for copy number alterations
For relative log2 normalized copy number data analyzed from 10,570 tumors from TCGA, the following thresholds were used for copy number classification: homozygous loss log2 values <-1.2, hemizygous loss log2 <=-0.35. For cancer cell lines used in functional studies: copy-loss cells had log2 copy number <=-0.35, and copy neutral cells had log2 copy number >-0.2 and <0.2.
Analysis of gene expression across normal tissues
RNA sequencing data were downloaded from the GTEX database
(http://www.gtexportal.org/home/). For every gene in the genome, the expression variance across all samples were calculated and the variance was ranked among the 20 genes with the most similar average expression level. These ranks served as a nearest-neighbors normalized measure of expression variance.
CYCLOPS Analysis
The significance of differences in ATARiS scores between copy -neutral and -loss lines were determined for every gene by comparing the observed data to data representing random permutations of copy -number class labels, each maintaining the number of cell lines and lineage distribution in each class. Copynumber classes were assigned as copy-loss for cells with log2 relative copy number ratios <=-0.35 and copy -neutral otherwise.
Generation of heterozygous SF3Blloss cells by CRISPR-Cas9
For CRlSPRframeshift"l0SS cells, short guide RNAs targeting the first constitutively expressed coding exon of SF3B1 (exon 2) were designed with the aid of a web-based application (http://crispr.mit.edu/). Sense and anti-sense oligonucelotides were annealed and cloned into Bbsl site of pX458 (Addgene) and verified by Sanger sequencing. Single GFP+ cells were sorted by FACS and plated at low density for single cell cloning. CRISPRneutral 1 cells were processed identically, but did not have inactivating SF3B1 mutations.
Oligonucleotide sequences for CRISPRframeshift"loss were as follows: 5'-
CACCGCATAATAACCTGTAGAATCG (forward), 5'-
AAACCGATTCTACAGGTTATTATGC (reverse). pX458 was transfected with LipoD293 (SignaGen) into the diploid breast cancer cell line, Cal51. 19 monoclonal cell lines were genotyped for Cas-9 induced mutations by Sanger sequencing cloned PCR products. All monocolonal lines had either no mutations or harbored biallelic mutations in SF3B1. The genotypes of the Cal51 CRISPR cell lines used from this method of generation were:
SF3BldelT36/delT36 (CRISPRneutral 1) and SF3BldelT36/A23fsX20 (CRlSPRframeshifWoss). Copy number profiles from the two lines were characterized by SNP array. No SCNAs were detected as a result of single cell cloning (data not shown).
For CRISPRcopy"loss cells, a Cas9 construct co-expressing two sgRNAs and GFP was used to delete a 57 kb region encoding SF3B1. The guide RNA targeting the 5' upstream of SF3B1 used a mismatch from a heterozygous SNP (rs3849362) in Cal51 to bias towards mono-allelic deletion of SF3B1. Single GFP+ cells were plated as described above and expanded. One of these was validated by PCR to harbor a 57 kb deletion encoding SF3B1.
This was designated "CRISPRcopy" oss" for subsequent experiments. Another one of these was found by PCR not to harbor this deletion and was designated as the control cell line for subsequent experiments ("CRISPRneutral 2").
Oligonucleotides for CRISPRcopy"loss cells were cloned in a similar fashion as
cR!SpRframeshift-ioss in pX45 g BbgI overhangs) xhe sequences are as follows : For the 5 ' guide targeting SNP, 5 '-CACCGCGCATTATAGATTATGGCCC (forward) and 5'- AAAC GGGCC ATAATCT AT AATGC GC (reverse). For the 3' targeting guide: 5'- CACCGCGGAGTTTCATCCGTTACAC (forward), 5'- AA AC GTGT A AC GGATGA A AC TC C GC (reverse) were used.
Tissue culture
Human cancer cell lines were maintained in RPMI-1640 supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin and were assayed to be free of
mycoplasma. Non-transformed MCF10A and HMEC cells were cultured in Mammary Epithelial Growth Medium (CC-3150, Lonza). For cells expressing tetracycline-regulated shRNAs, tetracycline-approved fetal bovine serum (Clonetech) was used.
