WO2017136629A1 - Vectors and system for modulating gene expression - Google Patents

Vectors and system for modulating gene expression Download PDF

Info

Publication number
WO2017136629A1
WO2017136629A1 PCT/US2017/016357 US2017016357W WO2017136629A1 WO 2017136629 A1 WO2017136629 A1 WO 2017136629A1 US 2017016357 W US2017016357 W US 2017016357W WO 2017136629 A1 WO2017136629 A1 WO 2017136629A1
Authority
WO
WIPO (PCT)
Prior art keywords
grna
polynucleotide
grnas
array
transcription
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/016357
Other languages
French (fr)
Inventor
David A. Largaespada
Branden S. MORIARITY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Minnesota Twin Cities
University of Minnesota System
Original Assignee
University of Minnesota Twin Cities
University of Minnesota System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Minnesota Twin Cities, University of Minnesota System filed Critical University of Minnesota Twin Cities
Priority to US16/075,218 priority Critical patent/US20190038780A1/en
Publication of WO2017136629A1 publication Critical patent/WO2017136629A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00Preparations for testing in vivo
    • A61K49/0004Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/12Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function

Definitions

  • SequenceListing_ST25.txt having a size of 8 kilobytes and created on February 1, 2017. The information contained in the Sequence Listing is incorporated by reference herein.
  • the polynucleotide for modulating transcription from a plurality of genomic targets.
  • the polynucleotide includes a polynucleotide encoding a gRNA array and a polynucleotide sequence encoding a nuclease-deficient Cas9 polypeptide.
  • the polynucleotide encoding a gRNA array generally includes polynucleotides encoding at least two gRNAs operably linked to an inducible regulatory sequence.
  • an enzyme-cleavable linker sequence links the polynucleotide encoding the first gRNA and the polynucleotide encoding the second gRNA.
  • the nuclease-deficient Cas9 polypeptide comprises a fusion polypeptide including a transcription activating domain.
  • the transcription activating domain can include VP64.
  • the nuclease-deficient Cas9 polypeptide can include a
  • the transcription repressing domain can include a Kriippel associated box domain.
  • the gRNA array can include at least 5 gRNAs.
  • this disclosure describes a method of modulating expression of a plurality of genomic target coding regions in a cell.
  • the method includes introducing into the cell any embodiment of the polynucleotide summarized above, wherein gRNAs in the array target the genomic target coding regions, and inducing transcription of the gRNA array.
  • the method involves modulating expression of two or more genomic target coding regions simultaneously.
  • the method can further include screening the modulated expression of the genomic target coding regions for a change in phenotype.
  • the method can further include identifying mRNA targets of a particular phenotype.
  • the method can further include identifying causal cancer genes.
  • the method can further include overexpressing a genomic target coding region that encodes a polypeptide of interest. In some of these embodiments, the method further includes isolating at least a portion of the polypeptide of interest.
  • the method can further include altering biochemical pathways to favor biosynthesis of a compound of interest. In some of these embodiments, the method can further include isolating at least a portion of the compound of interest.
  • the method can further include generating a synthetic CRISPR immune system to increase resistance of the cell to infection by a virus.
  • the method can further include activating a cellular pathway in a therapeutic cell to increase the therapeutic cell's therapeutic activity.
  • this disclosure describes a method for generating a genetically modified organism.
  • the method includes introducing into cells of the organism any embodiment of the polynucleotide summarized above, wherein gRNAs in the array target the genomic target coding regions, and inducing transcription of the gRNA array.
  • the organism can be a mouse.
  • FIG. 1 Diagram of the CRISPR locus in Pseudomonas aeruginosa UCBPP- PA14.
  • CRISPR locus is flanked by arrays of spacers linked by target sequences (SEQ ID NO:2) of the sequence specific RNA nuclease Csy4.
  • FIG. 2 Plasmids required for Golden Gate assembly of up to 10 gRNAs linked by Csy4 sites (Left). Example Golden Gate assembly of 4 gRNAs (right).
  • FIG. 3. CELI results of 10 gRNA array targeting 10 genes.
  • A Diagram of gRNA array.
  • FIG. 4. (A) Diagram of gRNA arrays in pENTRl and pENTR2. (B) Diagram of PB- Dual-DEST- dCas9 Activator vector. (C) Final PB-Dual-gRNA-Array- dCas9 Activator vector.
  • Sp S. pyogenes
  • DEST Gateway destination cassette
  • TRE tertracycline responsive element
  • rtTA reverse tetracycline transactivator
  • Puro puromycin
  • ITR piggyBac inverted terminal repeates
  • 2A ribosomal skip sequence P2A.
  • FIG. 5 (A) Schematic diagram of the schema to identify highly functioning gRNAs. (B) Hypothetical single cell RNA sequencing results from a cell expressing 5 gRNAs targeting genes A-E and the dCAS9:VP64 fusion. ***Indicates gRNAs that robustly induce expression of their target gene.
  • FIG. 6 Diagram of the base pGG (left) and pENTR-ACPT (right) plasmids highlighting the type IIS restriction enzymes used for protospacer oligonucleotide ligation (Bsal) and golden gate assembly (BsmBI).
  • the pGG cassette contains a filler sequence that is removed upon enzyme digestion and a 5' Csy4 site for array processing once assembled and expressed.
  • a terminal Csy4 site was included in the pENTR-ACPT cassette to remove additional plasmid sequence from the terminal gRNA when expressed and a LacZ gene that is removed upon golden gate assembly to allow for blue/white colony selection.
  • FIG. 7 Gene editing frequency of pol III driven 10 gRNA array.
  • A Diagram depicting the plasmid vectors transfected into HEK293T cells to induce targeted DSBs using a pol III driven 10 gRNA array combined with Cas9 and Csy4.
  • B Results of CRISPR/Cas9 editing at each of the 10 gRNA target sites when using gRNA arrays with a 20 bp or 28 bp Csy4 target sequence.
  • C Results of surveyor nuclease assay performed on genomic DNA of HEK293T cells transfected with a 10 gRNA array and Cas9 with or without Csy4 three days post transfection.
  • P2A ribosomal skip sequence
  • BGH pA bovine growth hormone polyadenylation signal
  • CAG strong mammalian promoter comprised of cytomegalovirus (CMV) early enhancer element, the first exon and intron of chicken beta-actin gene, and the splice acceptor of the rabbit beta-globin gene.
  • CMV cytomegalovirus
  • FIG. 8 Comparison of gene editing frequency of pol Il-driven and pol Ill-driven three- gRNA array, five-gRNA array, and seven-gRNA array.
  • FIG. 9 Modified golden gate assembly plasmid library. Diagram depicting the cloning strategy to remove the U6 promoter from the pENTR-ACPT 1-10 plasmids used for gRNA array assembly. Plasmids were treated with Dral (blunt) and subsequently self-ligated and sequence verified.
  • FIG. 10 Comparison of gene editing frequency of pol II and pol III driven gRNA arrays.
  • A Diagram depicting the plasmid vectors transfected into HEK293T cells containing pol II or pol III promoters driving transcription of a 10 gRNA array.
  • B left panel
  • B right panel Bar graph depicting the average gene editing frequency of the 10 gRNA array expressed from each promoter normalized to the editing frequency of each individual gRNA transcribed from the standard U6 pol III promoter. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown.
  • P2A ribosomal skip sequence
  • BGH pA bovine growth hormone polyadenylation signal
  • CMV cytomegalovirus
  • CAG strong mammalian promoter comprised of CMV early enhancer element, the first exon and the first intron of chicken beta- actin gene, and the splice acceptor of the rabbit beta-globin gene. **P ⁇ 0.001, ***p ⁇ 0.0001, Student's t test. Error bars, s.d.
  • FIG. 11 Enhanced multiplex editing using gRNA arrays.
  • A Diagram depicting the plasmid vectors transfected into HEK293T cells to compare gene editing by multiplexing 10 standard U6-gRNA plasmids and a 10 gRNA array.
  • B Bar graph depicting the gene editing frequency at each of 10 gRNA target sites three days post transfection using multiplexed individual U6-gRNA plasmids or 10 gRNA array encoding the same gRNAs. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown.
  • P2A ribosomal skip sequence
  • BGH pA bovine growth hormone polyadenylation signal
  • CAG strong mammalian promoter comprised of CMV early enhancer element, the first exon and the first intron of chicken beta-actin gene, and the splice acceptor of the rabbit beta- globin gene. **P ⁇ 0.001, ***P ⁇ 0.0001, Student' s t test. Error bars, s.d.
  • FIG. 12 Stable expression of the CRISPR/Cas9 based gRNA array system.
  • A Diagram depicting gateway ready DNA transposon vector for expression of all components of the gRNA system for multiplex editing.
  • B Results of gene editing at all 10 gRNA target sites seven days post transfection and puromycin selection in HEK293T cells. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown.
  • FIG. 13 Golden Gate assembly of MS2 gRNA arrays.
  • A Diagram of the base pGG- MS2 (left) and pENTR-ACPT (right) plasmids highlighting the type IIS restriction enzymes used for protospacer oligonucleotide ligation (Bsal) and Golden Gate assembly (BsmBI).
  • the pGG-MS2 cassette contains a filler sequence that is removed upon oligonucleotide ligation and a 5' Csy4 site for array processing once assembled and expressed.
  • a terminal Csy4 site was included in the pENTR-ACPT cassette to remove additional plasmid sequence from the terminal gRNA when expressed and a LacZ gene that is removed upon Golden Gate assembly to allow for blue/white colony selection.
