WO2017134252A1 - Antisense oligonucleotides effective to reduce the expression of menin in cancer cells of a subject - Google Patents

Abstract

The present invention relates to the treatment of prostate cancer and particularly resistant prostate cancer (CRPC). It is already know that Heat shock protein 27 (Hsp27) is highly overexpressed in castration-resistant prostate cancer (CRPC). Here, the inventors report that Menin is a new Hsp27 client protein involved in Hsp27 cytoprotection. They found that Menin expression is absent or weak in hyperpalsie prostate cells, and becomes uniformly and strongly expressed of CRPC. They develop a Menin antisense oligonucleotide (ASO) to define Menin function. Thus, the present invention relates to antisense oligonucleotides effective to reduce the expression of Menin in cancer cells of a subject.

Description

ANTISENSE OLIGONUCLEOTIDES EFFECTIVE TO REDUCE THE EXPRESSION OF MENIN IN CANCER CELLS OF A SUBJECT

FIELD OF THE INVENTION:

The present invention relates to antisense oligonucleotides effective to reduce the expression of Menin in cancer cells of a subject.

BACKGROUND OF THE INVENTION:

Cancer is one of the leading causes of death in the world. For instance, prostate cancer (PC) is the most common non-cutaneous malignancy among men in the Western world. After lung cancer, PC is the second most common cause of cancer-related mortality in men being responsible for approximately 13% of all cancer deaths. Although patients with localized disease may be treated by surgery or radiation, androgen ablation is usually the initial therapy in patients with advanced or metastatic disease. Unfortunately, the disease gradually progresses to a metastatic castration-resistant (CR) state, which remains incurable. During this state, tumor growth proceeds in the absence of androgens, resulting in death within 2 to 3 years after diagnosis. Since most of the patients ultimately become unresponsive, and relapse within 2-3 years with a castration-resistant prostate cancer (CRPC), efforts have focused on the development of non-hormonal therapies targeting castration-resistant (CR) cells. Until recently, chemotherapy failed to demonstrate a survival benefit and had only a palliative role for men with CRPC. The efficacy of docetaxel in metastatic CRPC has been shown. Recently, cabazytaxel and Abiraterone has been approved as second line chemotherapy but overall survival is only around 12 to 18 months (Badrising, S., et al, 2014 and Resnick, M. J. et al, 2015). However, the median overall survival was prolonged for only a few months, highlighting the need for new therapies. Previously Hsp27 was shown to be overexpressed in castration resistant prostate cancer (CRCP) and plays a role in resistance to treatment. An inhibitor of Hsp27 (OGX-427) is currently in clinical trial phase II in the USA and Canada in patients with CRCP. It was previously shown that Menin expression is higher in CRPC than in both hormone- naive prostate cancer and benign prostate tissue, and high menin expression correlates with poor overall survival of individuals diagnosed with prostate cancer (Malik R. et al. Nat Med. 2015 Apr; 21(4):344-52). Treatment with a small-molecule inhibitor of menin- mixed-lineage leukemia protein (MLL) interaction blocks AR signaling and inhibits the growth of castration- resistant tumors in vivo in mice (Malik R. et al. Nat Med. 2015 Apr;21(4):344-52).

SUMMARY OF THE INVENTION: The present invention relates to antisense oligonucleotides effective to reduce the expression of Menin in cancer cells of a subject. In particular, the present invention is defined by the claims.

DETAILED DESCRIPTION OF THE INVENTION:

A first objet of the present invention relates to an antisense oligonucleotide effective to reduce the expression of Menin in cancer cells of a subject.

As used herein the term "Menin" has its general meaning in the art and refers to a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcripts. The sequence of human Menin mRNA is known, for example from NCBI Accession Numbers NM_000244.3, NMJ30799.2, NMJ30800.2, NMJ30801.2, NMJ30802.2, NMJ30803.2, and NMJ30804.2. The cDNA sequence (SEQ ID NO: l) forms the basis for the development of the antisense oligonucleotide of the present invention.

SEQ ID NO: l Menin homo sapiens

ggtgtccgga gccgcggacc tagagatccc agaagccaca gcgcagcggc ccggcccgcc actatttcca ggctctgcgg ggcaggggcc gccgcccacc gcccgccgcc atggggctga aggccgccca gaagacgctg ttcccgctgc gctccatcga cgacgtggtg cgcctgtttg ctgccgagct gggccgagag gagccggacc tggtgctcct ttccttggtg ctgggcttcg tggagcattt tctggctgtc aaccgcgtca tccctaccaa cgttcccgag ctcaccttcc agcccagccc cgcccccgac ccgcctggcg gcctcaccta ctttcccgtg gccgacctgt ctatcatcgc cgccctctat gcccgcttca ccgcccagat ccgaggcgcc gtcgacctgt ccctctatcc tcgagaaggg ggtgtctcca gccgtgagct ggtgaagaag gtctccgatg tcatatggaa cagcctcagc cgctcctact tcaaggatcg ggcccacatc cagtccctct tcagcttcat cacaggcacc aaattggaca gctccggtgt ggcctttgct gtggttgggg cctgccaggc cctgggtctc cgggatgtcc acctcgccct gtctgaggat catgcctggg tagtgtttgg gcccaatggg gagcagacag ctgaggtcac ctggcacggc aagggcaacg aggaccgcag gggccagaca gtcaatgccg gtgtggctga gcggagctgg ctgtacctga aaggatcata catgcgctgt gaccgcaaga tggaggtggc gttcatggtg tgtgccatca acccttccat tgacctgcac accgactcgc tggagcttct gcagctgcag cagaagctgc tctggctgct ctatgacctg ggacatctgg aaaggtaccc catggcctta gggaacctgg cagatctaga ggagctggag cccacccctg gccggccaga cccactcacc ctctaccaca agggcattgc ctcagccaag acctactatc gggatgaaca catctacccc tacatgtacc tggctggcta ccactgtcgc aaccgcaatg tgcgggaagc cctgcaggcc tgggcggaca cggccactgt catccaggac tacaactact gccgggaaga cgaggagatc tacaaggagt tctttgaagt agccaatgat gtcatcccca acctgctgaa ggaggcagcc agcttgctgg aggcgggcga ggagcggccg ggggagcaaa gccagggcac ccagagccaa ggttccgccc tccaggaccc tgagtgcttc gcccacctgc tgcgattcta cgacggcatc tgcaaatggg aggagggcag tcccacgcct gtgctgcacg tgggctgggc cacctttctt gtgcagtccc taggccgttt tgagggacag gtgcggcaga aggtgcgcat agtgagccga gaggccgagg cggccgaggc cgaggagccg tggggcgagg aagcccggga aggccggcgg cggggcccac ggcgggagtc caagccagag gagcccccgc cgcccaagaa gccagcactg gacaagggcc tgggcaccgg ccagggtgca gtgtcaggac ccccccggaa gcctcctggg actgtcgctg gcacagcccg aggccctgaa ggtggcagca cggctcaggt gccagcaccc gcagcatcac caccgccgga gggtccagtg ctcactttcc agagtgagaa gatgaagggc atgaaggagc tgctggtggc caccaagatc aactcgagcg ccatcaagct gcaactcacg gcacagtcgc aagtgcagat gaagaagcag aaagtgtcca cccctagtga ctacactctg tctttcctca agcggcagcg caaaggcctc tgaactactg gggacttcgg accgcttgtg gggacccagg ctccgcctta gtcccccaac tctgagccca tgttctgccc ccagcccaaa ggggacaggc ctcacctcta cccaaaccct aggttcccgg tcccgagtac agtctgtatc aaacccacga ttttctccag ctcagaaccc agggctctgc cccagtcgtt agaatatagg tctcttctcc cagaatccca gccggccaat ggaaacctca cgctgggtcc taattaccag tctttaaagg cccagcccct agaaacccaa gctcctcctc ggaaccgctc acctagagcc agaccaacgt tactcagggc tcctcccagc ttgtaggagc tgaggtttca cccttaaccc aagggagcac aggtcccacc tccagcccgg ggagcctagg accactcagc ccctaggagt atatttccgc acttcagaat tccatatctt gcgaatccaa gctccctgcc ccaaataact tcagtcctgc ttccagaatt tggaaatcct agtttcctct ccttcgtatc ccgagtctgg gacacaaaac tccgccccca gcctatgagc atcctgagcc ccgccctctt cctgacgaaa ctggccccgg atcagagcag gacctccctt ccgaccctct gggaacctcc cagaggtcca gcccatctcg gagcatcccg gaggaaatct gcagaggggt taggagtggg tgacaagagc ctgatctctt cctgttttgt acatagattt atttttcagt tccaagaaag atgaatacat tttgttaaaa aaaaaaaaaa aa

