WO2017139544A1 - Qtls associated with and methods for identifying lodging resistance in soybean - Google Patents
Qtls associated with and methods for identifying lodging resistance in soybean Download PDFInfo
- Publication number
- WO2017139544A1 WO2017139544A1 PCT/US2017/017326 US2017017326W WO2017139544A1 WO 2017139544 A1 WO2017139544 A1 WO 2017139544A1 US 2017017326 W US2017017326 W US 2017017326W WO 2017139544 A1 WO2017139544 A1 WO 2017139544A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- chromosome
- marker locus
- allele
- soybean
- gml3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/54—Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
- A01H6/542—Glycine max [soybean]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- This disclosure relates to compositions and methods for identifying and/or selecting soybean plants or soybean germplasm that have resistance to lodging, have improved resistance to lodging, or are susceptible to lodging, where the methods use molecular genetic markers to identify, select and/or construct plants with lodging resistance.
- This disclosure also relates to soybean plants and soybean germplasm that display resistance or improved resistance to lodging that are generated by the methods described herein.
- Soybean a legume
- Soybean productivity is a vital agricultural and economic consideration.
- a continuing goal of plant breeding is to develop stable, high yielding soybean plants that are agronomically sound in order to maximize the plant yield.
- Specific chromosomal loci can be mapped in an organism's genome that correlate with particular quantitative phenotypes. Such loci are termed quantitative trait loci, or QTL.
- QTL quantitative trait loci
- the plant breeder can advantageously use molecular markers to identify desired individuals by identifying marker alleles that show a statistically significant probability of co- segregation with a desired phenotype (e.g., resistance to lodging). By identifying a molecular marker or clusters of molecular markers that co-segregate with a quantitative trait, the breeder is thus identifying a QTL.
- the plant breeder By identifying and selecting a marker allele (or desired alleles from multiple markers) that associates with the desired phenotype, the plant breeder is able to rapidly select a desired phenotype by selecting for the proper molecular marker allele (a process called marker-assisted selection, or MAS).
- MAS marker-assisted selection
- compositions and methods for identifying soybean plants or germplasm with decreased lodging are provided.
- Methods of making soybean plants or germplasm that have decreased lodging e.g., through introgression of desired resistance marker alleles and/or by transgenic production methods, as well as plants and germplasm made by these methods, are also provided.
- Systems and kits for selecting plants and germplasm with resistance or improved resistance to lodging are also a feature of the disclosure.
- a first soybean plant or soybean germplasm e.g., a line or variety
- at least one allele of one or more marker locus e.g., a plurality of marker loci that is associated with the resistance, improved resistance, or susceptibility is detected in the first soybean plant or soybean germplasm.
- a method of selecting a first soybean plant or soybean germplasm that displays improved lodging resistance comprising: (a) detecting in a first soybean plant or soybean germplasm at least one allele of one or more marker locus within or linked to a quantitative trait locus (QTL) associated with improved lodging resistance, wherein the allele positively correlates with improved lodging resistance, and wherein the one or more marker locus localizes within a chromosomal interval from about 67 cM to about 88 cM from the proximal end of chromosome 13; (b) selecting a first soybean plant or soybean germplasm comprising the at least one allele from step (a), thereby selecting a soybean plant or soybean germplasm that displays improved lodging resistance; and (c) crossing the selected first soybean plant or soybean germplasm with a second soybean plant or soybean germplasm to introgress the QTL into a progeny soybean plant or soybean germplasm.
- the method further comprises analyzing progeny soybean germplasm to determine the presence of improved lodging resistance and selecting
- kits for selecting at least one soybean plant by marker assisted selection of a QTL associated with improved lodging resistance comprising: (a) primers or probes for detecting a polymorphism in the soybean genome, wherein the physical position of the polymorphism is: (i) selected from the group consisting of 36,431,456 bp on chromosome 13, 36,490,271 bp on chromosome 13, 36,491,753 bp on chromosome 13, 36,491,754 bp on chromosome 13, 36,492,037 bp on chromosome 13, 36,492,926 bp on chromosome 13, 36,492,955 bp on chromosome 13, 36,493,615 bp on chromosome 13, 36,494,839 bp on chromosome 13, 36,517,239 bp on chromosome 13, 36,539,789 bp on chromosome 13, 36,539,798
- Also disclosed is a method of selecting a first soybean plant or soybean germplasm that displays improved lodging resistance comprising: (a) detecting in a first soybean plant or soybean germplasm at least one allele of one or more marker locus within or linked to a QTL associated with improved lodging resistance, wherein the allele positively correlates with improved lodging resistance, and wherein the one or more marker locus localizes within a chromosomal interval from about 5 cM to about 15 cM from the proximal end of chromosome 19; (b) selecting a first soybean plant or soybean germplasm comprising the at least one allele from step (a), thereby selecting a soybean plant or soybean germplasm that displays improved lodging resistance; and (c) crossing the selected first soybean plant or soybean germplasm with a second soybean plant or soybean germplasm to introgress the QTL into a progeny soybean plant or soybean germplasm.
- the method further comprises analyzing progeny soybean germplasm to determine the presence of improved lodging resistance and selecting progeny soybean germplasm that test positive for the presence of improved lodging resistance as being soybean germplasm into which germplasm having said QTL has been introgressed.
- kits for selecting at least one soybean plant by marker assisted selection of a QTL associated with improved lodging resistance comprising: (a) primers or probes for detecting a polymorphism in the soybean genome, wherein the physical position of the polymorphism is selected from the group consisting of 1,306,591 bp on chromosome 19, 1,635,254 bp on chromosome 19, 841,738 bp on chromosome 19, 1,589,758 bp on chromosome 19 and a combination thereof; and (b) instructions for using the primers or probes to detect the marker loci and correlating the loci with predicted improved lodging resistance.
- Also disclosed is a method of selecting a first soybean plant or soybean germplasm that displays improved lodging resistance comprising: (a) detecting in a first soybean plant or soybean germplasm at least one allele of one or more marker locus within or linked to a QTL associated with improved lodging resistance, wherein the allele positively correlates with improved lodging resistance, and wherein the one or more marker locus is selected from the group consisting of: (1) a marker locus localizing within a chromosomal interval flanked by and including marker loci BARC-038503-10136 and Satt554 on chromosome 13; (2) a marker locus localizing within a genetic recombination distance of less than or equal to 5 cM from marker locus Gml3 :36704369 on chromosome 13; (3) a marker locus localizing within a genetic recombination distance of less than or equal to 5 cM from marker locus Gml3 :36300296 on chromosome 13; and (4) a marker locus localizing within
- Also disclosed is a method of selecting a first soybean plant or soybean germplasm that displays improved lodging resistance comprising: (a) detecting in a first soybean plant or soybean germplasm at least one allele of one or more marker locus within or linked to a QTL associated with improved lodging resistance, wherein the allele positively correlates with improved lodging resistance, and wherein the one or more marker locus is selected from the group consisting of: (1) a marker locus localizing within a chromosomal interval flanked by and including marker loci BARC-039375-07306 and BARC-050993-10894 on chromosome 19; (2) a marker locus localizing within a genetic recombination distance of less than or equal to 5 cM from marker locus Gml9: 1306591 on chromosome 19; (3) a marker locus localizing within a genetic recombination distance of less than or equal to 5 cM from marker locus Gml9: 1635254 on chromosome 19; (4)
- Gml9 1589758 on chromosome 19; (b) selecting a first soybean plant or soybean germplasm comprising the at least one allele from step (a), thereby selecting a soybean plant or soybean germplasm that displays improved lodging resistance; and (c) crossing the selected first soybean plant or soybean germplasm with a second soybean plant or soybean germplasm to introgress the QTL into a progeny soybean plant or soybean germplasm.
- the method further comprises analyzing progeny soybean germplasm to determine the presence of improved lodging resistance and selecting progeny soybean germplasm that test positive for the presence of improved lodging resistance as being soybean germplasm into which germplasm having said QTL has been introgressed.
- FIG. 1 shows diagrams of the chromosome 13 (left) and chromosome 19 (right) of soybean.
- the mapping positions of representative marker loci are provided in centiMorgan (cM).
- the arrows indicate the proximal and distal ends of each chromosome, it being understood that the proximal end is the end of the chromosome closest to and above the marker locus or loci at the 0 cM position based upon Hyten et al., "A High Density Integrated Linkage Map of Soybean and the Development of a 1536 Universal Soy Linkage Panel for Quantitative Trait Locus Mapping" (2010) Crop. Sci. 50:960-968 while the distal end is the end of the chromosome most distal from the marker locus or loci at the 0 cM position.
- FIG. 2A illustrates a genetic map comprising a portion of chromosome 13 of soybean and provides a list of marker loci in linkage group F between genetic map positions 40.041 cM and 52.069 cM. Map positions are provided in cM using a genetic map based upon Hyten et al. (2010), and is also available at the USDA affiliated soybean website (www.soybase.org).
- FIG. 2B is a continuation of FIG. 2A and illustrates a genetic map comprising a portion of chromosome 13 of soybean and provides a list of marker loci in linkage group F between genetic map positions 52.218 cM and 62.496 cM.
- FIG. 2C is a continuation of FIG. 2B and illustrates a genetic map comprising a portion of chromosome 13 of soybean and provides a list of marker loci in linkage group F between genetic map positions 64.119 cM and 77.164 cM.
- FIG. 2D is a continuation of FIG. 2C and illustrates a genetic map comprising a portion of chromosome 13 of soybean and provides a list of marker loci in linkage group F between genetic map positions 77.324 cM and 107.33 cM.
- FIG. 3A illustrates a genetic map comprising a portion of chromosome 19 of soybean and provides a list of marker loci in linkage group L between genetic map positions 0 cM and 26.389 cM. Map positions are provided in cM using a genetic map based upon Hyten et al. (2010), and is also available at the USDA affiliated soybean website
- FIG. 3B is a continuation of FIG. 3A and illustrates a genetic map comprising a portion of chromosome 19 of soybean and provides a list of marker loci in linkage group L between genetic map positions 26.576 cM and 29.32 cM.
- FIG. 3C is a continuation of FIG. 3B and illustrates a genetic map comprising a portion of chromosome 19 of soybean and provides a list of marker loci in linkage group L between genetic map positions 29.32 cM and 37.655 cM.
- FIG. 4 shows representative data for lodging severity between parental alleles within two families of near isogenic lines ("NILs").
- NILs near isogenic lines
- SEQ ID NOs: 1-27 are genomic DNA regions encompassing the marker loci described on Table 1.
- SEQ ID NOs: 28-31 are genomic DNA regions encompassing the marker loci described on Table 2.
- SEQ ID NOs: 32-35 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml3 :36704369 on chromosome 13 (LG-F).
- SEQ ID NOs: 32 and 33 are used as primers and SEQ ID NOs: 34 and 35 are used as allele specific probes.
- SEQ ID NOs: 36-39 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml3 :36300296 on chromosome 13 (LG-F).
- SEQ ID NOs: 36 and 37 are used as primers and SEQ ID NOs: 38 and 39 are used as allele specific probes.
- SEQ ID NOs: 40-43 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml3 :36567042 on chromosome 13 (LG-F).
- SEQ ID NOs: 40 and 41 are used as primers and SEQ ID NOs: 42 and 43 are used as allele specific probes.
- SEQ ID NOs: 44-47 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml3 :36792347 on chromosome 13 (LG-F).
- SEQ ID NOs: 44 and 45 are used as primers and SEQ ID NOs: 46 and 47 are used as allele specific probes.
- SEQ ID NOs: 48-51 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml3 :36864280 on chromosome 13 (LG-F).
- SEQ ID NOs: 48 and 49 are used as primers and SEQ ID NOs: 50 and 51 are used as allele specific probes.
- SEQ ID NOs: 52-55 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml3 :37443784 on chromosome 13 (LG-F).
- SEQ ID NOs: 52 and 53 are used as primers and SEQ ID NOs: 54 and 55 are used as allele specific probes.
- SEQ ID NOs: 56-59 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml3 :36593549 on chromosome 13 (LG-F).
- SEQ ID NOs: 56 and 57 are used as primers and SEQ ID NOs: 58 and 59 are used as allele specific probes.
- SEQ ID NOs: 60-63 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml9: 1306591 on chromosome 19 (LG-L).
- SEQ ID NOs: 60 and 61 are used as primers and SEQ ID NOs: 62 and 63 are used as allele specific probes.
- SEQ ID NOs: 64-67 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml9: 1635254 on chromosome 19 (LG-L).
- SEQ ID NOs: 64 and 65 are used as primers and SEQ ID NOs: 66 and 67 are used as allele specific probes.
- SEQ ID NOs: 68-71 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml9:841738 on chromosome 19 (LG-L).
- SEQ ID NOs: 68 and 69 are used as primers and SEQ ID NOs: 70 and 71 are used as allele specific probes.
- SEQ ID NOs: 72-75 comprise nucleotide sequences of regions of the soybean genome, each capable of being used as a probe or primer, either alone or in combination, for the detection of a marker locus Gml9: 1589758 on chromosome 19 (LG-L).
- SEQ ID NOs: 72 and 73 are used as primers and SEQ ID NOs: 74 and 75 are used as allele specific probes.
- SEQ ID NO: 76 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 32 as a forward or reverse primer in conjunction with SEQ ID NO: 33 as the other primer in the pair. This amplicon encompasses marker locus Gml3 :36704369 on chromosome 13 (LG-F).
- SEQ ID NO: 77 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 36 as a forward or reverse primer in conjunction with SEQ ID NO: 37 as the other primer in the pair. This amplicon encompasses marker locus Gml3 :36300296 on chromosome 13 (LG-F).
- SEQ ID NO: 78 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 40 as a forward or reverse primer in conjunction with SEQ ID NO: 41 as the other primer in the pair. This amplicon encompasses marker locus Gml3 :36567042 on chromosome 13 (LG-F).
- SEQ ID NO: 79 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 44 as a forward or reverse primer in conjunction with SEQ ID NO: 45 as the other primer in the pair. This amplicon encompasses marker locus Gml3 :36792347 on chromosome 13 (LG-F).
- SEQ ID NO: 80 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 48 as a forward or reverse primer in conjunction with SEQ ID NO: 49 as the other primer in the pair. This amplicon encompasses marker locus Gml3 :36864280 on chromosome 13 (LG-F).
- SEQ ID NO: 81 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 52 as a forward or reverse primer in conjunction with SEQ ID NO: 53 as the other primer in the pair. This amplicon encompasses marker locus Gml3 :37443784 on chromosome 13 (LG-F).
- SEQ ID NO: 82 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 56 as a forward or reverse primer in conjunction with SEQ ID NO: 57 as the other primer in the pair. This amplicon encompasses marker locus Gml3 :36593549 on chromosome 13 (LG-F).
- SEQ ID NO: 83 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 60 as a forward or reverse primer in conjunction with SEQ ID NO: 61 as the other primer in the pair. This amplicon encompasses marker locus Gml9: 1306591 on chromosome 19 (LG-L).
- SEQ ID NO: 84 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 64 as a forward or reverse primer in conjunction with SEQ ID NO: 65 as the other primer in the pair. This amplicon encompasses marker locus Gml9: 1635254 on chromosome 19 (LG-L).
- SEQ ID NO: 85 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 68 as a forward or reverse primer in conjunction with SEQ ID NO: 69 as the other primer in the pair. This amplicon encompasses marker locus Gml9:841738 on chromosome 19 (LG-L).
- SEQ ID NO: 86 is the amplicon produced by amplifying genomic DNA using SEQ ID NO: 72 as a forward or reverse primer in conjunction with SEQ ID NO: 73 as the other primer in the pair. This amplicon encompasses marker locus Gml9: 1589758 on chromosome 19 (LG-L).
- SEQ ID NO: 87 is the genomic DNA region located from 36,410,000 bp to 36,419,000 bp of chromosome 13.
- kits comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers.
- plant also includes a plurality of plants; also, depending on the context, use of the term “plant” can also include genetically similar or identical progeny of that plant; use of the term “a nucleic acid” optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term “probe” optionally (and typically) encompasses many similar or identical probe molecules.
- nucleic acids are written left to right in 5 ' to 3 ' orientation.
- Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer or any non-integer fraction within the defined range.
- all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, the preferred materials and methods are described herein. In order to provide a clear and consistent understanding of the present disclosure and claims, including the scope to be given to such terms, the following definitions apply unless specifically stated otherwise.
- a "plant” can be a whole plant, any part thereof, or a cell or tissue culture derived from a plant.
- the term “plant” can refer to any of: whole plants, plant components or organs (e.g., leaves, stems, roots, etc.), plant tissues, seeds, plant cells, and/or progeny of the same.
- a plant cell is a cell of a plant, taken from a plant, or derived through culture from a cell taken from a plant.
- soybean plant includes whole soybean plants, soybean plant cells, soybean plant protoplast, soybean plant cell or soybean tissue culture from which soybean plants can be regenerated, soybean plant calli, soybean plant clumps and soybean plant cells that are intact in soybean plants or parts of soybean plants, such as soybean seeds, soybean pods, soybean flowers, soybean cotyledons, soybean leaves, soybean stems, soybean buds, soybean roots, soybean root tips and the like.
- germplasm refers to genetic material of or from an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety or family), or a clone derived from a line, variety, species, or culture.
- the germplasm can be part of an organism or cell, or can be separate from the organism or cell.
- germplasm provides genetic material with a specific molecular makeup that provides a physical foundation for some or all of the hereditary qualities of an organism or cell culture.
- germplasm includes cells, seed or tissues from which new plants may be grown, or plant parts, such as leafs, stems, pollen, or cells that can be cultured into a whole plant.
- allele refers to one of two or more different nucleotide sequences that occur at a specific locus. For example, a first allele can occur on one chromosome, while a second allele occurs on a second homologous chromosome, e.g., as occurs for different chromosomes of a heterozygous individual, or between different homozygous or
- a "favorable allele” is the allele at a particular locus that positively correlates with, confers, and/or contributes to, an agronomically desirable phenotype, e.g., resistance to lodging, or alternatively, is an allele that allows the identification of susceptible plants that can be removed from a breeding program or planting.
- a "favorable allele" of a marker is a marker allele that segregates with the favorable phenotype, or alternatively, segregates with susceptible plant phenotype, therefore providing the benefit of identifying undesirable plants.
- a favorable allelic form of a chromosome segment is a chromosome segment that includes a nucleotide sequence that contributes to superior agronomic performance at one or more genetic loci physically located on the chromosome segment.
- Allele frequency refers to the frequency (proportion or percentage) at which an allele is present at a locus within an individual, within a line, or within a population of lines. For example, for an allele "A”, diploid individuals of genotype "AA”, “Aa”, or “aa” have allele frequencies of 1.0, 0.5, or 0.0, respectively. One can estimate the allele frequency within a line by averaging the allele frequencies of a sample of individuals from that line.
- an allele frequency can be expressed as a count of individuals or lines (or any other specified grouping) containing the allele.
- An allele "positively” correlates with a trait when it is linked to it and when the presence of the allele is an indictor that the desired trait or trait form will occur in a plant comprising the allele.
- An allele “negatively” correlates with a trait when it is linked to it and when the presence of the allele is an indicator that a desired trait or trait form will not occur in a plant comprising the allele.
- An individual is "homozygous” if the individual has only one type of allele at a given locus (e.g., a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes).
- An individual is "heterozygous” if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles).
- the term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.
- locus is a chromosomal region where a polymorphic nucleic acid, trait determinant, gene or marker is located.
- a "gene locus” is a specific chromosome location in the genome of a species where a specific gene can be found.
- QTL quantitative trait locus
- a QTL can act through a single gene mechanism or by a polygenic mechanism.
- marker refers to a nucleotide sequence or encoded product thereof (e.g., a protein) used as a point of reference when identifying a linked locus.