  • B Diagram of the final 10 pGG-MS2 and 10 pENTR-ACPT plasmids for assembly of arrays containing 1-10 gRNAs. The gateway attLl/2 sites of pENTR- ACPT plasmids have been left out for simplicity.
  • FIG. 14 Multiplexed gene activation using the SAM system with gRNA arrays.
  • A Diagram depicting the elements encoded in plasmids used for multiplex gene activation using the SAM system combined with gRNA arrays containing MS2 sequences.
  • B RT-PCR results of gene activation at five gRNA target sites three days post transfection using individual U6- gRNAs or a gRNA array containing all five gRNAs (left). Average gene activation using either approach is also shown, demonstrating no difference in gene activation using single U6-gRNA plasmids or gRNA arrays (right).
  • dCas9 nuclease deficient Cas9
  • dCas9 fused to the transcriptional activation VP64 domain can induce targeted gene activation, which can be enhanced when combined with p65/HSFl recruitment, providing optimal and robust gene activation.
  • dCas9 fused to a specific p300 domain can robustly activate gene expression through epigenetic
  • dCas9 targeted to a promoter region can interfere with transcription on its own and this gene repression is enhanced when a Kriippel associated box (KRAB) domain is fused to dCas9.
  • KRAB Kriippel associated box
  • the system described herein allows one to stably or transiently deliver numerous gRNAs targeting coding regions, miRNAs, and/or IncRNAs to a single cell at one time, along with the appropriate dCas9 fusion.
  • the dCas9 fusion can be under the control of an inducible operon such as, for example, the tetracycline operon.
  • the system involves linking many gRNAs in a gRNA array expressed from a single U6 promoter, analogous to what is observed in nature (FIG. 1).
  • the gRNAs are assembled using Golden Gate cloning with a library of validated plasmids or PCR products or annealed DNA oligonucleotides (FIG. 3).
  • the assembled arrays contain sites in between each gRNA that are identified and cleaved by the site- specific RNA nuclease Csy4, which can be co-expressed with the dCas9 fusions.
  • the upper limit of the number of gRNAs while maintaining robust Csy4 processing and Cas9 targeting can be, for example, no more than 200 gRNAs such as, for example, no more than 150 gRNAs, no more than 125 gRNAs, no more than 100 gRNAs, no more than 75 gRNAs, no more than 50 gRNAs, no more than 45 gRNAs, no more than 40 gRNAs, no more than 35 gRNAs, no more than 30 gRNAs, no more than 25 gRNAs, no more than 24 gRNAs, no more than 23 gRNAs, no more than 22 gRNAs, no more than 21 gRNAs, no more than 20 gRNAs, , no more than 19 gRNAs, no more than 18 gRNAs, no more than 17 gRNAs,
  • lentiviral vectors can be incapable of faithfully delivering cargo containing many repeat regions, they can have a limited cargo capacity (e.g., up to approximately 12 kb), and they can be more time consuming to generate compared to plasmids.
  • the vector can be designed to include dual LR Clonase Gateway (Life Technologies Corp., Carlsbad, CA) ready sites for simple and efficient cloning of gRNA arrays (FIG. 4).
  • dual LR Clonase Gateway Life Technologies Corp., Carlsbad, CA
  • the placement of gRNAs relative to the promoter region of the gene influences the extent of gene modulation.
  • One can target multiple coding regions (e.g., 10-20) by, for example, integrating a gRNA for each target coding region.
  • This disclosure describes a schema to identify, in a high throughput manner, gRNAs that modulate gene expression to a desired degree.
  • the schema involves using single cell RNA sequencing.
  • 5-10 gRNAs are computationally designed to the promoter region of each gene, IncRNA, or miRNA of interest (FIG. 5 A).
  • the gRNAs can be synthesized into oligonucleotides and cloned into lentiviral vectors as previously described (Nissim et al., 2014, Mol. Cell 54:698-710).
  • Stable cell lines expressing an appropriate vector can be transduced with the gRNA library and selected and expanded.
  • the cells may be transduced at a multiplicity of infection (MOI) such that each cell gets multiple gRNAs.
  • MOI multiplicity of infection
  • the transduced cells can be transcriptionally profiled using single cell RNA sequencing. Within each cell, one can categorize each gRNA that is expressed and determine if the expressed gRNA correlates with significant changes in transcript expression of its cognate gene (FIG. 5B). This method allows one to identify gRNAs for each target gene, IncRNA, and miRNA, and have a quantitative measure of how well each gene-specific gRNA functions for gene activation or repression.
  • HEK293T cells were transfected with gRNA arrays of three, five, seven or ten gRNAs and a plasmid expressing Cas9 alone or Cas9 linked to the human codon-optimized Csy4 ribonuclease (Tsai et al., 2014. Nat. Biotechnol, 32:569-576) via a P2A element (FIG. 7A). Negligible editing was observed without expression of Csy4 to process the array into individual gRNAs, confirming the necessity of Csy4 for array processing (FIG. 7C).
  • Editing frequencies were increased by removing the U6 promoter from the pACPT 1-10 plasmids, as illustrated in FIG. 9, and again assembled an array of 10 gRNAs that were subsequently cloned into a vector containing the strong pol II CMV promoter with a poly adenylation sequence (FIG. 10A).
  • the array was transfected into HEK293T and demonstrated improved gene editing frequencies overall, with approximately 10%-21% gene editing across all gRNA targets (FIG. 10B, CMV array vs. U6 single gRNA).
  • the 10 gRNA array was expressed from the very strong intron-containing pol II CAG promoter with a poly adenylation sequence (FIG. 10A, CAG).
  • the rates of gene editing using the CAG promoter were significantly higher than the individual U6-gRNA editing (FIG. 10B, CAG array vs. U6 single gRNA, P > 0.0002).
  • the effect of the promoter in driving the expression of three-gRNA arrays, five-gRNA arrays, and seven-gRNA arrays were tested and increased gene editing was observed using the CAG promoter (FIG. 8).
  • FIG. 12 A An all-in-one gateway-ready transposon vector, compatible with both piggyBac and Sleeping Beauty systems, was developed to investigate the ability to stably express the gRNA array system in human cells.
  • the 10 gRNA array was transferred to the transposon vector and stably integrated the transposon into HEK293T cells using piggyBac transposase.
  • Surveyor nuclease assay demonstrated gene editing at all target sites of the 10 gRNA array after puromycin selection (FIG. 12B). These data demonstrate that DNA transposons can be used to successfully deliver functional gRNA arrays to human cells. Multiplex SAM activation using gRNA arrays
  • a set of pGGl-10 vectors with gRNAs containing two MS2 binding sites were generated to allow for multiplex gene activation using gRNA arrays (FIG. 13 A). These gRNAs are compatible with the SAM activation system (Konermann et al., 2015. Nature 517(7536):583- 588). This system was used to generate a gRNA activation array containing five previously validated gRNAs used for gene activation (Konermann et al., 2015. Nature 517(7536):583-588) (FIG. 14A).
  • HEK293T cells were transfected with individual U6-MS2-gRNAs, dCas9-VP64, or MS2:p65:HSFl plasmids to assess standard gene activation with the SAM system using individual U6 gRNAs (FIG. 14B). These activation results were then compared with gene activation in cells transfected with the MS2 gRNA array, Csy4/dCas9-VP64, or MS2:HSF1 :p65 plasmids. Robust levels of gene activation were observed in both systems and the level of activation was not significantly different between using individual U6-MS2-gRNA plasmids or the MS2 gRNA array (FIG. 14B). These results demonstrate that MS2 gRNA arrays are amenable to multiplex gene activation and produce levels of activation on par with individual U6-MS2-gRNA plasmids.
  • this disclosure describes assembly of CRISRP/Cas9 gRNA arrays capable of expressing multiple gRNAs from a single promoter.
  • the gRNA arrays are effectively processed by Csy4 ribonuclease and high rates of gene editing can be detected at all gRNA target sites when the gRNA array is expressed from a suitable promoter.
  • the array can be expressed from the pol II CAG promoter containing a polyadenylation sequence.
  • gene editing frequencies are higher when using pol Il-driven gRNA arrays compared to the individual standard U6-gRNA plasmids, especially when multiplexing numerous U6- gRNA plasmids. It is also possible to stably express the gRNA arrays in cultured mammalian cells when delivered using DNA transposons.
  • Csy4 may protect the gRNAs from degradation that normally occurs from endogenous non-specific RNases in the cytoplasm, providing a larger window of time for Cas9 to bind the gRNA and induce targeted DSBs.
  • Csy4 may directly interact with Cas9 to enhance gRNA loading after gRNA array processing.
  • a nuclear localization sequence can protect the gRNAs from degradation by cytoplasmic nucleases by localizing the gRNAs in the nucleus of the cell.
  • the gRNA array platform for spCas9 employs standard and MS2-containing chimeric gRNA backbones
  • similar platforms employing other CRISPR orthologs (e.g., Neisseria meningitidis Cas9 and Staphylococcus aureus Cas9), other modified gRNA backbones, and/or other CRISPR systems (such as Cpfl).
  • CRISPR orthologs e.g., Neisseria meningitidis Cas9 and Staphylococcus aureus Cas9
  • CRISPR systems such as Cpfl
  • Sp dCas9-VP64 can be used for gene activation combined with Sa dCas9-KRAB for gene repression using a gRNA array containing both Sp and Sa specific gRNA backbones.
  • Cpfl for enhanced multiplex genome engineering exploiting the character of Cpfl having both DNase and RNase activity.
  • the DNase activity of Cpfl can be exploited to induce sequence specific DSBs and its RNase function can be exploited to process the transcribed CRISPR arrays into individual gRNAs.
  • Cpfl may be used to deliver analogous functions of Cas9 and Cys4 in a single protein.
  • IVT in vitro transcribed RNA encoding the gRNA array.
