WO2017173237A1 - Mortalin binding aptamers - Google Patents
Mortalin binding aptamers Download PDFInfo
- Publication number
- WO2017173237A1 WO2017173237A1 PCT/US2017/025320 US2017025320W WO2017173237A1 WO 2017173237 A1 WO2017173237 A1 WO 2017173237A1 US 2017025320 W US2017025320 W US 2017025320W WO 2017173237 A1 WO2017173237 A1 WO 2017173237A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- cell
- aptamer
- nucleic acid
- carcinoma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- Undifferentiated cancers are cancers in which the ceils are very immature and "primitive” and do not look like cells in the tissue from which they arose. Undifferentiated cells are said to be anaplastic. As a rule, an undifferentiated cancer is more malignant than a cancer of that type which is well differentiated. Such tumors generally carry a poorer prognosis than well differentiated cancers, and are more likely to spread into surrounding tissues or to other parts of the body. The origin (or primary tumor) of such cancers can be difficult to determine, requiring extensive testing.
- Glioma is a type of brain or spinal tumour arising from glial cells. They are rarely curable, and patients diagnosed with high-grade gliomas have poor prognosis. Of 10,000
- Glioblastoma multiforme also known as glioblastoma
- Glioblastoma tumors are characterized by the presence of small areas of necrotizing tissue that are surrounded by undifferentiated cells.
- aptamers that bind mortalin and their use in the treatment and diagnosis of cancer, and specifically in the treatment and diagnosis of nonpancreatic cancer.
- mortalin binding aptamers for the treatment and diagnosis of poorly differentiated or undifferentiated cancers are provided.
- the present disclosure provides, inter alia, methods for treating cancer, and mortalin binding aptamers for use in such methods.
- a method for treating nonpancreatic cancer in a subject is provided, the method comprising administering a mortalin binding aptamer to the subject.
- a mortalin binding aptamer for use in a method of treating non-pancreatic cancer is provided.
- the use of a mortalin binding aptamer in the manufacture of a medicament for the treatment of non-pancreatic cancer is provided.
- the cancer may be a non-pancreatic cancer.
- the cancer may be a poorly differentiated or undifferentiated cancer.
- the cancer is a poorly differentiated or undifferentiated non-pancreatic cancer.
- the cancer may be a metastatic or invasive cancer.
- the cancer may be a malignant cancer.
- the cancer is poorly differentiated or undifferentiated glioblastoma, or colorectal cancer, or liver, breast or prostate cancer.
- the method of treatment may comprise intravenous administration of the aptamer.
- the methods involve administration of a mortalin binding aptamer, and mortalin binding aptamers for use in methods of treatment.
- the aptamer may comprise the sequence GAAUGCCC, and be at least 29 nucleotides in length. In some cases the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and is at least 29 nucleotides in length. The aptamer may have at least 80% identity to SEQ ID
- the aptamer does not consist of SEQ ID NO: 1.
- the aptamer is administered with a therapeutic agent, such as an anticancer therapeutic agent.
- the aptamer may be linked to a therapeutic agent, such as an anti-cancer therapeutic agent.
- Also provided herein are methods for identifying a cancer cell in a sample, and/or for diagnosing cancer in an individual. The methods involve contacting the sample with a mortalin binding aptamer.
- the cancer may be a non-pancreatic cancer.
- the cancer may be a poorly differentiated or undifferentiated cancer.
- the cancer is a poorly differentiated or undifferentiated non-pancreatic cancer.
- the cancer may be a metastatic or invasive cancer.
- the cancer may be a malignant cancer.
- the cancer is poorly differentiated or undifferentiated glioblastoma or colorectal cancer, or liver, breast or prostate cancer. Also provided herein is the use of a mortalin binding aptamer in the manufacture of a medicament for the treatment of cancer, and particularly non-pancreatic cancer, and poorly differentiated or undifferentiated cancer.
- a mortalin binding aptamer for use in a method of treating non-pancreatic cancer.
- the aptamer comprises the sequence GAAUGCCC, and is at least 29 nucleotides in length.
- the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and is at least 29 nucleotides in length.
- a method for identifying a non-pancreatic cancer cell in a sample comprising contacting the sample with a mortalin binding aptamer.
- a method for diagnosing a non-pancreatic cancer in an individual comprising contacting a sample from the individual with a mortalin binding aptamer.
- a method for treating non-pancreatic cancer in a subject comprising administering a mortalin binding aptamer to the subject. 17. The method of any one of paragraphs 12 - 16 wherein the non-pancreatic cancer or non-pancreatic cancer cell is a poorly differentiated or undifferentiated non-pancreatic cancer or cell. 18. Use of a mortalin binding aptamer in the manufacture of a medicament for the treatment of non-pancreatic cancer.
- Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-, double- or multiple-stranded form, or complements thereof.
- polynucleotide refers to a linear sequence of nucleotides.
- nucleotide typically refers to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be
- nucleic acids can be linear or branched.
- nucleic acids can be a linear chain of nucleotides or the nucleic acids can be branched, e.g., such that the nucleic acids comprise one or more arms or branches of nucleotides.
- the branched nucleic acids are repetitively branched to form higher ordered structures such as dendrimers and the like.
- Nucleic acids, including nucleic acids with a phosphothioate backbone can include one or more reactive moieties.
- the term reactive moiety includes any group capable of reacting with another molecule, e.g., a nucleic acid or polypeptide through covalent, noncovalent or other interactions.
- the nucleic acid can include an amino acid reactive moiety that reacts with an amino acid on a protein or polypeptide through a covalent, non-covalent or other interaction.
- nucleic acids containing known nucleotide analogs or modified backbone residues or linkages which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- Examples of such analogs include, without limitation, phosphodiester derivatives including, e.g., phosphoramidate, phosphorodiamidate, phosphorothioate (also known as phosphothioate), phosphorodithioate, phosphonocarboxylic acids,
- nucleic acid backbones and linkages include those with positive backbones; non-ionic backbones, modified sugars, and non- ribose backbones (e.g. phosphorodiamidate morpholino oligos or locked nucleic acids (LNA)), including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and
- nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose- phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
- the internucleotide linkages in DNA are phosphodiester, phosphodiester derivatives, or a combination of both.
- the words "complementary” or “complementarity” refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide.
- the sequence A-G-T is complementary to the sequence T-C-A.
- Complementarity may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.
- aptamer refers to oligonucleotides (e.g. short
- oligonucleotides or deoxyribonucleotides that bind (e.g. with high affinity and specificity) to proteins, peptides, and small molecules.
- An aptamer may be referred to as an oligonucleotide based target binding moiety.
- Aptamers may be RNA or DNA. Aptamers may have secondary or tertiary structure and, thus, may be able to fold into diverse and intricate molecular structures.
- Aptamers can be selected in vitro from very large libraries of randomized sequences by the process of systemic evolution of ligands by exponential enrichment (SELEX as described in Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346:818-822; Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505-510) or by developing SOMAmers (slow off-rate modified aptamers) (Gold Let al. (2010) Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS ONE 5(12):e15004).
- Applying the SELEX and the SOMAmer technology includes for instance adding functional groups that mimic amino acid side chains to expand the aptamer's chemical diversity.
- high affinity aptamers for a protein may be enriched and identified.
- Aptamers may exhibit many desirable properties for targeted drug delivery, such as ease of selection and synthesis, high binding affinity and specificity, low immunogenicity, and versatile synthetic accessibility.
- Anti-cancer agents e.g. chemotherapy drugs, toxins, and siRNAs
- Aptamers are nucleic acid molecules characterised by the ability to bind to a target molecule with high specificity and high affinity. Almost every aptamer identified to date is a non-naturally occurring molecule.
- Aptamers may be DNA or RNA molecules and may be single stranded or double stranded.
- the aptamer may comprise chemically modified nucleotides or nucleosides, for example in which the sugar and/or phosphate and/or base is chemically modified. Such modifications may improve the stability of the aptamer or make the aptamer more resistant to degradation.
- the aptamers described herein may include chemical modifications as described herein such as a chemical substitution at a sugar position, a phosphate position, and/or a base position of the nucleic acid including, for example., incorporation of a modified nucleotide, incorporation of a capping moiety (e.g.
- Base modifications may include 5-position pyrimidine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo- or 5-iodo-uracil, backbone modifications.
- Sugar modifications may include 2'-amine nucleotides (2'-NH 2 ) , 2'-fluoro nucleotides (2'-F), and 2'-0-methyl (2'-OMe) nucleotides.
- nucleotide, nucleoside, base and phosphate modifications are known to those or ordinary skill in the art, e.g. as described in Eaton et al., Bioorganic & Medicinal Chemistry, Vol.5, No.6, pp1087-1096, 1997.
- Aptamers may be synthesised by methods which are well known to the skilled person.
- aptamers may be chemically synthesised, e.g. on a solid support.
- Solid phase synthesis may use phosphoramidite chemistry. Briefly, a solid supported nucleotide is detritylated, then coupled with a suitably activated nucleoside
- Aptamers can be thought of as the nucleic acid equivalent of monoclonal antibodies and often have K d 's in the nM or pM range, e.g. less than one of 500nM, 100nM, 50nM, 10nM, 1 nM, 500pM, 100pM.
- K d 's in the nM or pM range, e.g. less than one of 500nM, 100nM, 50nM, 10nM, 1 nM, 500pM, 100pM.
- monoclonal antibodies may be useful in virtually any situation in which target binding is required, including use in therapeutic and diagnostic applications, in vitro or in vivo. In vitro diagnostic applications may include use in detecting the presence or absence of a target molecule.
- Aptamers described herein may be provided in purified or isolated form. Aptamers described herein may be formulated as a pharmaceutical composition or medicament.
- a "tumor cell antigen aptamer” is an aptamer that has high affinity and specificity for a tumor cell antigen, as defined herein.
- WO2013/154735 and Table 1 describe the pancreatic cancer cell binding aptamers P19, P15, P1 , P11 , P7, P6 and the consensus sequence SEQ ID NO:8. The sequence of a truncated P19 aptamer is shown in Table 1.
- the tumor cell antigen aptamer is a mortalin binding aptamer.
- Mortalin binding aptamers such as P19, tP19 and P1 are described in WO2013/154735 and in co-pending US provisional patent application no. 62/141 156, incorporated herein by reference.
- the aptamer may comprise the sequence GAAUGCCC, and be at least 29 nucleotides in length.
- the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and is at least 29 nucleotides in length.
- the aptamer may have at least 80% identity to SEQ ID NO: 2 or SEQ ID NO: 4.
- the aptamer does not consist of SEQ ID NO: 1.
- the aptamer may comprise the amino acid sequence set out as SEQ ID NO: 1 and one or more additional amino acids, at either or both or the C or N termini.
- Aptamers are normally mono-specific, i.e. having high affinity and specificity for a single target molecule.
- the nucleic acid sequence of a mono-specific aptamer, or mono-specific part of a bi- specific aptamer may optionally have a minimum length of one of 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91
- the nucleic acid sequence of a mono-specific aptamer, or mono-specific part of a bi- specific aptamer may optionally have a maximum length of one of 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.
- the nucleic acid sequence of a mono-specific aptamer, or mono-specific part of a bi- specific aptamer may optionally have a length of one of 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 ,
- the nucleic acid sequence of a mortalin binding aptamer may have a degree of primary sequence identity with one of SEQ ID Nos 1 , 2, or 4, that is at least one of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
- An "antisense nucleic acid” as referred to herein is a nucleic acid (e.g. DNA or RNA molecule) that is complementary to at least a portion of a specific target nucleic acid (e.g.
- an mRNA translatable into a protein is capable of reducing transcription of the target nucleic acid (e.g. mRNA from DNA) or reducing the translation of the target nucleic acid (e.g. mRNA) or altering transcript splicing (e.g. single stranded morpholino oligo).
- target nucleic acid e.g. mRNA from DNA
- target nucleic acid e.g. mRNA
- altering transcript splicing e.g. single stranded morpholino oligo
- synthetic antisense nucleic acids e.g. oligonucleotides
- antisense nucleic acids are capable of hybridizing to (e.g. selectively hybridizing to) a target nucleic acid (e.g. target mRNA).
- the antisense nucleic acid hybridizes to the target nucleic acid sequence (e.g. mRNA) under stringent hybridization conditions. In embodiments, the antisense nucleic acid hybridizes to the target nucleic acid (e.g. mRNA) under moderately stringent hybridization conditions.
- Antisense nucleic acids may comprise naturally occurring nucleotides or modified nucleotides such as, e.g., phosphorothioate, methylphosphonate, and -anomeric sugar-phosphate, backbone modified nucleotides. In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule.
- antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate an mRNA that is double-stranded.
- the use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal. Biochem., 172:289, (1988)). Further, antisense molecules which bind directly to the DNA may be used. Antisense nucleic acids may be single or double stranded nucleic acids.
- Non-limiting examples of antisense nucleic acids include siRNAs (including their derivatives or pre-cursors, such as nucleotide analogs), short hairpin RNAs (shRNA), micro RNAs (miRNA), saRNAs (small activating RNAs) and small nucleolar RNAs (snoRNA) or certain of their derivatives or precursors.
- siRNAs including their derivatives or pre-cursors, such as nucleotide analogs
- shRNA short hairpin RNAs
- miRNA micro RNAs
- saRNAs small activating RNAs
- snoRNA small nucleolar RNAs
- RNA refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when present in the same cell as the gene or target gene.
- the complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity.
- a siRNA or RNAi is a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA.
- the siRNA inhibits gene expression by interacting with a complementary cellular rnRNA thereby interfering with the expression of the complementary mRNA.
- the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length).
- the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
- a “saRNA,” or “small activating RNA” as provided herein refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to increase or activate expression of a gene or target gene when present in the same cell as the gene or target gene.
- the complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity.
- a saRNA is a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded saRNA.
- the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded saRNA is 15-50 nucleotides in length, and the double stranded saRNA is about 15-50 base pairs in length).
- the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
- isolated when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified.
- nucleic acid or protein gives rise to essentially one band in an electrophoretic gel.
- the nucleic acid or protein is at least 50% pure, optionally at least 65% pure, optionally at least 75% pure, optionally at least 85% pure, optionally at least 95% pure, and optionally at least 99% pure.
- isolated may also refer to a cell or sample cells.
- An isolated cell or sample cells are a single cell type that is substantially free of many of the components which normally accompany the cells when they are in their native state or when they are initially removed from their native state.
- an isolated cell sample retains those components from its natural state that are required to maintain the cell in a desired state.
- an isolated (e.g. purified, separated) cell or isolated cells are cells that are substantially the only cell type in a sample.
- a purified cell sample may contain at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of one type of cell.
- an isolated cell sample may be obtained through the use of a cell marker or a combination of cell markers, either of which is unique to one cell type in an unpurified cell sample.
- the cells are isolated through the use of a cell sorter.
- antibodies against cell proteins are used to isolate cells.
- conjugate refers to the association between atoms or molecules. The association can be direct or indirect.
- a conjugate between a nucleic acid (e.g., ribonucleic acid) and a compound moiety as provided herein can be direct, e.g., by covalent bond, or indirect, e.g., by non-covalent bond.
- conjugates are formed using conjugate chemistry including, but are not limited to nucleophilic substitutions (e.g., reactions of amines and alcohols with acyl halides, active esters), electrophilic substitutions (e.g., enamine reactions) and additions to carbon- carbon and carbon-heteroatom multiple bonds (e.g., Michael reaction, Diels-Alder addition).
- nucleophilic substitutions e.g., reactions of amines and alcohols with acyl halides, active esters
- electrophilic substitutions e.g., enamine reactions
- additions to carbon- carbon and carbon-heteroatom multiple bonds e.g., Michael reaction, Diels-Alder addition.
- the nucleic acid acids can be attached to a compound moiety through its backbone.
- the ribonucleic acid includes one or more reactive moieties, e.g., an amino acid reactive moiety, that facilitates the interaction of the ribonucleic acid with the compound moiety.
- Useful reactive moieties or functional groups used for conjugate chemistries herein include, for example: (a) carboxyl groups and various derivatives thereof including, but not limited to, Nhydroxysuccinimide esters, N-hydroxybenztriazole esters, acid halides, acyl imidazoles, thioesters, p-nitrophenyl esters, alkyl, alkenyl, alkynyl and aromatic esters; (b) hydroxyl groups which can be converted to esters, ethers, aldehydes, etc.
- halo alkyl groups wherein the halide can be later displaced with a nucleophilic group such as, for example, an amine, a carboxylate anion, thiol anion, carbanion, or an alkoxide ion, thereby resulting in the covalent attachment of a new group at the site of the halogen atom;
- dienophile groups which are capable of participating in Diels-Alder reactions such as, for example, maleimido groups;
- aldehyde or ketone groups such that subsequent derivatization is possible via formation of carbonyl derivatives such as, for example, imines, hydrazones, semicarbazones or oximes, or via such mechanisms as Grignard addition or alkyllithium addition;
- sulfonyl halide groups for subsequent reaction with amines, for example, to form sulfonamides;
- thiol groups which can be converted to disulfides, re
- alkenes which can undergo, for example, cycloadditions, acylation, Michael addition, etc
- epoxides which can react with, for example, amines and hydroxyl compounds
- phosphoramidites and other standard functional groups useful in nucleic acid synthesis (I) metal silicon oxide bonding; (m) metal bonding to reactive phosphorus groups (e.g. phosphines) to form, for example, phosphate diester bonds; and (n) sulfones, for example, vinyl sulfone.
- the reactive functional groups can be chosen such that they do not participate in, or interfere with, the chemical stability of the proteins described herein.
- the nucleic acids can include a vinyl sulfone or other reactive moiety.
- the nucleic acids can include a reactive moiety having the formula S-S-R.
- R can be, for example, a protecting group.
- R is hexanol.
- hexanol includes compounds with the formula C6H130H and includes, 1-hexanol, 2-hexanol, 3- hexanol, 2-methyl-1-pentanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 2-methyl-2- pentanol, 3-methyl-2-pentanol, 4-methyl-2-pentanol, 2-methyl-3-pentanol, 3-methyl-3- pentanol, 2,2-dimethyl-1-butanol, 2,3-dimethyl-1-butanol, 3,3-dimethyl-1-butanol, 2,3- dimethyl-2-butanol, 3,3-dimethyl-2-butanol, and 2-ethyl-1-butanol.
- R is 1- hexanol.
- the term "about” means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, the term “about” means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to +/- 10% of the specified value. In embodiments, about means the specified value.
- nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http://wW'.v.ncbi.
- sequences are then said to be “substantially identical.”
- This definition also refers to, or may be applied to, the compliment of a test sequence.
- the definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like.
- identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
- sequence comparisons typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence algorithm program parameters Preferably, default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J.
- a preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et ai, Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et ai, J. Mol. ⁇ / ⁇ / 215 :403-410 ( 1990), respectively.
- the named protein includes any of the protein's naturally occurring forms, variants or homologs (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- the protein is the protein as identified by its NCBI sequence reference.
- the protein is the protein as identified by its NCBI sequence reference, homolog or functional fragment thereof.
- tumor cell antigen refers to any protein, carbohydrate or other component that is abnormally expressed by a tumor cell or is expressed by a tumor cell with an abnormal structure.
- a tumor cell antigen may be expressed at the cell surface by tumor / cancer cells of the tumor / cancer concerned.
- a tumor cell antigen may optionally be capable of eliciting an immune response.
- a tumor cell antigen may be a protein, carbohydrate or other component that is normally expressed inside the cell, but is expressed at the cell surface or in/at the cell membrane of a tumor cell.
- the tumor cell antigen is mortalin.
- Mortalin is a heat-shock cognate protein involved in the control of cell proliferation, which may also act as a chaperone. It is a member of the heat shock protein 70 (HSP-70) family of proteins, which contains both heat-inducible and constitutively expressed members.
- HSP-70 heat shock protein 70
- HSP70 refers to the family of approximately 70 kilodalton heat shock proteins as well-known in the art.
- the HSP70 is mHSP70.
- mHSP70 as provided herein includes any of the mitochondrial HSP70 (mHSP70) protein naturally occurring forms, homologs or variants that maintain the activity of mHSP70 (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants or homologs have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- Mortalin may also be referred to herein as mHSP70, Stress-70 protein, CSA, GRP-75, GRP75, HEL-S-124m, HSPA9B, MOT, MOT2, MTHSP75 or PBP74.
- the mortalin is the protein as identified by the NCBI sequence reference NP_004125.3 Gl:24234688, homolog or functional fragment thereof. Overexpression of mortalin in cancer is linked to poor prognosis, e.g. see Bagatell and Whitesell., ol Cancer Ther August 2004 3; 1021 Therapeutic agents
- Anti-cancer agent is used in accordance with its plain ordinary meaning and refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having antineoplastic properties or the ability to inhibit the growth or proliferation of cells.
- an anti-cancer agent is a chemotherapeutic.
- an anti-cancer agent is an agent identified herein having utility in methods of treating cancer.
- an anti-cancer agent is an agent approved by the FDA or similar regulatory agency of a country other than the USA, for treating cancer. Examples of anti-cancer agents include, but are not limited to, MEK (e.g.MEKI , MEK2, or MEKI andMEK2) inhibitors (e.g.
- alkylating agents e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambucil,
- ethylenimine and methylmelamines e.g., hexamethlymelamine, thiotepa
- alkyl sulfonates e.g., busulfan
- nitrosoureas e.g., carmustine, lomusitne, semustine, streptozocin
- triazenes decarbazine
- anti-metabolites e.g., 5-azathioprine, leucovorin, capecitabine, fludarabine, gemcitabine, pemetrexed, raltitrexed, folic acid analog (e.g., methotrexate ), or pyrimidine analogs (e.g., fluorouracil, floxouridine, Cytarabine), purine analogs (e.g., mercaptopurine, thioguanine, pentostatin), etc.), plant alkaloids (e.g., vincristine, vinblastine,
- cisplatin oxaloplatin, carboplatin
- anthracenedione e.g., mitoxantrone
- substituted urea e.g., hydroxyurea
- methyl hydrazine derivative e.g., procarbazine
- adrenocortical suppressant e.g., mitotane, aminoglutethimide
- epipodophyllotoxins e.g., etoposide
- anti-cancer agents include, but are not limited to, antibiotics (e.g., daunorubicin, doxorubicin, bleomycin), enzymes (e.g., L-asparaginase), inhibitors of mitogen activated protein kinase signaling (e.g.
- antibiotics e.g., daunorubicin, doxorubicin, bleomycin
- enzymes e.g., L-asparaginase
- inhibitors of mitogen activated protein kinase signaling e.g.