- a marker can be derived from genomic nucleotide sequence or from expressed nucleotide sequences (e.g., from a spliced RNA or a cDNA), or from an encoded polypeptide.
- the term also refers to nucleic acid sequences complementary to or flanking the marker sequences, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence.
- a “marker probe” is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence.
- a marker probe refers to a probe of any type that is able to distinguish (i.e., genotype) the particular allele that is present at a marker locus.
- Nucleic acids are "complementary" when they specifically hybridize in solution, e.g., according to Watson-Crick base pairing rules.
- a "marker locus” is a locus that can be used to track the presence of a second linked locus, e.g., a linked locus that encodes or contributes to expression of a phenotypic trait.
- a marker locus can be used to monitor segregation of alleles at a locus, such as a QTL, that are genetically or physically linked to the marker locus.
- a "marker allele”, alternatively an “allele of a marker locus” is one of a plurality of polymorphic nucleotide sequences found at a marker locus in a population that is polymorphic for the marker locus. Any detectable polymorphic trait can be used as a marker so long as it is inherited
- the present invention provides marker loci correlating with resistance to lodging in soybean.
- Each of the identified markers is expected to be in close physical and genetic proximity (resulting in physical and/or genetic linkage) to a genetic element, e.g., a QTL that contributes to and is associated with resistance to lodging.
- Genetic marker or “genetic marker locus” as used herein refers to a type of molecular marker comprised of one or more nucleic acids that are polymorphic in a population and where the alleles of which can be detected and distinguished by one or more analytic methods, e.g., RFLP, AFLP, isozyme, SNP, SSR, and the like.
- the term also refers to nucleic acid sequences complementary to the genomic sequences, such as nucleic acids used as probes.
- Markers corresponding to genetic polymorphisms between members of a population can be detected by methods well-established in the art. These include, e.g., PCR- based sequence specific amplification methods, detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, detection of polynucleotide polymorphisms by allele specific hybridization (ASH), detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, detection of simple sequence repeats (SSRs), detection of single nucleotide polymorphisms (S Ps), or detection of amplified fragment length polymorphisms (AFLPs).
- ESTs expressed sequence tags
- SSR markers derived from EST sequences and randomly amplified polymorphic DNA
- a “genetic map” is a description of genetic linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form. "Genetic mapping” is the process of defining the linkage relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
- a “genetic map location” is a location on a genetic map relative to surrounding genetic markers on the same linkage group where a specified marker can be found within a given species.
- a “map location” or “map position” is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found in a given species.
- Map positions are generally provided in cM, and, unless otherwise indicated, genetic map positions are provided based on the Glycine max consensus map v 4.0 as provided by Hyten et al, (2010), which is also available at the USDA affiliated soybase website (www.soybase.org).
- a "physical map” of the genome refers to absolute distances (for example, measured in base pairs or isolated and overlapping contiguous genetic fragments, e.g., contigs).
- a physical map of the genome does not take into account the genetic behavior ⁇ e.g., recombination frequencies) between different points on the physical map.
- a "physical position” or “physical location” or “physical map location” is the position, typically in nucleotide bases, of a particular nucleotide, such as a S P nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature
- a "proximal end" of a chromosome refers to the upstream terminus of the chromosome that is closest to and above the marker locus (or loci) having a genetic map location at the 0 cM position on a given chromosome.
- a “distal end” of a chromosome refers to the mapping position on a genetic map that is most distal from the 0 cM position and indicates the downstream terminus of the chromosome.
- a chromosomal interval that is between about 50 cM and 60 cM from the proximal end of the chromosome indicates that the chromosomal interval begins at about 50 cM from the 0 cM position and ends at about 60 cM from the 0 cM position on a given genetic map.
- a "genetic recombination frequency” is the frequency of a crossing over event (recombination) between two genetic loci. Recombination frequency can be observed by following the segregation of markers and/or traits following meiosis.
- recombination frequency can be expressed in cM, where one cM is the distance between two genetic markers that show a 1% recombination frequency (i.e., a crossing-over event occurs between those two markers once in every 100 cell divisions).
- linkage or “genetic linkage” is used to describe the degree with which one marker locus is “associated with” another marker locus or some other locus (for example, a resistance locus) based on the frequency of recombination between the loci during meiosis. Loci that are genetically linked are generally located in close proximity along a chromosome and tend to be inherited together. Linkage implies that relevant loci are within sufficient physical proximity along a length of a chromosome that they segregate together with greater than random (i.e., non-random) frequency (in the case of co-segregating traits, the loci that underlie the traits are in sufficient proximity to each other).
- Linked loci co- segregate more than 50% of the time, e.g., from about 51% to about 100% of the time.
- the term "physically linked” is sometimes used to indicate that two loci, e.g., two marker loci, are physically present on the same chromosome.
- linkage equilibrium describes a situation where two markers have a random association in a population.
- linkage disequilibrium describes a situation where two markers have a non-random association in a population, Markers that show linkage disequilibrium are usually genetically linked.
- linkage and LD can be between two markers, or alternatively between a marker and a phenotype.
- a marker locus can be associated with (linked to and in LD with) a trait, e.g., a marker locus can be associated with resistance or improved resistance to plant lodging when the marker locus is in linkage disequilibrium with the resistance trait.
- the degree of linkage of a molecular marker to a phenotypic trait is measured, e.g., as a statistical probability of co- segregation of that molecular marker with the phenotype.
- association when used in reference to a marker, marker allele, polymorphism and/or QTL and a phenotypic trait refers to any statistically significant correlation between the presence of a given allele of a marker locus and the phenotypic trait, which may be qualitative or quantitative.
- the linkage relationship between a molecular marker and a phenotype is given as a "probability" or "adjusted probability".
- the two linked loci are located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g., such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time.
- the phrase "closely linked”, in the present application, means that recombination between two linked loci occurs with a frequency of equal to or less than about 10% (i.e., are separated on a genetic map by not more than 10 cM). Put another way, the closely linked loci co-segregate at least 90% of the time. Marker loci are especially useful in the present invention when they demonstrate a significant probability of co- segregation (linkage) with a desired trait (e.g., lodging resistance). For example, in some aspects, these markers can be termed linked QTL markers. In other aspects, especially useful molecular markers are those markers that are linked or closely linked.
- linkage can be expressed as any desired limit or range.
- two linked loci are two loci that are separated by less than 50 cM map units.
- linked loci are two loci that are separated by less than 40 cM.
- two linked loci are two loci that are separated by less than 30 cM.
- two linked loci are two loci that are separated by less than 25 cM.
- two linked loci are two loci that are separated by less than 20 cM.
- two linked loci are two loci that are separated by less than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 cM.
- bracketed range of linkage for example, between 1 and 5 cM, between 5 and 10 cM, between 1 and 10 cM, between 10 and 20 cM, between 10 and 30 cM, or between 10 and 40 cM.
- closely linked loci such as a marker locus and a second locus display an inter-locus recombination frequency of 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less.
- the relevant loci display a recombination a frequency of about 1% or less, e.g., about 0.75% or less, more preferably about 0.5% or less, or yet more preferably about 0.25% or less.
- Two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%), 0.25%), or less) are also said to be "proximal to" each other.
- two different markers can have the same genetic map coordinates. In that case, the two markers are in such close proximity to each other that recombination occurs between them with such low frequency that it is undetectable.
- chromosome interval or "chromosome segment” designate a contiguous linear span of genomic DNA that resides in planta on a single chromosome.
- the genetic elements or genes located on a single chromosome interval are physically linked.
- the size of a chromosome interval is not particularly limited.
- the genetic elements located within a single chromosome interval are also genetically linked, typically within a genetic recombination distance of, for example, less than or equal to 20 cM, or alternatively, less than or equal to 10 cM. That is, two genetic elements within a single chromosome interval undergo recombination at a frequency of less than or equal to 20% or 10%.
- any marker of the disclosure is linked (genetically and physically) to any other marker that is at or less than 50 cM distant.
- any marker of the invention is closely linked (genetically and physically) to any other marker that is in close proximity, e.g., at or less than 10 cM distant.
- Two closely linked markers on the same chromosome can be positioned 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5 or 0.25 cM or less from each other.
- the term “lodging,” “harvest stability,” or “LDGSEV” refers to the bending or breakage of the plant stem, or the tilting over of the plant, which complicates harvest and can diminish the value of the harvested product. Lodging severity is scored visually for a plot and is rated using a 1-9 scale representing the percentage of plants in the plot at harvest maturity that were less than fully erect. A score of 1 indicates a plot with almost all plants lying on the ground, a score of 5 indicates that most plants are leaning at a 45° angle in relation to the ground, and a score of 9 indicates a plot with almost all plants fully erect.
- soybean line refers to a substantially homozygous soybean line and minor modifications thereof that retains the overall genetics of the soybean line including but not limited to a subline, a locus conversion, a mutation, a transgenic, or a somaclonal variant. Variety includes seeds, plants, plant parts, and/or seed parts of the instant soybean line.
- seed yield is the actual yield in bushels/acre of the grain at harvest.
- inoculum refers to a pathogen or its parts that can cause infection; that portion of individual pathogens that are brought into contact with the host.
- innoculate refers to bringing a pathogen into contact with a host plant or plant organ.
- crossed or “cross” in the context of this disclosure means the fusion of gametes via pollination to produce progeny (e.g., cells, seeds or plants).
- progeny e.g., cells, seeds or plants.
- introgression refers to the transmission of a desired gene, QTL, haplotype, marker profile, marker locus, marker allele, trait and/or trait locus from one genetic background to another.
- introgression of a desired allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the desired allele in its genome.
- transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome.
- the desired allele can be, e.g., a selected allele of a marker, a QTL, or the like.
- offspring comprising the desired allele can be repeatedly backcrossed to a line having a desired genetic background and selected for the desired allele, to result in the allele becoming fixed in a selected genetic background.
- a "line” or “strain” is a group of individuals of identical parentage that is generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic).
- a “subline” refers to an inbred subset of descendants that is genetically distinct from other similarly inbred subsets descended from the same progenitor. Traditionally, a “subline” has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are "fixed” or homozygous across most or all loci.
- soybean varieties are typically produced by aggregating ("bulking") the self-pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self-pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was heterozygous in the originally selected F3 to F5 plant.
- F8 marker-based sublines, that differ from each other based on qualitative
- polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant.
- the seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample.
- seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (yield, lodging resistance, herbicide tolerance, etc.).
- An "ancestral line” is a parent line used as a source of genes e.g., for the development of elite lines.
- An “ancestral population” is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
- “Descendants” are the progeny of ancestors, and may be separated from their ancestors by many generations of breeding. For example, elite lines are the descendants of their ancestors.
- a “pedigree structure” defines the relationship between a descendant and each ancestor that gave rise to that descendant.
- a pedigree structure can span one or more generations, describing relationships between the descendant and its parents, grand parents, great-grand parents, etc.
- An "elite line” or “elite strain” is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding. An "elite population” is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean. Similarly, an "elite germplasm” or elite strain of germplasm is an agronomically superior germplasm, typically derived from and/or capable of giving rise to a plant with superior agronomic performance, such as an existing or newly developed elite line of soybean.
- an "exotic soybean strain” or an “exotic soybean germplasm” is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm.
- an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
- a "recurrent" plant or “recurrent parent” plant refers to a plant typically having a genetic background with favorable agronomic traits that can be crossed with a soybean plant comprising a desired trait or allele, which is sometimes referred to as a "donor” plant or “donor parent” plant. Backcrossing then enables the breeder to transfer the desired trait or allele from the donor plant into the favored genetic background of the recurrent plant.
- amplifying in the context of nucleic acid amplification is any process whereby an additional copy or copies of a selected nucleic acid (or a transcribed form thereof) are produced.
- Typical amplification methods include various polymerase based replication methods, including the polymerase chain reaction (PCR), ligase mediated methods such as the ligase chain reaction (LCR) and RNA polymerase based amplification (e.g., by transcription) methods.
- An "amplicon” is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, or the like).
- genomic nucleic acid is a nucleic acid that corresponds in sequence to a heritable nucleic acid in a cell. Common examples include nuclear genomic DNA and amplicons thereof.
- a genomic nucleic acid is, in some cases, different from a spliced RNA, or a corresponding cDNA, in that the spliced RNA or cDNA is processed, e.g., by the splicing machinery, to remove introns.
- Genomic nucleic acids optionally comprise non-transcribed (e.g., chromosome structural sequences, promoter regions, or enhancer regions) and/or non-translated sequences (e.g., introns), whereas spliced RNA/cDNA typically do not have non-transcribed sequences or introns.
- a "template nucleic acid” is a nucleic acid that serves as a template in an amplification reaction (e.g., a polymerase based amplification reaction such as PCR, a ligase mediated amplification reaction such as LCR, a transcription reaction, or the like).
- a template nucleic acid can be genomic in origin, or alternatively, can be derived from expressed sequences, e.g., a cDNA or an expressed sequence tag (EST).
- exogenous nucleic acid is a nucleic acid that is not native to a specified system (e.g., a germplasm, plant, or variety), with respect to sequence, genomic position, or both.
- a specified system e.g., a germplasm, plant, or variety
- the terms “exogenous” or “heterologous” as applied to polynucleotides or polypeptides typically refers to molecules that have been artificially supplied to a biological system (e.g., a plant cell, a plant gene, a particular plant species or variety or a plant chromosome under study) and are not native to that particular biological system.
- the terms can indicate that the relevant material originated from a source other than a naturally occurring source, or can refer to molecules having a non-natural configuration, genetic location or arrangement of parts.
- a “native” or “endogenous” gene is a gene that does not contain nucleic acid elements encoded by sources other than the chromosome or other genetic element on which it is normally found in nature.
- An endogenous gene, transcript or polypeptide is encoded by its natural chromosomal locus, and not artificially supplied to the cell.
- recombinant in reference to a nucleic acid or polypeptide indicates that the material (e.g., a recombinant nucleic acid, gene, polynucleotide, or polypeptide) has been altered by human intervention. Generally, the arrangement of parts of a recombinant molecule is not a native configuration, or the primary sequence of the recombinant polynucleotide or polypeptide has in some way been manipulated. The alteration to yield the recombinant material can be performed on the material within or removed from its natural environment or state.
- a naturally occurring nucleic acid becomes a recombinant nucleic acid if it is altered, or if it is transcribed from DNA which has been altered, by means of human intervention performed within the cell from which it originates.
- a gene sequence open reading frame is recombinant if that nucleotide sequence has been removed from it natural context and cloned into any type of artificial nucleic acid vector. Protocols and reagents to produce recombinant molecules, especially recombinant nucleic acids, are common and routine in the art.
- an artificial chromosome can be created and inserted into maize plants by any method known in the art (e.g., direct transfer processes, such as, e.g., PEG-induced DNA uptake, protoplast fusion, microinjection, electroporation, and microprojectile bombardment).
- An artificial chromosome is a piece of DNA that can stably replicate and segregate alongside endogenous chromosomes. It has the capacity to accommodate and express heterologous genes inserted therein. Integration of heterologous DNA into the megareplicator region (primary replication initiation site of centromeres) or in close proximity thereto, initiates a large-scale amplification of megabase-size chromosomal segments, which leads to de novo chromosome formation. See, e.g., U.S. Pat. No. 6,077,697, incorporated herein by reference in its entirety.
- recombinant can also refer to an organism that harbors recombinant material, e.g., a plant that comprises a recombinant nucleic acid is considered a recombinant plant.
- a recombinant organism is a transgenic organism.
- the term "introduced” when referring to translocating a heterologous or exogenous nucleic acid into a cell refers to the incorporation of the nucleic acid into the cell using any methodology.
- the term encompasses such nucleic acid introduction methods as “transfection”, “transformation” and “transduction”.
- vector is used in reference to polynucleotide or other molecules that transfer nucleic acid segment(s) into a cell.
- the term “vehicle” is sometimes used interchangeably with “vector”.
- a vector optionally comprises parts which mediate vector maintenance and enable its intended use (e.g., sequences necessary for replication, genes imparting drug or antibiotic resistance, a multiple cloning site, or operably linked promoter/enhancer elements which enable the expression of a cloned gene).
- Vectors are often derived from plasmids, bacteriophages, or plant or animal viruses.
- a "cloning vector” or “shuttle vector” or “subcloning vector” contains operably linked parts that facilitate subcloning steps (e.g., a multiple cloning site containing multiple restriction endonuclease sites).
- expression vector refers to a vector comprising operably linked polynucleotide sequences that facilitate expression of a coding sequence in a particular host organism (e.g., a bacterial expression vector or a plant expression vector).
- Polynucleotide sequences that facilitate expression in prokaryotes typically include, e.g., a promoter, an operator (optional), and a ribosome binding site, often along with other sequences.
- Eukaryotic cells can use promoters, enhancers, termination and polyadenylation signals and other sequences that are generally different from those used by prokaryotes.
- transgenic plant refers to a plant that comprises within its cells a heterologous polynucleotide.
- the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations.
- the heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette.
- Transgenic is used herein to refer to any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenic organisms or cells initially so altered, as well as those created by crosses or asexual propagation from the initial transgenic organism or cell.
- transgenic does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods (e.g., crosses) or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
- a specified nucleic acid is "derived from" a given nucleic acid when it is constructed using the given nucleic acid's sequence, or when the specified nucleic acid is constructed using the given nucleic acid.
- a cDNA or EST is derived from an expressed mRNA.
- genomic element refers to a heritable sequence of DNA, i.e., a genomic sequence, with functional significance.
- the term “gene” can also be used to refer to, e.g., a cDNA and/or a mRNA encoded by a genomic sequence, as well as to that genomic sequence.
- genotype is the genetic constitution of an individual (or group of individuals) at one or more genetic loci, as contrasted with the observable trait (the phenotype). Genotype is defined by the allele(s) of one or more known loci that the individual has inherited from its parents.
- genotype can be used to refer to an individual's genetic constitution at a single locus, at multiple loci, or, more generally, the term genotype can be used to refer to an individual's genetic make-up for all the genes in its genome.
- haplotype is the genotype of an individual at a plurality of genetic loci.
- the genetic loci described by a haplotype are physically and genetically linked, i.e., on the same chromosome segment.
- phenotype refers to one or more trait of an organism.
- the phenotype can be observable to the naked eye, or by any other means of evaluation known in the art, e.g., microscopy, biochemical analysis, genomic analysis, or an assay for a particular disease resistance.
- a phenotype is directly controlled by a single gene or genetic locus, i.e., a "single gene trait”.
- a phenotype is the result of several genes.
- a "molecular phenotype” is a phenotype detectable at the level of a population of (one or more) molecules. Such molecules can be nucleic acids such as genomic DNA or RNA, proteins, or metabolites. For example, a molecular phenotype can be an expression profile for one or more gene products, e.g., at a specific stage of plant development, in response to an environmental condition or stress, etc. Expression profiles are typically evaluated at the level of RNA or protein, e.g., on a nucleic acid array or "chip” or using antibodies or other binding proteins.
- yield refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
- Agronomics refers to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of growing season. Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability and the like. Yield is, therefore, the final culmination of all agronomic traits.
- a "set" of markers or probes refers to a collection or group of markers or probes, or the data derived therefrom, used for a common purpose, e.g., identifying soybean plants with a desired trait ⁇ e.g., resistance to lodging). Frequently, data corresponding to the markers or probes, or data derived from their use, is stored in an electronic medium. While each of the members of a set possess utility with respect to the specified purpose, individual markers selected from the set as well as subsets including some, but not all of the markers, are also effective in achieving the specified purpose.
- a "look up table” is a table that correlates one form of data to another, or one or more forms of data with a predicted outcome that the data is relevant to.
- a look up table can include a correlation between allele data and a predicted trait that a plant comprising a given allele is likely to display.
- These tables can be, and typically are, multidimensional, e.g., taking multiple alleles into account simultaneously, and, optionally, taking other factors into account as well, such as genetic background, e.g., in making a trait prediction.
