WO2017134115A1 - Method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma - Google Patents
Method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma Download PDFInfo
- Publication number
- WO2017134115A1 WO2017134115A1 PCT/EP2017/052168 EP2017052168W WO2017134115A1 WO 2017134115 A1 WO2017134115 A1 WO 2017134115A1 EP 2017052168 W EP2017052168 W EP 2017052168W WO 2017134115 A1 WO2017134115 A1 WO 2017134115A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mtc
- mir
- vandetanib
- sec23a
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- the present invention concerns a method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma (MTC).
- MTC medullary thyroid carcinoma
- the present invention also concerns an inhibitor of the SEC23A gene expression for use in the treatment of MTC, preferably in combination with vandetanib.
- Thyroid carcinomas are the most common cancer of the endocrine system. Among these tumors, medullary thyroid carcinoma is a rare calcitonin-producing tumor, which arises from thyroid gland parafollicular C cells and accounts for 3-8% of all thyroid carcinomas. Most cases of MTC are sporadic (SMTC), whereas the remaining cases are due to hereditary forms (HMTC) caused by germline activating mutations of the RET (Rearranged During Transfection) proto-oncogene. Somatic RETgene mutations can also be found in 40-50% of SMTC.
- SMTC sporadic
- HMTC hereditary forms
- Somatic RETgene mutations can also be found in 40-50% of SMTC.
- MCT are aggressive tumors, for which lymph node metastases are found in 55% of
- MTC patients at diagnosis are MTC patients at diagnosis.
- surgery is the treatment of choice for MTC, consisting in total thyroidectomy and lymph node dissection.
- 50% of patients with MTC relapse are 50% of patients with MTC relapse.
- Vandetanib has been recently approved for the treatment of patients with recurrent or metastatic unresectable MTC.
- the aim of the present invention is to provide a method for determining the responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma.
- Another aim of the invention is to provide an improved treatment of medullary thyroid carcinoma, in particular of advanced medullary thyroid carcinoma.
- MicroRNAs are a class of endogenously expressed small non-protein- coding RNAs that can post-transcriptionally modulate the expression of hundreds of genes by inhibiting the translation or promoting the degradation of targeted RNAs, thereby controlling a wide range of biological functions such as development, cellular proliferation, cellular differentiation, cell death and affecting major biological domains such as sternness, immunity and cancer.
- miRNAs can function as tumor suppressors or oncogenes, and alteration in their expression plays a critical role in tumorigenesis.
- Vandetanib (ZD6474, trade name CAPRELSA ® ) is a tyrosine kinase inhibitor that selectively targets vascular endothelial growth factor receptor-2, epidermal growth factor receptor and the RET proto-oncogene.
- the MAPK Ras/Mek1 -2/p44-42
- PI3K/AKT pathways have been described to be the two major signaling pathways inhibited by vandetanib.
- the invention arises from the unexpected finding by the inventors that the over- expression of miR-375 and/or the down-regulation of the SEC23A gene is(are) associated with a decrease in the cancer cells proliferation and with an increase in the response to vandetanib.
- the inventors surprisingly found that in MTC cells the miRNA-375 is over- expressed and that this over-expression is responsible for the down-regulation of the SEC23A gene which plays a role in the response to vandetanib.
- the inventors also find that the expression of miRNA-375 decreases cell proliferation by both a reduction in the S/G2 phases of the cell cycle together with an increase of cells blocked in the G1 phase.
- miRNA-375 over-expression and/or SEC23A down-regulation potentiate the therapeutic effect of vandetanib in MTC cells.
- vandetanib and miRNA-375 have a synergistic effect on the inhibition of the expression of the SEC23A gene.
- vandetanib and miRNA-375 have a synergistic effect on the treatment of MTC.
- beneficial effect it may be meant that the effect of vandetanib with miRNA-375 is superior to the effect of vandetanib alone added to the effect of miRNA-375 alone, on the inhibition of the expression of the SEC23A gene and/or on the treatment of MTC.
- vandetanib and miRNA-375 have an additive effect on the inhibition of the expression of the SEC23A gene and/or on the treatment of MTC.
- additive effect it may be meant that the effect of vandetanib with miRNA-375 corresponds (ie. is about equal or equal) to the effect of vandetanib alone added to the effect of mi-RNA375 alone, on the inhibition of the expression of the SEC23A gene and/or on the treatment of MTC.
- the invention relates to a method for determining responsiveness to vandetanib in a patient suffering from MTC comprising a step of detecting the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells of said patient.
- the invention also relates to an inhibitor of the SEC23A gene expression for use in the treatment of MTC, in combination with vandetanib.
- the invention also relates to a method of treatment of a patient suffering from MTC comprising the administration to said patient of a therapeutically effective amount of an inhibitor of the SEC23A gene expression, preferably in combination with vandetanib.
- the term "patient” or “individual” to be treated is preferably intended for a human or non-human mammal (such as a rodent, for example a mouse or a rat, a feline, a canine, or a primate) affected or likely to be affected with MTC.
- a human or non-human mammal such as a rodent, for example a mouse or a rat, a feline, a canine, or a primate
- the patient is a human.
- treating means reversing, alleviating, inhibiting the progress of the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
- the treatment of MTC may consist in destroying and/or depleting MTC cells and/or preventing resistance to vandetanib of MTC cells. Most preferably, such treatment leads to the complete depletion of MTC cells. In particular, the depletion of the MCT cells is obtained by inducing an arrest of the cellular cycle of said cells.
- the expression "cellular cycle” relates to the series of events that take place in a cell leading to its division and duplication (replication). As it is well known, the cycle is divided in four successive phases G1 , S, G2 and M.
- the expression “an arrest of the cellular cycle” means that this cycle is totally stopped in either one of the phases, preferably G1 . Such an arrest leads to cellular death.
- responsiveness to vandetanib or “responsive to vandetanib” is meant that vandetanib has a therapeutic effect, i.e. vandetanib is responsible for the diminution of the MTC and/or the inhibition of the growth of the MTC. More particularly, vandetanib may be responsible for a decrease of the MTC cells and/or a decrease in MTC cells proliferation in the patient, preferably when administered at therapeutic doses.
- responsiveness to vandetanib” or “responsive to vandetanib” means that vandetanib reduces tumor cell-induced angiogenesis and/or tumor vessel permeability and/or inhibits tumor growth and/or metastasis, preferably when administered at therapeutic doses.
- non-responsive to vandetanib is meant that vandetanib has no or a not therapeutic effect on the MTC as defined above, preferably when administered at pharmaceutical doses to the patient.
- the MTC is refractory to vandetanib.
- the patient is resistant to vandetanib.
- the "percentage of identity” is calculated using a global alignment (i.e. the two sequences are compared over their entire length). Methods for comparing the identity of two or more sequences are well known in the art.
- the « needle » program which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970 J. Mol. Biol. 48:443-453) to find the optimum alignment (including gaps) of two sequences when considering their entire length, may for example be used.
- the needle program is for example available on the ebi.ac.uk World Wide Web site.
- the percentage of identity in accordance with the invention is preferably calculated, when referring to amino acid sequences, using the EMBOSS: needle (global) program with a "Gap Open” parameter equal to 10.0, a "Gap Extend” parameter equal to 0.5, and a BLOSUM62 matrix, or, when referring to nucleic acid sequences, using the EMBOSS: needle (global) program with a "Gap Open” parameter equal to 10.0, a "Gap Extend” parameter equal to 0.5, and a DNAFULL matrix.
- microRNA-375 is used to qualify a micro ribonucleic acid having at least 80%, preferably 90%, percentage of identity with the following sequence:
- SEQ ID n° 1 UUUGUUCGUUCGGCUCGCGUGA.
- miRNA-375 is hsa miRNA-375. In one embodiment, mi-RNA-
- SEQ ID n°1 is typically represented by SEQ ID n°1 , which is also described on the website http://www.mirbase.org/, with the accession number MI0000783 on January 21 , 2016.
- miRNA-375 notably encompasses all the various allelic or polymorphic variants of miRNA-375. More particularly, the variants of the miRNA-375 can be represented by mi-RNAs wherein at the 3' end, at least one base, preferably one or two bases such as A, U or G, is missing. For example, the variants of the miRNA-375 may have the following sequences:
- the variant of miRNA-375 is typically represented by SEQ ID n°2 or SEQ ID n°12 (also identified as RS 751522848).
- a "precursor" of the miRNA-375 according to the invention refers to any intermediate in the mi-RNA maturation pathway starting from the transcript obtained from the transcription of a chromosome and ending with the obtaining of a mi-RNA.
- a precursor according to the invention can be a mi-RNA primary transcripts (pri-miRNA) or a pre-miRNA, as well as a long non-coding RNA, a snoRNA or a transposon which encodes a mi-RNA before processing via the enzyme Dicer.
- the precursor of the miRNA-375 is a ribonucleic acid having at least 80%, preferably 90%, percentage of identity with the following sequence:
- the precursor of the miRNA-375 is typically represented by SEQ ID n°7.
- SEC23A gene is used to qualify a desoxyribonucleic acid having at least 80%, preferably 90%, percentage of identity with the SEQ ID n°8.
- the SEC23A gene is typically represented by SEQ ID n° 8.
- GenBAnk on the website http://www.ncbi.nlm.nih.gov/genbank/, with accession number NM006364 or at http://www.ncbi.nlm.nih.gov/nuccore/NM_006364, on January 21 , 2016.
- the protein encoded by this gene is the transport protein SEC23A which is a member of the SEC23 subfamily of the SEC23/SEC24 family.
- the protein encoded by the SEC23A gene is suggested to play a role in the ER-Golgi protein trafficking.
- the naturally occurring human SEC23A protein has an aminoacid sequence as shown in GenBank on the website http://www.ncbi.nlm.nih.gov/genbank/, with the protein accession number NP006355 or at http://www.ncbi.nlm.nih.gov/protein/NP_006355 on January 21 , 2016.
- the sequence of the protein SEC23A is typically represented by SEQ ID n°9.
- the RET (Rearranged During Transfection) proto-oncogene encodes a receptor tyrosine kinase for members of the glial cell line-derived neurotrophic factor (GDNF) family of extracellular signalling molecules.
- GDNF glial cell line-derived neurotrophic factor
- mutations of the RET gene in MTC it can be cited the mutations localized on exon 15 codon 891 ; exon 13 codon 790; exon 10 codon 61 1 ; exon 10 codon 618; exon 14 codon 804 and exon 1 1 codon 618.
- the RET mutation can be germinal or somatic.
- a gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA) or a protein produced by translation of a mRNA.
- Gene products also include messenger RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins (e.g., the SEC23A protein) modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, SUMOylation, ADP-ribosylation, myristilation, and glycosylation.
- proteins e.g., the SEC23A protein modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, SUMOylation, ADP-ribosylation, myristilation, and glycosylation.
- level of the SEC23A gene expression is meant the level of protein SEC23A.
- an “inhibitor of expression” refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of a gene. Consequently an “inhibitor of the SEC23A expression” refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of the SEC23A gene.
- the method according to the invention is an in vitro method.
- the level of expression of the miRNA-375 in the cells can be measured by any techniques known by the person skilled in the art. Numerous methods are available which allow quantifying a target RNA, for example, methods based on PCR after reverse transcription (RT-PCR) using oligonucleotides which are specific of the target RNA sequences, or alternatively, methods allowing the hybridization of the target RNA, of duplicates or triplicates of the target RNA with probes under stringent conditions.
- RT-PCR PCR after reverse transcription
- the probes according to the invention are preferably laid down on microarrays.
- hybridization under stringent conditions indicates that the target RNA or the duplicates thereof can specifically bind pairwise, essentially by forming Watson-Crick-type pairs (e.g. G-C pairs or U-A pairs), with probes having sequences complementary thereto.
- Adequate stringent conditions according to the invention can be easily determined by one of skill in the art.
- Preferred stringent conditions according to the invention comprise a hybridization step of 10 to 20 hours, preferably 16 hours, at about 40 to 55°C, preferably 50°C, under an ionic strength equivalent to that provided by 500 mM to 2 M NaCI, preferably 1 M NaCI.
- Additional compounds well known to one skilled in the art can also be added such as pH buffers (e.g. Tris or MES), EDTA, Tween, Bovine Serum Albumin, and herring sperm DNA.
- the level of the SEC23A gene expression may be determined by determining the level of transport protein SEC23A encoded by said gene.
- the level of protein can be measured by any techniques known by the person skilled in the art such as immunoprecipitation, Immunoelectrophoresis, in particular western blot, enzyme-linked immunosorbent assay or by immunohistochemistry.
