WO2017132541A1 - A method for monitoring cancer and for regulation of semaphorin 4d to improve cancer immunotherapy regimens - Google Patents

A method for monitoring cancer and for regulation of semaphorin 4d to improve cancer immunotherapy regimens Download PDF

Info

Publication number
WO2017132541A1
WO2017132541A1 PCT/US2017/015395 US2017015395W WO2017132541A1 WO 2017132541 A1 WO2017132541 A1 WO 2017132541A1 US 2017015395 W US2017015395 W US 2017015395W WO 2017132541 A1 WO2017132541 A1 WO 2017132541A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
sema4d
semaphorin
cancer
tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/015395
Other languages
French (fr)
Inventor
Rania H. YOUNIS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Maryland Baltimore
University of Maryland College Park
Original Assignee
University of Maryland Baltimore
University of Maryland College Park
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Maryland Baltimore, University of Maryland College Park filed Critical University of Maryland Baltimore
Priority to US16/071,133 priority Critical patent/US10973843B2/en
Publication of WO2017132541A1 publication Critical patent/WO2017132541A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/864Parvoviral vectors, e.g. parvovirus, densovirus
    • C12N15/8645Adeno-associated virus
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/715Assays involving receptors, cell surface antigens or cell surface determinants for cytokines; for lymphokines; for interferons
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/56Staging of a disease; Further complications associated with the disease