The term "antisense oligonucleotide" refers to an oligonucleotide sequence that is inverted relative to its normal orientation for transcription and so expresses an RNA transcript that is complementary to a target gene mRNA molecule expressed within the host cell (e.g., it can hybridize to the target gene mRNA molecule through Watson-Crick base pairing). An antisense strand may be constructed in a number of different ways, provided that it is capable of interfering with the expression of a target gene. For example, the antisense strand can be constructed by inverting the coding region (or a portion thereof) of the target gene relative to its normal orientation for transcription to allow the transcription of its complement, (e.g., RNAs encoded by the antisense and sense gene may be complementary). Furthermore, the antisense oligonucleotide strand need not have the same intron or exon pattern as the target gene, and noncoding segments of the target gene may be equally effective in achieving antisense suppression of target gene expression as coding segments.

As used herein, the term "oligonucleotide" refers to a nucleic acid sequence, 3'-5' or 5'- 3' oriented, which may be single- or double-stranded. The antisense oligonucleotide used in the context of the invention may in particular be DNA or RNA. According to the invention, the antisense oligonucleotide of the present invention targets an mRNA encoding Menin, and is capable of reducing the amount of Menin in cells. As used herein, an oligonucleotide that "targets" an mRNA refers to an oligonucleotide that is capable of specifically binding to said mRNA. That is to say, the antisense oligonucleotide comprises a sequence that is at least partially complementary, preferably perfectly complementary, to a region of the sequence of said mRNA, said complementarity being sufficient to yield specific binding under intra-cellular conditions. As immediately apparent to the skilled in the art, by a sequence that is "perfectly complementary to" a second sequence is meant the reverse complement counterpart of the second sequence, either under the form of a DNA molecule or under the form of a RNA molecule. A sequence is "partially complementary to" a second sequence if there are one or more mismatches. The antisense oligonucleotide of the present invention that target an mRNA encoding Menin may be designed by using the sequence of said mRNA as a basis, e.g. using bioinformatic tools. For example, the sequence of SEQ ID NO: 1 can be used as a basis for designing nucleic acids that target an mRNA encoding Menin. Preferably, the antisense oligonucleotide according to the invention is capable of reducing the amount of Menin in cells, e.g. in cancerous cells such as LNCaP or PC3 cells. Methods for determining whether an oligonucleotide is capable of reducing the amount of Menin in cells are known to the skilled in the art. This may for example be done by analyzing Menin protein expression by Western blot, and by comparing Menin protein expression in the presence and in the absence of the antisense oligonucleotide to be tested.

In some embodiments, the antisense oligonucleotide of the present invention has a length of from 12 to 50 nucleotides, e.g. 12 to 35 nucleotides, from 12 to 30, from 12 to 25, from 12 to 22, from 15 to 35, from 15 to 30, from 15 to 25, from 15 to 22, from 18 to 22, or about 19, 20 or 21 nucleotides. The antisense oligonucleotide according to the invention may for example comprise or consist of 12 to 50 consecutive nucleotides, e.g. 12 to 35, from 12 to 30, from 12 to 25, from 12 to 22, from 15 to 35, from 15 to 30, from 15 to 25, from 15 to 22, from 18 to 22, or about 19, 20 or 21 consecutive nucleotides of a sequence complementary to the mRNA of SEQ ID NO : 1.

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 211-230 of SEQ ID NO: 1

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 231-250 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 251-270 of SEQ ID NO: l In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 271-290 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 331-350 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 351-370 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 411-430 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 431-450 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 451-470 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 471-490 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 511-530 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 531-550 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 551-570 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 631-650 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 651-670 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 771-790 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 791-810 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 811-830 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 831-850 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 871-890 of SEQ ID NO: l n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 891-910 of SEQ ID NO: l

some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 911-930 of SEQ ID NO: l

embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 931-950 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 951-970 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1011-1030 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1031-1050 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1051-1070 of SEQ ID NO: l

embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1071-1090 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1091-1110 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1151-1170 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1191-1210 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1351-1370 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1371-1390 of SEQ ID NO: l

embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1411-1430 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1431-1450 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1471-1490 of SEQ ID NO: l

n some embodiments, the antisense oligonucleotide targets the region consisting of nucleot des 1771-1790 of SEQ ID NO: l In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 1811-1830 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 1831-1850 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 1851-1870 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 1871-1890 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 1891-1910 of SEQ ID NO: l

In some embodiments, the antisense oligonucleotide targets the region consisting of nucleotides 1911-1930 of SEQ ID NO: l

Table A: sequences of the antisense oligonucleotides of the

ASO position Antisense 5 '-3' SEQ ID NO: % GC

6 211-230 caccaaggaaaggagcacca SEQ ID NO:2 55

7 231-250 aaatcgtccacgaagcccag SEQ ID NO:3 55

8 251-270 tgacgcggttgacagccaga SEQ ID NO:4 60

9 271-290 ctcgggaacgttggtaggga SEQ ID NO:5 60

12 331-350 cacgggaaagtaggtgaggc SEQ ID NO:6 60

13 351-370 gcgatgatagacaggtcggc SEQ ID NO:7 60

16 411-430 ggatagagggacaggtcgac SEQ ID NO: 8 60

17 431-450 tggagacacccccttctcga SEQ ID NO:9 60

18 451-470 cttcttcaccagctcacggc SEQ ID NO: 10 60

19 471-490 ttccatatgacatcggagac SEQ ID NO: 11 45

21 511-530 gatgtgggcccgatccttga SEQ ID NO: 12 60

22 531-550 atgaagctgaagagggactg SEQ ID NO: 13 50

23 551-570 tgtccaatttggtgcctgtg SEQ ID NO: 14 50

27 631-650 atcctcagacagggcgaggt SEQ ID NO: 15 60

28 651-670 ccaaacactacccaggcatg SEQ ID NO: 16 55

34 771-790 tatgatcctttcaggtacag SEQ ID NO: 17 40

35 791-810 tcttgcggtcacagcgcatg SEQ ID NO: 18 60

36 811-830 caccatgttcgccacctcca SEQ ID NO: 19 60

37 831-850 tgatggcacaatggaagggt SEQ ID NO:20 50 39 871-890 ctgcagctgcagaagctcca SEQ ID N0:21 60