- Protein extracts may be run as described in Brest et al. 201 1 Endocr Relat Cancer.
- rabbit anti-SEC23 antibody rabbit anti-PARP antibody, rabbit anti-phospho-AKT, rabbit anti-AKT, rabbit anti-phospho-p44/42 MAPK (ERK1 /2) (Thr202/Tyr204), rabbit anti-p44/42 MAPK (ERK1/2), may be used with mouse anti-tubulin and/or mouse anti-actin antibodies as loading controls.
- Antibodies may be detected with a HRP (horseradish peroxidase) conjugated anti-mouse or anti-rabbit antibody using chemioluminescence.
- HRP horseradish peroxidase
- the level of the RNA encoded by the SEC23A gene may be determined by the same methods as described for determining the level of expression of the miRNA-375, in particular by RT-PCR.
- the method as defined above comprises the following steps: i) measuring the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells;
- the “reference value” according to the invention can be a unique value such as a given level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene, alternatively, it can an average between levels of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene.
- the reference value is the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in at least one non-cancer cell.
- the non-cancer cell is a hyperplasic cell preferably a hyperplasic thyroid gland parafollicular C cell.
- the non- cancer cell is a Nthy ORI 3.1 cell.
- the non-cancer cell is a non- cancer thyroid gland parafollicular C cell, preferably a non-cancer thyroid gland parafollicular C cell of the patient for which the responsiveness to vandetanib is to be determined.
- the reference value is the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in at least one cancer cell such as a TT cell (medullary carcinoma). In one embodiment, the reference value as defined above is determined before administration of vandetanib.
- an increase in the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the reference value is indicative of the responsiveness to vandetanib of said patient.
- the increase in the level of expression of the miRNA-375 and/or precursors thereof in MTC cells is statistically significant.
- the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the reference value is increased of at least 10 fold, preferably from 10 to 80 fold, for example 60 fold.
- the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the level of expression of the miRNA-375 and/or precursors thereof in non-cancer cells is increased of at least 20 fold, preferably from 20 to 80 fold, for example 60 fold.
- the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the level of expression of the miRNA-375 and/or precursors thereof in hyperplasic thyroid gland parafollicular C cells is increased of at least 10 fold, preferably from 10 to 80 fold, for example 30 fold.
- a decrease in the level of expression of the SEC23A gene typically represented by a decrease in the level of the SEC23A protein in MTC cells compared to the reference value is indicative of the responsiveness to vandetanib of said patient.
- the decrease in the level of expression of the SEC23A gene in MTC cells is statistically significant.
- the method of the invention may further comprise monitoring the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene over a period of time in MTC cells from a patient treated with vandetanib.
- the monitoring is performed at consecutive times during the course of the treatment with vandetanib in order to establish a therapeutic follow-up of the patient.
- the follow-up is typically performed by determining the level of expression of the miRNA- 375 and/or precursors thereof and/or of the SEC23A gene according to the invention, at various time intervals, for instance every 2 weeks, 1 month, 2 months, 3 months, 5 months, etc.
- the reference value according to the invention can also be, in addition to the previous definitions of the term, a previous level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells from the same patient.
- the therapeutic follow-up according to the invention is started at the same time or upon onset of the treatment of the patient with vandetanib.
- a decrease in the level of expression of the miRNA-375 and/or precursors thereof during the therapeutic follow-up is indicative of a decrease of the responsiveness to vandetanib thereby indicating that the MTC becomes resistant to vandetanib.
- an increase in the level of expression of the SEC23A gene during the therapeutic follow-up is indicative of a decrease of the responsiveness to vandetanib thereby indicating that the MTC becomes resistant to vandetanib.
- the invention also relates to an inhibitor of the SEC23A gene expression for use in the treatment of MTC, preferably in combination with vandetanib.
- the invention also relates to the combination of vandetanib with an inhibitor of the SEC23A gene expression for use in the treatment of MTC.
- the invention also relates to a kit comprising an inhibitor of the SEC23A gene expression and vandetanib, preferably for use in the treatment of MTC.
- the patient to be treated is a non-responsive patient to vandetanib.
- Inhibitors of the SEC23A gene expression for use in the present invention may be based on anti-sense oligonucleotide constructs.
- Anti-sense oligonucleotides including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of SEC23A mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of the SEC23A protein, in a cell.
- antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding the SEC23A protein can be synthesized, e.g., by conventional phosphodiester techniques and administered by e.g., intravenous injection or infusion.
- Small inhibitory RNAs can also function as inhibitors of the SEC23A gene expression for use in the present invention.
- the SEC23A gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that the SEC23A gene expression is specifically inhibited (i.e. RNA interference or RNAi).
- dsRNA small double stranded RNA
- RNAi RNA interference
- Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001 ); Hannon, GJ.
- Ribozymes can also function as inhibitors of the SEC23A gene expression for use in the present invention.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of the corresponding mRNA sequences are thereby useful within the scope of the present invention.
- ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.
- antisense oligonucleotides and ribozymes useful as inhibitors of the SEC23A gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life.
- Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.
- Inhibitors of SEC23A are commercially available and well known by the man skilled in the art. Measurement of RNA knockdown may be carried out by suing a relevant TaqMan® Gene Expression Assay. Examples of inhibitors of SEC23A gene expression include SEC23A siRNAs or shRNAs such as those purchased from Thermo Fisher Scientific: https://www.thermofisher.com/order/genome- database/browse/sirna/gene/SEC23A.
- siSEC23A is chosen from the Table below:
- the invention also relates to an inhibitor of the SEC23A gene expression for use in a method for inducing responsiveness to a treatment with vandetanib in a non-responsive patient suffering from MTC.
- the invention also relates to the use of an inhibitor of the SEC23A gene expression for the manufacture of a medicament for the treatment of MTC, preferably in combination with vandetanib.
- the invention also relates to a method of treatment of medullary thyroid carcinoma comprising the administration to a patient of a therapeutically effective amount of an inhibitor of the SEC23A gene expression, preferably in combination with vandetanib.
- the inhibitor of the SEC23A gene expression may be administered simultaneously, separately or sequentially with vandetanib.
- “simultaneously” means that vandetanib and the inhibitor of the SEC23A gene expression are administered by the same route and at the same time (eg they can be mixed), “separately” means they are administered by different routes and/or at different times, and “sequentially” means they are administered separately, at different times.
- the inhibitor of the SEC23A gene expression for the uses or in the method of treatment as defined above may be comprised in a pharmaceutical composition.
- the pharmaceutical composition may also comprise vandetanib.
- the inhibitor of the SEC23A gene expression and vandetanib are administered to a patient in need thereof in combination or are present together in a same medicament or pharmaceutical composition.
- the nucleic acid can be associated to one or more pharmaceutically acceptable carriers.
- the pharmaceutically acceptable carrier be suitable for delivering nucleic acid into cells.
- Carriers suitable for delivering nucleic acid into cells are well known to one of skill in the art and notably comprise cationic lipids or peptides, nanoparticles and liposomes, optionally linked to moieties, such as antibodies or antibody fragments, having a specificity towards a specific receptor of the target cells, notably MTC cells.
- Either local or systemic routes can be used for administering the nucleic acid of the invention to a patient.
- Examples of administration procedures for nucleic acids are notably described in Nguyen et al. (op. cit.) and Dykxhoorn et al. (op. cit.)
- Vandetanib may be administered at a therapeutically effective dose.
- the dose of vandetanib can vary as is customary and known to the physician to suit the individual conditions, depending on the nature and severity of the MTC. Vandetanib may be administered from 100 mg to 400 mg, for example 100 mg, 200 mg, 300 mg or 400 mg once daily, preferably 300 mg once daily.
- Dose means the administration dose.
- the dose is not necessarily the "unit dose", i.e. a single dose which is capable of being administered to a patient, and which can be readily handled and packaged, remaining as a physically and chemically stable unit dose.
- vandetanib is administered orally.
- a “therapeutically effective dose” or “therapeutic dose” is an amount sufficient to obtain the desired clinical results (i.e., achieve therapeutic efficacy).
- a therapeutically effective dose can be administered in one or more administrations.
- a therapeutically effective dose is an amount that is sufficient to treat MTC as defined above.
- the MTC is sporadic (SMTC) or hereditary (HMTC).
- MTC may also be a part of a multiple endocrine neoplasia of type 2 or a familial thyroid medullary carcinoma.
- the MTC is a persistent or recurrent MTC.
- the MTC is a refractory MTC.
- Recurrent MTC may be intended to refer to a patient who was clinically and biochemically cured at 3 months after treatment but MTC recurred thereafter.
- clinically cured is meant that the medullary thyroid carcinoma has been removed, for example by thyroidectomy.
- biochemically cured is meant that the calcitonine level of said patient was inferior to 5pg/ml_.
- recurrent MTC refers to a patient who relapses three months after thyroidectomy
- Persistent MTC may be intended to refer to a patient with a MTC which has not been cured after thyroidectomy, for example a patient with a calcitonin level superior or equal to 5 pg/mL, 3 months after thyroidectomy.
- persistent MTC refers to a patient with a calcitonin level superior or equal to 5 pg/mL, 3 months after initial thyroidectomy with lymph node dissection.
- the patient with MTC had a thyroidectomy and a lymph node dissection before administration of vandetanib.
- MTC is refractory.
- refractory MTC it may be meant a MTC which is not responsive to standard MTC treatment, such as chemotherapy, like vandetanib, and/or radiotherapy and/or surgery (thyroidectomy and/or lymph node dissection), preferably which is not responsive to vandetanib.
- Advanced MTC means an unresectable medullary thyroid carcinoma and/or a metastatic MTC (stage IV).
- the MTC is metastatic.
- metastatic MTC refer to MTC with secondary tumors that are formed by cells from the primary tumor (MTC) which have moved to another localization, more particularly in the lymph node.
- the MTC has a mutated RET gene. In another embodiment, the MTC has not a mutated RETgene. Description of the Figures
- (B) Semi quantitative real-time PCR validation of the miRNA microarray results. Relative expression of miRNA-375 in non-tumor adjacent tissue, C-Cell hyperplasia and MTC of 6 patients bearing these pathologies in their thyroid. RNU19 was used as reference and values were normalized given the percentage of C-Cell quantification in the tissue (hyperplasia, MCT).
- MTC Medullary Thyroid Carcinoma.
- HMTC Hereditary Medullary Thyroid Carcinoma.
- SMTC Sporadic Medullary Thyroid Carcinoma
- Figure 2 Semi quantitative real-time PCR of miR-375 in thyroid cell lines. MiRNA were extracted from 70 percent confluent cells. RNU19 was used as normer and 8505C cell line was used as reference.
- Figure 3 A Venn diagram of the genes passing the cutoff filters of 3 independent approaches.
- ORI pre-mir DOWN - genes that are under-expressed in the ORI premir-375 condition.
- TT antagomir UP - genes over-expressed in the TT antagomir-375 transfection.
- Thyroid Cell Lines TT DOWN - genes specifically under-expressed in the TT cell lines compared to 1 1 thyroid cell lines from the public dataset GSE36133. The different cutoff values are given in the Material and Methods section.
- FIG. 4 SEC23A expression is negatively associated with miR-375 levels in the thyroid.
- Nthy-ori 3-1 or TT cells were seeded and transfected with pre-miR-375 or pre-miR-
- TUBA actin B
- ACTB actin B
- Papillary thyroid carcinoma intense cytoplasmic expression in tumor cells
- c Normal thyroid tissue: intense cytoplasmic expression in normal follicular cells
- a-c immunoperoxdiase, original magnification x 200
- Figure 5 Effect of miR-375 on proliferation and cancer drug response.
- Nthy-ORI 3.1_FUCCI2A cells were seeded and transfected with pre-miR-375 or pre- miR-CTL at 20pM for 24h. Cells were then harvested and analysed by flow cytometry. The cell cycle distribution is shown in the upper panel.
- Nthy-ori 3.1 cells were seeded and transfected with pre-miR-375 or pre-miR-CTL at 20pM for 24h and vandetanib was then added for 48h. Dead cells were stained with propidium iodide before microscopic analysis. Pictures representative of four biological replicates.
- Nthy-ORI3.1 cells were seeded and transfected with siCTL or siSEC23A#1 or siSEC23#2 (defined in the Table above) for 48h.
- SEC23A protein levels were quantified by immunoblotting.
- Tubulin protein levels were used as a loading control.
- Nthy-ori 3.1 cells were seeded and transfected with siSEC23A or siCTL for 24h and vandetanib was then added for 48h. Dead cells were stained with propidium iodide before microscopic analysis. Quantification of propidium iodide positive cells.