Definitions

  • the field of the invention relates generally to the field of medicine and cancer biology.
  • HNSCC Head and Neck squamous cell carcinoma
  • MDSC Myeloid Derived Suppressor cells
  • MDSC Circulating MDSC correlated with advanced stages of HNSCC (stages III and IV) as well as in other carcinomas (Vasquez-Dunddel et al, 2013. J Clin Invest 123 : 1580-1589; Filipazzi et al, 2012. Cancer Immunol Immunother 61 : 255-263; Vuk-Pavlovic et al, 2010. Prostate 70: 443-455).
  • MDSC represent a key player in immune regulation in the tumor microenvironment. It is generally agreed that they comprise a heterogeneous population of myeloid progenitor cells and immature myeloid cells that have a suppressive function on T cells (Gabrilovich et al, 2009.
  • MDSC described in human malignancies have the phenotype of CD33 + , CDl lb + , and non-lineage determined (Lin " ) with poor antigen presentation abilities (HLA-DR “/low ). They can have a pro-granulocytic phenotype expressing CD66b or CD15 (PM L-MDSC) or monocytic features (M-MDSC) expressing CD14 (Filipazzi et al, 2012. Cancer Immunol Immunother 61 : 255-263; Lechner et al, 2010. J Immunol 185: 2273-2284; Gabrilovich et al, 2012.
  • MDSC induce their immune suppressive effect mainly through production of arginase-1 and inducible nitric oxide (iNOS) which consume extracellular arginine and accordingly suppress T cell activation in an antigen non-specific manner in the tumor microenvironment. While they mediated antigen specific suppression by NADPH oxidase (NOX2) production of reactive oxygen and nitrogen species, particularly in peripheral lymphoid tissue, as well as by other mechanisms (Gabrilovich et al, 2009. Nat Rev Immunol 9: 162-174; Gabrilovich et al, 2012. Nat Rev Immunol 12: 253-268; Condamine et al, 2011. Trends Immunol 32: 19-25; Corzo et al, 2010.
  • NOX2 NADPH oxidase
  • Semaphorin 4D (Sema4D; CD 100) is a transmembrane glycoprotein belonging to the fourth group of the Semaphorin family that can also be found in a soluble form following proteolytic cleavage. It was initially identified as an evolutionarily conserved chemo- repellant protein that regulates axonal guidance in the developing nervous system (Kolodkin et al, 1993. Cell 75: 1389-1399).
  • Sema4D is described to be expressed abundantly on resting T cells and weakly on resting B cells and APCs (Delaire et al, 1998. Cell Mol Life Sci 54: 1265-1276; Roth et al, 2009. Cell Mol Life Sci 66: 649-666; Bismuth et al, 2002. Sci STKE 2002: re4; Shi et al, 2000. Immunity 13 : 633-642; Tamagnone et al, 2004. EMBO Rep 5: 356-361). Two opposing roles of Sema4D have been described in the immune system.
  • Sema4D acts on B cells and dendritic cells, respectively, promoting pro- inflammatory cytokines (Shi et al., 2000. Immunity 13 : 633-642; Tamagnone et al., 2004. EMBO Rep 5: 356-361 ; Ishida et al, 2003. Int Immunol 15: 1027-1034). Sema4D expressed by T cells and K cells has also been implicated in their activation through a Sema4D associated tyrosine kinase (Elhabazi etal, 1997.
  • Sema4D produced by tumor cells in inducing tumor angiogenesis, invasiveness and progression has been demonstrated in several malignancies, both in human and animal models, and correlates with poor prognosis (Basile et al, 2006. Proc Natl Acad Sci U S A 103 : 9017-9022; Zhou et al, 2012. Exp Cell Res 318: 1685-1698; Zhou et al., 2012. Angiogenesis; Mu et al., 2014. Zhonghua Wei Chang Wai Ke Za Zhi 17: 388-392; Liu et al, 2014. Microvasc Res 93 : 1-8; Ch'ng, et al, 2010. Mol Cancer 9: 251; Chen et al, 2012.
  • Sema4D overexpression has been described in a large number of human HNSCC tumor tissue samples and in a panel of primary and metastatic cell lines (Basile et al, 2006. Proc Natl Acad Sci U S A 103 : 9017- 9022).
  • TAMs tumor associated macrophages
  • HNSCC derived Sema4D plays a role in inducing MDSC and its effects were examined on T cell phenotype and function. It was found that Sema4D produced by the HNSCC HN6 and HN13 cell lines polarized myeloid cells into MDSC phenotype, which corresponded with a reduction in T cell proliferation and IFN- ⁇ production.
  • HNSCC-associated Sema4D production as one of the mechanisms by which the tumors induce MDSC, that subsequently mediate their immunosuppression effects on T cells.
  • the invention relates to a rapid and sensitive method for monitoring certain cancers such as head and neck squamous cell carcinoma and lymphomas.
  • the invention relates to methods for improving certain cancer immunotherapy treatment regimens based on the cytokine Semaphorin 4D.
  • the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
  • the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject undergoing immunotherapy, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
  • the immunotherapeutic agent comprises T cells.
  • the invention provides a method of screening for an agent that has anti-cancer activity, comprising i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; and ii) assaying whether Semaphorin 4D activity is reduced, wherein if Semaphorin 4D activity is reduced, the agent has anti-cancer activity.
  • the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid-derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti -cancer activity.
  • the invention provides a method of monitoring progression of cancer in a subject, comprising i) obtaining a tissue sample from the subject; and ii) assaying the sample for the presence of Semaphorin 4D, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
  • the invention provides a composition for inhibiting tumor- mediated immunosuppression in a subject and thereby treating cancer, comprising a nucleic acid that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D and a pharmaceutically acceptable carrier.
  • FIG. 1 HNSCC conditioned media polarizes myeloid cells towards a MDSC phenotype.
  • CD33 + cells were cultured in normal media (NM) or HNSCC conditioned media (HN6, HN13) for 72hrs, and then analyzed by flow cytometry.
  • B Dose dependent induction of MDSC following culture in HNSCC condition media.
  • CD33 + cells were cultured in serial dilutions of HN6 CM and
  • C HN13 CM. Cells were first gated for CD33 + then for CDl lb + , followed by a third gate for CDl lb + HLA-DR "/low .
  • CD33 cells were isolated using magnetic cell sorting (MACS), from PBMC separated by centrifugation gradient of peripheral blood. All samples were run in duplicates.
  • NM Normal media, CM; Conditioned medium.
  • A Sema4D is secreted by HN6 and HN13 cell lines. CM and total cell lysates from HN6 and HN13 HNSCC cell lines were analyzed by Western blot. Ponceau staining was used as a control for protein loading prior to immunoblotting. ⁇ -actin served as control for cell lysates.
  • B Anti-sema4D antibody treatment downregulates MDSC induction by HNSCC cells.
  • CD33 + cells were cultured in NM, NOK, HN6 and HN13 CM in the presence or absence of anti-Sema4D mAb (10 ug/ml) or isotype control mAb for 72hrs. Cells were analyzed by flow cytometry by gating on CD33 + CD1 lb + , then analyzed for CD1 lb + HLA- DR _ /low . The experiment was independently repeated twice.
  • C Graphical presentation of
  • FIG. 3 Inhibition of Sema4D produced by HN6 rescues MDSC mediated T cell suppression.
  • A Recovery of T cell proliferation following inhibition of Sema4D in HN6 cell line using lentivirus shRNA. T cells stained with CFSE and myeloid cells were added at the indicated ratios (M:T). Cells were co-cultured in CM from HN6 Sema4D-shRNA or HN6 Ctl-shRNA, and activated by anti-CD3/CD28 microbeads for 72hrs. CFSE dilution in T cells was analyzed by FACS.
  • B Graphical representation of flow cytometry data shown in A. Data normalized to activated T cells cultured alone in NM. The supernatants were collected to assess IFN- ⁇ (C) and IL-4 (D) production using ELISA. Error bars indicate S.D. of triplicate assays.
  • FIG. 4 Sema4D produced by HN6 induces an immune suppressive T cell phenotype.
  • T cells were co-cultured with myeloid cells at the indicated ratios, followed by CD3/CD28 activation for 72hrs. Then cells were analyzed by flow cytometry.
  • A The cells were gated on the myeloid and T cell subpopulations, followed by a second gate on CD3 + cells. CD3 + cells were then gated on (B) CD4 + T-bet + and (C) CD8 + T-bet + .
  • the CD4 + population was gated on CD25 + FoxP3 + .
  • FIG. 5 Sema4D enhances GM-CSF + IL-6 mediated induction of MDSC.
  • A The percentage of CD33 + HLA-DR- /low MDSC induced by culture in HN6 CM is reduced following Sema4D or GM-CSF immune precipitation (IP) HN6 CM.
  • IP GM-CSF immune precipitation
  • B Graph shows comparable decrease in the CD33 + HLA-DR "/low population following immune depletion of Sema4D or GM-CSF, compared to the control HN6 CM.
  • C HN6 CM was depleted of Sema4D or GM-CSF by immune precipitation (IP), then used to culture myeloid cells and T cells, followed by anti-CD3/CD28 stimulation.
  • IP immune precipitation
  • CD33 + cells separated from PBMC of normal donors were cultured in NM with the recombinant protein GM-CSF alone, or GM-CSF+ IL-6 or the cytokine induction mixture of GM-CSF + IL-6 + Sema4D.
  • Each of the recombinant proteins was used at a concentration of lOng/ml.
  • A Sema4D promotes proliferation of total myeloid cells. Bulk CD33 + cells cultured in HN6 control or Sema4D-shRNA CM for 24hrs were analyzed using the WST-1 proliferation assay.
  • B Sema4D promotes proliferation of CD33 + HLA- DR "/low cells. CD33 + HLA-DR "/low cells were sorted using magnetic beads and analyzed by WST-1 proliferation assay. All readings were normalized to cells growing in NM. NT; non-transfected.
  • C Reconstitution of HN6 Sema4D-shRNA CM with human recombinant Sema4D rescues CD33 + HLA-DR- /low MDSC proliferation.
  • CD33 + HLA-DR "/low labeled with CFSE were analyzed by FACS.
  • D Sema4D inhibition in HN6 decreases arginase-1 expression in myeloid cells.
  • CD33 + cells were cultured in NT, Ctl-shRNA or Sema4D- shRNA HN6 CM for 24 hrs, and then analyzed by Western blot for arginase-1 expression. GAPDH served as a loading control. Densitometric analysis included for Western blot data were determined using Image J.
  • HN6 Sema4D-shRNA CM inhibits nitrite production by myeloid cells.
  • Total CD33 + cells were cultured in CM from HN6 Ctl-shRNA or HN6 Sema4D-shRNA for 72hrs, then the media was collected to detect the nitrite concentration using Griess reagent.
  • (F) CD33 + cells were cultured in HN6 Sema4D-shRNA or Ctl- shRNA CM and cytokine production was assessed by ELISA. Knockdown of Sema4D results in a decrease in IL-10 production by CD33 + cells.
  • HNSCC CM induces MDSC from total PBMC or myeloid cells of healthy donors and anti-Sema4D Ab treatment reduces its induction.
  • HNSCC CM induces MDSC from total PBMC. PBMC were separated by density gradient centrifugation then plated for 72hrs in M or CM from NOK versus CM of HN4, HN6, HN13 and SCC-9 cell lines. The average MDSC generation from PBMC was -20%. For flow cytometry analysis total PBMC were gated followed by a CD33 + HLA-DR "/l0 gate.
  • B Induction of MDSC from total CD33 + cells by HNSCC cell line CM is decreased by anti-Sema4D Ab treatment.
  • Total myeloid cells were gated for CD33 + CDl lb + followed by a CDl lb + HLA-DR "/l0 gate.
  • initial plating cell density was 1ml of 2.5 xlO 5 in 24 well plate.
  • NM Normal media.
  • CM conditioned media.
  • HN6 CM induces CD3 + CDl lb + HLA-DR "/low upon co-culture of total CD33 + cells with T cells.
  • B Inhibition of Sema4D production in HN6 using lentivirus Sema4D-shRNA (cell lysates).
  • C and in the supernatant CM.
  • D Graphical presentation of accumulative data of frequency for CD3 + CD4 + Tbet +
  • E CD3 + CD8 + Tbet + effector cells
  • F CD4 + CD25 + FOXP3 + Tregs in HN6 CM of Sema4D-shRNA versus Ctl-shRNA.
  • D, E, and F T cells at 2.5xl0 5 cell density were co-cultured with myeloid cells at the indicated M:T ratios, followed by CD3/CD28 activation. Cells were collected for flow cytometry analysis after 72hrs.
  • CD3 positive cells were gated for CD4 + Tbet + and CD8 + Tbet + , then CD3+ were gated for CD4 + then for a CD25 + FOXP3 + . Samples were run in duplicates. Graphical presentation is normalized to activated T cells growing alone in NM.
  • FIG. 9 Characterization of commercially available Sema4D Abs for ELISA.
  • An indirect ELISA was performed in which plates were coated with serial dilutions of Sema4D recombinant protein (Peprotech), then incubated with the indicated Abs to determine which Abs could be used for ELISA.
  • BD - mouse anti-Human (IgGi) eBioscience- mouse anti- Human (IgM)
  • Novus - Ab is biotinylated, avidin peroxidase was used.
  • FIG. 10 Sema4D levels are higher in patients with head and neck cancer, compared to sera from healthy donors (HD serum purchased from Atlanta Biologicals).
  • IHC shows Sema4D "ve/low expression in tumor cells of a stage I SCC of the nasal cavity.
  • B Sema4D "ve/low expression in tumor cells of Stage II SCC of the larynx. Moderate stromal infiltration with Sema4D +ve/hi h TAIs.
  • C Sema4D +ve/high expression in tumor cells of a stage III SCC of the upper Jaw.
  • FIG. 13 Sema4D high expression in tumor cells correlates directly with fibrosis and TGF- ⁇ production.
  • IHC shows Sema4D +ve/high expression in tumor islands with surrounding dense fibrotic stroma in a stage I SCC of the maxillary sinus.
  • B Sema4D +ve /hi g h ex p ress i on m tumor islands of a stage II Adenoid Cystic Carcinoma of minor salivary glands arising in the tongue, associated with dense fibrotic stroma.
  • C Sema4D +ve/hi s h expression in stage III SCC of the larynx and surrounding dense fibrotic stroma.
  • CM conditioned medium.
  • T Tumor, FS; fibrotic stroma, (20x; 200um scale, inset: 40x).
  • FIG. 14 Sema4D +ve/high expression in stromal infiltrating TAIs correlates inversely with its expression in tumor cells.
  • FIG. 15. Stratification of HNC tumors into 4 subtypes according to Sema4D and PD- Ll expression.
  • A-D. Sema4D +ve/high /PD-Lr ve/low tumor subtype.
  • C Total strong pixel intensity for Sema4D stain in (A) ⁇ 2xl0 6 .
  • D Total strong pixel intensity for PD-L1 stain in (B) ⁇ 10 4 .
  • Sema4D- ve/low /PD-Ll +ve/high tumor subtype (E) A stage IV SCC of the lip showed Sema4D "ve/low tumor cells with Sema4D +ve/high TAIs in the peri-tumoral stroma. (F) Same tumor as in (E) showed PD-Ll +ve/high tumor cells, TAIs were PD-Ll "ve/low . (G) Total strong pixel intensity of Sema4D stain in (E) of - 1.5xl0 5 . (H) Total strong pixel intensity for PD-Ll stain in (F) ⁇ 5.3xl0 6 . 1-L.
  • Sema4D- ve/low /PD-Lr ve/low tumor subtype Tumor cells of a stage III SCC of the larynx were Sema4D "ve/low , TAIs were Sema4D +ve/high .
  • J The same tumor as in (I), PD-Ll- ve/low for tumor cells and TAIs.
  • K Total strong pixel intensity for tumor stain in (I) ⁇ 10 4 .
  • (M) A stage III SCC of the larynx, with tumor cells Sema4D +ve/high with peri-tumoral fibrotic stroma showing focal Sema4D +ve/high TAIs.
  • (N) PD-Ll +ve/hi h in same tumor as in (M) TAIs were PD-L1 negative.
  • (O) Total strong pixel intensity for Sema4D stain in (M) 1.5xl0 6 .
  • (P) Total strong pixel intensity for PD-L1 stain in (N) ⁇ 4 xlO 6 . (20x; 200um scale, inset: 40x,pixel intensity was calculated as the mean of 3 annotation layers per tumor core taken at 20x; at area 0.2mm 2 . Cut off value for positive is 5xl0 5 ).
  • FIG. 16 Analysis of Sema4D in sera of HNC patients.
  • A ELISA assay of Sema4D in sera of HNC patients compared to HD (p ⁇ 0.0001). Two ranges of Sema4D level were detected, a low range group and a higher range group.
  • FIG. 17 A model for Sema4D +ve/high tumor cells with a fibrotic peri-tumoral stromal phenotype.
  • A Sema4D +ve/high tumor cells induce increased production of TGF- ⁇ which increases deposition of ECM and collagen fibers. This model is suggestive of high Sema4D levels in peripheral blood.
  • B Sema4D "ve/low tumor cells with inflamed stroma. Sema4D " ve /i ow ⁇ umors h as decreased level of TGF- ⁇ 1 production, less fibrotic and more into the loose peri-tumoral stroma with increased infiltrate of Sema4D +ve/high TAIs. This model is suggestive of low Sema4D levels in peripheral blood.
  • MDSC Myeloid derived suppressor cells.
  • TAIs Tumor Associated Inflammatory cells.
  • FIG. 18 Graphical presentation of the human HNC tumor samples
  • A Pie chart representative of the HNC tumors included in the study.
  • B Graphical presentation of the SCC cases included in the study according to tissue of origin. SCC; Squamous cell carcinoma, SGA; Salivary gland adenocarcinoma.
  • FIG. 19 Sema4D expression in the normal epithelium and epithelial tissue adjacent to tumor margin.
  • A Normal parakeratinized stratified squamous epithelium of the tongue is negative for Sema4D expression.
  • B Digital analysis of tissue in (A) showing negative
  • Sema4D expression (blue) through the entire thickness with only 6x10 strong positive pixel intensity.
  • C Normal parakeratinized stratified squamous epithelium showing Sema4D _ve/low expression with focal positivity in the prickle cells.
  • D Digital analysis of tissue in (C) shows negative (blue) to focal positive (orange) expression of the prickle cell layer with 3.5 xlO 4 of strong positive pixel intensity.
  • E Normal tongue epithelium showing focal Sema4D +ve/high expression in the parabasal cell layer.
  • the strong positive pixel intensity presented is the mean of three annotations of each tissue section. (20x; 200um scale, inset: 40x).
  • FIG. 20 Sema4D expression in normal salivary glands and epiglottis.
  • A Normal salivary gland acini and ducts, shows positive expression in the ductal cells (arrows), mucous and serous acini are negative.
  • B Normal epiglottis shows positive Sema4D expression in the lining epithelium (arrow) and focal expression in chondrocytes (dotted arrow) (20x; 200um scale).
  • FIG. 21 Standardization of Sema4D expression in tumor islands.
  • A Stage I SCC of the lip showing _ve/low expression of Sema4D in the annotated tumor island.
  • B Digital analysis of Sema4D staining in (A) showing low expression (yellow), in the tumor cells with low level of strong positive pixel intensity of 1.5xl0 5 .
  • C Stage III SCC of the left upper jaw, showing diffuse Sema4D +ve/high expression, with annotation set for digital analysis.
  • D Digital analysis of Sema4D expression in (C) showed high level of strong positive pixel intensity of l . lxlO 6 . The total intensity of strong positive pixels was calculated as the mean of three different annotations representative of the whole tumor, each annotation was analyzed under 200x magnification in an area of - 0. 2 mm 2 (20x; 200um scale, inset: 40x).
  • FIG. 22 Sema4D +ve/high TAIs.
  • A TAIs infiltrating the stroma of stage II SCC of the right palate were Sema4D +ve/high
  • B Digital analysis shows high Sema4D expression (red) in the TAIs with 1.3x10 6 strong positive pixel intensity (20x; 200um scale).
  • FIG. 23 PD-L1 expression in epithelial tissue adjacent to tumor margin and in tumor cells.
  • A PD-L1 is negative in tissue adjacent to tumor margin with a focal positive area (arrows).
  • B Digital analysis shows negative expression (blue) with focal positivity (arrows) (20x; 200um scale).
  • C Tumor cells of stage II SCC of the right palate shows PD-L1 +ve/hi s h expression in tumor cells, TAIs are PD-L1 negative.
  • D PD-L1 staining in (C) showed high level of strong positive pixel intensity of 5.5x10 6 (20x; 200um scale).
  • FIG. 24 Sema4D inhibition in HN6 cells recovers T cell proliferation and IFN- ⁇ production in Normoxic and hypoxic conditions.
  • the siRNA target sequence is CAAGACGCTGCAGTTCGTTAA (SEQ ID NO:7).
  • A-D Normoxic conditions.
  • A Flowcytometry analysis for tracking T cell proliferation using CFSE.
  • B Western blot showing Sema4D knock down in HN6 cells using siRNA.
  • C Graphical representation of T cell proliferation detected in A using Flowcytometry analysis.
  • E-G IFN- ⁇ levels upon inhibition of Sema4D detected using ELISA and read using spectrophotometer
  • E-G Recapitulating the tumor hypoxic conditions, incubating in 2% Oxygen in hypoxia chambers. CFSE stained T cells activated using anti-CD3, CD28 beads, proliferation detected using flow cytometry.
  • E Flowcytometry analysis for tracking T cell proliferation using CFSE under hypoxia.
  • F Graphical representation of T cell proliferation detected in E using Flowcytometry analysis.
  • G IFN- ⁇ levels upon inhibition of Sema4D under hypoxia, detected using ELISA and read using spectrophotometer
  • One of the mechanisms by which malignancies can induce immune suppression is through the production of cytokines that affect the maturation and differentiation of inflammatory cells in the tumor microenvironment.
  • the inventor has surprisingly discovered that inhibition of Semaphorin 4D inhibits tumor-mediated immunosuppression, and that inhibiting Semaphorin 4D can be employed in methods useful for treating cancer.
  • the inventor has also discovered methods which can be used in monitoring cancer progression involving monitoring detection of Semaphorin 4D.
  • Semaphorin 4D is a pro-angiogenic cytokine produced by several malignancies, which has been described in the regulation of the immune system. Described herein are studies which examined the role of human Head and Neck Squamous Cell Carcinoma (HNSCC) secreted Sema4D on myeloid cell differentiation.
  • HNSCC Human Head and Neck Squamous Cell Carcinoma
  • MDSC myeloid derived suppressor cells
  • Sema4D was comparative to GM- CSF in its induction of MDSC.
  • this work describes a novel immunosuppressive role for Sema4D in HNSCC through induction of MDSC, and highlights it as a therapeutic target to enhance the antitumorigenic inflammatory response in HNSCC and other epithelial malignancies.
  • the term "about” means plus or minus 10% of the numerical value of the number with which it is being used.
  • the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
  • Semaphorin 4D also known as CD 100, is a transmembrane protein that belongs to the semaphorin gene family. Semaphorin 4D is expressed on the cell surface as a homodimer, but upon cell activation Semaphorin 4D can be released from the cell surface via proteolytic cleavage to generate sSEMA4D, a soluble form of the protein, which is also biologically active. See Suzuki et al, Nature Rev. Immunol. 3 : 159-167 (2003); Kikutani et al., Nature Immunol. 9: 17-23 (2008).
  • the human Semaphorin 4D amino acid sequence is SEQ ID NO: l and the nucleotide sequence is SEQ ID NO:2.
  • Information about Semaphorin 4D gene sequences and variants can also be found in the NCBI gene database. See, e.g., htips://mvw.ncbi.nlrn.nih.gov/geiie/ (gene ID: 10507).
  • Semaphorin 4D is expressed on the surface of or secreted by a cell.
  • Semaphorin 4D is membrane bound.
  • Semaphorin 4D is soluble.
  • Semaphorin 4D may include a full-sized Semaphorin 4D or a fragment thereof, or a Semaphorin 4D variant polypeptide, wherein the fragment of Semaphorin 4D or Semaphorin 4D variant polypeptide retains some or all functional properties of the full-sized Semaphorin 4D.
  • the full-sized human Semaphorin 4D protein is a homodimeric transmembrane protein consisting of two polypeptide chains of 150 kDa. Semaphorin 4D belongs to the semaphorin family of cell surface receptors and is also referred to as CD 100. Both human and mouse Semaphorin 4D are proteolytically cleaved from their transmembrane form to generate 120-kDa soluble forms, indicating the existence of two Semaphorin 4D isoforms (Kumanogoh et al., J. Cell Science 116(7):3464 (2003)).
  • Semaphorins consist of soluble and membrane-bound proteins that were originally defined as axonal -guidance factors which play an important role in establishing precise connections between neurons and their appropriate target.
  • Structurally considered a class IV semaphorin Semaphorin 4D consists of an amino-terminal signal sequence followed by a characteristic ' Sema ' domain, which contains 17 conserved cysteine residues, an Ig-like domain, a lysine-rich stretch, a hydrophobic transmembrane region, and a cytoplasmic tail.
  • the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject undergoing immunotherapy, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
  • the immunotherapeutic agent comprises T cells.
  • the inhibition of Semaphorin 4D decreases the level of myeloid-derived suppressor cells in the tumor microenvironment.
  • the myeloid-derived suppressor cells have a phenotype that is CD33 + , CD1 lb + , and HLA- DR "/low .
  • the inhibition of Semaphorin 4D results in one or more of the following effects: i) an increase in T cell proliferation;
  • subject refers to animals, such as mammals.
  • mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like.
  • subject and patient can refer to therapeutic or prophylactic treatment.
  • those in need thereof of treatment include those already with a pathological condition of the invention (including, for example, a cancer), in which case treating refers to administering to a subject (including, for example, a human or other mammal in need of treatment) a therapeutically effective amount of a composition so that the subject has an improvement in a sign or symptom of a pathological condition of the invention.
  • the improvement may be any observable or measurable improvement.
  • a treatment may improve the patient's condition, but may not be a complete cure of the pathological condition.
  • those in need thereof of treatment include, those in which a pathological condition is to be prevented, in which case treating refers to administering a therapeutically effective amount of a composition to a subject (including, for example, a human or other mammal in need of treatment) at risk of developing a disease or condition such as cancer.
  • a “therapeutically effective amount” or “effective amount” is administered to the subject.
  • a “therapeutically effective amount” or “effective amount” is an amount sufficient to decrease, suppress, or ameliorate one or more symptoms associated with the disease or condition.
  • Cancer refers to leukemias, lymphomas, carcinomas, and other malignant tumors of potentially unlimited growth that can expand locally by invasion and potentially systemically by metastasis.
  • cancers include, but are not limited to, cancer of the adrenal gland, bone, brain, breast, bronchi, colon and/or rectum, gallbladder, head and neck, kidneys, larynx, liver, lung, neural tissue, pancreas, prostate, parathyroid, skin, stomach, and thyroid.
  • cancers include, acute and chronic lymphocytic and granulocytic tumors, adenocarcinoma, adenoma, basal cell carcinoma, cervical dysplasia and in situ carcinoma, Ewing's sarcoma, epidermoid carcinomas, giant cell tumor, glioblastoma multiforma, hairy-cell tumor, intestinal ganglioneuroma, hyperplastic corneal nerve tumor, islet cell carcinoma, Kaposi's sarcoma, leiomyoma, leukemias, lymphomas, malignant carcinoid, malignant melanomas, malignant hypercalcemia, marfanoid habitus tumor, medullary carcinoma, metastatic skin carcinoma, mucosal neuroma, myeloma, mycosis fungoides, neuroblastoma, osteo sarcoma, osteogenic and other sarcoma, ovarian tumor, pheochromocytoma, polycythermia vera, primary brain tumor,
  • the subject is administered one or more anti-cancer agents and/or radiotherapy in combination with the agent that inhibits Semaphorin 4D.
  • the anti-cancer agent is an immunotherapeutic agent.
  • administering the agent that inhibits tumor-mediated immunosuppression caused by Semaphorin 4D can bolster the effectiveness of the immunotherapeutic anti-cancer agent administered to the subject.
  • the cancer immunotherapy is not limiting and can include one or more immunotherapies.
  • immunotherapies can include monoclonal antibodies, checkpoint inhibitors/immune modulators, therapeutic cancer vaccines, oncolytic viruses, adoptive T cell transfer, cytokines, and adjuvant immunotherapy.
  • the combination of therapeutic agents discussed herein may be administered concurrently as a single composition in a pharmaceutically acceptable carrier, or concurrently as separate compositions with each agent in a pharmaceutically acceptable carrier.
  • the combination of therapeutic agents can be administered sequentially. The duration of time separating administrations in sequential administrations is not necessarily limiting.
  • the agent that inhibits Semaphorin 4D is combined with an immunogenic agent, such as cancerous cells, purified tumor antigens (including recombinant proteins, peptides, and carbohydrate molecules), cells, and cells transfected with genes encoding immune stimulating cytokines (He et al. (2004) J. Immunol. 173 :4919-28).
  • an immunogenic agent such as cancerous cells, purified tumor antigens (including recombinant proteins, peptides, and carbohydrate molecules), cells, and cells transfected with genes encoding immune stimulating cytokines (He et al. (2004) J. Immunol. 173 :4919-28).
  • the agent that inhibits Semaphorin 4D can be further combined with a vaccination protocol.
  • Many experimental strategies for vaccination against tumors have been devised (see Rosenberg, S. (2000) Development of Cancer Vaccines, ASCO Educational Book Spring: 60-62; Logothetis, C, 2000, ASCO Educational Book Spring: 300-302; Khayat, D. (2000) ASCO Educational Book Spring: 414-428; Foon, K. (2000) ASCO Educational Book Spring: 730-738; see also Restifo and Sznol, Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita et al. (eds.), 1997, Cancer: Principles and Practice of Oncology. Fifth Edition).
  • a vaccine is prepared using autologous or allogeneic tumor cells. These cellular vaccines have been shown to be most effective when the tumor cells are transduced to express GM-CSF. GM-CSF has been shown to be a potent activator of antigen presentation for tumor vaccination (Dranoff et al. (1993) Proc. Natl. Acad. Sci U.S.A. 90: 3539-43).
  • tumor specific antigens are differentiation antigens expressed in the tumors and in the cell from which the tumor arose. More importantly, many of these antigens can be shown to be the targets of tumor specific T cells found in the host.
  • the agent that inhibits Semaphorin 4D may be used in conjunction with one or more recombinant proteins and/or peptides expressed in a tumor in order to generate an immune response to these proteins. These proteins are normally viewed by the immune system as self-antigens and are, therefore, tolerant to them.
  • the tumor antigen may also include the protein telomerase, which is required for the synthesis of telomeres of chromosomes and which is expressed in more than 85% of human cancers and in only a limited number of somatic tissues (Kim et al. (1994) Science 266: 2011-2013). These somatic tissues may be protected from immune attack by various means. Tumor antigen may also be "neo-antigens" expressed in cancer cells because of somatic mutations that alter protein sequence or create fusion proteins between two unrelated sequences ⁇ i.e., bcr-abl in the Philadelphia chromosome), or idiotype from B cell tumors.
  • tumor vaccines may include the proteins from viruses implicated in human cancers such a Human Papilloma Viruses (HPV), Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV).
  • HPV Human Papilloma Viruses
  • HBV Hepatitis Viruses
  • KHSV Kaposi's Herpes Sarcoma Virus
  • Another form of tumor specific antigen which may be used in conjunction with Semaphorin 4D blockade is purified heat shock proteins (HSP) isolated from the tumor tissue itself. These heat shock proteins contain fragments of proteins from the tumor cells and these HSPs are highly efficient at delivery to antigen presenting cells for eliciting tumor immunity (Suot & Srivastava (1995) Science 269: 1585- 1588; Tamura et al. (1997) Science 278: 117-120).
  • DCs Dendritic cells
  • DCs are potent antigen presenting cells that can be used to prime antigen-specific responses.
  • DCs can be produced ex vivo and loaded with various protein and peptide antigens as well as tumor cell extracts (Nestle et al. (1998) Nature Medicine 4: 328-332).
  • DCs may also be transduced by genetic means to express these tumor antigens as well.
  • DCs have also been fused directly to tumor cells for the purposes of immunization (Kugler et al. (2000) Nature Medicine 6:332-336).
  • DC immunization may be effectively further combined with the agent that inhibits Semaphorin 4D to activate more potent anti-tumor responses.
  • Non-limiting examples of tumor vaccines that can also be used include peptides possible head and neck cancer antigens, such as p53, melanoma-associated antigens (MAGEs) such as MAGE-3, NY-ESO-1, cyclin Bl, caspase-8, SART-1, carcino- embryonal antigen, and extracellular matrix metalloproteinase inducer (EMMPRIN) (CD147).
  • MAGEs melanoma-associated antigens
  • EMMPRIN extracellular matrix metalloproteinase inducer
  • the peptides can be coupled with antigen presenting cells, such as dendritic cells in some embodiments.
  • Semaphorin 4D inhibiting agents can also be used in combination with bispecific antibodies that target Fca or Fey receptor-expressing effector cells to tumor cells (see, e.g., U.S. Pat. Nos. 5,922,845 and 5,837,243).
  • Bispecific antibodies can be used to target two separate antigens.
  • anti-Fc receptor/anti-tumor antigen ⁇ e.g., Her-2/neu
  • bispecific antibodies have been used to target macrophages to sites of tumor. This targeting may more effectively activate tumor specific responses.
  • the T cell arm of these responses could be augmented by the use of a Semaphorin 4D inhibiting agents.
  • antigen may be delivered directly to DCs by the use of bispecific antibodies which bind to tumor antigen and a dendritic cell specific cell surface marker.
  • a Semaphorin 4D inhibiting agent can be used in conjunction with anti -neoplastic antibodies, such as Rituxan® (rituximab), Herceptin® (trastuzumab), Bexxar® (tositumomab), Zevalin® (ibritumomab), Campath® (alemtuzumab), Lymphocide® (eprtuzumab), Avastin® (bevacizumab), and Tarceva® (erlotinib), Kadcyla® (ado-trastuzumab emtansine), Perjeta® (pertuzumab), Adcetris® (brentuximab vedotin), Erbitux® (cetuximab), Vectibix® (panitumumab), Gazyva® (obinutuzumab), Arzerra® (ofatumumab), Cyramza® (ramucirumab), Bl
  • the antibody can be bound to a toxin.
  • treatment with an anti-cancer antibody or an anti-cancer antibody conjugated to a toxin can lead to cancer cell death (e.g., tumor cells) which would potentiate an immune response mediated by Semaphorin 4D inhibiting agents.
  • a treatment of a hyperproliferative disease e.g., a cancer tumor
  • Tumors evade host immune surveillance by a large variety of mechanisms. Many of these mechanisms may be overcome by the inactivation of proteins, which are expressed by the tumors and which are immunosuppressive. These include, among others, TGF- ⁇ (Kehrl, J. et al. (1986) J Exp. Med. 163 : 1037-1050), IL-10 (Howard, M. & O'Garra, A. (1992) Immunology Today 13 : 198-200), and Fas ligand (Hahne, M. et al. (1996) Science 274: 1363-1365). In another example, antibodies to each of these entities may be further combined with Semaphorin 4D inhibiting agents to counteract the effects of immunosuppressive agents and favor anti -tumor immune responses by the host.
  • a Semaphorin 4D inhibiting agent can be used in conjunction with one or more checkpoint inhibitors or immune modulators.
  • Checkpoint inhibitors/immune modulators can make cancer cells more susceptible to attack by the immune system.
  • Checkpoint inhibitors and immune modulators include CTLA-4 inhibitors such as Yervoy® and tremelimumab, PD-1/PD-L1 inhibitors such as Keytruda®, Opdivo®, MPDL3280A and MEDI4736, LAG- 3 inhibitors and KIR inhibitors.
  • the immune modulator is selected from CD27 inhibitors and GITR inhibitors.
  • T cell costimulatory molecules such as OX-40 (Weinberg, A. et al. (2000) Immunol 164: 2160-2169), 4-1BB (Melero, I. et al. (1997) Nature Medicine 3 : 682-685 (1997), and ICOS (Hutloff, A. et al. (1999) Nature 397: 262-266) may also provide for increased levels of T cell activation.
  • Bone marrow transplantation is currently being used to treat a variety of tumors of hematopoietic origin. While graft versus host disease is a consequence of this treatment, therapeutic benefit may be obtained from graft vs. tumor responses.
  • combined Semaphorin 4D blockade can be used to increase the effectiveness of the donor engrafted tumor specific T cells.
  • the subject is administered Semaphorin 4D inhibiting agents in combination with T cells.
  • Semaphorin 4D inhibiting agents in combination with T cells.
  • Adoptive T cell transfer is an anti-cancer approach that enhances the natural cancer-fighting ability of the body's T cells by removing immune system cells, growing and/or making changes to them outside of the body, and then re-infusing them back into the patient.
  • T cells can be collected from a sample of a patient's tumor and multiplied in a laboratory.
  • T cells can be taken out of the body and genetically modified to attack antigens on cancer cells.
  • T cells can be taken out of the body and equipped with special receptors called chimeric antigen receptors (CARs); when given back to the patient, these "CAR T cells" recognize and attack cancer cells.
  • CARs chimeric antigen receptors
  • the Semaphorin 4D inhibiting agent can be used in conjunction with oncolytic virus immununotherapy.
  • An oncolytic virus is virus that can activate a greater immune response.
  • the Semaphorin 4D inhibiting agent can be used in conjunction with one or more cytokines.
  • the cytokine is selected from IL-2 and IFN-alpha.
  • the agent that inhibits Semaphorin 4D may also be combined with standard cancer treatments.
  • Semaphorin 4D blockade may be effectively combined with chemotherapeutic regimes. In these instances, it may be possible to reduce the dose of other chemotherapeutic reagent administered (Mokyr et al. (1998) Cancer Research 58: 5301-5304).
  • chemotherapeutic compounds should result in increased levels of tumor antigen in the antigen presentation pathway as a result of increased cell death.
  • combination therapies that may result in synergy with Semaphorin 4D blockade through cell death include radiation, surgery, or hormone deprivation. Each of these protocols creates a source of tumor antigen in the host. Angiogenesis inhibitors may also be combined with Semaphorin 4D blockade.
  • the anti -cancer agent is selected from the group consisting of Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin- stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afatinib Dimaleate, Afinitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Aminolevulinic Acid, Anastrozole, Apre
  • the therapeutically effective amount of an agent that inhibits the activity of Semaphonn 4D is an antibody.
  • antibody is used to refer to any antibody like molecule that has an antigen binding region, and includes full length antibody molecules, antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like.
  • DABs single domain antibodies
  • Fv single domain antibodies
  • scFv single chain Fv
  • Monoclonal antibodies as used herein also include sequences corresponding to human antibodies, animal antibodies, and combinations thereof.
  • chimeric antibody includes antibodies that have variable regions derived from an animal antibody, such as a rat or mouse antibody, fused to another molecule, for example, the constant domains derived from a human antibody.
  • One type of chimeric antibodies, "humanized antibodies,” have had the variable regions altered (through mutagenesis or CDR grafting) to match (as much as possible) the known sequence of human variable regions.
  • CDR grafting involves grafting the CDRs from an antibody with desired specificity onto the FRs of a human antibody, thereby replacing much of the non-human sequence with human sequence.
  • Humanized antibodies therefore, more closely match (in amino acid sequence) the sequence of known human antibodies. By humanizing mouse monoclonal antibodies, the severity of the human anti-mouse antibody, or HAMA, response is diminished.
  • Antibodies that bind Semaphorin 4D have been described in the art. See, for example, US Publ. Nos. 2008/0219971 Al, US 2010/0285036 Al, and US 2006/0233793 Al, International Patent Applications WO 93/14125, WO 2008/100995, and WO 2010/129917, and Herold et al, Int. Immunol. 7(1): 1-8 (1995), each of which is herein incorporated in its entirety by reference. Such antibodies can be used in the methods of the present invention.
  • the antibody is a monoclonal antibody. In some embodiments, the antibody is a mouse monoclonal antibody. In some embodiments, the antibody is clone 30/CDlOO (Cat # 610670) (BD Biosciences PharMingen, San Diego, CA). In some embodiments, the antibody is clone eBiol33-lC6 (Cat# 14-1009) (eBioscience, San Diego, CA). In some embodiments, the antibody comprises one or more complementarity determining regions (CDRs) identical to the CDRs of clone 30/CD100. In some embodiments, the antibody comprises one or more complementarity determining regions (CDRs) identical to the CDRs of clone eBiol33-lC6.
  • CDRs complementarity determining regions
  • an anti-Semaphorin 4D antibody for use in the methods provided herein binds human, murine, or both human and murine Semaphorin 4D. Also useful are antibodies which bind to the same epitope as any of the aforementioned antibodies and/or antibodies which competitively inhibit binding or activity of any of the aforementioned antibodies.
  • Humanized antibodies can be produced, for example by replacing an immunogenic portion of an antibody with a corresponding, but non-immunogenic portion (i.e., chimeric antibodies). See, e.g., Robinson et al, WO/1987/002671 ; Akira et al, EP Application 184,187; Taniguchi, EP Application 171,496; Morrison etal, EP Application 173,494; Neuberger et al. , WO 86/01533; Cabilly et al, EP Application 125,023, all of which are incorporated herein by reference.
  • the agent that inhibits Semaphorin 4D is a humanized antibody.
  • the antibody is a humanized antibody of antibody clone 30/CD100.
  • the antibody is a humanized antibody of antibody clone eBiol33-lC6 In some embodiments, the antibody is a fully human antibody.
  • the Semaphorin 4D inhibitory agent useful in the methods of the invention comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D.
  • the nucleic acid molecule can be of any length, so long as at least part of the molecule hybridizes sufficiently to Semaphorin 4D mRNA.
  • the nucleic acid molecule can bind to any region of Semaphorin 4D mRNA. In some embodiments, the nucleic acid molecule binds to a particular domain of Semaphorin 4D mRNA.
  • the nucleotide sequence of human Semaphorin 4D is shown in SEQ ID NO:2 (GenBank Accession No. U60800.1).
  • a region of the nucleic acid molecule is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary to at least a portion of SEQ ID NO:2.
  • the portion of SEQ ID NO:2 comprises SEQ ID NO:4 (5 ' -GGCCTGAGGACCTTGC AGAAG A-3 ' ), corresponding to a portion of Homo sapiens semaphorin 4D (SEMA4D), Homo sapiens semaphorin 4D (SEMA4D), transcript variant 1, mRNA NCBI Reference Sequence: NM_0()6378.3 (SEQ ID NO : 5) and transcript van ant 2, mRN A NCB I Reference Sequence; NM 001 142287.1 (SEQ ID NO: 6).
  • a region of the nucleic acid molecule is 100% complementary to SEQ ID NO:4.
  • the composition can comprise a DNA molecule, such as an antisense DNA molecule.
  • the composition can comprise an RNA molecule, such as an anti-sense RNA molecule, a small interfering RNA (siRNA) molecule, or small hairpin RNA (shRNA) molecule, which may or may not be comprised on a vector, including a viral vector (such as an adeno-associated viral vector, an adenoviral vector, a retroviral vector, or a lentiviral vector) or a non-viral vector.
  • the expression of the DNA or RNA molecule may be regulated by a regulatory region specific to one or more types of cancer.
  • a target sequence on a target mRNA can be selected from a given cDNA sequence corresponding to the Semaphorin 4D, in some embodiments, beginning 50 to 100 nt downstream ⁇ i.e., in the 3' direction) from the start codon.
  • the target sequence can, however, be located in the 5' or 3' untranslated regions, or in the region nearby the start codon.
  • the Semaphorin 4D inhibitory agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D mRNA.
  • the nucleic acid molecule is a DNA. In some embodiments, the nucleic acid molecule is an RNA.
  • the composition comprises an anti-sense DNA.
  • Anti-sense DNA binds with mRNA and prevents translation of the mRNA.
  • the anti-sense DNA can be complementary to a portion of Semaphorin 4D mRNA.
  • the anti- sense DNA is complementary to the entire reading frame of Semaphorin 4D.
  • the anti-sense DNA is complementary to the entire reading frame of SEQ ID NO:2.
  • the antisense DNA is complementary to a portion of SEQ ID NO:2.
  • the antisense DNA is at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 1200 nucleotides, at least about 1500 nucleotides, at least about 2000 nucleotides, at least about 2500 nucleotides, at least about 3000 nucleotides,
  • the composition comprises an anti-sense RNA.
  • Anti-sense RNA binds with mRNA and prevents translation of the mRNA.
  • the anti-sense RNA can be complementary to a portion of Semaphorin 4D mRNA.
  • the anti- sense RNA is complementary to the entire reading frame of Semaphorin 4D.
  • the anti-sense RNA is complementary to the entire reading frame of SEQ ID NO:2.
  • the antisense RNA is complementary to a portion of SEQ ID NO:2.
  • the antisense RNA is at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 1200 nucleotides, at least about 1500 nucleotides, at least about 2000 nucleotides, at least about 2500 nucleotides, at least about 3000 nucleotides
  • the composition is an siRNA targeting Semaphorin 4D.
  • SiRNAs are small single or dsRNAs that do not significantly induce the antiviral response common among vertebrate cells but that do induce target mRNA degradation via the RNAi pathway.
  • the term siRNA refers to RNA molecules that have either at least one double stranded region or at least one single stranded region and possess the ability to effect RNA interference (RNAi). It is specifically contemplated that siRNA can refer to RNA molecules that have at least one double stranded region and possess the ability to effect RNAi.
  • the dsRNAs may be generated by various methods including chemical synthesis, enzymatic synthesis of multiple templates, digestion of long dsRNAs by a nuclease with RNAse III domains, and the like.
  • An "siRNA directed to" at least a particular region of Semaphorin 4D means that a particular Semaphorin 4D siRNA includes sequences that result in the reduction or elimination of expression of the target gene, i.e., the siRNA is targeted to the region or gene.
  • the nucleotide sequence of the siRNA is defined by the nucleotide sequence of its target gene.
  • the Semaphorin 4D siRNA contains a nucleotide sequence that is essentially identical to at least a portion of the target gene.
  • the siRNA contains a nucleotide sequence that is completely identical to at least a portion of the Semaphorin 4D gene.
  • an "identical" RNA sequence will contain ribonucleotides where the DNA sequence contains deoxyribonucleotides, and further that the RNA sequence will typically contain a uracil at positions where the DNA sequence contains thymidine.
  • a Semaphorin 4D siRNA comprises a double stranded structure, the sequence of which is "substantially identical” to at least a portion of the target gene.
  • Identity is the relationship between two or more polynucleotide (or polypeptide) sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polynucleotide sequences, as determined by the match of the order of nucleotides between such sequences. Identity can be readily calculated by standard practices in the art.
  • polynucleotides of different lengths may be compared over the entire length of the longer fragment. Alternatively, small regions may be compared. Normally sequences of the same length are compared for a final estimation of their utility in the practice of the present invention. In some embodiments, there is 100% sequence identity between the dsRNA for use as siRNA and at least 15 contiguous nucleotides of the target gene, although a dsRNA having 70%, 75%, 80%, 85%, 90%), or 95%) or greater may also be used in the present invention.
  • a siRNA that is essentially identical to a least a portion of the target gene may also be a dsRNA wherein one of the two complementary strands (or, in the case of a self-complementary RNA, one of the two self-complementary portions) is either identical to the sequence of that portion or the target gene or contains one or more insertions, deletions or single point mutations relative to the nucleotide sequence of that portion of the target gene.
  • siRNA technology thus has the property of being able to tolerate sequence variations that might be expected to result from genetic mutation, strain polymorphism, or evolutionary divergence.
  • the invention provides an Semaphorin 4D siRNA that is capable of triggering RNA interference, a process by which a particular RNA sequence is destroyed (also referred to as gene silencing).
  • Semaphorin 4D siRNA are dsRNA molecules that are 100 bases or fewer in length (or have 100 base pairs or fewer in its complementarity region).
  • a dsRNA may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides or more in length.
  • Semaphorin 4D siRNA may be approximately 21 to 25 nucleotides in length. In some cases, it has a two nucleotide 3' overhang and a 5' phosphate.
  • the particular Semaphorin 4D RNA sequence is targeted as a result of the complementarity between the dsRNA and the particular Semaphorin 4D RNA sequence.
  • dsRNA or siRNA of the disclosure can effect at least a 20, 30, 40, 50, 60, 70, 80, 90 percent or more reduction of expression of a targeted Semaphorin 4D RNA in a cancer cell.
  • dsRNA of the invention (the term “dsRNA” will be understood to include “siRNA” and/or “candidate siRNA”) is distinct and distinguishable from antisense and ribozyme molecules by virtue of the ability to trigger RNAi.
  • dsRNA molecules for RNAi differ from antisense and ribozyme molecules in that dsRNA has at least one region of complementarity within the RNA molecule.
  • the complementary (also referred to as "complementarity") region comprises at least or at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94
  • long dsRNA are employed in which "long” refers to dsRNA that are 1000 bases or longer (or 1000 base pairs or longer in complementarity region).
  • the term “dsRNA” includes “long dsRNA”, “intermediate dsRNA” or “small dsRNA” (lengths of 2 to 100 bases or base pairs in complementarity region) unless otherwise indicated.
  • dsRNA can exclude the use of siRNA, long dsRNA, and/or "intermediate” dsRNA (lengths of 100 to 1000 bases or base pairs in complementarity region).
  • a dsRNA may be a molecule comprising two separate RNA strands in which one strand has at least one region complementary to a region on the other strand.
  • a dsRNA includes a molecule that is single stranded yet has at least one complementarity region as described above (such as when a single strand with a hairpin loop is used as a dsRNA for RNAi).
  • lengths of dsRNA may be referred to in terms of bases, which simply refers to the length of a single strand or in terms of base pairs, which refers to the length of the complementarity region.
  • a dsRNA comprised of two strands are contemplated for use with respect to a dsRNA comprising a single strand, and vice versa.
  • the strand that has a sequence that is complementary to the targeted mRNA is referred to as the "antisense strand” and the strand with a sequence identical to the targeted mRNA is referred to as the "sense strand.”
  • the "antisense region” has the sequence complementary to the targeted mRNA
  • the “sense region” has the sequence identical to the targeted mRNA.
  • sense and antisense region like sense and antisense strands, are complementary (i.e., can specifically hybridize) to each other.
  • Strands or regions that are complementary may or may not be 100% complementary ("completely or fully complementary”). It is contemplated that sequences that are "complementary” include sequences that are at least 50% complementary, and may be at least 50%, 60%, 70%, 80%, or 90% complementary.
  • siRNA generated from sequence based on one organism may be used in a different organism to achieve RNAi of the cognate target gene.
  • siRNA generated from a dsRNA that corresponds to a human gene may be used in a mouse cell if there is the requisite complementarity, as described above.