- oligonucleotides oligonucleotides; apoptosis gene modulators; apoptosis regulators; arginine deaminase; BCR/ ABL antagonists; beta lactam derivatives; bFGF inhibitor; bicalutamide;
- camptothecin derivatives include casein kinase inhibitors (ICOS); clomifene analogues;
- etanidazole etoposide phosphate; exemestane; fadrozole; finasteride; fludarabine;
- fluorodaunorunicin hydrochloride gadolinium texaphyrin; gallium nitrate; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; immunostimulant peptides; insulin-like growth factor-l receptor inhibitor; interferon agonists; interferons; interleukins; letrozole; leukemia inhibiting factor; leukocyte alpha interferon;
- leuprolide+estrogen+progesterone leuprorelin
- matrilysin inhibitors matrix
- metalloproteinase inhibitors include MIF inhibitor; mifepristone; mismatched double stranded RNA; monoclonal antibody,; mycobacterial cell wall extract; nitric oxide modulators;
- oxaliplatin panomifene; pentrozole; phosphatase inhibitors; plasminogen activator inhibitor; platinum complex; platinum compounds; prednisone; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; ribozymes; signal transduction inhibitors; signal transduction modulators; single chain antigen-binding protein; stem cell inhibitor; stem-cell division inhibitors; stromelysin inhibitors; synthetic glycosaminoglycans; tamoxifen methiodide; telomerase inhibitors; thyroid stimulating hormone; translation inhibitors; tyrosine kinase inhibitors; urokinase receptor antagonists; steroids (e.g.,
- fluoxymesterone e.g., flutamide
- immunostimulants e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alpha-interferon, etc.
- monoclonal antibodies e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, and anti-VEGF monoclonal antibodies
- immunotoxins e.g., anti-CD33 monoclonal antibody- calicheamicin conjugate, anti-CD22 monoclonal antibody-pseudomonas exotoxin conjugate, etc.
- radioimmunotherapy e.g., anti-CD20 monoclonal antibody conjugated to 1 1n, 90Y, or 1311, etc.
- triptolide homoharringtonine, dactinomycin, doxorubicin, epirubicin, topotecan, itraconazole, vindesine, cerivastatin, vincristine,
- gefitinib IressaTM
- erlotinib TarcevaTM
- cetuximab ErbituxTM
- lapatinib TykerbTM
- panitumumab VectibixTM
- vandetanib CaprelsaTM
- afatinib/BIBW2992 CI-1033/canertinib, neratinib/HKI-272, CP-724714, TAK-285, AST- 1306, ARRY334543, ARRY-380, AG- 1478, dacomitinib/PF299804,OSI-420/desmethyl erlotinib, AZD8931 , AEE788, pelitinib/EKB-569, CUDC-101 , WZ8040, WZ4002, WZ3146, AG-490, XL647, PD-153035, BMS-599626), sorafenib, imatinib, sunitinib
- “Chemotherapeutic” or “chemotherapeutic agent” is used in accordance with its plain ordinary meaning and refers to a chemical composition or compound having
- antineoplastic properties or the ability to inhibit the growth or proliferation of cells.
- nucleic acid compound described herein can be co-administered with or covalently attached to conventional immunotherapeutic agents including, but not limited to, immunostimulants (e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alphainterferon, etc.), monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, anti-PD-1 and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti- CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody- pseudomonas exotoxin conjugate, etc.), and radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated to 1 11 In, 90 Y, or 1311, etc. ) .
- immunostimulants e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin
- nucleic acid compounds described herein can be coadministered with conventional radiotherapeutic agents including, but not limited to, radionucleotides such as 47 Sc, 64 Cu, 67 Cu, 89 Sr, 86 Y, 90 Y, 105 Rh, 111 Ag, 111 ln, 117m Sn, 149 Pm, 153 Sm, 166 Ho, 177 Lu, 186 Re, 211 At and 212 Bi, optionally conjugated to antibodies directed against tumor antigens.
- radionucleotides such as 47 Sc, 64 Cu, 67 Cu, 89 Sr, 86 Y, 90 Y, 105 Rh, 111 Ag, 111 ln, 117m Sn, 149 Pm, 153 Sm, 166 Ho, 177 Lu, 186 Re, 211 At and 212 Bi, optionally conjugated to antibodies directed against tumor antigens.
- sample includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histological purposes.
- samples include blood and blood fractions or products (e.g., bone marrow, serum, plasma, platelets, red blood cells, and the like), sputum, tissue, cultured cells (e.g., primary cultures, explants, and transformed cells), stool, urine, other biological fluids (e.g., prostatic fluid, gastric fluid, intestinal fluid, renal fluid, lung fluid, cerebrospinal fluid, and the like), etc.
- a sample is typically obtained from a "subject" such as a eukaryotic organism, most preferably a mammal such as a primate, e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish.
- a subject such as a eukaryotic organism, most preferably a mammal such as a primate, e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish.
- the sample is obtained from a human.
- a "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample.
- a test sample can be taken from a test condition, e.g., in the presence of a test compound, and compared to samples from known conditions, e.g., in the absence of the test compound (negative control), or in the presence of a known compound (positive control).
- a control can also represent an average value gathered from a number of tests or results.
- controls can be designed for assessment of any number of parameters. For example, a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of side effects).
- Controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant.
- Disease or “condition” refers to a state of being or health status of a patient or subject capable of being treated with a compound, pharmaceutical composition, or method provided herein.
- the disease is cancer.
- the cancer is non-pancreatic cancer.
- Non-pancreatic cancers are cancers that do not form in the tissues of the pancreas.
- the cancer is glioblastoma.
- the cancer is colorectal cancer.
- the cancer is liver, breast or prostate cancer.
- the cancer is poorly differentiated or undifferentiated cancer.
- the cancer is a metastatic or invasive cancer.
- the cancer is a metastatic or invasive non-pancreatic cancer. Poorly differentiated and Undifferentiated Cancer
- the cancer is a poorly differentiated, or undifferentiated cancer.
- These tumors may have abnormal looking cells and may lack normal tissue structures.
- the cells are very immature and "primitive" and do not look like cells in the tissue from which it arose.
- less differentiated cancer cells are more malignant than a cancer cell of that type which is more differentiated.
- Undifferentiated cells are said to be anaplastic.
- the cancer may be an undifferentiated metastatic cancer.
- Undifferentiated cancer cells do not have specialised (i.e. "mature") structures or functions. Such cancer cells often grow and spread quickly. Undifferentiated cancer cells often do not look like the cells in the tissue from which the cancer arose. As such, it can be difficult to categorise such cancers as a particular type of cancer, such as carcinoma, lymphoma or melanoma.
- Grading systems differ, depending on the type of cancer. In general, tumors are graded as 1 , 2, 3 or 4, depending on the amount of abnormality. In Grade 1 tumors, the tumor cells and the organisation of the tumor tissue appear close to normal. These tumors tend to grow and spread slowly. In contrast, the cells and tissue of Grade 3 and Grade 4 tumors do not look like normal cells and tissue. Grade 3 and Grade 4 tumors tend to grow rapidly and spread faster than tumors with a lower grade.
- G1 Well differentiated (low grade)
- G2 Moderately differentiated (intermediate grade)
- G4 Undifferentiated (high grade).
- the cancer is a high grade cancer, such as a poorly differentiated or undifferentiated cancer, or G3 or G4 cancer.
- the cancer is an undifferentiated cancer, or G4 cancer.
- the cancer is a malignant cancer.
- the cancer is high grade non-pancreatic cancer. That is, a cancer of non-pancreatic origin which is poorly differentiated or undifferentiated.
- the cancer may be a malignant non-pancreatic cancer.
- the cancer is selected from prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma.
- prostate cancer renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer
- breast cancer triple negative breast cancer
- glioblastoma ovarian cancer
- lung cancer squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma.
- squamous cell carcinoma e.g., head, neck, or esophagus
- cancer refers to all types of cancer, neoplasm or malignant tumors found in mammals, including leukemia, lymphoma, carcinomas and sarcomas.
- Exemplary cancers that may be treated with a compound, pharmaceutical composition, or method provided herein include lymphoma, sarcoma, bladder cancer, bone cancer, brain tumor, cervical cancer, colon cancer, esophageal cancer, gastric cancer, head and neck cancer, kidney cancer, myeloma, thyroid cancer, leukemia, prostate cancer, breast cancer (e.g.
- ER positive triple negative
- ER negative chemotherapy resistant
- herceptin resistant HER2 positive
- doxorubicin resistant tamoxifen resistant
- ductal carcinoma lobular carcinoma, primary, metastatic
- ovarian cancer pancreatic cancer
- liver cancer e.g., hepatocellular carcinoma
- lung cancer e.g.
- non-small cell lung carcinoma non-small cell lung carcinoma, squamous cell lung carcinoma, adenocarcinoma, large cell lung carcinoma, small cell lung carcinoma, carcinoid, sarcoma), glioblastoma multiforme, glioma, melanoma, prostate cancer, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma.
- squamous cell carcinoma e.g., head, neck, or esophagus
- colorectal cancer leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma.
- Additional examples include, cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head & neck, esophagus, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus or Medulloblastoma, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial
- leukemia refers broadly to progressive, malignant diseases of the blood forming organs and is generally characterized by a distorted proliferation and
- Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood-leukemic or a leukemic (subleukemic).
- Exemplary leukemias that may be treated with a compound, pharmaceutical composition, or method provided herein include, for example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute
- sarcoma generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance.
- Sarcomas that may be treated with a compound, pharmaceutical composition, or method provided herein include a
- chondrosarcoma chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, immunoblast
- leukosarcoma malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, or telangiectaltic sarcoma.
- melanoma is taken to mean a tumor arising from the melanocytic system of the skin and other organs. Melanomas that may be treated with a compound,
- compositions, or method provided herein include, for example, acral- lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma.
- carcinoma refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases.
- Exemplary carcinomas that may be treated with a compound, pharmaceutical composition, or method provided herein include, for example, medullary thyroid carcinoma, familial medullary thyroid carcinoma, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, ductal carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatin
- carcinoma carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tubular carcinoma, tuberous carcinoma, verrucous carcinoma, or carcinoma villosum.
- the terms “metastasis,” “metastatic,” and “metastatic cancer” can be used interchangeably and refer to the spread of a proliferative disease or disorder, e.g., cancer, from one organ or another non-adjacent organ or body part. Cancer occurs at an originating site, e.g., breast, which site is referred to as a primary tumor, e.g., primary breast cancer. Some cancer cells in the primary tumor or originating site acquire the ability to penetrate and infiltrate surrounding normal tissue in the local area and/or the ability to penetrate the walls of the lymphatic system or vascular system circulating through the system to other sites and tissues in the body.
- a second clinically detectable tumor formed from cancer cells of a primary tumor is referred to as a metastatic or secondary tumor.
- the metastatic tumor and its cells are presumed to be similar to those of the original tumor.
- the secondary tumor in the breast is referred to a metastatic lung cancer.
- metastatic cancer refers to a disease in which a subject has or had a primary tumor and has one or more secondary tumors.
- non-metastatic cancer or subjects with cancer that is not metastatic refers to diseases in which subjects have a primary tumor but not one or more secondary tumors.
- metastatic lung cancer refers to a disease in a subject with or with a history of a primary lung tumor and with one or more secondary tumors at a second location or multiple locations, e.g., in the breast.
- a disease e.g., diabetes, cancer (e.g. prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) or viral disease (e.g., HIV infection associated disease)) means that the disease (e.g., diabetes, cancer (e.g.
- prostate cancer renal cancer, metastatic cancer, melanoma, castration- resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) or viral disease (e.g., HIV infection associated disease)) is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
- squamous cell carcinoma e.g., head, neck, or esophagus
- colorectal cancer e.g., leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma
- viral disease e.g., HIV infection associated disease
- aberrant refers to different from normal. When used to describe enzymatic activity, aberrant refers to activity that is greater or less than a normal control or the average of normal non-diseased control samples. Aberrant activity may refer to an amount of activity that results in a disease, wherein returning the aberrant activity to a normal or non-disease-associated amount (e.g. by using a method as described herein), results in reduction of the disease or one or more disease symptoms. In some embodiments, the cancer is one in which mortalin expression is upregulated (overexpressed).
- Upregulation of expression comprises expression of mortalin a level that is greater than would normally be expected for a cell or tissue of a given type. Upregulation may be determined by measuring the level of expression mortalin in a cell or tissue.
- comparison may be made between the level of expression in a cell or tissue sample from a subject and a reference level of, e.g. a value or range of values representing a normal level of expression for the same or corresponding cell or tissue type.
- a reference level of e.g. a value or range of values representing a normal level of expression for the same or corresponding cell or tissue type.
- reference levels may be determined by detecting expression in a control sample, e.g. in corresponding cells or tissue from a healthy subject or from healthy tissue of the same subject. In some embodiments reference levels may be obtained from a standard curve or data set.
- Levels of expression may be quantitated for absolute comparison, or relative
- upregulation of expression may be considered to be present when the level of expression in the test sample is at least 1.1 times that of a reference level. More preferably, the level of expression may be selected from one of at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1 , at least 2.2, at least 2.3, at least 2.4 at least 2.5, at least 2.6, at least 2.7, at least 2.8, at least 2.9, at least 3.0, at least 3.5, at least 4.0, at least 5.0, at least 6.0, at least 7.0, at least 8.0, at least 9.0, or at least 10.0 times that of the reference level.
- Expression levels may be determined by one of a number of known in vitro assay techniques, such as PCR based assays, in situ hybridisation assays, flow cytometry assays, immunological or immunohistochemical assays.
- suitable techniques involve a method of detecting the level of mortalin in a sample by contacting the sample with an agent capable of binding mortalin and detecting the formation of a complex of the agent and mortalin.
- the agent may be any suitable binding molecule, e.g. an antibody, polypeptide, peptide, oligonucleotide, aptamer or small molecule, and may optionally be labelled to permit detection, e.g.
- Suitable labels and means for their detection are well known to those in the art and include fluorescent labels (e.g. fluorescein, rhodamine, eosine and NDB, green fluorescent protein (GFP), chelates of rare earths such as europium (Eu), terbium (Tb) and samarium (Sm), tetramethyl rhodamine, Texas Red, 4- methyl umbelliferone, 7-amino-4-methyl coumarin, Cy3, Cy5), isotope markers, radioisotopes (e.g. 32 P, 33 P, 35 S), chemiluminescence labels (e.g.
- acridinium ester e.g. peroxidase, alkaline phosphatase, glucose oxidase, beta-galactosidase, luciferase
- enzymes e.g. peroxidase, alkaline phosphatase, glucose oxidase, beta-galactosidase, luciferase
- antibodies e.g. antibodies to ligands and receptors.
- Detection techniques are well known to those of skill in the art and can be selected to correspond with the labelling agent. Suitable techniques include PCR amplification of oligonucleotide tags, mass spectrometry, detection of fluorescence or colour, e.g. upon enzymatic conversion of a substrate by a reporter protein, or detection of radioactivity.
- Assays may be configured to quantify the mortalin in a sample. Quantified amounts from a test sample may be compared with reference values, and the comparison used to determine whether the test sample contains an amount of mortalin that is higher or lower than that of the reference value to a selected degree of statistical significance. Quantification of detected mortalin may be used to determine up- or down-regulation or amplification of genes encoding mortalin.
- Contacting is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including biomolecules, or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated, however, that the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture. Contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be a nucleic acid compound as described herein and a cell (e.g., cancer cell).
- a cell e.g., cancer cell
- the aptamers provided herein, including embodiments thereof, are, inter alia, capable of binding cell surface target protein (and particularly binding cell surface mortalin) and internalizing into the cell.
- the compounds e.g., nucleic acid compounds
- the compounds may be used to deliver therapeutic or diagnostic molecules into a target molecule-expressing cancer cell.
- the therapeutic or diagnostic molecule may form part of the compound (e.g., nucleic acid compound) provided herein including
- the therapeutic or diagnostic molecule forms part (e.g., through covalent attachment) of the compound (e.g., nucleic acid compound) provided herein, including embodiments thereof, the therapeutic or diagnostic molecule is referred to as a
- compound moiety e.g., therapeutic moiety, imaging moiety
- the therapeutic or diagnostic molecule may not form part of the compound (e.g., nucleic acid compound) provided herein, including embodiments thereof, but may be independently internalized by a target molecule-expressing cell upon binding of a compound (e.g., nucleic acid compound) provided herein to the target molecule on said cell.
- the therapeutic or diagnostic molecule does not form part of the compound (e.g., nucleic acid compound) provided herein, the molecule is referred to as a "second compound.”
- the compounds (e.g., nucleic acid compounds) provided herein including embodiments thereof provide highly specific and efficient means for targeted cancer drug delivery and molecular imaging.
- nucleic acid sequence has at least 80% (80% or more) sequence identity to a given sequence
- the nucleic acid sequence may have 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to that sequence.
- the nucleic acid sequence has at least 80% (80% or more) sequence identity to a nucleic acid that hybridizes to a given sequence.
- nucleic acid sequence of a mono-specific aptamer or region of a bi- specific aptamer capable of binding one of the two target molecules is less than 100 (99 or less) nucleotides in length.
- two nucleic acid sequences may be present, each nucleic acid sequence having a length as described herein.
- the length calculation may optionally exclude nucleotides or carbon moieties of any spacer, linker or sticky bridge that forms part of the nucleic acid molecule.
- the length calculation may also optionally exclude any compound moiety conjugated to the nucleic acid, e.g. any nucleic acid moiety such as siRNA, saRNA, miRNA etc.
- nucleic sequence is less than 100 (99 or less) nucleotides in length
- sequence is one of 99, 98, 97, 96, 95, 94, 93, 92, 91 , 90, 89, 88, 87, 86, 85, 84, 83, 82, 81 , 80, 79, 78, 77, 76, 75, 74, 73, 72, 71 , 70, 69, 68, 67, 66, 65, 64, 63, 62, 61 , 60, 59, 58, 57, 56, 55, 54, 53, 52, 51 , 50, 49, 48, 47, 46, 45, 44, 43, 42, 41 , 40, 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , or 20 nucleotides in length.
- the nucleic acid sequence is less than 90 nucleotides in length. In embodiments, the nucleic acid sequence is less than 80 nucleotides in length. In embodiments, the nucleic acid sequence is less than 70 nucleotides in length. In embodiments, the nucleic acid sequence is less than 60 nucleotides in length. In embodiments, the nucleic acid sequence is less than 50 nucleotides in length. In embodiments, the nucleic acid sequence is less than 40 nucleotides in length. However, in some embodiments, the nucleic acid sequence is at least 29 nucleotides in length.
- the nucleic acid sequence is between 20 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 25 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 30 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 35 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 40 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 45 and 99 nucleotides in length
- the nucleic acid sequence is between 50 and 99 nucleotides in length
- the nucleic acid sequence is between 55 and 99 nucleotides in length
- the nucleic acid sequence is between 60 and 99 nucleotides in length
- the nucleic acid sequence is between 65 and 99 nucleotides in length
- the nucleic acid sequence is between 70 and 99 nucleotides in length
- the nucleic acid sequence is between 75 and 99 nucleotides in length
- the nucleic acid sequence is between 80 and 99 nucleotides in length
- the nucleic acid sequence is between 85 and 99 nucleotides in length In particular embodiments, the nucleic acid sequence is between 29 and 99 nucleotides in length.
- the nucleic acid compound provided herein may be internalized by the cell.
- the term "internalized,” “internalizing,” or “internalization” as provided herein refers to a composition (e.g., a compound, a nucleic acid compound, a therapeutic agent, an imaging agent) being drawn into the cytoplasm of the cell (e.g. after being engulfed by a cell membrane).
- the cell is a malignant cell.
- the cell is a breast cancer cell.
- the cell is a prostate cancer cell.
- the cell is a liver cancer cell.
- the cell is a non-pancreatic cancer cell.
- the cell is a lung cancer cell.
- the cell is a leukemia cell.
- the cell is a non-malignant cell.
- the aptamer is a deoxyribonucleic acid. In some preferred embodiments the aptamer may be a ribonucleic acid. The aptamer may be single stranded. Aptamers may contain one or more bases that are chemically modified. In some embodiments, each base of a given type (e.g. A, T, C, G) may contain the same chemical modification.
- Aptamers may contain one or more nucleotides that are chemically modified at the 2' position of ribose.
- each ribose contains the same chemical modification.
- the ribose of certain nucleotides e.g. A, T, C, G
- modifications may include O-methyl modification (2'-OMe), Fluoride modification (2'-F) or amine modification (2-NH 2 ).
- the nucleic acid compound provided herein may include a compound moiety.
- the compound moiety may be covalently (e.g. directly or through a covalently bonded intermediary) attached to the nucleic acid sequence (see, e.g., useful reactive moieties or functional groups used for conjugate chemistries set forth above).
- the nucleic acid compound further includes a compound moiety covalently attached to the nucleic acid sequence.
- the compound moiety and the nucleic acid sequence form a conjugate.
- the compound moiety is non-covalently (e.g.
- the compound moiety is a therapeutic moiety or an imaging moiety.
- the therapeutic moiety is covalently attached to the nucleic acid sequence.
- the imaging moiety is covalently attached to the nucleic acid sequence.
- Therapeutic moieties as provided herein may include, without limitation, peptides, proteins, nucleic acids, nucleic acid analogs, small molecules, antibodies, enzymes, prodrugs, cytotoxic agents (e.g. toxins) including, but not limited to ricin, doxorubicin, daunorubicin, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxy anthracin dione, actinomycin D, diphteria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, and glucocorticoid.
- cytotoxic agents e.g. toxins
- ricin doxorubicin, daunorubicin, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, di
- the therapeutic moiety is an anti-cancer agent or chemotherapeutic agent as described herein.
- the therapeutic moiety is a nucleic acid moiety, a peptide moiety or a small molecule drug moiety.
- the therapeutic moiety is a nucleic acid moiety.
- the therapeutic moiety is a peptide moiety.
- the therapeutic moiety is a small molecule drug moiety.
- the therapeutic moiety is a nuclease.
- the therapeutic moiety is an immunostimulator.
- the therapeutic moiety is a toxin.
- the therapeutic moiety is a nuclease.