  • This approach may be especially desirable for multiplexed editing of primary human lymphocytes, such as T cells. Plasmid DNA is toxic to primary lymphocytes and thus the use of IVT gRNA arrays can allow for multiplex gene editing of primary human cell types for research and therapy.
  • the methods described herein can be used in connection with any application that involves modulating expression of many genes at one time in a single cell.
  • the methods may be used in connection with, for example, inducing transdifferentiation, screening candidate genes for a given phenotype, identifying transcription factor targets of a given phenotype, identifying miRNA targets of a given phenotype, identifying causal cancer genes in amplified or deleted regions in cancer, super overexpression of a gene or cDNA for the purpose of protein production, altering biochemical pathways to favor the production of a given compound, modeling cancer development/metastasis/drug resistance, generating synthetic CRISPR immune systems to protect cells (such as immune cells or any cell) from invading viruses, activating cellular pathways in therapeutic cells to improve therapeutic effects (such as cells for the purpose of gene therapy or immunotherapy).
  • the ability to deliver multiple gRNAs at one time allows the CRISPR/Cas9 system to easily perform multiplex genome editing.
  • multiplexed CRISPR gRNAs By implementing multiplexed CRISPR gRNAs, one can target, for example, up to 50 coding regions for deletion and/or activation.
  • the CRISPR system is highly effective at inducing large deletions (e.g., 300 kb) and can achieve more massive deletions (e.g., >30 Mb, unpublished result), opening the possibility to use this technology for large-scale chromosome engineering. This can allow for functional genomics studies targeting commonly deleted chromosomal regions of human cancer in the mouse.
  • the analogous regions commonly lost in human cancers can be targeted for deletion in segments in the mouse using the MCC system.
  • the term “and/or” means one or all of the listed elements or a combination of any two or more of the listed elements; the terms “comprises,” “comprising,” and variations thereof are to be construed as open ended— i.e., additional elements or steps are optional and may or may not be present; unless otherwise specified, "a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
  • the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
  • Inducible CRISPR vectors were designed using published sequences for all elements, such as Cas9, Csy4, rtTA, Puro, EFIA, etc. Designed sequences were then ordered as gBLOCKs (IDT) in 2 kb fragments and assembled using Gibson assembly (New England Biolabs, Inc., Ipswich, MA), following the manufacturer's instructions. Golden Gate platform assembly
  • Optimal overhangs for the assembly of up to 10 unique gRNAs were determined bioinformatically as previously described (Cermak et al., 2011, Nucleic Acids Res 39(12):e82). Csy4 site sequences have been previously described (Nissim et al., 2014, Mol Cell 54:698-710; Tsai et al., 2014, Nature Biotechnol 32:569-576).
  • the vectors were termed pENTRl -GG-gRNAl , pENTRl -GG-gRNA2, pENTRl - GG-gRNA3, etc. denoting their location in a finished Golden Gate assembled gRNA array.
  • gRNAs Guide RNAs
  • CRISPR Design Program Zhang Lab, MIT 2015; crispr.mit.edu
  • Multiple gRNAs were chosen based on the highest ranked values determined by off-target locations.
  • the gRNAs were ordered in oligonucleotide pairs: 5'-overhang-G-gRNA sequence-3' and 5 '-AAAC -reverse complement gRNA sequence-C-3' .
  • the gRNAs were cloned together using a modified version of the target sequence cloning protocol (Zhang Lab, MIT 2015; crispr.mit.edu).
  • oligonucleotide pairs were phosphorylated and annealed together using T4 PNK (New England Biolabs, Inc., Ipswich, MA) and 10X T4 Ligation Buffer (New England Biolabs, Inc., Ipswich, MA) in a thermocycler with the following protocol: 37°C 30 minutes, 95°C five minutes and then ramped down to 25°C at 5°C/minute.
  • T4 PNK New England Biolabs, Inc., Ipswich, MA
  • 10X T4 Ligation Buffer New England Biolabs, Inc., Ipswich, MA
  • pENTRl vector backbones were digested with FastDigest Bbsl (Fermentas, Thermo Fisher Scientific, Inc., Waltham, MA), FastAP (Fermentas, Thermo Fisher Scientific, Inc., Waltham, MA), and 10X Fast Digest Buffer and used for the ligation reaction.
  • the digested pENTRl vector was ligated together with the phosphorylated and annealed oligo duplex
  • Immortalized HSC1L cells were electroporated using the Neon Transfection System (100 ⁇ Kit, Invitrogen Corp., Carlsbad, CA). Cells were counted and resuspended at a density of 1 ⁇ 10 6 cells in 100 of R buffer. 2 ⁇ g of Cas9 plasmid, 2 ⁇ g of gRNA and 100 ng of GFP plasmid were added to the cell mixture. Cells were electroporated at 1400 V, 30 ms, one pulse. After transfection, cells were plated in a 2 mL culturing media in a 6-well plate.
  • gRNAs were incubated for three days at 37°C and then genomic DNA was collected using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific, Inc., Waltham, MA). Activity of the gRNAs was quantified by a Surveyor Digest, gel electrophoresis, and densitometry (Gushin et al., 2010, Meth MolBiol 649:247-256).
  • HEK293T cells were maintained in DMEM medium supplemented with 10% fetal bovine serum (FBS). I ⁇ 10 5 cells of HEK293T cells were seeded in 24-well plate the day before transfection. Transfection was performed using LIPOFECTAMINE 2000 (Invitrogen Corp., Carlsbad, CA), following the manufactures protocol. 500 ng of pT3.5-CAG-Csy4-T2A- hCas9, 250 ng of pENTR221-U6-gRNA, or 250 ng of pACPT array plasmid were diluted in 75iL of OptiMEM (Thermo Fisher Scientific, Inc., Waltham, MA) and 5 ⁇ of
  • LIPOFECTAMINE 2000 was diluted in 75 ⁇ , of OptiMEM and then the mixtures were combined. The complete mixture was incubated for 15 minutes before being added to cells in a drop wise fashion. After 16 hours, the media was changed to fresh DMEM medium containing 10% fetal bovine serum. Cells were incubated for three days at 37°C and then genomic DNA was collected using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific, Inc., Waltham, MA).
  • gRNAs Activity of the gRNAs was quantified by a Surveyor nuclease digest, gel electrophoresis, and densitometry (Gushin et al., 2010, MethMolBiol 649:247-256).
  • Assembled single gRNAs were ligated into one vector via Golden Gate cloning (Engler et al., 2009. PLoS One, 4:e5553.).
  • 150 ng of each gRNA to be put into the array was combined with 150 ng of pACT vector, Bsal (New England Biolabs, Inc., Ipswich, MA), T4 DNA Ligase and Buffer (New England Biolabs, Inc., Ipswich, MA) and water.
  • Each array was run in a thermocycler according to the following protocol: 37°C for five minutes, 16°C for ten minutes for ten cycles; 50°C for five minutes; 80°C for five minutes; and then cooled to 4°C.
  • Each reaction was then combined with 1 ⁇ _, of 25 mM ATP and 1 ⁇ _, of Plasmid Safe and incubated for one hour at 37°C.
  • the gRNA arrays were then transformed on kanamycin selection plates with X-gal and mini-prepped (GeneJET Plasmid Miniprep Kit, Life Technologies). The plasmids were sequenced to confirm the proper insertion.
  • a gRNA array acceptor plasmid (pACPT) was designed containing a LacZ gene, for blue/white colony selection after Golden Gate assembly, flanked by appropriate BsmBI sites and an upstream U6 pol II promoter to drive expression of assembled gRNA arrays (FIG. 6).
  • attLl/2 sequences were included in pACPT for Gateway cloning (FIG. 1).
  • the set of plasmids for oligonucleotide ligation are referred to as pGG 1-10 and the acceptor plasmids are referred to as pACPT 1-10 (FIG. 2).
  • pGG 1-10 The set of plasmids for oligonucleotide ligation
  • acceptor plasmids are referred to as pACPT 1-10 (FIG. 2).
  • FIG. 2 An example of the plasmids required for Golden Gate assembly of a four gRNA array and the structure of the final expression plasmid are shown in the right panel of FIG. 2.
  • 293T cells were plated out at a density of 1 ⁇ 10 5 cells per well in a 24-well plate.
  • 150 ⁇ _, of Opti-MEM medium was combined with 1.5 ⁇ g of single gRNA plasmid, 1.5 ⁇ g of Cas9 plasmid and 100 ng of GFP plasmid or 1.5 ⁇ g gRNA array, 1.5 ⁇ g Cas9-Csy4 and 100 ng of GFP plasmid.
  • Another 150 ⁇ _, of Opti-MEM medium was combined with 5 ⁇ of
  • LIPOFECTAMINE 2000 transfection reagent (Invitrogen Corp., Carlsbad, CA). The solutions were combined together and incubated for 10-15 minutes at room temperature. The DNA-lipid complex was added dropwise to one well of the 24-well plate. Cells were incubated for three days at 37°C and then genomic DNA was collected using the GeneJET Genomic DNA
  • HEK293T cells One hundred thousand HEK293T cells were seeded into 24-well plates and allowed to adhere for eight hours. Cells were then transfected with 500 ng transposon plasmid and 500 ng PiggyBac7 hyperactive transposase expressing plasmid using LIPOFECTAMINE 2000
  • PCR amplicons were generated spanning the Cas9 binding site using ACCUPRIME Taq HF (Invitrogen Corp., Carlsbad, CA) using the following PCR cycle: initial denaturation at 95°C for five minutes; 40x (95°C for 30 seconds, 55°C or 60°C for 30 seconds, 68°C for 40 seconds); final extension at 68°C for two minutes.
  • PCR amplicons were denatured and annealed as follows: 95°C for five minutes, 95-85°C at -2°C/s, 85-25°C at -0.1°C/s, 4°C hold. Primer sequences can be found in Table 1, below.
  • Taq-man quantitative PCR was performed with following primer and probes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Toxicology (AREA)
  • Rheumatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Endocrinology (AREA)
  • Diabetes (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A polynucleotide that modulates transcription from a plurality of genomic targets can include, generally, a polynucleotide encoding a gRNA array and a polynucleotide sequence encoding a nuclease-deficient Cas9 polypeptide. The polynucleotide encoding a gRNA array generally includes polynucleotides encoding at least two gRNAs operably linked to an inducible regulatory sequence.

