WO2017102014A1 - Propenamide thiophene derivatives as flavivirus inhibitors and their use - Google Patents

Propenamide thiophene derivatives as flavivirus inhibitors and their use Download PDF

Info

Publication number
WO2017102014A1
WO2017102014A1 PCT/EP2015/080354 EP2015080354W WO2017102014A1 WO 2017102014 A1 WO2017102014 A1 WO 2017102014A1 EP 2015080354 W EP2015080354 W EP 2015080354W WO 2017102014 A1 WO2017102014 A1 WO 2017102014A1
Authority
WO
WIPO (PCT)
Prior art keywords
prop
compound
enamide
bromothiophen
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2015/080354
Other languages
French (fr)
Inventor
Jean-Claude Guillemot
Karine Barral
Bruno Canard
Gilles Querat
Karine Alvarez
Xavier NICOLAS DE LAMBALLERIE
Florence Mahuteau-Betzer
Cédric POINSARD
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Original Assignee
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aix Marseille Universite, Centre National de la Recherche Scientifique CNRS, Institut National de la Sante et de la Recherche Medicale INSERM, Institut Curie filed Critical Aix Marseille Universite
Priority to PCT/EP2015/080354 priority Critical patent/WO2017102014A1/en
Publication of WO2017102014A1 publication Critical patent/WO2017102014A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/38Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41781,3-Diazoles not condensed 1,3-diazoles and containing further heterocyclic rings, e.g. pilocarpine, nitrofurantoin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4245Oxadiazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/4261,3-Thiazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/472Non-condensed isoquinolines, e.g. papaverine
    • A61K31/4725Non-condensed isoquinolines, e.g. papaverine containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965Non-condensed pyrazines
    • A61K31/497Non-condensed pyrazines containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • A61K31/53771,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D277/00Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
    • C07D277/02Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
    • C07D277/20Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
    • C07D277/22Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • C07D277/30Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D309/00Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings
    • C07D309/02Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
    • C07D309/04Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having no double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D333/00Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/06Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to the ring carbon atoms
    • C07D333/24Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D333/00Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/26Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D333/28Halogen atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D333/00Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/26Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D333/38Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D409/00Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/12Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/12Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D417/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention deals with new f!avivirus inhibitors, compositions comprising said inhibitors and methods for the treatment of viral infections comprising administering said inhibitors.
  • Flavivirus is a genus of viruses of the Flaviviridae family including West Nile virus (WNV), dengue virus (DENV), tick-borne encephalitis virus (TBEV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Kunjin virus (KUNV), Zika virus (Zika) and several other viruses. Flaviviruses share several common aspects: common size (40-65 nm), symmetry (enveloped, icosahedral nucleocapsid), nucleic acid (positive-sense, single- stranded NA of approximately 10,000-11,000 bases), and appearance in the electron microscope. Most of these viruses are transmitted by the bite from an infected arthropod (mosquito or tick). However, among flaviviruses, YFV and DENV, which still require mosquito vectors, are well-enough adapted to humans as to not necessarily depend upon animal hosts (although both continue to have important animal transmission routes as well).
  • DENV in one of the identified serotypes is the cause of dengue fever. It is a mosquito- borne single positive-stranded RNA virus of the Flavivirus genus. All identified serotypes (at least DENV-1 to 4) can cause the full spectrum of disease.
  • the infection by these flaviviruses triggers conditions that represent a major public health issue, such as hemorrhagic fevers or encephalitis for instance.
  • a major public health issue such as hemorrhagic fevers or encephalitis for instance.
  • the flaviviruses such as DENV, KUNV, Zika and WNV
  • the only measures to limit the viruses such as the DENV are to contend the dissemination of the vectors (ticks or mosquitoes).
  • YFV, TBEV and JEV a vaccine already exists, but no antiviral treatment exists.
  • the Applicant has identified new compounds that are able to inhibit the polymerases of at least one flavivirus, in particular of the DENV, especially the DENV NS5 polymerase. Summary of the invention
  • the first object of the present invention is a compound of formula (A):
  • anti- viral agent for use as an anti- viral agent, preferably for use as anti- flavivirus agent, in particular as anti-dengue virus agent.
  • the invention also deals with new compounds of formula (A), and their use as medicines.
  • Another object of the invention is a composition
  • a composition comprising a pharmaceutically acceptable support and at least a compound of formula (A).
  • the present invention relates to a compound of formula (A):
  • - A is independently a C-R2 group or a nitrogen atom
  • - Z is independently a carbon atom or a nitrogen atom with the proviso that when Z is a nitrogen atom, the R4, R5, Re, R7, or Rs group linked to said nitrogen atom is absent, and the number of nitrogen atoms is 1 or 2,
  • - Ri and R2 are chosen independently in the group consisting of:
  • R3 is a hydrogen atom or a CN group
  • two adjacent groups among R4, R5, R5, R7 and Rs may form, together with the carbon atoms to which they are linked, an aryl, a cyclic ketone or a
  • heterocycle preferably a heterocycle of formula
  • R9 is a hydrogen atom or an alkyl group.
  • Each of the hydrogen atoms in formula (A) may be independently replaced with a halogen atom, preferably a fluorine atom.
  • Z is independently a carbon atom or a nitrogen atom, with the proviso that when Z is a nitrogen atom, the number of nitrogen atoms cannot be greater than 2.
  • the phenyl group with the Z groups can comprise 0, 1 or 2 nitrogen atoms at most.
  • the corresponding R4, R5, R0, R7, and Rs groups are such as above defined.
  • the corresponding R4, Rs, Re, R7, and/or Rs group which are linked to said nitrogen atom are absent for sake of covalency. For instance, if Z linked to the 4 group is a nitrogen atom, then R4 is absent. If Z linked to the R5 group is a nitrogen atom, then R5 is absent. If Z linked to the R6 group is a nitrogen atom, then Re is absent. If Z linked to the R7 group is a nitrogen atom, then R 7 is absent. If Z linked to the Rs group is a nitrogen atom, then s is absent.
  • alkyl designates a saturated hydrocarbon group, linear, branched or cyclic, having from 1 to 10, preferably from 1 to 6, more preferably from 1 to 3, carbon atoms, such as methyl, ethyl, n-propyl and isopropyl.
  • Each of the hydrogen atoms of the alkyl groups may be replaced with a fluorine atom; for instance, the alkyl group may be a trifluoromethyl group.
  • aryl designates a hydrocarbonated aromatic cyclic system having between 5 and 12 carbon atoms, and preferably 6 carbon atoms.
  • halogen atom designates a chlorine atom, a bromine atom, an iodine atom or a fluorine atom. Chlorine, bromine and fluorine atoms are preferred.
  • alkoxy designates an alkyl group as defined above, linked to the rest of the molecule via an ether (-0-) bond.
  • the alkoxy group is a trifluoromethoxy group.
  • phenoxy designates a phenyl group linked to the rest of the molecule via an ether (-0-) bond.
  • heterocycle designates a saturated or unsaturated cyclic system having between 5 and 12 atoms, comprising at least one heteroatom, preferably chosen among oxygen, nitrogen, sulphur and phosphorous atoms.
  • the heterocycle comprises 1, 2, 3, 4, 5, or 6 heteroatoms.
  • the heterocycle designates a saturated or unsaturated cyclic system having between 5 and 12 atoms, comprising at least one heteroatom, preferably chosen among oxygen, nitrogen, sulphur and phosphorous atoms.
  • the heterocycle comprises 1, 2, 3, 4, 5, or 6 heteroatoms.
  • the heterocycle comprises 1, 2, 3, 4, 5, or 6 heteroatoms.
  • heterocycle is a pyridine (pyridyl group), of formula o o
  • ketone designates a group of formula alkyl or heterocycle ⁇ wherein alkyl and heterocycle are as defined above.
  • a "cyclic ketone” is a cyclic alkyl group, wherein one of the carbon atoms of the alkyl group is substituted through a double-bond with an oxygen atom. Examples of cyclic ketones are cyclohexanone and cyclopentanone.
  • esters designates a group of formula ° , wherein alkyl is as defined above.
  • amide designates a group of formula or — HN ⁇ alkyl
  • alkyl groups are independently as defined above.
  • the present invention also includes the pharmaceutically acceptable salts of the compounds of formula (A).
  • salts include pharmaceutically acceptable acid addition salts, pharmaceutically acceptable base addition salts, pharmaceutically acceptable metal salts, and ammonium and alkylated ammonium salts.
  • Acid addition salts include salts of inorganic acids as well as organic acids. Representative examples of suitable inorganic acids include hydrochloric, hydrobromic, hydroiodic, phosphoric, sulfuric, nitric acids and the like.
  • suitable organic acids include formic, acetic, trichloroacetic, trifluoroacetic, propionic, benzoic, cinnamic, citric, fumaric, glycolic, lactic, maleic, malic, malonic, mandelic, oxalic, picric, pyruvic, salicylic, succinic, methanesulfonic, ethanesulfonic, tartaric, ascorbic, pamoic, bismethylene salicylic, ethanedisulfonic, gluconic, citraconic, aspartic, stearic, palmitic, EDTA, glycolic, p-aminobenzoic, glutamic, benzenesulfonic, p-toluenesulfonic acids, sulphates, nitrates, phosphates, perchlorates, borates, acetates, benzoates, hydroxynaphthoates, glycerophosphate
  • the salt of the compound of formula (A) is a hydrochloride.
  • a compound of formula (A) as above defined is a compound of formula ( ⁇ ):
  • Ri and R2 are chosen independently in the group consisting of : a hydrogen atom, an alkyl group, a halogen atom, a NO2 group, a pyridyl group, a CN group and an aryl group optionally substituted with at least one halogen atom, CN group, alkyl group and/or alkoxy group.
  • R3 is a hydrogen atom or a CN group.
  • two adjacent groups among R4, R5, 3 ⁇ 4, R7 and Rs may form together with the carbon atoms to which they are linked a cyclic ketone or a
  • heterocycle preferably a heterocycle of formula
  • R9 is a hydrogen atom or an alkyl group
  • - n 0, 1 or 2.
  • the compound of formula ( ⁇ ) is a compound of formula (I):
  • Ri and R2 are chosen independently in the group consisting of : a hydrogen atom, an alkyl group, a halogen atom, a NO2 group, a pyridyl group, a CN group and an aryl group optionally substituted with at least one halogen atom, CN group and/or alkoxy group.
  • R3 is a hydrogen atom or a CN group.
  • two adjacent groups among R4, R5, R5, R7 and Rs may form together with the carbon atoms to which they are linked a heterocycle, preferably
  • Each of the hydrogen atoms in formula (I) may be independently replaced with a halogen atom, preferably a fluorine atom.
  • Ri and R2 are chosen independently in the group consisting of a hydrogen atom, an alkyl group, a halogen atom, a pyridyl group, a NO2 group, and an aryl group optionally substituted with at least one halogen atom.
  • R3 is a hydrogen atom.
  • Ri is different from a hydrogen atom and R 2 is a hydrogen atom.
  • R4 is a hydrogen atom, an alkyl group, a hydroxyl group or an alkoxy group.
  • Re is different from a hydrogen atom.
  • Re is a trifluoromethyl or a trifluoromethoxy group.
  • R7 and Rs are hydrogen atoms.
  • Ri and R2 are chosen independently in the group consisting of a hydrogen atom, a halogen atom, a pyridyl group and an aryl group optionally substituted with at least one halogen atom
  • R4, R5, Re, R7 and Rs are chosen independently in the group consisting of a hydrogen atom, a halogen atom and an alkoxy group.
  • RI is a pyridyl group and R4, Rs, Re, R7 and Rs are chosen independently in the group consisting of a hydrogen atom and a halogen atom.
  • n is 0. In another preferred embodiment, n is 2.
  • the double-bond in a of the thiophene group in formulae (I) and ( ⁇ ) is a is-double bond.
  • a compound of formula (A) as above defined is a compound of formula (A) wherein:
  • Ri and R2 are chosen independently in the group consisting of a hydrogen atom, a halogen atom, an aryl group optionally substituted with at least one halogen atom, and a pyridyl group,
  • R3 is a hydrogen atom
  • R 4 , R5, Re, R7 and Rs are chosen independently in the group consisting of: a hydrogen atom, a halogen atom, an alkoxy group, or a SO2 group, wherein R is an alkyl group,
  • two adjacent groups among R 4 , R5, e, R7 and Rs may form together with the carbon atoms to which they are linked an aryl group.
  • Compound 1 (2£')-N-(2-hydroxy-4-nitrophenyl)-3-(5-nitrothiophen-2-yl)acrylamide, which responds to formulae (A), (I) and ( ⁇ ) according to the invention, has been surprisingly identified to be an inhibitor of the DENV-2 NS5 polymerase in a screening involving more than 16 000 compounds.
  • the anti- viral agent of the invention preferably aims at treating at least one disorder related to a viral infection.
  • the disorder is due to a virus of the flaviviridae family, more preferably a virus of the flavivirus genus.
  • the term "flavivirus” includes preferably DENV, W V, YFV, TBEV, JEV, KU V and Zika.
  • the flavivirus is DENV.
  • the term "dengue virus or DENV” includes at least each of the 4 serotypes DENV-1, DENV-2, DENV-3 and DENV-4. In a specific embodiment, the flavivirus is DENV-2 serotype.
  • treatment comprises a curative treatment as well as a prophylactic treatment of the disorder related to a viral infection, such as a flavivirus infection.
  • a curative treatment is defined as a treatment that eases, improves and/or eliminates, reduces and/or stabilizes at least one of the symptoms of the disorder related to a viral infection, such as a flavivirus infection.
  • a prophylactic treatment comprises a treatment that prevents at least one of the symptoms of the disorder related to a viral infection, such as a flavivirus infection, as well as a treatment that reduces and/or delays at least one of the symptoms of the disorder related to a viral infection, such as a flavivirus infection.
  • the compound of formula (A) or ( ⁇ ) can be chosen for instance in the group consisting of:
  • the compound of formula (A) or ( ⁇ ) is chosen in the group consisting of: compound 1, compound 2, compound 3, compound 6, compound 22, compound 32, compound 38, compound 44, compound 50, compound 56, compound 59, compound 66, compound 68, compound 71, compound 80, compound 86, compound 92, compound 93, compound 94, compound 133, compound 134, compound 135, compound 136, compound 137, and compound 138.
  • the compound of formula (A) or ( ⁇ ) is chosen in the group consisting of: compound 115 and compound 131, preferably it is compound 115.
  • the compound of formula (A) or ( ⁇ ) is chosen in the group consisting of: compound 104, compound 105, compound 58 and compound 112.
  • the compounds of formula (A) have been shown to unexpectedly inhibit the polymerase of at least one flavivirus, preferably of DENV, in particular of DENV-2.
  • Another object of the invention is a method for the treatment of a disorder related to a viral infection, such as a flavivirus infection, in particular an infection by the DENV, comprising administering to a mammal, preferably a human, in need thereof, an efficient amount of a compound of formula (A).
  • a disorder related to a viral infection such as a flavivirus infection, in particular an infection by the DENV
  • Another object of the invention is the use of a compound of formula (A) for the preparation of a medicine for the treatment of a disorder related to a viral infection, such as a flavivirus infection, in particular an infection by the DENV.
  • Another object of the invention is a new compound, selected in the group consisting of: compound 1, compound 2, compound 3, compound 32, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131, compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144
  • Another object of the invention is the use of compound 1, compound 2, compound 3, compound 32, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131, compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144, and/or compound 145 as a medicine.
  • Another object of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising at least one compound selected among compound 1, compound 2, compound 3, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131, compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144, compound 145, and a pharmaceutically acceptable support.
  • compositions according to the invention advantageously comprise one or more pharmaceutically acceptable excipients or vehicles.
  • pharmaceutically acceptable excipients or vehicles examples include saline, physiological, isotonic, buffered solutions and the like, compatible with pharmaceutical use and known to those skilled in the art.
  • the compositions may contain one or more agents or vehicles selected in the group consisting of dispersants, solubilizers, stabilizers, preservatives, and the like.
  • Agents or vehicles that can be used in the formulations are in particular methylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polysorbate 80, mannitol, gelatin, lactose, plant oils, acacia, and the like.
  • compositions may be formulated as suspensions for injection, gels, oils, tablets, suppositories, powders, capsules, gelules, and the like, possibly by means of pharmaceutical forms or devices ensuring prolonged and/or delayed release.
  • an agent such as cellulose, carbonates or starch is advantageously used.
  • the compounds or compositions according to the invention may be administered in various ways and in various forms. Thus, they may be administered by oral or more generally by a systemic route, such as, for example, by intravenous, intramuscular, subcutaneous, transdermal, intra-arterial route, etc. Preferably, the compounds or compositions according to the invention are administered by oral route.
  • the compounds are generally packaged in the form of liquid suspensions, which may be injected via syringes or perfusions, for example.
  • the compounds are generally dissolved in saline, physiological, isotonic or buffered solutions, etc., compatible with pharmaceutical use and known to the person skilled in the art.
  • compositions may contain one or more agents or excipients selected from dispersants, solubilizers, stabilizers, preservatives, etc.
  • Agents or excipients that can be used in liquid and/or injectable formulations are notably methylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polysorbate 80, mannitol, gelatin, lactose, vegetable oils, acacia, etc.
  • the compounds may also be administered in the form of gels, oils, tablets, suppositories, powders, gelatin capsules, capsules, etc., optionally by means of dosage forms or devices that ensure prolonged and/or delayed release.
  • an agent such as cellulose, carbonate or starch is advantageously used.
  • Example 1 Preparation and characterization of compounds according to the invention
  • Preparative flash column chromatographies were performed using silica gel (Merck) G60 230-240 mesh. Analytical thin layer chromatographies were performed on silica gel 60F 254 aluminium plates (Merck) of 0.2 mm thickness. The spots were examined with UV light, Cericdip Sray and Ninhydrine. HPLC was performed on a Thermo Scientific Accela LC systems equipped with a PDA detector. Samples were eluted at a flow rate of 400 ⁇ using a linear gradient 5-100% B in 6 min. Reverse phase (RP) chromatography was carried out on a 2.1 x 100 mm Hypersil GOLD PFP column. Eluant A: water + 0.1% HC0 2 H and eluant B: acetonitrile + 0.1% HCO2H.
  • RP Reverse phase
  • Triethylamine (lOmL) was added to a vigourously stirred mixture of 5-nitro-2- thiophenecarboxyaldehyde (leq, 32mmol), malonic acid (leq, 32mmol) and glacial acetic acid (32mL). The mixture was heated at 70°C for 5h. After cooling, the mixture was concentrated to a half of its volume and then poured into a mixture of 60mL water, 60mL ice and 60mL concentrated hydrochloric acid to yield a solid. The precipitating solid was filtered off, washed with water and dried under pressure to give the corresponding (5-nitro-2- thienyl)methylenemalonic acid.
  • 2-Thiophene carboxyaldehyde derivative (leq, 20mmol) and cyanoacetic acid (1.5eq, 30mmol) were dissolved in dry acetonitrile (250mL). Piperidine (2mL) was added and the mixture was refluxed for 2h. After cooling the solution to 4°C, the mixture was acidified with concentrated hydrochloric acid to yield a precipitate. This precipitate was washed with water and dried under pressure to give the corresponding 3-(2-thienyl)-2-cyanoacrylic acid derivative.
  • 850 mg of terf-butyl iV-[2-(4-propoxyphenyl)ethyl]carbamate 125 was added to 2.24 mL (3eq) of a 4M solution of HC1 in dioxane and the reaction mixture was stirred for 6h. The reaction mixture was concentrated under vacuum and the white solid was triturated in 3x10 mL of heptane, yielding 550 mg of compound 126 after drying.
  • reaction mixture was stirred at room temperature for 5h. The progress of the reaction was monitored by TLC. After completion, the reaction mixture was poured into IN aqueous solution of hydrochloric acid (lOmL).
  • DENV-2 and DENV-3 polymerase plasmid constructs, enzyme preparation and reasents
  • DENV-2 and DENV-3 polymerase domain genes were tagged by six C-terminal Histidine residues and expressed from the pQE30 vector (Quiagen) in E.coli Rosetta pLacI cells (Novagen). The enzyme was produced and purified as previously described (Selisko et al, Virology 2006, 351 , 145-158).
  • RNA template was obtained from Amersham- Pharmacia. Uniformly labeled [ H]GTP (5, 1 Ci/mmol) was purchased from Amersham- Bioscience.
  • Polymerase activity was assayed by monitoring the incorporation of radiolabeled guanosine into a homopolymeric cytosine RNA (Poly rC) template by the purified recombinant DENV RNA-dependent RNA polymerase domain DENV-NS5pol, as previously described (Selisko et al., Virology 2006, 351, 145-158).
  • Poly rC homopolymeric cytosine RNA
  • the Z' factor had an average value of 0.834 with a standard deviation of 0.058 for assay plates indicating that there is a wide separation of data points between the baseline and positive signals. For each compound, the percentage of inhibition was calculated as follows:
  • Inhibition% 100(raw_data_of_compound-avg(pos)/(avg(neg)-avg(pos)).
  • the library was organized in 84 plates (96-wells), each containing 80 compounds.
  • Assay plates contained positive and negative controls distributed in the first and 12 th columns respectively.
  • Our experimental screening consisted of an in vitro nucleotide incorporation assay in which a functionally active recombinant DENV- NS5pol enzyme and a homopolymeric polycytosine template were used. Reactions were conducted in 20 ⁇ xL volume.
  • Positive and negative controls consisted of a reaction mix (50 mM HEPES pH 8.0, 10 mM KCl, 2 mM MnCl 2 , 1 mM MgCl 2 , 10 mM DTT, 100 nM of homopolymeric polycytosine RNA template, 20 nM of DENV-NS5pol) supplemented by 10 ⁇ [ 3 H]-GTP (0.25 ⁇ Ci) and 5 % DMSO or 20 mM EDTA respectively.
  • the enzyme mix was first distributed in plate wells using a BioMek 3000 automate (Beckman).
  • the radioactivity bound to the filter was determined using liquid scintillation counting (Wallac Microbeta ® Trilux). After determining the percentage of inhibition, data were stored and managed using the LIMS software provided by ModulBio (Marseille). Compounds showing 80 % or more reaction inhibition were selected and used to generate new experimental plates. These experimental plates were used for a second screen at a 10 ⁇ final concentration, with the same experimental procedure. Compounds leading to a 80% inhibition or more in the second screen were qualified as hits. Hits were then confirmed on purified freshly solubilized compound and IC50 determined.
  • the compound concentration leading to 50% inhibition of DE V-NS5pol-mediated R A synthesis was determined in the same buffer as for the screen (cf. library screening section). It contains 100 nM of homopolymeric cytosine RNA template, 40 nM of DENV-NS5pol and various concentrations of compound (0 ; 0.1 ; 0.5 ; 1 ; 5 ; 10 ; 50 ⁇ ). Reactions were incubated at 30°C and initiated by the addition of 0.04 mM [ 3 H]-GTP (0.2 ⁇ ). The reaction time course was followed from 0 to 7.5 min and stopped by the addition of EDTA (100 mM final concentration).
  • the compound's concentrations leading to 50% inhibition of DENV2 NS5pol mediated RNA synthesis was determined in IC50 buffer (50 mM HEPES pH 8.0, 10 mM KC1, 2 mM MnCi2, 2 mM MgCb, 10 mM DTT) containing 100 nM of homopolymeric uridine RNA template, 20 nM of DENV2 NS5pol and 7 various concentrations of compound.
  • Five ranges of inhibitor were available (0.01 to 5 ⁇ / 0.1 to 50 ⁇ / 0.5 to 0 ⁇ / 1 to 100 ⁇ / 5 to 400 ⁇ ). According to the inhibitory potency of the compound tested, a range was selected to obtain the more accurate IC50 based on the best repartition of the points surrounding the range.
  • Reactions were conducted in 40 ⁇ 1 ⁇ volume on a 96-well Nunc plate. All experiments were robotized by using a BioMek 3000 automate (Beckman). 2 ⁇ of each diluted compounds in 100% DMSO were added in wells to the chosen concentration (5% DMSO final concentration). For each assay, the enzyme mix was distributed in wells. Reactions were started by the addition of the nucleotide mix (100 ⁇ ATP) and were incubated at 30°C for 10 min. Reaction assays were stopped by the addition of 20 ⁇ EDTA 100 mM.
  • Positive and negative controls consisted respectively of a reaction mix with 5% DMSO final concentration or EDTA 100 mM instead of compounds. Reaction mixes were then transferred to Greiner plate using a Biomek NX automate (Beckman). Picogreen® fluorescent reagent from Molecular probes was diluted to 1/800° in TE buffer according data manufacturer and 60 ⁇ of reagent were distributed into each well of the Greiner plate. The plate was incubated 5 min in the dark at room temperature and the fluorescence signal was then read at 480 nm (excitation) and 530 nm (emission) using a TecanSafire2.
  • Table 1 presents the chemical structure and IC50 values, determined with an enzymatic assay monitored by the incorporation of [ 3 H]-GTP, for a first set of identified DENV-2 polymerase inhibitors.
  • Table 2 presents the chemical structure and the inhibition percentage, determined with an enzymatic assay monitored by the incorporation of [ 3 H]-GTP, for a second set of identified DENV-2 polymerase inhibitors. All compounds of table 2 display an inhibition > 50% at 50 ⁇ . % inhibition
  • Table 2 presents the chemical structure and ICso values determined with a fluorescent assay using PicoGreen ® for a third set of identified DENV-2 polymerase inhibitors.
  • Example 4 Effect of compounds according to the invention on the replication of DENY.
  • the amount of each virus in the assay has been calibrated by trial so that the replication growth is at the end of the growth curve or beginning of the plateau at day 3 or 4, depending of the virus species.
  • Approximate MOI Multiplicity Of Infection ie ratio of infectious virus to target cells
  • strains information is indicated together with strains information in table 4.
  • One day prior to infection 5 X 10 4 Vero E6 cells (or 10 5 HE 293 cells for YFV and TBEV assay) were seeded in 100 ⁇ of medium (with 2.5 % FCS) in each wells of a 96- well titer plates.
  • RNAs were extracted (NucleoSpin 96 virus kit running on an Eppendorf epMotion 5075 liquid handler automat). Washing of the binding plates were done by centrifugation and RNA was eluted in 75 ⁇ of water.
  • Viral RNAs were then quantified by real time RT-PCR to determine viral RNA yield (Superscript III Platinium one-step RT-PCR with Rox from Invitrogen), using 7.5 ⁇ of RNA and 12.5 ⁇ of RT-PCR mix using standard cycling parameters, 20 min at 50 °C, 3 min at 95 °C and 40 cycles of amplification (95 °C 15 sec followed by 60 °C, 1 min). The four control wells were replaced by four 2 log dilutions of an appropriate TV- generated R A standards of known quantities for each serotypes (100 copies to 100 million copies). qRT-PCR reactions were performed on ABI 7900 HT Fast Real-Time PCR System and analyzed using SDS 1.2 Applied Bio-system software.
  • Mean inhibition of virus yield is equal to 100 X (mean quantities of viral RNA in VC quadriplicates - mean quantities of viral RNA in drug treated triplicates) / mean quantities of viral RNA in VC.
  • primers R: Reverse; F: Forward
  • probes P
  • DENV-1 position 1130-1200 of genome (Genebank accession number AF298808); DENV-1-F5: CRAGATGTCCRACACAAGGA (SEQ ID No 1),
  • DENV-1 -P5 FAM-CTGGTGGAAGAACAAG-MGB (SEQ ID No 3).
  • DENV-2 position 845-935 of genome (Genebank accession number AF208496), DENV-2-F2: TGGCAGCAATCCTGGCATA (SEQ ID No 4),
  • DENV-2-R2 GTCATTGAAGGAGCGACAGCT (SEQ ID No 5),
  • DENV-2-P2 Fam-CRATAGGAACGACACATT-MGB (SEQ ID No 6);
  • DENV-2-F2 TGGCAGCAATCYTGGCATA (SEQ ID No 7).
  • DENV-3 position 155 - 216 of genome (Genebank accession number M93130);
  • DENV-3-F2 AACCGTGTGTCAACTGGATCAC (SEQ ID No 8);
  • DENV-3 -R2 TGGCCGTTCARCAATCCT (SEQ ID No 9);
  • DENV-3-P2 Fam TGGCGAAGAGATTC-MGB (SEQ ID No 10).
  • DENV-4 position 787-806 of genome (Genebank accession number AF326573);
  • DENV-4-F3 GCTTGGAAGCATGCTCAGAGA (SEQ ID No 11);
  • DENV-4-P3 807-825 FAM-TAGAGAGCTGGATACTCA-MGB (SEQ ID No 12), DENV-4-R3: 827-843 GCGCGAATCCTGGGTTT (SEQ ID No 13).
  • pan_YFV-F AATCGAGTTGCTAGGCAATAAACAC (SEQ ID No 14);
  • pan_YFV-R TCCCTGAGCTTTACGACCAGA (SEQ ID No 15);
  • pan_YFV-P FAM-ATCGTTCGTTGAGCGATTAGCAG-Tamra (SEQ ID No 16).
  • WNV-Uganda position 8338-8404 of genome (Genebank accession number M12294)
  • WNV-UG-F GCCACGCTTCAGGCAATATC (SEQ ID No 17);
  • WNV-UG-R CCATCCTCCCCAGAAGCAC (SEQ ID No 18);
  • WNV-UG-P Fam-TCCCACTCCGTCAACATGACAAGCCA-Tamra (SEQ ID No 19).
  • JEV position 9897-9942 of genome (Genebank accession number M55506):
  • panJEV-F5 GGCAGGGCKCGCATYTC (SEQ ID No 20);
  • panJEV-R4 AGRCAAGCTGTGTCCTTCACA (SEQ ID No 21),
  • panJEV-P3 FAM-CAGGAGCTGGATGGA-MGB (SEQ ID No 22).
  • TBEV position 8287-8379 of genome (Genebank accession number AB062063): TBEV-F: TGAGGACCCCGTTTTCGA (SEQ ID No 23),
  • TBEV-R TTGATTGGATGTTGACAGAATTCA (SEQ ID No 24)
  • TBEV-P FAM-AACTCAACCCATGAAATGTATTACTCAACCGCT-Tamra (SEQ ID No 25).
  • Zika virus position 9721-9781 of genome (Genbank accession number
  • panZik-F2 AARGACGGGAGRTCCATTGTG (SEQ ID No 26)
  • panZik-R2 GRGCYCGGCCAATCAG (SEQ ID No 27)
  • panZik-P2 FAM-CGCCACCAAGATGA-MGB (SEQ ID No 28)
  • WNV-Uganda, JEV_Laos and TBEV Oshima are reconstituted from infectious molecular clones or PCR overlapping fragments.
  • MOI Multiplicity of infection (ratio of infectious virus per cell at time of infection).
  • Table 5 and table 6 present the effect of compounds according to the invention on the replication of DENV clinical isolates (no: no inhibition, nd: not determined).
  • Example 5 Effect of compounds according to the invention on other flaviviruses.
  • Cells were cultivated for 3 (HEK 293) or 4 (Vero E6, MRC5, HeLa, L929) days after which the supernatant was removed and replaced with 70 ⁇ of medium containing CellTiter-Blue reagent (Promega) and further incubated for 90 mn at 37 ° C. Fluorescence of the plates were then read on a TECAN Infinite M 200 Pro reader. The Cell viabilities in percent were calculated as 100 x (mean value of X- Background without cells)/(CC - background).
  • Table 9 presents cytotoxicity results obtained for compounds according to the invention on Vero E6, HEK 293, MRC-5, HeLa and L929 cell lines.
  • Vero E6 ATCC CRL-1586 Simian embryonic kidney cells epithelial
  • HEK 293 ATCC CRL-1573 Human embryonic kidney cellls, epithelial (tumorigenic in mice)
  • MRC-5 Human normal lung fibroblast (not transformed)
  • HeLa ATCC CCL-21 human cervix epithelial cells (adenocarcinoma)
  • L929 ATCC CCL-1 mouse C3H/An connective tissue fibroblast (tumorigenic)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention deals with new flavivirus inhibitors, compositions comprising said inhibitors and methods for the treatment of disorders related to a viral infection, such as a disease due to a flavivirus infection, comprising administering said inhibitors.