- 62 MTC from patients with well-documented clinical follow-up were included in the study.
- a set of 40 MTC was used for microarray analyzes (training set) and a set of 22 MTC was used for validation of miRNAs of interest (validation set).
- training set all patients had a total thyroidectomy and a lymph node dissection and one patient had also radiotherapy.
- Tissue specimens (from both tumor and non- tumor thyroid tissue) were immediately frozen in nitrogen after surgical resection and stored at -80°C until use.
- Mirror tissue samples of the frozen specimens were fixed in formaldehyde and stained with hematoxylin eosin for histological assessment of the percentage of tumor cells and the absence of associated C cell hyperplasia on the non- tumor adjacent tissue samples.
- V2 miRBase release 10.1 , Platform GPL8227 in GEO: http://www.ncbi.nlm.nih.gov/geo
- V3 miRBase release 12.0, Platform GPL10850 in GEO
- the scanned images were processed by Agilent's Feature Extraction software version 9.5.3. All probes were associated with the most recent miRBase release annotations (v12.0). Normalization was performed using the Limma package available from Bioconductor (Diboun I et al. 2006. BMC Genomics 7 252). Inter slide normalization was performed using the quantile method followed by log2 transformation, after addition of a small constant (10), such that the smallest value of the data set was 10.1 before taking the log. Means of ratios from all comparisons were calculated and a t-test analysis was performed.
- the Benjamini-Hochberg procedure was used to control the experiment-wise false discovery rate (FDR) from multiple testing procedures. Genes with a log2 average expression value superior or equal to 6, an absolute log2 fold-change superior to 1 .0, and an adjusted p-value inferior to 0.05 are considered differentially expressed. Hierarchical clustering was performed on the logFC expression values of the 64 differentially expressed miRs using GenePattern (Reich M et al. 2006 GenePattern 2.0. Nat Genet 38 500-501 ). The eucledian distance measure and the complete clustering method were used both on the patients and the genes. The experimental data have been deposited in the NCBI Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) under Serial record GSE40807.
- GEO NCBI Gene Expression Omnibus
- the expression of the miRNA candidates identified in the training set was further evaluated for a second independent set of 22 MTC samples. Quantitative real-time RT- PCR was performed for the validation set to check for the expression of the 2 selected miRNAs of interest (miR-375 and miR-451 ), according to the manufacturer's protocol (Applied Biosystems, SD, CA).
- the relative expression level was calculated for each sample after normalization against the endogenous expression level of the housekeeping miRNA RNU-19, using the AACt method for comparison of relative fold-expression differences.
- Statistical analysis was performed using the unpaired two-tailed t-test to compare the relative miRNA expression level in tumor and non-tumor tissues or on at least 4 different biological replicates for statistical significance was defined as a P-value of ⁇ 0.05. Kits for amplification are listed below (Table 1 ). Table 1 : List of different primers used for qPCR analysis.
- Nthy ORI 3.1 non-tumor follicular cell line, ECACC, catalogue number 9001 1609), TT cells (medullary carcinoma, ATCC® CRL-1803TM), 8505C (Anaplasic carcinoma, DSMZ, ACC-219), B-CPAP (Papillary carcinoma, DSMZ, ACC-273), Cal62 (Anaplasic carcinoma, DSMZ, ACC-448) were grown in appropriate media supplemented with 10% fetal calf serum, sodium pyruvate and penicillin/streptomycin (Life Technologies) for less than 25 passages.
- Vandetanib (Caprelsa ® , AstraZeneca, London) was residual material given to patients in Centre Antoine Lacassagne. Vandetanib was dissolved in DMSO and used at 10 ⁇ for 48h. Treated cells showed induced cytotoxicity as determined by contrast phase microscopy and propidium iodide staining ⁇ g/ml) of late apoptotic cells. Dead cells were counting using ImageJ software (NIH) (particle analysis, size 100-1000, circularity 0.3-1 ).
- TT cells were transfected with antagomiR-375 (ref. MH10327) or antagomiR-CTL (ref. 4464076), and Nthy ORI3.1 cells with pre-miR-375 (ref. MC10327) or pre-miR-CTL (ref. 4464058) or siSEC23A (ref. ID135698, 135699) or siCTL (ref. AM461 1 ) (all purchased from Life Technologies, France) as previously described (Brest P., et al. 201 1 MiR-129-5p is required for histone deacetylase inhibitor-induced cell death in thyroid cancer cells. Endocr Relat Cancer 18 71 1 -719).
- RNA of TT or Nthy ORI3.1 cells transfected for 48h with either pre-miR-CTL, pre-miR-375 or antagomiR-375 was extracted using the RNeasy kit (Qiagen, Hilden, Germany). The integrity of the RNA was assessed using an Agilent BioAnalyzer 2100 (Agilent Technologies). RNA samples were then labeled and hybridized on 8 ⁇ 60 ⁇ high density SurePrint G3 gene expression human Agilent microarrays following the manufacturer's instructions. Two or three biological replicates were performed for each experimental condition. The microarray experimental data were deposited in the NCBI GEO under the serial record number GSE67742.
- Differentially expressed genes were analysed based on two contrasts, pre-miR- 375 versus the pre-miR-CTL transfection in the Nthy ORI3.1 cells and the antagomiR-375 transfection versus the CTL in the TT cells.
- Down-regulated genes in Nthy ORI3.1 pre- miR-375 versus control were selected based on a log2 average expression value superior to 6, a log2 fold change value inferior to -1 , and an adjusted p-value inferior or equal to 0.05.
- the selection of genes up-regulated in TT antagomiR-375 versus control was based on a log2 average expression value superior to 6 and a log2 fold change superior or equal to 0.6.
- Protein extracts were run as previously described (Brest P. et al. 201 1 MiR-129- 5p is required for histone deacetylase inhibitor-induced cell death in thyroid cancer cells. Endocr Relat Cancer 18 71 1 -719). Membranes were incubated either with rabbit anti- SEC23 antibody (1 :5,000, AB137583, Abeam, USA) or mouse anti-tubulin antibody (1 :10,000, DM1 A clone, Sigma Aldrich, USA) as a loading control. Antibodies were detected with a HRP-conjugated anti-mouse or anti-rabbit antibody (1 :6,000, Santa Cruz Biotechnology, USA) using the Enhanced Chemiluminescence detection system (Pxi, Syngene).
- Anti-SEC23A immunostaining was performed on 3 ⁇ thick whole tissue sections of 14 MTC FFPE tumors and 13 thyroid follicular tumors (8 papillary carcinomas and 4 follicular carcinomas), using the polyclonal rabbit antibody provided by Abeam (AB137583). Immunostaining was performed with a Ventana® Benchmark immunostainer (Roche Diagnostics, Meylan, France) using the Ventana Ultraview detection kit, following the manufacturer's procedure (CC2 ⁇ pre-treatment for 60min, antibody dilution at 1 :200, incubation at 37°C for 32min, UltraView detection kit ⁇ without UltraView Amplification ⁇ ). Slides were freshly cut less than two weeks before IHC technique and stored at 4°C before use. SEC23A antibody staining was blindly analyzed by three pathologists (S.L, V.H. and E.L).
- Replication-defective, self-inactivating retroviral constructs were used for establishing a stable Nthy ORI 3.1 _FUCCI-2A cell line.
- the pPRIPu CrUCCI plasmid was obtained from Celine Feillet and Frank Delaunay and cell lines were generated as previously described (Feillet C. et al. 2014 Phase locking and multiple oscillating attractors for the coupled mammalian clock and cell cycle. Proc Natl Acad Sci U S A 111 9828- 9833). Based on their fluorescence, single cells were analysed post-transfection using a BD FACS ARIA (Becton Dickinson).
- the Prism6 program was used for statistical analysis (Graphpad Software, La Jolla, CA, USA). The results were evaluated for statistical significance by the Student's t- test or the ANOVA test. Error bars represent the S.D. of the mean. P values ⁇ 0.05 were regarded as significant. II. Results:
- microRNA expression profiles were first determined for 40 MTC, corresponding to 14 HMTC with germinal RET mutations, and 26 SMTC with (1 1 cases) or without (15 cases) somatic RET mutations.
- MiR-375 was the most up-regulated and miR-451 the most down-regulated.
- These 2 miRNAs were selected for further validation by qPCR in 22 MTC (1 1 HMTC and 1 1 SMTC).
- the validation set yielded over-expression of miR-375 and under-expression of miR-451 in tumor vs non-tumor tissues.
- miR-375 expression was gradually increased with disease progression, even after an adjustment of their percentage weightings based the estimation of C-cell content by calcitonin and haematoxylin staining. (Fig. 1 and Table 2).
- Table 2 Altered miRNA expression in MTC (training set).
- miRNAs miRNAs log2 Log 2 Mean Adj. P value (miRBase v.12) (miRBase v.20) Average Exp Ratio (JIN)
- hsa-miR-375 hsa-miR-375 9.89 6.14 2.64E-27 hsa-miR-136 hsa-miR-136-5p 7.8 3.77 1 .49E-1 7 hsa-miR-487b hsa-miR-487b-3p 6.15 3.01 3.90E-1 7 hsa-miR-130a hsa-miR-130a-3p 9.22 -2.3 4.00E-1 6 hsa-miR-376c hsa-miR-376c-3p 7.24 3.67 1 .01 E-15 hsa-miR-127-3p hsa-miR-127-3p 6.4 3.6 2.90E-15 hsa-miR-129-3p hsa-miR-129-2-3p 7.54 4.22 3.69E-15 hsa-miR-199b-5p hsa-miR-199b-5p
- miR-375 expression was screened in B-CPAP (papillary thyroid carcinoma cell line), Nthy ORI 3.1 (normal follicular immortalized thyroid cell line), CAL62 and 8505C (thyroid anaplastic carcinoma cell lines) and TT thyroid cell line (HMTC, RET MEN2A).
- miR-375 expression was restricted to the TT cell line (Fig. 2).
- the transfection of either miR-375 in Nthy ORI 3.1 control cells or antagomiR-375 in TT cells, respectively was then performed.
- MiR-375 target genes in the context of MTC are expected to be down-regulated in premiRNA-375 transfected Nthy ORI 3.1 cells and up-regulated in the antagomiR-375 transfected TT cells.
- SEC23A expression was validated at the protein level in MTC by immunoblotting and immunohistochemistry.
- the SEC23A protein expression level was low in TT cells in comparison with Nthy-ori 3-1 cells (Fig. 4).
- the SEC23A levels decreased after transfection with a miR-375 mimic (Fig. 4A), while SEC23A expression was increased in TT cells transfected with the antagomiR-375, according to the microarray results.
- Immunohistochemical analysis of MTC tissue confirmed the decreased in SEC23A cytoplasmic expression in tumor sections when compared to non-tumor tissues and non-MTC thyroid carcinomas (Fig. 4B).
- 2.4 MiR-375 is associated with decreased cell proliferation and responsiveness to vandetanib treatment
- Nthy ORI 3.1 FUCCI-2A A cell cycle-reporter (Nthy ORI 3.1 FUCCI-2A) cell line was generated and transfected with miR-375. Expression of miR-375 in Nthy ORI 3.1 cells decreased cell proliferation after 24h as shown by both a reduction in S/G2 of the cell cycle together with an increase in the percentage of cells in G1 (Fig. 5A).
- Vandetanib markedly decreased proliferation of Nthy ORI 3.1 cells.
- Addition of miR-375 increased the effect of the drug, as shown by a stronger decrease in proliferation and pronounced increase in dead cells (Fig. 5C and D) (P value 5 x 10 ⁇ 5 ). This effect was also associated with strong inhibition of the phosphorylated form of AKT/PKB and increased accumulation of PARP cleavage (Fig 5E).
- TT cells were transfected with antagomiR-375 and treated with vandetanib.
- AntagomiR-375 significantly reduced the mortality of TT cells induced by vandetanib compared to either antagomiR-CTL or lipofectamine alone (Fig. 5D).
- SEC23A was silenced (siSEC23A) in Nthy-ori 3-1 cells using 2 different siRNAs. Decreased proliferation and increased toxicity was observed in cells silenced for SEC23A, in line with the pro-apoptotic effect of miR-375. An increased cell mortality in the presence of vandetanib was also found, underscoring that SEC23A down- regulation is associated with the miR-375-mediated sensitization of vandetanib (Fig. 6).
- miR-375 over-expression resulted in a decrease in cell proliferation and increase in apoptosis of the transfected cells compared to control cells. This effect is mediated through SEC23A since siSEC23A were associated with decreased proliferation and increased cell death.