40 891-910 agcagccagagcagcttctg SEQ ID NO:22 60

41 911-930 ccagatgtcccaggtcatag SEQ ID NO:23 55

42 931-950 taaggccatggggtaccttt SEQ ID NO:24 50

43 951-970 tctagatctgccaggttccc SEQ ID NO:25 55

46 1011-1030 gcaatgcccttgtggtagag SEQ ID NO:26 55

47 1031-1050 gatagtaggtcttggctgag SEQ ID NO:27 50

48 1051-1070 ggggtagatgtgttcatccc SEQ ID NO:28 55

49 1071-1090 tagccagccaggtacatgta SEQ ID NO:29 50

50 1091-1110 cattgcggttgcgacagtgg SEQ ID NO:30 60

53 1151-1170 actagttgtagtcctggctg SEQ ID N0:31 45

55 1191-1210 acttcaaagaactccttgta SEQ ID NO:32 35

63 1351-1370 gatgccgtcgtagaatcgca SEQ ID NO:33 55

64 1371-1390 ctgccctcctcccatttgca SEQ ID NO:34 60

66 1411-1430 aagaaaggtggcccagccca SEQ ID NO:35 60

67 1431-1450 aaacggcctagggactgcac SEQ ID NO:36 60

69 1471-1490 tcggctcactatgcgcacct SEQ ID NO:37 60

84 1771-1790 gcccttcatcttctcgctct SEQ ID NO:38 50

86 1811-1830 cgctcgagttgatcttggtg SEQ ID NO:39 55

87 1831-1850 cgtgagttgcagcttgatgg SEQ ID NO:40 55

88 1851-1870 atctgcacttgcgactgtgc SEQ ID N0:41 55

89 1871-1890 tggacactttctgcttcttc SEQ ID NO:42 45

90 1891-1910 catagtgtagtcactagggg SEQ ID NO:43 55

91 1911-1930 cgctgccgcttgaggaaaga SEQ ID NO:44 60

In some embodiments, the antisense oligonucleotide of the present invention comprises a sequence consisting of SEQ ID NO:2-44

In some embodiments, the antisense oligonucleotide of the present invention is further modified, preferably chemically modified, in order to increase the stability and/or therapeutic efficiency of the antisense oligonucleotide in vivo. In particular, the antisense oligonucleotide used in the context of the invention may comprise modified nucleotides. Chemical modifications may occur at three different sites: (i) at phosphate groups, (ii) on the sugar moiety, and/or (iii) on the entire backbone structure of the antisense oligonucleotide. For example, the antisense oligonucleotide may be employed as phosphorothioate derivatives (replacement of a non-bridging phosphoryl oxygen atom with a sulfur atom), which have increased resistance to nuclease digestion. 2'-methoxyethyl (MOE) modification (such as the modified backbone commercialized by ISIS Pharmaceuticals) is also effective. Additionally or alternatively, the antisense oligonucleotide of the present invention may comprise completely, partially or in combination, modified nucleotides which are derivatives with substitutions at the 2' position of the sugar, in particular with the following chemical modifications: O-methyl group (2'-0-Me) substitution, 2-methoxyethyl group (2'-0-MOE) substitution, fluoro group (2'- fluoro) substitution, chloro group (2'-Cl) substitution, bromo group (2'-Br) substitution, cyanide group (2'-CN) substitution, trifluoromethyl group (2'-CF3) substitution, OCF3 group (2'-OCF3) substitution, OCN group (2'-OCN) substitution, O-alkyl group (2'-0-alkyl) substitution, S-alkyl group (2'-S-alkyl) substitution, N-alkyl group (2'-N-akyl) substitution, O-alkenyl group (2'-0- alkenyl) substitution, S-alkenyl group (2'-S-alkenyl) substitution, N-alkenyl group (2'-N- alkenyl) substitution, SOCH3 group (2^*-SOCH3) substitution, S02CH3 group (2^*-S02CH3) substitution, ON02 group (2'-ON02) substitution, N02 group (2'-N02) substitution, N3 group (2'-N3) substitution and/or NH2 group (2 -NH2) substitution. Additionally or alternatively, the antisense oligonucleotide of the present invention may comprise completely or partially modified nucleotides wherein the ribose moiety is used to produce locked nucleic acid (LNA), in which a covalent bridge is formed between the 2' oxygen and the 4' carbon of the ribose, fixing it in the 3'-endo configuration. These constructs are extremely stable in biological medium, able to activate RNase H and form tight hybrids with complementary R A and DNA. Accordingly, in a preferred embodiment, the antisense oligonucleotide used in the context of the invention comprises modified nucleotides selected from the group consisting of LNA, 2'- OMe analogs, 2'-phosphorothioate analogs, 2'-fluoro analogs, 2'-Cl analogs, 2'-Br analogs, 2'- CN analogs, 2'-CF3 analogs, 2'-OCF3 analogs, 2'-OCN analogs, 2'-0-alkyl analogs, 2'-S- alkyl analogs, 2 '-N-alkyl analogs, 2 '-O-alkenyl analogs, 2 '-S-alkenyl analogs, 2 '-N-alkenyl analogs, 2'-SOCH3 analogs, 2'-S02CH3 analogs, 2'-ON02 analogs, 2'-N02 analogs, 2'-N3 analogs, 2'-NH2 analogs and combinations thereof. More preferably, the modified nucleotides are selected from the group consisting of LNA, 2'-OMe analogs, 2'-phosphorothioate analogs and 2 '-fluoro analogs.

The antisense oligonucleotide of the invention can be synthesized de novo using any of a number of procedures well known in the art. These chemistries can be performed by a variety of automated nucleic acid synthesizers available in the market. These nucleic acids may be referred to as synthetic nucleic acids. Alternatively, antisense oligonucleotide can be produced on a large scale in plasmids (see Sambrook, et al, 1989). The antisense oligonucleotide can be prepared from existing nucleic acid sequences using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.

In some embodiments, the antisense oligonucleotide of the present invention is modified by substitution at the 3' or the 5' end by a moiety comprising at least three saturated or unsaturated, preferably saturated, linear or branched, preferably linear, hydrocarbon chains comprising from 2 to 30 carbon atoms, preferably from 5 to 20 carbon atoms, more preferably from 10 to 18 carbon atoms as described in WO2014195432.

In some embodiments, the modified antisense oligonucleotide is of the general formula

(I):

wherein:

Oligo represents the antisense oligonucleotide sequence of the present invention oriented 3 '-5' or 5 '-3',

X represents a divalent linker moiety selected from ether -0-, thio -S-, amino -NH-, and methylene -CH₂- ;

Ri and R₂ may be identical or different and represent:

(i) a hydrogen atom,

(ii) a halogen, in particular fluorine atom,

(iii) a hydroxy 1 group,

(iv) an alkyl group comprising from 1 to 12 carbon atoms ;

Mi, M₂ and M₃ may be identical or different and represent:

- a saturated or unsaturated, preferably saturated, linear or branched, preferably linear, hydrocarbon chain comprising from 2 to 30 carbon atoms, preferably from 6 to 22 carbon atoms, more preferably from 12 to 20 carbon atoms, which may be substituted by one or more halogen atoms, notably be fluorinated or perfluorinated and/or be interrupted by one or more groups selected from ether -0-, thio -S-, amino -NH-, oxycarbonyl -O-C(O)-, thiocarbamate - 0-C(S)-NH-, carbonate -0-C(0)-0-, carbamate -0-C(0)-NH-, phosphate -0-P(0)(0)-0- and phosphonate -P-0(0)(0)- groups; and/or be substituted at the terminal carbon atom by an aliphatic or aromatic, notably benzylic or naphtylic ester or ether group;

- an acyl radical with 2 to 30 carbon atoms, preferably with 6 to 22 carbon atoms, more preferably with 12 to 20 carbon atoms, or - an acylglycerol, sphingosine or ceramide group.