Description

PROPENAMIDE THIOPHENE DERIVATIVES AS FLAVIVIRUS
INHIBITORS AND THEIR USE
The present invention deals with new f!avivirus inhibitors, compositions comprising said inhibitors and methods for the treatment of viral infections comprising administering said inhibitors.
Background of the invention Flavivirus is a genus of viruses of the Flaviviridae family including West Nile virus (WNV), dengue virus (DENV), tick-borne encephalitis virus (TBEV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Kunjin virus (KUNV), Zika virus (Zika) and several other viruses. Flaviviruses share several common aspects: common size (40-65 nm), symmetry (enveloped, icosahedral nucleocapsid), nucleic acid (positive-sense, single- stranded NA of approximately 10,000-11,000 bases), and appearance in the electron microscope. Most of these viruses are transmitted by the bite from an infected arthropod (mosquito or tick). However, among flaviviruses, YFV and DENV, which still require mosquito vectors, are well-enough adapted to humans as to not necessarily depend upon animal hosts (although both continue to have important animal transmission routes as well).
DENV in one of the identified serotypes is the cause of dengue fever. It is a mosquito- borne single positive-stranded RNA virus of the Flavivirus genus. All identified serotypes (at least DENV-1 to 4) can cause the full spectrum of disease.
The infection by these flaviviruses triggers conditions that represent a major public health issue, such as hemorrhagic fevers or encephalitis for instance. For some of the flaviviruses, such as DENV, KUNV, Zika and WNV, there is no available antiviral treatment or vaccine. The only measures to limit the viruses such as the DENV are to contend the dissemination of the vectors (ticks or mosquitoes). For YFV, TBEV and JEV, a vaccine already exists, but no antiviral treatment exists.
In this context, there remains a need for an antiviral treatment for flaviviruses. In the cases where a vaccine exists, an antiviral would nevertheless be useful to contend the expansion of infectious peaks. In this context, the Applicant has identified new compounds that are able to inhibit the polymerases of at least one flavivirus, in particular of the DENV, especially the DENV NS5 polymerase. Summary of the invention
The first object of the present invention is a compound of formula (A):
Figure imgf000003_0001
for use as an anti- viral agent, preferably for use as anti- flavivirus agent, in particular as anti-dengue virus agent.
The invention also deals with new compounds of formula (A), and their use as medicines.
Another object of the invention is a composition comprising a pharmaceutically acceptable support and at least a compound of formula (A).
Detailed description of the invention
The present invention relates to a compound of formula (A):
Figure imgf000003_0002
for use as an anti- viral agent or for use in the treatment of at least one disorder related to a viral infection.
The substituents of formula (A) are defined as follows:
- A is independently a C-R2 group or a nitrogen atom, - Z is independently a carbon atom or a nitrogen atom with the proviso that when Z is a nitrogen atom, the R4, R5, Re, R7, or Rs group linked to said nitrogen atom is absent, and the number of nitrogen atoms is 1 or 2,
- Ri and R2 are chosen independently in the group consisting of:
a hydrogen atom, an alkyl group, a halogen atom, a NO2 group, a pyridyl group, a CN group and an aryl group optionally substituted with at least one halogen atom, CN group, alkyl group and/or alkoxy group,
R3 is a hydrogen atom or a CN group,
R4, R5, Ri, R7 and Rs are chosen independently in the group consisting a hydrogen atom, an alkyl group, a halogen atom, a hydroxyl group, an alkoxy group, a phenoxy group, a NO2 group, a CN group, an O-alkyl-O-alkyl group, a heterocycle, an amine NRaRh group, wherein Ra and Rb are independently a hydrogen atom or an alkyl group, an amide group, a ketone group, an ester group, a NH-C(=0)-alkyl group or a SO2R group, wherein R is a hydrogen atom, an alkyl group, a heterocycle or an amine NRaRb,
alternatively, two adjacent groups among R4, R5, R5, R7 and Rs may form, together with the carbon atoms to which they are linked, an aryl, a cyclic ketone or a
heterocycle, preferably a heterocycle of formula
Figure imgf000004_0001
- R9 is a hydrogen atom or an alkyl group.
- n is 0, 1 or 2,
Each of the hydrogen atoms in formula (A) may be independently replaced with a halogen atom, preferably a fluorine atom.
According to the present invention, Z is independently a carbon atom or a nitrogen atom, with the proviso that when Z is a nitrogen atom, the number of nitrogen atoms cannot be greater than 2. In other terms, the phenyl group with the Z groups can comprise 0, 1 or 2 nitrogen atoms at most.
In the particular embodiment wherein Z is a carbon atom the corresponding R4, R5, R0, R7, and Rs groups are such as above defined. In the particular embodiment wherein Z is a nitrogen atom, the corresponding R4, Rs, Re, R7, and/or Rs group which are linked to said nitrogen atom are absent for sake of covalency. For instance, if Z linked to the 4 group is a nitrogen atom, then R4 is absent. If Z linked to the R5 group is a nitrogen atom, then R5 is absent. If Z linked to the R6 group is a nitrogen atom, then Re is absent. If Z linked to the R7 group is a nitrogen atom, then R7 is absent. If Z linked to the Rs group is a nitrogen atom, then s is absent.
In the present invention, the term "alkyl" designates a saturated hydrocarbon group, linear, branched or cyclic, having from 1 to 10, preferably from 1 to 6, more preferably from 1 to 3, carbon atoms, such as methyl, ethyl, n-propyl and isopropyl. Each of the hydrogen atoms of the alkyl groups may be replaced with a fluorine atom; for instance, the alkyl group may be a trifluoromethyl group.
The term "aryl" designates a hydrocarbonated aromatic cyclic system having between 5 and 12 carbon atoms, and preferably 6 carbon atoms. One can cite, for example, the phenyl group.
The term "halogen atom" designates a chlorine atom, a bromine atom, an iodine atom or a fluorine atom. Chlorine, bromine and fluorine atoms are preferred.
The term "alkoxy" designates an alkyl group as defined above, linked to the rest of the molecule via an ether (-0-) bond. In an embodiment, the alkoxy group is a trifluoromethoxy group.
The term "phenoxy" designates a phenyl group linked to the rest of the molecule via an ether (-0-) bond.
The term "heterocycle" designates a saturated or unsaturated cyclic system having between 5 and 12 atoms, comprising at least one heteroatom, preferably chosen among oxygen, nitrogen, sulphur and phosphorous atoms. In specific embodiments, the heterocycle comprises 1, 2, 3, 4, 5, or 6 heteroatoms. One can cite for example morpholine, imidazole, N-methylimidazole, tetrazole and oxadiazole. In articular, the
heterocycle is a pyridine (pyridyl group), of formula
Figure imgf000005_0001
Figure imgf000005_0002
o o
The term "ketone" designates a group of formula alkyl or heterocycle ^ wherein alkyl and heterocycle are as defined above. A "cyclic ketone" is a cyclic alkyl group, wherein one of the carbon atoms of the alkyl group is substituted through a double-bond with an oxygen atom. Examples of cyclic ketones are cyclohexanone and cyclopentanone.
O
A., alkyl
The term "ester" designates a group of formula ° , wherein alkyl is as defined above.
The term "amide" designates a group of formula
Figure imgf000006_0001
or — HN^alkyl
T
, wherein the alkyl groups are independently as defined above.
The present invention also includes the pharmaceutically acceptable salts of the compounds of formula (A).
When the compounds according to the invention are in the forms of salts, they are preferably pharmaceutically acceptable salts. Such salts include pharmaceutically acceptable acid addition salts, pharmaceutically acceptable base addition salts, pharmaceutically acceptable metal salts, and ammonium and alkylated ammonium salts. Acid addition salts include salts of inorganic acids as well as organic acids. Representative examples of suitable inorganic acids include hydrochloric, hydrobromic, hydroiodic, phosphoric, sulfuric, nitric acids and the like. Representative examples of suitable organic acids include formic, acetic, trichloroacetic, trifluoroacetic, propionic, benzoic, cinnamic, citric, fumaric, glycolic, lactic, maleic, malic, malonic, mandelic, oxalic, picric, pyruvic, salicylic, succinic, methanesulfonic, ethanesulfonic, tartaric, ascorbic, pamoic, bismethylene salicylic, ethanedisulfonic, gluconic, citraconic, aspartic, stearic, palmitic, EDTA, glycolic, p-aminobenzoic, glutamic, benzenesulfonic, p-toluenesulfonic acids, sulphates, nitrates, phosphates, perchlorates, borates, acetates, benzoates, hydroxynaphthoates, glycerophosphates, ketoglutarates and the like. Further examples of pharmaceutically acceptable inorganic or organic acid addition salts include the pharmaceutically acceptable salts listed in J. Pharm. Sci. 1977, 66, 2.
In particular, the salt of the compound of formula (A) is a hydrochloride.
In a first particular embodiment a compound of formula (A) as above defined is a compound of formula (Γ):
Figure imgf000007_0001
Ri and R2 are chosen independently in the group consisting of : a hydrogen atom, an alkyl group, a halogen atom, a NO2 group, a pyridyl group, a CN group and an aryl group optionally substituted with at least one halogen atom, CN group, alkyl group and/or alkoxy group.
- R3 is a hydrogen atom or a CN group.
- R4, Rs, Rs, R7 and Rs are chosen independently in the group consisting of: a hydrogen atom, an alkyl group, a halogen atom, a hydroxyl group, an alkoxy group, a phenoxy group, a NO2 group, a CN group, an alkoxy-O-alkyl group, a heterocycle, an amine NRaRb group, wherein Ra and Rb are independently a hydrogen atom or an alkyl group, an amide group, a ketone group, an ester group, a NH-C(=0)-alkyl group or a SO2R group, wherein R is a hydrogen atom, an alkyl group, a heterocycle or an amine NRaRb,
alternatively, two adjacent groups among R4, R5, ¾, R7 and Rs may form together with the carbon atoms to which they are linked a cyclic ketone or a
Figure imgf000007_0002
heterocycle, preferably a heterocycle of formula
- R9 is a hydrogen atom or an alkyl group,
- n is 0, 1 or 2.
In a more particular embodiment, the compound of formula (Γ) is a compound of formula (I):
Figure imgf000008_0001
wherein:
Ri and R2 are chosen independently in the group consisting of : a hydrogen atom, an alkyl group, a halogen atom, a NO2 group, a pyridyl group, a CN group and an aryl group optionally substituted with at least one halogen atom, CN group and/or alkoxy group.
- R3 is a hydrogen atom or a CN group.
- R4, R5, R6, R7 and Rs are chosen independently in the group consisting of: a hydrogen atom, an alkyl group, a halogen atom, a hydroxyl group, an alkoxy group, a phenoxy group, a NO2 group, a CN group, a heterocycle, an amine NRaRb group, wherein Ra and Rb are independently a hydrogen atom or an alkyl group, an amide group, a ketone group, an ester group, a NH-C(=0)-alkyl group or a SO2R group, wherein R is a hydrogen atom, an alkyl group, a heterocycle or an amine NRaRb,
- alternatively, two adjacent groups among R4, R5, R5, R7 and Rs may form together with the carbon atoms to which they are linked a heterocycle, preferably
a heterocycle of formula
Figure imgf000008_0002
Each of the hydrogen atoms in formula (I) may be independently replaced with a halogen atom, preferably a fluorine atom.
The following preferred embodiments may be applied indifferently to formulae (Γ) and (I) as disclosed above.
In an embodiment, Ri and R2 are chosen independently in the group consisting of a hydrogen atom, an alkyl group, a halogen atom, a pyridyl group, a NO2 group, and an aryl group optionally substituted with at least one halogen atom. In an embodiment, R3 is a hydrogen atom. In an embodiment, Ri is different from a hydrogen atom and R2 is a hydrogen atom.
In specific embodiments of the invention, 0, 1 , 2 or 3 groups among R4, R5, Re, R7 and Rs are different from a hydrogen atom. In an embodiment, R4 is a hydrogen atom, an alkyl group, a hydroxyl group or an alkoxy group. In an embodiment, Re is different from a hydrogen atom. In an embodiment, Re is a trifluoromethyl or a trifluoromethoxy group. In an embodiment, R7 and Rs are hydrogen atoms. In embodiments of the invention, Ri and R2 are chosen independently in the group consisting of a hydrogen atom, a halogen atom, a pyridyl group and an aryl group optionally substituted with at least one halogen atom, and R4, R5, Re, R7 and Rs are chosen independently in the group consisting of a hydrogen atom, a halogen atom and an alkoxy group.
In an embodiment, RI is a pyridyl group and R4, Rs, Re, R7 and Rs are chosen independently in the group consisting of a hydrogen atom and a halogen atom.
In a preferred embodiment, n is 0. In another preferred embodiment, n is 2. The double-bond in a of the thiophene group in formulae (I) and (Γ) is a is-double bond.
In a second particular embodiment, a compound of formula (A) as above defined is a compound of formula (A) wherein:
- Ri and R2 are chosen independently in the group consisting of a hydrogen atom, a halogen atom, an aryl group optionally substituted with at least one halogen atom, and a pyridyl group,
- R3 is a hydrogen atom,
- R9 is a hydrogen atom,
- n is O or l ,
- R4, R5, Re, R7 and Rs are chosen independently in the group consisting of: a hydrogen atom, a halogen atom, an alkoxy group, or a SO2 group, wherein R is an alkyl group,
- alternatively, two adjacent groups among R4, R5, e, R7 and Rs may form together with the carbon atoms to which they are linked an aryl group.
Compound 1 (2£')-N-(2-hydroxy-4-nitrophenyl)-3-(5-nitrothiophen-2-yl)acrylamide, which responds to formulae (A), (I) and (Γ) according to the invention, has been surprisingly identified to be an inhibitor of the DENV-2 NS5 polymerase in a screening involving more than 16 000 compounds.
The anti- viral agent of the invention preferably aims at treating at least one disorder related to a viral infection. Preferably, the disorder is due to a virus of the flaviviridae family, more preferably a virus of the flavivirus genus. The term "flavivirus" includes preferably DENV, W V, YFV, TBEV, JEV, KU V and Zika. Preferably, the flavivirus is DENV. The term "dengue virus or DENV" includes at least each of the 4 serotypes DENV-1, DENV-2, DENV-3 and DENV-4. In a specific embodiment, the flavivirus is DENV-2 serotype.
The term "treatment" comprises a curative treatment as well as a prophylactic treatment of the disorder related to a viral infection, such as a flavivirus infection. A curative treatment is defined as a treatment that eases, improves and/or eliminates, reduces and/or stabilizes at least one of the symptoms of the disorder related to a viral infection, such as a flavivirus infection. A prophylactic treatment comprises a treatment that prevents at least one of the symptoms of the disorder related to a viral infection, such as a flavivirus infection, as well as a treatment that reduces and/or delays at least one of the symptoms of the disorder related to a viral infection, such as a flavivirus infection.
The compound of formula (A) or (Γ) can be chosen for instance in the group consisting of:
(2£')-N-(2-hydroxy-4-nitrophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 1,
(2i?)-3-(5-bromothiophen-2-yl)-N-(3,4-dichlorophenyl)prop-2-enamide 2,
(2£')-N-(3,4-dichlorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 3, (2£')-N-(2-methoxy-4-nitroplienyl)-3-(thioplien-2-yl)prop-2-enamide 4,
(2£)-N-[2-methoxy-5-(morpholine-4-sulfonyl)phenyl]-3-(thiophen-2-yl)prop-2-enamide
5,
(2i?)-N-(2-methoxy-4-nitrophenyl)-3 -(5 -nitrothiophen-2-yl)prop-2-enamide 6,
2£^)-N-(4-cyanophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 7,
(2£^-N-(4-chlorophenyl)-3 -(5 -nitrothiophen-2-yl)prop-2-enamide 8,
l-{4-[(2i?)-3-(5-nitrot iophen-2-yl)prop-2-enamido]p enyl}-lH-imidazol-3-ium chloride 9,
(2£^-N-(4-(acetamido)phenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 10,
(2£')-3-(5-nitrothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 11,
(2£)-3-(5-chlorothiophen-2-yl)-N-[4-(morpholin-4-yl)phenyl]prop-2-enamide 12, (2£')-3-(5-chlorothiophen-2-yl)-N-[2-methoxyphenyl]prop-2-enamide 13,
(2^)-3-(5-chlorothiophen-2-yl)-N-[2-(trifluoromethyl)phenyl]prop-2-enamide 14, (2£)-3-(5-chlorothiophen-2-yl)-N-(3,4,5 rimethoxyphenyl)prop-2-enamide 15,
(2£')-3-(5-chlorothiophen-2-yl)-N-(3-acetamidophenyl)prop-2-enamide 16,
(2^)-3-(5-chlorothiophen-2-yl)-N-[3-(dimethylsulfamoyl)phenyl]prop-2-enamide 17, (2JE)-3-(5-chlorothiophen-2-yl)-N-(4-methanesulfonylphenyl)prop-2-enamide 18,
(2£')-3-(5-chlorothiophen-2-yl)-N-(3-methanesulfonylphenyl)prop-2-enamide 19,
(^^-3-(5-bromothiophen-2-yl)-N-(2-methoxyphenyl)prop-2-enamide 20,
(2£)-3-(5-bromothiophen-2-yl)-N-[3-(dimethylsulfamoyl)-4-methylphenyl]prop-2- enamide 21,
(2^)-3-(5-bromothiophen-2-yl)-N-[4-(lH-l,2,3,4 etrazol-l-yl)phenyl]prop-2-enamide 22,
(2£)-3-(5-bromothiophen-2-yl)-N- {4-[methyl(propan-2-yl)sulfamoyl]phenyl}prop-2- enamide 23,
(2£)-3-(5-bromothiophen-2-yl)-N-(5-methanesulfonyl-2-methylphenyl)prop-2-enamide 24,
(2i?)-3-(5-bromothiophen-2-yl)-N-(4,5-dimethoxy-2-methylphenyl)prop-2-enamide 25, (2£)-3-(5-bromothiophen-2-yl)-N- {4-[(l-methyl-lH-imidazol-2- yl)carbonyl]phenyl}prop-2-enamide 26,
(2£)-N-(4-bromo-2-fluorophenyl)-3 -(5 -bromothiophen-2-yl)prop-2-enamide 27, 3- [(2£)-3-(5-bromothiophen-2-yl)prop-2-enamido]-N-(2,2,2-trifluoroethyl)benzamide 28,
(2£)-3-(5-bromothiophen-2-yl)-N-[4-fluoro-3-(morpholine-4-sulfonyl)phenyl]prop-2- enamide 29,
(2J£')-3-(5-bromothiophen-2-yl)-N-(2-oxo-2,3-dihydro- 1H- 1 ,3-benzodiazol-5-yl)prop-2- enamide 30,
(2i?)-3-(5-bromothiop en-2-yl)-N-(4-acetamidop enyl)prop-2-enamide 31,
(2J£')-3-(5-bromothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 32,
4- [(2£)-3-(5-bromothiophen-2-yl)prop-2-enamido]-N,N-dimethylanilinium chloride 33, Ethyl 4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamido]benzoate 34,
(2J£')-3-(5-bromothiophen-2-yl)-N-[4-(l ,3,4-oxadiazol-2-yl)phenyl]prop-2-enamide 35, (2£')-N-(4-acetylphenyl)-3-(5-bromothiophen-2-yl)prop-2-enamide 36,
(2£')-3-(5-bromothiophen-2-yl)-N-[4-(morpholin-4-yl)phenyl]prop-2-enamide 37, (2J£')-3-(5-bromothiophen-2-yl)-N-(4-cyanophenyl)prop-2-enamide 38,
(2£')-3-(5-bromothiophen-2-yl)-N-(3-chlorophenyl)prop-2-enamide 39,
(2£')-3-(5-bromothiophen-2-yl)-N-[3-(methylsulfonyl)phenyl]prop-2-enamide 40, (2J£')-3-(5-bromothiophen-2-yl)-N-(4-chloro-2-hydroxyphenyl)prop-2-enamide 41, (2£')-3-(5-bromothiophen-2-yl)-N-[4-(trifluoromethyl)phenyl]prop-2-enamide 42, (2£')-3-(5-bromothiophen-2-yl)-N-(3-chloro-4-fluorophenyl)prop-2-enamide 43,
(2J£')-3-(5-bromothiophen-2-yl)-N-(2-methoxy-4-nitrophenyl)prop-2-enamide 44,
(2£,)-3-(5-bromothiophen-2-yl)-N-(2-hydroxy-4-nitrophenyl)prop-2-enamide 45,
(2£')-3-(5-bromothiophen-2-yl)-N-(2-chloro-4-fluorophenyl)prop-2-enamide 46,
4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamide]benzamide 47,
(2¾)-3-(5-bromothiophen-2-yl)-N-(2-chlorophenyl)prop-2-enamide 48,
(2£)-3-(5-bromothiophen-2-yl)-N-(3-nitrophenyl)prop-2-enamide 49,
(2J£,)-N-(2-hydroxy-4-nitrophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 50,
(2£')-N-(2-methoxy-4-nitrophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 51 , (2£)-N-(4-acetamidophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 52,
l-{4-[(2£)-3-(5-phenylthiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 53,
(2i?)-N-(2,4-dimethoxyphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 54,
(2£')-3-(5-phenylthiophen-2-yl)-N-(3-sulfamoylphenyl)prop-2-enamide 55, (2J£,)-3-(5-phenylthiophen-2-yl)-N-(4-propoxyplienyl)prop-2-enamide 56,
(2£)-N-(4-bromo-2-fluorophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 57,
(2E)-N- [4-(methylsulfonyl)phenyl] -3 -(5 -phenylthiophen-2-yl)-prop-2-enamide 58, (2i?)-N-(3-chlorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 59,
(2J£')-N-(2-chloro-4-fluorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 60,
(2E)-N- [3 -(methylsulfonyl)phenyl] -3 -(5 -phenylthiophen-2-yl)prop-2-enamide 61, (2i?)-N-[4-(l ,3,4-oxadiazol-2-yl)p enyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 62, (2£)-N-[4-(morpholin-4-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 63, (2£)-3-(5-phenylthiophen-2-yl)-N-[4-(trifluoromethyl)phenyl]prop-2-enamide 64, Ethyl 4-[(2£')-3-(5-phenylthiophen-2-yl)prop-2-enamido]benzoate 65,
(2J£,)-N-(4-acetylphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 66,