- the therapeutic moiety is a zinc finger nuclease. In embodiments, the therapeutic moiety is a transcription activator-like effector nuclease. In embodiments, the therapeutic moiety is Cas9. In embodiments, the therapeutic moiety is gemcitabine or a reactive fragment thereof. "Gemcitabine” as provided herein refers to the chemical compound 4-amino-1-(2-deoxy-2,2-difluoro-13-D- erythropentofuranosyl) pyrimidin-2(1 H)-on. In a customary sense gemcitabine refers to CAS Registry No. 95058-81-4. In embodiments, the therapeutic moiety is an activating nucleic acid moiety (a
- an activating nucleic acid refers to a nucleic acid capable of detectably increasing the expression or activity of a given gene or protein.
- the activating nucleic acid can increase expression or activity 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control in the absence of the activating nucleic acid.
- expression or activity is 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or higher than the expression or activity in the absence of the activating nucleic acid.
- the therapeutic moiety is an miRNA moiety (a monovalent compound including a miRNA), an mRNA moiety (a monovalent compound including an mRNA), an siRNA moiety (a monovalent compound including an siRNA) or an saRNA moiety (a monovalent compound including an saRNA).
- the therapeutic moiety is a miRNA moiety.
- miRNA is used in accordance with its plain ordinary meaning and refers to a small non-coding RNA molecule capable of post-transcriptionally regulating gene expression.
- a miRNA is a nucleic acid that has substantial or complete identity to a target gene.
- the miRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA.
- the miRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the miRNA is 15-50 nucleotides in length, and the miRNA is about 15-50 base pairs in length).
- the length is 20-30 base nucleotides, preferably about 20-25 or about 24- 29 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
- the therapeutic moiety is a siRNA moiety or saRNA moiety as described herein.
- the therapeutic moiety is an anti-cancer agent moiety. In embodiments, the therapeutic moiety is an mRNA moiety. In embodiments, the therapeutic moiety is a siRNA moiety. In embodiments, the therapeutic moiety is a saRNA moiety. In embodiments, the therapeutic moiety is a cDNA moiety. In embodiments, the therapeutic moiety is a C/EBPalpha saRNA moiety.
- a "C/EBPalpha saRNA" as provided herein is a saRNA capable of activating the expression of a C/EBPalpha protein. In embodiments, the therapeutic moiety is a HSP70 siRNA moiety.
- the compound moiety provided herein may be an imaging moiety.
- An "imaging moiety” as provided herein is a monovalent compound detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. In embodiments, the imaging moiety is covalently attached to the RNA sequence.
- imaging moieties are without limitation 32P, radionuclides, positron-emitting isotopes, fluorescent dyes, fluorophores, antibodies, bioluminescent molecules, chemoluminescent molecules, photoactive molecules, metals, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), magnetic contrast agents, quantum dots, nanoparticles, biotin, digoxigenin, haptens and proteins or other entities which can be made detectable, e.g., by incorporating a radiolabel into a peptide or antibody specifically reactive with a target peptide.
- any method known in the art for conjugating an antibody to the moiety may be employed, e.g., using methods described in Hermanson, Bioconjugate Techniques 1996, Academic Press, Inc., San Diego.
- Exemplary fluorophores include fluorescein, rhodamine, GFP, coumarin, FITC, Alexa fluor, Cy3, Cy5, BODIPY, and cyanine dyes.
- Exemplary radionuclides include Fluorine-18, Gallium-68, and Copper-64.
- Exemplary magnetic contrast agents include gadolinium, iron oxide and iron platinum, and manganese.
- the imaging moiety is a bioluminescent molecule.
- the imaging moiety is a photoactive molecule.
- the imaging moiety is a metal. In embodiments, the imaging moiety is a nanoparticle.
- the compound (e.g., nucleic acid compound) provided herein may include a ligand moiety.
- a "mortalin ligand moiety" as used herein refers to a monovalent compound (e.g. substituent) capable of binding (interacting) to mortalin, as described herein. The binding may be specific relative to other cell surface proteins.
- ligand moiety is a nucleic acid moiety, a peptide moiety or a small molecule moiety (e.g. a small molecule drug moiety). In embodiments, the ligand moiety forms part of the RNA sequence.
- Cell surface refers to a protein expressed (e.g. present) on the surface of a cell (i.e. on the cell membrane accessible to the extracellular space).
- the cellular receptor is expressed (e.g. present) on a cancer cell (i.e. on the cancer cell membrane accessible to the extracellular space).
- the cancer cell is a non-pancreatic cancer cell and/or a poorly differentiated or undifferentiated cancer cell.
- the cancer cell is a glioblastoma cell.
- the cancer cell is a liver cancer cell.
- the cancer cell is a prostate cancer cell.
- the cancer cell is a breast cancer cell. In embodiments, the cancer cell is a leukemia cell.
- compositions of the compounds may include compositions having a therapeutic moiety contained in a
- therapeutically effective amount i.e., in an amount effective to achieve its intended purpose.
- compositions of the compounds may include compositions having imaging moieties contained in an effective amount, i.e., in an amount effective to achieve its intended purpose.
- the actual amount effective for a particular application will depend, inter alia, on the condition being treated, tested, detected, or diagnosed.
- compositions When administered in methods to treat a disease, such compositions will contain an amount of active ingredient effective to achieve the desired result, e.g., modulating the activity of a target molecule, and/or reducing, eliminating, or slowing the progression of disease symptoms. Determination of a therapeutically effective amount of a therapeutic moiety provided herein is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure herein.
- compositions When administered in methods to diagnose or detect a disease, such compositions will contain an amount of an imaging moiety described herein effective to achieve the desired result, e.g., detecting the absence or presence of a target molecule, cell, or tumor in a subject. Determination of a detectable amount of an imaging moiety provided herein is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure herein.
- the dosage and frequency (single or multiple doses) administered to a mammal can vary depending upon a variety of factors, for example, whether the mammal suffers from another disease, and its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems.
- Other therapeutic regimens or agents can be used in conjunction with the methods and compositions described herein including embodiments thereof. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art.
- composition e.g., the nucleic acid compounds provided, combinations of an anticancer agent and the nucleic acid compound provided
- the nucleic acid compounds provided e.g., the nucleic acid compounds provided, combinations of an anticancer agent and the nucleic acid compound provided
- therapeutically effective amount can be initially determined from cell culture assays.
- Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art.
- effective amounts for use in humans can also be determined from animal models.
- a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals.
- the dosage in humans can be adjusted by monitoring effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.
- a pharmaceutical formulation including the nucleic acid compound as provided herein including embodiments thereof and a pharmaceutically acceptable excipient is provided.
- the ribonucleic acid includes a compound moiety covalently attached to the nucleic acid sequence.
- the compound moiety may be a therapeutic moiety or an imaging moiety covalently attached to the nucleic acid sequence.
- the pharmaceutical formulation includes the nucleic acid compound as provided herein including embodiments thereof and a therapeutic agent.
- the nucleic acid compound and the therapeutic agent are not covalently attached.
- a therapeutic agent as provided herein refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having a therapeutic effect.
- the therapeutic agent is an anti-cancer agent.
- the pharmaceutical formulation includes a pharmaceutically acceptable excipient.
- “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions provided herein without causing a significant adverse toxicological effect on the patient.
- Non-limiting examples of pharmaceutically acceptable excipients include water, NaCI, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylase or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like.
- Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds provided herein.
- auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds provided herein.
- auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds provided herein.
- compositions provided herein refers to pharmaceutically acceptable salts derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like.
- preparation is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
- carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
- cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.
- the pharmaceutical preparation is optionally in unit dosage form.
- the preparation is subdivided into unit doses containing appropriate quantities of the active component.
- the unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules.
- the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.
- the unit dosage form can be of a frozen dispersion.
- a method of delivering a compound into a cell includes contacting a cell surface target molecule with a compound including a nucleic acid sequence capable of binding to the target molecule.
- the compound is allowed to pass into the cell thereby delivering the compound into the cell.
- the passage into the cell may be facilitated
- a "cell surface target molecule” refers to a protein expressed (i.e. presents) on the surface of a cell (i.e. on the cell membrane accessible to the extracellular space), to which a nucleic acid compound described herein is designed bind.
- a cell surface target molecule is a tumor cell antigen.
- the cell surface target molecule is present on a cell surface.
- the target molecule forms part of a cellular vesicle upon passage into the cell.
- nucleic acid compounds provided herein including embodiments thereof may be used to deliver compound moieties or compounds (e.g., therapeutic agents or imaging agents) into a cell.
- a compound moiety e.g., therapeutic moiety or imaging moiety
- the compound moiety may be covalently attached to the nucleic acid compound (RNA sequence) provided herein including embodiments thereof.
- RNA sequence nucleic acid compound
- a method of delivering a compound moiety into a cell includes, (i) contacting a cell with the nucleic acid compound as provided herein including
- nucleic acid compound binds to a ligand on the cell and pass into the cell thereby delivering the compound moiety into the cell.
- the compound e.g., a therapeutic agent or an imaging agent
- the nucleic acid compound may not be covalently attached to the nucleic acid compound (nucleic acid sequence).
- the nucleic acid compound and the compound provided are internalized by the cell without being covalently attached to each other.
- a method of delivering a compound into a cell includes (i) contacting a cell with a compound and the nucleic acid compound as provided herein including embodiments thereof and (ii) allowing the nucleic acid compound to bind to a target molecule on the cell and the compound to pass into the cell thereby delivering the compound into the cell.
- the compound is a therapeutic agent or imaging agent.
- the compound is non-covalently attached to the nucleic acid compound.
- the compound includes a therapeutic agent or an imaging agent.
- the compound is a therapeutic agent or an imaging agent.
- the therapeutic agent is an antibody, a peptide, a nucleic acid or a small molecule (e.g. a drug).
- the imaging agent is a bioluminescent molecule, a photoactive molecule, a metal or a nanoparticle.
- the compound is an antibody, a peptide, a nucleic acid or a small molecule.
- the compound is an antibody.
- the compound is a nucleic acid compound as provided herein including embodiments thereof.
- the method includes detecting the nucleic acid compound in the cell thereby detecting the cell.
- treatment or “treating,” or “palliating” or “ameliorating” are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit.
- therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated.
- a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the underlying disorder.
- the compositions may be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.
- Treatment includes preventing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition prior to the induction of the disease; suppressing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition after the inductive event but prior to the clinical appearance or reappearance of the disease; inhibiting the disease, that is, arresting the development of clinical symptoms by administration of a protective composition after their initial appearance; preventing re-occurring of the disease and/or relieving the disease, that is, causing the regression of clinical symptoms by
- cancer e.g. non-pancreatic cancer and/or poorly
- differentiated or undifferentiated cancer such as prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma).
- certain methods herein treat cancer by decreasing or reducing or preventing the occurrence, growth, metastasis, or progression of cancer; or treat cancer by decreasing a symptom of cancer.
- Symptoms of cancer e.g.
- non-pancreatic cancer and/or poorly differentiated or undifferentiated cancer such as prostate cancer, renal cancer, metastatic cancer, melanoma, castration- resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) would be known or may be determined by a person of ordinary skill in the art.
- squamous cell carcinoma e.g., head, neck, or esophagus
- colorectal cancer e.g., leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma
- agents i.e. nucleic acid compounds
- the agents described herein may be administered in combination as simple mixtures as well as chemical hybrids.
- An example of the latter is where the agent is covalently linked to a targeting carrier or to an active pharmaceutical.
- Covalent binding can be accomplished in many ways, such as, though not limited to, the use of a commercially available cross-linking agent.
- An "effective amount" is an amount sufficient to accomplish a stated purpose (e.g.
- an "effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a "therapeutically effective amount.”
- a “reduction” of a symptom or symptoms means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s ).
- a “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms.
- the full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations.
- An “activity decreasing amount,” as used herein, refers to an amount of antagonist required to decrease the activity of an enzyme or protein relative to the absence of the antagonist.
- a “function disrupting amount,” as used herein, refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist.
- Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. For example, for the given parameter, an effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Efficacy can also be expressed as "-fold" increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.
- Patient or “subject in need thereof refers to a living organism suffering from or prone to a disease or condition that can be treated by using the methods provided herein.
- the term does not necessarily indicate that the subject has been diagnosed with a particular disease, but typically refers to an individual under medical supervision.
- Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals.
- a patient is human.
- administering means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow- release device, e.g., a mini-osmotic pump, to a subject.
- Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal).
- administration of the aptamer is intravenous.
- Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial.
- Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
- co-administer it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies, for example cancer therapies such as chemotherapy, hormonal therapy, radiotherapy, or immunotherapy.
- the compounds can be administered alone or can be coadministered to the patient.
- Coadministration is meant to include simultaneous or sequential administration of the compounds individually or in combination (more than one compound).
- compositions can also be combined, when desired, with other active substances (e.g. to reduce metabolic degradation).
- the compositions can be delivered by transdermal ⁇ , by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
- an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient.
- This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.
- a method of treating cancer includes administering to a subject in need thereof an effective amount of the nucleic acid compound as provided herein (including embodiments thereof).
- the nucleic acid compound further includes an anti-cancer therapeutic moiety.
- a method of treating cancer includes administering to a subject in need thereof an effective amount of an anti-cancer agent and a nucleic acid compound as provided herein including embodiments thereof.
- the nucleic acid compositions provided herein may also be used for the delivery of compounds and compound moieties to a cell expressing a target molecule (i.e. mortalin).
- the compounds and compound moieties delivered may be imaging agents useful for cell detections.
- a method of detecting a cell includes (i) contacting a cell with the nucleic acid compound as provided herein including embodiments thereof, wherein the nucleic acid compound further includes an imaging moiety, (ii) the nucleic acid compound is allowed to bind to the target molecule on the cell and pass into the cell, (iii) the imaging moiety is detected thereby detecting the cell.
- a method of detecting a cell is provided.
- the method includes (i) contacting a cell with an imaging agent and the nucleic acid compound as provided herein including embodiments thereof, (ii) The nucleic acid compound is allowed to bind to the target molecule on the cell and the imaging agent is allowed to pass into the cell. (iii) The imaging agent is detected thereby detecting the cell.
- the cell is a malignant cell. In embodiments, the cell is a breast cancer cell. In embodiments, the cell is a prostate cancer cell. In embodiments, the cell is a liver cancer cell. In embodiments, the cell is a non-pancreatic cancer cell. In embodiments, the cell is a non-malignant cell. In embodiments, the cell forms part of an organism. In embodiments, the organism is a mammal. In embodiments, the cell forms part of a cell culture.
- in vitro is intended to encompass experiments with materials, biological substances, cells and/or tissues in laboratory conditions or in culture whereas the term “in vivo” is intended to encompass experiments and procedures with intact multi-cellular organisms.
- FIGS 1 A to 1G Aptamer secondary structure and cancer cell-specific
- FIG. 1A The secondary structures of P19 and P1 , selected from randomized N40 RNA libraries, were predicted using the Mfold software.
- Figure 1 B Cy3-labeled P19 and P1 aptamers were assessed for binding efficiency by flow cytometry in PANC-1 and control Huh7 cells. The data show the measurements of positively stained cells and representative of triplicates.
- Figure 1C The pancreatic cell lines PANC-1 , AsPC-1 , MIA PaCa and Capan-1 were treated with 100 nM of the Cy3-labeled P19 and P1 aptamer and analysed by confocal microscopy. All of the pancreatic lines showed punctate regions of Cy3 labeling.
- Non pancreatic lines including Huh7, HepG2, MCF7 and PC3 cells were also treated with 100nM of Cy3-labeled P19 and P1 aptamers. No Cy3 signal was observed.
- Figure 1 D Normal primary pancreatic cells were treated with 100nM Cy3-labeled aptamers and imaged by confocal microscopy.
- Figure 1 E Flow cytometry analysis of normal T and B cells treated with Cy3- labeled P19 and P1 aptamers.
- Figures 1 F and 1G The dissociation constant (KD) was measured by flow cytometry using increasing concentrations of Cy3-labeled aptamers (from 15.6 to 500 nM).
- Mean fluorescence intensity (MFI) was measured and calculated using a one-site binding model for non-linear regression.
- Figure 2 P19 Aptamer internalisation into Glioblastoma line U251. Nucleus and tP19 are dye labelled.
- Figures 3A to 3D Target identification for P19.
- Figure 3A PANC-1 cells were incubated with fluorescently labeled P19 RNA (200nM) and increasing amounts (1 uM) of unlabelled each clone aptamers as competitors against the labeled RNA. The
- Figures 5A to 5C Cell proliferation assays. Cell proliferation was assessed after 72 hours of exposure to tP19 (control, triangles) or tP19-MMAE (circles) in ( Figure 5A)
- PANC-1 pancreatic cancer cells (Figure 5B) U251 undifferentiated glioblastoma cells, and (C) HCT1 16 undifferentiated colon cancer cells.
- FIG. 6 Internalisation of P1 , P19 and tP19 into mortalin positive glioblastoma (U251-MG) and colon cancer [colorectal carcinoma (HCT116)] cells.
- U251-MG and HCT1 16 cells were treated with 200 nM of Cy3-labeled P1 , P19, and tP19 aptamers and analyzed by live-cell confocal microscopy for internalization.
- the punctuate regions of Cy3 labeling indicate cross-activity of the pancreatic-targeting aptamers in glioblastoma and colorectal carcinoma cells.
- Scale bar 10 ⁇
- Figures 7A to 7C Validation of interaction of aptamer with mortalin.
- Figures 7A and 7B Charts showing biosensor analysis of the mortalin-aptamer interaction. Binding of mortalin to P19 and P1 is shown. Biotinylated P19 or P1 was bound to a streptavidin- coupled carboxyl methyl dextran surface and binding was measured using the surface plasmon resonance (SPR) technique. The increase in response units (RUs) from the baseline was measured.
- Figure 7C Photograph of a gel shift assay of the mortalin- aptamer interaction. The shifted band represents binding of mortalin to P1 or P19.
- Pancreatic ductal adenocarcinoma is the fourth most common cause of cancer death in the United states, accounting for 30,000 deaths yearly in the US (Jemal et al, 2009, CA Cancer J. Clin 59: 225-249).
- gemcitabine achieves an improved 1 year survival rate from 16 to 19%.
- the limited success of conventional treatments is due to the profound resistance of PDAC cells towards anti-cancer drugs emerging from the efficient protection against chemotherapeutic drugs (Wong et al., (2009) Nat Rev Gastroenterol Hepatol 6: 412-422). It is therefore imperative to develop new therapeutic strategies for this devastating disease.
- RNA aptamers For comparison of individual sequences and structures, two different groups of aptamers were selected. P19 and P1 showed multi-stem loops and the structural similarity containing a common motif, GAAUGCCC (SEQ ID NO: 8). Minimum energy structural analyses of the selected aptamers were carried out using Mfold30. As depicted, the calculated secondary structures of the RNA aptamers contained several stem-loop regions (Fig. 1a). Pancreatic cancer internalization of RNA aptamers
- RNA aptamers were internalized in target cells Panc-1 , but not control cells (Fig. 1 c).
- Figure 1 C showed the aptamers aggregated within the cytoplasm, suggesting that the RNA aptamers enter into cells via receptor- mediated endocytosis.
- pancreatic cancer cell line cells were tested for aptamer uptake.
- Fig. 1c All of the tested aptamers are internalized in the different pancreatic cancer cells.
- Fig. 1c In order to determine the selected aptamers binds to the normal pancreatic cell primary epithelial pancreatic cancer cells were incubated with Cy3 labeled aptamers. The aptamers didn't get internalized in the pancreatic epithelial normal cells (Fig.1 d), indicating that the RNA aptamers bound to and were internalized in cancer cells specifically.
- Cy3 labeled P1 and P19 were tested on human pancreatic cancer and normal pancreas tissue specimens by histopathology.
- P1 and P19 recognize cancer specifically. There is almost no or only scanty P1 or P19 positive staining noted in non-tumor part of pancreas and breast cancer specimen as control. As cell binding assays showed, both P19 and P1 recognized pancreatic cancer tissues specifically, not normal pancreas tissues. The representative images showed in Figure 1e. The measured binding affinity (Kd) of P19 was 13.07nM. P1 was 2.2 nM (Fig. 1g). In cancer tissue staining histopathologically, both the P1 and P19 present in cytoplasm and the correlation coefficient between aptamer scores of P1 and P19 is 0.891 (Fig. 1f)- Other normal tissues such as liver, spleen, and kidney etc showed negative staining including T and B cells (Fig. 2a and b). The internalization assays were screened in other type of cancers.
- the P19 was truncated to the size of 28mer including the common motif based on the expected structure by Mfold (tP19, SEQ ID NO: 1).
- the Kd value of truncated P19 was 8.77nM.
- the minimized P19 got internalized into Panc-1 and AsPC-1 cells in the same way of full length of P19.
- Cell binding assays was screened in other types of cancers like liver, breast and prostate cancers.
- the truncated P19 showed negative reaction, indicating that it is pancreatic cancer specific RNA aptamers. Taken together, these results show that the P1 and P19 recognize pancreatic cancer cells.
- Panc-1 cells were incubated with fluorescently labeled P19 RNA (200 nM) and increasing amounts (1 ⁇ ) of unlabeled each clone aptamers as competitors against the labeled one (Fig. 3a).
- the fluorescence intensity of labeled RNAs was measured in the presence of increasing amounts of competitors using confocal microscopy.
- the intensity of P19 competed with unlabeled P19 was significantly decreased; others showed insignificant changes, indicating that each RNA aptamer has the different binding sites or bind the different targets.
- cell membrane proteins were retrieved by biotinylated aptamers.
- the retrieved proteins were run in SDS-PAGE gel. P19 and P1 showed the band sized around 75 kDa (Fig. 3b).
- the aptamer captured proteins were analyzed by MASS-SPEC for peptide matching fingerprinting.
- mitochondrial Hsp70 which is mortalin was identified (Fig. 3c and d).
- gel shift assays and surface plasmon resonance (SPR) assays were used. In gel shift assays, the shifted band was observed in both P19 and P1 (Fig. 3c and d). As shown in SPR sensogram, P1 and P19 bound to the mortalin.
- mitochondrial Hsp70 was identified as the target ligands of the P19 and P1 , even though the further research is necessary to figure out whether the common motif is the binding site against the target protein.
- Example 2 Determining the effect of anti-HSP70 RNA aptamers in mitochondrial apoptosis
- Hsp70 is constitutively expressed on cell surface of human tumor, not normal cells (Hantschel, Pfister et al. 2000, Shin, Wang et al. 2003).
- the translocalization of Hsp70 on the cancer cell surface and organelle distribution is related to their specific lipid compositions (Arispe, Doh et al. 2004, Gehrmann, Liebisch et al. 2008, Mahalka, Kirkegaard et al. 2014).
