WO2017175176A1 - Vectors for cloning and expression of proteins, methods and applications thereof - Google Patents

Vectors for cloning and expression of proteins, methods and applications thereof Download PDF

Info

Publication number
WO2017175176A1
WO2017175176A1 PCT/IB2017/051990 IB2017051990W WO2017175176A1 WO 2017175176 A1 WO2017175176 A1 WO 2017175176A1 IB 2017051990 W IB2017051990 W IB 2017051990W WO 2017175176 A1 WO2017175176 A1 WO 2017175176A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
yeast
fragment
sequence
light chain
Prior art date
Application number
PCT/IB2017/051990
Other languages
French (fr)
Inventor
Sohang CHATTERJEE
Kavitha Iyer RODRIGUES
Maloy GHOSH
Sunit Maity
Divya UNNIKRISHNAN
Yogendra Manjunath Bangalore MUNIRAJU
Sathyabalan MURUGESAN
Pavithra MUKUNDA
Bhargav PRASAD
Veeresha KAMANAGOWDA
Sanghamitra BHATTACHARJEE
Pravin Kumar DAKSHINAMURTHY
Vivek HALAN
Sankaranarayanan Srinivasan
Anuradha HORA
Bairavabalakumar NATARAJAN
Karthika NAIR
Aswini THANIGAIVEL
Amol MALIWALAVE
Bharath Ravindra SHENOY
Sahana Bhima RAO
Subhra Prakash CHAKRABARTY
Ashvini Kumar DUBEY
Amir Khan
Ankurina SHARMA
Rashmi Sharma
Anurag Tiwari
Santosh Kumar
Shivani PATEL
Nikitha M
Original Assignee
Zumutor Biologics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zumutor Biologics, Inc. filed Critical Zumutor Biologics, Inc.
Priority to JP2018553115A priority Critical patent/JP6987076B2/en
Priority to US16/090,783 priority patent/US11549119B2/en
Priority to EP17722873.1A priority patent/EP3440208B1/en
Priority to DK17722873.1T priority patent/DK3440208T3/en
Priority to CA3018936A priority patent/CA3018936C/en
Priority to KR1020187031366A priority patent/KR102165777B1/en
Priority to ES17722873T priority patent/ES2837482T3/en
Publication of WO2017175176A1 publication Critical patent/WO2017175176A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/005—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/20—Vector systems having a special element relevant for transcription transcription of more than one cistron
    • C12N2830/205—Vector systems having a special element relevant for transcription transcription of more than one cistron bidirectional
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/02—Libraries contained in or displayed by microorganisms, e.g. bacteria or animal cells; Libraries contained in or displayed by vectors, e.g. plasmids; Libraries containing only microorganisms or vectors

Definitions

  • the present disclosure relates to the field of biotechnology, genetic engineering and immunology. Particularly, the present disclosure relates to vectors for cloning and expressing genetic material, and methods of generating said vectors. Any genetic material including but not limiting to genetic material obtained from naturally occurring antibody genes or parts thereof, artificially designed synthetic antibody genes or parts thereof, or a combination of both can be employed for cloning and expression using the vectors of the present disclosure.
  • Cell surface display is a technique that allows the target protein to be expressed on the cell exterior by fusing it to a carrier protein, which is typically a cell membrane associated protein or its subunit.
  • a carrier protein typically a cell membrane associated protein or its subunit.
  • Surface display technology is employed as library screening tool for protein engineering, directed evolution, and drug discovery. However, said display technology is associated with it's own merits and demerits.
  • the ribosome display method is technically more challenging due to relative instability of the RNA and the ribosomal complex.
  • Another limitation of this technique is the inability to display a single chain protein such as ScFv.
  • Intracellular selection methods such as yeast-two-hybrid system or protein complementation assay directly rely on intracellular expression of the target protein.
  • they come with several limitations including propensity to aggregate in intracellular scenario, low cellular half-life and most importantly the whole system needs to be tailored for a specific application depending on the type of antigen against which the screening is intended.
  • phage display is widely accepted method, there are limitations on proper protein folding due to being a prokaryotic expression system and lack of post translational modifications of the displayed proteins.
  • yeast display platform a eukaryotic display system can be employed.
  • major challenge in case of yeast display system and similarly all other eukaryotic cell surface systems is the limited transformation efficiency setting limits on the library size that can be achieved which makes the entire process less efficient.
  • Success of a protein/antibody library, in terms of screening against an antigen lies in its independent representation of vast size without compromising on the diversity and functional size of the library along with secretion efficiency, processing efficiency and post translation efficiency amongst other factors.
  • the flexibility of display systems such as phage and/or yeast display platforms, is an absolute essential criterion to achieve such an objective.
  • the flexibility of display systems is contingent on the kind of expression vectors being used and whether compatibility exists between them.
  • compatibility and complementarity of vectors signify the transfer of diversity from phage to yeast display system either via combinatorial or batch transfer approaches. Said compatibility and complementarity features are lacking in the presently employed synthetic constructs/vectors of phage and yeast display systems.
  • the instant disclosure is directed towards addressing the above limitations of the current technologies and therefore aims at providing vectors which accommodate and cross-transfer large and diverse protein gene libraries via a combinatorial process which thereby improves the potential of identifying, transferring, preserving and generating proteins with varied affinities and specificities.
  • the present disclosure relates to a vector construct designed to clone antibody or a fragment thereof, said vector construct containing an expression cassette which comprises:
  • At least one cloning region for receiving a gene encoding a peptide or protein that selectively binds to a biologically active ligand
  • constant region immunoglobulin heavy chain or constant region immunoglobulin light chain, or fragments thereof wherein said constant region comprises at least one mutation with respect to constant region of a native immunoglobulin or fragments thereof, and
  • the at least one cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bglll, Bmtl, Hindlll, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof;
  • vector construct designed to clone antibody or a fragment thereof, or, to transfer or receive an antibody or a fragment thereof from the vector construct as claimed in claim 1 , said vector construct containing an expression cassette which comprises;
  • nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system
  • a first cloning region operably linked to a second cloning region in presence of a second linker sequence, wherein the cloning regions receive gene encoding a peptide or protein that selectively binds to a biologically active ligand,
  • the first cloning region or the second cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bglll, Hindlll, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof;
  • a method of preparing the vector construct as described above comprising steps of: a) synthesis of the expression cassette, b) linearization of a destination vector, and c) inserting the expression cassette into the linearized destination vector to obtain the vector construct;
  • a method of preparing library of vector constructs comprising steps of; a) preparing the vector construct by the method as described above, b) cloning nucleotide sequences encoding for regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VH) and combinations thereof, into the cloning region of the vector construct to obtain the library, or, transferring the nucleotide sequences encoding regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VH) and combinations thereof, from the cloning region of one vector construct to the cloning region of another vector construct to obtain the library;
  • a method of screening and identifying antibody or a fragment thereof having desired functional characteristic(s) comprising steps of: (a) preparing the library of vector constructs by the method as described above and transforming said vector constructs into bacterial host cells, yeast host cells or a combination thereof, and (b) selecting the bacterial or yeast host cells expressing the antibody or fragment thereof having the desired functional characterise c(s);
  • a bacterial or yeast host cell or a phage library or a yeast library thereof comprising the vector construct(s) as described above;
  • an expression cassette provided by the vector constructs as described above wherein said expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 1 1 , SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.
  • Figure 1 illustrates modification of pADL23c vector. Multiple restriction sites and backbone sequences were modified, described as modification - 1, modification - 2, modification - 3, modification - 4, respectively.
  • Figure 2 illustrates generation of pZBOOl - phagemid vector with kappa light chain constant region
  • Figure 3 illustrates generation of pZBOOl.l - phagemid vector with lambda light chain constant region.
  • Figure 4 illustrates modification of pRS314 vector. Multiple restriction sites were modified as described in the figure.
  • Figure 5 illustrates generation of pZB004 - yeast bidirectional vector with antibody kappa light chain constant region.
  • E Schematic depiction of pZB004 construct designed to clone antibody library genes comprising antibody variable heavy chain and antibody light chain (kappa) in respective cloning sites.
  • Figure 6 illustrates generation of pZB004.1 - yeast bidirectional vector with antibody lambda light chain constant region.
  • Figure 7 illustrates generation of pZB004.2 - yeast unidirectional vector with antibody kappa light chain constant region.
  • Figisre 8 illustrates generation of pZB004.3 - yeast unidirectional vector with antibody lambda light chain constant region.
  • Figure 10 illustrates generation of pZB004.4 - yeast scFv vector.
  • Figure 11 illustrates modification of p414GALl vector. Multiple restriction sites were moditied as described in the figure.
  • Figure 12 illustrates generation of pZB002 construct yeast mating vector with heavy chain constant region
  • Figure 13 illustrates modification of p416 GAL1 vector. Multiple restriction sites were modified as described in the figure.
  • Figure 14 illustrates generation of pZB003.1 construct yeast mating vector with Light chain lambda constant region
  • Figure 15 illustrates generation of pZB003.2 construct yeast mating vector with Light chain kappa constant region A) Schematic depiction of designed insert containing Kappa light chain CK domain with SSOl signal sequence
  • Figure 16 illustrates generation of pZB003 construct yeast mating vector with Light chain kappa constant region containing SS02 signal sequence
  • FIG. 17 illustrates generation of pZB003.3 construct yeast mating vector with Light chain kappa constant region containing SS03 signal sequence
  • Figure 18 illustrates generation of pZB003.4 construct yeast mating vector with Light chain kappa constant region containing SS04 signal sequence
  • Figure 19 illustrates restriction digestion analysis of antibody genes cloned in pZBOOl .
  • Figure 20 illustrates restriction digestion analysis of antibody genes cloned in pZBOOl.l
  • Figure 21 illustrates restriction digestion analysis of antibody genes cloned in yeast mating type vectors.
  • Figure 22 illustrates flow cytometry analysis to confirm antibody Fab expression.
  • Figure 23 illustrates flow cytometry analysis to confirm antibody ScFv expression on surface of yeast after transformation with pZB004.4 containing anti-Her2 ScFv sequences.
  • the present disclosure relates to a vector construct designed to clone antibody or a fragment thereof, said vector construct containing an expression cassette which comprises;
  • At least one cloning region for receiving a gene encoding a peptide or protein that selectively binds to a biologically active ligand
  • constant region immunoglobulin heavy chain or constant region immunoglobulin light chain, or fragments thereof wherein said constant region comprises at least one mutation with respect to constant region of a native immunoglobulin or fragments thereof, and
  • the at least one cloning region of the expression cassette contains restriction sites selected from a group comprismg Ndel, Bglll, Bmtl, HindlU, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof.
  • the vector construct as described above is designed to receive antibody or a fragment thereof from a phagemid comprising at least one cloning region or from a yeast vector comprising at least one cloning region, or, to transfer antibody or a fragment thereof to a yeast vector comprising at least one cloning region; and wherein the at least one cloning region of the expression cassette, the phagemid and the yeast vector comprises one or more common restriction sites selected from a group comprising Ndel, Bglll, Bmtl, HindlU, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof.
  • the expression cassette as described above comprises at least one terminator sequence lacking or comprising at upstream an enzyme cleavage site fused with a nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system; or, a nucleotide sequence encoding phage coat protein comprising at upstream at least one ribosomal binding site.
  • the expression cassette as described above contains or lacks one or more promoter sequence, operator sequence or a combination thereof;
  • the vector construct as described above is capable of expressing the antibody or a fragment thereof in a bacterial cell or a yeast cell;
  • the restriction sites in the cloning region of the expression cassette as described above, the phagemid and the yeast vector is selected from combinations comprising Hindlll and AscI; Ndel, Bglll, Hindlll and AscI; Ncol and Xhal; Ncol and Notl; Xhal, Nhel and Notl;
  • the promoter sequence is selected from a group comprising Gal 1 , Gal 1/10 and a combination thereof;
  • the leader sequence is selected from a group comprising pelB sequence, alpha leader sequence, Aga2P leader sequence, alpha mating factor 1 secretory signal sequence (SSO i), engineered alpha factor (aapS4) signal sequence (SS02), engineered alpha factor (aap8) signal sequence (SS03), engineered alpha
  • the nucleotide sequence encoding constant region immunoglobulin heavy chain or constant region immunoglobulin light chain having at least one mutation is selected from a group comprising first constant domain (CHI) of the immunoglobulin heavy chain or a fragment thereof, kappa constant region (Ck) of the immunoglobulin light chain or a fragment thereof and lambda constant region (CL) of the immunoglobulin light chain or a fragment thereof; and wherein the gene of the cloning region is selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain or a fragment thereof, lambda variable region (VL) of the immunoglobulin light chain or a fragment thereof and variable region of the immunoglobulin heavy chain (VH) or a fragment thereof.
  • CHI first constant domain
  • Ck kappa constant region
  • CL lambda constant region
  • the vector construct as described above is selected from a group comprising yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector and phagemid; and wherein the expression cassette is selected from a group comprising:
  • a cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Bmtl, Nhel, Notl and combinations thereof;
  • CHI first constant domain
  • a terminator sequence comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence
  • a cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
  • Ck kappa constant region
  • CL lambda constant region
  • a first terminator sequence a first set of recombinant tag sequences or selection coding nucleic acid
  • a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to light chain constant region of a native immunoglobulin or fragment thereof;
  • a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
  • a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xbal, Nhel, Notl and combinations thereof;
  • CHI first constant domain
  • a second set of recombinant tag sequences or selection coding nucleic acid sequences comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence,
  • a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bg!II, Hindlll, Ascl and combinations thereof;
  • a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant domain comprises at least one mutation with respect to light chain constant domain of native immunoglobulin or fragment thereof; a first set of recombinant tag sequences or selection coding nucleic acid sequences; a first terminator sequence;
  • a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xhal, Nhel, Not! and combinations thereof;
  • a second set of recombinant tag sequences or selection coding nuclei acid sequences comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence, and
  • a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bg!II, Hindlll, Ascl and combinations thereof;
  • a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant domain comprises at least one mutation with respect to light chain constant domain of native immunoglobulin or fragment thereof;
  • a second leader sequence capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xhal, Nhel, Noil and combinations thereof:
  • the present disclosure further relates to a vector construct designed to clone antibody or a fragment thereof, or, to transfer or receive an antibody or a fragment thereof from the vector construct as claimed in claim 1 , said vector construct containing an expression cassette which comprises:
  • nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system
  • a first cloning region operabiy linked to a second cloning region in presence of a second linker sequence, wherein the cloning regions receive gene encoding a peptide or protein that selectively binds to a biologically active ligand,
  • the first cloning region or the second cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl, Ncol, Xhal, Nhel, Noil and combinations thereof.
  • this vector construct is a scFv vector and is capable of expressing single-chain variable fragment (scFv) or a fragment thereof in yeast cell: wherein the cloning region of the expression cassette of said scFv vector and the vector construct further as described above comprises one or more common restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl, Ncol, Xbal, Nhel, Noil and combinations thereof; and wherein the promoter sequence is Gal 1 ; the nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system is Aga2P protein; the enzyme cleavage sites are protease cleavage sites selected from a group comprising Factor Xa cleavage site, TEV protease cleavage site and a combination thereof; the recombinant tag sequences or selection coding nucleic acid sequences are selected from a group comprising
  • the vector constructs as described above have a nucleic acid sequence selected from a group comprising SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24 and SEQ ID No. 26.
  • the vector constructs as described above further comprises regions selected from a group comprising origin of replication (Ori), antibiotic resistant marker, fl origin of replication, promoter and combinations thereof and combinations thereof; and wherein the vector constmcts are capable of expressing or displaying an antibody or a fragment thereof in a prokaryotic expression system, yeast expression system or a combination thereof.
  • origin of replication Ori
  • antibiotic resistant marker fl origin of replication
  • promoter and combinations thereof and combinations thereof
  • the vector constmcts are capable of expressing or displaying an antibody or a fragment thereof in a prokaryotic expression system, yeast expression system or a combination thereof.
  • the CHI region has a nucleic acid sequence of SEQ ID No. 27, the Ck region has a nucleic acid sequence of SEQ ID No. 28, and the CL region has a nucleic acid sequence of SEQ ID No. 29; and wherein the Vk, VL and VH sequences are derived from naive antibody repertoire, synthetic antibody repertoire, or a combination thereof.
  • the present disclosure further relates to a method of preparing the vector construct as described above, said method comprising steps of: a) synthesis of the expression cassette, b) linearization of a destination vector, and c) inserting the expression cassette into the linearized destination vector to obtain the vector construct.
  • the method of preparing the vector construct as described above comprises confirming error-free vector clones by sequencing technique; the destination vector is selected from a group comprising pADL23c, pRS314, p414Gall, p416Gall and combinations thereof; the linearization is carried out by digestion with restriction enzyme(s); and inserting the expression cassette into the linearized destination vector is carried out by techniques selected from a group comprising homologous recombination, restriction digestion followed by ligation and a combination thereof.
  • the present disclosure further relates to a method of preparing library of vector constructs, said method comprising steps of: a) preparing the vector construct by the method as described above, b) cloning nucleotide sequences encoding for regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VST) and combinations thereof, into the cloning region of the vector construct to obtain the library, or, transferring the nucleotide sequences encoding regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof ( V!
  • the vector construct is selected from a group comprising phagemid, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector, yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector and single-chain variable fragment (scFv) vector; the Vk, VL and VH regions are derived from naive antibody, synthetic antibody or a combination thereof; the library of vector constructs is a synthetic library, naive library or a combination thereof; and wherein the transfer of the nucleotide sequence is carried out between the phagemid vector construct to the yeast vector construct or between yeast vector constructs.
  • scFv single-chain variable fragment
  • the present disclosure further relates to a method of screening and identifying antibody or a fragment thereof having desired functional characteristic(s), comprising steps of: (a) preparing the library of vector constructs by the method as described above and transforming said vector constructs into bacterial host cells, yeast host cells or a combination thereof, and (b) selecting the bacterial or yeast host cells expressing the antibody or fragment thereof having the desired functional characteristic(s).
  • the screening and identification is carried out by phage display in bacterial host cells, yeast display in yeast host cells or sequentially by phage display and yeast display; and wherein the desired functional characteristic(s) is selected from a group comprising affinity, specificity, antigenicity, manufacturability, generation of new epitopes, thermal stability, solubility, aggregation and catalytic activity and combinations thereof.
  • the screening and identification as described above is carried out by sequential phage display and yeast display comprising steps of:
  • the antibody or a fragment thereof is in Fab or Scfv format for cloning into phage or yeast vector: and wherein transformation efficiency into the phage vector is in the range of about 10 9 to about 10 11 ; and transferring or transformation efficiency into the yeast vector is in the range of about iO 6 to about 10 8 .
  • the present disclosure further relates to a bacterial or yeast host cell, or a phage library or a yeast library thereof comprising the vector construct(s) as described above.
  • the present disclosure further relates to an expression cassette provided by the vector construct(s) as described above wherein said expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7,
  • SEQ ID No. 9 SEQ ID No. 1 1, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 59, SEQ ID No. 21 , SEQ ID No. 23 and SEQ ID No. 25.
  • the term 'vector' refers to a DNA molecule used as a vehicle to artificially cany foreign genetic material into another cell, where it can be replicated and/or expressed.
  • the vector of the present disclosure is capable of replicating and/or expressing in prokaryotic cell, eukaryotic cell, or a combination thereof.
  • Antigen refers to any foreign, substance which induces an immune response in the body.
  • antibody or “a fragment thereof refers to an immunoglobulin which may be derived from natural sources or synthetically produced, in whole or in part.
  • immunoglobulin refers to an immunoglobulin which may be derived from natural sources or synthetically produced, in whole or in part.
  • antibody and immunoglobulin are used synonymously throughout the specification unless indicated otherwise.
  • the term “antibody” includes both polyclonal and monoclonal antibody preparations and also includes the following: Chimeric antibody molecules, F(ab')2 and F(ab) fragments, Fv molecules, single chain Fv molecules (ScFv), dimeric and trimeric antibody fragments, minibodies, humanized monoclonal antibody molecules, human antibodies, fusion proteins comprising Fc region of antibody and any functional fragments arising out of these molecules, where derivative molecules retain immunological functionality of the parent antibody molecule.
  • the term “monoclonal antibody” in the present disclosure refers to an antibody composition having a homogeneous antibody population. The antibody is not limited to the species or source of the antibody or by the manner in which it is made.
  • the term encompasses whole immunoglobulins as well as fragments such as Fab, F(ab')2, Fv, and other fragments, as well as chimeric, and humanized homogeneous antibody populations that exhibit immunological binding properties of the parent monoclonal antibody molecule.
  • antibody fragment is a portion of a whole antibody which retains the ability to exhibit antigen binding activity.
  • Fab or ScFv are used as antibody fragments with specific mention wherein the former being associated exclusively with heavy chain constant domain (CHI ) and light chain constant region for either kappa or lambda (Ck or CA).
  • Antibody display library refers to a platform(s) expressing antibodies on the surface of cell or ceil-free suited for a screening methodology against target antigens.
  • phage display library and yeast display library are used with accurate specification unless indicated otherwise.
  • the terms “signal peptide” and “leader peptide” are used interchangeably.
  • the terms “cloning region”, “multiple cloning site” and “MCS” are used interchangeably.
  • the present disclosure relates to vectors for cloning and expressing genetic material.
  • the disclosure relates to generation of vectors to clone and express genetic material, including but not limiting to genetic material obtained from naturally occurring antibody genes, artificially designed synthetic antibody genes or parts of it, or a combination thereof.
  • the present disclosure provides phagemid and yeast vectors.
  • the vectors of the present disclose include but are not limited to phagemid, yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector and scFv vector.
  • the vectors are designed for cloning of large library of genes, and at the same time are flexible for transferring the cloned library between different vectors.
  • the vectors of the present disclosure are flexible for transferring the cloned library from phagemid to yeast vector(s) i.e. inter-transfer.
  • the vectors of the present disclosure are equipped with multiple expression tags and genetic elements to ensure proper expression and screening of expressed gene products through high throughput screening platforms.
  • the vectors of the present disclosure are flexible for transferring the cloned library between different yeast vectors i.e. intra-transfer.
  • the phagemid vector comprises an expression cassette which includes homologous recombination sequences, ribosome binding sites, promoter, signal peptide/1 eader peptide, tags, multiple cloning sites (MCS), constant regions of heavy chain [constant region of IgGl heavy chain (CHI)] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof, arid genelllP phage coat protein.
  • the constant regions of heavy chain and/or light chain is derived from naive antibody or synthetic antibody.
  • the phagemid also comprises but not limiting to origin of replication (Ori), antibiotic resistant marker and fl origin of replication.
  • the expression cassettes for phagemids are provided in Figures 2A and 3A respectively.
  • the expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 1 and SEQ ID No. 3.
  • the phagemid vector map is depicted in Figures 2D and 3D respectively.
  • the phagemid vector has a nucleic acid sequence selected from a group comprising SEQ ID No. 2 and SEQ ID No. 4.
  • the yeast vector is selected from a group comprising mating type heavy chain expressing vector, mating type light chain expressing vector, bi-directional bi-cistronic vector, unidirectional bi-cistronic vector and mono-cistronic ScFv display vector.
  • the yeast vector comprises an expression cassette which includes promoter, signal peptide, tag, multiple cloning sites (MCS), enzyme cleavage sites, transcription terminator and optionally, constant regions of heavy chain [constant region of IgGl heavy chain (CHI)] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof, and linker sequence.
  • the constant regions of heavy chain and/or light chain is derived from naive antibody or synthetic antibody.
  • the yeast vector comprises constant regions of heavy chain [constant region of IgGl heavy chain (CHI)] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof when the antibody is to be displayed in Fab format.
  • such yeast vector displaying Fab format is selected from mating type heavy chain expressing vector, mating type light chain expressing vector, bi-directional bi-cistronic vector and unidirectional bi-cistronic vector and mono-cistronic ScFv display vector.
  • the yeast vector lacks constant regions of heavy chain [constant region of IgG l heavy chain (CHI )] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof when the antibody is to be displayed in scFv format.
  • such yeast vector displaying scFv format is scFv vector.
  • the yeast vectors also comprise regions including but not limiting to origin of replication, fl origin of replication, antibiotic resistant marker, auxotrophic marker and centromere fused autonomously replicating sequence.
  • the yeast vectors are depicted in Figures 5E, 6C, 7C, 8C, IOC, 12C, 14C, 15C, 16C, 17C and 18C respectively.
  • the yeast vector has a nucleic acid sequence selected from a group comprising SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 18, SEQ ID No. 24 and SEQ ID No. 26.
  • the present disclosure further provides expression cassette/insert for expression of antibody or a fragment thereof.
  • the expression cassette is provided for expressing the antibody in Fab format, scFv format or a combination thereof, in another exemplary embodiment, the expression cassette is designed to form a part of phagemid vector, yeast vector, or a combination thereof. In an embodiment, the expression cassette is designed for phagemid vector to express antibody in Fab format. In another embodiment, the expression cassette is designed for yeast vector to express antibody in Fab format, scFv format, or a combination thereof. In an embodiment of the present disclosure, the representative expression cassettes for yeast vectors are provided in 5 A, 6A, 7A, 8A, 10A, 12 A, 14A, 15 A, 16A, 17A and 18A respectively.
  • the yeast expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11 , SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 17, SEQ ID No. 23 and SEQ ID No. 25.
  • the present disclosure further relates to generation of expression cassettes and vectors for cloning and expressing genetic material.
  • said vector is a phagemid, yeast expression vector, or a combination thereof, as described above.
  • the method of generating phagemid comprises synthesizing expression cassette/insert region and incorporating the said region into a linearized vector backbone (destination vector) to obtain the phagemid.
  • the method of generating phagemid comprises steps of;
  • variable region of heavy chain (VH) and light chain (Vk or VL) repertoire are cloned to destined location (MCS) by employing designated restriction enzymes in the of the generated phagemid vectors.
  • said variable region of heavy chain or light chain are derived from naive antibodies or synthetically generated antibodies.
  • naive repertoire or synthetic consensus pool of VH, Vk and VL are cloned into respective MCS of specific location in vectors to generate library constructs.
  • the synthesized nucleotide sequence (expression cassette) of above step (1) is a large DNA segment of - 2 Kb size comprising two segments wherein segment 1 comprises of homologous region, operator, promoter, ribosome binding sites (RBS) 1, multiple cloning site (MCS) I, light chain constant region [kappa (Ck) or lambda (CL)] while segment 2 comprises RBS 2, MCS II, heavy chain constant region (CHI) followed by a phage protein Genelllp as fusion protein and homologous region.
  • segment 1 comprises of homologous region, operator, promoter, ribosome binding sites (RBS) 1, multiple cloning site (MCS) I, light chain constant region [kappa (Ck) or lambda (CL)]
  • segment 2 comprises RBS 2, MCS II, heavy chain constant region (CHI) followed by a phage protein Genelllp as fusion protein and homologous region.
  • the synthesized expression cassette is incorporated into the linearized pADL23c vector backbone via an efficient, productive and ligation-free infusion cloning methodology which is a homologous recombination based cloning method.
  • Light chain and heavy chain variables from naive and/or synthetic antibody repertoire are cloned into MCS I of segment I and MCS II of segment 2 of phagemid, respectively. Therefore, two designated phagemids solely based on kappa or lambda constant regions are generated, thus accommodating respective variable regions of kappa and lambda light chain pools into respective destination phagemid vectors ( Figures 2D & 3D).
  • these phagemids are used to generate multiple clones in possible combinations of consensus heavy and light chain variable regions retaining the phagemid categorization/expression cassettes based on the constant regions of light chains. Further, synthetic diversity is introduced to designated restriction enzyme boundaries in CDR regions of Vh, Vk and ⁇ chains. On the other hand, naive repertoire with differentiation in kappa and lambda light chains is cloned directly into designated phagemids.
  • the method of generating yeast vector comprises designing the expression cassette, linearization of the destination vector followed by homologous recombination for insertion of the cassette or using restriction digestion followed by ligation of the cassette into the linearized vector to generate the yeast vector. Further, variable heavy chain and light chain repertoire is cloned to the destined location within the respective vector.
  • the method of generating yeast vector comprises steps of;
  • confirmation of error-free yeast vector clones is performed by sequencing, and variable regions heavy chain (VH) and light chain (Vk or VL) repertoire are cloned into destined MCS location with designated restriction enzymes in the respective yeast vectors.
  • said variable region of heavy chain or light chain are derived from aive antibodies or synthetically generated antibodies.
  • naive pool and/or synthetic pool of Vh, Vk and ⁇ are transferred from phagemids to yeast vectors or these regions are directly cloned into respective MCS of yeast vectors to generate eukaryotic antibody gene library of constructs.
  • the representative yeast vectors are depicted under Figures 5E, 6C, 7C, 8C, IOC, I2C, 14C, 15C, 16C, 17C and 58C respectively.
  • other characteristics such as display format have been featured in yeast vectors, as exemplified by Fab and ScFv format, while Fab format is further projected via expression systems: 1 ) mating type yeast vector, comprising genes encoding the two different heavy and light chains on different vectors in different yeast strains yielding a larger library size in Fab format; 2) bi-cistronic yeast vector wherein single yeast display vector is constructed comprising two expression cassettes driven by identical or different inducible promoters.
  • This bi-cistronic yeast vector format lead to the production of stoichiometric amounts of separate light chain and heavy chain proteins and thus optimize the yield of functional Fab antibodies; and 3) ScFv vector for cloning ScFv fragment of antibody gene with a specific length linker separating the VH and VL regions.
  • the yeast vectors of the present disclosure have suitable fusion tags for fluorescence based detection and separation.
  • the protein tags are placed as both N- terminal and C-terminal tags as applicable.
  • the utility of these tags are multiple, including but not limiting to detection, isolation, purification and assay development.
  • the commercially available vectors pADL23c, pRS314 and p414GALl & p416GALl were employed for designing the vectors for phage and yeast display platforms, respectively.
  • restriction enzymes sites were carefully provided in such a way so that they are absent in the vector backbone, constant regions of heavy & light chains, tags, display proteins such as Genelllp or G3P for phage vector and Aga2P for yeast vector, leader and terminator sequences.
  • the vectors of the present disclosure are uniquely designed to comprise specific restriction sites for inter- transfer (i.e. transfer of antibody genes from a vector of one expression system to another) as well as intra-transfer (i.e. transfer within the vectors of the same expression system).
  • the vectors of the present disclosure are capable of intersystem transfer viz. transfer of antibody genes from phage system to yeast expression system.
  • the vectors of the present disclosure are capable of intra-system transfer i.e., altering display format from Fab to ScFv or vice versa, or same format but different expression vector such as transferring from mating type yeast vectors to bi-cistronic yeast vector via respective set of MCS enzymes.
  • the cloning regions (MCS) of the vectors i.e. phagemid and yeast vectors comprise uniform restriction sites selected from a group comprising Ndel, Bglll, Bmtl, Hindlll, Ascl, Ncol, Xbal, Nhel, Noil and combinations thereof.
  • the MCS I/MCS region of phagemid vector and yeast vectors for cloning variable light chain sequence comprises restriction sites selected from Ndel, Bglll, Hindlll, Ascl and any combination thereof.
  • the MCS II MCS region of phagemid vector and yeast vectors for cloning variable heavy chain sequence comprises restriction sites selected from Ncol, Xbal, Nhel, Noil and any combination thereof.
  • the cloning region for variable light chain comprises combination of restriction sites selected from Hindlll and Ascl, and Ndel and Ascl.
  • the cloning region for variable heavy chain comprises combination of restriction sites selected from Ncol and Xhal, and Ncol and Noil.
  • the present disclosure further relates to the application of instant vectors in constructing a protein library.
  • the protein library is an antibody library.
  • the antibody library includes but is not limited to synthetic antibody gene expression library, naive antibody library, or a combination thereof.
  • the vectors as described above are employed in a method of generating antibody gene expression library including but not limiting to synthetic antibody gene expression library, naive antibody gene expression library or a combination thereof wherein said method comprises screening procedure for specifi antigen(s), by employing combinatorial tools.
  • the combinatorial tools include phage display technology and yeast display technology.
  • the method employs screening by phage display technology alone, yeast display technology alone, or a combination of phage and yeast display technology to create antibody gene expression library.
  • the method employs screening by phage display technology sequentially followed by yeast display technology to create antibody gene expression library.
  • the synthetic antibody gene expression library allows isolation of unique antibody molecules with desired functional properties for a specific therapeutic target i.e., antigen, with enhanced affinity and specificity.
  • the desired functional properties of the antibodies are selected from a group comprising, but not limiting to affinity, specificity, manufacturability, generation of new epitopes, thermal stability, antigenicity, solubility, aggregation and catalytic activity, or any combination thereof and any other properties related to successful product commercialization.
  • the method of generating antibody gene expression library includes sequentially exploring phage display technology and yeast display technology which allows in harnessing larger set of antibody gene diversity, a character of phage based library.
  • the antibody clones are thereafter screened through yeast display system.
  • yeast system for antibody gene expression is advantageous because of eukaryotic protein translation, processing and proper folding of the antibody products on ceil surface. Further, yeast expression allows proper interaction with antigenic targets with high specificity. Information obtained using these two complementary systems generate "lead molecules" (i.e., antibodies specific to an antigen) with higher success rate in terms of commercialization potential.
  • the vectors of the present disclosure successfully aid in generating antibody gene expression library by the sequential phage display technology and yeast display technology due to the various features of the vectors as described above.
  • the phagemid and yeast vectors of the present disclosure accommodate and cross-transfer large and diverse antibody gene libraries via an error-free process which thereby improves the potential of identifying, transferring, preserving and generating unique/lead molecules against multitude of antigens with varied affinities and specificities.
  • the prokaryotic phage display surface expression system is employed in the present disclosure to accommodate large antibody gene library about I0 9 to about 10" and preferably >10 H in such a way that the widespread diversity inherent in suc library is maintained.
  • the phage display system is therefore integrated with eukaryotic yeast display platform that allows post translaiional modifications for superior functionality.
  • the phagemid vectors for cloning and expression of highly diversified antibody gene library are designed and employed in the present disclosure.
  • the strategy is to first screen a large antibody gene library through phage display technology, wherein the selected clones thereafter are re-cloned in yeast display vectors to represent the antibody gene formats including but not limiting to ScFv or Fab or other antibody formats. Therefore, the phagemid vectors of the present disclosure are designed in such a way that preliminary screening of antibody genes are completed through phagemid and then the clones are transferred to various yeast expression vectors to express different antibody gene formats including but not limiting to ScFv, Fab or other antibody formats.
  • the phagemid vectors of the present disclosure are compatible for transferring the cloned genes to multiple types of yeast display vectors.
  • the present yeast expression vectors are al so unique in terms of cloning and expression of different formats of antibody genes including but not limiting to ScFv, Fab and other formats. Further, the present yeast expression vectors are used either for transferring the partially screened clones from phage display system to yeast display system or to directly generate naive or synthetic library in the yeast systems either combinatorially or non-combinatorially, wherein the later strategy preserves a specific combination of heavy chain and light chain being transferred directly from phage display system. Transfer of clones preferably takes place preferably via restriction digestion based methods into yeast strains. Restriction sites for gene transferring or new cloning are carefully and uniquely designed to render the gene transfer compatible between different vectors.
  • the yeast expression plasmids contain multiple fusion protein tags and cleavage sites to ensure expression of full length proteins and designed to be isolated and purified through high throughput methodologies. Multiple variants of signal sequences were used to optimize the secretion of various antibody formats once expressed inside yeast.
  • high throughput methodology includes but is not limited to ELISA, fluorescence-activated cell sorting (FACS), high throughput bead based selection methods, cell separation technologies, automated high throughput microscopy, magnetic separation technology and combinations thereof.
  • FACS fluorescence-activated cell sorting
  • the selected clonal populations are also useful in rapid purification of antibody gene product using strategically positioned protein cleavage sites.
  • the present vectors and methods tap both diverse and unique antibody repertoire of antibody gene library based on unique design and exclusive screening/selection criteria.
  • the vector design, expression profiling and screening strategies adopted herein enables efficient transition between phage to yeast display platforms, or between various vectors themselves.
  • the designing also accommodates the non-combinatorial transfer of clones obtained from phage display screening to yeast display system.
  • the phage display accommodates the library size (>l0 n ) for primary screening which is focused on stringency and specificity of antibody-antigen interaction in a high-throughput format and the screened molecules again go through a randomization process to mimic native display via yeast platform.
  • each kind of vectors contribute combinatorial ly to the pipeline of developing functionally specific yet structurally varied antibody moieties/lead molecules.
  • the expression procedure also ensures a unique display of Fab moiety or such type of antibody fragments on phage while Fab and scFv fragments or similar antibody fragments display on yeast surface.
  • the yeast display platform has a provision of selecting vectors with bicistronic and mating type approach to display Fab or similar antibody fragments.
  • This particular strategy, especially mating type is adopted to circumvent the issue of poor transformation efficiency generally observed in yeast cells when compared with E. coli transformation efficiency, thereby screening more number of clones.
  • the overall process with multiple rounds of selection on an antigen or on antigen-expressing cells via two different display systems is extremely valuable to positively or negatively select a range of desired antibody properties, such as affinity, specificity, manufacturabiiity and catalytic activity.
  • the strategic design and combinatorial use of the vectors of the present disclosure enables to preserve diversity in the antibody gene library that is capable of identifying unique molecules against varied antigenic targets.
  • the present vectors and their employment as a part of two different display systems thus helps in the generation of antibody gene libraries including but not limiting to na ' ive or synthetic libraries of human antibodies with high diversity which serve as a tremendous resource for new and functionally improved antibody identification and further commercial development.
  • the phagemid vectors of the present disclosure are used to clone and screen potential antibody genes with high to moderate affinity towards specific antigen. These genes are then transferred to the yeast display vectors of the present disclosure for further screening and identifying lead molecules.
  • Use of these two technologies by employing the present vectors is beneficial as phage display technology allows cloning and expression of large diversified antibody libraries while yeast display technology is superior in terms of eukaryotic expression system and proper protein folding. Therefore, yeast display technology- helps in mimicking antibody structural motifs for better antigen recognition when expressed on surface of yeast cell.
  • prokaryotic and eukaryotic vectors of the present disclosure are advantageous in screening highly diverse antibody libraries and developing new antibody molecules against specific antigens.
  • the lead molecules identified have higher potential for productization as the present strategy accounts for higher antibody library diversification, screening through eukaryotic systems and incorporation of rational designing.
  • Accommodates Accommodates Accommodates display system that >10 s clone > 10 8 clone diversity 1 i f clone >10 8 clone diversity can accommodate diversity with with compatible diversity with with compatible approximately or compatible display system. compatible display display system. greater thanl O u display system. system.
  • vector constructs/vector backbones were deposited with Microbial Type Culture Collection and Gene Bank (MTCC), India.
  • antibody libraries such as naive or imraurie or synthetic libraries solely depends on the unique design which has to be diverse and on final library size which should be sufficiently large. Any antibody library size & diversity and antibody specificity & affinity are directly linked. Apart from the crucial design of variable light chain and heavy chain repertoire - synthetic or naive; development of a system especially different expression vectors to accommodate the large repertoire is extremely important. In addition to the stated fact, aligning the usefulness of each vector strategically is the key feature to successful library generation and screening.
  • naive or synthetic phage libraries are used for screening against target antigens of various immune-oncology network.
  • the method involves the use of present phagemids and yeast expression plasmids in separate protein display technologies to express the proteins/antibody genes from naive and/or synthetic library.
  • phage display technology is used to clone and screen potential antibody genes with high to moderate affinity towards specific antigen. These genes are then transferred to yeast display plasmids for further screening and identification of lead molecules. Combining these two complementary technologies result in screening of highly diverse antibody libraries and developing new/lead antibody molecules against specific antigens.
  • the smooth transfer of clonal population from phage to yeast vectors is efficient since restriction enzymes used in MCS I and MCS II are identical with respect to the two expression systems.
  • restriction enzyme sites allow transferring selected population of variable light chains from MCS I of Phagemid to MCS I of any yeast vector while heavy chains are relocated to MCS II of any yeast vectors.
  • intra-system transfer i.e., altering display format from Fab to ScFv or vice versa, or same format but different expression vector such as transferring from mating type vectors to bi-cistronic vector is possible via respective set of MCS based restriction enzymes.
  • the free transition across all possible systems and formats also provide a randomization of heavy and light chains which allows compensating the differences across two display systems.
  • the Phagemid vectors are with bicistronic operon having specific human antibody constant regions attached for both light chains (Ck or C & CI or CL) and heavy chains (human IgGl-CHl domain).
  • Other essential features such as ribosome binding site, PelB signal sequence, multiple cloning sites (MCS I for light chain repertoire and MCS II for Heavy chain repertoire), FLAG and c-Myc tags are present in the phagemid vectors.
  • the tags are associated in continuation of CHI domain and will be used for detection of Fab expression.
  • IgGl-CHl domain is linked with phage coat PHI protein, GenelllP.
  • heavy chain is displayed on phage in an associated form through expressed GenelllP protein while the light chain is expressed as separate fragment, secreted into the periplasm, where it pairs with the heavy chain and completes the display configuration.
  • An amber stop codon (TAG) is strategically placed between the antibody genes and phage GenelllP protein enabling the production of Fab fragments in a non-suppressor strain of E. coli as exemplified TGI cells.
  • Pool of light chain variable regions will be cloned into MCS I region consisting of Ndel, Bglll, Hindlll and AscI restriction sites while heavy chain variable regions was destined in MCS II which contains Ncol, Xhal, Nhel and Noil sites.
  • restriction enzymes were based on their low probability to cut within human variable heavy and light chain coding regions. Additionally, they produce overlaps of 4 nucleotides or more leading to optimal cloning efficiency. The enzymes do not depend on methylation and their efficiency in recommended double digestions is more that 90 %. These restriction sites are maintained constant across multiple vectors in various expression systems such as yeast. To maintain the cloning sites throughout, there were several modifications that were made in Phagemid and subsequent vectors in yeast. As described above, these vectors are used to accommodate pool of nucleotide sequences of both naive and synthetic origin, therefore several unique changes were incorporated to ease library generation process and subsequent transfer into yeast. These changes also diminished specific restriction sites or certain peptides without changing the amino acid compositions or frame of translation. Some of the modifications carried out in the vector backbone and other individual elements/sequences are as follows:
  • BamHI restriction site (SEQ ID No. 30, 2754 bp to 2760 bp) was modified from GenelllP protein.
  • BstEII ( SEQ ID No. 27, 2882bp to 2888 bp)
  • Bsu36I (SEQ ID No. 27, 2779 bp to 2786 bp)
  • e/ (SEQ ID No. 27, 2733 bp to 2738 bp) enzyme sites were modified in the CHI region.
  • HinclIII site was modified from c-Myc tag (SEQ ID No. 2, 2958 bp to 2963 bp).
  • phagemid vectors being the first step to generate and screen libraries (naive or synthetic antibody libraries) were designed with utmost attention considering various subsequent processes in mind. Taken together, this was the most efficient route for library construction and move along with the screening.
  • the insert/expression cassette was designed for kappa ( Figure 2A and SEQ ID No. 1) and Lambda ( Figure 3A and SEQ ID No. 3), and synthesized followed by incorporation of the insert/expression cassette into the commercially procured pADL23c vector backbone which was subsequently subjected to several modifications before linearization and cloning of the insert/expression cassette.
  • pADL23c was used as a vector backbone towards the generation of two different Phagemid vectors. These Phagemid vectors will be majorly differentiated through the light chain constant regions i.e., kappa and lambda light chain constant regions.
  • Infusion reaction was set up for vector and insert, kappa and lambda inserts (Table 5) followed by incubation at about 50 °C for about 15 minutes. Post incubation about 2.5 ⁇ of the In-Fusion reaction mixture was added to the 50 uL Stellar competent ceils. The reaction mixture was incubated for about 30 minutes on ice followed by addition about 500 ⁇ . SOC media for recovery of transformed cells. Cells were plated on LB agar plates with ampicillin followed by incubation for overnight at about 37 °C. Colonies appeared on the following day and were inoculated in 5 mL LB- Amp and plasmid was isolated.
  • Vector pZBOOl has been submitted to MTCC under Budapest treaty with accession number being MTCC 25125 and named as pZBOOl.
  • the phagemid vector having light chain constant region (lambda insert - CL) can be prepared by a person average skilled in the art based on the aforementioned experimental procedure and the details of deposited phagemid vector (kappa insert).
  • Sequence confirmed Phagemid vectors pZBOO ' l and pZBOOl. l were used for generation of naive and synthetic phage library for screening/panning against target antigen. The size and diversity of the library was estimated by both peer group and next generation sequencing approaches. Sequencing results of panned molecule also confirmed that the diversity of the panned molecules is retained. Single stranded DNA was isolated from Panned molecules and to be transferred to yeast expression vectors.
  • Antibody display library represents a library of partial or complete antibodies expressed on ceil surface linked to other cellular proteins. Phage display is the most accepted method due to ease of cloning, allowing for large library sizes, monovalent display and easy to determine various stability parameters. However, with phage display there are associated limitations on proper protein folding due to prokaryotic expression system and lack of post translational modifications of the displayed antibody fragments thereby. To overcome these limitations, yeast display platform, a robust, versatile, quantitative methodology for isolating and engineering antibody fragments is employed. Yeast, a eukaryotic display system is of choice as it is compatible with quantitative and real-time assessment employing fluorescence activated cell sorter (FACS)- sorting techniques.
  • FACS fluorescence activated cell sorter
  • yeast display of naive / non-immune antibody libraries using the agglutinin adhesion receptor complex AgalP and Aga2P has a significant number of advantages.
  • use of flow cytometry analysis allows rapid clone characterization including Kn determination, ⁇ 0 ⁇ measurement and epitope binding of mutually exclusive clones directly on the surface of yeast. This eliminates the need for purification of protein to perform these characterizations.
  • the successful display of Fab antibody fragments on yeast suggests a simpler approach to large library construction.
  • Fab fragments are composed of heavy and light chains, therefore it is possible to encode the two polypeptides on different vectors in different yeast strains wherein two chains can be brought together in a single diploid yeast by mating, a highly efficient process.
  • major challenge in case of yeast display is relatively smaller library size due to lower transformation efficiency in yeast, which is hereby overcome by the aspects provided by the instant disclosure, which employs a combination of phage and/or yeast display concept.
  • phage panned molecules should be to be transferred to various Yeast expression vectors either combinatorially or non-combinatorially in various formats such as ScFv, Fab etc.
  • yeast expression vectors are with either bicistronic bidirectional or bicistronic unidirectional having specific human antibody constant regions attached for both light (Ck or CK & C l or CL) and heavy chains (human IgGl - CHI domain).
  • leader signal sequence (Mating type alpha factor for light chain; Aga2P leader peptide for heavy chain), multiple cloning sites (MCS I for light chain repertoire and MCS II for Heavy chain repertoire), tags (V5 epitope tag and 6xHis tag for light chain; FLAG and c-Myc tags for heavy chain repertoire) are present in all kinds of yeast vectors.
  • the tags are associated in continuation of constant domain and will be used for detection of Fab expression.
  • the screening to obtain the yeast library by the surface display is carried out by employing competing antigenic epitopes, antibody paratope conformation, sequences and sequence motifs or any combination thereof to isolate Fab or ScFv molecule using protease cleavage sites selected from a group comprising Tobacco Etch Virus (TE V), Entero kinase (Ek) etc strategically placed after tags in heavy chain.
  • TE V Tobacco Etch Virus
  • Ek Entero kinase
  • pRS3 I4veetor ATCC, USA
  • backbone Figure 4
  • Some of the modifications carried out in the vector backbone and other individual elements/sequences are as follows: 1. Sad, SacIL Eagl, Noil, Spel, BamHI, Xrnal, Smal, Pstl, EcoRI, EcoRV, Sail, Xhol, Apai, are few of the restriction enzymes that were removed from the pRS314vector (SEQ ID No. 31 , 1893 bp to 1989 bp, as shown in Figure 4).
  • Spel site (SEQ ID No. 29, 2600 bp to 2605 bp) was diminished from lambda light chain constant region(CL).
  • inserts/expression cassettes for kappa ( Figure 5 A and SEQ ID No. 5) and lambda ( Figure 6 A and SEQ ID No. 7) was designed and synthesized comprising Gall/10 promoter, alpha leader peptide, Aga2P leader peptide, MCS I & II, Tags (V5 and His-Tags for Light chains and FLAG, c-Myc for Heavy chain), respective constants regions attached for both light (Ck or Ck) and heavy chains (human IgGl-CHl domain).
  • a Spel restriction site has been removed from Ck region.
  • heavy chain will be displayed on yeast in an associated form through expressed Aga2P protein while the light chain is expressed as separate fragment. During protein maturation process, it pairs with the heavy chain and completes the Fab display configuration. Separate terminator sequences were kept as exemplified by CYC1 terminator for heavy chain and alpha terminator for light chain. To aid the further screening process with soluble Fab, TEV protease cleavage site was fixed after the tags and before Aga2P protein sequence. There is a (G4S) 3 linker region strategically placed before the start of Aga2P protein in order to introduce flexibility in protein conformation.
  • G4S G4S
  • Ligation set up was done individually for kappa vectors at a ratio of 1 :5 followed by transformation individually into TGI , highly competent cells. Individual colonies were picked up, inoculated followed by isolation plasmid DNA and restriction digestion set up using PvuII enzyme. Confirmed clones produce bands of ⁇ 4.3 Kb and -2.9 Kb fragments ( Figure 5 B). Positive clones were further confirmed by restriction digestions with EcoRV/Kpnl and NdellKpnl enzymes in respective combinations wherein former produces sizes of -3.7 Kb & ⁇ 3.5 Kb while later produce -5.5 Kb & ⁇ 1 .8 Kb fragments ( Figure 5 C & D).
  • yeast bicistronic Directional vector having lambda light chain constant region is prepared by using said deposited vector yeast bicistronic birectional vector having kappa insert. The same is prepared wherein 10 ,ug of confirmed and deposited kappa vector (pZB004) and insert-lambda-yeast (SEQ ID No. 7) were digested with Spel-HF/SacII (Table 8) followed by gel elution and ligation (Table 9) at about 4°C for overnight. 25 ng of ligation mixture was transformed into TGI competent cells. Individual colonies were inoculated and screened for insert release with PviiII, Ndeh'Notl and NcoIIAscI enzymes ( Figure 6 B). Positive clones were sent for sequencing and found to be error-free ( Figure 6 C). The confirmed yeast bicistronic bidirectional vector containing lambda light chain constant region is named as pZB004.1 (SEQ ID No. 8).
  • Yeast Bicistronic Unidirectional vector was designed to have an option of two separate promoters for expressing heavy chain and light chain in Fab format. Besides, unique configuration of this vector will allow for non-combinatorial transfer of Fab molecules from phage system to yeast system. This will in turn preserve a specific combination heavy chain and light chain to explore in eukaryotic system.
  • the deposited yeast Bicistronic Bidirectional vector was used as backbone, wherein the insert for kappa ( Figure 7 A and SEQ ID No. 9) and lambda ( Figure 8 A and SEQ ID No. 11) were designed and synthesized comprising two Gal 1/10 promoter (light and heavy chain), alpha leader peptide, Aga2P leader peptide, MCS I & II, Tags (V5 and His-Tags for Light chains and FLAG, c-Myc for Heavy chain), respective constants regions attached for both light (CK or CL) and heavy chains (human IgG l-CHl domain).
  • the gene in the vector backbone was replaced by the designed and synthesized insert/expression cassette ( Figure 10 A and SEQ ID. No. 13) between Apal and SacII enzymes.
  • the designed insert contains Gall promoter, nucleotide encoding Aga2P protein sequence, Aga2P leader sequence, Factor Xa site, HA tag, TEV cleavage site, MCS I (for Light chain variable region incorporation, Ndel, Bglll, Hi d::: and Ascl), linker region (G 4 S), MCS II (for heavy chain variable region incorporation, Ncol, Xhal, Nhel and Noil), c-Myc tag, FLAG tag, alpha terminator.
  • yeast surface display technology has constraint in the library size (typically 10 6 ⁇ 10 s ) compared with either phage (10 9 to 10 11 ) or ribosome (10 n to 10 i 2 ) display technologies due to its limitations in yeast transformation efficiencies. Improved yeast transformation methods could overcome this limitation. However, various improved yeast transformation protocols are time- consuming and labor-intensive. So, yeast mating can be used as a powerful tool for generating a large antibody library. The yeast mating is achieved by cellular fusion between two haploid cells of opposite mating types through interaction with a-agglutinin of MATa cells and a-agglutinin of MATa cells.
  • Fab antibody fragments comprise two chains; a heavy chain (HC) with VH and CHI (the first domain of heavy chain constant regions) and a light chain (LC) with VL and CL (light chain constant domain).
  • HC heavy chain
  • CHI heavy chain constant regions
  • LC light chain
  • yeast mating is suitable for the construction of a combinatorial Fab library from two haploid cells of opposite mating types containing HC and LC libraries.
  • Mating type heavy chain expressing vector is designed to express HC chain (VH+CH1) on with tags and TEV cleavage site on yeast ceil surface under the control of GALl promoter and CYC1 terminator.
  • Aga2P signal sequence present in this vector facilitates HC chain to secretory pathway.
  • Combination of various restriction sites is important to transfer to transfer phage panned molecules (VH) from phagemid to HC expressing vector.
  • unique restriction sites ⁇ Ncol, Bmtl, Nhel, Not! are kept between Aga2P signal sequence and CHI open reading frame. Presence of myc and FLAG tags are provided to detect HC chain during flow cytometry screening.
  • To cleave Fab firagment form yeast cell surface highly sequence-specific cysteine protease Tobacco Etch Virus protease (TEV) and Enterokinase (EK) sites are incorporated in HC expressing vector.
  • TEV Tobacco Etch Virus protease
  • p414GALl and HC DNA cassette SEQ ID No. 15
  • p414 GALl a CEN-based shuttle vector with TRPl marker from ATCC (Cat. No. ATCC 3 ⁇ 4 87328 TM ) was modified in order to accommodate HC DNA cassette. Said modifications are provided in Figure 1 1 and are summarized below:
  • HC DNA cassette (SEQ ID No. 15) is composed of unique AGA2P single sequence coding region, multi-cloning sites ⁇ Ncol, Bmtl, Nhel, Notl), heavy chain constant regionl (CHI) with Cysteine residue intact at the last position followed by tags (c-myc and FLAG), TEV cleavage site which is fused with c-terminally AGA2P open reading frame.
  • HC DNA cassette is synthesized through Gene Art.
  • HC DNA cassette ( Figure 12 A) and p414 GALl are digested with Spel and Xhol at 37 °C and ligated (at 4 °C) further to create pZB002 ( Figure 12 B).
  • the synthesized pZB002 HC expressing vector is deposited with MTCC under the accession number MTCC 25126.
  • HC DNA cassette is under the control of GALl promoter and CYC1 terminator.
  • Unique Ncol, Bmtl, Nhel and Noil sites were kept after AGA2P signal sequence to clone VH region received from phage panned library in pZB002.
  • Mating type light chain expressing vector is designed to express and secrete LC chain (VL+ Ck) with tags yeast cell surface under the control of GALI promoter and CYCl terminator, mating alpha factor single sequence (pre region) present in this vector facilitates LC chain to secretory pathway.
  • Combination of various restriction sites is important to transfer to transfer phage panned molecules (VL) from phagemid to HC expressing vector.
  • To achieve this unique restriction sites (NdeL Bglll, HindUJ and Ascl) are kept between mating alpha factor singie and LCX open reading frame. Presence of V5 and His tags provide to detect LC- ⁇ chain during flow cytometry screening.
  • p416 GALI is a CEN-based shuttle vector with URA3 marker from ATCC (ATCC® 87332TM) ( Figure 13). Which was used to generate several light chain constructs with different signal sequences. Said p4! 6 GAL1 vector backbone was modified as provided in
  • modified p416 GAL1 and LC DNA cassette (SEQ ID No. 19) was used.
  • LC cassette is composed of alpha factor single sequence (SSOl), unique multi-cloning sites (Ndel, Bgill, Hindi! and AscI), and light chain constant region (LC with Cysteine residues intact at the last position followed by tags (V5 and His).
  • L DNA cassette ( Figure 14 A) is synthesized through Gene Art. Modified p416 GAL1 and LCX are digested with Spel and Xhol at 37 °C and iigated at 4 °C further to create pZB003.1 (Tables 18 and 19; Figure 14 B).
  • LC DNA cassette will be under the control of GAL I promoter and CYC I terminator in pZB003.1 vector.
  • Unique Ndel, Bg!II Hindlll and AscI sites were kept after SSOl signal sequence to clone VL region from phage panned library in pZB003.1 vector ( Figure 14 C).
  • the generated pZB003.1 vector is provided as SEQ ID No.
  • Mating type light chain expressing vector is designed to express and secrete LC chain (VL+ LCsc) with tags yeast cell surface under the control of GALI promoter and CYCI terminator. mating alpha factor single sequence (pre region) present in this vector facilitates LC chain to secretory pathway. Combination of various restriction sites is important to transfer to transfer phage panned molecules (VL) from phagemid to HC expressing vector. To achieve this, unique restriction sites (Ndel, Bglll, Hindlll and Ascl) are kept between mating alpha factor single and LCK open reading frame. Presence of V5 and His tags detect LCK chain during flow cytometry screening.
  • LCK cassette is composed of mating alpha factor single sequence (SS01), unique multi-cloning sites (Ndel, BgllL Hindlll and Ascl), light chain constant region (LCK) with Cysteine residues intact at the last position followed by tags (V5 and His).
  • LCK cassette ( Figure 15 A) is synthesized through Gene Art.
  • p416 GALl and LCK are digested with Spel and Xhol at about 37 °C and ligated at about 4°C further to create pZB003.2 vector (Tables 21 and 22; Figure 15 B).
  • LCK DNA cassette will be under the control of GALl promoter and CYC1 terminator in pZB003.2.
  • Unique Ndel, Bglll, Hindlll and Ascl sites were kept after SS01 signal sequence to clone VL region from phage panned library in pZB003.2 vector ( Figure 15 C).
  • the synthesized pZB003.2 vector is provided as SEQ ID No. 22.
  • SS02 signal sequence is introduced in the place of mating factor alpha 1 signal sequence (pre region).
  • SS02 is an engineered mating factor alpha factor 1 signal sequence including pre and pro region called as appS4. It was previously demonstrated that appS4 has 16 times better secretion ability than mating factor alpha 1 signal sequence including pre and pro region.
  • pZB003.2 and SS02- LCK cassette ( Figure 16 A) (SEQ ID No. 17) were used.
  • SS02 DNA cassette contains engineered alpha factor single sequence (appS4) coding region.
  • SS02 DNA cassette is synthesized through Gene Art.
  • pZB003.2 and SS02- LCK are digested at about 37 °C with Spel and Hindlll and ligated at about 4 °C further to create pZB003 (Tables 24 and 25: Figure 16 B).
  • the synthesized pZB003 vector ( Figure 16 C) is provided as SEQ ID No. 18 and deposited to MTCC with accession number MTCC 25127.
  • SS03 signal sequence is introduced in the place of mating factor alpha 1 signal sequence (Pre region).
  • Pre region is an engineered mating factor alpha factor 1 signal sequence including pre and pro region called as app8. app8 has 16 times better secretion ability than mating factor alpha 1 signal sequence including pre and pro region.
  • pZB003.2 and SS03-LC DNA were used for the constraction of the SS03 based secretion plasmid of LC .
  • SS03 DNA cassette contains engineered alpha factor single sequence (app8) coding region.
  • pZB003.2 and SS03-LCK DNA are digested with Spel and Hindlll at about 37 °C and ligated at about 4 °C further to create pZB003.3 (Tables 27 and 28; Figure 17 A & B).
  • the synthesized pZB003.3 vector ( Figure 17 C) is provided as SEQ ID No. 24.
  • SS04 signal sequence is introduced in the place of mating factor alpha 1 signal sequence (pre region).
  • SS04 is a Suc2p signal sequence which has secretion ability for various proteins in yeast.
  • pZB003.2 and SS04 DNA- LCK cassette SEQ ID No. 25
  • SS04 DNA cassette contains Suc2p signal sequence coding region.
  • pZB003.2 and SS04 DNA-LCK are digested with Spel and Hindlll at about 37°C and ligated at about 4°C further to create pZB003.4 (Tables 30 and 31 ; Figure 18 A & B).
  • the synthesized pZB003.4 vector (Figure 18 C) is provided as SEQ ID No. 26.
  • 5 ⁇ ig of the kappa and lambda light chain from secondary PGR pool representing the naive repertoire from healthy human donor along with phagemid vectors (kappa pZBOOl and lambda pZBOOl. l, respectively) are digested with Hindlll-HF and AscI at about 37 ° C for overnight in a total volume of about 100 pL.
  • the digested samples are gel ehited followed by ligation set up at about 4 ° C for overnight.
  • the 25-50 ng of ligation mixture is transformed into about 25 ⁇ . of TGI cells through electroporation wherein 3.0 mm cuvette is used with an optimal setting of 1800 volts, 600 ohm and 10 ⁇ , ⁇ .
  • Transformation efficiency is calculated by dilution plating and found to be in the range of about 10 8 to about 10 i 0 , preferably at ⁇ 10 8 .
  • the total numbers of cells are determined per vial of glycerol stocks through dilution plating and found to be 10 52 .
  • Colonies are inoculated in about 5 mL LB -Amp and plasmid is isolated. The isolated plasmids are checked for restriction digestion analysis. The insert release of -300 bp confirmed the presence of light chain, both kappa and lambda in the pool.
  • One vial of light chain pool (both kappa and lambda) are inoculated in about 100 niL of LB -Amp and grown for about 2-3 hours at about 37 ° C shaker-incubator followed by plasmid isolation by qiagen midi prep kit as per manufacturer's protocol.
  • the midi prepped DNA for both the light chains are confirmed with restriction digestion analysis before proceeding with incorporation of heavy chain into it. Few of the representative clones are used for plasmid isolation and confirmed by restriction digestion which indicated the -100% presence of light chain insert. Separate Midi prep is done to isolate light chain library DNA, both kappa and lambda from the pool. Midi prep DNA is again confirmed through restriction digestion before using for further insertion of heavy chain pool.
  • About 5fig of the kappa and lambda light chain library DNA along with secondary PCR pool of heavy chain are digested with Ncol and Xbal at about 37 " C for overnight in a total volume of about 100 iL.
  • the digested samples are gel eluted followed by ligation set up at about 4 ° C for overnight.
  • the 25-50 ng of ligation mixture is transformed into 25 ⁇ _ of TGI cells through electroporation wherein 1.0 mm cuvette is used with an optimal setting of 1800 volts, 600 ohm and 10 ⁇ .
  • Post recovery in recovery media about 200uL of transformed cells are spread on 144 mm plates and incubated overnight at about 37°C.
  • Transformation efficiency is calculated by dilution plating and found to be in the range of about 30 s to about 10 1J , preferably at ⁇ 10 8 .
  • the total numbers of cells are determined per vial of glycerol stocks through dilution plating and found to be 10 i2 .
  • Colonies are inoculated in 5 mL LB- Amp and plasmid is isolated.
  • the isolated plasmids are checked for restriction digestion analysis with Ncol and Xbal for heavy chain and Hindlll and Ascl for Kappa & Lambda light chains.
  • the insert release of -400 bp confirmed the presence of heavy chain, in kappa pool ( Figure 19 A & B) and lambda pool ( Figure 20 A & B).
  • the heavy chain along with kappa and lambda light chain secondary PCR pool containing DN A library are digested individually with Ncol and Xbal followed by ligation and transformation individually into TGI , highly competent E. coli cells.
  • About 1 ml of kappa and lambda bacterial glycerol stock are grown into about 200 ml LB-AMP medium at about 37°C until OD at 600 nm reaches 0.8.
  • M13K07 helper phage at multiplicity of infection (MOI) of 10 to the bacteria is added and incubated at about 37°C for another 30 minutes.
  • infected bacteria is centrifuged and the pellet is re-suspended into about 200 ml of LB with 100 ⁇ ig/ml ampicillin and 25 ⁇ g/ml kanamycin followed by growth at about 30°C for overnight at 250 rpm.
  • Suspension is spun down at about 8000 rpm for about 15 minutes at about 4°C followed by discarding the pellet.
  • Separated supernatant is mixed with PEG/NaCl solution in 1 ⁇ 4 volume of supernatant and the mixture is incubated on ice for about 1 hour.
  • the mixture is centrifuged at 10000 g for about 15 minutes and the phage pellet is re- suspended into about 20 ml of PBS.
  • Glycerol is added to a final concentration of 50% to the entire phage suspension and frozen in aliquots of about 1 ml at -80°C as phage library stock.
  • Glycerol stocks of both kappa and lambda bacterial library are mixed, inoculated and used for phage library generation.
  • helper phage the phage particles displaying the diversity are precipitated and purified, and stored as glycerol stocks for future use.
  • the estimated number of phage library that is derived from plaque forming assay is found to be about 10 l0 to about 10 11 , preferably- 10 11 pfu/mL. Formation of plaque indicates the functionality of the Phagemid library displaying Fab fragment which will be screened against Her2 antigen.
  • Panning experiments were performed to remove the non-binders from the naive pool followed by plaque formation assay to estimate the number of binders.
  • Estimation of binders was found to be ⁇ 10 7 which is four decades lower than the initial phage number indicating a successful panning.
  • the plan of the whole strategy is to transfer the specific binders from phage to yeast expression vectors in order to do the screening and sorting in yeast system.
  • An affinity based method is employed using a compatible method i.e., FACS to further select and rank the best binders.
  • the panned phage was amplified and ssDNA was isolated followed by PGR amplification to incorporate in yeast mating type vectors; for heavy chain and light chain incorporation.
  • the Fab library is developed by exploiting the mating system wherein light chain library and heavy chain library is cloned in different yeast expression vectors.
  • the kappa and lambda light chain PGR pool of panned molecules along with the in-house yeast expression vector (pZB003.1 & pZB003.2) exclusively designed and generated for light chains are digested with Hindlll and Ascl followed by ligation and transformation individually into TGI, highly competent cells.
  • HC chain pool and the respective vector (pZB002) are digested with Ncol and Not! followed by ligation and transformation into TGI, highly competent ceils. Transformation efficiency obtained for both heavy and light chain panned library are >10 7 cfu.
  • EBYiOO is used as a host for the cell surface display of the heavy chain library while YVH10 is used to express light chain library.
  • Post transformation the plates are incubated at about 30°C for 2-4 days to allow for growth of transformants.
  • Both heavy chain and light chain panned library are successfully transformed into yeast strains (EBYI OO-wraiA and YVH10) with an efficiency of >10 6 .
  • mating of the two grown haploid cells representing heavy chain and light chain libraries is performed by mixing equal numbers of haploid cells.
  • the mating efficiency is calculated as the number of diploid colonies in the double-selective plates divided by the number of total colonies in the single selective plates wherein the calculated mating percentage is -40%.
  • the diploid cells are enriched in double drop out media (ura " , Tip " ) prior to any growth and expression analysis. Saccharomyces cerevisiae 2N library having plasmids expressing heavy chain pool and light chain kappa pool are inoculated into 10 ml of SDCAA double drop out media and grown overnight at about 30°C ( 16-20 hrs).
  • the OD at 600nm of the overnight grown culture is measured and inoculated accordingly in about 10 ml SDCAA double drop out glucose media (uiiinduced culture) and about 10 mi 2XSGCAA media (induced culture) such that the final OD at 600nm becomes 0.2 to 0.3.
  • Uiiinduced and induced cells are grown for different time points ranging from 24 to 48 hours at about 20°C.
  • the expression of light chain and heavy chain are observed in significant percentages.
  • the light chain expression are probed by anti-His antibody and found to be >7 % ( Figure 22 A) while heavy chain which is probed with anti-e-Myc antibody are found to be appearing in double positive quadrant with biotiiiyiated Her2 at a percentage of 7.2 ( Figure 22 B).
  • variable light chain kappa and lambda light chains
  • heavy chain regions obtained firom synthetic antibodies/repertoire
  • yeast ScFv expression construct i.e., yeast ScFv expression construct (pZB004.4) was tested for expression of anti ⁇ Her2 ScFv gene sequence and binding with Her2 antigen.
  • Anti-Her2 genes, VH and VL were cloned into pZB004.4 vector in to MCS I and II, respectively, between NdellAscI and NcoI!Notl, enzymes.
  • Clones were transformed into yeast EBYIOO followed by induction for expression and binding studies as described earlier.
  • Flow cytometry analysis of induced yeast cells revealed interaction with Her2 antigen. Flow cytometry were carried out with biotinylated Her2 antigen, which is detected with streptavidin Alexa 633 conjugate.
  • anti c-myc antibody (alexa flour 488, conjugate) was used to detect expression of C-terminus c- rnyc tag.
  • the result revealed distinct double positive fluorescence signal indicating expression of Anti Her2 ScFv molecules on yeast cell surface ( Figure 23 ).
  • the present disclosure relates to the use of present phagemids and yeast expression piasmids in protein display technologies to express the proteins/antibody genes from naive and/or synthetic library.
  • phage display technology is used to clone and screen potential antibody genes with high to moderate affinity towards specific antigen. These genes are then transferred to yeast display plasmids for further screening and identification of lead molecules. Combining these two complementary technologies result in screening of highly diverse antibody libraries and developing new/lead antibody molecules against specific antigens.
  • the smooth transfer of clonal population from phage to yeast vectors is efficient since restriction enzymes used in MCS I and MCS II are identical with respect to the two expression systems.
  • variable heavy chain and light chain repertoire from naive and/or synthetic antibodies can also be directly cloned into the phagemid and yeast vectors of the present disclosure and desired results can be obtained.
  • intra-system transfer i.e., altering display format from Fab to ScFv or vice versa, or same format but different expression vector such as transferring from mating type vectors to bi-cistronic vector is possible via respective set of MCS enzymes.
  • the free transition across all possible systems and formats also provide a randomization of heavy and light chains which allows compensating the differences across two display systems while availability of a system wherein specific combination is preserved across systems is definitely a benefit.
  • the present vectors provide numerous advantages in protein display technology, including but not limiting to:
  • Intratransfer approach wherein display format can be altered from Fab to ScFv or vice versa, or the same fonnat can be transfenred from one yeast vector to another yeast vector, such as transferring from mating type vectors to bi-cistronic vector via respective set of MCS enzymes.
  • tcgacggcac ttatccgcct 1320 ggtactgagc aaaaccccgc taatcctaat ccttctctg aggagtctca gcctcttaat 1380 actttcatgt ttcagaataa taggttccga aataggcagg gtgcattaac tgtttatacg 1440 ggcactgtta ctcaaggcac tgaccccgtt aaaacttatt accagtacac tcctgtatca 1500 tcaaaagcca tgtatgacgc.
  • ttgtttgatt 240 cagaagcagg tgggacaggt gaacttttgg attggaactc gatttctgac taggttggaa 300 ggcaagagag ccccgaaagc ttacatttta tgttagctgg tggactgacg ccagaaaatg 360 ttggtgatgc gcttagatta aatggcgtta ttggtgttga tgtaagcgga ggtgtggaga 420 caaatggtgt aaaagactct aacaaatag caaatttcgt caaaaatgct aagaaatagg 480 ttattactga gtagtatttta tttaagtattgtgtgcac tgcgggggggggg 240 caa
  • tcgtagtctg ctttcgacag 1800 cgtcagggtg ctgctgaggc tgtaggtgct gtccttg tcctgctctg tgacactctc 1860 ctgggagtta cccgattgga gggcgttatc caccttccac.
  • ggaggtgtgg 1080 agacaaatgg tgtaaaagac tctaacaaa tagcaaattt cgtcaaaaat gctaagaaat 1140 aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgcctg cggtgtgaa 1200 taccgcacag atgcgtaagg agaaaatacc gcatcaggaa attgtaaacg ttaatatttt 1260 gttaaaattc gcgttaaatt ttgttaaat cagctcattttttaaccaat aggccgaaat 1320 cggcaaaatc ccttataaat caaaaqaata gaccgagata gggttg
  • gacatgattt 5820 atcttcgttt cctgcaggtt tttgttctgt gcagttgggt taagaatact gggcaatttc 5880 atgtttcttc aacactacat atgcgtatat ataccaatct aagtctgtgc tccttccttc 5940 gttcttcttcggag attaccgaat caaaaaaatt tcaaagaaac cgaaatcaaaa 6000 aaaagaata aaaaaaaat gatgaattga attgaaaagc tgtggtatgg tgcactctca 6060 gtacaatctg ctctgatgcc gcatagttaa gccagccc
  • gacttatcgc 3480 cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 3540 agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg 3600 ctctgctgaa gccagttacc ttcggaaaa gagttggtag ctcttgatcc ggcaaacaaa 3660 ccaccgctgg tagcggtggt tttttgttt gcaagcagcagattacgcgc agaaaaaaag 3720 aatctcaaga agatcctttq atcttttcta cggggtctga cggggtct