Description

VECTORS AND SYSTEM FOR MODULATING GENE EXPRESSION
CROSS-REFERENCE TO RELATED APPLICATION
This application claims priority to U.S. Provisional Patent Application No. 62/291,908, filed February 5, 2016, which is incorporated herein by reference.
GOVERNMENT FUNDING
This invention was made with government support under R03CA201502 awarded by the National Institutes for Health. The government has certain rights in the invention.
SEQUENCE LISTING
This application contains a Sequence Listing electronically submitted via EFS-Web to the
United States Patent and Trademark Office as an ASCII text file entitled "2017-02-01-
SequenceListing_ST25.txt" having a size of 8 kilobytes and created on February 1, 2017. The information contained in the Sequence Listing is incorporated by reference herein.
SUMMARY
This disclosure describes, in one aspect, a polynucleotide for modulating transcription from a plurality of genomic targets. Generally, the polynucleotide includes a polynucleotide encoding a gRNA array and a polynucleotide sequence encoding a nuclease-deficient Cas9 polypeptide. The polynucleotide encoding a gRNA array generally includes polynucleotides encoding at least two gRNAs operably linked to an inducible regulatory sequence.
In some embodiments, an enzyme-cleavable linker sequence links the polynucleotide encoding the first gRNA and the polynucleotide encoding the second gRNA.
In some embodiments, the nuclease-deficient Cas9 polypeptide comprises a fusion polypeptide including a transcription activating domain. In some of these embodiments, the transcription activating domain can include VP64.
In some embodiments, the nuclease-deficient Cas9 polypeptide can include a
transcription repressing domain. In some of these embodiments, the transcription repressing domain can include a Kriippel associated box domain. In some embodiments, the gRNA array can include at least 5 gRNAs.
In another aspect, this disclosure describes a method of modulating expression of a plurality of genomic target coding regions in a cell. Generally, the method includes introducing into the cell any embodiment of the polynucleotide summarized above, wherein gRNAs in the array target the genomic target coding regions, and inducing transcription of the gRNA array.
In some embodiments, the method involves modulating expression of two or more genomic target coding regions simultaneously.
In some embodiments, the method can further include screening the modulated expression of the genomic target coding regions for a change in phenotype.
In some embodiments, the method can further include identifying mRNA targets of a particular phenotype.
In some embodiments, the method can further include identifying causal cancer genes.
In some embodiments, the method can further include overexpressing a genomic target coding region that encodes a polypeptide of interest. In some of these embodiments, the method further includes isolating at least a portion of the polypeptide of interest.
In some embodiments, the method can further include altering biochemical pathways to favor biosynthesis of a compound of interest. In some of these embodiments, the method can further include isolating at least a portion of the compound of interest.
In some embodiments, the method can further include generating a synthetic CRISPR immune system to increase resistance of the cell to infection by a virus.
In some embodiments, the method can further include activating a cellular pathway in a therapeutic cell to increase the therapeutic cell's therapeutic activity.
In another aspect, this disclosure describes a method for generating a genetically modified organism. Generally the method includes introducing into cells of the organism any embodiment of the polynucleotide summarized above, wherein gRNAs in the array target the genomic target coding regions, and inducing transcription of the gRNA array.
In some embodiments, the organism can be a mouse.
The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.
BRIEF DESCRIPTION OF THE FIGURES FIG. 1. Diagram of the CRISPR locus in Pseudomonas aeruginosa UCBPP- PA14. The
CRISPR locus is flanked by arrays of spacers linked by target sequences (SEQ ID NO:2) of the sequence specific RNA nuclease Csy4.
FIG. 2. Plasmids required for Golden Gate assembly of up to 10 gRNAs linked by Csy4 sites (Left). Example Golden Gate assembly of 4 gRNAs (right).
FIG. 3. CELI results of 10 gRNA array targeting 10 genes. (A) Diagram of gRNA array.
(B) Cells treated with Cas9 and 10 gRNA array. (C) Cells treated with Cas9, Csy4, and the 10 gRNA array.
FIG. 4. (A) Diagram of gRNA arrays in pENTRl and pENTR2. (B) Diagram of PB- Dual-DEST- dCas9 Activator vector. (C) Final PB-Dual-gRNA-Array- dCas9 Activator vector. Sp: S. pyogenes DEST: Gateway destination cassette, TRE: tertracycline responsive element, rtTA: reverse tetracycline transactivator, Puro: puromycin, ITR: piggyBac inverted terminal repeates, 2A: ribosomal skip sequence P2A.
FIG. 5. (A) Schematic diagram of the schema to identify highly functioning gRNAs. (B) Hypothetical single cell RNA sequencing results from a cell expressing 5 gRNAs targeting genes A-E and the dCAS9:VP64 fusion. ***Indicates gRNAs that robustly induce expression of their target gene.
FIG. 6. Diagram of the base pGG (left) and pENTR-ACPT (right) plasmids highlighting the type IIS restriction enzymes used for protospacer oligonucleotide ligation (Bsal) and golden gate assembly (BsmBI). In addition, the pGG cassette contains a filler sequence that is removed upon enzyme digestion and a 5' Csy4 site for array processing once assembled and expressed. A terminal Csy4 site was included in the pENTR-ACPT cassette to remove additional plasmid sequence from the terminal gRNA when expressed and a LacZ gene that is removed upon golden gate assembly to allow for blue/white colony selection.
FIG. 7. Gene editing frequency of pol III driven 10 gRNA array. (A) Diagram depicting the plasmid vectors transfected into HEK293T cells to induce targeted DSBs using a pol III driven 10 gRNA array combined with Cas9 and Csy4. (B) Results of CRISPR/Cas9 editing at each of the 10 gRNA target sites when using gRNA arrays with a 20 bp or 28 bp Csy4 target sequence. (C) Results of surveyor nuclease assay performed on genomic DNA of HEK293T cells transfected with a 10 gRNA array and Cas9 with or without Csy4 three days post transfection. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown. P2A: ribosomal skip sequence; BGH pA: bovine growth hormone polyadenylation signal; CAG: strong mammalian promoter comprised of cytomegalovirus (CMV) early enhancer element, the first exon and intron of chicken beta-actin gene, and the splice acceptor of the rabbit beta-globin gene.
FIG. 8. Comparison of gene editing frequency of pol Il-driven and pol Ill-driven three- gRNA array, five-gRNA array, and seven-gRNA array. Line graphs (left) depicting the gene editing frequency of each gRNA when expressed as individual gRNAs transcribed from the standard U6 pol III promoter (dots) or in a single three-gRNA array (top), five-gRNA array (middle), or seven-gRNA array (bottom) transcribed from the standard U6 pol III promoter, CMV promoter with BGH polyadenylation signal, and CAG promoter with BGH
polyadenylation signal three days post transfection. Bar graphs (right) depicting the average gene editing frequency of the three-gRNA array (top), five-gRNA array (middle), seven-gRNA array (bottom) expressed from each promoter normalized to the editing frequency of each individual gRNA transcribed from the standard U6 pol III promoter. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown.
FIG. 9. Modified golden gate assembly plasmid library. Diagram depicting the cloning strategy to remove the U6 promoter from the pENTR-ACPT 1-10 plasmids used for gRNA array assembly. Plasmids were treated with Dral (blunt) and subsequently self-ligated and sequence verified.
FIG. 10. Comparison of gene editing frequency of pol II and pol III driven gRNA arrays. (A) Diagram depicting the plasmid vectors transfected into HEK293T cells containing pol II or pol III promoters driving transcription of a 10 gRNA array. (B, left panel) Graph depicting the gene editing frequency of each gRNA when expressed as individual gRNAs transcribed from the standard U6 pol III promoter or in a single 10 gRNA array transcribed from the standard U6 pol III promoter, CMV promoter with BGH polyadenylation signal, and CAG promoter with BGH polyadenylation signal assessed three days post transfection. (B, right panel) Bar graph depicting the average gene editing frequency of the 10 gRNA array expressed from each promoter normalized to the editing frequency of each individual gRNA transcribed from the standard U6 pol III promoter. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown. P2A: ribosomal skip sequence; BGH pA: bovine growth hormone polyadenylation signal; CMV: cytomegalovirus; CAG: strong mammalian promoter comprised of CMV early enhancer element, the first exon and the first intron of chicken beta- actin gene, and the splice acceptor of the rabbit beta-globin gene. **P < 0.001, ***p < 0.0001, Student's t test. Error bars, s.d.
FIG. 11. Enhanced multiplex editing using gRNA arrays. (A) Diagram depicting the plasmid vectors transfected into HEK293T cells to compare gene editing by multiplexing 10 standard U6-gRNA plasmids and a 10 gRNA array. (B) Bar graph depicting the gene editing frequency at each of 10 gRNA target sites three days post transfection using multiplexed individual U6-gRNA plasmids or 10 gRNA array encoding the same gRNAs. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown. P2A: ribosomal skip sequence; BGH pA: bovine growth hormone polyadenylation signal; CAG: strong mammalian promoter comprised of CMV early enhancer element, the first exon and the first intron of chicken beta-actin gene, and the splice acceptor of the rabbit beta- globin gene. **P < 0.001, ***P < 0.0001, Student' s t test. Error bars, s.d.
FIG. 12. Stable expression of the CRISPR/Cas9 based gRNA array system. (A) Diagram depicting gateway ready DNA transposon vector for expression of all components of the gRNA system for multiplex editing. (B) Results of gene editing at all 10 gRNA target sites seven days post transfection and puromycin selection in HEK293T cells. Mutation frequencies were assessed by Surveyor Nuclease assay with means of triplicate measurements shown.