shRNAs targeting SF3B1
Lentiviral expression constructs for shRNA-mediated suppression of SF3B1 were obtained through the RNAi-consortium (http://www.broadinstitute.org/rnai/public/). The clone ID's and names used in our studies are as follows:
Generation of Inducible SF3B1 shRNA expression system
Sense and anti-sense oligonucleotides were annealed and cloned into the Agel and EcoRI restriction sites of the pLKO-Tet-puro vector (Addgene, plasmid #21915). The oligonucleotide sequences were:
shRNA Sequence
LacZ (sense) CCGGTGTTCGCATTATCCGAACCATCTCGAGATGGTTCGGA
TAATGCGAACATTTTTG (SEQ ID NO: 10)
LacZ (anti-sense) AATTCAAAAATGTTCGCATTATCCGAACCATCTCGAGATGG
TTCGGATAATGCGAACA (SEQ ID NO: 11)
TR-shSF3Bl#3 CCGGCAACTCCTTATGGTATCGAATCTCGAGATTCGATACC (sense) ATAAGGAGTTGTTTTTG (SEQ ID NO: 12)
TR-shSF3Bl#3 AATTCAAAAACAACTCCTTATGGTATCGAATCTCGAGATTC (anti-sense) GAT AC C AT AAGGAGTTG (SEQ ID NO: 13)
TR-shSF3Bl#5 CCGGCCTCGATTCTACAGGTTATTACTCGAGTAATAACCTG (sense) TAGAATCGAGGTTTTTG (SEQ ID NO: 14)
TR-shSF3Bl#5 AATTCAAAAACCTCGATTCTACAGGTTATTACTCGAGTAAT (anti-sense) AACCTGTAGAATCGAGG (SEQ ID NO: 15)
Cellular Growth Assays
Cells were plated in 96 well plates at 1000 cells per well. Cell number was inferred by ATPdependent luminescence by Cell Titer Glo (Promega) and normalized to the relative luminescence on the day of plating. For short-term lentiviral infections, cells were infected 24 hours prior to plating.
GFP Competition Assays
Oligonucleotides encoding LacZ or SF3B1 shRNA#4 hairpin sequences were annealed and cloned into the pLKO. l derivative vector TRC047 (pLK0.3pgw) and verified by Sanger sequencing. Cells were infected with serial dilutions of virus to achieve -50%
GFP-positive cells. Cells with approximately equivalent ratios of GFP-positive -and negative cells were assayed by flow cytometry 3 days post infection and at subsequent time-points. The fold change in GFP+ cells was normalized to the percentage present 3 days after infection. For competition assays re-introducing exogenous SF3B1, expression of a human codon-optimized SF3B1 by lentivirus was utilized. Cells were infected as described above and treated with doxycycline two days after infection.
Propidium Iodide Cell Viability Assays
Cells were treated with either short-term lentiviral infection or tetracycline-inducible SF3B1 shRNAs. After treatment, cells were trypsinized and pelleted including any cells in suspension. Cells were resuspended in propidium iodide viability staining solution (lx PBS,
1% BSA, 2.5 ug/mL propidium iodide) and quantified by live-cell flow cytometry. The change in viability was normalized to the percent of viable cells quantified on the first day of the assay.
Determination of Cell Cycle Distribution by Propidium Iodide
Cells were trypsinized, washed and fixed with ice-cold 70% ethanol for a minimum of
15 minutes at 4C. Cells were incubated in propidium iodide cell cycle staining solution (lx PBS, 1% BSA, 50 ug/mL propidium iodide, lOOug/mL RNAse A) for 15 minutes and analyzed by flow cytometry. Debris and aggregates were gated out and cell cycle stage was quantified using Modfit (Varity Software House).
Annexin-V Apoptosis Assays
Cellular apoptosis was quantified by live-cell flow cytometry using Alexa-Fluor 488 conjugated Annexin-V (Life Technologies) and propidium iodide. Cells were incubated in Annexin binding buffer containing propidium iodide (10 mM Hepes, 140 mM NaCl, 2.5 mM CaC12, 2.5 ug/mL propdium iodide) for 15 min, washed and resuspended in FACS buffer (lx PBS, 1% BSA and 50 mM EDTA). Determination of the stage of apoptosis by gating was as follows: viable cells (Annexin-V -/PI-), early apoptosis (Annexin-V +/PI-), late apoptosis (Annexin-V+/PI+), and dead cells (Annexin-V -/PI+).
Glycerol Gradient Sedimentation
Glycerol gradient sedimentation was performed as previously described (Klaus Hartmuth, 2012) with slight modifications for use with whole-cell lysates. Briefly, 10-30% glycerol gradients were formed by layering 10% glycerol gradient buffer (20 mM Hepes- KOH (pH 7.9), 150 mM NaCl, 1.5 mM MgC12 10% glycerol) on top of a 30% glycerol buffer with identical salt concentrations. Gradients were formed using a Gradient Station (Biocomp Instruments). Cells were lysed in "IP lysis buffer" (50mM Tris, 150 mM NaCl and 1% Triton X-100). 400 uL containing 1-3 mg of crude lysate was loaded per gradient in
SW55 centrifuge tubes and spun at 55,000 RPM for 3.5 hours at 4C. 200 uL fractions were collected by manually pipetting from the top of the gradient. Recombinant proteins of known mass were run in parallel gradients as controls.