Abstract

The present disclosure relates to vectors for cloning and expressing genetic material including but not limiting to antibody gene or parts thereof, and methods of generating said vectors. Said vectors express the antibody genes in different formats such as Fab or scFv as a part of intertransfer system, intratransfer system or direct cloning and expression in individual display systems. In particular, phage display technology is used to clone and screen potential antibody genes in phagemid which is followed by the transfer of said genes to yeast vector for further screening and identification of lead molecules against antigens. The present vectors have numerous advantages including uniquely designed inserts/expression cassettes resulting in efficient and smooth transfer of clonal population from phage to yeast vectors resulting in efficient library preparation and identification of lead molecules.

Description

The present disclosure relates to the field of biotechnology, genetic engineering and immunology. Particularly, the present disclosure relates to vectors for cloning and expressing genetic material, and methods of generating said vectors. Any genetic material including but not limiting to genetic material obtained from naturally occurring antibody genes or parts thereof, artificially designed synthetic antibody genes or parts thereof, or a combination of both can be employed for cloning and expression using the vectors of the present disclosure.
BACKGROUND OF THE DISCLOSURE
Cell surface display is a technique that allows the target protein to be expressed on the cell exterior by fusing it to a carrier protein, which is typically a cell membrane associated protein or its subunit. Surface display technology is employed as library screening tool for protein engineering, directed evolution, and drug discovery. However, said display technology is associated with it's own merits and demerits.
For instance, the ribosome display method is technically more challenging due to relative instability of the RNA and the ribosomal complex. Another limitation of this technique is the inability to display a single chain protein such as ScFv. Intracellular selection methods, such as yeast-two-hybrid system or protein complementation assay directly rely on intracellular expression of the target protein. However, they come with several limitations including propensity to aggregate in intracellular scenario, low cellular half-life and most importantly the whole system needs to be tailored for a specific application depending on the type of antigen against which the screening is intended. Further, though phage display is widely accepted method, there are limitations on proper protein folding due to being a prokaryotic expression system and lack of post translational modifications of the displayed proteins. To overcome these limitations, yeast display platform, a eukaryotic display system can be employed. However, major challenge in case of yeast display system and similarly all other eukaryotic cell surface systems is the limited transformation efficiency setting limits on the library size that can be achieved which makes the entire process less efficient. Success of a protein/antibody library, in terms of screening against an antigen, lies in its independent representation of vast size without compromising on the diversity and functional size of the library along with secretion efficiency, processing efficiency and post translation efficiency amongst other factors. In this regard, the flexibility of display systems, such as phage and/or yeast display platforms, is an absolute essential criterion to achieve such an objective. The flexibility of display systems is contingent on the kind of expression vectors being used and whether compatibility exists between them. Further, the compatibility and complementarity of vectors signify the transfer of diversity from phage to yeast display system either via combinatorial or batch transfer approaches. Said compatibility and complementarity features are lacking in the presently employed synthetic constructs/vectors of phage and yeast display systems.
The instant disclosure is directed towards addressing the above limitations of the current technologies and therefore aims at providing vectors which accommodate and cross-transfer large and diverse protein gene libraries via a combinatorial process which thereby improves the potential of identifying, transferring, preserving and generating proteins with varied affinities and specificities.
STATEMENT OF THE DISCLOSURE This section contains a copy of independent claims. The present disclosure relates to a vector construct designed to clone antibody or a fragment thereof, said vector construct containing an expression cassette which comprises:
at least one leader sequence,
at least one cloning region for receiving a gene encoding a peptide or protein that selectively binds to a biologically active ligand,
at least one nucleotide sequence encoding constant region immunoglobulin heavy chain or constant region immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to constant region of a native immunoglobulin or fragments thereof, and
at least one recombinant tag sequence or selection coding nucleic acid sequence,
wherein, the at least one cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bglll, Bmtl, Hindlll, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof;
a vector construct designed to clone antibody or a fragment thereof, or, to transfer or receive an antibody or a fragment thereof from the vector construct as claimed in claim 1 , said vector construct containing an expression cassette which comprises;
a promoter sequence,
a leader sequence,
a nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system,
a first enzyme cleavage site,
a first recombinant tag sequence or selection coding nucleic acid sequence,
a first linker sequence,
a second enzyme cleavage site,
a first cloning region operably linked to a second cloning region in presence of a second linker sequence, wherein the cloning regions receive gene encoding a peptide or protein that selectively binds to a biologically active ligand,
a second recombinant tag sequence(s) or selection coding nucleic acid sequence(s), and a terminator sequence,
wherein, the first cloning region or the second cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bglll, Hindlll, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof;
a method of preparing the vector construct as described above, said method comprising steps of: a) synthesis of the expression cassette, b) linearization of a destination vector, and c) inserting the expression cassette into the linearized destination vector to obtain the vector construct;
a method of preparing library of vector constructs, said method comprising steps of; a) preparing the vector construct by the method as described above, b) cloning nucleotide sequences encoding for regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VH) and combinations thereof, into the cloning region of the vector construct to obtain the library, or, transferring the nucleotide sequences encoding regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VH) and combinations thereof, from the cloning region of one vector construct to the cloning region of another vector construct to obtain the library;
a method of screening and identifying antibody or a fragment thereof having desired functional characteristic(s), comprising steps of: (a) preparing the library of vector constructs by the method as described above and transforming said vector constructs into bacterial host cells, yeast host cells or a combination thereof, and (b) selecting the bacterial or yeast host cells expressing the antibody or fragment thereof having the desired functional characterise c(s);
a bacterial or yeast host cell, or a phage library or a yeast library thereof comprising the vector construct(s) as described above; and
an expression cassette provided by the vector constructs ) as described above wherein said expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 1 1 , SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.
BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES
The features of the present disclosure will become fully apparent from the following description taken in conjunction with the accompanying figures. With the understanding that the figures depict only several embodiments in accordance with the disclosure and are not to be considered limiting of its scope, the disclosure will be described further through use of the accompanying figures.
Figure 1 illustrates modification of pADL23c vector. Multiple restriction sites and backbone sequences were modified, described as modification - 1, modification - 2, modification - 3, modification - 4, respectively. Figure 2 illustrates generation of pZBOOl - phagemid vector with kappa light chain constant region
A) Schematic depiction of designed insert/expression cassette containing heavy chain CHI domain and ka constant light chain (CK) domain,
B) Analysis of independent clones from pZBOOl construct using BamHI and EcoRI enzymes
C) Analysis of independent clones from pZBOOl construct using Hindlll and Ncol enzymes
D) Schematic depiction of the pZBOOl vector comprising the insert/expression cassette designed to clone antibody library genes comprising variable antibody heavy chain and antibody light chain (kappa) in respective cloning sites.
Figure 3 illustrates generation of pZBOOl.l - phagemid vector with lambda light chain constant region.
A) Schematic depiction of designed insert/ expression cassette containing heavy chain CHI domain and Lambda constant light chain (CL) domain.
B) Analysis of independent clones from pZBOOl.l construct using PvuJJ enzyme.
C) Analysis of independent clones from pZBOOl.l construct using Ncol and Hindlll enzymes.
D) Schematic depiction of pZBOOl .l vector construct comprising the insert/ expression cassette designed to clone antibody library genes comprising variable antibody heavy chain and antibody light chain (lambda) in respective cloning sites.
Figure 4 illustrates modification of pRS314 vector. Multiple restriction sites were modified as described in the figure. Figure 5 illustrates generation of pZB004 - yeast bidirectional vector with antibody kappa light chain constant region.
A) Schematic depiction of designed insert/expression cassette containing heavy chain CHI domain and kappa light chain (CK) constant domain.
B) Analysis of independent clones from pZB004 construct using PvuII enzyme. C) Analysis of independent clones from pZB004 construct using EcoRV and Kpnl enzymes.
D) Analysis of independent clones from pZB004 construct using Ndel and Kpnl enzymes. E) Schematic depiction of pZB004 construct designed to clone antibody library genes comprising antibody variable heavy chain and antibody light chain (kappa) in respective cloning sites. Figure 6 illustrates generation of pZB004.1 - yeast bidirectional vector with antibody lambda light chain constant region.
A) Schematic depiction of designed insert/expression cassette containing heavy chain CHI domain and lambda light chain CL domain.
B) Analysis of independent clones from pZB004.1 construct using PvuII, Ndel & Not! and Ncol & Ascl enzymes in respective combinations.
C) Schematic depiction of pZB004. i construct designed to clone antibody library genes comprising antibody variable heavy chain and light chain (lambda) in respective cloning sites.
Figure 7 illustrates generation of pZB004.2 - yeast unidirectional vector with antibody kappa light chain constant region.
A) Schematic depiction of designed insert containing heavy chain CHI domain and kappa light chain CK domain.
B) Analysis of independent clones from pZB004.2 construct using HindJJJ, Spel & SacII enzymes in respective combinations. C) Schematic depiction of pZB004.2 vector construct designed to clone antibody library genes comprising antibody variable heavy chain and light chain (kappa) in respective cloning sites.
Figisre 8 illustrates generation of pZB004.3 - yeast unidirectional vector with antibody lambda light chain constant region. A) Schematic depiction of designed insert/expression cassette containing heavy chain CHI domain and lambda light chain CL domain.
B) Analysis of independent clones from pZB004.3 construct using Hindlll, Spel & SacII enzymes in respective combinations.
C) Schematic depiction of pZB004.3 vector construct designed to clone antibody library genes comprising antibody variable heavy chain and light chain (lambda) in respective cloning sites. Figure 9 illustrates modification of pRS314 vector. Multiple restriction sites were modified as described in the figure.
Figure 10 illustrates generation of pZB004.4 - yeast scFv vector. A) Schematic depiction of designed insert/expression cassette containing cloning regions (MCS I and MCS II) for antibody heavy chain variable domain and antibody light chain variable domain respectively.
B) Analysis of independent clones from pZB004.4 construct using EcoRV & Xhol enzymes.
C) Schematic depiction of pZB004,4 vector construct designed to clone antibody library genes comprising antibody heavy chain variable region and light chain variable region at respective cloning sites.
Figure 11 illustrates modification of p414GALl vector. Multiple restriction sites were moditied as described in the figure.
Figure 12 illustrates generation of pZB002 construct yeast mating vector with heavy chain constant region
A) Schematic depiction of designed insert containing heavy chain CHI domain
B) Analysis of independent clones from pZB002 construct using Spel-HF and Xhol enzymes B) Schematic depiction of pZB002 construct designed to clone antibody library genes comprising antibody heavy chain in respective cloning site.
Figure 13 illustrates modification of p416 GAL1 vector. Multiple restriction sites were modified as described in the figure.
Figure 14 illustrates generation of pZB003.1 construct yeast mating vector with Light chain lambda constant region
A) Schematic depiction of designed insert containing Lambda light chain CL domain with SS01 signal sequence B) Analysis of independent clones from pZB003.1 construct using Spel-HF and ^¾io/ enzymes
C) Schematic depiction of pZB003.1 construct designed to clone antibody library genes comprising antibody light chain (Lambda) in respective cloning site
Figure 15 illustrates generation of pZB003.2 construct yeast mating vector with Light chain kappa constant region A) Schematic depiction of designed insert containing Kappa light chain CK domain with SSOl signal sequence
B) Analysis of independent clones from pZB003.2 construct using Spel-HF and Xho/ enzymes
C) Schematic depiction of pZB003.2 construct designed to clone antibody library genes comprising antibody light chain (kappa) in respective cloning site
Figure 16 illustrates generation of pZB003 construct yeast mating vector with Light chain kappa constant region containing SS02 signal sequence
A) Schemati depiction of designed insert containing Kappa light chain CK domain with SS02 signal sequence B)Analysis of independent clones from pZB003 construct using Spel-HF and HindllJ-HF enzymes
C) Schematic depiction of pZB003 construct with SS02 signal sequence designed to clone antibody library genes comprising antibody light chain (kappa) at respective cloning site. Figure 17 illustrates generation of pZB003.3 construct yeast mating vector with Light chain kappa constant region containing SS03 signal sequence
A) Schematic depiction of designed insert containing Kappa light chain CK domain with SS03 signal sequence
B) Analysis of independent clones from pZB003.3 construct using Spel-HF and Hindlll-HF enzymes
C) Schematic depiction of pZB003.3 construct with SS03 signal sequence designed to clone antibody library genes comprising antibody light chain (kappa) at respective cloning site.
Figure 18 illustrates generation of pZB003.4 construct yeast mating vector with Light chain kappa constant region containing SS04 signal sequence A) Schematic depiction of designed insert containing Kappa light chain CK domain with SS04 signal sequence
B) Analysis of independent clones from pZB003.4 construct using Spel-HF and Hindlll-HF enzymes
C) Schematic depiction of pZB003.4 construct with SS04 signal sequence designed to clone antibody library genes comprising antibody light chain (kappa) at respective cloning site.
Figure 19 illustrates restriction digestion analysis of antibody genes cloned in pZBOOl .
A. Digestion with Hindlll and Ascl to confirm antibody Light chain Kappa insert,
B. Digestion with Ncol and Xbal to confirm antibody Heavy chain insert
Figure 20 illustrates restriction digestion analysis of antibody genes cloned in pZBOOl.l
A. Digestion with Hindlll and Ascl to confirm antibody Light chain Lambda insert,
B. Digestion with Ncol and Xinil to confirm antibody Heavy chain insert
Figure 21 illustrates restriction digestion analysis of antibody genes cloned in yeast mating type vectors.
A. Restriction enzyme digestion of antibody light chain genes (Kappa) cloned in pZB003.2 using Hindlll & Ascl.
B, Restriction enzyme digestion of antibody heavy chain genes cloned in pZB002 using
Ncol & No/7.
Figure 22 illustrates flow cytometry analysis to confirm antibody Fab expression.
A. Flow analysis with Anti His antibody.
B. Flow analysis with Anti c-myc antibody and biotinylated Her2 Antigen.
Figure 23 illustrates flow cytometry analysis to confirm antibody ScFv expression on surface of yeast after transformation with pZB004.4 containing anti-Her2 ScFv sequences. DETAILED DESCRIPTION OF THE DISCLOSURE
This section starts with a copy of our entire claim set.
The present disclosure relates to a vector construct designed to clone antibody or a fragment thereof, said vector construct containing an expression cassette which comprises;
at least one leader sequence,
at least one cloning region for receiving a gene encoding a peptide or protein that selectively binds to a biologically active ligand,
at least one nucleotide sequence encoding constant region immunoglobulin heavy chain or constant region immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to constant region of a native immunoglobulin or fragments thereof, and
at least one recombinant tag sequence or selection coding nuclei acid sequence,
wherein, the at least one cloning region of the expression cassette contains restriction sites selected from a group comprismg Ndel, Bglll, Bmtl, HindlU, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof.
In an embodiment of the present disclosure, the vector construct as described above is designed to receive antibody or a fragment thereof from a phagemid comprising at least one cloning region or from a yeast vector comprising at least one cloning region, or, to transfer antibody or a fragment thereof to a yeast vector comprising at least one cloning region; and wherein the at least one cloning region of the expression cassette, the phagemid and the yeast vector comprises one or more common restriction sites selected from a group comprising Ndel, Bglll, Bmtl, HindlU, AscI, Ncol, Xbal, Nhel, NotI and combinations thereof.
In another embodiment of the present disclosure, the expression cassette as described above comprises at least one terminator sequence lacking or comprising at upstream an enzyme cleavage site fused with a nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system; or, a nucleotide sequence encoding phage coat protein comprising at upstream at least one ribosomal binding site. In yet another embodiment of the present disclosure, the expression cassette as described above contains or lacks one or more promoter sequence, operator sequence or a combination thereof; the vector construct as described above is capable of expressing the antibody or a fragment thereof in a bacterial cell or a yeast cell; the restriction sites in the cloning region of the expression cassette as described above, the phagemid and the yeast vector is selected from combinations comprising Hindlll and AscI; Ndel, Bglll, Hindlll and AscI; Ncol and Xhal; Ncol and Notl; Xhal, Nhel and Notl; the promoter sequence is selected from a group comprising Gal 1 , Gal 1/10 and a combination thereof; the leader sequence is selected from a group comprising pelB sequence, alpha leader sequence, Aga2P leader sequence, alpha mating factor 1 secretory signal sequence (SSO i), engineered alpha factor (aapS4) signal sequence (SS02), engineered alpha factor (aap8) signal sequence (SS03), engineered alpha factor (aap8), signal sequence (SS04) and combinations thereof; the recombinant tag sequence or selection coding nucleic acid sequence is selected from a group comprising FLAG, c-Myc, V5, His and combinations thereof; the terminator sequence is selected from a group comprising alpha terminator, CYCl tenninator, and combinations thereof; the enzyme cleavage site is TEV protease cleavage site; the nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system is Aga2P protein; and the phage coat protein is selected from a group comprising pi l l protein, G8P and a combination thereof. In still another embodiment of the present disclosure, the nucleotide sequence encoding constant region immunoglobulin heavy chain or constant region immunoglobulin light chain having at least one mutation is selected from a group comprising first constant domain (CHI) of the immunoglobulin heavy chain or a fragment thereof, kappa constant region (Ck) of the immunoglobulin light chain or a fragment thereof and lambda constant region (CL) of the immunoglobulin light chain or a fragment thereof; and wherein the gene of the cloning region is selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain or a fragment thereof, lambda variable region (VL) of the immunoglobulin light chain or a fragment thereof and variable region of the immunoglobulin heavy chain (VH) or a fragment thereof. In still another embodiment of the present disclosure, the vector construct as described above is selected from a group comprising yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector and phagemid; and wherein the expression cassette is selected from a group comprising:
(a) sequentially,
a promoter sequence:
a leader sequence;
a cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Bmtl, Nhel, Notl and combinations thereof;
a nucleotide sequence encoding first constant domain (CHI) of the IgGl immunoglobulin heavy chain, wherein said constant domain comprises at least one mutation with respect to heavy chain constant domain of native immunoglobulin or fragment thereof;
recombinant tag sequences or selection coding nucleic acid sequences; and
a terminator sequence comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence,
(b) sequentially,
a promoter sequence;
a leader sequence;
a cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
a nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to light chain constant region of a native immunoglobulin or fragment thereof;
recombinant tag sequences or selection coding nucleic acid sequences; and
a terminator sequence,
(c) sequentially,
a first terminator sequence; a first set of recombinant tag sequences or selection coding nucleic acid
sequences;
a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to light chain constant region of a native immunoglobulin or fragment thereof;
a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
a first leader sequence,
a promoter sequence;
a second leader sequence;
a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xbal, Nhel, Notl and combinations thereof;
a second nucleotide sequence encoding first constant domain (CHI ) of the IgGl immunoglobulin heavy chain, wherein said constant region comprises at least one mutation with respect to heavy chain constant region of a native immunoglobulin or fragment thereof;
a second set of recombinant tag sequences or selection coding nucleic acid sequences; and a second terminator sequence comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence,
(d) sequentially,
a first promoter sequence;
a first leader sequence,
a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bg!II, Hindlll, Ascl and combinations thereof;
a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant domain comprises at least one mutation with respect to light chain constant domain of native immunoglobulin or fragment thereof; a first set of recombinant tag sequences or selection coding nucleic acid sequences; a first terminator sequence;
a second promoter sequence;
a second leader sequence;
a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xhal, Nhel, Not! and combinations thereof;
a second nucleotide sequence encoding first constant domain (CHI) of the IgGl immunoglobulin heavy chain, wherem said constant domain comprises at least one mutation with respect to heavy chain constant domain of native immunoglobulin or fragment thereof;
a second set of recombinant tag sequences or selection coding nuclei acid sequences; and a second terminator sequence comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence, and
(e) sequentially,
a promoter sequence;
a operator sequence;
a first ribosomal binding site;
a first leader sequence;
a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bg!II, Hindlll, Ascl and combinations thereof;
a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant domain comprises at least one mutation with respect to light chain constant domain of native immunoglobulin or fragment thereof;
a second ribosomal binding site;
a second leader sequence; a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xhal, Nhel, Noil and combinations thereof:
a second nucleotide sequence encoding first constant domain (CHI) of the IgGl immunoglobulin heavy chain, wherein said constant domain comprises at least one mutation with respect to heavy chain constant domain of native immunoglobulin or fragment thereof;
a recombinant tag sequence(s) or selection coding nucleic acid sequence(s): and
a nucleotide sequence encoding phage coat protein. The present disclosure further relates to a vector construct designed to clone antibody or a fragment thereof, or, to transfer or receive an antibody or a fragment thereof from the vector construct as claimed in claim 1 , said vector construct containing an expression cassette which comprises:
a promoter sequence,
a leader sequence,
a nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system,
a first enzyme cleavage site,
a first recombinant tag sequence or selection coding nucleic acid sequence,
a first linker sequence,
a second enzyme cleavage site,
a first cloning region operabiy linked to a second cloning region in presence of a second linker sequence, wherein the cloning regions receive gene encoding a peptide or protein that selectively binds to a biologically active ligand,
a second recombinant tag sequence(s) or selection coding nucleic acid sequence(s), and a terminator sequence,
wherein, the first cloning region or the second cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl, Ncol, Xhal, Nhel, Noil and combinations thereof. In an embodiment of the present disclosure, this vector construct is a scFv vector and is capable of expressing single-chain variable fragment (scFv) or a fragment thereof in yeast cell: wherein the cloning region of the expression cassette of said scFv vector and the vector construct further as described above comprises one or more common restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl, Ncol, Xbal, Nhel, Noil and combinations thereof; and wherein the promoter sequence is Gal 1 ; the nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system is Aga2P protein; the enzyme cleavage sites are protease cleavage sites selected from a group comprising Factor Xa cleavage site, TEV protease cleavage site and a combination thereof; the recombinant tag sequences or selection coding nucleic acid sequences are selected from a group comprising HA tag, c-Myc tag, FLAG and combinations thereof; the linker sequence is G4S sequence; the gene of the first cloning region is selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain or a fragment thereof, lambda variable region (VL) of the immunoglobulin light chain or a fragment thereof and a combination thereof; the gene of the second cloning region is variable region of the immunoglobulin heavy chain (VH) or a fragment thereof; and the terminator sequence is selected from a group comprising alpha terminator, CYCl terminator and a combination thereof.
In another embodiment of the present disclosure, the vector constructs as described above have a nucleic acid sequence selected from a group comprising SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24 and SEQ ID No. 26.
In yet another embodiment of the present disclosure, the vector constructs as described above further comprises regions selected from a group comprising origin of replication (Ori), antibiotic resistant marker, fl origin of replication, promoter and combinations thereof and combinations thereof; and wherein the vector constmcts are capable of expressing or displaying an antibody or a fragment thereof in a prokaryotic expression system, yeast expression system or a combination thereof.
In still another embodiment of the present disclosure, the CHI region has a nucleic acid sequence of SEQ ID No. 27, the Ck region has a nucleic acid sequence of SEQ ID No. 28, and the CL region has a nucleic acid sequence of SEQ ID No. 29; and wherein the Vk, VL and VH sequences are derived from naive antibody repertoire, synthetic antibody repertoire, or a combination thereof.
The present disclosure further relates to a method of preparing the vector construct as described above, said method comprising steps of: a) synthesis of the expression cassette, b) linearization of a destination vector, and c) inserting the expression cassette into the linearized destination vector to obtain the vector construct.
In an embodiment of the present disclosure, the method of preparing the vector construct as described above comprises confirming error-free vector clones by sequencing technique; the destination vector is selected from a group comprising pADL23c, pRS314, p414Gall, p416Gall and combinations thereof; the linearization is carried out by digestion with restriction enzyme(s); and inserting the expression cassette into the linearized destination vector is carried out by techniques selected from a group comprising homologous recombination, restriction digestion followed by ligation and a combination thereof.
The present disclosure further relates to a method of preparing library of vector constructs, said method comprising steps of: a) preparing the vector construct by the method as described above, b) cloning nucleotide sequences encoding for regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VST) and combinations thereof, into the cloning region of the vector construct to obtain the library, or, transferring the nucleotide sequences encoding regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof ( V! I ) and combinations thereof, from the cloning region of one vector construct to the cloning region of another vector constmct to obtain the library. In an embodiment of the above method of preparing library of vector constructs, the vector construct is selected from a group comprising phagemid, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector, yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector and single-chain variable fragment (scFv) vector; the Vk, VL and VH regions are derived from naive antibody, synthetic antibody or a combination thereof; the library of vector constructs is a synthetic library, naive library or a combination thereof; and wherein the transfer of the nucleotide sequence is carried out between the phagemid vector construct to the yeast vector construct or between yeast vector constructs.
The present disclosure further relates to a method of screening and identifying antibody or a fragment thereof having desired functional characteristic(s), comprising steps of: (a) preparing the library of vector constructs by the method as described above and transforming said vector constructs into bacterial host cells, yeast host cells or a combination thereof, and (b) selecting the bacterial or yeast host cells expressing the antibody or fragment thereof having the desired functional characteristic(s). In an embodiment of the present disclosure, the screening and identification is carried out by phage display in bacterial host cells, yeast display in yeast host cells or sequentially by phage display and yeast display; and wherein the desired functional characteristic(s) is selected from a group comprising affinity, specificity, antigenicity, manufacturability, generation of new epitopes, thermal stability, solubility, aggregation and catalytic activity and combinations thereof.
In another embodiment of the present disclosure, the screening and identification as described above is carried out by sequential phage display and yeast display comprising steps of:
(i) transforming the library of phagemid constructs into bacterial host cells to obtain phage antibody library;
(ii) screening the displayed antibody or fragment thereof against antigen(s) to obtain panned phage antibody library comprising selected clones;
(iii) transferring the antibody or fragment thereof from the selected clones into yeast vector followed by transformation into yeast host cells for expression and display of said antibody or fragment thereof; (iv) screening the yeast displayed antibody or fragment thereof against antigen(s) to identify the antibody or fragment thereof having desired functional characteristic(s).
In yet another embodiment of the above described method of screening and identifying antibody or a fragment thereof, the antibody or a fragment thereof is in Fab or Scfv format for cloning into phage or yeast vector: and wherein transformation efficiency into the phage vector is in the range of about 109 to about 1011; and transferring or transformation efficiency into the yeast vector is in the range of about iO6 to about 108.
The present disclosure further relates to a bacterial or yeast host cell, or a phage library or a yeast library thereof comprising the vector construct(s) as described above.
The present disclosure further relates to an expression cassette provided by the vector construct(s) as described above wherein said expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7,
SEQ ID No. 9, SEQ ID No. 1 1, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 59, SEQ ID No. 21 , SEQ ID No. 23 and SEQ ID No. 25.
Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular as is considered appropriate to the context and'or application. The various singular/plural permutations may be expressly set forth herein for the sake of clarity. Generally, nomenclatures used in connection with, and techniques of biotechnology, immunology, molecular and cellular biology, recombinant DNA technology described herein are those well-known and commonly used in the art. Certain references cited herein are expressly incorporated herein by reference. In case of conflict, the present specification, including definitions, will control. The materials, methods, figures and examples are illustrative only and not intended to be limiting. Furthermore, the methods and preparation of the various phagemid and yeast expression vectors disclosed employ, unless otherwise indicated, techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA technology, Polymerase Chain Reaction (PGR) and related fields. These techniques, their principles, and requirements are explained in the literature and are known. Before the expression vectors and the nucleic acid sequences which constitutes these vectors and other embodiments/methods of the present disclosure are disclosed and described, it is to be understood that the terminologies used herein are for the purpose of describing particular embodiments only and are not intended to be limiting. It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise.
As used herein, the term 'vector' refers to a DNA molecule used as a vehicle to artificially cany foreign genetic material into another cell, where it can be replicated and/or expressed. The vector of the present disclosure is capable of replicating and/or expressing in prokaryotic cell, eukaryotic cell, or a combination thereof.
As used herein, the term "Antigen" refers to any foreign, substance which induces an immune response in the body. As used herein, the term "antibody" or "a fragment thereof refers to an immunoglobulin which may be derived from natural sources or synthetically produced, in whole or in part. The terms "antibody" and "immunoglobulin" are used synonymously throughout the specification unless indicated otherwise. Further, as used herein, the term "antibody" includes both polyclonal and monoclonal antibody preparations and also includes the following: Chimeric antibody molecules, F(ab')2 and F(ab) fragments, Fv molecules, single chain Fv molecules (ScFv), dimeric and trimeric antibody fragments, minibodies, humanized monoclonal antibody molecules, human antibodies, fusion proteins comprising Fc region of antibody and any functional fragments arising out of these molecules, where derivative molecules retain immunological functionality of the parent antibody molecule. As used herein, the term "monoclonal antibody" in the present disclosure, refers to an antibody composition having a homogeneous antibody population. The antibody is not limited to the species or source of the antibody or by the manner in which it is made. The term encompasses whole immunoglobulins as well as fragments such as Fab, F(ab')2, Fv, and other fragments, as well as chimeric, and humanized homogeneous antibody populations that exhibit immunological binding properties of the parent monoclonal antibody molecule.
As used herein, "antibody fragment" is a portion of a whole antibody which retains the ability to exhibit antigen binding activity. The terms Fab or ScFv are used as antibody fragments with specific mention wherein the former being associated exclusively with heavy chain constant domain (CHI ) and light chain constant region for either kappa or lambda (Ck or CA).
As used herein, "Antibody display library" refers to a platform(s) expressing antibodies on the surface of cell or ceil-free suited for a screening methodology against target antigens. Herein, phage display library and yeast display library are used with accurate specification unless indicated otherwise.
As used herein, the terms "signal peptide" and "leader peptide" are used interchangeably. As used herein, the terms "cloning region", "multiple cloning site" and "MCS" are used interchangeably.
The present disclosure relates to vectors for cloning and expressing genetic material. In particular, the disclosure relates to generation of vectors to clone and express genetic material, including but not limiting to genetic material obtained from naturally occurring antibody genes, artificially designed synthetic antibody genes or parts of it, or a combination thereof.
The present disclosure provides phagemid and yeast vectors. In an embodiraent, the vectors of the present disclose include but are not limited to phagemid, yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector and scFv vector. The vectors are designed for cloning of large library of genes, and at the same time are flexible for transferring the cloned library between different vectors. In an exemplary embodiment, the vectors of the present disclosure are flexible for transferring the cloned library from phagemid to yeast vector(s) i.e. inter-transfer. The vectors of the present disclosure are equipped with multiple expression tags and genetic elements to ensure proper expression and screening of expressed gene products through high throughput screening platforms. In another exemplary embodiment, the vectors of the present disclosure are flexible for transferring the cloned library between different yeast vectors i.e. intra-transfer. In a non-limiting embodiment of the present disclosure, the phagemid vector comprises an expression cassette which includes homologous recombination sequences, ribosome binding sites, promoter, signal peptide/1 eader peptide, tags, multiple cloning sites (MCS), constant regions of heavy chain [constant region of IgGl heavy chain (CHI)] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof, arid genelllP phage coat protein. In an embodiment, the constant regions of heavy chain and/or light chain is derived from naive antibody or synthetic antibody. Additionally, the phagemid also comprises but not limiting to origin of replication (Ori), antibiotic resistant marker and fl origin of replication. In an embodiment of the present disclosure, the expression cassettes for phagemids are provided in Figures 2A and 3A respectively. In another embodiment of the present disclosure, the expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 1 and SEQ ID No. 3. In an embodiment of the present disclosure, the phagemid vector map is depicted in Figures 2D and 3D respectively. In another embodiment of the present disclosure, the phagemid vector has a nucleic acid sequence selected from a group comprising SEQ ID No. 2 and SEQ ID No. 4.
In another non-limiting embodiment of the present disclosure, the yeast vector is selected from a group comprising mating type heavy chain expressing vector, mating type light chain expressing vector, bi-directional bi-cistronic vector, unidirectional bi-cistronic vector and mono-cistronic ScFv display vector.
In yet another non-limiting embodiment of the present disclosure, the yeast vector comprises an expression cassette which includes promoter, signal peptide, tag, multiple cloning sites (MCS), enzyme cleavage sites, transcription terminator and optionally, constant regions of heavy chain [constant region of IgGl heavy chain (CHI)] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof, and linker sequence. In an embodiment, the constant regions of heavy chain and/or light chain is derived from naive antibody or synthetic antibody. In an exemplary embodiment, the yeast vector comprises constant regions of heavy chain [constant region of IgGl heavy chain (CHI)] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof when the antibody is to be displayed in Fab format. In a preferred embodiment, such yeast vector displaying Fab format is selected from mating type heavy chain expressing vector, mating type light chain expressing vector, bi-directional bi-cistronic vector and unidirectional bi-cistronic vector and mono-cistronic ScFv display vector. In another exemplary embodiment, the yeast vector lacks constant regions of heavy chain [constant region of IgG l heavy chain (CHI )] and light chain [constant region of kappa light chain (Ck) or lambda light chain (CL)] or fragments thereof when the antibody is to be displayed in scFv format. In a preferred embodiment, such yeast vector displaying scFv format is scFv vector. Additionally, the yeast vectors also comprise regions including but not limiting to origin of replication, fl origin of replication, antibiotic resistant marker, auxotrophic marker and centromere fused autonomously replicating sequence.
In an embodiment of the present disclosure, the yeast vectors are depicted in Figures 5E, 6C, 7C, 8C, IOC, 12C, 14C, 15C, 16C, 17C and 18C respectively. In another embodiment of the present disclosure, the yeast vector has a nucleic acid sequence selected from a group comprising SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 18, SEQ ID No. 24 and SEQ ID No. 26. The present disclosure further provides expression cassette/insert for expression of antibody or a fragment thereof. In an exemplary embodiment of the present disclosure, the expression cassette is provided for expressing the antibody in Fab format, scFv format or a combination thereof, in another exemplary embodiment, the expression cassette is designed to form a part of phagemid vector, yeast vector, or a combination thereof. In an embodiment, the expression cassette is designed for phagemid vector to express antibody in Fab format. In another embodiment, the expression cassette is designed for yeast vector to express antibody in Fab format, scFv format, or a combination thereof. In an embodiment of the present disclosure, the representative expression cassettes for yeast vectors are provided in 5 A, 6A, 7A, 8A, 10A, 12 A, 14A, 15 A, 16A, 17A and 18A respectively. In another embodiment of the present disclosure, the yeast expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11 , SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 17, SEQ ID No. 23 and SEQ ID No. 25.