- silencing of Hsp70 with antisense results in massive death of cancer cells, whereas non-cancer cells are not affected (Nylandsted, Rohde et al. 2000).
- Hsp70 Inhibition of Hsp70 is independent of classical apoptosis pathway such as Bcl- 2 and Bcl-XL(Nylandsted, Rohde et al. 2000). Its high expression in tumors correlates with therapy resistance and poor prognosis (Sliutz, Karlseder et al. 1996, Elpek, Karaveli et al. 2003). Hsp70 promotes chemoresistance by blocking Bax mitochondrial translocation, pro-apoptotic protein of the mitochondria apoptosis (Yang, Wang et al. 2012) . Hsp70 indirectly blocks apoptotic pathways at premitochondrial and mitochondrial level, and a post-mitochondrial stage (Garrido, Brunei et al.
- Hsp70 also protects mitochondrial from damage by oxidative stress (Polla, Kantengwa et al. 1996). Hsp70 plays important role in the assembly of the cytochrome c oxidase, mitochondria transmembrane protein (Bottinger, Guiard et al.2013).
- mitochondria are gatekeeper of response to chemotherapy and good target to reduce chemoresistance.
- the most differentially expressed mitochondrial proteins between normal and cancerous cells are cytochrome oxidase and hsp70 (Chen, Chou et al. 2011 , Bottoni, Giardina et al. 2012).
- Mitochondria is the cellular powerhouses, primary source of energy. Because cancer cells are demanding high energy, they are much more dependent to mitochondria than normal cells.
- Peptide targeting hsp70 is sensitizing to apoptotic cell death (Rerole, Gobbo et al. 201 1).
- the aptamer binding ligands expressed on cell surface were identified tumor associated Hsp70. It is necessary to inhibit hsp70 function to induce mitochondria apoptosis affecting cancer cells specifically and to diminish chemoresistance.
- To test chemoresistant tumor regression in mice twelve 5-weeks-old female
- NOD/SCID mice were injected subcutaneously (S.C.) on the flank with 2.8x106 ASPC-1 gemcitabine resistant pancreatic cancer cells in 0.05 ml PBS with 0.15 ml matrigel. After 3 weeks, mice were divided into four groups. One group served as untreated controls and the others injected with P1 , P19 and P1 combined with P19. Aptamer were injected through tail vein. Animals were injected 4 times at days 1 , 3, 5, and 7, and were sacrificed at day 9. Comparing control, significant tumor growth inhibition showed in aptamer treated group (Figure 4).
- oligomycine positive control
- anti- hsp70 RNA aptamer test material
- rotenone XF Cell Mi to Stress kit, Seahorse Bioscience
- ECAR extracellular acidification rate
- lactate production cells will be plated in base assay.
- Glucose, oligomycin, anti-hsp70 RNA aptamer, and 2-deoxy-glucose will be sequentially injected (XF
- OXPHOS suppression cells increase their glucose uptake and glycolysis activity to maintain the intracellular level of ATP.
- the components of glycolysis and OXPHOS in the bioenergetic constitution will be calculated.
- an indicator of metabolically active cells CellTiter Glo luminescent cell viability assays will be used following manufacture's instruction (Promega). Cytochrome C (COX) activity is assayed calorimetrically.
- Panc-1 was cultured from a 56-year-old male with an adenocarcinoma in the head of the pancreas which invaded the duodenal wall. Metastases in one peripancreatic lymph node were discovered during a pancreaticoduodenectomy. It has poor differentiation.
- AsPC-1 was obtained from a 62-year-old woman with adenocarcinoma of the head of the pancreas and metastases to several abdominal organs. It has poor differentiation.
- MIA PaCa is an established cell line from an undifferentiated human pancreatic carcinoma. The tumour was taken from a 65 year old Caucasian male. It has poor differentiation.
- Capan-1 was obtained from a liver metastasis of a 40-year-old male with a pancreas adenocarcinoma in the head of the pancreas.
- HuH-7 is a well differentiated hepatocyte derived cellular carcinoma cell line that was originally taken from a liver tumor in a 57-year-old Japanese male in 1982.
- Hep G2 is a perpetual cell line which was derived from the liver tissue of a 15-year-old Caucasian American male with a well-differentiated hepatocellular carcinoma.
- MCF7 is a breast cancer cell line isolated in 1970 from a 69-year-old Caucasian woman. This cell line retained several characteristics of differentiated mammary epithelium, including the ability to process estradiol via cytoplasmic estrogen receptors and the capability of forming clones.
- PC3 cell lines were established in 1979 from bone metastasis of grade IV prostate cancer in a 62-year-old Caucasian male. Although originally considered to show characteristics of poorly-differentiated adenocarcinoma, Tai et al (2012) recognized that PC3 cells were instead characteristic of prostatic SCNCs.
- U251 cells which are an undifferentiated glioblastoma cell line derived from a malignant glioblastoma tumour by explant technique (Lorenzi et al (2009)), and which are known to overexpress mortalin (Takano et al., 1997), and HCT1 16 colorectal carcinoma cells, also known to overexpress mortalin (Wu et al, 2013).
- aptamers P1 , P19, and tP19 internalized in Glioblastoma cell line U251 , confirming that mortalin binding aptamers could target, and be internalised by, undifferentiated non-pancreatic cancer cells, in addition to pancreatic cancer cells.
- Example 4 C/EBPa-conjugated P19 and P1 demonstrate strong anti-proliferation in undifferentiated cancer cells as well as pancreatic cancer cells.
- Chemotoxine monomethyl auristatin E (MMAE)
- MMAE monomethyl auristatin E
- the mortalin binding aptamer-MMAE construct inhibited cell proliferation in (a) PANC-1 pancreatic cancer cells, (b) U251 undifferentiated glioblastoma cells, and (c) HCT1 16 undifferentiated colon cancer cells after 72 hours.
- Example 5 Methods
- PANC-1 CL-1469
- Capan-I HTB-79
- CFPAC-1 CL-1918
- MIA PaCa-2 CL-1420
- BxPC-3 CL-1687
- AsPC-1 CL- 1682
- Primary human pancreatic epithelial cells were purchased in cell systems. The cells were cultured according to the cell bank's
- the SELEX cycle was performed basically as described by Tuerk and Gold 22. In vitro selection was carried out essentially as described 52, with a few modifications for this study.
- 5 nmol of the RNA library was incubated with target cells (Pane- I) in 1 ml binding buffer (PBS with Ca2+ and Mg2 +, 0.01 % BSA, yeast tRNA).
- RNAs that bound to target cells were recovered, amplified by RT-PCR and in vitro transcription, and used in the following selection rounds. In subsequent rounds, the RNA concentration was reduced by 10-fold and incubation time was reduced to create a more stringent condition. To remove RNAs nonspecifically binding the target cells, the counter-selection was carried out.
- the cells were grown in 35mm glass bottom dishes (MatTek,
- RNAs were labelled with Cy3 using the Cy3 Silencer siRNA labeling kit (Ambion, TX, USA.). Cy3- labeled RNAs at 1 OOnM were added to the cells and incubated for 1 hour. The images were taken using a Zeiss LSM 510 Meta Inverted 2 photon confocal microscope system using a C-Apo 40x/l.2NA Water immersion objective.
- Aptamer binding and uptake was also assessed by flow cytometry.
- cells were detached using a non-enzymatic cell dissociation solution, washed with PBS and suspended in binding buffer. Next, Cy3-labeled aptamers were added and incubated for 1 hours at 37°C. The binding of individual aptamers for the staiiing pool as a control to pancreatic cancer cells was performed in triplicate. Flow cytometry was performed on a Cyan (Beckman Coulter counter) and Fortessa. The data were analyzed with Flow Jo software.
- MFI median fluorescence intensity
- the dissociation constants were calculated using one site binding non-linear curve regression with a Graph Pad Prism (GraphPad Software, La Jolla, California, USA).
- pancreatic cancer was determined by measuring the average of positive-stained particle numbers in five independent fields randomly.
- a total of 72 patients (45 male and 27 female) of pancreatic adenocarcinoma had undergone surgical intervention between January 2008 and December 2010 in National Taiwan University Hospital. Diagnosis was settled by pathologic analysis of specimen. All of the enrolled patients fulfilled the informed consent to receive the procedure, and this study was Institutional Review Board approved of NTUH.
- Target membrane proteins were isolated following procedures described by Daniels et al or extracted by ProteoExtract Native Membrane protein Extraction Kit (Calbiochem).
- Agilent 6520 Q-TOF mass spectrometer used to identify aptamer retrieved proteins.
- the WST-1 measurement was performed according to the manufacturer's standard protocol (Takara Bio Europe). Briefly cells were culture into 96-well plate at a density of 2.5x105 cells per well as three independent replicates. 10 ⁇ of the WST-1 reagent was added and incubated for a duration of 1 hour with spectrophotometry readings at 420 nm and 620 nm taken every 15 minutes.
- the Biacore T100 (GE Healthcare, Uppsala, Sweden) was used to monitor label-free the aptamer-vimentin interactions in real time. Biotinylated aptamers were coupled to a streptavidin-coated Biocore chip (SensorChip SA, BR-1003-98, General Electric
- binding buffer at concentration of 25 ⁇ g/mL at 10 ⁇ _/ ⁇ .
- mortalin protein was injected at a flow rate of 10 ⁇ _/ ⁇ .
- the surface was regenerated by injecting 50 mM NaOH at flow rate of 15 ⁇ _ per minute for 20 seconds. Data from the control surface was subtracted. BIAevaluation software (GE Healthcare) was used for analysis. The binding data were fit to a 1 : 1 binding with a mass transfer model.
- Electrophoretic mobility shift assay (EMSA)
- RNA-mortalin complexes were run on a 7% native polyacrylamide gel containing 2% glycerol. Bands were visualized using SYBR Gold (Invitrogen).
- PC3 is a cell line characteristic of prostatic small cell carcinoma Prostate 71 (15) 1668-1679
- Yamamoto, K, Tateishi, K, Kudo, Y, Sato, T Yamamoto, S, Miyabayashi, K, et al.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Food Science & Technology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Provided herein are, for example, aptamers and particularly, although not exclusively, aptamers for the treatment and diagnosis of cancer, such as non-pancreatic cancer, and particularly for the treatment and diagnosis of poorly differentiated or undifferentiated cancer.
Description
Mortalin Binding Aptamers
Cross-References to Related Applications
This application claims the priority and benefit of U.S. Provisional Application No.
62/316,041 , filed March 31 , 2016, the content of which is incorporated herein by reference in its entirety and for all purposes.
Incorporation by Reference of Sequence Listing
The contents of the txt file named RICLP7252604_ST25.TXT, created on March 27, 2017, and is 8, 168 bytes in size, are hereby incorporated by reference in their entireties.
Background
Undifferentiated cancers are cancers in which the ceils are very immature and "primitive" and do not look like cells in the tissue from which they arose. Undifferentiated cells are said to be anaplastic. As a rule, an undifferentiated cancer is more malignant than a cancer of that type which is well differentiated. Such tumors generally carry a poorer prognosis than well differentiated cancers, and are more likely to spread into surrounding tissues or to other parts of the body. The origin (or primary tumor) of such cancers can be difficult to determine, requiring extensive testing.
Glioma is a type of brain or spinal tumour arising from glial cells. They are rarely curable, and patients diagnosed with high-grade gliomas have poor prognosis. Of 10,000
Americans diagnosed each year with malignant gliomas, about half are alive one year after diagnosis, and 25% after two years. Glioblastoma multiforme (also known as glioblastoma) is the most common and aggressive cancer that begins within the brain. Glioblastoma tumors are characterized by the presence of small areas of necrotizing tissue that are surrounded by undifferentiated cells.
For patients diagnosed with glioblastoma multiforme, median overall survival is around 15 months, and the cancer usually recurs following treatment. Glioblastoma is very difficult to treat, as the tumor cells are very resistant to conventional therapies. Moreover, as with all tumors of the brain, the susceptibility of the brain and limited repair capacity makes such tumors challenging to treat. Indeed, many drugs cannot cross the blood-brain barrier in order to contact the tumor.
Accordingly, there is a need to identify new therapeutic and diagnostic strategies for poorly differentiated or undifferentiated cancers.
Summary
Provided here are, for example, aptamers that bind mortalin, and their use in the treatment and diagnosis of cancer, and specifically in the treatment and diagnosis of nonpancreatic cancer. Also provided are mortalin binding aptamers for the treatment and diagnosis of poorly differentiated or undifferentiated cancers. The present disclosure provides, inter alia, methods for treating cancer, and mortalin binding aptamers for use in such methods. In one aspect, a method for treating nonpancreatic cancer in a subject is provided, the method comprising administering a mortalin binding aptamer to the subject. In another aspect, a mortalin binding aptamer for use in a method of treating non-pancreatic cancer is provided. In another aspect, the use of a mortalin binding aptamer in the manufacture of a medicament for the treatment of non-pancreatic cancer is provided.
The cancer may be a non-pancreatic cancer. The cancer may be a poorly differentiated or undifferentiated cancer. In some aspects, the cancer is a poorly differentiated or undifferentiated non-pancreatic cancer. The cancer may be a metastatic or invasive cancer. The cancer may be a malignant cancer. In some aspects the cancer is poorly differentiated or undifferentiated glioblastoma, or colorectal cancer, or liver, breast or prostate cancer. The method of treatment may comprise intravenous administration of the aptamer.
In some aspects the methods involve administration of a mortalin binding aptamer, and mortalin binding aptamers for use in methods of treatment. The aptamer may comprise the sequence GAAUGCCC, and be at least 29 nucleotides in length. In some cases the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and is at least 29 nucleotides in length. The aptamer may have at least 80% identity to SEQ ID
NO: 2 or SEQ ID NO: 4. In some aspects, the aptamer does not consist of SEQ ID NO: 1.
In some cases, the aptamer is administered with a therapeutic agent, such as an anticancer therapeutic agent. The aptamer may be linked to a therapeutic agent, such as an anti-cancer therapeutic agent.
Also provided herein are methods for identifying a cancer cell in a sample, and/or for diagnosing cancer in an individual. The methods involve contacting the sample with a mortalin binding aptamer. The cancer may be a non-pancreatic cancer. The cancer may be a poorly differentiated or undifferentiated cancer. In some aspects, the cancer is a poorly differentiated or undifferentiated non-pancreatic cancer. The cancer may be a metastatic or invasive cancer. The cancer may be a malignant cancer. In some aspects the cancer is poorly differentiated or undifferentiated glioblastoma or colorectal cancer, or liver, breast or prostate cancer. Also provided herein is the use of a mortalin binding aptamer in the manufacture of a medicament for the treatment of cancer, and particularly non-pancreatic cancer, and poorly differentiated or undifferentiated cancer.
The following numbered paragraphs contain statements of embodiments of the methods and compositions provided herein :-
1. A mortalin binding aptamer for use in a method of treating non-pancreatic cancer.
2. The mortalin binding aptamer for use according to paragraph 1 wherein the non- pancreatic cancer is a poorly differentiated or undifferentiated cancer.
3. The mortalin binding aptamer for use according to paragraph 1 or paragraph 2 wherein the cancer is a metastatic or invasive cancer. 4. The mortalin binding aptamer for use according to any one of the preceding paragraphs wherein the cancer is a malignant cancer.
5. The mortalin binding aptamer for use according to paragraph 1 wherein the cancer is poorly differentiated or undifferentiated glioblastoma or colorectal cancer, or liver, breast or prostate cancer.
6. The mortalin binding aptamer for use according to any one of the preceding paragraphs wherein the treatment comprises intravenous administration of the aptamer.
7. The mortalin binding aptamer for use according to any one of the preceding paragraphs wherein the aptamer comprises the sequence GAAUGCCC, and is at least 29 nucleotides in length. 8. The mortalin binding aptamer for use according to paragraph 7 wherein the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and is at least 29 nucleotides in length.
9. The mortalin binding aptamer for use according to any one of the preceding paragraphs wherein the aptamer does not consist of SEQ ID NO: 1.
10. The mortalin binding aptamer for use according to any one of the preceding paragraphs wherein the aptamer has at least 80% identity to SEQ ID NO: 2 or SEQ ID NO: 4.
11. The mortalin binding aptamer for use according to any one of the preceding paragraphs wherein the aptamer is linked to a therapeutic agent.
12. The mortalin binding aptamer for use according to paragraph 1 1 wherein the therapeutic agent is an anti-cancer therapeutic agent.
13. The mortalin binding aptamer for use according to any one of the preceding paragraphs wherein the method further comprises administering an anti-cancer therapeutic agent.
14. A method for identifying a non-pancreatic cancer cell in a sample, the method comprising contacting the sample with a mortalin binding aptamer.
15. A method for diagnosing a non-pancreatic cancer in an individual, the method comprising contacting a sample from the individual with a mortalin binding aptamer.
16. A method for treating non-pancreatic cancer in a subject, the method comprising administering a mortalin binding aptamer to the subject.
17. The method of any one of paragraphs 12 - 16 wherein the non-pancreatic cancer or non-pancreatic cancer cell is a poorly differentiated or undifferentiated non-pancreatic cancer or cell. 18. Use of a mortalin binding aptamer in the manufacture of a medicament for the treatment of non-pancreatic cancer.
Description
While various embodiments and aspects are shown and described herein, it will be obvious to those skilled in the art that such embodiments and aspects are provided by way of example only. Numerous variations, changes, and substitutions of the teaching herein will now occur to those skilled in the art. It should be understood that various alternatives to the aspects and embodiments described herein may be employed in practicing the methods and compositions herein.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in the application including, without limitation, patents, patent applications, articles, books, manuals, and treatises are hereby expressly incorporated by reference in their entirety for any purpose.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. See, e.g., Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J. Wiley & Sons (New York, NY 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, NY 1989).
Any methods, devices and materials similar or equivalent to those described herein can be used in the methods and compositions described herein. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.
Nucleic acids
"Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-, double- or multiple-stranded form, or complements thereof. The term "polynucleotide" refers to a linear sequence of nucleotides. The term "nucleotide" typically refers to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be
ribonucleotides, deoxyribonucleotides, or modified versions thereof. Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA (including siRNA), and hybrid molecules having mixtures of single and double stranded DNA and RNA. Nucleic acids can be linear or branched. For example, nucleic acids can be a linear chain of nucleotides or the nucleic acids can be branched, e.g., such that the nucleic acids comprise one or more arms or branches of nucleotides. Optionally, the branched nucleic acids are repetitively branched to form higher ordered structures such as dendrimers and the like. Nucleic acids, including nucleic acids with a phosphothioate backbone can include one or more reactive moieties. As used herein, the term reactive moiety includes any group capable of reacting with another molecule, e.g., a nucleic acid or polypeptide through covalent, noncovalent or other interactions. By way of example, the nucleic acid can include an amino acid reactive moiety that reacts with an amino acid on a protein or polypeptide through a covalent, non-covalent or other interaction.
The terms also encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
Examples of such analogs include, without limitation, phosphodiester derivatives including, e.g., phosphoramidate, phosphorodiamidate, phosphorothioate (also known as phosphothioate), phosphorodithioate, phosphonocarboxylic acids,
phosphonocarboxylates, phosphonoacetic acid, phosphonoformicacid, methyl phosphonate, boron phosphonate, or O-methylphosphoroamidite linkages (see
Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press); and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, modified sugars, and non- ribose backbones (e.g. phosphorodiamidate morpholino oligos or locked nucleic acids (LNA)), including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and
Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in Antisense
Research, Sanghui & Cook, eds. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose- phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. In embodiments, the internucleotide linkages in DNA are phosphodiester, phosphodiester derivatives, or a combination of both. The words "complementary" or "complementarity" refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide. For example, the sequence A-G-T is complementary to the sequence T-C-A.
Complementarity may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.
Aptamers
The term "aptamer" as provided herein refers to oligonucleotides (e.g. short
oligonucleotides or deoxyribonucleotides), that bind (e.g. with high affinity and specificity) to proteins, peptides, and small molecules. An aptamer may be referred to as an oligonucleotide based target binding moiety. Aptamers may be RNA or DNA. Aptamers may have secondary or tertiary structure and, thus, may be able to fold into diverse and intricate molecular structures.
Aptamers can be selected in vitro from very large libraries of randomized sequences by the process of systemic evolution of ligands by exponential enrichment (SELEX as described in Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346:818-822; Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505-510) or by developing SOMAmers (slow off-rate modified aptamers) (Gold Let al. (2010) Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS ONE 5(12):e15004). Applying the SELEX and the SOMAmer technology includes for instance adding functional groups that mimic amino acid side chains to expand the aptamer's chemical diversity. As a result high affinity aptamers for a protein may be enriched and identified. Aptamers may exhibit many desirable properties for targeted drug delivery, such as ease of selection and synthesis, high binding affinity and specificity, low immunogenicity, and versatile synthetic accessibility. Anti-cancer agents
(e.g. chemotherapy drugs, toxins, and siRNAs) may be successfully delivered to cancer cells in vitro using aptamers.
Aptamers are nucleic acid molecules characterised by the ability to bind to a target molecule with high specificity and high affinity. Almost every aptamer identified to date is a non-naturally occurring molecule.
Aptamers may be DNA or RNA molecules and may be single stranded or double stranded. The aptamer may comprise chemically modified nucleotides or nucleosides, for example in which the sugar and/or phosphate and/or base is chemically modified. Such modifications may improve the stability of the aptamer or make the aptamer more resistant to degradation. The aptamers described herein may include chemical modifications as described herein such as a chemical substitution at a sugar position, a phosphate position, and/or a base position of the nucleic acid including, for example., incorporation of a modified nucleotide, incorporation of a capping moiety (e.g. 3' capping), conjugation to a high molecular weight, non-immunogenic compound (e.g. polyethylene glycol (PEG)), conjugation to a lipophilic compound, substitutions in the phosphate backbone. Base modifications may include 5-position pyrimidine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo- or 5-iodo-uracil, backbone modifications. Sugar modifications may include 2'-amine nucleotides (2'-NH2), 2'-fluoro nucleotides (2'-F), and 2'-0-methyl (2'-OMe) nucleotides. A wide range of nucleotide, nucleoside, base and phosphate modifications are known to those or ordinary skill in the art, e.g. as described in Eaton et al., Bioorganic & Medicinal Chemistry, Vol.5, No.6, pp1087-1096, 1997.