4-[(2£')-3-(5-phenylthiophen-2-yl)prop-2-enamido]benzamide 67,
(2E)-N-(3 -nitrophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 68,
f2£^)-N-(2-methoxyphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 69,
4-[(2£)-3-[5-(2-fluorophenyl)thiophen-2-yl]prop-2-enamido]-N,N-dimethylbenzamide 70,
4-[(2£')-3-[5-(2-fluorophenyl)thiophen-2-yl]prop-2-enamido]benzamide 71,
(2£,)-3-[5-(2-fluorophenyl)thiophen-2-yl]-N-(5-methanesulfonyl-2-methylphenyl)prop- 2-enamide 72,
(2J£')-3-[5-(4-fluoroplienyl)tliiophen-2-yl]-N-(4-methyl-3-sulfamoylphenyl)prop-2- enamide 73,
(2E)-3 - [5-(2-chlorophenyl)thiophen-2-yl] -N-(5 -methanesulfonyl-2-methylphenyl)prop- 2-enamide 74,
(2ii)-3 - [5-(2-chlorophenyl)thiophen-2-yl] -N-(2-fluoro-5 -methanesulfonylphenyl)prop- 2-enamide 75,
(2J£')-3-[5-(2-chlorophenyl)thiophen-2-yl]-N-(3-acetamido-2-methylphenyl)prop-2- enamide 76,
(2i?)-3 - [5-(2-chlorophenyl)thiophen-2-yl] -N-(2-methyl-3 -propanamidophenyl)prop-2- enamide 77,
(2ii)-3 - [5-(4-chlorophenyl)thiophen-2-yl] -N-(5 -methanesulfonyl-2-methylphenyl)prop- 2-enamide 78, (2£)-3-[5-(4-chlorophenyl)thiophen-2-yl]-N-(4-acetamido-3-methylphenyl)prop-2- enamide 79,
(2E)-3 - [5-(4-chlorophenyl)thiophen-2-yl] -N-(2-methyl-3 -propanamidophenyl)prop-2- enamide 80,
(2£)-2-cyano-3-(5-methylthiophen-2-yl)-N-[4-(morpholin-4-yl)phenyl]prop-2-enamide 81,
(2i?)-2-cyano-N-[4-(morpholin-4-yl)phenyl]-3-(5-nitrothiophen-2-yl)prop-2-enamide 82,
(2£,)-2-cyano-3-(5-nitrothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 83,
(2£ )-2-cyano-N-(4-acetamidophenyl)-3 -(5 -nitrothiophen-2-yl)prop-2-enamide 84, (2J£,)-2-cyano-3-(5-nitrothiophen-2-yl)-N-[4-(l ,3,4-oxadiazol-2-yl)phenyl]prop-2- enamide 85,
(2£')-3-(5-bromothiophen-2-yl)-2-cyano-N-(2-ethoxyphenyl)prop-2-enamide 86, (2J£')-3-(5-bromothiophen-2-yl)-2-cyano-N-(2-methoxyphenyl)prop-2-enamide 87, (2£')-3-(5-bromothiophen-2-yl)-2-cyano-N-(4-propoxyphenyl)prop-2-enamide 88, (2^)-3-(5-bromothiophen-2-yl)-2-cyano-N-(4-acetamidophenyl)prop-2-enamide 89, (2E)-3 -(5-bromothiophen-2-yl)-2-cyano-N- [4-( 1 ,3 ,4-oxadiazo l-2-yl)phenyl]prop-2- enamide 90,
(2£,)-3-(4-bromothiophen-2-yl)-N-(3-chloro-4-fluorophenyl)-2-cyanoprop-2-enamide 91,
(2£)-2-cyano-N-[4-(morpholin-4-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 92,
(2J£')-2-cyano-3-(5-phenyltliiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 93, (2ii)-2-cyano-N-(4-acetamidophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 94, (2£')-2-cyano-N-[4-(l ,3,4-oxadiazol-2-yl)phenyl]-3-(5-phenyltliiophen-2-yl)prop-2- enamide 95,
(2£')-2-cyano-3-[5-(4-fluorophenyl)thiophen-2-yl]-N-(2-methoxyphenyl)prop-2- enamide 96,
(2E) N-(2-methoxy-4-nitrophenyl)-3 -(5 -methylthiophen-2-yl)prop-2-enamide 97, (2£')-N-(2-hydroxy-4-mtrophenyl)-3-(5-methylthiophen-2-yl)prop-2-enamide 98, l-{4-[(2ii)-3-(5-bromothiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 99, (2£,)-3-(5-bromothiophen-2-yl)-N-(4-chloroplienyl)prop-2-enamide 100,
(2£)-3-(4-bromothiophen-2-yl)-N-(2-methoxy-4-nitrophenyl)prop-2-enamide 101, (2E)-3 -(4-bromothiophen-2-yl)-N-(2-hydroxy-4-nitrophenyl)prop-2-enamide 102, (2i?)-N-(4-cyanop enyl)-3-(5-phenylthiophen-2-yl)-prop-2-enamide 103,
(2E)-N-(3 -chloro-4-propoxyphenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 104, (2£,)-N-(3,4-dichlorophenyl)-3-[5-(pyridin-2-yl)thiophen-2-yl]prop-2-enamide 105, (2£)-N-(3 -chloro-4-propoxyphenyl)-3 - [5 -(2-ethylp enyl)thiophen-2-yl]prop-2-enamide 106,
(2£^-3-(5-bromothiophen-2-yl)-N-(3-chloro-4-propoxyphenyl)prop-2-enamide 107, (2£')-3-(5-bromothiophen-2-yl)-N-(5-oxo-5,6,7,8-tetrahydronaphthalen-2-yl)prop-2- enamide 108,
(2£)-3-(5-bromothiophen-2-yl)-N-[4-(trifluoromethoxy)phenyl]prop-2-enamide 109, (2£')-3-(5-bromothiophen-2-yl)-N-(4-butoxyphenyl)prop-2-enamide 110,
(2E)-3 -(5-bromothiophen-2-yl)-N- [4-(propan-2-yloxy)phenyl]prop-2-enamide 111, (2£')-3-[5-(2-chlorophenyl)thiophen-2-yl]-N-(4-propoxyphenyl)prop-2-enamide 112, (2£')-N-(3-cyanophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 113,
(2J£')-3-[5-(3-chlorophenyl)thiophen-2-yl]-N-(4-propoxyphenyl)prop-2-enamide 114, (2£)-N-ethyl-N-(3-methanesulfonylphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 115,
(2J£')-3-(5-bromothiophen-2-yl)-N-(4-phenoxyphenyl)prop-2-enamide 116,
(2E)-N-(3 -bromophenyl)-3 -(5 -bromothiophen-2-yl)prop-2-enamide 117,
(2£')-3-(5-bromothiophen-2-yl)-N-(4-ethoxyphenyl)prop-2-enamide 118,
(2E)-N-(3 ,4-dichlorophenyl)-3 - [5 -(4-methoxyphenyl)thiophen-2-yl]prop-2-enamide 119,
(2£')-3-(4-phenylthiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 120,
(2£)-3-[5-(3-cyanophenyl)thiophen-2-yl]-N-(3,4-dichlorophenyl)prop-2-enamide 121, (2£')-3-(5-bromothiophen-2-yl)-N-[4-(2-methoxyethoxy)phenyl]prop-2-enamide 122, (2i?)-3-(5-bromothiophen-2-yl)-N-(l-oxo-2,3-dihydro-lH-inden-5-yl)prop-2-enamide 123,
(2£')-3-(5-cyanothiophen-2-yl)-N-(3,4-dichlorophenyl)prop-2-enamide 124,
4-[(2i?)-3-(5-bromothiophen-2-yl)prop-2-enamido]-N-methylbenzamide 125,
(2J£')-3-(5-cyanothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 126, (2E)-N- 3 ,4-dichlorophenyl)-3 - [ -(2-methoxyphenyl)thiophen-2-yl]prop-2-enamide 127,
(2£')-3-(5-bromothiophen-2-yl)-N-(4-methoxyphenyl)prop-2-enamide 128,
(2i?)-N-(3,4-dichlorophenyl)-3-[5-(p ridin-3-yl)thioprien-2-yl]prop-2-enamide 129, (2J£,)-3-(5-bromothiophen-2-yl)-N-[3-chloro-4-(2-methoxyethoxy)phenyl]prop-2- enamide 130,
(2E)-3 -(5-bromothiophen-2-yl)-N- [2-(4-propoxyphenyl)ethyl]prop-2-enamide 131,
(2£)-3-(5-bromothiophen-2-yl)-N-[3-chloro-4-(morpholin-4-yl)phenyl]prop-2-enamide
132,
(2£)-3-(2 -phenyl- l ,3-thiazol-5-yl)-N-(4-propox phenyl)prop-2-enamide 133,
(2E)-N-(5 -propoxypyridin-2-yl)-3 - [2-(pyridin-2-yl)- 1 ,3-thiazol-5 -yl]prop-2-enamide 134,
(2E)-N-(5 -propoxypyridin-2-yl)-3 - [2-(pyridin-2-yl)- 1 ,3-thiazol-5 -yl]prop-2-enamide hydrochloride 134-HCl,
(2£')-3-(5-bromothiophen-2-yl)-N-(5-propoxypyridin-2-yl)prop-2-enamide 135,
(2J£')-3-(5-bromothiophen-2-yl)-N-(6-chloropyridin-2-yl)prop-2-enamide 136,
(2E)-3 -(2 -phenyl- 1 ,3-thiazol-5-yl)-N-[(4-propoxyphenyl)methyl]prop-2-enamide 137, (2E)-3 -(2 -phenyl- 1 ,3-thiazol-5-yl)-N-(5-propoxypyridin-2-yl)prop-2-enamide 138, (2i?)-N-(3-methanesulfonylphenyl)-3-(2-phenyl-l ,3-thiazol-5-yl)prop-2-enamide 139, (2£')-3-(5-bromothiophen-2-yl)-N-(6-chloropyrazin-2-yl)prop-2-enamide 140,
(2£')-N-(3-chloro-4-propoxyphenyl)-3-(2-phenyl-l ,3-thiazol-5-yl)prop-2-enamide 141, (2^)-3-(5-bromothiophen-2-yl)-N-(2-propoxyp3T-imidin-5-yl)prop-2-enamide 142, (2J£')-3-(5-bromothiophen-2-yl)-N-(quinolin-3-yl)prop-2-enamide 143,
(2i?)-3-(5-bromothiophen-2-yl)-N-(isoquinolin-4-yl)prop-2-enamide 144, and
(2i?)-3-(5-bromothiophen-2-yl)-N-(6-propoxypyridin-3-yl)prop-2-enamide 145.
In a specific embodiment, the compound of formula (A) or (Γ) is chosen in the group consisting of: compound 1, compound 2, compound 3, compound 6, compound 22, compound 32, compound 38, compound 44, compound 50, compound 56, compound 59, compound 66, compound 68, compound 71, compound 80, compound 86, compound 92, compound 93, compound 94, compound 133, compound 134, compound 135, compound 136, compound 137, and compound 138. In another specific embodiment, the compound of formula (A) or (Γ) is chosen in the group consisting of: compound 115 and compound 131, preferably it is compound 115. In another specific embodiment, the compound of formula (A) or (Γ) is chosen in the group consisting of: compound 104, compound 105, compound 58 and compound 112.
The compounds of formula (A) have been shown to unexpectedly inhibit the polymerase of at least one flavivirus, preferably of DENV, in particular of DENV-2.
Another object of the invention is a method for the treatment of a disorder related to a viral infection, such as a flavivirus infection, in particular an infection by the DENV, comprising administering to a mammal, preferably a human, in need thereof, an efficient amount of a compound of formula (A).
Another object of the invention is the use of a compound of formula (A) for the preparation of a medicine for the treatment of a disorder related to a viral infection, such as a flavivirus infection, in particular an infection by the DENV. Another object of the invention is a new compound, selected in the group consisting of: compound 1, compound 2, compound 3, compound 32, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131, compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144, and compound 145. In an embodiment, the compound is selected from the group consisting of compound 104, compound 105 and compound 112.
Another object of the invention is the use of compound 1, compound 2, compound 3, compound 32, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131, compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144, and/or compound 145 as a medicine.
Another object of the invention is a pharmaceutical composition comprising at least one compound selected among compound 1, compound 2, compound 3, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131, compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144, compound 145, and a pharmaceutically acceptable support.
The pharmaceutical compositions according to the invention advantageously comprise one or more pharmaceutically acceptable excipients or vehicles. Examples include saline, physiological, isotonic, buffered solutions and the like, compatible with pharmaceutical use and known to those skilled in the art. The compositions may contain one or more agents or vehicles selected in the group consisting of dispersants, solubilizers, stabilizers, preservatives, and the like. Agents or vehicles that can be used in the formulations (liquid and/or injectable and/or solid) are in particular methylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polysorbate 80, mannitol, gelatin, lactose, plant oils, acacia, and the like. The compositions may be formulated as suspensions for injection, gels, oils, tablets, suppositories, powders, capsules, gelules, and the like, possibly by means of pharmaceutical forms or devices ensuring prolonged and/or delayed release. For this type of formulation, an agent such as cellulose, carbonates or starch is advantageously used.
The compounds or compositions according to the invention may be administered in various ways and in various forms. Thus, they may be administered by oral or more generally by a systemic route, such as, for example, by intravenous, intramuscular, subcutaneous, transdermal, intra-arterial route, etc. Preferably, the compounds or compositions according to the invention are administered by oral route. For injections, the compounds are generally packaged in the form of liquid suspensions, which may be injected via syringes or perfusions, for example. In this respect, the compounds are generally dissolved in saline, physiological, isotonic or buffered solutions, etc., compatible with pharmaceutical use and known to the person skilled in the art. Thus, the compositions may contain one or more agents or excipients selected from dispersants, solubilizers, stabilizers, preservatives, etc. Agents or excipients that can be used in liquid and/or injectable formulations are notably methylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polysorbate 80, mannitol, gelatin, lactose, vegetable oils, acacia, etc.
The compounds may also be administered in the form of gels, oils, tablets, suppositories, powders, gelatin capsules, capsules, etc., optionally by means of dosage forms or devices that ensure prolonged and/or delayed release. For this type of formulation, an agent such as cellulose, carbonate or starch is advantageously used. Other aspects and advantages of the present invention will become apparent upon consideration of the following examples, which must be regarded as illustrative and nonrestrictive. Examples
Example 1 : Preparation and characterization of compounds according to the invention
General methods
The ¾ NMR and 13C NMR spectra were determined with a BRU ER AMX 250 MHz. Chemical shifts are expressed in ppm and coupling constants (J) are in hertz (s = singlet, bs = broad singlet, d = doublet, bd = broad doublet, dd = double doublet, ddd = double double doublet, t = triplet, bt = broad triplet, dt = double triplet, td = triple doublet, q = quadruplet, hetp = heptuplet, m = multiplet). ESI Mass Spectra were obtained on a Thermo Scientific MSQ™ Plus mass spectrometer. Preparative flash column chromatographies were performed using silica gel (Merck) G60 230-240 mesh. Analytical thin layer chromatographies were performed on silica gel 60F 254 aluminium plates (Merck) of 0.2 mm thickness. The spots were examined with UV light, Cericdip Sray and Ninhydrine. HPLC was performed on a Thermo Scientific Accela LC systems equipped with a PDA detector. Samples were eluted at a flow rate of 400 μυπύη using a linear gradient 5-100% B in 6 min. Reverse phase (RP) chromatography was carried out on a 2.1 x 100 mm Hypersil GOLD PFP column. Eluant A: water + 0.1% HC02H and eluant B: acetonitrile + 0.1% HCO2H.
General procedure
Figure imgf000020_0001
(a) malonic acid, pyridine, piperidine, reflux, 2h; or (b) malonic acid, Et3N, acetic acid, 70°C, 5h then acetic anhydride, reflux, 15min; or (c) cyanoacetic acid, piperidine, dry CH3CN, reflux, 2h; (d) aniline derivatives, DMAP, EDCI, dry DCM, rt, 5h; or (e) SOC12, dry toluene, reflux, 2h then aniline derivatives, pyridine, dry DCM, rt, 16h. Synthesis of 3-(2-thienyl)acrylic acid derivatives and (2£)-3-(2-phenyl-l,3-thiazol-5- yl)prop-2-enoic acid 16 (Intermediates 11-17)
Figure imgf000021_0001
(a) malonic acid, pyridine, piperidine, reflux, 2h; or
(b) malonic acid, Et3N, acetic acid, 70°C, 5h then acetic anhydride, reflux, 15min.
Procedure A
2- Thiophenecarboxyaldehyde derivative or 2-phenyl-l,3-thiazole-5-carbaldehyde (leq, 30mmol) was dissolved in pyridine (60mL) and piperidine (3mL). After addition of malonic acid (1.2eq, 36mmol), the mixture was refluxed for 2h. After cooling, the mixture was poured into a mixture of 200mL water, 200mL ice and 200mL concentrated hydrochloric acid to yield a solid. The precipitating solid was filtered off, washed with water and dried under pressure to give the corresponding 3-(2-thienyl)acrylic acid derivative.
3- (5-bromo-2-thienyl)acrylic acid II
LH NMR (DMSO-<i<5, 250 MHz): δ = 6.20 (d, 7 = 15.7 Hz, 1H), 7.32 (d, 7 = 3.9 Hz, 1H), 7.40 (d, 7= 3.9 Hz, 1H), 7.71 (d, 7= 15.7 Hz, 1H), 12.47 (bs, 1H); 13C NMR (DMSO-76, 62 MHz): δ = 114.96, 118.16, 131.72, 132.72, 135.80, 140.73, 167.07 ; LC/MS (ESI): 230.87 [M-H]" and isotopic peak 232.88 ; HRMS (FAB) cald for C7H402SBr (M+H)+ 230.9115, found 230.9131 ; purity > 99% ; beige powder. Yield = 72%.
3-(5-phenyl-2-thienyl)acrylic acid 12
[H NMR (DMSO-i¾, 250 MHz): δ = 6.03 (d, J = 15.7 Hz, 1H), 7.17-7.35 (m, 3H), 7.36-7.43 (m, 2H), 7.50-7.63 (m, 3H), 12.16 (bs, 1H); 13C NMR (DMSO-c¾, 62 MHz): δ = 117 .29, 124.89, 125.57, 126.19, 128.50, 129.22, 129.36, 132.90, 133.45, 136.66, 138.10, 146.11, 167.24 ; LC/MS (ESI): 228.96 [M-H]" and 231.10 [M-H]+ ; HRMS (FAB) cald for C13H11O2S (M+H)+ 231.0480, found 231.0486; purity > 99% ; slight yellow powder. Yield = 94%.
3-(5-methyl-2-thienyl)acrylic acid 13
LH NMR (DMSO-c¾, 250 MHz): δ = 2.27 (s, 3H), 6.05 (d, 7 = 15.7 Hz, 1H), 6.83 (dd, 7 = 1.1 Hz and 3.6 Hz, 1H), 7.30 (d, 7 = 3.6 Hz, 1H), 7.63 (d, 7 = 15.6 Hz, 1H), 12.28 (bs, 1H); 13C NMR (DMSO-£¾ 62 MHz): δ = 15.34, 116.06, 126.97, 132.28, 136.86, 136.99, 143.57, 167.30 ; LC/MS (ESI): 169.10 [M+H]+, 167.10 [M-H]"; purity =90% ; pale yellow powder. Yield = 72%. 3-(4-bromo-2-thienyl)acrylic acid 14
LH NMR (OMSO-d6, 250 MHz): δ = 6.25 (d, J = 15.8 Hz, 1H), 7.58 (s, 1H), 7.66 (d, J = 15.8 Hz, 1H), 7.82 (s, 1H), 12.51 (bs, 1H); 13C NMR (DMSO-i½, 62 MHz): δ = 109.91, 119.00, 126.54, 132.57, 135.32, 140.16, 166.93; LC/MS (ESI): 230.89 [M-H]" and isotopic peak 232.89; purity = 95% ; pale grey powder. Yield = 14%.
3-(4-phenyl-2-thienyl)acrylic acid 15
LC/MS (ESI): 228.92 [M-H]" ; purity 97% ; brown powder. Yield = 81%.
(2E)-3-(2-phenyl-l,3-(2E)-3-(2-phenyl-l,3-thiazol-5-yl)prop-2-enoic acid 16
Eisenmann et al, ChemMedChem. 2009, 4(5), 809-819.
Procedure B
Triethylamine (lOmL) was added to a vigourously stirred mixture of 5-nitro-2- thiophenecarboxyaldehyde (leq, 32mmol), malonic acid (leq, 32mmol) and glacial acetic acid (32mL). The mixture was heated at 70°C for 5h. After cooling, the mixture was concentrated to a half of its volume and then poured into a mixture of 60mL water, 60mL ice and 60mL concentrated hydrochloric acid to yield a solid. The precipitating solid was filtered off, washed with water and dried under pressure to give the corresponding (5-nitro-2- thienyl)methylenemalonic acid. (5-Nitro-2-thienyl)methylenemalonic acid (5.4g, 22mmol) was suspended in acetic anhydride (4.1mL) and the mixture was refluxed for 15min. After cooling, the mixture was poured into a mixture of 12mL water, 12mL ice and 12mL concentrated hydrochloric acid to yield a solid. The precipitating solid was filtered off, washed with water and diethylether then dried under pressure to afford 3-(5-nitro-2-thienyl)acrylic acid as a slight brown powder (2.97g, 47%).
3-(5-nitro-2-thienyl)acrylic acid 17
LH NMR DMSO-d6, 250 MHz): δ = 6.70 (d, J = 16.0 Hz, 1H), 7.75 (d, J = 4.0 Hz, 1H), 7.85 (d, J= 16.0 Hz, 1H), 8.20 (d, J= 16.0 Hz, 1H), 12.52 (bs, 1H); 13C NMR (DMSO-<i<5, 62 MHz): δ = 121.46, 128.42, 128.80, 133.26, 144.15, 149.61, 164.84 ; LC/MS (ESI): 198.00 [M-H]" ; HRMS (FAB) cald for C7H4NO4S (M+H)+ 197.9861, found 197.9863; purity = 91%.
Synthesis of 3-(2-thienyl)-2-cyanoacrylic acid derivatives (Intermediates 18-110)
Figure imgf000022_0001
(a) cyanoacetic acid, piperidine, dry CH3CN, reflux, 2h.
2-Thiophene carboxyaldehyde derivative (leq, 20mmol) and cyanoacetic acid (1.5eq, 30mmol) were dissolved in dry acetonitrile (250mL). Piperidine (2mL) was added and the mixture was refluxed for 2h. After cooling the solution to 4°C, the mixture was acidified with concentrated hydrochloric acid to yield a precipitate. This precipitate was washed with water and dried under pressure to give the corresponding 3-(2-thienyl)-2-cyanoacrylic acid derivative.
3-(5-bromo-2-thienyl)-2-cyanoacr lic acid 18
LH NMR (DMSO-i/6, 250 MHz): δ = 7.60 (d, J= 3.8 Hz, 1H), 7.94 (d, J= 3.8 Hz, 1H), 8.58 (s, 1H), 14.00 (bs, 1H); 13C NMR (DMSO-i/5, 62 MHz): δ = 99.74, 116.27, 122.93, 132.13, 137.24, 140.40, 146.22, 163.20 ; LC/MS (ESI): 255.83 [M-H] and isotopic peak 257.82 ; purity = 98% ; slight orange powder. Yield = 86%.
3-(5-phenyl-2-thienyl)-2-cyanoacrylic acid 19
LH NMR (DMSO-J(5, 250 MHz): δ = 7.25 (m, 3H), 7.46 (d, J= 3.8 Hz, 1H), 7.57 (d, J= 9.8 Hz, 2H), 7.81 (d, J = 3.8 Hz, 1H), 8.29 (s, 1H), 13.60 (bs, 1H); LC/MS (ESI): 253.95 [M-H]"; 13C NMR (DMSO-i 6, 62 MHz): δ = 99.56, 116.39, 125.21, 126.20, 129.44, 129.64, 132.27, 134.62, 141.23, 146.63, 152.64, 163.52; purity = 85% ; orange powder. Yield = 84%.
3-(5-nitro-2-thienyl)-2-cyanoacrylic acid 110
[H NMR (DMSO-i¾, 250 MHz): δ = 7.91 (d, J= 4.4 Hz, 1H), 8.14 (d, J= 4.5 Hz, 1H), 8.52 (s, 1H), 14.15 (bs, 1H); 13C NMR (DMSO-t/5, 62 MHz): δ =104.87, 115.58, 129.61, 137.43, 140.52, 145.78, 154.78, 162.33 ; LC/MS (ESI): 222.95 [M-H]" ; purity = 85% ; brown powder. Yield = 74%. Synthesis of (2£)-3-[2-(pyridin-2-yl)-l,3-thiazol-5-yl]prop-2-enoic acid 112 (Intermediates 111
Figure imgf000023_0001
(a) 2-bromopropanedial, pyridine, reflux, 2h; (b) malonic acid, pyridine, piperidine, reflux, 2h. 2-(pyridin-2-y])-l,3-thiazole-5-carbaldehyde II 1
2.7ml of pyridine was added to a solution of 1.5g (10.87 mmol) of 2-pyridinethioamide in 14 mL of THF. The reaction mixture was heated to reflux and a solution of 2.4g (15.89, 1.5eq) of 2-bromopropanedial was added dropwise over 10 min. The reaction mixture was refluxed for 2 h, concentrated under vacuum and the residue was partitioned between 150 mL of ethyl acetate and 150 mL of sat NaHC03 aq. The aqueous phase was further extracted with 150 mL of ethyl acetate. The combined organic phase were washed with 200 mL of brine and concentrated under vacuum. The residue was purified by chromatography on silica, eluting with a mixture of 2% acetone to 6% in dichlorome thane. The intermediate was obtained as a brick red solid 111 (600mg, Yiel =30%).
Rodriguez et al.: WO 2010/080864.
(2£)-3-[2-(pyridin-2-yl)-l,3-thiazol-5-yl]prop-2-enoic acid 112
263 mg (2.53 mmol, 1.2 eq) of malonic acid was added to a mixture of 400 mg (2.11 mmol, leq) of 2-(2-pyridyl)thiazole-5-carbaldehyde, 10 mL of piperidine and 10 mL of pyridine. The reaction mixture was heated to 80°C for 1.5 h then at 100°C overnight. The solvent was evaporated and the residue was added to a 10% aqueous solution of citric acid. The resulting precipitate was filtrated, dried under vacuum, yielding 300mg of light brown solid 112 (Yield = 61%)