The present disclosure further relates to generation of expression cassettes and vectors for cloning and expressing genetic material. In a non-limiting embodiment, said vector is a phagemid, yeast expression vector, or a combination thereof, as described above.
In an embodiment, the method of generating phagemid comprises synthesizing expression cassette/insert region and incorporating the said region into a linearized vector backbone (destination vector) to obtain the phagemid.
In an exemplary embodiment, the method of generating phagemid comprises steps of;
1. designing and syntheses of expression cassette comprising signal sequences, ribosomal binding sites (RBS), MCSs, tags, phage coat protein, respective constant region of light chain and heavy chain to align with Fab display format, and optionally along with homologous nucleotide length against destination vector to aid insertion of the expression cassette;
2. linearization of a destination vector such as pADL23c with restriction enzymes;
3. purification of respective fragments and set up of enzyme-mediated homologous
recombination to insert the synthesized expression cassette into the linearized vector to generate the phagemid. In another embodiment, confirmation of error-free phagemid clones is carried out by sequencing, and the variable region of heavy chain (VH) and light chain (Vk or VL) repertoire are cloned to destined location (MCS) by employing designated restriction enzymes in the of the generated phagemid vectors. In an embodiment, said variable region of heavy chain or light chain are derived from naive antibodies or synthetically generated antibodies. In another embodiment, naive repertoire or synthetic consensus pool of VH, Vk and VL are cloned into respective MCS of specific location in vectors to generate library constructs. Further, synthetic diversity is introduced into CDR regions of frame-work constructs to develop synthetic antibody gene library of phagemids. In an exemplary embodiment, the synthesized nucleotide sequence (expression cassette) of above step (1) is a large DNA segment of - 2 Kb size comprising two segments wherein segment 1 comprises of homologous region, operator, promoter, ribosome binding sites (RBS) 1, multiple cloning site (MCS) I, light chain constant region [kappa (Ck) or lambda (CL)] while segment 2 comprises RBS 2, MCS II, heavy chain constant region (CHI) followed by a phage protein Genelllp as fusion protein and homologous region. The synthesized expression cassette is incorporated into the linearized pADL23c vector backbone via an efficient, productive and ligation-free infusion cloning methodology which is a homologous recombination based cloning method. Light chain and heavy chain variables from naive and/or synthetic antibody repertoire are cloned into MCS I of segment I and MCS II of segment 2 of phagemid, respectively. Therefore, two designated phagemids solely based on kappa or lambda constant regions are generated, thus accommodating respective variable regions of kappa and lambda light chain pools into respective destination phagemid vectors (Figures 2D & 3D). For synthetic library, these phagemids are used to generate multiple clones in possible combinations of consensus heavy and light chain variable regions retaining the phagemid categorization/expression cassettes based on the constant regions of light chains. Further, synthetic diversity is introduced to designated restriction enzyme boundaries in CDR regions of Vh, Vk and νλ chains. On the other hand, naive repertoire with differentiation in kappa and lambda light chains is cloned directly into designated phagemids.
In another embodiment of the present disclosure, the method of generating yeast vector comprises designing the expression cassette, linearization of the destination vector followed by homologous recombination for insertion of the cassette or using restriction digestion followed by ligation of the cassette into the linearized vector to generate the yeast vector. Further, variable heavy chain and light chain repertoire is cloned to the destined location within the respective vector.
In an exemplary embodiment, the method of generating yeast vector comprises steps of;
1. designing and syntheses of expression cassette with desired promoters, terminators, signal sequences, MCSs, tags, restriction sites against destination vector to aid insertion, optional elements including linker, homologous recombination sequence, fusion protein for display, and optionally, respective constant region of heavy and light chains to align with Fab display format or lack of said constant region of heavy and light chains if the antibody is to be displayed in ScFv format:
2. linearization of destination vector such as pRS314, p414GALl, or p416GALl with restriction enzymes;
3. purification of respective fragments and set up of enzyme-mediated homologous recombination for insertion of synthesized expression cassette into linearized destination vector; or setting up restriction digestions and ligations to incorporate synthesized cassette into linearized vector to generate the yeast vector.
In another embodiment, confirmation of error-free yeast vector clones is performed by sequencing, and variable regions heavy chain (VH) and light chain (Vk or VL) repertoire are cloned into destined MCS location with designated restriction enzymes in the respective yeast vectors. In an embodiment, said variable region of heavy chain or light chain are derived from aive antibodies or synthetically generated antibodies. In another embodiment, naive pool and/or synthetic pool of Vh, Vk and νλ, are transferred from phagemids to yeast vectors or these regions are directly cloned into respective MCS of yeast vectors to generate eukaryotic antibody gene library of constructs.
In another exemplary embodiment, the representative yeast vectors are depicted under Figures 5E, 6C, 7C, 8C, IOC, I2C, 14C, 15C, 16C, 17C and 58C respectively. Apart from restriction sites and related compatibility factors, other characteristics such as display format have been featured in yeast vectors, as exemplified by Fab and ScFv format, while Fab format is further projected via expression systems: 1 ) mating type yeast vector, comprising genes encoding the two different heavy and light chains on different vectors in different yeast strains yielding a larger library size in Fab format; 2) bi-cistronic yeast vector wherein single yeast display vector is constructed comprising two expression cassettes driven by identical or different inducible promoters. This bi-cistronic yeast vector format lead to the production of stoichiometric amounts of separate light chain and heavy chain proteins and thus optimize the yield of functional Fab antibodies; and 3) ScFv vector for cloning ScFv fragment of antibody gene with a specific length linker separating the VH and VL regions.
In a non-limiting embodiment, the yeast vectors of the present disclosure have suitable fusion tags for fluorescence based detection and separation. The protein tags are placed as both N- terminal and C-terminal tags as applicable. The utility of these tags are multiple, including but not limiting to detection, isolation, purification and assay development.
There are several inherent features of surface display technology via using a suitably designed vector that would make it a seemly protein/antibody library screening tool against a specific antigen/protein. First, the display of a combinatorial protein library on the cell surface establishes a physical link between DNA and protein, conveniently and efficiently allowing the use of high throughput methods such as ELISA or fluorescence-activated cell sorting (FACS) in a quantitative manner. Second, the target substrates or ligands/receptors are directly accessible to proteins displayed on the surface without the need of crossing the ceil membrane barrier, thus avoiding any labor-intensive protein purification steps being required. Third, cell attachment stabilizes proteins displayed on the surface. Owing to the design of display system and their inter-connectivity, it is necessary to make sure that there is no loss of molecules while being transferred to another system, which should be again be error free. The same is successfully achieved in the present disclosure which provide vectors for smooth and error-free transfer of genes from prokaryotic/phage display system to eukaryotic/yeast display system.
In an embodiment of the present disclosure, the commercially available vectors pADL23c, pRS314 and p414GALl & p416GALl were employed for designing the vectors for phage and yeast display platforms, respectively. For efficient cloning of variable heavy chains and light chains from naive or synthetic antibody repertoire in respective display systems and transfer across display systems, restriction enzymes sites were carefully provided in such a way so that they are absent in the vector backbone, constant regions of heavy & light chains, tags, display proteins such as Genelllp or G3P for phage vector and Aga2P for yeast vector, leader and terminator sequences. Moreover, said uniquely designed and placed restrictions sites should not be present in the designed consensus sequence of variable regions - VH (7 families), Vk (4 families) and VL (3 families) chains. In addition, boundary enzymes selected for incorporation of synthetic diversity across all CDRs are unique and non-existent in any of the vectors carrying synthetic antibody gene repertoire. Accordingly, the vectors of the present disclosure are uniquely designed to comprise specific restriction sites for inter- transfer (i.e. transfer of antibody genes from a vector of one expression system to another) as well as intra-transfer (i.e. transfer within the vectors of the same expression system). In an embodiment, the vectors of the present disclosure are capable of intersystem transfer viz. transfer of antibody genes from phage system to yeast expression system. In another embodiment, the vectors of the present disclosure are capable of intra-system transfer i.e., altering display format from Fab to ScFv or vice versa, or same format but different expression vector such as transferring from mating type yeast vectors to bi-cistronic yeast vector via respective set of MCS enzymes. In an embodiment, the cloning regions (MCS) of the vectors i.e. phagemid and yeast vectors comprise uniform restriction sites selected from a group comprising Ndel, Bglll, Bmtl, Hindlll, Ascl, Ncol, Xbal, Nhel, Noil and combinations thereof. In an exemplar}' embodiment, the MCS I/MCS region of phagemid vector and yeast vectors (yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector and scFv vector) for cloning variable light chain sequence comprises restriction sites selected from Ndel, Bglll, Hindlll, Ascl and any combination thereof. In another exemplary embodiment, the MCS II MCS region of phagemid vector and yeast vectors (yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector and scFv vector) for cloning variable heavy chain sequence comprises restriction sites selected from Ncol, Xbal, Nhel, Noil and any combination thereof. In a preferred embodiment, the cloning region for variable light chain (MCS I/MCS) comprises combination of restriction sites selected from Hindlll and Ascl, and Ndel and Ascl. In another preferred embodiment, the cloning region for variable heavy chain (MCS I/MCS) comprises combination of restriction sites selected from Ncol and Xhal, and Ncol and Noil.
The present disclosure further relates to the application of instant vectors in constructing a protein library. In an embodiment, the protein library is an antibody library. In another embodiment, the antibody library includes but is not limited to synthetic antibody gene expression library, naive antibody library, or a combination thereof.
In the present disclosure, the vectors as described above are employed in a method of generating antibody gene expression library including but not limiting to synthetic antibody gene expression library, naive antibody gene expression library or a combination thereof wherein said method comprises screening procedure for specifi antigen(s), by employing combinatorial tools.
In an exemplary embodiment, the combinatorial tools include phage display technology and yeast display technology. In another embodiment, the method employs screening by phage display technology alone, yeast display technology alone, or a combination of phage and yeast display technology to create antibody gene expression library. In a preferred embodiment, the method employs screening by phage display technology sequentially followed by yeast display technology to create antibody gene expression library.
In a non-limiting embodiment of the present disclosure, the synthetic antibody gene expression library allows isolation of unique antibody molecules with desired functional properties for a specific therapeutic target i.e., antigen, with enhanced affinity and specificity. In another non-limiting embodiment of the present disclosure, the desired functional properties of the antibodies are selected from a group comprising, but not limiting to affinity, specificity, manufacturability, generation of new epitopes, thermal stability, antigenicity, solubility, aggregation and catalytic activity, or any combination thereof and any other properties related to successful product commercialization. In yet another non-limiting embodiment of the present disclosure, the method of generating antibody gene expression library includes sequentially exploring phage display technology and yeast display technology which allows in harnessing larger set of antibody gene diversity, a character of phage based library. The antibody clones are thereafter screened through yeast display system. Use of yeast system for antibody gene expression is advantageous because of eukaryotic protein translation, processing and proper folding of the antibody products on ceil surface. Further, yeast expression allows proper interaction with antigenic targets with high specificity. Information obtained using these two complementary systems generate "lead molecules" (i.e., antibodies specific to an antigen) with higher success rate in terms of commercialization potential. The vectors of the present disclosure successfully aid in generating antibody gene expression library by the sequential phage display technology and yeast display technology due to the various features of the vectors as described above.
The phagemid and yeast vectors of the present disclosure accommodate and cross-transfer large and diverse antibody gene libraries via an error-free process which thereby improves the potential of identifying, transferring, preserving and generating unique/lead molecules against multitude of antigens with varied affinities and specificities.
In a non-limiting embodiment of the present disclosure, the prokaryotic phage display surface expression system is employed in the present disclosure to accommodate large antibody gene library about I09 to about 10" and preferably >10H in such a way that the widespread diversity inherent in suc library is maintained. At the same time, since using a prokaryotic screening system may not be best for identifying superior functionality of antibody molecule, the phage display system is therefore integrated with eukaryotic yeast display platform that allows post translaiional modifications for superior functionality. To achieve this feat, the phagemid vectors for cloning and expression of highly diversified antibody gene library (>10H clones) are designed and employed in the present disclosure. These gene libraries are gathered either from artificially designed and chemically synthesized oligonucleotides or from naturally occurring antibody gene sequences. Ail sets of vectors are designed with genetic elements as described in the above paragraphs which ensure high level of expression of antibody genes as fusion proteins as well as multiple protein tags which allow efficient isolation and purification of targeted antibody genes.
In a specific embodiment of the disclosure, the strategy is to first screen a large antibody gene library through phage display technology, wherein the selected clones thereafter are re-cloned in yeast display vectors to represent the antibody gene formats including but not limiting to ScFv or Fab or other antibody formats. Therefore, the phagemid vectors of the present disclosure are designed in such a way that preliminary screening of antibody genes are completed through phagemid and then the clones are transferred to various yeast expression vectors to express different antibody gene formats including but not limiting to ScFv, Fab or other antibody formats. The phagemid vectors of the present disclosure are compatible for transferring the cloned genes to multiple types of yeast display vectors. The present yeast expression vectors are al so unique in terms of cloning and expression of different formats of antibody genes including but not limiting to ScFv, Fab and other formats. Further, the present yeast expression vectors are used either for transferring the partially screened clones from phage display system to yeast display system or to directly generate naive or synthetic library in the yeast systems either combinatorially or non-combinatorially, wherein the later strategy preserves a specific combination of heavy chain and light chain being transferred directly from phage display system. Transfer of clones preferably takes place preferably via restriction digestion based methods into yeast strains. Restriction sites for gene transferring or new cloning are carefully and uniquely designed to render the gene transfer compatible between different vectors. The yeast expression plasmids contain multiple fusion protein tags and cleavage sites to ensure expression of full length proteins and designed to be isolated and purified through high throughput methodologies. Multiple variants of signal sequences were used to optimize the secretion of various antibody formats once expressed inside yeast. In an embodiment, high throughput methodology includes but is not limited to ELISA, fluorescence-activated cell sorting (FACS), high throughput bead based selection methods, cell separation technologies, automated high throughput microscopy, magnetic separation technology and combinations thereof. The selected clonal populations are also useful in rapid purification of antibody gene product using strategically positioned protein cleavage sites. Thus, the present vectors and methods tap both diverse and unique antibody repertoire of antibody gene library based on unique design and exclusive screening/selection criteria. The vector design, expression profiling and screening strategies adopted herein enables efficient transition between phage to yeast display platforms, or between various vectors themselves. The designing also accommodates the non-combinatorial transfer of clones obtained from phage display screening to yeast display system. The phage display accommodates the library size (>l0n) for primary screening which is focused on stringency and specificity of antibody-antigen interaction in a high-throughput format and the screened molecules again go through a randomization process to mimic native display via yeast platform. The unique set of restxiction enzymes/sites used in both phagemids and yeast vectors of the present disclosure enables the transfer of heavy and light variable chains without an introduction of any amplification based methodologies such as PGR, thereby preserving the existing screened diversity of the library. Such an approach is very important/critical for successful generation of antibody gene libraries and screening for lead antibody molecules/products. Thus, each kind of vectors (vectors for phage display and vectors for yeast display) contribute combinatorial ly to the pipeline of developing functionally specific yet structurally varied antibody moieties/lead molecules. The expression procedure also ensures a unique display of Fab moiety or such type of antibody fragments on phage while Fab and scFv fragments or similar antibody fragments display on yeast surface. In addition, the yeast display platform has a provision of selecting vectors with bicistronic and mating type approach to display Fab or similar antibody fragments. This particular strategy, especially mating type, is adopted to circumvent the issue of poor transformation efficiency generally observed in yeast cells when compared with E. coli transformation efficiency, thereby screening more number of clones. The overall process with multiple rounds of selection on an antigen or on antigen-expressing cells via two different display systems is extremely valuable to positively or negatively select a range of desired antibody properties, such as affinity, specificity, manufacturabiiity and catalytic activity. The strategic design and combinatorial use of the vectors of the present disclosure enables to preserve diversity in the antibody gene library that is capable of identifying unique molecules against varied antigenic targets. The present vectors and their employment as a part of two different display systems thus helps in the generation of antibody gene libraries including but not limiting to na'ive or synthetic libraries of human antibodies with high diversity which serve as a tremendous resource for new and functionally improved antibody identification and further commercial development.
Taken together, in phage display technology, the phagemid vectors of the present disclosure are used to clone and screen potential antibody genes with high to moderate affinity towards specific antigen. These genes are then transferred to the yeast display vectors of the present disclosure for further screening and identifying lead molecules. Use of these two technologies by employing the present vectors is beneficial as phage display technology allows cloning and expression of large diversified antibody libraries while yeast display technology is superior in terms of eukaryotic expression system and proper protein folding. Therefore, yeast display technology- helps in mimicking antibody structural motifs for better antigen recognition when expressed on surface of yeast cell.
Thus, combining these two complementary technologies by employing the prokaryotic and eukaryotic vectors of the present disclosure is advantageous in screening highly diverse antibody libraries and developing new antibody molecules against specific antigens. The lead molecules identified have higher potential for productization as the present strategy accounts for higher antibody library diversification, screening through eukaryotic systems and incorporation of rational designing.
In an embodiment of the disclosure, the unique/critical features of the vectors of the present invention are further summarized in table 1.
Table 1 : Features of the present vectors
Figure imgf000035_0001
development display final
antibody Fab format
Designed for stable Designed for Designed for high Designed for high Designed for high and High copy high expression. expression. expression. expression.
number Maintains copy Maintains copy Maintains copy Maintains copy number in yeast number in yeast number in yeast number in yeast
Independent and Introduced an Introduced an Introduced an Introduced an individual exclusive exclusive exclusive exclusive representation of Fab recombination recombination recombination recombination on surface based based based based
transformation. transformation. transformation. transformation.
Unique restriction Uniquely Uniquely designed Uniquely designed Uniquely designed enzyme sites and designed expression cassette expression cassette expression cassette design of expression expression and Engineered and Engineered and Engineered cassette to cassette and Multiple Cloning Multiple Cloning Multiple Cloning accommodate Engineered Sites compatible Sites compatible Sites compatible antibody repertoire Multiple Cloning with phagemid with phagemid with phagemid
Sites compatible
with phagemid
Featured an easy Added feature to Added feature to Added feature to Added feature to modification at DNA Improve Improve Improve Improve level without major transformation transformation transformation transformation alteration of efficiency efficiency efficiency efficiency backbone vector
Multiple tags to Maintains a Maintains a Maintains a Maintains a confirm expression conserved conserved genetic conserved genetic conserved genetic genetic element element required element required element required for required for for amplification in for amplification amplification in amplification in bacteria and in bacteria and bacteria and bacteria and compatible for compatible for compatible for compatible for future future future
future modifications. modifications. modifications. modifications.
improved Cleavable tag to Cleavable tag to Cleavable tag to Cleavable tag to purification of purify antibody purify antibody Fab purify antibody- purify antibody Fab protein ScFv Fab and ScFv
Important part of a Accommodates Accommodates Accommodates Accommodates display system that >10s clone > 108 clone diversity 1 i f clone >108 clone diversity can accommodate diversity with with compatible diversity with with compatible approximately or compatible display system. compatible display display system. greater thanl Ou display system. system.
clones.
No additional PGR No additional No additional PGR No additional PGR No additional PGR based method PGR based based method while based method based method while required while method required generating or while generating generating or generating or while generating transferring clones or transferring transferring clones transferring clones or transferring clones
clones
High throughput Compatible for Compatible for in Compatible for in Compatible for in assay compatibility in vitro assay. vitro assay. High- vitro assay. High- vitro assay. High- High-throughput throughput assay throughput assay throughput assay assay compatible compatible compatible compatible
The present disclosure is further described with reference to the following examples, which is only illustrative in nature and should not be construed to limit the scope of the present disclosure in any manner.
All the biological materials employed in the present disclosure/examples were obtained from outside India.
EXAMPLES
Materials employed:
The following materials were employed to arrive at the present examples:
1 Kb Ladder (Invitrogen, USA); Agarose (SIGMA, USA); Gel elution Kit (Qiagen, USA); Mini prep Kit (Qiagen, USA); Taq Polymerase (NEB, USA); dATP (NEB, USA); T4 DNA ligase (NEB, USA); LB-Agar, dam-idem- (NEB, USA), Neb5alpha (NEB, USA); Ampiciliin (MP Biomedicals, USA); NcoI-HF, (NEB, USA); Xbal, (NEB, USA); Hindlll-RF, (NEB, USA); AscI (NEB, USA); HindiUAFF, (NEB, USA); AscI (NEB, USA); Noil (NEB, USA), Spel-HF (NEB, USA), SacII fNEB, USA), (NEB, USA); TGI ceils (Lucigen, USA); T4 DNA ligase (NEB, USA); PGR purification Kit (Qiagen, USA); LB-Agar; Mini prep Kit (Qiagen, USA); LB-Broth; Ampiciliin (MP Biomedicals, USA); Kanamycin (MP biomedicals, USA); Infusion HI) (Clontech, USA); Glycerol (Fischer Scientific, USA); Dextrose (Merck, USA); Cas-amino acid (BD, USA): Yeast Nitrogen Base (SIGMA, USA); Di sodium hydrogen Phosphate (SIGMA, USA); Galactose (SIGMA, USA); YPD broth (SIGMA, USA); Ura Trp double drop out supplement (Clontech,USA).
Further, the following vector constructs/vector backbones were deposited with Microbial Type Culture Collection and Gene Bank (MTCC), India.
Figure imgf000038_0002
Figure imgf000038_0001
The success of antibody libraries such as naive or imraurie or synthetic libraries solely depends on the unique design which has to be diverse and on final library size which should be sufficiently large. Any antibody library size & diversity and antibody specificity & affinity are directly linked. Apart from the crucial design of variable light chain and heavy chain repertoire - synthetic or naive; development of a system especially different expression vectors to accommodate the large repertoire is extremely important. In addition to the stated fact, aligning the usefulness of each vector strategically is the key feature to successful library generation and screening.
Current method involves the development of twro unique Phagemid vectors in order to accommodate and express antibodies in Fab format with specific modifications designated towards kappa and lambda light chain constant regions along with heavy chain constant region, along with other features/modifications.
Developed vectors are used to accommodate antibody repertoire from natural source and synthetically designed source, interchangeably so. Post generation of naive or synthetic phage libraries, these are used for screening against target antigens of various immune-oncology network.
The method involves the use of present phagemids and yeast expression plasmids in separate protein display technologies to express the proteins/antibody genes from naive and/or synthetic library. Firstly, phage display technology is used to clone and screen potential antibody genes with high to moderate affinity towards specific antigen. These genes are then transferred to yeast display plasmids for further screening and identification of lead molecules. Combining these two complementary technologies result in screening of highly diverse antibody libraries and developing new/lead antibody molecules against specific antigens. The smooth transfer of clonal population from phage to yeast vectors is efficient since restriction enzymes used in MCS I and MCS II are identical with respect to the two expression systems. These carefully placed restriction enzyme sites allow transferring selected population of variable light chains from MCS I of Phagemid to MCS I of any yeast vector while heavy chains are relocated to MCS II of any yeast vectors. Apart from intersystem transfer, intra-system transfer i.e., altering display format from Fab to ScFv or vice versa, or same format but different expression vector such as transferring from mating type vectors to bi-cistronic vector is possible via respective set of MCS based restriction enzymes. The free transition across all possible systems and formats also provide a randomization of heavy and light chains which allows compensating the differences across two display systems.
EXAMPLE 2
Generation of Phagemid vector:
To obtain a highly efficient and functionally large protein/peptide library such as antibody library, the following important considerations were taken: 1 ) Efficient generation of functional and large antibody repertoire with either PGR amplified natural pool or in silico designed and synthetically developed pool of molecules in phagemid vectors; 2) Chosen antibody format and compatible cloning & expression vector, which would permit the rapid downstream analysis of selected clones as exemplified by compatibility with suitable screening method followed by transferring of selected clones for several subsequent characterization experiments. In order to accommodate large number of molecules in Fab format, two step cloning method was adopted confirming the presence of both types of inserts i.e., light chain and heavy chain variable regions, at the construction level. Herein, the Phagemid vectors are with bicistronic operon having specific human antibody constant regions attached for both light chains (Ck or C & CI or CL) and heavy chains (human IgGl-CHl domain). Other essential features such as ribosome binding site, PelB signal sequence, multiple cloning sites (MCS I for light chain repertoire and MCS II for Heavy chain repertoire), FLAG and c-Myc tags are present in the phagemid vectors. The tags are associated in continuation of CHI domain and will be used for detection of Fab expression. IgGl-CHl domain is linked with phage coat PHI protein, GenelllP. As a part of Fab display format, heavy chain is displayed on phage in an associated form through expressed GenelllP protein while the light chain is expressed as separate fragment, secreted into the periplasm, where it pairs with the heavy chain and completes the display configuration. An amber stop codon (TAG) is strategically placed between the antibody genes and phage GenelllP protein enabling the production of Fab fragments in a non-suppressor strain of E. coli as exemplified TGI cells. Pool of light chain variable regions will be cloned into MCS I region consisting of Ndel, Bglll, Hindlll and AscI restriction sites while heavy chain variable regions was destined in MCS II which contains Ncol, Xhal, Nhel and Noil sites. The design and employment of restriction enzymes was based on their low probability to cut within human variable heavy and light chain coding regions. Additionally, they produce overlaps of 4 nucleotides or more leading to optimal cloning efficiency. The enzymes do not depend on methylation and their efficiency in recommended double digestions is more that 90 %. These restriction sites are maintained constant across multiple vectors in various expression systems such as yeast. To maintain the cloning sites throughout, there were several modifications that were made in Phagemid and subsequent vectors in yeast. As described above, these vectors are used to accommodate pool of nucleotide sequences of both naive and synthetic origin, therefore several unique changes were incorporated to ease library generation process and subsequent transfer into yeast. These changes also diminished specific restriction sites or certain peptides without changing the amino acid compositions or frame of translation. Some of the modifications carried out in the vector backbone and other individual elements/sequences are as follows:
1. Noil Eagl, Spel, Xmal, Srnal, Sfil (SEQ ID No. 30, 2045 bp to 2106 bp) are few of the restriction enzymes that were removed from the pADL23c vector (Figure i).
2. EcoRI (SEQ ID No. 30, 2004 bp to 2009 bp) and BstXI (SEQ ID No. 30, 2116 bp to 2127 bp) enzyme sites from vector backbone are modified.
3. Specific regions (SEQ ID No. 30, 2108 bp to 2128 bp and SEQ ID No. 30, 2132 bp to 2161 bp) were removed from pADL23c vector backbone.
4. BamHI restriction site (SEQ ID No. 30, 2754 bp to 2760 bp) was modified from GenelllP protein.
5. BstEII, ( SEQ ID No. 27, 2882bp to 2888 bp) Bsu36I (SEQ ID No. 27, 2779 bp to 2786 bp) and e/ (SEQ ID No. 27, 2733 bp to 2738 bp) enzyme sites were modified in the CHI region.
6. HinclIII site was modified from c-Myc tag (SEQ ID No. 2, 2958 bp to 2963 bp).
7. BlpJ (SEQ ID No. 28, 2345 bp to 235 lbp) was removed from CK. orne of the aforesaid changes are also highlighted in Figure 1 of the present disclosure.
As can be understood, phagemid vectors being the first step to generate and screen libraries (naive or synthetic antibody libraries) were designed with utmost attention considering various subsequent processes in mind. Taken together, this was the most efficient route for library construction and move along with the screening.
Considering ail modifications and aim in mind, the insert/expression cassette was designed for kappa (Figure 2A and SEQ ID No. 1) and Lambda (Figure 3A and SEQ ID No. 3), and synthesized followed by incorporation of the insert/expression cassette into the commercially procured pADL23c vector backbone which was subsequently subjected to several modifications before linearization and cloning of the insert/expression cassette. pADL23c was used as a vector backbone towards the generation of two different Phagemid vectors. These Phagemid vectors will be majorly differentiated through the light chain constant regions i.e., kappa and lambda light chain constant regions. Homologous recombination based approach was adopted to clone the insert/expression cassette into the modified pADL23c backbone. Synthesized kappa-insert and lambda-insert constructs were transformed into dam-Idem- cells and respective DNA were isolated in bulk quantity using midi prep kit from qiagen for further digestion. Strategies for cloning of kappa insert was slightly different in comparison to the cloning of lambda insert. About 10 ^ig of pADL23c was linearized using BamHI-HF and EcoRI-HF enzymes while about 5 g of insert-kappa was digested with Sfil enzyme. On the other hand, about 5 ig of lambda- insert was first digested with Pvul at about 37°C for about 2 hours followed by addition of Sfil at about 37°C for about 2 hours which resulted three bands wherein the desired band size was ~2.3 kb. Linearized vector pADL23c and digested kappa-insert and Lambda-insert are gel eluted wherein excised gel is dissolved by mixing about 3 volumes of Buffer QX1 solution. About 30 ,u,L of QIAEX II beads are added by vortexing for 30 seconds followed by incubation at about 50°C for about 10 minutes. Series of washes are given to beads; first with about 500μΕ of QX1 followed by 2 washes with about 500 μ,Ε of PE buffer. DNA is eluted with about 30 μΕ of nuclease-free water. Tables 2-4 below depicts the components/reagents used to linearize pADL23c vector and generation of kappa-insert and lambda-insert based phagemid vectors.
Table 2
Figure imgf000042_0001
Table 4
Figure imgf000043_0001
Infusion reaction was set up for vector and insert, kappa and lambda inserts (Table 5) followed by incubation at about 50 °C for about 15 minutes. Post incubation about 2.5 μΐ of the In-Fusion reaction mixture was added to the 50 uL Stellar competent ceils. The reaction mixture was incubated for about 30 minutes on ice followed by addition about 500 μΐ. SOC media for recovery of transformed cells. Cells were plated on LB agar plates with ampicillin followed by incubation for overnight at about 37 °C. Colonies appeared on the following day and were inoculated in 5 mL LB- Amp and plasmid was isolated. The isolated plasmids were checked for restriction digestion analysis with BamHIIEcoRI and NcoIIHindlll and confirmed for the presence of kappa insert (Figure 2 B & C) whereas for lambda vector, the clones were tested for PvuII, NcoIIHindlll-HF, Ncoll PvuII and Ndell PvuII alone or in respective combinations (Figure 3B & 3C). Positive clones were sent for sequencing and found to be error-free. Phagemid vectors were named as pZBOOl - phagemid with kappa insert (Figure 2 D and SEQ ID No. 2) and pZBOOl .l phagemid with lambda insert (Figure 3 D and SEQ ID No. 4). Vector pZBOOl has been submitted to MTCC under Budapest treaty with accession number being MTCC 25125 and named as pZBOOl. Further, the phagemid vector having light chain constant region (lambda insert - CL) can be prepared by a person average skilled in the art based on the aforementioned experimental procedure and the details of deposited phagemid vector (kappa insert).
Table 5
Figure imgf000043_0002
Total 10 μ/L Total 10 uL
Sequence confirmed Phagemid vectors pZBOO'l and pZBOOl. l were used for generation of naive and synthetic phage library for screening/panning against target antigen. The size and diversity of the library was estimated by both peer group and next generation sequencing approaches. Sequencing results of panned molecule also confirmed that the diversity of the panned molecules is retained. Single stranded DNA was isolated from Panned molecules and to be transferred to yeast expression vectors.
EXAMPLE 3
Generation of yeast expressio vectors:
Antibody display library represents a library of partial or complete antibodies expressed on ceil surface linked to other cellular proteins. Phage display is the most accepted method due to ease of cloning, allowing for large library sizes, monovalent display and easy to determine various stability parameters. However, with phage display there are associated limitations on proper protein folding due to prokaryotic expression system and lack of post translational modifications of the displayed antibody fragments thereby. To overcome these limitations, yeast display platform, a robust, versatile, quantitative methodology for isolating and engineering antibody fragments is employed. Yeast, a eukaryotic display system is of choice as it is compatible with quantitative and real-time assessment employing fluorescence activated cell sorter (FACS)- sorting techniques.
In comparison with other in vitro display technologies, yeast display of naive / non-immune antibody libraries using the agglutinin adhesion receptor complex AgalP and Aga2P has a significant number of advantages. For example, use of flow cytometry analysis allows rapid clone characterization including Kn determination, Κ0π measurement and epitope binding of mutually exclusive clones directly on the surface of yeast. This eliminates the need for purification of protein to perform these characterizations. The successful display of Fab antibody fragments on yeast suggests a simpler approach to large library construction. As Fab fragments are composed of heavy and light chains, therefore it is possible to encode the two polypeptides on different vectors in different yeast strains wherein two chains can be brought together in a single diploid yeast by mating, a highly efficient process. However, major challenge in case of yeast display is relatively smaller library size due to lower transformation efficiency in yeast, which is hereby overcome by the aspects provided by the instant disclosure, which employs a combination of phage and/or yeast display concept.
As can be understood from the aforementioned facts, phage panned molecules should be to be transferred to various Yeast expression vectors either combinatorially or non-combinatorially in various formats such as ScFv, Fab etc. In order to have a convenient transfer from phagemids to yeast vectors, multiple cloning sites were kept identical. Herein, the yeast expression vectors are with either bicistronic bidirectional or bicistronic unidirectional having specific human antibody constant regions attached for both light (Ck or CK & C l or CL) and heavy chains (human IgGl - CHI domain). Other crucial features such as leader signal sequence (Mating type alpha factor for light chain; Aga2P leader peptide for heavy chain), multiple cloning sites (MCS I for light chain repertoire and MCS II for Heavy chain repertoire), tags (V5 epitope tag and 6xHis tag for light chain; FLAG and c-Myc tags for heavy chain repertoire) are present in all kinds of yeast vectors. The tags are associated in continuation of constant domain and will be used for detection of Fab expression. The screening to obtain the yeast library by the surface display is carried out by employing competing antigenic epitopes, antibody paratope conformation, sequences and sequence motifs or any combination thereof to isolate Fab or ScFv molecule using protease cleavage sites selected from a group comprising Tobacco Etch Virus (TE V), Entero kinase (Ek) etc strategically placed after tags in heavy chain.
Approaches towards generation of yeast vectors that have been developed, are of three types: 1) Bi-cistronie bidirectional vector; 2) Bi cistronic unidirectional vector 3) ScFv vector and 4) mating type vectors.
(A) Generation of yeast Bicistronic Bidirectional vector: (pZB004 and ZB004.1 )
To generate the yeast Bicistroni Bidirectional vector, pRS3 I4veetor (ATCC, USA) was used as backbone (Figure 4). Some of the modifications carried out in the vector backbone and other individual elements/sequences are as follows: 1. Sad, SacIL Eagl, Noil, Spel, BamHI, Xrnal, Smal, Pstl, EcoRI, EcoRV, Sail, Xhol, Apai, are few of the restriction enzymes that were removed from the pRS314vector (SEQ ID No. 31 , 1893 bp to 1989 bp, as shown in Figure 4).
2. Spel site (SEQ ID No. 29, 2600 bp to 2605 bp) was diminished from lambda light chain constant region(CL).
Further, inserts/expression cassettes for kappa (Figure 5 A and SEQ ID No. 5) and lambda (Figure 6 A and SEQ ID No. 7) was designed and synthesized comprising Gall/10 promoter, alpha leader peptide, Aga2P leader peptide, MCS I & II, Tags (V5 and His-Tags for Light chains and FLAG, c-Myc for Heavy chain), respective constants regions attached for both light (Ck or Ck) and heavy chains (human IgGl-CHl domain). A Spel restriction site has been removed from Ck region.