  • the requisite threshold level of complementarity to achieve RNAi is dictated by functional capability. It is specifically contemplated that there may be mismatches in the complementary strands or regions. Mismatches may number at most or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 residues or more, depending on the length of the complementarity region.
  • the single RNA strand or each of two complementary double strands of a dsRNA molecule may be of at least or at most the following lengths: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180
  • the two strands may be the same length or different lengths. If the dsRNA is a single strand, in addition to the complementarity region, the strand may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,
  • the strand or strands of dsRNA are 100 bases (or base pairs) or less. In specific embodiments, the strand or strands of the dsRNA are less than 70 bases in length. With respect to those embodiments, the dsRNA strand or strands may be from 5-70, 10-65, 20-60, 30-55, 40-50 bases or base pairs in length.
  • a dsRNA that has a complementarity region equal to or less than 30 base pairs such as a single stranded hairpin RNA in which the stem or complementary portion is less than or equal to 30 base pairs
  • one in which the strands are 30 bases or fewer in length is specifically contemplated, as such molecules evade a mammalian's cell antiviral response.
  • a hairpin dsRNA (one strand) may be 70 or fewer bases in length with a complementary region of 30 base pairs or fewer.
  • a dsRNA may be processed in the cell into siRNA.
  • the siRNA of the invention can comprise partially purified RNA, substantially pure
  • RNA synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.
  • One or both strands of the siRNA of the disclosure can comprise a 3' overhang.
  • a "3' overhang” refers to at least one unpaired nucleotide extending from the 3'- end of a duplexed RNA strand.
  • the Semaphorin 4D siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length.
  • the length of the overhangs can be the same or different for each strand.
  • the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length.
  • each strand of the Semaphorin 4D siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu").
  • the 3' overhangs can be also stabilized against degradation.
  • the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
  • substitution of pyrimidine nucleotides by modified analogues e.g., substitution of uridine nucleotides in the 3' overhangs with 2'-deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation.
  • the absence of a 2' hydroxyl in the 2'-deoxythymidine significantly enhances the nuclease resistance of the 3' overhang in tissue culture medium.
  • the Semaphorin 4D siRNA of the invention comprises the sequence AA(N19)TT or NA(N21), where N is any nucleotide.
  • These Semaphorin 4D siRNA comprise approximately 30-70% GC, and in some embodiments comprise approximately 50% G/C.
  • the sequence of the sense siRNA strand corresponds to (N19)TT or N21 (i.e., positions 3 to 23), respectively. In the latter case, the 3' end of the sense siRNA is converted to TT.
  • the rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense strand 3' overhangs.
  • the antisense RNA strand is then synthesized as the complement to positions 1 to 21 of the sense strand.
  • the 3'-most nucleotide residue of the antisense strand can be chosen deliberately.
  • the penultimate nucleotide of the antisense strand (complementary to position 2 of the 23 -nt sense strand in either embodiment) is generally complementary to the targeted sequence.
  • the Semaphorin 4D siRNA of the invention comprises the sequence NAR(N17)YNN, where R is a purine (e.g., A or G) and Y is a pyrimidine (e.g., C or U/T).
  • R is a purine
  • Y is a pyrimidine
  • the respective 21-nt sense and antisense RNA strands of this embodiment therefore generally begin with a purine nucleotide.
  • Such siRNA can be expressed from pol III expression vectors without a change in targeting site, as expression of RNAs from pol III promoters is only believed to be efficient when the first transcribed nucleotide is a purine.
  • the Semaphorin 4D siRNA of the disclosure can be targeted to any stretch of approximately 19-25 contiguous nucleotides in any of the target mRNA sequences (the "target sequence”).
  • target sequence any of the target mRNA sequences.
  • Techniques for selecting target sequences for siRNA are given, for example, in Tuschl T et al, "The siRNA User Guide,” revised Oct. 11, 2002, the entire disclosure of which is herein incorporated by reference. "The siRNA User Guide” is available on the worldwide web at a website maintained by Dr.
  • the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.
  • the Semaphorin 4D siRNA targets the Semaphorin 4D ORF sequence: 5 ' -C AAGACGCTGC AGTTCGTTAA-3 ' (SEQ ID NO:7).
  • the siRNA molecule is complementary to SEQ ID NO:7.
  • the Semaphorin 4D inhibitory agent useful in the methods of the invention comprises an shRNA molecule that targets Semaphorin 4D mRNA (Semaphorin 4D shRNA).
  • shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi).
  • RNAi RNA interference
  • expression of Semaphorin 4D shRNA in cells is achieved through delivery of non- viral vectors (such as plasmids or bacterial vectors) or through viral vectors.
  • shRNA is useful because it has a relatively low rate of degradation and turnover.
  • the oligonucleotide used to knockdown Semaphorin 4D protein levels using shRNA is 5 ' -GGCCTGAGGACCTTGC AGAAGA-3 ' (SEQ ID NO:3).
  • expression vectors that continually express siRNAs in stably transfected mammalian cells can be used (Brummelkamp et al., Science 296: 550-553, 2002; Lee et al, Nature Biotechnol. 20:500-505, 2002; Miyagishi, M, and Taira, K. Nature Biotechnol. 20:497-500, 2002; Paddison, et al, Genes & Dev.
  • shRNAs are processed, converting the shRNAs into ⁇ 21 nt siRNA-like molecules.
  • the siRNA-like molecules can, in turn, bring about gene-specific silencing in the transfected mammalian cells.
  • stem lengths can be varied.
  • stem lengths could range anywhere from 25 to 29 nucleotides and loop size could range between 4 to 23 nucleotides without affecting silencing activity.
  • presence of G- U mismatches between the two strands of the shRNA stem does not necessarily lead to a decrease in potency.
  • the present invention is directed towards methods of administering subjects with compositions comprising expression vectors and/or chemically synthesized shRNA molecules that target Semaphorin 4D.
  • the composition comprises a nucleotide sequence expressing a small hairpin RNA (shRNA) molecule.
  • shRNA small hairpin RNA
  • the shRNA molecule is expressed by an expression vector comprising SEQ ID NO:3.
  • the expression vector is a lentivirus expression vector.
  • nucleic acids or antibodies of the invention may be labeled.
  • the label may be fluorescent, radioactive, enzymatic, or calorimetric. It is contemplated that a dsRNA may have one label attached to it or it may have more than one label attached to it. When more than one label is attached to a dsRNA, the labels may be the same or be different. If the labels are different, they may appear as different colors when visualized.
  • the label may be on at least one end and/or it may be internal. Furthermore, there may be a label on each end of a single stranded molecule or on each end of a dsRNA made of two separate strands.
  • the end may be the 3' and/or the 5' end of the nucleic acid.
  • a label may be on the sense strand or the sense end of a single strand (end that is closer to sense region as opposed to antisense region), or it may be on the antisense strand or antisense end of a single strand (end that is closer to antisense region as opposed to sense region).
  • a strand is labeled on a particular nucleotide (G, A, U, or C).
  • fluorescent resonance energy transfer (FRET) techniques may be employed to characterize the dsRNA.
  • Labels contemplated for use in several embodiments are non-radioactive.
  • the labels are fluorescent, though they may be enzymatic, radioactive, or positron emitters.
  • Fluorescent labels that may be used include, but are not limited to, BODIPY, Alexa Fluor, fluorescein, Oregon Green, tetramethylrhodamine, Texas Red, rhodamine, cyanine dye, or derivatives thereof.
  • the labels may also more specifically be Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, DAPI, 6-FAM, Killer Red, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red.
  • a labeling reagent is a composition that comprises a label and that can be incubated with the nucleic acid to effect labeling of the nucleic acid under appropriate conditions.
  • the labeling reagent comprises an alkylating agent and a dye, such as a fluorescent dye.
  • a labeling reagent comprises an alkylating agent and a fluorescent dye such as Cy3, Cy5, or fluorescein (FAM).
  • the labeling reagent is also incubated with a labeling buffer, which may be any buffer compatible with physiological function (i.e., buffers that is not toxic or harmful to a cell or cell component) (termed "physiological buffer").
  • the nucleic acids of the invention can be modified.
  • the nucleic acids can be modified to include a phosphorothioate (PS) backbone.
  • PS phosphorothioate
  • the modification to the backbone can be throughout the molecule or at one or more defined sites.
  • the nucleic acids can be modified to encompass peptide nucleic acids (PNA).
  • the nucleic acids can be modified to encompass phosphorodiamidate morpholino oligomers (PMO).
  • the nucleic acid molecules of the invention can include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos).
  • S-oligos are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom.
  • the S-oligos of the present invention may be prepared by treatment of the corresponding O-oligos with 3H-l,2-benzodithiol-3 -one- 1,1 -dioxide which is a sulfur transfer reagent. See Iyer et al, J. Org. Chem. 55:4693-4698 (1990); and Iyer et al, J. Am. Chem. Soc. 112: 1253-1254 (1990), the disclosures of which are fully incorporated by reference herein.
  • a dsRNA has one or more non-natural nucleotides, such as a modified residue or a derivative or analog of a natural nucleotide. Any modified residue, derivative or analog may be used to the extent that it does not eliminate or substantially reduce (by at least 50%) RNAi activity of the dsRNA.
  • the nucleic acid molecules of the present methods are encoded by expression vectors.
  • the expression vectors may be obtained and introduced into a cell. Once introduced into the cell the expression vector is transcribed to produce various nucleic acids.
  • Expression vectors include nucleic acids that provide for the transcription of a particular nucleic acid.
  • Expression vectors include plasmid DNA, linear expression elements, circular expression elements, viral expression constructs (including adenoviral, adeno-associated viral, retroviral, lentiviral, and so forth), and the like, all of which are contemplated as being used in the compositions and methods of the present disclosure.
  • one or at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid molecules binding to Semaphorin 4D RNA are encoded by a single expression construct. Expression of the nucleic acid molecules binding to Semaphorin 4D RNA may be independently controlled by at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more regulatory elements. In certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more expression constructs can be introduced into a cell.
  • Each expression construct can encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid molecules binding to Semaphorin 4D RNA.
  • nucleic acid molecules binding to Semaphorin 4D RNA may be encoded as expression domains.
  • Expression domains include a transcription control element, which may or may not be independent of other control or promoter elements; a nucleic acid; and optionally a transcriptional termination element.
  • any suitable viral vector can be used in the methods of the invention.
  • the tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses.
  • an AAV vector of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.
  • VSV vesicular stomatitis virus
  • RNA of the claimed invention to cause RNAi-mediated degradation of the target mRNA can be evaluated using standard techniques for measuring the levels of RNA or protein in cells.
  • Semaphorin 4D siRNA of the invention can be delivered to cultured cells, and the levels of target mRNA can be measured by Northern blot or dot blotting techniques, or by quantitative RT-PCR. Alternatively, the levels of Semaphorin 4D protein in the cultured cells can be measured by ELISA or Western blot. A suitable cell culture system for measuring the effect of the present siRNA on target mRNA or protein levels may be utilized. RNAi-mediated degradation of Semaphorin 4D mRNA by an siRNA containing a given target sequence can also be evaluated with animal models, for example.
  • the method comprises administering a composition comprising an antibody that reduces activity of Semaphorin 4D.
  • antibody includes any immunologic binding agent, such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM may be utilized because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting.
  • the term "antibody” may be used to refer to any antibody -like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. Monoclonal and humanized antibodies are also contemplated in the disclosure.
  • the nucleic acids can be administered to the subject either as naked nucleic acid, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector that expresses the nucleic acids.
  • Delivery of nucleic acids or vectors to an individual may occur by any suitable means, but in specific embodiments it occurs by one of the following: cyclodextrin delivery system; ionizable lipids; DPC conjugates; GalNAc- conjugates; self- assembly of oligonucleotide nanoparticles (DNA tetrahedra carrying multiple siRNAs); or polymeric nanoparticles made of low-molecular-weight polyamines and lipids (see Kanasty et al. Nature Materials 12, 967-977 (2013) for review of same).
  • Suitable delivery reagents for administration in conjunction with the present nucleic acids or vectors include the Minis Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes.
  • a particular delivery reagent comprises a liposome.
  • Liposomes can aid in the delivery of the present nucleic acids or vectors to a particular tissue, and can also increase the blood half-life of the nucleic acids.
  • Liposomes suitable for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol.
  • lipids are generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream.
  • a variety of methods are known for preparing liposomes, for example as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9: 467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are herein incorporated by reference.
  • the liposomes encapsulating the present nucleic acids comprise a ligand molecule that can target the liposome to a particular cell or tissue at or near the site of interest.
  • Ligands that bind to receptors prevalent in the tissues to be targeted such as monoclonal antibodies that bind to surface antigens, are contemplated.
  • the liposomes are modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example by having opsonization-inhibition moieties bound to the surface of the structure.
  • a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.
  • Opsonization-inhibiting moieties for use in preparing the liposomes of the disclosure are typically large hydrophilic polymers that are bound to the liposome membrane.
  • an opsonization inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids.
  • These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system ("MMS") and reticuloendothelial system ("RES"); e.g., as described in U.S. Pat.
  • MMS macrophage-monocyte system
  • RES reticuloendothelial system
  • Liposomes modified with opsonization-inhibition moieties thus remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes.
  • Stealth liposomes are known to accumulate in tissues fed by porous or "leaky” microvasculature. Thus, target tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al. (1988), P.N.A.S., USA, 18: 6949-53.
  • liposomes of the invention that are modified with opsonization-inhibition moieties can deliver the present nucleic acids to tumor cells.
  • Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 Daltons, and more preferably from about 2,000 to about 20,000 Daltons.
  • Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1.
  • PEG polyethylene glycol
  • PPG polypropylene glycol
  • synthetic polymers such as polyacrylamide or poly N-vinyl
  • Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable.
  • the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide.
  • the opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
  • natural polysaccharides containing amino acids or carboxylic acids e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan
  • aminated polysaccharides or oligosaccharides linear or branched
  • the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes.”
  • the opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N- hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid- soluble anchor, and then bound to a membrane.
  • a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH 3 and a solvent mixture such as tetrahydrofuran and water in a 30: 12 ratio at 60 degrees C.
  • Recombinant plasmids that express nucleic acids of the invention are discussed above. Such recombinant plasmids can also be administered directly or in conjunction with a suitable delivery reagent, including the Minis Transit LT 1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
  • a suitable delivery reagent including the Minis Transit LT 1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
  • the nucleic acids reducing the level of Semaphorin 4D of the invention can be administered to the subject by any suitable means.
  • the nucleic acids can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes, or by injection, for example, by intramuscular or intravenous injection.
  • Suitable parenteral administration routes include intravascular administration (e.g. intravenous bolus injection, intravenous infusion, intra-arterial bolus inj ection, intraarterial infusion and catheter instillation into the vasculature); peri- and intra-tissue administration (e.g., peri-tumoral and intra-tumoral injection, intra-retinal injection or subretinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct (e.g., topical) application to the area at or near the site of interest, for example by a catheter or other placement device (e.g., a corneal pellet or a suppository, eye-dropper, or an implant comprising a porous, non-porous, or gelatinous material); and inhalation.
  • injections or infusions of the composition(s) are given at or near the site of disease.
  • the nucleic acids reducing the level of Semaphorin 4D of the invention can be administered in a single dose or in multiple doses.
  • the infusion can be a single sustained dose or can be delivered by multiple infusions.
  • Injection of the agent directly into the tissue is at or near the site of need. Multiple injections of the agent into the tissue at or near the site of interest are encompassed within this disclosure.
  • the composition(s) can be administered to the subject once, such as by a single injection or deposition at or near the site of interest.
  • the composition(s) can be administered to a subject once or twice daily to a subject once weekly for a period of from about three to about twenty-eight days, in some embodiments, from about seven to about ten weeks.
  • the composition(s) is injected at or near the site of interest once a day for seven days.
  • a dosage regimen comprises multiple administrations, it is understood that the effective amount of composition(s) administered to the subject can comprise the total amount of composition(s) administered over the entire dosage regimen.
  • the present invention is directed towards a composition for treating cancer comprising an isolated nucleic acid that decreases the level and/or activity of Semaphorin 4D and a pharmaceutically acceptable carrier.
  • the nucleic acid comprises SEQ ID NO:3 or a fragment or derivative thereof capable of decreasing the level and/or activity of Semaphorin 4D.
  • the Semaphorin 4D inhibitory agents of the disclosure may be formulated as pharmaceutical compositions prior to administration to a subject, according to techniques known in the art. See, e.g., Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference.
  • pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free.
  • pharmaceutical formulations include formulations for human and veterinary use.
  • compositions of the disclosure can also comprise conventional pharmaceutical excipients and/or additives.
  • Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate).
  • Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
  • a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, or 25%-75%, of one or more compositions of the invention.
  • a pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20%) by weight or 1%>-10%> by weight, of one or more compositions of the invention encapsulated in a liposome as described above, and propellant.
  • a carrier can also be included as desired; e.g., lecithin for intranasal delivery.
  • an assay for Semaphorin 4D activity in cells can be used to determine the functionality of the Semaphorin 4D in the presence of an agent which may act as an inhibitor, and thus, agents that interfere with the activity of Semaphorin 4D can be identified.
  • the Semaphorin 4D of the present invention is employed in a screening process for compounds which bind Semaphorin 4D or one of its binding partners or both and which inhibits the biological activity of the Semaphorin 4D interaction.
  • Inhibitors of Semaphorin 4D are particularly advantageous and can be used in methods as therapeutic agents in the treatment of cancer, such as head and neck cancer and lymphoma.
  • inhibitor is intended naturally occurring and/or synthetic agents capable of inhibiting the biological activity of Semaphorin 4D, which can include inhibiting transcription or translation of Semaphorin 4D mRNA.
  • the screening procedures involve producing appropriate cells which produce Semaphorin 4D.
  • Such cells can include cells from mammals, yeast, Drosophila or E. coli.
  • the cells express Semaphorin 4D endogenously.
  • the cells have been transfected or engineered to express Semaphorin 4D.
  • cells expressing Semaphorin 4D are contacted with a test compound to observe stimulation or inhibition of a functional response.
  • assays can test binding of Semaphorin 4D to its targets or assays can involve competition with a competitor compound, such as a labeled competitor.
  • a competitor compound such as a labeled competitor.
  • Potential antagonists are not limiting and examples include antibodies, peptides, carbohydrates, or small molecules which bind to Semaphorin 4D or its targets. These agents can be selected and screened 1) at random, 2) by a rational selection or 3) by design using for example, ligand modeling techniques (e.g., computer modeling).
  • agents such as antibodies, peptides, carbohydrates, pharmaceutical agents and the like are selected at random and are assayed for their ability to bind to or block the interaction of the Semaphorin 4D to its targets or reduce expression of Semaphorin 4D.
  • agents may be rationally selected or designed.
  • an agent is said to be "rationally selected or designed" when the agent is chosen based on the configuration of the Semaphorin 4D or its targets.
  • the invention provides a method of screening for an anti-cancer agent which inhibits Semaphorin 4D, comprising: (a) contacting Semaphorin 4D; and (b) assaying the agent's effect on the Semaphorin 4D activity.
  • the activity to be tested is generation of myeloid-derived suppressor cells.
  • the present invention is directed towards methods of screening for anti -cancer agents comprising i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; ii) and assaying whether Semaphorin 4D activity is reduced, wherein if Semaphorin 4D activity is reduced, the agent has anti-cancer activity.
  • the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid-derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti-cancer activity.
  • the myeloid-derived suppressor cells have a phenotype that is CD33 + , CDl lb + , and HLA-DR/ /low
  • the cell culture medium comprising Semaphorin 4D is a conditioned medium from a cancer cell line.
  • the cell culture medium is from a head and neck squamous cell carcinoma cell line.
  • the cell line is a human cell line. In some embodiments, the cell line is selected from the group consisting of HN4, HN6, HN13, and SCC-9. In some embodiments, the cell population comprises total PBMC. In some embodiments, the cell population comprises total myeloid cells (CD33 + ) isolated from PBMC.
  • the candidate anti-cancer agent reduces the level of myeloid- derived suppressor cells by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or about 95% relative to a control lacking the agent.
  • the agent is selected from a nucleic acid or an antibody.
  • the agent comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D, wherein the assaying of part ii) comprises detecting Semaphorin 4D mRNA and/or protein and comparing its level to a control sample lacking the agent.
  • the invention provides a method of monitoring progression of cancer in a subject, comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
  • the cancer is selected from head and neck cancer and hematological malignancies, such as lymphoma.
  • the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA.
  • the subject has stage III or stage IV cancer.
  • tissue sample is not particularly limiting.
  • the tissue sample comprises peripheral blood.
  • the tissue sample comprises cancer tissue.
  • the tissue sample comprises cancer tissue from head and neck cancer.
  • Semaphorin 4D is detected by an antibody.
  • the antibody is clone 30/CDlOO (Cat # 610670) (BD Biosciences PharMingen, San Diego, CA).
  • the antibody is clone eBiol33-lC6 (Cat# 14-1009) (eBioscience, San Diego, CA).
  • the antibody is clone 133-1C6 (available through Novus Biosciences).
  • Semaphorin 4D is detected by an ELISA (enzyme-linked immunosorbent assay) technique. In some embodiments, Semaphorin 4D is detected by immunohistochemistry.
  • the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject. Additional tissue samples can be obtained at later periods of time in order to monitor progression by assaying for the presence of Semaphorin 4D in the tissue sample.
  • an elevated level of expression of Semaphorin 4D corresponds to a positive pixel intensity of at least 1.5xl0 5 by standardized digital analysis as described herein.
  • the pixel intensity can be determined digitally by the Algorithm (Positive Pixel count v9) of the Leica Aperio software.
  • the cut off value 1.5xl0 5 was determined as the mean between the negative/low expression and the positive/high expression values (see the materials and methods of Example 3, below).
  • the subject's tumor has a fibrotic peri -turn oral stroma.
  • stromal analysis for fibrosis can be carried out by a pathologist on H&E and IHC stained sections under light microscopy.
  • delicately fibrous stroma (+), moderately fibrotic (++) and densely fibrotic (+++) parameters can used.
  • the subject's tumor has a dense, fibrotic peri- tumoral stroma.
  • the stroma is analyzed by cell staining.
  • the stroma is stained with Picrosirius stain.
  • the method further comprises obtaining the results of an assay that detects the presence or absence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D. In some embodiments, there is an inverse correlation between elevated Semaphorin 4D in the tissue and the presence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D. In some embodiments, the method further comprises obtaining the results of an assay that detects the presence or absence of immune checkpoint molecules, such as PD- Ll, in the tissue sample, wherein the tissue sample is cancer tissue. In some embodiments, the cancer tissue is PD-Ll "ve/low . The level of PD-L1 can be assayed and measured relative to its expression in normal oral epithelium. In some embodiments, when the PD-L1 level is negative or low, the method further comprises administering to the subject an agent that inhibits the activity of Semaphorin 4D. In some embodiments, this agent is administered as a monotherapy.
  • the tissue is positive for the presence of the immune checkpoint molecule, such as PD-L1.
  • the cut off value for elevated PD-L1 (PD-Ll +ve/high ) is strong focal expression >1% in tumor cells or in tumor associated inflammatory cells or both, and using a positive pixel intensity of at least 1.5xl0 5 by standardized digital analysis as described above and in the Examples.
  • the method further comprises administering to the subject an agent that inhibits the activity of Semaphorin 4D and an agent that inhibits the immune checkpoint molecule.
  • the inhibitor is a PD-L1 inhibitor.
  • a method of inhibiting tumor-mediated immunosuppression in a subject comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D. 2. The method of paragraph 1, wherein the agent decreases the expression level of Semaphorin 4D.
  • the agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D.
  • Semaphorin 4D is SEQ ID NO:2.
  • a method of screening for an agent that has anti-cancer activity comprising i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; and
  • the agent has anti-cancer activity.
  • the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid- derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti-cancer activity.
  • the agent is a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D
  • the assaying of part ii) comprises detecting Semaphorin 4D mRNA and/or protein and comparing its level to a control sample lacking the agent.
  • a method of monitoring progression of cancer in a subject comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
  • the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject.
  • cancer selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA.
  • HNSCC squamous cell carcinoma of the head and neck
  • SGA salivary gland adenocarcinomas
  • metastatic HNSCC metastatic SGA.
  • the methods of the present invention are combined with one or more other known treatments.
  • one or more other known treatments can include radiation, surgery, chemotherapy or administration of other anti-cancer agents and combinations thereof.
  • Example 1 Human head and neck squamous cell carcinoma associated Semaphorin
  • HNSCC derived Sema4D plays a role in inducing MDSC and examined its effect on T cell phenotype and function. It was found that Sema4D produced by the HNSCC HN6 and HN13 cell lines polarized myeloid cells into MDSC phenotype, which corresponded with a reduction in T cell proliferation and IFN- ⁇ production. Furthermore, shRNA inhibition of Sema4D in HN6 resulted in a decrease in the production of the immunosuppressive factors; arginase-1, TGF- ⁇ , and IL- 10 by myeloid cells and the recovery of autologous T cell proliferation, IFN- ⁇ production, specifically leading to an increase in the effector T cell population and decrease in Tregs. These findings describe HNSCC-associated Sema4D production as one of the mechanisms by which the tumors induce MDSC, that subsequently mediate their immunosuppression effects on T cells.
  • Sema4D expressed by HNSCC cell lines induces CD33 + , CDllb + , HLA-DR - /low cells
  • HNSCC-derived condition medium To examine the effects of HNSCC-derived condition medium on myeloid differentiation, total human PBMC or total myeloid cells (CD33 + ) isolated from PBMC were plated in conditioned medium from HNSCC cell lines HN4, HN6, HN13 and SCC- 9.
  • Total PBMC or separated myeloid cells cultured in HNSCC conditioned medium displayed markers characteristic of MDSC, namely CD33 + CDl lb + HLA-DR/ /low compared to cells cultured in normal medium (NM) or NOK conditioned medium.
  • Fig.7A The percentage of MDSC developed from total PBMC were -20% (Fig.7A), while that generated from CD33 + myeloid cells averaged 30% depending on the HNSCC cell line and density used (Fig.1 A) (Fig.7B). Moreover, titration of HN6 and HN13 derived conditioned medium with normal medium corresponded with a dose-dependent decrease in the MDSC population (Fig. IB, 1C).
  • T cells grown in FIN6 Ctl-shRNA medium were suppressed upon co-culture with the myeloid cells, but not when cultured in NM, indicating that the suppression is mediated by the induction of MDSC (Fig.3B).
  • the knock down of Sema4D produced by FIN6 resulted in significant recovery of the T cells at different M:T cell ratios (Fig. 3 A, 3B). This was paralleled with recovery of IFN- ⁇ production (Fig. 3C) as well as inhibition of IL-4 in the supernatant (Fig. 3D).
  • HN6 secreted Sema4D induces an immunosuppressive T cell phenotype
  • Sema4D enhances GM-CSF + IL-6 mediated induction of MDSC
  • GM- CSF GM- CSF
  • Sema4D acts synergistically with GM-CSF + IL-6 to increase the repertoire of the MDSC cells in the HNSCC tumor microenvironment (Fig. 5F, 5G) Sema4D promotes the production of immunosuppressive mediators by MDSC
  • HNSCC associated-Sema4D has an effect on MDSC viability
  • a WST cell proliferation assay and a CFSE proliferation tracking experiment were performed using CD33 + cells grown in conditioned medium from the HN6 cells in which Sema4D has been knocked down using shRNA.
  • the loss of Sema4D resulted in a significant decrease in the proliferation of total CD33 + cells, as well as that of the CD33 + HLA-DR "/low population compared to conditioned medium from controls (Figs. 6A, 6B).
  • the myeloid cells mediate their suppressive effects by various mechanisms. Among these arginase-1 and nitric oxide (NO) play a major role in MDSC suppressive effect.
  • HNSCC-HN6 arginase-1 and nitric oxide (NO) play a major role in MDSC suppressive effect.
  • NO nitric oxide
  • CD33 + enriched myeloid cells were grown in conditioned media from Sema4D-shRNA HN6, and then checked for arginase-1 expression. A significant reduction in arginase-1 production by the CD33 + cells was observed when grown in Sema4D-shRNA HN6 conditioned media (Fig. 6D).
  • MDSC can also indirectly induce its suppressive effect, through production of other immune suppressive cytokines like IL-10 and expansion of Tregs in a TGF- ⁇ dependent pathway (Vuk-Pavlovic et al, 2010. Prostate 70: 443-455; Cappamccia et al, 2009. J Cell Sci 122: 1723-1736). These cytokines were assessed by ELISA, specifically to measure IL-10 and TGF- ⁇ produced by MDSC (Cuenca et al, 2011. Mol Med 17: 281-292). Interestingly, there was a significant reduction in both IL-10 and TGF- ⁇ production by CD33 + cells upon inhibition of Sema4D in HN6 (Figs. 6F, 6G).
  • HN6, and WSU-HN13 underwent DNA authentication (Johns Hopkins genetic resources core facility, Baltimore, MD) to ensure consistency in cell identity in comparison with their source (Martin et al. 2014. Oncotarget 5: 8906-8923).
  • SCC-9 was obtained from American Type Culture Collection (ATCC) (Manassas, VA).
  • the WSU-HN4 cell line was a generous gift from Dr. Silvio Gutkind (NIDCR, Bethesda, MD). All HNSCC cell lines used were derived from primary carcinomas of the Tongue.
  • All cell lines were grown and maintained in DMEM supplemented with 10% FBS, 100 units/ml penicillin, 100 ⁇ g/ml streptomycin, and 250 ng/ml amphotericin B (Sigma, St. Louis, MO) at 37°C in humidified air with 5% C0 2 .
  • conditioned medium culture medium was collected from confluent FINSCC cells grown in 5ml DMEM for 24 hrs.
  • conditioned medium supplemented with 5% FBS was used for myeloid and T cell co-culture experiments.
  • Mononuclear cell suspension was prepared from peripheral blood of healthy donors obtained from commercial vendors, Biological Speciality Corp (Colmar, PA) or New York Blood Center (New York, NY) using Ficoll-Paque Plus density-gradient centrifugation (GE Healthcare Life Sciences, Pittsburgh, PA).
  • CD33 + myeloid cells were separated from the PBMC using Magnetic Cell Sorting (MACS) CD33 microbeads (Cat #130-045-501), HLA-DR positive cells were separated using anti-HLA-DR microbeads (Cat #130-046- 100) (Miltenyi Biotec Inc, Auburn, CA).
  • Autologous T cells were enriched by negative selection with the Human Pan T cell isolation kit (Cat # 19051, STEMCELL Technologies Inc., Vancouver, BC, Canada).
  • MDSC were characterized using multicolor staining fluorochrome-labeled anti- human CD33-PerCP/Cy5.5 (Cat # 303414), HLA-DR-APC (Cat # 307610), CDl lb-PE (Cat #301306), CD14-FITC (Cat # 325604) (Biolegend, San Diego, CA).
  • CD3-APC/Cy7 Cat # 300317) (Biolegend)
  • CD8a PE-Cy7 cat # 25-0088-42
  • CD25-APC Cat #17-0259-42
  • Foxp3-PE Cat # 12-4776-42
  • T-bet PerCP-Cyanine5.5 Cat # 45-5825-82 (eBioscience, Inc., San Diego, CA).
  • T cell proliferation T cells were stained with CFSE (Cat # C34554) (Life Technologies, Grand Island, NY), prior to plating.
  • Dynabeads human T-activator CD3/CD28 (Life Technologies) were used at a 1 :3 (T cell: bead) ratio after coculture with myeloid cells for at least 4hrs. Data was acquired using a BD LSR II Flow cytometer, Flow Jo software (Tree Star, Ashland, OR) and analyzed using BD FACSDivaTM software (BD Biosciences, San Jose, CA). Immunoblot, antibodies and reagents
  • Cells were harvested in cell lysis buffer (20mM Tris-HCL (pH7.5), 150mM NaCl, ImM Na 2 EDTA, ImM EGTA, l%Triton, 2.5mM sodium pyrophosphate, ImM ⁇ - glycerophosphate, ImM Na 3 V0 4 , lug/ml leupeptin) (Cat # 9803) (Cell Signaling Tech., Danvers, MA) with the addition of IX protease inhibitor Complete Mini, EDTA-Free (cat #11836170001) (Roche Diagnostics Corporation, Indianapolis, IN). Whole-cell lysate was separated using SDS-PAGE.
  • the primary antibodies Sema4D (30/CDlOO, Cat # 610670) (BD Biosciences PharMingen, San Diego, CA), Arginase-1 (A-2: sc-365547), GAPDH (8C2: sc-81545), and ⁇ -actin (Cat # sc-2301), (Santa Cruz Biotechnology, Inc., Dallas, TX), were used.
  • the secondary antibodies used were anti-rabbit IgG (Cat # sc-2301) and anti-mouse IgG (Cat # sc-2302) (Santa Cruz Biotechnology, Inc.). For Arginase-1 detection 15 ⁇ g of protein were loaded, while for Sema4D detection 70-100 ⁇ g were loaded.
  • Sema4D For detection of Sema4D in the tumor conditioned medium, equal aliquots of the medium or of a concentrate of the medium using Millipore amicon Ultra centrifugal filter units were loaded after adding the sample buffer. Cell viability was measured using the cell proliferation reagent, WST-1 (Roche Diagnostics Corporation). The plate was read at 450nm on BioTek Epoch microplate spectrophotometer (BioTek, Winooski, VT). The recombinant human Sema4D (sCDIOO) (Cat # 310-29) was obtained from (Peprotech, Rocky Hill, NJ). Recombinant human GM-CSF (Cat # 215-GM-010) (R&D Systems, Inc.
  • Sema4D for target protein inhibition in the conditioned medium anti-Sema4D (Cat #610670) (BD Biosciences) was used at concentration (10 ⁇ g/ml).
  • immunoprecipitation of Sema4D or GM-CSF was carried out by overnight incubation of the conditioned media with Sema4D (Cat # ab39710) (Abeam, Cambridge, MA) or GM- CSF (clone: BVD2-21C11) (Cat #502301) (Biolegend) ( ⁇ g/ml) mAbs using protein A beads, followed by precipitation.
  • the lentivirus and short-hairpin RNA (shRNA) system were a kind gift of Dr. John R. Basile, UMB (Basile et al. 2006. Proc Natl Acad Sci USA 103 : 9017-9022).
  • shRNA sequences for human Sema4D were obtained from Cold Spring Harbor Laboratory's RNAi library (RNAi Codex; http: katahdin.cshl.org:933 l_homepage_portal_scripts_main2.pl).
  • the oligonucleotides (Invitrogen, Grand Island, NY) used to knockdown Sema4D protein levels were: 5- GGCCTGAGGACCTTGCAGAAGA-3 (SEQ ID NO:3).
  • Sema4D shRNA oligonucleotides were cloned into lentiviral expression vector pWPI GW as previously described (Basile et al. 2006. Proc Natl Acad Sci U SA 103 : 9017-9022).
  • pWPI (empty) vector was used as negative control.
  • Infections were performed using Fugene HD transfection reagent (Cat # E2311, Promega, Madison, WI).
  • Human ELISA MAXTM IFN- ⁇ (Cat # 430103), TGF- ⁇ total (Cat # 436707), IL- 10 (Cat # 430601), and IL-4 (Cat # 430301) were obtained from Biolegend. Samples were run in triplicates and read using BioTek Epoch microplate spectrophotometer at 450nm wavelength.
  • Semaphorin 4D human recombinant Semaphorin 4D (Cat# 310-29) (PEPROTECH, Rocky Hill, NJ) was used. Semaphorin 4D (clone eBiol33-lC6) (Cat# 14- 1009) (eBioscience, San Diego, CA) was used as the primary detection antibody. The secondary antibody, goat anti -mouse anti-IgM HRP (Caltag Cat# M31507) was applied followed by detection with tetramethybenzidine (TMB) substrate.
  • TMB tetramethybenzidine
  • AD Assay Diluent
  • Immunohistochemistry was carried out on paraffin embedded tissue microarray including 124 primary HNSCC, 9 primary adenocarcinomas of the salivary glands, 3 metastatic HNSCC, 4 metastatic adenocarcinomas of the salivary glands to lymph nodes,
  • Sema4D is a diagnostic marker in peripheral blood of cancer patients
  • Sema4D is a candidate diagnostic marker for cancer patients in peripheral blood.
  • Sema4D insitu expression as a predictive marker for disease progression
  • Sema4D as a prognostic marker in HNSCC, we carried out immunohistochemistry on primary HNSCC, primary adenocarcinomas of the salivary gland, metastatic HNSCC and metastatic salivary gland tumors to lymph nodes. Collectively, Stages I and II of the primary HNSCC showed negative to week expression of Sema4D. Stages III and IV showed strong diffuse expression of Sema4D. Metastatic HNSCC and salivary gland metastatic adenocarcinomas to lymph nodes showed strong and diffuse expression. In stages III, and IV HNSCC as well as in the metastatic lesions, increased inflammatory cell infiltrate with strong expression of Sema4D in the tumor stroma was noticed.
  • the control normal oral epithelium showed week to negative basal and parabasal expression of Sema4D.
  • the normal epiglottis lining showed moderate diffuse expression and the normal salivary gland tissue showed diffuse weak to moderate expression of Sema4D in the acini and ductal structures.
  • Sema4D +ve/high high levels of Sema4D expression (Sema4D +ve/high ) by HNC tumor cells significantly correlated with clinical staging, being highest in stage III. It also showed a positive nonsignificant correlation with nodal metastasis. Sema4D +ve/high expression in tumor cells correlated significantly with dense fibrotic noninflamed peri-tumoral stroma and inversely with infiltrating Sema4D +ve/hi h TAIs.
  • Sema4D identified a unique subset of HNC tumors distinct from the PD-Ll positive tumors. Furthermore, high levels of circulating Sema4D were detected in HNC patients' sera compared to healthy donors.
  • Sema4D expression has been described in several epithelial malignancies, but it is believed that there are no studies investigating whether it correlates with clinical progression in HNC (Ch'ng E et al., Cancer. 2007; 110(1): 164-172; Wang et al., World J Gastroenterol. 2015; 21 (7):2191-2198).
  • Immunohistochemical (THC) analysis was performed on 160 human tissue samples. These included twenty one cases of normal tissue, and one hundred and thirty-nine cases of HNC.
  • the malignancies consisted of 119 primary squamous cell carcinomas of the head and neck (HNSCC), 9 primary salivary gland adenocarcinomas (SGA), 4 metastatic HNSCC and 4 metastatic SGA to the lymph nodes.
  • the pattern of expression of Sema4D was generally membranous and cytoplasmic.
  • the normal oral epithelium and salivary acini were negative to low positive (Sema4D " ve/iow ⁇ yjith mean strong positive pixel intensity ranging from ⁇ 10 4 to 2xl0 5 ( Figure 19 A- F), while the salivary ductal epithelium and the normal epiglottis epithelial lining were positive for Sema4D ( Figure 20).
  • the normal tissue adjacent to tumor margin (NAT) was Sema4D positive to strongly positive (Sema4D +ve/hi s h ) in the basal and prickle cell layer with mean strong positive pixel intensity of up to 10 6 ( Figure 19 G-H).
  • the scattered inflammatory cells in the normal tissue sections were also positive for Sema4D.
  • Sema4D +ve/high expression was observed in in 47 (34.5%) cases out of the 136 primary and metastatic malignancies (Table 5).
  • the cut off value to consider Sema4D +ve/high in tumor cells was 5xl0 5 strong pixel intensity as guided by the standardized digital analysis ( Figure 21).
  • Tumor cells were generally Sema4D _ve/low for expression in stage I and II, Sema4D +ve/high in stage III and Sema4D "ve/low expression in stage IV tumor cells ( Figure 12A-D).
  • Sema4D expression by tumor cells correlates with a dense fibrotic peri-tumoral stroma
  • the peri-tumoral - stroma is a very important reflection of the complexity of the tumor (Hanahan D and Weinberg RA. Cell. 2011; 144(5):646-674; Pietras K and Ostman A. Exp Cell Res. 2010; 316(8): 1324-1331).
  • To determine whether Sema4D has a role in modulating the immune response within the tumor microenvironment we examined the stroma in all of the provided specimens.
  • the data showed 77% of the cases with dense peri-tumoral stroma to be Sema4D +ve/high
  • inhibition of Sema4D in HNC cell lines can downregulate TGF- ⁇ production by myeloid cells (Younis RH et al. J Immunol. 2016; 196(3): 1419-1429).
  • Sema4D expression was highest in stage III tumors (Table 1), therefore we generated stable Sema4D knockdown and controls using the WSU- HN6 cell line, derived from a stage III SCC of the base of the tongue (Morikawa et al, Cold Spring Harb Per sped Biol. 2016; 8(5); Prud'Neill et al., Lab Invest. 2007; 87(11): 1077-1091; Jeon et al, Int J Cancer. 2004; 112(2):249-258).
  • WSC-HN6 cells produce high levels of TGF- ⁇ in the culture medium, compared to controls normal oral keratinocytes (NOK).
  • NOK normal oral keratinocytes
  • Inhibition of Sema4D in WSC-HN6 cells using shRNA significantly reduced TGF- ⁇ 1 production by the tumor cells to levels comparable to NOK and to that present in normal cell culture media (Figure 13D).
  • Te peri -turn oral stroma was further investigated for the extent of inflammation.
  • TAIs Sema4D +ve/high TAIs
  • the stroma in Stage I and II UNC tumors showed mild to moderate infiltrate of Sema4D +ve/high TAIs ( Figure 12A and 12B) ( Figure 22).
  • Stage III UNC tumors were generally moderately inflamed, with considerable overall increase in TAIs infiltration compared to stage I and II, with almost all TAIs staining strongly positive for Sema4D.
  • Stage IV tumors showed prominent increase of Sema4D +ve/high TAIs infiltration in most of the specimens, compared to stages I, II and III, ( Figure 12D and Figure 14A-14B).
  • Inflammatory cells in the lymph nodes with metastatic SCC generally showed strong Sema4D expression (Figure 12E).
  • Programmed death-ligand 1 (PD-L1) expression has been linked to poor patients' prognosis (Lin et al, PLoS One. 2015; 10(1 l):e0142656.; Chen et al, Oral Oncol. 2015; 51(11): 1004-1010; Mukaigawa et al, J Surg Oncol. 2016; 114(l):36-43).
  • the inhibition of PD-1/PD-L1 pathway had shown promising overall response rate in many clinical studies.
  • Yet patients' response had been linked to the initial presence of an inflamed tumor microenvironment (Cho et al, Oral Oncol. 2011; 47(12): 1148-1153; Zandberg et al, Oral Oncol.
  • HNC tissue microarray HN802 and HN803c
  • US Biomax Rockville, MD
  • the tissue microarray of hundred and sixty cases of head and neck cancer with normal tissue included demographic data, TNM system, clinical stage, and pathologic grade.
  • the hematoxylin and eosin sections were examined by an oral and maxillofacial (OMF) pathologist to verify histopathological diagnosis prior to immunohistochemical (IHC) staining.
  • OMF oral and maxillofacial pathologist
  • tissue sections were deparaffinized in xylene, rehydrated in graded ethanol, treated with Tris- EDTA buffer for antigen retrieval, and quenched in hydrogen peroxide to block endogenous peroxidase. Tissue sections were blocked with 2.5% normal serum, incubated overnight at 4 degrees C with anti- Sema4D antibody 1 :200, (clone 30/CDlOO; BD Transduction Laboratories), followed by biotinylated secondary antibody (catalog no.
  • ABS Vectastain elite ABC kit
  • Diaminobenzidine (SK-4105) was used as chromogen and counterstained with Mayer's hematoxylin (Sigma- Aldrich Corp.).
  • the Sema4D labeling index (LI) reflecting the intensity and extent of staining in the tumor cells was defined semi quantitatively as (0, 1, 2, and 3) and digitally using the Aperio software (Positive Pixel count v9) Blue, yellow, orange and red. Where (0) was negative (Blue digitally), (1) was diffuse weak staining (yellow digitally), (2) diffuse weak positivity with scattered strong positive ⁇ 25% (yellow with scattered orange digitally), and (3) was for diffuse strong positivity or focal strong positive >25% (orange and red digitally).
  • the cut off value for pD-Ll +ve/high was strong focal expression >1% in tumor cells or in TAIs or both, and using the same cutoff value digitally as with Sema4D (Madore etal, Clin Cancer Res. 2016; 22(15):3915-3923).
  • the strong pixel intensity for all the stains was calculated as the mean of three representative annotation layers of -0.2 mm 2 area at 20x magnification, 200um scale.
  • the serum concentration of Sema4D was determined by ELISA. Immulon 4 HBX microtiter plates (Thermo Scientific, Waltham, MA) were coated with 50 microliters of undiluted serum, washed, then incubated with anti-human CD100 antibody (clone: 133- 1C6; Novus Biologicals). Goat anti-mouse IgM-HRP (catalog no. M31507; Life Technologies) was added followed by detection with TMB (Pierce). The serum concentrations of Sema4D were calculated using the standard curve established for recombinant Sema4D (catalog no. 310-29) (Peprotech, RockyHill, NJ). The detection limit was 3.1 ng/mL.
  • TGF- ⁇ 1 For detection of TGF- ⁇ 1 by WSU-HN6 tumor cells, Human ELISA TGF- ⁇ total (catalog no.436707) was purchased from BioLegend (San Diego, CA). Conditioned medium was run in triplicate and plates were read using a BioTek Epoch microplate spectrophotometer at 450nm wavelength.
  • the cell lines normal oral keratinocytes (NOK) and oral squamous cell carcinoma WSU-HN6, derived from a stage III (T3N2bM0) primary malignancy of the base of the tongue, were DNA authenticated at (Johns Hopkins Genetic Resources Core Facility, Baltimore, MD) to ensure consistency in cell identity in comparison with their source (Jeon et al, Int J Cancer. 2004; 112(2):249-258).
  • NOK normal oral keratinocytes
  • WSU-HN6 oral squamous cell carcinoma WSU-HN6, derived from a stage III (T3N2bM0) primary malignancy of the base of the tongue
  • T3N2bM0 stage III
  • Sema4D shRNA oligonucleotides were cloned into lentiviral expression vector pWPI GW as previously described (Basile et al, Proc Natl Acad Sci U S A. 2006; 103(24):9017-9022).
  • pWPI (empty) vector was used as negative control.
  • Transductions were performed using FuGENE HD transfection reagent (catalog no. E2311; Promega).
  • the independent variables are tumor clinical stage coded as (I+II, III, and IV), Nodal metastasis (yes/no), Sema4D +ve/high TAIs infiltrate (moderate to heavy are scores 2, 3), negative to low are 0, 1) and fibrotic tumor microenvironment as (+,++,+++).
  • patient characteristics such as age ( ⁇ 45, 45-54, 55-64, 65+), sex, organ category (Oral cavity, Salivary glands, Larynx -Pharynx -Nose, Lymph node), histological grade (1, 2, 3), Pathology (SCC, SGA) and type of tissue (normal or malignant).
  • the associations of two categorical variables were evaluated using two-sided Fisher Exact test or Chi-square test and the association of a continuous variable and a categorical variable were evaluated using two sample t-test or ANOVA F test for the categorical variable having more than two levels. P-values ⁇ 0.05 were considered statistically significant.
  • Table 1 Sema4D expression in HNC tumor cells in correlation to tumor progression, peri-tumoral stromal fibrosis and Sema4D +ve/high TAIs.
  • Table 2 Differential expression of Sema4D and PD-Ll in HNC.
  • Table 3 PD-Ll expression in relation to peri-tumoral fibrosis and Sema4D expressing TAIs.
  • Table 4 Sema4D analysis in the sera of HNC patients in relation to demographics and clinical characteristics
  • Normal tissue 11 Tongue, 2 normal tissue adjacent to tumor margin (NAT), 3 Salivary gland tissue, and 4 epiglottis.
  • Table 6 Sema4D expression in tumor cells in correlation to Patient's demographics and histological grading.
  • Table 7 Sema4D +ve/high TAIs in correlation to malignancy, pathological diagnosis clinical staging
  • Table 8 Descriptive analysis of PD-Ll staining according to tissue type

