WO2017106034A1 - Lgr4 specific monoclonal antibodies and methods of their use - Google Patents

Lgr4 specific monoclonal antibodies and methods of their use Download PDF

Info

Publication number
WO2017106034A1
WO2017106034A1 PCT/US2016/065788 US2016065788W WO2017106034A1 WO 2017106034 A1 WO2017106034 A1 WO 2017106034A1 US 2016065788 W US2016065788 W US 2016065788W WO 2017106034 A1 WO2017106034 A1 WO 2017106034A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
domain
seq
cancer
cdr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/065788
Other languages
French (fr)
Inventor
Qingyun Liu
Xing GONG
Kendra Carmon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Texas System
University of Texas at Austin
Original Assignee
University of Texas System
University of Texas at Austin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Texas System, University of Texas at Austin filed Critical University of Texas System
Priority to US16/062,386 priority Critical patent/US10729781B2/en
Publication of WO2017106034A1 publication Critical patent/WO2017106034A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/68031Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being an auristatin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54366Apparatus specially adapted for solid-phase testing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/77Internalization into the cell
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates generally to the field of cancer biology. More particularly, it concerns LGR4 targeting monoclonal antibodies for the treatment and detection of cancer.
  • LGR4 leucine-rich repeat-containing G-protein coupled receptor 4
  • GPR48 G-protein coupled receptor 48
  • ECD extracellular domain
  • 7TM seven transmembrane domain typical of the rhodopsin family of G protein-coupled receptors. It has been demonstrated that LGR4, along with its closely related homologs LGR5 and LGR6, function as receptors of the R-spondin group of stem cell factors to potentiate Wnt signaling (8-10).
  • RSPO-LGR4 signaling is mediated by the inhibition of two E3 ubiquitin ligases (RNF43 and ZNRF3) of Wnt receptors and the recruitment of IQGAP1 to coordinate LRP6 phosphorylation as well as actin dynamics.
  • R-spondins As a receptor for R-spondins, LGR4 potentiates the canonical Wnt signaling pathway and is involved in the formation of various organs.
  • R-spondins Upon binding to R-spondins (RSPOl, RSP02, RSP03 or RSP04), LGR4 associates with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes.
  • LGR4 does not activate heterotrimeric G-proteins to transduce the signal.
  • LGR4 activation of the Wnt signaling pathway is required for the development of various organs, including liver, kidney, intestine, bone, reproductive tract and eye.
  • LGR4 is also required during spermatogenesis to activate the Wnt signaling pathway in peritubular myoid cells and for the maintenance of intestinal stem cells and Paneth cell differentiation in postnatal intestinal crypts.
  • LGR4 also acts as a regulator of bone formation and remodeling and is involved in kidney development.
  • LGR4 is also involved in the development of the anterior segment of the eye; required during erythropoiesis; and also acts as a negative regulator of innate immunity by inhibiting TLR2/TLR4 associated pattern-recognition and proinflammatory cytokine production. LGR4 is also believed to play an important role in regulating the circadian rhythms of plasma lipids, partially through regulating the rhythmic expression of MTTP. The complex interactions of LGR4 receptors and ligands provide a great potential for significant therapeutic intervention.
  • LGR4 monoclonal antibodies that potently block LGR4 signaling and inhibit cancer cell proliferation.
  • an isolated or recombinant monoclonal antibody that specifically binds to a LGR4.
  • an antibody that competes for the binding of a LGR4 with the 8D2 or 3G6 monoclonal antibody is provided.
  • the antibody may comprise all or part of the heavy chain variable region and/or light chain variable region of the 8D2 or 3G6 monoclonal antibodies.
  • the antibody may comprise an amino acid sequence that corresponds to a first, second, and/or third complementarity determining region (CDR) from the light variable and/or heavy variable chain of the 8D2 or 3G6 monoclonal antibodies of the present embodiments.
  • CDR complementarity determining region
  • the isolated antibody comprises CDR sequences at least 80%, 90%, or 95% identical to the CDR regions of the 8D2 or 3G6 heavy and light chain amino acid sequences.
  • an antibody comprises CDR regions identical to the 8D2 or 3G6 CDR regions, except for one or two amino acid substitutions, deletions, or insertions at one or more of the CDRs.
  • the antibody can comprise CDRs wherein the CDR sequences comprise 1 or 2 amino acid substitutions in the VH CDRl, VH CDR2, VH CDR3, VL CDRl, VL CDR2 and/or VL CDR3 relative to the CDRs of a 8D2 or 3G6 monoclonal antibody.
  • an antibody of the embodiments comprises (a) a first VH CDR at least 80% identical to VH CDRl of 8D2 (SEQ ID NO: 3) or 3G6 (SEQ ID NO: 13); (b) a second VH CDR at least 80% identical to VH CDR2 of 8D2 (SEQ ID NO: 4) or 3G6 (SEQ ID NO: 14); (c) a third VH CDR at least 80% identical to VH CDR3 of 8D2 (SEQ ID NO: 5) or 3G6 (SEQ ID NO: 15); (d) a first VL CDR at least 80% identical to VL CDRl of 8D2 (SEQ ID NO: 8) or 3G6 (SEQ ID NO: 18); (e) a second VL CDR at least 80% identical to VL CDR2 of 8D2 (SEQ ID NO: 9) or 3G6 (SEQ ID NO: 19); and (f) a third VL CDR at least 80% identical to VH CDRl
  • such an antibody is a humanized or de-immunized antibody comprising the foregoing CDRs on a human IgGs (e.g. , IgGl, IgG2, IgG4, or a genetically modified IgG) backbone.
  • a human IgGs e.g. , IgGl, IgG2, IgG4, or a genetically modified IgG
  • the isolated antibody comprises a first VH, a second VH, a third VH, a first VL, a second VL, and a third VL CDR sequence at least 80% identical to the corresponding CDR sequence of monoclonal antibody 8D2, which are represented by SEQ ID NOs: 3, 4, 5, 8, 9, and 10, respectively.
  • the isolated antibody comprises CDR sequences that are identical to the CDR sequences of monoclonal antibody 8D2.
  • the isolated antibody comprises a VH domain at least about 80% identical to the the VH domain of 8D2 (SEQ ID NO: 1) or the humanized VH domain of 8D2 mAB; and a VL domain at least about 80% identical to the VL domain of 8D2 (SEQ ID NO: 6) or the humanized VL domain of 8D2 mAB.
  • the antibody can comprise a VH domain at least 95% identical to the VH domain of the humanized 8D2 mAB and a VL domain at least 95% identical to the VL domain of the humanized 8D2 mAB.
  • an antibody comprises a VH domain identical to the VH domain of humanized 8D2 mAB and a VL domain identical to the VL domain of the humanized 8D2 mAB.
  • the isolated antibody can comprise VH and VL domains identical to those of monoclonal antibody 8D2.
  • the isolated antibody comprises a first VH, a second VH, a third VH, a first VL, a second VL, and a third VL CDR sequence at least 80% identical to the corresponding CDR sequence of monoclonal antibody 3G6, which are represented by SEQ ID NOs: 13, 14, 15, 18, 19, and 20, respectively.
  • the isolated antibody comprises CDR sequences that are identical to the CDR sequences of monoclonal antibody 3G6.
  • the isolated antibody comprises a VH domain at least about
  • the antibody comprises a VH domain at least 95% identical to the VH domain of the humanized 3G6 mAB and a VL domain at least 95% identical to the VL domain of the humanized 3G6 mAB.
  • the antibody can comprise a VH domain identical to the VH domain of the humanized 3G6 mAB and a VL domain identical to the VL domain of the humanized 3G6 mAB.
  • the isolated antibody can comprise VH and VL domains identical to those of monoclonal antibody 3G6.
  • an antibody of the embodiments may be an IgG (e.g., IgGl, IgG2, IgG3 or IgG4), IgM, IgA, genetically modified IgG isotype, or an antigen binding fragment thereof.
  • the antibody may be a Fab', a F(ab')2 a F(ab')3, a monovalent scFv, a bivalent scFv, a bispecific or a single domain antibody.
  • the antibody may be a human, humanized, or de-immunized antibody.
  • the isolated antibody is the 8D2 or 3G6 antibody.
  • the antibody may be conjugated to an imaging agent, a chemotherapeutic agent, a toxin, or a radionuclide.
  • a recombinant polypeptide comprising an antibody VH domain comprising CDRs 1-3 of the VH domain of 8D2 (SEQ ID NOs: 3, 4, and 5) or CDRs 1-3 of the VH domain of 3G6 (SEQ ID NOs: 13, 14, and 15).
  • a recombinant polypeptide comprising an antibody VL domain comprising CDRs 1-3 of the VL domain of 8D2 (SEQ ID NOs: 8, 9, and 10) or 3G6 (SEQ ID NOs: 18, 19, and 20).
  • an isolated polynucleotide molecule comprising nucleic acid sequence encoding an antibody or a polypeptide comprising an antibody VH or VL domain disclosed herein.
  • a host cell that produces a monoclonal antibody or recombinant polypeptide of the embodiments.
  • the host cell is a mammalian cell, a yeast cell, a bacterial cell, a ciliate cell, or an insect cell.
  • the host cell is a hybridoma cell.
  • a method of manufacturing an antibody of the present invention comprising expressing one or more polynucleotide molecule(s) encoding a VL or VH chain of an antibody disclosed herein in a cell and purifying the antibody from the cell.
  • there are pharmaceutical compositions comprising an antibody or antibody fragment as discussed herein. Such a composition further comprises a pharmaceutically acceptable carrier and may or may not contain additional active ingredients.
  • the antibody is a monoclonal antibody of the embodiments herein, such as the 8D2 or 3G6 antibody or a recombinant polypeptide comprising antibody segment derived therefrom.
  • the cancer may be a breast cancer, lung cancer, head & neck cancer, prostate cancer, esophageal cancer, tracheal cancer, brain cancer, liver cancer, bladder cancer, stomach cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer or skin cancer.
  • the antibody may be administered systemically.
  • the antibody may be administered intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.
  • the method may further comprise administering at least a second anticancer therapy to the subject.
  • the second anticancer therapy include, but are not limited to, surgical therapy, chemotherapy, radiation therapy, cryotherapy, hormonal therapy, immunotherapy, or cytokine therapy.
  • the method may further comprise administering a composition of the present invention more than one time to the subject, such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more times.
  • a method for detecting a cancer in a subject comprising testing for the presence of elevated LGR4 relative to a control in a sample from the subject, wherein the testing comprises contacting the sample with an antibody disclosed herein.
  • the method may be an in vitro or in vivo method.
  • Certain embodiments are directed to an antibody or recombinant polypeptide composition comprising an isolated and/or recombinant antibody or polypeptide that specifically binds LGR4.
  • the antibody or polypeptide has a sequence that is, is at least, or is at most 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical (or any range derivable therein) to all or part of any monoclonal antibody provided herein.
  • the isolated and/ or recombinant antibody or polypeptide has, has at least, or has at most 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100 or more contiguous amino acids from any of the sequences provided herein or a combination of such sequences.
  • an antibody or polypeptide of the embodiments comprises one or more amino acid segments of the any of the amino acid sequences disclosed herein.
  • the antibody or polypeptide can comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid segments comprising about, at least or at most 5, 6, 7, 8, 9, 10, 1 1, 12, 13,
  • an antibody or polypeptide of the embodiments comprises an amino acid segment of the any of the amino acid sequences disclosed herein, wherein the segment begins at amino acid position 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14,
  • an antibody or polypeptide of the embodiments comprises an amino acid segment that is at least 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical (or any range derivable therein) to a V, VJ, VDJ, D, DJ, J or CDR domain of a LGR4-binding antibody (as provided in Table 1).
  • a polypeptide may comprise 1 , 2 or 3 amino acid segment that are at least 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical (or any range derivable therein) to CDRs 1 , 2, and/or 3 a LGR4-binding antibody as provided in Table 1.
  • FIG. 1 A schematic diagram illustrating the working principles of ADC (antibody-drug conjugate). Upon binding to its target antigen, the niAb-antigen complex is internalized into endosomes which is then fused with lysosomes where the mAb is degraded and the drug is released.
  • ADC antibody-drug conjugate
  • FIGS. 2A-2B LGR4 is highly expressed in primary tumors and cell lines of major epithelial cancers.
  • 2A RNA-seq data of LGR4 from TCGA are presented by a box and whiskers plot (top and lower bar are max and min values, respectively. The box represents the 95% confidence range of the mean for each tumor type).
  • 2B Microarray expression data (normalized) of LGR4 in box and whiskers plot. Numbers in each box represent the number of cases/cell lines with expression data .
  • CRC colorectal adenocarcinoma
  • LUAD lung adenocarcinoma
  • LUSQ lung squamous cell carcinoma
  • BrCa breast cancer
  • HCC hepatocellular carcinoma
  • OvCA ovarian cancer
  • RCC kidney renal clear cell carcinoma
  • LuCA lung cancer
  • KiCA kidney cancer. All data were downloaded from the cBioportal website (cbioportal.org).
  • FIGS. 3A-3F Identification and characterization of anti-LGR4 mAbs.
  • 3A Eight mAbs were purified to homogeneity. HC, heavy chain; LC, light chain.
  • 3B Seven purified rat mAbs gave dose-dependent binding to HEK293 cells stably expressing human LGR4.
  • 3C mAb 8D2 only detected recombinant LGR4 in WB. The lanes are: 1, HEK293, 2, HEK293-LGR4-mouse, 3, HEK293-LGR4-human, 4, breast cancer cell line BT474, 5, HeLa cells.
  • 3D ICC of 8D2 bound to LGR4 on the cell surface in HEK293 cells stably expressing LGR4.
  • 3E Binding of 8D2 to lung cancer cell line A549 cells led to its internalization (left panel), which was competed off by conditioned media containing LGR4-ECD (mid-panel) but not by control conditioned media (right panel).
  • 3F 8D2 (green) and RSPOl-Fc (red) were co-intemalized in A549 cells.
  • FIG. 4 The LGR4-mAb complex is internalized into the lysosome. 8D2 was incubated with SKOV3 cells for 4 hours, fixed, permeabilized, co-stained with anti-rat(red) and anti-LAMPl (green) antibodies, and viewed by confocal microscopy. [0037] FIGS. 5A-5D. LGR4 mAb ADC showed cytotoxic activity in LGR4-high cancer cell lines. 5A: diagram of the 8D2-MC-VC-PAB-MMAE (8D2-MMAE) ADC.
  • OVCAR3 cells were implanted subcutaneously into nude mice. The animals were dosed with vehicle or the indicated substances every 10 days when tumors reached an average size of ⁇ 100 mm3.
  • FIG. 7 Binding of anti-LGR4 mAbs 8D2 and 3G6 to LGR4. Serial dilutions of the purified 8D2 and 3G6 were incubated with HEK293 cells overexpressing LGR4, washed, fixed, and incubated with Alexa-488-labeled anti-rat IgG and then washed. Binding was based on amount of fluorescence retained by the cells.