As a part of Fab display format, heavy chain will be displayed on yeast in an associated form through expressed Aga2P protein while the light chain is expressed as separate fragment. During protein maturation process, it pairs with the heavy chain and completes the Fab display configuration. Separate terminator sequences were kept as exemplified by CYC1 terminator for heavy chain and alpha terminator for light chain. To aid the further screening process with soluble Fab, TEV protease cleavage site was fixed after the tags and before Aga2P protein sequence. There is a (G4S)3 linker region strategically placed before the start of Aga2P protein in order to introduce flexibility in protein conformation. About 10 fig of pRS314 vector and inser -kappa-yeast was digested with EcoRV and Kpnl, respectively (Table 6) at about 37°C for overnight followed by gel elution wherein excised gel is dissolved by mixing about 3 volumes of Buffer QX1 solution. About 30 p,L of QIAEX II beads are added by vortex ing for about 30 seconds followed by incubation at about 50°C for about 10 minutes. Series of washes are given to beads, first with about 500 p,L of QX3 followed by 2 washes with about 500 of PE buffer. DNA is eluted with about 30 ,uL of nuclease-free water. Digested and eluted, about 3 p.g of pRS314 and insert-kappa-yeast were further cleaved with Kpnl and EcoRV for overnight at about 37°C, respectively followed by gel elution and ligation set up. Table 6a
Figure imgf000047_0001
Table 6b
Figure imgf000047_0002
Table 7
Figure imgf000047_0003
Ligation set up was done individually for kappa vectors at a ratio of 1 :5 followed by transformation individually into TGI , highly competent cells. Individual colonies were picked up, inoculated followed by isolation plasmid DNA and restriction digestion set up using PvuII enzyme. Confirmed clones produce bands of ~ 4.3 Kb and -2.9 Kb fragments (Figure 5 B). Positive clones were further confirmed by restriction digestions with EcoRV/Kpnl and NdellKpnl enzymes in respective combinations wherein former produces sizes of -3.7 Kb & ~ 3.5 Kb while later produce -5.5 Kb & ~1 .8 Kb fragments (Figure 5 C & D). Confirmed clones were sent for sequencing and found to be error free (Figure 5 E and SEQ ID No. 6). The confirmed yeast bi- directional vector containing kappa light chain constant region has been submitted to MTCC under Budapest treaty with accession number being MTCC 25128 and named as pZB004,
Further, the yeast bicistronic Directional vector having lambda light chain constant region is prepared by using said deposited vector yeast bicistronic birectional vector having kappa insert. The same is prepared wherein 10 ,ug of confirmed and deposited kappa vector (pZB004) and insert-lambda-yeast (SEQ ID No. 7) were digested with Spel-HF/SacII (Table 8) followed by gel elution and ligation (Table 9) at about 4°C for overnight. 25 ng of ligation mixture was transformed into TGI competent cells. Individual colonies were inoculated and screened for insert release with PviiII, Ndeh'Notl and NcoIIAscI enzymes (Figure 6 B). Positive clones were sent for sequencing and found to be error-free (Figure 6 C). The confirmed yeast bicistronic bidirectional vector containing lambda light chain constant region is named as pZB004.1 (SEQ ID No. 8).
Figure imgf000048_0001
(B) Generation of yeast Bicistronic Unidirectional vectors (pZB004.2 and pZB004.3 ):
concept of non-combinatorial transfer
Yeast Bicistronic Unidirectional vector was designed to have an option of two separate promoters for expressing heavy chain and light chain in Fab format. Besides, unique configuration of this vector will allow for non-combinatorial transfer of Fab molecules from phage system to yeast system. This will in turn preserve a specific combination heavy chain and light chain to explore in eukaryotic system.
To generate the yeast Bicistronic unidirectional vector, the deposited yeast Bicistronic Bidirectional vector was used as backbone, wherein the insert for kappa (Figure 7 A and SEQ ID No. 9) and lambda (Figure 8 A and SEQ ID No. 11) were designed and synthesized comprising two Gal 1/10 promoter (light and heavy chain), alpha leader peptide, Aga2P leader peptide, MCS I & II, Tags (V5 and His-Tags for Light chains and FLAG, c-Myc for Heavy chain), respective constants regions attached for both light (CK or CL) and heavy chains (human IgG l-CHl domain). Confirmed yeast Bicistronic Bidirectional vectors kappa and lambda along with synthesized kappa and lambda insert were digested with Spel-HF and Sacll restriction enzymes at about 37°C for about 3 hours (Table 10). Digested vectors (-4.8 Kb) and inserts (kappa and lambda, -2.9 Kb) were gel eluted and ligation reaction (Table 11) was set up for overnight at about 4°C followed by transformation in NEB 5 -alpha Competent E.coli cells by heat shock method. Individual colonies were inoculated and screened for insert release with Spel-HF I SacII enzymes (-2.9 Kb) and internal digestion with Hindlll~HF enzyme (-1.7 Kb) (Figure 7 B and 8 B). Positive clones were sent for sequencing and found to be error-free (Figure 7 C & 8 C). The confirmed yeast uni-directional vectors containing kappa and lambda light chain constant regions are named as pZB004.2 (SEQ ID No. 50) and ZB004.3 (SEQ ID No. 12), respectively.
Table 10:
Figure imgf000049_0001
10X Cut Smart 2 ,uL water 13 }iL
TOTAL VOLUME 20 μΐ
Table 1 1 :
Figure imgf000050_0001
(C) Generation of yeast ScFv vector: pZB004.4
Another alternative vector which was generated for yeast display studies was compatible for ScFv molecules. The product of this constract is antibody molecules in ScFv format which is different from Fab format, wherein constant regions for both heavy chain and light chains are removed. This vector was based on a backbone of construct which was originated from pRS314 vector (ATCC, USA) (Figure 9). Some of the modifications carried out in the vector backbone and other individual elements/sequences are as follows: 1. Eagl, Noi Spel BaniHl, Xmal, Smal, Pstl, EcoRI, EcoRV, Sail, Xhol are few of the restriction enzymes that were removed from the pRS314 vector (SEQ ID No. 31, 1904 bp to 1984 bp, and as shown in Figure 9).
The gene in the vector backbone was replaced by the designed and synthesized insert/expression cassette (Figure 10 A and SEQ ID. No. 13) between Apal and SacII enzymes. The designed insert contains Gall promoter, nucleotide encoding Aga2P protein sequence, Aga2P leader sequence, Factor Xa site, HA tag, TEV cleavage site, MCS I (for Light chain variable region incorporation, Ndel, Bglll, Hi d::: and Ascl), linker region (G4S), MCS II (for heavy chain variable region incorporation, Ncol, Xhal, Nhel and Noil), c-Myc tag, FLAG tag, alpha terminator.
As provided in Tables 12 and 13 below, about 10 g of vector and insert were digested with Apal at about 25°C for overnight followed by addition of SacII enzyme at about 37°C for about 3 hours. Digested material was gel eluted and ligated at about 4°C for overnight. The 2 of the ligated mixture was transformed into NEB alpha competent cells. Individual colonies were inoculated and screened for internal digestion with EcoRV/XhoI enzyme (-2.9 Kb) (Figure 10 B). Positive clones were sent for sequencing and found to be error-free (Figure 10 C). The confirmed yeast ScFv vector containing heavy and light chain incorporation sites is named as pZB004.4 (SEQ ID No. 14). Table 12
Figure imgf000051_0001
Total volume 100 μΐ 100 μΐ
Table 1 3
DNA (Vector) 106.8 ng
DNA (insert) 361.2 ng
T4 DNA ligase 0.5 uL
T4 DNA ligase buffer (1 OX) 2 uL
Water Respective
volume of water
Total 20 iL
(D) Construction of yeast mating type vectors (YMT Vectors):
Yeast surface display technology has constraint in the library size (typically 106 ~ 10s) compared with either phage (109 to 1011) or ribosome (10n to 10i 2) display technologies due to its limitations in yeast transformation efficiencies. Improved yeast transformation methods could overcome this limitation. However, various improved yeast transformation protocols are time- consuming and labor-intensive. So, yeast mating can be used as a powerful tool for generating a large antibody library. The yeast mating is achieved by cellular fusion between two haploid cells of opposite mating types through interaction with a-agglutinin of MATa cells and a-agglutinin of MATa cells. After mating, two distinct plasmids in each haploid cell are combined into one diploid cell, expressing simultaneously the encoded antibody fragment from each plasmid in the subsequent diploid cells. Fab antibody fragments comprise two chains; a heavy chain (HC) with VH and CHI (the first domain of heavy chain constant regions) and a light chain (LC) with VL and CL (light chain constant domain). Thus, yeast mating is suitable for the construction of a combinatorial Fab library from two haploid cells of opposite mating types containing HC and LC libraries. The heterodimerization of secreted LC to yeast surface-anchored HC by formation of a disulfide bond between the two C-terminal Cys residues of CHI and CL (light chain constant domain) facilitates the construction of the display Fab on the yeast cell surface. (D.l ) Construction of mating type heavy chain (HQ expressing vector CpZBQQ2) in Saccharomyces cerevisiae
Mating type heavy chain expressing vector is designed to express HC chain (VH+CH1) on with tags and TEV cleavage site on yeast ceil surface under the control of GALl promoter and CYC1 terminator. Aga2P signal sequence present in this vector facilitates HC chain to secretory pathway. Combination of various restriction sites is important to transfer to transfer phage panned molecules (VH) from phagemid to HC expressing vector. To achieve this, unique restriction sites {Ncol, Bmtl, Nhel, Not!) are kept between Aga2P signal sequence and CHI open reading frame. Presence of myc and FLAG tags are provided to detect HC chain during flow cytometry screening. To cleave Fab firagment form yeast cell surface, highly sequence-specific cysteine protease Tobacco Etch Virus protease (TEV) and Enterokinase (EK) sites are incorporated in HC expressing vector.
For the construction of mating type heavy chain HC vector (pZB002), p414GALl and HC DNA cassette (SEQ ID No. 15) was used. p414 GALl , a CEN-based shuttle vector with TRPl marker from ATCC (Cat. No. ATCC¾ 87328™) was modified in order to accommodate HC DNA cassette. Said modifications are provided in Figure 1 1 and are summarized below:
I) BamHI, Smal, Pstl, EcoRI, BspDI, Sail, TspMI,
Clal, Hindi and Xmal restriction sites were modified. To modify above mentioned restriction sites, nucleotides from 2208 bp to 2158 bp are removed from p414 GALl (SEQ ID No. 32 and Figure 11).
HC DNA cassette (SEQ ID No. 15) is composed of unique AGA2P single sequence coding region, multi-cloning sites {Ncol, Bmtl, Nhel, Notl), heavy chain constant regionl (CHI) with Cysteine residue intact at the last position followed by tags (c-myc and FLAG), TEV cleavage site which is fused with c-terminally AGA2P open reading frame. HC DNA cassette is synthesized through Gene Art. HC DNA cassette (Figure 12 A) and p414 GALl are digested with Spel and Xhol at 37 °C and ligated (at 4 °C) further to create pZB002 (Figure 12 B). The synthesized pZB002 HC expressing vector is deposited with MTCC under the accession number MTCC 25126. HC DNA cassette is under the control of GALl promoter and CYC1 terminator. Unique Ncol, Bmtl, Nhel and Noil sites were kept after AGA2P signal sequence to clone VH region received from phage panned library in pZB002.
Table 14
Figure imgf000054_0001
Table 15
Figure imgf000054_0002
Below is the table which allows to understand the features of pZB002 (Figure 12 C and SEQ ID No. 16). Table 16
Figure imgf000055_0001
(D.2) Construction of mating type light chain (LCA.) expressing vector (pZBQQ3.1) in Saccharomyces cerevisiae
Mating type light chain expressing vector is designed to express and secrete LC chain (VL+ Ck) with tags yeast cell surface under the control of GALI promoter and CYCl terminator, mating alpha factor single sequence (pre region) present in this vector facilitates LC chain to secretory pathway. Combination of various restriction sites is important to transfer to transfer phage panned molecules (VL) from phagemid to HC expressing vector. To achieve this unique restriction sites (NdeL Bglll, HindUJ and Ascl) are kept between mating alpha factor singie and LCX open reading frame. Presence of V5 and His tags provide to detect LC-λ chain during flow cytometry screening. p416 GALI is a CEN-based shuttle vector with URA3 marker from ATCC (ATCC® 87332™) (Figure 13). Which was used to generate several light chain constructs with different signal sequences. Said p4! 6 GAL1 vector backbone was modified as provided in
Figure 13 and summarized below:
1 ) BamHI, Smal, Xmal, TspMI, EcoRI, Hindlll, BspDI,
C!al and Sail restriction sites were modified. To modify above mentioned restriction sites nucleotides from 2318 bp to 2268 bp are removed from p416 GALL
For the construction of the SSO l based secretion piasmid of LC' , modified p416 GAL1 and LC DNA cassette (SEQ ID No. 19) was used. LC cassette is composed of alpha factor single sequence (SSOl), unique multi-cloning sites (Ndel, Bgill, Hindi!! and AscI), and light chain constant region (LC with Cysteine residues intact at the last position followed by tags (V5 and His). L DNA cassette (Figure 14 A) is synthesized through Gene Art. Modified p416 GAL1 and LCX are digested with Spel and Xhol at 37 °C and iigated at 4 °C further to create pZB003.1 (Tables 18 and 19; Figure 14 B). LC DNA cassette will be under the control of GAL I promoter and CYC I terminator in pZB003.1 vector. Unique Ndel, Bg!II Hindlll and AscI sites were kept after SSOl signal sequence to clone VL region from phage panned library in pZB003.1 vector (Figure 14 C). The generated pZB003.1 vector is provided as SEQ ID No.
fable 17
Figure imgf000056_0001
DNA (Vector --3,ug
Figure imgf000057_0001
Table 18
Below is table 19 which allows one to understand the features of pZB003.1.
Table 19
Figure imgf000057_0002
(D.3) Construction of mating type light chain (LCK) expressing vector (pZB003.2) having SS01 signal sequence in Saccharomvces cerevisiae
Mating type light chain expressing vector is designed to express and secrete LC chain (VL+ LCsc) with tags yeast cell surface under the control of GALI promoter and CYCI terminator. mating alpha factor single sequence (pre region) present in this vector facilitates LC chain to secretory pathway. Combination of various restriction sites is important to transfer to transfer phage panned molecules (VL) from phagemid to HC expressing vector. To achieve this, unique restriction sites (Ndel, Bglll, Hindlll and Ascl) are kept between mating alpha factor single and LCK open reading frame. Presence of V5 and His tags detect LCK chain during flow cytometry screening.
For the construction of the SS01 based secretion plasmid of LCK, modified p416 GALl and SSO I -LCK DNA (SEQ ID No. 21) cassette was used. p416 GALl is CEN-based shuttle vector with JJRA3 marker from ATCC (ATCCfe 87332""). LCK cassette is composed of mating alpha factor single sequence (SS01), unique multi-cloning sites (Ndel, BgllL Hindlll and Ascl), light chain constant region (LCK) with Cysteine residues intact at the last position followed by tags (V5 and His). LCK cassette (Figure 15 A) is synthesized through Gene Art. p416 GALl and LCK are digested with Spel and Xhol at about 37 °C and ligated at about 4°C further to create pZB003.2 vector (Tables 21 and 22; Figure 15 B). LCK DNA cassette will be under the control of GALl promoter and CYC1 terminator in pZB003.2. Unique Ndel, Bglll, Hindlll and Ascl sites were kept after SS01 signal sequence to clone VL region from phage panned library in pZB003.2 vector (Figure 15 C). The synthesized pZB003.2 vector is provided as SEQ ID No. 22.
Table 20
Figure imgf000058_0001
Table 21
Figure imgf000059_0001
Below is the table which allows one to understand the features of pZB003.2.
Table 22
Figure imgf000059_0002
( D.4) Construction of mating type light chain LCK expressing vectors in Saccharomyces cerevisiae having SS02 signal sequence (pZB003):
To facilitate better secretion of LC chain, SS02 signal sequence is introduced in the place of mating factor alpha 1 signal sequence (pre region). SS02, is an engineered mating factor alpha factor 1 signal sequence including pre and pro region called as appS4. It was previously demonstrated that appS4 has 16 times better secretion ability than mating factor alpha 1 signal sequence including pre and pro region.
For the construction of SS02 based secretion plasmid of LCK, pZB003.2 and SS02- LCK: cassette (Figure 16 A) (SEQ ID No. 17) were used. SS02 DNA cassette contains engineered alpha factor single sequence (appS4) coding region. SS02 DNA cassette is synthesized through Gene Art. pZB003.2 and SS02- LCK are digested at about 37 °C with Spel and Hindlll and ligated at about 4 °C further to create pZB003 (Tables 24 and 25: Figure 16 B). The synthesized pZB003 vector (Figure 16 C) is provided as SEQ ID No. 18 and deposited to MTCC with accession number MTCC 25127. Table 23
Figure imgf000060_0001
Table 24 DNA (Vector) 1 μΕ
DNA (Insert) 7 μΕ
T4 DNA i lyas I μ/L
T4 DNA iigase buffer 1 μΕ
(10 X)
Milli-Q water 0 μΕ
5
Total volume 10 μΐ,
Below is the table which allows one to understand the features of pZB003.
Table 25
Figure imgf000061_0001
(D.5) Construction of mating type light chain LCK expressing vectors in Saccharomyces cerevisiae having SS03 signal sequence (pZB003.3): To facilitate better secretion of LC chain, SS03 signal sequence is introduced in the place of mating factor alpha 1 signal sequence (Pre region). SS03, is an engineered mating factor alpha factor 1 signal sequence including pre and pro region called as app8. app8 has 16 times better secretion ability than mating factor alpha 1 signal sequence including pre and pro region.
For the constraction of the SS03 based secretion plasmid of LC , pZB003.2 and SS03-LC DNA (SEQ ID No. 23) were used. SS03 DNA cassette contains engineered alpha factor single sequence (app8) coding region. pZB003.2 and SS03-LCK DNA are digested with Spel and Hindlll at about 37 °C and ligated at about 4 °C further to create pZB003.3 (Tables 27 and 28; Figure 17 A & B). The synthesized pZB003.3 vector (Figure 17 C) is provided as SEQ ID No. 24.
Table 26
Figure imgf000062_0001
Table 27
Figure imgf000062_0002
Milli-Q water 0
Total volume 10 μΐ.
Below is the table which allows to understand the features of pZB003.3. Table 28
Figure imgf000063_0001
(D.6) Construction of mating type light chain LCK expressing vectors in Saccharomvces cerevisiae having SS04 signal sequence (pZB003,4):
To facilitate better secretion of LC chain, SS04 signal sequence is introduced in the place of mating factor alpha 1 signal sequence (pre region). SS04 is a Suc2p signal sequence which has secretion ability for various proteins in yeast. For the construction of the SS04 based secretion plasmid of LCK, pZB003.2 and SS04 DNA- LCK cassette (SEQ ID No. 25) were used. SS04 DNA cassette contains Suc2p signal sequence coding region. pZB003.2 and SS04 DNA-LCK are digested with Spel and Hindlll at about 37°C and ligated at about 4°C further to create pZB003.4 (Tables 30 and 31 ; Figure 18 A & B). The synthesized pZB003.4 vector (Figure 18 C) is provided as SEQ ID No. 26.
Table 29
Figure imgf000064_0001
Table 30
Figure imgf000064_0002
Below is the table which allows to understand the features of pZB003.4.
Table 31
Figure imgf000064_0003
protein
Suc2p signal sequence Allows efficient secretion of protein
Multiple cloning site (Ndel, Bg!I Hindlll Allows insertion of VL from phage panned and AscI) library
LCK with cysteine residue at the last position Allows the formation of constant region of κ light chain and cysteine residue will make disulfide bond with heavv chain
V5 epitope and Polyhistidine epitope (6xHis Allows detection of the fusion protein with tag) epitopes the
Anti V5 or anti his antibodies
CYC1 terminator Efficient transcription termination of mRNA
URA3gene Allows selection of yeast transformants
CEN6IARS Allows stable, episomal replication and
partitioning into daughter ceils in yeast
Ampicillin resistance gene (β- lactamase) Selection in E. coli
Figure imgf000065_0001
vectors
5 \ig of the kappa and lambda light chain from secondary PGR pool representing the naive repertoire from healthy human donor along with phagemid vectors (kappa pZBOOl and lambda pZBOOl. l, respectively) are digested with Hindlll-HF and AscI at about 37°C for overnight in a total volume of about 100 pL. The digested samples are gel ehited followed by ligation set up at about 4°C for overnight. The 25-50 ng of ligation mixture is transformed into about 25μΙ. of TGI cells through electroporation wherein 3.0 mm cuvette is used with an optimal setting of 1800 volts, 600 ohm and 10 μ,Ρ. Post recovery in recovery media, about 200 μΐ, of transformed cells are spread on 144 mm plates and incubated overnight at about 37°C. In total, there are about 6-8 plates from which colonies are scraped on following day arid stocks are made with about 20% glycerol. Transformation efficiency is calculated by dilution plating and found to be in the range of about 108 to about 10i 0, preferably at ~108.
The total numbers of cells are determined per vial of glycerol stocks through dilution plating and found to be 1052. Colonies are inoculated in about 5 mL LB -Amp and plasmid is isolated. The isolated plasmids are checked for restriction digestion analysis. The insert release of -300 bp confirmed the presence of light chain, both kappa and lambda in the pool. One vial of light chain pool (both kappa and lambda) are inoculated in about 100 niL of LB -Amp and grown for about 2-3 hours at about 37°C shaker-incubator followed by plasmid isolation by qiagen midi prep kit as per manufacturer's protocol. The midi prepped DNA for both the light chains are confirmed with restriction digestion analysis before proceeding with incorporation of heavy chain into it. Few of the representative clones are used for plasmid isolation and confirmed by restriction digestion which indicated the -100% presence of light chain insert. Separate Midi prep is done to isolate light chain library DNA, both kappa and lambda from the pool. Midi prep DNA is again confirmed through restriction digestion before using for further insertion of heavy chain pool.
About 5fig of the kappa and lambda light chain library DNA along with secondary PCR pool of heavy chain are digested with Ncol and Xbal at about 37"C for overnight in a total volume of about 100 iL. The digested samples are gel eluted followed by ligation set up at about 4°C for overnight. The 25-50 ng of ligation mixture is transformed into 25μΙ_ of TGI cells through electroporation wherein 1.0 mm cuvette is used with an optimal setting of 1800 volts, 600 ohm and 10 μΡ. Post recovery in recovery media, about 200uL of transformed cells are spread on 144 mm plates and incubated overnight at about 37°C. In total, there are about 6-8 plates from which colonies are scraped on following day and stocks are made with about 20% glycerol and stored in -80°C freezer. Transformation efficiency is calculated by dilution plating and found to be in the range of about 30s to about 101J, preferably at ~108.
The total numbers of cells are determined per vial of glycerol stocks through dilution plating and found to be 10i2. Colonies are inoculated in 5 mL LB- Amp and plasmid is isolated. The isolated plasmids are checked for restriction digestion analysis with Ncol and Xbal for heavy chain and Hindlll and Ascl for Kappa & Lambda light chains. The insert release of -400 bp confirmed the presence of heavy chain, in kappa pool (Figure 19 A & B) and lambda pool (Figure 20 A & B).
The heavy chain along with kappa and lambda light chain secondary PCR pool containing DN A library are digested individually with Ncol and Xbal followed by ligation and transformation individually into TGI , highly competent E. coli cells. About 1 ml of kappa and lambda bacterial glycerol stock are grown into about 200 ml LB-AMP medium at about 37°C until OD at 600 nm reaches 0.8. Further, M13K07 helper phage at multiplicity of infection (MOI) of 10 to the bacteria is added and incubated at about 37°C for another 30 minutes. Post infection, infected bacteria is centrifuged and the pellet is re-suspended into about 200 ml of LB with 100 ^ig/ml ampicillin and 25 μg/ml kanamycin followed by growth at about 30°C for overnight at 250 rpm. Suspension is spun down at about 8000 rpm for about 15 minutes at about 4°C followed by discarding the pellet. Separated supernatant is mixed with PEG/NaCl solution in ¼ volume of supernatant and the mixture is incubated on ice for about 1 hour. The mixture is centrifuged at 10000 g for about 15 minutes and the phage pellet is re- suspended into about 20 ml of PBS. Glycerol is added to a final concentration of 50% to the entire phage suspension and frozen in aliquots of about 1 ml at -80°C as phage library stock.
Glycerol stocks of both kappa and lambda bacterial library are mixed, inoculated and used for phage library generation. With addition of helper phage, the phage particles displaying the diversity are precipitated and purified, and stored as glycerol stocks for future use. The estimated number of phage library that is derived from plaque forming assay, is found to be about 10l0 to about 1011, preferably- 1011 pfu/mL. Formation of plaque indicates the functionality of the Phagemid library displaying Fab fragment which will be screened against Her2 antigen. Panning experiments were performed to remove the non-binders from the naive pool followed by plaque formation assay to estimate the number of binders. Estimation of binders was found to be ~107 which is four decades lower than the initial phage number indicating a successful panning.
The plan of the whole strategy is to transfer the specific binders from phage to yeast expression vectors in order to do the screening and sorting in yeast system. An affinity based method is employed using a compatible method i.e., FACS to further select and rank the best binders. The panned phage was amplified and ssDNA was isolated followed by PGR amplification to incorporate in yeast mating type vectors; for heavy chain and light chain incorporation. The Fab library is developed by exploiting the mating system wherein light chain library and heavy chain library is cloned in different yeast expression vectors. However, the kappa and lambda light chain PGR pool of panned molecules along with the in-house yeast expression vector (pZB003.1 & pZB003.2) exclusively designed and generated for light chains are digested with Hindlll and Ascl followed by ligation and transformation individually into TGI, highly competent cells. Likewise, HC chain pool and the respective vector (pZB002) are digested with Ncol and Not! followed by ligation and transformation into TGI, highly competent ceils. Transformation efficiency obtained for both heavy and light chain panned library are >107 cfu. Obtained transformed colonies for both heavy and light chain libraries are checked for insert release using HindllllAscI for light chain (Figure 21 A) and Ncoh'Notl for heavy chain (Figure 21 B) before the}' are scraped for glycerol stock preparation. Insert release for both the chains confirmed the presence of panned molecul es. Glycerol stocks are stored at -80°C for future use. Upon validation, the about 1 ,ug of each DNA is taken and transformed into yeast cells at ~5 x 106-2 x 10 ' cells/ml by electroporati n method. Regarding the strains for transformation, EBYiOO is used as a host for the cell surface display of the heavy chain library while YVH10 is used to express light chain library. Post transformation, the plates are incubated at about 30°C for 2-4 days to allow for growth of transformants. Both heavy chain and light chain panned library are successfully transformed into yeast strains (EBYI OO-wraiA and YVH10) with an efficiency of >106.
In order to display Fab format of library on the surface, mating of the two grown haploid cells representing heavy chain and light chain libraries is performed by mixing equal numbers of haploid cells. The mating efficiency is calculated as the number of diploid colonies in the double-selective plates divided by the number of total colonies in the single selective plates wherein the calculated mating percentage is -40%. Further, the diploid cells are enriched in double drop out media (ura", Tip") prior to any growth and expression analysis. Saccharomyces cerevisiae 2N library having plasmids expressing heavy chain pool and light chain kappa pool are inoculated into 10 ml of SDCAA double drop out media and grown overnight at about 30°C ( 16-20 hrs). The OD at 600nm of the overnight grown culture is measured and inoculated accordingly in about 10 ml SDCAA double drop out glucose media (uiiinduced culture) and about 10 mi 2XSGCAA media (induced culture) such that the final OD at 600nm becomes 0.2 to 0.3. Uiiinduced and induced cells are grown for different time points ranging from 24 to 48 hours at about 20°C. The expression of light chain and heavy chain are observed in significant percentages. The light chain expression are probed by anti-His antibody and found to be >7 % (Figure 22 A) while heavy chain which is probed with anti-e-Myc antibody are found to be appearing in double positive quadrant with biotiiiyiated Her2 at a percentage of 7.2 (Figure 22 B). This result indicates the Fab formation and successful binding of the same with target antigen. This result indicates that the dual auxotrophic marker selected diploids express light chain associated with the heavy chain. Successful transfer of clones from phage to yeast system followed by- expression of Fab and its binding to Her2 antigen validates the functionality and efficiency of phagemid and yeast vectors of the instant disclosure.
Similarly, the above approach can also be employed using variable light chain (kappa and lambda light chains) and heavy chain regions obtained firom synthetic antibodies/repertoire.
Another yeast expression construct i.e., yeast ScFv expression construct (pZB004.4) was tested for expression of anti~Her2 ScFv gene sequence and binding with Her2 antigen. Anti-Her2 genes, VH and VL were cloned into pZB004.4 vector in to MCS I and II, respectively, between NdellAscI and NcoI!Notl, enzymes. Clones were transformed into yeast EBYIOO followed by induction for expression and binding studies as described earlier. Flow cytometry analysis of induced yeast cells revealed interaction with Her2 antigen. Flow cytometry were carried out with biotinylated Her2 antigen, which is detected with streptavidin Alexa 633 conjugate. Additionally, anti c-myc antibody (alexa flour 488, conjugate) was used to detect expression of C-terminus c- rnyc tag. The result revealed distinct double positive fluorescence signal indicating expression of Anti Her2 ScFv molecules on yeast cell surface (Figure 23 ).
Taken together, the present disclosure relates to the use of present phagemids and yeast expression piasmids in protein display technologies to express the proteins/antibody genes from naive and/or synthetic library. Firstly, phage display technology is used to clone and screen potential antibody genes with high to moderate affinity towards specific antigen. These genes are then transferred to yeast display plasmids for further screening and identification of lead molecules. Combining these two complementary technologies result in screening of highly diverse antibody libraries and developing new/lead antibody molecules against specific antigens. The smooth transfer of clonal population from phage to yeast vectors is efficient since restriction enzymes used in MCS I and MCS II are identical with respect to the two expression systems. These carefully chosen restriction enzymes allow transferring selected population of variable light chains from MCS I of Phagemid to MCS I of any yeast vector while heavy chains are relocated to MCS II of any yeast vectors. Further, the variable heavy chain and light chain repertoire from naive and/or synthetic antibodies can also be directly cloned into the phagemid and yeast vectors of the present disclosure and desired results can be obtained.
Apart from intersystem transfer, intra-system transfer i.e., altering display format from Fab to ScFv or vice versa, or same format but different expression vector such as transferring from mating type vectors to bi-cistronic vector is possible via respective set of MCS enzymes. The free transition across all possible systems and formats also provide a randomization of heavy and light chains which allows compensating the differences across two display systems while availability of a system wherein specific combination is preserved across systems is definitely a benefit.
Accordingly, the present vectors provide numerous advantages in protein display technology, including but not limiting to:
• Intertransfer approach wherein the two complementary technologies (phage display and yeast display) result in screening of highly diverse antibody libraries and developing new/lead antibody molecules against specific antigens.
* Uniquely designed inserts/expression cassettes resulting in efficient and smooth transfer of clonal population from phage to yeast vectors, thus maintaining the diversity of the antibody molecules/fragments. ® Overcoming the drawbacks of yeast display technology which accommodates small library and the limitation of expressing/displaying eukaryotic proteins using prokaryotic display systems such as phage display.
* Intratransfer approach wherein display format can be altered from Fab to ScFv or vice versa, or the same fonnat can be transfenred from one yeast vector to another yeast vector, such as transferring from mating type vectors to bi-cistronic vector via respective set of MCS enzymes.
SEQUENCE LISTING
<110> ZUMUTOR BIOLOGICS, INC.
<120> VECTORS FOR CLONING AND EXPRESSION OF PROTEINS, METHODS AND
APPLICATIONS THEREOF
<130> IP34109
<150> IN 201641012164
<151> 2016-04-06
<160> 33
<170> Patentin version 3.5
<210> 1
<211> 2205
<212> D A
<213> Artificial Sequence
<223> pZBOOl - Phagemid Kappa insert
<220>
< 21> gene
<222> (1)..(2205)
<400> 1
caattcaagg agacagtcat aatgaaatac ctgctgccga ccgctgctgc tggtctgctg 60 ctcctcgctg cccagccggc gatggcccat atgaaaagat ctgcgaagct tgctggcgcg 120 cccggaactg tggctgcacc atctgtcttc atcttcccgc catctgatga gcagttgaaa 180 tctggaactg cctctgttgt gtgcctgctg aataacttct atcccagaga ggccaaagta 240 cagtggaagg tggataacgc cctccaatcg ggtaactccc aggagagtgt cacagagcag 300 gacagcaagg acagcaccta cagcctcagc agcaccctga cgctgtcgaa agcagactac 360 gagaaacaca aagtctacgc ctgcgaagtc acccatcagg gcctgagctc gcccgtcaca 420 aagagcttca acaggggaga gtgtacgcgt gtttaaacat aagccgcgcc aattctattt 480 caaggagaca gtcataaaat gaaatacctg ctgccgaccg ctgctgctgg tctgctgctc 540 ctcgctgccc agccggcgat ggccccatgg acatctagaa aagctagcac agcggccgca 600 gcctccacca agggcccatc. ggtcttcccc ctggcaccct cctccaagag cacctctggg 660 ggcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 720 tggaactcag gcgcgctgac cagcggcgtg cacaccttcc cggctgtcct acagtcatca 780 ggactctact ccctcagcag cgtagtgacc gtgccctcca gcagcttggg cacccagacc 840 tacatctgca acgtgaatca caag ccagc aacaccaagg tggacaagaa agttgagccc 900 aaatcttgtg aattcgacta caaagacgat gacgacaagg gggccgcaga acaaaaactt 960 atttctgaag aggacttgtc ttaggccgaa actgttgaaa gttgtttagc aaaacctcat 1020 acagaaaatt catttactaa cgtctggaaa gacgacaaaa ctttagatcg ttacgctaac 1080 tatgagggct gtctgtggaa tgctacaggc gttgtggttt gtactggtga cgaaactcag 1140 tgttacggta catgggttcc tattgggctt gctatccctg aaaatgaggg tggtggctct 1200 gagggtggcg gttctgaggg tggcggttct gagggtggcg gtactaaacc tcctgagtac 1260 ggtgatacac ctattccggg ctatacttat atcaaccctc. tcgacggcac ttatccgcct 1320 ggtactgagc aaaaccccgc taatcctaat ccttctcttg aggagtctca gcctcttaat 1380 actttcatgt ttcagaataa taggttccga aataggcagg gtgcattaac tgtttatacg 1440 ggcactgtta ctcaaggcac tgaccccgtt aaaacttatt accagtacac tcctgtatca 1500 tcaaaagcca tgtatgacgc. ttactggaac ggtaaattca gagactgcgc tttccattct 1560 ggctttaatg aggacccatt cgtttgtgaa tatcaaggcc aatcgtctga cctgcctcaa 1620 cctcctgtca atgctggcgg cggctctggt ggtggttctg gtggcggctc tgagggtggc 1680 ggctctgagg gtggcggttc tgagggtggc ggctctgagg gtggcggttc cggtggcggc 1740 tccggttccg gtgattttga ttatgaaaaa atggcaaacg ctaataaggg ggctatgacc 1800 gaaaatgccg atgaaaacgc gctacagtct gacgctaaag gcaaacttga ttctgtcgct 1860 actgattacg gtgctgctat cgatggtttc attggtgacg tttccggcct tgctaatggt 1920 aatggtg ta ctggtgattt tgctggctct aattcccaaa tggctcaagt cggtgacggt 1980 gataattcac ctttaatgaa taatttccgt caatatttac cttctttgcc tcagtcggtt 2040 gaatgtcgcc cttatgtctt tggcgctggt aaaccatatg aattttctat tgattgtgac 2100 aaaataaact tattccgtgg tgtctttgcg tttcttttat atgttgccac ctttatgtat 2160 gtattttcga cgtttgctaa catactgcgt aataaggagt cttaa 2205
<210> 2
<211> 4780
<212> DNA
<213> Artificial Sequence
<220>
<223> pZBOOl - Phagemid Kappa vector Construct
<220>
<221> mi sc_recomb
<222> (1). .. (4780)
<400> 2
gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 60 atatgt tcc gctcatgaga caataaccct gataaatget tcaataatat tgaaaaagga 120 agagtatgag tattcaacat ttccgtgtcg cccttattcc ettttttgeg geattttgee ISO ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgetgaa gatcagttgg 240 gtgcacgagt gggttacatc gaactggatc teaacagegg taagatcctt gagagttttc 300 gccccgaaga acgttttcca atgatgagca cttttaaagt tetgetatgt ggegeggtat 360 tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg 420 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 480 aattatgcag tgctgccata accatgagtg ataacactgc ggecaactta cttctgacaa 540 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 600 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 660 cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactgg gaa ctacttactc 720 tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 780 tgcgctcggc gcttccggct ggctggttta ttgctgataa atetggagee ggtgagcgtg 840 ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt ategtagtta 900 tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc. gctgagatag 960 gtgcctcact gattaageat tggtaactgt cagaccaagt ttactcatat atactttaga 1020 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 1080 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agegtcagae cccgtagaaa 1140 agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa 1200 aaaaaccacc gctaccagcg gtggtttgtt tgeeggatea agagctacca actctttttc 1260 cgaaggtaac tggcttcagc agagegcaga taccaaatac tgttcttcta gtgtagccgt 1320 agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 1380 tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 1440 gatagttacc ggataaggcg cageggtegg getgaaeggg gggttcgtgc acacagccca 1500 gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 1560 ccacacttcc cgaagggaga aagacggaca ggtatccggt aagcgacagg gtcggaacag 1620 gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 1680 ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagc tat 1740 ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc 1800 acatgcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 1860 ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt 1920 agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg 1980 gaattgtgag cggataacaa tttcaattca aggagacagt cataatgaaa tacctgctgc 2040 cgaccgctgc tgctggtctg ctgctcctcg ctgcccagcc ggcgatggcc catatgaaaa 2100 gatctgcgaa gcttgctggc gcgcccggaa ctgtggctgc accatctgtc ttcatcttcc 2160 cgccatctga tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg ctgaataact 2220 tctatcccag agaggccaaa gtacagtgga aggtggataa cgccctccaa tcgggtaact 2280 cccaggagag tgtcacagag caggacagca aggacagcac. ctacagcctc agcagcaccc 2340 tgacgctgtc gaaagcagac tacgagaaac acaaagtcta cgcctgcgaa gtcacccatc 2400 agggcctgag ctcgcccgtc acaaagagct tcaacagggg agagtgtacg cgtgtttaaa 2460 cataagccgc gccaattcta ttt aaggag acagtcataa aatgaaatac. ctgctgccga 2520 ccgctgctgc tggtctgctg ctcctcgctg cccagccggc gatggcccca tggacatcta 2580 gaaaagctag cacagcggcc gcagcctcca ccaagggccc atcggtcttc cccctggcac 2640 cctcctccaa gagcacctct gggggcacag cggccctggg ctgcctggtc aaggactact 2700 tccccgaacc ggtgacggtg tcgtggaact caggcgcgct gaccagcggc gtgcacacct 2760 tcccggctgt cctacagtca tcaggactct actccctcag cagcgtagtg accgtgccct 2820 ccagcagctt gggcacccag ac.ctac.atct gcaacgtgaa tcacaagccc agcaacacca 2880 aggtggacaa gaaagttgag cccaaatctt gtgaattcga ctacaaagac gatgacgaca 2940 agggggccgc agaacaaaaa cttatttctg aagaggactt gtcttaggcc gaaactgttg 3000 aaagttgttt agcaaaacct catacagaaa attcatttac taacgtctgg aaagacgaca 3060 aaactttaga tcgttacgct aactatgagg gctgtctgtg gaatgctaca ggcgttgtgg 3120 tttgtactgg tgacgaaact cagtgttacg gtacatgggt tcctattggg cttg tatcc 3180 ctgaaaatga gggtggtggc tctgagggtg gcggttctga gggtggcggt tctgagggtg 3240 gcggtactaa acctcctgag tacggtgata cacctattcc gggctatact tatatcaacc 3300 ctctcgacgg cacttatccg cctggtactg agcaaaaccc cgctaatcct aatccttctc 3360 ttgaggagtc tcagcctctt aatactttca tgtttcagaa taataggttc cgaaataggc 3420 agggtgcatt aactgtttat acgggcactg ttactcaagg cactgacccc gttaaaactt 3480 attaccagta cactcctgta tcat aaaag ccatgtatga cgcttactgg aacggtaaat 3540 tcagagactg cgctttccat tctggcttta atgaggaccc attcgtttgt gaatatcaag 3600 gccaatcgtc tgacctgcct caacctcctg tcaatgctgg cggcggctct ggtggtggtt 3660 ctggtggcgg ctctgagggt ggcggctctg agggtggcgg ttctgagggt ggcggctctg 3720 agggtggcgg ttccggtggc ggctccggtt ccggtgattt tgattatgaa aaaatggcaa 3780 acgctaataa gggggctatg accgaaaatg ccgatgaaaa cgcgctacag tctgacgcta 3840 aaggcaaact tgattctgtc gctactgatt acggtgctgc tatcgatggt ttcattggtg 3900 acgtttccgg ccttgctaat ggtaatggtg ctactggtga ttttgctggc tctaattccc 3960 aaatggctca agtcggtgac ggtgataatt cacctttaat gaataatttc cgtcaatatt 4020 taccttcttt gcctcagtcg gttgaatgtc gcccttatgt ctttggcgct ggtaaaccat 4080 atgaattttc tattgattgt gacaaaataa acttattccg tggtgtcttt gcgtttcttt 4140 tatatgttgc. cacctttatg tatgtatttt cgacgtttgc taacatactg cgtaataagg 4200 agtcttaagc. tagctaacag tcctatgaat caactactta gatggtatta gtgacctgta 4260 acagagcatt agcgcaaggt gatttttgtc ttcttgcgct aattttttgt catcaaacct 4320 gtcgcactcc ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt 4380 tttaaccaat aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata 4440 gggttgagtg ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac 4500 gtcaaagggc gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa 4560 tcaagttttt tggggtcgag gtgccgtaaa gcactaaatc. agaaccctaa aggaagcccc 4620 cgatttagag cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg 4680 aaaggagcgg gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca 4740 cccgccgcgc ttaatgcgcc gctacagggc gcgtcaggtg 4780
<210> 3
<211> 2202
<212> DNA
<213> Artificial Sequence
<220>
<223> pzBOOl.l -- Phagenrid Lambda insert
< 20>
<221> gene
<222> (13 ,. (2202)
<400> 3
caattcaagg agacagtcat aatgaaatac ctgctgccga ccgctgctgc tggtctgctg 60 ctcctcgctg cccagccggc gatggcccat atgaaaagat ctgcgaagct tgctggcgcg 120 cccggtcagc. ccaaggccaa ccccactgtc actctgttcc cgccctcctc tgaggagctc 180 caagccaaca aggccacact agtgtgtctg atcagtgact tctacccggg agctgtgaca 240 gtggcctgga aggcagatgg cagccccgtc aaggcgggag tggagaccac caaaccctcc 300 aaacagagca acaacaagta cgcggccagc agctacctga gcctgacgcc cgagcagtgg 360 aagtcccaca gaagctacag ctgccaggtc acgcatgaag ggagcaccgt ggagaagaca 420 gtggccccta cagaatgttc aacgcgtgtt taaacataag ccgcgccaat tctatttcaa 480 ggagacagtc ataaaatgaa atacctgctg ccgaccgctg ctgctggtct gctgctcctc 540 gctgcccagc cggcgatggc cccatggaca tctagaaaag ctagcacagc ggccgcagcc 600 tccaccaagg gcccatcggt cttccccctg acaccctcct ccaagagcac ctctgggggc 660 acagcggccc tgggctgcct ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 720 aactcaggcg cgctgaccag cggcgtgcac accttcccgg ctgtcctaca gtcatcagga 780 ctctactccc tcagcagcgt agtgaccgtg ccctccagca gcttgggcac ccagacctac 840 atctgcaacg tgaatcacaa gcccagcaac accaaggtgg acaagaaagt tgagcccaaa 900 tcttgtgaat tcgactacaa agacgatgac gacaaggggg ccgcagaaca aaaacttatt 960 tctgaagagg acttgtctta ggccgaaact gttgaaagtt gtttagcaaa acctcataca 1020 gaaaattcat ttactaacgt ctggaaagac gacaaaactt tagatcgtta cgctaactat 1080 gagggctgtc tgtggaatgc tacaggcgtt gtggtttgta ctggtgacga aactcagtgt 1140 tacggtacat gggttcctat tgggcttgct atccctgaaa atgagggtgg tggctctgag 1200 ggtggcggtt ctgagggtgg cggttctgag ggtggcggta ctaaacctcc tgagtacggt 1260 gatacaccta ttccgggcta tacttatatc aaccctctcg acggcactta tccgcctggt 1320 actgagcaaa accccgctaa tcctaatcct tctcttgagg agtctcagcc tcttaatact 1380 ttcatgtttc agaataatag gttccgaaat aggcagggtg cattaactgt ttatacgggc 1440 actgttactc aaggcactga ccccgttaaa acttattacc agtacactcc tgtatcatca 1500 aaagccatgt atgacgctta ctggaacggt aaattcagag actgcgcttt ccattctggc 1560 tttaatgagg acccattcgt ttgtgaatat caaggccaat cgtctgacct gcctcaacct 1620 cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg gcggctctga gggtggcggc 1680 tctgagggtg gcggttctga gggtggcggc tctgagggtg gcggttccgg tggcggctcc 1740 ggttccggtg attttgatta tgaaaaaatg gcaaacgcta ataagggggc. tatgaccgaa 1800 aatgccgatg aaaacgcgct acagtctgac gctaaaggca aacttgattc tgtcgctact 1860 gattacggtg ctgctatcga tggtttcatt ggtgacgttt ccggccttgc taatggtaat 1920 ggtgctactg gtgattttgc tggctctaat tcccaaatgg ctcaagtcgg tgacggtgat 1980 aattcacctt taatgaataa tttccgtcaa tatttacctt ctttgcctca gtcggttgaa 2040 tgtcgccctt atgtctttgg cgctggtaaa ccatatgaat tttctattga ttgtgacaaa 2100 ataaacttat tccgtggtgt ctttgcgttt cttttatatg ttgccacctt tatgtatgta 2160 ttttcgacgt ttgctaacat actgcgtaat aaggagtctt aa 2202