Gel Filtration Chromatography
Sephacryl S-500 (17-0613-05, GE Healthcare) columns were packed into a 50 x 1.5 cm column and equilibrated with column buffer (10 mM Tris, 60 mM KC1, 25 mM EDTA, 1% Triton X-100 and 0.1% sodium azide). Whole-cell lysates were collected in IP lysis buffer as described above and incubated with 0.5 mM ATP, 3.2 mM MgC12 and 20 mM creatine phosphate (di-Tris salt) for 20 min at 30C to dissociate multi-snRNP spliceosomal
complexes. 2 mL of lysate containing 5 mg of protein was loaded on columns and 90 1.5 mL fractions were collected overnight at 4C.
Western Blotting
For denaturing protein immunoblots, cells were washed in ice cold PBS and lysed in lx RIPA buffer (lOmM Tris-Cl Ph 8.0, 1 mM EDTA, 1% Triton X-100, 0.1% SDS and 140 mM NaCl) supplemented with lx protease and phosphatase inhibitor cocktail (PI-290, Boston Bioproducts). Lysates were sonicated in a bioruptor (Diagenode) for 5 minutes (medium intensity) and cleared by centrifugation at 15000 x g for 15 min at 4C. Proteins were electrophoresed on polyacrylamide gradient gels (Life Technologies) and detected by chemiluminescence. For native western blotting, cells were washed in ice cold PBS and lysed in lx sonication buffer (10% Glycerol, 25 mM HEPES pH 7.4, 10 mM MgC12) supplemented with protease and phosphatase inhibitors. Coomassie blue native PAGE western blots were run according the manufacturer's instructions (Life Technologies).
Immunoprecipitation
Immunoprecipitations were performed with pooled glycerol gradient fractions. The Fc region of mouse anti-SF3Bl (Medical and Biological Laboratories, D221-3) was
directionally cross-linked to protein G Dynabeads (Life Technologies) using 20 mM dimethyl pimelimidate (DMP). IgG isotype controls were cross-linked and processed identically. Proteins were eluted with elution buffer (15% glycerol, 1% SDS, 50mM tris-HCl, 150mM NaCl pH 8.8) at 80C and subjected to western blot analysis.
Quantitative and reverse transcription PCR
RNA was extracted using the RNeasy extraction kit (Qiagen) and subjected to on- column DNase treatment. cDNA was synthesized with the Superscript II Reverse
Transcriptase kit (Life Technologies) with no reverse transcriptase samples serving as negative controls. Gene expression was quantified by Power Sybr Green Master Mix
(Applied Biosystems). Primers for all genes were determined to be equally efficient over 5 serial two-fold dilutions. Gene expression values were normalized to ACTB and the fold change calculated by the AACt method. For quantification of the U2 snRNA, the above method was used except total cellular RNA was extracted with Trizol (Life Technologies). SF3B1 qPCR primer sequences: (forward) 5'-ccaaagattgcagaccggga-3' (SEQ ID NO: 24), (reverse) 5'-tcaggggttttccctccatc-3' (SEQ ID NO: 25). These primers detect all three splicing variants of SF3B1 (SEQ ID NOs: 2-4).
Library preparation and RNA-sequencing
Total RNA was extracted with the RNeasy mini extraction kit (Qiagen) and treated by on-column DNAse digestion. RNA quality was determined with a bioanalyzer (Agilent) and samples with RIN values >7 were used for sequencing. mRNA were enriched with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs, #E7490S). Library preparations for paired end sequencing were performed using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7420S) according to manufacturer's specifications. Samples were pooled and 75bp paired reads were generated using a NextSeq 500 sequencer (Illumina). Approximately 50 million reads per sample were generated.
RNA sequencing analysis
FASTQ files were aligned using TOPHAT vl .4 with parameters "--mateinner-dist 300—mate-std-dev 500 ~no-sort-bam ~no-convert-bam -p 4". juncBase was used to identify read counts at splice junctions. The spliced in/spliced out counts at each junction were used to create an estimate of the risk of retaining an intron for each cell line. The distribution of this statistic was calculated for each cell line in each condition (with and without SF3B1 suppression) using a beta binomial distribution in which spliced in and spliced out read counts were the a and β terms, respectively. The distribution over relative risk of intron retention upon SF3B1 suppression was calculated as follows. For every quintile of the beta binomial distribution for the SF3B1 suppressed state, the ratio of the two beta-binomial distributions for each cell line was calculated. The posterior distributions over the relative risk of intron retention were combined for cell lines of the same genotype (i.e. SF3Blneutral or SF3Blloss) by obtaining the product of their distributions. P-values were obtained by calculating the overlap in the distributions over the relative risk of intron retention in each of the genotypes.