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention provides a method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.

Description

A Method for Monitoring Cancer and for Regulation of Semaphorin 4D to Improve
Cancer Immunotherapy Regimens
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Appl. No. 62/287,622 filed on January 27, 2016, the contents of which are hereby incorporated by reference in their entirety.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
Incorporated by reference in its entirety herein is a computer-readable sequence listing submitted concurrently herewith and identified as follows: One 25,847 Byte ASCII (Text) file named "Seq_listing_ST25.txt," created on January 27, 2017.
FIELD OF THE INVENTION
The field of the invention relates generally to the field of medicine and cancer biology.
BACKGROUND OF THE INVENTION
Head and Neck squamous cell carcinoma (HNSCC) is a malignancy of high morbidity and mortality, with 45,780 new cases and 8,650 estimated deaths of oral and pharyngeal cancer estimated to occur in the United States in the year 2015 (Siegel et al, 2015. CA Cancer J Clin 65: 5-29). There is accumulating evidence indicating the immune- modulatory effects of HNSCC by which it can escape and/or suppress the immune system (Hadden et al, 1994. Arch Otolaryngol Head Neck Surg 120: 395-403; Katz, A. E. 1993. Med Clin North Am 77: 625-631; Vlock, D. R. 1991. Hematol Oncol Clin North Am 5: 797-820; Russell et al, 2011. Oral Oncol 47: 810-817; Gildener-Leapman et al, 2013. Oral Oncol 49: 1089-1096).
Myeloid Derived Suppressor cells (MDSC) have been described in peripheral blood, draining lymphoid tissue and tumor tissue of several malignancies (Russell et al, 2011. Oral Oncol M: 810-817; Lechner et al, 2011. J Transl Med 9: 90; Vasquez-Dunddel et al, 2013. J Clin Invest 123 : 1580-1589; Gabitass et al, 2011. Cancer Immunol Immunother 60: 1419-1430; Filipazzi et al, 2012. Cancer Immunol Immunother 61 : 255- 263). Circulating MDSC correlated with advanced stages of HNSCC (stages III and IV) as well as in other carcinomas (Vasquez-Dunddel et al, 2013. J Clin Invest 123 : 1580-1589; Filipazzi et al, 2012. Cancer Immunol Immunother 61 : 255-263; Vuk-Pavlovic et al, 2010. Prostate 70: 443-455). MDSC represent a key player in immune regulation in the tumor microenvironment. It is generally agreed that they comprise a heterogeneous population of myeloid progenitor cells and immature myeloid cells that have a suppressive function on T cells (Gabrilovich et al, 2009. Nat Rev Immunol 9: 162-174; Talmadge et al, 2013. Nat Rev Cancer 13 : 739-752). MDSC described in human malignancies have the phenotype of CD33+, CDl lb+, and non-lineage determined (Lin") with poor antigen presentation abilities (HLA-DR"/low). They can have a pro-granulocytic phenotype expressing CD66b or CD15 (PM L-MDSC) or monocytic features (M-MDSC) expressing CD14 (Filipazzi et al, 2012. Cancer Immunol Immunother 61 : 255-263; Lechner et al, 2010. J Immunol 185: 2273-2284; Gabrilovich et al, 2012. Nat Rev Immunol 12: 253- 268). MDSC induce their immune suppressive effect mainly through production of arginase-1 and inducible nitric oxide (iNOS) which consume extracellular arginine and accordingly suppress T cell activation in an antigen non-specific manner in the tumor microenvironment. While they mediated antigen specific suppression by NADPH oxidase (NOX2) production of reactive oxygen and nitrogen species, particularly in peripheral lymphoid tissue, as well as by other mechanisms (Gabrilovich et al, 2009. Nat Rev Immunol 9: 162-174; Gabrilovich et al, 2012. Nat Rev Immunol 12: 253-268; Condamine et al, 2011. Trends Immunol 32: 19-25; Corzo et al, 2010. J Exp Med 207: 2439-2453). In addition to direct T cell suppression, recent evidence suggests a role for MDSC in the expansion of CD4+CD25+FoxP3+, regulatory T cells (Tregs) in the tumor microenvironment through both TGF-β dependent and independent pathways (Vuk- Pavlovic et al, 2010. Prostate 70: 443-455; Capparuccia et al, 2009. JCellSci 122: 1723- 1736). While several mechanisms have been described by which tumor cells induce MDSC, the specific pathways by which HNSCC recruit, expand, and activate MDSC remain to be investigated (Gabrilovich et al, 2012. Nat Rev Immunol 12: 253-268; Pak et al, 1995. Clin Cancer Res 1 : 95-103; Young et al, 1997. Int J Cancer 74: 69-74).
Tumor cells overexpress several cytokines in order to manipulate their own microenvironment, among which are multiple Semaphorins, that have the potential to act on different stromal cells (Capparuccia et al, 2009. J Cell Sci 122: 1723-1736). Semaphorin 4D (Sema4D; CD 100) is a transmembrane glycoprotein belonging to the fourth group of the Semaphorin family that can also be found in a soluble form following proteolytic cleavage. It was initially identified as an evolutionarily conserved chemo- repellant protein that regulates axonal guidance in the developing nervous system (Kolodkin et al, 1993. Cell 75: 1389-1399). Later on, its interactions in other systems were emphasized, including the cardiovascular system and immune system. In the immune system, Sema4D is described to be expressed abundantly on resting T cells and weakly on resting B cells and APCs (Delaire et al, 1998. Cell Mol Life Sci 54: 1265-1276; Roth et al, 2009. Cell Mol Life Sci 66: 649-666; Bismuth et al, 2002. Sci STKE 2002: re4; Shi et al, 2000. Immunity 13 : 633-642; Tamagnone et al, 2004. EMBO Rep 5: 356-361). Two opposing roles of Sema4D have been described in the immune system. One role is a proinflammatory response; where for example in the humoral and cell mediated immune system, Sema4D acts on B cells and dendritic cells, respectively, promoting pro- inflammatory cytokines (Shi et al., 2000. Immunity 13 : 633-642; Tamagnone et al., 2004. EMBO Rep 5: 356-361 ; Ishida et al, 2003. Int Immunol 15: 1027-1034). Sema4D expressed by T cells and K cells has also been implicated in their activation through a Sema4D associated tyrosine kinase (Elhabazi etal, 1997. J Biol Chem 272: 23515-23520), and has been shown to play a role in T cell priming and accordingly in the pathogenesis of autoimmune diseases (Okuno etal, 2010. J Immunol 184: 1499-1506). While on the other hand, an anti-inflammatory role of Sema4D in the immune system has also been described. On monocytes and immature dendritic cells, Sema4D can act on Plexin CI and Plexin Bl, respectively, inhibiting their migration, but not that of mature dendritic cells, which can provide more interaction between immature myeloid cells and T cells (Chabbert-de Ponnat et al, 2005. Int Immunol 17: 439-447; Delaire et al, 2001. J Immunol 166: 4348-4354). Furthermore, in vitro studies have shown that Sema4D can modulate cytokine production by monocytes and dendritic cells, and can induce a significant increase in the antiinflammatory cytokine IL-10 and a decrease in the pro-inflammatory cytokines IL-6, IL-8 and T F-α (Tamagnone et al., 2004. EMBO Rep 5: 356-361; Chabbert-de Ponnat et al, 2005. Int Immunol 17: 439-447; Delaire et al, 2001. J Immunol 166: 4348-4354). The role of Sema4D produced by tumor cells in inducing tumor angiogenesis, invasiveness and progression has been demonstrated in several malignancies, both in human and animal models, and correlates with poor prognosis (Basile et al, 2006. Proc Natl Acad Sci U S A 103 : 9017-9022; Zhou et al, 2012. Exp Cell Res 318: 1685-1698; Zhou et al., 2012. Angiogenesis; Mu et al., 2014. Zhonghua Wei Chang Wai Ke Za Zhi 17: 388-392; Liu et al, 2014. Microvasc Res 93 : 1-8; Ch'ng, et al, 2010. Mol Cancer 9: 251; Chen et al, 2012. Int J Mol Sci 13 : 13264-13274). Sema4D overexpression has been described in a large number of human HNSCC tumor tissue samples and in a panel of primary and metastatic cell lines (Basile et al, 2006. Proc Natl Acad Sci U S A 103 : 9017- 9022). In the tumor microenvironment, tumor associated macrophages (TAMs) were reported to be the main producers of Sema4D in a mouse breast cancer model (Sierra et al, 2008. J Exp Med 205 : 1673-1685).
There is a need to develop new methods for enhancing the effectiveness of immunotherapeutic approaches and for treating cancer. The present invention satisfies this need and provides additional advantages as well.
This background information is provided for informational purposes only. No admission is necessarily intended, nor should it be construed, that any of the preceding information constitutes prior art against the present invention.
SUMMARY OF THE INVENTION
It is to be understood that both the foregoing general description of the embodiments and the following detailed description are exemplary, and thus do not restrict the scope of the embodiments.
The hypothesis tested in the current study was that the net inflammatory profile orchestrated by Sema4D in the tumor microenvironment is pro-tumorigenic through induction of immune suppressive cells. Herein, it is investigated whether HNSCC derived Sema4D plays a role in inducing MDSC and its effects were examined on T cell phenotype and function. It was found that Sema4D produced by the HNSCC HN6 and HN13 cell lines polarized myeloid cells into MDSC phenotype, which corresponded with a reduction in T cell proliferation and IFN-γ production. Furthermore, shRNA inhibition of Sema4D in HN6 resulted in a decrease in the production of the immunosuppressive factors; arginase- 1, TGF-βΙ, and IL-10 by myeloid cells and the recovery of autologous T cell proliferation, IFN-γ production, specifically leading to an increase in the effector T cell population and decrease in Tregs. These findings describe HNSCC-associated Sema4D production as one of the mechanisms by which the tumors induce MDSC, that subsequently mediate their immunosuppression effects on T cells.
In one aspect, the invention relates to a rapid and sensitive method for monitoring certain cancers such as head and neck squamous cell carcinoma and lymphomas.
In another aspect, the invention relates to methods for improving certain cancer immunotherapy treatment regimens based on the cytokine Semaphorin 4D.
In another aspect, the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
In another aspect, the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject undergoing immunotherapy, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D. In some embodiments, the immunotherapeutic agent comprises T cells.
In another aspect, the invention provides a method of screening for an agent that has anti-cancer activity, comprising i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; and ii) assaying whether Semaphorin 4D activity is reduced, wherein if Semaphorin 4D activity is reduced, the agent has anti-cancer activity. In some embodiments, the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid-derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti -cancer activity.
In another aspect, the invention provides a method of monitoring progression of cancer in a subject, comprising i) obtaining a tissue sample from the subject; and ii) assaying the sample for the presence of Semaphorin 4D, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
In another aspect, the invention provides a composition for inhibiting tumor- mediated immunosuppression in a subject and thereby treating cancer, comprising a nucleic acid that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D and a pharmaceutically acceptable carrier.
Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE FIGURES
The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
FIG. 1. HNSCC conditioned media polarizes myeloid cells towards a MDSC phenotype. (A) CD33+ cells were cultured in normal media (NM) or HNSCC conditioned media (HN6, HN13) for 72hrs, and then analyzed by flow cytometry. (B) Dose dependent induction of MDSC following culture in HNSCC condition media. CD33+ cells were cultured in serial dilutions of HN6 CM and (C) HN13 CM. Cells were first gated for CD33+ then for CDl lb+, followed by a third gate for CDl lb+ HLA-DR"/low. CD33 cells were isolated using magnetic cell sorting (MACS), from PBMC separated by centrifugation gradient of peripheral blood. All samples were run in duplicates. NM; Normal media, CM; Conditioned medium.
FIG. 2. Sema4D produced by HNSCC plays a role in MDSC induction. (A) Sema4D is secreted by HN6 and HN13 cell lines. CM and total cell lysates from HN6 and HN13 HNSCC cell lines were analyzed by Western blot. Ponceau staining was used as a control for protein loading prior to immunoblotting. β-actin served as control for cell lysates. (B) Anti-sema4D antibody treatment downregulates MDSC induction by HNSCC cells. CD33+ cells were cultured in NM, NOK, HN6 and HN13 CM in the presence or absence of anti-Sema4D mAb (10 ug/ml) or isotype control mAb for 72hrs. Cells were analyzed by flow cytometry by gating on CD33+CD1 lb+, then analyzed for CD1 lb+HLA- DR_ /low. The experiment was independently repeated twice. (C) Graphical presentation of
+ + -/low
2 combined experiments, showing MDSC reduction (CD33 CDl lb HLA-DR ) upon anti-Sema4D Ab treatment of HN6 and HN13 CM. Data normalized to MDSC in NM treated with IgG isotype.
FIG. 3. Inhibition of Sema4D produced by HN6 rescues MDSC mediated T cell suppression. (A) Recovery of T cell proliferation following inhibition of Sema4D in HN6 cell line using lentivirus shRNA. T cells stained with CFSE and myeloid cells were added at the indicated ratios (M:T). Cells were co-cultured in CM from HN6 Sema4D-shRNA or HN6 Ctl-shRNA, and activated by anti-CD3/CD28 microbeads for 72hrs. CFSE dilution in T cells was analyzed by FACS. (B) Graphical representation of flow cytometry data shown in A. Data normalized to activated T cells cultured alone in NM. The supernatants were collected to assess IFN-γ (C) and IL-4 (D) production using ELISA. Error bars indicate S.D. of triplicate assays.
FIG. 4. Sema4D produced by HN6 induces an immune suppressive T cell phenotype. (A) T cells were co-cultured with myeloid cells at the indicated ratios, followed by CD3/CD28 activation for 72hrs. Then cells were analyzed by flow cytometry. (A) The cells were gated on the myeloid and T cell subpopulations, followed by a second gate on CD3+ cells. CD3+ cells were then gated on (B) CD4+T-bet+ and (C) CD8+T-bet+. The CD4+ population was gated on CD25+FoxP3+. Representative flow cytometry plots displaying percentage of recovery of (B) CD3+ CD4+ Tbet+ effector cells (C) CD3+ CD8+ Tbet+ effector cells and (D) decrease in CD4+ CD25+ FoxP3+ Tregs in HN6 CM of Sema4D- shRNA versus Ctl-shRNA.
FIG. 5. Sema4D enhances GM-CSF + IL-6 mediated induction of MDSC. (A) The percentage of CD33+ HLA-DR-/low MDSC induced by culture in HN6 CM is reduced following Sema4D or GM-CSF immune precipitation (IP) HN6 CM. (B) Graph shows comparable decrease in the CD33+ HLA-DR"/low population following immune depletion of Sema4D or GM-CSF, compared to the control HN6 CM. (C) HN6 CM was depleted of Sema4D or GM-CSF by immune precipitation (IP), then used to culture myeloid cells and T cells, followed by anti-CD3/CD28 stimulation. After 72 hrs, the cells were analysed by flow cytometry analysis, and the supernatants were collected for ELISA. CFSE dilution in T cells was analyzed by flow cytometry. (D) Graph shows comparable recovery of T cell proliferation upon immune depletion of Sema4D or GM-CSF in HN6 CM. (E) IFN-γ production following immune depletion of Sema4D is comparable to GM-CSF depleted CM. (F) Sema4D is synergistic to GM-CSF + IL-6 in MDSC induction. CD33+ cells separated from PBMC of normal donors were cultured in NM with the recombinant protein GM-CSF alone, or GM-CSF+ IL-6 or the cytokine induction mixture of GM-CSF + IL-6 + Sema4D. (G) CD33+ HLA-DR"/low induction in response to treatment with Sema4D, IL- 6, GM-CSF alone or combination. (F, G) Each of the recombinant proteins was used at a concentration of lOng/ml.
FIG. 6. HN6 secreted Sema4D induces production of immune-suppressive mediators by MDSC. (A) Sema4D promotes proliferation of total myeloid cells. Bulk CD33+ cells cultured in HN6 control or Sema4D-shRNA CM for 24hrs were analyzed using the WST-1 proliferation assay. (B) Sema4D promotes proliferation of CD33+ HLA- DR"/low cells. CD33+ HLA-DR"/low cells were sorted using magnetic beads and analyzed by WST-1 proliferation assay. All readings were normalized to cells growing in NM. NT; non-transfected. (C) Reconstitution of HN6 Sema4D-shRNA CM with human recombinant Sema4D rescues CD33+ HLA-DR-/low MDSC proliferation. CD33+ HLA-DR"/low labeled with CFSE were analyzed by FACS. (D) Sema4D inhibition in HN6 decreases arginase-1 expression in myeloid cells. CD33+ cells were cultured in NT, Ctl-shRNA or Sema4D- shRNA HN6 CM for 24 hrs, and then analyzed by Western blot for arginase-1 expression. GAPDH served as a loading control. Densitometric analysis included for Western blot data were determined using Image J. (E) Sema4D inhibition in HN6 decreases NO production by myeloid cells. HN6 Sema4D-shRNA CM inhibits nitrite production by myeloid cells. Total CD33+ cells were cultured in CM from HN6 Ctl-shRNA or HN6 Sema4D-shRNA for 72hrs, then the media was collected to detect the nitrite concentration using Griess reagent. (F) CD33+ cells were cultured in HN6 Sema4D-shRNA or Ctl- shRNA CM and cytokine production was assessed by ELISA. Knockdown of Sema4D results in a decrease in IL-10 production by CD33+ cells. (G) A reduction in Sema4D results in a concomitant decrease in TGF-β production by CD33+ cells. Data are shown with background levels of cytokine subtracted to demonstrate myeloid cell-specific cytokine production.
FIG. 7. HNSCC CM induces MDSC from total PBMC or myeloid cells of healthy donors and anti-Sema4D Ab treatment reduces its induction. (A) HNSCC CM induces MDSC from total PBMC. PBMC were separated by density gradient centrifugation then plated for 72hrs in M or CM from NOK versus CM of HN4, HN6, HN13 and SCC-9 cell lines. The average MDSC generation from PBMC was -20%. For flow cytometry analysis total PBMC were gated followed by a CD33+ HLA-DR"/l0 gate. (B) Induction of MDSC from total CD33+ cells by HNSCC cell line CM is decreased by anti-Sema4D Ab treatment. Total CD33+ cells separated from PBMC using CD33 microbeads magnetic cell sorting (MACS), were cultured for 72hrs in HNSCC HN4 and SCC-9 CM only (-), CM with IgG Isotype, or CM with anti-Sema4D antibody (lOug/ml). Total myeloid cells were gated for CD33+ CDl lb+ followed by a CDl lb+ HLA-DR"/l0 gate. For both experiments initial plating cell density was 1ml of 2.5 xlO5 in 24 well plate. NM: Normal media. CM: conditioned media.
FIG. 8. HN6 produced Sema4D induces MDSC and suppressive T cells in myeloid and T cell co-culture. (A) HN6 CM induces CD3+ CDl lb+ HLA-DR"/low upon co-culture of total CD33+ cells with T cells. (B) Inhibition of Sema4D production in HN6 using lentivirus Sema4D-shRNA (cell lysates). (C) and in the supernatant CM. (D) Graphical presentation of accumulative data of frequency for CD3+ CD4+ Tbet+ (E) CD3+ CD8+ Tbet+ effector cells and (F) CD4+ CD25+ FOXP3+ Tregs in HN6 CM of Sema4D-shRNA versus Ctl-shRNA. For D, E, and F, T cells at 2.5xl05 cell density were co-cultured with myeloid cells at the indicated M:T ratios, followed by CD3/CD28 activation. Cells were collected for flow cytometry analysis after 72hrs. CD3 positive cells were gated for CD4+ Tbet + and CD8+ Tbet+, then CD3+ were gated for CD4+ then for a CD25+ FOXP3+. Samples were run in duplicates. Graphical presentation is normalized to activated T cells growing alone in NM.
FIG. 9. Characterization of commercially available Sema4D Abs for ELISA. An indirect ELISA was performed in which plates were coated with serial dilutions of Sema4D recombinant protein (Peprotech), then incubated with the indicated Abs to determine which Abs could be used for ELISA. BD - mouse anti-Human (IgGi), eBioscience- mouse anti- Human (IgM), Novus - Ab is biotinylated, avidin peroxidase was used.
FIG. 10. Sema4D levels are higher in patients with head and neck cancer, compared to sera from healthy donors (HD serum purchased from Atlanta Biologicals).
FIG. 11. Sema4D is present in sera from some lymphoma patients. FIG. 12. Sema4D expression in HNC tumor cells in different clinical stages and metastases. (A) IHC shows Sema4D"ve/low expression in tumor cells of a stage I SCC of the nasal cavity. (B) Sema4D"ve/low expression in tumor cells of Stage II SCC of the larynx. Moderate stromal infiltration with Sema4D+ve/hi h TAIs. (C) Sema4D+ve/high expression in tumor cells of a stage III SCC of the upper Jaw. (D) Sema4D"ve/low expression in tumor cells of stage IV SCC of the gingiva with the peri-tumoral stroma showing heavy infiltration of Sema4D+ve/high TAIs. (E) Metastatic SCC to the lymph nodes. Tumor cells show strong Sema4D+ve/high expression as well as the inflammatory cells of the lymph node. (F) Metastatic acinic cell carcinoma to the lymph nodes, showing Sema4D+ve/high expression. (20x; 200um scale, inset: 40x).
FIG. 13. Sema4D high expression in tumor cells correlates directly with fibrosis and TGF-βΙ production. (A) IHC shows Sema4D+ve/high expression in tumor islands with surrounding dense fibrotic stroma in a stage I SCC of the maxillary sinus. (B) Sema4D +ve/hi g h expression m tumor islands of a stage II Adenoid Cystic Carcinoma of minor salivary glands arising in the tongue, associated with dense fibrotic stroma. (C) Sema4D +ve/hish expression in stage III SCC of the larynx and surrounding dense fibrotic stroma. (D) Detection of TGF-βΙ in CM of stage III HNC cell line. Sema4D knockdown in HN6 cell line using sh-RNA lentivirus shows downregulation of TGF-βΙ production in the CM as detected by ELISA, compared to transfection control (Ctl), non-transfected (NT), normal oral keratinocytes (NOK) and Normal media (NM). CM; conditioned medium. T; Tumor, FS; fibrotic stroma, (20x; 200um scale, inset: 40x).
FIG. 14. Sema4D+ve/high expression in stromal infiltrating TAIs correlates inversely with its expression in tumor cells. (A) Sema4D+ve/high expression in TAIs corresponded to negative Sema4D expression in tumor cells of stage IV SCC of the larynx. (B) Sema4D+ve/high expression in TAIs corresponded to negative Sema4D expression in tumor cells of stage IV SCC of gingiva. TAIs; tumor associated inflammatory cells, T; Tumor. (20x; 200um scale, inset: 40x).
FIG. 15. Stratification of HNC tumors into 4 subtypes according to Sema4D and PD- Ll expression. A-D. Sema4D+ve/high/PD-Lrve/low tumor subtype. (A) A stage III SCC of the larynx with Sema4D+ve/high tumor cells surrounded with fibrotic peri-tumoral stroma. (B) The same tumor as in (A) showed PD-Ll"ve/low expression. (C) Total strong pixel intensity for Sema4D stain in (A) ~ 2xl06. (D) Total strong pixel intensity for PD-L1 stain in (B) <104. E-H. Sema4D-ve/low/PD-Ll+ve/high tumor subtype. (E) A stage IV SCC of the lip showed Sema4D"ve/low tumor cells with Sema4D+ve/high TAIs in the peri-tumoral stroma. (F) Same tumor as in (E) showed PD-Ll+ve/high tumor cells, TAIs were PD-Ll"ve/low. (G) Total strong pixel intensity of Sema4D stain in (E) of - 1.5xl05. (H) Total strong pixel intensity for PD-Ll stain in (F) ~ 5.3xl06. 1-L. Sema4D-ve/low/PD-Lrve/low tumor subtype. (I) Tumor cells of a stage III SCC of the larynx were Sema4D"ve/low, TAIs were Sema4D+ve/high. (J) The same tumor as in (I), PD-Ll-ve/low for tumor cells and TAIs. (K) Total strong pixel intensity for tumor stain in (I) <104. (L) Total strong pixel intensity for PD-L1 (J) ~104. M- P. Sema4D+ve/high /PD-Ll+ve/high tumor subtype. (M) A stage III SCC of the larynx, with tumor cells Sema4D+ve/high with peri-tumoral fibrotic stroma showing focal Sema4D+ve/high TAIs. (N) PD-Ll+ve/hi h in same tumor as in (M) TAIs were PD-L1 negative. (O) Total strong pixel intensity for Sema4D stain in (M) 1.5xl06. (P) Total strong pixel intensity for PD-L1 stain in (N) ~ 4 xlO6. (20x; 200um scale, inset: 40x,pixel intensity was calculated as the mean of 3 annotation layers per tumor core taken at 20x; at area 0.2mm2. Cut off value for positive is 5xl05).
FIG. 16. Analysis of Sema4D in sera of HNC patients. (A) ELISA assay of Sema4D in sera of HNC patients compared to HD (p<0.0001). Two ranges of Sema4D level were detected, a low range group and a higher range group. (B) Sema4D in the sera of HNC patients showed highest distribution in stage III (p= 0.055). HD; Healthy donors, HN; Head and Neck cancer patients.
FIG. 17. A model for Sema4D+ve/high tumor cells with a fibrotic peri-tumoral stromal phenotype. (A) Sema4D+ve/high tumor cells induce increased production of TGF-βΙ which increases deposition of ECM and collagen fibers. This model is suggestive of high Sema4D levels in peripheral blood. (B) Sema4D"ve/low tumor cells with inflamed stroma. Sema4D" ve/iow ^umors has decreased level of TGF-β 1 production, less fibrotic and more into the loose peri-tumoral stroma with increased infiltrate of Sema4D+ve/high TAIs. This model is suggestive of low Sema4D levels in peripheral blood. MDSC: Myeloid derived suppressor cells. TAIs: Tumor Associated Inflammatory cells.
FIG. 18. Graphical presentation of the human HNC tumor samples (A) Pie chart representative of the HNC tumors included in the study. (B) Graphical presentation of the SCC cases included in the study according to tissue of origin. SCC; Squamous cell carcinoma, SGA; Salivary gland adenocarcinoma.
FIG. 19. Sema4D expression in the normal epithelium and epithelial tissue adjacent to tumor margin. (A) Normal parakeratinized stratified squamous epithelium of the tongue is negative for Sema4D expression. (B) Digital analysis of tissue in (A) showing negative
3
Sema4D expression (blue) through the entire thickness with only 6x10 strong positive pixel intensity. (C) Normal parakeratinized stratified squamous epithelium showing Sema4D _ve/low expression with focal positivity in the prickle cells. (D) Digital analysis of tissue in (C) shows negative (blue) to focal positive (orange) expression of the prickle cell layer with 3.5 xlO4 of strong positive pixel intensity. (E) Normal tongue epithelium showing focal Sema4D+ve/high expression in the parabasal cell layer. (F) Digital analysis of (E) shows diffuse weak expression (yellow) in the prickle cells, to focal positive (orange) expression in the parabasal layer with 2xl05 mean of strong positive pixel intensity. (G) Sema4D+ve/high in the basal and prickle cell layer of the surface epithelium (arrows). (H) Digital analysis of Sema4D staining in (G) shows high (red) expression in the basal cell layer and diffuse positive expression in the prickle cell layer with 1.3xl06 mean of strong positive pixel intensity .The strong positive pixel intensity presented is the mean of three annotations of each tissue section. (20x; 200um scale, inset: 40x).
FIG. 20. Sema4D expression in normal salivary glands and epiglottis. (A) Normal salivary gland acini and ducts, shows positive expression in the ductal cells (arrows), mucous and serous acini are negative. (B) Normal epiglottis shows positive Sema4D expression in the lining epithelium (arrow) and focal expression in chondrocytes (dotted arrow) (20x; 200um scale).
FIG. 21. Standardization of Sema4D expression in tumor islands. (A) Stage I SCC of the lip showing _ve/low expression of Sema4D in the annotated tumor island. (B) Digital analysis of Sema4D staining in (A) showing low expression (yellow), in the tumor cells with low level of strong positive pixel intensity of 1.5xl05. (C) Stage III SCC of the left upper jaw, showing diffuse Sema4D+ve/high expression, with annotation set for digital analysis. (D) Digital analysis of Sema4D expression in (C) showed high level of strong positive pixel intensity of l . lxlO6. The total intensity of strong positive pixels was calculated as the mean of three different annotations representative of the whole tumor, each annotation was analyzed under 200x magnification in an area of - 0. 2 mm2 (20x; 200um scale, inset: 40x).
FIG. 22. Sema4D+ve/high TAIs. (A) TAIs infiltrating the stroma of stage II SCC of the right palate were Sema4D+ve/high (B) Digital analysis shows high Sema4D expression (red) in the TAIs with 1.3x10 6 strong positive pixel intensity (20x; 200um scale).
FIG. 23. PD-L1 expression in epithelial tissue adjacent to tumor margin and in tumor cells. (A) PD-L1 is negative in tissue adjacent to tumor margin with a focal positive area (arrows). (B) Digital analysis shows negative expression (blue) with focal positivity (arrows) (20x; 200um scale). (C) Tumor cells of stage II SCC of the right palate shows PD-L1 +ve/hish expression in tumor cells, TAIs are PD-L1 negative. (D) PD-L1 staining in (C) showed high level of strong positive pixel intensity of 5.5x106 (20x; 200um scale).
FIG. 24. Sema4D inhibition in HN6 cells recovers T cell proliferation and IFN-γ production in Normoxic and hypoxic conditions. Sema4D inhibition using siRNA in HN6 cell lines for 24hrs cultured in a trans well with T cells or T cells +Myeloid cells (M:T, 2: 1). The siRNA target sequence is CAAGACGCTGCAGTTCGTTAA (SEQ ID NO:7). (A-D). Normoxic conditions. (A) Flowcytometry analysis for tracking T cell proliferation using CFSE. (B) Western blot showing Sema4D knock down in HN6 cells using siRNA. (C) Graphical representation of T cell proliferation detected in A using Flowcytometry analysis. (D) IFN-γ levels upon inhibition of Sema4D detected using ELISA and read using spectrophotometer (E-G). Recapitulating the tumor hypoxic conditions, incubating in 2% Oxygen in hypoxia chambers. CFSE stained T cells activated using anti-CD3, CD28 beads, proliferation detected using flow cytometry. (E) Flowcytometry analysis for tracking T cell proliferation using CFSE under hypoxia. (F) Graphical representation of T cell proliferation detected in E using Flowcytometry analysis. (G) IFN-γ levels upon inhibition of Sema4D under hypoxia, detected using ELISA and read using spectrophotometer
DETAILED DESCRIPTION OF THE INVENTION
One of the mechanisms by which malignancies can induce immune suppression is through the production of cytokines that affect the maturation and differentiation of inflammatory cells in the tumor microenvironment. The inventor has surprisingly discovered that inhibition of Semaphorin 4D inhibits tumor-mediated immunosuppression, and that inhibiting Semaphorin 4D can be employed in methods useful for treating cancer. The inventor has also discovered methods which can be used in monitoring cancer progression involving monitoring detection of Semaphorin 4D.
Semaphorin 4D (Sema4D) is a pro-angiogenic cytokine produced by several malignancies, which has been described in the regulation of the immune system. Described herein are studies which examined the role of human Head and Neck Squamous Cell Carcinoma (HNSCC) secreted Sema4D on myeloid cell differentiation. CD33+ cells cultured in HNSCC cell line derived-conditioned medium differentiated into myeloid derived suppressor cells (MDSC) (CD33+ CDl lb+ HLA-DR"/low). The addition of anti- Sema4D antibody to HNSCC conditioned medium significantly reduced the expansion of the MDSC population. Similarly, knockdown of Sema4D in a HNSCC cell line resulted in a loss of MDSC function as shown by a decrease in the production of the immune suppressive cytokines, arginase-1, TGF-β, and IL-10 by MDSC, concomitant with recovery of T cell proliferation and IFN-γ production following stimulation of CD3/CD28. Importantly, CD33+ myeloid and T cells cultured in conditioned medium of HNSCC cells in which Sema4D was knocked down, promoted anti-tumor inflammatory profile, through recovery of the effector T cells (CD4+Tbet+ and CD8+Tbet+), as well as a decrease in Tregs (CD4+CD25+FoxP3+) cell. It is also shown herein that Sema4D was comparative to GM- CSF in its induction of MDSC. Collectively, this work describes a novel immunosuppressive role for Sema4D in HNSCC through induction of MDSC, and highlights it as a therapeutic target to enhance the antitumorigenic inflammatory response in HNSCC and other epithelial malignancies.
Reference will now be made in detail to the presently preferred embodiments of the invention which, together with the drawings and the following examples, serve to explain the principles of the invention. These embodiments describe in sufficient detail to enable those skilled in the art to practice the invention, and it is understood that other embodiments may be utilized, and that structural, biological, and chemical changes may be made without departing from the spirit and scope of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd edition (1989); Current Protocols in Molecular Biology (F. M. Ausubel et al. eds. (1987)); the series Methods in Enzymology (Academic Press, Inc.); PCR: A Practical Approach (M. MacPherson et al. IRL Press at Oxford University Press (1991)); PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)); Antibodies, A Laboratory Manual (Harlow and Lane eds. (1988)); Using Antibodies, A Laboratory Manual (Harlow and Lane eds. (1999)); and Animal Cell Culture (R. I. Freshney ed. (1987)).
Definitions of common terms in molecular biology may be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.); The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341).
For the purpose of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example in the document where the term is originally used). The use of "or" means "and/or" unless stated otherwise. As used in the specification and claims, the singular form "a," "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof. The use of "comprise," "comprises," "comprising," "include," "includes," and "including" are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term "comprising," those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language "consisting essentially of and/or "consisting of."
As used herein, the term "about" means plus or minus 10% of the numerical value of the number with which it is being used.
In one embodiment, the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
Semaphorin 4D, also known as CD 100, is a transmembrane protein that belongs to the semaphorin gene family. Semaphorin 4D is expressed on the cell surface as a homodimer, but upon cell activation Semaphorin 4D can be released from the cell surface via proteolytic cleavage to generate sSEMA4D, a soluble form of the protein, which is also biologically active. See Suzuki et al, Nature Rev. Immunol. 3 : 159-167 (2003); Kikutani et al., Nature Immunol. 9: 17-23 (2008). In some embodiments, the human Semaphorin 4D amino acid sequence is SEQ ID NO: l and the nucleotide sequence is SEQ ID NO:2. Information about Semaphorin 4D gene sequences and variants can also be found in the NCBI gene database. See, e.g., htips://mvw.ncbi.nlrn.nih.gov/geiie/ (gene ID: 10507).
In certain embodiments, Semaphorin 4D is expressed on the surface of or secreted by a cell. In another embodiment, Semaphorin 4D is membrane bound. In another embodiment, Semaphorin 4D is soluble. In another embodiment, Semaphorin 4D may include a full-sized Semaphorin 4D or a fragment thereof, or a Semaphorin 4D variant polypeptide, wherein the fragment of Semaphorin 4D or Semaphorin 4D variant polypeptide retains some or all functional properties of the full-sized Semaphorin 4D.
The full-sized human Semaphorin 4D protein is a homodimeric transmembrane protein consisting of two polypeptide chains of 150 kDa. Semaphorin 4D belongs to the semaphorin family of cell surface receptors and is also referred to as CD 100. Both human and mouse Semaphorin 4D are proteolytically cleaved from their transmembrane form to generate 120-kDa soluble forms, indicating the existence of two Semaphorin 4D isoforms (Kumanogoh et al., J. Cell Science 116(7):3464 (2003)). Semaphorins consist of soluble and membrane-bound proteins that were originally defined as axonal -guidance factors which play an important role in establishing precise connections between neurons and their appropriate target. Structurally considered a class IV semaphorin, Semaphorin 4D consists of an amino-terminal signal sequence followed by a characteristic ' Sema' domain, which contains 17 conserved cysteine residues, an Ig-like domain, a lysine-rich stretch, a hydrophobic transmembrane region, and a cytoplasmic tail.
In one embodiment, the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject undergoing immunotherapy, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D. In some embodiments, the immunotherapeutic agent comprises T cells.
In some embodiments, the inhibition of Semaphorin 4D decreases the level of myeloid-derived suppressor cells in the tumor microenvironment. In some embodiments, the myeloid-derived suppressor cells have a phenotype that is CD33+, CD1 lb+, and HLA- DR"/low. In some embodiments, the inhibition of Semaphorin 4D results in one or more of the following effects: i) an increase in T cell proliferation;
ϋ) an increase in IFN-γ levels;
iii) a decrease in IL-4 levels;
iv) a decrease in arginase-1 production by CD33+myeloid cells;
v) a decrease in NO production by CD33+myeloid cells;
vi) a decrease in IL-10 by CD33+myeloid cells;
vii) a decrease in TGF-β Ι production by CD33+myeloid cells;
viii) a decrease in TGF-β Ι production by tumor cells.
ix) an increase in effector Thl T cells (CD4+Tbet+);
x) an increase in cytotoxic T cells (CD8+Tbet+); and
xi) a decrease in Tregs cells (CD4+CD25+FoxP3+).
The term "subject" as used herein is not limiting and is used interchangeably with patient. In some embodiments, the subject refers to animals, such as mammals. For example, mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like. The terms "subject" and "patient." As used herein, "treat" and all its forms and tenses (including, for example, treating, treated, and treatment) can refer to therapeutic or prophylactic treatment. In certain aspects of the invention, those in need thereof of treatment include those already with a pathological condition of the invention (including, for example, a cancer), in which case treating refers to administering to a subject (including, for example, a human or other mammal in need of treatment) a therapeutically effective amount of a composition so that the subject has an improvement in a sign or symptom of a pathological condition of the invention. The improvement may be any observable or measurable improvement. Thus, one of skill in the art realizes that a treatment may improve the patient's condition, but may not be a complete cure of the pathological condition. In other certain aspects of the invention, those in need thereof of treatment include, those in which a pathological condition is to be prevented, in which case treating refers to administering a therapeutically effective amount of a composition to a subject (including, for example, a human or other mammal in need of treatment) at risk of developing a disease or condition such as cancer.
In accordance with the invention, a "therapeutically effective amount" or "effective amount" is administered to the subject. As used herein a "therapeutically effective amount" or "effective amount" is an amount sufficient to decrease, suppress, or ameliorate one or more symptoms associated with the disease or condition.