  • FIG. 8 Comparison of cytostatic effect of 3G6 and 8D2 in the presence of MMAF-conjugated anti-rat IgG.
  • an antibody or a fragment thereof that binds to at least a portion of LGR4 protein and inhibits LGR4 signaling and cancer cell proliferation are contemplated.
  • the term "antibody” is intended to refer broadly to any immunologic binding agent, such as IgG, IgM, IgA, IgD, IgE, and genetically modified IgG as well as polypeptides comprising antibody CDR domains that retain antigen binding activity.
  • the antibody may be selected from the group consisting of a chimeric antibody, an affinity matured antibody, a polyclonal antibody, a monoclonal antibody, a humanized antibody, a human antibody, or an antigen-binding antibody fragment or a natural or synthetic ligand.
  • the anti-LGR4 antibody is a monoclonal antibody or a humanized antibody.
  • polyclonal or monoclonal antibodies, antibody fragments, and binding domains and CDRs may be created that are specific to LGR4 protein, one or more of its respective epitopes, or conjugates of any of the foregoing, whether such antigens or epitopes are isolated from natural sources or are synthetic derivatives or variants of the natural compounds.
  • antibody fragments suitable for the present embodiments include, without limitation: (i) the Fab fragment, consisting of VL, VH, CL, and CHI domains; (ii) the "Fd” fragment consisting of the VH and CHI domains; (iii) the "Fv” fragment consisting of the VL and VH domains of a single antibody; (iv) the "dAb” fragment, which consists of a VH domain; (v) isolated CDR regions; (vi) F(ab')2 fragments, a bivalent fragment comprising two linked Fab fragments; (vii) single chain Fv molecules ("scFv”), wherein a VH domain and a VL domain are linked by a peptide linker that allows the two domains to associate to form a binding domain; (viii) bi-specific single chain Fv dimers (see U.S.
  • Fv, scFv, or diabody molecules may be stabilized by the incorporation of disulphide bridges linking the VH and VL domains.
  • Minibodies comprising a scFv joined to a CH3 domain may also be made (Hu et al, 1996).
  • Antibody-like binding peptidomimetics are also contemplated in embodiments. Liu et al. (2003) describe "antibody like binding peptidomimetics" (ABiPs), which are peptides that act as pared-down antibodies and have certain advantages of longer serum half-life as well as less cumbersome synthesis methods.
  • ABSiPs antibody like binding peptidomimetics
  • Animals may be inoculated with an antigen, such as a LGR4 extracellular domain (ECD) protein, in order to produce antibodies specific for LGR4 protein.
  • ECD extracellular domain
  • the ECD may have 17 leucine-rich repeats and a seven transmembrane (7TM) domain typical of the rhodopsin family of G protein-coupled receptors.
  • GenBank entries include: AF346711, AF346709, AF346710 (Genomic DNA), AAK31153.1 (Translation), BC033039, AAH33039.1 (mRNA and translation) and UniProtKB - Q9BXB1 (LGR4_Human).
  • the LGR4 extracellular domain proteins may include amino acids 25-544, 597-620, 683-703, and 778-783 of UniProtKB Accession No. Q9BXB1.
  • an antigen is bound or conjugated to another molecule to enhance the immune response.
  • a conjugate is any peptide, polypeptide, protein, or non-proteinaceous substance bound to an antigen that is used to elicit an immune response in an animal.
  • Antibodies produced in an animal in response to antigen inoculation comprise a variety of non-identical molecules (polyclonal antibodies) made from a variety of individual antibody producing B lymphocytes.
  • a polyclonal antibody is a mixed population of antibody species, each of which may recognize a different epitope on the same antigen. Given the correct conditions for polyclonal antibody production in an animal, most of the antibodies in the animal's serum will recognize the collective epitopes on the antigenic compound to which the animal has been immunized. This specificity is further enhanced by affinity purification to select only those antibodies that recognize the antigen or epitope of interest.
  • a monoclonal antibody is a single species of antibody wherein every antibody molecule recognizes the same epitope because all antibody producing cells are derived from a single B-lymphocyte cell line.
  • the methods for generating monoclonal antibodies generally begin along the same lines as those for preparing polyclonal antibodies.
  • rodents such as mice and rats are used in generating monoclonal antibodies.
  • rabbit, sheep, or frog cells are used in generating monoclonal antibodies. The use of rats is well known and may provide certain advantages.
  • Mice e.g., BALB/c mice
  • Hybridoma technology involves the fusion of a single B lymphocyte from a mouse previously immunized with a LGR4 antigen with an immortal myeloma cell (usually mouse myeloma).
  • This technology provides a method to propagate a single antibody- producing cell for an indefinite number of generations, such that unlimited quantities of structurally identical antibodies having the same antigen or epitope specificity (monoclonal antibodies) may be produced.
  • Plasma B cells may be isolated from freshly prepared rabbit peripheral blood mononuclear cells of immunized rabbits and further selected for LGR4 binding cells. After enrichment of antibody producing B cells, total RNA may be isolated and cDNA synthesized. DNA sequences of antibody variable regions from both heavy chains and light chains may be amplified, constructed into a phage display Fab expression vector, and transformed into E. coli. LGR4 specific binding Fab may be selected out through multiple rounds enrichment panning and sequenced.
  • Selected LGR4 binding hits may be expressed as full length IgG in rabbit and rabbit/human chimeric forms using a mammalian expression vector system in human embryonic kidney (HEK293) cells (Invitrogen) and purified using a protein G resin with a fast protein liquid chromatography (FPLC) separation unit.
  • HEK293 human embryonic kidney
  • FPLC fast protein liquid chromatography
  • the antibody is a chimeric antibody, for example, an antibody comprising antigen binding sequences from a non-human donor grafted to a heterologous non-human, human, or humanized sequence (e.g., framework and/or constant domain sequences).
  • a heterologous non-human, human, or humanized sequence e.g., framework and/or constant domain sequences.
  • Methods have been developed to replace light and heavy chain constant domains of the monoclonal antibody with analogous domains of human origin, leaving the variable regions of the foreign antibody intact.
  • "fully human" monoclonal antibodies are produced in mice transgenic for human immunoglobulin genes.
  • Methods have also been developed to convert variable domains of monoclonal antibodies to more human form by recombinantly constructing antibody variable domains having both rodent, for example, mouse, and human amino acid sequences.
  • Antibodies may be produced from any animal source, including birds and mammals.
  • the antibodies are ovine, murine (e.g., mouse and rat), rabbit, goat, guinea pig, camel, horse, or chicken.
  • newer technology permits the development of and screening for human antibodies from human combinatorial antibody libraries.
  • bacteriophage antibody expression technology allows specific antibodies to be produced in the absence of animal immunization, as described in U.S. Pat. No. 6,946,546, which is incorporated herein by reference. These techniques are further described in: Marks (1992); Stemmer (1994); Gram et al. (1992); Barbas et al. (1994); and Schier et al. (1996).
  • antibodies to LGR4 will have the ability to neutralize or counteract the effects of LGR4 regardless of the animal species, monoclonal cell line, or other source of the antibody.
  • Certain animal species may be less preferable for generating therapeutic antibodies because they may be more likely to cause allergic response due to activation of the complement system through the "Fc" portion of the antibody.
  • whole antibodies may be enzymatically digested into "Fc” (complement binding) fragment, and into antibody fragments having the binding domain or CDR. Removal of the Fc portion reduces the likelihood that the antigen antibody fragment will elicit an undesirable immunological response, and thus, antibodies without Fc may be preferential for prophylactic or therapeutic treatments.
  • antibodies may also be constructed so as to be chimeric or partially or fully human, so as to reduce or eliminate the adverse immunological consequences resulting from administering to an animal an antibody that has been produced in, or has sequences from, other species.
  • Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, with or without the loss of other functions or properties. Substitutions may be conservative, that is, one amino acid is replaced with one of similar shape and charge.
  • Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
  • substitutions may be non-conservative such that a function or activity of the polypeptide is affected.
  • Non-conservative changes typically involve substituting a residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa.
  • Proteins may be recombinant, or synthesized in vitro. Alternatively, a non- recombinant or recombinant protein may be isolated from bacteria. It is also contemplated that a bacteria containing such a variant may be implemented in compositions and methods. Consequently, a protein need not be isolated.
  • compositions there is between about 0.001 mg and about 10 mg of total polypeptide, peptide, and/or protein per ml.
  • concentration of protein in a composition can be about, at least about or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 mg/ml or more (or any range derivable therein).
  • about, at least about, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% may be an antibody that binds LGR4.
  • An antibody or preferably an immunological portion of an antibody can be chemically conjugated to, or expressed as, a fusion protein with other proteins.
  • a fusion protein with other proteins.
  • all such fused proteins are included in the definition of antibodies or an immunological portion of an antibody.
  • Antibody-drug conjugates have emerged as a breakthrough approach to the development of cancer therapeutics. Cancer is one of the leading causes of deaths in the world.
  • Antibody-drug conjugates comprise monoclonal antibodies (mAbs) that are covalently linked to cell-killing drugs (see, e.g., FIG. 1).
  • mAbs monoclonal antibodies
  • embodiments provide antibodies and antibody-like molecules against LGR4, polypeptides and peptides that are linked to at least one agent to form an antibody conjugate or payload.
  • this approach combines the high specificity of mAbs against their antigen targets with highly potent cytotoxic drugs, resulting in "armed" mAbs that deliver the payload (drug) to tumor cells with enriched levels of the antigen (Carter et al , 2008; Teicher 2014; Leal et al, 2014). Targeted delivery of the drug also minimizes its exposure in normal tissues, resulting in decreased toxicity and improved therapeutic index.
  • a molecule or moiety may be, but is not limited to, at least one effector or reporter molecule. Effector molecules comprise molecules having a desired activity, e.g., cytotoxic activity.
  • Non-limiting examples of effector molecules that have been attached to antibodies include toxins, therapeutic enzymes, antibiotics, radio-labeled nucleotides and the like.
  • a reporter molecule is defined as any moiety that may be detected using an assay.
  • Non-limiting examples of reporter molecules that have been conjugated to antibodies include enzymes, radiolabels, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffinity molecules, colored particles or ligands, such as biotin.
  • LGR4 presented itself as an excellent target of ADC-based drug development for the treatment of LGR4-high tumors.
  • the anti-LGR4 monoclonal antibodies disclosed herein demonstrate that an auristatin-conjugated LGR4 ADC had a strong cytotoxic effect in vitro on multiple LGR4-high cancer cell lines.
  • novel anti-LGR4 monoclonal antibodies with improved properties can be used to generate LGR4 ADC displaying strong cytotoxic effects on multiple LGR4-expressing human cancer cells, both in vitro and in vivo.
  • a metal chelate complex employing, for example, an organic chelating agent such as a diethylenetriaminepentaacetic acid anhydride (DTP A); ethylenetriaminetetraacetic acid; N- chloro-p-toluenesulfonamide; and/or tetrachloro-3-6-diphenylglycouril-3 attached to the antibody.
  • DTP A diethylenetriaminepentaacetic acid anhydride
  • ethylenetriaminetetraacetic acid ethylenetriaminetetraacetic acid
  • N- chloro-p-toluenesulfonamide and/or tetrachloro-3-6-diphenylglycouril-3 attached to the antibody.
  • Monoclonal antibodies may also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate.
  • Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with an isothio
  • Certain aspects of the present embodiments can be used to prevent or treat a disease or disorder associated with LGR4 signaling.
  • Signaling of LGR4 may be reduced by any suitable drugs to prevent cancer cell proliferation.
  • such substances would be an anti- LGR4 antibody.
  • Treatment refers to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition.
  • a treatment may include administration of a pharmaceutically effective amount of an antibody that inhibits the LGR4 signaling.
  • Subject and “patient” refer to either a human or non-human, such as primates, mammals, and vertebrates. In particular embodiments, the subject is a human.
  • therapeutic benefit or “therapeutically effective” as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease.
  • treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis. Treatment of cancer may also refer to prolonging survival of a subject with cancer.
  • compositions may comprise, for example, at least about 0.1% of an active compound.
  • an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein.
  • compositions of the present embodiments are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to inj ection may also be prepared. These preparations also may be emulsified.
  • phrases "pharmaceutical or pharmacologically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal, such as a human, as appropriate.
  • the preparation of a pharmaceutical composition comprising an antibody or additional active ingredient will be known to those of skill in the art in light of the present disclosure.
  • animal (e.g., human) administration it will be understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biological Standards.
  • aqueous solvents e.g., water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles, such as sodium chloride, Ringer's dextrose, etc.
  • non-aqueous solvents e.g., propylene glycol, polyethylene glycol, vegetable oil, and injectable organic esters, such as ethyloleate
  • dispersion media coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, anti-oxidants, chelating agents, and inert gases), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, fluid and nutrient replenishers, such like materials and combinations thereof, as would be known to one of ordinary skill in the art.
  • the pH and exact concentration e.g., water, alcoholic/aqueous solutions,