- miR-375 over-expression increased the responsiveness of transfected cells to vandetanib, with a stronger decrease in cell proliferation associated with a large increase in dead cells in transfected cells compared to control cells.
- the decrease in SEC23A was sufficient for vandetanib responsiveness, since siSEC23A showed an improvement in the vandetanib response.
- MiR-375 over-expression and/or SEC23A down-regulation improves the efficacy of vandetanib in tumor cells.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to a method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma (MTC). The prediction of a therapeutic response to vandetanib, used in the treatment of MTC, is of great interest. By following studies on 62 MTC tissues taken from patients, the inventors showed that the over-expression of miRNA-375 and/or the down-regulation of the SEC23A gene is (are) associated with a decrease in the cancer cells proliferation and with an increase in the response to vandetanib. The present invention thus relates to a method for determining responsiveness to vandetanib in a patient suffering from MTC comprising a step of detecting the level of expression of the miRNA-375 (e.g. by RT-PCR) and/or precursors thereof and/or of the SEC23A gene (e.g. by immunoblotting and immunohistochemistry) in MTC cells of said patient. The invention also concerns an inhibitor of the SEC23A gene expression for use in the treatment of MTC, in combination with vandetanib.
Description
Method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma
The present invention concerns a method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma (MTC). The present invention also concerns an inhibitor of the SEC23A gene expression for use in the treatment of MTC, preferably in combination with vandetanib.
Thyroid carcinomas are the most common cancer of the endocrine system. Among these tumors, medullary thyroid carcinoma is a rare calcitonin-producing tumor, which arises from thyroid gland parafollicular C cells and accounts for 3-8% of all thyroid carcinomas. Most cases of MTC are sporadic (SMTC), whereas the remaining cases are due to hereditary forms (HMTC) caused by germline activating mutations of the RET (Rearranged During Transfection) proto-oncogene. Somatic RETgene mutations can also be found in 40-50% of SMTC.
MCT are aggressive tumors, for which lymph node metastases are found in 55% of
MTC patients at diagnosis. Currently, surgery is the treatment of choice for MTC, consisting in total thyroidectomy and lymph node dissection. However, despite surgery, 50% of patients with MTC relapse.
Recently, multi-kinase inhibitors such as vandetanib have been tested for treatment of advanced MTC. Vandetanib has been recently approved for the treatment of patients with recurrent or metastatic unresectable MTC.
In the particular case of cancer treatment, there is a need for methods of determining responsiveness to drugs, in particular prior to their administration, thus allowing classifying patients into groups that are responsive or not to the drug to be administered.
There is also a need for improved treatments of medullary thyroid carcinoma.
The aim of the present invention is to provide a method for determining the responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma.
Another aim of the invention is to provide an improved treatment of medullary thyroid carcinoma, in particular of advanced medullary thyroid carcinoma.
MicroRNAs (miRNAs) are a class of endogenously expressed small non-protein- coding RNAs that can post-transcriptionally modulate the expression of hundreds of genes by inhibiting the translation or promoting the degradation of targeted RNAs, thereby controlling a wide range of biological functions such as development, cellular proliferation,
cellular differentiation, cell death and affecting major biological domains such as sternness, immunity and cancer. In particular, miRNAs can function as tumor suppressors or oncogenes, and alteration in their expression plays a critical role in tumorigenesis.
Few studies have investigated the expression of miRNAs in MTC, with cohorts of paired tumor and normal tissue (Abraham D et al. 201 1 . Clin Cancer Res 17 4772- 4781 . Duan et al. 2014).
Vandetanib (ZD6474, trade name CAPRELSA®) is a tyrosine kinase inhibitor that selectively targets vascular endothelial growth factor receptor-2, epidermal growth factor receptor and the RET proto-oncogene. The MAPK (Ras/Mek1 -2/p44-42), and PI3K/AKT pathways have been described to be the two major signaling pathways inhibited by vandetanib. Both the FDA (Food and Drug Administration) and EMEA (European Medicines Agency) approved vandetanib for treatment of patients with recurrent or metastatic MTC that are unresectable and/or symptomatic.
The invention arises from the unexpected finding by the inventors that the over- expression of miR-375 and/or the down-regulation of the SEC23A gene is(are) associated with a decrease in the cancer cells proliferation and with an increase in the response to vandetanib.
Indeed, the inventors surprisingly found that in MTC cells the miRNA-375 is over- expressed and that this over-expression is responsible for the down-regulation of the SEC23A gene which plays a role in the response to vandetanib. The inventors also find that the expression of miRNA-375 decreases cell proliferation by both a reduction in the S/G2 phases of the cell cycle together with an increase of cells blocked in the G1 phase.
Even more surprising, the inventors found that miRNA-375 over-expression and/or SEC23A down-regulation potentiate the therapeutic effect of vandetanib in MTC cells.
In one embodiment, vandetanib and miRNA-375 have a synergistic effect on the inhibition of the expression of the SEC23A gene.
In another embodiment, vandetanib and miRNA-375 have a synergistic effect on the treatment of MTC.
By "synergistic effect", it may be meant that the effect of vandetanib with miRNA-375 is superior to the effect of vandetanib alone added to the effect of miRNA-375 alone, on the inhibition of the expression of the SEC23A gene and/or on the treatment of MTC.
In another embodiment, vandetanib and miRNA-375 have an additive effect on the inhibition of the expression of the SEC23A gene and/or on the treatment of MTC.
By "additive effect", it may be meant that the effect of vandetanib with miRNA-375 corresponds (ie. is about equal or equal) to the effect of vandetanib alone added to the
effect of mi-RNA375 alone, on the inhibition of the expression of the SEC23A gene and/or on the treatment of MTC.
Thus, the invention relates to a method for determining responsiveness to vandetanib in a patient suffering from MTC comprising a step of detecting the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells of said patient.
The invention also relates to an inhibitor of the SEC23A gene expression for use in the treatment of MTC, in combination with vandetanib.
The invention also relates to a method of treatment of a patient suffering from MTC comprising the administration to said patient of a therapeutically effective amount of an inhibitor of the SEC23A gene expression, preferably in combination with vandetanib.
Definitions
According to the invention, the term "patient" or "individual" to be treated is preferably intended for a human or non-human mammal (such as a rodent, for example a mouse or a rat, a feline, a canine, or a primate) affected or likely to be affected with MTC. Preferably, the patient is a human.
The term "treating" or "treatment" means reversing, alleviating, inhibiting the progress of the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition. In particular, the treatment of MTC may consist in destroying and/or depleting MTC cells and/or preventing resistance to vandetanib of MTC cells. Most preferably, such treatment leads to the complete depletion of MTC cells. In particular, the depletion of the MCT cells is obtained by inducing an arrest of the cellular cycle of said cells.
As intended herein, the expression "cellular cycle" relates to the series of events that take place in a cell leading to its division and duplication (replication). As it is well known, the cycle is divided in four successive phases G1 , S, G2 and M. The expression "an arrest of the cellular cycle" means that this cycle is totally stopped in either one of the phases, preferably G1 . Such an arrest leads to cellular death.
By "responsiveness to vandetanib" or "responsive to vandetanib" is meant that vandetanib has a therapeutic effect, i.e. vandetanib is responsible for the diminution of the MTC and/or the inhibition of the growth of the MTC. More particularly, vandetanib may be responsible for a decrease of the MTC cells and/or a decrease in MTC cells proliferation in the patient, preferably when administered at therapeutic doses. In a particular embodiment, "responsiveness to vandetanib" or "responsive to vandetanib" means that
vandetanib reduces tumor cell-induced angiogenesis and/or tumor vessel permeability and/or inhibits tumor growth and/or metastasis, preferably when administered at therapeutic doses.
By "non-responsive to vandetanib" is meant that vandetanib has no or a not therapeutic effect on the MTC as defined above, preferably when administered at pharmaceutical doses to the patient. In one embodiment, the MTC is refractory to vandetanib. In one embodiment, the patient is resistant to vandetanib.
In the context of the present application, the "percentage of identity" is calculated using a global alignment (i.e. the two sequences are compared over their entire length). Methods for comparing the identity of two or more sequences are well known in the art. The « needle » program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970 J. Mol. Biol. 48:443-453) to find the optimum alignment (including gaps) of two sequences when considering their entire length, may for example be used. The needle program is for example available on the ebi.ac.uk World Wide Web site. The percentage of identity in accordance with the invention is preferably calculated, when referring to amino acid sequences, using the EMBOSS: needle (global) program with a "Gap Open" parameter equal to 10.0, a "Gap Extend" parameter equal to 0.5, and a BLOSUM62 matrix, or, when referring to nucleic acid sequences, using the EMBOSS: needle (global) program with a "Gap Open" parameter equal to 10.0, a "Gap Extend" parameter equal to 0.5, and a DNAFULL matrix.
The term "miRNA-375", "miR-375" or "microRNA-375" is used to qualify a micro ribonucleic acid having at least 80%, preferably 90%, percentage of identity with the following sequence:
SEQ ID n° 1 : UUUGUUCGUUCGGCUCGCGUGA.
In one embodiment, miRNA-375 is hsa miRNA-375. In one embodiment, mi-RNA-
375 is typically represented by SEQ ID n°1 , which is also described on the website http://www.mirbase.org/, with the accession number MI0000783 on January 21 , 2016.
The term "miRNA-375" notably encompasses all the various allelic or polymorphic variants of miRNA-375. More particularly, the variants of the miRNA-375 can be represented by mi-RNAs wherein at the 3' end, at least one base, preferably one or two bases such as A, U or G, is missing. For example, the variants of the miRNA-375 may have the following sequences:
SEQ ID n°2: UUUGUUCGUUCGGCUCGCGUG
SEQ ID n°3: UUUGUUCGUUCGGCUCGCGU
SEQ ID n°4: UUUGUUCGUUCGGCUCGCGUGA
SEQ ID n°5: UUUGUUCGUUCGGCUCGCG
SEQ ID n°6: UUGUUCGUUCGGCUCGCGUGA
SEQ ID n°12: UUUGUUCGUUCGGCUCGUGUG.
In one embodiment, the variant of miRNA-375 is typically represented by SEQ ID n°2 or SEQ ID n°12 (also identified as RS 751522848).
A "precursor" of the miRNA-375 according to the invention refers to any intermediate in the mi-RNA maturation pathway starting from the transcript obtained from the transcription of a chromosome and ending with the obtaining of a mi-RNA. Thus, a precursor according to the invention can be a mi-RNA primary transcripts (pri-miRNA) or a pre-miRNA, as well as a long non-coding RNA, a snoRNA or a transposon which encodes a mi-RNA before processing via the enzyme Dicer. In one embodiment, the precursor of the miRNA-375 is a ribonucleic acid having at least 80%, preferably 90%, percentage of identity with the following sequence:
SEQ ID n°7:
CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCU CGCGUGAGGC
In one embodiment, the precursor of the miRNA-375 is typically represented by SEQ ID n°7. The term "SEC23A gene" is used to qualify a desoxyribonucleic acid having at least 80%, preferably 90%, percentage of identity with the SEQ ID n°8. In one embodiment, the SEC23A gene is typically represented by SEQ ID n° 8. The SEC23A gene sequence is also described on GenBAnk on the website http://www.ncbi.nlm.nih.gov/genbank/, with accession number NM006364 or at http://www.ncbi.nlm.nih.gov/nuccore/NM_006364, on January 21 , 2016.
The protein encoded by this gene is the transport protein SEC23A which is a member of the SEC23 subfamily of the SEC23/SEC24 family. The protein encoded by the SEC23A gene is suggested to play a role in the ER-Golgi protein trafficking. The naturally occurring human SEC23A protein has an aminoacid sequence as shown in GenBank on the website http://www.ncbi.nlm.nih.gov/genbank/, with the protein accession number NP006355 or at http://www.ncbi.nlm.nih.gov/protein/NP_006355 on January 21 , 2016. The sequence of the protein SEC23A is typically represented by SEQ ID n°9.
The RET (Rearranged During Transfection) proto-oncogene encodes a receptor tyrosine kinase for members of the glial cell line-derived neurotrophic factor (GDNF) family of extracellular signalling molecules. As examples of mutations of the RET gene in MTC, it can be cited the mutations localized on exon 15 codon 891 ; exon 13 codon 790; exon 10
codon 61 1 ; exon 10 codon 618; exon 14 codon 804 and exon 1 1 codon 618. The RET mutation can be germinal or somatic.