- a "computer readable medium” is an information storage media that can be accessed by a computer using an available or custom interface. Examples include memory (e.g., ROM, RAM, or flash memory), optical storage media (e.g., CD-ROM), magnetic storage media (computer hard drives, floppy disks, etc.), punch cards, and many others that are commercially available.
- Information can be transmitted between a system of interest and the computer, or to or from the computer to or from the computer readable medium for storage or access of stored information. This transmission can be an electrical transmission, or can be made by other available methods, such as an IR link, a wireless connection, or the like.
- System instructions are instruction sets that can be partially or fully executed by the system. Typically, the instruction sets are present as system software.
- soybean marker loci that demonstrate statistically significant co- segregation with decreased lodging. Detection of these loci or additional linked loci can be used in marker assisted soybean breeding programs to produce soybean plants or soybean germplasm with resistance or improved resistance to lodging.
- suitable marker loci are provided, including, but not limited to, Gml3 :36704369 on chromosome 13 (LG-F), Gml3 :36300296 on chromosome 13 (LG-F), Gml3 :36593549 on chromosome 13 (LG-F), and/or Gml9: 1589758 on chromosome 19 (LG-L).
- Each of the marker loci can be visualized as PCR amplicons as described herein.
- PCR primer pairs suitable for generating marker loci amplicons including, but not limited to, oligonucleotides represented by SEQ ID NO: 32 and SEQ ID NO: 33 used to amplify a DNA region flanking Gml3 :36704369; SEQ ID NO: 36 and SEQ ID NO: 37 used to amplify a DNA region flanking Gml3 :36300296; SEQ ID NO: 56 and SEQ ID NO: 57 used to amplify a DNA region flanking Gml3 :36593549; and SEQ ID NO: 72 and SEQ ID NO: 73 used to amplify a DNA region flanking Gm 19: 1589758.
- certain alleles of the various marker loci can be visualized by probes such as the group consisting of SEQ ID NOs: 34, 35, 38, 39, 58, 59
- the disclosure also provides chromosomal QTL intervals that correlate with decreased lodging located on chromosome 13. Any marker located within these intervals finds use as a marker for decreased lodging.
- the interval is located at about 67 cM to about 88 cM from the proximal end of chromosome 13.
- the interval is localized within a chromosomal interval flanked by and included marker loci BARC-038503- 10136 and Satt554 on chromosome 13.
- the interval can be specified as a chromosomal interval located within about 2 Mbp of an interval at 36,410-36,419 kbp of chromosome 13 (SEQ ID NO: 87).
- the disclosure also provides chromosomal QTL intervals that correlate with decreased lodging located on chromosome 19. Any marker located within this interval finds use as a marker for decreased lodging.
- the interval is located at about 5 cM to about 15 cM from the proximal end of chromosome 19. In other aspects, the interval is localized within a chromosomal interval flanked by and included marker loci BARC-039375- 07306 and BARC-050993-10894 on chromosome 19. Alternatively, the interval can be specified as a chromosomal interval located within about 2 cM of 1,589,758 bp on chromosome 19. Testing and data demonstrate that a gene responsible for the lodging phenotype is within 2 cM of 1,589,758 bp on chromosome 19.
- Methods for identifying soybean plants or germplasm that carry preferred alleles of resistance marker loci are a feature of the disclosure.
- any of a variety of marker detection protocols is used to identify marker loci, depending on the type of marker loci.
- Typical methods for marker detection include amplification and detection of the resulting amplified markers, e.g., by PCR, LCR, transcription based amplification methods, or the like. These include ASH, SSR detection, RFLP analysis and many others.
- a first soybean plant or germplasm e.g., a line or variety
- improved lodging resistance i.e., decreased lodging
- at least one allele of one or more marker locus e.g., a plurality of marker loci
- at least one allele of one or more marker locus that is associated with the lodging resistance or improved lodging resistance is detected in the first soybean plant or germplasm.
- methods for identifying a first soybean plant or germplasm e.g., a line or variety
- displays lodging susceptibility i.e., increased lodging
- at least one allele of one or more marker locus e.g., a plurality of marker loci
- the marker locus is localizing within a chromosomal interval flanked by and including BARC-038503-10136 and Satt554 on chromosome 13.
- the marker locus is localized within a chromosomal interval from about 5 cM to about 15 cM from the proximal end of chromosome 19 or a chromosomal interval flanked by and including BARC-039375-07306 and BARC-050993-10894 on chromosome 19.
- the QTL is a chromosomal interval flanked by and including BARC-038503-10136 and Satt554 on chromosome 13 or BARC- 039375-07306 and BARC-050993-10894 on chromosome 19.
- the marker locus is localized within the chromosomal intervals described herein.
- the QTL is a chromosomal interval flanked by and including BARC-038503- 10136 and Satt554 on chromosome 13 or BARC-039375-07306 and BARC-050993-10894 on chromosome 19.
- the marker locus is localized within the
- marker alleles can show co-segregation with a lodging resistance or susceptibility phenotype
- the marker locus is not necessarily part of the QTL locus responsible for the resistance or susceptibility.
- the marker polynucleotide sequence be part of a gene that imparts lodging resistance (for example, be part of the gene open reading frame).
- the association between a specific marker allele with the resistance or susceptibility phenotype is due to the original "coupling" linkage phase between the marker allele and the QTL resistance or susceptibility allele in the ancestral soybean line from which the resistance or susceptibility allele originated.
- the favorable marker allele may change depending on the linkage phase that exists within the resistant parent used to create segregating populations. This does not change the fact that the genetic marker can be used to monitor segregation of the phenotype. It only changes which marker allele is considered favorable in a given segregating population.
- Lodging resistance assays are useful to verify that the lodging resistance trait still segregates with the marker in any particular plant or population, and, of course, to measure the degree of lodging resistance improvement achieved by introgressing or recombinantly introducing the trait into a desired background.
- Systems including automated systems for selecting plants that comprise a marker and/or marker allele of interest and/or for correlating presence of the marker and/or marker allele with lodging resistance are also a feature of the invention.
- These systems can include probes relevant to marker locus detection, detectors for detecting labels on the probes, appropriate fluid handling elements and temperature controllers that mix probes and templates and/or amplify templates, and systems instructions that correlate label detection to the presence of a particular marker locus or marker allele.
- Kits are also a feature of the invention.
- a kit can include appropriate primers or probes for detecting resistance associated marker loci and/or marker alleles and instructions in using the primers or probes for detecting the marker loci and correlating the marker loci or alleles thereof with predicted decreased lodging.
- the kits can further include packaging materials for packaging the probes, primers or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
- kits for selecting at least one soybean plant by marker assisted selection of a quantitative trait locus associated with improved lodging resistance comprising: (a) primers or probes for detecting a polymorphism in the soybean genome, wherein the physical position of the polymorphism is (i) selected from the group consisting of 36,431,456 bp on chromosome 13, 36,490,271 bp on chromosome 13, 36,491,753 bp on chromosome 13, 36,491,754 bp on chromosome 13, 36,492,037 bp on chromosome 13, 36,492,926 bp on chromosome 13, 36,492,955 bp on chromosome 13, 36,493,615 bp on chromosome 13, 36,494,839 bp on chromosome 13, 36,517,239 bp on chromosome 13, 36,539,789 bp on chromosome 13, 36,539,798 b
- the primers of the kit comprise a pair of oligonucleotides selected from the group consisting of: (a) SEQ ID NO:32 and SEQ ID NO:33; (b) SEQ ID NO:36 and SEQ ID NO:37; (c) SEQ ID NO:40 and SEQ ID NO:41; (d) SEQ ID NO:44 and SEQ ID NO:45; (e) SEQ ID NO:48 and SEQ ID NO:49; (f) SEQ ID NO:52 and SEQ ID NO:53; (g) SEQ ID NO:56 and SEQ ID NO:57; and (h) a combination thereof.
- the probes of the kit comprise an oligonucleotide selected from the group consisting of SEQ ID NOs: 34, 35, 38, 39, 42, 43, 46, 47, 50, 51, 54, 55, 58, and 59, and wherein the oligonucleotide is linked to a detectable label.
- kits for selecting at least one soybean plant by marker assisted selection of a quantitative trait locus associated with improved lodging resistance (a) primers or probes for detecting a polymorphism in the soybean genome, wherein the physical position of the polymorphism is selected from the group consisting of 1,306,591 bp on chromosome 19, 1,635,254 bp on chromosome 19, 841,738 bp on chromosome 19, 1,589,758 bp on chromosome 19, and a combination thereof; and (b) instructions for using the primers or probes to detect the marker loci and correlating the loci with predicted improved lodging resistance.
- the primers of the kit comprise a pair of oligonucleotides selected from the group consisting of: (a) SEQ ID NO:60 and SEQ ID NO:61; (b) SEQ ID NO: 64 and SEQ ID NO: 65; (c) SEQ ID NO: 68 and SEQ ID NO: 69; (d) SEQ ID NO: 72 and SEQ ID NO: 73; and (h) a combination thereof.
- the probes of the kit comprise an oligonucleotide selected from the group consisting of SEQ ID NOs: 62, 63, 66, 67, 70, 71, 74, and 75, and wherein the oligonucleotide is linked to a detectable label.
- the frequency with which the traits are inherited together is the primary measure of how tightly the traits are linked, i.e., traits which are inherited together with a higher frequency are more closely linked than traits which are inherited together with lower (but still above random) frequency.
- Traits are linked because the genes which underlie the traits reside on the same chromosome. The further apart on a chromosome the genes reside, the less likely they are to segregate together, because homologous chromosomes recombine during meiosis. Thus, the further apart on a chromosome the genes reside, the more likely it is that there will be a crossing over event during meiosis that will result in two genes segregating separately into progeny.
- a common measure of linkage is the frequency with which traits cosegregate. This can be expressed as a percentage of cosegregation (recombination frequency) or, also commonly, in centiMorgans (cM).
- the cM is named after the pioneering geneticist Thomas Hunt Morgan and is a unit of measure of genetic recombination frequency.
- One cM is equal to a 1% chance that a trait at one genetic locus will be separated from a trait at another locus due to crossing over in a single generation (meaning the traits segregate together 99% of the time).
- chromosomal distance is approximately proportional to the frequency of crossing over events between traits, there is an approximate physical distance that correlates with recombination frequency. For example, in soybean, 1 cM correlates, on average, to about 400,000 base pairs (400 Kb).
- Marker loci are themselves traits and can be assessed according to standard linkage analysis by tracking the marker loci during segregation.
- one cM is equal to a 1% chance that a marker locus will be separated from another locus (which can be any other trait, e.g., another marker locus, or another trait locus that encodes a QTL), due to crossing over in a single generation.
- the markers are sufficiently proximal to a resistance trait that they can be used as a predictor for the lodging resistance trait. This is extremely useful in the context of marker assisted selection (MAS), discussed in more detail herein.
- MAS marker assisted selection
- soybean plants or soybean germplasm can be selected for markers or marker alleles that positively correlate with resistance, without actually raising soybean and measuring for resistance or improved resistance (or, contrarily, soybean plants can be selected against if they possess markers that negatively correlate with resistance or improved resistance).
- MAS is a powerful shortcut to selecting for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines). MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
- a favorable allele of a marker is that allele of the marker that co-segregates with a desired phenotype (e.g., lodging resistance).
- a marker within or linked to a QTL has a minimum of one favorable allele, although it is possible that the marker might have two or more favorable alleles found in the population. Any favorable allele of that marker can be used advantageously for the identification and construction of soybean lines with resistance or improved resistance to lodging.
- one, two, three or more favorable allele(s) of different markers are identified in, or introgressed into a plant, and can be selected for or against during MAS. Desirably, plants or germplasm are identified that have at least one such favorable allele that positively correlates with resistance or improved resistance to lodging.
- a marker allele that co-segregates with lodging susceptibility also finds use with the invention, since that allele can be used to identify and counter select susceptible plants.
- Such an allele can be used for exclusionary purposes during breeding to identify alleles that negatively correlate with resistance, to eliminate susceptible plants or germplasm from subsequent rounds of breeding.
- a method of identifying and/or selecting a soybean plant or soybean germplasm that displays improved lodging resistance includes detecting in a soybean plant or soybean germplasm at least one allele of one or more marker locus within or linked to a QTL associated with improved lodging resistance.
- the detected allele positively correlates with improved lodging resistance.
- the QTL associated with improved lodging is localized on chromosome 13. In other embodiments, the QTL associated with improved lodging is localized on chromosome 19.
- the method comprises the detection of multiple marker alleles to enable the detection of a QTL associated with improved lodging resistance on chromosome 13 and a QTL associated with improved lodging resistance on chromosome 19.
- marker loci on chromosome 13 of soybean such as the marker loci provided in Table 1
- marker loci on chromosome 19 of soybean such as the marker loci provided in Table 2
- chromosomal intervals such as the chromosomal intervals located from about 67 cM to about 88 cM of chromosome 13 and/or about 5 cM to about 15 cM of chromosome 19, have been found to positively correlate with decreased lodging in soybean.
- the chromosomal interval can be specified as a chromosomal interval located within about 2 Mbp of an interval at 36,410-36,419 kbp of chromosome 13 (SEQ ID NO: 87).
- Table 1 Non-limiting embodiments of marker loci on chromosome 13 of soybean and suitable for detecting improved lodging resistance.
- Gml3 37443784 80.27 37,443,784 G/C GTTTAATTTTTAAAAAAAAAAACTGCCTCAGATT 6
- Gml3 36493615 77.54 36,493,615 G/A AAATAATAGGTTAAAAGTTCTAACTCTTCATCCT 15
- Gml3 36697528 78.04 36,697,528 G/A AAAAAAAATCAAATTTTTGTCAATATACTTTAAA 19
- soybean and suitable for detecting improved lodging resistance soybean and suitable for detecting improved lodging resistance.
- Gml9:1635254 10.43 1,635,254 A/G GTCTGAGTAGTGGTGACAGTTTTGTAAATACAAC 29
- Gml9 1589758 10.06 1,589,758 G/T TGCGAGCAACCTTCGAAAYGAGGGAAGTGGTGG 31
- a method of identifying and/or selecting a soybean plant or soybean germplasm with improved resistance to lodging comprises detecting in the soybean plant or soybean germplasm at least one allele of one or more marker locus within or linked to a QTL associated improved lodging resistance.
- the one or more allele detected is of one or more marker locus localizing on chromosome 13 (LG-F), such as the marker loci provided in Figures 2A-2D and Table 1.
- the one or more allele detected is of one or more marker locus localizing within a chromosomal interval from about 67 cM to about 88 cM from the proximal end of chromosome 13.
- Figure 1 depicts a diagram of chromosome 13 showing the proximal and distal ends in relation to several marker loci.
- the one or more allele detected is of one or more marker locus localizing within a chromosomal interval from about 68 cM to about 87 cM from the proximal end of chromosome 13.
- the one or more allele detected is of one or more marker locus localizing within a
- chromosomal interval (i) from about 69 cM to about 86 cM from the proximal end of
- chromosome 13 (ii) from about 70 cM to about 85 cM from the proximal end of
- chromosome 13 from about 75 cM to about 80 cM from the proximal end of chromosome 13; (iv) from about 75.4 cM to about 79.5 cM from the proximal end of chromosome 13; (v) from about 75.9 cM to about 79 cM from the proximal end of chromosome 13; (vi) from about 76.4 cM to about 78.5 cM from the proximal end of chromosome 13; or (vii) from about 76.9 cM to about 78 cM from the proximal end of chromosome 13.
- chromosomal intervals are defined by the marker loci flanking either end of the interval.
- the one or more allele detected is of one or more marker locus localizing within a chromosomal interval flanked by and including marker loci BARC-038503-10136 and Satt554 on chromosome 13.
- the one or more marker locus is localized within a chromosomal interval flanked by and including marker loci Satt072 and BARC-027792-06674 on chromosome 13.
- the one or more marker locus is localized within a chromosomal interval flanked by and including marker loci BARC-018605-02982 and BARC-027792-06674 on chromosome 13 or a chromosomal interval flanked by and including marker loci BARC- 025859-05126 and BARC-014657-01608 on chromosome 13.
- the one or more marker locus is localized within a chromosomal interval flanked by and including marker loci Gml3 :36704369 and Gml3 :36300296 on chromosome 13.
- the one or more marker locus within or linked to the QTL associated with improved lodging resistance is localized within a chromosomal interval flanked by and including marker loci: (i) BARC-028583-05961 and BARC-025561-06521 on chromosome 13; (ii) BARC-028887-06033 and BARC-027792-06674 on chromosome 13; or (iii) BARC-018007-02494 and Satt522 on chromosome 13.
- marker loci suitable for use in the methods provided herein are localized on chromosome 13.
- the at least one allele detected is of one or more marker locus selected from the group consisting of
- the at least one allele detected is of one or more marker locus selected from the group consisting of Gm 13 :36704369, Gm 13 :36300296, Gml3 :36593549, and a combination thereof.
- the marker locus is Gml3 :36593549.
- the method comprises detecting one or more polymorphisms of and/or linked to one or more marker locus selected from the group consisting of Gml3:36431456, Gm 13:36490271, Gml3:36491753, Gml3:36491754, Gm 13:36492037, Gm 13:36492926, Gml3:36492955, Gml3:36493615, Gm 13:36494839, Gml3:36517239, Gml3:36539789, Gml3:36539798, Gml3:36540415, Gml3:36593549, Gml3:36613902, Gml3:36644196, Gm 13:36644203, Gm 13:36644207, Gm 13:36678427, Gml3:36697528, Gml3:36795108, Gm 13:36704369, Gm 13:3630029
- the one or more allele detected is of one or more marker locus localizing within one or more of the genomic DNA regions of SEQ ID NOs: 1-27. In some embodiments, the one or more allele detected is of one or more marker locus localizing within 1 cM, 2 cM, 3 cM, 4 cM, 5 cM, 6 cM, 7 cM, 8 cM, 9 cM, 10 cM, 11 cM, 12 cM, 13 cM, 14 cM, 15 cM, 20 cM, or 30 cM of marker locus Gml3:36431456, Gm 13:36490271, Gml3:36491753, Gml3:36491754, Gm 13:36492037, Gm 13:36492926, Gml3:36492955, Gml3:36493615, Gm 13:36494839, Gml3:36517239, Gml3
- the one or more marker locus is localized within a genetic recombination distance of less than or equal to 20 cM, e.g., about 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5,4,3,2, 1,0.75, 0.5, or 0.25 cM or less, from marker locus Gml3:36431456, Gml3:36490271, Gml3:36491753, Gml3:36491754,
- the one or more marker locus is localized within a genetic recombination distance of less than or equal to 20 cM, e.g., about 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less, from a favorable allele of marker locus Gml3:36431456, Gml3:36490271, Gml3:36491753, Gml3:36491754, Gm 13:36492037, Gm 13:36492926, Gml3:36492955, Gml3:36493615, Gm 13:36494839, Gml3:36517239, Gml3:36539789, Gml3:36539798, Gml3:36540415, Gml3:36593549, Gml3:36613902, Gm 13:36644196, Gm 13:36644203, Gm 13:366442
- the method comprises detecting one or more polymorphisms having a physical position on chromosome 13 of the soybean genome based on the Glyma 1 Assembly (Schmutz et al., 2010) (see Table 1).
- the physical position is on chromosome 13 of the soybean genome and selected from the group consisting of 36,431,456 bp on chromosome 13, 36,490,271 bp on chromosome 13, 36,491,753 bp on chromosome 13, 36,491,754 bp on chromosome 13, 36,492,037 bp on chromosome 13, 36,492,926 bp on chromosome 13, 36,492,955 bp on chromosome 13, 36,493,615 bp on chromosome 13, 36,494,839 bp on chromosome 13, 36,517,239 bp on chromosome 13, 36,539,789 bp on chromos
- S Ps polymorphisms
- S Ps polymorphisms
- the approximate physical positions of the SNPs in Table 1 are based on a publically available genomic sequence, which may be the same or different as compared to genomic sequence for a particular soybean variety. In either case, the skilled artisan can easily determine the approximate physical positions of the SNPs provided herein on any genomic sequence using sequencing and sequence analysis techniques, such as sequence alignments, BLAST searching, and the like.