In the context of the invention, the term "alkyl" refers to a hydrocarbon chain that may be a linear or branched chain, containing the indicated number of carbon atoms. For example, C1-C12 alkyl indicates that the group may have from 1 to 12 (inclusive) carbon atoms in it. In the context of the invention, the term "acyl" refers to an alkylcarbonyl, cycloalkylcarbonyl, arylcarbonyl, heterocyclylcarbonyl or heteroarylcarbonyl substituent.

Typically, the antisense oligonucleotide sequence "Oligo-" is connected to the divalent linker moiety X via a phosphate moiety -0-P(=0)(0^")-, at its 3' or 5' end, advantageously at its 5' end.

In some embodiments, the antisense modified oligonucleotide is of the general formula

wherein:

X, Ri, R2, Mi, M2 and M3 are as defined above in formula (I),

[3'— 5'] represents, along with the PO3^" residue, the antisense oligonucleotide of the present invention, and

A⁺ represents a cation, preferably H⁺, Na⁺, K⁺ or NH₄ ⁺.

In the formulae (I) and (Γ), the divalent linker moiety is preferably ether -0-.

In the formulae (I) and (Γ), Ri and R2 are preferably hydrogen atoms.

In some embodiments, the antisense modified oligonucleotide is of the formula (Γ'):

wherein A⁺, Mi, M2 and M3 are as defined above in formula (I) and [3'— 5'] represents, along with the PO3^" residue, the antisense oligonucleotide of the present invention.

In the formulae (I), (Γ) and (I"), Mi, M2 and M3 preferably represent a hydrocarbon chain, preferably a linear hydrocarbon chain, comprising from 6 to 22 carbon atoms, preferably from 12 to 20 carbon atoms, more preferably 18 carbon atoms. In some embodiments, the antisense modified oligonucleotide is of the formula (Γ"):

wherein A⁺ is as defined above in formula (I) and [3'— 5'] represents, along with the PO3^" residue, the antisense oligonucleotide of the present invention.

In formula (Γ "), the chains -C18H37 are preferably straight alkyl chains.

In some embodiments, the antisense oligonucleotide of the present invention is modified by substitution at the 3 ' or the 5 ' end by a moiety comprising at least one ketal functional group, wherein the ketal carbon of said ketal functional group bears two saturated or unsaturated, preferably saturated, linear or branched, preferably linear, hydrocarbon chains comprising from 1 to 22 carbon atoms, preferably from 6 to 20 carbon atoms, in particular 10 to 19 carbon atoms, and even more preferably from 12 to 18 carbon atoms as described in WO2014195430.

In some embodiments, the modified antisense oligonucleotide is of the general formula

(I):

(I)

wherein:

Oligo represents the antisense oligonucleotide of the present invention;

X represents a divalent linker moiety selected from ether -0-, thio -S-, amino -NH-, and methylene -CH2-;

Ri and R2 may be identical or different and represent:

(i) a hydrogen atom,

(ii) a halogen atom, in particular fluorine atom,

(iii) a hydroxy 1 group,

(iv) an alkyl group comprising from 1 to 12 carbon atoms ; Li and L2 may be identical or different and represent a saturated or unsaturated, preferably saturated, linear or branched, preferably linear, hydrocarbon chain comprising from 1 to 22 carbon atoms, preferably from 6 to 20 carbon atoms, more preferably from 12 to 18 carbon atoms,

B is an optionally substituted nucleobase, selected from the group consisting of purine nucleobases, pyrimidine nucleobases, and non-natural monocyclic or bicyclic heterocyclic nucleobases wherein each cycle comprises from 4 to 7 atoms.

Typically, the antisense oligonucleotide sequence "Oligo-" is connected to the divalent linker moiety X via a phosphate moiety -0-P(=0)(0^")-, at its 3' or 5' end, advantageously at its 5' end.

In some embodiments, the antisense modified oligonucleotide is of the general formula

wherein:

wherein X, Ri, R2, Li, L2 and B are as defined above in formula (I),

[3'— 5'] represents, along with the PO3^" residue, the antisense oligonucleotide of the present invention, and

A⁺ represents a cation, preferably H⁺, Na⁺, K⁺ or NH₄ ⁺.

In the formulae (I) and (Γ), the divalent linker moiety is preferably ether -0-.

In the formulae (I) and (Γ), Ri and R2 are preferably hydrogen atoms.

In some embodiments, the antisense modified oligonucleotide is of the formula (!"):

wherein A⁺, X, Li, L2 and B are as defined above in formula (I) and [3 '— 5 '] represents, along with the PO3^" residue, the antisense oligonucleotide of the present invention. In the formulae (I), (Γ) and (I"), Li and L2 preferably represent a hydrocarbon chain, preferably a linear hydrocarbon chain, comprising from 6 to 22 carbon atoms, preferably from 8 to 18 carbon atoms, advantageously from 12 to 16 carbon atoms, more advantageously 15 carbon atoms.

In the formulae (I), (Γ) and (I"), B preferably represents a non-substituted nucleobase selected from the group consisting of uracil, thymine, adenine, guanine, cytosine, 6- methoxypurine, 7-methylguanine, xanthine, 5,6-dihydrouracil, 5-methylcytosine, 5- hydroxymethylcytosine and hypoxanthine. Preferably, in the formulae (I), (Γ) and (I"), B represents a non substituted nucleobase selected from the group consisting of uracil, thymine, adenine, cytosine, 6-methoxypurine and hypoxanthine. More preferably, in the formulae (I), (Γ) and (I"), B represents uracil.

In some embodiments, the antisense modified oligonucleotide is of the formula (!" '):

wherein A⁺ is as defined above in formula (I) and [3'— 5'] represents, along with the PO3^" residue, the antisense oligonucleotide of the present invention.

In some embodiments, the antisense oligonucleotide of the present invention is associated with a carrier or vehicle, e.g., liposomes or micelles, although other carriers could be used, as would be appreciated by one skilled in the art. Liposomes are vesicles made of a lipid bilayer having a structure similar to biological membranes. Such carriers are used to facilitate the cellular uptake or targeting of the antisense oligonucleotide, or improve the antisense oligonucleotide's pharmacokinetic or toxicologic properties. For example, the antisense oligonucleotide of the present invention may also be administered encapsulated in liposomes, pharmaceutical compositions wherein the active ingredient is contained either dispersed or variously present in corpuscles consisting of aqueous concentric layers adherent to lipidic layers. The antisense oligonucleotide, depending upon solubility, may be present both in the aqueous layer and in the lipidic layer, or in what is generally termed a liposomic suspension. The hydrophobic layer, generally but not exclusively, comprises phopholipids such as lecithin and sphingomyelin, steroids such as cholesterol, more or less ionic surfactants such as diacetylphosphate, stearylamine, or phosphatidic acid, or other materials of a hydrophobic nature. The diameters of the liposomes generally range from about 15 nm to about 5 microns. The use of liposomes as drug delivery vehicles offers several advantages. Liposomes increase intracellular stability, increase uptake efficiency and improve biological activity. Liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids, which make up the cell membrane. They have an internal aqueous space for entrapping water soluble compounds and range in size from 0.05 to several microns in diameter. Several studies have shown that liposomes can deliver nucleic acids to cells and that the nucleic acids remain biologically active. For example, a liposome delivery vehicle originally designed as a research tool, such as Lipofectin, can deliver intact nucleic acid molecules to cells specific advantages of using liposomes include the following: they are non-toxic and biodegradable in composition; they display long circulation half-lives; and recognition molecules can be readily attached to their surface for targeting to tissues. Finally, cost-effective manufacture of liposome-based pharmaceuticals, either in a liquid suspension or lyophilized product, has demonstrated the viability of this technology as an acceptable drug delivery system.