The term "expression" when used in the context of expression of a gene or nucleic acid refers to the conversion of the information, contained in a gene, into a gene product. A gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA) or a protein produced by translation of a mRNA. Gene products also include messenger RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins (e.g., the SEC23A protein) modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, SUMOylation, ADP-ribosylation, myristilation, and glycosylation.
In one embodiment, by the expression "level of the SEC23A gene expression" is meant the level of protein SEC23A.
An "inhibitor of expression" refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of a gene. Consequently an "inhibitor of the SEC23A expression" refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of the SEC23A gene.
Method of determining responsiveness to vandetanib
Preferably, the method according to the invention is an in vitro method.
The level of expression of the miRNA-375 in the cells can be measured by any techniques known by the person skilled in the art. Numerous methods are available which allow quantifying a target RNA, for example, methods based on PCR after reverse transcription (RT-PCR) using oligonucleotides which are specific of the target RNA sequences, or alternatively, methods allowing the hybridization of the target RNA, of duplicates or triplicates of the target RNA with probes under stringent conditions.
The probes according to the invention are preferably laid down on microarrays. As intended herein, the expression "hybridization under stringent conditions" indicates that the target RNA or the duplicates thereof can specifically bind pairwise, essentially by forming Watson-Crick-type pairs (e.g. G-C pairs or U-A pairs), with probes having sequences complementary thereto.
Adequate stringent conditions according to the invention can be easily determined by one of skill in the art. Preferred stringent conditions according to the invention comprise a hybridization step of 10 to 20 hours, preferably 16 hours, at about 40 to 55°C, preferably 50°C, under an ionic strength equivalent to that provided by 500 mM to 2 M NaCI, preferably 1 M NaCI. Additional compounds well known to one skilled in the art can also
be added such as pH buffers (e.g. Tris or MES), EDTA, Tween, Bovine Serum Albumin, and herring sperm DNA.
Numerous methods are available which allow quantifying the level of expression of a gene, i.e. the level of the protein and/or the RNA encoded by said gene. The level of the SEC23A gene expression may be determined by determining the level of transport protein SEC23A encoded by said gene.
The level of protein can be measured by any techniques known by the person skilled in the art such as immunoprecipitation, Immunoelectrophoresis, in particular western blot, enzyme-linked immunosorbent assay or by immunohistochemistry.
Protein extracts may be run as described in Brest et al. 201 1 Endocr Relat Cancer.
201 1 Nov 14;18(6):71 1 -9. doi: 10.1530/ERC-10-0257. Print 201 1 Dec). For example, rabbit anti-SEC23 antibody, rabbit anti-PARP antibody, rabbit anti-phospho-AKT, rabbit anti-AKT, rabbit anti-phospho-p44/42 MAPK (ERK1 /2) (Thr202/Tyr204), rabbit anti-p44/42 MAPK (ERK1/2), may be used with mouse anti-tubulin and/or mouse anti-actin antibodies as loading controls. Antibodies may be detected with a HRP (horseradish peroxidase) conjugated anti-mouse or anti-rabbit antibody using chemioluminescence.
The level of the RNA encoded by the SEC23A gene may be determined by the same methods as described for determining the level of expression of the miRNA-375, in particular by RT-PCR.
In one embodiment, the method as defined above comprises the following steps: i) measuring the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells;
ii) comparing the level of expression with a reference value; and
iii) determining therefrom the responsiveness to vandetanib of said patient.
The "reference value" according to the invention can be a unique value such as a given level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene, alternatively, it can an average between levels of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene.
More particularly, in the method as defined above, the reference value is the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in at least one non-cancer cell. In one embodiment, the non-cancer cell is a hyperplasic cell preferably a hyperplasic thyroid gland parafollicular C cell. In one embodiment, the non- cancer cell is a Nthy ORI 3.1 cell. In another embodiment, the non-cancer cell is a non- cancer thyroid gland parafollicular C cell, preferably a non-cancer thyroid gland parafollicular C cell of the patient for which the responsiveness to vandetanib is to be
determined. In one embodiment, in the method as defined above, the reference value is the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in at least one cancer cell such as a TT cell (medullary carcinoma). In one embodiment, the reference value as defined above is determined before administration of vandetanib.
In one embodiment, an increase in the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the reference value is indicative of the responsiveness to vandetanib of said patient. Preferably, the increase in the level of expression of the miRNA-375 and/or precursors thereof in MTC cells is statistically significant.
In one embodiment, the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the reference value is increased of at least 10 fold, preferably from 10 to 80 fold, for example 60 fold.
In one embodiment, the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the level of expression of the miRNA-375 and/or precursors thereof in non-cancer cells is increased of at least 20 fold, preferably from 20 to 80 fold, for example 60 fold.
In one embodiment, the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the level of expression of the miRNA-375 and/or precursors thereof in hyperplasic thyroid gland parafollicular C cells is increased of at least 10 fold, preferably from 10 to 80 fold, for example 30 fold.
In another embodiment, a decrease in the level of expression of the SEC23A gene typically represented by a decrease in the level of the SEC23A protein in MTC cells compared to the reference value is indicative of the responsiveness to vandetanib of said patient. Preferably, the decrease in the level of expression of the SEC23A gene in MTC cells is statistically significant.
The method of the invention may further comprise monitoring the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene over a period of time in MTC cells from a patient treated with vandetanib.
Preferably, the monitoring is performed at consecutive times during the course of the treatment with vandetanib in order to establish a therapeutic follow-up of the patient. The follow-up is typically performed by determining the level of expression of the miRNA- 375 and/or precursors thereof and/or of the SEC23A gene according to the invention, at
various time intervals, for instance every 2 weeks, 1 month, 2 months, 3 months, 5 months, etc.
Thus, when a therapeutic follow-up is performed, the reference value according to the invention can also be, in addition to the previous definitions of the term, a previous level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells from the same patient.
In one embodiment, the therapeutic follow-up according to the invention is started at the same time or upon onset of the treatment of the patient with vandetanib. In a particular embodiment, a decrease in the level of expression of the miRNA-375 and/or precursors thereof during the therapeutic follow-up is indicative of a decrease of the responsiveness to vandetanib thereby indicating that the MTC becomes resistant to vandetanib. In a particular embodiment, an increase in the level of expression of the SEC23A gene during the therapeutic follow-up is indicative of a decrease of the responsiveness to vandetanib thereby indicating that the MTC becomes resistant to vandetanib.
An inhibitor of the SEC23A gene expression for use in the treatment of medullay thyroid carcinoma
The invention also relates to an inhibitor of the SEC23A gene expression for use in the treatment of MTC, preferably in combination with vandetanib.
The invention also relates to the combination of vandetanib with an inhibitor of the SEC23A gene expression for use in the treatment of MTC.
The invention also relates to a kit comprising an inhibitor of the SEC23A gene expression and vandetanib, preferably for use in the treatment of MTC.
In one embodiment, the patient to be treated is a non-responsive patient to vandetanib.
Inhibitors of the SEC23A gene expression for use in the present invention may be based on anti-sense oligonucleotide constructs. Anti-sense oligonucleotides, including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of SEC23A mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of the SEC23A protein, in a cell. For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding the SEC23A protein can be synthesized, e.g., by conventional phosphodiester techniques and administered by e.g., intravenous injection or infusion. Methods for using antisense techniques for specifically
inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131 ; 6,365,354; 6,410,323; 6,107,091 ; 6,046,321 ; and 5,981 ,732).
Small inhibitory RNAs (siRNAs) can also function as inhibitors of the SEC23A gene expression for use in the present invention. The SEC23A gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that the SEC23A gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001 ); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01/36646, WO 99/32619, and WO 01/68836).
Ribozymes can also function as inhibitors of the SEC23A gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of the corresponding mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.
Both antisense oligonucleotides and ribozymes useful as inhibitors of the SEC23A gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular
stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.
Inhibitors of SEC23A are commercially available and well known by the man skilled in the art. Measurement of RNA knockdown may be carried out by suing a relevant TaqMan® Gene Expression Assay. Examples of inhibitors of SEC23A gene expression include SEC23A siRNAs or shRNAs such as those purchased from Thermo Fisher Scientific: https://www.thermofisher.com/order/genome- database/browse/sirna/gene/SEC23A.
In a particular embodiment, the siSEC23A is chosen from the Table below:
The invention also relates to an inhibitor of the SEC23A gene expression for use in a method for inducing responsiveness to a treatment with vandetanib in a non-responsive patient suffering from MTC.
The invention also relates to the use of an inhibitor of the SEC23A gene expression for the manufacture of a medicament for the treatment of MTC, preferably in combination with vandetanib. Method of treatment of medullary thyroid carcinoma
The invention also relates to a method of treatment of medullary thyroid carcinoma comprising the administration to a patient of a therapeutically effective amount of an inhibitor of the SEC23A gene expression, preferably in combination with vandetanib. In the method of treatment according to the invention or the uses of an inhibitor of the SEC23A gene expression as defined above, the inhibitor of the SEC23A gene expression may be administered simultaneously, separately or sequentially with vandetanib.
According to the invention, "simultaneously" means that vandetanib and the inhibitor of the SEC23A gene expression are administered by the same route and at the same time (eg they can be mixed), "separately" means they are administered by different
routes and/or at different times, and "sequentially" means they are administered separately, at different times.
As intended herein the inhibitor of the SEC23A gene expression for the uses or in the method of treatment as defined above, may be comprised in a pharmaceutical composition. The pharmaceutical composition may also comprise vandetanib. Preferably, the inhibitor of the SEC23A gene expression and vandetanib are administered to a patient in need thereof in combination or are present together in a same medicament or pharmaceutical composition.
Methods for delivering nucleic acids into cells in vitro or in vivo are well known to one of skill in the art and are notably described in Nguyen et al. (2008) Curr Opin Mol Ther 10:158-67 and Dykxhoorn et al. (2006) Gene Therapy 13:541 -552, which are incorporated herein by reference.
Where a medicament, a pharmaceutical composition, or a method of treatment of the invention is contemplated, the nucleic acid can be associated to one or more pharmaceutically acceptable carriers. In particular, it is preferred that the pharmaceutically acceptable carrier be suitable for delivering nucleic acid into cells. Carriers suitable for delivering nucleic acid into cells are well known to one of skill in the art and notably comprise cationic lipids or peptides, nanoparticles and liposomes, optionally linked to moieties, such as antibodies or antibody fragments, having a specificity towards a specific receptor of the target cells, notably MTC cells.
Either local or systemic routes can be used for administering the nucleic acid of the invention to a patient. Examples of administration procedures for nucleic acids are notably described in Nguyen et al. (op. cit.) and Dykxhoorn et al. (op. cit.)
Vandetanib may be administered at a therapeutically effective dose. The dose of vandetanib can vary as is customary and known to the physician to suit the individual conditions, depending on the nature and severity of the MTC. Vandetanib may be administered from 100 mg to 400 mg, for example 100 mg, 200 mg, 300 mg or 400 mg once daily, preferably 300 mg once daily. "Dose" means the administration dose. The dose is not necessarily the "unit dose", i.e. a single dose which is capable of being administered to a patient, and which can be readily handled and packaged, remaining as a physically and chemically stable unit dose. In one embodiment, vandetanib is administered orally.
A "therapeutically effective dose" or "therapeutic dose" is an amount sufficient to obtain the desired clinical results (i.e., achieve therapeutic efficacy). A therapeutically effective dose can be administered in one or more administrations. In particular, a
therapeutically effective dose is an amount that is sufficient to treat MTC as defined above.
In one embodiment, in the methods or the uses as defined above, the MTC is sporadic (SMTC) or hereditary (HMTC). In one embodiment, MTC may also be a part of a multiple endocrine neoplasia of type 2 or a familial thyroid medullary carcinoma.
In one embodiment, the MTC is a persistent or recurrent MTC.
In another embodiment, the MTC is a refractory MTC.
Recurrent MTC may be intended to refer to a patient who was clinically and biochemically cured at 3 months after treatment but MTC recurred thereafter. By "clinically cured" is meant that the medullary thyroid carcinoma has been removed, for example by thyroidectomy. By "biochemically cured" is meant that the calcitonine level of said patient was inferior to 5pg/ml_.
In one embodiment, recurrent MTC refers to a patient who relapses three months after thyroidectomy
Persistent MTC may be intended to refer to a patient with a MTC which has not been cured after thyroidectomy, for example a patient with a calcitonin level superior or equal to 5 pg/mL, 3 months after thyroidectomy. In a particular embodiment, persistent MTC refers to a patient with a calcitonin level superior or equal to 5 pg/mL, 3 months after initial thyroidectomy with lymph node dissection.