- alleles that are favorable for, positively correlate with and/or are associated with resistance to lodging.
- at least one allele of one or more marker locus positively correlates with improved lodging resistance and is selected from the group consisting of a lodging resistance allele of a marker locus provided in Table 1 and any combination thereof.
- at least one allele of one or more marker loci negatively correlates with lodging resistance and is selected from the group consisting of a lodging susceptibility allele of a marker locus provided in Table 1 and any combination thereof.
- an allele that positively correlates with lodging resistance and an allele that negatively correlates with lodging resistance is detected in a soybean plant or soybean germplasm (i.e., the soybean plant or soybean germplasm is heterozygous).
- alleles that positively correlate with lodging resistance are provided.
- the at least one allele that positively correlates with lodging resistance comprises allele A of marker locus Gml3 :36431456, allele T of marker locus Gml3 :36490271, allele T of marker locus Gml3 :36491753, allele T of marker locus Gm 13 :36491754, allele T of marker locus Gm 13 :36492037, allele G of marker locus Gm 13 :36492926, allele A of marker locus Gml3 :36492955, allele G of marker locus Gml3 :36493615, allele G of marker locus Gm 13 :36494839, allele A of marker locus Gml3 :36517239, allele T of marker locus Gml3 :36539789, allele T of marker locus Gml3 :36539798, allele C of marker locus
- marker loci suitable for use in the methods provided herein are localized on chromosome 19.
- a method of identifying and/or selecting a soybean plant or soybean germplasm with improved resistance to lodging comprises detecting in the soybean plant or soybean germplasm at least one allele of one or more marker locus within or linked to a QTL associated improved lodging resistance.
- the one or more allele detected is of one or more marker locus localizing on chromosome 19 (LG-L), such as the marker loci provided in Figures 3 A-3C and Table 2.
- the one or more allele detected is of one or more marker locus localizing within a chromosomal interval from about 5 cM to about 15 cM from the proximal end of chromosome 19.
- Figure 1 depicts a diagram of chromosome 19 showing the proximal and distal ends in relation to several marker loci.
- the one or more allele detected is of one or more marker locus localizing within a chromosomal interval from about 5.5 cM to about 14.5 cM from the proximal end of chromosome 19.
- the one or more allele detected is of one or more marker locus localizing within a chromosomal interval: (i) from about 6 cM to about 14 cM from the proximal end of chromosome 19; (ii) from about 7 cM to about 13 cM from the proximal end of chromosome 19; (iii) from about 7.5 cM to about 12.5 cM from the proximal end of chromosome 19; (iv) from about 8 cM to about 12 cM from the proximal end of chromosome 19; (v) from about 8.5 cM to about 11.5 cM from the proximal end of chromosome 19; (vi) from about 9 cM to about 11 cM from the proximal end of chromosome 19; or (vii) from about 9.2 cM to about 10.8 cM from the proximal end of chromosome 19.
- chromosomal intervals are defined by the marker loci flanking either end of the interval.
- the one or more allele detected is of one or more marker locus localizing within a chromosomal interval flanked by and including marker loci BARC-039375-07306 and BARC-050993-10894 on chromosome 19.
- the one or more marker locus is localized within a chromosomal interval flanked by and including marker loci BARC-039375-07306 and Sattl82 on chromosome 19.
- the one or more marker locus is localized within a chromosomal interval flanked by and including marker loci BARC-039375-07306 and Satt232 on chromosome 19 or a chromosomal interval flanked by and including marker loci Sat_301 and Sattl82 on chromosome 19. In a more preferred embodiment, the one or more marker locus is localized within a chromosomal interval flanked by and including marker loci Sat_301 and Satt232 on chromosome 19.
- the one or more marker locus within or linked to the QTL associated with improved lodging resistance is localized within a chromosomal interval flanked by and including marker loci: (i) BARC-039375-07304 and BARC-065445- 19463 on chromosome 19; (ii) R176 1 and Sattl82 on chromosome 19; or (iii) Sat_301 and Satt446 on chromosome 19.
- the at least one allele detected is of one or more marker locus selected from the group consisting of Gml9: 1306591, Gml9: 1635254, Gml9:841738, Gml9: 1589758 and a combination thereof.
- the at least one allele detected is of marker locus Gml9: 1589758.
- the method comprises detecting one or more
- polymorphisms of and/or linked to one or more marker locus selected from the group consisting of Gml9: 1306591, Gml9: 1635254, Gml9:841738, Gml9: 1589758 and a combination thereof.
- the one or more allele detected is of one or more marker locus localizing within one or more of the genomic DNA regions of SEQ ID NOs: 28-31. In some embodiments, the one or more allele detected is of one or more marker locus localizing within 1 cM, 2 cM, 3 cM, 4 cM, 5 cM, 6 cM, 7 cM, 8 cM, 9 cM, 10 cM, 1 1 cM, 12 cM, 13 cM, 14 cM, 15 cM, 20 cM, or 30 cM of marker locus Gml9: 1306591, Gml9: 1635254, Gm 19: 841738, Gm 19: 1589758, or a combination thereof.
- the one or more marker locus is localized within a genetic recombination distance of less than or equal to 20 cM, e.g., about 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less, from marker locus Gml9: 1306591, Gml9: 1635254, Gml9:841738, Gml9: 1589758, or a combination thereof.
- the one or more marker locus is localized within a genetic recombination distance of less than or equal to 20 cM, e.g., about 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less, from a favorable allele of marker locus Gm 19: 1306591, Gm 19: 1635254, Gm 19: 841738, Gml9: 1589758, or a combination thereof.
- the method comprises detecting one or more polymorphisms having a physical position on chromosome 19 of the soybean genome based on the Glyma 1 Assembly (Schmutz et al. 2010) ⁇ see Table 2).
- the physical position is on chromosome 19 of the soybean genome and selected from the group consisting of 1,306,591 bp on chromosome 19, 1,635,254 bp on chromosome 19, 841,738 bp on chromosome 19, 1,589,758 bp on chromosome 19 and a combination thereof.
- S Ps polymorphisms
- S Ps polymorphisms
- the approximate physical positions of the SNPs in Table 2 are based on a publically available genomic sequence, which may be the same or different as compared to genomic sequence for a particular soybean variety. In either case, the skilled artisan can easily determine the approximate physical positions of the SNPs provided herein on any genomic sequence using sequencing and sequence analysis techniques, such as sequence alignments, BLAST searching, and the like.
- alleles that are favorable for, positively correlate with and/or are associated with resistance to lodging.
- at least one allele of one or more marker locus positively correlates with improved lodging resistance and is selected from the group consisting of a lodging resistance allele of a marker locus provided in Table 2 and any combination thereof.
- at least one allele of one or more marker loci negatively correlates with lodging resistance and is selected from the group consisting of a lodging susceptibility allele of a marker locus provided in Table 2 and any combination thereof.
- an allele that positively correlates with lodging resistance and an allele that negatively correlates with lodging resistance is detected in a soybean plant or soybean germplasm (i.e., the soybean plant or soybean germplasm is heterozygous).
- alleles that positively correlate with lodging resistance are provided.
- the at least one allele that positively correlates with lodging resistance comprises allele C of marker locus Gml9: 1306591, allele A of marker locus Gm 19: 1635254, allele G of marker locus Gm 19: 841738, allele G of marker locus
- the at least one allele that positively correlates with lodging resistance comprises allele G of marker locus
- a plurality of marker alleles are simultaneously selected for in a single plant or a population of plants.
- plants are selected that contain favorable alleles from more than one resistance marker, or alternatively, favorable alleles from more than one resistance marker are introgressed into a desired soybean germplasm.
- favorable alleles from more than one resistance marker in the same plant is likely to result in an additive (or even synergistic) protective effect for the plant.
- At least one allele of one or more marker locus within or linked to a QTL associated with improved resistance to lodging can be detected using one of the detection techniques described elsewhere herein.
- the detection technique comprises amplification, e.g., via polymerase chain reaction (PCR), of a genomic DNA region encompassing the marker locus.
- the one or more marker locus is localized on chromosome 13 of soybean and selected from the group consisting of a marker locus described in Table 1 and a combination thereof.
- the detection step comprises PCR detection using amplification primers for amplifying at least a portion of one or more genomic DNA regions of the soybean genome having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%), or 99% or 100% sequence identity to the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-27.
- the one or more marker locus is selected from the group consisting of Gm 13 :36704369, Gm 13 :36300296, Gml3 :36567042, Gml3 :36792347, Gml3 :36864280, Gm 13 :37443784, Gml3 :36593549, and any combination thereof.
- the detection step comprises PCR detection using amplification primers for amplifying at least a portion of one or more genomic DNA regions of the soybean genome having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or 100%) sequence identity to the nucleic acid sequence selected from the group consisting of SEQ ID 1, 2, 3, 4, 5, 6, and 7 using oligonucleotide primers comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 32, 33, 36, 37, 40, 41, 44, 45, 48, 49, 52, 53, 56, and 57.
- Exemplary amplicons produced by such a PCR amplification technique comprise at least a portion of a genomic DNA region of the soybean genome having a nucleic acid sequence represented by SEQ ID NOs: 76, 77, 78, 79, 80, 81, or 82.
- the amplification step further includes the use of allele-specific probes capable of hybridizing to a specific allele of the marker locus.
- one or more probes comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 34, 35, 38, 39, 42, 43, 46, 47, 50, 51, 54, 55, 58, and 59 can be used in the present methods for detecting an allele of the marker locus associated with improved resistance to lodging.
- the one or more marker locus is localized on chromosome 19 of soybean and selected from the group consisting of a marker locus described in Table 2 and a combination thereof.
- the detection step comprises PCR detection using amplification primers for amplifying at least a portion of one or more genomic DNA regions of the soybean genome having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or 100%) sequence identity to the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 28-31.
- the one or more marker locus is selected from the group consisting of Gml9: 1306591, Gml9: 1635254, Gml9:841738, Gml9: 1589758, and any combination thereof.
- the detection step comprises PCR detection using amplification primers for amplifying at least a portion of one or more genomic DNA regions of the soybean genome having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or 100%) sequence identity to the nucleic acid sequence selected from the group consisting of SEQ ID 28, 29, 30 and 31 using oligonucleotide primers comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 60, 61, 64, 65, 68, 69, 72, and 73.
- Exemplary amplicons produced by such a PCR amplification technique comprise at least a portion of a genomic DNA region of the soybean genome having a nucleic acid sequence represented by SEQ ID NOs: 83, 84, 85, or 86.
- the amplification step further includes the use of allele-specific probes capable of hybridizing to a specific allele of the marker locus.
- one or more probes comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 62, 63, 66, 67, 70, 71, 74, and 75 can be used in the present methods for detecting an allele of the marker locus associated with improved resistance to lodging.
- Exemplary primers and probes are provided in Table 3.
- amplification primers and detection probes can, of course, vary.
- the invention is not limited to the primers and probes specifically recited herein.
- methods of the invention utilize an amplification step to detect/genotype a marker locus.
- amplification is not a requirement for marker detection—for example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA.
- Procedures for performing Southern blotting, amplification (PCR, LCR, or the like) and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., (2000) Molecular Cloning— A Laboratory Manual (3rd Ed.), Vol. 1-3, Cold Spring Harbor
- Separate detection probes can also be omitted in amplification/detection methods, e.g., by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamplified precursors (e.g., by fluorescence polarization).
- molecular markers are detected by any established method available in the art, including, without limitation, allele specific hybridization (ASH) or other methods for detecting single nucleotide polymorphisms (S P), amplified fragment length polymorphism (AFLP) detection, amplified variable sequence detection, randomly amplified polymorphic DNA (RAPD) detection, restriction fragment length polymorphism (RFLP) detection, self- sustained sequence replication detection, simple sequence repeat (SSR) detection, single- strand conformation polymorphisms (SSCP) detection, isozyme markers detection, or the like.
- Any of the aforementioned marker types can be employed in the context of the invention to identify chromosome segments encompassing genetic element that contribute to superior agronomic performance (e.g., resistance or improved resistance to lodging).
- the invention provides QTL chromosome intervals, where a QTL (or multiple QTLs) that segregate with decreased lodging are contained in those intervals.
- QTL or multiple QTLs
- a variety of methods well known in the art are available for identifying chromosome intervals, including those methods described herein.
- the boundaries of such chromosome intervals are drawn to encompass markers that will be linked to one or more QTL.
- the chromosome interval is drawn such that any marker that lies within that interval (including the terminal markers that define the boundaries of the interval) can be used as markers for lodging resistance.
- Each interval comprises at least one QTL, and furthermore, may indeed comprise more than one QTL.
- Close proximity of multiple QTL in the same interval may obfuscate the correlation of a particular marker with a particular QTL, as one marker may demonstrate linkage to more than one QTL. Conversely, e.g., if two markers in close proximity show co-segregation with the desired phenotypic trait, it is sometimes unclear if each of those markers identifying the same QTL or two different QTL. Regardless, knowledge of how many QTL are in a particular interval is not necessary to make or practice the method described herein.
- the present disclosure provides a soybean chromosome interval, where the markers within that interval demonstrate co-segregation with decreased lodging.
- this interval comprises at least one decreased lodging QTL.
- the interval is a chromosomal interval located at about 67 cM to about 88 cM from the proximal end of chromosome 13.
- the interval is a chromosomal interval localizing: (i) from about 68 cM to about 87 cM from the proximal end of chromosome 13; (ii) from about 69 cM to about 86 cM from the proximal end of chromosome 13; (iii) from about 70 cM to about 85 cM from the proximal end of chromosome 13; (iv) from about 75 cM to about 80 cM from the proximal end of chromosome 13; (v) from about 75.4 cM to about 79.5 cM from the proximal end of chromosome 13; (vi) from about 75.9 cM to about 79 cM from the proximal end of chromosome 13; (vii) from about 76.4 cM to about 78.5 cM from the proximal end of chromosome 13; or (viii) from about 76.9 cM to about 78
- chromosomal interval located within about 2 million base pairs (Mbp), e.g., 1.75 Mbp, 1.5 Mbp, 1.25 Mbp, 1 Mbp, 750 kbp, 500 kbp, 250 kbp, 1,000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp or less of an interval at 36,410-36,419 kbp of chromosome 13 (SEQ ID NO: 87).
- Mbp base pairs
- the interval is a chromosomal interval located at about 5 cM to about 15 cM from the proximal end of chromosome 19.
- the interval is a chromosomal interval localizing: (i) from about 5 cM to about 15 cM from the proximal end of chromosome 19; (ii) from about 5.5 cM to about 14.5 cM from the proximal end of chromosome 19; (iii) from about 6 cM to about 14 cM from the proximal end of chromosome 19; (iv) from about 7 cM to about 13 cM from the proximal end of chromosome 19; (v) from about 7.5 cM to about 12.5 cM from the proximal end of chromosome 19; (v) from about 8 cM to about 12 cM from the proximal end of chromosome 19; (vii) from about 8.5 c
- the interval is defined by flanking marker loci.
- the interval is a chromosomal interval flanked by and including: (i) marker loci BARC-038503-10136 and Satt554 on chromosome 13; (ii) marker loci Satt072 and BARC- 027792-06674 on chromosome 13; (iii) marker loci BARC-018605-02982 and BARC- 027792-06674 on chromosome 13; (iv) marker loci BARC-025859-05126 and BARC- 014657-01608 on chromosome 13; (v) marker loci Gml3 :36704369 and Gml3 :36300296 on chromosome 13; (vi) marker loci BARC-028583-05961 and BARC-025561-06521 on chromosome 13; (vii) marker loci BARC-028887-06033 and BARC-027792-06674 on
- Each of the intervals described above shows a clustering of markers that co- segregate with decreased lodging (i.e., improved resistance to lodging). This clustering of markers occurs in relatively small domains on the linkage groups, indicating the presence of one or more QTL in those chromosome regions. QTL intervals were drawn to encompass the markers that co-segregate with improved resistance to lodging. The intervals are defined by the markers on their termini, where the interval encompasses all the markers that map within the interval as well as the markers that define the termini.
- an interval can be drawn, where the interval is defined by linkage to a particular marker locus.
- an interval on chromosome 13 can be defined where any marker that is linked to the marker locus Gm 13 : 36704369, Gml3 :36300296 and/or Gml3 :36593549 is a member of that interval.
- linkage is defined as any marker that is within 25 cM, e.g., about 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, 0.25 cM or less from Gm 13 :36704369, Gml3 :36300296 and/or Gml3 :36593549.
- an interval on a marker that is within 25 cM e.g., about 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, 0.25 cM or less from Gm 13 :36704369, Gml3 :36300296 and/or Gml3 :36593549.
- chromosome 19 can be defined where any marker that is linked to the marker locus
- Gml9: 1589758 is a member of that interval.
- linkage is defined as any marker that is within 25 cM, e.g., about 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, 0.25 cM or less from Gml9: 1589758.
- an interval e.g., a chromosome interval or a QTL interval
- An interval can be described by the terminal markers that define the endpoints of the interval, and typically the interval will include the terminal markers that define the extent of the interval.
- An interval can include any marker localizing within that chromosome domain, whether those markers are currently known or unknown.
- the interval can be described by one marker, for example the interval on chromosome 13 can be described as including marker Gml3 :36704369 and below. In various further aspects, the interval on chromosome 13 can be described as including marker
- the interval on chromosome 13 can be described as flanked by and including Gml3 :36704369 and Gml3 :36300296.
- recombination frequencies and as a result, genetic map positions in any particular population are not static.
- the genetic distances separating two markers can vary depending on how the map positions are determined.
- variables such as the parental mapping populations used, the software used in the marker mapping or QTL mapping, and the parameters input by the user of the mapping software can contribute to the QTL/marker genetic map relationships.
- the present methods be limited to any particular mapping populations, use of any particular software, or any particular set of software parameters to determine linkage of a particular marker or chromosome interval with the decreased lodging phenotype.
- Any suitable soybean strains can be used to generate mapping data or for marker association studies.
- a large number of commonly used soybean lines (e.g., commercial varieties) and mapping populations are known in the art.
- a broad range of mapping populations were used to obtain the results described in Examples.
- a variety of commercial software is available for genetic mapping and marker association studies (e.g., QTL mapping). This software includes but is not limited to:
- a consensus map is derived by simply overlaying one map on top of another.
- various algorithms e.g., JoinMap® analysis, allows the combination of genetic mapping data from multiple sources, and reconciles discrepancies between mapping data from the original sources. See Van Ooijen, and Voorrips (2001) "JoinMap 3.0 software for the calculation of genetic linkage maps," Plant Research
- the soybean integrated linkage map provided in Song et al, (2004) is based on the principle described by Stam (1993) "Construction of integrated genetic linkage maps by means of a new computer package: JoinMap," The Plant Journal 3(5):739-744; and Van Ooijen and Voorrips (2001) "JoinMap 3.0 software for the calculation of genetic linkage maps,” Plant Research International, Wageningen, the Netherlands. Mapping information from five soybean populations was used in the map integration, and also used to place recently identified SSR markers onto the soybean genome.
- mapping populations were MinsoyxNoir 1 (MN), Minsoyx Archer (MA), Noir l Archer (NA), ClarkxHarosoy (CH) and A81-356022xP1468916 (MS).
- the JoinMap® analysis resulted in a map with 20 linkage groups containing a total of 1849 markers, including 1015 SSRs, 709 RFLPs, 73 RAPDs, 24 classical traits, six AFLPs, ten isozymes and 12 others.
- mapped SSR markers were 417 previously uncharacterized SSRs.