<210> 4
<211> 4777
<212> DNA
<213> Artificial Sequence
<220>
<223> pZBOOl . l - phagenrid lambda vector Construct
<220>
<221> mi sc recomb
<222> (1) . . (4777)
<400> 4
gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 60 atatgtatcc gctcatgaga caataaccct gataaatgct t aataatat tgaaaaagga 120 agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 180 ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 240 gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 300 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat 360 tatcccgtat tgacgccggg caagag aac tcggtcgccg catacactat tctcagaatg 420 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 480 aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 540 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 600 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 660 cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc 720 tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 780 tgcgctcggc gcttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 840 ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta 900 tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 960 gtgcctcact gattaag at tggtaactgt cagaccaagt ttactcatat atactttaga 1020 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 1080 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa 1140 agatcaaagg atcttcttga gatccttttt ttctgcgcgt aat tgctgc ttgcaaacaa 1200 aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc 1260 cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta gtgtagccgt 1320 agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 1380 tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 1440 gatagttacc, ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca 1500 gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 1560 ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag 1620 gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 1680 ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat 1740 ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc 1800 acatgcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 1860 ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt 1920 agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg 1980 gaattgtgag cggataacaa tttcaattca aggagacagt cataatgaaa tacctgctgc 2040 cgaccgctgc tgctggtctg ctgctcctcg ctgcccagcc ggcgatggcc catatgaaaa 2100 gatctgcgaa gcttgctggc gcgcccggtc agcccaaggc caaccccact gtcactctgt 2160 tcccgccctc ctctgaggag ctccaagcca acaaggccac actagtgtgt ctgatcagtg 2220 acttctaccc gggagctgtg acagtggcct ggaaggcaga tggcagcccc gtcaaggcgg 2280 gagtggagac caccaaaccc tccaaacaga gcaacaacaa gtacgcggcc agcagctacc 2340 tgagcctgac gcccgagcag tggaagtccc acagaagcta cagctgccag gtcacgcatg 2400 aagggag ac cgtggagaag acagtggccc ctacagaatg ttcaacgcgt gtttaaacat 2460 aagccgcgcc aattctattt caaggagaca gtcataaaat gaaatacctg ctgccgaccg 2520 ctgctgctgg tctgctgctc ctcgctgccc agccggcgat ggccccatgg acatctagaa 2580 aagctagcac agcggccgca gcctccacca agggcccatc ggtcttcccc ctggcaccct 2640 cctccaagag cacctctggg ggcacagcgg ccctgggctg cctggtcaag gactacttcc 2700 ccgaaccggt gacggtgtcg tggaactcag gcgcgctgac cagcggcgtg cacaccttcc 2760 cggctgtcct acagtcatca ggactctact ccctcagcag cgtagtgacc gtgccctcca 2820 gcagcttggg cacccagacc tacatctgca acgtgaatca caagcccagc aacaccaagg 2880 tggacaagaa agttgagccc aaatcttgtg aattcgacta caaagacgat gacgacaagg 2940 gggccgcaga acaaaaactt atttctgaag aggacttgtc ttaggccgaa actgttgaaa 3000 gttgtttagc aaaacctcat acagaaaatt catttactaa cgtctggaaa gacgacaaaa 3060 ctttagatcg ttacgctaac tatgagggct gtctgtggaa tgctacaggc gttgtggttt 3120 gtactggtga cgaaactcag tgttacggta catgggttcc tattgggctt gctatccctg 3180 aaaatgaggg tggtggctct gagggtggcg gttctgaggg tggcggttct gagggtggcg 3240 gtactaaacc tcctgagtac ggtgatacac ctattccggg ctatacttat atcaaccctc 3300 tcgacggcac ttatccgcct ggtactgagc aaaaccccgc taatcctaat ccttctcttg 3360 aggagtctca gcctcttaat actttcatgt ttcagaataa taggttccga aataggcagg 3420 gtgcattaac tgtttatacg ggcactgtta ctcaaggcac tgaccccgtt aaaacttatt 3480 accagtacac tcctgtatca tcaaaagcca tgtatgacgc ttactggaac ggtaaattca 3540 gagactgcgc tttccattct ggctttaatg aggatccatt cgtttgtgaa tatcaaggcc 3600 aatcgtctga cctgcctcaa cctcctgtca atgctggcgg cggctctggt ggtggttctg 3660 gtggcggctc, tgagggtggc ggctctgagg gtggcggttc tgagggtggc ggctctgagg 3720 gtggcggttc cggtggcggc tccggttccg gtgattttga ttatgaaaaa atggcaaacg 3780 ctaataaggg ggctatgacc gaaaatgccg atgaaaacgc gctacagtct gacgctaaag 3840 gcaaacttga ttctgtcgct actgattacg gtgctgctat cgatggtttc attggtgacg 3900 tttccggcct tgctaatggt aatggtgcta ctggtgattt tgctggctct aattcccaaa 3960 tggctcaagt cggtgacggt gataattcac ctttaatgaa taatttccgt caatatttac 4020 cttctttgcc tcagtcggtt gaatgtcgcc cttatgtctt tggcgctggt aaaccatatg 4080 aattttctat tgattgtgac aaaataaact tattccgtgg tgtctttgcg tttcttttat 4140 atgttgccac ctttatgtat gtattttcga cgtttgctaa catactgcgt aataaggagt 4200 cttaagctag ctaacagtcc tatgaatcaa ctacttagat ggtattagtg acctgtaaca 4260 gagcattagc gcaaggtgat ttttgtcttc ttgcgctaat tttttgtcat caaacctgtc 4320 gcactcctta atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt 4380 aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg 4440 ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc 4500 aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca 4560 agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga 4620 tttagagctt gacggggaaa gc.cggc.gaac gtggcgagaa aggaagggaa gaaagcgaaa 4680 ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc 4740 gccgcgctta atgcgccgct acagggcgcg tcaggtg 4777
<210> 5
<211> 3940
<212> DMA
<213> Artificial Sequence
<220>
<223> pZB004 - Bi ci st rorri c Bi cn rfictional Kappa insert
<220>
<2 1> gene
<222> (1) . . (3940)
<400> 5
gcccatgagg ccagttaatt aagaggtacc tagaattctg ggatcctaag gaggatgttt 60 tggctctggt caatgattac ggcattgata tcgtccaact gcatggagat gagtcgtggc 120 aagaatacca agagttcctc ggtttgccag ttattaaaag actcgtattt ccaaaagact 180 acaacatact actcagtgca gcttcacaga aacctcattc gtttattccc. ttgtttgatt 240 cagaagcagg tgggacaggt gaacttttgg attggaactc gatttctgac taggttggaa 300 ggcaagagag ccccgaaagc ttacatttta tgttagctgg tggactgacg ccagaaaatg 360 ttggtgatgc gcttagatta aatggcgtta ttggtgttga tgtaagcgga ggtgtggaga 420 caaatggtgt aaaagactct aacaaaatag caaatttcgt caaaaatgct aagaaatagg 480 ttattactga gtagtattta tttaagtatt gtttgtgcac ttgcctgcgg tgtgaaatac 540 cgcacagatg cgtaaggaga aaataccgca tcaggaaatt gtaaacgtta atattttgtt 600 aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg ccgaaatcgg 660 caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg ttccagtttg 720 gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa aaaccgtcta 780 tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg ggtcgaggtg 840 ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt gacggggaaa 900 gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg ctagggcgct 960 ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta atgcgccgct 1020 acagggcgcg tcgcgccatt cgccattcag gctgcgcaac tgttgggaag ggcgatcggt 1080 gcgggcctct tcgctattac gccagctggc gaagggggga tgtgctgcaa ggcgattaag 1140 ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgaattgta 1200 atacgactca ctatagggcg aattggagct cttaattaat tacatttaca tttacattta 1260 catttacatt tacatttaca tccgcgggcg aattggagct caattctctt aggattcgat 1320 tcacattcat ctttttttag ctactaatag gataaattat aggaatttat aacaaattga 1380 aatatggcag gcagcaaaat taaaattgtc ttagtttttt agtgtataga agtgaatagc 1440 tatataaagt atgtgtaaag ttggtaacgg aacgaaaaat agaaaaggat attacatggg 1500 aaaacatgtt gtttacggag aaatgaaaag tatattgtat tttgtacgag ctaaaagtac 1560 agtgggaaca aagtcgattt tgttacatct acactgttgt tatcagattc aatggtgatg 1620 gtgatgatga ccggtacgcg tagaatcgag accgaggaga gggttaggga taggcttacc 1680 gtcgactgta acacgcgtac actctcccct gttgaagctc tttgtgacgg gcgagctcag 1740 gccctgatgg gtgacttcgc aggcgtagac tttgtgtttc. tcgtagtctg ctttcgacag 1800 cgtcagggtg ctgctgaggc tgtaggtgct gtccttgctg tcctgctctg tgacactctc 1860 ctgggagtta cccgattgga gggcgttatc caccttccac. tgtactttgg cctctctggg 1920 atagaagtta ttcagcaggc acacaacaga ggcagttcca gatttcaact gctcatcaga 1980 tggcgggaag atgaagacag atggtgcagc cacagttccg ggcgcgccag caagcttcgc 2040 agatcttttc atatgagcta atgcggagga tgctgcgaat aaaactgcag taaaaattga 2100 aggaaatctc atggttttca aaaattctta cttttttttt ggatggacgc aaagaagttt 2160 aataatcata ttacatggca ttaccaccat atacatatcc atatacatat ccatatctaa 2220 tcttacttat atgttgtgga aatgtaaaga gccccattat cttagcctaa aaaaaccttc 2280 tctttggaac tttcagtaat acgcttaact gctcattgct atattgaagt acggattaga 2340 agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt cctcgtcttc 2400 acc.ggtc.gcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga acaataaaga 2460 ttctacaata ctagctttta tqgttatgaa gaggaaaaat tggcagtaac ctggccccac 2520 aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga ttagtttttt 2580 agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat taacagatat 2640 ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc ggtttgtatt 2700 acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac ctctatactt 2760 taacgtcaag gagaaaaaac accatgcagt tacttcgctg tttttcaata ttttctgtta 2820 ttgcttcagt tttagcacca tggacatcta gaaaagctag cacagcggcc gcagcctcca 2880 ccaagggccc atcggtcttc cccctggcac cctcctccaa gagcacctct gggggcacag 2940 cggccctggg ctgcctggtc aaggactact tccccgaacc ggtgacggtg tcgtggaact 3000 caggcgcgct gaccagcggc gtgcacacct tcccggctgt cctacagtca tcaggactct 3060 actccctcag cagcgtagtg accgtgccct ccagcagctt gggcacccag acctacatct 3120 gcaacgtgaa tcacaagccc agcaacacca aggtggacaa gaaagttgag cccaaatctt 3180 gtgaattcga acaaaaactt atttctgaag aggacttgga ctacaaagac gatgacgaca 3240 aggaaaacct gtattttcag ggcctgcagg ctagtggtgg aggaggctct ggtggaggcg 3300 gtagcggagg cggagggtcg atgactggtc aggaactgac aactatatgc gagcaaatcc 3360 cctcaccaac tttagaatcg acgccgtact ctttgtcaac gactactatt ttggccaacg 3420 ggaaggcaat gcaaggagtt tttgaatatt acaaatcagt aacgtttgtc agtaattgcg 3480 gttctcaccc ctcaacaact agcaaaggca gccccataaa cacacagtat gttttttaat 3540 catgtaatta gttatgtcac gcttacattc acgccctccc cccacatccg ctctaaccga 3600 aaaggaagga gttagacaac ctgaagtcta ggtccctatt tattttttta tagttatgtt 3660 agtattaaga acgttattta tatttcaaat ttttcttttt tttctgtaca gacgcgtgta 3720 cgcatgtaac attatactga aaaccttgct tgagaaggtt ttgggacgct cgaaggcttt 3780 aatttgcact agtatgtaaa tgtaaatgta aatgtaaatg taaatgtaaa tgtaaggcca 3840 tataggccgg tacccagctt ttgttccctt tagtgagggt taattccgag cttgctcgag 3900 cgaagcttta gagctcatgg cgcgcctagg ccttgacggc 3940
<210> 6
<211> 7304
<212> DMA
<213> Artificial Sequence
<220>
<223> pZB004 - Bicistronic Bidirectional Kappa vector construct
<220>
<221> mi screcomb
<222> (1)..(7304)
<400> 6
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaacg acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240 atatgtgtac tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300 aaatagcttg tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360 gaattaattc ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420 tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480 atttcacagg tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540 cagaatgtgc tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600 agagaacaat tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660 atagttcagg cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720 ttttggctct ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780 ggcaagaata ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840 actgcaacat actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900 attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960 gaaggcaaga gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020 atgttggtga tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080 agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140 aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgcctg cggtgtgaaa 1200 taccgcacag atgcgtaagg agaaaatacc gcatcaggaa attgtaaacg ttaatatttt 1260 gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat 1320 cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt 1380 ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt 1440 ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag 1500 gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg 1560 aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc 1620 gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc 1680 gctacagggc gcgtcgcgcc attcgccatt caggctgcgc aactgttggg aagggcgatc 1740 ggtgcgggcc tcttcgctat tacgccagct ggcgaagggg ggatgtgctg caaggcgatt 1800 aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt 1860 gtaatacgac tcactatagg gcgaattgga gctcttaatt aattacattt acatttacat 1920 ttacatttac atttacattt acatccgcgg gcgaattgga gctcaattct cttaggattc 1980 gattcacatt catctttttt tagctactaa taggataaat tataggaatt tataacaaat 2040 tgaaatatgg caggcagcaa aattaaaatt gtcttagttt tttagtgtat agaagtgaat 2100 agctatataa agtatgtgta aagttggtaa cggaacgaaa aatagaaaag gatattacat 2160 gggaaaacat gttgtttacg gagaaatgaa aagtatattg tattttgtac gagctaaaag 2220 tacagtggga acaaagtcga ttttgttaca tctacactgt tgttatcaga ttcaatggtg 2280 atggtgatga tgaccggtac gcgtagaatc gagaccgagg agagggttag ggataggctt 2340 accgtcgact gtaacacgcg tacactctcc cctgttgaag ctctttgtga cgggcgagct 2400 caggccctga tgggtgactt cgcaggcgta gactttgtgt ttctcgtagt ctgctttcga 2460 cagcgtcagg gtgctgctga ggctgtaggt gctgtccttg ctgtcctgct ctgtgacact 2520 ctcctgggag ttacccgatt atccaccttc cactgtactt tggcctctct 2580 gggatagaag ttattcagca ggcacacaac agaggcagtt ccagatttca actgctcatc 2640 agatggcggg aaqatgaaga cagatggtgc agccacagtt ccgggcgcgc cagcaagctt 2700 cgcagatctt ttcatatgag ctaatgcgga ggatgctgcg aataaaactg cagtaaaaat 2760 tgaaggaaat ctcatggttt tcaaaaattc ttactttttt tttggatgga cgcaaagaag 2820 tttaataatc atattacatg gcattaccac catatacata tccatataca tatccatatc 2880 taatcttact tatatgttgt ggaaatgtaa agagccccat tatcttagcc taaaaaaacc 2940 ttctctttgg aactttcagt aatacgctta actgctcatt gctatattga agtacggatt 3000 agaagccgcc gagcgggtga cagccctccg aaggaagact ctcctccgtg cgtcctcgtc 3060 ttcaccggtc gcgttcctga aacgcagatg tgcctcgcgc cgcactgctc cgaacaataa 3120 agattctaca atactagctt ttatggttat gaagaggaaa aattggcagt aacctggccc 3180 cacaaacctt caaatgaacg aatcaaatta acaaccatag gatgataatg cgattagttt 3240 tttagcctta tttctggggt aattaatcag cgaagcgatg atttttgatc tattaacaga 3300 tatataaatg caaaaactgc ataaccactt taactaatac tttcaacatt ttcggtttgt 3360 attacttctt attcaaatgt aataaaagta tcaacaaaaa attgttaata tacctctata 3420 ctttaacgtc. aaggagaaaa aacaccatgc agttacttcg ctgtttttca atattttctg 3480 ttattgcttc agttttagca ccatggacat ctagaaaagc tagcacagcg gccgcagcct 3540 ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc tctgggggca 3600 cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg gtgtcgtgga 3660 actcaggcgc gctgaccagc ggcgtgcaca ccttcccggc. tgtcctacag tcatcaggac 3720 tctactccct cagcagcgta gtgaccgtgc cctccagcag cttgggcacc cagacctaca 3780 tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caagaaagtt gagcccaaat 3840 cttgtgaatt cgaacaaaaa cttatttctg aagaggactt ggactacaaa gacgatgacg 3900 acaaggaaaa cctgtatttt cagggcctgc aggctagtgg tggaggaggc tctggtggag 3960 gcggtagcgg aggcggaggg tcgatgactg gtcaggaact gacaactata tgcgagcaaa 4020 tcccctcacc aactttagaa tcgacgccgt actctttgtc aacgactact attttggcca 4080 acgggaaggc aatgcaagga gtttttgaat attacaaatc agtaacgttt gtcagtaatt 4140 gcggttctca ccc tcaaca actagcaaag gcagccccat aaacacacag tatgtttttt 4200 aatcatgtaa ttagttatgt cacgcttaca ttcacgccct ccccccacat ccgctctaac 4260 cgaaaaggaa ggagttagac aacctgaagt ctaggtccct atttattttt ttatagttat 4320 gttagtatta agaacgttat ttatatttca aatttttctt ttttttctgt acagacgcgt 4380 gtacgcatgt aacattatac tgaaaacctt gcttgagaag gttttgggac gctcgaaggc 4440 tttaatttgc actagtatgt aaatgtaaat gtaaatgtaa atgtaaatgt aaatgtaagg 4500 ccatataggc cggtacccag cttttgttcc ctttagtgag ggttaattcc gagcttggcg 4560 taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 4620 atagaagccg aaag ataaa gtgtaaagcc tggggtgcct aatgagtgag gtaactcaca 4680 ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 4740 taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc 4800 tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 4860 aaggcggtaa tacggttatc cacaaaatca ggggataacg caggaaagaa catgtgagca 4920 aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 4980 ctcggccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 5040 acaggactat aaagatacca ggcgttcccc cctggaagct ccctcgtgcg ctctcctgtt 5100 ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 5160 tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 5220 tgtgtgcacg aaccccccgt tcag ccgac cgctgcgcct tatccggtaa ctatcgtctt 5280 gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 5340 agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 5400 tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 5460 agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 5520 tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 5580 acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 5640 tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 5700 agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 5760 tcagcgatct gtctatttcg ttcatccata gttgcctgac tgcccgtcgt gtagataact 5820 acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 5880 tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 5940 ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 6000 agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 6060 tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 6120 acatgatccc ccatgttgtg aaaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 6180 agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 6240 actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 6300 tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 6360 gcgccacata gcagaacttt aaaagtgctc atcattggaa aacattcttc ggggcgaaaa 6 20 ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 6480 tgatcttcag cat ttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 6540 aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 6600 tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 6660 tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 6720 gggtcctttt catcacgtgc tataaaaata attataattt aaatttttta atataaatat 6780 ataaattaaa aatagaaagt aaaaaaagaa attaaagaaa aaatagtttt tgttttccga 6840 agatgtaaaa gactctaggg ggat gccaa caaatactac cttttatctt gctcttcctg 6900 ctctcaggta ttaatgccga attgtttcat cttgtctgtg tagaagacca cacacgaaaa 6960 tcctgtgatt ttacatttta cttatcgtta atcgaatgta tatctattta atctgctttt 7020 cttgtctaat aaatatatat gtaaagtacg ctttttgttg aaatttttta aacctttgtt 7080 tatttttttt tcttcattcc gtaactcttc taccttcttt atttactttc taaaatccaa 7140 atacaaaaca taaaaataaa taaacacaga gtaaattccc aaattattcc atcattaaaa 7200 gatacgaggc. gcgtgtaagt tacaggcaag cgatccgtcc taagaaacca ttattatcat 7260 gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtc 7304
<210> 7
<211> 2509
<212> DNA
<213> Artificial Sequence
<220>
<223> pzB004.1 - Bi ci stroni c B direct onal Lambda insert
<220>
<2 1> aene
<222> (1)..(2509)
<400> 7
ccgcgggcga attggagctc aattctctta ggattcgatt cacattcatc tttttttagc 60 tactaatagg ataaattata ggaatttata acaaattgaa atatggcagg cagcaaaatt 120 aaaattgtct tagtttttta gtgtatagaa gtgaatagct atataaagta tgtgtaaagt 180 tggtaacgga acgaaaaata gaaaaggata ttacatggga aaacatgttg tttacggaga 240 aatgaaaagt atattgtatt ttgtacgagc taaaagtaca gtgggaacaa agtcgatttt 300 gttacatcta cactgttgtt atcagattca atggtgatgg tgatgatgac. cggtacgcgt 360 agaatcgaga ccgaggagag ggttagggat aggcttaccg tcgactgtaa cacgcgttga 420 acattctgta ggggccactg tcttctccac ggtgctccct tcatgcgtga cctggcagct 4S0 gtagcttctg tgggacttcc actgctcggg cgtcaggctc aggtagctgc tggccgcgta 540 cttgttgttg ctctgtttgg agggtttggt ggtctccact cccgccttga cggggctgcc 600 atctgccttc caggccactg tcacagctcc cgggtagaag tcactgatca gacacactag 660 ggtggccttg ttggcttgga gctcctcaga ggagggcggg aacagagtga cagtggggtt 720 ggccttgggc tgaccgggcg cgccagcaag cttcgcagat cttttcatat gagctaatgc 7S0 ggaggatgct gcgaataaaa ctgcagtaaa aattgaagga aatctcatgg ttttcaaaaa 840 ttcttacttt ttttttggat ggacgcaaag aagtttaata atcatattac atggcattac 900 caccatatac atatccatat acatatccat atctaatctt acttatatat tgtgaaaatg 960 taaagagccc cattatctta gcctaaaaaa accttctctt tggaactttc agtaatacgc 1020 ttaactgctc attgctatat tgaagtacgg attagaagcc gccgagcggg tgacagccct 1080 ccgaaggaag actctcctcc gtgcgtcctc gtcttcaccg gtcgcgttcc tgaaacgcag 1140 atgtgcctcg cgccgcactg ctccgaacaa taaagattct acaatactag cttttatggt 1200 tatgaagagg aaaaattggc agtaacctgg ccccacaaac cttcaaatga acgaatcaaa 1260 ttaacaacca taggatgata atgcgattag ttttttagcc ttatttctgg ggtaattaat 1320 cagcgaagcg atgatttttg atctattaac agatatataa atgcaaaaac tgcataacca 1380 ctttaactaa tactttcaac attttcggtt tgtattactt cttattcaaa tgtaataaaa 1440 gtatcaacaa aaaattgtta atatacctct atactttaac gtcaaggaga aaaaacacca 1500 tgcagttact tcgctgtttt tcaatatttt ctgttattgc ttcagtttta gcaccatgga 1560 catctagaaa agctagcaca gcggccgcag cctccaccaa gggcccatcg gtcttccccc 1620 tggcaccctc ctccaagagc acctctgggg gcacagcggc cctgggctgc ctggtcaagg 1680 actacttccc cgaaccggtg acggtgtcgt ggaactcagg cgcgctgacc agcggcgtgc 1740 acaccttccc ggctgtccta cagtcatcag gactctactc cctcagcagc gtagtgaccg 1800 tgccctccag cagcttgggc acccagacct acatctgcaa cgtgaatcac aagcccagca 1860 acaccaaggt ggacaagaaa gttgagccca aatcttgtga attcgaacaa aaacttattt 1920 ctgaagagga cttggactac aaagacgatg acgacaagga aaacctgtat tttcagggcc 1980 tgcaggctag tggtggagga ggctctggtg gaggcggtag cggaggcgga gggtcgatga 2040 ctggtcagga actgacaact atatgcgagc aaatcccctc accaacttta gaatcgacgc cgtactcttt gtcaacgact actattttgg ccaacgggaa ggcaatgcaa ggagtttttg aatattacaa atcagtaacg tttgtcagta attgcggttc. tcacccctca acaactagca aaggcagccc, cataaacaca cagtatgttt tttaatcatg taattagtta tgtcacgctt acattcacgc cctcccccca catccgctct aaccgaaaag gaaggagtta gacaacctga agtctaggtc cctatttatt tttttatagt tatgttagta ttaagaacgt tatttatatt tcaaattttt cttttttttc tgtacagacg cgtgtacgca tgtaacatta tactgaaaac cttgcttgag aaggttttgg gacgctcgaa ggctttaatt tgcactagt
<210> 8
<211> 7301
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB004.1 -- Bicistronic Bidirectional lambda vector construe < 20>
<221> m sc recomb
<222> (Γ).. (7301)
<400> 8
tcgcgcgttt eggtgatgae ggtgaaaacc tctgacacat gcagctcccg gagaeggtea caacttgtct gtaageggat gccgggagca gacaagcccg teagggegeg teagegggtg ttggcgggtg teggggctgg cttaactatg eggcatcaga gcagattgta ctgagagtgc accataaacg acattactat atatataata taggaagcat ttaatagaca geategtaat atatgtgtac tttgcagtta tgacgecaga tggcagtagt ggaagatatt ctttattgaa aaatagcttg tcaccttacg tacaatcttg ateeggaget tttctttttt tgccgattaa gaattaattc ggtcgaaaaa agaaaaggag agggecaaga aggagggcat tggtgactat tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta atttcacagg tagttctggt ccattggtga aagtttg gg ettgeagage acagaggecg cagaatgtgc tctagattcc gatgetgact tgctgggtat tatatgtgtg cccaatagaa agagaacaat tgacccggtt attgeaagga aaatttcaag tcttgtaaaa gcatataaaa atagttcagg cactccgaaa tacttggttg g gtgtttcg taatcaacct aaggaggatg ttttggctct ggtcaatgat tacggcattg atategtcca actgcatgga gatgagtcgt ggcaagaata ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag actgeaacat actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg gaaggcaaga gagccccgaa agcttacatt ttatgttagc tggtggactg aegecagaaa atgttggtga tgegcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt gtcaaaaat gctaagaaat aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgcctg cggtgtgaaa taccgcacag atgegtaagg agaaaatacc gcatcaggaa attgtaaacg ttaatatttt gttaaaattc g gttaaatt tttgttaaat cagctcattt tttaaccaat aggecgaaat eggcaaaate ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag ettgaegggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagegg gegctaggge gctggcaagt gtageggtea cgctgcgcgt aaccaccaca cccgccgcgc ttaatgegee gctacagggc gcgtcgcgcc attcgccatt caggctgcgc aactgttggg aagggcgatc 1740 ggtgcgggcc tcttcgctat tacgccagct ggcgaagggg ggatgtgctg caaggcgatt 1300 aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt 1860 gtaatacgac tcactatagg gcgaattgga gctcttaatt aattacattt acatttacat 1920 ttacatttac atttacattt acatccgcgg gcgaattgga gctcaattct cttaggattc 1980 gattcacatt catctttttt tagctactaa taggataaat tataggaatt tataacaaat 2040 tgaaatatgg caggcagcaa aattaaaatt gtcttagttt tttagtgtat agaagtgaat 2100 agctatataa agtatgtgta aagttggtaa cggaacgaaa aatagaaaag gatattacat 2160 gggaaaacat gttgtttacg gagaaatgaa aagtatattg tattttgtac gagctaaaag 2220 tacagtggga acaaagtcga ttttgttaca tctacactgt tgttatcaga ttcaatggtg 2280 atggtgatga tgaccggtac. gcgtagaatc gagaccgagg agagggttag ggataggctt 2340 accgtcgact gtaacacgcg ttgaacattc tgtaggggcc actgtcttct ccacggtgct 2400 cccttcatgc gtgacctggc agctgtagct tctgtgggac ttccactgct cgggcgtcag 2460 gctcaggtag ctgctggccg cgtacttgtt gttgctctgt ttggagggtt tggtggtctc 2520 cactcccgcc ttgacggggc tgccatctgc cttccaggcc actgtcacag ctcccgggta 2580 gaagtcactg atcagacaca ctagggtggc cttgttggct tggagctcct cagaggaggg 2640 cgggaacaga gtgacagtgg ggttggcctt gggctgaccg ggcgcgccag caagcttcgc 2700 agatcttttc atatgagcta atgcggagga tgctgcgaat aaaactgcag taaaaattga 2760 aggaaatctc atggttttca aaaattctta ttttttttt ggatggacgc aaagaagttt 2820 aataatcata ttacatggca ttaccaccat atacatatcc atatacatat ccatatctaa 2880 tcttacttat atgttgtgga aatgtaaaga gccccattat cttagcctaa aaaaaccttc 2940 tctttggaac tttcagtaat acgcttaact gctcattgct atattgaagt acggattaga 3000 agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt cctcgtcttc 3060 accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga acaataaaga 3120 ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac ctggccccac 3180 aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga ttagtttttt 3240 agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat taacagatat 3300 ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc ggtttgtatt 3360 acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac ctctatactt 3420 taacgtcaag gagaaaaaac accatgcagt tacttcgctg tttttcaata ttttctgtta 3480 ttgcttcagt tttagcacca tggacatcta gaaaagctag cacagcggcc gcag ctcca 3540 ccaagggccc atcggtcttc cccctggcac cctcctccaa gagcacctct gggggcacag 3600 cggccctggg ctgcctggt aaggactact tccccgaacc ggtgacggtg tcgtggaact 3660 caggcgcgct gaccagcggc gtgcacacct tcccggctgt cctacagtca tcaggactct 3720 actccctcag cagcgtagtg accgtgccct ccagcagctt gggcacccag acctacatct 3780 gcaacgtgaa tcacaagccc agcaacacca aggtggacaa gaaagttgag cccaaatctt 3840 gtgaattcga acaaaaactt atttctgaag aggacttgga ctacaaagac gatgacgaca 3900 aggaaaacct gtattttcag ggcctgcagg ctagtggtgg aggaggctct ggtggaggcg 3960 gtagcggagg cggagggtcg atgactggtc aggaactgac aactatatgc gagcaaatcc 4020 cctcaccaac tttagaatcg acgccgtact ctttgtcaac gactactatt ttggccaacg 4080 ggaaggcaat gcaaggagtt tttgaatatt acaaatcagt aacgtttgtc agtaattgcg 4140 gttctcaccc ctcaacaact agcaaaggca gccccataaa cacacagtat gttttttaat 4200 catgtaatta gttatgtcac gcttacattc acgccctccc cccacatccg ctctaaccga 4260 aaaggaagga gttagacaac ctgaagtcta ggtccctatt tattttttta tagttatgtt 4320 agtatt aga acgttattta tatttcaaat ttttcttttt tttctgtaca gacgcgtgta 43S0 cgcatgtaac attatactga aaaccttgct tgagaaggtt ttgggacgct cgaaggcttt 4440 aatttgcact agtatgtaaa tgtaaatgta aatgtaaatg taaatgtaaa tgtaaggcca 4500 tataggccgg tacccagctt ttgttccctt tagtgagggt taattccgag cttggcgtaa 4560 tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata 4620 ggagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgaggta actcacatta 4680 attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa 4740 tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 4800 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc. tcactcaaag 4860 gcggtaatac ggttatcxac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 4920 ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc, tggcgttttt ccataggctc 4980 ggcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 5040 ggactataaa gataccaggc gttcccccct ggaagctccc tcgtgcgctc tcctgttccg 5100 accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 5160 caatgctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 5220 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 5280 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 5340 agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 5400 actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 5460 gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc 5520 aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg 5580 gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca 5640 aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt 5700 atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca 5760 gcgatctgtc tatttcgttc atccatagtt gcctgactgc ccgtcgtgta gataactacg 5820 atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca 5880 ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt 5940 cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt 6000 agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca 6060 cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca 6120 tgatccccca tgttgtgaaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga 6180 agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact 6240 gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga 6300 gaatagtgta tgcggcgacc gagttg tct tgcccggcgt caatacggga taataccgcg 6360 ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc 6 20 tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 6480 tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat 6540 gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcat ct cttccttttt 6600 caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 6660 atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctggg 6720 tccttttcat cacgtgctat aaaaataatt ataatttaaa ttttttaata taaatatata 6780 aattaaaaat agaaagtaaa aaaagaaatt aaagaaaaaa tagtttttgt tttccgaaga 6840 tgtaaaagac tctaggggga tcgccaacaa atactacctt ttatcttgct cttcctgctc 6900 tcaggtatta atgccgaatt gtttcatctt gtctgtgtag aagaccacac acgaaaatcc 6960 tgtgatttta cattttactt atcgttaatc gaatgtatat ctatttaatc tgcttttctt 7020 gtctaataaa tatatatgta aagtacgctt tttgttgaaa ttttttaaac ctttgtttat 7080 ttttttttct tcattccgta actcttctac cttctttatt tactttctaa aatccaaata 7140 caaaacataa aaataaataa acacagagta aattcccaaa ttattccatc attaaaagat 7200 acgaggcgcg tgtaagttac aggcaagcga tccgtcctaa aaaaccatta ttatcatgac 7260 attaacctat aaaaataggc gtatcacgag gccctttcgt c 7301
<210> 9
<211> 2951
<212> DMA
<213> Artificial Sequence
<220>
<223> pZB004.2 - Bicistronic unid rectional kappa insert
<400> 9
ccgcgggttt tttctccttg acgttaaagt atagaggtat attaacaatt ttttgttgat 60 acttttatta catttgaata agaagtaata caaaccgaaa atgttgaaag tattagttaa 120 agtggttatg cagtttttgc atttatatat ctgttaatag atcaaaaatc atcgcttcgc 180 tgattaatta ccccagaaat aaggctaaaa aactaatcgc attatcatcc tatggttgtt 240 aatttgattc. gttcatttga aggtttgtgg ggccaggtta ctgccaattt ttcctcttca 300 taaccataaa agctagtatt gtagaatctt tattgttcgg agcagtgcgg cgcgaggcac 360 atctgcgttt caggaacgcg accggtgaag acgaggacgc acggaggaga gtcttccttc 420 ggagggctgt cacccgctcg gcggcttcta atccgtactt caatatagca atgagcagtt 480 aagcgtatta ctgaaagttc caaagagaag gtttttttag gctaagataa tggggctctt 540 tacatttcca caacatataa gtaagattag atatggatat gtatatggat atgtatatgg 600 tggtaatgcc atgtaatatg attattaaac ttctttgcgt ccatccaaaa aaaaagtaag 660 aatttttgaa aaccatgaga tttccttcaa tttttactgc agttttattc gcagcatcct 720 ccgcattagc tcatatgaaa agatctgcga agcttgctgg cgcgcccgga actgtggctg 780 caccatctgt cttcatcttc ccgccatctg atgagcagtt gaaatctgga actgcctctg 840 ttgtgtgcct gctgaataac ttctatccca gagaggccaa agtacagtgg aaggtggata 900 acgccctcca atcgggtaac tcccaggaga gtgtcacaga gcaggacagc aaggacagca 960 cctacagcct cagcagcacc ctgacgctgt cgaaagcaga ctacgagaaa cacaaagtct 1020 acgcctgcga agtcacccat cagggcctga gctcgcccgt cacaaagagc ttcaacaggg 1080 gagagtgtac gcgtgttaca gtcgacggta agcctatccc taaccctctc. ctcggtctcg 1140 attctacgcg taccggtcat catcaccatc accatatctg ataacaacag tgtagatgta 1200 acaaaatcga ctttgttccc actgtacttt tagctcgtac. aaaatacaat atacttttca 1260 tttctccgta aacaacatgt tttcccatgt aatatccttt tctatttttc gttccgttac 1320 caactttaca catactttat atagctattc acttctatac actaaaaaac taagacaatt 1380 ttaattttgc tgcctgccat attt aattt gttataaatt cctataattt atcctattag 1440 tagctaaaaa aagatgaatg tgaatcgaat cctaagagaa ttgagctcca attcgccgga 1500 ttagaagccg ccgagcgggt gacagccctc cgaaggaaga ctctcctccg tgcgtcctcg 1560 tcttcaccgg tcgcgttcct gaaacgcaga tgtgcctcgc gccgcactgc tccgaacaat 1620 aaagattcta caatactagc ttttatggtt atgaag gga aaaattggca gtaacctggc 1680 cccacaaacc ttcaaatgaa cgaatcaaat taacaaccat aggatgataa tgcgattagt 1740 tttttagcct tatttctggg gtaattaatc agcgaagcga tgatttttga tctattaaca 1800 gatatataaa tgcaaaaact gcataaccac tttaactaat actttcaaca ttttcggttt 1860 gtattacttc ttattcaaat gtaataaaag tatcaacaaa aaattgttaa tatacctcta 1920 tactttaacg tcaaggagac catgcagtta cttcgctgtt tttcaatatt ttctgttatt 1980 gcttcagttt tagcaccatg gacatctaga aaagctagca cagcggccgc agcctccacc 2040 aagggcccat cggtcttccc cctggcaccc tcctccaaga gcacctctgg gggcacagcg 2100 gccctgggct gcctggtcaa ggactacttc cccgaaccgg tgacggtgtc gtggaactca 2160 ggcgcgctga ccagcggcgt gcacaccttc ccggctgtcc tacagtcatc aggactctac 2220 tccctcagca gcgtagtgac cgtgccctcc agcagcttgg gcacccagac ctacatctgc 2280 aacgtgaatc acaagcccag caacaccaag gtggacaaga aagttgagcc caaatcttgt 2340 gaattcgaac aaaaacttat ttctgaagag gacttggact acaaagacga tgacgacaag 2400 gaaaacctgt atttt aggg cctgcaggct agtggtggag gaggctctgg tggaggcggt 2460 agcggaggcg gagggtcgat gactggtcag gaactgacaa ctatatgcga gcaaatcccc 2520 tcaccaactt tagaatcgac gccgtactct ttgtcaacga ctactatttt ggccaacggg 2580 aaggcaatgc aaggagtttt tgaatattac aaatcagtaa cgtttgtcag taattgcggt 2640 tctcacccct caacaactag caaaggcagc cccataaaca cacagtatgt tttttaatca 2700 tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct ctaaccgaaa 2760 aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata gttatgttag 2820 tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga cgcgtgtacg 2880 catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg aaggctttaa 2940 tttgcactag t 2951
<210> 10
<211> 7743
<212> DNA
<213> Artificial sequenc
<223> pZB004.2 -- Bicistronic unidirectional kappa vector construct
<220>
<221> mi sc_recomb
<222> (1). .. (7743)
<400> 10
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaacg acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240 atatgtgtac tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300 aaatagcttg tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360 gaattaattc ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420 tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480 atttcacagg tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540 cagaatgtgc tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600 agagaacaat tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660 atagttcagg cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720 ttttggctct ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780 ggcaagaata ccaagagttc ctcggtttgc caqttattaa aagactcgta tttccaaaag 840 actgcaacat actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900 attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960 gaaggcaaga gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020 atgttggtga tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc. ggaggtgtgg 1080 agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140 aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgcctg cggtgtgaaa 1200 taccgcacag atgcgtaagg agaaaatacc gcatcaggaa attgtaaacg ttaatatttt 1260 gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat 1320 cggcaaaatc ccttataaat caaaaqaata gaccgagata gggttgagtg ttgttccagt 1380 ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt 1440 ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag 1500 gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg 1560 aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc 1620 gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc 1680 gctacagggc gcgtcgcgcc attcgccatt caggctgcgc aactgttggg aagggcgatc 1740 ggtgcgggcc tcttcgctat tacgccagct ggcgaagggg ggatgtgctg caaggcgatt 1800 aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt 1860 gtaatacgac tcactatagg gcgaattgga gctcccgcgg atgtaaatgt aaatgtaaat 1920 gtaaatgtaa atgtaaatgt aattaattaa gttttttctc cttgacgtta aagtatagag 1980 gtatattaac. aattttttgt tgatactttt attacatttg aataagaagt aatacaaacc 2040 gaaaatgttg aaagtattag ttaaagtggt tatgcagttt ttgcatttat atatctgtta 2100 atagatcaaa aatcatcgct tcgctgatta attaccccag aaataaggct aaaaaactaa 2160 tcgcattatc atcctatggt tgttaatttg attcgttcat ttgaaggttt gtggggccag 2220 gttactgcca atttttcctc ttcataacca taaaagctag tattgtagaa tctttattgt 2280 tcggagcagt gcggcgcgag gcacatctgc gtttcaggaa cgcgaccggt gaagacgagg 2340 acgcacggag gagagtcttc cttcggaggg ctgtcacccg ctcggcggct tctaatccgt 2400 acttcaatat agcaatgagc agttaagcgt attactgaaa gttccaaaga gaaggttttt 2460 ttaggctaag ataatggggc tctttacatt tccacaacat ataagtaaga ttagatatgg 2520 atatgtatat ggatatgtat atggtggtaa tgccatgtaa tatgattatt aaacttcttt 2580 gcgtccatcc. aaaaaaaaag taagaatttt tgaaaaccat gagatttcct tcaattttta 2640 ctgcagtttt attcgcagca tcctccgcat tagctcatat gaaaagatct gcgaagcttg 2700 ctggcgcgc cggaactgtg gctgcaccat ctgtcttcat cttcccgcca tctgatgagc 2760 agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa taacttctat cccagagagg 2820 ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag gagagtgtca 2880 cagagcagga cagcaaggac agcacctaca gcctcagcag caccctgacg ctgtcgaaag 2940 cagactacga gaaacacaaa gtctacgcct gcgaagtcac ccatcagggc ctgagctcgc 3000 ccgtcacaaa gagcttcaac aggggagagt gtacgcgtgt tacagtcgac ggtaagccta 3060 tccctaaccc tctcctcggt ctcgattcta cgcgtaccgg tcatcatcac catcaccata 3120 tctgataaca acagtgtaga tgtaacaaaa tcgactttgt tcccactgta cttttagctc 3180 gtacaaaata caatatactt ttcatttctc cgtaaacaac atgttttccc atgtaatatc 3240 cttttctatt tttcgttccg ttaccaactt tacacatact ttatatagct attcacttct 3300 atacactaaa aaactaagac aattttaatt ttgctgcctg ccatatttca atttgttata 3360 aattcctata atttatccta ttagtagcta aaaaaagatg aatgtgaatc gaatcctaag 3420 agaattgagc tccaattcgc cggattagaa gccgccgagc gggtgacagc cctccgaagg 34SO aagactctcc tccgtgcgtc ctcgtcttca ccggtcgcgt tcctgaaacg cagatgtgcc 3540 tcgcgccgca ctgctccgaa caataaagat tctacaatac tagcttttat ggttatgaag 3600 aggaaaaatt ggcagtaacc tggccccaca aaccttcaaa tgaacgaatc. aaattaacaa 3660 ccataggatg ataatgcgat tagtttttta gccttatttc tggggtaatt aatcagcgaa 3720 gcgatgattt ttgatctatt aacagatata taaatgcaaa aactgcataa ccactttaac 3780 taatactttc aacattttcg gtttgtatta cttcttattc aaatgtaata aaagtatcaa 3840 caaaaaattg ttaatatacc tctatacttt aacgtcaagg agaccatgca gttacttcgc 3900 tgtttttcaa tattttctgt tattgcttca gttttagcac catggacatc tagaaaagct 3960 agcacag gg ccgcagcctc caccaagggc ccatcggtct tccccctggc accctcctcc 4020 aagagcacct ctgggggcac agcggccctg ggctgcctgg tcaaggacta cttccccgaa 4080 ccggtgacgg tgtcgtggaa ctcaggcgcg ctgaccagcg gcgtgcacac cttcccggct 4140 gtcctacagt catcaggact ctactccctc agcagcgtag tgaccgtgcc ctccagcagc 4200 ttgggcaccc agacctacat ctgcaacgtg aatcacaagc ccagcaacac caaggtggac 4260 aagaaagttg agcccaaatc ttgtgaattc gaacaaaaac ttatttctga agaggacttg 4320 gactacaaag acgatgacga caaggaaaac ctgtattttc agggcctgca ggctagtggt 4380 ggaggaggct ctggtggagg cggtagcgga ggcggagggt cgatgactgg tcaggaactg 4440 acaactatat gcgagcaaat cccctcacca actttagaat cgacgccgta ctctttgtca 4500 acgactacta ttttggccaa cgggaaggca atgcaaggag tttttgaata ttacaaatca 4560 gtaacgtttg tcagtaattg cggttctcac ccctcaacaa ctagcaaagg cagccccata 4620 aacacacagt atgtttttta atcatgtaat tagttatgtc acgcttacat tcacgccctc 4680 cccccacatc cgctctaacc gaaaaggaag gagttagaca acctgaagtc taggtcccta 4740 tttatttttt tatagttatg ttagtattaa gaacgttatt tatatttcaa atttttcttt 4800 tttttctgta cagacgcgtg tacgcatgta acattatact gaaaaccttg cttgagaagg 4860 ttttgggacg ctcgaaggct ttaatttgca ctagtatgta aatgtaaatg taaatgtaaa 4920 tgtaaatgta aatgtaaggc catataggcc ggtacccagc ttttgttccc tttagtgagg 4980 gttaattccg agcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc 5040 gctcacaatt ccacacaaca taggagccgg aagcataaag tgtaaagcct ggggtgccta 5100 atgagtgagg taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 5160 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 5220 tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 5280 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 5340 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 5400 gctggcgttt ttccataggc tcggcccccc tgacgagcat cacaaaaatc gacgctcaag 5460 tcagaggtgg cgaaacccga caggactata aagataccag gcgttccccc ctggaagctc 5520 cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 5580 ttcgggaagc gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt 5640 cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 5700 atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 5760 agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 5820 gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa 5880 gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 5940 tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga 6000 agatcctttg atcttttcta cgggqtctga cgctcagtgg aacqaaaact cacgttaagg 6060 gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg 6120 aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt 6180 aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact 6240 gcccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat 6300 gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg 6360 aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg 6420 ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat 6480 tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc 6540 ccaacgatca aggcgagtta catgatcccc catgttgtga aaaaaagcgg ttagctcctt 6600 cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc 6660 agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga 6720 gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc 6780 gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa 6840 acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta 6900 acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg 6960 agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg 7020 aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat 7080 gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt 7140 tccccgaaaa gtgccacxtg ggtccttttc atcacgtgct ataaaaataa ttataattta 7200 aattttttaa tataaatata taaattaaaa atagaaagta aaaaaagaaa ttaaagaaaa 7260 aatagttttt gttttccgaa gatgtaaaag actctagggg gatcgccaac aaatactacc 7320 ttttatcttg ctcttcctgc tctcaggtat taatgccgaa ttgtttcatc ttgtctgtgt 7380 agaagaccac acacgaaaat cctgtgattt tacattttac ttatcgttaa tcgaatgtat 7440 atctatttaa tctgcttttc ttgtctaata aatatatatg taaagtacgc tttttgttga 7500 aattttttaa acctttgttt attttttttt cttcattccg taactcttct accttcttta 7560 tttactttct aaaatccaaa tacaaaacat aaaaataaat aaacacagag taaattccca 7620 aattattcca tcattaaaag atacgaggcg cgtgtaagtt acaggcaagc gatccgtcct 7680 aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc 7740 gtc 7743 <210> 11
<211> 2948
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB004.3 - Bicistronic un d rect onal lambda insert
<220>
<221> qene
<222> (1)..(2948)
<400> 11