"Cancer" refers to leukemias, lymphomas, carcinomas, and other malignant tumors of potentially unlimited growth that can expand locally by invasion and potentially systemically by metastasis. Examples of cancers include, but are not limited to, cancer of the adrenal gland, bone, brain, breast, bronchi, colon and/or rectum, gallbladder, head and neck, kidneys, larynx, liver, lung, neural tissue, pancreas, prostate, parathyroid, skin, stomach, and thyroid. Certain other examples of cancers include, acute and chronic lymphocytic and granulocytic tumors, adenocarcinoma, adenoma, basal cell carcinoma, cervical dysplasia and in situ carcinoma, Ewing's sarcoma, epidermoid carcinomas, giant cell tumor, glioblastoma multiforma, hairy-cell tumor, intestinal ganglioneuroma, hyperplastic corneal nerve tumor, islet cell carcinoma, Kaposi's sarcoma, leiomyoma, leukemias, lymphomas, malignant carcinoid, malignant melanomas, malignant hypercalcemia, marfanoid habitus tumor, medullary carcinoma, metastatic skin carcinoma, mucosal neuroma, myeloma, mycosis fungoides, neuroblastoma, osteo sarcoma, osteogenic and other sarcoma, ovarian tumor, pheochromocytoma, polycythermia vera, primary brain tumor, small-cell lung tumor, squamous cell carcinoma of both ulcerating and papillary type, hyperplasia, seminoma, soft tissue sarcoma, retinoblastoma, rhabdomyosarcoma, renal cell tumor, topical skin lesion, veticulum cell sarcoma, and Wilm's tumor. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is lymphoma.
In some embodiments, the subject is administered one or more anti-cancer agents and/or radiotherapy in combination with the agent that inhibits Semaphorin 4D.
In some embodiments, the anti-cancer agent is an immunotherapeutic agent. In some embodiments, administering the agent that inhibits tumor-mediated immunosuppression caused by Semaphorin 4D can bolster the effectiveness of the immunotherapeutic anti-cancer agent administered to the subject.
The cancer immunotherapy is not limiting and can include one or more immunotherapies. There are several different approaches to immunotherapy. For example, immunotherapies can include monoclonal antibodies, checkpoint inhibitors/immune modulators, therapeutic cancer vaccines, oncolytic viruses, adoptive T cell transfer, cytokines, and adjuvant immunotherapy.
In certain embodiments, the combination of therapeutic agents discussed herein may be administered concurrently as a single composition in a pharmaceutically acceptable carrier, or concurrently as separate compositions with each agent in a pharmaceutically acceptable carrier. In another embodiment, the combination of therapeutic agents can be administered sequentially. The duration of time separating administrations in sequential administrations is not necessarily limiting.
In some embodiments, the agent that inhibits Semaphorin 4D is combined with an immunogenic agent, such as cancerous cells, purified tumor antigens (including recombinant proteins, peptides, and carbohydrate molecules), cells, and cells transfected with genes encoding immune stimulating cytokines (He et al. (2004) J. Immunol. 173 :4919-28).
The agent that inhibits Semaphorin 4D can be further combined with a vaccination protocol. Many experimental strategies for vaccination against tumors have been devised (see Rosenberg, S. (2000) Development of Cancer Vaccines, ASCO Educational Book Spring: 60-62; Logothetis, C, 2000, ASCO Educational Book Spring: 300-302; Khayat, D. (2000) ASCO Educational Book Spring: 414-428; Foon, K. (2000) ASCO Educational Book Spring: 730-738; see also Restifo and Sznol, Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita et al. (eds.), 1997, Cancer: Principles and Practice of Oncology. Fifth Edition). In one of these strategies, a vaccine is prepared using autologous or allogeneic tumor cells. These cellular vaccines have been shown to be most effective when the tumor cells are transduced to express GM-CSF. GM-CSF has been shown to be a potent activator of antigen presentation for tumor vaccination (Dranoff et al. (1993) Proc. Natl. Acad. Sci U.S.A. 90: 3539-43).
The study of gene expression and large scale gene expression patterns in various tumors has led to the definition of so called tumor specific antigens (Rosenberg (1999) Immunity 10:281-7). In many cases, these tumor specific antigens are differentiation antigens expressed in the tumors and in the cell from which the tumor arose. More importantly, many of these antigens can be shown to be the targets of tumor specific T cells found in the host. In certain embodiments, the agent that inhibits Semaphorin 4D may be used in conjunction with one or more recombinant proteins and/or peptides expressed in a tumor in order to generate an immune response to these proteins. These proteins are normally viewed by the immune system as self-antigens and are, therefore, tolerant to them. The tumor antigen may also include the protein telomerase, which is required for the synthesis of telomeres of chromosomes and which is expressed in more than 85% of human cancers and in only a limited number of somatic tissues (Kim et al. (1994) Science 266: 2011-2013). These somatic tissues may be protected from immune attack by various means. Tumor antigen may also be "neo-antigens" expressed in cancer cells because of somatic mutations that alter protein sequence or create fusion proteins between two unrelated sequences {i.e., bcr-abl in the Philadelphia chromosome), or idiotype from B cell tumors.
Other tumor vaccines may include the proteins from viruses implicated in human cancers such a Human Papilloma Viruses (HPV), Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV). Another form of tumor specific antigen which may be used in conjunction with Semaphorin 4D blockade is purified heat shock proteins (HSP) isolated from the tumor tissue itself. These heat shock proteins contain fragments of proteins from the tumor cells and these HSPs are highly efficient at delivery to antigen presenting cells for eliciting tumor immunity (Suot & Srivastava (1995) Science 269: 1585- 1588; Tamura et al. (1997) Science 278: 117-120).
Dendritic cells (DC) are potent antigen presenting cells that can be used to prime antigen-specific responses. DCs can be produced ex vivo and loaded with various protein and peptide antigens as well as tumor cell extracts (Nestle et al. (1998) Nature Medicine 4: 328-332). DCs may also be transduced by genetic means to express these tumor antigens as well. DCs have also been fused directly to tumor cells for the purposes of immunization (Kugler et al. (2000) Nature Medicine 6:332-336). As a method of vaccination, DC immunization may be effectively further combined with the agent that inhibits Semaphorin 4D to activate more potent anti-tumor responses.
Non-limiting examples of tumor vaccines that can also be used include peptides possible head and neck cancer antigens, such as p53, melanoma-associated antigens (MAGEs) such as MAGE-3, NY-ESO-1, cyclin Bl, caspase-8, SART-1, carcino- embryonal antigen, and extracellular matrix metalloproteinase inducer (EMMPRIN) (CD147). The peptides can be coupled with antigen presenting cells, such as dendritic cells in some embodiments.
Semaphorin 4D inhibiting agents can also be used in combination with bispecific antibodies that target Fca or Fey receptor-expressing effector cells to tumor cells (see, e.g., U.S. Pat. Nos. 5,922,845 and 5,837,243). Bispecific antibodies can be used to target two separate antigens. For example anti-Fc receptor/anti-tumor antigen {e.g., Her-2/neu) bispecific antibodies have been used to target macrophages to sites of tumor. This targeting may more effectively activate tumor specific responses. The T cell arm of these responses could be augmented by the use of a Semaphorin 4D inhibiting agents. In some embodiments, antigen may be delivered directly to DCs by the use of bispecific antibodies which bind to tumor antigen and a dendritic cell specific cell surface marker.
In another embodiment, a Semaphorin 4D inhibiting agent can be used in conjunction with anti -neoplastic antibodies, such as Rituxan® (rituximab), Herceptin® (trastuzumab), Bexxar® (tositumomab), Zevalin® (ibritumomab), Campath® (alemtuzumab), Lymphocide® (eprtuzumab), Avastin® (bevacizumab), and Tarceva® (erlotinib), Kadcyla® (ado-trastuzumab emtansine), Perjeta® (pertuzumab), Adcetris® (brentuximab vedotin), Erbitux® (cetuximab), Vectibix® (panitumumab), Gazyva® (obinutuzumab), Arzerra® (ofatumumab), Cyramza® (ramucirumab), Blincyto® (blinatumomab) nimotuzumab, panitumumab, zalutumumab, cetuximab, matuzumab, figitumumab, bavituximab, Chl4.18, and rilotumumab. In some embodiments, the antibody can be bound to a toxin. By way of example and not wishing to be bound by theory, treatment with an anti-cancer antibody or an anti-cancer antibody conjugated to a toxin can lead to cancer cell death (e.g., tumor cells) which would potentiate an immune response mediated by Semaphorin 4D inhibiting agents. In an exemplary embodiment, a treatment of a hyperproliferative disease (e.g., a cancer tumor) may include an anti-cancer antibody in combination with a Semaphorin 4D inhibiting agent, concurrently or sequentially or any combination thereof, which may potentiate an anti-tumor immune responses by the host.
Tumors evade host immune surveillance by a large variety of mechanisms. Many of these mechanisms may be overcome by the inactivation of proteins, which are expressed by the tumors and which are immunosuppressive. These include, among others, TGF-β (Kehrl, J. et al. (1986) J Exp. Med. 163 : 1037-1050), IL-10 (Howard, M. & O'Garra, A. (1992) Immunology Today 13 : 198-200), and Fas ligand (Hahne, M. et al. (1996) Science 274: 1363-1365). In another example, antibodies to each of these entities may be further combined with Semaphorin 4D inhibiting agents to counteract the effects of immunosuppressive agents and favor anti -tumor immune responses by the host.
In another embodiment, a Semaphorin 4D inhibiting agent can be used in conjunction with one or more checkpoint inhibitors or immune modulators. Checkpoint inhibitors/immune modulators can make cancer cells more susceptible to attack by the immune system. Checkpoint inhibitors and immune modulators include CTLA-4 inhibitors such as Yervoy® and tremelimumab, PD-1/PD-L1 inhibitors such as Keytruda®, Opdivo®, MPDL3280A and MEDI4736, LAG- 3 inhibitors and KIR inhibitors. In some embodiments, the immune modulator is selected from CD27 inhibitors and GITR inhibitors.
Other antibodies that may be used to activate host immune responsiveness can be further used in combination with Semaphorin 4D inhibiting agents. These include molecules on the surface of dendritic cells that activate DC function and antigen presentation. Anti-CD40 antibodies are able to substitute effectively for T cell helper activity (Ridge, J. et al. (1998) Nature 393 : 474-478) and can be used in conjunction with Semaphorin 4D inhibiting agents (Ito, N. et al. (2000) Immunobiology 201 (5) 527-40). Activating antibodies to T cell costimulatory molecules, such as OX-40 (Weinberg, A. et al. (2000) Immunol 164: 2160-2169), 4-1BB (Melero, I. et al. (1997) Nature Medicine 3 : 682-685 (1997), and ICOS (Hutloff, A. et al. (1999) Nature 397: 262-266) may also provide for increased levels of T cell activation.
Bone marrow transplantation is currently being used to treat a variety of tumors of hematopoietic origin. While graft versus host disease is a consequence of this treatment, therapeutic benefit may be obtained from graft vs. tumor responses. In some embodiments, combined Semaphorin 4D blockade can be used to increase the effectiveness of the donor engrafted tumor specific T cells.
In some embodiments, the subject is administered Semaphorin 4D inhibiting agents in combination with T cells. There are also several treatment protocols that involve ex vivo activation and expansion of antigen specific T cells and adoptive transfer of these cells into recipients in order to generate antigen-specific T cells against tumor. Adoptive T cell transfer is an anti-cancer approach that enhances the natural cancer-fighting ability of the body's T cells by removing immune system cells, growing and/or making changes to them outside of the body, and then re-infusing them back into the patient. In some embodiments, T cells can be collected from a sample of a patient's tumor and multiplied in a laboratory. In some embodiments, T cells can be taken out of the body and genetically modified to attack antigens on cancer cells. In some embodiments, T cells can be taken out of the body and equipped with special receptors called chimeric antigen receptors (CARs); when given back to the patient, these "CAR T cells" recognize and attack cancer cells.
In some embodiments, the Semaphorin 4D inhibiting agent can be used in conjunction with oncolytic virus immununotherapy. An oncolytic virus is virus that can activate a greater immune response.
In some embodiments, the Semaphorin 4D inhibiting agent can be used in conjunction with one or more cytokines. In some embodiments, the cytokine is selected from IL-2 and IFN-alpha. The agent that inhibits Semaphorin 4D may also be combined with standard cancer treatments. For example, Semaphorin 4D blockade may be effectively combined with chemotherapeutic regimes. In these instances, it may be possible to reduce the dose of other chemotherapeutic reagent administered (Mokyr et al. (1998) Cancer Research 58: 5301-5304). In some embodiments, chemotherapeutic compounds should result in increased levels of tumor antigen in the antigen presentation pathway as a result of increased cell death. Other combination therapies that may result in synergy with Semaphorin 4D blockade through cell death include radiation, surgery, or hormone deprivation. Each of these protocols creates a source of tumor antigen in the host. Angiogenesis inhibitors may also be combined with Semaphorin 4D blockade.
In some embodiments, the anti -cancer agent is selected from the group consisting of Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin- stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afatinib Dimaleate, Afinitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Aminolevulinic Acid, Anastrozole, Aprepitant, Aredia (Pamidronate Disodium), Arimidex (Anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Avastin (Bevacizumab), Axitinib, Azacitidine, BEACOPP, Becenum (Carmustine), Beleodaq (Belinostat), Belinostat, Bendamustine Hydrochloride, BEP, Bevacizumab, Bexarotene, Bexxar (Tositumomab and I 131 Iodine Tositumomab), Bicalutamide, BiCNU (Carmustine), Bleomycin, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Busulfan, Busulfex (Busulfan), Cabazitaxel, Cabozantinib-S- Malate, CAF, Campath (Alemtuzumab), Camptosar (Irinotecan Hydrochloride), Capecitabine, CAPOX, Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Carmubris (Carmustine), Carmustine, Carmustine Implant, Casodex (Bicalutamide), CeeNU (Lomustine) Ceritinib, Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar (Clofarabine), CMF, Cometriq (Cabozantinib-S-Malate), COPP, COPP-ABV, Cosmegen (Dactinomycin), Crizotinib, CVP, Cyclophosphamide, Cyfos (Ifosfamide), Cyramza (Ramucirumab), Cytarabine, Cytarabine, Liposomal, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dabrafenib, Dacarbazine, Dacogen (Decitabine), Dactinomycin, Dasatinib, Daunorubicin Hydrochloride, Decitabine, Degarelix, Denileukin Diftitox, Denosumab, DepoCyt (Liposomal Cytarabine), DepoFoam (Liposomal Cytarabine), Dexrazoxane Hydrochloride, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC-Dome (Dacarbazine), Efudex (Fluorouracil), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista (Raloxifene Hydrochloride), Exemestane, Fareston (Toremifene), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil), Fluorouracil, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRI- BEVACIZUMAB, F OLF IRI- CETUXFM AB , FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Gardasil 9 (Recombinant HPV Nonavalent Vaccine), Gazyva (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, GEMCITABINE- OXALIPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gleevec (Imatinib Mesylate), Gliadel (Carmustine Implant), Gliadel wafer (Carmustine Implant), Glucarpidase, Goserelin Acetate, Halaven (Eribulin Mesylate), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, Hycamtin (Topotecan Hydrochloride), Hyper-CVAD, Ibrance (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig (Ponatinib Hydrochloride), Idamycin (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), Imatinib Mesylate, Imbruvica (Ibrutinib), Imiquimod, Inlyta (Axitinib), Intron A (Recombinant Interferon Alfa-2b), Iodine 131 Tositumomab and Tositumomab, Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Istodax (Romidepsin), Ixabepilone, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), Jevtana (Cabazitaxel), Kadcyla (Ado-Trastuzumab Emtansine), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Lenalidomide, Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Levulan (Aminolevulinic Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Liposomal Cytarabine, Lomustine, Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lupron Depot-3 Month (Leuprolide Acetate), Lupron Depot-4 Month (Leuprolide Acetate), Lynparza (Olaparib), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megace (Megestrol Acetate), Megestrol Acetate, Mekinist (Trametinib), Mercaptopurine, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Mexate (Methotrexate), Mexate-AQ (Methotrexate), Mitomycin C, Mitoxantrone Hydrochloride, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine Hydrochloride), Mutamycin (Mitomycin C), Myleran (Busulfan), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Nelarabine, Neosar (Cyclophosphamide), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilotinib, Nivolumab, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Obinutuzumab, OEPA, Ofatumumab, OFF, Olaparib, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ontak (Denileukin Diftitox), Opdivo (Nivolumab), OPPA, Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride, Pamidronate Disodium, Panitumumab, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, Pegaspargase, Peginterferon Alfa-2b, PEG-Intron (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Pomalidomide, Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Pralatrexate, Prednisone, Procarbazine Hydrochloride, Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, R-EPOCH, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Rituxan (Rituximab), Rituximab, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Ruxolitinib Phosphate, Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, Somatuline Depot (Lanreotide Acetate), Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent (Sunitinib Malate), Sylatron (Peginterferon Alfa-2b), Sylvant (Siltuximab), Synovir (Thalidomide), Synribo (Omacetaxine Mepesuccinate), TAC, Tafinlar (Dabrafenib), Talc, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib),Taxol (Paclitaxel),Taxotere (Docetaxel), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Thiotepa, Toposar (Etoposide), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and I 131 Iodine Tositumomab, Totect (Dexrazoxane Hydrochloride), TPF, Trametinib, Trastuzumab, Treanda (Bendamustine Hydrochloride), Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Vandetanib, VAMP, Vectibix (Panitumumab), VelP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, VePesid (Etoposide), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, VIP, Vismodegib, Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELIRI, Xgeva (Denosumab), Xofigo (Radium 223 Dichloride), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Zaltrap (Ziv-Aflibercept), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-Aflibercept, Zoladex (Goserelin Acetate), Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), Zydelig (Idelalisib), Zykadia (Ceritinib), and Zytiga (Abiraterone Acetate). In some embodiments, the anti -cancer agent is selected from gefitinib, erlotinib or cilengitide.
In some embodiments, the therapeutically effective amount of an agent that inhibits the activity of Semaphonn 4D is an antibody. The term "antibody" is used to refer to any antibody like molecule that has an antigen binding region, and includes full length antibody molecules, antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. The techniques for preparing and using various antibody based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are also well known in the art (see, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; incorporated herein by reference).
Monoclonal antibodies (mAbs) as used herein also include sequences corresponding to human antibodies, animal antibodies, and combinations thereof. The term "chimeric antibody," as used herein, includes antibodies that have variable regions derived from an animal antibody, such as a rat or mouse antibody, fused to another molecule, for example, the constant domains derived from a human antibody. One type of chimeric antibodies, "humanized antibodies," have had the variable regions altered (through mutagenesis or CDR grafting) to match (as much as possible) the known sequence of human variable regions. CDR grafting involves grafting the CDRs from an antibody with desired specificity onto the FRs of a human antibody, thereby replacing much of the non-human sequence with human sequence. Humanized antibodies, therefore, more closely match (in amino acid sequence) the sequence of known human antibodies. By humanizing mouse monoclonal antibodies, the severity of the human anti-mouse antibody, or HAMA, response is diminished. Antibodies that bind Semaphorin 4D have been described in the art. See, for example, US Publ. Nos. 2008/0219971 Al, US 2010/0285036 Al, and US 2006/0233793 Al, International Patent Applications WO 93/14125, WO 2008/100995, and WO 2010/129917, and Herold et al, Int. Immunol. 7(1): 1-8 (1995), each of which is herein incorporated in its entirety by reference. Such antibodies can be used in the methods of the present invention. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a mouse monoclonal antibody. In some embodiments, the antibody is clone 30/CDlOO (Cat # 610670) (BD Biosciences PharMingen, San Diego, CA). In some embodiments, the antibody is clone eBiol33-lC6 (Cat# 14-1009) (eBioscience, San Diego, CA). In some embodiments, the antibody comprises one or more complementarity determining regions (CDRs) identical to the CDRs of clone 30/CD100. In some embodiments, the antibody comprises one or more complementarity determining regions (CDRs) identical to the CDRs of clone eBiol33-lC6.
In certain embodiments, an anti-Semaphorin 4D antibody for use in the methods provided herein binds human, murine, or both human and murine Semaphorin 4D. Also useful are antibodies which bind to the same epitope as any of the aforementioned antibodies and/or antibodies which competitively inhibit binding or activity of any of the aforementioned antibodies.
In some embodiments, it may be desirable to "humanize" the antibody in order to attenuate any adverse immune reaction. Humanized antibodies can be produced, for example by replacing an immunogenic portion of an antibody with a corresponding, but non-immunogenic portion (i.e., chimeric antibodies). See, e.g., Robinson et al, WO/1987/002671 ; Akira et al, EP Application 184,187; Taniguchi, EP Application 171,496; Morrison etal, EP Application 173,494; Neuberger et al. , WO 86/01533; Cabilly et al, EP Application 125,023, all of which are incorporated herein by reference. In some embodiments, the agent that inhibits Semaphorin 4D is a humanized antibody. In some embodiments, the antibody is a humanized antibody of antibody clone 30/CD100. In some embodiments, the antibody is a humanized antibody of antibody clone eBiol33-lC6 In some embodiments, the antibody is a fully human antibody.
In some embodiments, the Semaphorin 4D inhibitory agent useful in the methods of the invention comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D. The nucleic acid molecule can be of any length, so long as at least part of the molecule hybridizes sufficiently to Semaphorin 4D mRNA. The nucleic acid molecule can bind to any region of Semaphorin 4D mRNA. In some embodiments, the nucleic acid molecule binds to a particular domain of Semaphorin 4D mRNA. In some embodiments, the nucleotide sequence of human Semaphorin 4D is shown in SEQ ID NO:2 (GenBank Accession No. U60800.1). In some embodiments, a region of the nucleic acid molecule is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary to at least a portion of SEQ ID NO:2. In some embodiments, the portion of SEQ ID NO:2 comprises SEQ ID NO:4 (5 ' -GGCCTGAGGACCTTGC AGAAG A-3 ' ), corresponding to a portion of Homo sapiens semaphorin 4D (SEMA4D), Homo sapiens semaphorin 4D (SEMA4D), transcript variant 1, mRNA NCBI Reference Sequence: NM_0()6378.3 (SEQ ID NO : 5) and transcript van ant 2, mRN A NCB I Reference Sequence; NM 001 142287.1 (SEQ ID NO: 6). In some embodiments, a region of the nucleic acid molecule is 100% complementary to SEQ ID NO:4.
In some embodiments, the composition can comprise a DNA molecule, such as an antisense DNA molecule. In some embodiments, the composition can comprise an RNA molecule, such as an anti-sense RNA molecule, a small interfering RNA (siRNA) molecule, or small hairpin RNA (shRNA) molecule, which may or may not be comprised on a vector, including a viral vector (such as an adeno-associated viral vector, an adenoviral vector, a retroviral vector, or a lentiviral vector) or a non-viral vector. In some embodiments, the expression of the DNA or RNA molecule may be regulated by a regulatory region specific to one or more types of cancer.
A target sequence on a target mRNA can be selected from a given cDNA sequence corresponding to the Semaphorin 4D, in some embodiments, beginning 50 to 100 nt downstream {i.e., in the 3' direction) from the start codon. The target sequence can, however, be located in the 5' or 3' untranslated regions, or in the region nearby the start codon.
In one embodiment, the Semaphorin 4D inhibitory agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D mRNA. In some embodiments, the nucleic acid molecule is a DNA. In some embodiments, the nucleic acid molecule is an RNA.
In some embodiments, the composition comprises an anti-sense DNA. Anti-sense DNA binds with mRNA and prevents translation of the mRNA. The anti-sense DNA can be complementary to a portion of Semaphorin 4D mRNA. In some embodiments, the anti- sense DNA is complementary to the entire reading frame of Semaphorin 4D. In some embodiments, the anti-sense DNA is complementary to the entire reading frame of SEQ ID NO:2. In some embodiments, the antisense DNA is complementary to a portion of SEQ ID NO:2. In some embodiments, the antisense DNA is at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 1200 nucleotides, at least about 1500 nucleotides, at least about 2000 nucleotides, at least about 2500 nucleotides, at least about 3000 nucleotides, at least about 3500 nucleotides, or at least about 4000 nucleotides.
In some embodiments, the composition comprises an anti-sense RNA. Anti-sense RNA binds with mRNA and prevents translation of the mRNA. The anti-sense RNA can be complementary to a portion of Semaphorin 4D mRNA. In some embodiments, the anti- sense RNA is complementary to the entire reading frame of Semaphorin 4D. In some embodiments, the anti-sense RNA is complementary to the entire reading frame of SEQ ID NO:2. In some embodiments, the antisense RNA is complementary to a portion of SEQ ID NO:2. In some embodiments, the antisense RNA is at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 1200 nucleotides, at least about 1500 nucleotides, at least about 2000 nucleotides, at least about 2500 nucleotides, at least about 3000 nucleotides, at least about 3500 nucleotides, or at least about 4000 nucleotides.
In some embodiments, the composition is an siRNA targeting Semaphorin 4D. SiRNAs are small single or dsRNAs that do not significantly induce the antiviral response common among vertebrate cells but that do induce target mRNA degradation via the RNAi pathway. The term siRNA refers to RNA molecules that have either at least one double stranded region or at least one single stranded region and possess the ability to effect RNA interference (RNAi). It is specifically contemplated that siRNA can refer to RNA molecules that have at least one double stranded region and possess the ability to effect RNAi. The dsRNAs (siRNAs) may be generated by various methods including chemical synthesis, enzymatic synthesis of multiple templates, digestion of long dsRNAs by a nuclease with RNAse III domains, and the like. An "siRNA directed to" at least a particular region of Semaphorin 4D means that a particular Semaphorin 4D siRNA includes sequences that result in the reduction or elimination of expression of the target gene, i.e., the siRNA is targeted to the region or gene.
The nucleotide sequence of the siRNA is defined by the nucleotide sequence of its target gene. The Semaphorin 4D siRNA contains a nucleotide sequence that is essentially identical to at least a portion of the target gene. In some embodiments, the siRNA contains a nucleotide sequence that is completely identical to at least a portion of the Semaphorin 4D gene. Of course, when comparing an RNA sequence to a DNA sequence, an "identical" RNA sequence will contain ribonucleotides where the DNA sequence contains deoxyribonucleotides, and further that the RNA sequence will typically contain a uracil at positions where the DNA sequence contains thymidine.
In some embodiments, a Semaphorin 4D siRNA comprises a double stranded structure, the sequence of which is "substantially identical" to at least a portion of the target gene. "Identity," as known in the art, is the relationship between two or more polynucleotide (or polypeptide) sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polynucleotide sequences, as determined by the match of the order of nucleotides between such sequences. Identity can be readily calculated by standard practices in the art.
One of skill in the art will appreciate that two polynucleotides of different lengths may be compared over the entire length of the longer fragment. Alternatively, small regions may be compared. Normally sequences of the same length are compared for a final estimation of their utility in the practice of the present invention. In some embodiments, there is 100% sequence identity between the dsRNA for use as siRNA and at least 15 contiguous nucleotides of the target gene, although a dsRNA having 70%, 75%, 80%, 85%, 90%), or 95%) or greater may also be used in the present invention. A siRNA that is essentially identical to a least a portion of the target gene may also be a dsRNA wherein one of the two complementary strands (or, in the case of a self-complementary RNA, one of the two self-complementary portions) is either identical to the sequence of that portion or the target gene or contains one or more insertions, deletions or single point mutations relative to the nucleotide sequence of that portion of the target gene. siRNA technology thus has the property of being able to tolerate sequence variations that might be expected to result from genetic mutation, strain polymorphism, or evolutionary divergence.
In some embodiments, the invention provides an Semaphorin 4D siRNA that is capable of triggering RNA interference, a process by which a particular RNA sequence is destroyed (also referred to as gene silencing). In specific embodiments, Semaphorin 4D siRNA are dsRNA molecules that are 100 bases or fewer in length (or have 100 base pairs or fewer in its complementarity region). In some embodiments, a dsRNA may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides or more in length. In certain embodiments, Semaphorin 4D siRNA may be approximately 21 to 25 nucleotides in length. In some cases, it has a two nucleotide 3' overhang and a 5' phosphate. The particular Semaphorin 4D RNA sequence is targeted as a result of the complementarity between the dsRNA and the particular Semaphorin 4D RNA sequence. It will be understood that dsRNA or siRNA of the disclosure can effect at least a 20, 30, 40, 50, 60, 70, 80, 90 percent or more reduction of expression of a targeted Semaphorin 4D RNA in a cancer cell. dsRNA of the invention (the term "dsRNA" will be understood to include "siRNA" and/or "candidate siRNA") is distinct and distinguishable from antisense and ribozyme molecules by virtue of the ability to trigger RNAi. Structurally, dsRNA molecules for RNAi differ from antisense and ribozyme molecules in that dsRNA has at least one region of complementarity within the RNA molecule. In some embodiments, the complementary (also referred to as "complementarity") region comprises at least or at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 contiguous bases. In some embodiments, long dsRNA are employed in which "long" refers to dsRNA that are 1000 bases or longer (or 1000 base pairs or longer in complementarity region). The term "dsRNA" includes "long dsRNA", "intermediate dsRNA" or "small dsRNA" (lengths of 2 to 100 bases or base pairs in complementarity region) unless otherwise indicated. In some embodiments of the disclosure, dsRNA can exclude the use of siRNA, long dsRNA, and/or "intermediate" dsRNA (lengths of 100 to 1000 bases or base pairs in complementarity region).
It is specifically contemplated that a dsRNA may be a molecule comprising two separate RNA strands in which one strand has at least one region complementary to a region on the other strand. Alternatively, a dsRNA includes a molecule that is single stranded yet has at least one complementarity region as described above (such as when a single strand with a hairpin loop is used as a dsRNA for RNAi). For convenience, lengths of dsRNA may be referred to in terms of bases, which simply refers to the length of a single strand or in terms of base pairs, which refers to the length of the complementarity region. It is specifically contemplated that embodiments discussed herein with respect to a dsRNA comprised of two strands are contemplated for use with respect to a dsRNA comprising a single strand, and vice versa. In a two-stranded dsRNA molecule, the strand that has a sequence that is complementary to the targeted mRNA is referred to as the "antisense strand" and the strand with a sequence identical to the targeted mRNA is referred to as the "sense strand." Similarly, with a dsRNA comprising only a single strand, it is contemplated that the "antisense region" has the sequence complementary to the targeted mRNA, while the "sense region" has the sequence identical to the targeted mRNA. Furthermore, it will be understood that sense and antisense region, like sense and antisense strands, are complementary (i.e., can specifically hybridize) to each other.
Strands or regions that are complementary may or may not be 100% complementary ("completely or fully complementary"). It is contemplated that sequences that are "complementary" include sequences that are at least 50% complementary, and may be at least 50%, 60%, 70%, 80%, or 90% complementary. In some embodiments, siRNA generated from sequence based on one organism may be used in a different organism to achieve RNAi of the cognate target gene. In other words, siRNA generated from a dsRNA that corresponds to a human gene may be used in a mouse cell if there is the requisite complementarity, as described above. Ultimately, the requisite threshold level of complementarity to achieve RNAi is dictated by functional capability. It is specifically contemplated that there may be mismatches in the complementary strands or regions. Mismatches may number at most or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 residues or more, depending on the length of the complementarity region.
In some embodiments, the single RNA strand or each of two complementary double strands of a dsRNA molecule may be of at least or at most the following lengths: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, or more (including the full-length of a particular's gene's mRNA without the poly-A tail) bases or base pairs. If the dsRNA is composed of two separate strands, the two strands may be the same length or different lengths. If the dsRNA is a single strand, in addition to the complementarity region, the strand may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more bases on either or both ends (5' and/or 3') or as forming a hairpin loop between the complementarity regions.
In some embodiments, the strand or strands of dsRNA are 100 bases (or base pairs) or less. In specific embodiments, the strand or strands of the dsRNA are less than 70 bases in length. With respect to those embodiments, the dsRNA strand or strands may be from 5-70, 10-65, 20-60, 30-55, 40-50 bases or base pairs in length. A dsRNA that has a complementarity region equal to or less than 30 base pairs (such as a single stranded hairpin RNA in which the stem or complementary portion is less than or equal to 30 base pairs) or one in which the strands are 30 bases or fewer in length is specifically contemplated, as such molecules evade a mammalian's cell antiviral response. Thus, a hairpin dsRNA (one strand) may be 70 or fewer bases in length with a complementary region of 30 base pairs or fewer. In some cases, a dsRNA may be processed in the cell into siRNA.
The siRNA of the invention can comprise partially purified RNA, substantially pure
RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.
One or both strands of the siRNA of the disclosure can comprise a 3' overhang. As used herein, a "3' overhang" refers to at least one unpaired nucleotide extending from the 3'- end of a duplexed RNA strand.
Thus, in some embodiments, the Semaphorin 4D siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length.
In some embodiments in which both strands of the Semaphorin 4D siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In some embodiments, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the Semaphorin 4D siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu").
In order to enhance the stability of the present Semaphorin 4D siRNA, the 3' overhangs can be also stabilized against degradation. In some embodiments, the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotides in the 3' overhangs with 2'-deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation. In particular, the absence of a 2' hydroxyl in the 2'-deoxythymidine significantly enhances the nuclease resistance of the 3' overhang in tissue culture medium. In some embodiments, the Semaphorin 4D siRNA of the invention comprises the sequence AA(N19)TT or NA(N21), where N is any nucleotide. These Semaphorin 4D siRNA comprise approximately 30-70% GC, and in some embodiments comprise approximately 50% G/C. The sequence of the sense siRNA strand corresponds to (N19)TT or N21 (i.e., positions 3 to 23), respectively. In the latter case, the 3' end of the sense siRNA is converted to TT. The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense strand 3' overhangs. The antisense RNA strand is then synthesized as the complement to positions 1 to 21 of the sense strand.
Because position 1 of the 23 -nt sense strand in these embodiments is not recognized in a sequence-specific manner by the antisense strand, the 3'-most nucleotide residue of the antisense strand can be chosen deliberately. However, the penultimate nucleotide of the antisense strand (complementary to position 2 of the 23 -nt sense strand in either embodiment) is generally complementary to the targeted sequence.
In another embodiment, the Semaphorin 4D siRNA of the invention comprises the sequence NAR(N17)YNN, where R is a purine (e.g., A or G) and Y is a pyrimidine (e.g., C or U/T). The respective 21-nt sense and antisense RNA strands of this embodiment therefore generally begin with a purine nucleotide. Such siRNA can be expressed from pol III expression vectors without a change in targeting site, as expression of RNAs from pol III promoters is only believed to be efficient when the first transcribed nucleotide is a purine.