- LOD scores and pairwise recombination frequencies between markers were calculated.
- a LOD of 5.0 was used to create groups in the MS, MA, NA populations and LOD 4.0 in the MN and CH populations.
- the map of each linkage group was then integrated. Recombination values were converted to genetic distances using the Kosambi mapping function.
- useful QTL marker loci identified herein include one or more of the marker loci described on Tables 1 and 2.
- useful QTL marker loci include one or more marker locus selected from the group consisting of Gm 13 :36704369, Gm 13 :36300296, Gml3 :36593549, Gml9: 1589758 and a combination thereof.
- Additional markers linked to the QTL markers can also be used to predict the resistance or resistance to lodging trait in a soybean plant.
- any other marker showing less than 50%, e.g., 45%, 40%, 35%, 30%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less recombination frequency (separated by a genetic distance less than 50 cM%, e.g., 45, 40, 35, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 cM or less) with a QTL marker of the invention is also a feature of the disclosure. Any marker that is linked to a QTL marker can also be used advantageously in marker-assisted selection for the particular trait.
- QTL markers are particularly useful when they are sufficiently proximal (e.g., closely linked) to a given QTL marker so that the genetic marker and the QTL marker display a low recombination frequency.
- closely linked markers are a feature of the present disclosure.
- closely linked markers display a recombination frequency of about 10% or less, e.g., 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less (the given marker is within 10 cM, e.g., about 9, 8, 7, 6, 5, 4, 3, 2, 1 cM or less, of the QTL).
- these closely linked loci co-segregate at least 90% of the time, e.g., about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the time.
- the closer a marker is to a QTL marker the more effective and advantageous that marker becomes as an indicator for the desired trait.
- closely linked loci such as a QTL marker locus and a second locus display an inter-locus cross-over frequency of about 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less.
- the relevant loci e.g., a marker locus and a target locus such as a QTL
- the loci are about 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.75 cM, 0.5 cM or 0.25 cM or less apart.
- two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%), 0.25%), or less) are said to be proximal to each other.
- linked markers can be determined by review of any suitable soybean genetic map.
- the integrated genetic map described in Song et al, (2004) also provides a means to identify linked
- linked markers as defined herein can be determined from any genetic map known in the art (an experimental map or an integrated map), or alternatively, can be determined from any new mapping dataset.
- markers that are placed on any two maps may not be identical, and furthermore, some maps may have a greater marker density than another map.
- mapping populations, methodologies and algorithms used to construct genetic maps can differ.
- one genetic map is not necessarily more or less accurate than another, and furthermore, recognizes that any soybean genetic map can be used to determine markers that are linked and closely linked to the QTL markers of the present disclosure.
- molecular markers that have a significant probability of co- segregation with QTL that impart a decreased lodging phenotype. These QTL markers find use in marker assisted selection for desired traits (decreased lodging), and also have other uses. It is not intended that the invention be limited to any particular method for the detection of these markers.
- Markers corresponding to genetic polymorphisms between members of a population can be detected by numerous methods well-established in the art (e.g., PCR-based sequence specific amplification, restriction fragment length polymorphisms (RFLPs), isozyme markers, allele specific hybridization (ASH), amplified variable sequences of the plant genome, self-sustained sequence replication, simple sequence repeat (SSR), single nucleotide polymorphism (S P), random amplified polymorphic DNA (“RAPD”) or amplified fragment length polymorphisms (AFLP)).
- PCR-based sequence specific amplification e.g., restriction fragment length polymorphisms (RFLPs), isozyme markers, allele specific hybridization (ASH), amplified variable sequences of the plant genome, self-sustained sequence replication, simple sequence repeat (SSR), single nucleotide polymorphism (S P), random amplified polymorphic DNA (“RAPD”) or amplified fragment length polymorphisms (AFLP)
- NGS Next Generation Sequencing
- GGS genotyping by sequencing
- MIP Molecular Inversion Probe
- nucleic acids In general, the majority of genetic markers rely on one or more property of nucleic acids for their detection. For example, some techniques for detecting genetic markers utilize hybridization of a probe nucleic acid to nucleic acids corresponding to the genetic marker ⁇ e.g., amplified nucleic acids produced using genomic soybean DNA as a template).
- Hybridization formats including but not limited to solution phase, solid phase, mixed phase, or in situ hybridization assays are useful for allele detection.
- An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in
- stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to about 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C for short probes ⁇ e.g., 10 to 50 nucleotides) and at least about 60° C for long probes ⁇ e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1%) SDS at 37° C, and a wash in 0.5x to lxSSC at 55 to 60° C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C, and a wash in O.
- Tm thermal melting point
- Tm 81.5° C + 16.6 (log M) 4-0.41 (%GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guano sine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
- the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C.
- Tm hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10° C.
- stringent conditions are selected to be about 5° C. lower than Tm for the specific sequence and its complement at a defined ionic strength and pH.
- severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C lower than the Tm
- moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C lower than the Tm
- low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C lower than the Tm.
- Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120, or 240 minutes.
- markers that comprise restriction fragment length polymorphisms are detected, e.g., by hybridizing a probe which is typically a sub-fragment (or a synthetic oligonucleotide corresponding to a sub-fragment) of the nucleic acid to be detected to restriction digested genomic DNA.
- the restriction enzyme is selected to provide restriction fragments of at least two alternative (or polymorphic) lengths in different individuals or populations. Determining one or more restriction enzyme that produces informative fragments for each cross is a simple procedure, well known in the art.
- the labeled probe After separation by length in an appropriate matrix (e.g., agarose or polyacryl amide) and transfer to a membrane (e.g., nitrocellulose, nylon, etc.), the labeled probe is hybridized under conditions which result in equilibrium binding of the probe to the target followed by removal of excess probe by washing.
- an appropriate matrix e.g., agarose or polyacryl amide
- a membrane e.g., nitrocellulose, nylon, etc.
- Nucleic acid probes to the marker loci can be cloned and/or synthesized. Any suitable label can be used with a probe of the invention.
- Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
- Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels.
- Other labels include ligands which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes.
- a probe can also constitute radiolabeled PCR primers that are used to generate a radiolabeled amplicon.
- Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene Oreg.); or
- PCR, RT-PCR and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g., those comprising marker loci), facilitating detection of the markers. Details regarding the use of these and other amplification methods can be found in any of a variety of standard texts, including, e.g., Sambrook, Ausubel, Berger and Croy, herein. Many available biology texts also have extended discussions regarding PCR and related amplification methods. One of skill will appreciate that essentially any RNA can be converted into a double stranded DNA suitable for restriction digestion, PCR expansion and sequencing using reverse transcriptase and a polymerase ("Reverse Transcription-PCR, or "RT-PCR”). See also Ausubel, Sambrook and Berger, above.
- a molecular beacon is an oligonucleotide or PNA which, under appropriate hybridization conditions, self- hybridizes to form a stem and loop structure.
- the MB has a label and a quencher at the termini of the oligonucleotide or PNA; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher.
- the MB does not display intra-molecular hybridization (e.g., when bound to a target nucleic acid, e.g., to a region of an amplicon during
- PCR detection and quantification using dual-labeled fluorogenic oligonucleotide probes can also be performed according to the present invention. These probes are composed of short ⁇ e.g., 20-25 base)
- oligodeoxynucleotides that are labeled with two different fluorescent dyes.
- On the 5' terminus of each probe is a reporter dye, and on the 3 ' terminus of each probe a quenching dye is found.
- the oligonucleotide probe sequence is complementary to an internal target sequence present in a PCR amplicon.
- energy transfer occurs between the two fluorophores and emission from the reporter is quenched by the quencher by FRET.
- the probe is cleaved by 5' nuclease activity of the polymerase used in the reaction, thereby releasing the reporter from the oligonucleotide-quencher and producing an increase in reporter emission intensity.
- TaqManTM probes are oligonucleotides that have a label and a quencher, where the label is released during amplification by the exonuclease action of the polymerase used in amplification. This provides a real time measure of amplification during synthesis.
- a variety of TaqManTM reagents are commercially available, e.g., from Applied Biosystems (Division Headquarters in Foster City, Calif.) as well as from a variety of specialty vendors such as Biosearch Technologies (e.g., black hole quencher probes).
- Amplified variable sequences refer to amplified sequences of the plant genome which exhibit high nucleic acid residue variability between members of the same species. All organisms have variable genomic sequences and each organism (with the exception of a clone) has a different set of variable sequences. Once identified, the presence of specific variable sequence can be used to predict phenotypic traits.
- DNA from the plant serves as a template for amplification with primers that flank a variable sequence of DNA. The variable sequence is amplified and then sequenced.
- self-sustained sequence replication can be used to identify genetic markers.
- Self-sustained sequence replication refers to a method of nucleic acid amplification using target nucleic acid sequences which are replicated exponentially in vitro under substantially isothermal conditions by using three enzymatic activities involved in retroviral replication: (1) reverse transcriptase, (2) RNase H, and (3) a DNA-dependent RNA polymerase (Guatelli, et al, (1990) Proc Natl Acad Sci USA 87: 1874). By mimicking the retroviral strategy of RNA replication by means of cDNA intermediates, this reaction accumulates cDNA and RNA copies of the original target.
- Amplified fragment length polymorphisms can also be used as genetic markers (Vos, et al, (1995) Nucleic Acids Res 23 :4407).
- the phrase "amplified fragment length polymorphism” refers to selected restriction fragments which are amplified before or after cleavage by a restriction endonuclease. The amplification step allows easier detection of specific restriction fragments.
- AFLP allows the detection large numbers of polymorphic markers and has been used for genetic mapping of plants (Becker, et al, (1995) Mol Gen Genet 249:65; and Meksem, et al, (1995) Mol Gen Genet 249:74).
- Allele-specific hybridization can be used to identify the genetic markers of the invention.
- ASH technology is based on the stable annealing of a short, single-stranded, oligonucleotide probe to a completely complementary single-strand target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe.
- ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences. Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization. In this manner, only one of the alternative probes will hybridize to a target sample that is homozygous or homogenous for an allele. Samples that are heterozygous or heterogeneous for two alleles will hybridize to both of two alternative probes.
- ASH markers are used as dominant markers where the presence or absence of only one allele is determined from hybridization or lack of hybridization by only one probe. The alternative allele may be inferred from the lack of hybridization.
- ASH probe and target molecules are optionally RNA or DNA; the target molecules are any length of nucleotides beyond the sequence that is complementary to the probe; the probe is designed to hybridize with either strand of a DNA target; the probe ranges in size to conform to variously stringent hybridization conditions, etc.
- PCR allows the target sequence for ASH to be amplified from low concentrations of nucleic acid in relatively small volumes. Otherwise, the target sequence from genomic DNA is digested with a restriction endonuclease and size separated by gel electrophoresis. Hybridizations typically occur with the target sequence bound to the surface of a membrane or, as described in U.S. Pat. No. 5,468,613 (the contents of which are incorporated herein by reference), the ASH probe sequence may be bound to a membrane.
- ASH data are typically obtained by amplifying nucleic acid fragments (amplicons) from genomic DNA using PCR, transferring the amplicon target DNA to a membrane in a dot-blot format, hybridizing a labeled oligonucleotide probe to the amplicon target, and observing the hybridization dots by autoradiography.
- amplicons nucleic acid fragments
- Single nucleotide polymorphisms are markers that consist of a shared sequence differentiated on the basis of a single nucleotide. Typically, this distinction is detected by differential migration patterns of an amplicon comprising the SNP on e.g., an acrylamide gel.
- SNP single nucleotide polymorphisms
- alternative modes of detection such as hybridization, e.g., ASH, or RFLP analysis are also appropriate.
- Isozyme markers can be employed as genetic markers, e.g., to track markers other than the tolerance markers herein, or to track isozyme markers linked to the markers herein.
- Isozymes are multiple forms of enzymes that differ from one another in their amino acid, and therefore their nucleic acid sequences. Some isozymes are multimeric enzymes containing slightly different subunits. Other isozymes are either multimeric or monomeric but have been cleaved from the proenzyme at different sites in the amino acid sequence. Isozymes can be characterized and analyzed at the protein level, or alternatively, isozymes which differ at the nucleic acid level can be determined. In such cases any of the nucleic acid based methods described herein can be used to analyze isozyme markers.
- nucleic acid amplification techniques such as PCR and LCR are well known in the art and can be applied to the present invention to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci.
- techniques sufficient to direct persons of skill through such in vitro methods including the polymerase chain reaction (PCR), the ligase chain reaction (LCR), QPP-replicase amplification and other RNA polymerase mediated techniques (e.g., NASBA), are found in the references noted above, e.g., Innis, Sambrook, Ausubel, Berger and Croy. Additional details are found in Mullis, et al, (1987) U.S. Pat. No.
- oligonucleotides in general, synthetic methods for making oligonucleotides, including probes, primers, molecular beacons, PNAs, LNAs (locked nucleic acids), etc., are well known.
- oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers, (1981) Tetrahedron Letts 22(20): 1859-1862, e.g., using a commercially available automated synthesizer, e.g., as described in Needham-VanDevanter, et al, (1984) Nucleic Acids Res 12:6159-6168.
- Oligonucleotides including modified oligonucleotides can also be ordered from a variety of commercial sources known to persons of skill. There are many commercial providers of oligo synthesis services, and thus this is a broadly accessible technology. Any nucleic acid can be custom ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company, The Great American Gene Company, ExpressGen Inc., Operon
- PNAs can be custom ordered from any of a variety of sources, such as PeptidoGenic, HTI Bio-Products, Inc., BMA Biomedicals Ltd (U.K.), Bio » Synthesis, Inc., and many others.
- in silico methods can be used to detect the marker loci of interest.
- the sequence of a nucleic acid comprising the marker locus of interest can be stored in a computer.
- the desired marker locus sequence or its homolog can be identified using an appropriate nucleic acid search algorithm as provided by, for example, in such readily available programs as BLAST, or even simple word processors.
- the molecular markers of the invention are detected using a suitable PCR-based detection method, where the size or sequence of the PCR amplicon is indicative of the absence or presence of the marker (e.g., a particular marker allele).
- PCR primers are hybridized to the conserved regions flanking the polymorphic marker region.
- PCR markers used to amplify a molecular marker are sometimes termed "PCR markers" or simply "markers”.
- primers can be designed using any suitable method. It is not intended that the invention be limited to any particular primer or primer pair.
- primers can be designed using any suitable software program, such as LASERGE E®.
- the primers of the invention are radiolabeled, or labeled by any suitable means (e.g., using a non-radioactive fluorescent tag), to allow for rapid visualization of the different size amplicons following an amplification reaction without any additional labeling step or visualization step.
- the primers are not labeled, and the amplicons are visualized following their size resolution, e.g., following agarose gel electrophoresis.
- ethidium bromide staining of the PCR amplicons following size resolution allows visualization of the different size amplicons.
- the primers of the present methods be limited to generating an amplicon of any particular size.
- the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus.
- the primers can generate an amplicon of any suitable length that is longer or shorter than the amplicons described herein.
- marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
- Marker alleles in addition to those recited in Tables 1 and 2 also find use with the present methods.
- a primary motivation for development of molecular markers in crop species is the potential for increased efficiency in plant breeding through marker assisted selection (MAS).
- MAS marker assisted selection
- Genetic markers are used to identify plants that contain a desired genotype at one or more loci, and that are expected to transfer the desired genotype, along with a desired phenotype to their progeny.
- Genetic markers can be used to identify plants that contain a desired genotype at one locus, or at several unlinked or linked loci (e.g., a haplotype), and that would be expected to transfer the desired genotype, along with a desired phenotype to their progeny.
- the present disclosure provides the means to identify plants, particularly soybean plants that are resistant or exhibit improved resistance to lodging by identifying plants having a marker allele that positively correlates with improved resistance to lodging, such as a favorable allele of one of the marker loci described in Tables 1 and 2.
- a soybean plant or soybean germplasm is identified and/or selected that comprises a favorable allele of marker locus Gm 13 :36704369, Gm 13 :36300296, Gml3 :36596549, and/or Gm 19: 1589758.
- the present disclosure provides the means to identify plants, particularly soybean plants that are susceptible to lodging by identifying plants having a marker allele that positively correlates with lodging susceptibility, such as an allele of one or the marker loci described in Tables 1 and 2.
- marker loci can be introgressed into any desired genomic background, germplasm, plant, line, variety, etc., as part of an overall MAS breeding program designed to enhance soybean yield.
- the disclosure also provides chromosome QTL intervals that find equal use in MAS to select plants that demonstrate decreased lodging. Similarly, the QTL intervals can also be used to counter-select plants that display increased lodging. Any marker that maps within the QTL interval (including the termini of the intervals) finds use with the invention.
- the interval is a chromosomal interval that is localized: (i) from about 67 cM to about 88 cM from the proximal end of chromosome 13; (ii) from about 68 cM to about 87 cM from the proximal end of chromosome 13; (iii) from about 69 cM to about 86 cM from the proximal end of chromosome 13; (iv) from about 70 cM to about 85 cM from the proximal end of chromosome 13; (v) from about 75 cM to about 80 cM from the proximal end of chromosome 13; (vi) from about 75.4 cM to about 79.5 cM from the proximal end of chromosome 13; (vii) from about 75.9 cM to about 79 cM from the proximal end of chromosome 13; (viii) from about 76.4 cM to about 78.5
- the interval is a chromosomal interval located at about 5 cM to about 15 cM from the proximal end of chromosome 19.
- the interval is a chromosomal interval that is localized: : (i) from about 5 cM to about 15 cM from the proximal end of chromosome 19; (ii) from about 5.5 cM to about 14.5 cM from the proximal end of chromosome 19; (iii) from about 6 cM to about 14 cM from the proximal end of chromosome 19; (iv) from about 7 cM to about 13 cM from the proximal end of chromosome 19; (v) from about 7.5 cM to about 12.5 cM from the proximal end of chromosome 19; (vi) from about 8 cM to about 12 cM from the proximal end of chromosome 19; (vii) from about 8.5 c
- the interval is described as flanked by and including: (i) marker loci BARC-038503-10136 and Satt554 on chromosome 13; (ii) marker loci Satt072 and BARC-027792-06674 on chromosome 13; (iii) marker loci BARC-018605-02982 and BARC-027792-06674 on chromosome 13; (iv) marker loci BARC-025859-05126 and BARC-014657-01608 on chromosome 13; (v) marker loci Gml3 :36704369 and
- MAS uses polymorphic markers that have been identified as having a significant likelihood of co- segregation with a lodging resistance trait. Such markers are presumed to map near a gene or genes that give the plant its lodging resistance phenotype, and are considered indicators for the desired trait, and are termed QTL markers. Plants are tested for the presence of a desired allele in the QTL marker. The most preferred markers (or marker alleles) are those that have the strongest association with the lodging resistance trait.
- Linkage analysis is used to determine which polymorphic marker allele demonstrates a statistical likelihood of co- segregation with the lodging resistance phenotype (thus, a "lodging resistance marker allele"). Following identification of a marker allele for co- segregation with the lodging resistance phenotype, it is possible to use this marker for rapid, accurate screening of plant lines for the lodging resistance allele without the need to grow the plants through their life cycle and await phenotypic evaluations, and furthermore, permits genetic selection for the particular lodging resistance allele even when the molecular identity of the actual lodging resistance QTL is unknown. Tissue samples can be taken, for example, from the first leaf of the plant and screened with the appropriate molecular marker, and it is rapidly determined which progeny will advance. Linked markers also remove the impact of environmental factors that can often influence phenotypic expression.
- a polymorphic QTL marker locus can be used to select plants that contain the marker allele (or alleles) that correlate with the desired lodging resistance phenotype.
- a nucleic acid corresponding to the marker nucleic acid allele is detected in a biological sample from a plant to be selected. This detection can take the form of hybridization of a probe nucleic acid to a marker allele or amplicon thereof, e.g., using allele-specific hybridization, Southern analysis, northern analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a region of the marker, or the like.