  • unit dose refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the desired responses discussed above in association with its administration, i.e., the appropriate route and treatment regimen.
  • the quantity to be administered depends on the effect desired.
  • the actual dosage amount of a composition of the present embodiments administered to a patient or subject can be determined by physical and physiological factors, such as body weight, the age, health, and sex of the subject, the type of disease being treated, the extent of disease penetration, previous or concurrent therapeutic interventions, idiopathy of the patient, the route of administration, and the potency, stability, and toxicity of the particular therapeutic substance.
  • a dose may also comprise from about 1 ⁇ g/kg/body weight to about 1000 mg/kg/body weight (this such range includes intervening doses) or more per administration, and any range derivable therein.
  • a derivable range from the numbers listed herein, a range of about 5 ⁇ g/kg/body weight to about 100 mg/kg/body weight, about 5 ⁇ g/kg/body weight to about 500 mg/kg/body weight, etc., can be administered.
  • the practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • the active compounds can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, or even intraperitoneal routes.
  • parenteral administration e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, or even intraperitoneal routes.
  • such compositions can be prepared as either liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and, the preparations can also be emulsified.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the
  • the proteinaceous compositions may be formulated into a neutral or salt form.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
  • a pharmaceutical composition can include a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • compositions and methods of the present embodiments involve an antibody or an antibody fragment against LGR4 to inhibit its activity in cancer cell proliferation, in combination with a second or additional therapy.
  • Such therapy can be applied in the treatment of any disease that is associated with LGR4-mediated cell proliferation.
  • the disease may be cancer.
  • Therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation.
  • This process may involve contacting the cells with both an antibody or antibody fragment and a second therapy.
  • a tissue, tumor, or cell can be contacted with one or more compositions or pharmacological formulation(s) comprising one or more of the agents (i.e., antibody or antibody fragment or an anti-cancer agent), or by contacting the tissue, tumor, and/or cell with two or more distinct compositions or formulations, wherein one composition provides 1) an antibody or antibody fragment, 2) an anti-cancer agent, or 3) both an antibody or antibody fragment and an anticancer agent.
  • a combination therapy can be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or immunotherapy.
  • contacted and “exposed,” when applied to a cell are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell.
  • both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
  • An inhibitory antibody may be administered before, during, after, or in various combinations relative to an anti-cancer treatment.
  • the administrations may be in intervals ranging from concurrently to minutes to days to weeks.
  • the antibody or antibody fragment is provided to a patient separately from an anti-cancer agent, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the two compounds would still be able to exert an advantageously combined effect on the patient.
  • a course of treatment will last 1 -90 days or more (this such range includes intervening days). It is contemplated that one agent may be given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof, and another agent is given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no anti-cancer treatment is administered.
  • This time period may last 1-7 days, and/or 1-5 weeks, and/or 1-12 months or more (this such range includes intervening days), depending on the condition of the patient, such as their prognosis, strength, health, etc. It is expected that the treatment cycles would be repeated as necessary. [0078] Various combinations may be employed. For the example below an antibody therapy is "A” and an anti-cancer therapy is "B":
  • chemotherapeutic agents may be used in accordance with the present embodiments.
  • the term "chemotherapy” refers to the use of drugs to treat cancer.
  • a "chemotherapeutic agent” is used to connote a compound or composition that is administered in the treatment of cancer.
  • agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle.
  • an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis.
  • chemotherapeutic agents include alkylating agents, such as thiotepa and cyclosphosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; aziridines, such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines, including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide, and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); do
  • DNA damaging factors include what are commonly known as ⁇ -rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells.
  • Other forms of DNA damaging factors are also contemplated, such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287), and UV- irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes.
  • Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens.
  • Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. iii. Immunotherapy
  • immunotherapeutics generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells.
  • Rituximab (RITUXAN®) is such an example.
  • the immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell.
  • the antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing.
  • the antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve as a targeting agent.
  • the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target.
  • Various effector cells include cytotoxic T cells and NK cells
  • the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells.
  • Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, laminin receptor, erb B, and pi 55.
  • An altemative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects.
  • Immune stimulating molecules also exist including: cytokines, such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines, such as MIP-1, MCP-1, IL-8, and growth factors, such as FLT3 ligand.
  • cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN
  • chemokines such as MIP-1, MCP-1, IL-8
  • growth factors such as FLT3 ligand.
  • immunotherapies currently under investigation or in use are immune adjuvants, e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al, 1998); cytokine therapy, e.g., interferons ⁇ , ⁇ , and y, IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al, 1998); gene therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al, 1998; Austin-Ward and Villaseca, 1998; U.S.
  • immune adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds
  • Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed and may be used in conjunction with other therapies, such as the treatment of the present embodiments, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy, and/or altemative therapies.
  • Tumor resection refers to physical removal of at least part of a tumor.
  • treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically-controlled surgery (Mohs' surgery).
  • a cavity may be formed in the body.
  • Treatment may be accomplished by perfusion, direct injection, or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well. v. Other Agents
  • agents may be used in combination with certain aspects of the present embodiments to improve the therapeutic efficacy of treatment.
  • additional agents include agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Increases in intercellular signaling by elevating the number of GAP junctions would increase the anti -hyperproliferative effects on the neighboring hyperproliferative cell population.
  • cytostatic or differentiation agents can be used in combination with certain aspects of the present embodiments to improve the anti-hyperproliferative efficacy of the treatments.
  • Inhibitors of cell adhesion are contemplated to improve the efficacy of the present embodiments.
  • Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with certain aspects of the present embodiments to improve the treatment efficacy.
  • kits are envisioned containing therapeutic agents and/or other therapeutic and delivery agents.
  • the present embodiments contemplates a kit for preparing and/or administering a therapy of the embodiments.
  • the kit may comprise one or more sealed vials containing any of the pharmaceutical compositions of the present embodiments.
  • the kit may include, for example, at least one LGR4 antibody as well as reagents to prepare, formulate, and/or administer the components of the embodiments or perform one or more steps of the inventive methods.
  • the kit may also comprise a suitable container, which is a container that will not react with components of the kit, such as an eppendorf tube, an assay plate, a syringe, a bottle, or a tube.
  • a suitable container which is a container that will not react with components of the kit, such as an eppendorf tube, an assay plate, a syringe, a bottle, or a tube.
  • the container may be made from sterilizable materials such as plastic or glass.
  • the kit may further include an instruction sheet that outlines the procedural steps of the methods set forth herein, and will follow substantially the same procedures as described herein or are known to those of ordinary skill in the art.
  • the instruction information may be in a computer readable media containing machine-readable instructions that, when executed using a computer, cause the display of a real or virtual procedure of delivering a pharmaceutically effective amount of a therapeutic agent.
  • Example 1 - LGR4 is highly upregulated in many major types of solid tumors
  • LGR4 is highly upregulated in colorectal cancer (CRC) and non-small cell lung cancer (NSCLC).
  • CRC colorectal cancer
  • NSCLC non-small cell lung cancer
  • LGR4 gain-of-expression gene fusions of RSP02 (to EIF3E) and RSP03 (PTPRK) occur in a fraction of colorectal and other cancers as a driving mechanism.
  • LAD lung adenocarcinoma
  • LGR4 lung adenocarcinoma
  • RNA-sequence data provided by The Cancer Genome Atlas (TCGA, cancergenome.nih.gov) for a large number cases across multiple types of solid tumors
  • TCGA cancergenome.nih.gov
  • LGR4 was also found to be expressed at similar or even higher levels in hepatocellular carcinoma (HCC), ovarian serous adenocarcinoma (OvCA), and kidney renal cell carcinoma (RCC) (FIG. 2A).
  • HCC hepatocellular carcinoma
  • OvCA ovarian serous adenocarcinoma
  • RRCC kidney renal cell carcinoma
  • expression level of LGR4 is also high across cancer cell lines of the same tumor types (FIG. 2B) based on microarray data of gene expression in the CCLE (Cancer Cell Line Encyclopedia) database (Barretina, et al. 2012), indicating that LGR4 is expressed in cancer cells of primary tumors instead of stromal cells.
  • Anti-LGR4 monoclonal antibodies were generated under contract by the company Aldevron/Genovac (Aldevron, Fargo, ND, USA, aldevron.com) using DNA-based immunization of rats with a vector containing full-length human LGR4. After a series of steps from antibody purification to characterization, sixteen (16) clones were identified that produced LGR4-binding monoclonal antibodies. To further characterize the monoclonal antibodies, eight clones with the best apparent binding affinity were scaled up and purified using protein G-based affinity chromatography (FIG. 3A).
  • LGR4-mAb-8D2 complex was co-internalized into lysosome.
  • Current antibody-drug conjugate (ADC) approaches generally require internalization of the antigen- ADC complex into the lysosome where the payload cytotoxin can be released by protease- mediated digestion. Therefore to investigate the potential of LGR4-mAb-8D2 complex for use in ADC, the fate of the mAb 8D2 following incubating with ovarian cancer cell line SKOV3 cells which express high levels of LGR4 (LGR4-high cancer cells) and it was determined that the antibody was completely co-localized with the lysosome marker LAMP1 (FIG. 4), indicating that LGR4 is a suitable target for ADCs that are designed to rely on lysosomal proteases.
  • ADC antibody-drug conjugate
  • LGR4-mAb-8D2 conjugated to auristatin (8D2-MMAE) inhibits the growth of cancer cell lines.
  • the mAb 8D2 was conjugated with the toxin auristatin through a MC-VC-PAB (maleimidocaproyl-valine-citrulline-p-aminobenzyloxycarbonyl) linker in which the valine-citrulline peptide bond is subject to cleavage by proteases in the lysosome (as described in Doronina et al, 2003, and diagramed in FIG. 5A).
  • MC-VC-PAB maleimidocaproyl-valine-citrulline-p-aminobenzyloxycarbonyl
  • Auristatin is a highly potent inhibitor of microtubule assembly and is the payload used in the clinically approved drug ADCETRIS® (brentuximab vedotin).
  • A549 cells were used to confirm the binding affinity of mAb 8D2 was conjugated with auristatin (8D2-MMAE) to LGR4.
  • a panel of cell lines with high levels of LGR4 that are represent the major types of epithelial cancers expressing LGR4 were used to validate that 8D2-MMAE was high toxic to a series of ovarian cancer cell lines (FIGS. 5B- 5D)
  • the IC50 for 8D2-MMAE on the cell lines were: OVCAR3, -30 ng/ml;
  • 8D2-MMAE inhibits the growth of OVCAR3 xenograft tumors in vivo.
  • a pilot study was carried out to test if 8D2-MMAE could inhibit the growth of OVCAR3 xenograft tumor in vivo.
  • Tolerability of 8D2-MMAE was first tested in non-tumor bearing mice and it was found that a single dose of the ADC was well tolerated at 10 mg/kg.
  • OVCAR3 cells were implanted subcutaneously into the dorsal flanks of athymic nude mice and when tumors reached an average size of -100 mm3, 8D2-MMAE, along with vehicle (PBS) and 8D2 control (naked, unconjugated 8D2), were administered by intravenous (IV) injection through the tail vein at 2 mg/kg, once every 10 days. Tumor sizes were measured once per week. As shown in FIG. 6, after treatment with 8D2-MMAE, tumor growth in 2 of the 6 animals was in complete remission.
  • GYTFTSNF IYPGDGDT SRSNSGYN QNINKN YTN SEQ YQYRTGWT (SEQ ID (SEQ ID WFAY (SEQ ID NO: (SEQ ID NO: 13) NO: 14) (SEQ ID NO: 18) 19) NO: 20)
  • Antibody-drug conjugates an emerging modality for the treatment of cancer, Ann N Y Acad Sci 1321, 41-54.
  • R-spondins function as ligands of the orphan receptors LGR4 and LGR5 to regulate Wnt/beta- catenin signaling, Proc Natl Acad Sci U S A 108, 11452-11457.
  • LGR4 and LGR5 are R-spondin receptors mediating Wnt/beta-catenin and Wnt/PCP signalling, EMBO Rep 12, 1055- 1061.
  • the R-spondin/Lgr5/Rnf43 module regulator of Wnt signal strength, Genes Dev 28, 305-316.
  • GPR87 is an overexpressed G-protein coupled receptor in squamous cell carcinoma of the lung, Dis Markers 24, 41-50. Seshagiri, S., Stawiski, E. W., Durinck, S., Modrusan, Z., Storm, E. E., Conboy, C. B., Chaudhuri, S., Guan, Y., Janakiraman, V., Jaiswal, B. S., Guillory, J., Ha, C, Dijkgraaf, G.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Isolated or recombinant anti-LGR4 monoclonal antibodies are provided. In some cases, antibodies of the embodiments can be used for the detection, diagnosis and/or therapeutic treatment of human diseases, such as cancer.