Synthesis of substituted anilines (Intermediates 113-123)
Figure imgf000024_0001
(a) propanol, K2C03, DMF, 70°C, 48h. (b) Fe, AcOH, 60°C, 2h.
2- chloro-4-nitro-l-propoxybenzene 113
A mixture of 1 g of 2-chloro-l-fluoro-4-nitrobenzene (5.70 mmol), 0.51 g of propanol (1.5 eq, 8.55 mmol) and 2.36 g of K2C03 (3eq, 17.40 mmol) in 15 mL of DMF were heated to 70°C for 48h. Then, 45 mL of water were added and the reaction mixture was extracted twice with 20mL of ethyl acetate. The organic layers were combined, concentrated under vacuum and the residue was purified by chromatography on silica eluting with a gradient of 0 to 5% of diethyl ether in petroleum ether, yielding 570 mg of compound 113.
LH NMR (CDCls, 250 MHz): δ = 1.09 (t, J = 7.4 Hz, 3H), 1.92 (m, 2H), 4.10 (d, J = 6.4 Hz, 2H), 6.97 (d, .7= 9.1 Hz, 1H), 8.14 (dd, J= 2.7 Hz and J= 9.1 Hz, 1H), 8.28 (d, J= 2.7 Hz, 1H); yellow oil. Yield = 57%.
3- chloro-4-propoxyaniline 114
A mixture of 570 mg of 2-chloro-4-nitro-l-propoxybenzene 113 (2.64 mmol) and 450 mg of powdered iron (3 eq, 7.93 mmol) in 30 mL of acetic acid, was heated to 60°C for 2h. Then, 50mL of water was then added and the reaction mixture was extracted twice with 20 mL of ethyl acetate. The organic layers were combined and concentrated under vacuum yielding 500 mg of the crude aniline 114 which was used directly in the next step.
LH NM (CDCb, 250 MHz): δ = 1.03 (t, J= 7.4 Hz, 3H), 1.80 (m, 2H), 3.44 (bs, 2H), 3.89 (d, J = 6.6 Hz, 2H), 6.52 (dd, J = 2.8 Hz and J = 8.6 Hz, 1H), 6.72 (d, J = 2.9 Hz, 1H), 6.76 (d, J = 8.8 Hz, 1H) ; brown solid.
Figure imgf000025_0001
(a) 2-methoxyethanol, KOH, DMSO, 60°C, 16h. (b) ¾ Pd/C, MeOH, rt, 3h. l-(2-methoxyethoxy)-4-nitrobenzene 115
A mixture of 5 g of 1 -fluoro-4-nitro-benzene (35.46 mmol), 4.04 g of 2-methoxyethanol (1.5eq, 53.19 mmol) and 3.97 g of KOH (2 eq, 70.92 mmol) in 50 mL of DMSO were heated to 60°C for 16h. Then, 300 mL of water were added and the reaction mixture was extracted twice with 30mL of ethyl acetate. The organic layers were combined and concentrated under vacuum yielding 4.4 g of pure product 115, used directly in the next step. [H NMR (CDCI3, 250 MHz): δ = 3.45 (s, 3H), 3.78 (t, J= 4.7 Hz, 2H), 4.20 (t, J= 4.6 Hz, 2H), 6.98 (d, J= 8.8 Hz, 2H), 8.19 (d, J= 8.9 Hz, 1H) ; purity = 90% ; yellow solid. Yield = 63%.
4-(2-methoxyethoxy)aniline 116
Compound 115 (lg, 5.08 mmol) was hydrogenated with 100 mg of Pd/C in 20mL of methanol under a hydrogen atmosphere for 3h. The reaction mixture was filtrated on Celite, washed with 20mL of methanol and concentrated under vacuum to yield 700 mg of the pure aniline 116. Light brown oil. Yield = 68%.
Figure imgf000025_0002
(a) 2-methoxyethanol, K2C03, DMF, 70°C, 72h. (b) Fe, AcOH, 60°C, 2h. 2-chloro-l-(2-methoxyethoxy)-4-nitrobenzene 117
A mixture of 2 g of 2-chloro-l-fluoro-4-nitrobenzene (11.3 mmol), 1.25 g of 2-methoxyethanol (1.5 eq, 16.95 mmol) and 4.68 g of K2CO3 (3eq, 33.9 mmol) in 30 mL of DMF were heated to 70°C for 72h. The reaction mixture was concentrated to dryness under vacuum and the residue was solubilized in 20 mL of DCM, filtered and purified by chromatography on silica eluting with a gradient of 12% to 90% of diethyl ether in petroleum ether, yielding 680 mg of compound 117.
B NMR (CDCh, 250 MHz): δ = 3.48 (s, 3H), 3.84 (t, J= 4.6 Hz, 2H), 4.30 (t, J= 4.6 Hz, 2H), 7.02 (d, J= 9.1 Hz, 1H), 8.14 (dd, J= 2.7 Hz and J= 9.1 Hz, 1H), 8.29 (d, J= 2.7 Hz, 1H); off- white solid. Yield = 26%.
3-chloro-4-(2-methoxyethoxy)aniline 118
A mixture of 675 mg of 2-chloro-l-(2-methoxyethoxy)-4-nitrobenzene 117 (2.92 mmol) and 490 mg of powdered iron (3 eq, 8.76 mmol) in 30 mL of acetic acid, was heated to 60°C for 2h. The reaction mixture was concentrated to dryness under vacuum and the residue was purified by chromatography on silica, eluting with a gradient of 20% to 100% diethylether in petroleum ether, yielding 310 mg of compound 118
LH NMR (CDC13, 250 MHz): δ = 3.38 (bs, 2H), 3.45 (s, 3H), 3.74 (t, J = 4.6 Hz, 2H), 4.07 (t, J = 4.6 Hz, 2H), 6.52 (dd, J = 2.6 Hz and J = 8.6 Hz, 1H), 6.71 (d, J = 2.6 Hz, 1H), 6.79 (d, J = 8.6 Hz, 1H) ; brown solid. Yield = 53%.
Figure imgf000026_0001
(a) morpholine, K2C03, DMF, 70°C, 3h. (b) Fe, AcOH, 70°C, 2h.
4-(2-chloro-4-nitrophenyl)morpholine 119
A mixture of 2 g of 2-chloro-l-fluoro-4-nitrobenzene (11.3 mmol), 1.47 g of morpholine (1.5 eq, 16.95 mmol) and 4.68 g of K2CO3 (3eq, 33.9 mmol) in 30 mL of DMF were heated to 70°C for 3h. The reaction mixture was concentrated to dryness under vacuum and the residue was solubilized in 20 mL of DCM, filtered and purified by chromatography on silica eluting with a gradient of 12% to 90% of diethyl ether in petroleum ether, yielding 2.5 g of compound 119. LH NMR (CDCI3, 250 MHz): δ = 3.21 (m, 4H), 3.90 (m, 4H), 7.05 (d, J= 8.9 Hz, 1H), 8.14 (dd, J= 2.6 Hz and J= 9.0 Hz, 1H), 8.26 (d, J= 2.6 Hz, 1H) ; yellow solid. Yield = 91%.
3-chloro-4-(morpholin-4-yl)aniline 120
A mixture of 795 mg of 2-chloro-l-(2-methoxyethoxy)-4-nitrobenzene 119 (3.28 mmol) and 551 mg of powdered iron (3 eq, 9.84 mmol) in 30 mL of acetic acid, was heated to 70°C for 2h. The reaction mixture was concentrated to dryness under vacuum and the residue was purified by chromatography on silica, eluting with a gradient of 20% to 100% diethylether in petroleum ether, yielding 100 mg of compound 120.
LH NM (CDCI3, 250 MHz): δ = 2.95 (m, 4H), 3.72 (bs, 2H), 3.86 (m, 4H), 6.56 (dd, J= 2.7 Hz and J = 8.5 Hz, 1H), 6.74 (d, J = 2.7 Hz, 1H), 6.88 (d, J = 8.5 Hz, 1H). Brown solid. Yield =
Figure imgf000027_0001
(a) NaH, Etl, THF, rt 16h. -ethyl-S-methanesulfonylaniline 121
129 mg of NaH (60%, 1.1 eq, 3.22 mmol) were added to a solution of 500 mg of (2.92 mmol) in 10 mL of THF. After lh at room temperature, 912 mg of ethyl iodide (2 eq, 5.84 mmol) were added and the reaction mixture was stirred a room temperature overnight and quenched with 30 mL of a saturated aqueous solution of ammonium chloride. Then, 30 mL of ethyl acetate were added and the organic phase was further washed with 30 ml of water and concentrated under vacuum. The residue was purified by chromatography on silica gel yielding 70 mg of aniline 121. LC/MS (ESI): 241.11 [M+CH3CN+H]+; purity = 95% ; brown solid. Yield = 12%.
Figure imgf000027_0002
(a) n-propanol, diisopropylethylamine, KF, DMF, rt, 3h; (b) H2, Pd/C, MeOH, rt, 18h. 5-nitro-2-propoxypyrimidine 122
A mixture of 500 mg (3.135 mmol, 1 eq) of 2-chloro-5-nitro-pyrimidine, 375 mg (5.27 mmol, 2 eq) of n-propanol, 1.215 g (9.405 mmol, 3eq) of diisopropylethylamine and 180 mg (3.135 mmol, 1 eq) of potassium fluoride in 8 mL DMF was stirred at room temperature for 3 h under nitrogen. The reaction mixture was concentrated under vacuum, the residue was partitioned between 20 mL of ethyl acetate and 30 mL of water, the organic phase was concentrated under vacuum and the residue was purified by chromatography on silica, eluting with a mixture of 100/1 to 10/ petroleum ether in ethyl acetate, yielding 220 mg of 5-nitro-2-propoxy-pyrimidine 122 as a clear brown oil. 5-methyl-2-propoxypyrimidine amine 123
220 mg of 5-nitro-2-propoxy-pyrimidine was hydrogenated on Pd/C (12 mg) in 5ml of methanol under atmospheric pressure at room temperature for 18 h. The reaction mixture was filtrated under nitrogen through a short pad of celite and the filtrate was concentrated under vacuum yielding 96 mg of product 123 as a pale yellow oil (Yield = 52%), used as a crude.
All other substituted anilines used for the synthesis of (2£)-N-phenyl-3-(thiophen-2- yl)acrylamide derivatives (described below) are commercially available. Synthesis of substituted 2-phenylethan-l-amine (Intermediates 124-126)
Figure imgf000028_0001
(a) Boc20, THF, rt, 2h30. (b) iodopropane, KOH, EtOH, reflux, 20h, (c) HC1 4M, dioxane, it, 6h. tot-butyl Ar-[2-(4-hydroxyphenyl)ethyl] carbamate 124
1 g (7.35 mmol) of tyramine was added portionwise to 1.92 g (1.2 eq, 8.82 mmol) of BOC2O in 15 mL of THF at 0°C, over 15 min. After 2h30 stirring, the reaction mixture was concentrated to dryness under vacuum and the residue was purified by chromatography on silica eluting with a gradient of 100% DCM to 25% acetone/75% DCM. The fractions containing the product were combined and evaporated yielding 1,7 g of compound 124.
LH NMR (CDCI3, 250 MHz): δ = 1.44 (s, 9H), 2.67 (t, J = 7.0 Hz, 2H), 3.32 (m, 2H), 4.65 (bs, 1H), 6.65 (bs, 1H), 6.78 (d, J = 7.8 Hz, 2H), 7.00 (d, J = 8.0 Hz, 2H) ; off-white solid. Yield = 97%.
teri-butyl Ar-[2-(4-propoxyphenyl)ethyl] carbamate 125
231 mg of potassium hydroxide (1.3 eq, 4.13 mmol) was added slowly to a solution of 750 mg of tert-butyl Ar-[2-(4-hydroxyphenyl)ethyl]carbamate 124 (3.18 mmol) and 810 mg of iodopropane (1.5 eq, 4.77 mmol) in 5 mL of EtOH. The reaction mixture was heated to reflux for 20h. After concentration under vacuum, the residue was purified by chromatography on silica eluting with 5% acetone in DCM. The fractions containing the product were combined and evaporated yielding 850 mg of compound 125.
'H NMR (CDCI3, 250 MHz): δ = 1.01 (t, J= 7.4 Hz, 3H), 1.42 (s, 9H), 1.78 (m, 2H), 2.71 (t, J = 7.0 Hz, 2H), 3.31 (bt, J= 6.8 Hz, 2H), 3.88 (t, J= 6.6 Hz, 2H), 4.58 (bs, 1H), 6.82 (d, J = 8.6 Hz, 2H), 7.08 (d, J = 8.6 Hz, 2H) ; LC/MS (ESI): 255.83 [M-H]" ; purity = 98% ; white solid. Yield = 96%.
2-(4-propoxyphenyl)ethan-l-aminium 126
850 mg of terf-butyl iV-[2-(4-propoxyphenyl)ethyl]carbamate 125 was added to 2.24 mL (3eq) of a 4M solution of HC1 in dioxane and the reaction mixture was stirred for 6h. The reaction mixture was concentrated under vacuum and the white solid was triturated in 3x10 mL of heptane, yielding 550 mg of compound 126 after drying.
LH NMR (DMSO-i¾, 250 MHz): δ = 0.96 (t, J = 7.3 Hz, 3H), 1.71 (m, 2H), 2.83 (m, 2H), 2.93 (m, 2H), 3.89 (t, J = 6.5 Hz, 2H), 6.88 (d, J = 8.2 Hz, 2H), 7.16 (d, J = 8.3 Hz, 2H), 8.02 (bs, 3H) ; white solid. Yield = quantitative
General procedures for the synthesis of derivatives 2, 3, 4, 6, 7, 8, 9, 10, 19, 26, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 46, 47, 48, 49, 51, 52, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 82, 83, 84, 85, 88, 89, 90, 92, 93, 94, 95, 96, 97, 99, 103, 104, 107, 108, 109, 110, 111, 113, 115, 116, 117, 118, 120, 122, 123, 125, 128, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, and 145.
Figure imgf000029_0001
(a) aniline derivatives, DMAP, EDCI, dry DCM, rt, 5h; or
(b) SOCb, dry toluene, reflux, 2hthen aniline derivatives or (4-propoxyphenyl)methanamine, pyridine, dry DCM, rt, 16h.
Procedure A
To a stirred solution of 3-(Thien-2-yl)- or 3-(Thiazol-5-yl)acrylic acid derivative (1.5eq, 200mg) and substituted aniline (l eq) in dry dichloromethane or in dry THF (20mL), l -(3-
Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (2eq) and DMAP (2eq) were added.
The reaction mixture was stirred at room temperature for 5h. The progress of the reaction was monitored by TLC. After completion, the reaction mixture was poured into IN aqueous solution of hydrochloric acid (lOmL).
At this stage, compounds 9, 33, 53 and 99 precipitated. Precipitates were filtered off, washed with water and dried to afford pure hydrochloride salts. For all other compounds, the organic layer was washed twice with IN aqueous solution of hydrochloric acid (IN), then twice with saturated NaHCC , water and brine. The organic layer was dried under MgS04, then filtered off and concentrated under reduced pressure. The crude product was purified by flash chromatography (cyclohexane/ethyl acetate or dichloromethane/methanol) afforded the final product.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(3,4-dichlorophenyl)prop-2-enamide 2
LH NMR (CDC13, 250 MHz): δ = 6.13 (d, J = 15.1 Hz, 1H), 6.93 (d, J= 3.9 Hz, 1H), 6.95 (d, J = 3.9 Hz, 1H), 7.32 (m, 2H), 7.36 (bs, 1H), 7.66 (d, J= 15.1 Hz, 1H), 7.77 (d, J = 1.8 Hz, 1H); LC/MS (ESI): 373.79 [M-H]" and isotopic peak 375.79, 375.91 [M+H]+ and isotopic peak 377.91 ; purity = 95% ; slight yellow powder. Yield = 60%.
(2£,)-/V-(3,4-dichlorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 3
LH NMR (DMSO-i¾, 250 MHz): δ = 6.53 (d, J= 15.4 Hz, 1H), 7.37-7.46 (m, 3H), 7.50 (d, J = 3.8 Hz, 1H), 7.56 (m, 3H), 7.71 (d, .7 = 7.0 Hz, 2H), 7.74 (d, J = 15.4 Hz, 1H), 8.11 (bd, .7= 1.4 Hz, 1H), 10.51 (s, 1H); LC/MS (ESI): 371.89 [M-H]" and isotopic peak 373.89, 373.98 [M+H]+ and isotopic peak 376.08 ; purity > 99% ; yellow powder. Yield = 54%.
(2£)-/V-(4-cyanophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 7
LH NMR (OMSO-d6, 250 MHz): δ = 6.63 (d, J = 15.6 Hz, 1H), 7.35 (d, J = 4.3 Hz, 1H), 7.56- 7.65 (m, 5H), 7.90 (d, J = 4.3 Hz, 1H), 10.55 (bs, 1H); LC/MS (ESI): 297.98 [M-H]"; purity > 99%; brown powder. Yield = 33%.
2£)-/V-(4-chlorophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 8
LH NMR (OMSO-d6, 250 MHz) : δ = 6.52 (d, J = 15.6 Hz, 1H), 7.17 (d, J = 8.7 Hz, 2H), 7.35 (d, J = 4.2 Hz, 1H), 7.48 (d, J = 8.6 Hz, 2H), 7.54 (d, J = 15.7 Hz, 1H), 7.94 (d, J = 4.2 Hz, 1H), 10.30 (bs, 1H); LC/MS (ESI): 306.72 [M-H]" and isotopic peak 308.70, 308.75 [M+H]+ and isotopic peak 310.82 ; purity = 98% ; yellow powder. Yield = 16%.
l-{4-[(2£,)-3-(5-nitrothiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 9 LH NMR (OMSO-d6, 250 MHz) : δ = 6.92 (d, J = 15.5 Hz, 1H), 7.51 (d, J= 4.2 Hz, 1H), 7.72- 7.81 (m, 5H), 7.88 (d, J= 8.8 Hz, 2H), 8.08 (d, .7= 4.3 Hz, 1H), 8.18 (s, 1H), 9.57 (s, 1H), 10.99 (bs, 1H) ; LC/MS (ESI): 338.83 [M-H]" and 340.83 [M+H]+ ; purity = 99% ; yellow powder. Yield = 66%.
2£ -/V-(4-(acetamido)phenyl)-3-(5-nitrothiophen-2-yl)prop-2-enaniide 10
LH NMR (OMSO-d6, 250 MHz) : δ = 2.22 (s, 3H), 7.04 (d, J= 15.6 Hz, 1H), 7.72-7.90 (m, 5H), 7.93 (d, J = 15.5 Hz, 1H), 8.32 (d, J = 3.3 Hz, 1H), 10.06 (bs, 1H), 10.46 (bs, 1H); LC/MS (ESI): 330.00 [M-H]" and 332.14 [M+H]+ ; purity = 94% ; slight red powder. Yield = 75%. (2£')-3-(5-nitrothiophen-2-yl)-iV-(4-propox phenyl)prop-2-enainide 11
LH NMR (OMSO-d6, 250 MHz) : δ = 1.03 (t, J= 7.3 Hz, 3H), 1.77 (m, 2H), 3.96 (t, J= 6.6 Hz, 2H), 6.89 (d, J = 15.6 Hz, 1H), 6.97 (d, J = 8.9 Hz, 2H), 7.60 (d, J = 4.3 Hz, 1H), 7.65 (d, J = 8.9 Hz, 2H), 7.79 (d, J= 15.6 Hz, 1H) , 8.19 (d, J = 4.3 Hz, 1H), 10.26 (bs, 1H); LC/MS (ESI): 330.97 [M-H]- and 333.17 [M+H]+ ; purity > 99% ; slight red powder. Yield = 8%.
2ii>-3-(5-bromothiophen-2-yl)-Ar-(2-methoxyphenyl)prop-2-enamide 20
LH NMR (OMSO-d6, 250 MHz) : δ = 3.92 (s, 3H), 6.92 (d, J = 15.4 Hz, 1H), 7.01 (m, 1H), 7.10-7.15 (m, 2H), 7.31-7.34 (m, 2H), 7.69 (d, J= 15.4 Hz, 1H), 8.18 (bd, J= 7.7 Hz, 1H), 9.43 (bs, 1H); LC/MS (ESI): 338.06 [M+H]+ and isotopic peak : 340.05; purity > 99% ; beige powder. Yield = 66%.
(2£')-iV-(4-bromo-2-fluorophenyl)-3-(5-bromothiophen-2-yl)prop-2-enamide 27
LH NMR (DMSO-c¾, 250 MHz): δ = 6.18 (d, J = 15.1 Hz, 1H), 6.95 (d, J = 3.8 Hz, 1H), 6.96 (d, J = 3.8 Hz, 1H), 7 .21 (m, 2H), 7.35 (bs, 1H), 7.68 (d, J = 15.1 Hz, 1H), 8.30 (dd, 4JHF= 8.4 Hz and J = 8.6 Hz, 1H) ; LC/MS (ESI) : 403.76 [M-H]" and isotopic peak 405.77, 405.90 [M+H]+ and isotopic peak 407.88 ; purity = 80% ; yellow powder, Yield = 40%.
(2£)-3-(5-bromothiophen-2-yl)-/V-(4-acetamidophenyl)prop-2-enamide 31
LH NMR (DMSO-<i6, 250 MHz): δ = 2.10 (s, 3H), 6.50 (d, J = 15.6 Hz, 1H), 7.28 (d, J = 3.8 Hz, 1H), 7.31 (d, J = 3.8 Hz, 1H), 7.48-7.69 (m, 5H), 9.92 (bs, 1H), 10.17 (bs, 1H) ; LC/MS (ESI): 362.88 [M-H]" and isotopic peak 364.89, 365.01 [M+H]+ and isotopic peak 366.99 ; purity > 99% ; slight beige powder. Yield = 62%.
(2£)-3-(5-bromothiophen-2-yl)-Ar-(4-propoxyphenyl)prop-2-enamide 32
LH NMR (CDC13, 250 MHz): δ = 0.96 (t, J= 7.4 Hz, 3H), 1.69 (m, 2H), 3.82 (t, J= 6.6 Hz, 2H), 6.16 (d, J= 15.1 Hz, 1H), 6.79 (d, J= 8.6 Hz, 2H), 6.88 (d, J= 3.8 Hz, 1H), 6.93 (d, J= 3.8 Hz, 1H), 7.31 (bs, 1H), 7.41 (d, J = 8.4 Hz, 2H), 7.70 (d, J = 15.0 Hz, 1H) ; LC/MS (ESI): 363.91 [M-H]" and isotopic peak 365.92, 366.02 [M+H]+ and isotopic peak 368.01 ; purity = 98% ; yellow powder. Yield = 70%.
4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamido]-Ar,/V-dimethylanilinium chloride 33
Ή NMR (DMSO-i», 250 MHz): δ = 2.84 (s, 6H), 6.31 (d, J = 15.5 Hz, 1H), 7.06 (d, J = 3.8 Hz, 1H), 7.09 (d, J = 3.9 Hz, 1H), 7.30 (bs, 1H) 7.45 (d, J = 15.4 Hz, 1H), 7.54 (m, 4H), 10.27 (bs, 1H) ; LC/MS (ESI): 350.93 [M+H]+ and isotopic peak 352.66; purity = 87% ; slight green powder. Yield = 75%.
Ethyl 4-[(2£)-3-(5-bromothiophen-2-yl)prop-2-enamido]benzoate 34
LH NMR (CDCb, 250 MHz): δ = 1.32 (t, J= 7.1 Hz, 3H), 4.31 (q, J = 7.1 Hz, 2H), 6.23 (d, J = 15.0 Hz, 1H), 6.91 (d, J = 3.9 Hz, 1H), 6.94 (d, J= 3.9 Hz, 1H), 7.62 (d, J = 8.7 Hz, 2H), 7.68 (d, J= 15.0 Hz, 1H), 7.69 (bs, 1H), 7.95 (d, J= 8.7 Hz, 2H) ; LC/MS (ESI): 377.92 [M-H]" and isotopic peak 379.90, 380.01 [M+H]+ and isotopic peak 382.02 ; purity > 99% ; slight yellow powder. Yield = 26%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-[4-(l,3,4-oxadiazol-2-yl)phenyl]prop-2-enamide 35
B NMR (DMSO-c¾, 250 MHz): δ = 6.67 (d, J = 15.3 Hz, 1H), 7.01 (d, J = 3.9 Hz, 1H), 7.05 (d, J = 3.9 Hz, 1H), 8.07 (d, J = 15.3 Hz, 1H), 8.12 (d, J = 9.0 Hz, 2H), 8.21 (d, J = 9.0 Hz, 2H), 9.26 (s, 1H), 11.38 (bs, 1H) ; LC/MS (ESI) 373.89 [M-H]" and isotopic peak 375.87, 375.98 [M+H]+ and isotopic peak 377.99 ; purity > 99% ; slight yellow powder. Yield = 75%. (2£')-iV-(4-acetylphenyl)-3-(5-bromothiophen-2-yl)prop-2-enamide 36
LH NMR (DMSO-i 6, 250 MHz): δ = 2.32 (s, 3H), 6.31 (d, J = 15.4 Hz, 1H), 7.08 (d, J = 3.9 Hz, 1H), 7.13 (d, J= 3.9 Hz, 1H), 7.51 (d, J= 15.4 Hz, 1H), 7.59 (d, J= 8.7 Hz, 2H), 7.74 (d, J = 8.7 Hz, 2H), 10.33 (s, 1H) ; LC/MS (ESI): 347.89 [M-H]" and isotopic peak 349.87, 349.94 [M+H]+ and isotopic peak 351.96 ; yellow powder. Yield = 65%.
(2£')-3-(5-bromothiophen-2-yl)-A,-[4-(morpholin-4-yl)phenyl]prop-2-enamide 37
LH NMR (DMSO-ito, 250 MHz): δ = 3.31 (m, 4H), 3.90 (m, 4H), 6.59 (d, J = 15.3 Hz, 1H), 7.30 (d, J = 9.0 Hz, 2H), 7.35 (d, J = 3.8 Hz, 1H), 7. 37 (d, J = 3.8 Hz, 1H), 7.68 (d, J = 15.3 Hz, 1H), 7.72 (d, J = 9.0 Hz, 2H), 10.34 (bs, 1H); LC/MS (ESI): 390.87 [M-H]" and isotopic peak 392.82, 393.00 [M+H]+ and isotopic peak 394.96 ; purity = 90% ; yellow powder. Yield = 83%.
(2£)-3-(5-bromothiophen-2-yl)-A^4-cyanophenyl)prop-2-enamide 38
LH NMR (DMSO-iM, 250 MHz): δ = 6.52 (d, J = 15.4 Hz, 1H), 7.31 (d, J = 3.9 Hz, 1H), 7.36 (d, J= 3.9 Hz, 1H), 7.71 (d, J= 15.3 Hz, 1H), 7.78 (d, J= 8.9 Hz, 2H), 7.85 (d, J= 8.9 Hz, 2H), 10.66 (s, 1H) ; LC/MS (ESI): 330.74 [M-H]" and isotopic peak 332.86, 332.76 [M+H]+ and isotopic peak 334.80 ; purity = 98% ; lightly yellow powder. Yield = 44%.
(2£)-3-(5-bromothiophen-2-yl)-Ar-(3-chlorophenyl)prop-2-enamide 39
LH NMR (CDC13, 250 MHz): δ = 6.14 (d, J = 15.1 Hz, 1H), 6.94 (d, J= 3.9 Hz, 1H), 6.96 (d, J = 3.9 Hz, 1H), 7.03 (ddd, J = J = 1.0 Hz, J = 1.9 Hz and 7.9 Hz, 1H), 7.20 (m, 2H), 7.35 (dm, 1H), 7.66 (bs, 1H), 7.72 (d, J = 15.1 Hz, 1H); LC/MS (ESI) : 339.80 [M-H]" and isotopic peak 341.82, 341.91 [M+H]+ and isotopic peak 343.80 ; purity = 90% ; yellow oil. Yield = 80%. (2£')-3-(5-bromothiophen-2-yl)-Ar-[3-(methylsulfonyl)phenyl]prop-2-enamide 40
B NMR (DMSO-c¾, 250 MHz): δ = 3.20 (s, 3H), 6.48 (d, J = 15.3 Hz, 1H), 7.27 (d, J = 3.9 Hz, 1H), 7.28 (d, J = 3.9 Hz, 1H), 7.33 (m, 2H), 7.71 (d, J = 15.3 Hz, 1H), 7.91 (m, 1H), 8.30 (m, 1H), 10.61 (s, 1H); LC/MS (ESI): 383.87 [M-H]" and isotopic peak 385.88, 385.98 [M+H]+ and isotopic peak 387.99 ; purity = 80% ; white powder. Yield = 18%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(4-chloro-2-hydroxyphenyl)prop-2-enamide 41 Ή NMR (DMSO-i¾, 250 MHz): δ = 6.95 (m, 3H), 7.36 (d, J= 3.9 Hz, 1H), 7.38 (d, J= 3.9 Hz, 1H), 7.72 (d, J = 15.2 Hz, 1H), 8.11 (d, J = 8.7 Hz, 1H), 9.63 (s, 1H), 10.60 (bs, 1H) ; LC/MS (ESI): 355.84 [M-H]" and isotopic peak 357.82, 357.90 [M+H]+ and isotopic peak 359.83 ; purity = 92% ; yellow powder. Yield = 24%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-[4-(trifluoromethyl)phenyl]prop-2-enamide 42
LH NMR (DMSO-cM, 250 MHz): δ = 6.57 (d, J = 15.4 Hz, 1H), 7.36 (d, J = 3.9 Hz, 1H), 7.41 (d, J= 3.9 Hz, 1H), 7.76 (d, J= 8.7 Hz, 2H), 7.80 (d, J= 15.4 Hz, 1H), 7.95 (d, J= 8.7 Hz, 2H), 10.63 (bs, 1H) ; LC/MS (ESI): 373.83 [M-H]" and isotopic peak 375.83, 375.93 [M+H]+ and isotopic peak 377.80 ; purity = 93% ; slight orange powder. Yield = 14%.
(2£')-3-(5-bromothiophen-2-yl)-A'-(3-chloro-4-fluorophenyl)prop-2-enamide 43
NMR >H (CDCI3, 250 MHz): δ = 6.17 (d, J= 15.0 Hz, 1H), 6.88 (d, J = 3.8 Hz, 1H), 6.93 (d, J = 3.8 Hz, 1H), 6.98 (dd, J= 8.7 Hz and 3JHF = 8.9 Hz, 1H), 7.33 (ddd, J= 2.6 Hz, 4JHF = 6.6 Hz and J= 8.7 Hz, 1H), 7.40 (bs, 1H), 7.65 (d, J= 15.0 Hz, 1H), 7.71 (dd, J= 2.4 Hz and4JHF = 6.5 Hz, 1H); LC/MS (ESI): 357.80 [M-H]" and isotopic peak 359.79, 359.86 [M-H]+ and isotopic peak 361.88 ; purity = 97% ; yellow powder. Yield = 50%.