In one embodiment, the patient with MTC had a thyroidectomy and a lymph node dissection before administration of vandetanib.
In one embodiment, MTC is refractory. By refractory MTC it may be meant a MTC which is not responsive to standard MTC treatment, such as chemotherapy, like vandetanib, and/or radiotherapy and/or surgery (thyroidectomy and/or lymph node dissection), preferably which is not responsive to vandetanib.
MTC can be classified using AJCC Cancer Staging Manual 7th edition defining several stages. Advanced MTC means an unresectable medullary thyroid carcinoma and/or a metastatic MTC (stage IV).
In one embodiment, the MTC is metastatic. The terms "metastatic MTC" refer to MTC with secondary tumors that are formed by cells from the primary tumor (MTC) which have moved to another localization, more particularly in the lymph node.
In one embodiment, the MTC has a mutated RET gene. In another embodiment, the MTC has not a mutated RETgene.
Description of the Figures
Figure 1 : (A) Semi quantitative real-time PCR validation of the miRNA microarray results. Relative expression of miRNA-375 and mi-RNA-451 in tumor vs non-tumor tissue of 22 patients (1 1 HMTC, 1 1 SMTC), RNU19 normalized. *= P value < 0.05.
(B) Semi quantitative real-time PCR validation of the miRNA microarray results. Relative expression of miRNA-375 in non-tumor adjacent tissue, C-Cell hyperplasia and MTC of 6 patients bearing these pathologies in their thyroid. RNU19 was used as reference and values were normalized given the percentage of C-Cell quantification in the tissue (hyperplasia, MCT).
MTC: Medullary Thyroid Carcinoma. HMTC: Hereditary Medullary Thyroid Carcinoma. SMTC: Sporadic Medullary Thyroid Carcinoma
Figure 2: Semi quantitative real-time PCR of miR-375 in thyroid cell lines. MiRNA were extracted from 70 percent confluent cells. RNU19 was used as normer and 8505C cell line was used as reference.
Figure 3: A Venn diagram of the genes passing the cutoff filters of 3 independent approaches. ORI pre-mir: DOWN - genes that are under-expressed in the ORI premir-375 condition. TT antagomir: UP - genes over-expressed in the TT antagomir-375 transfection. Thyroid Cell Lines: TT DOWN - genes specifically under-expressed in the TT cell lines compared to 1 1 thyroid cell lines from the public dataset GSE36133. The different cutoff values are given in the Material and Methods section.
Figure 4: SEC23A expression is negatively associated with miR-375 levels in the thyroid. (A) Nthy-ori 3-1 or TT cells were seeded and transfected with pre-miR-375 or pre-miR-
CTL for 48h. After 48h, SEC23A protein levels were quantified by immunoblotting. Tubulin
(TUBA) and actin B (ACTB) protein levels were used as loading controls.
(B) Immunohistochemistry with anti-SEC23A. (a) MTC: weak expression in tumor cells.
(b) Papillary thyroid carcinoma: intense cytoplasmic expression in tumor cells (c) Normal thyroid tissue: intense cytoplasmic expression in normal follicular cells (a-c: immunoperoxdiase, original magnification x 200).
Figure 5: Effect of miR-375 on proliferation and cancer drug response.
(A) Nthy-ORI 3.1_FUCCI2A cells were seeded and transfected with pre-miR-375 or pre- miR-CTL at 20pM for 24h. Cells were then harvested and analysed by flow cytometry. The cell cycle distribution is shown in the upper panel.
(B) Nthy-ori 3.1 cells were seeded and transfected with pre-miR-375 or pre-miR-CTL at 20pM for 24h and vandetanib was then added for 48h. Dead cells were stained with propidium iodide before microscopic analysis. Pictures representative of four biological replicates.
(C) Quantification of propidium iodide positive Nthy-ori 3.1 cells.
(D) TT cells were seeded and transfected with antagomiR-375 or antagomiR-CTL for 24h and vandetanib was then added for 48h. Quantification of propidium iodide positive TT cells.
(E) Immunoblot of the protein levels after miR-375 expression and vandetanib treatment of Nthy-ori 3-1 cells. Tubulin (TUBA) and actin B (ACTB) protein levels were used as loading controls.
Figure 6: Effect of siSEC23A on the vandetanib response.
(A) Nthy-ORI3.1 cells were seeded and transfected with siCTL or siSEC23A#1 or siSEC23#2 (defined in the Table above) for 48h. SEC23A protein levels were quantified by immunoblotting. Tubulin protein levels were used as a loading control.
(B) Nthy-ori 3.1 cells were seeded and transfected with siSEC23A or siCTL for 24h and vandetanib was then added for 48h. Dead cells were stained with propidium iodide before microscopic analysis. Quantification of propidium iodide positive cells.
The following examples are illustrative of the present invention.
EXAMPLES
I. Materials and Methods: 1.1 Patients and tissue samples
62 MTC from patients with well-documented clinical follow-up were included in the study. A set of 40 MTC was used for microarray analyzes (training set) and a set of 22 MTC was used for validation of miRNAs of interest (validation set). In the training set, all patients had a total thyroidectomy and a lymph node dissection and one patient had also radiotherapy. 9 patients presented a multiple endocrine neoplasia and one patient a familial medullary thyroid carcinoma. 14 patients presented a germinal RET mutation and 1 1 patients a somatic 918 RET mutation.
10 patients had a persistent disease meaning that they had high calcitonin level 3 months after initial surgery (i.e. a calcitonine level superior to 5 pg/mL). 2 patients had a recurrent disease meaning that they had a clinical and biochemical cure at 3 months but disease recurrence thereafter.
4 patients had a persistent and a recurrent MTC. Tissue specimens were collected from five related hospital biobanks in France
(Bordeaux, Marseille, Nice, Paris, Reims). Tissue specimens (from both tumor and non- tumor thyroid tissue) were immediately frozen in nitrogen after surgical resection and stored at -80°C until use. Mirror tissue samples of the frozen specimens were fixed in formaldehyde and stained with hematoxylin eosin for histological assessment of the percentage of tumor cells and the absence of associated C cell hyperplasia on the non- tumor adjacent tissue samples.
All patients provided a signed informed consent for participation in the study and the protocol was approved by the local ethics committee of each university participating in the study.
1.2 MiRNA microarrays
Total RNA was extracted from samples with TRIzol solution (Invitrogen, Carlsbad, CA, USA), and the integrity of the RNA was assessed using an Agilent Bioanalyzer 2100 (Agilent Palo Alto, CA). Total RNA (100 ng) was labeled and hybridized onto Agilent Human miRNA Microarrays V2 (miRBase release 10.1 , Platform GPL8227 in GEO: http://www.ncbi.nlm.nih.gov/geo) or V3 (miRBase release 12.0, Platform GPL10850 in
GEO) according to the manufacturer's protocol, and scanned using the Agilent Microarray Scanner. The scanned images were processed by Agilent's Feature Extraction software version 9.5.3. All probes were associated with the most recent miRBase release annotations (v12.0). Normalization was performed using the Limma package available from Bioconductor (Diboun I et al. 2006. BMC Genomics 7 252). Inter slide normalization was performed using the quantile method followed by log2 transformation, after addition of a small constant (10), such that the smallest value of the data set was 10.1 before taking the log. Means of ratios from all comparisons were calculated and a t-test analysis was performed.
The Benjamini-Hochberg procedure was used to control the experiment-wise false discovery rate (FDR) from multiple testing procedures. Genes with a log2 average expression value superior or equal to 6, an absolute log2 fold-change superior to 1 .0, and an adjusted p-value inferior to 0.05 are considered differentially expressed. Hierarchical clustering was performed on the logFC expression values of the 64 differentially expressed miRs using GenePattern (Reich M et al. 2006 GenePattern 2.0. Nat Genet 38 500-501 ). The eucledian distance measure and the complete clustering method were used both on the patients and the genes. The experimental data have been deposited in the NCBI Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) under Serial record GSE40807.
1.3 MiRNA quantitative real-time RT-PCR analysis
The expression of the miRNA candidates identified in the training set was further evaluated for a second independent set of 22 MTC samples. Quantitative real-time RT- PCR was performed for the validation set to check for the expression of the 2 selected miRNAs of interest (miR-375 and miR-451 ), according to the manufacturer's protocol (Applied Biosystems, SD, CA).
The relative expression level was calculated for each sample after normalization against the endogenous expression level of the housekeeping miRNA RNU-19, using the AACt method for comparison of relative fold-expression differences. Statistical analysis was performed using the unpaired two-tailed t-test to compare the relative miRNA expression level in tumor and non-tumor tissues or on at least 4 different biological replicates for statistical significance was defined as a P-value of <0.05. Kits for amplification are listed below (Table 1 ).
Table 1 : List of different primers used for qPCR analysis.
Nthy ORI 3.1 (non-tumor follicular cell line, ECACC, catalogue number 9001 1609), TT cells (medullary carcinoma, ATCC® CRL-1803™), 8505C (Anaplasic carcinoma, DSMZ, ACC-219), B-CPAP (Papillary carcinoma, DSMZ, ACC-273), Cal62 (Anaplasic carcinoma, DSMZ, ACC-448) were grown in appropriate media supplemented with 10% fetal calf serum, sodium pyruvate and penicillin/streptomycin (Life Technologies) for less than 25 passages. Vandetanib (Caprelsa®, AstraZeneca, London) was residual material given to patients in Centre Antoine Lacassagne. Vandetanib was dissolved in DMSO and used at 10μΜ for 48h. Treated cells showed induced cytotoxicity as determined by contrast phase microscopy and propidium iodide staining ^g/ml) of late apoptotic cells. Dead cells were counting using ImageJ software (NIH) (particle analysis, size 100-1000, circularity 0.3-1 ).
1.5 siRNA, Pre-miRNA and antagomiR transfection
TT cells were transfected with antagomiR-375 (ref. MH10327) or antagomiR-CTL (ref. 4464076), and Nthy ORI3.1 cells with pre-miR-375 (ref. MC10327) or pre-miR-CTL (ref. 4464058) or siSEC23A (ref. ID135698, 135699) or siCTL (ref. AM461 1 ) (all purchased from Life Technologies, France) as previously described (Brest P., et al. 201 1 MiR-129-5p is required for histone deacetylase inhibitor-induced cell death in thyroid cancer cells. Endocr Relat Cancer 18 71 1 -719). Cells were plated at 100 000 cells/well in a six-well plate and transfected for 48h with synthetic pre-miRs, antagomiRs or siRNA using Lipofectamine RNAiMAX reagent (Life Technologies), following the manufacturer's instructions at a final concentration of 50, 200, or 50nM respectively. The level of transfection was checked by RT-PCR for the specific transfected miRNA on AB7500 thermal cycler (Applied Biosystems).
1.6 Transcriptome microarray analysis
Total RNA of TT or Nthy ORI3.1 cells transfected for 48h with either pre-miR-CTL, pre-miR-375 or antagomiR-375 was extracted using the RNeasy kit (Qiagen, Hilden, Germany). The integrity of the RNA was assessed using an Agilent BioAnalyzer 2100 (Agilent Technologies). RNA samples were then labeled and hybridized on 8χ60Κ high density SurePrint G3 gene expression human Agilent microarrays following the manufacturer's instructions. Two or three biological replicates were performed for each experimental condition. The microarray experimental data were deposited in the NCBI GEO under the serial record number GSE67742.
The data were quantile normalized using the Bioconductor package limma
(Diboun I, Wernisch L, Orengo CA & Koltzenburg M 2006 Microarray analysis after RNA amplification can detect pronounced differences in gene expression using limma. BMC Genomics 7 252.). Means of ratios from all comparisons were calculated and the moderated t-statistic of the limma package provided the per gene P values. The Benjamini-Hochberg procedure was used to control the experiment-wise false discovery rate (FDR) from multiple testing procedures.
Differentially expressed genes were analysed based on two contrasts, pre-miR- 375 versus the pre-miR-CTL transfection in the Nthy ORI3.1 cells and the antagomiR-375 transfection versus the CTL in the TT cells. Down-regulated genes in Nthy ORI3.1 pre- miR-375 versus control were selected based on a log2 average expression value superior to 6, a log2 fold change value inferior to -1 , and an adjusted p-value inferior or equal to 0.05. The selection of genes up-regulated in TT antagomiR-375 versus control was based on a log2 average expression value superior to 6 and a log2 fold change superior or equal to 0.6.
The normalized gene expression values of 12 thyroid cancer cell lines extracted from the publicly available GEO have been downloaded (accession number GSE36133).