SF3B1 Gene expression analysis from TCGA and CCLE datasets
Relative copy number and Affymetrix expression data for SF3B1 were downloaded from the CCLE portal from the Broad Institute (presently at www dot broadinstitute dot org forward slash ccle forward slash home). TCGA breast adenocarcinoma data were downloaded from the cBioPortal (presently at www dot cbioportal dot org forward slash public-portal forward slash index dot do). For both datasets, samples lacking either gene expression or copy -number were removed. As described above, copy-loss was defined as samples with log2 normalized relative copy number of <-0.35, copy gain was defined as >=0.3.
Nuclear speckle quantification by SC-35 Immunofluorescence with CellProfiler image analysis
Cells were plated on 35 mm glass bottom dishes with #1.5 cover glass (D35-14-1.5-N, In Vitro Scientific). Cells were fixed and stained with anti-SC-35 antibody (S4045, Sigma- Aldrich) at 1 : 1000 dilution and detected with Alexafluor488 secondary antibody at 1 : 1000 (Life Technologies). Nuclei were counterstained with Hoescht dye. Monochromatic images were captured under identical conditions and pseudo-colored using Photoshop. A custom image analysis pipeline was empirically adapted from a preexisting pipeline designed for detecting H2AX foci using CellProfiler (Kamentsky et al, 2011). Measurements of nuclear speckles were generated from at least 15 random microscopic fields. A minimum of 100 nuclei identified by CellProfiler were used for quantitation per treatment.
Correlation analysis of copy-loss of SF3b genes with cell dependencies upon suppression of other SF3b complex genes
Relative copy number and ATARiS gene dependency scores were determined after knockdown of each SF3b complex member across the same 179 cell lines used in the
CYCLOPS analysis. Linear regression analysis was performed for copy number of each SF3b complex gene with knockdown of every SF3b component. One-sided p-values were calculated for association of sensitivity to suppression with gene loss for all intra-SF3b complex comparisons. Samples were excluded if they harbored co-deletion of the two genes used to generate the correlation.
Generation of xenografts and growth assessment
All animal husbandry was done with the approval of the Dana-Farber Cancer Institute IACUC. lxlO6 CRISPRneutral 1 or CRISPRframeshift"loss cells expressing TR-shSF3Bl #3 were subcutaneously injected into opposing flanks of nude mice (Foxnl nu/nu, Harlan). Animals were randomized to control group or doxycycline treatment after detection of a palpable tumor on either flank. Mice in the doxycycline treatment arm were continuously fed a doxycycline diet (2,000 ppm). Mice were sacrificed at the end of the experiment, or when endpoints were reached based on failure to thrive according to IACUC recommendation. Repeated measures two-way ANOVA was used to assess significance.
A custom image analysis pipeline was used to systematically quantify Ki67+ cells from tumor xenografts using CellProfilier. A minimum of 3 tumors per group, totaling at least 2,440 nuclei per tumor, was used to quantify the ratio of Ki67+ cells. At least 5 individual and random microscopic images from each tumor were analyzed.
Sequence listing
SEQ ID NO: 1 - human SF3B1 genomic sequence (NG_032903.2 nucleotide 4955..48074) SEQ ID NO: 2 - human SF3B1 mRNA sequence, transcript variant 1 (NM_012433.3) SEQ ID NO: 3 - human SF3B1 mRNA sequence, transcript variant 2 (NM_001005526.2) SEQ ID NO: 4 - human SF3B1 mRNA sequence, transcript variant 3 (NM_001308824.1) SEQ ID NO: 5 - human SF3B1 protein sequence, isoform 1 (NP_036565.2)
SEQ ID NO: 6 - human SF3B1 protein sequence, isoform 2 (NP_001005526.1)
SEQ ID NO: 7 - human SF3B1 protein sequence, isoform 3 (NP_001295753.1)
SEQ ID NO: 8 - target sequence of TR-shSF3Bl#3 on human SF3B1 mRNA
C AACTC CTTATGGT ATC GAATCT
SEQ ID NO: 9 - target sequence of TR-shSF3Bl#5 on human SF3B1 mRNA
CCTCGATTCTACAGGTTATTA
SEQ ID NOs: 10-15 - see example 11
SEQ ID NO: 16 - target sequence of shSF3Bl #2 on human SF3B1 mRNA
CGCTATTGATTGATGAAGATT
SEQ ID NO: 17 - target sequence of shSF3Bl #3 on human SF3B1 mRNA
C AACTC CTTATGGT ATC GAAT
SEQ ID NO: 18 - target sequence of shSF3Bl #4 on human SF3B1 mRNA
TGCTTTGATTTGGTGATGTAA SEQ ID NO: 19 - target sequence of shSF3Bl #5 on human SF3B1 mRNA
CCTCGATTCTACAGGTTATTA SEQ ID NOs 20-23 - see example 11
SEQ ID NO: 24 - forward primer for amplifying human SF3B1 mRNA or cDNA ccaaagattgcagaccggga
SEQ ID NO: 25 - reverse primer for amplifying human SF3B1 mRNA or cDNA tcaggggttttccctccatc
Claims
1. A method for determining the likelihood that a subject with cancer responds to an SF3B1 suppression treatment, comprising measuring the copy number of SF3B1 in a sample comprising cells from the subject, wherein the likelihood is increased if the copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample.