Description

DESCRIPTION
LGR4 SPECIFIC MONOCLONAL ANTIBODIES AND METHODS OF THEIR USE
[0001] This application claims the benefit of United States Provisional Patent Application No. 62/267,409, filed December 15, 2015, the entirety of which is incorporated herein by reference.
[0002] This invention was made with government support under Grant No. GM102485 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION 1. Field of the Invention
[0003] The present invention relates generally to the field of cancer biology. More particularly, it concerns LGR4 targeting monoclonal antibodies for the treatment and detection of cancer.
2. Description of Related Art
[0004] The leucine-rich repeat-containing G-protein coupled receptor 4 (LGR4), also called G-protein coupled receptor 48 (GPR48), consists of a large extracellular domain (ECD) with 17 leucine-rich repeats and a seven transmembrane (7TM) domain typical of the rhodopsin family of G protein-coupled receptors. It has been demonstrated that LGR4, along with its closely related homologs LGR5 and LGR6, function as receptors of the R-spondin group of stem cell factors to potentiate Wnt signaling (8-10). This function of RSPO-LGR4 signaling is mediated by the inhibition of two E3 ubiquitin ligases (RNF43 and ZNRF3) of Wnt receptors and the recruitment of IQGAP1 to coordinate LRP6 phosphorylation as well as actin dynamics. As a receptor for R-spondins, LGR4 potentiates the canonical Wnt signaling pathway and is involved in the formation of various organs. Upon binding to R-spondins (RSPOl, RSP02, RSP03 or RSP04), LGR4 associates with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. In contrast to classical G-protein coupled receptors, LGR4 does not activate heterotrimeric G-proteins to transduce the signal. LGR4 activation of the Wnt signaling pathway is required for the development of various organs, including liver, kidney, intestine, bone, reproductive tract and eye. LGR4 is also required during spermatogenesis to activate the Wnt signaling pathway in peritubular myoid cells and for the maintenance of intestinal stem cells and Paneth cell differentiation in postnatal intestinal crypts. LGR4 also acts as a regulator of bone formation and remodeling and is involved in kidney development. LGR4 is also involved in the development of the anterior segment of the eye; required during erythropoiesis; and also acts as a negative regulator of innate immunity by inhibiting TLR2/TLR4 associated pattern-recognition and proinflammatory cytokine production. LGR4 is also believed to play an important role in regulating the circadian rhythms of plasma lipids, partially through regulating the rhythmic expression of MTTP. The complex interactions of LGR4 receptors and ligands provide a great potential for significant therapeutic intervention.
SUMMARY OF THE INVENTION
[0005] Described herein are LGR4 monoclonal antibodies that potently block LGR4 signaling and inhibit cancer cell proliferation. Thus, in a first embodiment, there is provided an isolated or recombinant monoclonal antibody that specifically binds to a LGR4. In certain aspects, an antibody that competes for the binding of a LGR4 with the 8D2 or 3G6 monoclonal antibody is provided. In certain aspects, the antibody may comprise all or part of the heavy chain variable region and/or light chain variable region of the 8D2 or 3G6 monoclonal antibodies. In a further aspect, the antibody may comprise an amino acid sequence that corresponds to a first, second, and/or third complementarity determining region (CDR) from the light variable and/or heavy variable chain of the 8D2 or 3G6 monoclonal antibodies of the present embodiments.
[0006] In certain aspects, the isolated antibody comprises CDR sequences at least 80%, 90%, or 95% identical to the CDR regions of the 8D2 or 3G6 heavy and light chain amino acid sequences. In further aspects, an antibody comprises CDR regions identical to the 8D2 or 3G6 CDR regions, except for one or two amino acid substitutions, deletions, or insertions at one or more of the CDRs. For example, the antibody can comprise CDRs wherein the CDR sequences comprise 1 or 2 amino acid substitutions in the VH CDRl, VH CDR2, VH CDR3, VL CDRl, VL CDR2 and/or VL CDR3 relative to the CDRs of a 8D2 or 3G6 monoclonal antibody. Thus, in some specific aspects, an antibody of the embodiments comprises (a) a first VH CDR at least 80% identical to VH CDRl of 8D2 (SEQ ID NO: 3) or 3G6 (SEQ ID NO: 13); (b) a second VH CDR at least 80% identical to VH CDR2 of 8D2 (SEQ ID NO: 4) or 3G6 (SEQ ID NO: 14); (c) a third VH CDR at least 80% identical to VH CDR3 of 8D2 (SEQ ID NO: 5) or 3G6 (SEQ ID NO: 15); (d) a first VL CDR at least 80% identical to VL CDRl of 8D2 (SEQ ID NO: 8) or 3G6 (SEQ ID NO: 18); (e) a second VL CDR at least 80% identical to VL CDR2 of 8D2 (SEQ ID NO: 9) or 3G6 (SEQ ID NO: 19); and (f) a third VL CDR at least 80% identical to VL CDR3 of 8D2 (SEQ ID NO: 10) or 3G6 (SEQ ID NO: 20). In certain aspects, such an antibody is a humanized or de-immunized antibody comprising the foregoing CDRs on a human IgGs (e.g. , IgGl, IgG2, IgG4, or a genetically modified IgG) backbone.
[0007] In further aspects, the isolated antibody comprises a first VH, a second VH, a third VH, a first VL, a second VL, and a third VL CDR sequence at least 80% identical to the corresponding CDR sequence of monoclonal antibody 8D2, which are represented by SEQ ID NOs: 3, 4, 5, 8, 9, and 10, respectively. In one aspect, the isolated antibody comprises CDR sequences that are identical to the CDR sequences of monoclonal antibody 8D2.
[0008] In another aspect, the isolated antibody comprises a VH domain at least about 80% identical to the the VH domain of 8D2 (SEQ ID NO: 1) or the humanized VH domain of 8D2 mAB; and a VL domain at least about 80% identical to the VL domain of 8D2 (SEQ ID NO: 6) or the humanized VL domain of 8D2 mAB. For example, the antibody can comprise a VH domain at least 95% identical to the VH domain of the humanized 8D2 mAB and a VL domain at least 95% identical to the VL domain of the humanized 8D2 mAB. Thus, in some aspects, an antibody comprises a VH domain identical to the VH domain of humanized 8D2 mAB and a VL domain identical to the VL domain of the humanized 8D2 mAB. In a specific example, the isolated antibody can comprise VH and VL domains identical to those of monoclonal antibody 8D2.
[0009] In further aspects, the isolated antibody comprises a first VH, a second VH, a third VH, a first VL, a second VL, and a third VL CDR sequence at least 80% identical to the corresponding CDR sequence of monoclonal antibody 3G6, which are represented by SEQ ID NOs: 13, 14, 15, 18, 19, and 20, respectively. In one aspect, the isolated antibody comprises CDR sequences that are identical to the CDR sequences of monoclonal antibody 3G6. [0010] In another aspect, the isolated antibody comprises a VH domain at least about
80% identical to the VH domain of 3G6 (SEQ ID NO: 11) or the humanized 3G6 mAB; and a VL domain at least about 80% identical to the VL domain of 3G6 (SEQ ID NO: 16) or the humanized 3G6 mAB. Thus, in some aspects, the antibody comprises a VH domain at least 95% identical to the VH domain of the humanized 3G6 mAB and a VL domain at least 95% identical to the VL domain of the humanized 3G6 mAB. For instance the antibody can comprise a VH domain identical to the VH domain of the humanized 3G6 mAB and a VL domain identical to the VL domain of the humanized 3G6 mAB. In a specific example, the isolated antibody can comprise VH and VL domains identical to those of monoclonal antibody 3G6.
[0011] In some aspects, an antibody of the embodiments may be an IgG (e.g., IgGl, IgG2, IgG3 or IgG4), IgM, IgA, genetically modified IgG isotype, or an antigen binding fragment thereof. The antibody may be a Fab', a F(ab')2 a F(ab')3, a monovalent scFv, a bivalent scFv, a bispecific or a single domain antibody. The antibody may be a human, humanized, or de-immunized antibody. In a further aspect, the isolated antibody is the 8D2 or 3G6 antibody. [0012] In some aspects, the antibody may be conjugated to an imaging agent, a chemotherapeutic agent, a toxin, or a radionuclide.
[0013] In one embodiment, there is provided a recombinant polypeptide comprising an antibody VH domain comprising CDRs 1-3 of the VH domain of 8D2 (SEQ ID NOs: 3, 4, and 5) or CDRs 1-3 of the VH domain of 3G6 (SEQ ID NOs: 13, 14, and 15). In another embodiment, there is provided a recombinant polypeptide comprising an antibody VL domain comprising CDRs 1-3 of the VL domain of 8D2 (SEQ ID NOs: 8, 9, and 10) or 3G6 (SEQ ID NOs: 18, 19, and 20).
[0014] In some embodiments, there is provided an isolated polynucleotide molecule comprising nucleic acid sequence encoding an antibody or a polypeptide comprising an antibody VH or VL domain disclosed herein.
[0015] In further embodiments, a host cell is provided that produces a monoclonal antibody or recombinant polypeptide of the embodiments. In some aspects, the host cell is a mammalian cell, a yeast cell, a bacterial cell, a ciliate cell, or an insect cell. In certain aspects, the host cell is a hybridoma cell. [0016] In still further embodiments, there is provided a method of manufacturing an antibody of the present invention comprising expressing one or more polynucleotide molecule(s) encoding a VL or VH chain of an antibody disclosed herein in a cell and purifying the antibody from the cell. [0017] In additional embodiments, there are pharmaceutical compositions comprising an antibody or antibody fragment as discussed herein. Such a composition further comprises a pharmaceutically acceptable carrier and may or may not contain additional active ingredients.
[0018] In embodiments of the present invention, there is provided a method for treating a subject having a cancer comprising administering an effective amount of an antibody disclosed herein. In certain aspects, the antibody is a monoclonal antibody of the embodiments herein, such as the 8D2 or 3G6 antibody or a recombinant polypeptide comprising antibody segment derived therefrom.
[0019] In certain aspects, the cancer may be a breast cancer, lung cancer, head & neck cancer, prostate cancer, esophageal cancer, tracheal cancer, brain cancer, liver cancer, bladder cancer, stomach cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer or skin cancer.
[0020] In one aspect, the antibody may be administered systemically. In additional aspects, the antibody may be administered intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally. The method may further comprise administering at least a second anticancer therapy to the subject. Examples of the second anticancer therapy include, but are not limited to, surgical therapy, chemotherapy, radiation therapy, cryotherapy, hormonal therapy, immunotherapy, or cytokine therapy.
[0021] In further aspects, the method may further comprise administering a composition of the present invention more than one time to the subject, such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more times.
[0022] In another embodiment, there is provided a method for detecting a cancer in a subject comprising testing for the presence of elevated LGR4 relative to a control in a sample from the subject, wherein the testing comprises contacting the sample with an antibody disclosed herein. For example, the method may be an in vitro or in vivo method. [0023] Certain embodiments are directed to an antibody or recombinant polypeptide composition comprising an isolated and/or recombinant antibody or polypeptide that specifically binds LGR4. In certain aspects the antibody or polypeptide has a sequence that is, is at least, or is at most 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical (or any range derivable therein) to all or part of any monoclonal antibody provided herein. In still further aspects the isolated and/ or recombinant antibody or polypeptide has, has at least, or has at most 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100 or more contiguous amino acids from any of the sequences provided herein or a combination of such sequences.
[0024] In still further aspects, an antibody or polypeptide of the embodiments comprises one or more amino acid segments of the any of the amino acid sequences disclosed herein. For example, the antibody or polypeptide can comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid segments comprising about, at least or at most 5, 6, 7, 8, 9, 10, 1 1, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 to 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 1 1, 112, 113, 1 14, 1 15, 116, 117, 1 18, 1 19, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 5, 146, 147, 148, 149, 150, 151 , 152, 153, 154, 155, 156, 157, 158, 159, 160, 161 , 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177, 178, 179, 180, 181 , 182, 183, 184, 185, 186, 187, 188, 189, 190, 191 , 192, 193, 194, 195, 196, 197, 198, 199 or 200 amino acids in length, including all values and ranges there between, that are at least 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical to any of the amino acid sequences disclosed herein. In certain aspects the amino segment(s) are selected from one of the amino acid sequences of a LGR4-binding antibody as provided in Table 1.
[0025] In still further aspects, an antibody or polypeptide of the embodiments comprises an amino acid segment of the any of the amino acid sequences disclosed herein, wherein the segment begins at amino acid position 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 to 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 112, 1 13, 1 14, 115, 116, 1 17, 1 18, 119, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 5, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161 , 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177, 178, 179, 180, 181 , 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200 in any sequence provided herein and ends at amino acid position 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 to 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 11 , 112, 113, 1 14, 1 15, 116, 117, 1 18, 1 19, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 , 152, 153, 154, 155, 156, 157, 158, 159, 160, 161 , 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200 in the same provided sequence. In certain aspects the amino segment(s), or portions thereof, are selected from one of the amino acid sequences of a LGR4-binding antibody as provided in Table 1.
[0026] In yet further aspects, an antibody or polypeptide of the embodiments comprises an amino acid segment that is at least 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical (or any range derivable therein) to a V, VJ, VDJ, D, DJ, J or CDR domain of a LGR4-binding antibody (as provided in Table 1). For example, a polypeptide may comprise 1 , 2 or 3 amino acid segment that are at least 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical (or any range derivable therein) to CDRs 1 , 2, and/or 3 a LGR4-binding antibody as provided in Table 1.
[0027] Embodiments discussed in the context of methods and/or compositions of the invention may be employed with respect to any other method or composition described herein. Thus, an embodiment pertaining to one method or composition may be applied to other methods and compositions of the invention as well. [0028] As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one.
[0029] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." As used herein "another" may mean at least a second or more.
[0030] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
[0031] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0033] FIG. 1. A schematic diagram illustrating the working principles of ADC (antibody-drug conjugate). Upon binding to its target antigen, the niAb-antigen complex is internalized into endosomes which is then fused with lysosomes where the mAb is degraded and the drug is released.