FIG. 13. Golden Gate assembly of MS2 gRNA arrays. (A) Diagram of the base pGG- MS2 (left) and pENTR-ACPT (right) plasmids highlighting the type IIS restriction enzymes used for protospacer oligonucleotide ligation (Bsal) and Golden Gate assembly (BsmBI). In addition, the pGG-MS2 cassette contains a filler sequence that is removed upon oligonucleotide ligation and a 5' Csy4 site for array processing once assembled and expressed. A terminal Csy4 site was included in the pENTR-ACPT cassette to remove additional plasmid sequence from the terminal gRNA when expressed and a LacZ gene that is removed upon Golden Gate assembly to allow for blue/white colony selection. (B) Diagram of the final 10 pGG-MS2 and 10 pENTR-ACPT plasmids for assembly of arrays containing 1-10 gRNAs. The gateway attLl/2 sites of pENTR- ACPT plasmids have been left out for simplicity.
FIG. 14. Multiplexed gene activation using the SAM system with gRNA arrays. (A) Diagram depicting the elements encoded in plasmids used for multiplex gene activation using the SAM system combined with gRNA arrays containing MS2 sequences. (B) RT-PCR results of gene activation at five gRNA target sites three days post transfection using individual U6- gRNAs or a gRNA array containing all five gRNAs (left). Average gene activation using either approach is also shown, demonstrating no difference in gene activation using single U6-gRNA plasmids or gRNA arrays (right).
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
This disclosure describes a system to induce, repress, knockout, or otherwise modify numerous genes at one time in a single cell, including in vivo. There have been numerous reports and advances in the use of nuclease deficient Cas9 (dCas9) for targeted activation or repression of gene expression in human cells. For example, dCas9 fused to the transcriptional activation VP64 domain can induce targeted gene activation, which can be enhanced when combined with p65/HSFl recruitment, providing optimal and robust gene activation. Alternatively, dCas9 fused to a specific p300 domain can robustly activate gene expression through epigenetic
modifications. dCas9 targeted to a promoter region can interfere with transcription on its own and this gene repression is enhanced when a Kriippel associated box (KRAB) domain is fused to dCas9.
The system described herein allows one to stably or transiently deliver numerous gRNAs targeting coding regions, miRNAs, and/or IncRNAs to a single cell at one time, along with the appropriate dCas9 fusion. To further control this system, in the event the activation or repression is toxic or lethal to cells, the dCas9 fusion can be under the control of an inducible operon such as, for example, the tetracycline operon.
In order to accommodate the stable delivery of many gRNAs at once, the system involves linking many gRNAs in a gRNA array expressed from a single U6 promoter, analogous to what is observed in nature (FIG. 1). The gRNAs are assembled using Golden Gate cloning with a library of validated plasmids or PCR products or annealed DNA oligonucleotides (FIG. 3). The assembled arrays contain sites in between each gRNA that are identified and cleaved by the site- specific RNA nuclease Csy4, which can be co-expressed with the dCas9 fusions. We have been able to assemble arrays ranging from 2-10 gRNAs with >99% efficiency and all assembled vectors sequence perfectly via standard Sanger sequencing. To validate the functionality of our assembled arrays, we induced double strand breaks at 10 independent genomic sites by transfecting HEK293T cells with a plasmid encoding Cas9 nuclease, Csy4, and a 10 gRNA array. CELI assay performed on genomic DNA from treated cells demonstrated detectable cutting at all 10 target genes only when both Cas9 and Csy4 were co-delivered (FIG. 4).
It is also possible to further clone two (or more) arrays of 10 together to have 20 (or more) gRNAs expressed form a single promoter. Thus, in certain embodiments, the upper limit of the number of gRNAs while maintaining robust Csy4 processing and Cas9 targeting can be, for example, no more than 200 gRNAs such as, for example, no more than 150 gRNAs, no more than 125 gRNAs, no more than 100 gRNAs, no more than 75 gRNAs, no more than 50 gRNAs, no more than 45 gRNAs, no more than 40 gRNAs, no more than 35 gRNAs, no more than 30 gRNAs, no more than 25 gRNAs, no more than 24 gRNAs, no more than 23 gRNAs, no more than 22 gRNAs, no more than 21 gRNAs, no more than 20 gRNAs, , no more than 19 gRNAs, no more than 18 gRNAs, no more than 17 gRNAs, no more than 16 gRNAs, no more than 15 gRNAs, no more than 14 gRNAs, no more than 13 gRNAs, no more than 12 gRNAs, no more than 11 gRNAs, no more than 10 gRNAs, no more than nine gRNAs, no more than eight gRNAs, no more than seven gRNAs, no more than six gRNAs, or no more than five gRNAs. Thus, in some cases, the system can involve delivery of, for example, up to 20 gRNAs. In certain embodiments, the system can involve delivery of 5-10 gRNAs.
For stable delivery of the doxycycline inducible system, one can use, for example, any suitable transposon vector system or viral vector system. In some cases, one can use a piggyBac transposon vector system, which is a cut and paste DNA transposon capable of integrating cargo of greater than 100 kb in size. The piggyBac transposon system can provide one or more benefits over standard lentiviral vectors. For example, lentiviral vectors can be incapable of faithfully delivering cargo containing many repeat regions, they can have a limited cargo capacity (e.g., up to approximately 12 kb), and they can be more time consuming to generate compared to plasmids. The vector can be designed to include dual LR Clonase Gateway (Life Technologies Corp., Carlsbad, CA) ready sites for simple and efficient cloning of gRNA arrays (FIG. 4). When using a CRISPR activation and repression system, the placement of gRNAs relative to the promoter region of the gene influences the extent of gene modulation. One can design, for example, 5-10 gRNAs for a given target and identify the gRNA or gRNAs that activate or repress transcription of the target to the desired level. One can target multiple coding regions (e.g., 10-20) by, for example, integrating a gRNA for each target coding region.
This disclosure describes a schema to identify, in a high throughput manner, gRNAs that modulate gene expression to a desired degree. The schema involves using single cell RNA sequencing. In an exemplary embodiment, 5-10 gRNAs are computationally designed to the promoter region of each gene, IncRNA, or miRNA of interest (FIG. 5 A). The gRNAs can be synthesized into oligonucleotides and cloned into lentiviral vectors as previously described (Nissim et al., 2014, Mol. Cell 54:698-710). Stable cell lines expressing an appropriate vector (e.g., dCas9:VP64/p300 or dCas9:KRAB) can be transduced with the gRNA library and selected and expanded. The cells may be transduced at a multiplicity of infection (MOI) such that each cell gets multiple gRNAs. The transduced cells can be transcriptionally profiled using single cell RNA sequencing. Within each cell, one can categorize each gRNA that is expressed and determine if the expressed gRNA correlates with significant changes in transcript expression of its cognate gene (FIG. 5B). This method allows one to identify gRNAs for each target gene, IncRNA, and miRNA, and have a quantitative measure of how well each gene-specific gRNA functions for gene activation or repression.
For example, HEK293T cells were transfected with gRNA arrays of three, five, seven or ten gRNAs and a plasmid expressing Cas9 alone or Cas9 linked to the human codon-optimized Csy4 ribonuclease (Tsai et al., 2014. Nat. Biotechnol, 32:569-576) via a P2A element (FIG. 7A). Negligible editing was observed without expression of Csy4 to process the array into individual gRNAs, confirming the necessity of Csy4 for array processing (FIG. 7C). The results of nuclease activity for the 10 gRNA array transfected with Cas9-P2A-Csy4 demonstrated detectable rates of editing with the first four gRNAs in the array and then the editing diminished to nearly undetectable levels at gRNA 7 and gRNA 8, but editing was again observed with the gRNA 9 and gRNA 10 (FIG. 7B).
Previous reports have identified Cys4 target sites of 20 bp and 28 bp in length (Tsai et al., 2014. Nat. Biotechnol, 32:569-576; Nissim et al., 2014. Mol. Cell 54:698-710). Thus, an additional set of pGGl-10 and pACPT plasmids were generated harboring the 28 bp Csy4 target site and again assembled the 10 gRNA array expressed via the U6 pol III promoter. The gRNA array containing the 20 bp Csy4 site produced higher levels of gene editing at all 10 target sites, indicating the 20 bp Csy4 site may be more efficiently cleaved by Csy4 than the 28 bp sequence (FIG. 7B). Editing frequencies using U6 driven three-gRNA arrays, five-gRNA arrays, and seven-gRNA arrays also induced detectable gene editing. (FIG. 8).
Editing frequencies were increased by removing the U6 promoter from the pACPT 1-10 plasmids, as illustrated in FIG. 9, and again assembled an array of 10 gRNAs that were subsequently cloned into a vector containing the strong pol II CMV promoter with a poly adenylation sequence (FIG. 10A). The array was transfected into HEK293T and demonstrated improved gene editing frequencies overall, with approximately 10%-21% gene editing across all gRNA targets (FIG. 10B, CMV array vs. U6 single gRNA). The 10 gRNA array was expressed from the very strong intron-containing pol II CAG promoter with a poly adenylation sequence (FIG. 10A, CAG). The rates of gene editing using the CAG promoter were significantly higher than the individual U6-gRNA editing (FIG. 10B, CAG array vs. U6 single gRNA, P > 0.0002). The effect of the promoter in driving the expression of three-gRNA arrays, five-gRNA arrays, and seven-gRNA arrays were tested and increased gene editing was observed using the CAG promoter (FIG. 8). These results demonstrate gRNA arrays expressed from strong pol II promoters with polyadenylation sequences enhance gene editing frequencies to levels as high or higher than the gene editing levels observed with individual standard U6-gRNA plasmids.
Effects of transfecting a cell with numerous U6-gRNA-containing plasmids include toxicity and low transfection efficiency. Thus, the gRNA array plasmids were tested head-to- head with standard multiplexed U6-gRNA plasmid delivery (FIG. 11 A). Cells were transfected with either each of the 10 individual U6-gRNA plasmids along with Cas9 or the gRNA array and Csy4/Cas9 vector. In both cases, the total amount (in micrograms) of transfecting plasmid was the same. This resulted in no obvious toxicity and analysis of gene editing efficiency at all 10 target sites was significantly higher using the gRNA array approach (FIG. 1 IB). The average editing efficiency for 10 individual U6-gRNA plasmids was significantly lower (8.2%) compared to with the gRNA array (25.0%). These data demonstrate the gRNA array system is a superior approach to the use of numerous multiplexed U6-gRNA plasmids. Stable expression of the CRISPR/Cas9 based gRNA array system