In some embodiments, the Semaphorin 4D siRNA of the disclosure can be targeted to any stretch of approximately 19-25 contiguous nucleotides in any of the target mRNA sequences (the "target sequence"). Techniques for selecting target sequences for siRNA are given, for example, in Tuschl T et al, "The siRNA User Guide," revised Oct. 11, 2002, the entire disclosure of which is herein incorporated by reference. "The siRNA User Guide" is available on the worldwide web at a website maintained by Dr. Thomas Tuschl, Department of Cellular Biochemistry, AG 105, Max -Planck-Institute for Biophysical Chemistry, 37077 Gottingen, Germany, and can be found by accessing the website of the Max Planck Institute and searching with the keyword "siRNA." Thus, in some embodiments, the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.
In some embodiments of the invention, the Semaphorin 4D siRNA targets the Semaphorin 4D ORF sequence: 5 ' -C AAGACGCTGC AGTTCGTTAA-3 ' (SEQ ID NO:7). In some embodiments, the siRNA molecule is complementary to SEQ ID NO:7.
In some embodiments, the Semaphorin 4D inhibitory agent useful in the methods of the invention comprises an shRNA molecule that targets Semaphorin 4D mRNA (Semaphorin 4D shRNA). shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). In certain cases, expression of Semaphorin 4D shRNA in cells is achieved through delivery of non- viral vectors (such as plasmids or bacterial vectors) or through viral vectors. shRNA is useful because it has a relatively low rate of degradation and turnover.
In some embodiments, the oligonucleotide used to knockdown Semaphorin 4D protein levels using shRNA is 5 ' -GGCCTGAGGACCTTGC AGAAGA-3 ' (SEQ ID NO:3). In order to obtain long-term gene silencing, expression vectors that continually express siRNAs in stably transfected mammalian cells can be used (Brummelkamp et al., Science 296: 550-553, 2002; Lee et al, Nature Biotechnol. 20:500-505, 2002; Miyagishi, M, and Taira, K. Nature Biotechnol. 20:497-500, 2002; Paddison, et al, Genes & Dev. 16:948-958, 2002; Paul et al, Nature Biotechnol. 20:505-508, 2002; Sui et al., Proc. Natl Acad. Sci. USA 99(6):5515-5520, 2002; Yu et al, Proc. Natl Acad. Sci. USA 99(9):6047- 6052, 2002). Many of these plasmids have been engineered to express shRNAs lacking poly (A) tails. Transcription of shRNAs is initiated at a polymerase III (pol III) promoter and is believed to be terminated at position 2 of a 4-5-thymine transcription termination site. Upon expression, shRNAs are thought to fold into a stem-loop structure with 3' UU- overhangs. Subsequently, the ends of these shRNAs are processed, converting the shRNAs into ~21 nt siRNA-like molecules. The siRNA-like molecules can, in turn, bring about gene-specific silencing in the transfected mammalian cells.
The length of the stem and loop of shRNAs can be varied. In some embodiments, stem lengths could range anywhere from 25 to 29 nucleotides and loop size could range between 4 to 23 nucleotides without affecting silencing activity. Moreover, presence of G- U mismatches between the two strands of the shRNA stem does not necessarily lead to a decrease in potency.
In some embodiments, the present invention is directed towards methods of administering subjects with compositions comprising expression vectors and/or chemically synthesized shRNA molecules that target Semaphorin 4D. In some embodiments, the composition comprises a nucleotide sequence expressing a small hairpin RNA (shRNA) molecule. In some embodiments, the shRNA molecule is expressed by an expression vector comprising SEQ ID NO:3. In some embodiments, the expression vector is a lentivirus expression vector.
In some embodiments, it is contemplated that nucleic acids or antibodies of the invention may be labeled. The label may be fluorescent, radioactive, enzymatic, or calorimetric. It is contemplated that a dsRNA may have one label attached to it or it may have more than one label attached to it. When more than one label is attached to a dsRNA, the labels may be the same or be different. If the labels are different, they may appear as different colors when visualized. The label may be on at least one end and/or it may be internal. Furthermore, there may be a label on each end of a single stranded molecule or on each end of a dsRNA made of two separate strands. The end may be the 3' and/or the 5' end of the nucleic acid. A label may be on the sense strand or the sense end of a single strand (end that is closer to sense region as opposed to antisense region), or it may be on the antisense strand or antisense end of a single strand (end that is closer to antisense region as opposed to sense region). In some cases, a strand is labeled on a particular nucleotide (G, A, U, or C). When two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize the dsRNA.
Labels contemplated for use in several embodiments are non-radioactive. In many embodiments of the invention, the labels are fluorescent, though they may be enzymatic, radioactive, or positron emitters. Fluorescent labels that may be used include, but are not limited to, BODIPY, Alexa Fluor, fluorescein, Oregon Green, tetramethylrhodamine, Texas Red, rhodamine, cyanine dye, or derivatives thereof. The labels may also more specifically be Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, DAPI, 6-FAM, Killer Red, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red. A labeling reagent is a composition that comprises a label and that can be incubated with the nucleic acid to effect labeling of the nucleic acid under appropriate conditions. In some embodiments, the labeling reagent comprises an alkylating agent and a dye, such as a fluorescent dye. In some embodiments, a labeling reagent comprises an alkylating agent and a fluorescent dye such as Cy3, Cy5, or fluorescein (FAM). In still further embodiments, the labeling reagent is also incubated with a labeling buffer, which may be any buffer compatible with physiological function (i.e., buffers that is not toxic or harmful to a cell or cell component) (termed "physiological buffer").
In some embodiments, the nucleic acids of the invention can be modified. In some embodiments, the nucleic acids can be modified to include a phosphorothioate (PS) backbone. The modification to the backbone can be throughout the molecule or at one or more defined sites. In some embodiments, the nucleic acids can be modified to encompass peptide nucleic acids (PNA). In some embodiments, the nucleic acids can be modified to encompass phosphorodiamidate morpholino oligomers (PMO).
In some embodiments, the nucleic acid molecules of the invention can include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos). S-oligos (nucleoside phosphorothioates) are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom. The S-oligos of the present invention may be prepared by treatment of the corresponding O-oligos with 3H-l,2-benzodithiol-3 -one- 1,1 -dioxide which is a sulfur transfer reagent. See Iyer et al, J. Org. Chem. 55:4693-4698 (1990); and Iyer et al, J. Am. Chem. Soc. 112: 1253-1254 (1990), the disclosures of which are fully incorporated by reference herein.
In some embodiments of the invention, a dsRNA has one or more non-natural nucleotides, such as a modified residue or a derivative or analog of a natural nucleotide. Any modified residue, derivative or analog may be used to the extent that it does not eliminate or substantially reduce (by at least 50%) RNAi activity of the dsRNA.
A person of ordinary skill in the art is well aware of achieving hybridization of complementary regions or molecules. Such methods typically involve heat and slow cooling of temperature during incubation, for example. In some embodiments, the nucleic acid molecules of the present methods are encoded by expression vectors. The expression vectors may be obtained and introduced into a cell. Once introduced into the cell the expression vector is transcribed to produce various nucleic acids. Expression vectors include nucleic acids that provide for the transcription of a particular nucleic acid. Expression vectors include plasmid DNA, linear expression elements, circular expression elements, viral expression constructs (including adenoviral, adeno-associated viral, retroviral, lentiviral, and so forth), and the like, all of which are contemplated as being used in the compositions and methods of the present disclosure. In some embodiments one or at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid molecules binding to Semaphorin 4D RNA are encoded by a single expression construct. Expression of the nucleic acid molecules binding to Semaphorin 4D RNA may be independently controlled by at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more regulatory elements. In certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more expression constructs can be introduced into a cell. Each expression construct can encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid molecules binding to Semaphorin 4D RNA. In some embodiments, nucleic acid molecules binding to Semaphorin 4D RNA may be encoded as expression domains. Expression domains include a transcription control element, which may or may not be independent of other control or promoter elements; a nucleic acid; and optionally a transcriptional termination element.
Any suitable viral vector can be used in the methods of the invention. For example, vectors derived from adenovirus (AV); adeno-associated virus (AAV; including AAV serotypes); retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses. For example, an AAV vector of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.
Selection of recombinant viral vectors suitable for use in the invention, are within the skill in the art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990), Hum Gene Therap. 1 : 5-14; and Anderson W F (1998), Nature 392: 25-30, the entire disclosures of which are herein incorporated by reference. The ability of a RNA of the claimed invention to cause RNAi-mediated degradation of the target mRNA can be evaluated using standard techniques for measuring the levels of RNA or protein in cells. For example, Semaphorin 4D siRNA of the invention can be delivered to cultured cells, and the levels of target mRNA can be measured by Northern blot or dot blotting techniques, or by quantitative RT-PCR. Alternatively, the levels of Semaphorin 4D protein in the cultured cells can be measured by ELISA or Western blot. A suitable cell culture system for measuring the effect of the present siRNA on target mRNA or protein levels may be utilized. RNAi-mediated degradation of Semaphorin 4D mRNA by an siRNA containing a given target sequence can also be evaluated with animal models, for example.
In other embodiments, the method comprises administering a composition comprising an antibody that reduces activity of Semaphorin 4D. As used herein, the term "antibody" includes any immunologic binding agent, such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM may be utilized because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. The term "antibody" may be used to refer to any antibody -like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. Monoclonal and humanized antibodies are also contemplated in the disclosure.
In some embodiments, the nucleic acids can be administered to the subject either as naked nucleic acid, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector that expresses the nucleic acids. Delivery of nucleic acids or vectors to an individual may occur by any suitable means, but in specific embodiments it occurs by one of the following: cyclodextrin delivery system; ionizable lipids; DPC conjugates; GalNAc- conjugates; self- assembly of oligonucleotide nanoparticles (DNA tetrahedra carrying multiple siRNAs); or polymeric nanoparticles made of low-molecular-weight polyamines and lipids (see Kanasty et al. Nature Materials 12, 967-977 (2013) for review of same).
Suitable delivery reagents for administration in conjunction with the present nucleic acids or vectors include the Minis Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes. In specific embodiments, a particular delivery reagent comprises a liposome. Liposomes can aid in the delivery of the present nucleic acids or vectors to a particular tissue, and can also increase the blood half-life of the nucleic acids. Liposomes suitable for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9: 467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are herein incorporated by reference.
In certain aspects, the liposomes encapsulating the present nucleic acids comprise a ligand molecule that can target the liposome to a particular cell or tissue at or near the site of interest. Ligands that bind to receptors prevalent in the tissues to be targeted, such as monoclonal antibodies that bind to surface antigens, are contemplated. In particular cases, the liposomes are modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example by having opsonization-inhibition moieties bound to the surface of the structure. In one embodiment, a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand. Opsonization-inhibiting moieties for use in preparing the liposomes of the disclosure are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system ("MMS") and reticuloendothelial system ("RES"); e.g., as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference. Liposomes modified with opsonization-inhibition moieties thus remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes. Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" microvasculature. Thus, target tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al. (1988), P.N.A.S., USA, 18: 6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation in the liver and spleen. Thus, liposomes of the invention that are modified with opsonization-inhibition moieties can deliver the present nucleic acids to tumor cells.
Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 Daltons, and more preferably from about 2,000 to about 20,000 Daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
In some embodiments, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes." The opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N- hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid- soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH 3 and a solvent mixture such as tetrahydrofuran and water in a 30: 12 ratio at 60 degrees C.
Recombinant plasmids that express nucleic acids of the invention are discussed above. Such recombinant plasmids can also be administered directly or in conjunction with a suitable delivery reagent, including the Minis Transit LT 1 lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
The nucleic acids reducing the level of Semaphorin 4D of the invention can be administered to the subject by any suitable means. For example, the nucleic acids can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes, or by injection, for example, by intramuscular or intravenous injection.
Suitable parenteral administration routes include intravascular administration (e.g. intravenous bolus injection, intravenous infusion, intra-arterial bolus inj ection, intraarterial infusion and catheter instillation into the vasculature); peri- and intra-tissue administration (e.g., peri-tumoral and intra-tumoral injection, intra-retinal injection or subretinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct ( e.g., topical) application to the area at or near the site of interest, for example by a catheter or other placement device ( e.g., a corneal pellet or a suppository, eye-dropper, or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. In a particular embodiment, injections or infusions of the composition(s) are given at or near the site of disease.
The nucleic acids reducing the level of Semaphorin 4D of the invention can be administered in a single dose or in multiple doses. Where the administration of a composition is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions. Injection of the agent directly into the tissue is at or near the site of need. Multiple injections of the agent into the tissue at or near the site of interest are encompassed within this disclosure.
One skilled in the art can also readily determine an appropriate dosage regimen for administering the nucleic acids reducing the level of Semaphorin 4D of the invention to a given subject. For example, the composition(s) can be administered to the subject once, such as by a single injection or deposition at or near the site of interest. In some embodiments, the composition(s) can be administered to a subject once or twice daily to a subject once weekly for a period of from about three to about twenty-eight days, in some embodiments, from about seven to about ten weeks. In some dosage regimens, the composition(s) is injected at or near the site of interest once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of composition(s) administered to the subject can comprise the total amount of composition(s) administered over the entire dosage regimen.
In one embodiment, the present invention is directed towards a composition for treating cancer comprising an isolated nucleic acid that decreases the level and/or activity of Semaphorin 4D and a pharmaceutically acceptable carrier. In some embodiments, the nucleic acid comprises SEQ ID NO:3 or a fragment or derivative thereof capable of decreasing the level and/or activity of Semaphorin 4D.
The Semaphorin 4D inhibitory agents of the disclosure may be formulated as pharmaceutical compositions prior to administration to a subject, according to techniques known in the art. See, e.g., Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference. In some embodiments, pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use.
Pharmaceutical compositions of the disclosure can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
For solid compositions, conventional nontoxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, or 25%-75%, of one or more compositions of the invention. In some embodiments, a pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20%) by weight or 1%>-10%> by weight, of one or more compositions of the invention encapsulated in a liposome as described above, and propellant. A carrier can also be included as desired; e.g., lecithin for intranasal delivery.
Methods of screening for anti-cancer agents
In some embodiments, an assay for Semaphorin 4D activity in cells can be used to determine the functionality of the Semaphorin 4D in the presence of an agent which may act as an inhibitor, and thus, agents that interfere with the activity of Semaphorin 4D can be identified.
In some embodiments, the Semaphorin 4D of the present invention is employed in a screening process for compounds which bind Semaphorin 4D or one of its binding partners or both and which inhibits the biological activity of the Semaphorin 4D interaction. Inhibitors of Semaphorin 4D are particularly advantageous and can be used in methods as therapeutic agents in the treatment of cancer, such as head and neck cancer and lymphoma.
By "inhibitor" is intended naturally occurring and/or synthetic agents capable of inhibiting the biological activity of Semaphorin 4D, which can include inhibiting transcription or translation of Semaphorin 4D mRNA.
In some embodiments, the screening procedures involve producing appropriate cells which produce Semaphorin 4D. Such cells can include cells from mammals, yeast, Drosophila or E. coli. In some embodiments, the cells express Semaphorin 4D endogenously. In other embodiments, the cells have been transfected or engineered to express Semaphorin 4D. In some embodiments, cells expressing Semaphorin 4D (or extracts or purified preparations from cells) are contacted with a test compound to observe stimulation or inhibition of a functional response.
In some embodiments, assays can test binding of Semaphorin 4D to its targets or assays can involve competition with a competitor compound, such as a labeled competitor. Potential antagonists are not limiting and examples include antibodies, peptides, carbohydrates, or small molecules which bind to Semaphorin 4D or its targets. These agents can be selected and screened 1) at random, 2) by a rational selection or 3) by design using for example, ligand modeling techniques (e.g., computer modeling).
For random screening, agents such as antibodies, peptides, carbohydrates, pharmaceutical agents and the like are selected at random and are assayed for their ability to bind to or block the interaction of the Semaphorin 4D to its targets or reduce expression of Semaphorin 4D.
Alternatively, agents may be rationally selected or designed. As used herein, an agent is said to be "rationally selected or designed" when the agent is chosen based on the configuration of the Semaphorin 4D or its targets.
In one aspect, the invention provides a method of screening for an anti-cancer agent which inhibits Semaphorin 4D, comprising: (a) contacting Semaphorin 4D; and (b) assaying the agent's effect on the Semaphorin 4D activity. In some embodiments, the activity to be tested is generation of myeloid-derived suppressor cells.
In one embodiment, the present invention is directed towards methods of screening for anti -cancer agents comprising i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; ii) and assaying whether Semaphorin 4D activity is reduced, wherein if Semaphorin 4D activity is reduced, the agent has anti-cancer activity.
In some embodiments, the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid-derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti-cancer activity. In some embodiments, the myeloid-derived suppressor cells have a phenotype that is CD33+, CDl lb+, and HLA-DR//low In some embodiments, the cell culture medium comprising Semaphorin 4D is a conditioned medium from a cancer cell line. In some embodiments, the cell culture medium is from a head and neck squamous cell carcinoma cell line. In some embodiments, the cell line is a human cell line. In some embodiments, the cell line is selected from the group consisting of HN4, HN6, HN13, and SCC-9. In some embodiments, the cell population comprises total PBMC. In some embodiments, the cell population comprises total myeloid cells (CD33+) isolated from PBMC.
In some embodiments, the candidate anti-cancer agent reduces the level of myeloid- derived suppressor cells by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or about 95% relative to a control lacking the agent.
In some embodiments, the agent is selected from a nucleic acid or an antibody. In some embodiments, the agent comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D, wherein the assaying of part ii) comprises detecting Semaphorin 4D mRNA and/or protein and comparing its level to a control sample lacking the agent.
Diagnostic/Prognostic screening assays
In another embodiment, the invention provides a method of monitoring progression of cancer in a subject, comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
In some embodiments, the cancer is selected from head and neck cancer and hematological malignancies, such as lymphoma. In some embodiments, the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA. In some embodiments, the subject has stage III or stage IV cancer.
The tissue sample is not particularly limiting. In some embodiments, the tissue sample comprises peripheral blood. In some embodiments, the tissue sample comprises cancer tissue. In some embodiments, the tissue sample comprises cancer tissue from head and neck cancer.
In some embodiments, Semaphorin 4D is detected by an antibody. In some embodiments, the antibody is clone 30/CDlOO (Cat # 610670) (BD Biosciences PharMingen, San Diego, CA). In some embodiments, the antibody is clone eBiol33-lC6 (Cat# 14-1009) (eBioscience, San Diego, CA). In some embodiments, the antibody is clone 133-1C6 (available through Novus Biosciences).
In some embodiments, Semaphorin 4D is detected by an ELISA (enzyme-linked immunosorbent assay) technique. In some embodiments, Semaphorin 4D is detected by immunohistochemistry.
In some embodiments, the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject. Additional tissue samples can be obtained at later periods of time in order to monitor progression by assaying for the presence of Semaphorin 4D in the tissue sample.
In some embodiments, an elevated level of expression of Semaphorin 4D corresponds to a positive pixel intensity of at least 1.5xl05 by standardized digital analysis as described herein. The pixel intensity can be determined digitally by the Algorithm (Positive Pixel count v9) of the Leica Aperio software. The cut off value 1.5xl05 was determined as the mean between the negative/low expression and the positive/high expression values (see the materials and methods of Example 3, below).
In some embodiments, the subject's tumor has a fibrotic peri -turn oral stroma. For example, stromal analysis for fibrosis can be carried out by a pathologist on H&E and IHC stained sections under light microscopy. For analysis of fibrosis in the tumor stroma, delicately fibrous stroma (+), moderately fibrotic (++) and densely fibrotic (+++) parameters can used. In some embodiments, the subject's tumor has a dense, fibrotic peri- tumoral stroma. In some embodiments, the stroma is analyzed by cell staining. In some embodiments, the stroma is stained with Picrosirius stain.
In some embodiments, the method further comprises obtaining the results of an assay that detects the presence or absence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D. In some embodiments, there is an inverse correlation between elevated Semaphorin 4D in the tissue and the presence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D. In some embodiments, the method further comprises obtaining the results of an assay that detects the presence or absence of immune checkpoint molecules, such as PD- Ll, in the tissue sample, wherein the tissue sample is cancer tissue. In some embodiments, the cancer tissue is PD-Ll"ve/low. The level of PD-L1 can be assayed and measured relative to its expression in normal oral epithelium. In some embodiments, when the PD-L1 level is negative or low, the method further comprises administering to the subject an agent that inhibits the activity of Semaphorin 4D. In some embodiments, this agent is administered as a monotherapy.
In some embodiments, the tissue is positive for the presence of the immune checkpoint molecule, such as PD-L1. Since PD-L1 is negative in normal epithelium, in some embodiments, the cut off value for elevated PD-L1 (PD-Ll+ve/high) is strong focal expression >1% in tumor cells or in tumor associated inflammatory cells or both, and using a positive pixel intensity of at least 1.5xl05 by standardized digital analysis as described above and in the Examples.
In some embodiments where the tissue is both positive for the immune checkpoint molecule and Semaphorin 4D, the method further comprises administering to the subject an agent that inhibits the activity of Semaphorin 4D and an agent that inhibits the immune checkpoint molecule. In one embodiment, the inhibitor is a PD-L1 inhibitor. Sample embodiments
This section describes exemplary compositions and methods of the invention, presented without limitation, as a series of paragraphs, some or all of which may be alphanumerically designated for clarity and efficiency. Each of these paragraphs can be combined with one or more other paragraphs, and/or with disclosure from elsewhere in this application, including the materials incorporated by reference, in any suitable manner. Some of the paragraphs below expressly refer to and further limit other paragraphs, providing without limitation examples of some of the suitable combinations.
1. A method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D. 2. The method of paragraph 1, wherein the agent decreases the expression level of Semaphorin 4D.
3. The method of any of paragraphs 1-2, wherein the cancer is selected from head and neck cancer and lymphoma.
4. The method of any of paragraphs 1-3, wherein the inhibition of Semaphorin 4D decreases the level of myeloid-derived suppressor cells in the tumor microenvironment.
5. The method of any of paragraphs 1-4, wherein the myeloid-derived suppressor cells have a phenotype that is CD33+, CD1 lb+, and HLA-DR"/low.
6. The method of any of paragraphs 1-5, wherein the inhibition of Semaphorin 4D results in one or more of the following effects:
i) an increase in T cell proliferation;
ii) an increase in IFN-γ levels;
iii) a decrease in IL-4 levels;
iv) a decrease in arginase-1 production by CD33+myeloid cells;
v) a decrease in NO production by CD33+myeloid cells;
vi) a decrease in IL-10 by CD33+myeloid cells;
vii) a decrease in TGF-β Ι production by CD33+myeloid cells;
viii) a decrease in TGF-βΙ production by tumor cells.
ix) an increase in effector Thl T cells (CD4+Tbet+);
x) an increase in cytotoxic T cells (CD8+Tbet+); and
xi) a decrease in Tregs cells (CD4+CD25+FoxP3+).
7. The method of any of paragraphs 1-6, wherein the agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D.
8. The method of any of paragraphs 1-7, wherein the nucleotide sequence of
Semaphorin 4D is SEQ ID NO:2.
9. The method of any of paragraphs 1-8, wherein a portion of the nucleic acid molecule is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% 97%,
97%, 98% or 99% complementary to at least a portion of SEQ ID NO:2.
10. The method of any of paragraphs 1-9, wherein a portion of the nucleic acid molecule is 100% complementary to SEQ ID NO:4. 11. The method of any of paragraphs 1-10, wherein the agent comprises a DNA molecule or an RNA molecule.
12. The method of any of paragraphs 1-11, wherein the agent comprises an anti-sense DNA molecule or an anti-sense RNA molecule.
13. The method of any of paragraphs 1-12, wherein the agent comprises a small interfering RNA (siRNA) molecule.
14. The method of any of paragraphs 1-13, wherein the siRNA molecule targets the sequence CAAGACGCTGCAGTTCGTTAA (SEQ ID NO: 7).
15. The method of any of paragraphs 1-14, wherein the agent comprises a small hairpin RNA (shRNA) molecule.
16. The method of any of paragraphs 1-15, wherein the agent comprises an expression vector comprising SEQ ID NO:3.
17. The method of any of paragraphs 1-16, wherein the expression vector is a lentivirus vector.
18. The method of any of paragraphs 1-17, wherein the agent comprises an antibody specifically binding to Semaphorin 4D.
19. The method of any of paragraphs 1-18, wherein the method further comprises administering to the subject an effective amount of an additional anti-cancer therapeutic agent.
20. The method of any of paragraphs 1-19, wherein the anti-cancer agent comprises an immunotherapeutic agent.
21. The method of any of paragraphs 1-20, wherein the immunotherapeutic agent comprises T cells.
22. A method of screening for an agent that has anti-cancer activity, comprising i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; and
ii) assaying whether Semaphorin 4D activity is reduced,
wherein if Semaphorin 4D activity is reduced, the agent has anti-cancer activity.
23. The method of paragraph 22, wherein the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid- derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti-cancer activity.
24. The method of paragraph 23, wherein the myeloid-derived suppressor cells have a phenotype that is CD33+, CD1 lb+, and HLA-DR"/low
25. The method of any of paragraphs 22-24, wherein the cell population comprises total
PBMC.
26. The method of any of paragraphs 22-25, wherein the cell population comprises total myeloid cells (CD33+) isolated from PBMC.
27. The method of any of paragraphs 22-26, wherein the cell culture medium comprising Semaphorin 4D is a conditioned medium from a head and neck squamous cell carcinoma cell line.
28. The method of paragraph 27, wherein the cell line is a human cell line.
29. The method of paragraph 28, wherein the cell line is selected from the group consisting of HN4, HN6, HN13, and SCC-9.
30. The method of paragraph 23, wherein the level of myeloid-derived suppressor cells is reduced at least about 50% relative to a control lacking the agent.
31. The method of any of paragraphs 22-30, wherein the agent is a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D, wherein the assaying of part ii) comprises detecting Semaphorin 4D mRNA and/or protein and comparing its level to a control sample lacking the agent.
32. A method of monitoring progression of cancer in a subject, comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
33. The method of paragraph 32, wherein the tissue sample comprises peripheral blood.
34. The method of paragraph 32, wherein the tissue sample comprises cancer tissue.
35. The method of any of paragraphs 32-34, wherein the presence of Semaphorin 4D is detected by an antibody.
36. The method of any of paragraphs 32-35, wherein the Semaphorin 4D is detected by an ELISA (enzyme-linked immunosorbent assay) technique. 37. The method of any of paragraphs 32-35, wherein the Semaphorin 4D is detected by immunohi stochemi stry .
38. The method of any of paragraphs 32-37, wherein the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject.
39. The method of any of paragraphs 32-38, wherein the cancer is selected from head and neck cancer and lymphoma.
40. The method of any of paragraphs 32-39, wherein the cancer is head and neck cancer.
41. The method of any of paragraphs 32-40, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA.
42. The method of any of paragraphs 32-41, wherein the elevated level of expression of Semaphorin 4D corresponds to a positive pixel intensity of at least 1.5xl05 by standardized digital analysis.
43. The method of any of paragraphs 32-42, wherein the subject has stage III or IV cancer.
44. The method of any of paragraphs 32-43, wherein the subject's tumor has a dense, fibrotic peri-tumoral stroma.
45. The method of any of paragraphs 32-44, wherein the dense, fibrotic peri-tumoral stroma is detected by cell staining.
46. The method of any of paragraphs 32-45, further comprising obtaining the results of an assay that detects the presence or absence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D.
47. The method of any of paragraphs 32-46, wherein there is an inverse correlation between elevated Semaphorin 4D in the tissue and the presence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D. 48. The method of any of paragraphs 32-47, further comprising obtaining the results of an assay that detects the presence or absence of an immune checkpoint molecule such as PD-Ll in the tissue sample, wherein the tissue sample is cancer tissue.
49. The method of any of paragraphs 32-48, wherein the cancer tissue is pD-Ll"ve/low.
50. The method of any of paragraphs 32-49, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D.
51. The method of any of paragraphs 32-50, wherein the tissue is positive for the presence of the checkpoint molecule, such as PD-Ll, wherein the cut off value for elevated PD-Ll (PD-Ll +ve/high) is strong focal expression >1% in tumor cells or in tumor associated inflammatory cells or both, and using a positive pixel intensity of at least 1.5xl05 by standardized digital analysis.
52. The method of any of paragraphs 32-51, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D and an agent that inhibits the checkpoint molecule.
53. The method of paragraph 52, wherein the checkpoint molecule is PD-Ll .
In some embodiments, the methods of the present invention are combined with one or more other known treatments. For the treatment of cancer, one or more other known treatments can include radiation, surgery, chemotherapy or administration of other anti-cancer agents and combinations thereof.
Application of the teachings of the present invention to a specific problem is within the capabilities of one having ordinary skill in the art in light of the teaching contained herein. Examples of the compositions and methods of the invention appear in the following non-limiting Examples. EXAMPLES
Example 1. Human head and neck squamous cell carcinoma associated Semaphorin
4D induces expansion of myeloid derived suppressor cells
The present example investigated whether HNSCC derived Sema4D plays a role in inducing MDSC and examined its effect on T cell phenotype and function. It was found that Sema4D produced by the HNSCC HN6 and HN13 cell lines polarized myeloid cells into MDSC phenotype, which corresponded with a reduction in T cell proliferation and IFN-γ production. Furthermore, shRNA inhibition of Sema4D in HN6 resulted in a decrease in the production of the immunosuppressive factors; arginase-1, TGF-β, and IL- 10 by myeloid cells and the recovery of autologous T cell proliferation, IFN-γ production, specifically leading to an increase in the effector T cell population and decrease in Tregs. These findings describe HNSCC-associated Sema4D production as one of the mechanisms by which the tumors induce MDSC, that subsequently mediate their immunosuppression effects on T cells.
Results
Sema4D expressed by HNSCC cell lines induces CD33+, CDllb+, HLA-DR -/low cells To examine the effects of HNSCC-derived condition medium on myeloid differentiation, total human PBMC or total myeloid cells (CD33+) isolated from PBMC were plated in conditioned medium from HNSCC cell lines HN4, HN6, HN13 and SCC- 9. Total PBMC or separated myeloid cells cultured in HNSCC conditioned medium displayed markers characteristic of MDSC, namely CD33+ CDl lb+ HLA-DR//low compared to cells cultured in normal medium (NM) or NOK conditioned medium. The percentage of MDSC developed from total PBMC were -20% (Fig.7A), while that generated from CD33+ myeloid cells averaged 30% depending on the HNSCC cell line and density used (Fig.1 A) (Fig.7B). Moreover, titration of HN6 and HN13 derived conditioned medium with normal medium corresponded with a dose-dependent decrease in the MDSC population (Fig. IB, 1C).
Several groups have recently described an immunomodulatory role for tumor produced pro-angiogenic factors (Chouaib et al. 2012. Front Immunol 3 : 21). Given the immune modulatory role previously described for Sema4D in the immune system (Ishida et al. 2003. Int Immunol 15: 1027-1034; Chabbert-de Ponnat et al. 2005. Int Immunol 17: 439-447), we sought to investigate if the pro-angiogenic factor, Sema4D secreted by HNSCC (Basile et al. 2006. Proc Natl Acad Sci USA 103 : 9017-9022), plays a role in the induction of CD33+ CD1 lb+ HLA-DR"/low myeloid cells. Immunoblotting was performed on conditioned medium from HN6 and HN13 HNSCC cell lines and their cellular lysates as served as controls. We detected the cleaved form of Sema4D in the medium at ~120KDa (Fig. 2A) as previously reported (Kumanogoh et al, 2003. J Cell Sci 116: 3463-3470). We then neutralized Sema4D in the HN4, HN6, HN13 and SCC-9 conditioned medium using anti-Sema4D antibody (clone 30/CDlOO), then used the medium to culture myeloid cells. Blocking Sema4D in HNSCC conditioned medium resulted in -50% reduction in the MDSC population compared to cells growing in HNSCC conditioned medium pretreated with the isotype control mAb (Fig. 2B, 2C) (Fig. 7B).
Sema4D inhibition rescues MDSC induced T cell suppression
We next sought to ascertain whether FINSCC-derived Sema4D mediated its suppressive effects when myeloid cells were cultured with primary T cells. The induction of HLA-DR"/low cells by FIN6 conditioned media was still observed upon co-culture of the CD33+ cells with autologous T cells (Fig. 8A). To determine if Sema4D induction of MDSC induces T cell suppression, we constructed Sema4D-shRNA to knock down Sema4D in FIN6 cells and accordingly in the conditioned medium (Fig.8B-C). Significant recovery of T cell proliferation was observed upon co-culture of myeloid and T cells, in the HN6 Sema4D-shRNA compared to the Ctl-shRNA medium (Fig. 3A, 3B). T cells grown in FIN6 Ctl-shRNA medium were suppressed upon co-culture with the myeloid cells, but not when cultured in NM, indicating that the suppression is mediated by the induction of MDSC (Fig.3B). Notably, the knock down of Sema4D produced by FIN6, resulted in significant recovery of the T cells at different M:T cell ratios (Fig. 3 A, 3B). This was paralleled with recovery of IFN-γ production (Fig. 3C) as well as inhibition of IL-4 in the supernatant (Fig. 3D).