ccgcgggttt tttctccttg acgttaaagt atagaggtat attaacaatt ttttgttgat 60 acttttatta catttgaata agaagtaata caaaccgaaa atgttgaaag tattagttaa 120 agtggttatg cagtttttgc atttatatat ctgttaatag atcaaaaatc atcgcttcgc 180 tgattaatta ccccagaaat aaggctaaaa aactaatcgc attatcatcc tatggttgtt 240 aatttga tc gttcatttga aggtttgtgg ggccaggtta ctgccaattt ttcctcttca 300 taaccataaa agctagtatt gtagaatctt tattgttcgg agcagtgcgg cgcgaggcac 360 atctgcgttt caggaacgcg accggtgaag acgaggacgc acggaggaga gtcttccttc 420 ggagggctgt cacccgctcg gcgacttcta atccgtactt caatatagca atgagcagtt 480 aagcgtatta ctgaaagttc caaagagaag gtttttttag gctaagataa tggggctctt 540 tacatttcca caacatataa gtaagattag atatggatat gtatatggat atgtatatgg 600 tggtaatgcc atgtaatatg attattaaac ttctttgcgt ccatccaaaa aaaaagtaag 660 aatttttgaa aaccatgaga tttccttcaa tttttactgc agttttattc gcagcatcct 720 ccgcattagc tcatatgaaa agatctgcga agcttgctgg cgcgcccggt cagcccaagg 780 ccaaccccac tgtcactctg ttcccgccct cctctgagga gctccaagcc aacaaggcca 840 ccctagtgtg tctgatcagt gacttctacc cgggagctgt gacagtggcc tggaaggcag 900 atggcagccc cgtcaaggcg ggagtggaga ccaccaaacc ctccaaacag agcaacaaca 960 agtacgcggc cagcagctac ctgagcctga cgcccgagca gtggaagtcc cacagaagct 1020 acagctgcca ggtcacgcat gaagggagca ccgtggagaa gacagtggcc cctacagaat 1080 gttcaacgcg tgttacagtc gacggtaagc ctatccctaa ccctctcctc ggtctcgatt 1140 ctacgcgtac cggtcatcat caccatcacc atatctgata acaacagtgt agatgtaaca 1200 aaatcgactt tgttcccact gtacttttag ctcgtacaaa atacaatata cttttcattt 1260 ctccgtaaac aacatgtttt cccatgtaat atccttttct atttttcgtt ccgttaccaa 1320 ctttacacat actttatata gctattcact tctatacact aaaaaactaa gacaatttta 1380 attttgctgc ctgccatatt tcaatttgtt ataaattcct ataatttatc ctattagtag 1440 ctaaaaaaag atgaatgtga atcgaatcct aagagaattg agctccaatt cgccggatta 1500 gaagccgccg agcgggtgac agccctccga aggaagactc tcctccgtgc gtcctcgtct 1560 tcaccggtcg cgttcctgaa acgcagatgt gcctcgcgcc gcactgctcc gaacaataaa 1620 gattctacaa tactagcttt tatggttatg aagaggaaaa attggcagta acctggcccc 1680 acaaaccttc aaatgaacga atcaaattaa caaccatagg atgataatgc. gattagtttt 1740 ttagccttat ttctggggta attaatcagc gaagcgatga tttttgatct attaacagat 1800 atataaatgc aaaaactgca taaccacttt aactaatact ttcaacattt tcggtttgta 1860 ttacttctta ttcaaatgta ataaaa tat caacaaaaaa ttgttaatat acctctatac 1920 tttaacgtca aggagaccat gcagttactt cgctgttttt caatattttc tgttattgct 1980 tcagttttag caccatggac atctagaaaa gctagcacag cggccgcagc ctccaccaag 2040 ggcccatcgg tcttccccct ggcaccctcc tccaagagca cctctggggg cacagcggcc 2100 ctgggctgcc tggtcaagga ctacttcccc gaaccggtga cggtgtcgtg gaactcaggc 2160 gcgctgacca gcggcgtgca caccttcccg gctgtcctac agtcatcagg actctactcc 2220 ctcagcagcg tagtgaccgt gccctccagc agcttgggca cccagaccta catctgcaac 2280 gtgaatcaca agcccagcaa caccaaggtg gacaagaaag ttgagcccaa atcttgtgaa 2340 ttcgaacaaa aacttatttc tgaagaggac ttggactaca aagacgatga cgacaaggaa 2400 aacctgtatt ttcagggcct gcaggctagt ggtggaggag gctctggtgg aggcggtagc 2460 ggaggcggag ggtcgatgac tggtcaggaa ctgacaacta tatgcgagca aatcccctca 2520 ccaactttag aatcgacgcc gtactctttg tcaacgacta ctattttggc caacgggaag 2580 gcaatgcaag gagtttttga atattacaaa tcagtaacgt ttgtcagtaa ttgcggttct 2640 cacccctcaa caactagcaa aggcagcccc ataaacacac agtatgtttt ttaatcatgt 2700 aattagttat gtcacgctta cattcacgcc ctccccccac, atccgctcta accgaaaagg 2760 aaggagttag acaacctgaa gtctaggtcc ctatttattt ttttatagtt atgttagtat 2820 taagaacgtt atttatattt caaatttttc ttttttttct gtacagacgc gtgtacgcat gtaacattat actgaaaacc ttgcttgaga aggttttggg acgctcgaag gctttaattt gcactagt
<210> 12
<211> 7740
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB004.3 -- eic stronic unidirectional lambda vector construct
<221> m sc recomb
<222> (Γ),. (7740)
<400>
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaacg acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240 atatgtgtac tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300 aaatagcttg tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360 gaattaattc ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420 tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480 atttcacagg tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540 cagaatgtgc tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600 agagaacaat tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660 atagttcagg cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720 ttttggctct ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780 ggcaagaata ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840 actgcaacat actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900 attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960 gaaggcaaga gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020 atgttggtga tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080 agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140 aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgcctg cggtgtgaaa 1200 taccgcacag atgcgtaagg agaaaatacc gcatcaggaa attgtaaacg ttaatatttt 1260 gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat 1320 cggcaaaatc. ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt 1380 ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt 1440 ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag 1500 gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg 1560 aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc 1620 gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc 1680 gctacagggc gcgtcgcgcc attcgccatt caggctgcgc aactgttggg aagggcgatc 1740 ggtgcgggcc tcttcgctat tacgccagct ggcgaagggg ggatgtgctg caaggcgatt 1800 aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt 1860 gtaatacgac tcactatagg gcgaattgga gctcttaatt aattacattt acatttacat 1920 ttacatttac atttacattt acatccgcgg gttttttctc cttgacgtta aagtatagag 1980 gtatattaac aattttttgt tgatactttt attacatttg aataagaagt aatacaaacc 2040 gaaaatgttg aaagtattag ttaaagtggt tatgcagttt ttgcatttat atatctgtta 2100 a a. t aaa. aatcatcgct tcgctgatta attaccccag aaataaggct aaaaaactaa 2160 tcgcattatc atcctatggt tgttaatttg attcgttcat ttgaaggttt gtggggccag 2220 gttactgcca atttttcctc ttcataacca taaaagctag tattgtagaa tctttattgt 2280 tcggagcagt gcggcgcgag gcacatctgc gtttcaggaa cgcgaccggt gaagacgagg 2340 acgcacggag gagagtcttc cttcggaggg ctgtcacccg ctcggcggct tctaatccgt 2400 acttcaatat agcaatgagc agttaagcgt attactgaaa gttccaaaga gaaggttttt 2460 ttaggctaag ataatggggc tctttacatt tccacaacat ataagtaaga ttagatatgg 2520 atatgtatat ggatatgtat atggtggtaa tgccatgtaa tatgattatt aaacttcttt 2580 gcgtccatcc aaaaaaaaag taagaatttt tgaaaaccat gagatttcct tcaattttta 2640 tgcagtttt attcgcagca tcctccgcat tagctcatat gaaaagatct gcgaagcttg 2700 ctggcgcgcc cggtcagccc aaggccaacc ccactgtcac tctgttcccg ccctcctctg 2760 aggagctcca agccaacaag gccaccctag tgtgtctgat cagtgacttc tacccgggag 2820 ctgtgacagt ggcctggaag gcagatggca gccccgtcaa ggcgggagtg gagaccacca 2880 aac.cctc.caa acagagcaac aacaagtacg cggccagcag ctacctgagc ctgacgcccg 2940 agcagtggaa gtcccacaga agctacagct gccaggtcac gcatgaaggg agcaccgtgg 3000 agaagacagt ggcccctaca gaatgttcaa cgcgtgttac agtcgacggt aagcctatcc 3060 ctaaccctct cctcggtctc gattctacgc gtaccggtca tcatcaccat caccatatct 3120 gataacaaca gtgtagatgt aacaaaatcg actttgttcc cactgtactt ttagctcgta 3180 caaaatacaa tatacttttc atttctccgt aaacaacatg ttttcccatg taatatcctt 3240 ttctattttt cgttccgtta ccaactttac acatacttta tatagctatt cacttctata 3300 cactaaaaaa ctaagacaat tttaattttg ctgcctgcca tatttcaatt tgttataaat 3360 tcctat att tatcctatta gtagctaaaa aaagatgaat gtgaatcgaa tcctaagaga 3420 attgagctcc aattcgccgg attagaagcc gccgagcggg tgacagccct ccgaaggaag 3480 actctcctcc gtgcgtcctc gtcttcaccg gtcgcgttcc tgaaacgcag atgtgcctcg 3540 cgccgcactg ctccgaacaa taaagattct acaatactag cttttatggt tatgaagagg 3600 aaaaattggc agtaacctgg ccccacaaac cttcaaatga acgaatcaaa ttaacaacca 3660 taggatgata atgcgattag ttttttagcc ttatttctgg ggtaattaat cagcgaagcg 3720 atgatttttg atctattaac agatatataa atgcaaaaac tgcataacca ctttaactaa 3780 tactttcaac attttcggtt tgtattactt cttattcaaa tgtaataaaa gtatcaacaa 3840 aaaattgtta atatacctct atactttaac gtcaaggaga ccatgcagtt acttcgctgt 3900 ttttcaatat tttctgttat tgcttcagtt ttagcaccat ggacatctag aaaagctagc 3960 acagcggccg cagcctccac caagggccca tcggtcttcc ccctggcacc ctcctccaag 4020 agcacctctg ggggcacagc ggccctgggc tgcctggtca aggactactt ccccgaaccg 4080 gtgacggtgt cgtggaactc aggcgcgctg accagcggcg tgcacacctt cccggctgtc 4140 ctacagtcat caggactcta ctccctcagc agcgtagtga ccgtgccctc cagcagcttg 4200 ggcacccaga cctacatctg caacgtgaat cacaagccca gcaacaccaa ggtggacaag 4260 aaagttgagc ccaaatcttg tgaattcgaa caaaaactta ttt tgaaga ggacttggac 4320 tacaaagacg atgacgacaa ggaaaacctg tattttcagg gcctgcaggc tagtggtgga 4380 ggaggctctg gtggaggcgg tagcggaggc ggagggtcga tgactggtca ggaactgaca 4440 actatatgcg agcaaatccc ctcaccaact ttagaatcga cgccgtactc tttgtcaacg 4500 actactattt tggccaacgg gaaggcaatg caaggagttt ttgaatatta caaatcagta 4560 acgtttgtca gtaattgcgg ttctcacccc tcaacaacta gcaaaggcag ccccataaac 4620 acacagtatg ttttttaatc atgtaattag ttatgtcacg cttacattca cgccctcccc 46S0 ccacatccgc tctaaccgaa aaggaaggag ttagacaacc tgaagtctag gtccctattt 4740 atttttttat agttatgtta gtattaagaa cgttatttat atttcaaatt tttctttttt 4800 ttctgtacag acgcgtgtac gcatgtaaca ttatactgaa aaccttgctt gagaaggttt 4860 tgggacgctc, gaaggcttta atttgcacta gtatgtaaat gtaaatgtaa atgtaaatgt 4920 aaatgtaaat gtaaggccat ataggccggt acccagcttt tgttcccttt agtgagggtt 4980 aattccgagc ttggcgtaat catggtcata gctgtttcct gtgtgaaatt gttatccgct 5040 cacaattcca cacaacatag gagccggaag cataaagtgt aaagcctggg gtgcctaatg 5100 agtgaggtaa ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct 5160 gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg 5220 gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc 5280 ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg 5340 aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct 5400 ggcgtttttc cataggctcg gcccccctga cgagcatcac aaaaatcgac gctcaagtca 5460 gaggtggcga aacccgacag gactataaag ataccaggcg ttcccccctg gaagctccct 5520 cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 5580 gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 5640 tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 5700 cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 5760 cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 5820 gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc 5880 agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag 5940 cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga 6000 tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat 6060 tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag 6120 ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat 6180 cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg cctgactgcc 6240 cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat 6300 accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag 6360 ggccgagcgc agaagtggtc. ctgcaacttt atccgcctcc atccagtcta ttaattgttg 6420 ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc 6480 tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca 6540 acgatcaagg cgagttacat gatcccccat gttgtgaaaa aaagcggtta gctccttcgg 6600 tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc 6660 actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta 6720 ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc 6780 aatacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg 6840 ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc 6900 cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc 6960 aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat 7020 actcatactc ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag 7080 cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc 7140 ccgaaaagtg ccacctgggt ccttttcatc acgtgctata aaaataatta taatttaaat 7200 tttttaatat aaatatataa attaaaaata gaaagtaaaa aaagaaatta aagaaaaaat 7260 agtttttgtt ttccgaagat gtaaaagact ctagggggat cgccaacaaa tactaccttt 7320 tatcttgctc ttcctgctct caggtattaa tgccgaattg tttcatcttg tctgtgtaga 7380 agaccacaca cgaaaatcct gtgattttac attttactta tcgttaatcg aatgtatate 7440 tatttaatct gcttttcttg tctaataaat atatatgtaa agtacgcttt ttgttgaaat 7500 tttttaaacc tttgtttatt tttttttctt cattccgtaa ctcttctacc ttctttattt 7560 actttctaaa atccaaatac aaaacataaa aataaataaa cacagagtaa attcccaaat 7620 tattccatca ttaaaagata cgaggcgcgt gtaagttaca ggcaagcgat ccgtcctaag 7680 aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 7740
<210> 13
<211> 1446
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB004.4 -- Yeast SCFV insert
<2_>>
<221> gene
<222> (13 ,. (1446)
<400> 13
ccgcggacgg attagaagee gecgageggg tgacagccct ccgaaggaag actctcctcc 60 gtgcgtcctc gtcttcaccg gtcgcgttcc tgaaacgcag atgtgcctcg cgccgcactg 120 ctccgaacaa taaagattct acaatactag cttttatggt tatgaagagg aaaaattggc 180 agtaacctgg ccccacaaac cttcaaatga acgaatcaaa ttaacaacca taggatgata 240 atgegattag ttttttagee ttatttctgg ggtaattaat cagegaageg atgatttttg 300 atctattaac agatatataa atgeaaaaac tgcataacca ctttaactaa tactttcaac 360 attttcgatt tgtattactt cttattcaaa tgtaataaaa gtatcaacaa aaaattgtta 420 atatacctct atactttaac gtcaaggaga aaaaaccccg gatcgaattc cctacttcat 480 acattttcaa ttaagatgea gttacttege tgtttttcaa tattttctgt tattgettea 540 gttttagcac aggaactgac aactatatgc gagcaaatcc cctcaccaac tttagaatcg 600 acgccgtact ctttgtcaac gactactatt ttggccaacg ggaaggcaat gcaaggagtt 660 tttgaatatt acaaatcagt aacgtttgtc agtaattgcg gttctcaccc ctcaacaact 720 agcaaaggca gccccataaa cacacagtat gtttttaagg acaatagctc gacgattgaa 780 ggtagatacc catacgacgt tccagactac getctgeagg ctagtggtgg aggaggctct 840 ggtggaggcg gtageggagg eggagggteg atgactggtg aaaacctgta ttttcagggc 900 gctagcacta gtcatatgaa aagatctg g aagcttgctg gcgcgcccgg tggttcctct 960 agatcttcct cctctggtgg cggtggctcg ggcggtggtg ggccatggac atctagaaaa 1020 gctagcacag cggccgccct cgagggatcc gaacaaaagc ttatttctga agaggacttg 1080 cgtacccgtg actacaaaga cgatgacgac aagtaataga tctgataaca acagtgtaga 1140 tgtaacaaaa tcgactttgt tcccactgta cttttagctc gtacaaaata caatatactt 1200 ttcatttctc cgtaaacaac atgttttccc atgtaatatc cttttctatt tttcgttccg 1260 ttaccaactt tacacatact ttatatagct attcacttct atacactaaa aaactaagac 1320 aattttaatt ttg tgcctg ccatatttca atttgttata aattcctata atttatccta 1380 ttagtagcta aaaaaagatg aatgtgaatc gaatcctaag agaattgagc tccaattcgc 1440 gggece 1446 <210> 14
<211> 6135
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB004.4 - Yeast SCFV vector construct
<220>
<221> mi sc_recomb
<222> (1)..(6135)
<400> 14
gggcccggta cccagctttt gttcccttta gtgagggtta attccgagct tggcgtaatc 60 atggtcatag ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatagg 120 agccggaagc ataaagtgta aagcctgggg tgcctaatga gtgaggtaac tcacattaat 180 tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg 240 aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgctcttccg cttcctcgct 300 cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc 360 ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg 420 ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctcgg 480 cccccctga gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg 540 actataaaga taccaggcgt tcccccctgg aagctccctc gtgcgctctc ctgttccgac 600 cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca 660 atgctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt 720 gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc 780 caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag 840 agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac 900 tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt 960 tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa 1020 gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg 1080 gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa 1140 aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat 1200 atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc 1260 gatctgtcta tttcgttcat ccatagttgc ctgactgccc gtcgtgtaga taacta gat 1320 acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc 1380 ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc 1440 tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag 1500 ttcgccagtt aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg 1560 ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg 1620 atcccccatg ttgtgaaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag 1680 taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt 1740 catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga 1800 atagtgtatg cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc 1860 acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc 1920 aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc 1980 ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc 2040 cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca 2100 atattattga agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat 2160 ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgggtc 2220 cttttcatca cgtgctataa aaataattat aatttaaatt ttttaatata aatatataaa 22S0 ttaaaaatag aaagtaaaaa aa.gaaatta.a agaaaaaata gtttttgttt tccgaagatg 2340 taaaagactc tagggggatc gccaacaaat actacctttt atcttgctct tcctgctctc 2400 aggtattaat gccgaattgt ttcatcttgt ctgtgtagaa gaccacacac gaaaatcctg 2460 tgattttaca ttttacttat cgttaatcga atgtatatct atttaatctg cttttcttgt 2520 ctaataaata tatatgtaaa gtacgctttt tgttgaaatt ttttaaacct ttgtttattt 2580 ttttttcttc attccgtaac tcttctacct tctttattta ctttctaaaa tccaaataca 2640 aaacataaaa ataaataaac acagagtaaa ttcccaaatt attccatcat taaaagatac 2700 gaggcgcgtg taagttacag gcaagcgatc cgtcctaaga aaccattatt atcatgacat 2760 taacctataa aaataggcgt atcacgaggc cctttcgtct cgcgcgtttc ggtgatgacg 2820 gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg 2880 ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggctggc 2940 ttaactatgc ggcatcagag cagattgtac tgagagtgca ccataaacga cattactata 3000 tatataatat aggaagcatt taatagacag catcgtaata tatgtgtact ttgcagttat .3060 gacgccagat ggcagtagtg gaagatattc tttattgaaa aatagcttgt caccttacgt 3120 acaatcttga tccggagctt ttcttttttt gccgattaag aattaattcg gtcgaaaaaa 3180 gaaaaggaga gggccaagag ggagggcatt ggtgactatt gagcacgtga gtatacgtga 3240 ttaagcacac aaaggcagct tggagtatgt ctgttattaa tttcacaggt agttctggtc 3300 cattggtgaa agtttgcggc ttgcagagca cagaggccgc agaatgtgct ctagattccg 3360 atgctgactt gctgggtatt atatgtgtgc ccaatagaaa gagaacaatt gacccggtta 3420 ttgcaaggaa aatttcaagt cttgtaaaag catataaaaa tagttcaggc actccgaaat 3480 acttggttgg cgtgtttcgt aatcaaccta aggaggatgt tttggctctg gtcaatgatt 3540 acggcattga tatcgtccaa ctgcatggag atgagtcgtg gcaagaatac caagagttcc 3600 tcggtttgcc agttattaaa agactcgtat ttccaaaaga ctgcaacata ctactcagtg 3660 cagcttcaca gaaacctcat tcgtttattc ccttgtttga ttcagaagca ggtgggacag 3720 gtgaactttt ggattggaac tcgatttctg actgggttgg aaggcaagag agccccgaaa 3780 gcttacattt tatgttagct ggtggactga cgccagaaaa tgttggtgat gcgcttagat 3840 taaatggcgt tattggtgtt gatgtaagcg gaggtgtgga gacaaatggt gtaaaagact 3900 ctaacaaaat agcaaatttc gtcaaaaatg ctaagaaata ggttattact gagtagtatt 3960 tatttaagta ttgtttgtgc. ac.ttgc.ctgc ggtgtgaaat accgcacaga tgcgtaagga 4020 gaaaataccg catcaggaaa ttgtaaacgt taatattttg ttaaaattcg cgttaaattt 4080 ttgttaaatc agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc cttataaatc 4140 aaaagaatag accgagatag ggttgagtgt tgttccagtt tggaacaaga gtccactatt 4200 aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg atggcccact 4260 acgtgaacca tcaccctaat caagtttttt ggggtcgagg tgccgtaaag cactaaatcg 4320 gaaccctaaa gggagccccc gatttagagc ttgacgggga aagccggcga acgtggcgag 4380 aaaggaaggg aagaaagcga aaggagcggg cgctagggcg ctggcaagtg tagcggtcac 4440 gctgcgcgta accaccacac ccgccgcgct taatgcgccg ctacagggcg cgtcgcgcca 4500 ttcgccattc aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt 4560 acgccagctg gcgaaggggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt 4620 ttcccagtca cgacgttgta aaacgacggc cagtgaattg taatacgact cactataggg 4680 cgaattggag ctccaccgcg gacggattag aagccgccga gcgggtgaca gccctccgaa 4740 ggaagactct cctccgtgcg tcctcgtctt caccggtcgc gttcctgaaa cgcagatgtg 4800 cctcgcgccg cactgctccg aacaataaag attctacaat actagctttt atggttatga 4360 agaggaaaaa ttggcagtaa cctggcccca caaaccttca aatgaacgaa tcaaattaac 4920 aaccatagga tgataatgcg attagttttt tagccttatt tctggggtaa ttaatcagcg 4980 aagcgatgat ttttgatcta ttaacagata tataaatgca aaaactgcat aaccacttta 5040 actaatactt tcaacatttt cggtttgtat tacttcttat tcaaatgtaa taaaagtatc 5100 aacaaaaaat tgttaatata cctctatact ttaacgtcaa ggagaaaaaa ccccggatcg 5160 aattccctac ttcatacatt ttcaattaag atgcagttac ttcgctgttt ttcaatattt 5220 tctgttattg cttcagtttt agcacaggaa ctgacaacta tatgcgagca aatcccctca 5280 ccaactttag aatcgacgcc gtactctttg tcaacgacta ctattttggc. caacgggaag 5340 gcaatgcaag gagtttttga atattacaaa tcagtaacgt ttgtcagtaa ttgcggttct 5400 cacccctcaa caactagcaa aggcagcccc ataaacacac agtatgtttt taaggacaat 5460 agctcgacga ttgaaggtag atacccatac gacgttccag actacgctct gcaggctagt 5520 ggtggaggag gctctggtgg aggcggtagc ggaggcggag ggtcgatgac tggtgaaaac 5580 ctgtattttc agggcgctag cactagtcat atgaaaagat ctgcgaagct tgctggcgcg 5640 cccggtggtt cctctagatc ttcctcctct ggtggcggtg gctcgggcgg tggtgggcca 5700 tggacatcta gaaaagctag cacagcggcc gccctcgagg gatccgaaca aaagcttatt 5760 tctgaagagg acttgcgtac ccgtgactac aaagacgatg acgacaagta atagatctga 5820 taacaacagt gtagatgtaa caaaatcgac tttgttccca ctgtactttt agctcgtaca 5880 aaatacaata tacttttcat ttctccgtaa acaacatgtt ttcccatgta atatcctttt 5940 ctatttttcg ttccgttacc aactttacac atactttata tagctattca cttctataca 6000 ctaaaaaact aagacaattt taattttgct gcctgccata tttcaatttg ttataaattc 6060 ctataattta tcctattagt agctaaaaaa agatgaatgt gaatcgaatc ctaagagaat 6120 tgagctccaa ttcgc 6135
<210> 15
<211> 759
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB002 - Aga2p Heavy chain Mating Type
<220>
<221> gene
<222> (1)..(759)
<400> 15
actagtatgc agttacttcg ctgtttttca atattttctg ttattgcttc agttttagca 60 ccatggacat ctagaaaagc tagcacagcg gccgcagcct ccaccaaggg cccatcggtc 120 ttccccctgg caccctcctc caagagcacc tctgggggca cagcggccct gggctgcctg 180 gtcaaggact acttccccga accggtgacg gtgtcgtgga actcaggcgc gctgaccagc 240 ggcgtgcaca ccttcccggc tgtcctacag tcatcaggac tctactccct cagcagcgta 300 gtgaccgtgc cctccagcag cttgggcacc cagacctaca tctgcaacgt gaatcacaag 360 cccagcaaca ccaaggtgga caagaaagtt gagcccaaat cttgtgaatt cgaacaaaaa 420 cttatttctg aagaggactt ggactacaaa gacgatgacg acaaggaaaa cctgtatttt 480 cagggcctgc aggctagtgg tggaggaggc tctggtggag gcggtagcgg aggcggaggg 540 tcgcaggaac tgacaactat atgcgagcaa atcccctcac caactttaga atcqacgccg 600 tactctttgt caacgactac tattttggcc aacgggaagg caatgcaagg agtttttgaa 660 tattacaaat cagtaacgtt tgtcagtaat tgcggttctc acccctcaac aactagcaaa 720 ggcagcccca taaacacaca gtatgttttt tgactcgag 759
<210> 16
<211> 6169
<212> DNA
<213> Artificial Sequence
<220>
<223> pZ B002 -- Aga2 P Heavy chain Mating Type vector construct
<220>
<221> mi sc recomb
<222> (1)..(6169)
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaacg acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240 atatgtgtac tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300 aaatagcttg tcaccttacg tacaatcttg atccggagct ttt tttttt tgccgattaa 360 gaattaattc ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420 tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480 atttcacagg tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540 cagaatgtgc tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600 agagaacaat tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660 atagttcagg cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720 ttttggctct ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780 ggcaagaata ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840 actgcaacat actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900 attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960 gaaggcaaga gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020 atgttggtga tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080 agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140 aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgccta tgcggtgtga 1200 aataccgcac agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt 1260 ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 1320 atcggcaaaa t ccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 1380 gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 1440 gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg 1500 aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 1560 ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 1620 gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgcxgc gcttaatgcg 1680 ccgctacagg gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 1740 tcggtgcggg cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 1800 ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 1860 cgcgcgtaat acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg 1920 agcgtcccaa aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc 1980 tgtacagaaa aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta 2040 taaaaaaata aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag 2100 cggatgtggg gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagtca 2160 aaaaacatac tgtgtgttta tggggctgcc tttgctagtt gttgaggggt gagaaccgca 2220 attactgaca aacgttactg atttgtaata ttcaaaaact ccttgcattg ccttcccgtt 2280 ggccaaaata gtagtcgttg acaaagagta cggcgtcgat tctaaagttg gtgaggggat 2340 ttgctcgcat atagttgtca gttcctgcga ccctccgcct ccgctaccgc ctccaccaga 2400 gcctcctcca ccactagcct gcaggccctg aaaatacagg ttttccttgt cgtcatcgtc 2460 tttgtagtcc aagtcctctt cagaaataag tttttgttcg aattcacaag atttgggctc 2520 aactttcttg tccaccttgg tgttgctggg cttgtgattc acgttgcaga tgtaggtctg 2580 ggtgcccaag ctgctggagg gcacggtcac tacgctgctg agggagtaga gtcctgatga 2640 ctgtaggaca gccgggaagg tgtgcacgcc gctggtcagc gcgcctgagt tccacgacac 2700 cgtcaccggt tcggggaagt agtccttgac caggcagccc, agggccgctg tgcccccaga 2760 ggtgctcttg gaggagggtg ccagggggaa gaccgatggg cccttggtgg aggctgcggc 2820 cgctgtgcta gcttttctag atgtccatgg tgctaaaact gaagcaataa cagaaaatat 2880 tgaaaaacag cgaagtaact gcatactagt tctagatata gttttttctc cttgacgtta 2940 aagtatagag gtatattaac aattttttgt tgatactttt attacatttg aataagaagt 3000 aatacaaacc gaaaatgttg aaagtattag ttaaagtggt tatgcagttt ttgcatttat 3060 atatctgtta atagat aaa aatcatcgct tcgctgatta attaccccag aaataaggct 3120 aaaaaactaa tcgcattatc atcctatggt tgttaatttg attcgttcat ttgaaggttt 3180 gtggggccag gttactgcca atttttcctc ttcataacca taaaagctag tattgtagaa 3240 tctttattgt tcggagcagt gcggcgcgag gcacatctgc gtttcaggaa cgcgaccggt 3300 gaagacgagg acgcacggag gagagtcttc cttcggaggg ctgtcacccg ctcggcggct 3360 tctaatccgt acttcagagc tccagctttt gttcccttta gtgagggtta attgcgcgct 3420 tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc acaattccac 3480 acaacatagg agccggaagc ataaagtgta aagcctgggg tgcctaatga gtgaggtaac 3540 tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg tcgtgccagc 3600 tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgctcttccg 3660 cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc 3720 actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt 3780 gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc 3840 ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa 3900 acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc 3960 ctgttccgac, cctgccgctt accagatacc tgtccgcctt tctcccttcg ggaagcgtgg 4020 cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc 4080 tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc 4140 gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca 4200 ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact 4260 acggctacac, tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg 4320 gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt 4380 ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct 4440 tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga 4500 gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa 4560 tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac 4620 ctatctcagc. gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga 4680 taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc 4740 cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca 4800 gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta 4860 gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct acaggcatcg 4920 tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc 4980 gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg 5040 ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt 5100 ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt 5160 cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca atacgggata 5220 ataccgcgcc. acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc 5280 gaaaactctc aaggatctta ccgctgttga gatccagttc. gatgtaaccc actcgtgcac 5340 ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa 5400 ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct 5460 tcctttttca atattattga agcatttatc agggttattg tctcatgagc ggatacatat 5520 ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc 5580 cacctgggtc cttttcatca cgtgctataa aaataattat aatttaaatt ttttaatata 5640 aatatataaa ttaaaaatag aaagtaaaaa aagaaattaa agaaaaaata gtttttgttt 5700 tccgaagatg taaaagactc tagggggatc gccaacaaat actacctttt atcttg tct 5760 tcctgctctc aggtattaat gccgaattgt ttcatcttgt ctgtgtagaa gaccacacac 5820 gaaaatcctg tgattttaca ttttacttat cgttaatcga atgtatatct atttaatctg 5880 cttttcttgt ctaataaata tatatgtaaa gtacgctttt tgttgaaatt ttttaaacct 5940 ttgtttattt ttttttcttc attccgtaac tcttctacct tctttattta ctttctaaaa 6000 tccaaataca aaacataaaa ataaataaac acagagtaaa ttcccaaatt attccatcat 6060 taaaagatac gaggcgcgtg taagttacag gcaagcgatc cgtcctaaga aaccattatt 6120 atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtc 6169
<210> 17
<211> 501
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB003 -- Light chain. (Kappa) ss02 Mating Type insert
<220>
<221> gene
<222> (1). .. (501)
<400> 17
actagtatga gatttccttc aatttttact gcagttttat tcgcagcatc ctccgcatta 60 gctcatatga aaagatctgc gaagcttgct ggcgcgccag gtcagcccaa ggccaacccc 120 actgtcactc tgttcccgcc ctcctctgag gagctccaag ccaacaaggc caccctagtg 180 tgtctgatca gtgacttcta cccgggagct gtgacagtgg cctggaaggc agatggcagc 240 cccgtcaagg cgggagtgga gaccaccaaa ccctccaaac agagcaacaa caagtacgcg 300 gccagcagct acctgagcct gacgcccgag cagtggaagt cccacagaag ctacagctgc 360 caggtcacgc atgaagggag caccgtggag aagacagtgg cccctacaga atgttcagtc 420 gacggtaagc ctatccctaa ccctctcctc ggtctcgatt ctacgcgtac cggtcatcat 480 caccatcacc attgactcga g 501 <210> 18
<211> 6021
<212> DNA
<213> Artificial Sequence
<220>
<223> pZBOOS - Light chain (Kappa) ss02 Mating Type vector construct
<220>
<221> mi sc_recomb
<222> (1). .. (6021)
<400> 18
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataccac agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240 ggtttctttg aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300 agcacagact tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360 cagtattctt aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420 cgaaagctac atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480 ttaatatcat gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540 aggaattact ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600 tggatatctt gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660 ccaagtacaa ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720 aattgcagta ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780 acggtgtggt gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840 aggaacctag aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900 gagaatatac taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960 ttattgctca aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020 ccggtgtggg tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080 atgtggtctc tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140 gggatgctaa ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200 gatgcggcca gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260 aaattagagc ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320 agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380 tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440 tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500 agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560 gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620 aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680 cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740 gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800 gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 1860 cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 1920 taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag cgcgcgtaat 1980 acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg agcgtcccaa 2040 aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc tgtacagaaa 2100 aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta taaaaaaata 2160 aatagggacc, tagacttcag gttgtctaac tccttccttt tcggttagag cggatgtggg 2220 gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagtca atggtgatgg 22S0 tgatgatgac cggtacgcgt agaatcgaga ccgaggagag ggttagggat aggcttaccg 2340 tcgactgaac attctgtagg ggccactgtc ttctccacgg tgctcccttc atgcgtgacc 2400 tggcagctgt agcttctgtg ggacttccac tgctcgggcg tcaggctcag gtagctgctg 2460 gccgcgtact tgttgttgct ctgtttggag ggtttggtgg tctccactcc cgccttgacg 2520 gggctgccat ctgccttcca ggccactgtc acagctcccg ggtagaagtc actgatcaga 2580 cacactaggg tggccttgtt ggcttggagc tcctcagagg agggcgggaa cagagtgaca 2640 gtggggttgg ccttgggctg acctggcgcg ccagcaagct tcgcagatct tttcatatga 2700 gctaatgcgg aggatgctgc gaataaaact gcagtaaaaa ttgaaggaaa tctcatacta 2760 gttctagata tagttttttc. tccttgacgt taaagtatag aggtatatta acaatttttt 2820 gttgatactt ttattacatt tgaataagaa gtaatacaaa ccgaaaatgt tgaaagtatt 2880 agttaaagtg gttatgcagt ttttgcattt atatatctgt taatagatca aaaatcatcg 2940 cttcgctgat taattacccc agaaataagg ctaaaaaact aatcgcatta tcatcctatg 3000 gttgttaatt tgattcgttc atttgaaggt ttgtggggcc aggttactgc caatttttcc 3060 tcttcataac. cataaaagct agtattgtag aatctttatt gttcggagca gtgcggcgcg 3120 aggcacatct gcgtttcagg aacgcgaccg gtgaagacga ggacgcacgg aggagagtct 3180 tccttcggag ggctgtcacc cgctcggcgg cttctaatcc gtacttcaga gctccagctt 3240 ttgttccctt tagtgagggt taattgcgcg cttggcgtaa tcatggtcat agctgtttcc 3300 tgtgtgaaat tgttatccgc tcacaattcc acacaacata ggagccggaa gcataaagtg 3360 taaagcctgg ggtgcctaat gagtgaggta actcacatta attgcgttgc gctcactgcc 3420 cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg 3480 gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 3540 ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 3600 agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 3660 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 3720 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 3780 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 3840 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 3900 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 3960 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag t caacccgg taagacacga 4020 cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 4080 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg 4140 tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 4200 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 4260 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 4320 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 4380 ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 4440 tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 4500 atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 4560 tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 4620 aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 4680 catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 4740 gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 4800 ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 4360 aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 4920 atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 4980 cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 5040 gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 5100 agtgctcatc attggaaaac gttcttcggg gcgaaaactc. tcaaggatct taccgctgtt 5160 gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 5220 caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 5280 ggcgacacgg aaatgttgaa tactcatact ttccttttt caatattatt gaagcattta 5340 tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 5400 aggggttccg cgcacatttc cccgaaaagt gccacctggg tccttttcat cacgtgctat 5460 aaaaataatt ataatttaaa ttttttaata taaatatata aattaaaaat agaaagtaaa 5520 aaaagaaatt aaagaaaaaa tagtttttgt tttccgaaga tgtaaaagac tctaggggga 5580 tcgccaacaa atactacctt ttatcttgct cttcctgctc tcaggtatta atgccgaatt 5640 gtttcatctt gtctgtgtag aagaccacac acgaaaatcc tgtgatttta cattttactt 5700 atcgttaatc gaatgtatat ctatttaatc tgcttttctt gtctaataaa tatatatgta 5760 aagtacgctt tttgttgaaa ttttttaaac ctttgtttat tttttttt t tcattccgta 5820 actcttctac cttctttatt tactttctaa aatccaaata caaaacataa aa.at a ta.a 5880 acacagagta aattcccaaa ttattccatc attaaaagat acgaggcgcg tgtaagttac 5940 aggcaagcga tcc.gtc.ctaa gaaaccatta ttatcatgac attaacctat aaaaataggc 6000 gtatcacgag gccctttcgt c. 6021
<210> 19
<211> 501
<212> DNA
<213> Artificial Sequence
< 20>
<223> pZB003.1 - Light chain (Lambda) ssOl Mating Type insert
<221> gene
<222> '(1),. (501)
<400> 19
actagtatga gatttccttc aatttttact gcagttttat tcgcagcatc ctccgcatta 60 gctcatatga aaagatctgc gaagcttgct ggcgcgccaa ctgtggctgc accatctgtc 120 ttcatcttcc cgccatctga tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg 180 ctgaataact tctatcccag agaggccaaa gtacagtgga aggtggataa cgccctccaa 240 tcgggtaact cccaggagag tgtcacagag caggacagca aggacagcac ctacagcctc 300 agcagcaccc tgacgctgtc gaaagcagac tacgagaaac acaaagtcta cgcctgcgaa 360 gtcacccatc agggcctgag ctcgcccgtc acaaagagct tcaacagggg agagtgtgtc. 420 gacggtaagc ctatccctaa ccctctcctc ggtctcgatt ctacgcgtac cggtcatcat 480 caccatcacc attgactcga 9 501 <210> 20
<211> 6021
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB003.1 - Light chain (Lambda) ssOl Mating Type vector construct <220>
<221> m'isc recomb
<222> (1)..(6021)
<400> 20
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataccac agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240 ggtttctttg aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300 agcacagact tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360 cagtattctt aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420 cgaaagctac atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480 ttaatatcat gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540 aggaattact ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600 tggatatctt gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660 ccaagtacaa ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720 aattgcagta ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780 acggtgtggt gggcccaggt attgttagcg gtttaaagca ggcggcagaa gaaataacaa 840 aggaacctag aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900 gagaatatac taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960 ttattgctca aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020 ccggtgtggg tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080 atgtggtctc tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140 gggatgctaa ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200 gatgcggcca gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260 aaattagagc ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320 agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380 tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440 tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500 agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560 gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620 aagcactaaa tcggaacxct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680 cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740 gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800 gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 1860 cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 1920 taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag cgcgcgtaat 1980 acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg agcgtcccaa 2040 aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc tgtacagaaa 2100 aaaaagaaaa atttgaaata taaataacgt tcttaatact aac ta.a t taaaaaaata 2160 aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag cggatgtggg 2220 gggagggcgt gaatgtaagc gtgacataac taattacatg actcgagtca atggtgatgg 2280 tgatgatgac cggtacgcgt agaatcgaga ccgaggagag ggttagggat aggcttaccg 2340 tcgacacact ctcccctgtt gaagctcttt gtgacgggcg agctcaggcc ctgatgggtg 2400 acttcgcagg cgtagacttt gtgtttctcg tagtctgctt tcgacagcgt cagggtgctg 2460 ctgaggctgt aggtgctgtc cttgctgtcc tgctctgtga cactctcctg ggagttaccc 2520 gattggaggg cgttatccac cttccactgt actttggcct ctctgggata gaagttattc 2580 agcaggcaca caacagaggc agttccagat ttcaactgct catcagatgg cgggaagatg 2640 aagacagatg gtgcagccac agttggcgcg ccagcaagct tcgcagatct tttcatatga 2700 gctaatgcgg aggatgctgc gaataaaact gcagtaaaaa ttgaaggaaa tctcatacta 2760 gttctagata tagttttttc tccttgacgt taaagtatag aggtatatta acaatttttt 2820 gttgatactt ttattacatt tgaataagaa gtaatacaaa ccgaaaatgt tgaaagtatt 2880 agttaaagtg gttatgcagt ttttgcattt atatatctgt taatagatca aaaatcatcg 2940 cttcgctgat taattacccc agaaataagg ctaaaaaact aatcgcatta tcatcctatg 3000 gttgttaatt tgattcgttc atttgaaggt ttgtggggcc aggttactgc caatttttcc 3060 tcttcataac cataaaagct agtattgtag aatctttatt gttcggagca gtgcggcgcg 3120 aggcacatct gcgtttcagg aacgcgaccg gtgaagacga ggacgcacgg aggagagtct 3180 tccttcggag ggctgtcacc cgctcggcgg cttctaatcc gtacttcaga gctccagctt 3240 ttgttccctt tagtgagggt taattgcgcg cttggcgtaa tcatggtcat agctgtttcc 3300 tgtgtgaaat tgttatccgc tcacaattcc acacaacata ggagccggaa gcataaagtg 3360 taaagcctgg ggtgcctaat gagtgaggta actcacatta attgcgttgc gctcactgcc 3420 cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg 3480 gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 3540 ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 3600 agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 3660 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc, cgcccccctg acgagcatca 3720 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 3780 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 3840 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 3900 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 3960 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 4020 cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 4080 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg 4140 tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 4200 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 4260 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 4320 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 4380 ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 4440 tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 4500 atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 4560 tggcccxagt gctgcaatga taccgcgaga cccacgctca ccggctccag attt tcagc 4620 aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 4680 catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 4740 gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 4800 ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 4860 aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 4920 atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 4980 cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 5040 gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 5100 agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 5160 gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 5220 caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 5280 ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 5340 tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 5400 aggggttccg cgcacatttc cccgaaaagt gccacctggg tccttttcat cacgtgctat 5460 aaaaataatt ataatttaaa ttttttaata taaatatata aattaaaaat agaaagtaaa 5520 aaaagaaatt aaagaaaaaa tagtttttgt tttccgaaga tgtaaaagac. tctaggggga 5580 tcgccaacaa atactacctt ttatcttgct cttcctgctc tcaggtatta atgccgaatt 5640 gtttcatctt gtctgtgtag aagaccacac acgaaaatcc tgtgatttta cattttactt 5700 atcgttaatc gaatgtatat ctatttaatc tgcttttctt gtctaataaa tatatatgta 5760 aagtacgctt tttgttgaaa ttttttaaac ctttgtttat ttttttttct tcattccgta 5820 actcttctac cttctttatt tactttctaa aatccaaata caaaacataa aaat aataa 5880 acacagagta aattcccaaa ttattccatc attaaaagat acgaggcgcg tgtaagttac 5940 aggcaagcga tccgtcctaa gaaaccatta ttatcatgac attaacctat aaaaataggc 6000 gtatcacgag gccctttcgt c 6021
<210> 21
<2U> 711
<212> DNA
<213> Artificial Sequence
<220>
<223> PZB003.2 ~ Light chain (Kappa) ssOl Mating Typ
<220>
<221> aene
<222> (1)..(711)
<400> 21
actagtatga gatttccttc aatttttact gctgttgttt tcgcagcatc ctccgcatta 60 gctgctccag ctaacactac agctgaagat gaaacggcac aaattccggc tgaagctgtc 120 atcggttact taggtttaga aggggattca gatgttgctg ctttgccatt atccgatagc 180 acaaataacg ggtcattgtc aactaatact actattgcca gcattgctgc taaagaagaa 240 ggggtacaac tcgataaaag agaggctgaa gctcatatga aaagatctgc gaagcttgct 300 ggcgcgccaa ctgtggctgc accatctgtc ttcatcttcc cgccatctga tgagcagttg 360 aaatctggaa ctgcctctgt tgtgtgcctg ctgaataact tctatcccag agaggccaaa 420 gtacagtgga aggtggataa cgccctccaa tcgggtaact cccaggagag tgtcacagag 480 caggacagca aggacagcac ctacagcctc agcagcaccc tgacgctgtc gaaagcagac 540 tacgagaaac acaaagtcta cgcctgcgaa gtcacccatc agggcctgag ctcgcccgtc 600 acaaagagct tcaacagggg agagtgtgtc gacggtaagc ctatccctaa ccctctcctc 660 ggtctcgatt ctacgcgtac cggtcatcat caccatcacc attgactcga g 711
<210> 22
<211> 6231
<212> DNA
<213> Artificial Sequence
<220>
<223> pzB003.2 -- Light chain (Kappa) ssOl Mating Type vector construct <220>
<221> mi sc_recomb
<222> (1)..(6231)
<400> 22
gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttaggacgg atcgcttgcc tgtaacttac acgcgcctcg tatcttttaa tgatggaata 120 atttgggaat ttactctgtg tttatttatt tttatgtttt gtatttggat tttagaaagt 180 aaataaagaa ggtagaagag ttacggaatg aagaaaaaaa aataaacaaa ggtttaaaaa 240 atttcaacaa aaagcgtact ttacatatat atttattaga caagaaaagc agattaaata 300 gatatacatt cgattaacga taagtaaaat gtaaaatcac aggattttcg tgtgtggtct 360 tctacacaga caagatgaaa caattcggca ttaatacctg agagcaggaa gagcaagata 420 aaaggtagta tttgttggcg atccccctag agtcttttac atcttcggaa aacaaaaact 480 attttttctt taatttcttt ttttactttc tatttttaat ttatatattt atattaaaaa 540 atttaaatta taattatttt tatagcacgt gatgaaaagg acccaggtgg cacttttcgg 600 ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg 660 ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt 720 attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt 780 gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg 840 ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa 900 tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt 960 gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag 1020 tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt 1080 gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga 1140 ccgaaggagc taaccgcttt tttgcacaac atgggggatc. atgtaactcg ccttgatcgt 1200 tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta 1260 gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg 1320 caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc 1380 cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt 1440 atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg 1500 gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg 1560 attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa 1620 cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa 1680 atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga 1740 tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg 1800 ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact 1860 ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac 1920 cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg 1980 gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg 2040 gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga 2100 acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc 2160 gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg 2220 agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc 2280 tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc 2340 agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca catgttcttt 2400 cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc 2460 gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc 2520 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 25SO aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttacctcact 2640 cattaggcac cccaggcttt acactttatg cttccggctc ctatgttgtg tggaattgtg 2700 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcgcgcaatt 2760 aaccctcact aaagggaaca aaagctggag ctctgaagta cggattagaa gccgccgagc 2820 gggtgacagc cctccgaagg aagactctcc tccgtgcgtc ctcgtcttca ccggtcgcgt 2880 tcctgaaacg cagatgtgcc tcgcgccgca ctgctccgaa caataaagat tctacaatac 2940 tagcttttat ggttatgaag aggaaaaatt ggcagtaacc tggccccaca aaccttcaaa 3000 tgaacgaatc aaattaacaa ccataggatg ataatgcgat tagtttttta gccttatttc 3060 tggggtaatt aat agcgaa gcgatgattt ttgatctatt aacagatata taaatgcaaa 3120 aactgcataa ccactttaac taatactttc aacattttcg gtttgtatta cttcttattc 3180 aaatgtaata aaagtatcaa caaaaaattg ttaatatacc tctatacttt aacgtcaagg 3240 agaaaaaact atatctagaa ctagtatgag atttccttca atttttactg ctgttgtttt 3300 cgcagcatcc tccgcattag ctgctccagc taacactaca gctgaagatg aaacggcaca 3360 aattccggct gaagctgtca tcggttactt aggtttagaa ggggattcag atgttgctgc 3420 tttgccatta tccgatagca caaataacgg gtcattgtca actaatacta ctattgccag 3480 cattgctgct aaagaagaag gggtacaact cgataaaaga gaggctgaag ctcatatgaa 3540 aagatctgcg aagcttgctg gcgcgccaac tgtggctgca ccatctgtct tcatcttccc 3600 gccatctgat gagcagttga aatctgaaac tgcctctgtt gtgtgcctgc tgaataactt 3660 ctatcccaga gaggccaaag tacagtggaa ggtggataac g cctccaat cgggtaactc 3720 ccaggagagt gtcacagagc aggacagcaa ggacagcacc tacagcctca gcagcaccct 3780 gacgctgtcg aaagcagact acgagaaaca caaagtctac gcctgcgaag tcacccatca 3840 gggcctgagc tcgcccgtca caaagagctt caacagggga gagtgtgtcg acggtaagcc 3900 tatccctaac cctctcctcg gtctcgattc tacgcgtacc ggtcatcatc accatcacca 3960 ttgactcgag tcatgtaatt agttatgtca cgcttacatt cacgccctcc ccccacatcc 4020 gctctaaccg aaaaggaagg agttagacaa cctgaagtct aggtccctat ttattttttt 4080 atagttatgt tagtattaag aacgttattt atatttcaaa tttttctttt ttttctgtac 4140 agacgcgtgt acgcatgtaa cattatactg aaaaccttgc ttgagaaggt tttgggacgc 4200 tcgaaggctt taatttgcgg ccggtaccca attcgcccta tagtgagtcg tattacgcgc 4260 gctcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta 4320 atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg 4380 atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcgcgacgcg ccctgtagcg 4440 gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg 4500 ccctagcgcc cgctcctttc gctttcttcc cttcctttct cgccacgttc gccggctttc 4560 cccgtcaagc tctaaatcgg gggctccctt tagggttccg atttagtgct ttacggcacc 4620 tcgaccccaa aaaacttgat tagggtgatg gttcacgtag tgggccatcg ccctgataga 4680 cggtttttcg ccctttgacg ttggagtcca cgttctttaa tagtggactc ttgttccaaa 4740 ctggaacaac actcaaccct atctcggtct attcttttga tttataaggg attttgccga 4800 tttcggccta ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca 4860 aaatattaac gtttacaatt tcctgatgcg gtattttctc cttacgcatc tgtgcggtat 4920 ttcacaccgc atagggtaat aactgatata attaaattga agctctaatt tgtgagttta 4980 gtatacatgc atttacttat aatacagttt tttagttttg ctggccgcat cttctcaaat 5040 cttagcatcc cttccctttg 5100 agagaccaca tcatccacgg 5160 acccacaccg ggtgtcataa 5220 ttgagcaata aagccgataa 5280 agtatattct ccagtagata 5340 tctaggttcc tttgttactt 5400 caccacaccg tgtgcattcg 5460 gtactgcaat ttgactgtat 5520 attgtacttg gcggataatg 5580 caagatatcc acatgtgttt 5640 cagtaattcc ttggtggtac 5700 catgatatta aatagcttgg 5760 tgtagctttc gacatgattt 5820 taagaatact gggcaatttc 5880 aagtctgtgc tccttccttc 5940 t aaagaaac cgaaatcaaa 6000 tgtggtatgg tgcactctca 6060 acacccgcca acacccgctg 6120 cagacaagct gtgaccgtct 6180 gaaacgcgcg a 6231
<210> 23
<211> 711
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB003.3 Light chain (Kappa) ss03 Mating Type insert
Figure imgf000111_0001
<400> 23
actagtatga gatttccttc aatttttact gctgttttat tcgcagcatc ctccqcatta 60 gctgctccag ctaacactac aacagaagat gaaacggcac aaattccggc tgaagctgtc 120 atcgattact cagatttaga aggggatttc gatgctgctg ctttgccatt atccaacagc 180 acaaat acg gattatcatc aactaatact actattgcca gcattgctgc taaagaagaa 240 ggggtacaac tcgataaaag agaggctgaa gctcatatga aaagatctgc gaagcttgct 300 ggcgcgccaa ctgtggctgc accatctgtc ttcatcttcc cgccatctga tgagcagttg 360 aaatctggaa ctgcctctgt tgtgtgcctg ctgaataact tctatcccag agaggccaaa 420 gtacagtgga aggtggataa cgccctccaa tcgggtaact cccaggagag tgtcacagag 480 caggacagca aggacagcac ctacagcctc agcagcaccc tgacgctgtc gaaagcagac 540 tacgagaaac acaaagtcta cgcctgcgaa gtcacccatc agggcctgag ctcgcccgtc 600 acaaagagct tcaacagggg agagtgtgtc gacggtaagc ctatccctaa ccctctcctc 660 ggtctcgatt ctacgcgtac cggtcatcat caccatcacc attgactcga g 711
<210> 24
<211> 6231
<212> DNA
<213> Artificial Sequence <220>
<223> pZB003.3 - Light chain (Kappa) ss03 Mating Type vector construct
<220>
<221> mi sc recomb
<222> (1)..(6231)
<400> 24
gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttaggacgg atcgcttgcc tgtaacttac acgcgcctcg tatcttttaa tgatggaata 120 atttgggaat ttactctgtg tttatttatt tttatgtttt gtatttggat tttagaaagt 180 aaataaagaa ggtagaagag ttacggaatg aagaaaaaaa aataaacaaa ggtttaaaaa 240 atttcaacaa aaagcgtact ttacatatat atttattaga caagaaaagc agattaaata 300 gatatacatt cgattaacga taagtaaaat gtaaaatcac aggattttcg tgtgtggtct 360 tctacacaga caagatgaaa caattcggca ttaatacctg agagcaggaa gagcaagata 420 aaaggtagta tttgttggcg atccccctag agtcttttac atcttcggaa aacaaaaact 480 attttttctt taatttcttt ttttactttc tatttttaat ttatatattt atattaaaaa 540 atttaaatta taattatttt tatagcacgt gatgaaaagg acccaggtgg cacttttcgg 600 ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg 660 ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt 720 attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt 780 gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg 840 ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa 900 cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt 960 gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag 1020 tactcaccag tcacaaaaaa gcatcttacg gatgacatga cagtaagaga attatgcagt 1080 gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga 1140 ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt 1200 tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta 1260 gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg 1320 caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc 1380 cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt 1440 atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg 1500 gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg 1560 attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa 1620 cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa 1680 atcccttaac. gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga 1740 tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg 1800 ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact 1860 ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac 1920 cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg 1980 gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg 2040 gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga 2100 acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc 2160 gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg 2220 agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc 2280 tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc 2340 agcaacgcgg cctttttacg gttcctggcc ttttgctggc ettttgetea catgttcttt 2400 cctgcgttat cccctgattc tgtggataac gtattaccg cctttgagtg agctgatacc 2 60 gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gegaggaage ggaagagege 2520 ccaatacgca aaccgcctct ccccgcgcgt tggecgatte attaatgeag ctggcacgac 2580 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttacctcact 2640 cattaggcac cccaggcttt acactttatg cttccggctc ctatgttgtg tggaattgtg 2700 agcggataac aatttcacac aggaaacagc tatgaccatg attacgecaa gegegcaatt 2760 aacccreact aaagggaaca aaagctggag ctctgaagta eggattagaa gccgccgagc 2820 gggtgacagc cctccgaagg aagactctcc tccgtgcgtc ctcatcttca ccggtcgcgt 2880 tcctgaaacg cagatgtg c tcgcgccgca ctgctccgaa caataaagat tctacaatac 2940 tagcttttat ggttatgaag aggaaaaatt ggcagtaacc tggccccaca aaccttcaaa 3000 tgaacgaatc aaattaacaa ccataggatg ataatgcgat tagtttttta gecttattte 3060 tggggtaatt aatcagcgaa gcgatgattt ttgatctatt aacagatata taaatgcaaa 3120 aactgeataa ccactttaac taatactttc aacattttcg gtttgtatta cttcttattc 3180 aaatgtaata aaagtatcaa caaaaaattg ttaatatacc tctatacttt aacgtcaagg 3240 agaaaaaact atatctagaa ctagtatgag atttccttca atttttactg ctgttttatt 3300 cgcagcatcc teegcattag ctgctccagc taacactaca acagaagatg aaaeggcaca 3360 aattcegget gaagctgtca tcgattactc agatttagaa ggggatttcg atgctgctgc 3420 tttgecatta tccaacagca caaataaegg gttatcatca actaatacta etattgecag 3480 cattgetget aaagaagaag gggtacaact cgataaaaga gaggctgaag ctcatatgaa 3540 aagatctgcg aagcttgctg gcgcgccaac tgtggctgca ccatctgtct tcatcttccc 3600 gecatctgat gagcagttga aatctggaac tgcctctgtt gtgtgcctgc tgaataactt 3660 ctatcccaga gaggecaaag tacagtggaa ggtggataac gccctccaat egggtaaetc 3720 ccaggagagt gtcacagagc aggacagcaa ggacagcacc tacagcctca gcagcaccct 3780 gaegctgteg aaagcagact acgagaaaca caaagtctac gectgegaag tcacccatca 3840 gggectgage tcgcccgtca caaagagctt caacagggga gagtgtgtcg aeggtaagee 3900 tatccctaac cctctcctcg gtctcgattc tacgcgtacc ggtcatcatc accatcacca 3960 ttgactcgag tcatgtaatt agttatgtca cgcttacatt cacgccctcc ccccacatcc 4020 gctctaaccg aaaaggaagg agttagacaa cctgaagtct aggtccctat ttattttttt 4080 atagttatgt tagtattaag aacgttattt atatttcaaa tttttctttt ttttctgtac 4140 agacgcgtgt acgcatgtaa cattatactg aaaaccttgc ttgagaaggt tttgggacgc 4200 tcgaaggctt taatttgegg ccggtaccca attcgcccta tagtgagtcg tattacgcgc 4260 gctcactggc cgtcgtttta caaegtegtg actgggaaaa ccctggcgtt acccaactta 4320 atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagegaagag gcccgcaccg 4380 atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcgcgacgcg ccctgtagcg 4440 gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg 4500 ccctagcgcc cgctcctttc gctttcttcc ttcctttct cgccacgttc gccggctttc 4560 cccgtcaagc tetaaategg gggctccctt tagggttccg atttagtget ttacggcacc 4620 tcgaccccaa aaaacttgat tagggtgatg gttcaegtag tgggecateg ccctgataga 4680 eggttttteg ccctttgacg ttggagtcca cgttctttaa tagtggactc ttgttccaaa 4740 ctggaacaac actcaaccct ateteggtet attcttttga tttataaggg attttgeega 4800 ttteggecta ttggttaaaa aatgagctga tttaacaaaa atttaacgeg aattttaaca 4860 aaatattaac gtttacaatt tectgatgeg gtattttctc cttacgcatc tgtgcggtat 4920 ttcacaccgc atagggtaat aactgatata attaaattga agctctaatt tgtgagttta 4980 gtatacatgc atttacttat aatacagttt tttagttttg ctggccgcat cttctcaaat 5040 atgcttccca gcctgctttt ctgtaacgtt caccctctac cttagcatcc cttccctttg 5100 caaatagtcc tcttccaaca ataataatgt cagatcctgt agagaccaca tcatccacgg 5160 ttctatactg ttgacccaat gcgt tccct tgtcatctaa acccacaccg ggtgtcataa 5220 tcaaccaatc. gtaaccttca tctcttccac ccatgtctct ttgagcaata aagccgataa 5280 caaaatcttt gtcgctcttc gcaatgtcaa cagtaccctt agtatattct ccagtagata 340 gggagccctt gcatgacaat tctgctaaca tcaaaaggcc tctaggttcc tttgttactt 5400 cttctgccgc ctgcttcaaa ccgctaacaa tacctgggcc caccacaccg tgtgcattcg 5460 taatgtctgc ccattctgct attctgtata cacccgcaga gtactgcaat ttgactgtat 5520 taccaatgtc agcaaatttt ctgtcttcga agagtaaaaa attgtacttg gcggataatg 5580 cctttagcgg cttaactgtg ccctccatgg aaaaatcagt caagatatcc acatgtgttt 5640 ttagtaaaca aattttggga cctaatgctt caactaactc cagtaattcc ttggtggtac 5700 gaacatccaa tgaagcacac aagtttgttt gcttttcgtg catgatatta aatagcttgg 5760 cagcaacagg actaggatga gtagcagcac gttccttata tgtagctttc. gacatgattt 5820 atcttcgttt cctgcaggtt tttgttctgt gcagttgggt taagaatact gggcaatttc 5880 atgtttcttc aacactacat atgcgtatat ataccaatct aagtctgtgc tccttccttc 5940 gttcttcctt ctgttcggag attaccgaat caaaaaaatt tcaaagaaac cgaaatcaaa 6000 aaaaagaata aaaaaaaaat gatgaattga attgaaaagc tgtggtatgg tgcactctca 6060 gtacaatctg ctctgatgcc gcatagttaa gccagccccg acacccgcca acacccgctg 6120 acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct 6180 ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg a 6231
<210> 25
<211> 501
<212> DNA
<213> Artiif cia"! Sequence
<223> pZB003.4 - Light chain (Kappa) ss04 Mating Type inse
<220>
<221> gene
<222> (1),.(501)
<400> 25
actagtatgc. ttttgcaagc attccttttc cttttggctg gttttgcagc caaaatatct 60 gcacatatga aaagatctgc gaagcttgct ggcgcgccaa ctgtggctgc accatctgtc 120 ttcatcttcc cgccatctga tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg 180 ctgaataact tctatcccag agaggccaaa gtacagtgga aggtggataa cgccctccaa 240 tcgggtaact cccaggagag tgtcacagag caggacagca aggacagcac ctacagcctc 300 agcagcaccc tgacgctgtc gaaagcagac tacgagaaac acaaagtcta cgcctgcgaa 360 gtcacccatc agggcctgag ctcgcccgtc acaaagagct tcaacagggg agagtgtgtc 420 gacggtaagc ctatccctaa ccctctcctc ggtctcgatt ctacgcgtac cggtcatcat 480 caccatcacc attgactcga 9 501
<210> 26
<211> 6021
<212> DNA
<213> Artificial Sequence
<220>
<223> pZB003.4 - Light chain (Kappa) ss04 Mating Type vector construct <220>
<221> m'isc recomb
<222> (1)..(6021)
<400> 26
gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttaggacgg atcgcttgcc tgtaacttac acgcgcctcg tatcttttaa tgatggaata 120 atttgggaat ttactctgtg tttatttatt tttatgtttt gtatttggat tttagaaagt 180 aaataaagaa ggtagaagag ttacggaatg aagaaaaaaa aataaacaaa ggtttaaaaa 240 atttcaacaa aaagcgtact ttacatatat atttattaga caagaaaagc agattaaata 300 gatatacatt cgattaacga taagtaaaat gtaaaatcac aggattttcg tgtgtggtct 360 tctacacaga caagatgaaa caattcggca ttaatacctg agagcaggaa gagcaagata 420 aaaggtagta tttgttggcg atccccctag agtcttttac atcttcggaa aacaaaaact 480 attttttctt taatttcttt ttttactttc tatttttaat ttatatattt atattaaaaa 540 atttaaatta taattatttt tatagcacgt gatgaaaagg acccaggtgg cacttttcgg 600 ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg 660 ctcatgagac aataaccctg ataaatgctt caataatatt gaa aagqaa gagtatgagt 720 attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt 780 gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg 840 ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa 900 cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt 960 gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag 1020 tac.tcac.cag tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt 1080 gctgccataa ccatgagtga taacactgcg gccaacttac. ttctgacaac gatcggagga 1140 ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt 1200 tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta 1260 gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg 1320 caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc 1380 cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt 1440 atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg 1500 gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg 1560 attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa 1620 ttCattttt aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa 1680 atcccttaac gtgagttttc gttccactga gcgtcagacc. ccgtagaaaa gatcaaagga 1740 tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg 1800 ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact 1860 ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac 1920 cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg 1980 gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg 2040 gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga 2100 acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc 2160 gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg 2220 agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc 2280 tgacttgagc gtcgattttt gtgatgctcg tcaggggggc. ggagcctatg gaaaaacgcc 2340 agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca catgttcttt 2400 cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc 2460 gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc 2520 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 2580 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttacctcact 2640 cattaggcac cccaggcttt acactttatg cttccggctc ctatgttgtg tggaattgtg 2700 agcggataac aatttcacac aggaaacagc tatgaccatg attacgccaa gcgcgcaatt 2760 aaccctcact aaagggaaca aaagctggag ctctaaagta cggattagaa gccgccgagc 2820 gggtgacagc cctccgaagg aagact tcc tccgtgcgtc ctcgtcttca ccggtcgcgt 2880 tcctgaaacg cagatgtgcc tcgcgccgca ctgctccgaa caataaagat tctacaatac 2940 tagcttttat ggttatgaag aggaaaaatt ggcagtaacc tggccccaca aaccttcaaa 3000 tgaacgaatc. aaattaacaa ccataggatg ataatgcgat tagtttttta gccttatttc 3060 tggggtaatt aatcagcgaa gcgatgattt ttgatctatt aacagatata taaatgcaaa 3120 aactgcataa ccactttaac taatactttc aacattttcg gtttgtatta cttcttattc 3180 aaatgtaata aaagtatcaa caaaaaattg ttaatatacc tctatacttt aacgtcaagg 3240 agaaaaaact atatctagaa ctagtatgct tttgcaagca ttccttttcc ttttggctgg 3300 ttttgcagcc aaaatatctg cacatatgaa aagatctgcg aagcttgctg gcgcgccaac 3360 tgtggctgca ccatctgtct tcatcttccc gccatctgat gagcagttga aatctggaac 3420 tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga gaggccaaag tacagtggaa 3480 ggtggataac gccctccaat cgggtaactc ccaggagagt gtcacagagc aggacagcaa 3540 ggacagcacc tacagcctca gcagcaccct gacgctgtcg aaagcagact acgagaaaca 3600 caaagtctac gcctgcgaag tcacccatca gggcctgagc tcgcccgtca caaagagctt 3660 caacagggga gagtgtgtcg acggtaagcc tatccctaac cctctcctcg gtctcgattc 3720 tacgcgtacc ggtcatcatc accatcacca ttgactcgag tcatgtaatt agttatgtca 3780 cgcttacatt cacgccctcc ccccacatcc gctctaaccg aaaaggaagg agttagacaa 3840 cctgaagtct aggtccctat ttattttttt atagttatgt tagtattaag aacgttattt 3900 atatttcaaa tttttctttt ttttctgtac agacgcgtgt acgcatgtaa cattatactg 3960 aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt taatttgcgg ccggtaccca 4020 attcgcccta tagtgagtcg tattacgcgc gctcactggc cgtcgtttta caacgtcgtg 4080 actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca 4140 gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga 4200 atggcgaatg gcgcgacgcg ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta 4260 cgcgcagcgt gaccgctaca cttg cagcg ccctagcgcc cgctcctttc gctttcttcc 4320 cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg gggctccctt 4380 tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat tagggtgatg 4440 gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg ttggagtcca 4500 cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct atctcggtct 4560 attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa aatgagctga 4620 tttaacaaaa atttaacgcg aattttaaca aaatattaac gtttacaatt tcctgatgcg 4680 gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atagggtaat aactgatata 4740 attaaattga agctctaatt tgtgagttta gtatacatgc atttacttat aatacagttt 4800 tttagttttg ctggccgcat cttctcaaat atgcttccca gcctgctttt ctgtaacgtt 4860 caccctctac cttagcatcc cttccctttg caaatagtcc tcttccaaca ataataatgt 4920 cagatcctgt agagaccaca tcatccacgg ttctatactg ttgacccaat gcgtctccct 4980 tgtcatctaa acccacaccg ggtgtcataa tcaaccaatc gtaaccttca tctcttccac 5040 ccatgtctct ttgagcaata aagccgataa caaaatcttt gtcgctcttc gcaatgtcaa 5100 cagtaccctt agtatattct ccagtagata gggagccctt gcatgacaat tctgctaaca 5160 tcaaaaggcc tctaggttcc tttgttactt cttctgccgc ctgcttcaaa ccgctaacaa 5220 tacctgggcc caccacaccg tgtgcattcg taatgtctgc ccattctgct attctgtata 5280 cacccgcaga gtactgcaat ttgactgtat taccaatgtc agcaaatttt ctgtcttcga 5340 agagtaaaaa attgtacttg gcggataatg cctttagcgg cttaactgtg ccctccatgg 5400 aaaaatcagt caagatatcc acatgtgttt ttagtaaaca aattttggga cctaatgctt 5460 caactaactc cagtaattcc ttggtggtac gaacatccaa tgaagcacac aagtttgttt 5520 gcttttcgtg catgatatta aatagcttgg cagcaacagg actaggatga gtagcagcac 5580 gttccttata tgtagctttc gacatgattt atcttcgttt cctgcaggtt tttgttctgt 5640 gcagttgggt taagaatact gggcaatttc atgtttcttc aacactacat atgcgtatat 5700 ataccaatct aagtctgtgc tccttc ttc gttcttcctt ctgttcggag atta.c g 5760 caaaaaaatt tcaaagaaac cgaaatcaaa aaaaagaata aaaaaaaaat gatgaattga 5820 attgaaaagc tgtggtatgg tgcactctca gtacaatctg ctctgatgcc gcatagttaa 5880 gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt ctgctcccgg 5940 catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag aggttttcac 6000 cgtcatcacc gaaacgcgcg a 6021
<210> 27
<2U> 309
<212> DNA
<213> Artificial Sequence
<220>
<223> CHl - Modified CHl domain
<220>
<2 1> aene
<222> (D..C309)
<400> 27
gcctccacca agggcccatc ggtcttcccc ctggcaccct cctccaagag cacctctggg 60 ggcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 120 tggaactcag gcgcgctgac cagcggcgtg cacaccttcc cggctgtcct acagtcatca 180 ggactctact ccctcagcag cgtagtgacc gtgccctcca gcagcttggg cacccagacc 240 tacatctgca acgtgaatca caagcccagc aacaccaagg tggacaagaa agttgagccc 300 aaatcttgt 309
<210> 28
<211> 321
<212> DNA
<213> Artificial Sequence
<220>
<223> Ck - Modified Ck domain
<220>
<221> misc. recomb
<222> (1) . . (321)
<220>
<221> aene
<222> (1) . . (321)
<400> 28
ggaactgtgg ctgcaccatc tgtcttcatc ttcccgccat ctgatgagca gttgaaatct 60 ggaactgcct ctgttgtgtg cctgctgaat aacttctatc ccagagaggc caaagtacag 120 tggaaggtgg ataacgccct ccaatcgggt aactcccagg agagtgtcac agagcaggac 180 agcaaggaca gcacctacag cctcagcagc accctgacgc tgtcgaaagc agactacgag 240 aaacacaaag tctacgcctg cgaagtcacc catcagggcc tgagctcgcc cgtcacaaag 300 agcttcaaca ggggagagtg t 321
<210> 29
<211> 332
<212> DNA
<213> Artificial Sequence
<220>
<223> CL - Modified CL domain
<220>
<221> csene
<222> (1)..(332)
<400> 29
gtcagcccaa ggccaacccc actgtcactc tgttcccgcc ctcctctgag gagctccaag 60 ccaacaaggc caccctagtg tgtctgatca gtgacttcta cccgggagct gtgacagtgg 120 cctggaaggc agatggcagc cccgtcaagg cgggagtgga gaccaccaaa ccctccaaac 180 agagcaacaa caagtacgcg gccagcagct acctgagcct gacgcccgag cagtggaagt 240 cccacagaag ctacagctgc caggtcacgc atgaagggag caccgtggag aagacagtgg 300 cccctacaga atgttcaacg cgtgttacag tc 332
<210> 30
<211> 3960
<212> DNA
<213> Artificial Sequence
<220>
<223> pADL23c - Phagemid vector backbone
< 20>
<221> old sequence
<222> (1). .. (3960)
<400> 30
gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 60 atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 120 agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 180 ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 240 gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 300 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat 360 tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg 420 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 480 aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 540 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 600 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 660 cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc 720 tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 780 tgcgctcggc gcttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 840 ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtaqtta 900 tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 960 gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 1020 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 1080 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa 1140 agatcaaagg atcttcttga gatccttttt ttctgcgcgt aat tgctgc ttgcaaacaa 1200 aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc 1260 cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta gtgtagccgt 1320 agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 1380 tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 1440 gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca 1500 gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 1560 ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag 1620 gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 1680 ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat 1740 ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc. cttttgctgg ccttttgctc 1800 acatgcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 1860 ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt 1920 agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg 1980 gaattgtgag cggataacaa tttgaattca aggagacagt cataatgaaa tacctattgc 2040 ctacggcggc cgctggattg ttattactcg cggcccagcc. ggcctaacta gtggcccggg 2100 aggccaacac catcaccacc atcatggcgc agaacaaaaa ctcatctcag aagaggatct 2160 gtcttaggcc gaaactgttg aaagttgttt agcaaaacct catacagaaa attcatttac 2220 taacgtctgg aaagacgaca aaactttaga tcgttacgct aactatgagg gctgtctgtg 2280 gaatgctaca ggcgttgtgg tttgtactgg tgacgaaact cagtgttacg gtacatgggt 2340 tcctattggg cttgctatcc ctgaaaatga gggtggtggc tctgagggtg gcggttctga 2400 gggtggcggt tctgagggtg gcggtactaa acctcctgag tacggtgata cacctattcc 2460 gggctatact tatatcaacc ctctcgacgg cacttatccg cctggtactg agcaaaaccc 2520 cgctaatcct aatccttctc ttgaggagtc tcagcctctt aatactttca tgtttcagaa 2580 taataggttc. cgaaataggc agggtgcatt aactgtttat acgggcactg ttactcaagg 2640 cactgacccc gttaaaactt attaccagta cactcctgta tcatcaaaag ccatgtatga 2700 cgcttactgg aacggtaaat tcagagactg cgctttccat tctggcttta atgaggatcc 2760 attcgtttgt gaatatcaag gccaatcgtc tgacctgcct caacctcctg tcaatgctgg 2820 cggcggctct ggtggtggtt ctggtggcgg ctctgagggt ggcggctctg agggtggcgg 2880 ttctgagggt ggcggctctg agggtggcgg ttccggtggc ggctccggtt ccggtgattt 2940 tgattatgaa aaaatggcaa acgctaataa gggggctatg accgaaaatg ccgatgaaaa 3000 cgcgctacag tctgacgcta aaggcaaact tgattctgtc gctactgatt acggtgctgc 3060 tatcgatggt ttcattggtg acgtttccgg ccttgctaat ggtaatggtg ctactggtga 3120 ttttgctggc tctaattccc aaatggctca agtcggtgac ggtgataatt cacctttaat 3180 gaataatttc cgtcaatatt taccttcttt gcctcagtcg gttgaatgtc gcccttatgt 3240 ctttggcgct ggtaaaccat atgaattttc tattgattgt gacaaaataa acttattccg 3300 tggtgtcttt gcgtttcttt tatatgttgc cacctttatg tatgtatttt cgacgtttgc 3360 taacatactg cgtaataagg agtcttaagc tagctaacag tcctatgaat caactactta 3420 gatggtatta gtgacctgta acagagcatt agcgcaaggt gatttttgtc ttcttgcgct 3480 aattttttgt catcaaacct gtcgcactcc ttaatatttt gttaaaattc gcgttaaatt 3540 tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc ccttataaat 3600 caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag agtccactat 3660 taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc gcgtcaggtg
<210> 31
<211> 4783
<212> DNA
<213> Artificial Sequence
<220>
<223> pRS314 - veast eicistronic bidirectional, uni directional a
ScFv vector backbone
<220>
<221> old_sequence
<222> ί 1) .. f4783~!
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcxxg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaacg acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240 atatgtgtac tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300 aaatagcttg tcaccttacg tacaatcttg atccggagct ttt tttttt tgccgattaa 360 gaattaattc ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtgactat 420 tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480 atttcacagg tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540 cagaatgtgc tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600 agagaacaat tgacccggtt attgcaagga tcttgtaaaa gcatataaaa 660 atagttcagg cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720 ttttggctct ggt aatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780 ggcaagaata ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840 actgcaacat actactcagt gcagcttcac agaaacctca ttcgtttatt cxxttgtttg 900 attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960 gaaggcaaga gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020 atgttggtga tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080 agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140 aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgcctg cggtgtgaaa 1200 taccgcacag atgcgtaagg agaaaatacc gcatcaggaa attgtaaacg ttaatatttt 1260 gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat 1320 cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt 1380 ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt 1440 ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag 1500 gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg 1560 aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc 1620 gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc 1680 gctacagggc gcgtcgcgcc attcgccatt caggctgcgc aactgttggg aagggcgatc 1740 ggtgcgggcc tcttcgctat tacgccagct ggcgaagggg ggatgtgctg caaggcgatt 1800 aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt 1860 gtaatacgac tcactatagg gcgaattgga gctccaccgc ggtggcggcc gctctagaac 1920 tagtggatcc cccgggctgc aggaattcga tatcaagctt atcgataccg tcgacctcga 1980 gggggggccc ggtacccagc ttttgttccc tttagtgagg gttaattccg agcttggcgt 2040 aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 2100 taggagc gg aagcataaag tgtaaagcct ggggtgccta atgagtgagg taactcacat 2160 taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 2220 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 2280 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 2340 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac. atgtgagcaa 2400 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 2460 tcggcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 2520 caggactata aagataccag gcgttccccc ctggaagctc cctcgtgcgc tctcctgttc 2580 cgaccctgcc gcttaccgga tacctgtccg ctttctccc ttcgggaagc gtggcgcttt 2640 ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 2700 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 2760 agtccaaccc ggtaaaacac gacttatcac cactagcagc agccactggt aacaggatta 2820 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggc t aactacggct 2880 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 2940 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 3000 gcaagcagca gattacgcgc gaaaaa ag gatctcaaga agatcctttg atcttttcta 3060 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 3120 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 3180 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 3240 cagcgatctg tctatttcgt tcatccatag ttgcctgact gcccgtcgtg tagataacta 3300 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 3360 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 3420 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 3480 gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 3540 cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 3600 catgatcccc catgttgtga aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 3660 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 3720 ctgtcatgcc. atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 3780 gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 3840 cgccacatag cagaacttta aaagtg tca tcattggaaa acgttcttcg gggcgaaaac 3900 tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 3960 gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 4020 atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 4080 ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 4140 gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 4200 ggtccttttc atcacgtgct ataaaaataa ttataattta aattttttaa tataaatata 4260 taaattaaaa atagaaagta aaaaaagaaa ttaaagaaaa aatagttttt gttttccgaa 4320 gatgtaaaag actctagggg gatcgccaac aaatactacc ttttatcttg ctcttcctgc 4380 tctcaggtat taatgccgaa ttgtttcatc ttgtctgtgt agaagaccac acacgaaaat 4440 cctgtgattt tacattttac ttatcgttaa tcgaatgtat atctatttaa tctgcttttc 4500 ttgtctaata aatatatatg taaagtacgc tttttgttga aattttttaa acctttgttt 4560 attttttttt cttcattccg taactcttct accttcttta tttactttct aaaatccaaa 4620 tacaaaacat aaaaataaat aaacacagag taaattccca aattattcca tcattaaaag 4680 atacaaggcg cgtgtaagtt acaagcaagc gatccgtcct aagaaaccat tattatcatg 4740 acattaacct ataaaaatag gcgtatcacg aggccctttc. gtc 4783
<210> 32
<211> 5473
<212> DNA
<213> Artificial Sequence
<223> p414Gall - vector backbone for Mating Type Heavy Chain
<220>
<221> old sequence
<222> (1)...(5473)
<400> 32
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataaacg acattactat atatataata taggaagcat ttaatagaca gcatcgtaat 240 atatgtgtac tttgcagtta tgacgccaga tggcagtagt ggaagatatt ctttattgaa 300 aaatagcttg tcaccttacg tacaatcttg atccggagct tttctttttt tgccgattaa 360 gaattaattc ggtcgaaaaa agaaaaggag agggccaaga gggagggcat tggtga tat 420 tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg tctgttatta 480 atttcacagg tagttctggt ccattggtga aagtttgcgg cttgcagagc acagaggccg 540 cagaatgtgc tctagattcc gatgctgact tgctgggtat tatatgtgtg cccaatagaa 600 agagaacaat tgacccggtt attgcaagga aaatttcaag tcttgtaaaa gcatataaaa 660 atagttcagg cactccgaaa tacttggttg gcgtgtttcg taatcaacct aaggaggatg 720 ttttggctct ggtcaatgat tacggcattg atatcgtcca actgcatgga gatgagtcgt 780 ggcaagaata ccaagagttc ctcggtttgc cagttattaa aagactcgta tttccaaaag 840 actgcaacat actactcagt gcagcttcac agaaacctca ttcgtttatt cccttgtttg 900 attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct gactgggttg 960 gaaggcaaga gagccccgaa agcttacatt ttatgttagc tggtggactg acgccagaaa 1020 atgttggtga tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc ggaggtgtgg 1080 agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat gctaagaaat 1140 aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgccta tgcggtgtga 1200 aataccgcac. agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt 1260 ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa 1320 atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca 1380 gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc 1440 gtctatcagg gcgatggccc actacgtgaa ccatcaccct aat aagttt tttggggtcg 1500 aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg 1560 ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg 1620 gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg 1680 ccgctacagg gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 1740 tcggtgcggg cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 1800 ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 1860 cgcgcgtaat acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg 1920 agcgtcccaa aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc 1980 tgtacagaaa aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta 2040 taaaaaaata aatagggacc tagacttcag gttgtctaac tccttccttt tcggttagag 2100 cggatgtggg gggagggcgt gaatgtaagc gtgacataac taattacatg actcgaggtc 2160 gacggtatcg ataagcttga tatcgaattc ctgcagcccg ggggatccac tagttctaga 2220 tatagttttt tctccttgac gttaaagtat agaggtatat taacaatttt ttgttgatac 2280 ttttattaca tttgaataag aagtaataca aaccgaaaat gttgaaagta ttagttaaag 2340 tggttatgca gtttttgcat ttatatatct gttaatagat caaaaatcat cgcttcgctg 2400 attaattacc ccagaaataa ggctaaaaaa ctaatcgcat tatcatccta tggttgttaa 2460 tttgattcgt tcatttgaag gtttgtgggg ccaggttact gccaattttt cctcttcata 2520 accataaaag ctagtattgt agaatcttta ttgttcggag cagtgcggcg cgaggcacat 2580 ctgcgtttca ggaacgcgac cggtgaagac gaggacgcac ggaggagagt cttccttcgg 2640 agggctgtca cccgctcggc ggcttctaat ccgtacttca gagctccagc ttttgttccc 2700 tttagtgagg gttaattgcg cgcttggcgt aatcatggtc atagctgttt cctgtgtgaa 2760 attgttatcc. gctcacaatt ccacacaaca taggagccgg aagcataaag tgtaaagcct 2820 ggggtgccta atgagtgagg taactcacat taattgcgtt gcgctcactg cccgctttcc 2880 agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg 2940 gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc 3000 ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag 3060 gggataacgc aggaaagaac. atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 3120 aggccgcatt gctagcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 3180 gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 3240 ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 3300 cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt 3360 cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 3420 gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac. gacttatcgc 3480 cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 3540 agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg 3600 ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 3660 ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 3720 aatctcaaga agatcctttq atcttttcta cggggtctga cgctcagtgg aacgaaaact 3780 cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa 3840 attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 3900 accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 3960 ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 4020 gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 4080 agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 4140 ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 4200 ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 4260 gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 4320 ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 4380 tggttatggc agcactgcat aatt tctta ctgtcatgcc atccgtaaga tgcttttctg 4440 tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 4500 cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 4560 tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 4620 gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 4680 tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 4740 ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 4800 attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc 4860 cgcgcacatt tccccgaaaa gtgccacctg ggtccttttc atcacgtgct ataaaaataa 4920 ttataattta aattttttaa tataaatata taaattaaaa atagaaagta aaaaaagaaa 4980 ttaaagaaaa aatagttttt gttttccgaa gatgtaaaag actctagggg gatcgccaac 5040 aaatactacc ttttatcttg ctcttcctgc tctcaggtat taatgccgaa ttgtttcatc 5100 ttgtctgtgt agaagaccac acacgaaaat cctgtgattt tacattttac ttatcgttaa 5160 tcgaatgtat atctatttaa tctgcttttc ttgtctaata aatatatatg taaagtacgc 5220 tttttgttga aattttttaa acctttgttt attttttttt cttcattccg taactcttct 5280 accttcttta tttactttct aaaatccaaa tacaaaacat aaaaataaat aaacacagag 5340 taaattcxa aattattcca tcattaaaag atacgaggcg cgtgtaagtt acaggcaagc 5400 gatccgtcct aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg 5460 aggccctttc gtc 5473
<210> 3
<2U> 5583
<212> DNA
<213> Artificial Sequence
<220>
<223> p416Gall ~ vector backbone for Mat ng Type Light Chai
<220>
<221> old sequence
<222> (1)... (5583)
<400> 33
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accataccac agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240 ggtttctttg aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300 agcacagact tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360 cagtattctt aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420 cgaaagctac atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480 ttaatatcat g acgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540 aggaattact ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600 tggatatctt gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660 c a.agtacaa. ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720 aattgcagta ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780 acggtgtggt ggqcccaggt attgttagcg gtttgaagca ggcggcagaa qaagtaacaa 840 aggaacctag aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900 gagaatatac taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960 ttattgctca aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020 ccggtgtggg tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080 atgtggtctc tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140 gggatgctaa ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200 gatgcggcca gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260 aaattagagc ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320 agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380 tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440 tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500 agagtccact attaaagaac gtggactcca acgtcaaagg g gaaaaacc gtctatcagg 1560 gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620 aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680 cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740 gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800 gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 1860 cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 1920 taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag cgcgcgtaat 1980 acgactcact atagggcgaa ttgggtaccg gccgcaaatt aaagccttcg agcgtcccaa 2040 aaccttctca agcaaggttt tcagtataat gttacatgcg tacacgcgtc tgtacagaaa 2100 aaaaagaaaa atttgaaata taaataacgt tcttaatact aacataacta taaaaaaata 2160 aatagggacc tagacttcag gttgtctaac t cttccttt tcggttagag cggatgtggg 2220 gggagggcgt gaatgtaagc gtgacataac taattacatg actcgaggtc gacggtatcg 2280 ataagcttga tatcgaattc ctgcagcccg ggggatccac tagttctaga tatagttttt 2340 tctccttgac gttaaagtat agaggtatat taacaatttt ttgttgatac ttttattaca 2400 tttgaataag aagtaataca aaccgaaaat gttgaaagta ttagttaaag tggttatgca 2460 gtttttgcat ttatatatct gttaatagat caaaaatcat cgcttcgctg attaattacc 2520 ccagaaataa ggctaaaaaa ctaatcgcat tatcatccta tggttgttaa tttgattcgt 2580 tcatttgaag gtttgtgggg ccaggttact gccaattttt cctcttcata accataaaag 2640 ctagtattgt agaatcttta ttgttcggag cagtgcggcg cgaggcacat ctgcgtttca 2700 ggaacgcgac cggtgaagac gaggacgcac ggaggagagt cttccttcgg agggctgtca 2760 cccgctcggc ggcttctaat ccgtacttca gagctccagc ttttgttccc tttagtgagg 2820 gttaattgcg cgcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc 2880 gctcacaatt ccacacaaca taggagccgg aagcataaag tgtaaagcct ggggtgccta 2940 atgagtgagg taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3000 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3060 tgggcgctct tccgcttcct cgct actga ctcgctgcgc tcggtcgttc ggctgcggcg 3120 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 3180 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 3240 gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 3300 tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 3360 cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 3420 ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt 3480 cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 3540 atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 3600 agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 3660 gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa 3720 gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 3780 tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga 3840 agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg 3900 gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg 3960 aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt 4020 aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact 4080 ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat 4140 gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg 4200 aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg 4260 ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat 4320 tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc 4380 ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt 4440 cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc 4500 agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga 4560 gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc 4620 gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa 4680 acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta 4740 acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg 4800 agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg 4860 aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat 4920 gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt 4980 tccccgaaaa gtgccacctg ggtccttttc atcacgtgct ataaaaataa ttataattta 5040 aattttttaa tataaatata taaattaaaa atagaaagta aaaaaagaaa ttaaagaaaa 5100 aatagttttt gttttccgaa gatataaaag actctaggga gatcgccaac aaatactacc 5160 ttttatcttg ctcttcctgc tctcaggtat taatgccgaa ttgtttcatc ttgtctgtgt 5220 agaagaccac acacgaaaat cctgtgattt tacattttac ttatcgttaa tcgaatgtat 5280 at tatttaa tctgcttttc ttgtctaata aatatatatg taaagtacgc tttttgttga 5340 aattttttaa acctttgttt attttttttt cttcattccg taactcttct accttcttta 5400 tttactttct aaaatccaaa tacaaaacat aaaaataaat aaacacagag taaattccca 5460 aattattcca tcattaaaag atacgaggcg cgtgtaagtt acaggcaagc gatccgtcct 5520 aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc 5580 gtc 5583