An all-in-one gateway-ready transposon vector, compatible with both piggyBac and Sleeping Beauty systems, was developed to investigate the ability to stably express the gRNA array system in human cells (FIG. 12 A). The 10 gRNA array was transferred to the transposon vector and stably integrated the transposon into HEK293T cells using piggyBac transposase. Surveyor nuclease assay demonstrated gene editing at all target sites of the 10 gRNA array after puromycin selection (FIG. 12B). These data demonstrate that DNA transposons can be used to successfully deliver functional gRNA arrays to human cells. Multiplex SAM activation using gRNA arrays
A set of pGGl-10 vectors with gRNAs containing two MS2 binding sites were generated to allow for multiplex gene activation using gRNA arrays (FIG. 13 A). These gRNAs are compatible with the SAM activation system (Konermann et al., 2015. Nature 517(7536):583- 588). This system was used to generate a gRNA activation array containing five previously validated gRNAs used for gene activation (Konermann et al., 2015. Nature 517(7536):583-588) (FIG. 14A). HEK293T cells were transfected with individual U6-MS2-gRNAs, dCas9-VP64, or MS2:p65:HSFl plasmids to assess standard gene activation with the SAM system using individual U6 gRNAs (FIG. 14B). These activation results were then compared with gene activation in cells transfected with the MS2 gRNA array, Csy4/dCas9-VP64, or MS2:HSF1 :p65 plasmids. Robust levels of gene activation were observed in both systems and the level of activation was not significantly different between using individual U6-MS2-gRNA plasmids or the MS2 gRNA array (FIG. 14B). These results demonstrate that MS2 gRNA arrays are amenable to multiplex gene activation and produce levels of activation on par with individual U6-MS2-gRNA plasmids.
Thus, this disclosure describes assembly of CRISRP/Cas9 gRNA arrays capable of expressing multiple gRNAs from a single promoter. The gRNA arrays are effectively processed by Csy4 ribonuclease and high rates of gene editing can be detected at all gRNA target sites when the gRNA array is expressed from a suitable promoter. In one exemplary embodiment, the array can be expressed from the pol II CAG promoter containing a polyadenylation sequence. Moreover, gene editing frequencies are higher when using pol Il-driven gRNA arrays compared to the individual standard U6-gRNA plasmids, especially when multiplexing numerous U6- gRNA plasmids. It is also possible to stably express the gRNA arrays in cultured mammalian cells when delivered using DNA transposons.
One characteristic of using the CAG promoter to drive gRNA array expression was increased gene editing frequencies compared to individual U6-gRNAs plasmids, which is the most commonly used format of the CRISPR/Cas9 system. This is unexpected as the U6 promoter has been shown to be highly efficient at transcription of gRNAs with nearly a log-fold higher expression compared to, for example, CMV. Without wishing to be bound by any particular theory, the CAG promoter may produce larger amounts of transcript compared to the standard U6 promoter. Another possible reason for enhanced editing using the gRNA arrays described herein may be due to the use the Csy4 enzyme. Csy4 may protect the gRNAs from degradation that normally occurs from endogenous non-specific RNases in the cytoplasm, providing a larger window of time for Cas9 to bind the gRNA and induce targeted DSBs. Alternatively, Csy4 may directly interact with Cas9 to enhance gRNA loading after gRNA array processing.
Another strategy for increasing gene editing frequencies involves modifying the gRNAs to include a nuclear localization sequence (e.g., Zhang et al., 2014. Mol Cell Biol 34(12):2318- 2329). A nuclear localization sequence can protect the gRNAs from degradation by cytoplasmic nucleases by localizing the gRNAs in the nucleus of the cell.
While described herein in the context of an exemplary embodiment in which the gRNA array platform for spCas9 employs standard and MS2-containing chimeric gRNA backbones, similar platforms employing other CRISPR orthologs (e.g., Neisseria meningitidis Cas9 and Staphylococcus aureus Cas9), other modified gRNA backbones, and/or other CRISPR systems (such as Cpfl). Moreover, it is possible to generate Golden Gate assembly libraries to mix and match various gRNA backbones to use multiple orthologs simultaneously. For instance, Sp dCas9-VP64 can be used for gene activation combined with Sa dCas9-KRAB for gene repression using a gRNA array containing both Sp and Sa specific gRNA backbones. As another example, one can use Cpfl for enhanced multiplex genome engineering exploiting the character of Cpfl having both DNase and RNase activity. The DNase activity of Cpfl can be exploited to induce sequence specific DSBs and its RNase function can be exploited to process the transcribed CRISPR arrays into individual gRNAs. Thus, Cpfl may be used to deliver analogous functions of Cas9 and Cys4 in a single protein. Another character of gRNA array technology that may be useful in certain applications is the ability to use in vitro transcribed (IVT) RNA encoding the gRNA array. This approach may be especially desirable for multiplexed editing of primary human lymphocytes, such as T cells. Plasmid DNA is toxic to primary lymphocytes and thus the use of IVT gRNA arrays can allow for multiplex gene editing of primary human cell types for research and therapy.
The methods described herein can be used in connection with any application that involves modulating expression of many genes at one time in a single cell. Thus, the methods may be used in connection with, for example, inducing transdifferentiation, screening candidate genes for a given phenotype, identifying transcription factor targets of a given phenotype, identifying miRNA targets of a given phenotype, identifying causal cancer genes in amplified or deleted regions in cancer, super overexpression of a gene or cDNA for the purpose of protein production, altering biochemical pathways to favor the production of a given compound, modeling cancer development/metastasis/drug resistance, generating synthetic CRISPR immune systems to protect cells (such as immune cells or any cell) from invading viruses, activating cellular pathways in therapeutic cells to improve therapeutic effects (such as cells for the purpose of gene therapy or immunotherapy).
The ability to deliver multiple gRNAs at one time allows the CRISPR/Cas9 system to easily perform multiplex genome editing. By implementing multiplexed CRISPR gRNAs, one can target, for example, up to 50 coding regions for deletion and/or activation. The CRISPR system is highly effective at inducing large deletions (e.g., 300 kb) and can achieve more massive deletions (e.g., >30 Mb, unpublished result), opening the possibility to use this technology for large-scale chromosome engineering. This can allow for functional genomics studies targeting commonly deleted chromosomal regions of human cancer in the mouse. The analogous regions commonly lost in human cancers can be targeted for deletion in segments in the mouse using the MCC system. Deletion of specific regions harboring critical genes may lead to tumor development or progression, thereby functionally identifying the critical genes in large regions that drive tumor formation. In addition to large chromosomal deletions, targeted nucleases have been used to generate common translocations observed in human cancer leading to the production of oncogenic fusion proteins, such as EWSR1-FLI1 and NPM1-ALK fusions found commonly in Ewing sarcoma and anaplastic large cell lymphoma (ALCL), respectively. These fusions could be generated de novo in mouse somatic cells using the Merkel Cell Carcinoma (MCC) model, which may be more accurate than simply over expressing the human fusion cDNA as is typically done to study these oncogenic fusions. These are just a few experimental possibilities with the MCC model, demonstrating the potential power and utility of the system to the field of cancer research and other diseases.
In the preceding description and following claims, the term "and/or" means one or all of the listed elements or a combination of any two or more of the listed elements; the terms "comprises," "comprising," and variations thereof are to be construed as open ended— i.e., additional elements or steps are optional and may or may not be present; unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more
embodiments.
For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
EXAMPLES CRISPR Expression vector construction
Inducible CRISPR vectors were designed using published sequences for all elements, such as Cas9, Csy4, rtTA, Puro, EFIA, etc. Designed sequences were then ordered as gBLOCKs (IDT) in 2 kb fragments and assembled using Gibson assembly (New England Biolabs, Inc., Ipswich, MA), following the manufacturer's instructions. Golden Gate platform assembly
Optimal overhangs for the assembly of up to 10 unique gRNAs were determined bioinformatically as previously described (Cermak et al., 2011, Nucleic Acids Res 39(12):e82). Csy4 site sequences have been previously described (Nissim et al., 2014, Mol Cell 54:698-710; Tsai et al., 2014, Nature Biotechnol 32:569-576). Both the 20 bp (5'-guucacugccguauaggcag-3'; SEQ ID NO: l) and the 28 bp (5'-guucacugccguauaggcagcuaagaaa-3'; SEQ ID NO:2) handle region containing Csy4 sites were used to determine optimal sequences. These 10 gRNA fragments with appropriate Bsal type IIS restriction enzyme sites for Golden Gate cloning were ordered as gBLOCK fragments from IDT and included attB sequences on both ends for subsequent BP Clonase reaction using Gateway cloning, following manufactures protocol
(Invitrogen). The vectors were termed pENTRl -GG-gRNAl , pENTRl -GG-gRNA2, pENTRl - GG-gRNA3, etc. denoting their location in a finished Golden Gate assembled gRNA array.
Ten acceptor vectors were designed based on optimal type IIS restriction site overhangs as previously described (Cermak et al., 2011, Nucleic Acids Res 39(12):e82). These vectors contained a Bsal flanked region containing the LacZ coding region such that when a gRNA is inserted, the LacZ coding region is lost and thus blue/white colony selection can be
implemented. These also contain a standard U6 promoter to drive the gRNA array and a terminating Csy4 sequence on the 3' end and were ordered as gBLOCK fragments from IDT and included attB sequences on both ends for subsequent BP Clonase reaction using Gateway cloning, following manufactures protocol (Invitrogen Corp., Carlsbad, CA). The pENTR221 vector, modified to contain the spectinomycin coding region in place of the original kanamycin coding region, was used for cloning. These vectors were termed pENTRl -ACPT-GG1, pENTRl -ACPT-GG2, pENTRl -ACPT-GG3, etc., denoting the number of gRNAs to be incorporated via Golden Gate assembly.