[0034] FIGS. 2A-2B. LGR4 is highly expressed in primary tumors and cell lines of major epithelial cancers. 2A: RNA-seq data of LGR4 from TCGA are presented by a box and whiskers plot (top and lower bar are max and min values, respectively. The box represents the 95% confidence range of the mean for each tumor type). 2B: Microarray expression data (normalized) of LGR4 in box and whiskers plot. Numbers in each box represent the number of cases/cell lines with expression data . CRC = colorectal adenocarcinoma; LUAD = lung adenocarcinoma; LUSQ = lung squamous cell carcinoma; BrCa = breast cancer; HCC = hepatocellular carcinoma; OvCA = ovarian cancer; RCC = kidney renal clear cell carcinoma; LuCA, lung cancer; KiCA, kidney cancer. All data were downloaded from the cBioportal website (cbioportal.org).
[0035] FIGS. 3A-3F. Identification and characterization of anti-LGR4 mAbs. 3A: Eight mAbs were purified to homogeneity. HC, heavy chain; LC, light chain. 3B: Seven purified rat mAbs gave dose-dependent binding to HEK293 cells stably expressing human LGR4. 3C: mAb 8D2 only detected recombinant LGR4 in WB. The lanes are: 1, HEK293, 2, HEK293-LGR4-mouse, 3, HEK293-LGR4-human, 4, breast cancer cell line BT474, 5, HeLa cells. 3D: ICC of 8D2 bound to LGR4 on the cell surface in HEK293 cells stably expressing LGR4. 3E: Binding of 8D2 to lung cancer cell line A549 cells led to its internalization (left panel), which was competed off by conditioned media containing LGR4-ECD (mid-panel) but not by control conditioned media (right panel). 3F: 8D2 (green) and RSPOl-Fc (red) were co-intemalized in A549 cells.
[0036] FIG. 4. The LGR4-mAb complex is internalized into the lysosome. 8D2 was incubated with SKOV3 cells for 4 hours, fixed, permeabilized, co-stained with anti-rat(red) and anti-LAMPl (green) antibodies, and viewed by confocal microscopy. [0037] FIGS. 5A-5D. LGR4 mAb ADC showed cytotoxic activity in LGR4-high cancer cell lines. 5A: diagram of the 8D2-MC-VC-PAB-MMAE (8D2-MMAE) ADC. 5B- 5D: Dose response curves of 8D2-MMAE and naked 8D2 on the viability of OVCAR3 (B), IGROV1 (C), and SKOV3(D) cells after 4 days of antibody treatment. Cell viability was determined using the CelltiterGlo™ assay. Error bars are S.E.M. (n = 3). [0038] FIG. 6. LGR4 ADC inhibits the growth of xenograft tumors in vivo.
OVCAR3 cells were implanted subcutaneously into nude mice. The animals were dosed with vehicle or the indicated substances every 10 days when tumors reached an average size of ~100 mm3.
[0039] FIG. 7. Binding of anti-LGR4 mAbs 8D2 and 3G6 to LGR4. Serial dilutions of the purified 8D2 and 3G6 were incubated with HEK293 cells overexpressing LGR4, washed, fixed, and incubated with Alexa-488-labeled anti-rat IgG and then washed. Binding was based on amount of fluorescence retained by the cells.
[0040] FIG. 8. Comparison of cytostatic effect of 3G6 and 8D2 in the presence of MMAF-conjugated anti-rat IgG. Serial dilution of 8D2 or 3G6 mixed with MMAF- conjugated anti-rat IgG (ratio = 1 :2) were incubated with the ovarian cancer cell line OVCAR3 cells or HEK293 cells overexpression LGR4 for 4 days. Cell viability was determined using the cell titer glo assays.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS I. Antibodies of the Embodiments
[0041] In certain embodiments, an antibody or a fragment thereof that binds to at least a portion of LGR4 protein and inhibits LGR4 signaling and cancer cell proliferation are contemplated. As used herein, the term "antibody" is intended to refer broadly to any immunologic binding agent, such as IgG, IgM, IgA, IgD, IgE, and genetically modified IgG as well as polypeptides comprising antibody CDR domains that retain antigen binding activity. The antibody may be selected from the group consisting of a chimeric antibody, an affinity matured antibody, a polyclonal antibody, a monoclonal antibody, a humanized antibody, a human antibody, or an antigen-binding antibody fragment or a natural or synthetic ligand. Preferably, the anti-LGR4 antibody is a monoclonal antibody or a humanized antibody.
[0042] Thus, by known means and as described herein, polyclonal or monoclonal antibodies, antibody fragments, and binding domains and CDRs (including engineered forms of any of the foregoing) may be created that are specific to LGR4 protein, one or more of its respective epitopes, or conjugates of any of the foregoing, whether such antigens or epitopes are isolated from natural sources or are synthetic derivatives or variants of the natural compounds.
[0043] Examples of antibody fragments suitable for the present embodiments include, without limitation: (i) the Fab fragment, consisting of VL, VH, CL, and CHI domains; (ii) the "Fd" fragment consisting of the VH and CHI domains; (iii) the "Fv" fragment consisting of the VL and VH domains of a single antibody; (iv) the "dAb" fragment, which consists of a VH domain; (v) isolated CDR regions; (vi) F(ab')2 fragments, a bivalent fragment comprising two linked Fab fragments; (vii) single chain Fv molecules ("scFv"), wherein a VH domain and a VL domain are linked by a peptide linker that allows the two domains to associate to form a binding domain; (viii) bi-specific single chain Fv dimers (see U.S. Pat. No. 5,091,513); and (ix) diabodies, multivalent or multispecific fragments constructed by gene fusion (US Patent App. Pub. 20050214860). Fv, scFv, or diabody molecules may be stabilized by the incorporation of disulphide bridges linking the VH and VL domains. Minibodies comprising a scFv joined to a CH3 domain may also be made (Hu et al, 1996).
[0044] Antibody-like binding peptidomimetics are also contemplated in embodiments. Liu et al. (2003) describe "antibody like binding peptidomimetics" (ABiPs), which are peptides that act as pared-down antibodies and have certain advantages of longer serum half-life as well as less cumbersome synthesis methods.
[0045] Animals may be inoculated with an antigen, such as a LGR4 extracellular domain (ECD) protein, in order to produce antibodies specific for LGR4 protein. The ECD may have 17 leucine-rich repeats and a seven transmembrane (7TM) domain typical of the rhodopsin family of G protein-coupled receptors. GenBank entries include: AF346711, AF346709, AF346710 (Genomic DNA), AAK31153.1 (Translation), BC033039, AAH33039.1 (mRNA and translation) and UniProtKB - Q9BXB1 (LGR4_Human). The LGR4 extracellular domain proteins may include amino acids 25-544, 597-620, 683-703, and 778-783 of UniProtKB Accession No. Q9BXB1. Frequently an antigen is bound or conjugated to another molecule to enhance the immune response. As used herein, a conjugate is any peptide, polypeptide, protein, or non-proteinaceous substance bound to an antigen that is used to elicit an immune response in an animal. Antibodies produced in an animal in response to antigen inoculation comprise a variety of non-identical molecules (polyclonal antibodies) made from a variety of individual antibody producing B lymphocytes. A polyclonal antibody is a mixed population of antibody species, each of which may recognize a different epitope on the same antigen. Given the correct conditions for polyclonal antibody production in an animal, most of the antibodies in the animal's serum will recognize the collective epitopes on the antigenic compound to which the animal has been immunized. This specificity is further enhanced by affinity purification to select only those antibodies that recognize the antigen or epitope of interest.
[0046] A monoclonal antibody is a single species of antibody wherein every antibody molecule recognizes the same epitope because all antibody producing cells are derived from a single B-lymphocyte cell line. The methods for generating monoclonal antibodies (mAbs) generally begin along the same lines as those for preparing polyclonal antibodies. In some embodiments, rodents such as mice and rats are used in generating monoclonal antibodies. In some embodiments, rabbit, sheep, or frog cells are used in generating monoclonal antibodies. The use of rats is well known and may provide certain advantages. Mice (e.g., BALB/c mice) are routinely used and generally give a high percentage of stable fusions.
[0047] Hybridoma technology involves the fusion of a single B lymphocyte from a mouse previously immunized with a LGR4 antigen with an immortal myeloma cell (usually mouse myeloma). This technology provides a method to propagate a single antibody- producing cell for an indefinite number of generations, such that unlimited quantities of structurally identical antibodies having the same antigen or epitope specificity (monoclonal antibodies) may be produced.
[0048] Plasma B cells (CD45+CD5-CD19+) may be isolated from freshly prepared rabbit peripheral blood mononuclear cells of immunized rabbits and further selected for LGR4 binding cells. After enrichment of antibody producing B cells, total RNA may be isolated and cDNA synthesized. DNA sequences of antibody variable regions from both heavy chains and light chains may be amplified, constructed into a phage display Fab expression vector, and transformed into E. coli. LGR4 specific binding Fab may be selected out through multiple rounds enrichment panning and sequenced. Selected LGR4 binding hits may be expressed as full length IgG in rabbit and rabbit/human chimeric forms using a mammalian expression vector system in human embryonic kidney (HEK293) cells (Invitrogen) and purified using a protein G resin with a fast protein liquid chromatography (FPLC) separation unit.
[0049] In one embodiment, the antibody is a chimeric antibody, for example, an antibody comprising antigen binding sequences from a non-human donor grafted to a heterologous non-human, human, or humanized sequence (e.g., framework and/or constant domain sequences). Methods have been developed to replace light and heavy chain constant domains of the monoclonal antibody with analogous domains of human origin, leaving the variable regions of the foreign antibody intact. Alternatively, "fully human" monoclonal antibodies are produced in mice transgenic for human immunoglobulin genes. Methods have also been developed to convert variable domains of monoclonal antibodies to more human form by recombinantly constructing antibody variable domains having both rodent, for example, mouse, and human amino acid sequences. In "humanized" monoclonal antibodies, only the hypervariable CDR is derived from mouse monoclonal antibodies, and the framework and constant regions are derived from human amino acid sequences (see U.S. Pat. Nos. 5,091,513 and 6,881,557). It is thought that replacing amino acid sequences in the antibody that are characteristic of rodents with amino acid sequences found in the corresponding position of human antibodies will reduce the likelihood of adverse immune reaction during therapeutic use. A hybridoma or other cell producing an antibody may also be subject to genetic mutation or other changes, which may or may not alter the binding specificity of antibodies produced by the hybridoma. [0050] Methods for producing polyclonal antibodies in various animal species, as well as for producing monoclonal antibodies of various types, including humanized, chimeric, and fully human, are well known in the art and highly predictable. For example, the following U.S. patents and patent applications provide enabling descriptions of such methods: U.S. Patent Application Nos. 2004/0126828 and 2002/0172677; and U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,196,265; 4,275,149; 4,277,437; 4,366,241; 4,469,797; 4,472,509; 4,606,855; 4,703,003; 4,742,159; 4,767,720; 4,816,567; 4,867,973; 4,938,948; 4,946,778; 5,021,236; 5,164,296; 5,196,066; 5,223,409; 5,403,484; 5,420,253; 5,565,332; 5,571,698; 5,627,052; 5,656,434; 5,770,376; 5,789,208; 5,821,337; 5,844,091; 5,858,657; 5,861,155; 5,871,907; 5,969,108; 6,054,297; 6,165,464; 6,365,157; 6,406,867; 6,709,659; 6,709,873; 6,753,407; 6,814,965; 6,849,259; 6,861,572; 6,875,434; and 6,891,024. All patents, patent application publications, and other publications cited herein and therein are hereby incorporated by reference in the present application.
[0051] Antibodies may be produced from any animal source, including birds and mammals. Preferably, the antibodies are ovine, murine (e.g., mouse and rat), rabbit, goat, guinea pig, camel, horse, or chicken. In addition, newer technology permits the development of and screening for human antibodies from human combinatorial antibody libraries. For example, bacteriophage antibody expression technology allows specific antibodies to be produced in the absence of animal immunization, as described in U.S. Pat. No. 6,946,546, which is incorporated herein by reference. These techniques are further described in: Marks (1992); Stemmer (1994); Gram et al. (1992); Barbas et al. (1994); and Schier et al. (1996).
[0052] It is fully expected that antibodies to LGR4 will have the ability to neutralize or counteract the effects of LGR4 regardless of the animal species, monoclonal cell line, or other source of the antibody. Certain animal species may be less preferable for generating therapeutic antibodies because they may be more likely to cause allergic response due to activation of the complement system through the "Fc" portion of the antibody. However, whole antibodies may be enzymatically digested into "Fc" (complement binding) fragment, and into antibody fragments having the binding domain or CDR. Removal of the Fc portion reduces the likelihood that the antigen antibody fragment will elicit an undesirable immunological response, and thus, antibodies without Fc may be preferential for prophylactic or therapeutic treatments. As described above, antibodies may also be constructed so as to be chimeric or partially or fully human, so as to reduce or eliminate the adverse immunological consequences resulting from administering to an animal an antibody that has been produced in, or has sequences from, other species.
[0053] Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, with or without the loss of other functions or properties. Substitutions may be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Alternatively, substitutions may be non-conservative such that a function or activity of the polypeptide is affected. Non-conservative changes typically involve substituting a residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa.
[0054] Proteins may be recombinant, or synthesized in vitro. Alternatively, a non- recombinant or recombinant protein may be isolated from bacteria. It is also contemplated that a bacteria containing such a variant may be implemented in compositions and methods. Consequently, a protein need not be isolated.
[0055] It is contemplated that in compositions there is between about 0.001 mg and about 10 mg of total polypeptide, peptide, and/or protein per ml. Thus, the concentration of protein in a composition can be about, at least about or at most about 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 mg/ml or more (or any range derivable therein). Of this, about, at least about, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% may be an antibody that binds LGR4.
[0056] An antibody or preferably an immunological portion of an antibody, can be chemically conjugated to, or expressed as, a fusion protein with other proteins. For purposes of this specification and the accompanying claims, all such fused proteins are included in the definition of antibodies or an immunological portion of an antibody.