HN6 secreted Sema4D induces an immunosuppressive T cell phenotype
To investigate which T cell subset is rescued following blockade of Sema4D, a phenotypic analysis of the T cells was performed. We found that inhibition of Sema4D restored effector Thl cells (CD4+Tbet+) and cytotoxic T cells (CD8+Tbet+) cells, and significantly decreased Tregs (CD4+CD25+FoxP3+) at different myeloid to T cell ratios (Figs.4A-4D) (Figs 8D-F). These findings indicate that inhibition of Sema4D can rescue effector T cells, while suppressing the Treg population in the presence of myeloid cells. Sema4D enhances GM-CSF + IL-6 mediated induction of MDSC In order to better assess the role of HNSCC-derived Sema4D on myeloid differentiation, we compared Sema4D with another well-described MDSC inducer, GM- CSF (Lechner et al. 2010. J Immunol 185: 2273-2284). GM-CSF has been shown to be produced by several MDSC inducing human solid tumors including FINSCC and to best induce human CD33+ suppressive cells upon combination with IL-6 (Lechner et al. 2010. J Immunol 185: 2273-2284; Condamine et al., 2011. Trends Immunol 32: 19-25; Pak et al, 1995. Clin Cancer Res 1 : 95-103; Young et al, 1997. Int J Cancer 74: 69-74). In fact, we tested the HN6 HNSCC cell line using ELISA and it showed to produce both GM-CSF and IL-6 (data not shown). To compare the effect of tumor secreted Sema4D on the induction of MDSC to GM-CSF-mediated induction, CD33+ cells were co-cultured with T cells in HN6 medium with immune depletion of Sema4D versus immune depletion of GM-CSF. Immune depletion of Sema4D resulted in a significant reduction in the MDSC population that was comparable to that observed upon depletion of GM-CSF in HN6 conditioned medium (Fig. 5A, 5B). The reduction in MDSC cells corresponded with a significant increase in T cell proliferation (Figs. 5C, 5D) and IFN-γ production (Fig. 5E). These data strongly support a role for Sema4D produced by HN6 cells in the induction of MDSC and its subsequent T cell suppression. To further study the role of Sema4D in conjunction with other tumor produced cytokines in MDSC induction, we grew CD33+ cells in NM to which the three recombinant proteins Sema4D, IL-6 and GM-CSF were added. The three cytokines induction mixture of Sema4D+ GM-CSF+ IL-6 resulted in 30% increase in MDSC induction compared to the GM-CSF+ IL-6 mixture. This indicated that Sema4D acts synergistically with GM-CSF + IL-6 to increase the repertoire of the MDSC cells in the HNSCC tumor microenvironment (Fig. 5F, 5G) Sema4D promotes the production of immunosuppressive mediators by MDSC
To investigate whether HNSCC associated-Sema4D has an effect on MDSC viability, a WST cell proliferation assay and a CFSE proliferation tracking experiment, were performed using CD33+ cells grown in conditioned medium from the HN6 cells in which Sema4D has been knocked down using shRNA. The loss of Sema4D resulted in a significant decrease in the proliferation of total CD33+ cells, as well as that of the CD33+ HLA-DR"/low population compared to conditioned medium from controls (Figs. 6A, 6B). Interestingly, reconstitution of the Sema4D-shRNA HN6 conditioned media with human recombinant Sema4D protein recovered the CD33+ HLA-DR"/low proliferation as seen upon CFSE analysis (Fig. 6C). Taken together these findings showed that Sema4D produced by UNSCC plays a significant role in the proliferation and viability of MDSC.
The myeloid cells mediate their suppressive effects by various mechanisms. Among these arginase-1 and nitric oxide (NO) play a major role in MDSC suppressive effect. To investigate whether Sema4D produced by HNSCC-HN6 can affect arginase-1 production, CD33+ enriched myeloid cells were grown in conditioned media from Sema4D-shRNA HN6, and then checked for arginase-1 expression. A significant reduction in arginase-1 production by the CD33+ cells was observed when grown in Sema4D-shRNA HN6 conditioned media (Fig. 6D). While to check for the effect of Sema4D knock down on NO production by myeloid cells, CD33+ cells were grown in HN6 Sema4D-shRNA versus Ctl- shRNA conditioned media, then the media was collected after 72hrs to check for nitrite concentration. Interestingly there was a significant reduction in nitrite concentration produced by the myeloid cells in the media upon Sema4D knock down in HN6 (Fig. 6E).
MDSC can also indirectly induce its suppressive effect, through production of other immune suppressive cytokines like IL-10 and expansion of Tregs in a TGF-β dependent pathway (Vuk-Pavlovic et al, 2010. Prostate 70: 443-455; Cappamccia et al, 2009. J Cell Sci 122: 1723-1736). These cytokines were assessed by ELISA, specifically to measure IL-10 and TGF-β produced by MDSC (Cuenca et al, 2011. Mol Med 17: 281-292). Interestingly, there was a significant reduction in both IL-10 and TGF-β production by CD33+ cells upon inhibition of Sema4D in HN6 (Figs. 6F, 6G).
Material and Methods
Cell lines and tissue culture Human normal oral keratinocytes (NOK), human derived HNSCC cell lines WSU-
HN6, and WSU-HN13 underwent DNA authentication (Johns Hopkins genetic resources core facility, Baltimore, MD) to ensure consistency in cell identity in comparison with their source (Martin et al. 2014. Oncotarget 5: 8906-8923). SCC-9 was obtained from American Type Culture Collection (ATCC) (Manassas, VA). The WSU-HN4 cell line was a generous gift from Dr. Silvio Gutkind (NIDCR, Bethesda, MD). All HNSCC cell lines used were derived from primary carcinomas of the Tongue. All cell lines were grown and maintained in DMEM supplemented with 10% FBS, 100 units/ml penicillin, 100 μg/ml streptomycin, and 250 ng/ml amphotericin B (Sigma, St. Louis, MO) at 37°C in humidified air with 5% C02. For treatment with conditioned medium, culture medium was collected from confluent FINSCC cells grown in 5ml DMEM for 24 hrs. For myeloid and T cell co-culture experiments, conditioned medium supplemented with 5% FBS was used.
Separation of myeloid and T cells from human peripheral blood
Mononuclear cell suspension was prepared from peripheral blood of healthy donors obtained from commercial vendors, Biological Speciality Corp (Colmar, PA) or New York Blood Center (New York, NY) using Ficoll-Paque Plus density-gradient centrifugation (GE Healthcare Life Sciences, Pittsburgh, PA). CD33+ myeloid cells were separated from the PBMC using Magnetic Cell Sorting (MACS) CD33 microbeads (Cat #130-045-501), HLA-DR positive cells were separated using anti-HLA-DR microbeads (Cat #130-046- 100) (Miltenyi Biotec Inc, Auburn, CA). Autologous T cells were enriched by negative selection with the Human Pan T cell isolation kit (Cat # 19051, STEMCELL Technologies Inc., Vancouver, BC, Canada).
Flow cytometry characterization o/MDSC and T cells
MDSC were characterized using multicolor staining fluorochrome-labeled anti- human CD33-PerCP/Cy5.5 (Cat # 303414), HLA-DR-APC (Cat # 307610), CDl lb-PE (Cat #301306), CD14-FITC (Cat # 325604) (Biolegend, San Diego, CA). For T cell analysis CD3-APC/Cy7 (Cat # 300317) (Biolegend), CD8a PE-Cy7 (cat # 25-0088-42), CD25-APC (Cat #17-0259-42), Foxp3-PE (Cat # 12-4776-42), T-bet PerCP-Cyanine5.5 (Cat # 45-5825-82) (eBioscience, Inc., San Diego, CA). For anti-FoxP3-PE and anti-Tbet- PerCP/Cy5.5, fixation and permeabilization buffer (Cat # 00-8333) eBiosciences was used. For T cell proliferation, T cells were stained with CFSE (Cat # C34554) (Life Technologies, Grand Island, NY), prior to plating. Dynabeads human T-activator CD3/CD28 (Life Technologies) were used at a 1 :3 (T cell: bead) ratio after coculture with myeloid cells for at least 4hrs. Data was acquired using a BD LSR II Flow cytometer, Flow Jo software (Tree Star, Ashland, OR) and analyzed using BD FACSDiva™ software (BD Biosciences, San Jose, CA). Immunoblot, antibodies and reagents
Cells were harvested in cell lysis buffer (20mM Tris-HCL (pH7.5), 150mM NaCl, ImM Na2EDTA, ImM EGTA, l%Triton, 2.5mM sodium pyrophosphate, ImM β- glycerophosphate, ImM Na3V04, lug/ml leupeptin) (Cat # 9803) (Cell Signaling Tech., Danvers, MA) with the addition of IX protease inhibitor Complete Mini, EDTA-Free (cat #11836170001) (Roche Diagnostics Corporation, Indianapolis, IN). Whole-cell lysate was separated using SDS-PAGE. The primary antibodies Sema4D (30/CDlOO, Cat # 610670) (BD Biosciences PharMingen, San Diego, CA), Arginase-1 (A-2: sc-365547), GAPDH (8C2: sc-81545), and β-actin (Cat # sc-2301), (Santa Cruz Biotechnology, Inc., Dallas, TX), were used. The secondary antibodies used were anti-rabbit IgG (Cat # sc-2301) and anti-mouse IgG (Cat # sc-2302) (Santa Cruz Biotechnology, Inc.). For Arginase-1 detection 15μg of protein were loaded, while for Sema4D detection 70-100μg were loaded. For detection of Sema4D in the tumor conditioned medium, equal aliquots of the medium or of a concentrate of the medium using Millipore amicon Ultra centrifugal filter units were loaded after adding the sample buffer. Cell viability was measured using the cell proliferation reagent, WST-1 (Roche Diagnostics Corporation). The plate was read at 450nm on BioTek Epoch microplate spectrophotometer (BioTek, Winooski, VT). The recombinant human Sema4D (sCDIOO) (Cat # 310-29) was obtained from (Peprotech, Rocky Hill, NJ). Recombinant human GM-CSF (Cat # 215-GM-010) (R&D Systems, Inc. Minneapolis, MN), and 11-6 recombinant human (Cat # 11395) from (Sigma-Aldrich, St. Louis, MO) were also used. Griess reagent (Cat #G2930) (Promega corporation, Madison, WI) was used to measure the Nitrite (NO2-) concentration as a stable nonvolatile byproduct of nitric oxide (NO) in the media, read at absorbance of 520nm using BioTek Epoch microplate spectrophotometer (BioTek).
Anti-Sema4D treatment and immune depletion
For target protein inhibition in the conditioned medium anti-Sema4D (Cat #610670) (BD Biosciences) was used at concentration (10μg/ml). For immune-depletion, immunoprecipitation of Sema4D or GM-CSF, was carried out by overnight incubation of the conditioned media with Sema4D (Cat # ab39710) (Abeam, Cambridge, MA) or GM- CSF (clone: BVD2-21C11) (Cat #502301) (Biolegend) (^g/ml) mAbs using protein A beads, followed by precipitation. Sema4D shRNA and Lentivirus Infections
The lentivirus and short-hairpin RNA (shRNA) system were a kind gift of Dr. John R. Basile, UMB (Basile et al. 2006. Proc Natl Acad Sci USA 103 : 9017-9022). In brief, the shRNA sequences for human Sema4D were obtained from Cold Spring Harbor Laboratory's RNAi library (RNAi Codex; http: katahdin.cshl.org:933 l_homepage_portal_scripts_main2.pl). The oligonucleotides (Invitrogen, Grand Island, NY) used to knockdown Sema4D protein levels were: 5- GGCCTGAGGACCTTGCAGAAGA-3 (SEQ ID NO:3). The Sema4D shRNA oligonucleotides were cloned into lentiviral expression vector pWPI GW as previously described (Basile et al. 2006. Proc Natl Acad Sci U SA 103 : 9017-9022). pWPI (empty) vector was used as negative control. Infections were performed using Fugene HD transfection reagent (Cat # E2311, Promega, Madison, WI).
ELISA
Human ELISA MAX™ IFN-γ (Cat # 430103), TGF-βΙ total (Cat # 436707), IL- 10 (Cat # 430601), and IL-4 (Cat # 430301) were obtained from Biolegend. Samples were run in triplicates and read using BioTek Epoch microplate spectrophotometer at 450nm wavelength.
Statistics
Student's paired t tests were performed as appropriate. All data analysis was presented with custom STDEV and p values were annotated as: * p < 0.05; ** p < 0.01; *** p<0.001.
EXAMPLE 2 - Diagnostic Assays for Sema4D
Herein, it is presented for the first time a rapid and sensitive diagnostic test for head and neck cancer patients, as well as patients with hematologic malignancies using ELISA and IHC to measure Sema4D. The proposed ELISA test can be performed on patient's sera for diagnostic measures, and the IHC on head and neck cancer tissue can indicate the status of the tumor progression.
Material and methods
ELISA
ELISA performed using specimens from HNSCC patients, lymphoma patients and healthy donor serum. For the standard, human recombinant Semaphorin 4D (Cat# 310-29) (PEPROTECH, Rocky Hill, NJ) was used. Semaphorin 4D (clone eBiol33-lC6) (Cat# 14- 1009) (eBioscience, San Diego, CA) was used as the primary detection antibody. The secondary antibody, goat anti -mouse anti-IgM HRP (Caltag Cat# M31507) was applied followed by detection with tetramethybenzidine (TMB) substrate.
ELIS A Protocol:
1. Assay Diluent (AD) is 5% FBS in PBS; Plates- Immunlon (Nunc # 14-245-153)
2. Coat with protein, dilute standard in PBS (200ng/ml) and add 50 ul/well (4C overnight)
3. Block with AD- 1 OOul/well 2hr RT
4. Wash w PBST (0.05% Tween20 in IX PBS)
5. Primary Ab (eBioscience lOul/ml from 0.5mg/ml stock) in AD; incubate 2hr RT; wash
6. Add 2nd Ab (goat anti mouse IgM HRP; stock lmg/ml) 1 : 1000 dilution in AD for lhr RT
7. Wash, Detect w TMB, stop with 2N sulfuric acid
Immunohistochemistry
Immunohistochemistry was carried out on paraffin embedded tissue microarray including 124 primary HNSCC, 9 primary adenocarcinomas of the salivary glands, 3 metastatic HNSCC, 4 metastatic adenocarcinomas of the salivary glands to lymph nodes,
12 normal oral mucosa, 3 normal salivary glands and 4 normal epiglottis tissue. The microarray was obtained from US Biomax, Inc. (Rockville, MD). Citrate buffer
(Cat#21545, Millipore, Billerica, MA) and EDTA free trypsin (Corning, Manassas, VA)
(Cat #25-050-CI) were used for antigen retrieval. 3% Η202 was used to quench the endogenous peroxidase. Tissue was incubated in the primary antibody Semaphorin 4D
(clone 30/CDlOO) (Cat # 610670) (BD Biosciences PharMingen, San Diego, CA) at 1 :50 dilution in 2% BSA in PBS with 0.1% Tween, overnight in 4 degrees C. The Secondary antibody and the ABC (Vectastain Vector Elite Cat # PK-6102 mouse IgG) (Vector laboratories, Burlingame, CA) were used, followed by DAB (Cat# SK-4105) (Vector laboratories). Tissue was scanned and photomics were taken using ScanScope Aperio software. Results
Sema4D is a diagnostic marker in peripheral blood of cancer patients
To investigate if Sema4D is a candidate diagnostic marker for cancer patients in peripheral blood, we carried ELISA on sera from HNSCC patients, lymphoma patients and healthy donors. HNSCC patients showed almost double the expression of Sema4D in their sera compared to healthy donors (p = 0.00017). Also high levels of Sema4D were detected in sera of 2 of the lymphoma patients compared to the healthy donors (Figs. 9-11).
Sema4D insitu expression as a predictive marker for disease progression
To investigate the use of Sema4D as a prognostic marker in HNSCC, we carried out immunohistochemistry on primary HNSCC, primary adenocarcinomas of the salivary gland, metastatic HNSCC and metastatic salivary gland tumors to lymph nodes. Collectively, Stages I and II of the primary HNSCC showed negative to week expression of Sema4D. Stages III and IV showed strong diffuse expression of Sema4D. Metastatic HNSCC and salivary gland metastatic adenocarcinomas to lymph nodes showed strong and diffuse expression. In stages III, and IV HNSCC as well as in the metastatic lesions, increased inflammatory cell infiltrate with strong expression of Sema4D in the tumor stroma was noticed.
The control normal oral epithelium showed week to negative basal and parabasal expression of Sema4D. The normal epiglottis lining showed moderate diffuse expression and the normal salivary gland tissue showed diffuse weak to moderate expression of Sema4D in the acini and ductal structures.
EXAMPLE 3 -Semaphorin 4D in human head and neck cancer tissue and peripheral blood: A dense fibrotic peri-tumoral stromal phenotype
In this study, the immunohistochemical expression of Sema4D by HNC tumor cells in correlation to tumor progression, extent of fibrosis and TAIs infiltration in the peri-tumoral stroma, as well as PD-Ll expression was investigated. It is shown that high levels of Sema4D expression (Sema4D+ve/high) by HNC tumor cells significantly correlated with clinical staging, being highest in stage III. It also showed a positive nonsignificant correlation with nodal metastasis. Sema4D+ve/high expression in tumor cells correlated significantly with dense fibrotic noninflamed peri-tumoral stroma and inversely with infiltrating Sema4D+ve/hi h TAIs. Interestingly, knockdown of Sema4D in stage III HNC cell line, showed inhibition of TGF-βΙ production by the tumor cells. Sema4D identified a unique subset of HNC tumors distinct from the PD-Ll positive tumors. Furthermore, high levels of circulating Sema4D were detected in HNC patients' sera compared to healthy donors. These data provide a novel role for Sema4D in the context of fibrosis and inflammation within the tumor microenvironment and demonstrate its value as a novel diagnostic, prognostic and immune monitoring biomarker in HNC. Results
Sema4D expression by tumor cells correlates with tumor progression
Sema4D expression has been described in several epithelial malignancies, but it is believed that there are no studies investigating whether it correlates with clinical progression in HNC (Ch'ng E et al., Cancer. 2007; 110(1): 164-172; Wang et al., World J Gastroenterol. 2015; 21 (7):2191-2198). Immunohistochemical (THC) analysis was performed on 160 human tissue samples. These included twenty one cases of normal tissue, and one hundred and thirty-nine cases of HNC. The malignancies consisted of 119 primary squamous cell carcinomas of the head and neck (HNSCC), 9 primary salivary gland adenocarcinomas (SGA), 4 metastatic HNSCC and 4 metastatic SGA to the lymph nodes. One normal tongue specimen was excluded due to lack of epithelial tissue and three cases of malignancy were excluded due to lack of tumor tissue for analysis (Fig. 18A and 12B) (Table 5). The age range for the studied population was from 12 to 90 years old with mean of 53 among which there were 82 (51.25%) females and 78 (48.75%) males. The demographics of the 136 HNC patients in this study are summarized in Table 6.
The pattern of expression of Sema4D was generally membranous and cytoplasmic.
The normal oral epithelium and salivary acini were negative to low positive (Sema4D" ve/iow^ yjith mean strong positive pixel intensity ranging from ~104 to 2xl05 (Figure 19 A- F), while the salivary ductal epithelium and the normal epiglottis epithelial lining were positive for Sema4D (Figure 20). The normal tissue adjacent to tumor margin (NAT), was Sema4D positive to strongly positive (Sema4D +ve/hish) in the basal and prickle cell layer with mean strong positive pixel intensity of up to 106 (Figure 19 G-H). The scattered inflammatory cells in the normal tissue sections were also positive for Sema4D.
Sema4D+ve/high expression was observed in in 47 (34.5%) cases out of the 136 primary and metastatic malignancies (Table 5). The cut off value to consider Sema4D+ve/high in tumor cells was 5xl05 strong pixel intensity as guided by the standardized digital analysis (Figure 21). Sema4D+ve/high expression in tumor cells correlated significantly with stage III FINC (p=0.014), (Table 1). Tumor cells were generally Sema4D _ve/low for expression in stage I and II, Sema4D+ve/high in stage III and Sema4D"ve/low expression in stage IV tumor cells (Figure 12A-D). A positive association between Sema4D expression in tumor cells and nodal metastasis was observed, specifically patients with nodal metastasis had higher levels of Sema4D staining in the primary tumor (p=0.117) (Table 1). Only one out of four metastatic SCC to lymph nodes had Sema4D +ve/hish expression in the tumor cells, while the others were Sema4D"ve/low (Figure 12E). There was no association detected between the Sema4D expression in tumor cells and the demographic variables of the tested individuals or the histological grade of SCC (Table 6). Out of the limited number of SGA cases studied, Sema4D +ve/hish expression was observed in 7 (77%) out of the 9 primary and 3 out of 4 metastatic SGA to lymph nodes (Table 6) (Figure 12F).
Sema4D expression by tumor cells correlates with a dense fibrotic peri-tumoral stroma The peri-tumoral - stroma is a very important reflection of the complexity of the tumor (Hanahan D and Weinberg RA. Cell. 2011; 144(5):646-674; Pietras K and Ostman A. Exp Cell Res. 2010; 316(8): 1324-1331). To determine whether Sema4D has a role in modulating the immune response within the tumor microenvironment, we examined the stroma in all of the provided specimens. Sema4D+ve/high expression by HNC tumor cells of the primary malignancies correlated with a dense fibrotic peri-tumoral stroma representing 23% of the total cohort (Figure 13 A-C) (p=0.0001) (Table 1). The data showed 77% of the cases with dense peri-tumoral stroma to be Sema4D+ve/high We previously showed that inhibition of Sema4D in HNC cell lines can downregulate TGF-βΙ production by myeloid cells (Younis RH et al. J Immunol. 2016; 196(3): 1419-1429). These data led us to further investigate whether Sema4D can directly induce HNC cells to produce the potent fibroblast chemoattractant; TGF-βΙ, and conversely if inhibition of Sema4D would affect the production of TGF-βΙ by tumor cells. Sema4D expression was highest in stage III tumors (Table 1), therefore we generated stable Sema4D knockdown and controls using the WSU- HN6 cell line, derived from a stage III SCC of the base of the tongue (Morikawa et al, Cold Spring Harb Per sped Biol. 2016; 8(5); Prud'homme et al., Lab Invest. 2007; 87(11): 1077-1091; Jeon et al, Int J Cancer. 2004; 112(2):249-258).
As shown in Figure 13D, WSC-HN6 cells produce high levels of TGF-βΙ in the culture medium, compared to controls normal oral keratinocytes (NOK). Inhibition of Sema4D in WSC-HN6 cells using shRNA, significantly reduced TGF-β 1 production by the tumor cells to levels comparable to NOK and to that present in normal cell culture media (Figure 13D). Sema4D expression by tumor associated inflammatory cells (TAIs)
Te peri -turn oral stroma was further investigated for the extent of inflammation. When infiltrating TAIs were present, almost all of them showed positivity for Sema4D (Sema4D+ve/highTAIs). The stroma in Stage I and II UNC tumors showed mild to moderate infiltrate of Sema4D+ve/high TAIs (Figure 12A and 12B) (Figure 22). Stage III UNC tumors were generally moderately inflamed, with considerable overall increase in TAIs infiltration compared to stage I and II, with almost all TAIs staining strongly positive for Sema4D. Stage IV tumors showed prominent increase of Sema4D+ve/high TAIs infiltration in most of the specimens, compared to stages I, II and III, (Figure 12D and Figure 14A-14B). Sema4D+ve/high TAIs were statistically negatively associated with Sema4D expression in tumor cells (p= 0.0006), where Sema4D _ve/low expression in tumor cells correlated with increased infiltration of Sema4D+ve/high TAIs in the peri-tumoral stroma (Table 1). Sema4D+ve/high TAIs correlated generally with malignancy (p= 0.043) and specifically with SCC phenotype (p= 0.0004) (Table 7). Inflammatory cells in the lymph nodes with metastatic SCC generally showed strong Sema4D expression (Figure 12E).
HNC stratification according to Sema4D and PD-L1 expression
Programmed death-ligand 1 (PD-L1) expression has been linked to poor patients' prognosis (Lin et al, PLoS One. 2015; 10(1 l):e0142656.; Chen et al, Oral Oncol. 2015; 51(11): 1004-1010; Mukaigawa et al, J Surg Oncol. 2016; 114(l):36-43). The inhibition of PD-1/PD-L1 pathway had shown promising overall response rate in many clinical studies. Yet patients' response had been linked to the initial presence of an inflamed tumor microenvironment (Cho et al, Oral Oncol. 2011; 47(12): 1148-1153; Zandberg et al, Oral Oncol. 2014; 50(7):627-632; Kirilovsky et al, Int Immunol. 2016; 28(8):373-382; Ferris et al, J Natl Cancer Inst. 2016; 108(8)). Our findings that tumor cells expressing Sema4D +ve/high correiateci positively with a dense fibrotic stroma and inversely with Sema4D+ve/high TAIs, triggered the question; if HNC tumors expressing high Sema4D represent a distinct tumor phenotype other than the inflamed, PD-Ll positive tumors. To investigate the Sema4D/PD-Ll differential expression, we stained the same HNC tumor set studied for Sema4D with PD-Ll . The specimens from the normal epithelium, normal salivary glands and epiglottis, were negative for PD-Ll as well as the normal epithelium from the tumor margin (Figure 23A-23B). When present, PD-Ll expression in tumor cells, was mainly membranous, and was often high and associated with positive cytoplasmic staining. PD- Ll+ve/high tumor cells were observed in 31 (23%) cases out of the 136 primary and metastatic malignancies (Table 2) (Table 9). PD-Ll expression in tumor cells did not correlate with tumor staging (p=0.815) or lymph node metastasis (p=0.273) (Table 9), but interestingly, correlated inversely with peri-tumoral stromal fibrosis (p=0.067) and directly with Sema4D+ve/high TAIs (p=0.0139) (Table 3). Sema4D expression was analyzed in correlation to combined PD-Ll expression in both tumor cells and TAIs. In this context, 79% out of the Sema4D +ve/high tumor cells were PD-Lrve/low, and 38.5% out of the PD-Ll"ve/low cases were Sema4D+ve/high tumor cells. Most of the PD-Ll and Sema4D negative cases (double negative) showed Sema4D+ve/high TAIs. Only 10 cases (7.4%) out of the total cohort were Sema4D/ PD-Ll double positive (Figure 15, Table 2).
Materials and Methods
HNC tissue microarray
Formalin-fixed, paraffin-embedded tissues of HNC tissue microarray (HN802 and HN803c) was obtained from US Biomax (Rockville, MD). The tissue microarray of hundred and sixty cases of head and neck cancer with normal tissue included demographic data, TNM system, clinical stage, and pathologic grade. The hematoxylin and eosin sections were examined by an oral and maxillofacial (OMF) pathologist to verify histopathological diagnosis prior to immunohistochemical (IHC) staining.
Serum Samples
The patient specimens were collected under an approved protocol by the Institutional
Review Board at the University of Maryland School of Medicine. Banked HNC patient samples were obtained from patients with their written and informed consent. Healthy donor sera were purchased from Innovative research (Novi, MI).
Immunohistochemistry
For Sema4D staining, the avidin-biotin complex (ABC) technique was used following Vectastain elite ABC kit (PK-6102) mouse IgG (Vector Laboratories, CA). Briefly, tissue sections were deparaffinized in xylene, rehydrated in graded ethanol, treated with Tris- EDTA buffer for antigen retrieval, and quenched in hydrogen peroxide to block endogenous peroxidase. Tissue sections were blocked with 2.5% normal serum, incubated overnight at 4 degrees C with anti- Sema4D antibody 1 :200, (clone 30/CDlOO; BD Transduction Laboratories), followed by biotinylated secondary antibody (catalog no. BA- 9200) and then the ABC reagent. Diaminobenzidine (SK-4105) was used as chromogen and counterstained with Mayer's hematoxylin (Sigma- Aldrich Corp.). The Sema4D labeling index (LI) reflecting the intensity and extent of staining in the tumor cells was defined semi quantitatively as (0, 1, 2, and 3) and digitally using the Aperio software (Positive Pixel count v9) Blue, yellow, orange and red. Where (0) was negative (Blue digitally), (1) was diffuse weak staining (yellow digitally), (2) diffuse weak positivity with scattered strong positive <25% (yellow with scattered orange digitally), and (3) was for diffuse strong positivity or focal strong positive >25% (orange and red digitally). Since Sema4D showed negative to weak expression with focal strong positivity in some normal epithelium (Fig 19), the cut off value semi quantitatively for Sema4D+ve/high in tumor cells was the score (3), and digitally was total strong pixel intensity of > 5x 105 (diffuse orange to red), calculated as the median value between Sema4D"ve/low and Sema4D +ve hish expression (Fig 21). For PD-L1 staining, PD-L1 primary antibody clone SP142 (Roche/Ventana medical system, Inc) was used following the vendor recommended assay. Since PD-L1 was negative in normal epithelium, the cut off value for pD-Ll+ve/high was strong focal expression >1% in tumor cells or in TAIs or both, and using the same cutoff value digitally as with Sema4D (Madore etal, Clin Cancer Res. 2016; 22(15):3915-3923). The strong pixel intensity for all the stains was calculated as the mean of three representative annotation layers of -0.2 mm2 area at 20x magnification, 200um scale.
Stromal analysis for fibrosis or TAIs infiltrate was carried out by OMP pathologist on the H&E and IHC stained sections under light microscopy. For analysis of fibrosis in the tumor stroma, delicately fibrous stroma (+), moderately fibrotic (++) and densely fibrotic (+++) parameters were used. For the analysis of the tumor associated inflammatory cells (TAIs), (0, 1, 2, and 3) LI was used to reflect the extent of infiltrate of Sema4D+ve/hi h TAIs in the peri-tumoral stroma. Where (0) was stroma completely negative, (1) was mild, (2) moderate and (3) for heavy infiltrate. The cut off value for the extent of infiltrate of Sema4D+ve/high TAIs was the score (2). Photos were taken using the Aperio ScanScope and Image Scope software.
Sema4D ELISA
The serum concentration of Sema4D was determined by ELISA. Immulon 4 HBX microtiter plates (Thermo Scientific, Waltham, MA) were coated with 50 microliters of undiluted serum, washed, then incubated with anti-human CD100 antibody (clone: 133- 1C6; Novus Biologicals). Goat anti-mouse IgM-HRP (catalog no. M31507; Life Technologies) was added followed by detection with TMB (Pierce). The serum concentrations of Sema4D were calculated using the standard curve established for recombinant Sema4D (catalog no. 310-29) (Peprotech, RockyHill, NJ). The detection limit was 3.1 ng/mL. For detection of TGF-β 1 by WSU-HN6 tumor cells, Human ELISA TGF- βΐ total (catalog no.436707) was purchased from BioLegend (San Diego, CA). Conditioned medium was run in triplicate and plates were read using a BioTek Epoch microplate spectrophotometer at 450nm wavelength.
Cell lines, Sema4D shRNA and lentivirus infections
The cell lines, normal oral keratinocytes (NOK) and oral squamous cell carcinoma WSU-HN6, derived from a stage III (T3N2bM0) primary malignancy of the base of the tongue, were DNA authenticated at (Johns Hopkins Genetic Resources Core Facility, Baltimore, MD) to ensure consistency in cell identity in comparison with their source (Jeon et al, Int J Cancer. 2004; 112(2):249-258). To detect TGF-βΙ production by tumor cells in response to Sema4D, Sema4D knockdown using shRNA lentivirus system was used. The lentivirus and shRNA system were a gift of Dr. John R. Basile (University of Maryland, Baltimore) (Basile et al, Proc Natl Acad Sci USA. 2006; 103(24):9017-9022). In brief, the shRNA sequences for human Sema4D were obtained from Cold Spring Harbor Laboratory's RNAi library (RNAi Codex; http:katahdin.cshl.org:9331_homepage_portal_ scripts_main2.pl). The oligonucleotides (Invitrogen, Grand Island, NY) used to knockdown Sema4D protein levels were 5 ' -GGCCTGAGGACCTTGC AGAAGA-3 ' (SEQ ID NO:3). The Sema4D shRNA oligonucleotides were cloned into lentiviral expression vector pWPI GW as previously described (Basile et al, Proc Natl Acad Sci U S A. 2006; 103(24):9017-9022). pWPI (empty) vector was used as negative control. Transductions were performed using FuGENE HD transfection reagent (catalog no. E2311; Promega).
Statistical analysis
The primary outcome variable, staining status of Sema4D in tumor tissue, was defined as Sema4D+ve/hi h (score=3) and Sema4D"ve/low (score=0, 1, 2); and the secondary outcome variable, PD-L1, defined as PD-Ll+ve/high (>1%) and negative low (< 1%). The independent variables are tumor clinical stage coded as (I+II, III, and IV), Nodal metastasis (yes/no), Sema4D+ve/high TAIs infiltrate (moderate to heavy are scores 2, 3), negative to low are 0, 1) and fibrotic tumor microenvironment as (+,++,+++). Other factors included patient characteristics such as age (<45, 45-54, 55-64, 65+), sex, organ category (Oral cavity, Salivary glands, Larynx -Pharynx -Nose, Lymph node), histological grade (1, 2, 3), Pathology (SCC, SGA) and type of tissue (normal or malignant). The associations of two categorical variables were evaluated using two-sided Fisher Exact test or Chi-square test and the association of a continuous variable and a categorical variable were evaluated using two sample t-test or ANOVA F test for the categorical variable having more than two levels. P-values < 0.05 were considered statistically significant. If at least one categorical variable had more than two levels and the overall test p-value < 0.05, Post Hoc pairwise comparisons were performed. Bonferroni corrections were used for adjusting the p-values of the post hoc tests for multiple comparisons (Dunn). All the analyses were conducted using SAS 9.3.2 software. In addition, the associations of Sema4D levels by ELISA were analyzed using Graph pad Prism software, with age, sex, tumor stage etc. were evaluated by two sample t-test or ANOVA F test.
Sema4D detection in sera of HNC patients
The current findings of Sema4D expression in tumor cells and in TAIs, in addition to previous in vitro study showing that HNC cells can produce soluble Sema4D in the tumor-conditioned medium, led to an investigation of whether soluble Sema4D can be detected in patient's peripheral blood. ELISA was used to assess Sema4D levels in 10 healthy donors (HD) and 30 HNC patients' specimens. In the 10 HD, serum Sema4D levels were 24.6±17,3 ng/mL. There was a statistically insignificant gender difference: levels of sera Sema4D in men (27.3±15.9 ng/mL, n=9) were higher than that in women (not detectable, n \ ) The demograph cs of the 30 HNC patients in this study are summarized in Table 4. The levels of Sema4D in the HNC sera (418 ,2.-i-.276.8 ng/mL) were significantly higher than those in HD (27.3±15.9 ng/rnL) (p<0.0001) (Figure 16A). The data showed Sema4D levels clustered into two groups; notably both were significantly higher than in HD (Figure 16A). One cluster showed lower values with a mean of 114.68 ng/ml, while the other tumor cluster had higher values with a mean of 575.8 ng/ml. Irs contrast to HD, there were higher Sema4D levels in the sera of female compared to male patients (393±258 ng mL in males n:::27 vs. 642--J-.-398 ng mL in females, n::::3) (Table 4). The expression of Sema4D in the blood seemed to correlate significantly with stage III tumors (Figure 16B). There was no correlation between lymph node metastasis and soluble Sema4D levels (Table 4). Importantly, these data demonstrate the prognostic potential of Sema4D in peripheral blood of HNC patients.
Table 1 : Sema4D expression in HNC tumor cells in correlation to tumor progression, peri-tumoral stromal fibrosis and Sema4D+ve/high TAIs.
Sema4D expression in tumor cells
-ve / low +ve / high P-
Total
No (%) No (%) value
Tumor stage
I+II 41 (73.21) 15 (26.79) 56
III 16 (45.71) 19 (54.29) 35 0.0141
IV 25 (73.53) 9 (26.47) 34
Total 82 (65.6) 43 (34.4) 125
Lymph nodal
metastasis
Yes 26 (56.62) 20 (43.48) 46 0.117 No 63(70) 27(30) 90
Total 89 (65.4) 47 (34.6) 136
Stromal Fibrosis
Delicate 37 (82.22) 8 (17.78) 45
Moderate 20 (76.92) 6 (23.08) 26
Dense 7 (23.33) 23 (76.67) 30 0 0001
Total 64 (63.3) 37 (36.6) 101
Sema4D+ve hi§h
TAIs infiltrate
No/low 28 (50.91) 27 (49.09) 55
0.0006
Yes/high 56 (80) 14 (20) 70
Total 89 (71.2) 41(32.8) 125
*24 specimens were excluded from the analysis of the fibrosis category, due to dominating tumor islands with no abundant surrounding stroma to be assessed.
Table 2: Differential expression of Sema4D and PD-Ll in HNC.
PD-Ll in tumor cells
Sema4D in
Total P-value
tumor cells
-ve / low +ve / high
65 23
-ve/low 88 (65%)
(48%) (17%)
39 8
+ve/high 47(35%)
(29%) (6%) 0.23
104 31
Total 135 (100%)
(77%) (23%)
PD-Ll in tumor cells
Sema4D in and TAIs Total P-value
tumor cells
-ve / low +ve / high 59 29 88
-ve/low
(43.7%) (21.5%) (65.2%)
37 10 47 0.153
+ve/high
(27.4%) (7.4%) (34.8)
96 39 135
Total
(72%) (28%) (100%)
Table 3 : PD-Ll expression in relation to peri-tumoral fibrosis and Sema4D expressing TAIs.
PD-Ll expression in
tumor cells Total P-value
-ve/low +ve/high
Stromal
fibrosis
Delicate 30 (66.67%) 15 (33.33%) 45
Moderate 18 (72.00%) 7 (28.00%) 25 0.06
Dense 27 (90.00%) 3 (10.00%) 30
Total 75 25 100
Sema4D+ve hi§h
TAIs infiltrate
No (0, 1) 48 (87.27%) 7 (12.73%) 55
Yes (2,3) 48 (68.57%) 22 (31.43%) 70 0.01
Total 96 29 125
Table 4: Sema4D analysis in the sera of HNC patients in relation to demographics and clinical characteristics
Characteristics Number of Sema4D (ng/ml) P-valuS
patients
Mean age ±SD
(year) 30 57.7±11.6
10
Race
White 26 390.6±279 0.4
Black 3 511.6±115
Asian 1 854
15
Sex
0.142
Male 27 393±258
Female 3 642±398
20
Stage
I 1 97.7
II 3 277.7±123
III 3 566±286 0.055
IV 16 512.5±55
N/A 7 245.5±87
Location
Oral
O 13 466±95
P & BOT &
15 395±57 0.5
tonsils
600±79
Supra/trans glottic 2
LN status
NO 5 406±423 0.559
N1/N2/N3 18 488±228 Table 5:
Descriptive analysis of Sema4D staining according to tissue type.
Sema4D expression in tumor cells and
normal tissue
Type Total Net
-ve/low +ve/high N/A
^Primary
85 (66.4%) 43 (33.6%) 3 131 128 (82.1%) Malignancy
Metastatic 4 (50.0%) 4 (50%) 0 8 8 (5.1%) Normal/NAT 11 (55%) 9(45%) 1 21 20 (12.8%)
Total 100 (52.6%) 56 (35.9%) 4 160 156 (100%)
* Primary malignancies had 119 SCC (76.3 %), 9 (5.7%) SGA.
# 4 SCC (2.5%) and 4 SGA (2.5%), metastatic to lymph nodes.
## Normal tissue: 11 Tongue, 2 normal tissue adjacent to tumor margin (NAT), 3 Salivary gland tissue, and 4 epiglottis.
Table 6: Sema4D expression in tumor cells in correlation to Patient's demographics and histological grading.
Sema4D expression in tumor cells
-ve/low +ve/high
Total P value
No (%) No (%)
Age No (%) No (%)
<45 14 (70) 6(30) 20
45-54 29 (61.7) 18 (38.3) 47
55-64 21 (61.76) 13 (38.24) 34 0.745
65+ 25 (71.43) 10 (28.57) 35
Total 89 47 136
Gender
F 46 (66.67) 23 (33.33) 69
M 43 (64.18) 24(35.82) 67 0.76
Total 89 47 136
Organ
Oral cavity and
34 (70.83) 14 (29.17) 48
salivary glands
larynx,
pharynx and 51 (63.75) 29 (36.25) 80 0.458 nasal cavity
metastatic to
4 (50%) 4 (50%) 8
lymph node
Total 89 47 136
Pathological
Diagnosis
Normal 11(55) 9(45) 20
SCC 86 (69.67) 37 (30.33) 123 0.0024
SGA 3(23.08) 10 (76.92) 13
Total 100 56 156
SCC Hist
grade
1 28 (71.79) 11 (28.21) 36
0.513
2 35 (64.81) 19 (35.19) 54 3 20 (76.92) 6 (23.08) 26
83 36 119
Table 7: Sema4D+ve/high TAIs in correlation to malignancy, pathological diagnosis clinical staging
Figure imgf000081_0001
Table 8: Descriptive analysis of PD-Ll staining according to tissue type
PD-Ll expression in malignant tissue and
Type normal cells Net
-ve/low +ve/high N/A Total (%)
Primary
98 30 3 128 Malignanc 131
(74.81%) (22.90%) (2.29%) (82.1%) y
7 1 0 8
Metastasis 8
(87.50%) (12.50%) (0.00%) (5.1%)
Normal/N 21 0 0 21
21
AT (100%) 0.00 (0.0%) (12.8%)
157
Total 126 31 3 160
(100%)
Table 9: PD-Ll expression in correlation to tumor progression
PD-Ll expression in tumor
tissue Total P value
-ve/low +ve/high
Tumor Stage
I+II 44 (80%) 11 (20%) 55
III 27 (77.1%) 8 (22.9%) 35 0.816
IV 26 (74.3%) 9 (25.7%) 35
Total 97 28 125
Nodal metastasis
No (0, 1) 72 (80%) 18 (20%) 55
Yes (2,3) 33 (71.7%) 13 (28.3%) 70 0.277
Total 105 31 136 While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure to more fully describe the state of the art to which this invention pertains.