Aptamers may be synthesised by methods which are well known to the skilled person. For example, aptamers may be chemically synthesised, e.g. on a solid support. Solid phase synthesis may use phosphoramidite chemistry. Briefly, a solid supported nucleotide is detritylated, then coupled with a suitably activated nucleoside
phosphoramidite to form a phosphite triester linkage. Capping may then occur, followed by oxidation of the phosphite triester with an oxidant, typically iodine. The cycle may then be repeated to assemble the aptamer (e.g., see Sinha, N. D.; Biernat, J.; McManus, J.; Koster, H. Nucleic Acids Res. 1984, 72, 4539; and Beaucage, S. L; Lyer, R. P. (1992). Tetrahedron 48 (12): 2223).
Aptamers can be thought of as the nucleic acid equivalent of monoclonal antibodies and often have Kd's in the nM or pM range, e.g. less than one of 500nM, 100nM, 50nM, 10nM, 1 nM, 500pM, 100pM. As with monoclonal antibodies, they may be useful in virtually any situation in which target binding is required, including use in therapeutic and diagnostic applications, in vitro or in vivo. In vitro diagnostic applications may include use in detecting the presence or absence of a target molecule.
Aptamers described herein may be provided in purified or isolated form. Aptamers described herein may be formulated as a pharmaceutical composition or medicament.
A "tumor cell antigen aptamer" is an aptamer that has high affinity and specificity for a tumor cell antigen, as defined herein. WO2013/154735 and Table 1 describe the pancreatic cancer cell binding aptamers P19, P15, P1 , P11 , P7, P6 and the consensus sequence SEQ ID NO:8. The sequence of a truncated P19 aptamer is shown in Table 1.
In some embodiments the tumor cell antigen aptamer is a mortalin binding aptamer. Mortalin binding aptamers such as P19, tP19 and P1 are described in WO2013/154735 and in co-pending US provisional patent application no. 62/141 156, incorporated herein by reference. The aptamer may comprise the sequence GAAUGCCC, and be at least 29 nucleotides in length. In some cases the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and is at least 29 nucleotides in length. The aptamer may have at least 80% identity to SEQ ID NO: 2 or SEQ ID NO: 4. In some aspects, the aptamer does not consist of SEQ ID NO: 1. However, the aptamer may comprise the amino acid sequence set out as SEQ ID NO: 1 and one or more additional amino acids, at either or both or the C or N termini.
Aptamers are normally mono-specific, i.e. having high affinity and specificity for a single target molecule. The nucleic acid sequence of a mono-specific aptamer, or mono-specific part of a bi- specific aptamer, may optionally have a minimum length of one of 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.
In some cases the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and has a minimum length of at least 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40,
41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63,
64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.
The nucleic acid sequence of a mono-specific aptamer, or mono-specific part of a bi- specific aptamer, may optionally have a maximum length of one of 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides.
The nucleic acid sequence of a mono-specific aptamer, or mono-specific part of a bi- specific aptamer, may optionally have a length of one of 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 ,
42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64,
65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides. The nucleic acid sequence of a mortalin binding aptamer, may have a degree of primary sequence identity with one of SEQ ID Nos 1 , 2, or 4, that is at least one of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. An "antisense nucleic acid" as referred to herein is a nucleic acid (e.g. DNA or RNA molecule) that is complementary to at least a portion of a specific target nucleic acid (e.g. an mRNA translatable into a protein) and is capable of reducing transcription of the target nucleic acid (e.g. mRNA from DNA) or reducing the translation of the target nucleic acid (e.g. mRNA) or altering transcript splicing (e.g. single stranded morpholino oligo). See, e.g., Weintraub, Scientific American, 262:40 (1990). Typically, synthetic antisense nucleic acids (e.g. oligonucleotides) are generally between 15 and 25 bases in length. Thus, antisense nucleic acids are capable of hybridizing to (e.g. selectively hybridizing to) a target nucleic acid (e.g. target mRNA). In embodiments, the antisense nucleic acid hybridizes to the target nucleic acid sequence (e.g. mRNA) under stringent hybridization conditions. In embodiments, the antisense nucleic acid hybridizes to the target nucleic acid (e.g. mRNA) under moderately stringent hybridization conditions. Antisense nucleic
acids may comprise naturally occurring nucleotides or modified nucleotides such as, e.g., phosphorothioate, methylphosphonate, and -anomeric sugar-phosphate, backbone modified nucleotides. In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate an mRNA that is double-stranded. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal. Biochem., 172:289, (1988)). Further, antisense molecules which bind directly to the DNA may be used. Antisense nucleic acids may be single or double stranded nucleic acids. Non-limiting examples of antisense nucleic acids include siRNAs (including their derivatives or pre-cursors, such as nucleotide analogs), short hairpin RNAs (shRNA), micro RNAs (miRNA), saRNAs (small activating RNAs) and small nucleolar RNAs (snoRNA) or certain of their derivatives or precursors.
A "siRNA," "small interfering RNA," "small RNA," or "RNAi" as provided herein, refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when present in the same cell as the gene or target gene. The complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity. In one embodiment, a siRNA or RNAi is a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA. In embodiments, the siRNA inhibits gene expression by interacting with a complementary cellular rnRNA thereby interfering with the expression of the complementary mRNA. Typically, the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length). In other embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
A "saRNA," or "small activating RNA" as provided herein refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to increase or activate expression of a gene or target gene when present in the same cell as the gene or target gene. The complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity. In one embodiment, a saRNA is a nucleic acid that has substantial or complete identity to a
target gene and forms a double stranded saRNA. Typically, the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded saRNA is 15-50 nucleotides in length, and the double stranded saRNA is about 15-50 base pairs in length). In other embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
The term "isolated", when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified.
The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. In some embodiments, the nucleic acid or protein is at least 50% pure, optionally at least 65% pure, optionally at least 75% pure, optionally at least 85% pure, optionally at least 95% pure, and optionally at least 99% pure.
The term "isolated" may also refer to a cell or sample cells. An isolated cell or sample cells are a single cell type that is substantially free of many of the components which normally accompany the cells when they are in their native state or when they are initially removed from their native state. In certain embodiments, an isolated cell sample retains those components from its natural state that are required to maintain the cell in a desired state. In some embodiments, an isolated (e.g. purified, separated) cell or isolated cells are cells that are substantially the only cell type in a sample. A purified cell sample may contain at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of one type of cell. An isolated cell sample may be obtained through the use of a cell marker or a combination of cell markers, either of which is unique to one cell type in an unpurified cell sample. In some embodiments, the cells are isolated through the use of a cell sorter. In some embodiments, antibodies against cell proteins are used to isolate cells. As used herein, the term "conjugate" refers to the association between atoms or molecules. The association can be direct or indirect. For example, a conjugate between a
nucleic acid (e.g., ribonucleic acid) and a compound moiety as provided herein can be direct, e.g., by covalent bond, or indirect, e.g., by non-covalent bond. Optionally, conjugates are formed using conjugate chemistry including, but are not limited to nucleophilic substitutions (e.g., reactions of amines and alcohols with acyl halides, active esters), electrophilic substitutions (e.g., enamine reactions) and additions to carbon- carbon and carbon-heteroatom multiple bonds (e.g., Michael reaction, Diels-Alder addition). These and other useful reactions are discussed in, for example, March, ADVANCED ORGANIC CHEMISTRY, 3rd Ed., John Wiley & Sons, New York, 1985; Hermanson, BIOCONJUGATE TECHNIQUES, Academic Press, San Diego, 1996; and Feeney et al., MODIFICATION OF PROTEINS; Advances in Chemistry Series, Vol.
198, American Chemical Society, Washington, D.C., 1982. Thus, the nucleic acid acids can be attached to a compound moiety through its backbone. Optionally, the ribonucleic acid includes one or more reactive moieties, e.g., an amino acid reactive moiety, that facilitates the interaction of the ribonucleic acid with the compound moiety.
Useful reactive moieties or functional groups used for conjugate chemistries herein include, for example: (a) carboxyl groups and various derivatives thereof including, but not limited to, Nhydroxysuccinimide esters, N-hydroxybenztriazole esters, acid halides, acyl imidazoles, thioesters, p-nitrophenyl esters, alkyl, alkenyl, alkynyl and aromatic esters; (b) hydroxyl groups which can be converted to esters, ethers, aldehydes, etc. (c) halo alkyl groups wherein the halide can be later displaced with a nucleophilic group such as, for example, an amine, a carboxylate anion, thiol anion, carbanion, or an alkoxide ion, thereby resulting in the covalent attachment of a new group at the site of the halogen atom; (d) dienophile groups which are capable of participating in Diels-Alder reactions such as, for example, maleimido groups; (e) aldehyde or ketone groups such that subsequent derivatization is possible via formation of carbonyl derivatives such as, for example, imines, hydrazones, semicarbazones or oximes, or via such mechanisms as Grignard addition or alkyllithium addition; (f) sulfonyl halide groups for subsequent reaction with amines, for example, to form sulfonamides; (g) thiol groups, which can be converted to disulfides, reacted with acyl halides, or bonded to metals such as gold; (h) amine or sulfhydryl groups, which can be, for example, acylated, alkylated or
oxidized; (i) alkenes, which can undergo, for example, cycloadditions, acylation, Michael addition, etc; (j) epoxides, which can react with, for example, amines and hydroxyl compounds; (k) phosphoramidites and other standard functional groups useful in nucleic acid synthesis; (I) metal silicon oxide bonding; (m) metal bonding to reactive phosphorus
groups (e.g. phosphines) to form, for example, phosphate diester bonds; and (n) sulfones, for example, vinyl sulfone.
The reactive functional groups can be chosen such that they do not participate in, or interfere with, the chemical stability of the proteins described herein. By way of example, the nucleic acids can include a vinyl sulfone or other reactive moiety. Optionally, the nucleic acids can include a reactive moiety having the formula S-S-R. R can be, for example, a protecting group. Optionally, R is hexanol. As used herein, the term hexanol includes compounds with the formula C6H130H and includes, 1-hexanol, 2-hexanol, 3- hexanol, 2-methyl-1-pentanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 2-methyl-2- pentanol, 3-methyl-2-pentanol, 4-methyl-2-pentanol, 2-methyl-3-pentanol, 3-methyl-3- pentanol, 2,2-dimethyl-1-butanol, 2,3-dimethyl-1-butanol, 3,3-dimethyl-1-butanol, 2,3- dimethyl-2-butanol, 3,3-dimethyl-2-butanol, and 2-ethyl-1-butanol. Optionally, R is 1- hexanol.
As used herein, the term "about" means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, the term "about" means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to +/- 10% of the specified value. In embodiments, about means the specified value.
The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http://wW'.v.ncbi. nlm.nih.gov/BLAST/ or the like). Such sequences are then said to be "substantially identical." This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like.
Preferably, identity exists over a region that is at least about 25 amino acids or
nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J.
Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat 7. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology
(Ausubel et ai, eds. 1995 supplement)).
A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et ai, Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et ai, J. Mol. β/Ό/ 215 :403-410 ( 1990), respectively.
For specific proteins described herein (e.g., mortalin), the named protein includes any of the protein's naturally occurring forms, variants or homologs (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein). In some embodiments, variants or homologs have at least 90%, 95%, 96%, 97%, 98%,
99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form. In other embodiments, the protein is the protein as identified by its NCBI sequence reference. In other embodiments, the protein is the protein as identified by its NCBI sequence reference, homolog or functional fragment thereof.
The term "tumor cell antigen" refers to any protein, carbohydrate or other component that is abnormally expressed by a tumor cell or is expressed by a tumor cell with an abnormal structure. A tumor cell antigen may be expressed at the cell surface by tumor / cancer cells of the tumor / cancer concerned. A tumor cell antigen may optionally be capable of eliciting an immune response. A tumor cell antigen may be a protein, carbohydrate or other component that is normally expressed inside the cell, but is expressed at the cell surface or in/at the cell membrane of a tumor cell. Preferably, the tumor cell antigen is mortalin.
Mortalin
Mortalin is a heat-shock cognate protein involved in the control of cell proliferation, which may also act as a chaperone. It is a member of the heat shock protein 70 (HSP-70) family of proteins, which contains both heat-inducible and constitutively expressed members.
The term "HSP70" refers to the family of approximately 70 kilodalton heat shock proteins as well-known in the art. In some preferred embodiments, the HSP70 is mHSP70. The term "mHSP70" as provided herein includes any of the mitochondrial HSP70 (mHSP70) protein naturally occurring forms, homologs or variants that maintain the activity of mHSP70 (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein). In some embodiments, variants or homologs have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
Mortalin may also be referred to herein as mHSP70, Stress-70 protein, CSA, GRP-75, GRP75, HEL-S-124m, HSPA9B, MOT, MOT2, MTHSP75 or PBP74. In embodiments, the mortalin is the protein as identified by the NCBI sequence reference NP_004125.3 Gl:24234688, homolog or functional fragment thereof.
Overexpression of mortalin in cancer is linked to poor prognosis, e.g. see Bagatell and Whitesell., ol Cancer Ther August 2004 3; 1021 Therapeutic agents
"Anti-cancer agent" is used in accordance with its plain ordinary meaning and refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having antineoplastic properties or the ability to inhibit the growth or proliferation of cells. In embodiments, an anti-cancer agent is a chemotherapeutic. In embodiments, an anti-cancer agent is an agent identified herein having utility in methods of treating cancer. In embodiments, an anti-cancer agent is an agent approved by the FDA or similar regulatory agency of a country other than the USA, for treating cancer. Examples of anti-cancer agents include, but are not limited to, MEK (e.g.MEKI , MEK2, or MEKI andMEK2) inhibitors (e.g. XL518, CI-1040, PD035901 , selumetinib/ AZD6244, GSKI 120212/ trametinib, GDC-0973, ARRY- 162, ARRY-300, AZD8330, PD0325901 , U0126, PD98059, TAK-733, PD318088, AS703026, BAY 869766), alkylating agents (e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambucil,
meiphalan), ethylenimine and methylmelamines (e.g., hexamethlymelamine, thiotepa), alkyl sulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine, lomusitne, semustine, streptozocin), triazenes (decarbazine)), anti-metabolites (e.g., 5-azathioprine, leucovorin, capecitabine, fludarabine, gemcitabine, pemetrexed, raltitrexed, folic acid analog (e.g., methotrexate ), or pyrimidine analogs (e.g., fluorouracil, floxouridine, Cytarabine), purine analogs (e.g., mercaptopurine, thioguanine, pentostatin), etc.), plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel, docetaxel, etc.), topoisomerase inhibitors (e.g., irinotecan, topotecan, amsacrine, etoposide (VP16), etoposide phosphate, teniposide, etc.), antitumor antibiotics (e.g., doxorubicin, adriamycin, daunorubicin, epirubicin, actinomycin, bleomycin, mitomycin, mitoxantrone, plicamycin, etc.), platinum-based compounds (e.g. cisplatin, oxaloplatin, carboplatin), anthracenedione (e.g., mitoxantrone), substituted urea (e.g., hydroxyurea), methyl hydrazine derivative (e.g., procarbazine), or adrenocortical suppressant (e.g., mitotane, aminoglutethimide), epipodophyllotoxins (e.g., etoposide).
Further examples of anti-cancer agents include, but are not limited to, antibiotics (e.g., daunorubicin, doxorubicin, bleomycin), enzymes (e.g., L-asparaginase), inhibitors of mitogen activated protein kinase signaling (e.g. U0126, PD98059, PD-184352,
PD0325901 , ARRY- 142886, SB239063, SP600125, BAY 43-9006, wortmannin, or LY294002), mTOR inhibitors, antibodies (e.g., rituxan), 5-aza-2'-deoxycytidine, doxorubicin, vincristine, etoposide, gemcitabine, imatinib (Gleevec.RTM.), geldanamycin, I 7-N-Allylamino-17- Demethoxygeldanamycin (17-AAG), bortezomib, trastuzumab, anastrozole; angiogenesis inhibitors; antiandrogen, antiestrogen; antisense
oligonucleotides; apoptosis gene modulators; apoptosis regulators; arginine deaminase; BCR/ ABL antagonists; beta lactam derivatives; bFGF inhibitor; bicalutamide;
camptothecin derivatives; casein kinase inhibitors (ICOS); clomifene analogues;
cytarabine dacliximab; dexamethasone; estrogen agonists; estrogen antagonists;
etanidazole; etoposide phosphate; exemestane; fadrozole; finasteride; fludarabine;
fluorodaunorunicin hydrochloride; gadolinium texaphyrin; gallium nitrate; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; immunostimulant peptides; insulin-like growth factor-l receptor inhibitor; interferon agonists; interferons; interleukins; letrozole; leukemia inhibiting factor; leukocyte alpha interferon;
leuprolide+estrogen+progesterone; leuprorelin; matrilysin inhibitors; matrix
metalloproteinase inhibitors; MIF inhibitor; mifepristone; mismatched double stranded RNA; monoclonal antibody,; mycobacterial cell wall extract; nitric oxide modulators;
oxaliplatin; panomifene; pentrozole; phosphatase inhibitors; plasminogen activator inhibitor; platinum complex; platinum compounds; prednisone; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; ribozymes; signal transduction inhibitors; signal transduction modulators; single chain antigen-binding protein; stem cell inhibitor; stem-cell division inhibitors; stromelysin inhibitors; synthetic glycosaminoglycans; tamoxifen methiodide; telomerase inhibitors; thyroid stimulating hormone; translation inhibitors; tyrosine kinase inhibitors; urokinase receptor antagonists; steroids (e.g., dexamethasone), finasteride, aromatase inhibitors, gonadotropin-releasing hormone agonists (GnRH) such as goserelin or leuprolide, adrenocorticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, megestrol acetate, medroxyprogesterone acetate), estrogens (e.g., diethlystilbestrol, ethinyl estradiol), antiestrogen (e.g., tamoxifen), androgens (e.g., testosterone propionate,
fluoxymesterone), antiandrogen (e.g., flutamide), immunostimulants (e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alpha-interferon, etc.), monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti-CD33 monoclonal antibody- calicheamicin conjugate, anti-CD22 monoclonal antibody-pseudomonas exotoxin
conjugate, etc.), radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated to 1 1n, 90Y, or 1311, etc.), triptolide, homoharringtonine, dactinomycin, doxorubicin, epirubicin, topotecan, itraconazole, vindesine, cerivastatin, vincristine, deoxyadenosine, sertraline, pitavastatin, irinotecan, clofazimine, 5-nonyloxytryptamine, vemurafenib, dabrafenib, erlotinib, gefitinib, EGFR inhibitors, epidermal growth factor receptor (EGFR)- targeted therapy or therapeutic (e.g. gefitinib (Iressa™), erlotinib (Tarceva™), cetuximab (ErbituxTM), lapatinib (TykerbTM), panitumumab (Vectibix™), vandetanib (Caprelsa™), afatinib/BIBW2992, CI-1033/canertinib, neratinib/HKI-272, CP-724714, TAK-285, AST- 1306, ARRY334543, ARRY-380, AG- 1478, dacomitinib/PF299804,OSI-420/desmethyl erlotinib, AZD8931 , AEE788, pelitinib/EKB-569, CUDC-101 , WZ8040, WZ4002, WZ3146, AG-490, XL647, PD-153035, BMS-599626), sorafenib, imatinib, sunitinib, dasatinib, or the like.
"Chemotherapeutic" or "chemotherapeutic agent" is used in accordance with its plain ordinary meaning and refers to a chemical composition or compound having
antineoplastic properties or the ability to inhibit the growth or proliferation of cells.
Additionally, the nucleic acid compound described herein can be co-administered with or covalently attached to conventional immunotherapeutic agents including, but not limited to, immunostimulants (e.g., Bacillus Calmette-Guerin (BCG), levamisole, interleukin-2, alphainterferon, etc.), monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, anti-PD-1 and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti- CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody- pseudomonas exotoxin conjugate, etc.), and radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated to 1 11 In, 90 Y, or 1311, etc. ) .
In a further embodiment, the nucleic acid compounds described herein can be coadministered with conventional radiotherapeutic agents including, but not limited to, radionucleotides such as 47Sc, 64Cu, 67Cu, 89Sr, 86Y, 90Y, 105Rh, 111Ag, 111 ln, 117mSn, 149Pm, 153Sm, 166Ho, 177Lu, 186Re, 211At and 212Bi, optionally conjugated to antibodies directed against tumor antigens.
The term "sample" includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histological purposes. Such samples include blood and blood fractions or products (e.g., bone marrow, serum, plasma, platelets, red blood cells, and the like), sputum, tissue, cultured cells (e.g., primary cultures, explants, and transformed
cells), stool, urine, other biological fluids (e.g., prostatic fluid, gastric fluid, intestinal fluid, renal fluid, lung fluid, cerebrospinal fluid, and the like), etc. A sample is typically obtained from a "subject" such as a eukaryotic organism, most preferably a mammal such as a primate, e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish. In some embodiments, the sample is obtained from a human.
A "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample. For example, a test sample can be taken from a test condition, e.g., in the presence of a test compound, and compared to samples from known conditions, e.g., in the absence of the test compound (negative control), or in the presence of a known compound (positive control). A control can also represent an average value gathered from a number of tests or results. One of skill in the art will recognize that controls can be designed for assessment of any number of parameters. For example, a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of side effects). One of skill in the art will understand which controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant.
"Disease" or "condition" refers to a state of being or health status of a patient or subject capable of being treated with a compound, pharmaceutical composition, or method provided herein. In preferred embodiments, the disease is cancer.
In some embodiments the cancer is non-pancreatic cancer. Non-pancreatic cancers are cancers that do not form in the tissues of the pancreas. In some cases, the cancer is glioblastoma. In some cases, the cancer is colorectal cancer. In some cases, the cancer is liver, breast or prostate cancer.
In some embodiments the cancer is poorly differentiated or undifferentiated cancer. In some aspects, the cancer is a metastatic or invasive cancer. In particular, the cancer is a metastatic or invasive non-pancreatic cancer.
Poorly differentiated and Undifferentiated Cancer
In embodiments, the cancer is a poorly differentiated, or undifferentiated cancer. These tumors may have abnormal looking cells and may lack normal tissue structures. The cells are very immature and "primitive" and do not look like cells in the tissue from which it arose. As a rule, less differentiated cancer cells are more malignant than a cancer cell of that type which is more differentiated. Undifferentiated cells are said to be anaplastic.
The cancer may be an undifferentiated metastatic cancer.
Undifferentiated cancer cells do not have specialised (i.e. "mature") structures or functions. Such cancer cells often grow and spread quickly. Undifferentiated cancer cells often do not look like the cells in the tissue from which the cancer arose. As such, it can be difficult to categorise such cancers as a particular type of cancer, such as carcinoma, lymphoma or melanoma.