[0057] Antibody-drug conjugates have emerged as a breakthrough approach to the development of cancer therapeutics. Cancer is one of the leading causes of deaths in the world. Antibody-drug conjugates (ADCs) comprise monoclonal antibodies (mAbs) that are covalently linked to cell-killing drugs (see, e.g., FIG. 1). Thus, embodiments provide antibodies and antibody-like molecules against LGR4, polypeptides and peptides that are linked to at least one agent to form an antibody conjugate or payload. In some aspects, this approach combines the high specificity of mAbs against their antigen targets with highly potent cytotoxic drugs, resulting in "armed" mAbs that deliver the payload (drug) to tumor cells with enriched levels of the antigen (Carter et al , 2008; Teicher 2014; Leal et al, 2014). Targeted delivery of the drug also minimizes its exposure in normal tissues, resulting in decreased toxicity and improved therapeutic index. Such a molecule or moiety may be, but is not limited to, at least one effector or reporter molecule. Effector molecules comprise molecules having a desired activity, e.g., cytotoxic activity. Non-limiting examples of effector molecules that have been attached to antibodies include toxins, therapeutic enzymes, antibiotics, radio-labeled nucleotides and the like. By contrast, a reporter molecule is defined as any moiety that may be detected using an assay. Non-limiting examples of reporter molecules that have been conjugated to antibodies include enzymes, radiolabels, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffinity molecules, colored particles or ligands, such as biotin. [0058] In light of the noted oncogenic association of LGR4 and its broad expression at high levels in many major types of epithelial tumor cells and this added identification of spontaneous internalization, LGR4 presented itself as an excellent target of ADC-based drug development for the treatment of LGR4-high tumors. Indeed, the anti-LGR4 monoclonal antibodies disclosed herein demonstrate that an auristatin-conjugated LGR4 ADC had a strong cytotoxic effect in vitro on multiple LGR4-high cancer cell lines. As exemplified below, novel anti-LGR4 monoclonal antibodies with improved properties can be used to generate LGR4 ADC displaying strong cytotoxic effects on multiple LGR4-expressing human cancer cells, both in vitro and in vivo. [0059] Several methods are known in the art for the attachment or conjugation of an antibody to its conjugate moiety. Some attachment methods involve the use of a metal chelate complex employing, for example, an organic chelating agent such a diethylenetriaminepentaacetic acid anhydride (DTP A); ethylenetriaminetetraacetic acid; N- chloro-p-toluenesulfonamide; and/or tetrachloro-3-6-diphenylglycouril-3 attached to the antibody. Monoclonal antibodies may also be reacted with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with an isothiocyanate.
II. Treatment of Diseases
[0060] Certain aspects of the present embodiments can be used to prevent or treat a disease or disorder associated with LGR4 signaling. Signaling of LGR4 may be reduced by any suitable drugs to prevent cancer cell proliferation. Preferably, such substances would be an anti- LGR4 antibody.
[0061] "Treatment" and "treating" refer to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a treatment may include administration of a pharmaceutically effective amount of an antibody that inhibits the LGR4 signaling.
[0062] "Subject" and "patient" refer to either a human or non-human, such as primates, mammals, and vertebrates. In particular embodiments, the subject is a human. [0063] The term "therapeutic benefit" or "therapeutically effective" as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease. For example, treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis. Treatment of cancer may also refer to prolonging survival of a subject with cancer.
A. Pharmaceutical Preparations
[0064] Where clinical application of a therapeutic composition containing an inhibitory antibody is undertaken, it will generally be beneficial to prepare a pharmaceutical or therapeutic composition appropriate for the intended application. In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein.
[0065] The therapeutic compositions of the present embodiments are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to inj ection may also be prepared. These preparations also may be emulsified.
[0066] The phrases "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal, such as a human, as appropriate. The preparation of a pharmaceutical composition comprising an antibody or additional active ingredient will be known to those of skill in the art in light of the present disclosure. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biological Standards.
[0067] As used herein, "pharmaceutically acceptable carrier" includes any and all aqueous solvents (e.g., water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles, such as sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oil, and injectable organic esters, such as ethyloleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, anti-oxidants, chelating agents, and inert gases), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, fluid and nutrient replenishers, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. The pH and exact concentration of the various components in a pharmaceutical composition are adjusted according to well-known parameters.
[0068] The term "unit dose" or "dosage" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the desired responses discussed above in association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the effect desired. The actual dosage amount of a composition of the present embodiments administered to a patient or subject can be determined by physical and physiological factors, such as body weight, the age, health, and sex of the subject, the type of disease being treated, the extent of disease penetration, previous or concurrent therapeutic interventions, idiopathy of the patient, the route of administration, and the potency, stability, and toxicity of the particular therapeutic substance. For example, a dose may also comprise from about 1 μg/kg/body weight to about 1000 mg/kg/body weight (this such range includes intervening doses) or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 μg/kg/body weight to about 100 mg/kg/body weight, about 5 μg/kg/body weight to about 500 mg/kg/body weight, etc., can be administered. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0069] The active compounds can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, or even intraperitoneal routes. Typically, such compositions can be prepared as either liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and, the preparations can also be emulsified. [0070] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
[0071] The proteinaceous compositions may be formulated into a neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. [0072] A pharmaceutical composition can include a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
B. Combination Treatments
[0073] In certain embodiments, the compositions and methods of the present embodiments involve an antibody or an antibody fragment against LGR4 to inhibit its activity in cancer cell proliferation, in combination with a second or additional therapy. Such therapy can be applied in the treatment of any disease that is associated with LGR4-mediated cell proliferation. For example, the disease may be cancer. [0074] The methods and compositions, including combination therapies, enhance the therapeutic or protective effect, and/or increase the therapeutic effect of another anti-cancer or anti-hyperproliferative therapy. Therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with both an antibody or antibody fragment and a second therapy. A tissue, tumor, or cell can be contacted with one or more compositions or pharmacological formulation(s) comprising one or more of the agents (i.e., antibody or antibody fragment or an anti-cancer agent), or by contacting the tissue, tumor, and/or cell with two or more distinct compositions or formulations, wherein one composition provides 1) an antibody or antibody fragment, 2) an anti-cancer agent, or 3) both an antibody or antibody fragment and an anticancer agent. Also, it is contemplated that such a combination therapy can be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or immunotherapy.
[0075] The terms "contacted" and "exposed," when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing, for example, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
[0076] An inhibitory antibody may be administered before, during, after, or in various combinations relative to an anti-cancer treatment. The administrations may be in intervals ranging from concurrently to minutes to days to weeks. In embodiments where the antibody or antibody fragment is provided to a patient separately from an anti-cancer agent, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the two compounds would still be able to exert an advantageously combined effect on the patient. In such instances, it is contemplated that one may provide a patient with the antibody therapy and the anti-cancer therapy within about 12 to 24 or 72 h of each other and, more particularly, within about 6-12 h of each other. In some situations it may be desirable to extend the time period for treatment significantly where several days (2, 3, 4, 5, 6, or 7) to several weeks (1 , 2, 3, 4, 5, 6, 7, or 8) lapse between respective administrations.
[0077] In certain embodiments, a course of treatment will last 1 -90 days or more (this such range includes intervening days). It is contemplated that one agent may be given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof, and another agent is given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no anti-cancer treatment is administered. This time period may last 1-7 days, and/or 1-5 weeks, and/or 1-12 months or more (this such range includes intervening days), depending on the condition of the patient, such as their prognosis, strength, health, etc. It is expected that the treatment cycles would be repeated as necessary. [0078] Various combinations may be employed. For the example below an antibody therapy is "A" and an anti-cancer therapy is "B":
A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B
B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A
B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
[0079] Administration of any compound or therapy of the present embodiments to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the agents. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. i. Chemotherapy
[0080] A wide variety of chemotherapeutic agents may be used in accordance with the present embodiments. The term "chemotherapy" refers to the use of drugs to treat cancer. A "chemotherapeutic agent" is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis.
[0081] Examples of chemotherapeutic agents include alkylating agents, such as thiotepa and cyclosphosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; aziridines, such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines, including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide, and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB 1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards, such as chlorambucil, chlomaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, and uracil mustard; nitrosureas, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics, such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino- doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; anti-metabolites, such as methotrexate and 5- fluorouracil (5-FU); folic acid analogues, such as denopterin, pteropterin, and trimetrexate; purine analogs, such as fludarabine, 6-mercaptopurine, thiamiprine, and thioguanine; pyrimidine analogs, such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifiuridine, enocitabine, and floxuridine; androgens, such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, and testolactone; anti-adrenals, such as mitotane and trilostane; folic acid replenisher, such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids, such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSKpolysaccharide complex; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; taxoids, e.g., paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes, such as cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids, such as retinoic acid; capecitabine; carboplatin, procarbazine,plicomycin, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, and pharmaceutically acceptable salts, acids, or derivatives of any of the above^ ii. Radiotherapy
[0082] Other factors that cause DNA damage and have been used extensively include what are commonly known as γ-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated, such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287), and UV- irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. iii. Immunotherapy
[0083] The skilled artisan will understand that additional immunotherapies may be used in combination or in conjunction with methods of the embodiments. In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Rituximab (RITUXAN®) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells
[0084] In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present embodiments. Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, laminin receptor, erb B, and pi 55. An altemative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including: cytokines, such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines, such as MIP-1, MCP-1, IL-8, and growth factors, such as FLT3 ligand.
[0085] Examples of immunotherapies currently under investigation or in use are immune adjuvants, e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al, 1998); cytokine therapy, e.g., interferons α, β, and y, IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al, 1998); gene therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al, 1998; Austin-Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945); and monoclonal antibodies, e.g., anti-CD20, anti-ganglioside GM2, and anti-pl 85 (Hollander, 2012; Hanibuchi et al, 1998; U.S. Patent 5,824,311). It is contemplated that one or more anti-cancer therapies may be employed with the antibody therapies described herein. iv. Surgery
[0086] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed and may be used in conjunction with other therapies, such as the treatment of the present embodiments, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy, and/or altemative therapies. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically-controlled surgery (Mohs' surgery). [0087] Upon excision of part or all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection, or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well. v. Other Agents
[0088] It is contemplated that other agents may be used in combination with certain aspects of the present embodiments to improve the therapeutic efficacy of treatment. These additional agents include agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Increases in intercellular signaling by elevating the number of GAP junctions would increase the anti -hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with certain aspects of the present embodiments to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present embodiments. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with certain aspects of the present embodiments to improve the treatment efficacy.
III. Kits and Diagnostics
[0089] In various aspects of the embodiments, a kit is envisioned containing therapeutic agents and/or other therapeutic and delivery agents. In some embodiments, the present embodiments contemplates a kit for preparing and/or administering a therapy of the embodiments. The kit may comprise one or more sealed vials containing any of the pharmaceutical compositions of the present embodiments. The kit may include, for example, at least one LGR4 antibody as well as reagents to prepare, formulate, and/or administer the components of the embodiments or perform one or more steps of the inventive methods. In some embodiments, the kit may also comprise a suitable container, which is a container that will not react with components of the kit, such as an eppendorf tube, an assay plate, a syringe, a bottle, or a tube. The container may be made from sterilizable materials such as plastic or glass.
[0090] The kit may further include an instruction sheet that outlines the procedural steps of the methods set forth herein, and will follow substantially the same procedures as described herein or are known to those of ordinary skill in the art. The instruction information may be in a computer readable media containing machine-readable instructions that, when executed using a computer, cause the display of a real or virtual procedure of delivering a pharmaceutically effective amount of a therapeutic agent.
IV. Examples
[0091] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1 - LGR4 is highly upregulated in many major types of solid tumors