(2£)-3-(5-bromothiophen-2-yl)-/V-(2-chloro-4-fluorophenyl)prop-2-enamide 46
LH NMR (DMSO-i¾, 250 MHz): δ = 6.52 (d, J = 15.4 Hz, 1H), 7.06 (td, J = 2.8 Hz and FH = 8.3 Hz, 1H), 7.12 (d, J = 3.9 Hz, 1H), 7.16 (d, J = 3.9 Hz, 1H), 7.34 (dd, J = 2.8 Hz and JFH = 8.5 Hz, 1H), 7.53 (d, J = 15.4 Hz, 1H), 7.66 (dd, FH = 5.6 Hz, J = 9.0 Hz, 1H), 9.59 (s, 1H) ; LC/MS (ESI): 357.76 [M-H]" and isotopic peak 359.60, 359.80 [M+H]+ and isotopic peak 361.80 ; purity = 98% ; beige powder. Yield = 23%.
4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamide]benzamide 47
LH NMR (DMSO-rf6, 250 MHz) : δ = 6.55 (d, J = 15.4 Hz, 1H), 7.29 (d, J = 3.8 Hz, 1H), 7.33 (d, J= 3.9 Hz, 1H), 7.71 (d, J= 15.5 Hz, 1H), 7.74 (d, J= 8.7 Hz, 2H), 7.86 (d, J= 8.7 Hz, 2H), 10.43 (s, 1H); LC/MS (ESI): 348.90 [M-H]" and isotopic peak 350.89, 351.01 [M+H]+ and isotopic peak : 352.99; purity = 90% ; beige powder. Yield = 66%.
2£ -3-(5-bromothiophen-2-yl)-/V-(2-chlorophenyl)prop-2-enamide 48
'H NMR (DMSO-i6, 250 MHz) : δ = 6.83 (d, J= 15.5 Hz, 1H), 7.18-7.27 (m, 1H), 7.32 (d, J = 3.9 Hz, 1H), 7.35 (d, J = 3.9 Hz, 1H), 7.38-7.41 (m, 1H), 7.54 (dd, J= 1.5 Hz and J = 7.8 Hz, 1H), 7.73 (d, J= 15.5 Hz, 1H), 7.94 (dd, J= 1.5 Hz and J= 8.0 Hz, 1H), 9.72 (bs, 1H) ; LC/MS (ESI): 341.99 [M+H]+ and isotopic peak : 343.98; purity = 85% ; slight brown powder. Yield = 17%.
2£>-3-(5-bromothiophen-2-yl)-Ar-(3-nitrophenyl)prop-2-enamide 49
LH NMR (DMSO-i 5, 250 MHz) : δ = 6.29 (d, J = 15.4 Hz, 1H), 7.10 (d, J = 3.9 Hz, 1H), 7.16 (d, J = 3.9 Hz, 1H), 7.43 (t, J = 8.3 Hz, 1H), 7.54 (d, J= 15.4 Hz, 1H), 7.69-7.79 (m, 2H), 8.52 (t, J = 2.1 Hz, 1H), 10.47 (bs, 1H) ; LC/MS (ESI): 350.88 [M-H]" and isotopic peak 352.87, 352.96 [M+H]+ and isotopic peak 354.79; purity > 99% ; slight yellow powder. Yield = 25%. (2£')- V-(4-acetamidophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 52
LH NMR (DMSO-c¾, 250 MHz): δ = 2.03 (s, 3H), 6.57 (d, J = 15.4 Hz, 1H), Ί 31-1.15 (m, 12H), 9.91 (bs, 1H), 10.17 (bs, 1H); LC/MS (ESI): 361.02 [M-H]" , 363.00 [M+H]+ ; purity > 99%) ; slight brown powder. Yield = 35%.
l-{4-[(2£')-3-(5-phenylthiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 53
LH NMR (DMSO-i 6, 250 MHz): δ = 6.46 (d, J = 15.4 Hz, 1H), 7.23-7.35 (m, 6H), 7.51-7.70 (m, 8H), 8.04 (bs, 1H), 9.30 (bs, 1H), 10.42 (bs, 1H) ; LC/MS (ESI): 370.00 [M-H]" and 372.01 [M+H]+ ; purity = 93% ; yellow powder. Yield = 71%.
(2£')-3-(5-phenylthiophen-2-yl)-Ar-(4-propoxyphenyl)prop-2-enamide 56
LH NMR (DMSO-i¾, 250 MHz): δ = 0.94 (t, J = 7.4 Hz, 3H), 1.48 (m, 2H), 3.65 (t, J = 6.5 Hz, 2H), 6.33 (d, J= 15.2 Hz, 1H), 6.65 (d, = 3.5 Hz, 1H), 6.66 (d, J= 3.5 Hz, 1H), 7.10-7.26 (m, 4H), 7.32-7.51 (m, 6H), 9.85 (bs, 1H) ; LC/MS (ESI): 364.09 [M+H]+ ; purity = 95% ; yellow powder. Yield = 48%.
(2£)-iV-(4-bromo-2-fluorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 57
LH NMR (CDCls, 250 MHz): δ = 6.27 (d, J = 15.4 Hz, 1H), 7.17-7.38 (m, 7H), 7.53-7.66 (m, 2H), 7.78 (d, J = 15.4 Hz, 1H), 8.33 (dd, J = 8.6 Hz and
Figure imgf000034_0001
9.0 Hz, 1H), 9.82 (bs, 1H); LC/MS (ESI): 399.87 [M-H]" and isotopic peak 401.89, 401.95 [M+H]+ and isotopic peak 403.98 ; purity = 80% ; yellow powder. Yield = 18%.
(2£)-/V-[4-(methylsulfonyl)phenyl]-3-(5-phenylthiophen-2-yl)-prop-2-enamide 58
LH NMR (DMSC M, 250 MHz): δ = 3.26 (s, 3H), 6.68 (d, J= 15.4 Hz, 1H), 7.40-7.48 (m, 1H), 7.50-7.60 (m, 3H), 7.61 (d, J= 3.9 Hz, 1H), 7.67 (d, J = 3.8 Hz, 1H), 7.81 (bd, J = 7.2 Hz, 2H), 7.88 (d, J = 15.2 Hz, 1H), 7.98 (m, 3H), 10.75 (bs, 1H) ; LC/MS (ESI): 381.90 [M-H]", 383.94 [M+H]+ ; purity = 85% ; yellow powder. Yield = 45%.
(2£')-iV-(3-chlorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 59
Ή NMR (DMSO-<i<5, 250 MHz): δ = 6.57 (d, J = 15.4 Hz, 1H), 7.11 (ddd, J = 1.0 Hz, J = 2.1 Hz and J = 7.9 Hz, 1H), 7.34-7.51 (m, 7H), 7.57 (d, J = 3.8 Hz, 1H), 7.74 (d, J = 7.1 Hz, 1H), 7.80 (d, J = 15.4 Hz, 1H), 7.96 (dd, J = 2.0 Hz and J = 7.1 Hz, 1H), 10.42 (bs, 1H); LC/MS (ESI): 337.92 [M-H]" and isotopic peak 339.88, 339.93 [M+H]+ and isotopic peak 341.97 ; purity > 99% ; yellow powder. Yield = 45%.
(2£')-Ar-(2-chloro-4-fluorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 60
LH NMR (DMSO-<¾ 250 MHz): δ = 6.86 (d, J= 15.4 Hz, 1H), 7.28-7.35 (td, J= 3.0 Hz, Jm = 8.6 Hz, 1H), 7.40-7.47 (m, 1H), 7.50-7.56 (m, 3H), 7.54 (dd, J = 2.9 Hz and J = 8.7 Hz, 1H), 7.63 (d, J= 3.8 Hz, 1H), 7.75-7.80 (m, 2H), 7.78 (d, J = 15.3 Hz, 1H), 7.93 (dd, JFH = 6.0 Hz, J = 9.0 Hz, 1H), 9.81 (bs, 1H); LC/MS (ESI): 356.07 [M-H]\ 357.93 [M+H]+ ; purity = 94% ; yellow powder. Yield = 9%.
(2£')- V-[3-(methylsulfonyl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 61
LH NMR (DMSO-c¾, 250 MHz): δ = 3.22 (s, 3H), 6.58 (d, J = 15.3 Hz, 1H), 7.38 (d, J = 7.1 Hz, 1H), 7.45 (m, 2H), 7.53 (m, 2H), 7.59 (d, J= 3.8 Hz, 1H), 7.63 (m, 2H), 7.72 (d, J= 7.0 Hz, 2H), 7.77 (d, J= 15.3 Hz, 1H), 8.36 (m, 1H), 10.64 (bs, 1H); LC/MS (ESI): 381.96 [M-H]" and 384.05 [M+H]+ ; purity = 80% ; yellow powder. Yield = 17%.
(2£)-iV-[4-(l,3,4-oxadiazol-2-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 62
LH NMR (DMSO-i¾, 250 MHz): δ = 6.68 (d, J = 15.3 Hz, 1H), 7.44 (m, 1H), 7.54 (m, 2H), 7.58 (d, J= 3.9 Hz, 1H), 7.64 (d, J = 3.9 Hz, 1H), 7.78 (m, 2H), 7.83 (d, J= 15.3 Hz, 1H), 7.97 (d, J = 9.0 Hz, 2H), 8.05 (d, J = 8.9 Hz, 2H), 9.37 (s, 1H), 10.68 (bs, 1H) ; LC/MS (ESI): 371.98 [M-H]" and 374.03 [M+H]+ ; purity = 80% ; yellow powder. Yield = 11%.
(2£')-iV-[4-(morpholin-4-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 63
LH NMR (DMSO-i/6, 250 MHz): δ = 2.98 (t, J= 4.7 Hz, 4H), 3.44 (t, J= 4.7 Hz, 4H), 6.59 (d, J = 15.3 Hz, 1H), 6.80 (m, 2H), 7.13 (bd, J = 6.9 Hz, 2H), 7.20 (m, 2H), 7.32 (d, J= 3.8 Hz, 1H), 7.36 (m, 3H), 7.46 (bd, J = 6.9 Hz, 2H), 10.64 (bs, 1H); LC/MS (ESI): 391.14 [M+H]+ ; purity = 90% ; slight green powder. Yield = 80%.
(2£)-3-(5-phenylthiophen-2-yl)-A'-[4-(trifluoromethyl)phenyl]prop-2-enamide 64
LH NMR (DMSO-<¾, 250 MHz): δ = 6.54 (d, J = 15.3 Hz, 1H), 7.31 (m, 1H), 7.37 (m, 2H), 7.44 (d, J= 3.9 Hz, 1H), 7.50 (d, J = 3.9 Hz, 1H), 7.62 (m, 4H), 7.70 (d, J= 15.3 Hz, 1H), 7.82 (d, J = 8.6 Hz, 2H), 10.51 (bs, 1H); LC/MS (ESI): 372.02 [M-H]" and 374.10 [M+H]+ ; purity = 96% ; yellow powder. Yield = 25%.
Ethyl 4-[(2£,)-3-(5-phenylthiophen-2-yl)prop-2-enamido]benzoate 65
LH NMR (DMSO-iM, 250 MHz): δ = 1.24 (t, J = 7.0 Hz, 3H), 4.22 (q, J= 7.0 Hz, 2H), 6.54 (d, J = 15.4 Hz, 1H), ), 7.30 (m, 1H), 7.38 (m, 2H), 7.43 (d, J = 3.9 Hz, 1H), 7.50 (d, J = 3.9 Hz, 1H), 7.64 (m, 3H), 7.75 (d, J = 8.7 Hz, 2H), 7.87 (d, J = 8.7 Hz, 2H), 10.49 (bs, 1H) ; LC/MS (ESI): 376.01 [M-H]" and 378.04 [M+H]+ ; purity = 88% ; yellow powder. Yield = 45%. (2£')-/V-(4-acetylphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 66
LH NMR (DMSO-i/6, 250 MHz): δ = 2.00 (s, 3H), 6.54 (d, J= 15.3 Hz, 1H), 7.31 (m, 1H), 7.37 (m, 2H), 7.43 (d, J = 3.9 Hz, 1H), 7.51 (d, J = 3.9 Hz, 1H), 7.64 (m, 2H), 7.67 (d, J= 15.3 Hz, 1H), 7.74 (d, J = 8.8 Hz, 2H), 7.88 (d, J = 8.9 Hz, 2H), 10.49 (bs, 1H); LC/MS (ESI): 346.02 [M-H]" and 348.05 [M+H]+ ; purity > 99% ; yellow powder. Yield = 34%.
4-[(2ii)-3-(5-phenylthiophen-2-yl)prop-2-enainido]benzamide 67 Ή NMR (OMSO-d6, 250 MHz): 6.70 (d, J = 15.3 Hz, 1H), 7.32 (bs, 2H), 7.41-7.70 (m, 5H), 7.75-8.02 (m, 7H), 10.51 (bs, 1H); LC/MS (ESI): 349.13 [M+H]+; purity = 95% ; yellow powder. Yield = 50%.
2£)- V-(3-nitrophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 68
LH NMR (DMSO-i/6, 250 MHz) : δ = 6.42 (d, J = 15,4 Hz, 1H), 7.22 (bd, J= 7.0 Hz, 1H), 7.29 (m, 2H), 7.34 (d, J = 3.8 Hz, 1H), 7.42 (d, J= 3.8 Hz, 1H), 7.48-7.59 (m, 3H), 7.65 (d, J= 15.4 Hz, 1H), 7.76 (dd, J = 2.2 Hz and J = 8.2 Hz, 1H), 7.80 (dd, J = 1.0 Hz and J = 8.2 Hz, 1H), 8.59 (t, J = 2.1 Hz, 1H), 10.52 (bs, 1H); LC/MS (ESI): 349.00 [M-H]" and 351.11 [M+H]+ ; purity > 99% ; yellow powder. Yield = 28%.
2£)-iV-(2-methoxyphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enainide 69
LH NMR (DMSO-i/6, 250 MHz) : δ = 3.66 (s, 3H), 6.69-6.89 (m, 4H), 7.16-7.29 (m, 4H), 7.34 (d, J = 3.8 Hz, 1H), 7.46-7.52 (m, 3H), 7.94 (bd, J= 7.7 Hz, 1H), 9.21 (bs, 1H) ; LC/MS (ESI): 336,16 [M+H]+; purity > 99% ; slight yellow powder. Yield = 72%.
(2£')-2-cyano-/V-[4-(morpholin-4-yl)phenyl]-3-(5-nitrothiophen-2-yl)prop-2-enamide 82 LH NMR (DMSO-<¾, 250 MHz): δ = 2.86 (bt, J = 4.5 Hz, 4H), 3.57 (bt, J = 4.5 Hz, 4H), 6.76 (d, J = 8.9 Hz, 2H), 7.33 (d, J= 9.0 Hz, 2H), 7.74 (d, J = 4.4 Hz, 1H), 8.07 (d, J = 4.3 Hz, 1H), 8.34 (s, 1H), 10.13 (s, 1H); LC/MS (ESI): 383.04 [M-H]", 385.09 [M+H]+ ; purity = 99% ; brown powder. Yield = 40%.
(2£)-2-cyano-3-(5-nitrothiophen-2-yl)-/V-(4-propoxyphenyl)prop-2-enamide 83
LH NMR (DMSO-i/6, 250 MHz): δ = 0.72 (t, J= 7.4 Hz, 3H), 1.43 (m, 2H), 3.66 (t, J= 6.5 Hz, 2H), 6.70 (d, J= 9.1 Hz, 2H), 7.31 (d, = 9.1 Hz, 2H), 7.70 (d, .7= 4.6 Hz, 1H), 8.03 (d, .7= 4.6 Hz, 1H), 8.32 (s, 1H), 10.16 (bs, 1H); LC/MS (ESI): 356.00 [M-H]"; purity > 99% ; yellow powder. Yield = 31%.
(2£)-2-cyano-/V-(4-acetamidophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 84
LH NMR (DMSO-J(5, 250 MHz): δ = 1.82 (s, 3H), 7.36 (bs, 4H), 7.71 (d, J= 4.0 Hz, 1H), 8.06 (d, J = 4.0 Hz, 1H), 8.33 (s, 1H), 9.76 (bs, 1H), 10.24 (bs, 1H); LC/MS (ESI): 354.98 [M-H]", 356.99 [M+H]+; purity > 99% ; yellow powder. Yield = 58%.
(2£')-2-cyano-3-(5-nitrothiophen-2-yl)-/V-[4-(l,3,4-oxadiazol-2-yl)phenyl]prop-2-enamide 85
B NMR (DMSO-i¾, 250 MHz): δ = 7.98 (d, J= 9.0 Hz, 2H), 8.02 (d, J= 4.3 Hz, 1H), 8.12 (d, J = 8.9 Hz, 2H), 8.33 (d, J = 4.2 Hz, 1H), 8.66 (s, 1H), 9.38 (s, 1H), 10.88 (s, 1H) ; LC/MS (ESI): 366.00 [M-H]", 367.97 [M+H]+; purity = 98% ; orange powder. Yield = 43%.
(2£')-3-(5-bromothiophen-2-yl)-2-cyano-/V-(4-propoxyphenyl)prop-2-enainide 88
LH NMR (DMSO-<¾ 250 MHz): δ = 0.77 (t, J= 7.6 Hz, 3H), 1.54 (m, 2H), 3.77 (t, J= 6.5 Hz, 2H), 6.67 (d, J = 9.0 Hz, 2H), 7.25 (d, J = 4.1 Hz, 1H), 7.27 (d, J= 9.0 Hz, 2H), 7.60 (d, J= 4.1 Hz, 1H), 8.20 (s, 1H), 9.92 (bs, 1H); LC/MS (ESI): 388.96 [M-H]" and isotopic peak 390.97, 391.08 [M+H]+ and isotopic peak 393.09 ; purity > 99% ; yellow powder. Yield = 26%.
(2£')-3-(5-bromothiophen-2-yl)-2-cyano-Ar-(4-acetamidophenyl)prop-2-enamide 89
B NMR (DMSO-c¾, 250 MHz): δ = 1.89 (s, 3H), 7.41-7.60 (m, 6H), 8.29 (s, 1H), 9.77 (bs, 1H), 10.07 (bs, 1H); LC/MS (ESI): 387.99 [M-H]" and isotopic peak 390.02, 390.06 [M+H]+ and isotopic peak 392.06 ; purity > 99% ; yellow powder. Yield = 16%.
(2£')-3-(5-bromothiophen-2-yl)-2-cyano-/V-[4-(l,3,4-oxadiazol-2-yl)phenyl]prop-2-enamide 90
LH NMR (DMSO-i¾, 250 MHz): δ = 7.30 (d, J= 4.0 Hz, 1H), 7.56 (d, J= 4.1 Hz, 1H), 7.67 (d, J = 8.8 Hz, 2H), 7.80 (d, J = 8.8 Hz, 2H), 8.3 (bs, 1H), 9.12 (s, 1H), 10.45 (bs, 1H) ; LC/MS (ESI): 399.00 [M-H]" and isotopic peak 400.95, 401.07 [M+H]+ and isotopic peak 403.01 ; purity > 99% ; slight yellow powder. Yield = 10%.
(2£')-2-cyano-/V-[4-(morpholin-4-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 92
LH NMR (DMSO-<¾, 250 MHz): δ = 3.12 (bt, J = 4.7 Hz, 4H), 3.75 (bt, J = 4.7 Hz, 4H), 7.01 (d, J = 9.0 Hz, 2H), 7.65-7.49 (m, 5H), 7.85 (m, 3H), 8.00 (d, J = 4.1 Hz, 1H), 8.51 (s, 1H), 10.11 (s, 1H) ; LC/MS (ESI): 416.14 [M+H]+; purity = 85% ; slight orange powder. Yield = 15%.
(2£)-2-cyano-3-(5-phenylthiophen-2-yl)-/V-(4-propoxyphenyl)prop-2-enamide 93
LH NMR (DMSO-i/6, 250 MHz): δ = 1.05 (t, J= 7.5 Hz, 3H), 1.79 (m, 2H), 4.00 (t, J= 6.5 Hz, 2H), 7.05 (d, J= 8.9 Hz, 2H), 7.33 (d, J = 8.9 Hz, 2H), 7.44 (d, J= 7.1 Hz, 1H), 7.53 (m , 3H), 7.70 (bs, 2H), 7.82 (m, 2H), 8.81 (bs, 1H) ; LC/MS (ESI): 389.13 [M+H]+ ; purity = 84% ; slight yellow powder. Yield = 67%.
(2£)-2-cyano-/V-(4-acetamidophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 94
LH NMR (DMSO-iM, 250 MHz): δ = 1.80 (s, 3H), 7.20-7.33 (m, 7H), 7.55 (d, J = 4.0 Hz, 1H), 7.59 (m, 2H), 7.71 (d, J = 4.0 Hz, 1H), 8.28 (s, 1H), 9.72 (bs, 1H), 10.02 (bs, 1H) ; LC/MS (ESI): 386.04 [M-H]\ 388.11 [M+H]+ ; purity > 99% ; slight yellow powder. Yield = 31%.
(2£')-2-cyano-/V-[4-(l,3,4-oxadiazol-2-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 95
B NMR (DMSO-c¾, 250 MHz): δ = 7.30 (m, 3H), 7.46 (m, 1H), 7.63 (m, 2H), 7.73 (d, J = 8.9 Hz, 2H), 7.80 (d, J= 4.1 Hz, 1H), 7.85 (d, J= 8.9 Hz, 2H), 8.38 (s, 1H), 9.15, (s, 1H), 10.45 (bs, 1H); LC/MS (ESI): 397.02 [M-H]\ 399.11 [M+H]+ ; purity = 92% ; yellow powder. Yield = 10%.
l-{4-[(2ii)-3-(5-bromothiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 99 Ή NMR (DMSO-cM, 250 MHz): δ = 6.39 (d, J = 15.3 Hz, 1H), 7.10 (d, J = 5.4 Hz, 1H), 7.11 (d, J = 3.6 Hz, 1H), 7.47-7.73 (m, 6H), 8.03 (s, 1H), 9.45 (s, 1H), 10.58 (bs, 1H) ; LC/MS (ESI) : 371.83 [M-H]" and isotopic peak 373.84, 373.95 [M+H]+ and isotopic peak 375.95 ; purity > 99% ; slight brown powder. Yield = 65%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(4-chlorophenyl)prop-2-enamide 100
LH NMR (DMSO-cM, 250 MHz): δ = 6.57 (d, J = 15.3 Hz, 1H), 7.37 (d, J = 3.9 Hz, 1H), 7.41 (d, J = 3.8 Hz, 1H), 7.45 (d, J = 8.9 Hz, 2H), 7.75 (d, J= 15.3 Hz, 1H), 7.77 (d, J= 8.9 Hz, 2H), 10.41 (s, 1H) ; LC/MS (ESI): 339.73 [M-H]" and isotopic peak 341.75, 341.83 [M+H]+ and isotopic peak 343.83 ; purity = 99% ; white powder. Yield = 38%.
(2£')-iV-(4-cyanophenyl)-3-(5-phenylthiophen-2-yl)-prop-2-enamide 103
LH NMR (DMSO-i 6, 250 MHz): δ = 6.35 (d, J = 15.3 Hz, 1H), 7.10-7.16 (m, 1H), 7.19-7.26 (m, 2H), 7.28 (d, J = 3.8 Hz, 1H), 7.34 (d, J= 3.8 Hz, 1H), 7.46 (m, 1H), 7.49-7.55 (dd, J = 1.4 Hz and J = 8.3 Hz, 2H), 7.56-7.66 (m, 4H), 10.39 (s, 1H) ; LC/MS (ESI): 328.90 [M-H]", 330.95 [M+H]+ ; purity = 99% ; yellow powder. Yield = 40%.
(2£)-/V-(3-chloro-4-propoxyphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 104
LH NMR {OMSO-d6, 250 MHz): δ = 0.96 (t, J = 7.4 Hz, 3H), 1.70 (m, 2H), 3.94 (t, J = 6.4 Hz, 2H), 6.49 (d, J = 15.4 Hz, 1H), 7.08 (d, J= 9.0 Hz, 1H), 7.08 (bt, J= 9.0 Hz, 1H), 7.40-7.46 (m, 4H), 7.52 (d, J = 3.8 Hz, 1H), 7.66-7.70 (m, 3H), 7.86 (d, J = 2.4 Hz, 1H), 10.19 (s, 1H) ; 13C NMR (DMSO-iM, 62 MHz): δ = 10.90, 22.54, 70.75, 114.76, 1 19.44, 121.05, 121.14, 121.64, 125.48, 126.13, 128.98, 129.80, 133.50, 133.57, 133.63, 139.48, 145.64, 150.46, 163.53 ; LC/MS (ESI): 255.83 LC/MS (ESI): 398.1 [M+H]+ ; purity = 99% ; yellow powder. Yield = 11%.
2£)-3-(5-bromothiophen-2-yl)-Ar-(3-chloro-4-propoxyphenyl)prop-2-enamide 107
LH NMR (OMSO-d6, 250 MHz) : δ = 0.97 (t, J = 7.4 Hz, 3H), 1.73 (m, 2H), 3.96 (t, J = 6.4 Hz, 2H), 6.42 (d, J = 15.4 Hz, 1H), 7.09 (d, J = 9.0 Hz, 1H), 7.26 (d, J = 3.9 Hz, 1H), 7.29 (d, J = 3.9 Hz, 1H), 7.44 (dd, .7= 2.5 Hz and J= 8.9 Hz, 1H), 7.64 (d, J= 15.4 Hz, 1H), 7.86 (d, J = 2.4 Hz, 1H), 10.21 (s, 1H) ; 13C NMR (OMSO-d6, 62 MHz) : δ = 10.30, 21.96, 70.20, 1 13.18, 114.20, 118.91, 120.61 , 121.09, 121.20, 131.83, 132.00, 132.27, 132.80, 141.45, 149.98, 162.68 ; LC/MS (ESI): 399.8 [M+H]+ and isotopic peak 402.1 ; purity = 98% ; yellow powder. Yield = 22%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(5-oxo-5,6,7,8-tetrahydronaphthalen-2-yl)prop-2- enamide 108
LH NMR (OMSO-d6, 250 MHz) : δ = 2.00 (m, 2H), 2.49 (m, 2H), 2.90 (m, 2H), 6.50 (d, J = 15.4 Hz, 1H), 7.28 (d, J = 3.8 Hz, 1H), 7.32 (d, J = 3.7 Hz, 1H), 7.55 (d, J = 8.5 Hz, 1H), 7.64 (d, J = 15.3 Hz, 1H), 7.69 (s, 1H), 7.82 (d, J = 8.6 Hz, 1H), 10.48 (s, 1H) ; LC/MS (ESI): 376.1 [M+H]+ and isotopic peak 378.0 ; purity = 95% ; white powder. Yield = 23%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-[4-(trifluoromethoxy)phenyl]prop-2-enamide 109
'H MR (CDCh, 250 MHz) : δ = 6.27 (d, J = 15.1 Hz, 1H), 6.93 (d, J = 3.8 Hz, 1H), 6.99 (d, J = 3.8 Hz, 1H), 7.16 (d, J = 8.7 Hz, 2H), 7.63 (d, J= 8.8 Hz, 2H), 7.73 (d, J= 15.2 Hz, 1H), 7.84 (bs, 1H) ; LC/MS (ESI): 392.1 [M-H]" and 394.5 [M+H]+ ; purity = 99% ; white powder. Yield = 57%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(4-butoxyphenyl)prop-2-enamide 110
LH NMR (DMSO-i , 250 MHz) : δ = 0.91 (t, J = 7.3 Hz, 3H), 1.40 (m, J = 7.3 Hz, 2H), 1.77 (m, 2H), 3.90 (q, J = 6.4 Hz, 2H), 6.47 (d, J = 15.4 Hz, 1H), 6.89 (d, J = 9.0 Hz, 2H), 7.24 (d, J = 3.9 Hz, 1H), 7.27 (d, J = 3.9 Hz, 1H), 7.54 (d, J = 8.9 Hz, 2H), 7.59 (d, J = 15.3 Hz, 1H), 10.07 (s, 1H) ; 13C NMR (DMSO-if5, 62 MHz) : δ = 13.66, 18.71, 30.76, 67.20, 113.47, 1 14.45, 120.53, 121.76, 131.64, 131.70, 131.75, 132.23, 141.65, 154.73, 162.40; LC/MS (ESI): 380.1 [M+H]+ and isotopic peak 382.4; purity = 99% ; brown-yellow powder. Yield = 28%.
(2£)-3-(5-bromothiophen-2-yl)-A/-[4-(propan-2-yloxy)phenyl]prop-2-enamide 111
LH NMR (DMSO- 6, 250 MHz) : δ = 1.20 (d, J= 6.0 Hz, 6H), 3.94 (hept, J = 6.1 Hz, 1H), 6.41 (d, J = 15.4 Hz, 1H), 6.83 (d, J = 9.0 Hz, 2H), 7.24 (d, = 3.9 Hz, 1H), 7.26 (d, = 4.0 Hz, 1H), 7.56 (d, J= 8.9 Hz, 2H), 7.62 (d, J= 15.4 Hz, 1H), 10.06 (s, 1H) ; LC/MS (ESI): 366.1 [M+H]+ and isotopic peak 368.1 ; purity = 96% ; brown powder. Yield = 45%.
(2£)-iV-(3-cyanopheny])-3-(5-phenylthiophen-2-yl)prop-2-enamide 113
LH NMR DMSO-d6, 250 MHz): δ = 6.53 (d, J = 15.4 Hz, 1H), 7.31-7.57 (m, 7H), 7.68-7.72 (m, 2H), 7.80-7.87 (m, 2H), 8.19 (bs, 1H), 10.56 (s, 1H) ; LC/MS (ESI): 331.2 [M+H]+ ; purity = 99% ; yellow powder. Yield = 16%.
(2£)-3-(5-bromothiophen-2-yl)-Ar-(4-phenoxyphenyl)prop-2-enamide 116
LH NMR (CDCh, 250 MHz) : δ = 6.25 (d, J = 15.1 Hz, 1H), 6.97 (m, 6H), 7.1 1 (m, 1H), 7.33 (m, 2H), 7.54 (m, 2H), 7.74 (d, J = 15.1 Hz, 1H) ; LC/MS (ESI): 400.1 [M+H]+ and isotopic peak 402.0 ; purity = 98% ; green/grey powder. Yield = 54%.
(2£')-iV-(3-bromophenyl)-3-(5-bromothiophen-2-yl)prop-2-enamide 117
[H NMR (CDCh, 250 MHz) : 6.29 (d, J = 15.2 Hz, 1H), 6.89 (d, J = 3.9 Hz, 1H), 6.96 (d, J = 3.9 Hz, 1H), 7.10-7.26 (m, 2H), 7.52 (dt, 7 = 1.8 Hz and 7.7 Hz, 1H), 7.70 (d, J = 15.2 Hz, 1H), 7.85 (bs, 1H), 8.15 (s, 1H) ; LC/MS (ESI): 386.1 [M-H]" and 388.4 [M+H]+ ; purity = 94% ; light yellow oil. Yield = 25%.
(2£,)-3-(5-bromothiophen-2-yl)-Ar-(4-ethoxyphenyl)prop-2-enamide 118
LH NMR (OMSO-d6, 250 MHz) : δ = 1.29 (t, J = 7.0 Hz, 3H), 3.94 (q, J = 6.9 Hz, 2H), 6.42 (d, J = 15.4 Hz, 1H), 6.87 (d, J = 9.0 Hz, 2H), 7.24 (d, J = 3.9 Hz, 1H), 7.28 (d, J = 3.9 Hz, 1H), 7.54 (d, J= 9.1 Hz, 2H), 7.58 (d, J= 15.5 Hz, 1H), 10.07 (s, 1H) ; LC/MS (ESI): 382.1 [M+H]+ and isotopic peak 354.1 ; purity = 99% ; brown powder. Yield = 47%.
(2£')-3-(4-phenylthiophen-2-yl)-Ar-(4-propoxyphenyl)prop-2-enamide 120
LH NM (OMSO-d6, 250 MHz) : δ = 0.95 (t, J= 7.4 Hz, 3H), 1.69 (m, 2H), 3.87 (t, J= 6.5 Hz, 2H), 6.58 (d, J= 15.4 Hz, 1H), 6.88 (d, J= 9.0 Hz, 2H), 7.27-7.46 (m, 3H), 7.58 (d, J= 9.0 Hz, 2H), 7.69-7.77 (m, 3H), 7.87 (bs, 1H), 7.95 (bs, 1H), 10.08 (s, 1H) ; LC/MS (ESI): 364.2 [M+H]+ ; purity = 96% ; off-white powder. Yield = 60%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-[4-(2-methoxyethoxy)phenyl]prop-2-enamide 122
LH NMR (OMSO-d6, 250 MHz) : δ = 3.28 (s, 3H), 3.62 (m, 2H), 3.98 (m, 2H), 6.45 (d, J= 15.4 Hz, 1H), 6.89 (d, J= 9.0 Hz, 2H), 7.25 (d, J= 3.9 Hz, 1H), 7.27 (d, J= 4.0 Hz, 1H), 7.57 (d, J= 8.9 Hz, 2H), 7.63 (d, J = 15.3 Hz, 1H), 10.08 (s, 1H) ; LC/MS (ESI): 388.4 [M+H]+ and isotopic peak 384.2 ; purity = 97% ; yellow powder. Yield = 39%.
(2£')-3-(5-bromothiophen-2-yl)-A/-(l-oxo-2,3-dihydro-l/ -inden-5-yl)prop-2-enamide 123
LH NMR (OMSO-d6, 250 MHz) : δ = 2.60 (m, 2H), 3.06 (m, 2H), 6.51 (d, J = 15.4 Hz, 1H), 7.28 (d, J= 3.9 Hz, 1H), 7.34 (d, J = 3.9 Hz, 1H), 7.58 (m, 2H), 7.71 (d, J= 15.4 Hz, 1H), 7.99 (s, 1H), 10.58 (s, 1H) ; LC/MS (ESI): 362.0 [M+H]+ and isotopic peak 364.1 ; purity = 97% ; yellow powder. Yield = 8%.
4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamido]-iV-methylbenzamide 125
LH NMR (OMSO-d6, 250 MHz) : δ = 2.75 (d, J = 4.3 Hz, 3H), 6.51 (d, J = 15.4 Hz, 1H), 7.27 (d, J= 3.8 Hz, 1H), 7.31 (d, .7= 3.9 Hz, 1H), 7.68 (d, J= 15.6 Hz, 1H), 7.71 (d, J= 8.7 Hz, 2H),
7.79 (d, J = 8.8 Hz, 2H), 8.33 (bd, J = 4.4 Hz, 1H), 10.45 (s, 1H) ; LC/MS (ESI): 365.1
[M+H]+ and isotopic peak 367.1 ; purity = 99% ; yellow/green powder. Yield = 33%.
(2£)-3-(5-bromothiophen-2-yl)-Ar-(4-methoxyphenyl)prop-2-enamide 128
LH NMR (CDC13, 250 MHz) : δ = 3.75 (s, 3H), 6.31 (d, J = 15.2 Hz, 1H), 6.81 (d, J = 9.0 Hz, 2H), 6.85 (d, J = 3.8 Hz, 1H), 6.95 (d, J = 3.9 Hz, 1H), 7.50 (d, J = 8.9 Hz, 2H), 7.68 (d, J =
15.2 Hz, 1H), 8.12 (bs, 1H) ; LC/MS (ESI): 338.2[M-H]" and 340.5 [M+H]+ ; purity = 98% ; yellow powder. Yield = 11%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-[3-chloro-4-(2-methoxyethoxy)phenyl]prop-2-enamide 130