- allele-specific hybridization Southern analysis, northern analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a region of the marker, or the like.
- Soybean plant breeders desire combinations of lodging resistance loci with genes for high yield and other desirable traits to develop improved soybean varieties. Screening large numbers of samples by non-molecular methods (e.g., trait evaluation in soybean plants) can be expensive, time consuming, and unreliable.
- MAS is to assist the recovery of the recurrent parent genotype by backcross breeding.
- Backcross breeding is the process of crossing a progeny back to one of its parents or parent lines. Backcrossing is usually done for the purpose of introgressing one or a few loci from a donor parent (e.g., a parent comprising desirable lodging resistance marker loci) into an otherwise desirable genetic background from the recurrent parent (e.g., an otherwise high yielding soybean line).
- a donor parent e.g., a parent comprising desirable lodging resistance marker loci
- an otherwise desirable genetic background from the recurrent parent e.g., an otherwise high yielding soybean line.
- the more cycles of backcrossing that are done the greater the genetic contribution of the recurrent parent to the resulting introgressed variety. This is often necessary, because lodging resistant plants may be otherwise undesirable, e.g., due to low yield, low fecundity, or the like.
- One application of MAS in the context of the present disclosure is to use the resistance or improved resistance to lodging markers to increase the efficiency of an introgression or backcrossing effort aimed at introducing a lodging resistance QTL into a desired (typically high yielding) background.
- marker assisted backcrossing of specific markers (and associated QTL) from a donor source e.g., to an elite or exotic genetic background
- the markers and methods of the present disclosure can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (lodging resistance, along with any other available markers for yield, disease resistance, etc.).
- Any of the disclosed marker alleles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance.
- the number of alleles associated with lodging resistance that can be introduced or be present in a soybean plant of the present invention ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
- the present disclosure also extends to a method of making a progeny soybean plant and these progeny soybean plants, per se.
- the method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art.
- Such soybean plant progeny can be assayed for alleles associated with lodging resistance and, thereby, the desired progeny selected.
- Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding.
- At least one of the first or second soybean plants is a soybean plant of the present invention in that it comprises at least one of the allelic forms of the markers of the present invention, such that the progeny are capable of inheriting the allele.
- a method of the present invention is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plant's pedigree such that inheritance of the desired lodging resistance allele can be traced.
- the number of generations separating the soybean plants being subject to the methods of the present disclosure will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2 or 3
- Genetic diversity is important for long term genetic gain in any breeding program. With limited diversity, genetic gain will eventually plateau when all of the favorable alleles have been fixed within the elite population.
- One objective is to incorporate diversity into an elite pool without losing the genetic gain that has already been made and with the minimum possible investment.
- MAS provide an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
- the markers of the present disclosure can be used for MAS in crosses involving elite x exotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the lodging resistance marker alleles herein.
- a method comprises selecting a soybean plant or soybean germplasm having improved resistance to lodging by detecting one or more of the marker loci described herein and further crossing the selected soybean plant or soybean germplasm with a second soybean plant or soybean germplasm to introgress the improved lodging resistance QTL into a progeny soybean plant or soybean germplasm.
- the second soybean plant or soybean germplasm displays susceptibility to lodging or decreased lodging resistance as compared to the selected soybean plant or soybean progeny.
- the improved lodging resistance trait is then introgressed into a subset or subpopulation of progeny soybean plants or soybean germplasm and confers to these soybean progeny improved lodging resistance as compared to the second soybean parent.
- the marker loci provided herein are within or linked to a QTL or QTL interval that is associated with agronomic traits in addition to improved resistance to lodging.
- marker loci are provided herein that are associated with plant height in addition to lodging severity. Soybean plants with increased height are more susceptible to lodging than soybean plants having decreased height.
- favorable alleles of the marker loci described herein are suitable for detecting soybean plants and soybean germplasm with decreased height and improved resistance to lodging.
- the decreased height trait can be introgressed into progeny soybean plants or germplasm using the instant methods.
- the subset or subpopulation of progeny soybean plants or soybean germplasm produced by crossing the soybean plant selected by the methods provided herein with a second soybean plant may additionally display decreased height as compared to the second soybean parent.
- Progeny soybean plants and germplasm produced by the breeding a soybean plant or soybean germplasm having the improved lodging resistance trait with a soybean plant or soybean germplasm that does not have the improved lodging resistance trait can be screened using the detection methods described herein in order to identify and/or select a progeny soybean plant or germplasm in which the desired QTL has been introgressed.
- the present disclosure also relates to host cells and organisms which are transformed with nucleic acids corresponding to lodging resistance QTL identified according to the invention.
- nucleic acids include chromosome intervals (e.g., genomic fragments) that encode a lodging resistance or improved lodging resistance trait.
- Host cells are genetically engineered (e.g., transduced, transfected, transformed, etc.) with the vectors of this invention which can be, for example, a cloning vector, a shuttle vector or an expression vector.
- vectors are, for example, in the form of a plasmid, a phagemid, an agrobacterium, a virus, a naked polynucleotide (linear or circular), or a conjugated polynucleotide.
- Vectors can be introduced into bacteria, especially for the purpose of propagation and expansion.
- the vectors are also introduced into plant tissues, cultured plant cells or plant protoplasts by a variety of standard methods known in the art, including but not limited to electroporation (Fromm, et al, (1985) Proc Natl Acad Sci USA 82:5824), infection by viral vectors such as cauliflower mosaic virus (CaMV) (Hohn, et al, (1982) Molecular Biology of Plant Tumors Academic Press, New York, pp. 549-560; Howell, U.S. Pat. No.
- the T- DNA plasmid is transmitted to plant cells upon infection by Agrobacterium tumefaciens, and a portion is stably integrated into the plant genome (Horsch, et al, (1984) Science 233 :496; Fraley, et al, (1983) Proc Natl Acad Sci USA 80:4803). Additional details regarding nucleic acid introduction methods are found in Sambrook, Berger and Ausubel, supra.
- the method of introducing a nucleic acid of the present disclosure into a host cell is not critical to the instant disclosure, and it is not intended that the disclosure be limited to any particular method for introducing exogenous genetic material into a host cell.
- any suitable method e.g., including but not limited to the methods provided herein, which provides for effective introduction of a nucleic acid into a cell or protoplast can be employed and finds use with the disclosure.
- the engineered host cells can be cultured in conventional nutrient media modified as appropriate for such activities as, for example, activating promoters or selecting transformants. These cells can optionally be cultured into transgenic plants.
- plant regeneration from cultured protoplasts is described in Evans, et a/., (1983) "Protoplast Isolation and Culture," Handbook of Plant Cell Cultures 1 : 124-176 (MacMillan Publishing Co., New York; Davey, (1983) "Recent
- the present disclosure also relates to the production of transgenic organisms, which may be bacteria, yeast, fungi, animals or plants, transduced with the nucleic acids of the disclosure ⁇ e.g., nucleic acids comprising the marker loci and/or QTL noted herein).
- transgenic organisms which may be bacteria, yeast, fungi, animals or plants, transduced with the nucleic acids of the disclosure ⁇ e.g., nucleic acids comprising the marker loci and/or QTL noted herein).
- nucleic acids of the disclosure e.g., nucleic acids comprising the marker loci and/or QTL noted herein.
- Bacterial cells can be used to amplify the number of plasmids containing DNA constructs of this disclosure.
- the bacteria are grown to log phase and the plasmids within the bacteria can be isolated by a variety of methods known in the art (see, for instance, Sambrook).
- a plethora of kits are commercially available for the purification of plasmids from bacteria.
- the isolated and purified plasmids are then further manipulated to produce other plasmids, used to transfect plant cells or incorporated into Agrobacterium tumefaciens related vectors to infect plants.
- Typical vectors contain transcription and translation terminators, transcription and translation initiation sequences, and promoters useful for regulation of the expression of the particular target nucleic acid.
- the vectors optionally comprise generic expression cassettes containing at least one independent terminator sequence, sequences permitting replication of the cassette in eukaryotes, or prokaryotes, or both, ⁇ e.g., shuttle vectors) and selection markers for both prokaryotic and eukaryotic systems.
- Vectors are suitable for replication and integration in prokaryotes, eukaryotes, or preferably both. See, Giliman and Smith, (1979) Gene 8:81; Roberts, et al, (1987) Nature 328:731; Schneider, et al, (1995) Protein Expr Purif 6435: 10; Ausubel, Sambrook, Berger (all supra). A catalogue of Bacteria and
- Bacteriophages useful for cloning is provided, e.g., by the ATCC, e.g., The ATCC Catalogue of Bacteria and Bacteriophaqe (1992) Gherna, et al, (eds) published by the ATCC.
- nucleic acid can be custom or standard ordered from any of a variety of commercial sources, such as the Midland Certified Reagent Company (Midland, Tex.), The Great American Gene Company (Ramona, Calif), ExpressGen Inc. (Chicago, 111.), Operon Technologies Inc. (Alameda, Calif.) and many others.
- nucleic acid constructs of the disclosure e.g., plasmids, cosmids, artificial chromosomes, DNA and RNA polynucleotides
- plant cells either in culture or in the organs of a plant by a variety of conventional techniques.
- Techniques for transforming a wide variety of higher plant species are also well known and described in widely available technical, scientific, and patent literature. See, for example, Weissinger, et al, (1988) Ann Rev Genet 22:421-477.
- the DNA constructs of the disclosure for example plasmids, phagemids, cosmids, phage, naked or variously conjugated-DNA polynucleotides, ⁇ e.g., polylysine-conjugated DNA, peptide-conjugated DNA, liposome-conjugated DNA, etc.), or artificial chromosomes, can be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant cells using ballistic methods, such as DNA particle bombardment.
- Microinjection techniques for injecting plant e.g., cells, embryos, callus and protoplasts, are known in the art and well described in the scientific and patent literature. For example, a number of methods are described in Jones, (ed) (1995) Plant Gene Transfer and Expression Protocols— Methods in Molecular Biology, Volume 49 Humana Press, Towata, N.J., as well as in the other references noted herein and available in the literature.
- transformation is employed to generate transgenic plants.
- Agrobacterium-mediated transformation techniques including disarming and use of binary vectors, are also well described in the scientific literature. See, for example, Horsch, et al, (1984) Science 233 :496; and Fraley, et al, (1984) Proc Natl Acad Sci USA 80:4803 and recently reviewed in Hansen and Chilton, (1998) Current Topics in Microbiology 240:22; and Das, (1998) Subcellular Biochemistry 29: Plant Microbe Interactions, pp 343-363.
- DNA constructs are optionally combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector.
- the virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. See, U.S. Pat. No. 5,591,616.
- Agrobacterium is useful primarily in dicots, certain monocots can be transformed by Agrobacterium. For instance, Agrobacterium transformation of maize is described in U.S. Pat. No. 5,550,318.
- DNA can also be introduced into plants by direct DNA transfer into pollen as described by Zhou, et al, (1983) Methods in Enzymology 101 :433; Hess, (1987) Intern Rev Cytol 107:367; Luo, et al, (1988) Plant Mol Biol Rep 6: 165.
- Expression of polypeptide coding genes can be obtained by injection of the DNA into reproductive organs of a plant as described by Pena, et al, (1987) Nature 325:274.
- DNA can also be injected directly into the cells of immature embryos and the desiccated embryos rehydrated as described by Neuhaus, et al, (1987) Theor Appl Genet 75:30; and Benbrook, et al, (1986) in Proceedings Bio Expo Butterworth, Stoneham, Mass., pp. 27-54.
- plant viruses that can be employed as vectors are known in the art and include cauliflower mosaic virus (CaMV), geminivirus, brome mosaic virus, and tobacco mosaic virus.
- Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed genotype and thus the desired phenotype.
- Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Payne, et al, (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc.
- Regeneration can also be obtained from plant callus, explants, somatic embryos (Dandekar, et al., (1989) J Tissue Cult Meth 12: 145; McGranahan, et al., (1990) Plant Cell Rep 8:512) organs, or parts thereof.
- Such regeneration techniques are described generally in Klee, et al., (1987) Ann Rev Plant Phys 38:467-486. Additional details are found in Payne, (1992) and Jones (1995), both supra, and Weissbach and Weissbach, eds. (1988) Methods for Plant Molecular Biology Academic Press, Inc., San Diego, Calif.
- This regeneration and growth process includes the steps of selection of transformant cells and shoots, rooting the transformant shoots and growth of the plantlets in soil.
- the regeneration of plants containing nucleic acids of the present disclosure and introduced by Agrobacterium into cells of leaf explants can be achieved as described by Horsch, et al, (1985) Science 227: 1229-1231.
- transformants are grown in the presence of a selection agent and in a medium that induces the regeneration of shoots in the plant species being transformed as described by Fraley, et al, (1983) Proc Natl Acad Sci USA 80:4803.
- This procedure typically produces shoots within two to four weeks and these transformant shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth.
- Transgenic plants of the present disclosure may be fertile or sterile.
- Such species include primarily dicots, e.g., of the families: Leguminosae (including pea, beans, lentil, peanut, yam bean, cowpeas, velvet beans, soybean, clover, alfalfa, lupine, vetch, lotus, sweet clover, wisteria and sweetpea); and Compositae (the largest family of vascular plants, including at least 1,000 genera, including important commercial crops such as sunflower).
- Leguminosae including pea, beans, lentil, peanut, yam bean, cowpeas, velvet beans, soybean, clover, alfalfa, lupine, vetch, lotus, sweet clover, wisteria and sweetpea
- Compositae the largest family of vascular plants, including at least 1,000 genera, including important commercial crops such as sunflower).
- nucleic acids of the disclosure are preferred targets for modification with the nucleic acids of the disclosure, as well as those specified above, plants from the genera: Allium, Apium, Arachis, Brassica, Capsicum, Cicer, Cucumis, Curcubita, Daucus, Fagopyrum, Glycine, Helianthus, Lactuca, Lens, Lycopersicon, Medicago, Pisum, Phaseolus, Sola ium, Trifolium, Vigna and many others.
- Common crop plants which are targets of the present disclosure include soybean, sunflower, canola, peas, beans, lentils, peanuts, yam beans, cowpeas, velvet beans, clover, alfalfa, lupine, vetch, sweet clover, sweetpea, field pea, fava bean, broccoli, brussel sprouts, cabbage, cauliflower, kale, kohlrabi, celery, lettuce, carrot, onion, pepper, potato, eggplant and tomato.
- a plant promoter fragment is optionally employed which directs expression of a nucleic acid in any or all tissues of a regenerated plant.
- constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the - or 2'-promoter derived from T-DNA of Agrobacterium tumefaciens, and other transcription initiation regions from various plant genes known to those of skill.
- the plant promoter may direct expression of nucleic acids of the disclosure in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters).
- tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues, such as fruit, seeds or flowers.
- promoters which direct transcription in plant cells can be suitable.
- the promoter can be either constitutive or inducible.
- promoters of bacterial origin that operate in plants include the octopine synthase promoter, the nopaline synthase promoter and other promoters derived from native Ti plasmids. See, Herrara-Estrella, et al, (1983) Nature 303 :209.
- Viral promoters include the 35S and 19S RNA promoters of cauliflower mosaic virus. See, Odell, et al, (1985) Nature 313 :810.
- KTI Kunitz trypsin inhibitor promoter
- SCPl SCPl
- SUP UCD3
- ribulose-l,3-bisphosphate carboxylase small subunit promoter the ribulose-l,3-bisphosphate carboxylase small subunit promoter
- phaseolin promoter the promoter sequence from the E8 gene and other genes may also be used. The isolation and sequence of the E8 promoter is described in detail in Deikman and Fischer (1988) EMBO J 7:3315. Many other promoters are in current use and can be coupled to an exogenous DNA sequence to direct expression.
- a polyadenylation region at the 3 '-end of the coding region is typically included.
- the polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from, e.g., T-DNA.
- a vector comprising sequences of the disclosure will typically include a nucleic acid subsequence, a marker gene which confers a selectable, or alternatively, a screenable, phenotype on plant cells.
- the marker can encode biocide tolerance, particularly antibiotic tolerance, such as tolerance to kanamycin, G418, bleomycin, hygromycin, or herbicide tolerance, such as tolerance to chlorosulforon, or phosphinothricin (the active ingredient in the herbicides bialaphos or Basta). See, e.g., Padgette, et al, (1996) In:
- Herbicide-Resistant Crops (Duke, ed.), pp 53-84, CRC Lewis Publishers, Boca Raton ("Padgette, 1996").
- crop selectivity to specific herbicides can be conferred by engineering genes into crops that encode appropriate herbicide metabolizing enzymes from other organisms, such as microbes. See, Vasil, (1996) In: Herbicide-Resistant Crops (Duke, ed.), pp 85-91, CRC Lewis Publishers, Boca Raton) ("Vasil", 1996).
- transgenic plants can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
- vegetatively propagated crops mature transgenic plants can be propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants. Selection of desirable transgenics is made and new varieties are obtained and propagated vegetatively for commercial use.
- seed propagated crops mature transgenic plants can be self crossed to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced heterologous nucleic acid. These seeds can be grown to produce plants that would produce the selected phenotype.
- Parts obtained from the regenerated plant such as flowers, seeds, leaves, branches, fruit, and the like are included in the disclosure, provided that these parts comprise cells comprising the isolated nucleic acid of the present disclosure. Progeny and variants, and mutants of the regenerated plants are also included within the scope of the disclosure, provided that these parts comprise the introduced nucleic acid sequences.
- Transgenic or introgressed plants comprising nucleic acids of the present disclosure can be screened for transmission of the nucleic acid of the present disclosure by, for example, standard nucleic acid detection methods or by immunoblot protocols.
- a preferred embodiment of the disclosure is a transgenic plant that is homozygous for the added heterologous nucleic acid; e.g., a transgenic plant that contains two added nucleic acid sequence copies.
- a homozygous transgenic plant can be obtained by sexually mating (self-fertilizing) a heterozygous transgenic plant that contains a single added heterologous nucleic acid.
- Back-crossing to a parental plant and out-crossing with a non- transgenic plant can be used to introgress the heterologous nucleic acid into a selected background (e.g., an elite or exotic soybean line).
- plant resistance to lodging is a phenotypic spectrum consisting of extremes in resistance, susceptibility and a continuum of intermediate resistance phenotypes. Lodging resistance also varies due to environmental effects. Evaluation of phenotypes using reproducible assays and lodging resistance scoring methods are of value to scientists who seek to identify genetic loci that impart lodging resistance, conduct marker assisted selection for resistant populations, and for introgression techniques to breed a lodging resistance trait into an elite soybean line, for example.
- Ratings are assigned by evaluating all plants of a cultivar in a plot, e.g., a 5 feet by 36 inches plot. Cultivar scores are based on a 1 to 9 system where lodging is scored visually for each plot and rated on a scale of 1 to 9 representing the percentage of plants in the row at harvest maturity that are less than fully erect. Plots with almost all plants fully erect are scored a 9, plots with most plants at a 45 degree angle in relation to the ground are scored a 5, and plots with almost all plants laying on the ground are scored a 1.
- a typical system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker locus associated with resistance or improved resistance to lodging. These probes or primers are configured to detect the marker alleles noted in the tables and examples herein, e.g., using any available allele detection format, e.g., solid or liquid phase array based detection, mi croflui die-based sample detection, etc.