In some embodiments, the antisense oligonucleotide of the present invention is complexed with a complexing agent to increase cellular uptake of oligonucleotides. An example of a complexing agent includes cationic lipids. Cationic lipids can be used to deliver oligonucleotides to cells. The term "cationic lipid" includes lipids and synthetic lipids having both polar and non-polar domains and which are capable of being positively charged at or around physiological pH and which bind to polyanions, such as nucleic acids, and facilitate the delivery of nucleic acids into cells. In general cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides, or derivatives thereof. Straight-chain and branched alkyl and alkenyl groups of cationic lipids can contain, e.g., from 1 to about 25 carbon atoms. Preferred straight chain or branched alkyl or alkene groups have six or more carbon atoms. Alicyclic groups include cholesterol and other steroid groups. Cationic lipids can be prepared with a variety of counterions (anions) including, e.g., C1-, Br-, I-, F-, acetate, trifluoroacetate, sulfate, nitrite, and nitrate. Examples of cationic lipids include: polyethylenimine, polyamidoamine (PAMAM) starburst dendrimers, Lipofectin (a combination of DOTMA and DOPE), Lipofectase, Lipofectamine, DOPE, Cytofectin (Gilead Sciences, Foster City, Calif), and Eufectins (JBL, San Luis Obispo, Calif). Cationic liposomes may comprise the following: N-[l-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[l-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP), 3p-[N-(N' ,Ν' -dimethylaminoethane)carbamoyl]cholesterol (DC-Choi), 2,3,- dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium

trifluoroacetate (DOSPA), l,2-dimyristyloxypropyl-3-dimethy-l -hydroxy ethyl ammonium bromide; and dimethyldioctadecylammonium bromide (DDAB). The cationic lipid N-(l-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), for example, was found to increase 1000-fold the antisense effect of a phosphorothioate oligonucleotide. (Vlassov et al., 1994, Biochimica et Biophysica Acta 1197:95-108). Oligonucleotides can also be complexed with, e.g., poly(L-lysine) or avidin and lipids may, or may not, be included in this mixture (e.g., steryl-poly(L-lysine). Cationic lipids have been used in the art to deliver oligonucleotides to cells (see, e.g., U.S. Pat. Nos. 5,855,910; 5,851,548; 5,830,430; 5,780,053; 5,767,099; Lewis et al. 1996. Proc. Natl. Acad. Sci. USA 93:3176; Hope et al. 1998. Molecular Membrane Biology 15: 1). Other lipid compositions which can be used to facilitate uptake of the instant oligonucleotides can be used in connection with the claimed methods. In addition to those listed supra, other lipid compositions are also known in the art and include, e.g., those taught in U.S. Pat. No. 4,235,871; U.S. Pat. Nos. 4,501,728; 4,837,028; 4,737,323.

A further object of the present invention relates to a method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the antisense oligonucleotide of the present invention.

As used herein, the term "cancer" has its general meaning in the art and includes, but is not limited to, solid tumors and blood tumors. The term cancer includes diseases of the skin, tissues, organs, bone, cartilage, blood and vessels. The term "cancer" further encompasses both primary and metastatic cancers. Examples of cancers that may be treated by methods and compositions of the invention include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous; adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; and roblastoma, malignant; Sertoli cell carcinoma; Leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.

As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of patient at risk of contracting the disease or suspected to have contracted the disease as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a patient during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a patient during treatment of an illness, e.g., to keep the patient in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).

In some embodiments, the antisense oligonucleotide of the present invention is particularly suitable for the treatment of prostate cancer. In particular, the antisense oligonucleotide of the present invention is suitable for the treatment of castration-and chemo- resistant prostate cancer or therapy-resistant prostate cancer. In particular, the antisense oligonucleotide of the present invention is capable of delaying or preventing the emergence of a resistant hormone-independent phenotype, and is capable of reversing a resistant hormone- independent phenotype. It is thus particularly suitable for use in the treatment of a hormone- independent cancer or of a hormone-dependent cancer in which hormone-independency is expected to occur. The term "castration" in the expression "castration-resistant" or "castration- independency" according to the invention refers to "hormone" and corresponds to "Hormone- resistant" or "hormone -independency". Androgen independency refers to a hormone- independency. Indeed, an androgen-independent prostate cancer (AIPC) is a castration-resistant prostate cancer (CRPC). In some embodiments, the antisense oligonucleotide of the present invention is particularly suitable for the treatment of advanced prostate cancer. The skilled in the art is capable of determining whether a cancer is an "advanced" cancer using well-known classification methods, such as e.g. the grade or the TNM classification. For example, the grade (Gl-4) of the cancer cells may be used. More specifically, cancer cells are "low grade" if they appear similar to normal cells, and "high grade" if they appear poorly differentiated. For example, a G3 or G4 cancers would be classified as advanced cancers. Additionally or alternatively, the TNM classification may be used. In this classification, T(a,is,(0), 1 -4) indicates the size or direct extent of the primary tumor, N(0-3) indicates the degree of spread to regional lymph nodes, and M(0/ 1 ) indicates the presence of metastasis. For example, a T4/N3/M 1 cancer would be classified as an advanced cancer.

In some embodiments, the antisense oligonucleotide of the present invention is particularly suitable for the treatment or prevention of a hormone-independent or chemo- resistant cancer. Since the antisense oligonucleotide of the present invention is capable of restoring sensitivity to chemotherapeutic agents, it is particularly suitable for use in the treatment of advanced cancers or chemotherapy resistant cancers. In some embodiments, the antisense oligonucleotide of the present invention is used as a second line therapy for the treatment of prostate cancer.

As used herein, the term "therapeutically effective amount" as used herein refers to an amount or dose of the antisense oligonucleotide of the present invention that is sufficient to treat cancer. The amount of the antisense oligonucleotide in a given therapeutically effective combination may be different for different individuals and different tumor types, and will be dependent upon the one or more additional agents or treatments included in the combination. The "therapeutically effective amount" is determined using procedures routinely employed by those of skill in the art such that an "improved therapeutic outcome" results. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. The useful dosage to be administered and the particular mode of administration will also vary depending upon the form of the formulation, for example, suspension, emulsion, micelle or liposome, as will be readily apparent to those skilled in the art. When lipids are used to deliver the antisense oligonucleotide, the amount of lipid compound that is administered can vary and generally depends upon the amount of oligonucleotide agent being administered. For example, the weight ratio of lipid compound to oligonucleotide agent is preferably from about 1 : 1 to about 15 :1 , with a weight ratio of about 5: 1 to about 10: 1 being more preferred. Generally, the amount of cationic lipid compound, which is administered, will vary from between about 0.1 milligram (mg) to about 1 gram (g). By way of general guidance, typically between about 0.1 mg and about 20 mg of the particular oligonucleotide agent, and about 1 mg to about 100 mg of the lipid compositions, each per kilogram of patient body weight, is administered, although higher and lower amounts can be used.

In some embodiments, the antisense oligonucleotide of the present invention is used

(simultaneously or sequentially) in combination with at least one chemotherapeutic agent. In some embodiments, the chemotherapeutic agent is an antimitotic agent such as Docetaxel, Vincristine, Paclitaxel (Taxol), Vinorelbine, and Abraxane; an hormonal therapy drug, such drugs being commonly used in the frame of treatment of hormone-sensitive cancers. Hormonal therapy drugs include, e.g., Tamoxifen, Gonadotrophin-releasing hormone (GnRH) agonists and antagonists, androgen receptor (AR) pathways inhibitors? (antagonist), and estrogen receptor (ER) antagonists; an alkylating agent such as Cyclophosphamide, Chlorambucil and Melphalan; an antimetabolite such as Methotrexate, Cytarabine, Fludarabine, 6- Mercaptopurine and 5-Fluorouracil; a topoisomerase inhibitor such as Doxorubicin, Irinotecan, Platinum derivatives, Cisplatin, Carboplatin, Oxaliplatin; or an aromatase inhibitor such as Bicalutamide, Anastrozole, Examestane and Letrozole; a signaling inhibitor such as Imatinib (Gleevec), Gefitinib and Erlotinib.