lB NMR (CDCI3, 250 MHz) : δ = 3.47 (s, 3H), 3.80 (t, J = 4.9 Hz, 2H), 4.14 (d, J = 4.9 Hz, 2H), 6.22 (d, J = 15.2 Hz, 1H), 6.89 (d, J = 8.9 Hz, 1H), 6.96 (d, J = 4.0 Hz, 1H), 7.00 (d, J = 3.9 Hz, 1H), 7.41-7.64 (m, 2H), 7.72 (d, J = 15.1 Hz, 1H) ; LC/MS (ESI): 413.71 [M-H]" and isotopic peak 415.69 and 415.75 [M+H]+ and isotopic peak 417.77 ; purity = 99% ; yellow powder. Yield = 30%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-[2-(4-propoxyphenyl)ethyl]prop-2-enamide 131 [H NMR (CDCI3, 250 MHz) : δ = 1.03 (t, J = 7.4 Hz, 3H), 1.81 (m, 2H), 2.81 (t, J = 6.8 Hz, 2H), 3.60 (q, J= 6.6 Hz, 2H), 3.90 (d, J= 6.5 Hz, 2H), 5.58 (bs, 1H), 6.00 (d, J= 15.2 Hz, 1H), 6.86 (d, J= 8.2 Hz, 2H), 6.93 (d, J = 3.9 Hz, 1H), 6.98 (d, J= 3.8 Hz, 1H), 7.12 (d, J = 8.3 Hz, 2H), 7.61 (d, J= 15.2 Hz, 1H) ; LC/MS (ESI): 394.05 [M+H]+ and isotopic peak 396.09 ; purity = 99% ; off-white powder. Yield = 71%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-[3-chloro-4-(morpholin-4-yl)phenyl]prop-2-enamide 132 ¾ NMR (CDCI3, 250 MHz) : δ = 3.02 (m, 4H), 3.87 (m, 4H), 6.20 (d, J= 15.2 Hz, 1H), 6.99 (d, J= 3.6 Hz, 1H), 7.01 (d, J= 3.7 Hz, 1H), 7.32 (m, 2H), 7.43 (m, 1H), 7.69 (d, J= 15.2 Hz, 1H), 7.73 (bs, 1H) ; LC/MS (ESI): 424.71 [M-H]" and isotopic peak 426.70 and 426.74 [M+H]+ and isotopic peak 428.76 ; purity = 98% ; light brown powder. Yield = 50%.
(2£)-3-(2-phenyl-l,3-thiazol-5-yl)-Ar-(4-propoxyphenyl)prop-2-enamide 133
LH NMR (DMSO-£¾, 200 MHz): δ = 0.95 (t, J = 7.4 Hz, 3H), 1.69 (m, 2H) 3.87 (t, J = 6.5 Hz, 2H), 6.58 (d, J= 15.4 Hz, 1H), 6.89 (d, J= 9.0 Hz, 2H), 7.49-7.55 (m, 3H), 7.58 (d, J= 9.0 Hz, 2H), 7.77 (d, J= 15.3 Hz, 1H), 7.98 (m, 2H), 8.20 (s, 1H), 10.15 (s, 1H) ; LC/MS (ESI): 365.2 [M+H]+ ; purity = 99% ; yellow powder. Yield = 54%.
(2£')-/V-(5-propoxypyridin-2-yl)-3-[2-(pyridin-2-yl)-l,3-thiazol-5-yl]prop-2-enamide 134 LH NMR (DMSO-<¾, 200 MHz): δ = 0.95 (t, J = 7.4 Hz, 3H), 1.71 (m, 2H) 3.91 (t, J = 6.5 Hz, 2H), 6.84 (d, J= 15.4 Hz, 1H), 7.43 (dd, J = 2.9 Hz and J = 9.1 Hz, 1H), 7.52 (m, 1H), 7.8 (d, J = 15.4 Hz, 1H), 8.04 (m, 2H), 8.14 (d, J = 8.9 Hz, 2H), 8.25 (s, 1H), 8.66 (d, J = 4.5 Hz, 1H), 10.61 (s, 1H) ; LC/MS (ESI): 367.1 [M+H]+ ; purity = 95% ; white powder. Yield = 11%.
(2£)-3-(2-phenyl-l,3-thiazol-5-yl)-/V-(5-propoxypyridin-2-yl)prop-2-enamide 138
LH NMR (DMSO-i¾, 200 MHz): δ = 0.96 (t, J = 7.4 Hz, 3H), 1.68 (m, 2H) 3.96 (t, J = 6.5 Hz, 2H), 6.79 (d, J = 15.5 Hz, 1H), 7.43 (dd, J = 2.9 Hz and J = 9.0 Hz, 1H), 7.49-7.62 (m, 3H), 7.82 7.91 (d, J = 15.3 Hz, 1H), 7.97 (m, 2H), 8.04 (d, .7= 2.7 Hz, 1H), 8.15 (d, J = 9.1 Hz, 1H), 8.21 (s, 1H), 10.65 (s, 1H) ; LC/MS (ESI): 366.2 [M+H]+ ; purity = 99% ; yellow powder. Yield = 11%.
(2£)-/V-(3-chloro-4-propoxyphenyl)-3-(2-pheny]-l,3-thiazol-5-yl)prop-2-enamide 141
LH NMR (DMSO-iM, 200 MHz): δ = 0.97 (t, J = 7.4 Hz, 3H), 1.71 (m, 2H) 3.95 (t, J = 6.4 Hz, 2H), 6.54 (d, J = 15.3 Hz, 1H), 7.12 (d, J = 9.0 Hz, 1H), 7.53 (m, 4H), 7.78 (d, J = 15.3 Hz, 1H), 7.87 (d, J = 2.4 Hz, 1H), 7.96 (m, 2H), 8.21 (s, 1H), 10.19 (s, 1H) ; LC/MS (ESI): 399.1 [M+H]+ ; purity = 100%; yellow solid. Yield =25%.
(2£)-3-(5-bromothiophen-2-yl)-Ar-(2-propoxypyrimidin-5-yl)prop-2-enamide 142
LH NMR (DMSO-iM, 200 MHz): δ = 0.94 (t, J = 7.4 Hz, 3H), 1.73 (m, 2H) 4.20 (t, J = 6.7 Hz, 2H), 6.44 (d, J = 15.5 Hz, 1H), 7.27 (d, J= 3.9 Hz, 1H), 7.32 (d, J= 15.4 Hz, 1H), 7.69 (d, J = 3.9 Hz, 1H), 8.80 (s, H), 10.45 (s, 1H) ; LC/MS (ESI): 370.0 [M+H]+ ; purity = 96%; white solid. Yield = 25%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(quinolin-3-yl)prop-2-enamide 143
B NMR (DMSO-c¾, 200 MHz): δ = 6.77 (d, J = 15.5 Hz, 1H), 7.29 (d, J = 3.9 Hz, 1H), 7.35 (d, J = 3.9 Hz, 1H), 7.76 (d, J= 15.4 Hz, 1H), 7.74-7.93 (m, 2H), 8.17 (t, J= 8.2 Hz, 2H), 9.12 (d, J = 1.8 Hz, 1H), 9.39 (d, J = 2.2 Hz, 1H), 11.82 (s, 1H) ; LC/MS (ESI): 359.0 [M+H]+ ; purity = 99%; yellow solid. Yield = 91%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(isoquinolin-4-yl)prop-2-enamide 144
LH NMR (DMSO-c¾, 200 MHz): δ = 7.26-7.42 (m, 3H), 7.79 (d, J = 15.5 Hz, 1H), 7.97 (m, 1H), 8.14 (m, 1H), 8.46 (d, J= 8.2 Hz, 1H), 8.89 (d, J= 8.5 Hz, 1H), 9.21 (s, 1H), 9.57 (s, 1H), 11.15 (s, 1H) ; LC/MS (ESI): 359.1 [M+H]+ ; purity = 96%; grey-green solid. Yield = 94%. (2£')-3-(5-bromothiophen-2-yl)-Ar-(6-propoxypyridin-3-yl)prop-2-enamide 145
LH NMR (DMSO-cM, 200 MHz): δ = 0.93 (t, J = 7.3 Hz, 3H), 1.70 (m, 2H) 4.14 (t, J = 6.6 Hz, 2H), 6.46 (d, J = 15.6 Hz, 1H), 6.79 (d, J = 8.9 Hz, 1H), 7.27 (m, 2H), 7.65 (d, J = 15.5 Hz, 1H), 7.97 (dd, J= 1.9 Hz and J= 8.7 Hz, 1H), 8.40 (d, J= 31.6 Hz, 1H), 10.29 (s, 1H) ; LC/MS (ESI): 369.1 [M+H]+ ; purity = 98%; pale yellow solid. Yield = 35%.
Procedure B
3-(Thien-2-yl)- or 3-(Thiazol-5-yl)acrylic acid derivative (leq, 500mg) was dissolved in dry toluene (20mL). Thionyl chloride (lOeq, 2.36mL) was added and the reaction mixture was refluxed for lh. Excess of thionyl chloride was removed by concentration in vacuo to brown oil which was used without further purification in the next reaction step. The crude acyl chloride was dissolved in dry dichloromethane and a solution of substituted aniline or (4- propoxyphenyl)methanamine (1.2eq) in dry pyridine (5mL) was added. The reaction mixture was stirred at room temperature for 5h. After completion, the reaction mixture was poured into IN aqueous solution of hydrochloric acid (lOmL). The organic layer was washed twice with IN aqueous solution of hydrochloric acid (IN), then twice with saturated NaHCC>3, water and brine. The organic layer was dried under MgSC>4, then filtered off and concentrated under reduced pressure. The crude product was purified by flash chromatography (cyclohexane/ethyl acetate or dichloromethane/methanol) afforded the final product.
(2£)-iV-(2-methoxy-4-nitrophenyl)-3-(thiophen-2-yl)prop-2-enainide 4
LH NMR DMSO-d6, 250 MHz): δ = 3.40 (s, 3H), 7.15 (d, J = 15.4 Hz, 1H), 7.20 (dd, J = 3.5 Hz and 5.0 Hz, 1H), 7.57 (bd, J = 3.4 Hz, 1H), 7.76 (bd, J = 5.1 Hz, 1H), 7.84 (d, J= 15.4 Hz, 1H), 7.90 (d, J = 2.5 Hz, 1H), 7.98 (dd, J = 2.5 Hz and 9.0 Hz, 1H), 8.62 (d, J = 9.0 Hz, 1H), 9.95 (bs, 1H) ; LC/MS (ESI): 302.92 [M-H]" and 304.94 [M+H]+ ; purity = 96% ; slight yellow powder. Yield = 64%.
(2£')- V-(2-methoxy-4-nitrophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 6
LH NMR (DMSO-c¾, 250 MHz): δ = 3.87 (s, 3H), 7.20 (d, J = 15.6 Hz, 1H), 7.41 (d, J = 4.4 Hz, 1H), 7.65 (d, J= 15.6 Hz, 1H), 7.70 (bs, 1H), 7.76 (dd, J= 2.4 Hz and 9.0 Hz, 1H), 7.99 (d, J= A3 Hz, 1H), 8.37 (d, J= 9.0 Hz, 1H), 9.85 (bs, 1H) ; LC/MS (ESI): 347.90 [M-H]" ; purity > 99% ; orange powder. Yield = 10%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(2-methoxy-4-nitrophenyl)prop-2-enamide 44
LH NMR (DMSO-i 6, 250 MHz): δ = 4.16 (s, 3H), 7.07 (d, J = 15.1 Hz, 1H), 7.36 (d, J = 3.9 Hz, 1H), 7.40 (d, J = 3.9 Hz, 1H), 7.77 (d, J= 15.2 Hz, 1H), 7.89 (d, J= 2.5 Hz, 1H), 7.97 (dd, J= 2.5 Hz and 9.0 Hz, 1H), 8.62 (d, J= 9.0 Hz, 1H), 9.93 (bs, 1H) ; LC/MS (ESI): 380.92 [M- H]" and isotopic peak 382.91, 382.97 [M+H]+ and isotopic peak 385.00 ; purity = 96% ; slight yellow powder. Yield = 76%.
(2£')-iV-(2-methoxy-4-nitrophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 51
LH NMR (DMSO- 6, 250 MHz): 5 = 4.10 (s, 3H), 7.18 (d, J= 15.4 Hz, 1H), 7.45 (m, 1H), 7.51 (m, 2H), 7.57 (d, J = 3.9 Hz, 1H), 7.65 (d, J = 3.9 Hz, 1H), 7.77 (m, 2H), 7.81 (d, J= 15.4 Hz, 1H), 7.90 (d, J = 2.5 Hz, 1H), 7.98 (dd, J = 2.5 Hz and 9.0 Hz, 1H), 8.65 (d, J = 9.0 Hz, 1H), 9.98 (bs, 1H); LC/MS (ESI): 378.87 [M-H]" and 381.03 [M+H]+ ; purity > 99% ; slight yellow powder. Yield = 44%.
(2E) Ar-(2-methoxy-4-nitropheny])-3-(5-methylthiophen-2-y])prop-2-enamide 97
LH NMR (DMSO- 6, 250 MHz): δ = 2.55 (s, 3H), 4.07 (s, 3H), 6.90 (dd, J= 1.2 Hz and J = 3.6 Hz, 1H), 6.97 (d, J= 15.3 Hz, 1H), 7.34 (d, J= 3.6 Hz, 1H), 7.68 (d, J= 15.3 Hz, 1H), 7.84 (d, J= 2.5 Hz, 1H), 7.92 (dd, J= 2.5 Hz and J= 9.0 Hz, 1H), 8.56 (d, J= 9.0 Hz, 1H), 9.86 (s, 1H) ; LC/MS (ESI): 316.91 [M-H]", 318.96 [M+H]+ ; purity = 99% ; yellow powder. Yield = 61%. (2£')-3-(4-bromothiophen-2-yl)-Ar-(2-methoxy-4-nitrophenyl)prop-2-enamide 101
LH NMR (DMSO-iM, 250 MHz): δ = 4.01 (s, 3H), 7.13 (d, J = 15.3 Hz, 1H), 7.51 (d, J = 1.1 Hz, 1H), 7.76 (d, J= 1 .7 Hz, 1H), 7.80 (d, J= 1.1 Hz, 1H), 7.84 (d, J= 2.5 Hz, 1H), 7.93 (dd, J = 2.5 Hz and J = 9.0 Hz, 1H), 8.52 (d, J = 9.0 Hz, 1H), 9.89 (s,lH) ; LC/MS (ESI): 380.80 [M-H]" and isotopic peak 382.80, 382.80 [M+H]+ and isotopic peak 384.79 ; purity = 96% ; yellow powder. Yield = 55%.
(2£)-/V-ethyl-/V-(3-methanesulfonylphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 115 LH NMR (DMSO-£¾, 250 MHz): 1.15 (t, J= 7.0 Hz, 3H), 3.38 (s, 3H), 3.92 (q, J= 7.0 Hz, 2H), 6.12 (bd, J= 15.6 Hz, 1H), 7.38-7.50 (m, 4H), 7.56 (d, J= 3.8 Hz, 1H), 7.67-7.94 (m, 6H), 8.04 (d, J= 7.6 Hz, 1H) ; LC/MS (ESI): 412.0 [M+H]+ ; purity = 98% ; yellow powder. Yield = 15%. (2£')-3-(5-bromothiophen-2-yl)-Ar-(5-propoxypyridin-2-yl)prop-2-enamide 135 Ή NMR (DMSO-£¾, 200 MHz): δ = 0.96 (t, J = 7.4 Hz, 3H), 1.73 (m, 2H) 3.96 (t, J = 6.5 Hz, 2H), 6.67 (d, J = 15.5 Hz, 1H), 7.26 (m, 2H), 7.42 (dd, J = 3.0 Hz and J= 9.1 Hz, 1H), 7.67 (d, J= 15.4 Hz, 1H), 8.0 (d, J= 2.8 Hz, 1H), 8.12 (d, J= 9.0 Hz, 1H), 10.55 (s, 1H) ; LC/MS (ESI): 369-1 [M+H]+ ; purity = 95% ; yellow solid. Yield = 37%.
(2£')-3-(5-bromothiophen-2-yl)-Ar-(6-chloropyridin-2-yl)prop-2-enamide 136
LH NMR (DMSO-c¾, 200 MHz): δ = 6.65 (d, J = 15.5 Hz, 1H), 7.20 (d, J = 7.4 Hz, 1H), 7.27 (d, J= 3.9 Hz, 1H), 7.31 (d, J= 3.9 Hz, 1H), 7.72 (d, J= 15.4 Hz, 1H), 7.85 (t, J= 8.0 Hz, 1H), 8.17 (d, J= 8.0 Hz, 1H), 11.00 (s, 1H) ; LC/MS (ESI): 344.9 [M+H]+ ; purity = 99% ; off white solid. Yield = 54%.
(2£ -3-(2-phenyl-l,3-thiazol-5-yi)- V- [(4-propoxyphenyl)methyl]prop-2-enamide 137
LH NMR (DMSO-i¾, 200 MHz): δ = 0.93 (t, J = 7.4 Hz, 3H), 1.68 (m, 2H) 3.87 (t, J = 6.5 Hz, 2H), 4.30 (d, J = 5.7 Hz, 2H), 6.46 (d, J = 15.4 Hz, 1H), 6.88 (d, J = 8.6 Hz, 2H), 7.18 (d, J = 8.6 Hz, 2H), 7.46-7.54 (m, 3H), 7.68 (d, J= 15.4 Hz, 1H), 7.89-7.99 (m, 2H), 8.14 (s, 1H), 8.62 (t, J= 5.8 Hz, 1H) ; LC/MS (ESI): 379.1 [M+H]+ ; purity = 99% ; yellow solid. Yield = 47%. (2£,)-Ar-(3-methanesulfonylphenyl)-3-(2-phenyl-l,3-thiazol-5-yl)prop-2-enamide 139
LH NMR (DMSO-i¾, 200 MHz): δ = 3.20 (s, 3H), 6.60 (d, J= 15.4 Hz, 1H), 7.49-7.57 (m, 3H), 7.61 (d, J = 4.9 Hz, 2H), 7.85 (d, J = 15.4 Hz, 1H), 7.90-8.03 (m, 3H), 8.25 (s, 1H), 8.32 (s, 1H), 10.69 (s, 1H) ; LC/MS (ESI): 385.2 [M+H]+ ; purity = 97% ; green-yellow powder. Yield = 37%.
(2£')-3-(5-bromothiophen-2-yl)-A,-(6-chloropyrazin-2-yl)prop-2-enamide 140
LH NMR (DMSO-c¾, 200 MHz): δ = 6.63 (d, J = 15.5 Hz, 1H), 7.28 (d, J = 3.8 Hz, 1H), 7.34 (d, J = 3.8 Ηζ,ΙΗ), 7.78 (d, J = 15.5 Hz, 1H), 8.47 (s, 1H), 9.39 (s, 1H), 11.29 (bs, 1H) ; LC/MS (ESI): 345.6 [M+H]+ ; purity = 93% ; grey solid. Yield = 15%. General deprotection procedure for the synthesis of analogues 45, 50, 98 and 102
Figure imgf000044_0001
To a stirred solution of compound 44 (51, 97 or 101) (50 mg, 1 eq) in 12mL of anhydrous dichloromethane, cooled at -70°C under an argon flow, a solution of BBr3 (9eq, lm in CH2CI2) was slowly added. The reaction mixture was left at -10°C for 2h. The excess of reagent was destroyed by the addition of saturated NaHCCh, drop by drop with stirring, and yielded a precipitate appeared. The precipitating solid was filtered off, washed with water and dried under pressure afforded the final product.
(2£,)-3-(5-bromothiophen-2-yl)-Ar-(2-hydroxy-4-nitrophenyl)prop-2-enamide 45
LH NMR (DMSO-J6, 250 MHz) : δ = 7.18 (d, J= 15.3 Hz, 1H), 7.42 (d, J= 3.7 Hz, 1H),7.47 (d, J = 3.7 Hz, 1H), 7.79-7. ,96 (m, 3H), 8.61 (d, J = 9.0 Hz, 1H), 9.94 (bs, 1H), 11.24 (bs, 1H); LC/MS (ESI): 366.85 [M-H]" and isotopic peak 368.62, 734.73 [2M-H] and isotopic peak 736.72; purity = 95% ; yellow powder. Yield = 71%.
(2£')-iV-(2-hydroxy-4-nitrophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 50
LH NMR (DMSO-c , 250 MHz) : δ = 7.24 (d, J = 15.5 Hz, 1H), 7.44-7.74 (m, 5H), 7.77-7.98 (m, 5H), 8.61 (bd, J = 8.1 Hz, 1H), 9.95 (bs, 1H), 1 1.22 (bs, 1H); LC/MS (ESI): 365.01 [M-H]" and 367.04 [M+H]+ ; purity = 92% ; yellow powder. Yield = 57%.
(2£')-iV-(2-hydroxy-4-nitrophenyl)-3-(5-methylthiophen-2-yl)prop-2-enamide 98
'H MR (DMSO- 6, 250 MHz): 2.68 (s, 3H), 7.05 (dd, J = 1.1 Hz and J= 3.5 Hz, 1H), 7.14 (d, J= 15.3 Hz, 1H), 7.48 (d, J = 3.6 Hz, 1H), 7.85 (d, J= 15.3 Hz, 1H), 7.88 (d, J = 2.6 Hz, 1H), 7.98 (dd, J= 2.7 Hz and = 9.0 Hz, 1H), 8.66 (d, J= 9.0 Hz, 1H), 9.98 (s, 1H), 11.29 (s, 1H) ; LC/MS (ESI): 302.90 [M-H]" and 304.93 [M+H]+ ; purity = 95% ; green/yellow powder. Yield = 75%.
(2£)-3-(4-bromothiophen-2-yl)-A'-(2-hydroxy-4-nitrophenyl)prop-2-enamide 102
LH NMR (DMSO-iM, 250 MHz) : 6.95 (d, J = 15.4 Hz, 1H), 7.31 (bs, 1H), 7.47-7.60 (m, 4H), 8.27 (d, J = 9.0 Hz, 1H), 9.61 (bs, 1H), 11.00 (bs, 1H) ; LC/MS (ESI): 366.76 [M-H] and isotopic peak 368.77 368.79 [M+H]+ and isotopic peak 370.83; purity = 97% ; yellow powder. Yield = 40%. General procedure for the synthesis of (2£')-/V-phenyl-3-(thiophen-2-yl)acrylamide derivatives 105, 119, 121, 127, 129 from compound 2, 106 from 107 and 112, 114 from compound 32 via a Suzuki coupling reaction.
Compound (2£')-3-(5-bromothiophen-2-yl)-N-(3,4-dichlorophenyl)prop-2-enamide 2 or (2E)-3- (5-bromothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 32 (200 mg) and substituted phenyl- or pyridinylboronic acid (2eq) were suspended in a mixture of 3 mL of 1M aqueous K2CO3 (3 mmol), 3mL of toluene and 1.5 mL of ethanol. The reaction mixture was degassed by cycles of vacuum followed by nitrogen refill. Then, Pd(PPli3) (0.1 eq) and Pd(dppf)2C12 (0.1 eq) were added and the reaction mixture was heated to reflux for 5h before cooling to room temperature and concentration to dryness under vacuum. 30 mL of water and 30 mL of ethyl acetate were added to the residue. The organic phase was further washed twice with 30ml of water before concentration to dryness under vacuum. The residue was purified by preparative thin layer chromatography using a mixture of 5/1 petroleum ether/di ethyl ether as eluent, and was further purified by crystallization in a mixture of ethyl acetate/heptane, yielding the desired products.
( ^- V-iS^-dichlorophen O-S-IS-i ridin- - lJthio hen^- llpro - -enamide 105
LH NMR (DMSO-d6, 250 MHz) : δ = 6.54 (d, J = 15.4 Hz, 1H), 7.29 (m, 1H), 7.48 (d, J = 3.8 Hz, 1H), 7.52 (dd, J = 2.0 Hz and J = 8.9 Hz, 1H), 7.56 (d, J = 8.8 Hz, 1H), 7.73 (d, J = 15.4 Hz, 1H), 7.79 (d, J = 3.9 Hz, 1H), 7.82 (m, 1H), 7.95 (d, J = 8.0 Hz, 1H), 8.07 (d, J = 1.9 Hz, 1H), 8.53 (d, J = 4.5 Hz, 1H), 10.48 (s, 1H) ; 13C NMR (DMSO-if, 62 MHz) : δ = 1 19.77, 120.86, 121.05, 122.59, 125.28, 126.85, 131.30, 131.58, 133.59, 134.66, 137.81 , 139.84, 141.39, 147.06, 150.15, 151.57, 164.12 ; LC/MS (ESI): 375.1 [M+H]+ and isotopic peak 77.12 ; purity = 95% ; yellow powder. Yield = 11%.
(2£)-iV-(3-chloro-4-propoxyphenyl)-3-[5-(2-ethy]phenyl)thiophen-2-yl]prop-2-enamide 106 LH NMR (DMSO- 6, 250 MHz) : δ = 0.97 (t, J = 7.4 Hz, 3H), 1.12 (t, J = 7.5 Hz, 3H), 1.70 (m, 2H), 2.72 (q, J = 7.5 Hz, 2H), 3.95 (t, J= 6.4 Hz, 2H), 6.49 (d, J = 15.4 Hz, 1H), 7.07 (d, J = 3.8 Hz, 1H), 7.12 (m, 1H), 7.21-7.29 (m, 1H), 7.34-7.38 (m, 3H), 7.43-7.49 (m, 2H), 7.72 (d, J = 15.3 Hz, 1H), 7.88 (d, J = 2.4 Hz, 1H), 10.21 (s, 1H) ; 13C NMR (DMSO-J6, 62 MHz) : δ = 10.30, 15.65, 21.98, 25.98, 70.19, 114.47, 118.84, 120.41, 120.57, 121.1 1 , 126.10, 127.97, 128.76, 129.24, 130.32, 131.85, 132.36, 132.96, 133.02, 139.55, 141.79, 143.99, 149.91 , 162.96; LC/MS (ESI): 426.0 [M+H]+ ; purity = 99% ; yellow powder. Yield = 50%.
(2£)-3-[5-(2-chlorophenyl)thiophen-2-yl]-iV-(4-propoxypheny])prop-2-enamide 112
LH NMR (DMSO-J4, 250 MHz) : δ = 0.95 (t, J = 7.4 Hz, 3H), 1.71 (m, 2H), 3.87 (t, J = 6.5 Hz, 2H), 6.59 (d, J = 15.3 Hz, 1H), 6.88 (d, J= 9.0 Hz, 2H), 7.47 (m, 3H), 7.56 (d, J = 9.0 Hz, 2H), 7.60 (d, J = 8.9 Hz, 2H), 7.64 (d, J = 15.5 Hz, 1H), 7.79 (m, 1H), 10.10 (s, 1H) ; 13C NMR (OMSO-d6, 62 MHz) : δ = 10.37, 22.04, 69.01 , 114.48, 120.48, 121.52, 127.80, 129.18, 129.83, 130.60, 130.76, 131.14, 131.67, 132.26, 132.30, 140.36, 140.76, 154.69, 162.55; LC/MS (ESI): 398.2 [M+H]+ ; purity = 96% ; yellow powder. Yield = 39%.
(2£')-3-[5-(3-chlorophenyl)thiophen-2-yl]-Ar-(4-propoxyphenyl)prop-2-enamide 114
LH NMR (OMSO-d6, 250 MHz) : δ = 0.95 (t, J = 7.4 Hz, 3H), 1.68 (m, 2H), 3.87 (t, J = 6.5 Hz, 2H), 6.62 (d, J = 15.4 Hz, 1H), 6.90 (d, J = 9.0 Hz, 2H), 7.39 (dd, J = 2.0 Hz and J = 9.2 Hz, 1H), 7.42 (d, J = 9.0 Hz, 2H), 7.46 (m, 1H), 7.58 (m, 1H), 7.60 (d, J = 8.9 Hz, 2H), 7.66 (m, 2H), 10.08 (s, 1H) ; LC/MS (ESI): 398.1 [M+H]+ ; purity = 92% ; yellow powder. Yield = 36%. (2£')-Ar-(3,4-dichlorophenyl)-3-[5-(4-methoxyphenyl)thiophen-2-yl]prop-2-enamide 119 Ή NMR (OMSO-d6, 250 MHz) : δ = 3.78 (s, 3H), 6.46 (d, J = 15.3 Hz, 1H), 7.00 (d, J = 8.8 Hz, 2H), 7.43 (d, J = 3.8 Hz, 1H), 7.45 (d, J= 3.8 Hz, 1H), 7.54-7.66 (m, 4H), 7.73 (d, J= 15.2 Hz, 1H), 8.09 (bd, J = 1.9 Hz, 1H), 10.48 (s, 1H) ; LC/MS (ESI): 404.2 [M+H]+ and isotopic peak 406.4 ; purity = 98% ; yellow powder. Yield = 42%.
(2£')-3-[5-(3-cyanophenyl)thiophen-2-yl]-Ar-(3,4-dichlorophenyl)prop-2-enamide 121
LH NMR (OMSO-d6, 250 MHz) : δ = 6.54 (d, J = 15.2 Hz, 1H), 7.25-7.88 (m, 7H), 8.00 (d, J = 8.1 Hz, 1H), 8.09 (s, 1H), 8.23 (s, 1H), 10.56 (s, 1H) ; LC/MS (ESI): 397.2 [M-H] and isotopic peak 399.1 ; purity = 95% ; yellow powder. Yield = 38%.
(2£')-iV-(3,4-dichlorophenyl)-3-[5-(2-methoxyphenyl)thiophen-2-yl]prop-2-enamide 127 LH NMR (OMSO-d6, 250 MHz) : δ = 3.93 (s, 3H), 6.52 (d, J = 15.4 Hz, 1H), 7.03 (td, J = 0.8 Hz and 7.6 Hz, 1H), 7.17 (d, J = 8.0 Hz, 1H), 7.35 (td, J = 1.5 Hz and 7.7 Hz, 1H), 7.46 (d, J = 3.9 Hz, 1H), 7.54-7.58 (m, 2H), 7.63 (d, J = 4.0 Hz, 1H), 7.71 (d, J = 15.5 Hz, 1H), 7.79 (m, 1H), 8.09 (d, J = 1.8 Hz, 1H), 10.48 (s, 1H) ; LC/MS (ESI): 404.2 [M+H]+ and isotopic peak 406.2 ; purity = 98% ; yellow powder. Yield = 38%.
(2£)-/V-(3,4-dichlorophenyl)-3- [5-(pyridin-3-yl)thiophen-2-yl]prop-2-enamide 129
LH NMR {OMSO-d6, 250 MHz) : δ = 6.54 (d, J = 15.3 Hz, 1H), 7.45-7.60 (m, 4H), 7.69 (d, J = 3.8 Hz, 1H), 7.77 (d, J = 15.4 Hz, 1H), 8.09 (m, 2H), 8.56 (d, J = 3.8 Hz, 1H), 8.95 (s, 1H), 10.54 (s, 1H) ; LC/MS (ESI): 375.1 [M+H]+ and isotopic peak 377.2 ; purity = 97% ; yellow powder. Yield = 30%.
General procedure for the synthesis of (2£')- V-phenyl-3-(thiophen-2-yl)acrylamide derivatives 124 from compound 2 and 126 from compound 32.
Compound (2£')-3-(5-bromothiophen-2-yl)-N-(3,4-dichlorophenyl)prop-2-enamide 2 or (2E)-3- (5-bromothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 32 (400 mg) and Pd(PPli3)4 (0.1 eq) were added to a degassed mixture of Zn(CN)2 (1.5eq) and dppf (0.2 eq) in 6 mL of xylene. The reaction mixture was heated to 145°C under nitrogen for 14h and cooled down to room temperature before filtration and concentration under vacuum. The residue was crystallized three times in a mixture of DMSO/water, yielding the desired products.
(2£')-3-(5-cyanothiophen-2-yl)-Ar-(3,4-dichlorophenyl)prop-2-enamide 124
B NMR (OMSO-d6, 250 MHz) : δ = 6.67 (d, J = 15.3 Hz, 1H), 7.57 (m, 3H), 7.76 (d, J = 15.4 Hz, 1H), 7.96 (d, J = 3.9 Hz, 1H), 8.08 (d, J = 1.3 Hz, 1H), 10.69 (s, 1H) ; LC/MS (ESI): 322.7 [M+H]+ and isotopic peak 324.8 ; purity = 98% ; yellow powder. Yield = 1 1%.
(2ii)-3-(5-cyanothiophen-2-yl)-jV-(4-propoxyphenyl)prop-2-enamide 126 Ή NMR (DMSO-i/4, 250 MHz) : δ = 0.95 (t, J= 7.4 Hz, 3H), 1.69 (m, 2H), 3.87 (t, J= 6.5 Hz, 2H), 6.68 (d, J = 15.6 Hz, 1H), 6.88 (d, J = 8.9 Hz, 2H), 7.55 (d, J = 3.9 Hz, 1H), 7.57 (d, J = 8.8 Hz, 2H), 7.69 (d, J = 15.5 Hz, 1H), 7.97 (d, J = 3.9 Hz, 1H), 10.21 (s, 1H) ; LC/MS (ESI): 313.2 [M+H]+ ; purity = 99% ; yellow powder. Yield = 30%.
Procedure for the synthesis of (2£,)-Ar-(5-propoxypyridin-2-yl)-3-[2-(pyridin-2-yl)-l,3- thiazol-5-yl]prop-2-enamide hydrochloride 134-HCl
4.5 mg of (£')-3-(5-bromo-2-thienyl)-N-(5-propoxy-2-pyridyl)prop-2-enamide 134 free base were solubilised in 1ml of HCl 4M in dioxane and stirred under nitrogen for 2h. After 5mn, some white solid was detected. The solvent was evaporated under vacuum and the white solid was dried under vacuum at 40°C over 2 days, yielding 3,8mg of white solid. Yield = 39%. LH NMR (CD3OD, 200 MHz): δ = 1.07 (t, J = 7.4 Hz, 3H), 1.85 (m, 2H) 4.10 (t, J = 6.2 Hz, 2H), 6.68 (d, J= 15.7 Hz, 1H), 7.52 (bd, J= 7.3 Hz, 2H), 7.91-8.27 (m, 6H), 8.66 (bs, 1H). Other compounds
Compounds 5, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 28, 29, 30, 54, 55, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 86, 87, 91 and 96 were commercially available.
Example 2: Inhibition results obtained with compound 1
Figure imgf000048_0001
The upper results demonstrate that compound 1 inhibits the DENV-2 and DENV-3 polymerases in enzyme assays using proteins whose sequences are identical to those of relevant viral strains. Mechanism of inhibition of compound 1 :
Figure imgf000049_0001
The inhibition being non-competitive with either GTP or Poly rC template, the interpretation is that compound 1 probably binds to an allosteric site.
Example 3: Identification of dengue polymerase activity inhibitors according to the invention