Claims

CLAIMS I claim:
1. A method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
2. The method of claim 1, wherein the agent decreases the expression level of Semaphorin 4D.
3. The method of claim 1, wherein the subject has a cancer selected from head and neck cancer and lymphoma.
4. The method of claim 1, wherein the inhibition of Semaphorin 4D decreases the level of myeloid-derived suppressor cells in the tumor microenvironment.
5. The method of claim 4, wherein the myeloid-derived suppressor cells have a phenotype that is CD33+, CD1 lb+, and HLA-DR"/low.
6. The method of claim 1, wherein the inhibition of Semaphorin 4D results in one or more of the following effects:
i) an increase in T cell proliferation;
ϋ) an increase in IFN-γ levels;
iii) a decrease in IL-4 levels;
iv) a decrease in arginase-1 production by CD33+ myeloid cells;
v) a decrease in NO production by CD33+ myeloid cells;
vi) a decrease in IL-10 by CD33+ myeloid cells;
vii) a decrease in TGF-β Ι production by CD33+myeloid cells;
viii) a decrease in TGF-β Ι production by tumor cells.
ix) an increase in effector Thl T cells (CD4+Tbet+);
x) an increase in cytotoxic T cells (CD8+Tbet+); and
xi) a decrease in Tregs cells (CD4+CD25+FoxP3+).
7. The method of claim 1, wherein the agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D.
8. The method of claim 7, wherein the nucleotide sequence of Semaphorin 4D is SEQ ID NO:2.
9. The method of claim 8, wherein a portion of the nucleic acid molecule is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% 97%, 97%, 98% or 99% complementary to at least a portion of SEQ ID NO:2.
10. The method of claim 9, wherein a portion of the nucleic acid molecule is
100% complementary to SEQ ID NO:4.
11. The method of claim 7, wherein the agent comprises a DNA molecule or an RNA molecule.
12. The method of claim 11, wherein the agent comprises an anti-sense DNA molecule or an anti-sense RNA molecule.
13. The method of claim 11, wherein the agent comprises a small interfering RNA (siRNA) molecule.
14. The method of claim 13, wherein the siRNA molecule targets the sequence SEQ ID NO:7.
15. The method of claim 1, wherein the agent comprises a small hairpin RNA
(shRNA) molecule.
16. The method of claim 15, wherein the agent comprises an expression vector comprising SEQ ID NO: 3.
17. The method of claim 1 , wherein the method further comprises administering to the subject an effective amount of an immunotherapeutic anti-cancer agent.
18. A method of monitoring progression of cancer in a subject, comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
19. The method of claim 18, wherein the tissue sample comprises peripheral blood.
20. The method of claim 18, wherein the tissue sample comprises cancer tissue.
21. The method of claim 18, wherein the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject.
22. The method of claim 18, wherein the cancer is selected from head and neck cancer and lymphoma.
23. The method of claim 22, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA.
24. The method of claim 18, wherein the elevated level of expression of Semaphorin 4D corresponds to a positive pixel intensity of at least 1.5xl05 by standardized digital analysis.
25. The method of claim 18, wherein the subj ect has stage III or stage IV cancer.
26. The method of claim 18, wherein the subject's tumor has a dense, fibrotic peri-tumoral stroma.
27. The method of claim 18, further comprising obtaining the results of an assay that detects the presence or absence of an immune checkpoint molecule in the tissue sample, wherein the tissue sample is cancer tissue.
28. The method of claim 27, wherein the tissue is substantially negative for the presence of the checkpoint molecule.
29. The method of claim 28, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D.
30. The method of claim 27, wherein the tissue exhibits elevated expression of the checkpoint molecule.
31. The method of claim 30, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D and an agent that inhibits the checkpoint molecule.
32. The method of claim 31, wherein the checkpoint molecule is PD-Ll and the elevated level of expression of PD-Ll corresponds with strong focal expression in >1% of tumor cells or in tumor associated inflammatory cells or both, and having a positive pixel intensity of at least 1.5xl05 by standardized digital analysis.
PCT/US2017/015395 2016-01-27 2017-01-27 A method for monitoring cancer and for regulation of semaphorin 4d to improve cancer immunotherapy regimens Ceased WO2017132541A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/071,133 US10973843B2 (en) 2016-01-27 2017-01-27 Method for monitoring cancer and for regulation of semaphorin 4D to improve cancer immunotherapy regimens

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662287622P 2016-01-27 2016-01-27
US62/287,622 2016-01-27

Publications (1)

Publication Number Publication Date
WO2017132541A1 true WO2017132541A1 (en) 2017-08-03

Family

ID=59398984

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/015395 Ceased WO2017132541A1 (en) 2016-01-27 2017-01-27 A method for monitoring cancer and for regulation of semaphorin 4d to improve cancer immunotherapy regimens

Country Status (2)

Country Link
US (1) US10973843B2 (en)
WO (1) WO2017132541A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10287353B2 (en) 2016-05-11 2019-05-14 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US10385131B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors
WO2020198572A1 (en) * 2019-03-28 2020-10-01 Vaccinex, Inc. Semaphorin-4d antagonists for use in cancer therapy

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12253522B2 (en) * 2020-07-20 2025-03-18 University Of Maryland, Baltimore Method for treating a cancer based on inflammatory subtype thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090104193A1 (en) * 2005-04-07 2009-04-23 Albert Lai SEMA4D in Cancer Diagnosis, Detection and Treatment
US20150044219A1 (en) * 2013-06-25 2015-02-12 Vaccinex, Inc. Combination of SEMA-4D Inhibitors and Immunomodulators to Inhibit Tumors and Metastases
US20150204887A1 (en) * 2011-04-28 2015-07-23 University Of Southern California Human myeloid derived suppressor cell cancer markers

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080293053A1 (en) * 2006-12-28 2008-11-27 The Regents Of The University Of Michigan shRNA Materials and Methods of Using Same for Inhibition of DKK-1

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090104193A1 (en) * 2005-04-07 2009-04-23 Albert Lai SEMA4D in Cancer Diagnosis, Detection and Treatment
US20150204887A1 (en) * 2011-04-28 2015-07-23 University Of Southern California Human myeloid derived suppressor cell cancer markers
US20150044219A1 (en) * 2013-06-25 2015-02-12 Vaccinex, Inc. Combination of SEMA-4D Inhibitors and Immunomodulators to Inhibit Tumors and Metastases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BASILE ET AL.: "Semaphorin 4D provides a link between axon guidance processes and tumor- induced angiogenesis", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 103, no. 24, 2006, pages 9017 - 9022, XP002405818 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10287353B2 (en) 2016-05-11 2019-05-14 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US10385130B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US10385131B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors
US11535670B2 (en) 2016-05-11 2022-12-27 Huyabio International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors
US12122833B2 (en) 2016-05-11 2024-10-22 Huyabio International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
WO2020198572A1 (en) * 2019-03-28 2020-10-01 Vaccinex, Inc. Semaphorin-4d antagonists for use in cancer therapy
CN113631230A (en) * 2019-03-28 2021-11-09 瓦西尼斯公司 semaphorin-4D antagonists for cancer treatment
KR20210143896A (en) * 2019-03-28 2021-11-29 백시넥스 인코포레이티드 Semaphorin-4D antagonists for use in cancer therapy
AU2020244862B2 (en) * 2019-03-28 2023-01-05 Merck Kgaa Semaphorin-4D antagonists for use in cancer therapy
KR102614472B1 (en) 2019-03-28 2023-12-14 백시넥스 인코포레이티드 Semaphorin-4D antagonists for use in cancer therapy
IL284981B1 (en) * 2019-03-28 2025-07-01 Vaccinex Inc Semaphorin-4d antagonists for use in cancer therapy
IL284981B2 (en) * 2019-03-28 2025-11-01 Vaccinex Inc Semaphorin-4d antagonists for use in cancer treatment

Also Published As

Publication number Publication date
US20190030060A1 (en) 2019-01-31
US10973843B2 (en) 2021-04-13

Similar Documents

Publication Publication Date Title
Xia et al. EGFR‐targeted CAR‐T cells are potent and specific in suppressing triple‐negative breast cancer both in vitro and in vivo
EP3328401B1 (en) Motile sperm domain containing protein 2 and cancer
US10973843B2 (en) Method for monitoring cancer and for regulation of semaphorin 4D to improve cancer immunotherapy regimens
NL2024544B1 (en) Compositions And Methods For Cancer Therapy
KR102692667B1 (en) Use of TCTP as biomarker for predicting efficacy, prognosis of immunotherapy or resistance thereto, and target of immunotherapy for enhancing efficacy
JP2024527961A (en) Treatment of cancer patients with tumor-infiltrating lymphocyte therapy in combination with KRAS inhibitors
JP2023546359A (en) Treatment of NSCLC patients with tumor-infiltrating lymphocyte therapy
US20180128833A1 (en) Methods of treating with tumor membrane vesicle-based immunotherapy and predicting therapeutic response thereto
JP2024500403A (en) Treatment of cancer with tumor-infiltrating lymphocytes
US9957576B2 (en) Methods for determining responsiveness to an anti-CD47 agent
US10302629B2 (en) Compositions and methods for treating cancer by rational targeting of protein translation
JP2024528029A (en) Engineered immune cells that specifically target mesothelin and uses thereof
WO2023034793A1 (en) Exploiting il33 secretion as a therapeutic target in cancer
US20240252533A1 (en) Methods and compositions for pancreatic cancer evaluation and treatment
US20210196744A1 (en) Compositions for cancer therapy and methods
US20240226168A1 (en) Engineered nk cells and uses thereof
US20240307531A1 (en) Compositions and methods of treating sarcoma lung metastasis
CN107326027A (en) A kind of prna chimera body and application thereof
WO2025020931A1 (en) Cdk20 in cancer diagnosis and therapy
WO2026102329A1 (en) Methods and compositions for predicting response to oncolytic virotherapy
CN118272527A (en) Application of tumor-derived ILT3 in the prognosis and treatment of lung adenocarcinoma
HK40107105A (en) Chimeric costimulatory receptors, chemokine receptors, and the use of same in cellular immunotherapies
EP4619509A1 (en) T cell-nk cell interaction inhibitors for use in disease treatment
HK1255016A1 (en) Methods of treating solid or lymphatic tumors by combination therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17744993

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17744993

Country of ref document: EP

Kind code of ref document: A1