- a kit for selecting at least one soybean plant by marker assisted selection of a QTL associated with improved lodging resistance includes primers or probes for detecting one or more of the marker loci selected from the group consisting of Gml3 :36431456, Gm 13 :36490271, Gml3 :36491753, Gml3 :36491754, Gm 13 :36492037, Gm 13 :36492926, Gml3 :36492955, Gml3 :36493615, Gm 13 :36494839, Gml3 :36517239, Gml3 :36539789, Gml3 :36539798, Gml3 :36540415, Gml3 :36593549, Gml3 :36613902, Gml3 :36644196, Gm 13 :36644203, Gm 13 :36644207, Gm 13 :
- the one or more marker loci is localized between 36,410 and 36,419 kbp of chromosome 13 (SEQ ID NO: 87). In still other embodiments, the marker locus is localized within a chromosomal interval flanked by and including marker loci(i) marker loci BARC-038503-10136 and Satt554 on chromosome 13; (ii) marker loci Satt072 and BARC-027792-06674 on chromosome 13; (iii) marker loci BARC-018605-02982 and BARC-027792-06674 on chromosome 13; (iv) marker loci BARC-025859-05126 and BARC-014657-01608 on chromosome 13; (v) marker loci Gm 13 :36704369 and Gm 13 :36300296 on chromosome 13; (vi) marker loci BARC-028583-05961 and BARC-025561-06521 on chromosome
- kits for selecting at least one soybean plant by marker assisted selection of a QTL associated with improved lodging resistance includes primers or probes for detecting a polymorphism in the soybean genome, wherein the physical position of the polymorphism is selected from the group consisting of 36,431,456 bp on chromosome 13, 36,490,271 bp on chromosome 13, 36,491,753 bp on chromosome 13, 36,491,754 bp on chromosome 13, 36,492,037 bp on chromosome 13, 36,492,926 bp on chromosome 13, 36,492,955 bp on chromosome 13, 36,493,615 bp on chromosome 13, 36,494,839 bp on chromosome 13, 36,517,239 bp on chromosome 13, 36,539,789 bp on chromosome 13, 36,539,798 bp on chro
- kits for selecting at least one soybean plant by marker assisted selection of a QTL associated with improved lodging resistance includes primers or probes for detecting a polymorphism in the soybean genome, wherein the physical position of the polymorphism is selected from the group consisting of 1,306,591 bp on chromosome 19, 1,635,254 bp on chromosome 19, 841,738 bp on chromosome 19, 1,589,758 bp on chromosome 19, and a combination thereof.
- the typical system includes a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
- a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
- a wide variety of signal detection apparatus is available, including photo multiplier tubes, spectrophotometers, CCD arrays, arrays and array scanners, scanning detectors, phototubes and photodiodes, microscope stations, galvo- scanns, microfluidic nucleic acid amplification detection appliances and the like.
- the precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user.
- Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used.
- Typical detector embodiments include light (e.g., fluorescence) detectors or radioactivity detectors.
- detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele.
- Fluorescent detection is especially preferred and is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods).
- the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele.
- the detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to "real time" amplification assay results.
- System instructions that correlate the presence or absence of the favorable allele with the predicted lodging resistance phenotype are also a feature of the disclosure.
- the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and the predicted lodging resistance or improved lodging resistance.
- the precise form of the instructions can vary depending on the components of the system, e.g., they can be present as system software in one or more integrated unit of the system (e.g., a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g., computers or computer readable media) operably coupled to the detector.
- the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted lodging resistance or improved lodging resistance.
- the instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
- the system typically includes components for storing or transmitting computer readable data representing or designating the alleles detected by the methods of the present disclosure, e.g., in an automated system.
- the computer readable media can include cache, main, and storage memory and/or other electronic data storage components (hard drives, floppy drives, storage drives, etc.) for storage of computer code.
- Data representing alleles detected by the method of the present disclosure can also be electronically, optically, or magnetically transmitted in a computer data signal embodied in a transmission medium over a network such as an intranet or internet or combinations thereof.
- the system can also or alternatively transmit data via wireless, IR, or other available transmission alternatives.
- the system typically comprises a sample that is to be analyzed, such as a plant tissue, or material isolated from the tissue such as genomic DNA, amplified genomic DNA, cDNA, amplified cDNA, RNA, amplified RNA, or the like.
- allele detection/correlation system in the context of this disclosure refers to a system in which data entering a computer corresponds to physical objects or processes external to the computer, e.g., a marker allele, and a process that, within a computer, causes a physical transformation of the input signals to different output signals.
- the input data e.g., amplification of a particular marker allele is transformed to output data, e.g., the identification of the allelic form of a chromosome segment.
- the process within the computer is a set of instructions, or "program", by which positive amplification or hybridization signals are recognized by the integrated system and attributed to individual samples as a genotype.
- Additional programs correlate the identity of individual samples with phenotypic values or marker alleles, e.g., statistical methods.
- C/C++ programs for computing, Delphi and/or Java programs for GUI interfaces, and productivity tools (e.g., Microsoft Excel and/or SigmaPlot) for charting or creating look up tables of relevant allele-trait correlations.
- productivity tools e.g., Microsoft Excel and/or SigmaPlot
- Other useful software tools in the context of the integrated systems of the invention include statistical packages such as SAS, Genstat, Matlab, Mathematica, and S-Plus and genetic modeling packages such as QU-GE E.
- additional programming languages such as visual basic are also suitably employed in the integrated systems of the disclosure.
- lodging resistance marker allele values assigned to a population of progeny descending from crosses between elite lines are recorded in a computer readable medium, thereby establishing a database corresponding resistance alleles with unique identifiers for members of the population of progeny.
- Any file or folder, whether custom- made or commercially available (e.g., from Oracle or Sybase) suitable for recording data in a computer readable medium is acceptable as a database in the context of the present disclosure.
- Data regarding genotype for one or more molecular markers e.g., ASH, SSR, RFLP, RAPD, AFLP, S P, isozyme markers or other markers as described herein, are similarly recorded in a computer accessible database.
- marker data is obtained using an integrated system that automates one or more aspects of the assay(s) used to determine marker(s) genotype.
- input data corresponding to genotypes for molecular markers are relayed from a detector, e.g., an array, a scanner, a CCD, or other detection device directly to files in a computer readable medium accessible to the central processing unit.
- a set of system instructions typically embodied in one or more programs
- encoding the correlations between lodging resistance and the alleles of the disclosure is then executed by the computational device to identify correlations between marker alleles and predicted trait phenotypes.
- the system also includes a user input device, such as a keyboard, a mouse, a touchscreen, or the like (for, e.g., selecting files, retrieving data, reviewing tables of maker information), and an output device (e.g., a monitor, a printer) for viewing or recovering the product of the statistical analysis.
- a user input device such as a keyboard, a mouse, a touchscreen, or the like (for, e.g., selecting files, retrieving data, reviewing tables of maker information)
- an output device e.g., a monitor, a printer
- the disclosure provides an integrated system comprising a computer or computer readable medium comprising a set of files and/or a database with at least one data set that corresponds to the marker alleles herein.
- the system also includes a user interface allowing a user to selectively view one or more of these databases.
- standard text manipulation software such as word processing software (e.g., Microsoft WordTM or Corel WordPerfectTM) and database or spreadsheet software (e.g., spreadsheet software such as Microsoft ExcelTM, Corel Quattro ProTM, or database programs such as Microsoft AccessTM or ParadoxTM) can be used in conjunction with a user interface (e.g., a GUI in a standard operating system such as a Windows, Macintosh, Unix or Linux system) to manipulate strings of characters corresponding to the alleles or other features of the database.
- word processing software e.g., Microsoft WordTM or Corel WordPerfectTM
- database or spreadsheet software e.g., spreadsheet software such as Microsoft ExcelTM, Corel Quattro ProTM, or database programs such as Microsoft AccessTM or ParadoxTM
- a user interface e.g., a GUI in a standard operating system such as a Windows, Macintosh, Unix or Linux system
- the systems optionally include components for sample manipulation, e.g., incorporating robotic devices.
- a robotic liquid control armature for transferring solutions (e.g., plant cell extracts) from a source to a destination, e.g., from a microtiter plate to an array substrate, is optionally operably linked to the digital computer (or to an additional computer in the integrated system).
- An input device for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and, optionally, to control transfer by the armature to the solid support is commonly a feature of the integrated system.
- Many such automated robotic fluid handling systems are commercially available. For example, a variety of automated systems are available from Caliper
- Systems for molecular marker analysis of the present disclosure can include a digital computer with one or more of high-throughput liquid control software, image analysis software for analyzing data from marker labels, data interpretation software, a robotic liquid control armature for transferring solutions from a source to a destination operably linked to the digital computer, an input device (e.g., a computer keyboard) for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and, optionally, an image scanner for digitizing label signals from labeled probes hybridized, e.g., to markers on a solid support operably linked to the digital computer.
- the image scanner interfaces with the image analysis software to provide a measurement of, e.g., nucleic acid probe label intensity upon hybridization to an arrayed sample nucleic acid population (e.g., comprising one or more markers), where the probe label intensity
- the data interpretation software is interpreted by the data interpretation software to show whether, and to what degree, the labeled probe hybridizes to a marker nucleic acid (e.g., an amplified marker allele).
- the data so derived is then correlated with sample identity, to determine the identity of a plant with a particular genotype(s) for particular markers or alleles, e.g., to facilitate marker assisted selection of soybean plants with favorable allelic forms of chromosome segments involved in agronomic performance (e.g., lodging resistance or improved lodging resistance).
- Optical images e.g., hybridization patterns viewed (and, optionally, recorded) by a camera or other recording device (e.g., a photodiode and data storage device) are optionally further processed in any of the embodiments herein, e.g., by digitizing the image and/or storing and analyzing the image on a computer.
- a camera or other recording device e.g., a photodiode and data storage device
- a variety of commercially available peripheral equipment and software is available for digitizing, storing and analyzing a digitized video or digitized optical image, e.g., using PC (Intel x86 or Pentium chip- compatible DOSTM, OS2TM WINDOWSTM, WINDOWS NTTM or WINDOWS 95TM based machines), MACINTOSHTM, LINUX, or UNIX based (e.g., SUNTM work station) computers.
- PC Intel x86 or Pentium chip- compatible DOSTM
- MACINTOSHTM e.g., LINUX, or UNIX based (e.g., SUNTM work station) computers.
- Example 1 QTL Mapping.
- Bi-parental populations were created by crossing two soybean varieties.
- the Fl seed was grown and bulk generation advanced twice.
- the F3 seed was planted and individual plants were derived to create a segregating population of F3 :4 varieties.
- the individual varieties were planted and evaluated in field plots.
- Bi-parental populations of F3 :4 individuals were grown at research locations across the US including North Dakota,
- genomic DNA must be extracted from plant tissue using any suitable genomic DNA extraction technique known in the art.
- Nonradioactive Probes Ed: Isaac, Humana Press Inc, Totowa, NJ 1994, Ch 2, pp. 9-15.
- CTAB CTAB extraction buffer
- approximately 100-200 mg of tissue is ground into powder in liquid nitrogen and homogenized in 1 ml of CTAB extraction buffer (2% CTAB, 0.02 M EDTA, 0.1 M Tris-Cl pH 8, 1.4 M NaCl, 25 mM DTT) for 30 minutes at 65°C.
- Homogenized samples are cooled at room temperature for 15 minutes before a single protein extraction with approximately 1 ml 24: 1 v/v chloroform:octanol is done.
- RNAse A is added to the samples, which are then incubated at 37°C for 1 hour.
- MQM Multiple QTL mapping analysis
- a novel QTL controlling plant height and lodging was found on chromosome 13 at about 77.45 cM across twenty-three breeding populations. Both individual location QTL mapping and combined mapping across locations is presented. In total, eighteen populations showed significant QTL for height and ten populations showed a statistically significant QTL for lodging severity in the claimed region at one or a combination of locations. As seen in Table 4, the variance explained by the QTL ranged from 5.13% to 35.64%. The additive effect of the QTL on height ranged from 0.8-2.68 inches and on lodging severity ranged from a score change of 0.32-0.83 depending on the population and environment, suggesting that the QTL has a large impact on both of these traits. The additive effect is provided in positive and negative values.
- Example 2 Near Isogenic Lines (NILs).
- NIL Near isogenic lines
- Gm 13 :36704369 and twenty-seven NILs were homozygous for the female parent allele (parent 1 in FIG.4, SNP marker allele C of Gml3 :36704369).
- eighty- seven individual NILs were homozygous for the male parent allele (parent 4 in FIG.4, SNP marker allele C of Gm 13 :36704369) and eighty-seven NILs were homozygous for the female parent allele (parent 3 in FIG.4, SNP marker allele T of Gm 13 :36704369).
- Individual NILs were planted as 5 foot single replicate plots on 36 inch rows in a completely randomized design. Lodging severity data was collected on individual plots.
- FIG. 4 shows significant differences (P ⁇ 0.0001) in lodging severity for both families.
- the beneficial alleles i.e., alleles positively correlating with improved resistance to lodging
- parents 1 and 4 share the same SNP marker allele at Gml3 :36704369 (C,C) and Gml3 :36300296 (A, A) while the deleterious alleles (i.e., alleles positively correlating with susceptibility to lodging) from parents 2 and 3 share the same SNP marker allele at Gml3 :36704369 (T,T) and Gml3 :36300296 (C,C).
- S Ps Single nucleotide polymorphisms
- Table 5 shows SNP data for six strains with decreased lodging score and six strains with increased lodging score. A decreased lodging score indicates increased plant lodging, or increased susceptibility to lodging, whereas an increased lodging score indicates plants with improved lodging resistance.
- PHYS POS indicates the physical map position of the SNP based on the Glymal physical assembly (Schmutz et al, 2010).
- GTY POS indicates the genetic map position based on Soybean-Gm Consensus4.0 map (Hyten et al, 2010). Any methodology can be deployed to use this information, including, but not limited to, any one or more of the sequencing or marker methods.
- sample tissue from soybean leaves or seeds can be extracted from leaf discs using, e.g., a modification of the CTAB method as described elsewhere herein.
- Sample tissue can be screened with markers using a TAQMAN ® PCR assay system (Life Technologies, Grand Island, NY, USA).
- Genomic DNA (dried) 16 ng
- Bi-parental populations were created by crossing two soybean varieties.
- the Fl seed was grown and bulk generation advanced twice.
- the F3 seed was planted and individual plants were derived to create a segregating population of F3 :4 varieties.
- the individual varieties were planted and evaluated in field plots.
- Bi-parental populations of F3 :4 individuals were grown at research locations across the US including Ohio, Illinois, Iowa, and Mississippi. Individual varieties were grown as single replicate 5 foot plots on 36 inch rows. Bi-parental populations were grown at multiple locations within their target environments. Height data was collected at maturity by measuring the average of five plants from the soil level to the top of the mature plants for each plot. Lodging severity was scored visually for each plot using a 1-9 scale representing the percentage of plants in the row at harvest maturity that were less than fully erect. Plots with almost all plants fully erect were scored a 9, plots with most plants at a 45 degree angle in relation to the ground were scored a 5, and plots with almost all plants laying on the ground were scored a 1.
- Gml9: 1589758 was associated with an effect on height in twelve unique populations, with the PPOase herbicide resistance allele (i.e., allele T) positively correlating with increasing height between 1.19 inches and 4.45 inches across populations.
- PPOase herbicide resistance allele i.e., allele T
- Varieties possessing PPOase herbicide resistance alleles at Gm 19: 1589758 on average have higher plant height and are more susceptible to lodging. Therefore, Gml9: 1589758 can be used to identify and/or select plants with decreased height and/or improved resistance to lodging by detecting the PPOase herbicide susceptibility allele (i.e., the G allele).
- Gml9 1589758 within a population.
- SUS AVG the average height of varieties homozygous for the PPOase herbicide susceptibility allele at Gml9: 1589758 within a population.
- the /rvalue is the significance of the difference between the marker classes within a population.
- Example 6 Genome-wide Association Study on Height versus Lodging Severity.
- GWAS genome-wide association study
- the phenotypic data set consisted of departmental-wide advanced trial data from the last four years representing 1044 unique elite varieties of indeterminate growth habit. Elite varieties in advanced yield trials are purified homozygous varieties representing both commercial products as well as advanced varieties that are within two years of commercial release.
- the analysis was conducted using the GAP IT package in R (Lipka et al, 2012).
- Marker Gml9: 1589758 was the most significantly associated SNP with the LDGSEV trait, which is positioned at 10.06 cM on chromosome 19 (Tables 2 and 8).
- HGT three markers associated with a region on chromosome 13 were the top associations with that trait; however, marker Gml9: 1589758 is the fourth most associated SNP with HGT (Table 8).