The antisense oligonucleotide of the present invention is also particularly suitable for sensitizing a tumor cell to radiation. The present invention thus provides methods of treating cancer by increasing the cancer's sensitivity to ionizing radiation, and exposing the cancer to ionizing radiation when the cancer is in the sensitive state. The methods comprise administering a therapeutically effective amount of the antisense oligonucleotide of the present invention. Once the cancer cell has been sensitized to ionizing radiation the cancer is exposed to therapeutic amounts of ionizing radiation.

The antisense oligonucleotide of the present invention is administered to the subject in a biologically compatible form suitable for pharmaceutical administration. Accordingly, a further aspect of the present invention relates to a pharmaceutical composition comprising the antisense oligonucleotide of the present invention. By "biologically compatible form suitable for administration" is meant that the antisense oligonucleotide is administered in a form in which any toxic effects are outweighed by the therapeutic effects of the antisense oligonucleotide. Typically, the antisense oligonucleotide of the present invention is administered systemically to the subject. Systemic absorption refers to the entry of drugs into the blood stream followed by distribution throughout the entire body. Administration routes, which lead to systemic absorption include: intravenous, subcutaneous, intraperitoneal, and intranasal. Each of these administration routes delivers the antisense oligonucleotide to accessible diseased cells. Following subcutaneous administration, the therapeutic agent drains into local lymph nodes and proceeds through the lymphatic network into the circulation. The rate of entry into the circulation has been shown to be a function of molecular weight or size. The use of a liposome or other drug carrier localizes the antisense oligonucleotide at the lymph node. The antisense oligonucleotide can be modified to diffuse into the cell, or the liposome can directly participate in the delivery of either the unmodified or modified oligonucleotide into the cell. The pharmaceutical preparations of the present invention may be prepared and formulated as emulsions. Emulsions are usually heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μιη in diameter. The emulsions of the present invention may contain excipients such as emulsifiers, stabilizers, dyes, fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants may also be present in emulsions as needed. These excipients may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Examples of naturally occurring emulsifiers that may be used in emulsion formulations of the present invention include lanolin, beeswax, phosphatides, lecithin and acacia. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. Examples of finely divided solids that may be used as emulsifiers include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate. Examples of preservatives that may be included in the emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Examples of antioxidants that may be included in the emulsion formulations include free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin. In some embodiments, the compositions of oligonucleotides are formulated as microemulsions. A microemulsion is a system of water, oil and amphiphile, which is a single optically isotropic and thermodynamically stable liquid solution. Typically microemulsions are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a 4th component, generally an intermediate chain-length alcohol to form a transparent system. Surfactants that may be used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DA0750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil. Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both oil/water and water/oil) have been proposed to enhance the oral bioavailability of drugs. Microemulsions offer improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11 : 1385; Ho et al., J. Pharm. Sci., 1996, 85:138-143).

The invention will be further illustrated by the following figures and examples.

However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1: Menin was overexpressed in prostate cancer and in castration-resistant (CR) prostate cancer and increased risk of recurrence, (a) Representative microscopic fields of Menin immunostaining in prostate benign hyperplasia (BPH) and prostate cancer (PC). The arrows P represent the presence of immunoreactivity and the arrows N represent the absence of immunoreactivity. (b) Menin expression mean of BHP (SE): 0.071) and prostate cancer patients (SE: 0.049). (c) Means of expression of Menin in benign prostate cancers BHP (SE: 0.059), and non-metastatic cancers (SE: 0.058), metastatic (SE: 0.071) and resistant to castration (SE: 0.068). (d) Kaplan-Meier curve showing the overexpression of Menin increased risk of recurrence.

Figure 2: Menin silencing inhibits prostate cancer cells growth in vitro, (a) PC-3 cells were treated with 100 nmol/1 of differents ASOs or control-ASO (scr) and 2 days after second transfection proteins were extracted and analyzed by western blot, (b) PC-3 cells were treated with indicated concentrations of ASOs or control-ASO and 2 days after second transfection proteins were extracted and analyzed by western blot.

Figure 3: Menin silencing inhibits prostate cancer cells growth and enhances chemotherapy in vitro. PC-3 cell viability was determined using alamar blue. Menin inhibition with ASO lOOnM/1 decreases PC-3 cell survival after 24 hours tratement with docetaxel lOOnM/1. Error bars represent the SE,***p<0.001 by statview software.

Figure 4: Menin silencing induces apoptosis in prostate cancer cells in vitro, (a) Flow cytometry was used to quantify the percentage of PC-3 cells in each cell cycle phase, cells were transfected with lOOnmol ASO or scr (ASO-control) for 2 days after second transfection. The plot represents the mean of sub G0-G1 fractions from three independent flow samples. The results are expressed in percentages, PC-3 cells no transfected with ASO representing 100%.**difference was found between the phase sub G0-G1 fractions PC-3 no treated and PC-3 treated with ASO. (b) Inhibition of Menin enhances cell apoptosis. Cells were transfected with lOOnmol ASO or scr for2 days after second transfection.

EXAMPLE:

Material and methods

Proteomics analysis. Proteomic analysis was performed on cells of prostate cancer hormone-sensitive (LNCaP) stably transfected with an empty control lentivirus (LNCaP-Mock) or containing Hsp27 (Hsp27-LNCaP). We have used the technique of liquid chromatography coupled to mass spectrometry (Waters® the system, "Protein Expression").

This system gives the exact mass of peptide and information retention times, which allows to give a unique signature for each peptide contained in a protein. Through the use of deconvolution algorithms and developed on the alignment Waters® system, it was possible to identify proteins by peptide fragments thereof and to measure their expression in two samples LNCaP-Mock and LNCaP-Hsp27.

KEGG PATHWAYS DATABASE. The set of proteins whose expression was identified as being regulated by Hsp27 by proteomics was analyzed by bioinformatics.

To understand the involvement of Hsp27 in some processes and biological functions, we submitted all the proteins identified in both LNCaP-Mock and LNCaP-Hsp27 models to KEGG pathways database (Kyoto Encyclopedia of Genes and Genomes). This database represents the various metabolic and biochemical pathways in biological systems described in the literature. We conducted a mapping of these proteins against several metabolic pathways chosen according to the aims of this study. The different steps of this analysis are performed using the R package "Path View" (http://bioinformatics.oxfordjournals.org/ content / 29/14 / 1830. full). This package contains a set of tools for the integration and visualization of biological data including signaling pathways retrieved from the KEGG pathway database. Thus, using a list of protein and an identifier of a KEGG pathway signaling (eg hsa05215 cancer pathway of human prostate), we determined whether one or several proteins of this list were involved in this pathway biological reactions.

Cell lines and cell culture conditions. The AI prostate cancer cell line PC-3 was purchased from the American Type Culture Collection (Rockville, MD) and maintained in Dulbecco's Modified Eagle's Medium (Invitrogen, Cergy Pontoise, France), supplemented with 10% fetal calf serum (FCS). The human CS prostate cancer cell line LNCaP cells were kindly provided by the University of Virginia (Charlottesville, VA), this cells were maintained in RPMI 1640 (Invitrogen) supplemented with 10% FCS.