Among all the genes under-expressed in the TT cell line compared to all the other 1 1 thyroid cancer cell lines (follicular origin), those with an average log2 expression level superior or equal to 8 and a log2 fold change inferior to -1 were selected.
1.7 SEC23A immunoblot analysis
Protein extracts were run as previously described (Brest P. et al. 201 1 MiR-129- 5p is required for histone deacetylase inhibitor-induced cell death in thyroid cancer cells. Endocr Relat Cancer 18 71 1 -719). Membranes were incubated either with rabbit anti- SEC23 antibody (1 :5,000, AB137583, Abeam, USA) or mouse anti-tubulin antibody
(1 :10,000, DM1 A clone, Sigma Aldrich, USA) as a loading control. Antibodies were detected with a HRP-conjugated anti-mouse or anti-rabbit antibody (1 :6,000, Santa Cruz Biotechnology, USA) using the Enhanced Chemiluminescence detection system (Pxi, Syngene).
1.8 SEC23A immunohistochemistry
Anti-SEC23A immunostaining was performed on 3μηι thick whole tissue sections of 14 MTC FFPE tumors and 13 thyroid follicular tumors (8 papillary carcinomas and 4 follicular carcinomas), using the polyclonal rabbit antibody provided by Abeam (AB137583). Immunostaining was performed with a Ventana® Benchmark immunostainer (Roche Diagnostics, Meylan, France) using the Ventana Ultraview detection kit, following the manufacturer's procedure (CC2© pre-treatment for 60min, antibody dilution at 1 :200, incubation at 37°C for 32min, UltraView detection kit© without UltraView Amplification©). Slides were freshly cut less than two weeks before IHC technique and stored at 4°C before use. SEC23A antibody staining was blindly analyzed by three pathologists (S.L, V.H. and E.L).
1.9 Nthy ORI 3.1 _FUCCI-2A cell line and Cell cycle analysis
Replication-defective, self-inactivating retroviral constructs were used for establishing a stable Nthy ORI 3.1 _FUCCI-2A cell line. The pPRIPu CrUCCI plasmid was obtained from Celine Feillet and Frank Delaunay and cell lines were generated as previously described (Feillet C. et al. 2014 Phase locking and multiple oscillating attractors for the coupled mammalian clock and cell cycle. Proc Natl Acad Sci U S A 111 9828- 9833). Based on their fluorescence, single cells were analysed post-transfection using a BD FACS ARIA (Becton Dickinson). Non-marked: Early G1 , Kusabira-Orange 2 (mK02) only: G1 , mK02 + Azami-Green 1 (mAG1 ): Early S, mAG1 only: S/G2/M. mK02 and mAG1 were excited with 561 nm and 488 nm laser lines, respectively. Fluorescence was collected at 585 nm (585/15 BP) for mK02 and at 530 nm (530/30 BP) for Geminin. The experiment was done in triplicate.
1.10 Statistical analysis
The Prism6 program was used for statistical analysis (Graphpad Software, La Jolla, CA, USA). The results were evaluated for statistical significance by the Student's t- test or the ANOVA test. Error bars represent the S.D. of the mean. P values <0.05 were regarded as significant.
II. Results:
2.1 Specific microRNA expression profiles of MTC at diagnosis
The microRNA expression profiles were first determined for 40 MTC, corresponding to 14 HMTC with germinal RET mutations, and 26 SMTC with (1 1 cases) or without (15 cases) somatic RET mutations.
Sixty-four miRNA were the most highly discriminative miRNA modulated in tumor samples vs healthy tissue (average intensity >6, Log2 Ratio >1 or <-1 , adj. P. val<=0.05). MiR-375 was the most up-regulated and miR-451 the most down-regulated. These 2 miRNAs were selected for further validation by qPCR in 22 MTC (1 1 HMTC and 1 1 SMTC). As for the miRNA microarray analysis, the validation set yielded over-expression of miR-375 and under-expression of miR-451 in tumor vs non-tumor tissues.
Interestingly, miR-375 expression was gradually increased with disease progression, even after an adjustment of their percentage weightings based the estimation of C-cell content by calcitonin and haematoxylin staining. (Fig. 1 and Table 2).
Table 2: Altered miRNA expression in MTC (training set).
miRNAs miRNAs log2 Log 2 Mean Adj. P value (miRBase v.12) (miRBase v.20) Average Exp Ratio (JIN)
hsa-miR-375 hsa-miR-375 9.89 6.14 2.64E-27 hsa-miR-136 hsa-miR-136-5p 7.8 3.77 1 .49E-1 7 hsa-miR-487b hsa-miR-487b-3p 6.15 3.01 3.90E-1 7 hsa-miR-130a hsa-miR-130a-3p 9.22 -2.3 4.00E-1 6 hsa-miR-376c hsa-miR-376c-3p 7.24 3.67 1 .01 E-15 hsa-miR-127-3p hsa-miR-127-3p 6.4 3.6 2.90E-15 hsa-miR-129-3p hsa-miR-129-2-3p 7.54 4.22 3.69E-15 hsa-miR-199b-5p hsa-miR-199b-5p 6.92 -2.92 4.23E-15 hsa-miR-30a* hsa-miR-30a-3p 6.72 -2.45 8.70E-15 hsa-miR-20b hsa-miR-20b-5p 6.61 -2.18 5.36E-14 hsa-miR-193a-3p hsa-miR-193a-3p 7.5 -1 .6 1 .34E-13 hsa-miR-451 hsa-miR-451 a 13.22 -3.52 1 .57E-13 hsa-miR-200a hsa-miR-200a-3p 8.93 1 .7 2.08E-08 hsa-miR-30a hsa-miR-30a-5p 9.96 -1 .93 1 .44E-10 hsa-let-7i hsa-let-7i-5p 10.69 -2 7.38E-13 hsa-miR-376a hsa-miR-376a-3p 6.6 2.93 9.17E-13 hsa-miR-10a hsa-miR-10a-5p 8.26 2.1 7 1 .41 E-10 hsa-miR-30c hsa-miR-30c-5p 9.23 -1 .75 2.62E-08 hsa-miR-221 hsa-miR-221 -3p 7.26 2.23 6.80E-09 hsa-miR-429 hsa-miR-429 7.83 2.37 7.78E-12 hsa-miR-20a hsa-miR-20a-5p 8.1 6 -2.01 3.03E-1 1 hsa-miR-200b hsa-miR-200b-3p 9.37 1 .45 1 .15E-06 hsa-miR-17 hsa-miR-1 7-5p 7.41 -1 .44 1 .29E-10 hsa-miR-222 hsa-miR-222-3p 7.67 2.23 5.26E-10 hsa-miR-30e* hsa-miR-30e-3p 6.38 -1 .85 2.53E-10 hsa-miR-144 hsa-miR-144-3p 10.19 -2.68 2.96E-10 hsa-miR-126 hsa-miR-126-3p 10.27 -1 .97 6.44E-10 hsa-miR-150 hsa-miR-150-5p 7.33 -2.91 1 .04E-09 hsa-miR-223 hsa-miR-223-3p 7.85 -2.2 1 .19E-09 hsa-miR-100 hsa-miR-100-5p 9.03 -1 .79 1 .67E-09 hsa-miR-365 hsa-miR-365a-3p 7.72 -1 .42 1 .03E-08 hsa-miR-7 hsa-miR-7-5p 10.31 2.74 1 .38E-08 hsa-miR-19a hsa-miR-19a-3p 8.08 -1 .35 3.26E-08 hsa-miR-135b hsa-miR-135b-5p 7.39 -2.01 3.27E-08 hsa-miR-218 hsa-miR-218-5p 6.62 -1 .75 3.98E-08 hsa-let-7g hsa-let-7g-5p 10.31 -1 .66 1 .91 E-07 hsa-miR-335 hsa-miR-335-5p 6.73 2.33 3.04E-07 hsa-let-7f hsa-let-7f-5p 1 1 .83 -1 .43 9.04E-07 hsa-miR-199a-3p hsa-miR-199a-3p 9.36 -1 .95 2.93E-07 hsa-miR-338-3p hsa-miR-338-3p 7.63 1 .02 7.21 E-04 hsa-miR-96 hsa-miR-96-5p 6.63 1 .66 1 .43E-05
hsa-miR-126* hsa-miR-126-5p 6.51 -1.83 1.49E-06
hsa-miR-214 hsa-miR-214-3p 7.45 -1.51 1.95E-06
hsa-miR-324-5p hsa-miR-324-5p 6.79 1.1 6.04E-05
hsa-let-7d hsa-let-7d-5p 8.84 -1.44 5.99E-06
hsa-miR-15b hsa-miR-15b-5p 9.21 -1.23 6.13E-06
hsa-miR-195 hsa-miR-195-5p 8.62 -1.34 6.80E-06
hsa-miR-181c hsa-miR-181 c-5p 6.35 1.22 6.99E-06
hsa-miR-148a hsa-miR-148a-3p 8.9 -1.58 7.30E-06
hsa-miR-135a hsa-miR-135a-5p 9.12 -1.67 4.03E-05
hsa-miR-185 hsa-miR-185-5p 7.17 -1.01 2.74E-05
hsa-miR-199a-5p hsa-miR-199a-5p 8.3 -1.29 3.04E-05
hsa-miR-301a hsa-miR-301 a-3p 6.93 1.17 1.31 E-04
hsa-miR-26b hsa-miR-26b-5p 10.14 -1.31 1.29E-04
hsa-miR-486-5p hsa-miR-486-5p 7.78 -1.41 6.46E-05
hsa-miR-557 hsa-miR-557 6.29 1.36 6.46E-05
hsa-miR-142-3p hsa-miR-142-3p 9.69 -2 7.68E-05
hsa-miR-21 hsa-miR-21 -5p 13.06 0.99 2.21 E-02
hsa-let-7a hsa-let-7a-5p 12.17 -1.19 5.32E-04
hsa-miR-146a hsa-miR-146a-5p 6.77 -1.42 1.02 E-04
hsa-miR-143 hsa-miR-143-3p 7.73 -0.99 1.87E-04
hsa-miR-424 hsa-miR-424-5p 8.78 -1.33 1.37E-03
hsa-miR-142-5p hsa-miR-142-5p 7.13 -1.9 2.49E-04
hsa-miR-10b hsa-miR-10b-5p 7.09 -1 4.13E-04
2.2 Identification of miR-375-target genes
To determine the appropriate cell line for study, miR-375 expression was screened in B-CPAP (papillary thyroid carcinoma cell line), Nthy ORI 3.1 (normal follicular immortalized thyroid cell line), CAL62 and 8505C (thyroid anaplastic carcinoma cell lines) and TT thyroid cell line (HMTC, RET MEN2A).
The results showed that miR-375 expression was restricted to the TT cell line (Fig. 2). The transfection of either miR-375 in Nthy ORI 3.1 control cells or antagomiR-375 in TT cells, respectively was then performed. MiR-375 target genes in the context of MTC are expected to be down-regulated in premiRNA-375 transfected Nthy ORI 3.1 cells and up-regulated in the antagomiR-375 transfected TT cells.
In parallel, the MTC-specific differential mRNA expression levels in the 12 (5 anaplastic, 5 follicular, 1 papillary, 1 medullary) thyroid cancer cell lines from the CCLE public (dataset GSE36133) was performed. Genes under-expressed in the TT cell line and predicted as targets of miR-375 have been defined (TargetScan V6.0) (Le Brigand K,
Robbe-Sermesant K, Mari B & Barbry P 2010 MiRonTop: mining microRNAs targets across large scale gene expression studies. Bioinformatics 26 3131 -3132).
Finally, candidate genes retained were:
i) down-regulated in TT cells vs other cell lines and in silico predicted to be targeted by miR-375,
ii) down-regulated in premiR-375 transfected Nthy ORI 3.1 cells, and iii) up-regulated in the antagomiR-375 transfected TT cells.
Overall, by combining in silico and in vitro datasets, a reliable set of 3 candidate genes (SEC23A, MAT2B, KIAA 1 191) specifically modulated by miR-375 in MTC (Fig. 3) was defined.
2.3 Down-regulation of SEC23A is a reliable marker of high miR-375 expression in MTC
SEC23A expression was validated at the protein level in MTC by immunoblotting and immunohistochemistry. The SEC23A protein expression level was low in TT cells in comparison with Nthy-ori 3-1 cells (Fig. 4). As expected, the SEC23A levels decreased after transfection with a miR-375 mimic (Fig. 4A), while SEC23A expression was increased in TT cells transfected with the antagomiR-375, according to the microarray results. Immunohistochemical analysis of MTC tissue confirmed the decreased in SEC23A cytoplasmic expression in tumor sections when compared to non-tumor tissues and non-MTC thyroid carcinomas (Fig. 4B).