Materials and methods
DENV-2 and DENV-3 polymerase plasmid constructs, enzyme preparation and reasents
DENV-2 and DENV-3 polymerase domain genes were tagged by six C-terminal Histidine residues and expressed from the pQE30 vector (Quiagen) in E.coli Rosetta pLacI cells (Novagen). The enzyme was produced and purified as previously described (Selisko et al, Virology 2006, 351 , 145-158).
Homopolymeric cytosine (Poly rC) RNA template was obtained from Amersham- Pharmacia. Uniformly labeled [ H]GTP (5, 1 Ci/mmol) was purchased from Amersham- Bioscience.
Cells, media and reasents
Cells were grown in DMEM (PAA) supplemented with penicillin, streptomycin and 5 % (BHK cells) or 10% (COS and Huh7 cells) foetal calf serum (FCS).
Enzymatic activity assay of the Densue polymerase
Polymerase activity was assayed by monitoring the incorporation of radiolabeled guanosine into a homopolymeric cytosine RNA (Poly rC) template by the purified recombinant DENV RNA-dependent RNA polymerase domain DENV-NS5pol, as previously described (Selisko et al., Virology 2006, 351, 145-158). Chemical library screening
The screening campaign, during which compound 1 was discovered, was conducted using a chemical library from Institut Curie (UMR 176, Paris) made of 6720 molecules. Quality of measurements was assessed by calculating the Z' factor for each plates: Z' factor = l-((3SD(neg)+3SD(pos))/(avg(neg)-avg(pos))), where SD(neg) and SD(pos) stand for the standard deviation obtained for negative and positive controls, respectively, and where avg(neg) and avg(pos) are averages for negative and positive controls, respectively. The Z' factor had an average value of 0.834 with a standard deviation of 0.058 for assay plates indicating that there is a wide separation of data points between the baseline and positive signals. For each compound, the percentage of inhibition was calculated as follows:
Inhibition%= 100(raw_data_of_compound-avg(pos)/(avg(neg)-avg(pos)). The library was organized in 84 plates (96-wells), each containing 80 compounds. Assay plates contained positive and negative controls distributed in the first and 12th columns respectively. Our experimental screening consisted of an in vitro nucleotide incorporation assay in which a functionally active recombinant DENV- NS5pol enzyme and a homopolymeric polycytosine template were used. Reactions were conducted in 20 \xL volume. Positive and negative controls consisted of a reaction mix (50 mM HEPES pH 8.0, 10 mM KCl, 2 mM MnCl2, 1 mM MgCl2, 10 mM DTT, 100 nM of homopolymeric polycytosine RNA template, 20 nM of DENV-NS5pol) supplemented by 10 μΜ [3H]-GTP (0.25 μCi) and 5 % DMSO or 20 mM EDTA respectively. For each assay, the enzyme mix was first distributed in plate wells using a BioMek 3000 automate (Beckman). Each 80 compounds were then added to the assay using a BioMek NX automate (Beckman) to a final concentration of 50 μΜ in 5% DMSO. Reactions were initiated by addition of 10 μΜ [3H]-GTP (0.25 μϋϊ), incubated at 30°C, and stopped after 20 min by the addition of EDTA (100 mM final concentration). All distributions were conducted with the Biomek 3000 automate. Reaction products were then transferred onto DE-81 paper membrane (Whatman International Ltd.) with a Packard Filtermate® Harvester. Filter paper membranes were washed three times in 0.3 M ammonium formate, pH 8.0, washed two times in ethanol, and dried. The radioactivity bound to the filter was determined using liquid scintillation counting (Wallac Microbeta® Trilux). After determining the percentage of inhibition, data were stored and managed using the LIMS software provided by ModulBio (Marseille). Compounds showing 80 % or more reaction inhibition were selected and used to generate new experimental plates. These experimental plates were used for a second screen at a 10 μΜ final concentration, with the same experimental procedure. Compounds leading to a 80% inhibition or more in the second screen were qualified as hits. Hits were then confirmed on purified freshly solubilized compound and IC50 determined.
Inhibitory Concentration of 50 % of the reaction (ICso) determination
The compound concentration leading to 50% inhibition of DE V-NS5pol-mediated R A synthesis was determined in the same buffer as for the screen (cf. library screening section). It contains 100 nM of homopolymeric cytosine RNA template, 40 nM of DENV-NS5pol and various concentrations of compound (0 ; 0.1 ; 0.5 ; 1 ; 5 ; 10 ; 50 μΜ). Reactions were incubated at 30°C and initiated by the addition of 0.04 mM [3H]-GTP (0.2 μθ). The reaction time course was followed from 0 to 7.5 min and stopped by the addition of EDTA (100 mM final concentration). Reaction products were transferred onto DE-81 paper membrane (Whatman International Ltd.) with a Packard Filtermate® Harvester. Filter paper membranes were washed three times in 0.3 M ammonium formate, pH 8.0, two times in ethanol, and dried. Radioactivity bound to filters was determined using liquid scintillation counting (Wallac Microbeta® Trilux). The initial velocity for each condition was used to evaluate the residual activity and IC50 was determined using the equation: % of active enzyme = 100/(l+(I)2/ICso), where I is the concentration of inhibitor. IC50 was determined from curve-fitting using Kaleidagraph (Synergy Software). For each value, results were obtained using triplicate in a single experiment.
Inhibitory concentration of 50% of the reaction (IC50) determination based on a fluorescent assay
The compound's concentrations leading to 50% inhibition of DENV2 NS5pol mediated RNA synthesis was determined in IC50 buffer (50 mM HEPES pH 8.0, 10 mM KC1, 2 mM MnCi2, 2 mM MgCb, 10 mM DTT) containing 100 nM of homopolymeric uridine RNA template, 20 nM of DENV2 NS5pol and 7 various concentrations of compound. Five ranges of inhibitor were available (0.01 to 5 μΜ / 0.1 to 50 μΜ / 0.5 to 0 μΜ / 1 to 100 μΜ / 5 to 400 μΜ). According to the inhibitory potency of the compound tested, a range was selected to obtain the more accurate IC50 based on the best repartition of the points surrounding the range.
Reactions were conducted in 40μ1^ volume on a 96-well Nunc plate. All experiments were robotized by using a BioMek 3000 automate (Beckman). 2 μΐ of each diluted compounds in 100% DMSO were added in wells to the chosen concentration (5% DMSO final concentration). For each assay, the enzyme mix was distributed in wells. Reactions were started by the addition of the nucleotide mix (100 μΜ ATP) and were incubated at 30°C for 10 min. Reaction assays were stopped by the addition of 20 μΐ EDTA 100 mM.
Positive and negative controls consisted respectively of a reaction mix with 5% DMSO final concentration or EDTA 100 mM instead of compounds. Reaction mixes were then transferred to Greiner plate using a Biomek NX automate (Beckman). Picogreen® fluorescent reagent from Molecular probes was diluted to 1/800° in TE buffer according data manufacturer and 60 μΐ of reagent were distributed into each well of the Greiner plate. The plate was incubated 5 min in the dark at room temperature and the fluorescence signal was then read at 480 nm (excitation) and 530 nm (emission) using a TecanSafire2.
IC50 was determined using the equation: % of active enzyme = 100/(l+(I)2/ICso), where I is the concentration of inhibitor and 100% of activity is the fluorescence intensity without inhibitor. IC50 was determined from curve-fitting using Prism software. For each value, results were obtained using triplicate in a single experiment.
Results
The following compounds were identified as inhibiting the DENV polymerase.
Table 1 presents the chemical structure and IC50 values, determined with an enzymatic assay monitored by the incorporation of [3H]-GTP, for a first set of identified DENV-2 polymerase inhibitors.
Figure imgf000053_0001
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
70
23
71
7.0
72
18.2
73
5.4
74
15.4
75
10.0
F
76
8.6
77
9.3
78
13
Figure imgf000061_0001
Figure imgf000062_0001
Table 2 presents the chemical structure and the inhibition percentage, determined with an enzymatic assay monitored by the incorporation of [3H]-GTP, for a second set of identified DENV-2 polymerase inhibitors. All compounds of table 2 display an inhibition > 50% at 50μΜ. % inhibition
Compound Structure polymerase of
DENV-2 at 50μΜ
97
50
MeO
98
95
HO
99
55
100
54
101
58
MeO
102
98
HO
103
89
Table 2 Table 3 presents the chemical structure and ICso values determined with a fluorescent assay using PicoGreen® for a third set of identified DENV-2 polymerase inhibitors.
ICso polymerase of
Compound Structure
DENV-2 (μΜ)
104
7
CI
105
3
106
16
CI
107
ND
CI
108
48
109
4
110
15
111
37
112 Ow - ϋ 8
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
145
30
H
Table 3
Example 4: Effect of compounds according to the invention on the replication of DENY.
Materials and methods for examples 4 and 5: Virus yield reduction assay.
The amount of each virus in the assay has been calibrated by trial so that the replication growth is at the end of the growth curve or beginning of the plateau at day 3 or 4, depending of the virus species. Approximate MOI (Multiplicity Of Infection ie ratio of infectious virus to target cells) is indicated together with strains information in table 4. One day prior to infection 5X 104 Vero E6 cells (or 105 HE 293 cells for YFV and TBEV assay) were seeded in 100 μΐ of medium (with 2.5 % FCS) in each wells of a 96- well titer plates. The next day, 8 two-fold serial dilutions of the compounds (beginning at 20 μΜ final concentration, down to 0.16 μΜ), in triplicates or quadriplicates, were added to the cells (25 μΐ/well, in 2.5 % FCS containing medium). Four Virus Control (VC) wells (per virus) were supplemented with 25 μΐ medium containing 0.1 % DMSO and four cells control wells were supplemented with 50 μΐ of medium. Fifteen minutes later, 25 μΐ of a virus mix containing the appropriate amount of viral stock dilute in medium (2.5 % FCS) was added to the 96-well plates.
Cells were cultivated for 3 or 4 days after which 100 μΐ of the supernatant were collected and transferred to 96 square wells plates preloaded by the addition of 400 μΐ of RAV-1 Lysis buffer from Macherey Nagel "NucleoSpin 96 virus kit". Viral RNAs were extracted (NucleoSpin 96 virus kit running on an Eppendorf epMotion 5075 liquid handler automat). Washing of the binding plates were done by centrifugation and RNA was eluted in 75 μΐ of water.
Viral RNAs were then quantified by real time RT-PCR to determine viral RNA yield (Superscript III Platinium one-step RT-PCR with Rox from Invitrogen), using 7.5 μΐ of RNA and 12.5 μΐ of RT-PCR mix using standard cycling parameters, 20 min at 50 °C, 3 min at 95 °C and 40 cycles of amplification (95 °C 15 sec followed by 60 °C, 1 min). The four control wells were replaced by four 2 log dilutions of an appropriate TV- generated R A standards of known quantities for each serotypes (100 copies to 100 million copies). qRT-PCR reactions were performed on ABI 7900 HT Fast Real-Time PCR System and analyzed using SDS 1.2 Applied Bio-system software.
IC50 (half maximal inhibitory concentration) and IC9 (90% inhibitory concentration) determination
Mean inhibition of virus yield is equal to 100 X (mean quantities of viral RNA in VC quadriplicates - mean quantities of viral RNA in drug treated triplicates) / mean quantities of viral RNA in VC. The inhibition values (expressed as percent inhibition, in linear scale) obtained for each drug concentration (expressed in μΜ, in log scale) are plotted using Kaleidagraph plotting software (Synergy Software) and the best sigmoidal curve, fitting the mean values, is determined by a macro in the software: (Inhibition, Y is given by Y =
Figure imgf000069_0001
). This macro allows to determine the best curve fit and the ml and m2 parameters, where ml corresponds to IC50. The reverse equation x= Ml ((100/y)-l)(l/m2) allows to calculate x: IC90 concentration for Y =0.9.
Primers and robes:
Unless specified otherwise, primers (R: Reverse; F: Forward) and probes (P) are useful for all-same stereotype strains.
DENV-1 : position 1130-1200 of genome (Genebank accession number AF298808); DENV-1-F5: CRAGATGTCCRACACAAGGA (SEQ ID No 1),
DENV- 1 -R5 : CGKCGACACACAAARTTCG (SEQ ID No 2),
DENV-1 -P5: FAM-CTGGTGGAAGAACAAG-MGB (SEQ ID No 3).
DENV-2: position 845-935 of genome (Genebank accession number AF208496), DENV-2-F2: TGGCAGCAATCCTGGCATA (SEQ ID No 4),
DENV-2-R2: GTCATTGAAGGAGCGACAGCT (SEQ ID No 5),
DENV-2-P2: Fam-CRATAGGAACGACACATT-MGB (SEQ ID No 6);
For DENV-2 Mexico quantification DENV-2-F2 was replaced by DENV-2-F2bis: TGGCAGCAATCYTGGCATA (SEQ ID No 7).
DENV-3: position 155 - 216 of genome (Genebank accession number M93130);
DENV-3-F2: AACCGTGTGTCAACTGGATCAC (SEQ ID No 8);
DENV-3 -R2: TGGCCGTTCARCAATCCT (SEQ ID No 9);
DENV-3-P2: Fam TGGCGAAGAGATTC-MGB (SEQ ID No 10).
DENV-4: position 787-806 of genome (Genebank accession number AF326573);
DENV-4-F3: GCTTGGAAGCATGCTCAGAGA (SEQ ID No 11);
DENV-4-P3: 807-825 FAM-TAGAGAGCTGGATACTCA-MGB (SEQ ID No 12), DENV-4-R3: 827-843 GCGCGAATCCTGGGTTT (SEQ ID No 13).
YFV: position 40-142 of genome (Seq6-YFV),
pan_YFV-F: AATCGAGTTGCTAGGCAATAAACAC (SEQ ID No 14);
pan_YFV-R: TCCCTGAGCTTTACGACCAGA (SEQ ID No 15);
pan_YFV-P: FAM-ATCGTTCGTTGAGCGATTAGCAG-Tamra (SEQ ID No 16).
WNV-Uganda: position 8338-8404 of genome (Genebank accession number M12294) WNV-UG-F: GCCACGCTTCAGGCAATATC (SEQ ID No 17);
WNV-UG-R: CCATCCTCCCCAGAAGCAC (SEQ ID No 18);
WNV-UG-P: Fam-TCCCACTCCGTCAACATGACAAGCCA-Tamra (SEQ ID No 19).
JEV: position 9897-9942 of genome (Genebank accession number M55506):
panJEV-F5 : GGCAGGGCKCGCATYTC (SEQ ID No 20);
panJEV-R4: AGRCAAGCTGTGTCCTTCACA (SEQ ID No 21),
probe panJEV-P3: FAM-CAGGAGCTGGATGGA-MGB (SEQ ID No 22).
TBEV: position 8287-8379 of genome (Genebank accession number AB062063): TBEV-F: TGAGGACCCCGTTTTCGA (SEQ ID No 23),
TBEV-R: TTGATTGGATGTTGACAGAATTCA (SEQ ID No 24), TBEV-P: FAM-AACTCAACCCATGAAATGTATTACTCAACCGCT-Tamra (SEQ ID No 25).
Zika virus: position 9721-9781 of genome (Genbank accession number
panZik-F2: AARGACGGGAGRTCCATTGTG (SEQ ID No 26)
panZik-R2: GRGCYCGGCCAATCAG (SEQ ID No 27)
panZik-P2: FAM-CGCCACCAAGATGA-MGB (SEQ ID No 28)
Virus strains origin field/clinical MOI
Flavivirus
DE V-l Djibouti IMTSSA human serum
Yes 5 10"2
(Dl/H/IMTSSA/98/606) Djibouti 1998
DENV-l Indonesia E6 WRCDU human serum
Yes 5 10 1
(JKT 1186 TVP 949) Jakarta 1977
DENV-2 Martinique E6
IMTSSA human serum La
(H IMTSSA-MART/98- Yes 2 10-2
Martinique 1998
703)
DENV-2 Trinidad veroE6 WRCDU human serum
No 6 10"2
(1751 TC 544) 1953
UMR190 human serum
DENV-2 Mexico (3719) Yes 1.5 10"2
from Mexico, 2012
WRCDU human serum
DENV-3 H87 Phillipines No 5 10 1
from Phillipine 1956
UMR 190 human serum
DENV-3 Bolivia (4025) Yes 3 10-2
from Bolivia 2010
WRCDU human serum
DENV-4 Dakar H4 34460 Yes 1.5 10"3
1982 Roraima, Brasil)
UMR 190 human serum
DENV-4 Mart 017 yes 1.5 10"2
from La Martinique 2012
UMR 190 human serum
YFV Bolivie 88-99 Yes 5 10"2
from Bolivia 1999 Human patient Uganda
W V Uganda 956 Dl 17 1937 (from molecular No 1.5 10"2
clone)
UMR 190 virus collection;
JEV-mrs isolate from unknown Yes 5 10-3
origin
UMR 190 Human central
JEV_Laos (CNS769-Laos
nervous system Laos 2009 Yes 1 10"4
2009) Gen I
(from molecular clone)
DoDog blood Japan 1995
TBEV Oshima 5-10 No 2.5 10"2
(from molecular clone)
Aedes africanus Senegal
Zika Dakar Ai D41662 Yes 1 lO"2
1984
Table 4: Strains information
WNV-Uganda, JEV_Laos and TBEV Oshima are reconstituted from infectious molecular clones or PCR overlapping fragments.
MOI: Multiplicity of infection (ratio of infectious virus per cell at time of infection).
Results
Table 5 and table 6 present the effect of compounds according to the invention on the replication of DENV clinical isolates (no: no inhibition, nd: not determined).
Figure imgf000072_0001
Figure imgf000073_0001
Figure imgf000074_0003
Figure imgf000074_0001
Figure imgf000074_0002
IC50 0.13 0.37 nd 0.38 0.13 0.5 0.36 0.14 0.31
114
IC90 0.86 1.3 nd 1.3 0.22 3.3 0.75 0.9 0.65
IC50 >5 nd >5 nd nd nd nd nd nd
126
IC90 nd nd nd nd nd nd nd nd nd
IC50 >5 nd >5 nd nd nd nd nd nd
124
IC90 nd nd nd nd nd nd nd nd nd
IC50 nd 0.19 =0.2 nd nd nd 0.13 nd 0.31
111
IC90 nd 0.55 1.25 nd nd nd 0.8 nd 0.4
IC50 nd 0.24 0.014 nd nd nd 0.15 nd 0.3
110
IC90 nd 1.2 0.09 nd nd nd 0.56 nd 0.56
IC50 0.05 0.14 > 5 μΜ 0.12 0.55 0.06 0.15 0.05
109
IC90 0.77 1.5 0.77 5.5 0.7 0.3 0.66
IC50 0.17 0.01 0.08 0.9 nd nd 0.11 nd 0.05
105
IC90 2.1 1.5 no no nd nd 0.36 nd 1
IC50 ~ 2 nd no nd nd nd nd nd nd
129
IC90 nd nd nd nd nd nd nd nd nd
IC50 0.3 0.5 nd 1.3 6 1.5 0.2 0.4 0.23
121
IC90 2.9 1.6 nd 5 3.2 21 1 1 1
IC50 ~ 2 nd =2 nd nd nd nd nd nd
127
IC90 nd nd nd nd nd nd nd nd
IC50 0.3 0.5 nd 0.01 0.3 1.2 0.4 0.5 0.41
117
IC90 1.8 1.4 nd 1.7 1.1 4.8 1.1 1.2 1.5
IC50 >5 nd >5 nd nd nd nd nd nd
125
IC90 nd nd nd nd nd nd nd nd nd
IC50 nd ~ 1.5 0.14 nd nd nd 0.5 nd = 2.5
120
IC90 nd >5 1 nd nd nd >5 nd >5
IC50 ^ 4 nd = 0.5 nd nd nd nd nd nd
128
IC90 nd nd nd nd nd nd nd nd nd
IC50 0.21 0.35 0.057 0.16 0.2 no 0.26 ~ 1 0.5
116
IC90 1.5 0.61 0.34 0.8 0.33 nd 0.64 No 0.71
IC50 1 0.6 nd 1.7 1 3.3 0.3 0.8 0.12
119
IC90 7 4.1 nd 6 nd 13 0.8 2.3 4
IC50 0.35 1.2 0.6 nd nd nd 1.3 nd 0.7
122
IC90 1 4 1.4 nd nd nd 3 nd 2.5
IC50 >5 nd >5 nd nd nd nd nd nd
123
IC90 nd nd nd nd nd nd nd nd nd
IC50 0.12 0.17 0.12 0.18 0.03 0.26 0.1 0.001 0.3
108
IC90 0.42 0.43 0.92 0.86 0.39 0.75 0.44 0.07 0.32
IC50 0.26 0.12 0.2 1.1 nd nd 0.19 nd 0.11
113
IC90 0.4 0.64 0.51 1.4 nd nd 0.9 nd 0.73
106 nd nd nd
IC50 0.1 0.08 0.08 0.14 0.24 0.06 IC90 0.4 0.3 0.21 0.25 nd nd 0.29 nd 0.3
0.25 0.12
0.04+/0. +/- +/-
IC50 02 0.15 0.15 0.036 0.26 0.31 0.02 0.17 0.03
115
0.85
0.35 +/- 1.2 +/- +/-
IC90 0.15 0.1 1.2 1.3 0.77 0.36 0.05 1.4 0.3
IC50 1 nd nd 4 nd nd 0.1 nd 0.3
130
IC90 nd nd nd nd nd nd nd nd
IC50 3 nd nd 3.2 nd nd 1.2 nd 0.07
131
IC90 nd nd nd nd nd nd nd nd nd
IC50 < 0.08 ? nd nd ~ 1 nd nd <0,08 nd nd
132
IC90 nd nd nd nd nd nd nd nd nd
Table 6
Example 5: Effect of compounds according to the invention on other flaviviruses.
Table 7 and Table 8 present the effect of compounds according to the invention on other flaviviruses. (nd= not determined, no= no inhibition)
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000077_0002
Table 8 Example 6: Cytotoxicity of compounds according to the invention on various cell lines Material and methods:
One day prior to the assay 5χ 104 Vero E6 cells or alternatively human MRC5, human Hela and mouse L929 cells (or 105 HEK 293 cells) were seeded in 100 μΐ of medium (with 2.5 % FCS) in each wells of a 96-well titer plates. The next day, 6 two-fold serial dilutions of the compounds (beginning at 100 μΜ final concentration, down to 3.1 μΜ), in triplicates, were added to the cells (25 μΐ/well, in 2.5 % FCS containing medium). Six cell control (CC) wells were supplemented with 25 μΐ medium containing two-fold serial dilution of an equivalent amount of DMSO. Eight wells were not seeded by cells and served as background control of fluorescence for the plates.
Cells were cultivated for 3 (HEK 293) or 4 (Vero E6, MRC5, HeLa, L929) days after which the supernatant was removed and replaced with 70 μΐ of medium containing CellTiter-Blue reagent (Promega) and further incubated for 90 mn at 37 ° C. Fluorescence of the plates were then read on a TECAN Infinite M 200 Pro reader. The Cell viabilities in percent were calculated as 100 x (mean value of X- Background without cells)/(CC - background).
Results:
Table 9 presents cytotoxicity results obtained for compounds according to the invention on Vero E6, HEK 293, MRC-5, HeLa and L929 cell lines.
Vero E6: ATCC CRL-1586 Simian embryonic kidney cells epithelial
HEK 293 : ATCC CRL-1573 Human embryonic kidney cellls, epithelial (tumorigenic in mice)
MRC-5 : Human normal lung fibroblast (not transformed)
HeLa: ATCC CCL-21 human cervix epithelial cells (adenocarcinoma)
L929: ATCC CCL-1 mouse C3H/An connective tissue fibroblast (tumorigenic)
Simian Human Mouse
CCso (μΜ) CCso (μΜ) CCso (μΜ) CCso (μΜ) CCso (μΜ) compound Vero E6 HEK 293 MRC-5 HeLa L929
2 >60 μΜ > 100 μΜ > 100 μΜ nd 80% living
3 >60 μΜ nd nd nd > 100 μΜ
44 >60 μΜ > 100 μΜ > 100 μΜ nd
80% living
56 >60 μΜ nd nd > 100 μΜ at 100 μΜ
80% living
46 >60 μΜ nd nd 100 μΜ at 100 μΜ
62 >60 μΜ nd nd > 80 μΜ nd > 100 μΜ nd > 100 μΜ
> 80 μΜ > 100 μΜ > 100 μΜ > 100 μΜ > 100 μΜ
> 100 μΜ nd > 100 μΜ nd > 100 μΜ
> 100 μΜ > 100 μΜ > 100 μΜ > 100 μΜ > 100 μΜ
> 100 μΜ > 100 μΜ > 100 μΜ nd 80% living
> 100 μΜ 12 +/- 3 μΜ > 100 μΜ 15 μΜ 80% living
> 100 μΜ nd > 100 μΜ nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
>100 μΜ nd nd nd nd
Tal ble 9