[0092] LGR4 is highly upregulated in colorectal cancer (CRC) and non-small cell lung cancer (NSCLC). Recurrent, gain-of-expression gene fusions of RSP02 (to EIF3E) and RSP03 (PTPRK) occur in a fraction of colorectal and other cancers as a driving mechanism. Recently, the inventors demonstrated that in lung adenocarcinoma (LUAD) gain-of- expression of RSP03 was driven by NRF2 activation instead of gene fusion (Gong, et al, 2014). This aberrant RSP03-LGR4 signaling promotes tumor aggressiveness. Utilizing the RNA-sequence data provided by The Cancer Genome Atlas (TCGA, cancergenome.nih.gov) for a large number cases across multiple types of solid tumors, the expression of LGR4 across the major types of solid tumors was examined and it was confirmed that the receptor is highly expressed in CRC and NSCLC (FIG. 2A). LGR4 was also found to be expressed at similar or even higher levels in hepatocellular carcinoma (HCC), ovarian serous adenocarcinoma (OvCA), and kidney renal cell carcinoma (RCC) (FIG. 2A). Importantly, expression level of LGR4 is also high across cancer cell lines of the same tumor types (FIG. 2B) based on microarray data of gene expression in the CCLE (Cancer Cell Line Encyclopedia) database (Barretina, et al. 2012), indicating that LGR4 is expressed in cancer cells of primary tumors instead of stromal cells.
Example 2 - Anti-LGR4 monoclonal antibodies [0093] Anti-LGR4 monoclonal antibodies were generated under contract by the company Aldevron/Genovac (Aldevron, Fargo, ND, USA, aldevron.com) using DNA-based immunization of rats with a vector containing full-length human LGR4. After a series of steps from antibody purification to characterization, sixteen (16) clones were identified that produced LGR4-binding monoclonal antibodies. To further characterize the monoclonal antibodies, eight clones with the best apparent binding affinity were scaled up and purified using protein G-based affinity chromatography (FIG. 3A). Analysis of their binding affinity using live HEK293 cells stably expressing human LGR4 revealed that the clone 8D2 was the best with Kd = -0.1 μg/ml (0.7 nM) (FIG. 3B). It also binds native mouse receptor with similar affinity (human and mouse LGR4 are 93% identical in the ECD at the amino acid level). With denatured proteins (Western blots), 8D2 detected recombinant LGR4 of human and mouse (lower affinity) origin at the expected size without non-specific binding (FIG. 3C), and it bound to native LGR4 on the cell surface expressed on HEK293 cells (FIG. 3D). Next, the binding of 8D2 to the lung cancer cell line A549 cells which express high levels of LGR4 endogenously was determined. Incubation of 8D2 with live A549 cells at 37 degrees C led to its rapid internalization (FIG. 3E, left panel). Importantly, the internalized signal was completely blocked by conditioned media containing LGR4-ECD but not by control conditioned media (FIG. 3E). Furthermore, internalized 8D2 was totally co-localized the LGR4 ligand RSPOl when 8D2 and RSPOl-Fc were incubated together (FIG. 3F), indicating that 8D2 binds to LGR4 specifically without blocking its ligand binding site. In addition, a specificity cross check analysis showed that none of the 8 monoclonal antibodies bound to LGR5 or LGR6 .
Example 3 - Internalization of LGR4-mAb-8D2
[0094] LGR4-mAb-8D2 complex was co-internalized into lysosome. Current antibody-drug conjugate (ADC) approaches generally require internalization of the antigen- ADC complex into the lysosome where the payload cytotoxin can be released by protease- mediated digestion. Therefore to investigate the potential of LGR4-mAb-8D2 complex for use in ADC, the fate of the mAb 8D2 following incubating with ovarian cancer cell line SKOV3 cells which express high levels of LGR4 (LGR4-high cancer cells) and it was determined that the antibody was completely co-localized with the lysosome marker LAMP1 (FIG. 4), indicating that LGR4 is a suitable target for ADCs that are designed to rely on lysosomal proteases.
Example 4 - In vitro activity of anti LGR4-8D2-MMAE conjugate
[0095] LGR4-mAb-8D2 conjugated to auristatin (8D2-MMAE) inhibits the growth of cancer cell lines. To directly demonstrate that LGR4-targeted ADCs can inhibit the growth of LGR4-high cancer cells, the mAb 8D2 was conjugated with the toxin auristatin through a MC-VC-PAB (maleimidocaproyl-valine-citrulline-p-aminobenzyloxycarbonyl) linker in which the valine-citrulline peptide bond is subject to cleavage by proteases in the lysosome (as described in Doronina et al, 2003, and diagramed in FIG. 5A). Auristatin is a highly potent inhibitor of microtubule assembly and is the payload used in the clinically approved drug ADCETRIS® (brentuximab vedotin). [0096] A549 cells were used to confirm the binding affinity of mAb 8D2 was conjugated with auristatin (8D2-MMAE) to LGR4. A panel of cell lines with high levels of LGR4 that are represent the major types of epithelial cancers expressing LGR4 were used to validate that 8D2-MMAE was high toxic to a series of ovarian cancer cell lines (FIGS. 5B- 5D) [0097] The IC50 for 8D2-MMAE on the cell lines were: OVCAR3, -30 ng/ml;
IGROV1, -300 ng/ml; and SKOV3, 2.4 ug/ml (FIG. 5B-D). In contrast, 8D2 antibody that was not coupled to toxin, showed no effect on the growth of these cells (FIGS. 5B-5D). These results strongly suggest that anti-LGR4 ADCs have particular therapeutic potential for the treatment of ovarian cancer. Example 5 - In vivo activity of 8D2-MMAE
[0098] 8D2-MMAE inhibits the growth of OVCAR3 xenograft tumors in vivo. A pilot study was carried out to test if 8D2-MMAE could inhibit the growth of OVCAR3 xenograft tumor in vivo. Tolerability of 8D2-MMAE was first tested in non-tumor bearing mice and it was found that a single dose of the ADC was well tolerated at 10 mg/kg. OVCAR3 cells were implanted subcutaneously into the dorsal flanks of athymic nude mice and when tumors reached an average size of -100 mm3, 8D2-MMAE, along with vehicle (PBS) and 8D2 control (naked, unconjugated 8D2), were administered by intravenous (IV) injection through the tail vein at 2 mg/kg, once every 10 days. Tumor sizes were measured once per week. As shown in FIG. 6, after treatment with 8D2-MMAE, tumor growth in 2 of the 6 animals was in complete remission.
Example 6 -additional anti-LGR4 mAbs
[0099] Another LGR4 monoclonal antibody (mAb) clone was identified. Additional mAbs in the library were analyzed and it was determined that the clone 3G6 displayed higher affinity (Kd =0.1 ug/ml) than mAb 8D2 (Kd = 0.5 ug/ml) in binding to human LGR4 as is shown in FIG. 7.
[00100] It was determined that 3G6 was more potent than 8D2 in inhibiting cell survival when combined with a secondary ADC. Serial dilutions of the LGR4 monoclonal antibodies 8D2 or 3G6 were mixed with cells and MMAF-conjugated anti-rat IgG (ratio = 1 :2). When tested, 3G6 was more potent in inhibiting the growth of cells with high expression of LGR4. As shown in FIG. 8, 3G6 displayed high potency in reducing the growth of the ovarian cancer cell line OVCAR3 cells and HEK293 cells which overexpress LGR4. This suggests that while both LGR4 monoclonal antibodies have activity, 3G6 may be more effective at targeting tumor cells in vivo, thus increasing patient survival.
V. Sequences
[00101] The Vh and VI sequences of 3G6 and 8D2 clone were amplified by
PCR, cloned, and sequenced. Their DNA and protein sequences are shown below in Table 1.
[00102] Table 1. Anti-LGR4 antibody sequences.
Figure imgf000031_0001
5) 10)
QVQLQQSGAELVKPGASVNLSCKTSGY DIVLTQSPATLSVTPGESVSLSCRASQ TFSTSYMSWFKQIPGQTIEWVGLIYVG DISTSIHWYQQKSNESPRLLIKYASQS AGGPTYNQKFKGKASLTVDTSSSTAYM ISGIPSRFSGGGSGTDFTLTINRVESE DLSSLTAEDSAVYFCARVRGYAMDAWG DFSVYYCQQSYSLPVTFGSGTKLELKR QGTSVTVSS (SEQ ID NO: 1) (SEQ ID NO: 6)
CAGGTCCAGCTGCAGCAATCTGGGGCT GACATTGTGCTCACCCAGTCTCCAGCC GAGTTGGTAAAGCCTGGTGCTTCAGTG ACCCTGTCTGTGACTCCAGGAGAGAGT AATTTGTCCTGCAAGACTTCTGGTTAC GTGAGTCTCTCCTGCAGGGCCAGTCAG ACCTTCAGCACTAGCTACATGAGTTGG GATATTAGCACTAGCATTCATTGGTAT TTCAAGCAGATTCCTGGACAGACTATT CAGCAAAAATCAAATGAGTCTCCAAGG GAGTGGGTTGGACTGATTTATGTTGGA CTTCTCATCAAGTATGCTTCCCAGTCC GCTGGTGGTCCTACCTATAATCAGAAG ATCTCTGGAATCCCCTCCAGGTTCAGT TTCAAGGGCAAGGCCTCACTTACTGTC GGAGGTGGATCAGGGACAGATTTCACT GACACATCTTCCAGCACAGCGTACATG CTCACTATCAACAGAGTCGAATCTGAA GATCTCAGCAGCCTGACAGCTGAGGAC GATTTTTCAGTTTATTACTGTCAACAG TCTGCAGTCTATTTTTGTGCAAGGGTT AGTTACAGCTTGCCCGTCACGTTCGGA CGGGGCTATGCTATGGATGCCTGGGGT TCTGGGACCAAGCTGGAACTGAAACGG CAAGGAACTTCAGTCACCGTCTCCTCA (SEQ ID NO: 7)
(SEQ ID NO: 2)
GYTFTSNF IYPGDGDT SRSNSGYN QNINKN YTN (SEQ YQYRTGWT (SEQ ID (SEQ ID WFAY (SEQ ID ID NO: (SEQ ID NO: 13) NO: 14) (SEQ ID NO: 18) 19) NO: 20)
NO: 15)
QVQLQQSGAELVKPGSSVKISCKASGY DIVLTQSPPVLSASVGDRVTLSCKASQ TFTSNFMHWIKQQPGNGLEWIGWIYPG NINKNLDWYQQKHGEAPKLLIYYTNNL DGDTDYNQKFIGKATLTADKSSSTAYM QTGIPSRFSGSGSGTDYTLTIRSLQPE QLSSLTSEDSAVYFCSRSNSGYNWFAY DVATYYCYQYRTGWTFGGGTKLELKR WGQGTLVTVSS (SEQ ID NO: 11) (SEQ ID NO: 16)
CAGGTTCAGCTGCAGCAGTCTGGGGCT GACATTGTGCTCACCCAGTCTCCTCCA GAACTGGTGAAGCCTGGGTCCTCAGTG GTCCTGTCTGCATCTGTGGGAGACAGA AAAATTTCCTGCAAGGCTTCTGGCTAC GTCACTCTCAGCTGCAAAGCAAGTCAG ACCTTCACCAGTAACTTTATGCACTGG AATATTAATAAGAACTTAGACTGGTAT ATAAAACAGCAGCCTGGAAATGGCCTT CAACAAAAGCATGGAGAAGCTCCAAAA GAGTGGATTGGGTGGATTTATCCTGGA CTCCTGATATATTATACAAACAATTTG GATGGTGATACAGATTACAATCAAAAG CAAACGGGTATCCCATCAAGGTTCAGT TTCATTGGGAAGGCAACACTCACTGCA GGCAGTGGATCTGGTACAGATTACACA GACAAATCCTCCAGCACAGCCTATATG CTCACCATCAGAAGCCTGCAGCCTGAG CAGCTCAGCAGCCTGACATCTGAGGAC GATGTTGCCACATATTACTGCTATCAG TCTGCAGTCTATTTCTGTTCAAGATCG TATAGAACTGGGTGGACCTTCGGTGGA AATTCGGGATACAATTGGTTTGCTTAC GGCACCAAGCTGGAGTTGAAACGG TGGGGCCAAGGCACTCTGGTCACCGTC (SEQ ID NO: 17)
TCCTCA (SEQ ID NO: 12)
* * * [00103] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
U.S. Patent Application Nos. 2004/0126828 and 2002/0172677
U.S. Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,196,265; 4,275,149;
4,277,437; 4,366,241; 4,469,797; 4,472,509; 4,606,855; 4,703,003; 4,742,159;
4,767,720; 4,816,567; 4,867,973; 4,938,948; 4,946,778; 5,021,236; 5,164,296;
5,196,066; 5,223,409; 5,403,484; 5,420,253; 5,565,332; 5,571,698; 5,627,052;
5,656,434; 5,770,376; 5,789,208; 5,821,337; 5,844,091 ; 5,858,657; 5,861,155;
5,871,907; 5,969,108; 6,054,297; 6,165,464; 6,365,157; 6,406,867; 6,709,659;
6,709,873; 6,753,407; 6,814,965; 6,849,259; 6,861,572; 6,875,434; and 6,891,024. Lefranc et al, Methods in molecular biology, 907, 3, 2012.
Haidar et al, Proteins 80, 896, Mar., 2012.
Retter et al, Nucleic Acids Res 33, D671, Jan 1, 2005.
Singer et al, J Immunol 150, 2844, 1993.
Yu et al, PLoS ONE 5, e9072, 2010.
1. Carter, P. J., and Senter, P. D. (2008) Antibody-drug conjugates for cancer therapy, Cancer J 14, 154-169.
2. Teicher, B. A. (2014) Antibody drug conjugates, Current opinion in oncology 26, 476-483.
3. Leal, M., Sapra, P., Hurvitz, S. A., Senter, P., Wahl, A., Schutten, M., Shah, D. K., Haddish-Berhane, N., and Kabbarah, O. (2014) Antibody-drug conjugates: an emerging modality for the treatment of cancer, Ann N Y Acad Sci 1321, 41-54.
4. Senter, P. D. (2009) Potent antibody drug conjugates for cancer therapy, Current opinion in chemical biology 13, 235-244.
5. Teicher, B. A. (2009) Antibody-drug conjugate targets, Current cancer drug targets 9, 982-1004.
6. Bander, N. H. (2013) Antibody-drug conjugate target selection: critical factors, Methods Mol Biol 1045, 29-40. Hsu, S. Y., Kudo, M., Chen, T., Nakabayashi, K, Bhalla, A., van der Spek, P. I, van Duin, M., and Hsueh, A. J. (2000) The three subfamilies of leucine-rich repeat- containing G protein-coupled receptors (LGR): identification of LGR6 and LGR7 and the signaling mechanism for LGR7, Mol Endocrinol 14, 1257-1271.
Carmon, K. S., Gong, X., Lin, Q., Thomas, A., and Liu, Q. (2011) R-spondins function as ligands of the orphan receptors LGR4 and LGR5 to regulate Wnt/beta- catenin signaling, Proc Natl Acad Sci U S A 108, 11452-11457.
de Lau, W., Barker, N., Low, T. Y., Koo, B. K, Li, V. S., Teunissen, H., Kujala, P., Haegebarth, A., Peters, P. J., van de Wetering, M., Stange, D. E., van Es, J. E., Guardavaccaro, D., Schasfoort, R. B., Mohri, Y., Nishimori, K, Mohammed, S., Heck, A. J., and Clevers, H. (2011) Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling, Nature 476, 293-297.
Glinka, A., Dolde, C, Kirsch, N., Huang, Y. L., Kazanskaya, O., Ingelfinger, D., Boutros, M., Cruciat, C. M., and Niehrs, C. (2011) LGR4 and LGR5 are R-spondin receptors mediating Wnt/beta-catenin and Wnt/PCP signalling, EMBO Rep 12, 1055- 1061.
Hao, H. X., Xie, Y., Zhang, Y., Charlat, O., Oster, E., Avello, M., Lei, H., Mickanin, C, Liu, D., Ruffner, H., Mao, X., Ma, Q., Zamponi, R., Bouwmeester, T., Finan, P. M., Kirschner, M. W., Porter, J. A., Serluca, F. C, and Cong, F. (2012) ZNRF3 promotes Wnt receptor turnover in an R-spondin-sensitive manner, Nature 485, 195- 200.
Carmon, K. S., Gong, X., Yi, J., Thomas, A., and Liu, Q. (2014) RSPO-LGR4 functions via IQGAP1 to potentiate Wnt signaling, Proc Natl Acad Sci U S A 111, E1221-1229.
de Lau, W., Peng, W. C, Gros, P., and Clevers, H. (2014) The R-spondin/Lgr5/Rnf43 module: regulator of Wnt signal strength, Genes Dev 28, 305-316.
Gao, Y., Kitagawa, K., Hiramatsu, Y., Kikuchi, H., Isobe, T., Shimada, M., Uchida, C, Hattori, T., Oda, T., Nakayama, K., Nakayama, K. I., Tanaka, T., Konno, H., and Kitagawa, M. (2006) Up-regulation of GPR48 induced by down-regulation of p27Kipl enhances carcinoma cell invasiveness and metastasis, Cancer Res 66, 11623- 11631.
Gugger, M., White, R., Song, S., Waser, B., Cescato, R, Riviere, P., and Reubi, J. C. (2008) GPR87 is an overexpressed G-protein coupled receptor in squamous cell carcinoma of the lung, Dis Markers 24, 41-50. Seshagiri, S., Stawiski, E. W., Durinck, S., Modrusan, Z., Storm, E. E., Conboy, C. B., Chaudhuri, S., Guan, Y., Janakiraman, V., Jaiswal, B. S., Guillory, J., Ha, C, Dijkgraaf, G. J., Stinson, J., Gnad, F., Huntley, M. A., Degenhardt, J. D., Haverty, P. M., Bourgon, R., Wang, W., Koeppen, H., Gentleman, R., Starr, T. K., Zhang, Z., Largaespada, D. A., Wu, T. D., and de Sauvage, F. J. (2012) Recurrent R-spondin fusions in colon cancer, Nature 488, 660-664.
Shinmura, K., Kahyo, T., Kato, H., Igarashi, H., Matsuura, S., Nakamura, S., Kurachi, K., Nakamura, T., Ogawa, H., Funai, K., Tanahashi, M., Niwa, H., and Sugimura, H. (2014) RSPO fusion transcripts in colorectal cancer in Japanese population, Mol Biol Rep.
Gong, X., Yi, J., Carmon, K. S., Crumbley, C. A., Xiong, W., Thomas, A., Fan, X., Guo, S., An, Z., Chang, J. T., and Liu, Q. J. (2014) Aberrant RSP03-LGR4 signaling in Keapl -deficient lung adenocarcinomas promotes tumor aggressiveness, Oncogene. Yi, J., Xiong, W., Gong, X., Bellister, S., Ellis, L. M., and Liu, Q. (2013) Analysis of LGR4 Receptor Distribution in Human and Mouse Tissues, PLoS One 8, e78144. Barretina, J., Caponigro, G, Stransky, N., Venkatesan, K., Margolin, A. A., Kim, S., Wilson, C. J., Lehar, J., Kryukov, G. V., Sonkin, D., Reddy, A., Liu, M., Murray, L., Berger, M. F., Monahan, J. E., Morais, P., Meltzer, J., Korejwa, A., Jane-Valbuena, J., Mapa, F. A., Thibault, J., Bric-Furlong, E., Raman, P., Shipway, A., Engels, I. H., Cheng, J., Yu, G. K., Yu, J., Aspesi, P., Jr., de Silva, M., Jagtap, K., Jones, M. D., Wang, L., Hatton, C, Palescandolo, E., Gupta, S., Mahan, S., Sougnez, C, Onofrio, R. C, Liefeld, T., MacConaill, L., Winckler, W., Reich, M., Li, N., Mesirov, J. P., Gabriel, S. B., Getz, G, Ardlie, K., Chan, V., Myer, V. E., Weber, B. L., Porter, J., Warmuth, M., Finan, P., Harris, J. L., Meyerson, M., Golub, T. R, Morrissey, M. P., Sellers, W. R, Schlegel, R., and Garraway, L. A. (2012) The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity, Nature 483, 603-607.
Austin, C. D., De Maziere, A. M., Pisacane, P. I., van Dijk, S. M., Eigenbrot, C, Sliwkowski, M. X., Klumperman, J., and Scheller, R. H. (2004) Endocytosis and sorting of ErbB2 and the site of action of cancer therapeutics trastuzumab and geldanamycin, Mol Biol Cell 15, 5268-5282.
Erickson, H. K., Park, P. U., Widdison, W. C, Kovtun, Y. V., Garrett, L. M., Hoffman, K., Lutz, R. J., Goldmacher, V. S., and Blattler, W. A. (2006) Antibody- maytansinoid conjugates are activated in targeted cancer cells by lysosomal degradation and linker-dependent intracellular processing, Cancer Res 66, 4426-4433. Doronina, S. O., Toki, B. E., Torgov, M. Y., Mendelsohn, B. A., Cerveny, C. G., Chace, D. F., DeBlanc, R. L., Gearing, R. P., Bovee, T. D., Siegall, C. B., Francisco, J. A., Wahl, A. F., Meyer, D. L., and Senter, P. D. (2003) Development of potent monoclonal antibody auristatin conjugates for cancer therapy, Nat Biotechnol 21, 778-784.