2. The method of claim 1, wherein the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer.
3. The method of claim 2, wherein the cancer is selected from the group consisting of breast cancer and hematopoietic cancer.
4. The method of claim 1, wherein the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon
adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
5. The method of claim 1, wherein the sample comprises a cancerous lesion.
6. The method of claim 1, wherein the sample comprises circulating tumor cells.
7. The method of claim 1, wherein measuring the copy number of SF3B1 comprises comparative genomic hybridization (CGH).
8. The method of claim 1, wherein measuring the copy number of SF3B1 comprises fluorescence in situ hybridization (FISH).
9. The method of claim 1, wherein measuring the copy number of SF3B1 comprises amplifying a genomic sequence comprising at least 20 nucleotides of SF3B1.
10. The method of claim 1, wherein measuring the copy number of SF3B1 comprises DNA sequencing.
11. The method of claim 10, wherein DNA sequencing comprises whole-genome sequencing.
12. The method of claim 10, wherein DNA sequencing comprises whole-exome sequencing.
13. The method of any of the claims 1-12, wherein the copy number of SF3B1 in the sample is an average copy number if the sample is heterogeneous.
14. The method of claim 13, wherein the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the average copy number of SF3B1 in the sample from the subject is at least smaller than the ploidy of the cells in the sample by at least 25%.
15. The method of claim 1, further comprising treating the subject with an SF3B1 suppression treatment if the likelihood that the subject response is increased.
16. A method for determining the likelihood that a subject with cancer responds to an SF3B1 suppression treatment, comprising
a. measuring expression level of SF3B1 in a sample from the subject; and b. comparing the measured expression level of SF3B1 in the sample from the subject to the expression level of SF3B1 in a control sample,
wherein the likelihood that a subject with cancer responds to an SF3B1 suppression treatment is increased if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample.
17. The method of claim 16, wherein the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer.
18. The method of claim 17, wherein the cancer is selected from the group consisting of breast cancer and hematopoietic cancer.
19. The method of claim 16, wherein the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon
adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
20. The method of claim 16, wherein the sample comprises a cancerous lesion.
21. The method of claim 16, wherein the sample comprises circulating tumor cells.
22. The method of claim 16, wherein the control sample comprises one or more samples selected from the group consisting of a normal tissue, a tumor known to have the same ploidy as the sample from the subject, and a cell known to have the same ploidy as the sample from the subject.
23. The method of claim 16, wherein the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample by at least 25%.
24. The method of claim 16, wherein the expression level of SF3B1 in the sample from the subject is an mRNA level.
25. The method of claim 24, wherein the SF3B1 mRNA level in the sample from the subject is measured by a method comprising quantitative PCR.
26. The method of claim 24, wherein the SF3B1 mRNA level in the sample from the subject is measured by a method comprising RNA sequencing.
27. The method of claim 26, wherein RNA sequencing comprises whole-transcriptome sequencing.
28. The method of claim 16, wherein the expression level of SF3B1 in the sample from the subject is a protein level.
29. The method of claim 28, wherein the protein level of SF3B1 in the sample from the subject is measured by a method comprising immunohistochemistry.
30. The method of claim 28, wherein the protein level of SF3B1 in the sample from the subject is measured by a method comprising enzyme-linked immunosorbent assay (ELISA).
31. The method of claim 28, wherein the protein level of SF3B1 in the sample from the subject is measured by a method comprising quantitative mass spectrometry.
32. The method of claim 16, further comprising treating the subject with an SF3B1 suppression treatment if the likelihood that the subject response is increased.
33. The method of any of the claims 1-32, wherein the SF3B1 suppression treatment comprises reducing the amount of SF3B1 mRNA.
34. The method of claim 33, wherein reducing the amount of SF3B1 mRNA comprises RNA interference.
35. The method of claim 34, wherein the RNA interference targets one or more of the sequences selected from SEQ ID NOs 8, 9, 16, 17, 18 and 19.
36. The method of claim 33, wherein reducing the amount of SF3B1 mRNA comprises inhibiting one or more transcription cofactors that control SF3B1 transcription.
37. The method of claim 36, wherein the one or more transcription cofactors that control SF3B1 transcription comprise bromodomain containing 1 (BRDl), bromodomain containing 2 (BRD2), bromodomain containing 3 (BRD3), bromodomain containing 4 (BRD4), or a combination thereof.
38. The method of any of the claims 1-32, wherein the SF3B1 suppression treatment comprises reducing the amount or activity of SF3B1 protein.