Lentiviral infection of Hsp27 into LNCaP cells. The full-length cDNA for human Hsp27 was subcloned into the lentiviral vector PhR -CMV-EGFP at the BamHI and Xhol sites and stably transfected to LNCaP as described before by Rocchi et al. ( Rocchi P, Beraldi, E, Ettinger, S, Fazli, L, Vessella, RL, Nelson, C et al. Increased Hsp27 after androgen ablation facilitates androgen-independent progression in prostate cancer via signal transducers and activators of transcription 3-mediated suppression of apoptosis [Journal] // Cancer Res. - 2005. - pp. 65: 11083-11093.)

Western blot analysis. Western blot analysis was performed as described previously with 1 :5000 rabbit anti-Hsp27 polyclonal antibody (Enzo Life Science, Villeurbanne, France), 1 :500 anti-MENIN mouse monoclonal antibody (Santa Cruz Biotechnology, CA, USA), 1 :500 mouse anti-ubiquitin monoclonal antibody (Santa Cruz Biotechnology, Heidelberg, Germany). Loading levels were normalized using 1 :2000 mouse anti-vinculin monoclonal antibodies (Sigma Chemical, St Louis, MO).

Immunoprecipitation. Cleared lysates (1000μg) with adjusted protein concentration (Protein assay; Bio-Rad, Marnes-la-Coquette, France) were used for immunoprecipitation with 2.5μ1 anti-MENIN mouse monoclonal antibody (SANTA CRUZ) O/N at 4°C. Immune complexes were precipitated after 1 hour incubation with 30μ1 of TrueBlot anti-mouse Immunoglobulin beads (eBiosciences, Paris, France). The complexes were resuspended in protein sample buffer (Bio-Rad) and boiled for 5 minutes before western blot as described before. We used the rabbit or mouse True Blot anti-rabbit IgG secondary antibody (eBiosciences) to reveal the western blot.

TMA construction. Menin expression was assessed in two different TMA. The first

TMA was obtained from the Tissue Bank of Vancouver Prostate Centre. This TMA includes BPH (N=29) and PC Gleason grade 3 (G3), PC Gleason grade 4 (G4), and PC Gleason grade 5 (N=139) TMA was made with duplicate cores per patient with a total of 186 cores.

The second TMA includes BPH (n = 69), nonmetastatic cancer (N=96) metastatic cancer (N=60) and metastatic cancer castration resistant (CRPC) (N=96) with total of 321 cores this TMA was made with with a total of 321 cores.

TMA and image analysis. The TMA was analyzed as described previously (Charpin) (Charpin C, Secq, V, Giusiano, S, Carpentier, S, Andrac, L, Lavaut, signature predictive of disease outcome in breast carcinomas, identified by quantitative immunocytochemical assays [Journal] // Int J Cancer. - 2009. - Vol. 124. - pp. 2124-2134.) with 1 : 100 anti-Menin antibody (Santa Cruz).

ASOs sequences. Menin ASO sequences were manufactured by Pr. Philippe Barthelemy (ChemBioMed, Inserm U869, Bordeaux).

Treatment of cells with ASO. Cells were plated at a density of 80% and treated after 1 day with indicated ASO for 1 or 2 days, respectively. Oligofectamine, a cationic lipid (Invitrogen, Life Technologies, Burlington, ON, Canada), was used to increase ASO uptake into the cells. Cells were treated with indicated ASO concentrations after a preincubation for 20 min with 3 mg/ml oligofectamine in serum-free OPTI-MEM (Life Technologies, Inc.). After 4 h, the medium was replaced with standard culture medium described above.

Test of Cell viability Analysis with 3- (4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT), 3 days after transfection , 100 μΐ of MTT were added to the culture medium. This forms a precipitate in the mitochondria purple. The amount of precipitate formed is proportional to the quantity of living cells. So just after incubation of the cells with MTT, for 4 hours at 37 ° C, to dissolve the cells, their mitochondria and therefore precipitates violet formazan in 100 μΐ / well DMSO. A simple determination of optical density at 550 nm spectroscopy allows to determine the relative amount of living cells and metabolically active.

Flow cytometric analysis. Flow cytometry of propidium iodide-stained nuclei was performed as described previously. In brief, PC-3 cells were plated at the density of 106 cells into 10 cm dishes. Cells were treated the day after seeding 100 nmol/1 of Menin- or control- ASO. CellS and analyzed after 24 hours for relative DNA content on a dual laser flow cytometer (FACSCalibur; Becton Dickinson Biosciences, Le Pont de Claix, France). Each assay was performed in triplicate.

Chemotherapeutic agents. Docetaxel was obtained from Sanofi-aventis (Paris, France).

Statistical analysis. All the results were expressed as mean ± SE. Statistical analysis was performed using one-way analysis of variance followed by Fisher's protected least significant difference test (Statview 512; Brain Power, Calabasas, CA). *P < 0.05 was considered significant, with **P < 0.01 and ***P < 0.001.

Results

Menin, a new partner protein of Hsp27

To identify new Hsp27 partners specific to CRPC we have analysed proteomic data. We have found 1157 proteins from CS LNCaP stably transfected with Hsp27 (LNCaP-Hsp27) and 1418 proteins from CS LNCaP stably transfected with empty vector (LNCap-Mock) cell lines and 818 common proteins (data not shown). After submission of these data on the basis of KEGG pathways we highlighted the mechanisms by which Hsp27 controls several metabolics pathways which include apoptosis. After analysis more than 9 pathways for example (Apoptosis, VEGF, Ras, Metabolism, VEGFR2, MAPK, P53, AKT1, cell cycle and dysregulation of transcription in cancer), we are interested to the signalling pathway of dysregulation of transcription in cancer.

First, we are particularly interested in proteins only present in LNCaP-Hsp27 cells and for which no expression was identified in LNCaP Mock. Secondly, we are focused to a new potential therapeutic target which very little was known about their involvement in oncology. Our attention was drawn to the way of transcription dysregulation of signaling in cancer (data not shown).

However notwithstanding the overexpression of the protein (C/EBP) Enhancer binding protein in LNCaP-Hsp27 cells has not been selected due to its expression also in LNCaP-Mock cells. The FMS-like tyrosine kinase 1 (FLT1) also called growth factor receptor endothelium vasculairel (VEGFR1) was not selected because it does not represent an innovative target because of the many previous work. Indeed, its role in prostate cancer is well described and is the subject of 391 publications. Our attention is particularly focused on Menin. The expression levels of Menin were then determined on LNCaP-Mock and LNCaP-Hsp27 cell lines using western blot. We have found expression of Menin increase in LNCaP-Hsp27compared with LNCaP-Mock (data not shown). To further confirm and define the role of Hsp27 interaction with Menin, we examined whether Hsp27 colocalizes and interacts with

menin using immunofluorescence and co-immunoprecipitation. Confocal microscopy shows that Menin and Hsp27 colocalize in the cytoplasm of LNCaP-Mock, LNCaPHsp27 and PC- 3cells, and the intensity of Menin staining and colocalization with Hsp27 was higher in LNCaP- Hsp27 and PC-3 relative to LNCaP-Mock cells (data not shown). Using co- immunoprecipitation technique we have demonstrated an interaction between Hsp27 and these proteins (data not shown).

Menin expression is elevated in human prostate cancer

We then looked at their expression in human prostate cancer tissue samples and found that Menin was over-expressed in prostate cancer comparing to benign prostate tissue. We then looked at the expression of Menin in human samples using two different TMAs. The results of TMA showed that Menin is more expressed in prostate cancers compared to BHP and is thus more expressed in prostate cancer resistant to castration. This confirms that the expression of Menin is associated with disease progression. We also demonstrated with Kaplan-Meier analysis that the Menin rate increases the risk of recurrence and reduces the duration of survival without recurrence (figure 1).