Claims

e Claim:
1. A vector construct designed to clone antibody or a fragment thereof, said vector construct containing an expression cassette which comprises:
at least one leader sequence;
at least one cloning region for receiving a gene encoding a peptide or protein that selectively binds to a biologically active ligand;
at least one nucleotide sequence encoding constant region immunoglobulin heavy chain or constant region immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to constant region of a native immunoglobulin or fragments thereof; and
at least one recombinant tag sequence or selection coding nucleic acid sequence; wherein, the at least one cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bgli!, Bmil, Bind! II, Ascl, Ncol, Xbal, Nhel, Noil and combinations thereof.
2. The vector construct as claimed in claim 1, wherein the construct is designed to receive antibody or a fragment thereof from a phagemid comprising at least one cloning region or from a yeast vector comprising at least one cloning region, or, to transfer antibody or a fragment thereof to a yeast vector comprising at least one cloning region; and wherein the at least one cloning region of the expression cassette, the phagemid and the yeast vector comprises one or more common restriction sites selected from a group comprising Ndel, Bglll, Bmti, Hindffl, Ascl, Ncol, Xbal, Nhel, Notl and combinations thereof,
3. The vector construct as claimed in claim 1, wherein the expression cassette comprises:
at least one terminator sequence lacking or comprising at upstream an enzyme cleavage site fused with a nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system;
or,
a nucleotide sequence encoding phage coat protein comprising at upstream at least one ribosomal binding site.
4. The vector construct as claimed in claim 1, wherein the expression cassette contains or lacks one or more promoter sequence, operator sequence or a combination thereof; the vector construct is capable of expressing the antibody or a fragment thereof in a bacterial cell or a yeast cell; wherein the restriction sites in the cloning region of the expression cassette, the phagemid and the yeast vector is selected from combinations comprising Hindlll and AscI; Ndel, Bglll, Hindlll and AscI; Ncol and Xbal; Ncol and Notl; Xbal, Nhel and Nod; the promoter sequence is selected from a group comprising Gal 1, Gal 1/10 and a combination thereof; the leader sequence is selected from a group comprising pelB sequence, alpha leader sequence, Aga2P leader sequence, alpha mating factor 1 secretory signal sequence (SS01), engineered alpha factor (aapS4) signal sequence (SS02), engineered alpha factor (aap8) signal sequence (SS03), engineered alpha factor (aap8), signal sequence (SS04) and combinations thereof; the recombinant tag sequence or selection coding nucleic acid sequence is selected from a group comprising FLAG, c- yc, V5, His and combinations thereof; the terminator sequence is selected from a group comprising alpha terminator, CYC1 terminator, and combinations thereof; the enzyme cleavage site is TEV protease cleavage site; the nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system is Aga2P protein; and the phage coat protein is selected from a group comprising pill protein, G8P and a combination thereof.
5. The vector construct as claimed in claim 1, wherein the nucleotide sequence encoding constant region immunoglobulin heavy chain or constant region immunoglobulin light chain having at least one mutation is selected from a group comprising first constant domain (CHI ) of the immunoglobulin heavy chain or a fragment thereof, kappa constant region (Ck) of the immunoglobulin light chain or a fragment thereof and lambda constant region (CL) of the immunoglobulin light chain or a fragment thereof; and wherein the gene of the cloning region is selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain or a fragment thereof, lambda variable region (VL) of the immunoglobulin light chain or a fragment thereof and variable region of the immunoglobulin heavy chain (VH) or a fragment thereof,
6. The vector construct as claimed in claim 1, wherein the vector construct is selected from a group comprising yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector and phagemid; and wherein the expression cassette is selected from a group comprising:
(a) sequentially,
a promoter sequence;
a leader sequence;
a cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Bmtl, Nhel, Notl and combinations thereof; a nucleotide sequence encoding first constant domain (CHI ) of the IgGl immunoglobulin heavy chain, wherein said constant domain comprises at least one mutation with respect to heavy chain constant domain of native immunoglobulin or fragment thereof;
recombinant tag sequences or selection coding nucleic acid sequences; and a terminator sequence comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence,
(b) sequentially,
a promoter sequence;
a leader sequence;
a cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
a nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to light chain constant region of a native immunoglobulin or fragment thereof;
recombinant tag sequences or selection coding nucleic acid sequences; and a terminator sequence,
(c) sequentially,
a first terminator sequence;
a first set of recombinant tag sequences or selection coding nucleic acid sequences;
a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant region comprises at least one mutation with respect to light chain constant region of a native immunoglobulin or fragment thereof;
a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
a first leader sequence,
a promoter sequence;
a second leader sequence;
a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Nco!, Xbal, Nhel, Noil and combinations thereof;
a second nucleotide sequence encoding first constant domain (CHI ) of the IgGl immunoglobulin heavy chain, wherein said constant region comprises at least one mutation with respect to hea vy chain constant region of a native immunoglobulin or fragment thereof;
a second set of recombinant tag sequences or selection coding nucleic acid sequences; and
a second terminator sequence comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence,
(d) sequentially,
a first promoter sequence;
a first leader sequence,
a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant domain comprises at least one mutation with respect to light chain constant domain of native immunoglobulin or fragment thereof;
a first set of recombinant tag sequences or selection coding nucleic acid sequences; a first terminator sequence;
a second promoter sequence;
a second leader sequence;
a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xbal, Nhel, Noil and combinations thereof; a second nucleotide sequence encoding first constant domain (CHI) of the IgGl immunoglobulin heavy chain, wherein said constant domain comprises at least one mutation with respect to heavy chain constant domain of native immunoglobulin or fragment thereof;
a second set of recombinant tag sequences or selection coding nucleic acid sequences; and
a second terminator sequence comprising at upstream a protease cleavage site fused with a nucleotide sequence encoding Aga2P protein via a linker sequence, and
(e) sequentially,
a promoter sequence;
a operator sequence;
a first ribosomal binding site;
a first leader sequence;
a first cloning region capable of receiving a gene encoding variable region of the immunoglobulin light chain or a fragment thereof and comprising restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl and combinations thereof;
a first nucleotide sequence encoding kappa constant region (Ck) of the immunoglobulin light chain or lambda constant region (CL) of the immunoglobulin light chain, or fragments thereof, wherein said constant domain comprises at least one mutation with respect to light chain constant domain of native immunoglobulin or fragment thereof; a second ribosomal binding site;
a second leader sequence;
a second cloning region capable of receiving a gene encoding variable region of the immunoglobulin heavy chain or a fragment thereof and comprising restriction sites selected from a group comprising Ncol, Xhal, Nhel, Noil and combinations thereof;
a second nucleotide sequence encoding first constant domain (CHI) of the IgGl immunoglobulin heavy chain, wherein said constant domain comprises at least one mutation with respect to heavy chain constant domain of native immunoglobulin or fragment thereof;
a recombinant tag sequence(s) or selection coding nucleic acid sequence(s); and a nucleotide sequence encoding phage coat protein.
A vector construct designed to clone antibody or a fragment thereof, or, to transfer or receive an antibody or a fragment thereof from the vector construct as claimed in claim 1 , said vector construct containing an expression cassette which comprises: a promoter sequence;
a leader sequence;
a nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system;
a first enzyme cleavage site;
a first recombinant tag sequence or selection coding nucleic acid sequence;
a first linker sequence;
a second enzyme cleavage site;
a first cloning region operably linked to a second cloning region in presence of a second linker sequence, wherein the cloning regions receive gene encoding a peptide or protein that selectively binds to a biologically active ligand;
a second recombinant tag sequence(s) or selection coding nucleic acid sequence(s); and
a terminator sequence wherein, the first cloning region or the second cloning region of the expression cassette contains restriction sites selected from a group comprising Ndel, Bglll, Hind!II, Ascl, Ncol, Xhal, Nhel, Nod and combinations thereof.
8. The vector construct as claimed in claim 7, wherein said vector construct is a scFv vector and is capable of expressing single-chain variable fragment (scFv) or a fragment thereof in yeast cell; wherein the cloning region of the expression cassette of scFv vector and the vector construct of claim 1 comprises one or more common restriction sites selected from a group comprising Ndel, Bglll, Hindlll, Ascl, Ncol, Xbal, Nhel, Noil and combinations thereof; and wherein the promoter sequence is Gal 1; the nucleotide sequence encoding a product that enables display of a peptide or protein on the surface of a protein expression system is Aga2P protein; the enzyme cleavage sites are protease cleavage sites selected from a group comprising Factor Xa cleavage site, TEV protease cleavage site and a combination thereof; the recombinant tag sequences or selection coding nucleic acid sequences are selected from a group comprising HA tag, c-Myc tag, FLAG and combinations thereof; the linker sequence is G4S sequence; the gene of the first cloning region is selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain or a fragment thereof, lambda variable region (VL) of the immunoglobulin light chain or a fragment thereof and a combination thereof; the gene of the second cloning region is variable region of the immunoglobulin heavy chain ( VFI ) or a fragment thereof; and the terminator sequence is selected from a group comprising alpha terminator, CYC! terminator and a combination thereof,
9. The vector construct as claimed in claim 1 or claim 7, wherein the construct has a nucleic acid sequence selected from a group comprising SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24 and
SEQ ID No. 26.
10. The vector construct as claimed in any of the claims 1-9, wherein the vector construct farther comprises regions selected from a group comprising origin of replication (Ori), antibiotic resistant marker, fl origin of replication, promoter and combinations thereof and combinations thereof; and wherein the vector constnict is capable of expressing or displaying an antibody or a fragment thereof in a prokaryotic expression system, yeast expression system or a combination thereof.
11. The vector construct as claimed in any of the claims 1-9, wherein the CHI region has a nucleic acid sequence of SEQ ID No. 27, the Ck region has a nucleic acid sequence of SEQ ID No. 28, and the CL region has a nucleic acid sequence of SEQ ID No. 29; and wherein the Vk, VL and VH sequences are derived from naive antibody repertoire, synthetic antibody repertoire, or a combination thereof.
12, A method of preparing the vector constnict as claimed in claim 1 or claim 7, said method comprising steps of:
a) synthesis of the expression cassette;
b) linearization of a destination vector; and
c) inserting the expression cassette into the linearized destination vector to obtain the vector construct.
13. The method as claimed in claim 12, wherein the method comprises confirming error- free vector clones by sequencing technique; the destination vector is selected from a group comprising pADL23c, pRS314, p414Gall, p416Gall and combinations thereof; the linearization is carried out by digestion with restriction enzyme(s); inserting the expression cassette into the linearized destination vector is carried out by techniques selected from a group comprising homologous recombination, restriction digestion followed by ligation and a combination thereof.
14. A method of preparing library of vector constructs, said method comprising steps of; a) preparing the vector construct by the method as claimed in claim 12;
b) cloning nucleotide sequences encoding for regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VH) and combinations thereof, into the cloning region of the vector construct to obtain the library,
or
transferring the nucleotide sequences encoding regions selected from a group comprising kappa variable region (Vk) of the immunoglobulin light chain, lambda variable region (VL) of the immunoglobulin light chain or fragments thereof, variable region of the immunoglobulin heavy chain or a fragment thereof (VH) and combinations thereof, from the cloning region of one vector construct to the cloning region of another vector construct to obtain the library.
15. The method as claimed in claim 14, wherein the vector construct is selected from a group comprising phagemid, yeast mating type heavy chain expressing vector, yeast mating type light chain expressing vector, yeast bicistronic bidirectional vector, yeast bicistronic unidirectional vector and single-chain variable fragment (scFv) vector; the Vk, VL and VH regions are derived from na'ive antibody, synthetic antibody or a combination thereof; the library of vector constructs is a synthetic library, na'ive library or a combination thereof; and wherein the transfer of the nucleotide sequence is carried out between the phagemid vector construct to the yeast vector construct or between yeast vector cons tracts.
16. A method of screening and identifying antibody or a fragment thereof having desired functional characteristic(s), comprising steps of: (a) preparing the library of vector constructs by the method as claimed in claim 14 and transforming said vector constructs into bacterial host cells, yeast host cells or a combination thereof; and (b) selecting the bacterial or yeast host cells expressing the antibody or fragment thereof having the desired functional characteristic(s),
17. The method as claimed in claim 16, wherein the screening and identification is carried out by phage display in bacterial host cells, yeast display in yeast host cells or sequentially by phage display and yeast display; and wherein the desired functional characteristic (s) is selected from a group comprising affinity, specificity, antigenicity, manufacturability, generation of new epitopes, thermal stability, solubility, aggregation and catalytic activity and combinations thereof.
18. The method as claimed in claim 16, wherein the screening and identification is carried out by sequential phage display and yeast display comprising steps of:
(i) transforming the library of phagemid constructs into bacterial host cells to obtain phage antibody library;
(ii) screening the displayed antibody or fragment thereof against antigen(s) to obtain panned phage antibody library comprising selected clones; (iii) transferring the antibody or fragment thereof from the selected clones into yeast vector followed by transformation into yeast host cells for expression and di splay of said antibody or fragment thereof;
(iv) screening the yeast displayed antibody or fragment thereof against antigen(s) to identify the antibody or fragment thereof having desired functional characteristic(s).
19. The method as claimed in claim 16, wherein the antibody or a fragment thereof is in Fab or Scfv format for cloning into phage or yeast vector; and wherein transformation efficiency into the phage vector is in the range of about 109 to about 1011; and transferring or transformation efficiency into the yeast vector is in the range of about 106 to about 108.
20. A bacterial or yeast host cell, or a phage library or a yeast library thereof comprising the vector construct(s) as claimed in claim I or claim 7,
21. An expression cassette provided by the vector constructs) as claimed in claim 1 or claim 7 wherein said expression cassette has a nucleic acid sequence selected from a group comprising SEQ ID No. 1 , SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.
PCT/IB2017/051990 2016-04-06 2017-04-06 Vectors for cloning and expression of proteins, methods and applications thereof WO2017175176A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2018553115A JP6987076B2 (en) 2016-04-06 2017-04-06 Vectors for cloning and protein expression, methods thereof, and uses thereof
US16/090,783 US11549119B2 (en) 2016-04-06 2017-04-06 Vectors for cloning and expression of proteins, methods and applications thereof
EP17722873.1A EP3440208B1 (en) 2016-04-06 2017-04-06 Vectors for cloning and expression of proteins, methods and applications thereof
DK17722873.1T DK3440208T3 (en) 2016-04-06 2017-04-06 VECTORS FOR CLONING AND EXPRESSION OF PROTEINS, METHODS AND USES
CA3018936A CA3018936C (en) 2016-04-06 2017-04-06 Vectors for cloning and expression of proteins, methods and applications thereof
KR1020187031366A KR102165777B1 (en) 2016-04-06 2017-04-06 Vector for cloning and expression of protein, method and application thereof
ES17722873T ES2837482T3 (en) 2016-04-06 2017-04-06 Vectors for the cloning and expression of proteins, methods and applications of these

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN201641012164 2016-04-06
IN201641012164 2016-04-06

Publications (1)

Publication Number Publication Date
WO2017175176A1 true WO2017175176A1 (en) 2017-10-12

Family

ID=58699192

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2017/051990 WO2017175176A1 (en) 2016-04-06 2017-04-06 Vectors for cloning and expression of proteins, methods and applications thereof

Country Status (9)

Country Link
US (1) US11549119B2 (en)
EP (1) EP3440208B1 (en)
JP (1) JP6987076B2 (en)
KR (1) KR102165777B1 (en)
CA (1) CA3018936C (en)
DK (1) DK3440208T3 (en)
ES (1) ES2837482T3 (en)
PT (1) PT3440208T (en)
WO (1) WO2017175176A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3584258A1 (en) 2018-06-19 2019-12-25 IEO - Istituto Europeo di Oncologia Srl Antibodies anti tumor associated antigens and method for obtaining them
EP3995576A1 (en) * 2020-11-05 2022-05-11 Adlai Nortye Biopharma Co., Ltd. Design and construction of fully human antibody yeast display technique

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115109794A (en) * 2022-06-30 2022-09-27 武汉生之源生物科技股份有限公司 Phagemid vector and preparation method and application thereof

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992001047A1 (en) * 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1996007754A1 (en) * 1994-09-02 1996-03-14 The Scripps Research Institute Methods for producing antibody libraries using universal or randomized immunoglobulin light chains
WO1999036569A1 (en) * 1998-01-20 1999-07-22 The Board Of Trustees Of The University Of Illinois Yeast cell surface display of proteins and uses thereof
EP1054018A1 (en) * 1999-05-18 2000-11-22 Target Quest B.V. Fab fragment libraries and methods for their use
WO2002088315A2 (en) * 2001-04-27 2002-11-07 Alexion Pharmaceuticals, Inc. Phagemid vectors
US20030224408A1 (en) * 2002-03-07 2003-12-04 Dyax Corporation Ligand screening and discovery
WO2008143684A1 (en) * 2006-10-05 2008-11-27 Fred Hutchinson Cancer Research Center Methods of generation use of in vivo biotinylated recombinant antibodies
WO2011060233A1 (en) * 2009-11-11 2011-05-19 The Trustees Of The University Of Pennsylvania Anti-tem1 antibodies and uses thereof
WO2016125089A1 (en) * 2015-02-04 2016-08-11 Abcelex Technologies Inc. Anti-salmonella antibodies and uses thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2119788A1 (en) * 1999-03-02 2009-11-18 Life Technologies Corporation Compositions and methods for use in recombinational cloning of nucleic acids
GB0111015D0 (en) * 2001-05-04 2001-06-27 Norsk Hydro As Genetic material
JP4748984B2 (en) * 2002-06-16 2011-08-17 ダイアックス、コープ Recombination of nucleic acid library members
US20130085072A1 (en) * 2011-10-03 2013-04-04 Los Alamos National Security, Llc Recombinant renewable polyclonal antibodies

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992001047A1 (en) * 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1996007754A1 (en) * 1994-09-02 1996-03-14 The Scripps Research Institute Methods for producing antibody libraries using universal or randomized immunoglobulin light chains
WO1999036569A1 (en) * 1998-01-20 1999-07-22 The Board Of Trustees Of The University Of Illinois Yeast cell surface display of proteins and uses thereof
EP1054018A1 (en) * 1999-05-18 2000-11-22 Target Quest B.V. Fab fragment libraries and methods for their use
WO2002088315A2 (en) * 2001-04-27 2002-11-07 Alexion Pharmaceuticals, Inc. Phagemid vectors
US20030224408A1 (en) * 2002-03-07 2003-12-04 Dyax Corporation Ligand screening and discovery
WO2008143684A1 (en) * 2006-10-05 2008-11-27 Fred Hutchinson Cancer Research Center Methods of generation use of in vivo biotinylated recombinant antibodies
WO2011060233A1 (en) * 2009-11-11 2011-05-19 The Trustees Of The University Of Pennsylvania Anti-tem1 antibodies and uses thereof
WO2016125089A1 (en) * 2015-02-04 2016-08-11 Abcelex Technologies Inc. Anti-salmonella antibodies and uses thereof

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"PADL-23c Phagemid, Instruction Manual; Version A1.8", ANTIBODIES DESIGN LABORATORIES, 1 February 2017 (2017-02-01), pages 1 - 12, XP002770837, Retrieved from the Internet <URL:https://www.abdesignlabs.com/content/manuals/pADL-23c%20manual.pdf> [retrieved on 20170606] *
ARBABI-GHAHROUDI MEHDI ET AL: "Isolation of monoclonal antibody fragments from phage display libraries", METHODS IN MOLECULAR BIO, HUMANA PRESS, US, vol. 502, 1 January 2009 (2009-01-01), pages 341 - 364, XP009171725, ISSN: 1064-3745, DOI: 10.1007/978-1-60327-565-1_20 *
CHRISTIANSON T W ET AL: "Multifunctional yeast high-copy-number shuttle vectors", GENE, ELSEVIER, AMSTERDAM, NL, vol. 110, no. 1, 2 January 1992 (1992-01-02), pages 119 - 122, XP023542303, ISSN: 0378-1119, [retrieved on 19920102], DOI: 10.1016/0378-1119(92)90454-W *
KIRSCH M ET AL: "Parameters affecting the display of antibodies on phage", JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 301, no. 1-2, 1 June 2005 (2005-06-01), pages 173 - 185, XP027659320, ISSN: 0022-1759, [retrieved on 20050601] *
PERSIC L ET AL: "An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries", GENE, ELSEVIER, AMSTERDAM, NL, vol. 187, no. 1, 10 March 1997 (1997-03-10), pages 9 - 18, XP004093234, ISSN: 0378-1119, DOI: 10.1016/S0378-1119(96)00628-2 *
SIKORSKI R S ET AL: "A SYSTEM OF SHUTTLE VECTORS AND YEAST HOST STRAINS DESIGNED FOR EFFICIENT MANIPULATION OF DNA IN SACCHAROMYCES CEREVISIAE", GENETICS, GENETICS SOCIETY OF AMERICA, AUSTIN, TX, US, vol. 122, no. 1, 1 May 1989 (1989-05-01), pages 19 - 27, XP000828235, ISSN: 0016-6731 *
ZHAO AIZHI ET AL: "Rapid isolation of high-affinity human antibodies against the tumor vascular marker Endosialin/TEM1, using a paired yeast-display/secretory scFv library platform.", JOURNAL OF IMMUNOLOGICAL METHODS 05 JAN 2011, vol. 363, no. 2, 5 January 2011 (2011-01-05), pages 221 - 232, XP027558132, ISSN: 1872-7905 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3584258A1 (en) 2018-06-19 2019-12-25 IEO - Istituto Europeo di Oncologia Srl Antibodies anti tumor associated antigens and method for obtaining them
EP3995576A1 (en) * 2020-11-05 2022-05-11 Adlai Nortye Biopharma Co., Ltd. Design and construction of fully human antibody yeast display technique
US11680271B2 (en) 2020-11-05 2023-06-20 Adlai Nortye Biopharma Co., Ltd. Construction of fully human antibody yeast display technique

Also Published As

Publication number Publication date
KR102165777B1 (en) 2020-10-14
CA3018936A1 (en) 2017-10-12
DK3440208T3 (en) 2020-12-07
US20190119691A1 (en) 2019-04-25
KR20190015700A (en) 2019-02-14
EP3440208B1 (en) 2020-09-16
ES2837482T3 (en) 2021-06-30
EP3440208A1 (en) 2019-02-13
CA3018936C (en) 2021-10-19
JP6987076B2 (en) 2021-12-22
JP2019510505A (en) 2019-04-18
US11549119B2 (en) 2023-01-10
PT3440208T (en) 2020-12-04

Similar Documents

Publication Publication Date Title
KR102274445B1 (en) Methods for genomic integration
AU2020264412B2 (en) Dna-binding protein using ppr motif, and use thereof
KR20050044856A (en) Polycistronic expression of antibodies
AU2016319304A1 (en) Production of human milk oligosaccharides in microbial hosts with engineered import / export
KR20180056772A (en) Protective DNA templates and methods for intracellular gene modification and increased homologous recombination
CN101646766B (en) Detal 17 desaturases and use thereof in making polyunsaturated fatty acids
KR102165777B1 (en) Vector for cloning and expression of protein, method and application thereof
KR20150125994A (en) A cell expression system
TW201235469A (en) Methods of selecting and producing modified toxins, conjugates containing modified toxins, and uses thereof
DK2623594T3 (en) Antibody against human prostaglandin E2 receptor EP4
KR102652494B1 (en) A two-component vector library system for rapid assembly and diversification of full-length T-cell receptor open reading frames.
US20040265863A1 (en) Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
KR20210105382A (en) RNA encoding protein
CN113396222A (en) Adeno-associated virus (AAV) producing cell lines and related methods
CN111094569A (en) Light-controlled viral protein, gene thereof, and viral vector containing same
JP2023025182A (en) Engineered multicomponent systems for identification and characterization of t cell receptors and t cell antigens
CN109843909B (en) Cells and methods for producing rhamnolipids using alternative glucose transporters
CN112877292A (en) Human antibody producing cell
DK2935601T3 (en) RECOMBINANT MICROBELL CELLS PRODUCING AT LEAST 28% EICOSAPENTAIC ACID AS DRY WEIGHT
KR20190076992A (en) A manipulated multicomponent system for the identification and characterization of T-cell receptors, T-cell antigens and their functional interactions
KR20140043890A (en) Regulated gene expression systems and constructs thereof
US11814412B2 (en) Artificial proteins and compositions and methods thereof
KR20150100606A (en) Arterivirus protein and expression mechanisms
KR20230159994A (en) Recombinant vector comprising hybrid signal sequence, and secretary preparation method of human insulin-like growth factor-1 using the same
CA3226763A1 (en) Burden-addicted production strains

Legal Events

Date Code Title Description
DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 3018936

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2018553115

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20187031366

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017722873

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017722873

Country of ref document: EP

Effective date: 20181106

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17722873

Country of ref document: EP

Kind code of ref document: A1