39. The method of claim 38, wherein reducing the amount of SF3B1 protein comprises increasing the rate of SF3B1 protein degradation.
40. The method of claim 39, wherein increasing the rate of SF3B1 protein degradation comprises inhibiting the activity of one or more deubiquitinating enzymes.
41. The method of claim 38, wherein reducing the activity of SF3B1 protein comprises inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex.
42. The method of claim 38, wherein reducing the activity of SF3B1 protein comprises inhibiting the interaction between the SF3B complex and 15S U2 snRNP or 17S U2 snRNP.
43. The method of claim 38, wherein reducing the activity of SF3B1 protein comprises inhibiting the incorporation of SF3B1 into 15S U2 snRNP or 17S U2 snRNP.
44. The method of any of the claims 1-43, wherein response to an SF3B1 suppression treatment comprises a reduced tumor load, a longer progression-free survival, a longer overall survival, or a combination thereof.
45. A method for treating a subject with cancer, comprising providing an SF3B1 suppression treatment, thereby treating the cancer in the subject.
46. A method for treating a subject with cancer, comprising
a. measuring the copy number of SF3B1 in a sample comprising cells from the
subject; and
b. providing an SF3B1 suppression treatment if the copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample, thereby treating the cancer in the subject.
47. The method of claim 45 or 46, wherein the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer.
48. The method of claim 47, wherein the cancer is selected from the group consisting of breast cancer and hematopoietic cancer.
49. The method of claim 45 or 46, wherein the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial
carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma,
pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
50. The method of claim 45 or 46, wherein the sample comprises a cancerous lesion.
51. The method of claim 45 or 46, wherein the sample comprises circulating tumor cells.
52. The method of claim 46, wherein measuring the copy number of SF3B1 comprises comparative genomic hybridization (CGH).
53. The method of claim 46, wherein measuring the copy number of SF3B1 comprises fluorescence in situ hybridization (FISH).
54. The method of claim 46, wherein measuring the copy number of SF3B1 comprises amplifying a genomic sequence comprising at least 20 nucleotides of SF3B1.
55. The method of claim 46, wherein measuring the copy number of SF3B1 comprises DNA sequencing.
56. The method of claim 55, wherein DNA sequencing comprises whole-genome sequencing.
57. The method of claim 55, wherein DNA sequencing comprises whole-exome sequencing.
58. The method of claim 46, wherein the copy number of SF3B1 in the sample is an average copy number if the sample is heterogeneous.
59. The method of claim 58, wherein the average copy number of SF3B1 in the sample from the subject is smaller than the ploidy of the cells in the sample by at least 25%.
60. A method for treating a subject with cancer, comprising
a. measuring expression level of SF3B1 in a sample from the subject;
b. comparing the measured expression level of SF3B1 in the sample from the subject to the expression level of SF3B1 in a control sample; and
c. providing an SF3B1 suppression treatment if the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample,
thereby treating the cancer in the subject.
61. The method of claim 60, wherein the cancer is selected from the group consisting of breast cancer, hematopoietic cancer, bladder cancer and kidney cancer.
62. The method of claim 61 , wherein the cancer is selected from the group consisting of breast cancer and hematopoietic cancer.
63. The method of claim 60, wherein the cancer is selected from the group consisting of acute myeloid leukemia, adrenocortical carcinoma, bladder urothelial carcinoma, brain lower grade glioma, breast invasive carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, cholangiocarcinoma, chronic myelogenous leukemia, colon
adenocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, chromophobe renal cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, lymphoid neoplasm diffuse large B-cell lymphoma, mesothelioma, ovarian serous cystadenocarcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, prostate adenocarcinoma, rectum adenocarcinoma, sarcoma, skin cutaneous melanoma, stomach adenocarcinoma, testicular germ cell tumors, thymoma, thyroid carcinoma, uterine carcinosarcoma, uterine corpus endometrial carcinoma, uveal melanoma.
64. The method of claim 60, wherein the sample comprises a cancerous lesion.
65. The method of claim 60, wherein the sample comprises circulating tumor cells.
66. The method of claim 60, wherein the control sample comprises one or more samples selected from the group consisting of a normal tissue, a tumor known to have the same ploidy as the sample from the subject, and a cell known to have the same ploidy as the sample from the subject.
67. The method of claim 60, wherein the expression level of SF3B1 in the sample from the subject is lower than the expression level of SF3B1 in the control sample by at least 25%.
68. The method of claim 60, wherein the expression level of SF3B1 in the sample from the subject is an mRNA level.
69. The method of claim 68, wherein the SF3B1 mRNA level in the sample from the subject is measured by a method comprising quantitative PCR.
70. The method of claim 68, wherein the SF3B1 mRNA level in the sample from the subject is measured by a method comprising RNA sequencing.