Design and construction of guide RNAs
Guide RNAs (gRNAs) were designed to the desired region of a gene using the CRISPR Design Program (Zhang Lab, MIT 2015; crispr.mit.edu). Multiple gRNAs were chosen based on the highest ranked values determined by off-target locations. The gRNAs were ordered in oligonucleotide pairs: 5'-overhang-G-gRNA sequence-3' and 5 '-AAAC -reverse complement gRNA sequence-C-3' . The gRNAs were cloned together using a modified version of the target sequence cloning protocol (Zhang Lab, MIT 2015; crispr.mit.edu). The oligonucleotide pairs were phosphorylated and annealed together using T4 PNK (New England Biolabs, Inc., Ipswich, MA) and 10X T4 Ligation Buffer (New England Biolabs, Inc., Ipswich, MA) in a thermocycler with the following protocol: 37°C 30 minutes, 95°C five minutes and then ramped down to 25°C at 5°C/minute. pENTRl vector backbones were digested with FastDigest Bbsl (Fermentas, Thermo Fisher Scientific, Inc., Waltham, MA), FastAP (Fermentas, Thermo Fisher Scientific, Inc., Waltham, MA), and 10X Fast Digest Buffer and used for the ligation reaction. The digested pENTRl vector was ligated together with the phosphorylated and annealed oligo duplex
(dilution 1 :200) from the previous step using T4 DNA Ligase and Buffer (New England Biolabs, Inc., Ipswich, MA). The ligation was incubated at room temperature for at least one hour and then transformed and mini-prepped (GeneJET Plasmid Miniprep Kit, Life Technologies). The plasmids were sequenced to confirm the proper insertion.
Validation of guide RNAs
Immortalized HSC1L cells were electroporated using the Neon Transfection System (100 μΕ Kit, Invitrogen Corp., Carlsbad, CA). Cells were counted and resuspended at a density of 1 χ 106 cells in 100 of R buffer. 2 μg of Cas9 plasmid, 2 μg of gRNA and 100 ng of GFP plasmid were added to the cell mixture. Cells were electroporated at 1400 V, 30 ms, one pulse. After transfection, cells were plated in a 2 mL culturing media in a 6-well plate. Cells were incubated for three days at 37°C and then genomic DNA was collected using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific, Inc., Waltham, MA). Activity of the gRNAs was quantified by a Surveyor Digest, gel electrophoresis, and densitometry (Gushin et al., 2010, Meth MolBiol 649:247-256).
Alternatively, HEK293T cells were maintained in DMEM medium supplemented with 10% fetal bovine serum (FBS). I χ 105 cells of HEK293T cells were seeded in 24-well plate the day before transfection. Transfection was performed using LIPOFECTAMINE 2000 (Invitrogen Corp., Carlsbad, CA), following the manufactures protocol. 500 ng of pT3.5-CAG-Csy4-T2A- hCas9, 250 ng of pENTR221-U6-gRNA, or 250 ng of pACPT array plasmid were diluted in 75iL of OptiMEM (Thermo Fisher Scientific, Inc., Waltham, MA) and 5 μΕ of
LIPOFECTAMINE 2000 was diluted in 75 μΐ, of OptiMEM and then the mixtures were combined. The complete mixture was incubated for 15 minutes before being added to cells in a drop wise fashion. After 16 hours, the media was changed to fresh DMEM medium containing 10% fetal bovine serum. Cells were incubated for three days at 37°C and then genomic DNA was collected using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific, Inc., Waltham, MA).
Activity of the gRNAs was quantified by a Surveyor nuclease digest, gel electrophoresis, and densitometry (Gushin et al., 2010, MethMolBiol 649:247-256).
For gene activation experiments, 250 ng of pT3.5-CAG-Csy4-T2A-dCas9-VP64, 250 ng of pT3.5-CAG-MS2-p65-HSFl-2A-eGFP, and 250 ng of pENTR221-U6-gRNA or pACPT array plasmid were transfected as above. Cells were incubated for three days at 37°C and then RNA was extracted using PURELINK RNA Mini Kit (Thermo Fisher Scientific, Inc., Waltham, MA) and then reverse-transcribed by Transcriptor First Strand cDNA Synthesis Kit (Roche Molecular Systems, Inc., Pleasanton, CA).
Golden Gate assembly of gRNA arrays
Assembled single gRNAs were ligated into one vector via Golden Gate cloning (Engler et al., 2009. PLoS One, 4:e5553.). To make the arrays, 150 ng of each gRNA to be put into the array was combined with 150 ng of pACT vector, Bsal (New England Biolabs, Inc., Ipswich, MA), T4 DNA Ligase and Buffer (New England Biolabs, Inc., Ipswich, MA) and water. Each array was run in a thermocycler according to the following protocol: 37°C for five minutes, 16°C for ten minutes for ten cycles; 50°C for five minutes; 80°C for five minutes; and then cooled to 4°C. Each reaction was then combined with 1 μΙ_, of 25 mM ATP and 1 μΙ_, of Plasmid Safe and incubated for one hour at 37°C. The gRNA arrays were then transformed on kanamycin selection plates with X-gal and mini-prepped (GeneJET Plasmid Miniprep Kit, Life Technologies). The plasmids were sequenced to confirm the proper insertion.
To generate gRNA arrays with multiple gRNAs, Golden Gate cloning was used with type
IIS restriction enzyme sites (BsmBI) and overhangs previously published and validated for robust Golden Gate assembly of TALEN DNA binding domains (Cermak et al., 2011, Nucleic Acids Res 39(12):e82). Next, cassettes for oligonucleotide ligation of protospacer sequences using a different type IIS restriction enzyme (Bsal) flanking a stuffer sequence were designed and assembled. In addition, a Csy4 ribonuclease target sequence was included directly upstream of the target gRNA sequences such that after Golden Gate assembly each gRNA is directly flanked by the Csy4 target sequence (FIG. 6). Next, a gRNA array acceptor plasmid (pACPT) was designed containing a LacZ gene, for blue/white colony selection after Golden Gate assembly, flanked by appropriate BsmBI sites and an upstream U6 pol II promoter to drive expression of assembled gRNA arrays (FIG. 6). A terminal Csy4 target sequence— such that the last gRNA is free of additional sequence when processed— and a poly T termination sequence also were included. In order to produce a highly modular system for rapid and efficient cloning of the U6 driven gRNA array cassettes, attLl/2 sequences were included in pACPT for Gateway cloning (FIG. 1). The set of plasmids for oligonucleotide ligation are referred to as pGG 1-10 and the acceptor plasmids are referred to as pACPT 1-10 (FIG. 2). An example of the plasmids required for Golden Gate assembly of a four gRNA array and the structure of the final expression plasmid are shown in the right panel of FIG. 2.
Testing of multiplex gRNA arrays
293T cells were plated out at a density of 1 χ 105 cells per well in a 24-well plate. 150 μΙ_, of Opti-MEM medium was combined with 1.5 μg of single gRNA plasmid, 1.5 μg of Cas9 plasmid and 100 ng of GFP plasmid or 1.5 μg gRNA array, 1.5 μg Cas9-Csy4 and 100 ng of GFP plasmid. Another 150 μΙ_, of Opti-MEM medium was combined with 5 μΐ of
LIPOFECTAMINE 2000 transfection reagent (Invitrogen Corp., Carlsbad, CA). The solutions were combined together and incubated for 10-15 minutes at room temperature. The DNA-lipid complex was added dropwise to one well of the 24-well plate. Cells were incubated for three days at 37°C and then genomic DNA was collected using the GeneJET Genomic DNA
Purification Kit (Thermo Fisher Scientific, Inc., Ipswich, MA). Activity of the single gRNA and the gRNA arrays was quantified by a Surveyor Digest, gel electrophoresis, and densitometry. Generation of stable cell lines
One hundred thousand HEK293T cells were seeded into 24-well plates and allowed to adhere for eight hours. Cells were then transfected with 500 ng transposon plasmid and 500 ng PiggyBac7 hyperactive transposase expressing plasmid using LIPOFECTAMINE 2000
(Invitrogen Corp., Carlsbad, CA), following manufacturer's instructions. Two days post transfection cells were transferred to 10 cm plates and selected with 1 μg/mL puromycin for seven days to generate stable integration cell lines. Surveyor nuclease assay
Surveyor assays were performed as previously descried (Thermo Fisher Scientific, Inc., Ipswich, MA). Briefly, after electroporation of CRISPR/Cas9 plasmids and incubation for three days genomic DNA was extracted using GeneJET Genomic DNA Purification Kit (Thermo
Fisher Scientific, Inc., Ipswich, MA), following the manufacturer's instructions. PCR amplicons were generated spanning the Cas9 binding site using ACCUPRIME Taq HF (Invitrogen Corp., Carlsbad, CA) using the following PCR cycle: initial denaturation at 95°C for five minutes; 40x (95°C for 30 seconds, 55°C or 60°C for 30 seconds, 68°C for 40 seconds); final extension at 68°C for two minutes. PCR amplicons were denatured and annealed as follows: 95°C for five minutes, 95-85°C at -2°C/s, 85-25°C at -0.1°C/s, 4°C hold. Primer sequences can be found in Table 1, below.
Table 1. Primers
Figure imgf000019_0001
I L1B A A A A AC AG CG AG G G AG A A AC 14
ASCL1 GCAGCCGCTCGCTGCAGCAG 15
MY0D1 GGGCCCCTGCGGCCACCCCG 16
I L-1R2 GACCCAGCACTGCAGCCTGG 17
POU5Fl(OCT4) GGGGGGAGAAACTGAGGCGA 18
KLF4 ATGGGAGAAGGCGGAGGAAA 19
NALCN GGGACTGCAGTGATGCCGAA 20
LIN28A GGGGCTGCCCGCGGGGGGTT 21
ZFP42(REX1) GGGTCTTGGGAGGGGGCGCA 22
Cell primers
GOSR1 Forward GATCGTTTCTCACAGACCCTATA 23
GOSR1 Reverse ATTCAAGTG GTGTG GG G AG G 24
PPP2R2A Forward TCGGCTATGTGACATGAGGG 25
PPP2R2A Reverse CAAGGTTACAGAGCCCAACC 26
CNTFR Forward CCCG GTTTCTCCC AAC AG AT 27
CNTFR Reverse GTC AG C ATTCG ACC ACCCTA 28
DMD Forward CCTTCTCACTGTCTTCGGGT 29
DMD Reverse A ATG CCTG ATC ACGTG CATC 30
ZBTB10 Forward AGAGGAGGGGTACTGTGACT 31
ZBTB10 Reverse ATAGCTGGCCACGGTCATAA 32
KAT7 Forward AC AG AG G AATG CAGGCAGTA 33
KAT7 Reverse ATCCGCAGTTCCTTTGGGT 34 SPPL3 Forward TCCCCAACTCCTCCTTGAAC 35
SPPL3 Reverse AGATAAACAGCAGGCCAGGG 36
CCM2 Forward CCTGGTGGCCTGAGTATGAA 37
CCM2 Reverse A ATGTG ATG G G ACTG G CTC A 38
PRDX1 Forward AGGTGAAGGCTGCTGGTTAT 39
PRDX1 Reverse AG AAGTG GTTTG GTCCTAG G A 40
TRI P12 Forward AG C ATG G GTG A AG G CTGT A A 41
TRIP12 Reverse ACCTG G CTC AC A A ATC AG G A 42
Three microliters of the annealed amplicon was then diluted with 6 μΙ_, of lx
ACCUPRIME PCR buffer and treated with 1 μΙ_, of Surveyor nuclease with 1 μΙ_, of enhancer (Thermo Fisher Scientific, Inc., Ipswich, MA) at 42°C for 20 minutes. The reaction was then stopped by adding 3 μΙ_, of 15% Ficol-400 and 0.05% Orange G solution containing 1 mM EDTA and subsequently run on a standard 10% TBE gel. Percent gene modification was calculated using Image J software as described (Thermo Fisher Scientific, Inc., Ipswich, MA).
Q-RT-PCR analysis
Taq-man quantitative PCR was performed with following primer and probes. ASCL1; Hs00269932_ml, MYOD1; Hs02330075_gl, HBG1/HBG2; Hs00361131_gl, ILIB;
Hs01555410_ml, IL1R2; Hs01030384_ml, ACTB Hs99999903_ml . (Thermo Fisher Scientific, Inc. Ipswich, MA).
The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