Grading systems differ, depending on the type of cancer. In general, tumors are graded as 1 , 2, 3 or 4, depending on the amount of abnormality. In Grade 1 tumors, the tumor cells and the organisation of the tumor tissue appear close to normal. These tumors tend to grow and spread slowly. In contrast, the cells and tissue of Grade 3 and Grade 4 tumors do not look like normal cells and tissue. Grade 3 and Grade 4 tumors tend to grow rapidly and spread faster than tumors with a lower grade.
The following grading system may be applied:
GX: Grade cannot be assessed
G1 : Well differentiated (low grade)
G2: Moderately differentiated (intermediate grade)
G3: Poorly differentiated (high grade)
G4: Undifferentiated (high grade).
In embodiments, the cancer is a high grade cancer, such as a poorly differentiated or undifferentiated cancer, or G3 or G4 cancer. In some aspects, the cancer is an undifferentiated cancer, or G4 cancer. In some aspects, the cancer is a malignant cancer.
In particular aspects, the cancer is high grade non-pancreatic cancer. That is, a cancer of non-pancreatic origin which is poorly differentiated or undifferentiated. The cancer may be a malignant non-pancreatic cancer. In some cases, the cancer is selected from prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma.
As used herein, the term "cancer" refers to all types of cancer, neoplasm or malignant tumors found in mammals, including leukemia, lymphoma, carcinomas and sarcomas. Exemplary cancers that may be treated with a compound, pharmaceutical composition, or method provided herein include lymphoma, sarcoma, bladder cancer, bone cancer, brain tumor, cervical cancer, colon cancer, esophageal cancer, gastric cancer, head and neck cancer, kidney cancer, myeloma, thyroid cancer, leukemia, prostate cancer, breast cancer (e.g. triple negative, ER positive, ER negative, chemotherapy resistant, herceptin resistant, HER2 positive, doxorubicin resistant, tamoxifen resistant, ductal carcinoma, lobular carcinoma, primary, metastatic), ovarian cancer, pancreatic cancer, liver cancer (e.g., hepatocellular carcinoma), lung cancer (e.g. non-small cell lung carcinoma, squamous cell lung carcinoma, adenocarcinoma, large cell lung carcinoma, small cell lung carcinoma, carcinoid, sarcoma), glioblastoma multiforme, glioma, melanoma, prostate cancer, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma. Additional examples include, cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head & neck, esophagus, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus or Medulloblastoma, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, Paget's
Disease of the Nipple, Phyllodes Tumors, Lobular Carcinoma, Ductal Carcinoma, cancer of the pancreatic stellate cells, cancer of the hepatic stellate cells, or prostate cancer.
The term "leukemia" refers broadly to progressive, malignant diseases of the blood forming organs and is generally characterized by a distorted proliferation and
development of leukocytes and their precursors in the blood and bone marrow. Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood-leukemic or a leukemic (subleukemic). Exemplary leukemias that may be treated with a compound, pharmaceutical composition, or method provided herein include, for example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute
promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophylic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblasts leukemia, myelocytic leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, multiple myeloma, plasmacytic leukemia, promyelocytic leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemic leukemia, or undifferentiated cell leukemia.
The term "sarcoma" generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance. Sarcomas that may be treated with a compound, pharmaceutical composition, or method provided herein include a
chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma,
immunoblastic sarcoma of B cells, lymphoma, immunoblastic sarcoma of T-cells, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma,
leukosarcoma, malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, or telangiectaltic sarcoma.
The term "melanoma" is taken to mean a tumor arising from the melanocytic system of the skin and other organs. Melanomas that may be treated with a compound,
pharmaceutical composition, or method provided herein include, for example, acral- lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma. The term "carcinoma" refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. Exemplary carcinomas that may be treated with a compound, pharmaceutical composition, or method provided herein include, for example, medullary thyroid carcinoma, familial medullary thyroid carcinoma, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, ductal carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatinifomi carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hurthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky- cell carcinoma, large-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lobular carcinoma, lymphoepithelial carcinoma, carcinoma medullare, medullary carcinoma, melanotic carcinoma, carcinoma molle, mucinous
carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid
carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tubular carcinoma, tuberous carcinoma, verrucous carcinoma, or carcinoma villosum.
As used herein, the terms "metastasis," "metastatic," and "metastatic cancer" can be used interchangeably and refer to the spread of a proliferative disease or disorder, e.g., cancer, from one organ or another non-adjacent organ or body part. Cancer occurs at an originating site, e.g., breast, which site is referred to as a primary tumor, e.g., primary breast cancer. Some cancer cells in the primary tumor or originating site acquire the ability to penetrate and infiltrate surrounding normal tissue in the local area and/or the ability to penetrate the walls of the lymphatic system or vascular system circulating through the system to other sites and tissues in the body. A second clinically detectable tumor formed from cancer cells of a primary tumor is referred to as a metastatic or secondary tumor. When cancer cells metastasize, the metastatic tumor and its cells are presumed to be similar to those of the original tumor. Thus, if lung cancer metastasizes to the breast, the secondary tumor at the site of the breast consists of abnormal lung cells and not abnormal breast cells. The secondary tumor in the breast is referred to a metastatic lung cancer. Thus, the phrase metastatic cancer refers to a disease in which a subject has or had a primary tumor and has one or more secondary tumors. The phrases non-metastatic cancer or subjects with cancer that is not metastatic refers to diseases in which subjects have a primary tumor but not one or more secondary tumors. For example, metastatic lung cancer refers to a disease in a subject with or with a history of a primary lung tumor and with one or more secondary tumors at a second location or multiple locations, e.g., in the breast.
The term "associated" or "associated with" in the context of a substance or substance activity or function associated with a disease (e.g., diabetes, cancer (e.g. prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast
cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) or viral disease (e.g., HIV infection associated disease)) means that the disease (e.g., diabetes, cancer (e.g. prostate cancer, renal cancer, metastatic cancer, melanoma, castration- resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) or viral disease (e.g., HIV infection associated disease)) is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
The term "aberrant" as used herein refers to different from normal. When used to describe enzymatic activity, aberrant refers to activity that is greater or less than a normal control or the average of normal non-diseased control samples. Aberrant activity may refer to an amount of activity that results in a disease, wherein returning the aberrant activity to a normal or non-disease-associated amount (e.g. by using a method as described herein), results in reduction of the disease or one or more disease symptoms. In some embodiments, the cancer is one in which mortalin expression is upregulated (overexpressed).
Upregulation of expression comprises expression of mortalin a level that is greater than would normally be expected for a cell or tissue of a given type. Upregulation may be determined by measuring the level of expression mortalin in a cell or tissue. A
comparison may be made between the level of expression in a cell or tissue sample from a subject and a reference level of, e.g. a value or range of values representing a normal level of expression for the same or corresponding cell or tissue type. In some
embodiments reference levels may be determined by detecting expression in a control sample, e.g. in corresponding cells or tissue from a healthy subject or from healthy tissue of the same subject. In some embodiments reference levels may be obtained from a standard curve or data set.
Levels of expression may be quantitated for absolute comparison, or relative
comparisons may be made.
In some embodiments upregulation of expression may be considered to be present when the level of expression in the test sample is at least 1.1 times that of a reference level. More preferably, the level of expression may be selected from one of at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1 , at least 2.2, at least 2.3, at least 2.4 at least 2.5, at least 2.6, at least 2.7, at least 2.8, at least 2.9, at least 3.0, at least 3.5, at least 4.0, at least 5.0, at least 6.0, at least 7.0, at least 8.0, at least 9.0, or at least 10.0 times that of the reference level.
Expression levels may be determined by one of a number of known in vitro assay techniques, such as PCR based assays, in situ hybridisation assays, flow cytometry assays, immunological or immunohistochemical assays.
By way of example suitable techniques involve a method of detecting the level of mortalin in a sample by contacting the sample with an agent capable of binding mortalin and detecting the formation of a complex of the agent and mortalin. The agent may be any suitable binding molecule, e.g. an antibody, polypeptide, peptide, oligonucleotide, aptamer or small molecule, and may optionally be labelled to permit detection, e.g.
visualisation, of the complexes formed. Suitable labels and means for their detection are well known to those in the art and include fluorescent labels (e.g. fluorescein, rhodamine, eosine and NDB, green fluorescent protein (GFP), chelates of rare earths such as europium (Eu), terbium (Tb) and samarium (Sm), tetramethyl rhodamine, Texas Red, 4- methyl umbelliferone, 7-amino-4-methyl coumarin, Cy3, Cy5), isotope markers, radioisotopes (e.g. 32P, 33P, 35S), chemiluminescence labels (e.g. acridinium ester, luminol, isoluminol), enzymes (e.g. peroxidase, alkaline phosphatase, glucose oxidase, beta-galactosidase, luciferase), antibodies, ligands and receptors. Detection techniques are well known to those of skill in the art and can be selected to correspond with the labelling agent. Suitable techniques include PCR amplification of oligonucleotide tags, mass spectrometry, detection of fluorescence or colour, e.g. upon enzymatic conversion of a substrate by a reporter protein, or detection of radioactivity.
Assays may be configured to quantify the mortalin in a sample. Quantified amounts from a test sample may be compared with reference values, and the comparison used to determine whether the test sample contains an amount of mortalin that is higher or lower than that of the reference value to a selected degree of statistical significance.
Quantification of detected mortalin may be used to determine up- or down-regulation or amplification of genes encoding mortalin.
"Contacting" is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including biomolecules, or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated, however, that the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture. Contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be a nucleic acid compound as described herein and a cell (e.g., cancer cell).
Nucleic acid compounds
The aptamers provided herein, including embodiments thereof, are, inter alia, capable of binding cell surface target protein (and particularly binding cell surface mortalin) and internalizing into the cell.
Therefore, the compounds (e.g., nucleic acid compounds) provided herein, including embodiments thereof, may be used to deliver therapeutic or diagnostic molecules into a target molecule-expressing cancer cell. The therapeutic or diagnostic molecule may form part of the compound (e.g., nucleic acid compound) provided herein including
embodiments thereof. Where the therapeutic or diagnostic molecule forms part (e.g., through covalent attachment) of the compound (e.g., nucleic acid compound) provided herein, including embodiments thereof, the therapeutic or diagnostic molecule is referred to as a
"compound moiety" (e.g., therapeutic moiety, imaging moiety). Alternatively, the therapeutic or diagnostic molecule may not form part of the compound (e.g., nucleic acid compound) provided herein, including embodiments thereof, but may be independently internalized by a target molecule-expressing cell upon binding of a compound (e.g., nucleic acid compound) provided herein to the target molecule on said cell. Where the therapeutic or diagnostic molecule does not form part of the compound (e.g., nucleic acid compound) provided herein, the molecule is referred to as a "second compound." The compounds (e.g., nucleic acid compounds) provided herein including embodiments
thereof provide highly specific and efficient means for targeted cancer drug delivery and molecular imaging.
Where a nucleic acid sequence has at least 80% (80% or more) sequence identity to a given sequence, the nucleic acid sequence may have 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to that sequence. In some embodiments, the nucleic acid sequence has at least 80% (80% or more) sequence identity to a nucleic acid that hybridizes to a given sequence. In embodiments, the nucleic acid sequence of a mono-specific aptamer or region of a bi- specific aptamer capable of binding one of the two target molecules is less than 100 (99 or less) nucleotides in length. For a bi-specific aptamer, two nucleic acid sequences may be present, each nucleic acid sequence having a length as described herein. The length calculation may optionally exclude nucleotides or carbon moieties of any spacer, linker or sticky bridge that forms part of the nucleic acid molecule. The length calculation may also optionally exclude any compound moiety conjugated to the nucleic acid, e.g. any nucleic acid moiety such as siRNA, saRNA, miRNA etc.
Where the nucleic sequence is less than 100 (99 or less) nucleotides in length the sequence is one of 99, 98, 97, 96, 95, 94, 93, 92, 91 , 90, 89, 88, 87, 86, 85, 84, 83, 82, 81 , 80, 79, 78, 77, 76, 75, 74, 73, 72, 71 , 70, 69, 68, 67, 66, 65, 64, 63, 62, 61 , 60, 59, 58, 57, 56, 55, 54, 53, 52, 51 , 50, 49, 48, 47, 46, 45, 44, 43, 42, 41 , 40, 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , or 20 nucleotides in length. In embodiments, the nucleic acid sequence is less than 90 nucleotides in length. In embodiments, the nucleic acid sequence is less than 80 nucleotides in length. In embodiments, the nucleic acid sequence is less than 70 nucleotides in length. In embodiments, the nucleic acid sequence is less than 60 nucleotides in length. In embodiments, the nucleic acid sequence is less than 50 nucleotides in length. In embodiments, the nucleic acid sequence is less than 40 nucleotides in length. However, in some embodiments, the nucleic acid sequence is at least 29 nucleotides in length.
In embodiments, the nucleic acid sequence is between 20 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 25 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 30 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 35 and 99 nucleotides in length. In embodiments, the nucleic acid sequence is between 40 and 99 nucleotides in length.
In embodiments, the nucleic acid sequence is between 45 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 50 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 55 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 60 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 65 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 70 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 75 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 80 and 99 nucleotides in length
In embodiments, the nucleic acid sequence is between 85 and 99 nucleotides in length In particular embodiments, the nucleic acid sequence is between 29 and 99 nucleotides in length.
Upon binding a target molecule on the surface of a cell, the nucleic acid compound provided herein (including embodiments thereof) may be internalized by the cell. The term "internalized," "internalizing," or "internalization" as provided herein refers to a composition (e.g., a compound, a nucleic acid compound, a therapeutic agent, an imaging agent) being drawn into the cytoplasm of the cell (e.g. after being engulfed by a cell membrane). In embodiments, the cell is a malignant cell. In embodiments, the cell is a breast cancer cell. In embodiments, the cell is a prostate cancer cell. In embodiments, the cell is a liver cancer cell. In embodiments, the cell is a non-pancreatic cancer cell. In embodiments, the cell is a lung cancer cell. In embodiments, the cell is a leukemia cell. In embodiments, the cell is a non-malignant cell.
In some embodiments the aptamer is a deoxyribonucleic acid. In some preferred embodiments the aptamer may be a ribonucleic acid. The aptamer may be single stranded. Aptamers may contain one or more bases that are chemically modified. In some embodiments, each base of a given type (e.g. A, T, C, G) may contain the same chemical modification.
Aptamers may contain one or more nucleotides that are chemically modified at the 2' position of ribose. In some embodiments, each ribose contains the same chemical modification. In some other embodiments the ribose of certain nucleotides (e.g. A, T, C, G) may be independently modified. Such modifications may include O-methyl modification (2'-OMe), Fluoride modification (2'-F) or amine modification (2-NH2).
The nucleic acid compound provided herein (including embodiments thereof) may include a compound moiety. Where the nucleic acid compound includes a compound moiety, the
compound moiety may be covalently (e.g. directly or through a covalently bonded intermediary) attached to the nucleic acid sequence (see, e.g., useful reactive moieties or functional groups used for conjugate chemistries set forth above). Thus, in embodiments, the nucleic acid compound further includes a compound moiety covalently attached to the nucleic acid sequence. In embodiments, the compound moiety and the nucleic acid sequence form a conjugate. In embodiments, the compound moiety is non-covalently (e.g. through ionic bond(s), van der Waal's bond(s)/interactions, hydrogen bond(s), polar bond(s), or combinations or mixtures thereof) attached to the nucleic acid sequence. In embodiments, the compound moiety is a therapeutic moiety or an imaging moiety. In embodiments, the therapeutic moiety is covalently attached to the nucleic acid sequence. In embodiments, the imaging moiety is covalently attached to the nucleic acid sequence. The term "therapeutic moiety" as provided herein is used in accordance with its plain ordinary meaning and refers to a monovalent compound having a therapeutic benefit (prevention, eradication, amelioration of the underlying disorder being treated) when given to a subject in need thereof. Therapeutic moieties as provided herein may include, without limitation, peptides, proteins, nucleic acids, nucleic acid analogs, small molecules, antibodies, enzymes, prodrugs, cytotoxic agents (e.g. toxins) including, but not limited to ricin, doxorubicin, daunorubicin, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxy anthracin dione, actinomycin D, diphteria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, and glucocorticoid. In embodiments, the therapeutic moiety is an anti-cancer agent or chemotherapeutic agent as described herein. In embodiments, the therapeutic moiety is a nucleic acid moiety, a peptide moiety or a small molecule drug moiety. In embodiments, the therapeutic moiety is a nucleic acid moiety. In embodiments, the therapeutic moiety is a peptide moiety. In embodiments, the therapeutic moiety is a small molecule drug moiety. In embodiments, the therapeutic moiety is a nuclease. In embodiments, the therapeutic moiety is an immunostimulator. In embodiments, the therapeutic moiety is a toxin. In embodiments, the therapeutic moiety is a nuclease. In embodiments, the therapeutic moiety is a zinc finger nuclease. In embodiments, the therapeutic moiety is a transcription activator-like effector nuclease. In embodiments, the therapeutic moiety is Cas9. In embodiments, the therapeutic moiety is gemcitabine or a reactive fragment thereof. "Gemcitabine" as provided herein refers to the chemical compound 4-amino-1-(2-deoxy-2,2-difluoro-13-D- erythropentofuranosyl) pyrimidin-2(1 H)-on. In a customary sense gemcitabine refers to CAS Registry No. 95058-81-4.
In embodiments, the therapeutic moiety is an activating nucleic acid moiety (a
monovalent compound including an activating nucleic acid) or an antisense nucleic acid moiety (a monovalent compound including an antisense nucleic acid). An activating nucleic acid refers to a nucleic acid capable of detectably increasing the expression or activity of a given gene or protein. The activating nucleic acid can increase expression or activity 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control in the absence of the activating nucleic acid. In certain instances, expression or activity is 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or higher than the expression or activity in the absence of the activating nucleic acid.
In embodiments, the therapeutic moiety is an miRNA moiety (a monovalent compound including a miRNA), an mRNA moiety (a monovalent compound including an mRNA), an siRNA moiety (a monovalent compound including an siRNA) or an saRNA moiety (a monovalent compound including an saRNA). In embodiments, the therapeutic moiety is a miRNA moiety. The term "miRNA" is used in accordance with its plain ordinary meaning and refers to a small non-coding RNA molecule capable of post-transcriptionally regulating gene expression. In one embodiment, a miRNA is a nucleic acid that has substantial or complete identity to a target gene. In embodiments, the miRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA. Typically, the miRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the miRNA is 15-50 nucleotides in length, and the miRNA is about 15-50 base pairs in length). In other embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24- 29 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In embodiments, the therapeutic moiety is a siRNA moiety or saRNA moiety as described herein. In embodiments, the therapeutic moiety is an anti-cancer agent moiety. In embodiments, the therapeutic moiety is an mRNA moiety. In embodiments, the therapeutic moiety is a siRNA moiety. In embodiments, the therapeutic moiety is a saRNA moiety. In embodiments, the therapeutic moiety is a cDNA moiety. In embodiments, the therapeutic moiety is a C/EBPalpha saRNA moiety. A "C/EBPalpha saRNA" as provided herein is a saRNA capable of activating the expression of a C/EBPalpha protein. In embodiments, the therapeutic moiety is a HSP70 siRNA moiety.
The compound moiety provided herein may be an imaging moiety. An "imaging moiety" as provided herein is a monovalent compound detectable by spectroscopic,
photochemical, biochemical, immunochemical, chemical, or other physical means. In embodiments, the imaging moiety is covalently attached to the RNA sequence.
Exemplary imaging moieties are without limitation 32P, radionuclides, positron-emitting isotopes, fluorescent dyes, fluorophores, antibodies, bioluminescent molecules, chemoluminescent molecules, photoactive molecules, metals, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), magnetic contrast agents, quantum dots, nanoparticles, biotin, digoxigenin, haptens and proteins or other entities which can be made detectable, e.g., by incorporating a radiolabel into a peptide or antibody specifically reactive with a target peptide. Any method known in the art for conjugating an antibody to the moiety may be employed, e.g., using methods described in Hermanson, Bioconjugate Techniques 1996, Academic Press, Inc., San Diego. Exemplary fluorophores include fluorescein, rhodamine, GFP, coumarin, FITC, Alexa fluor, Cy3, Cy5, BODIPY, and cyanine dyes. Exemplary radionuclides include Fluorine-18, Gallium-68, and Copper-64. Exemplary magnetic contrast agents include gadolinium, iron oxide and iron platinum, and manganese. In embodiments, the imaging moiety is a bioluminescent molecule. In embodiments, the imaging moiety is a photoactive molecule. In embodiments, the imaging moiety is a metal. In embodiments, the imaging moiety is a nanoparticle. The compound (e.g., nucleic acid compound) provided herein may include a ligand moiety. A "mortalin ligand moiety" as used herein refers to a monovalent compound (e.g. substituent) capable of binding (interacting) to mortalin, as described herein. The binding may be specific relative to other cell surface proteins. In embodiments, ligand moiety is a nucleic acid moiety, a peptide moiety or a small molecule moiety (e.g. a small molecule drug moiety). In embodiments, the ligand moiety forms part of the RNA sequence. "Cell surface" as provided herein refers to a protein expressed (e.g. present) on the surface of a cell (i.e. on the cell membrane accessible to the extracellular space). In embodiments, the cellular receptor is expressed (e.g. present) on a cancer cell (i.e. on the cancer cell membrane accessible to the extracellular space). In embodiments, the cancer cell is a non-pancreatic cancer cell and/or a poorly differentiated or undifferentiated cancer cell. In embodiments, the cancer cell is a glioblastoma cell. In embodiments, the cancer cell is a liver cancer cell. In embodiments, the cancer cell is a prostate cancer cell. In
embodiments, the cancer cell is a breast cancer cell. In embodiments, the cancer cell is a leukemia cell.
PHARMACEUTICAL FORMULATIONS
Pharmaceutical compositions of the compounds (e.g., nucleic acid compounds) provided herein may include compositions having a therapeutic moiety contained in a
therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose.
The pharmaceutical compositions of the compounds (e.g., nucleic acid compounds) provided herein may include compositions having imaging moieties contained in an effective amount, i.e., in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, inter alia, on the condition being treated, tested, detected, or diagnosed. When administered in methods to treat a disease, such compositions will contain an amount of active ingredient effective to achieve the desired result, e.g., modulating the activity of a target molecule, and/or reducing, eliminating, or slowing the progression of disease symptoms. Determination of a therapeutically effective amount of a therapeutic moiety provided herein is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure herein. When administered in methods to diagnose or detect a disease, such compositions will contain an amount of an imaging moiety described herein effective to achieve the desired result, e.g., detecting the absence or presence of a target molecule, cell, or tumor in a subject. Determination of a detectable amount of an imaging moiety provided herein is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure herein.