71. The method of claim 70, wherein RNA sequencing comprises whole-transcriptome sequencing.
72. The method of claim 60, wherein the expression level of SF3B1 in the sample from the subject is a protein level.
73. The method of claim 72, wherein the protein level of SF3B1 in the sample from the subject is measured by a method comprising immunohistochemistry.
74. The method of claim 72, wherein the protein level of SF3B1 in the sample from the subject is measured by a method comprising enzyme-linked immunosorbent assay (ELISA).
75. The method of claim 72, wherein the protein level of SF3B1 in the sample from the subject is measured by a method comprising quantitative mass spectrometry.
76. The method of any of the claims 45-75, wherein the SF3B1 suppression treatment comprises reducing the amount of SF3B1 mRNA.
77. The method of claim 76, wherein reducing the amount of SF3B1 mRNA comprises RNA interference.
78. The method of claim 77, wherein the RNA interference targets one or more of the sequences selected from SEQ ID NOs 8, 9, 16, 17, 18 and 19.
79. The method of claim 76, wherein reducing the amount of SF3B1 mRNA comprises inhibiting one or more transcription cofactors that control SF3B1 transcription.
80. The method of claim 79, wherein the one or more transcription cofactors that control SF3B1 transcription comprise bromodomain containing 1 (BRDl), bromodomain containing 2 (BRD2), bromodomain containing 3 (BRD3), bromodomain containing 4 (BRD4), or a combination thereof.
81. The method of any of the claims 45-75, wherein the SF3B1 suppression treatment comprises reducing the expression or activity of SF3B1 protein.
82. The method of claim 81, wherein reducing the amount of SF3B1 protein comprises increasing the rate of SF3B1 protein degradation.
83. The method of claim 82, wherein increasing the rate of SF3B1 protein degradation comprises inhibiting the activity of one or more deubiquitinating enzymes.
84. The method of claim 81, wherein reducing the activity of SF3B1 protein comprises inhibiting the interaction between SF3B1 protein and one or more subunits of the SF3B complex.
85. The method of claim 81, wherein reducing the activity of SF3B1 protein comprises inhibiting the interaction between the SF3B complex and 15S U2 snRNP.
86. The method of claim 81, wherein reducing the activity of SF3B 1 protein comprises inhibiting the incorporation of SF3B 1 into 15S U2 snRNP or 17S U2 snRNP.
87. A kit comprising:
a. a reagent for reverse transcription of an RNA molecule;
b. two or more primers, wherein a first primer comprises a polynucleotide
comprising SEQ ID NO: 24, and a second primer comprises a polynucleotide comprising SEQ ID NO: 25; and
c. a reagent for amplification of a DNA sequence.
88. A kit comprising an antibody that is capable of binding SF3B1 and a reagent for the detection of the antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/091,731 US20190147975A1 (en) | 2016-04-07 | 2017-04-07 | Sf3b1 suppression as a therapy for tumors harboring sf3b1 copy loss |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662319490P | 2016-04-07 | 2016-04-07 | |
| US62/319,490 | 2016-04-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017177191A1 true WO2017177191A1 (en) | 2017-10-12 |
Family
ID=60000720
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/026693 Ceased WO2017177191A1 (en) | 2016-04-07 | 2017-04-07 | Sf3b1 suppression as a therapy for tumors harboring sf3b1 copy loss |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20190147975A1 (en) |
| WO (1) | WO2017177191A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022013474A1 (en) * | 2020-07-14 | 2022-01-20 | Servicio Andaluz De Salud | Compounds for treating hepatocellular carcinoma |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110265084A (en) * | 2019-06-05 | 2019-09-20 | 复旦大学 | The method and relevant device of riboSnitch element are rich in or lacked in prediction cancer gene group |
| CN110960677B (en) * | 2019-12-13 | 2021-07-06 | 上海交通大学医学院附属第九人民医院 | Use of SAGE1 inhibitor in the preparation of medicine or kit |
| CN113702648B (en) * | 2021-09-13 | 2024-06-04 | 中南大学湘雅三医院 | Application of POLR2A as biomarker for predicting anti-tumor curative effect of anti-tumor drug |
-
2017
- 2017-04-07 WO PCT/US2017/026693 patent/WO2017177191A1/en not_active Ceased
- 2017-04-07 US US16/091,731 patent/US20190147975A1/en not_active Abandoned
Non-Patent Citations (4)
| Title |
|---|
| BRECQUEVILLE ET AL.: "Array comparative genomic hybridization and sequencing of 23 genes in 80 patients with myelofibrosis at chronic or acute phase", HAEMATOLOGICA, vol. 99, no. 1, January 2014 (2014-01-01), pages 37 - 45, XP055430086 * |