- Marker Gml9 1589758, previously known to be associated with PPO-based herbicide tolerance, is also associated with plant height and lodging severity. Varieties possessing PPO resistance alleles at this locus on average have higher plant height and are more susceptible to lodging. This novel discovery will allow soybean breeding programs to more efficiently select for lodging and height though using this QTL in marker assisted selection.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Environmental Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Physiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Geophysics And Detection Of Objects (AREA)
- Luminescent Compositions (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112018016164-0A BR112018016164B1 (en) | 2016-02-11 | 2017-02-10 | METHOD FOR SELECTING A FIRST SOYBEAN PLANT OR GERMPLASM |
| US16/061,046 US11028453B2 (en) | 2016-02-11 | 2017-02-10 | QTLs associated with and methods for identifying lodging resistance in soybean |
| CA3008887A CA3008887A1 (en) | 2016-02-11 | 2017-02-10 | Qtls associated with and methods for identifying lodging resistance in soybean |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662293998P | 2016-02-11 | 2016-02-11 | |
| US62/293,998 | 2016-02-11 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2017139544A1 true WO2017139544A1 (en) | 2017-08-17 |
| WO2017139544A9 WO2017139544A9 (en) | 2018-05-24 |
Family
ID=58057340
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/017326 Ceased WO2017139544A1 (en) | 2016-02-11 | 2017-02-10 | Qtls associated with and methods for identifying lodging resistance in soybean |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US11028453B2 (en) |
| AR (1) | AR107591A1 (en) |
| CA (1) | CA3008887A1 (en) |
| CL (1) | CL2018002116A1 (en) |
| WO (1) | WO2017139544A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112575103B (en) * | 2020-12-11 | 2022-08-26 | 武汉市农业科学院 | QTL (quantitative trait locus), molecular marker, KASP (Kaposi-specific protein) detection primer group and application for controlling quality traits of single lotus seeds |
| CN112852989B (en) * | 2020-12-31 | 2023-08-18 | 中国科学院东北地理与农业生态研究所 | A combination of SNP sites related to soybean agronomic traits, liquid-phase gene chip and its application |
| CN112746121B (en) * | 2020-12-31 | 2023-08-18 | 中国科学院东北地理与农业生态研究所 | SNP locus combination related to soybean agronomic traits, gene chip and application |
| CN116555471B (en) * | 2023-04-17 | 2024-07-19 | 河北省农林科学院粮油作物研究所 | InDel molecular marker for identifying soybean close planting resistance and application thereof |
| WO2025014806A1 (en) * | 2023-07-07 | 2025-01-16 | Myriad Genetics, Inc. | Multiple-ancestry polygenic risk assessment for breast cancer |
Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4407956A (en) | 1981-03-13 | 1983-10-04 | The Regents Of The University Of California | Cloned cauliflower mosaic virus DNA as a plant vehicle |
| WO1985001856A1 (en) | 1983-11-03 | 1985-05-09 | Johannes Martenis Jacob De Wet | Method for the transfer of exogenous genes in plants using pollen as a vector |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| WO1988002405A1 (en) | 1986-10-01 | 1988-04-07 | The Plant Cell Research Institute, Inc. | Genetic transformation and controlled regeneration of cucumis sp. plants in vitro |
| US5468613A (en) | 1986-03-13 | 1995-11-21 | Hoffmann-La Roche Inc. | Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids |
| US5550318A (en) | 1990-04-17 | 1996-08-27 | Dekalb Genetics Corporation | Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof |
| US5591616A (en) | 1992-07-07 | 1997-01-07 | Japan Tobacco, Inc. | Method for transforming monocotyledons |
| US5925517A (en) | 1993-11-12 | 1999-07-20 | The Public Health Research Institute Of The City Of New York, Inc. | Detectably labeled dual conformation oligonucleotide probes, assays and kits |
| US5990387A (en) | 1988-06-10 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| US6037130A (en) | 1998-07-28 | 2000-03-14 | The Public Health Institute Of The City Of New York, Inc. | Wavelength-shifting probes and primers and their use in assays and kits |
| US6077697A (en) | 1996-04-10 | 2000-06-20 | Chromos Molecular Systems, Inc. | Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes |
| US6150097A (en) | 1996-04-12 | 2000-11-21 | The Public Health Research Institute Of The City Of New York, Inc. | Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes |
| CN103088148A (en) * | 2013-02-20 | 2013-05-08 | 中国农业科学院油料作物研究所 | Soybean lodging-resistant major gene locus and application |
-
2017
- 2017-02-10 US US16/061,046 patent/US11028453B2/en active Active
- 2017-02-10 AR ARP170100335A patent/AR107591A1/en unknown
- 2017-02-10 WO PCT/US2017/017326 patent/WO2017139544A1/en not_active Ceased
- 2017-02-10 CA CA3008887A patent/CA3008887A1/en active Pending
-
2018
- 2018-08-06 CL CL2018002116A patent/CL2018002116A1/en unknown
Patent Citations (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4407956A (en) | 1981-03-13 | 1983-10-04 | The Regents Of The University Of California | Cloned cauliflower mosaic virus DNA as a plant vehicle |
| WO1985001856A1 (en) | 1983-11-03 | 1985-05-09 | Johannes Martenis Jacob De Wet | Method for the transfer of exogenous genes in plants using pollen as a vector |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683202B1 (en) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US5468613A (en) | 1986-03-13 | 1995-11-21 | Hoffmann-La Roche Inc. | Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids |
| WO1988002405A1 (en) | 1986-10-01 | 1988-04-07 | The Plant Cell Research Institute, Inc. | Genetic transformation and controlled regeneration of cucumis sp. plants in vitro |
| US5990387A (en) | 1988-06-10 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| US5550318A (en) | 1990-04-17 | 1996-08-27 | Dekalb Genetics Corporation | Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof |
| US5591616A (en) | 1992-07-07 | 1997-01-07 | Japan Tobacco, Inc. | Method for transforming monocotyledons |
| US5925517A (en) | 1993-11-12 | 1999-07-20 | The Public Health Research Institute Of The City Of New York, Inc. | Detectably labeled dual conformation oligonucleotide probes, assays and kits |
| US6077697A (en) | 1996-04-10 | 2000-06-20 | Chromos Molecular Systems, Inc. | Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes |
| US6150097A (en) | 1996-04-12 | 2000-11-21 | The Public Health Research Institute Of The City Of New York, Inc. | Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes |
| US6037130A (en) | 1998-07-28 | 2000-03-14 | The Public Health Institute Of The City Of New York, Inc. | Wavelength-shifting probes and primers and their use in assays and kits |
| CN103088148A (en) * | 2013-02-20 | 2013-05-08 | 中国农业科学院油料作物研究所 | Soybean lodging-resistant major gene locus and application |
Non-Patent Citations (112)
| Title |
|---|
| "Life Science Research Cell Culture Catalogue", 1998, SIGMA-ALDRICH, INC |
| "Methods in Molecular Biology, Vol. 28: Protocols for Nucleic Acid Analysis by Nonradioactive Probes", vol. 28, 1994, HUMANA PRESS INC, pages: 9 - 15 |
| "Plant Culture Catalogue and supplement", 1997, SIGMA-ALDRICH, INC |
| ARENDS, D. ET AL., TUTORIAL-MULTIPLE-QTL MAPPING (MQM) ANALYSIS FOR R/QT, 2014, Retrieved from the Internet <URL:http://www.rqtl.org/tutorials/MQM-tour.pdf> |
| ARENDS, D.: "R/qtl: high-throughput multiple QTL mapping", BIOINFORMATICS, vol. 26, no. 23, 2010, pages 2990 - 2992 |
| ARNHEIM; LEVINSON, C&EN, 1 October 1990 (1990-10-01), pages 36 - 47 |
| ATLAS AND PARKS,: "The Handbook of Microbiological Media", 1993, CRC PRESS |
| AUSUBEL ET AL.,: "Current Protocols in Molecular Biology", 1995, GREENE PUBLISHING AND WILEY-INTER-SCIENCE |
| AUSUBEL, ET AL.,: "Current Protocols in Molecular Biology", 2002, CURRENT PROTOCOLS |
| BARRINGER ET AL., GENE, vol. 89, 1990, pages 117 |
| BEAUCAGE; CARUTHERS, TETRAHEDRON LETTS, vol. 22, no. 20, 1981, pages 1859 - 1862 |
| BECKER ET AL., MOL GEN GENET, vol. 249, 1995, pages 65 |
| BENBROOK ET AL.: "Proceedings Bio Expo", 1986, BUTTERWORTH, pages: 27 - 54 |
| BERGER; KIMMEL: "Guide to Molecular Cloning Techniques, Methods in Enzymology", vol. 152, ACADEMIC PRESS, INC. |
| BINDING: "Plant Protoplasts", 1985, CRC PRESS, article "Regeneration of Plants", pages: 21 - 73 |
| BINDING: "Regeneration of Plants, Plant Protoplasts", 1985, CRC PRESS, pages: 21 - 73 |
| BLOK; KRAMER: "Amplifiable hybridization probes containing a molecular switch", MOL CELL PROBES, vol. 11, 1997, pages 187 - 194, XP004457808, DOI: doi:10.1006/mcpr.1997.0103 |
| BONNET ET AL.: "Thermodynamic basis of the chemical specificity of structured DNA probes", PROC NATL ACAD SCI USA, vol. 96, 1999, pages 6171 - 6176, XP002244958, DOI: doi:10.1073/pnas.96.11.6171 |
| BROMAN, K. W.; SEN, S.: "A guide to QTL mapping with R/qtl", 2009, SPRINGER |
| CHENG ET AL., NATURE, vol. 369, 1994, pages 684 |
| CREGAN ET AL.: "An Integrated Genetic Linkage Map of the Soybean Genome", CROP SCIENCE, vol. 39, 1999, pages 1464 - 1490, XP002309701 |
| CROY,: "Plant Molecular Biology", 1993, BIOS SCIENTIFIC PUBLISHERS, ISBN: 0 12 198370 6 |
| CROY: "Plant Molecular Biology", 1993, BIOS SCIENTIFIC PUBLISHERS, INC. |
| DALE: "Protoplasts", 1983, BIRKHAUSER, article "Protoplast Culture and Plant Regeneration of Cereals and Other Recalcitrant Crops", pages: 31 - 41 |
| DANDEKAR ET AL., J TISSUE CULT METH, vol. 12, 1989, pages 145 |
| DAS: "Subcellular Biochemistry", vol. 29, 1998, PLANT MICROBE INTERACTIONS, pages: 343 - 363 |
| DAVEY: "Protoplasts", 1983, BIRKHAUSER, article "Recent Developments in the Culture and Regeneration of Plant Protoplasts", pages: 12 - 29 |
| DEIKMAN; FISCHER, EMBO J, vol. 7, 1988, pages 3315 |
| EDWARD BUCKLER, TRAIT ANALYSIS BY ASSOCIATION, EVOLUTION, AND LINKAGE |
| EGAN, A.N ET AL., AMERICAN JOURNAL OF BOTANY, vol. 99, no. 2, 2012, pages 175 - 185 |
| ELSHIRE, R.J. ET AL., PLOS ONE, vol. 6, no. 5, 2011, pages EL9379 |
| EVANS ET AL.: "Handbook of Plant Cell Cultures", vol. 1, 1983, MACMILLAN PUBLISHING CO., article "Protoplast Isolation and Culture", pages: 124 - 176 |
| EVANS ET AL.: "Protoplasts Isolation and Culture, Handbook of Plant Cell Culture", 1983, MACMILLIAN PUBLISHING COMPANY, pages: 124 - 176 |
| FANG ET AL.: "Designing a novel molecular beacon for surface-immobilized DNA hybridization studies", J AM CHEM SOC, vol. 121, 1999, pages 2921 - 2922, XP002315845, DOI: doi:10.1021/ja9837809 |
| FRALEY ET AL., PROC NATL ACAD SCI USA, vol. 80, 1983, pages 4803 |
| FRALEY ET AL., PROC NATL ACAD SCI USA, vol. 80, 1984, pages 4803 |
| FREEMAN ET AL., PLANT CELL PHYSIOL, vol. 25, 1984, pages 1353 |
| FROMM ET AL., PROC NATL ACAD SCI USA, vol. 82, 1985, pages 5824 |
| GAMBORG AND PHILLIPS,: "Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual", 1995, SPRINGER-VERLAG |
| GHERNA, ET AL.,: "The ATCC Catalogue of Bacteria and Bacteriophaqe", 1992, ATCC |
| GILIMAN; SMITH, GENE, vol. 8, 1979, pages 81 |
| GUATELLI ET AL., PROC NATL ACAD SCI USA, vol. 87, 1990, pages 1874 |
| HANSEN; CHILTON, CURRENT TOPICS IN MICROBIOLOGY, vol. 240, 1998, pages 22 |
| HARDENBOL, P. ET AL., NATURE BIOTECHNOLOGY, vol. 21, no. 6, 2003, pages 673 - 678 |
| HAUGLAND: "Handbook of Fluorescent Probes and Research Chemicals Eighth Edition", 2001, MOLECULAR PROBES, INC. |
| HAUGLAND: "Handbook of Fluorescent Probes and Research Chemicals Sixth Edition", 1996, MOLECULAR PROBES, INC. |
| HERRARA-ESTRELLA ET AL., NATURE, vol. 303, 1983, pages 209 |
| HESS, INTERN REV CYTOL, vol. 107, 1987, pages 367 |
| HOHN ET AL.: "Molecular Biology of Plant Tumors", 1982, ACADEMIC PRESS, pages: 549 - 560 |
| HORSCH ET AL., SCIENCE, vol. 227, 1985, pages 1229 - 1231 |
| HORSCH ET AL., SCIENCE, vol. 233, 1984, pages 496 |
| HSUIH ET AL.: "Novel, ligation-dependent PCR assay for detection of hepatitis C in serum", J CLIN MICROBIOL, vol. 34, 1997, pages 501 - 507 |
| HUANG, X ET AL., GENOME RESEARCH, vol. 19, 2009, pages 1068 - 1076 |
| HYTEN ET AL.: "A High Density Integrated Linkage Map of Soybean and the Development of a 1536 Universal Soy Linkage Panel for Quantitative Trait Locus Mapping", CROP. SCI., vol. 50, 2010, pages 960 - 968 |
| INNIS, ET AL.,: "PCR Protocols A Guide to Methods and Applications", 1990, ACADEMIC PRESS INC. |
| J. W. VANOOIJEN, SOFTWARE FOR THE MAPPING OF QUANTITATIVE TRAIT LOCI IN EXPERIMENTAL POPULATIONS |
| JONES,: "Plant Gene Transfer and Expression ProtocolsMethods in Molecular Biology", vol. 49, 1995, HUMANA PRESS |
| JONES,: "Plant Gene Transfer and Expression Protocols-Methods in Molecular Biology", vol. 49, 1995, HUMANA PRESS |
| KINDLE, PROC NATL ACAD SCI USA, vol. 87, 1990, pages 1228 |
| KLEE ET AL., ANN REV PLANT PHYS, vol. 38, 1987, pages 467 - 486 |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73 |
| KOSTRIKIS ET AL.: "Molecular beacons: spectral genotyping of human alleles", SCIENCE, vol. 279, 1998, pages 1228 - 1229, XP002942660, DOI: doi:10.1126/science.279.5354.1228 |
| KWOH ET AL., PROC NATL ACAD SCI USA, vol. 86, 1989, pages 1173 |
| LANDEGREN ET AL., SCIENCE, vol. 241, 1988, pages 1077 - 1080 |
| LEONE ET AL.: "Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA", NUCLEIC ACIDS RES, vol. 26, 1995, pages 2150 - 2155 |
| LICHTENSTEIN; DRAPER: "DNA Cloning", vol. II, 1985, IRI PRESS |
| LICHTENSTEIN; FULLER: "Genetic Engineering", vol. 6, 1987, ACADEMIC PRESS |
| LOMELI ET AL., J CLIN CHEM, vol. 35, 1989, pages 1826 |
| LUO ET AL., PLANT MOL BIOL REP, vol. 6, 1988, pages 165 |
| MANLY; CUDMORE; MEER, MAMM. GENOME, vol. 12, 2001, pages 930 - 932 |
| MANLY; OLSON, GENOME, vol. 10, 1999, pages 327 - 334 |
| MARRAS ET AL.: "Multiplex detection of single-nucleotide variation using molecular beacons", GENET ANAL BIOMOL ENG, vol. 14, 1999, pages 151 - 156 |
| MCGRANAHAN ET AL., PLANT CELL REP, vol. 8, 1990, pages 512 |
| MEINKOTH ET AL., ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284 |
| MEKSEM ET AL., MOL GEN GENET, vol. 249, 1995, pages 74 |
| NAOYA YAMAGUCHI ET AL: "Quantitative trait loci associated with lodging tolerance in soybean cultivar 'Toyoharuka'", BREEDING SCIENCE, vol. 64, no. 4, 1 January 2014 (2014-01-01), JP, pages 300 - 308, XP055359344, ISSN: 1344-7610, DOI: 10.1270/jsbbs.64.300 * |
| NEEDHAM-VANDEVANTER ET AL., NUCLEIC ACIDS RES, vol. 12, 1984, pages 6159 - 6168 |
| NEUHAUS ET AL., THEOR APPL GENET, vol. 75, 1987, pages 30 |
| ODELL ET AL., NATURE, vol. 313, 1985, pages 810 |
| PADGETTE ET AL.: "Herbicide-Resistant Crops", 1996, CRC LEWIS PUBLISHERS, pages: 53 - 84 |
| PASZKOWSKI ET AL., EMBO J, vol. 3, 1984, pages 2717 |
| PAYNE ET AL.: "Plant Cell and Tissue Culture in Liquid Systems", 1992, JOHN WILEY & SONS, INC |
| PAYNE ET AL.: "Plant Cell and Tissue Culture in Liquid Systems", 1992, JOHN WILEY & SONS, INC. |
| PENA ET AL., NATURE, vol. 325, 1987, pages 274 |
| ROBERTS ET AL., NATURE, vol. 328, 1987, pages 731 |
| SAMBROOK ET AL.: "Molecular Cloning-A Laboratory Manual (3rd Ed.)", vol. 1-3, 2000, COLD SPRING HARBOR LABORATORY |
| SCHMUTZ ET AL., NATURE, vol. 463, 2010, pages 178 - 183 |
| SCHNEIDER ET AL., PROTEIN EXPR PURIF, vol. 6435, 1995, pages 10 |
| SOKOL ET AL.: "Real time detection of DNA:RNA hybridization in living cells", PROC NATL ACAD SCI USA, vol. 95, 1998, pages 11538 - 11543, XP002123471, DOI: doi:10.1073/pnas.95.20.11538 |
| SONG ET AL.: "A New Integrated Genetic Linkage Map of the Soybean", THEOR APPL GENET, vol. 109, 2004, pages 122 - 128, XP055226779, DOI: doi:10.1007/s00122-004-1602-3 |
| SOOKNANAN; MALEK, BIOTECHNOLOGY, vol. 13, 1995, pages 563 - 564 |
| STAM, THE PLANT JOURNAL, vol. 3, no. 5, 1993, pages 739 - 744 |
| STAM: "Construction of integrated genetic linkage maps by means of a new computer package: JoinMap", THE PLANT JOURNAL, vol. 3, no. 5, 1993, pages 739 - 744, XP003005041 |
| SUNGWOO LEE ET AL: "SNP markers linked to QTL conditioning plant height, lodging, and maturity in soybean", EUPHYTICA, vol. 203, no. 3, 13 September 2014 (2014-09-13), NL, pages 521 - 532, XP055359381, ISSN: 0014-2336, DOI: 10.1007/s10681-014-1252-8 * |
| THE JOURNAL OF NIH RESEARCH, vol. 3, 1991, pages 81 - 94 |
| TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER |
| TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assays" |
| TYAGI ET AL.: "Multicolor molecular beacons for allele discrimination", NATURE BIOTECHNOLOGY, vol. 16, 1998, pages 49 - 53, XP002949994, DOI: doi:10.1038/nbt0198-49 |
| TYAGI; KRAMER: "Molecular beacons: probes that fluoresce upon hybridization", NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 303 - 308, XP002914999, DOI: doi:10.1038/nbt0396-303 |
| VAN BRUNT, BIOTECHNOLOGY, vol. 8, 1990, pages 291 - 294 |
| VAN OOIJEN; VOORRIPS: "JoinMap 3.0 software for the calculation of genetic linkage maps", PLANT RESEARCH INTERNATIONAL, 2001 |
| VANOOIJEN; VOORRIPS: "JoinMap 3.0 software for the calculation of genetic linkage maps", PLANT RESEARCH INTERNATIONAL, 2001 |
| VASIL: "Herbicide-Resistant Crops", 1996, CRC LEWIS PUBLISHERS, pages: 85 - 91 |
| VET ET AL.: "Multiplex detection of four pathogenic retroviruses using molecular beacons", PROC NATL ACAD SCI USA, vol. 96, 1999, pages 6394 - 6399, XP002145609, DOI: doi:10.1073/pnas.96.11.6394 |
| VOS ET AL., NUCLEIC ACIDS RES, vol. 23, 1995, pages 4407 |
| WATSON ET AL.: "Recombinant DNA, Second Edition,", 1992, SCIENTIFIC AMERICAN BOOKS |
| WEISSBACH AND WEISSBACH,: "Methods for Plant Molecular Biology", 1988, ACADEMIC PRESS, INC. |
| WEISSINGER ET AL., ANN REV GENET, vol. 22, 1988, pages 421 - 477 |
| WILCOX, J.R.; SEDIYAMA, T., EUPHYTICA, vol. 30, 1981, pages 323 - 326 |
| WU; WALLACE, GENE, vol. 4, 1989, pages 560 |
| ZHOU ET AL., METHODS IN ENZYMOLOGY, vol. 101, 1983, pages 433 |
Also Published As
| Publication number | Publication date |
|---|---|
| US11028453B2 (en) | 2021-06-08 |
| BR112018016164A2 (en) | 2019-01-22 |
| US20190024191A1 (en) | 2019-01-24 |
| CL2018002116A1 (en) | 2018-12-07 |
| AR107591A1 (en) | 2018-05-16 |
| WO2017139544A9 (en) | 2018-05-24 |
| CA3008887A1 (en) | 2017-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9745637B2 (en) | Genetic loci associated with fusarium solani tolerance in soybean | |
| US7790949B2 (en) | Genetic loci associated with Sclerotinia tolerance in soybean | |
| US20110258743A1 (en) | Genetic loci associated with iron deficiency tolerance in soybean | |
| US9756800B2 (en) | Loci associated charcoal rot drought complex tolerance in soybean | |
| US11028453B2 (en) | QTLs associated with and methods for identifying lodging resistance in soybean | |
| US7507874B2 (en) | Genetic loci associated with phytophthora tolerance in soybean | |
| US10568280B2 (en) | Loci associated with charcoal rot drought complex tolerance in soybean | |
| WO2020036954A1 (en) | Molecular markers for blackleg resistance gene rlm7 in brassica napus, and methods of using the same | |
| CA2986894C (en) | Loci associated with charcoal rot drought complex tolerance in soybean | |
| BR112018016164B1 (en) | METHOD FOR SELECTING A FIRST SOYBEAN PLANT OR GERMPLASM |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17706109 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3008887 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112018016164 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112018016164 Country of ref document: BR Kind code of ref document: A2 Effective date: 20180807 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17706109 Country of ref document: EP Kind code of ref document: A1 |