The dosage and frequency (single or multiple doses) administered to a mammal can vary depending upon a variety of factors, for example, whether the mammal suffers from another disease, and its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems. Other therapeutic regimens or agents can be used in conjunction with the methods and compositions described herein including embodiments thereof. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art.
For any composition (e.g., the nucleic acid compounds provided, combinations of an anticancer agent and the nucleic acid compound provided) described herein, the
therapeutically effective amount can be initially determined from cell culture assays.
Target concentrations will be those concentrations of active compound(s) that are
capable of achieving the methods described herein, as measured using the methods described herein or known in the art. As is well known in the art, effective amounts for use in humans can also be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan. In another aspect, a pharmaceutical formulation including the nucleic acid compound as provided herein including embodiments thereof and a pharmaceutically acceptable excipient is provided. In embodiments, the ribonucleic acid includes a compound moiety covalently attached to the nucleic acid sequence. As described above, the compound moiety may be a therapeutic moiety or an imaging moiety covalently attached to the nucleic acid sequence.
In another aspect, the pharmaceutical formulation includes the nucleic acid compound as provided herein including embodiments thereof and a therapeutic agent. In embodiments, the nucleic acid compound and the therapeutic agent are not covalently attached. A therapeutic agent as provided herein refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having a therapeutic effect. In embodiments, the therapeutic agent is an anti-cancer agent. In embodiments, the pharmaceutical formulation includes a pharmaceutically acceptable excipient. "Pharmaceutically acceptable excipient" and "pharmaceutically acceptable carrier" refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions provided herein without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCI, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylase or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not
deleteriously react with the compounds provided herein. One of skill in the art will recognize that other pharmaceutical excipients are useful in the methods and
compositions provided herein. The term "pharmaceutically acceptable salt" refers to salts derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like.
The term "preparation" is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.
The pharmaceutical preparation is optionally in unit dosage form. In such form the preparation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules. Also, the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form. The unit dosage form can be of a frozen dispersion.
Methods of Delivery
Provided herein are methods of delivering compounds (e.g., nucleic acid compounds as provided herein) to a cell through binding the compound to a cell surface target molecule (i.e. mortalin) and internalizing the compound into the cell. Thus, in one aspect, a method of delivering a compound into a cell is provided. The method includes contacting a cell surface target molecule with a compound including a nucleic acid sequence capable of binding to the target molecule. The compound is allowed to pass into the cell thereby delivering the compound into the cell. The passage into the cell may be facilitated
(mediated) by the cell surface target molecule. A "cell surface target molecule" refers to a protein expressed (i.e. presents) on the surface of a cell (i.e. on the cell membrane
accessible to the extracellular space), to which a nucleic acid compound described herein is designed bind. In embodiment, a cell surface target molecule is a tumor cell antigen.
In embodiments, the cell surface target molecule is present on a cell surface. In embodiments, the target molecule forms part of a cellular vesicle upon passage into the cell.
As described above the nucleic acid compounds provided herein including embodiments thereof may be used to deliver compound moieties or compounds (e.g., therapeutic agents or imaging agents) into a cell. Where a compound moiety (e.g., therapeutic moiety or imaging moiety) is delivered into a cell, the compound moiety may be covalently attached to the nucleic acid compound (RNA sequence) provided herein including embodiments thereof. Upon binding of the nucleic acid compound (RNA sequence) to a ligand on a cell, the compound moiety is internalized by the cell while being covalently attached to the nucleic acid compound (RNA sequence). Thus, in one aspect, a method of delivering a compound moiety into a cell is provided. The method includes, (i) contacting a cell with the nucleic acid compound as provided herein including
embodiments thereof and (ii) allowing the nucleic acid compound to bind to a ligand on the cell and pass into the cell thereby delivering the compound moiety into the cell.
Alternatively, where a compound is delivered into a cell, the compound (e.g., a therapeutic agent or an imaging agent) may not be covalently attached to the nucleic acid compound (nucleic acid sequence). Upon binding of the nucleic acid compound provided herein including embodiments thereof to the target molecule on a cell, the nucleic acid compound and the compound provided are internalized by the cell without being covalently attached to each other.
Thus, in another aspect, a method of delivering a compound into a cell is provided. The method includes (i) contacting a cell with a compound and the nucleic acid compound as provided herein including embodiments thereof and (ii) allowing the nucleic acid compound to bind to a target molecule on the cell and the compound to pass into the cell thereby delivering the compound into the cell. In embodiments, the compound is a therapeutic agent or imaging agent. In embodiments, the compound is non-covalently attached to the nucleic acid compound.
In embodiments, the compound includes a therapeutic agent or an imaging agent. In embodiments, the compound is a therapeutic agent or an imaging agent. In
embodiments, the therapeutic agent is an antibody, a peptide, a nucleic acid or a small molecule (e.g. a drug). In embodiments, the imaging agent is a bioluminescent molecule, a photoactive molecule, a metal or a nanoparticle. In embodiments, the compound is an antibody, a peptide, a nucleic acid or a small molecule. In embodiments, the compound is an antibody. In embodiments, the compound is a nucleic acid compound as provided herein including embodiments thereof. In embodiments, the method includes detecting the nucleic acid compound in the cell thereby detecting the cell.
Methods of Treatment
As used herein, "treatment" or "treating," or "palliating" or "ameliorating" are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the underlying disorder. For prophylactic benefit, the compositions may be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made. Treatment includes preventing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition prior to the induction of the disease; suppressing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition after the inductive event but prior to the clinical appearance or reappearance of the disease; inhibiting the disease, that is, arresting the development of clinical symptoms by administration of a protective composition after their initial appearance; preventing re-occurring of the disease and/or relieving the disease, that is, causing the regression of clinical symptoms by
administration of a protective composition after their initial appearance. For example, certain methods herein treat cancer (e.g. non-pancreatic cancer and/or poorly
differentiated or undifferentiated cancer such as prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia,
lymphoma, B cell lymphoma, or multiple myeloma). For example certain methods herein treat cancer by decreasing or reducing or preventing the occurrence, growth, metastasis, or progression of cancer; or treat cancer by decreasing a symptom of cancer. Symptoms of cancer (e.g. non-pancreatic cancer and/or poorly differentiated or undifferentiated cancer such as prostate cancer, renal cancer, metastatic cancer, melanoma, castration- resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus), colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) would be known or may be determined by a person of ordinary skill in the art.
Where combination treatments are contemplated, it is not intended that the agents (i.e. nucleic acid compounds) described herein be limited by the particular nature of the combination. For example, the agents described herein may be administered in combination as simple mixtures as well as chemical hybrids. An example of the latter is where the agent is covalently linked to a targeting carrier or to an active pharmaceutical. Covalent binding can be accomplished in many ways, such as, though not limited to, the use of a commercially available cross-linking agent. An "effective amount" is an amount sufficient to accomplish a stated purpose (e.g.
achieve the effect for which it is administered, treat a disease, reduce enzyme activity, reduce one or more symptoms of a disease or condition, reduce viral replication in a cell). An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a "therapeutically effective amount." A "reduction" of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s ). A "prophylactically effective amount" of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. An "activity decreasing amount," as used herein, refers to an amount of antagonist required to decrease the activity of an enzyme or protein relative to the absence of the antagonist.
A "function disrupting amount," as used herein, refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. For example, for the given parameter, an effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Efficacy can also be expressed as "-fold" increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins). "Patient" or "subject in need thereof refers to a living organism suffering from or prone to a disease or condition that can be treated by using the methods provided herein. The term does not necessarily indicate that the subject has been diagnosed with a particular disease, but typically refers to an individual under medical supervision. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals. In embodiments, a patient is human.
As used herein, the term "administering" means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow- release device, e.g., a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Preferably, administration of the aptamer is intravenous. Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc. By "co-administer" it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies, for example cancer therapies such as chemotherapy, hormonal therapy, radiotherapy, or immunotherapy. The compounds can
be administered alone or can be coadministered to the patient. Coadministration is meant to include simultaneous or sequential administration of the compounds individually or in combination (more than one compound). Thus, the preparations can also be combined, when desired, with other active substances (e.g. to reduce metabolic degradation). The compositions can be delivered by transdermal^, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
Utilizing the teachings provided herein, an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.
In another aspect, a method of treating cancer is provided. The method includes administering to a subject in need thereof an effective amount of the nucleic acid compound as provided herein (including embodiments thereof). In embodiments, the nucleic acid compound further includes an anti-cancer therapeutic moiety. In another aspect, a method of treating cancer is provided. The method includes administering to a subject in need thereof an effective amount of an anti-cancer agent and a nucleic acid compound as provided herein including embodiments thereof. Methods of Detecting a Cell
The nucleic acid compositions provided herein may also be used for the delivery of compounds and compound moieties to a cell expressing a target molecule (i.e. mortalin). As described above, the compounds and compound moieties delivered may be imaging agents useful for cell detections. Thus, in one aspect, a method of detecting a cell is provided. The method includes (i) contacting a cell with the nucleic acid compound as provided herein including embodiments thereof, wherein the nucleic acid compound further includes an imaging moiety, (ii) the nucleic acid compound is allowed to bind to the target molecule on the cell and pass into the cell, (iii) the imaging moiety is detected thereby detecting the cell.
In another aspect, a method of detecting a cell is provided. The method includes (i) contacting a cell with an imaging agent and the nucleic acid compound as provided herein including embodiments thereof, (ii) The nucleic acid compound is allowed to bind to the target molecule on the cell and the imaging agent is allowed to pass into the cell. (iii) The imaging agent is detected thereby detecting the cell.
In embodiments, the cell is a malignant cell. In embodiments, the cell is a breast cancer cell. In embodiments, the cell is a prostate cancer cell. In embodiments, the cell is a liver cancer cell. In embodiments, the cell is a non-pancreatic cancer cell. In embodiments, the cell is a non-malignant cell. In embodiments, the cell forms part of an organism. In embodiments, the organism is a mammal. In embodiments, the cell forms part of a cell culture.
Also included is the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. Aspects and embodiments provided herein will now be illustrated, by way of example, with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference. Throughout this specification, including the claims which follow, unless the context requires otherwise, the word "comprise," and variations such as "comprises" and
"comprising," will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value.
Similarly, when values are expressed as approximations, by the use of the antecedent "about," it will be understood that the particular value forms another embodiment.
Methods provided herein may be performed in vitro or in vivo. The term "in vitro" is intended to encompass experiments with materials, biological substances, cells and/or tissues in laboratory conditions or in culture whereas the term "in vivo" is intended to encompass experiments and procedures with intact multi-cellular organisms.
Brief Description of the Figures
Embodiments and experiments illustrating the principles of the methods and compositions provided herein will now be discussed with reference to the accompanying figures in which:
Figures 1 A to 1G. Aptamer secondary structure and cancer cell-specific
internalisation
(Figure 1A) The secondary structures of P19 and P1 , selected from randomized N40 RNA libraries, were predicted using the Mfold software. (Figure 1 B) Cy3-labeled P19 and P1 aptamers were assessed for binding efficiency by flow cytometry in PANC-1 and control Huh7 cells. The data show the measurements of positively stained cells and representative of triplicates. (Figure 1C) The pancreatic cell lines PANC-1 , AsPC-1 , MIA PaCa and Capan-1 were treated with 100 nM of the Cy3-labeled P19 and P1 aptamer and analysed by confocal microscopy. All of the pancreatic lines showed punctate regions of Cy3 labeling. Non pancreatic lines including Huh7, HepG2, MCF7 and PC3 cells were also treated with 100nM of Cy3-labeled P19 and P1 aptamers. No Cy3 signal was observed. Scale bar: 10 μηι (Figure 1 D) Normal primary pancreatic cells were treated with 100nM Cy3-labeled aptamers and imaged by confocal microscopy. Scale bar: 10 μηι (Figure 1 E) Flow cytometry analysis of normal T and B cells treated with Cy3- labeled P19 and P1 aptamers. (Figures 1 F and 1G) The dissociation constant (KD) was measured by flow cytometry using increasing concentrations of Cy3-labeled aptamers (from 15.6 to 500 nM). Mean fluorescence intensity (MFI) was measured and calculated using a one-site binding model for non-linear regression.
Figure 2. P19 Aptamer internalisation into Glioblastoma line U251. Nucleus and tP19 are dye labelled.
Figures 3A to 3D. Target identification for P19. (Figure 3A) PANC-1 cells were incubated with fluorescently labeled P19 RNA (200nM) and increasing amounts (1 uM) of unlabelled each clone aptamers as competitors against the labeled RNA. The
fluorescence intensity was quantified in the presence of increasing amounts of competitors using confocal microscopy and analysed statistically. One-way ANOVA: P<0.05. (Figure 3B) SDS Page gel was used to run samples after retrieving target proteins: (M) markers, P19 (lane 1), P1 (lane 2) NO (irrelevant RNA, lane 3). Arrow indicated the target. (Figure 3C) and (Figure 3D) Peptide matching and MS/MS spectrum of P19 and P1 affinity-purified peptides. The detected amino acids were highlighted. The full length amino acid sequence corresponds to the amino acid sequence of human mitochondrial precursor stress-70 protein (SEQ ID NO: 9) in Figures 3C and 3D. Gel shift assays. Native PAGE gel was used to run. The shifted band was observed in both P19 and PL Figure 4: In vivo assays. For gemcitabine resistant tumor test, ASPC-1 pancreatic cancer cells were engrafted in 5-weeks-old female NOD/SCI D mice. After engraftment, aptamer were treated through tail vein. * t-test: P value <0.05.
Figures 5A to 5C: Cell proliferation assays. Cell proliferation was assessed after 72 hours of exposure to tP19 (control, triangles) or tP19-MMAE (circles) in (Figure 5A)
PANC-1 pancreatic cancer cells, (Figure 5B) U251 undifferentiated glioblastoma cells, and (C) HCT1 16 undifferentiated colon cancer cells.
Figure 6: Internalisation of P1 , P19 and tP19 into mortalin positive glioblastoma (U251-MG) and colon cancer [colorectal carcinoma (HCT116)] cells. U251-MG and HCT1 16 cells were treated with 200 nM of Cy3-labeled P1 , P19, and tP19 aptamers and analyzed by live-cell confocal microscopy for internalization. The punctuate regions of Cy3 labeling indicate cross-activity of the pancreatic-targeting aptamers in glioblastoma and colorectal carcinoma cells. Scale bar: 10 μηι
Figures 7A to 7C: Validation of interaction of aptamer with mortalin. (Figures 7A and 7B) Charts showing biosensor analysis of the mortalin-aptamer interaction. Binding of mortalin to P19 and P1 is shown. Biotinylated P19 or P1 was bound to a streptavidin- coupled carboxyl methyl dextran surface and binding was measured using the surface plasmon resonance (SPR) technique. The increase in response units (RUs) from the
baseline was measured. (Figure 7C) Photograph of a gel shift assay of the mortalin- aptamer interaction. The shifted band represents binding of mortalin to P1 or P19.
Examples Example 1
We initially set out to identify aptamers specific to pancreatic cancer. Pancreatic ductal adenocarcinoma (PDAC) is the fourth most common cause of cancer death in the United states, accounting for 30,000 deaths yearly in the US (Jemal et al, 2009, CA Cancer J. Clin 59: 225-249). Currently, the most effective single agent gemcitabine achieves an improved 1 year survival rate from 16 to 19%. The limited success of conventional treatments is due to the profound resistance of PDAC cells towards anti-cancer drugs emerging from the efficient protection against chemotherapeutic drugs (Wong et al., (2009) Nat Rev Gastroenterol Hepatol 6: 412-422). It is therefore imperative to develop new therapeutic strategies for this devastating disease.
In vitro selection of RNA aptamers to the intact target cells
We employed a 2'-fluropyrimidine-RNA (2'F-RNA) combinatorial library and isolated 2'F RNA aptamers through a whole cell-based SELEX for the targeted delivery. The human pancreatic adenocarcinoma cells (Panc-1) were used as target cells for the aptamer selection and negative cells were used for the counter-selection steps to remove irrelevant binding. A library of 2'F RNAs was used to increase nuclease-resistance and enhance aptamer folding. To isolate 2'F RNA aptamers binding to intact cells, a library of approximately 440 different 2'F RNA molecules, containing a 40-nt-long random sequence flanked by defined sequences, was screened by SELEX. After 14 cycles of selection, the highly enriched aptamer pools were cloned (see Table 1).
Full length P11 GGGAGACAAGAAUAAACGCUCAAAUGAUUGCC SEQ ID NO: 5
CAUUCGGUUAUGCUUGCGCUUCCUAAAGAGCU
UCGACAGGAGGCUCACAACAGGC
Full length P7 GGGAGACAAGAAUAAACGCUCAAGGCCAUGUU SEQ ID NO: 6
GAAUGCCCAACUAAGCUUUGAGCUUUGGAGCU UCGACAGGAGGCUCACAACAGGC
Full length P6 GGGAGACAAGAAUAAACGCUCAACAAUGGAGC SEQ ID NO: 7
GUUAAACGUGAGCCAUUCGACAGGAGGCUCAC
AACAGGC
Consensus GAAUGCCC SEQ ID NO: 8
Table 1 : Aptamer sequences
For comparison of individual sequences and structures, two different groups of aptamers were selected. P19 and P1 showed multi-stem loops and the structural similarity containing a common motif, GAAUGCCC (SEQ ID NO: 8). Minimum energy structural analyses of the selected aptamers were carried out using Mfold30. As depicted, the calculated secondary structures of the RNA aptamers contained several stem-loop regions (Fig. 1a). Pancreatic cancer internalization of RNA aptamers
Flow cytometric analyses of the individual clones revealed the aptamers bound to the target cells (Fig. 1 b). In order to determine that the selected two different aptamers were internalized in the pancreatic cancer cells, the live-cell confocal microscopy with the Cy3- labeled RNA transcripts was carried out. The RNA aptamers were internalized in target cells Panc-1 , but not control cells (Fig. 1 c). Figure 1 C showed the aptamers aggregated within the cytoplasm, suggesting that the RNA aptamers enter into cells via receptor- mediated endocytosis. To test that the aptamers recognize different types of pancreatic cancer cells, five different pancreatic cancer cell line cells were tested for aptamer uptake. All of the tested aptamers are internalized in the different pancreatic cancer cells (Fig. 1c). In order to determine the selected aptamers binds to the normal pancreatic cell primary epithelial pancreatic cancer cells were incubated with Cy3 labeled aptamers. The aptamers didn't get internalized in the pancreatic epithelial normal cells (Fig.1 d), indicating that the RNA aptamers bound to and were internalized in cancer cells specifically.
Furthermore, to investigate the cancer specificity, Cy3 labeled P1 and P19 were tested on human pancreatic cancer and normal pancreas tissue specimens by histopathology. Based on the histopathology in human PC specimens, the aptamer score was divide into lower level ( <7), medium level (>7 and <14) and high level (>14 and <20). Only the specimens from 3 cases showed without prominent P1 or P19 positive staining (lower level). And these cases showed significantly longer survival (p=0.011 at P1 ,p=0.013 at P19) which means less malignant. The others show high level P1 and P19 positive rate in 43 and medium level in 26 patients. The survival period is 21.0± 2.64 months in high level P1 group, 15.9± 3.17 months in medium level P1 group and 13.0± 4.29 months in low level P1 group. P19 and P1 follow the high tumor grades with low survival rate. P1 and P19 recognize cancer specifically. There is almost no or only scanty P1 or P19 positive staining noted in non-tumor part of pancreas and breast cancer specimen as control. As cell binding assays showed, both P19 and P1 recognized pancreatic cancer tissues specifically, not normal pancreas tissues. The representative images showed in Figure 1e. The measured binding affinity (Kd) of P19 was 13.07nM. P1 was 2.2 nM (Fig. 1g). In cancer tissue staining histopathologically, both the P1 and P19 present in cytoplasm and the correlation coefficient between aptamer scores of P1 and P19 is 0.891 (Fig. 1f)- Other normal tissues such as liver, spleen, and kidney etc showed negative staining including T and B cells (Fig. 2a and b). The internalization assays were screened in other type of cancers.
To identify that the common motif, GAAUGCCC, was related with the binding motif, the P19 was truncated to the size of 28mer including the common motif based on the expected structure by Mfold (tP19, SEQ ID NO: 1). The Kd value of truncated P19 was 8.77nM. The minimized P19 got internalized into Panc-1 and AsPC-1 cells in the same way of full length of P19. Cell binding assays was screened in other types of cancers like liver, breast and prostate cancers. The truncated P19 showed negative reaction, indicating that it is pancreatic cancer specific RNA aptamers. Taken together, these results show that the P1 and P19 recognize pancreatic cancer cells.
Identification of cell membrane target of the RNA aptamer
To verify that the each aptamer was binding to the same cell surface proteins, Panc-1 cells were incubated with fluorescently labeled P19 RNA (200 nM) and increasing amounts (1 μΜ) of unlabeled each clone aptamers as competitors against the labeled one (Fig. 3a). The fluorescence intensity of labeled RNAs was measured in the presence of increasing amounts of competitors using confocal microscopy. The intensity of P19
competed with unlabeled P19 was significantly decreased; others showed insignificant changes, indicating that each RNA aptamer has the different binding sites or bind the different targets. To identify the target ligands of aptamer on cell membrane, cell membrane proteins were retrieved by biotinylated aptamers. The retrieved proteins were run in SDS-PAGE gel. P19 and P1 showed the band sized around 75 kDa (Fig. 3b). The aptamer captured proteins were analyzed by MASS-SPEC for peptide matching fingerprinting. For the target ligands of P19 and P1 , mitochondrial Hsp70 which is mortalin was identified (Fig. 3c and d). To validate the results of MASS-SPEC, gel shift assays and surface plasmon resonance (SPR) assays were used. In gel shift assays, the shifted band was observed in both P19 and P1 (Fig. 3c and d). As shown in SPR sensogram, P1 and P19 bound to the mortalin. Regarding the aptamer binding ligands on cell surface, the tumor-associated
mitochondrial Hsp70 was identified as the target ligands of the P19 and P1 , even though the further research is necessary to figure out whether the common motif is the binding site against the target protein. Example 2: Determining the effect of anti-HSP70 RNA aptamers in mitochondrial apoptosis
The data indicate that cancer cells become 'addicted' to Hsp70 through chaperone's activity on multiple survival pathways, specifically cancer specific features such as hypoxia, oxidative stress, and altered pH. The overexpression of Hsp70 in pancreatic adenocarcinoma increases tumorgenicity and inhibit apoptosis (Aghdassi, Phillips et al.