Claims

WHAT IS CLAIMED IS;
1. An isolated monoclonal antibody, wherein the antibody specifically binds to LGR4 and wherein the antibody comprises:
(i)
(a) a first VH CDR is identical to SEQ ID NO: 3;
(b) a second VH CDR is identical to SEQ ID NO: 4;
(c) a third VH CDR is identical to SEQ ID NO: 5;
(d) a first VL CDR is identical to SEQ ID NO: 8;
(e) a second VL CDR is identical to SEQ ID NO: 9; and
(f) a third VL CDR is identical to SEQ ID NO: 10; or
(ii)
(a) a first VH CDR is identical to SEQ ID NO: 13;
(b) a second VH CDR is identical to SEQ ID NO: 14;
(c) a third VH CDR is identical to SEQ ID NO: 15;
(d) a first VL CDR is identical to SEQ ID NO: 18;
(e) a second VL CDR is identical to SEQ ID NO: 19; and
(f) a third VL CDR is identical to SEQ ID NO: 20.
2. The antibody of claim 1, comprising:
(a) a first VH CDR is identical to SEQ ID NO: 3;
(b) a second VH CDR is identical to SEQ ID NO: 4;
(c) a third VH CDR is identical to SEQ ID NO: 5;
(d) a first VL CDR is identical to SEQ ID NO: 8;
(e) a second VL CDR is identical to SEQ ID NO: 9; and
(f) a third VL CDR is identical to SEQ ID NO: 10.
3. The antibody of claim 1, comprising:
(a) a first VH CDR is identical to SEQ ID NO: 13;
(b) a second VH CDR is identical to SEQ ID NO: 14;
(c) a third VH CDR is identical to SEQ ID NO: 15; (d) a first VL CDR is identical to SEQ ID NO: 18;
(e) a second VL CDR is identical to SEQ ID NO: 19; and
(f) a third VL CDR is identical to SEQ ID NO: 20.
4. The antibody of claim 1, wherein the antibody comprises:
(i) a VH domain at least about 80% identical to the VH domain of 8D2 (SEQ ID NO:
I) or the humanized VH domain of 8D2 mAB; and a VL domain at least about 80% identical to the VL domain of 8D2 (SEQ ID NO: 6) or the humanized VL domain of 8D2 mAB; or
(ii) a VH domain at least about 80% identical to the VH domain of 3G6 (SEQ ID NO:
I I) or the humanized VH domain of 3G6 mAB; and a VL domain at least about 80% identical to the VL domain of 3G6 (SEQ ID NO: 16) or the humanized VL domain of 3G6 mAB.
5. The antibody of claim 4, wherein the antibody comprises a VH domain identical to the VH domain of 8D2 (SEQ ID NO: 1) and a VL domain identical to the VL domain of 8D2 (SEQ ID NO: 6).
6. The antibody of claim 4, wherein the antibody comprises a VH domain at least 95% identical to the VH domain of the humanized 8D2 mAB and a VL domain at least 95% identical to the VL domain of the humanized 8D2 mAB.
7. The antibody of claim 6, wherein the antibody comprises a VH domain identical to the VH domain of the humanized 8D2 mAB and a VL domain identical to the VL domain of the humanized 8D2 mAB.
8. The antibody of claim 4, wherein the antibody comprises a VH domain identical to the VH domain of 3G6 (SEQ ID NO: 1 1) and a VL domain identical to the VL domain of 3G6 (SEQ ID NO: 16).
9. The antibody of claim 4, wherein the antibody comprises a VH domain at least 95% identical to the VH domain of the humanized 3G6 mAB and a VL domain at least 95% identical to the VL domain of the humanized 3G6 mAB.
10. The antibody of claim 9, wherein the antibody comprises a VH domain identical to the VH domain of the humanized 3G6 mAB and a VL domain identical to the VL domain of the humanized 3G6 mAB.
11. The antibody of any one of claims 1-10, wherein the antibody is recombinant.
12. The antibody of claim 1, wherein the antibody is an IgG, IgM, IgA or an antigen binding fragment thereof.
13. The antibody of any one of claims 1-10, wherein the antibody is a Fab', a F(ab')2, a F(ab')3, a monovalent scFv, a bivalent scFv, or a single domain antibody.
14. The antibody of any one of claims 1-3, wherein the antibody is a human, humanized antibody or de-immunized antibody.
15. The antibody of any one of claims 1-10, wherein the antibody is conjugated to an imaging agent, a chemotherapeutic agent, a toxin or a radionuclide.
16. The antibody of claim 15, wherein the antibody is conjugated to a toxin.
17. The antibody of claim 16, wherein the toxin is auristatin.
18. The antibody of claim 16, wherein the toxin is monomethyl auristatin E (MMAE).
19. A composition comprising an antibody of any one of claims 1-10 in a pharmaceutically acceptable carrier.
20. An isolated polynucleotide molecule comprising a nucleic acid sequence encoding an antibody of any one of claims 1-10.
21. A recombinant polypeptide comprising an antibody VH domain comprising CDRs 1-3 of the VH domain of 8D2 (SEQ ID NOs: 3, 4, and 5) or CDRs 1-3 of the VH domain of 3G6 (SEQ ID NOs: 13, 14, and 15).
22. A recombinant polypeptide comprising an antibody VL domain comprising CDRs 1-3 of the VL domain of 8D2 (SEQ ID NOs: 8, 9, and 10) or 3G6 (SEQ ID NOs: 18, 19, and 20).
23. An isolated polynucleotide molecule comprising a nucleic acid sequence encoding a polypeptide of claim 21 or 22.
24. A host cell comprising one or more polynucleotide molecule(s) encoding an antibody of any one of claims 1-10 or a recombinant polypeptide of claim 21 or 22.
25. The host cell of claim 24, wherein the host cell is a mammalian cell, a yeast cell, a bacterial cell, a ciliate cell or an insect cell.
26. A method of manufacturing an antibody comprising:
(a) expressing one or more polynucleotide molecule(s) encoding a VL and VH chain of an antibody of any one of claims 1-10 in a cell; and
(b) purifying the antibody from the cell.
27. A method for treating a subject having a cancer comprising administering an effective amount of an antibody of any one of claims 1-10 to the subject.
28. The method of claim 27, wherein the cancer is a breast cancer, lung cancer, head & neck cancer, prostate cancer, esophageal cancer, tracheal cancer, skin cancer brain cancer, liver cancer, bladder cancer, stomach cancer, pancreatic cancer, ovarian cancer, uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal cancer or skin cancer.
29. The method of claim 27, wherein the cancer is an epithelial cancer.
30. The method of claim 27, wherein the cancer is a colorectal adenocarcinoma, lung adenocarcinoma, lung squamous cell carcinoma, breast cancer, hepatocellular carcinoma, ovarian cancer, kidney renal clear cell carcinoma, lung cancer or kidney cancer.
31. The method of claim 27, wherein the antibody is in a pharmaceutically acceptable composition.
32. The method of claim 27, wherein the antibody is administered systemically.
33. The method of claim 27, wherein the antibody is administered intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.
34. The method of claim 27, further comprising administering at least a second anticancer therapy to the subject.
35. The method of claim 34, wherein the second anticancer therapy is a surgical therapy, chemotherapy, radiation therapy, cryotherapy, hormonal therapy, immunotherapy or cytokine therapy.
36. A method for detecting a cancer in a subject comprising testing for the presence of elevated LGR4 relative to a control in a sample from the subject, wherein the testing comprises contacting the sample with an antibody of any one of claims 4-10 or 15.
37. The method of claim 36, further defined as an in vitro method.
PCT/US2016/065788 2015-12-15 2016-12-09 Lgr4 specific monoclonal antibodies and methods of their use Ceased WO2017106034A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/062,386 US10729781B2 (en) 2015-12-15 2016-12-09 LGR4 specific monoclonal antibodies and methods of their use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562267409P 2015-12-15 2015-12-15
US62/267,409 2015-12-15

Publications (1)

Publication Number Publication Date
WO2017106034A1 true WO2017106034A1 (en) 2017-06-22

Family

ID=59057405

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/065788 Ceased WO2017106034A1 (en) 2015-12-15 2016-12-09 Lgr4 specific monoclonal antibodies and methods of their use

Country Status (2)

Country Link
US (1) US10729781B2 (en)
WO (1) WO2017106034A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022166780A1 (en) * 2021-02-03 2022-08-11 中国科学院动物研究所 Monoclonal antibody against human gpr48 and application thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN120058937B (en) * 2025-01-08 2026-01-06 上海交通大学医学院附属瑞金医院 A nanobody NB21 targeting LGR4 and its application in anti-obesity therapy

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006103116A1 (en) * 2005-04-01 2006-10-05 Biotherapix Molecular Medicines S.L.U. Human antibodies with beta-amyloid peptide-binding capacity and their applications
WO2013067057A1 (en) * 2011-11-01 2013-05-10 Bionomics, Inc. Anti-gpr49 antibodies
US20130231465A1 (en) * 2010-05-03 2013-09-05 Reinhard Zeidler Novel antibody to a carbonic anhydrase
WO2015032906A2 (en) * 2013-09-05 2015-03-12 Bionovion Holding B.V. Cd70-binding peptides and method, process and use relating thereto

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006103116A1 (en) * 2005-04-01 2006-10-05 Biotherapix Molecular Medicines S.L.U. Human antibodies with beta-amyloid peptide-binding capacity and their applications
US20130231465A1 (en) * 2010-05-03 2013-09-05 Reinhard Zeidler Novel antibody to a carbonic anhydrase
WO2013067057A1 (en) * 2011-11-01 2013-05-10 Bionomics, Inc. Anti-gpr49 antibodies
WO2015032906A2 (en) * 2013-09-05 2015-03-12 Bionovion Holding B.V. Cd70-binding peptides and method, process and use relating thereto

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022166780A1 (en) * 2021-02-03 2022-08-11 中国科学院动物研究所 Monoclonal antibody against human gpr48 and application thereof

Also Published As

Publication number Publication date
US20180369403A1 (en) 2018-12-27
US10729781B2 (en) 2020-08-04

Similar Documents

Publication Publication Date Title
EP2970494B1 (en) Her3 specific monoclonal antibodies for diagnostic and therapeutic use
JP7358426B2 (en) EGFL6-specific monoclonal antibodies and methods of using them
JP2017534251A (en) Blocking monoclonal antibodies against AGR2 and its receptor C4.4A
US20240299568A1 (en) Bone-specific delivery of polypeptides
US11512141B2 (en) Fibrinogen-like protein 2 (FGL2) monoclonal antibodies and their use in cancer detection and treatment
US10729781B2 (en) LGR4 specific monoclonal antibodies and methods of their use
US10759857B2 (en) JAM-C antibodies and methods for treatment of cancer
US20220363776A1 (en) Methods and pharmaceutical composition for the treatment of ovarian cancer, breast cancer or pancreatic cancer
US20230092390A1 (en) Human 4-1bb agonist antibodies and methods of use thereof
EP4081253A1 (en) Compositions and methods for treating autoimmune diseases and cancers by targeting igsf8
HK1213584B (en) Jam-c antibodies and methods for treatment of cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16876421

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16876421

Country of ref document: EP

Kind code of ref document: A1