In conclusion, these results showed an inverse correlation between miR-375 and SEC23A expression.
2.4 MiR-375 is associated with decreased cell proliferation and responsiveness to vandetanib treatment
2.4.1 Effect of miR-375 on the cell cycle.
A cell cycle-reporter (Nthy ORI 3.1 FUCCI-2A) cell line was generated and transfected with miR-375. Expression of miR-375 in Nthy ORI 3.1 cells decreased cell proliferation after 24h as shown by both a reduction in S/G2 of the cell cycle together with an increase in the percentage of cells in G1 (Fig. 5A).
At 72 h, this anti-proliferative effect was easily visualized by microscopy with a strong difference of confluence between miR-375 transfected cells and control cells (Fig 5B). Moreover, miR-375 transfected cells showed increased mortality as evidenced by a significant increase in the number of dead cells (Fig. 5B) and in PARP cleavage (Fig.
5E). PARP cleavage resulted in a fragment at 72 kDa, which may be compatible with activation of calpains, rather than the expected caspase cleavage at 95 kDa.
2.4.2. Effect of vandetanib in combination with miRNA-375.
Vandetanib markedly decreased proliferation of Nthy ORI 3.1 cells. Addition of miR-375 increased the effect of the drug, as shown by a stronger decrease in proliferation and pronounced increase in dead cells (Fig. 5C and D) (P value 5 x 10~5). This effect was also associated with strong inhibition of the phosphorylated form of AKT/PKB and increased accumulation of PARP cleavage (Fig 5E).
To demonstrate that endogenous levels of miR-375 were sufficient to mediate this effect, TT cells were transfected with antagomiR-375 and treated with vandetanib. AntagomiR-375 significantly reduced the mortality of TT cells induced by vandetanib compared to either antagomiR-CTL or lipofectamine alone (Fig. 5D).
SEC23A was silenced (siSEC23A) in Nthy-ori 3-1 cells using 2 different siRNAs. Decreased proliferation and increased toxicity was observed in cells silenced for SEC23A, in line with the pro-apoptotic effect of miR-375. An increased cell mortality in the presence of vandetanib was also found, underscoring that SEC23A down- regulation is associated with the miR-375-mediated sensitization of vandetanib (Fig. 6).
Together, these results demonstrated that the miR-375/SEC23A couple regulated thyroid tumor cell proliferation and miR-375 over-expression together with SEC23A down- regulation potentiate the therapeutic effect of vandetanib.
In conclusion, miR-375 over-expression resulted in a decrease in cell proliferation and increase in apoptosis of the transfected cells compared to control cells. This effect is mediated through SEC23A since siSEC23A were associated with decreased proliferation and increased cell death. In addition, miR-375 over-expression increased the responsiveness of transfected cells to vandetanib, with a stronger decrease in cell proliferation associated with a large increase in dead cells in transfected cells compared to control cells. Interestingly, the decrease in SEC23A was sufficient for vandetanib responsiveness, since siSEC23A showed an improvement in the vandetanib response.
MiR-375 over-expression and/or SEC23A down-regulation improves the efficacy of vandetanib in tumor cells.
Claims
1 . A method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma (MTC) comprising a step of detecting the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells of said patient.
2. The method according to claim 1 , comprising the following steps:
i) measuring the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in MTC cells;
ii) comparing the level of expression with a reference value; and
iii) determining therefrom the responsiveness to vandetanib of said patient.
3. The method according to claim 2, wherein the reference value is the level of expression of the miRNA-375 and/or precursors thereof and/or of the SEC23A gene in at least one non-cancer cell.
4. The method according to claim 2 or 3, wherein an increase in the level of expression of the miRNA-375 and/or precursors thereof in MTC cells compared to the reference value is indicative of the responsiveness to vandetanib of said patient.
5. The method according to claim 2 or 3, wherein a decrease in the level of expression of the SEC23A gene in MTC cells compared to the reference value is indicative of the responsiveness to vandetanib of said patient.
6. The method according to any one of claims 1 to 5, wherein the MTC is a persistent or recurrent MTC.
7. The method according to any one of claims 1 to 6, wherein the MTC is a metastatic MTC.
8. The method according to any one of claims 1 to 7, wherein the MTC is a refractory MTC.
9. An inhibitor of the SEC23A gene expression for use in the treatment of MTC.
10. The inhibitor of the SEC23A gene expression for use according to claim 9, in combination with vandetanib.
1 1 . The inhibitor of the SEC23A gene expression for use according to claim 9 or 10, wherein the patient to be treated is non-responsive to vandetanib.
12. The inhibitor of the SEC23A gene expression for use according to any one of claims 9 to 1 1 , wherein the MTC is a persistent or a recurrent MTC.
13. The inhibitor of the SEC23A gene expression for use according to any one of claims 9 to 12, wherein the MTC is a metastatic MTC.
14. A method of treatment of a patient suffering from MTC comprising the administration to said patient of a therapeutically effective amount of an inhibitor of the SEC23A gene expression.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16305099.0 | 2016-02-01 | ||
| EP16305099 | 2016-02-01 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017134115A1 true WO2017134115A1 (en) | 2017-08-10 |
Family
ID=55359479
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/052168 Ceased WO2017134115A1 (en) | 2016-02-01 | 2017-02-01 | Method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017134115A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439752A (en) * | 2018-11-16 | 2019-03-08 | 上海派森诺医学检验所有限公司 | A kind of specific primer sets and its kit and application thereof identifying medullary carcinoma of thyroid gland RET gene mutation |
| CN113755567A (en) * | 2020-06-03 | 2021-12-07 | 无锡准因生物科技有限公司 | Application of lncRNA in the diagnosis of Hashimoto's thyroiditis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008029123A1 (en) * | 2006-09-07 | 2008-03-13 | Astrazeneca Ab | Method for evaluating patients for treatment with drugs targeting ret receptor tyrosine kinase |
| WO2012068400A2 (en) * | 2010-11-17 | 2012-05-24 | Asuragen, Inc. | Mirnas as biomarkers for distinguishing benign from malignant thyroid neoplasms |
| WO2013134786A2 (en) * | 2012-03-09 | 2013-09-12 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
-
2017
- 2017-02-01 WO PCT/EP2017/052168 patent/WO2017134115A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008029123A1 (en) * | 2006-09-07 | 2008-03-13 | Astrazeneca Ab | Method for evaluating patients for treatment with drugs targeting ret receptor tyrosine kinase |
| WO2012068400A2 (en) * | 2010-11-17 | 2012-05-24 | Asuragen, Inc. | Mirnas as biomarkers for distinguishing benign from malignant thyroid neoplasms |
| WO2013134786A2 (en) * | 2012-03-09 | 2013-09-12 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
Non-Patent Citations (5)
| Title |
|---|
| ABRAHAM D ET AL: "MicroRNA profiling of sporadic and hereditary medullary thyroid cancer identifies predictors of nodal metastasis, prognosis, and potential therapeutic targets", CLINICAL CANCER RESEARCH, THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 17, no. 14, 15 July 2011 (2011-07-15), pages 4772 - 4781, XP002690703, ISSN: 1078-0432, [retrieved on 20110527], DOI: 10.1158/1078-0432.CCR-11-0242 * |
| JENA HUDSON ET AL: "Overexpression of miR-10a and miR-375 and downregulation of YAP1 in medullary thyroid carcinoma", EXPERIMENTAL AND MOLECULAR PATHOLOGY., vol. 95, no. 1, 1 August 2013 (2013-08-01), US, pages 62 - 67, XP055284440, ISSN: 0014-4800, DOI: 10.1016/j.yexmp.2013.05.001 * |
| JUSTIN S. GUNDARA ET AL: "Nodal metastasis microRNA expression correlates with the primary tumour in MTC", ANZ JOURNAL OF SURGERY, vol. 84, no. 4, 16 October 2012 (2012-10-16), AU, pages 235 - 239, XP055284448, ISSN: 1445-1433, DOI: 10.1111/j.1445-2197.2012.06291.x * |
| MANAV KORPAL ET AL: "Direct targeting of Sec23a by miR-200s influences cancer cell secretome and promotes metastatic colonization", NATURE MEDICINE., vol. 17, no. 9, 7 August 2011 (2011-08-07), US, pages 1101 - 1108, XP055284409, ISSN: 1078-8956, DOI: 10.1038/nm.2401 * |
| SANDRA LASSALLE ET AL: "MicroRNA-375/SEC23A as biomarkers of the <i>in vitro<i></i> efficacy of vandetanib", ONCOTARGET, vol. 7, 29 March 2016 (2016-03-29), XP055284404, DOI: 10.18632/oncotarget.8458 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439752A (en) * | 2018-11-16 | 2019-03-08 | 上海派森诺医学检验所有限公司 | A kind of specific primer sets and its kit and application thereof identifying medullary carcinoma of thyroid gland RET gene mutation |
| CN109439752B (en) * | 2018-11-16 | 2022-02-15 | 上海派森诺医学检验所有限公司 | Specific primer combination for identifying medullary thyroid carcinoma RET gene mutation, kit and application thereof |
| CN113755567A (en) * | 2020-06-03 | 2021-12-07 | 无锡准因生物科技有限公司 | Application of lncRNA in the diagnosis of Hashimoto's thyroiditis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huang et al. | miR-140-3p functions as a tumor suppressor in squamous cell lung cancer by regulating BRD9 | |
| Dong et al. | MiR-140-3p suppressed cell growth and invasion by downregulating the expression of ATP8A1 in non-small cell lung cancer | |
| Zhou et al. | MiR-135a promotes growth and invasion of colorectal cancer via metastasis suppressor 1 in vitro | |
| Di Martino et al. | In vitro and in vivo anti-tumor activity of miR-221/222 inhibitors in multiple myeloma | |
| Waltering et al. | Androgen regulation of micro‐RNAs in prostate cancer | |
| Bakirtzi et al. | Neurotensin signaling activates microRNAs-21 and-155 and Akt, promotes tumor growth in mice, and is increased in human colon tumors | |
| Pichiorri et al. | In vivo NCL targeting affects breast cancer aggressiveness through miRNA regulation | |
| Nurzadeh et al. | A comprehensive review on oncogenic miRNAs in breast cancer | |
| Lassalle et al. | MicroRNA-375/SEC23A as biomarkers of the in vitro efficacy of vandetanib | |
| Ciesla et al. | Heme oxygenase-1 controls an HDAC4-miR-206 pathway of oxidative stress in rhabdomyosarcoma | |
| EP3063276B1 (en) | Micrornas modulating the effect of glucocorticoid signaling | |
| Zhang et al. | MicroRNA-127-3p inhibits proliferation and invasion by targeting SETD8 in human osteosarcoma cells | |
| Zhang et al. | MicroRNA‐146a targets PRKCE to modulate papillary thyroid tumor development | |
| JP6153932B2 (en) | MicroRNA-based methods and assays for osteosarcoma | |
| US20140154303A1 (en) | Treating cancer by inhibiting expression of olfm4, sp5, tob1, arid1a, fbn1 or hat1 | |
| US9322015B2 (en) | Methods of using microRNA-26a to promote angiogenesis | |
| US9789132B2 (en) | Methods targeting miR-128 for regulating cholesterol/lipid metabolism | |
| US12121534B2 (en) | Agents and methods for treating pancreatic ductal adenocarcinomas | |
| Pouliot et al. | Contributions of microRNA dysregulation to cisplatin resistance in adenocarcinoma cells | |
| Liu et al. | miR-153 enhances the therapeutic effect of gemcitabine by targeting Snail in pancreatic cancer | |
| Liu et al. | Silencing circRNA protein kinase C iota (circ-PRKCI) suppresses cell progression and glycolysis of human papillary thyroid cancer through circ-PRKCI/miR-335/E2F3 ceRNA axis | |
| Mizbani et al. | MicroRNA deep sequencing in two adult stem cell populations identifies miR-501 as a novel regulator of myosin heavy chain during muscle regeneration | |
| Zhang et al. | Lin28B promotes melanoma growth by mediating a microRNA regulatory circuit | |
| WO2017134115A1 (en) | Method for determining responsiveness to vandetanib in a patient suffering from medullary thyroid carcinoma | |
| Li et al. | Micro ribonucleic acid‐93 promotes proliferation and migration of esophageal squamous cell carcinoma by targeting disabled 2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17703111 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17703111 Country of ref document: EP Kind code of ref document: A1 |