2007). Hsp70 is constitutively expressed on cell surface of human tumor, not normal cells (Hantschel, Pfister et al. 2000, Shin, Wang et al. 2003). The translocalization of Hsp70 on the cancer cell surface and organelle distribution is related to their specific lipid compositions (Arispe, Doh et al. 2004, Gehrmann, Liebisch et al. 2008, Mahalka, Kirkegaard et al. 2014). Interestingly, silencing of Hsp70 with antisense results in massive death of cancer cells, whereas non-cancer cells are not affected (Nylandsted, Rohde et al. 2000). Inhibition of Hsp70 is independent of classical apoptosis pathway such as Bcl- 2 and Bcl-XL(Nylandsted, Rohde et al. 2000). Its high expression in tumors correlates with therapy resistance and poor prognosis (Sliutz, Karlseder et al. 1996, Elpek, Karaveli et al. 2003). Hsp70 promotes chemoresistance by blocking Bax mitochondrial translocation, pro-apoptotic protein of the mitochondria apoptosis (Yang, Wang et al.
2012) . Hsp70 indirectly blocks apoptotic pathways at premitochondrial and mitochondrial level, and a post-mitochondrial stage (Garrido, Brunei et al. 2006). Hsp70 also protects mitochondrial from damage by oxidative stress (Polla, Kantengwa et al. 1996). Hsp70 plays important role in the assembly of the cytochrome c oxidase, mitochondria transmembrane protein (Bottinger, Guiard et al.2013).
Cancer cells acquiring mitochondria from endothelial display chemoresistance, implicating chemoresistance linked to mitochondria (Pasquier, Guerrouahen et al.
2013) . Therefore, mitochondria are gatekeeper of response to chemotherapy and good target to reduce chemoresistance. The most differentially expressed mitochondrial proteins between normal and cancerous cells are cytochrome oxidase and hsp70 (Chen, Chou et al. 2011 , Bottoni, Giardina et al. 2012). Mitochondria is the cellular powerhouses, primary source of energy. Because cancer cells are demanding high energy, they are much more dependent to mitochondria than normal cells. Peptide targeting hsp70 is sensitizing to apoptotic cell death (Rerole, Gobbo et al. 201 1). In our data, the aptamer binding ligands expressed on cell surface were identified tumor associated Hsp70. It is necessary to inhibit hsp70 function to induce mitochondria apoptosis affecting cancer cells specifically and to diminish chemoresistance. To test chemoresistant tumor regression in mice, twelve 5-weeks-old female
NOD/SCID mice were injected subcutaneously (S.C.) on the flank with 2.8x106 ASPC-1 gemcitabine resistant pancreatic cancer cells in 0.05 ml PBS with 0.15 ml matrigel. After 3 weeks, mice were divided into four groups. One group served as untreated controls and the others injected with P1 , P19 and P1 combined with P19. Aptamer were injected through tail vein. Animals were injected 4 times at days 1 , 3, 5, and 7, and were sacrificed at day 9. Comparing control, significant tumor growth inhibition showed in aptamer treated group (Figure 4).
We will measure mitochondrial apoptosis by anti-hsp70 RNA aptamer. To doing so, we measure the release of mitochondrial apoptotic proteins such as Cytochrome C,
Smac/DIABLO, HtrA2/0mi and AIF from mitochondrial fractionations by standard immune blotting procedure after treatment of anti-hsp70 RNA aptamer. Mitochondrial morphology changes will be performed by TEM (Transmission Electron Microscopy). To measure mitochondria metabolomics, oxygen consumption and glycolytic capacity by oxidative phosphorylation (OXPHOS) inhibition will be measured XF analyzer (Seahorse
Bioscience) with or without oligomycin and anti-hsp70 RNA aptamer for real time metabolic analysis.
Briefly, cells will be plated into XF96 cell culture microplates before the experiment. To measure the response to PXHPOS inhibition, oligomycine (positive control) and anti- hsp70 RNA aptamer (test material) and rotenone (XF Cell Mi to Stress kit, Seahorse Bioscience) will be sequentially injected. To measure extracellular acidification rate (ECAR) and lactate production, cells will be plated in base assay. Glucose, oligomycin, anti-hsp70 RNA aptamer, and 2-deoxy-glucose will be sequentially injected (XF
Glycolysis stress test kit, Seahorse Bioscience). Experiments will run using a XF96 analyzer and raw data will be normalized to metabolically active cells, evaluated Hoechst 33342positive/propidium iodide (PI) negative by imaging system immediately after each experiment. As an alternative way, lactate ELISA kit will be used. In response to
OXPHOS suppression, cells increase their glucose uptake and glycolysis activity to maintain the intracellular level of ATP. The components of glycolysis and OXPHOS in the bioenergetic constitution will be calculated. To quantify ATP present, an indicator of metabolically active cells, CellTiter Glo luminescent cell viability assays will be used following manufacture's instruction (Promega). Cytochrome C (COX) activity is assayed calorimetrically.
Example 3: Differentiated and non-differentiated cancers
Having identified aptamers P19 and P1 as binding mortalin, which is known to be highly expressed in cancers (Lu et al., 2011), we investigated why in experiments these aptamers were internalised into pancreatic cancer cells, but not into Huh7, HepG2, MCF7 or PC3 cancer cells (as mentioned in Example 1 above, and Figure 1 c).
We looked for characteristics shared by each of the cell lines used in our microscopy analysis of P1 and P19 internalisation. Panc-1 was cultured from a 56-year-old male with an adenocarcinoma in the head of the pancreas which invaded the duodenal wall. Metastases in one peripancreatic lymph node were discovered during a pancreaticoduodenectomy. It has poor differentiation.
AsPC-1 was obtained from a 62-year-old woman with adenocarcinoma of the head of the pancreas and metastases to several abdominal organs. It has poor differentiation.
MIA PaCa is an established cell line from an undifferentiated human pancreatic carcinoma. The tumour was taken from a 65 year old Caucasian male. It has poor differentiation. Capan-1 was obtained from a liver metastasis of a 40-year-old male with a pancreas adenocarcinoma in the head of the pancreas.
HuH-7 is a well differentiated hepatocyte derived cellular carcinoma cell line that was originally taken from a liver tumor in a 57-year-old Japanese male in 1982.
Hep G2 is a perpetual cell line which was derived from the liver tissue of a 15-year-old Caucasian American male with a well-differentiated hepatocellular carcinoma.
MCF7 is a breast cancer cell line isolated in 1970 from a 69-year-old Caucasian woman. This cell line retained several characteristics of differentiated mammary epithelium, including the ability to process estradiol via cytoplasmic estrogen receptors and the capability of forming clones.
PC3 cell lines were established in 1979 from bone metastasis of grade IV prostate cancer in a 62-year-old Caucasian male. Although originally considered to show characteristics of poorly-differentiated adenocarcinoma, Tai et al (2012) recognized that PC3 cells were instead characteristic of prostatic SCNCs.
We realised that a common feature shared by the Huh7, HepG2, MCF7 or PC3 cancer cells, as compared to our pancreatic lines was that these are samples of differentiated cancers.
We hypothesized that aptamers P1 and P19 would therefore bind and internalise into other undifferentiated or poorly differentiated cancers, in addition to pancreatic cancer lines.
We therefore repeated the internalization assays using U251 cells, which are an undifferentiated glioblastoma cell line derived from a malignant glioblastoma tumour by explant technique (Lorenzi et al (2009)), and which are known to overexpress mortalin (Takano et al., 1997), and HCT1 16 colorectal carcinoma cells, also known to overexpress mortalin (Wu et al, 2013).
As shown in Figures 2 and 6, aptamers P1 , P19, and tP19 internalized in Glioblastoma cell line U251 , confirming that mortalin binding aptamers could target, and be internalised by, undifferentiated non-pancreatic cancer cells, in addition to pancreatic cancer cells.
Example 4: C/EBPa-conjugated P19 and P1 demonstrate strong anti-proliferation in undifferentiated cancer cells as well as pancreatic cancer cells.
Chemotoxine, monomethyl auristatin E (MMAE), is a very potent antimitotic agent that inhibits cell division by blocking the polymerization of tubulin. However, it is prohibited to use by drug itself because of its high toxicity.
We linked toxic molecule MMAE to a mortalin binding aptamer (tP19) and investigated the effect on cell proliferation in culture.
As shown in Figure 5, the mortalin binding aptamer-MMAE construct inhibited cell proliferation in (a) PANC-1 pancreatic cancer cells, (b) U251 undifferentiated glioblastoma cells, and (c) HCT1 16 undifferentiated colon cancer cells after 72 hours. Example 5: Methods
Cell lines
To use intact cells as targets for SELEX, PANC-1 (CRL-1469), Capan-I (HTB-79), CFPAC-1 (CRL-1918), MIA PaCa-2 (CRL-1420), BxPC-3 (CRL-1687) and AsPC-1 (CRL- 1682) were purchased from ATCC. Primary human pancreatic epithelial cells were purchased in cell systems. The cells were cultured according to the cell bank's
instructions.
Whole-Cell SELEX (systemic evolution of ligands by exponential enrichment)
The SELEX cycle was performed basically as described by Tuerk and Gold 22. In vitro selection was carried out essentially as described 52, with a few modifications for this study. For the first round, 5 nmol of the RNA library was incubated with target cells (Pane- I) in 1 ml binding buffer (PBS with Ca2+ and Mg2 +, 0.01 % BSA, yeast tRNA). RNAs that bound to target cells were recovered, amplified by RT-PCR and in vitro transcription, and used in the following selection rounds. In subsequent rounds, the RNA concentration was reduced by 10-fold and incubation time was reduced to create a more stringent condition.
To remove RNAs nonspecifically binding the target cells, the counter-selection was carried out.
Live cell confocal imaging
For the internalization, the cells were grown in 35mm glass bottom dishes (MatTek,
Ashland, MA, USA) with seeding at 1 x 105 cells in medium for 24hrs. The RNAs were labelled with Cy3 using the Cy3 Silencer siRNA labeling kit (Ambion, TX, USA.). Cy3- labeled RNAs at 1 OOnM were added to the cells and incubated for 1 hour. The images were taken using a Zeiss LSM 510 Meta Inverted 2 photon confocal microscope system using a C-Apo 40x/l.2NA Water immersion objective.
For competition assays, 200 nM of Cy3 labeled P19 aptamer was used to compete with either unlabeled clones (1 μΜ). The fluorescence intensity was quantified in the presence of increasing amounts of competitors using confocal microscopy and analyzed statistically. Oneway ANOV A was used for statistical significant analysis (P<0.05).
Binding assay by flow cytometric analysis
Aptamer binding and uptake was also assessed by flow cytometry. For the assay, cells were detached using a non-enzymatic cell dissociation solution, washed with PBS and suspended in binding buffer. Next, Cy3-labeled aptamers were added and incubated for 1 hours at 37°C. The binding of individual aptamers for the staiiing pool as a control to pancreatic cancer cells was performed in triplicate. Flow cytometry was performed on a Cyan (Beckman Coulter counter) and Fortessa. The data were analyzed with Flow Jo software.
To determine the binding affinity of aptamers to Panc-1 , the median fluorescence intensity (MFI) of each concentrations was determined and subtracted the mean fluorescence background of controls from the corresponding MFI of aptamers described by Sefah et al53.
The dissociation constants were calculated using one site binding non-linear curve regression with a Graph Pad Prism (GraphPad Software, La Jolla, California, USA).
Human Pancreatic cancer specimens in histological quantification
The samples were stained by aptamer P1 and P19 respectively. We linked P1 and P19 with Cy3 as marker and DAPI stating was performed for cell nuclei as background. The
sample sections were then examined under microscope at 1 OOX magnification, and the aptamer content in each slide of pancreatic cancer was determined by measuring the average of positive-stained particle numbers in five independent fields randomly. A total of 72 patients (45 male and 27 female) of pancreatic adenocarcinoma had undergone surgical intervention between January 2008 and December 2010 in National Taiwan University Hospital. Diagnosis was settled by pathologic analysis of specimen. All of the enrolled patients fulfilled the informed consent to receive the procedure, and this study was Institutional Review Board approved of NTUH.
Target protein identification and validation
P1 and P19 were labeled with biotin at the 3' end. Target membrane proteins were isolated following procedures described by Daniels et al or extracted by ProteoExtract Native Membrane protein Extraction Kit (Calbiochem). Agilent 6520 Q-TOF mass spectrometer used to identify aptamer retrieved proteins. A BIAcore T100 (GE
Healthcare, Uppsala, Sweden) was used to measure binding by surface plasmon resonance (SPR) technique. BIAevaluation software (GE Healthcare) was used for analysis. Gel shift assay was also performed to validate the target ligand binding. WST-1 assay.
The WST-1 measurement was performed according to the manufacturer's standard protocol (Takara Bio Europe). Briefly cells were culture into 96-well plate at a density of 2.5x105 cells per well as three independent replicates. 10μΙ of the WST-1 reagent was added and incubated for a duration of 1 hour with spectrophotometry readings at 420 nm and 620 nm taken every 15 minutes.
Biosensor assay
The Biacore T100 (GE Healthcare, Uppsala, Sweden) was used to monitor label-free the aptamer-vimentin interactions in real time. Biotinylated aptamers were coupled to a streptavidin-coated Biocore chip (SensorChip SA, BR-1003-98, General Electric
Company) by an injection in binding buffer at concentration of 25 μg/mL at 10 μΙ_/ηιίη. To measure binding, mortalin protein was injected at a flow rate of 10 μΙ_/ηιίη. After binding, the surface was regenerated by injecting 50 mM NaOH at flow rate of 15 μΙ_ per minute for 20 seconds. Data from the control surface was subtracted. BIAevaluation software
(GE Healthcare) was used for analysis. The binding data were fit to a 1 : 1 binding with a mass transfer model.
Electrophoretic mobility shift assay (EMSA)
A gel shift assay was performed to validate the target ligand binding. The purified RNAs were incubated with mortalin in binding buffer and the RNA-mortalin complexes were run on a 7% native polyacrylamide gel containing 2% glycerol. Bands were visualized using SYBR Gold (Invitrogen).
Aptamer internalization studies.
1 x 105 cells of PANC-1 were seeded in 35-mm glass-bottom dishes (MatTek, Ashland, MA) and grown in appropriate media for 24 h. Aptamer RNA was labeled with Cy3 fluorescent dye using the Cy3 Silencer siRNA labeling kit (Thermo Fisher Scientific, Waltham, MA). Cy3-labeled aptamers were added to the cells at 200 nM and incubated for 2 h. Live-cell confocal imaging was performed with a Zeiss LSM 510 Meta inverted two-photon confocal microscope system using a C-Apo 40x/1.2NA water immersion objective, and AIM 4.2 software (Carl Zeiss, Jena, Germany).
References
Lu, W-J, Lee, N.P., Kaul., S.C>, Lan, F., Poon, T.R.P, Wadhwa, R., Luk, J.M., Mortalin - p53 interaction in cancer cells is stress dependent and constitutes a selective target for cancer therapy; Cell Death and Differentiation (201 1) 18, 1046-1056;
Tai, S., Sun, Y., Squires, J.M., Zhang, H., Oh, W.K., L, C-Z, Huang, J (2011) PC3 is a cell line characteristic of prostatic small cell carcinoma Prostate 71 (15) 1668-1679
Lorenzi, P.L., Reinhold, W.C., Varma, S., Hutchinson, A.A>, Pommier, Y., Chanock, S.J., Weinstein, J.N. (2009) 8(4) 713-724.
Yamamoto, K, Tateishi, K, Kudo, Y, Sato, T, Yamamoto, S, Miyabayashi, K, et al.
(2014). Loss of histone demethylase KDM6B enhances aggressiveness of pancreatic cancer through downregulation of C/EBPalpha. Carcinogenesis
Takano S, Wadhwa R, Yoshii Y, Nose T, Kaul SC, Mitsui Y. (1997) Elevated levels of mortalin expression in human brain tumors. Exp Cell Res. 237(1):38-45.
Wu, P-K., Hong, S-K., Weeranki, S., Karkhanis, M., Starenki, D., Plaza, J.A., Park, J-l (2013) A Mortalin/HSPA9-mediated switch in tumor suppressive signaling of
Raf/MEK/Extracellular Signal-regulated kinase. Mol. Cell. Biol. vol. 33 no. 20 4051-4067
Claims
1. A method for treating non-pancreatic cancer in a subject, the method comprising administering a mortalin binding aptamer to the subject.
2. The method of claim 1 wherein the non-pancreatic cancer is a poorly differentiated or undifferentiated cancer.
3. The method of claim 1 or claim 2 wherein the cancer is a metastatic or invasive cancer.
4. The method according to any one of the preceding claims wherein the cancer is a malignant cancer.
5. The method according to claim 1 wherein the cancer is poorly differentiated or undifferentiated glioblastoma or colorectal cancer, or liver, breast or prostate cancer.
6. The method according to any one of the preceding claims wherein the treatment comprises intravenous administration of the aptamer.
7. The method according to any one of the preceding claims wherein the aptamer comprises the sequence GAAUGCCC, and is at least 29 nucleotides in length.
8. The method according to claim 7 wherein the aptamer comprises a sequence having at least 80% identity to SEQ ID NO: 1 , and is at least 29 nucleotides in length.
9. The method according to any one of the preceding claims wherein the aptamer does not consist of SEQ ID NO: 1.
10. The method according to any one of the preceding claims wherein the aptamer has at least 80% identity to SEQ ID NO: 2 or SEQ ID NO: 4.
11. The method according to any one of the preceding claims wherein the aptamer is linked to a therapeutic agent.
12. The method according to claim 11 wherein the therapeutic agent is an anti-cancer therapeutic agent.
13. The method according to any one of the preceding claims wherein the method further comprises administering an anti-cancer therapeutic agent.
14. A method for identifying a non-pancreatic cancer cell in a sample, the method comprising contacting the sample with a mortalin binding aptamer.
15. A method for diagnosing a non-pancreatic cancer in an individual, the method comprising contacting a sample from the individual with a mortalin binding aptamer.
16. The method of any one of claims 14 to 15 wherein the non-pancreatic cancer or non-pancreatic cancer cell is a poorly differentiated or undifferentiated non-pancreatic cancer or cell.
17. A mortalin binding aptamer for use in a method of treating non-pancreatic cancer.
18. Use of a mortalin binding aptamer in the manufacture of a medicament for the treatment of non-pancreatic cancer.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662316041P | 2016-03-31 | 2016-03-31 | |
| US62/316,041 | 2016-03-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017173237A1 true WO2017173237A1 (en) | 2017-10-05 |
Family
ID=59966496
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/025320 Ceased WO2017173237A1 (en) | 2016-03-31 | 2017-03-31 | Mortalin binding aptamers |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017173237A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355294A (en) * | 2018-11-16 | 2019-02-19 | 温州医科大学附属第医院 | Nucleic acid aptamer that specifically recognizes Vimentin and its application |
| US10864283B2 (en) * | 2016-01-05 | 2020-12-15 | Industry-University Cooperation Foundation, Hanyang University | Composition for preventing or treating keloid or hypertrophic scars |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6872712B1 (en) * | 1999-03-25 | 2005-03-29 | Yeda Research And Development Co. Ltd. | Cyclic glycerophosphates and analogs thereof |
| US20060188883A1 (en) * | 2003-03-08 | 2006-08-24 | Murray Graeme I | Markers for colorectal cancer |
| US20100221183A1 (en) * | 2006-10-10 | 2010-09-02 | Shayne Squires | Peptides for treating and diagnosing cancers and methods for using the same |
-
2017
- 2017-03-31 WO PCT/US2017/025320 patent/WO2017173237A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6872712B1 (en) * | 1999-03-25 | 2005-03-29 | Yeda Research And Development Co. Ltd. | Cyclic glycerophosphates and analogs thereof |
| US20060188883A1 (en) * | 2003-03-08 | 2006-08-24 | Murray Graeme I | Markers for colorectal cancer |
| US20100221183A1 (en) * | 2006-10-10 | 2010-09-02 | Shayne Squires | Peptides for treating and diagnosing cancers and methods for using the same |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10864283B2 (en) * | 2016-01-05 | 2020-12-15 | Industry-University Cooperation Foundation, Hanyang University | Composition for preventing or treating keloid or hypertrophic scars |
| CN109355294A (en) * | 2018-11-16 | 2019-02-19 | 温州医科大学附属第医院 | Nucleic acid aptamer that specifically recognizes Vimentin and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12138279B2 (en) | Bi specific aptamer | |
| EP3206719B1 (en) | Rna aptamers against transferrin receptor (tfr) | |
| US11261449B2 (en) | Anti-cancer RNA aptamers | |
| US11845938B2 (en) | Aptamer compositions and the use thereof | |
| Zhang et al. | Expression and significance of TLR4 and HIF-1α in pancreatic ductal adenocarcinoma | |
| US20180243436A1 (en) | Therapeutic cell internalizing conjugates | |
| EP3244910B1 (en) | Cell penetrating antibodies | |
| US11427826B2 (en) | RNA aptamers against transferrin receptor (TfR) | |
| WO2017173237A1 (en) | Mortalin binding aptamers | |
| US11180761B2 (en) | PDGFR RNA aptamers | |
| US11759530B2 (en) | TKI permeability enhancers | |
| US11674184B2 (en) | Enhancing radiation sensitivity comprising administering PMVK inhibiting siRNA and shRNA | |
| US20240052355A1 (en) | APTAMER-siRNA FUSIONS | |
| EP3880820A1 (en) | Vdac1 silencing molecules and use thereof | |
| CN108159419A (en) | Induce application of the substance of IRF8 expression in the drug for preparing treatment androgen receptor unconventionality expression associated diseases | |
| CN112007164B (en) | Application of reagent for reducing expression or activity of TCRP1 in preparation of anti-liver cancer active drug for enhancing lycorine | |
| WO2025003680A1 (en) | Method for identifying specific cancer patient subgroups and novel cancer therapy for specific cancer patient subgroups | |
| US8361984B2 (en) | Small interfering RNAs and methods for prevention, inhibition and/or treatment of malignant progression of breast cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17776755 Country of ref document: EP Kind code of ref document: A1 |