| GIBSON: "Evolution and Vulnerabilities of Somatic Copy Number Alterations in Cancer", PH.D. THESIS, MASSACHUSETTS INSTITUTE OF TECHNOLOGY, 1 March 2016 (2016-03-01), pages 172, XP055430082, Retrieved from the Internet <URL:https://dspace.mit.edu/handle/1721.1/101341#files-area> [retrieved on 20170629] * |
| NIJHAWAN ET AL.: "Cancer vulnerabilities unveiled by genomic loss", CELL, vol. 150, no. 4, 17 August 2012 (2012-08-17), pages 842 - 854, XP028935053 * |
| PAOLELLA ET AL.: "Copy-number and gene dependency analysis reveals partial copy loss of wild- type SF3B1 as a novel cancer vulnerability", ELIFE, vol. 6, no. e23268, 8 February 2017 (2017-02-08), pages 1 - 35, XP055430087 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022013474A1 (en) * | 2020-07-14 | 2022-01-20 | Servicio Andaluz De Salud | Compounds for treating hepatocellular carcinoma |
| ES2891182A1 (en) * | 2020-07-14 | 2022-01-26 | Servicio Andaluz De Salud | Compounds for the treatment of hepatocellular carcinoma |
| EP4183393A4 (en) * | 2020-07-14 | 2024-10-16 | Servicio Andaluz De Salud | COMPOUNDS FOR THE TREATMENT OF HEPATOCELLULAR CARCINOMA |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190147975A1 (en) | 2019-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | The long noncoding RNA H19 regulates tumor plasticity in neuroendocrine prostate cancer | |
| Paolella et al. | Copy-number and gene dependency analysis reveals partial copy loss of wild-type SF3B1 as a novel cancer vulnerability | |
| Jeschke et al. | Downregulation of the FTO m6A RNA demethylase promotes EMT-mediated progression of epithelial tumors and sensitivity to Wnt inhibitors | |
| Wu et al. | RTEL1 suppresses G-quadruplex-associated R-loops at difficult-to-replicate loci in the human genome | |
| Ali et al. | PAN-cancer analysis of S-phase enriched lncRNAs identifies oncogenic drivers and biomarkers | |
| Hu et al. | GUARDIN is a p53-responsive long non-coding RNA that is essential for genomic stability | |
| Musa et al. | Cooperation of cancer drivers with regulatory germline variants shapes clinical outcomes | |
| Vaz et al. | Chronic cigarette smoke-induced epigenomic changes precede sensitization of bronchial epithelial cells to single-step transformation by KRAS mutations | |
| Aird et al. | HMGB2 orchestrates the chromatin landscape of senescence-associated secretory phenotype gene loci | |
| Díaz-Muñoz et al. | Tia1 dependent regulation of mRNA subcellular location and translation controls p53 expression in B cells | |
| Pruszko et al. | The mutant p53‐ID4 complex controls VEGFA isoforms by recruiting lncRNA MALAT1 | |
| Hong et al. | MicroRNA-150 suppresses epithelial-mesenchymal transition, invasion, and metastasis in prostate cancer through the TRPM4-mediated β-catenin signaling pathway | |
| Jamshidi et al. | The genomic landscape of epithelioid sarcoma cell lines and tumours | |
| Pomella et al. | Interaction between SNAI2 and MYOD enhances oncogenesis and suppresses differentiation in Fusion Negative Rhabdomyosarcoma | |
| Smith et al. | An ErbB2/c-Src axis links bioenergetics with PRC2 translation to drive epigenetic reprogramming and mammary tumorigenesis | |
| Xie et al. | Transcriptional regulation of PES1 expression by c-Jun in colon cancer | |
| Wang et al. | RasGRP1 promotes the acute inflammatory response and restricts inflammation-associated cancer cell growth | |
| Paul et al. | Cooperation between the Hippo and MAPK pathway activation drives acquired resistance to TEAD inhibition | |
| Bu et al. | TGF-β1 induces epigenetic silence of TIP30 to promote tumor metastasis in esophageal carcinoma | |
| Tsang et al. | A study of meiomitosis and novel pathways of genomic instability in cutaneous T-cell lymphomas (CTCL) | |
| Armas-Lopez et al. | Epigenomic study identifies a novel mesenchyme homeobox2-GLI1 transcription axis involved in cancer drug resistance, overall survival and therapy prognosis in lung cancer patients | |
| Tan et al. | Deregulated GATA6 modulates stem cell‐like properties and metabolic phenotype in hepatocellular carcinoma | |
| Ramachandiran et al. | Chromosome instability in diffuse large B cell lymphomas is suppressed by activation of the noncanonical NF‐κ B pathway | |
| Chen et al. | MiR-15a-16 represses Cripto and inhibits NSCLC cell progression | |
| US20190147975A1 (en) | Sf3b1 suppression as a therapy for tumors harboring sf3b1 copy loss |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17779946 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17779946 Country of ref document: EP Kind code of ref document: A1 |