Claims

What is claimed is:
1. A polynucleotide for modulating transcription from a plurality of genomic targets, the polynucleotide comprising:
a polynucleotide encoding a gRNA array comprising:
a polynucleotide encoding a first gRNA targeted to a first genomic target; and a polynucleotide encoding a second gRNA targeted to a second genomic target; the polynucleotide encoding the first gRNA and the polynucleotide encoding the second gRNA operably linked to an inducible regulatory sequence; and
a polynucleotide sequence encoding a nuclease-deficient Cas9 polypeptide.
2. The polynucleotide of claim 1 further comprising an enzyme cleavable linker sequence linking the polynucleotide encoding the first gRNA and the polynucleotide encoding the second gRNA.
3. The polynucleotide of claim 1 or claim 2 wherein the nuclease-deficient Cas9 polypeptide comprises a fusion polypeptide comprising a transcription activating domain.
4. The polynucleotide of claim 3 wherein the transcription activating domain comprises VP64.
5. The polynucleotide of claim 1 or claim 2 wherein the nuclease-deficient Cas9 polypeptide comprises a transcription repressing domain.
6. The polynucleotide of claim 5 wherein the transcription repressing domain comprises a Kriippel associated box domain.
7. The polynucleotide of any preceding claim wherein the gRNA array comprises at least 5 gRNAs.
8. A method of modulating expression of a plurality of genomic target coding regions in a cell, the method comprising: introducing into the cell the polynucleotide of any one of claims 1-7, wherein gRNAs in the array target the genomic target coding regions; and
inducing transcription of the gRNA array.
9. The method of claim 8 wherein expression of two or more genomic target coding regions are modulated simultaneously.
10. The method of claim 8 or claim 9 further comprising screening the modulated expression of the genomic target coding regions for a change in phenotype.
11. The method of claim 8 or claim 9 further comprising identifying mRNA targets of a particular phenotype.
12. The method of claim 8 or claim 9 further comprising identifying causal cancer genes.
13. The method of claim 8 or claim 9 further comprising overexpressing a genomic target coding region that encodes a polypeptide of interest.
14. The method of claim 13 further comprising isolating at least a portion of the polypeptide of interest.
15. The method of claim 8 or claim 9 further comprising altering biochemical pathways to favor biosynthesis of a compound of interest.
16. The method of claim 15 further comprising isolating at least a portion of the compound of interest.
17. The method of claim 8 or claim 9 further comprising generating a synthetic CRISPR immune system to increase resistance of the cell to infection by a virus.
18. The method of claim 8 or claim 9 further comprising activating a cellular pathway in a therapeutic cell to increase the therapeutic cell's therapeutic activity.
19. A method for generating a genetically modified organism, the method comprising: introducing into cells of the organism the polynucleotide of any one of claims 1-7, wherein gRNAs in the array target the genomic target coding regions; and
inducing transcription of the gRNA array.
20. The method of claim 19 wherein the organism is a mouse.
PCT/US2017/016357 2016-02-05 2017-02-03 Vectors and system for modulating gene expression Ceased WO2017136629A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/075,218 US20190038780A1 (en) 2016-02-05 2017-02-03 Vectors and system for modulating gene expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662291908P 2016-02-05 2016-02-05
US62/291,908 2016-02-05

Publications (1)

Publication Number Publication Date
WO2017136629A1 true WO2017136629A1 (en) 2017-08-10

Family

ID=59500173

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/016357 Ceased WO2017136629A1 (en) 2016-02-05 2017-02-03 Vectors and system for modulating gene expression

Country Status (2)

Country Link
US (1) US20190038780A1 (en)
WO (1) WO2017136629A1 (en)

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
WO2019121192A1 (en) * 2017-12-22 2019-06-27 Novozymes A/S Counter-selection by inhibition of conditionally essential genes
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
WO2020079454A1 (en) * 2018-10-18 2020-04-23 Imperial College Of Science, Technology And Medicine Rna mediated gene regulating methods
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
CN113897397A (en) * 2021-09-30 2022-01-07 中南大学 DNAzyme based gene editing regulation method
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240038811A (en) 2018-03-19 2024-03-25 리제너론 파마슈티칼스 인코포레이티드 Transcription modulation in animals using crispr/cas systems
CN114729343B (en) * 2019-09-10 2026-02-13 科学方案有限责任公司 No new type II and type V CRISPR-CAS RNA-guided endonucleases
US20220411795A1 (en) * 2019-10-31 2022-12-29 William Marsh Rice University Engineered cells for controlled production
US12582104B2 (en) 2021-12-08 2026-03-24 Regeneron Pharmaceuticals, Inc. Mutant myocilin disease model and uses thereof
WO2025008786A1 (en) * 2023-07-04 2025-01-09 Bybug Inc. Remote methods and elements for genetic modification of insects

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140273226A1 (en) * 2013-03-15 2014-09-18 System Biosciences, Llc Crispr/cas systems for genomic modification and gene modulation
WO2016011080A2 (en) * 2014-07-14 2016-01-21 The Regents Of The University Of California Crispr/cas transcriptional modulation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140273226A1 (en) * 2013-03-15 2014-09-18 System Biosciences, Llc Crispr/cas systems for genomic modification and gene modulation
WO2016011080A2 (en) * 2014-07-14 2016-01-21 The Regents Of The University Of California Crispr/cas transcriptional modulation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KABADI, AM ET AL.: "Multiplex CRISPR/Cas9-based Genome Engineering from a Single Lentiviral Vector", NUCLEIC ACID RESEARCH, vol. 42, no. 19, 13 August 2014 (2014-08-13), pages 1 - 11, XP055177310 *

Cited By (72)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
CN111630165A (en) * 2017-12-22 2020-09-04 诺维信公司 Counter-selection by suppressing conditionally essential genes
CN111630165B (en) * 2017-12-22 2024-07-16 诺维信公司 Counterselection by repression of conditionally essential genes
US20210017544A1 (en) * 2017-12-22 2021-01-21 Novozymes A/S Counter-Selection by Inhibition of Conditionally Essential Genes
WO2019121192A1 (en) * 2017-12-22 2019-06-27 Novozymes A/S Counter-selection by inhibition of conditionally essential genes
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
WO2020079454A1 (en) * 2018-10-18 2020-04-23 Imperial College Of Science, Technology And Medicine Rna mediated gene regulating methods
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12624354B2 (en) 2019-03-19 2026-05-12 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12624353B2 (en) 2019-03-19 2026-05-12 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
CN113897397A (en) * 2021-09-30 2022-01-07 中南大学 DNAzyme based gene editing regulation method
CN113897397B (en) * 2021-09-30 2024-04-02 中南大学 A method for regulating gene editing based on DNAzyme

Also Published As

Publication number Publication date
US20190038780A1 (en) 2019-02-07

Similar Documents

Publication Publication Date Title
US20190038780A1 (en) Vectors and system for modulating gene expression
AU2025287334B2 (en) Systems, methods, and compositions for site-specific genetic engineering using Programmable Addition via Site-Specific Targeting Elements (PASTE)
JP7832700B2 (en) Lentiviral-based vectors, related systems, and methods for gene editing in eukaryotes
US20230272380A1 (en) Engineered Guide RNA Sequences for In Situ Detection and Sequencing
US11746349B2 (en) DNA-guided gene editing and regulation
KR102481330B1 (en) Orthogonal cas9 proteins for rna-guided gene regulation and editing
EP3872177B1 (en) Compositions and methods for enhancing homologous recombination
JP2021048882A (en) Rna-guided human genome engineering
EP3219799A1 (en) Conditional crispr sgrna expression
US20180230450A1 (en) Cas9 Genome Editing and Transcriptional Regulation
WO2017161068A1 (en) Mutant cas proteins
US20140273226A1 (en) Crispr/cas systems for genomic modification and gene modulation
KR20220081988A (en) Modified bacterial retrofactors to enhance DNA production
JP2023508400A (en) Targeted integration into mammalian sequences to enhance gene expression
US20250002943A1 (en) Methods for gene editing
US20240100184A1 (en) Methods of precise genome editing by in situ cut and paste (icap)
WO2020117992A9 (en) Improved vector systems for cas protein and sgrna delivery, and uses therefor
Du Development and Utilization of Crispr-Based Tools for Human Cell Engineering
Ruis et al. SETDB1/ATF7IP regulate the precise genome engineering of HUSH-regulated genes
Zhang Experiments to Study DNA Double-Strand Break Repair by RNA in Human Cells
HK40058696A (en) Compositions and methods for enhancing homologous recombination
JP2026083211A (en) Lentiviral-based vectors, related systems, and methods for gene editing in eukaryotes
Yasuda et al. MultiSite Gateway Technology Is Useful for Donor DNA
HK40005602B (en) Compositions and methods for enhancing homologous recombination
HK40005602A (en) Compositions and methods for enhancing homologous recombination

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17748205

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17748205

Country of ref document: EP

Kind code of ref document: A1