Interaction protects Menin from the ubiquitin-proteasome degradation

To further confirm and define the role of Hsp27 interaction with Menin we examined whether Hsp27 interacts with Menin using co-immunoprecipitation. We then confirmed the interaction between Hsp27 and Menin. To determine whether Hsp27 also regulates Menin, we used LNCaP (LNCaP-Hsp27) cells. We found that Menin levels increased in LNCaP-Hsp27 cells compared with LNCaP-Mock. LNCaP-Mock and LNCaP-Hsp27 stained with mouse monoclonal Menin.

Menin antisense oligonucleotide 22 (AS022) treatment inhibits Menin's expression at ΙΟΟηΜ on CR PC-3 cells

We have tested five ASOs Menine synthesized by Philippe Barthelemy (ASO 19, AS022, AS023, AS034 and AS037) at a concentration of 100 nM in PC3 cell lines. The results show that a total inhibition with AS022, with an average inhibition AS037 and a lack of inhibition for ASO 19, AS023 and AS034 (Figure 2a).

Menin knockdown inhibits PC cell growth and enhances chemotherapy in vitro

To determine whether Menin inhibition affects PC progression in vitro, ASO induced inhibition of Menin was determined in AI PC-3 cells by western blot analysis.

Significant inhibition of Menin protein levels (***P<0.001) was observed after Menin- ASO treatment. To assess the effect of TCTP downregulation on AI cell growth, PC-3 cells were treated with Menin-ASO and incubated with docetaxel. show a 58.61% reduction in PC- 3 cell growth after Menin-ASO treatment compared with respective controls (***P . 0.001). Furthermore, Menin downregulation using ASO treatment can enhance docetaxel sensitivity by up tol3% (***P < 0.001) (Figure 3).

Menin-ASO silencing induces apoptosis in CR cells in vitro

Induction of apoptosis Menin-ASO was demonstrated by flow cytometry. The fraction of PC-3 cells undergoing apoptosis (sub G0-G1 fraction) was 411.92% compared with controls (***P < 0.001).A 156.57% increase (***P < 0.001) of apoptotic PC-3 treated with Menin-ASO was founed compared of control (Figure 6a). Annexin V was adopted to detect apoptosis, inhibition of Menin increase apopotosis apoptotic PC-3 treated with Menin-ASO was 256.75%.

REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. Badrising, S., van der Noort, V., van Oort, I. M., van den Berg, H. P., Los, M., Hamberg, P., Coenen, J. L., van den Eertwegh, A. J., de Jong, I. J., Kerver, E. D., van Tinteren, H., and Bergman, A. M. Clinical activity and tolerability of enzalutamide (MDV3100) in patients with metastatic, castration-resistant prostate cancer who progress after docetaxel and abiraterone treatment. Cancer, 120: 968-975, 2014.

Malik R, Khan AP, Asangani IA, Cieslik M, Prensner JR, Wang X, Iyer MK, Jiang X, Borkin D, Escara-Wilke J, Stender R, Wu YM, Niknafs YS, Jing X, Qiao Y, Palanisamy N, Kunju LP, Krishnamurthy PM, Yocum AK, Mellacheruvu D, Nesvizhskii AI, Cao X, Dhanasekaran SM, Feng FY, Grembecka J, Cierpicki T, Chinnaiyan AM. Targeting the MLL complex in castration-resistant prostate cancer. Nat Med. 2015 Apr;21(4):344-52

Resnick, M. J. Prostate cancer: Optimizing prostate cancer survivorship care. Nat Rev Urol, 12: 366-367, 2015.

Claims

CLAIMS:

1. An antisense oligonucleotide effective to reduce the expression of Menin in cancer cells of a subject wherein antisense oligonucleotide targets

- the region consisting of nucleotides 531-550 of SEQ ID NO: l

- the region consisting of nucleotides 21 1-230 of SEQ ID NO: 1

- the region consisting of nucleotides 231-250 of SEQ ID NO: 1

- the region consisting of nucleotides 251-270 of SEQ ID NO: 1

- the region consisting of nucleotides 271-290 of SEQ ID NO: l

- the region consisting of nucleotides 331-350 of SEQ ID NO: 1

- the region consisting of nucleotides 351-370 of SEQ ID NO: 1

- region consisting of nucleotides 41 1-430 of SEQ ID NO: l

- the region consisting of nucleotides 431-450 of SEQ ID NO: 1

- the region consisting of nucleotides 451-470 of SEQ ID NO: 1

- the region consisting of nucleotides 511-530 of SEQ ID NO: 1

- the region consisting of nucleotides 631 -650 of SEQ ID NO: 1

- the region consisting of nucleotides 651-670 of SEQ ID NO: 1

- the region consisting of nucleotides 791-810 of SEQ ID NO: 1

- the region consisting of nucleotides 811-830 of SEQ ID NO: l

- the region consisting of nucleotides 871-890 of SEQ ID NO: l

- the region consisting of nucleotides 891-910 of SEQ ID NO: 1

- the region consisting of nucleotides 911-930 of SEQ ID NO: 1

- the region consisting of nucleotides 931 -950 of SEQ ID NO: 1 - the region consisting of nucleotides 951-970 of SEQ ID NO: 1

- the region consisting of nucleotides 1011-1030 of SEQ ID NO: 1

- the region consisting of nucleotides 1031-1050 of SEQ ID NO: 1

- the region consisting of nucleotides 1051-1070 of SEQ ID NO : 1 - the region consisting of nucleotides 1071-1090 of SEQ ID NO: 1

- the region consisting of nucleotides 1091-1110 of SEQ ID NO : 1

- the region consisting of nucleotides 1151-1170 of SEQ ID NO : 1

- the region consisting of nucleotides 1191-1210 of SEQ ID NO : 1

- the region consisting of nucleotides 1351-1370 of SEQ ID NO: 1 - the region consisting of nucleotides 1371-1390 of SEQ ID NO: l the region consisting of nucleotides 1411-1430 of SEQ ID NO: 1

- the region consisting of nucleotides 1431-1450 of SEQ ID NO: 1

- the region consisting of nucleotides 1471 - 1490 of SEQ ID NO : 1

- the region consisting of nucleotides 1771-1790 of SEQ ID NO : 1 - the region consisting of nucleotides 1811-1830 of SEQ ID NO: l

- the region consisting of nucleotides 1831-1850 of SEQ ID NO: l

- the region consisting of nucleotides 1851-1870 of SEQ ID NO: l

- the region consisting of nucleotides 1871-1890 of SEQ ID NO: l

- the region consisting of nucleotides 1891 - 1910 of SEQ ID NO : 1 - the region consisting of nucleotides 1911-1930 of SEQ ID NO: 1

2. The antisense oligonucleotide of claim 1 which comprises a sequence consisting of SEQ ID NO:13, SEQ ID NO:2 SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID N0:9, SEQ ID NO: 10, SEQ ID NO: l 1, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43 and SEQ ID NO:44.

3. A method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the antisense oligonucleotide of claim 1.

4. The method of claim 3 wherein the subject suffers from a prostate cancer.

5. The method of claim 3 wherein the subject suffers from a castration-and chemo-resistant prostate cancer or therapy-resistant prostate cancer.

6. The method of claim 3 wherein the subject suffers from an advanced prostate cancer.

7. A pharmaceutical composition which comprises the antisense oligonucleotide of claim 1.