Claims

1. Compound of the formula (A)
(A)
Figure imgf000080_0001
, wherein:
- A is independently a C-R2 group or a nitrogen atom,
- Z is independently a carbon atom or a nitrogen atom with the proviso that when Z is a nitrogen atom, the R4, R5, Rfi, R7, or group linked to said nitrogen atom is absent, and the number of nitrogen atoms is 1 or 2
Ri and R2 are chosen independently in the group consisting of : a hydrogen atom, an alkyl group, a halogen atom, a NO2 group, a pyridyl group, a CN group and an aryl group optionally substituted with at least one halogen atom, CN group, alkyl group and/or alkoxy group,
- R3 is a hydrogen atom or a CN group,
- R4, R5, Re, R7 and Rs are chosen independently in the group consisting of: a hydrogen atom, an alkyl group, a halogen atom, a hydroxyl group, an alkoxy group, a phenoxy group, a NO2 group, a CN group, an O-alkyl-O-alkyl group, a heterocycle, an amine NRaRb group, wherein Ra and Rb are independently a hydrogen atom or an alkyl group, an amide group, a ketone group, an ester group, a NH-C(=0)-alkyl group or a SO2R group, wherein R is a hydrogen atom, an alkyl group, a heterocycle or an amine NRaRb,
- alternatively, two adjacent groups among R4, R5, Re, R7 and Rs may form together with the carbon atoms to which they are linked an aryl, a cyclic ketone
Figure imgf000080_0002
or a eterocyc e, pre era y a eterocyc e o ormu a
- R9 is a hydrogen atom or an alkyl group.
- n is 0, 1 or 2,
wherein each of the hydrogen atoms may be independently replaced with a fluorine atom,
or a salt thereof, for use as an anti-viral agent.
Compound for use according to claim 1 of the formula (Γ)
Figure imgf000081_0001
, wherein:
Ri and R2 are chosen independently in the group consisting of :
a hydrogen atom, an alkyl group, a halogen atom, a NO2 group, a pyridyl group, a CN group and an aryl group optionally substituted with at least one halogen atom, CN group, alkyl group and/or alkoxy group.
- R3 is a hydrogen atom or a CN group,
- R4, R5, R5, R7 and R8 are chosen independently in the group consisting of: a hydrogen atom, an alkyl group, a halogen atom, a hydroxyl group, an alkoxy group, a phenoxy group, a NO2 group, a CN group, an O-alkyl-O-alkyl group, a heterocycle, an amine NRaRb group, wherein Ra and Rb are independently a hydrogen atom or an alkyl group, an amide group, a ketone group, an ester group, a NH-C(=0)-alkyl group or a SO2R group, wherein R is a hydrogen atom, an alkyl group, a heterocycle or an amine NRaRb,
- alternatively, two adjacent groups among R4, R5, R<5, R7 and Rs may form together with the carbon atoms to which they are linked a cyclic ketone or a
Figure imgf000081_0002
heterocycle, preferably a heterocycle of formula ,
- R9 is a hydrogen atom or an alkyl group,
- n is 0, 1 or
2.
3. Compound for use according to claim 1 or 2, wherein Ri and R2 are chosen independently in the group consisting of: a hydrogen atom, an alkyl group, a halogen atom, a pyridyl group, a NO2 group, and an aryl group optionally substituted with at least one halogen atom.
4. Compound for use according to any one of claims 1 to 3, wherein 0, 1, 2 or 3 groups among R , R5, ¾, R7 and Rs are different from a hydrogen atom.
5. Compound for use according to anyone of claims 1 to 4, wherein:
- Ri and R2 are chosen independently in the group consisting of a hydrogen atom, a halogen atom, a pyridyl group, and an aryl group optionally substituted with at least one halogen atom, R4, R5, Ri, R7 and Rs are chosen independently in the group consisting of a hydrogen atom, a halogen atom and an alkoxy group.
6. Compound for use according to claim 1 , wherein:
- Ri and R2 are chosen independently in the group consisting of a hydrogen atom, a halogen atom, an aryl group optionally substituted with at least one halogen atom, and a pyridyl group,
- R3 is a hydrogen atom,
- R9 is a hydrogen atom,
- n is 0 or 1 ,
- R4, R5, Rs, R7 and Rs are chosen independently in the group consisting of: a hydrogen atom, a halogen atom, an alkoxy group, or a SO2R group, wherein R is an alkyl group,
- alternatively, two adjacent groups among R4, R5, R5, R7 and Rs may form together with the carbon atoms to which they are linked an aryl group.
7. Compound for use according to any one of claims 1 to 6, wherein the compound is selected in the group consisting of:
(2J£')-N-(2-hydroxy-4-nitrophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 1
(2£")-3-(5-bromothiophen-2-yl)-N-(3,4-dichlorophenyl)prop-2-enamide 2
(2£)-N-(3 ,4-dichlorophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 3
(2J£')-N-(2-methoxy-4-nitrophenyl)-3-(thiophen-2-yl)prop-2-enamide 4
(2£')-N-[2-methoxy-5-(morpholine-4-sulfonyl)phenyl]-3-(thiophen-2-yl)prop-2-enamide 5
(2ii)-N-(2-methoxy-4-nitrophenyl)-3 -( -nitrothiophen-2-yl)prop-2-enamide 6 2£/ )-N-(4-cyanophenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 7
2£^)-N-(4-chlorophenyl)-3 -(5 -nitrothiophen-2-yl)prop-2-enamide 8
l-{4-[(2£)-3-(5-nitrothiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 9
(2£^)-N-(4-(acetamido)phenyl)-3-(5-nitrothiophen-2-yl)prop-2-enamide 10
(2£')-3-(5-nitrothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 11
(2i?)-3-(5-chlorothiophen-2-yl)-N-[4-(morpholin-4-yl)phenyl]prop-2-enamide 12
(2J£,)-3-(5-chlorothiophen-2-yl)-N-[2-methoxyphenyl]prop-2-enamide 13
(2£)-3-(5-chlorothiophen-2-yl)-N-[2-(trifluoromethyl)phenyl]prop-2-enamide 14
(2^)-3-(5-chlorothiophen-2-yl)-N-(3,4,5-trimethoxyphenyl)prop-2-enamide 15
(2E)-3 -(5-chlorothiophen-2-yl)-N-(3 -acetamidophenyl)prop-2-enamide 16
(2£)-3-(5-chlorothiophen-2-yl)-N-[3-(dimethylsulfamoyl)phenyl]prop-2-enamide 17 (2£,)-3-(5-crilorothiophen-2-yl)-N-(4-methanesulfonylphenyl)prop-2-enamide 18
(2£)-3-(5-chlorothiophen-2-yl)-N-(3-methanesulfonylphenyl)prop-2-enamide 19
(2¾)-3-(5-bromothiophen-2-yl)-N-(2-methoxyphenyl)prop-2-enamide 20
(2^)-3-(5-bromothiophen-2-yl)-N-[3-(dimethylsulfamoyl)-4-methylphenyl]prop-2- enamide 21
(2£)-3-(5-bromothiophen-2-yl)-N-[4-(lH-l,2,3,4-tetrazol-l-yl)phenyl]prop-2-enamide 22
(2J£')-3-(5-bromothiophen-2-yl)-N- {4-[methyl(propan-2-yl)sulfamoyl]phenyl}prop-2- enamide 23
(2^)-3-(5-bromothiophen-2-yl)-N-(5-methanesulfonyl-2-methylphenyl)prop-2-enamide 24
(2£)-3-(5-bromothiophen-2-yl)-N-(4,5-dimethoxy-2-methylphenyl)prop-2-enamide 25 (2£')-3-(5-bromothiophen-2-yl)-N- {4-[(l-methyl-lH-imidazol-2- yl)carbonyl]phenyl}prop-2-enamide 26
(2ii)-N-(4-bromo-2-fluorophenyl)-3 -(5 -bromothiophen-2-yl)prop-2-enamide 27
3-[(2i?)-3-(5-bromothiophen-2-yl)prop-2-enamido]-N-(2,2,2-trifluoroethyl)benzamide
28
(2£)-3-(5-bromothiophen-2-yl)-N-[4-fluoro-3-(morpholine-4-sulfonyl)phenyl]prop-2- enamide 29 (2J£,)-3-(5-bromothiophen-2-yl)-N-(2-oxo-2,3-dihydro- 1H- 1 ,3-benzodiazol-5-yl)prop-2- enamide 30
(2£)-3-(5-bromothiophen-2-yl)-N-(4-acetamidophenyl)prop-2-enamide 31
(2i?)-3-(5-bromothioprien-2-yl)-N-(4-propoxyprienyl)prop-2-enamide 32
4-[(2£)-3-(5-bromothiophen-2-yl)prop-2-enamido]-N,N-dimethylanilinium chloride 33 Ethyl 4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamido]benzoate 34
(2i?)-3-(5-bromothiophen-2-yl)-N-[4-(l ,3,4-oxadiazol-2-yl)phenyl]prop-2-enamide 35 (2J£')-N-(4-acetylphenyl)-3-(5-bromothiophen-2-yl)prop-2-enamide 36
(2£)-3-(5-bromothiophen-2-yl)-N-[4-(morpholin-4-yl)phenyl]prop-2-enamide 37
(2£')-3-(5-bromothiophen-2-yl)-N-(4-cyanophenyl)prop-2-enamide 38
(2J£')-3-(5-bromothiophen-2-yl)-N-(3-chlorophenyl)prop-2-enamide 39
(2£')-3-(5-bromothiophen-2-yl)-N-[3-(methylsulfonyl)phenyl]prop-2-enamide 40
(2£')-3-(5-bromothiophen-2-yl)-N-(4-chloro-2-hydroxyphenyl)prop-2-enamide 41 (2£)-3-(5-bromothiophen-2-yl)-N-[4-(trifluoromethyl)phenyl]prop-2-enamide 42
(2£')-3-(5-bromothiophen-2-yl)-N-(3-chloro-4-fluorophenyl)prop-2-enamide 43
(2£')-3-(5-bromothiophen-2-yl)-N-(2-methoxy-4-nitrophenyl)prop-2-enamide 44
(2J£,)-3-(5-bromothiophen-2-yl)-N-(2-hydroxy-4-nitrophenyl)prop-2-enamide 45
(2£')-3-(5-bromothiophen-2-yl)-N-(2-chloro-4-fluorophenyl)prop-2-enamide 46
4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamide]benzamide 47
2£'/ )-3-(5-bromothiophen-2-yl)-N-(2-chlorophenyl)prop-2-enamide 48
(2£^-3-(5-bromothiophen-2-yl)-N-(3-nitrophenyl)prop-2-enamide 49
(2£,)-N-(2-hydroxy-4-nitrophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 50
(2i?)-N-(2-methoxy-4-nitrophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 51
(2ii)-N-(4-acetamidophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 52
l-{4-[(2£)-3-(5-phenylthiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 53
(2£')-N-(2,4-dimethoxyphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 54
(2i?)-3-(5-phenylthiophen-2-yl)-N-(3-sulfamoylphenyl)prop-2-enamide 55
(2J£')-3-(5-phenylthiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 56
(2ii)-N-(4-bromo-2-fluorophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 57
(2E)-N- [4-(methylsulfonyl)phenyl] -3 -(5 -phenylthiophen-2-yl)-prop-2-enamide 58 (2E)-N-(3 -chlorophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 59 (2£')-N-(2-chloro-4-fluorophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 60
(2E)-N- [3 -(methylsulfonyl)phenyl] -3 -(5 -phenylthiophen-2-yl)prop-2-enamide 61
(2£')-N-[4-(l ,3,4-oxadiazol-2-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 62 (2i?)-N-[4-(morpholin-4-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 63
(2£)-3-(5-phenylthiophen-2-yl)-N-[4-(trifluoromethyl)phenyl]prop-2-enamide 64
Ethyl 4-[(2£')-3-(5-phenylthiophen-2-yl)prop-2-enamido]benzoate 65
(2i?)-N-(4-acetylphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 66
4-[(2£')-3-(5-phenylthiophen-2-yl)prop-2-enamido]benzamide 67
(2E)-N-(3 -nitrophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 68
(^£^-N-(2-methoxyphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 69
4-[(2£)-3-[5-(2-fluorophenyl)thiophen-2-yl]prop-2-enamido]-N,N-dimethylbenzamide 70
4-[(2£')-3-[5-(2-fluorophenyl)thiophen-2-yl]prop-2-enamido]benzamide 71
(2£)-3-[5-(2-fluorophenyl)thiophen-2-yl]-N-(5-methanesulfonyl-2-methylphenyl)prop- 2-enamide 72
(2^)-3-[5-(4-fluorophenyl)thiophen-2-yl]-N-(4-methyl-3-sulfamoylphenyl)prop-2- enamide 73
(2i?)-3 - [5-(2-chlorophenyl)thiophen-2-yl] -N-(5 -methanesulfonyl-2-methylphenyl)prop- 2-enamide 74
(2ii)-3 - [5-(2-chlorophenyl)thiophen-2-yl] -N-(2-fluoro-5 -methanesulfonylphenyl)prop- 2-enamide 75
(2^)-3-[5-(2-chlorophenyl)thiophen-2-yl]-N-(3-acetamido-2-methylphenyl)prop-2- enamide 76
(2E)-3 - [5-(2-chlorophenyl)thiophen-2-yl] -N-(2-methyl-3 -propanamidophenyl)prop-2- enamide 77
(2ii)-3 - [5-(4-chlorophenyl)thiophen-2-yl] -N-(5 -methanesulfonyl-2-methylphenyl)prop- 2-enamide 78
(2i?)-3-[5-(4-chlorophenyl)thiophen-2-yl]-N-(4-acetamido-3-methylphenyl)prop-2- enamide 79
(2ii)-3 - [5-(4-chlorophenyl)thiophen-2-yl] -N-(2-methyl-3 -propanamidophenyl)prop-2- enamide 80 (2£)-2-cyano-3-(5-methylthiophen-2-yl)-N-[4-(morpholin-4-yl)phenyl]prop-2-enamide 81
(2£)-2-cyano-N-[4-(morpholin-4-yl)phenyl]-3-(5-nitrothiophen-2-yl)prop-2-enamide 82 (2i?)-2-cyano-3-(5-nitrothiop en-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 83
(2£)-2-cyano-N-(4-acetamidophenyl)-3 -( -nitrothiophen-2-yl)prop-2-enamide 84
(2£,)-2-cyano-3-(5-nitrothiophen-2-yl)-N-[4-(l ,3,4-oxadiazol-2-yl)phenyl]prop-2- enamide 85
(2J£')-3-(5-bromothiophen-2-yl)-2-cyano-N-(2-ethoxyphenyl)prop-2-enamide 86
(2£')-3-(5-bromothiophen-2-yl)-2-cyano-N-(2-methoxyphenyl)prop-2-enamide 87
(2£')-3-(5-bromothiophen-2-yl)-2-cyano-N-(4-propoxyphenyl)prop-2-enamide 88
(2J£')-3-(5-bromothiophen-2-yl)-2-cyano-N-(4-acetamidophenyl)prop-2-enamide 89 (2E)-3 -(5-bromothiophen-2-yl)-2-cyano-N- [4-( 1 ,3 ,4-oxadiazo l-2-yl)phenyl]prop-2- enamide 90
(2J£,)-3-(4-bromothiophen-2-yl)-N-(3-chloro-4-fluorophenyl)-2-cyanoprop-2-enamide 91 (2£')-2-cyano-N-[4-(morpliolin-4-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2-enamide 92
(2J£')-2-cyano-3-(5-phenyltliiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 93
(2£')-2-cyano-N-(4-acetamidophenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 94 (2£')-2-cyano-N-[4-(l ,3,4-oxadiazol-2-yl)phenyl]-3-(5-phenylthiophen-2-yl)prop-2- enamide 95
(2£')-2-cyano-3-[5-(4-fluorophenyl)thiophen-2-yl]-N-(2-methoxyphenyl)prop-2- enamide 96
(2E) N-(2-methoxy-4-nitrophenyl)-3 -(5 -methylthiophen-2-yl)prop-2-enamide 97
(2£')-N-(2-hydroxy-4-mtrophenyl)-3-(5-methylthiophen-2-yl)prop-2-enamide 98 l-{4-[(2£)-3-(5-bromothiophen-2-yl)prop-2-enamido]phenyl}-lH-imidazol-3-ium chloride 99
(2£,)-3-(5-bromothiophen-2-yl)-N-(4-chlorophenyl)prop-2-enamide 100
(2i?)-3-(4-bromothiophen-2-yl)-N-(2-methoxy-4-nitrophenyl)prop-2-enamide 101
(2E)-3 -(4-bromothiophen-2-yl)-N-(2-hydroxy-4-nitrophenyl)prop-2-enamide 102, (2£')-N-(4-cyanophenyl)-3-(5-phenyltliiophen-2-yl)-prop-2-enamide 103,
(2E)-N-(3 -chloro-4-propoxyphenyl)-3 -(5 -phenylthiophen-2-yl)prop-2-enamide 104, (2J£,)-N-(3,4-dichlorophenyl)-3-[5-(pyridin-2-yl)thiophen-2-yl]prop-2-enamide 105, (2E)-N- 3 -chloro-4-propoxyphenyl)-3 - [5 -(2-ethylphenyl)thiophen-2-yl]prop-2-enamide 106,
(2£)-3-(5-bromothiophen-2-yl)-N-(3-chloro-4-propoxyphenyl)prop-2-enamide 107, (2i?)-3-(5-bromothiop en-2-yl)-N-(5-oxo-5,6,7,8-tetrahydronaphthalen-2-yl)prop-2- enamide 108,
(2£)-3-(5-bromothiophen-2-yl)-N-[4-(trifluoromethoxy)phenyl]prop-2-enamide 109, (2i?)-3-(5-bromothiop en-2-yl)-N-(4-butoxyphenyl)prop-2-enamide 110,
(2E)-3 -(5-bromothiophen-2-yl)-N- [4-(propan-2-yloxy)phenyl]prop-2-enamide 111, (2£')-3-[5-(2-chlorophenyl)thiophen-2-yl]-N-(4-propoxyphenyl)prop-2-enamide 112, (2£')-N-(3-cyanophenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide 113,
(2J£')-3-[5-(3-chlorophenyl)thiophen-2-yl]-N-(4-propoxyphenyl)prop-2-enamide 114,
(2£)-N-ethyl-N-(3-methanesulfonylphenyl)-3-(5-phenylthiophen-2-yl)prop-2-enamide
115,
(2J£')-3-(5-bromothiophen-2-yl)-N-(4-phenoxyphenyl)prop-2-enamide 116,
(2E)-N-(3 -bromophenyl)-3 -(5 -bromothiophen-2-yl)prop-2-enamide 117,
(2£')-3-(5-bromothiophen-2-yl)-N-(4-ethoxyphenyl)prop-2-enamide 118,
(2E)-N-(3 ,4-dichlorophenyl)-3 - [5 -(4-methoxyphenyl)thiophen-2-yl]prop-2-enamide 119,
(2£')-3-(4-phenylthiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 120,
(2JE)-3-[5-(3-cyanophenyl)thiophen-2-yl]-N-(3,4-dichlorophenyl)prop-2-enamide 121, (2£')-3-(5-bromothiophen-2-yl)-N-[4-(2-methoxyethoxy)phenyl]prop-2-enamide 122, (2^)-3-(5-bromothiophen-2-yl)-N-(l-oxo-2,3-dihydro-lH-inden-5-yl)prop-2-enamide 123,
(2£')-3-(5-cyanothiophen-2-yl)-N-(3,4-dichlorophenyl)prop-2-enamide 124,
4-[(2£')-3-(5-bromothiophen-2-yl)prop-2-enamido]-N-methylbenzamide 125,
(2J£')-3-(5-cyanothiophen-2-yl)-N-(4-propoxyphenyl)prop-2-enamide 126,
(2E)-N-(3 ,4-dichlorophenyl)-3 - [5 -(2-methoxyphenyl)thiophen-2-yl]prop-2-enamide 127,
(2JE)-3-(5-bromothiophen-2-yl)-N-(4-methoxyphenyl)prop-2-enamide 128,
(2£,)-N-(3,4-dichlorophenyl)-3-[5-(pyridin-3-yl)thiophen-2-yl]prop-2-enamide 129, (2i?)-3-(5-bromothiophen-2-yl)-N-[3-chloro-4-(2-methoxyethoxy)phenyl]prop-2- enamide 130, (2E)-3 -(5-bromothiophen-2-yl)-N- [2-(4-propoxyphenyl)ethyl]prop-2-enamide 131,
(2£)-3-(5-bromothiophen-2-yl)-N-[3-chloro-4-(morpholin-4-yl)phenyl]prop-2-enamide
132,
(2E)-3 -(2 -phenyl- 1 ,3-thiazol-5-yl)-N-(4-propoxyphenyl)prop-2-enamide 133,
(2£)-N-(5-propoxypyridin-2-yl)-3-[2-(pyridin-2-yl)- l,3-thiazol-5-yl]prop-2-enamide 134,
(2E)-N-(5 -propoxypyridin-2-yl)-3 - [2-(pyridin-2-yl)- 1 ,3-thiazol-5 -yl]prop-2-enamide hydrochloride 134-HCl,
(2£')-3-(5-bromothiophen-2-yl)-N-(5-propoxypyridin-2-yl)prop-2-enamide 135,
(2J£')-3-(5-bromothiophen-2-yl)-N-(6-chloropyridin-2-yl)prop-2-enamide 136,
(2E)-3 -(2 -phenyl- 1 ,3-thiazol-5-yl)-N-[(4-propoxyphenyl)methyl]prop-2-enamide 137, (2E -3 -(2 -phenyl- 1 ,3-thiazol-5-yl)-N-(5-propoxypyridin-2-yl)prop-2-enamide 138, (2i?)-N-(3-methanesulfonylphenyl)-3-(2-phenyl-l ,3-thiazol-5-yl)prop-2-enamide 139, (2i?)-3-(5-bromothiophen-2-yl)-N-(6-chloropyrazin-2-yl)prop-2-enamide 140,
(2£')-N-(3-chloro-4-propoxyphenyl)-3-(2-phenyl-l ,3-thiazol-5-yl)prop-2-enamide 141, (2i?)-3-(5-bromothiophen-2-yl)-N-(2-propoxypyrimidin-5-yl)prop-2-enamide 142, (2J£')-3-(5-bromothiophen-2-yl)-N-(quinolin-3-yl)prop-2-enamide 143,
(2£')-3-(5-bromothiophen-2-yl)-N-(isoquinolin-4-yl)prop-2-enamide 144, and
(2£)-3-(5-bromothiophen-2-yl)-N-(6-propoxypyridin-3-yl)prop-2-enamide 145.
8. Compound for use according to claim 7, wherein the compound is selected in the group consisting of compound 1, compound 2, compound 3, compound 6, compound 22, compound 32, compound 38, compound 44, compound 50, compound 56, compound 59, compound 66, compound 68, compound 71, compound 80, compound 86, compound 92, compound 93, compound 94, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, and compound 138.
9. Compound for use according to anyone of claims 1 to 8, wherein the virus is of the flaviviridae family.
10. Compound for use according to claim 9, wherein the virus is of the flavivirus genus.
11. Compound for use according to claim 10, wherein the virus is selected in the group consisting of Dengue virus (DENV), West Nile virus (WNV), Yellow Fever virus (YFV), tick-borne encephalitis virus (TBEV), Kunjin virus (KUNV), Zika virus and Japanese encephalitis virus (JEV).
12. Compound for use according to claim 11, wherein the virus is dengue virus (DENV).
13. Compound for use according to claim 12, wherein the virus is selected among DENV-1, DENV-2, DENV-3 and DENV-4.
14. Compound for use according to claim 13, wherein the virus is DENV-2.
15. Compound of formula (A) as defined in claim 1, wherein the compound is selected in the group consisting of compound 1, compound 2, compound 3, compound 32, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131 compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144, and compound 145.
16. Compound according to claim 15, for use as a medicine.
17. Pharmaceutical composition comprising a pharmaceutically acceptable support and at least one compound selected in the group consisting of compound 1, compound 2, compound 3, compound 32, compound 44, compound 46, compound 50, compound 56, compound 62, compound 68, compound 92, compound 93, compound 94, compound 104, compound 105, compound 106, compound 107, compound 108, compound 110, compound 111, compound 112, compound 114, compound 115, compound 117, compound 119, compound 120, compound 121, compound 122, compound 123, compound 124, compound 126, compound 127, compound 129, compound 130, compound 131, compound 132, compound 133, compound 134, compound 134-HCl, compound 135, compound 136, compound 137, compound 138, compound 139, compound 140, compound 141, compound 142, compound 144, and compound 145.
PCT/EP2015/080354 2015-12-17 2015-12-17 Propenamide thiophene derivatives as flavivirus inhibitors and their use Ceased WO2017102014A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP2015/080354 WO2017102014A1 (en) 2015-12-17 2015-12-17 Propenamide thiophene derivatives as flavivirus inhibitors and their use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2015/080354 WO2017102014A1 (en) 2015-12-17 2015-12-17 Propenamide thiophene derivatives as flavivirus inhibitors and their use

Publications (1)

Publication Number Publication Date
WO2017102014A1 true WO2017102014A1 (en) 2017-06-22

Family

ID=55025057

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/080354 Ceased WO2017102014A1 (en) 2015-12-17 2015-12-17 Propenamide thiophene derivatives as flavivirus inhibitors and their use

Country Status (1)

Country Link
WO (1) WO2017102014A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN120022271A (en) * 2025-04-10 2025-05-23 中国医学科学院病原生物学研究所 Application of a small molecule compound in the preparation of antiviral drugs

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999049856A2 (en) * 1998-03-27 1999-10-07 Genentech, Inc. Antagonists for treatment of cd11/cd18 adhesion receptor mediated disorders
WO1999051580A1 (en) * 1998-04-08 1999-10-14 Abbott Laboratories Pyrazole inhibitors of cytokine production
WO2000026197A1 (en) * 1998-10-29 2000-05-11 Bristol-Myers Squibb Company Novel inhibitors of impdh enzyme
WO2002040449A1 (en) * 2000-11-14 2002-05-23 Altana Pharma Ag Dihydroisoquinolines as novel phosphodiesterase inhibitors
WO2003049702A2 (en) * 2001-12-10 2003-06-19 Amgen Inc. Vanilloid receptor ligands and their use in treatments

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999049856A2 (en) * 1998-03-27 1999-10-07 Genentech, Inc. Antagonists for treatment of cd11/cd18 adhesion receptor mediated disorders
WO1999051580A1 (en) * 1998-04-08 1999-10-14 Abbott Laboratories Pyrazole inhibitors of cytokine production
WO2000026197A1 (en) * 1998-10-29 2000-05-11 Bristol-Myers Squibb Company Novel inhibitors of impdh enzyme
WO2002040449A1 (en) * 2000-11-14 2002-05-23 Altana Pharma Ag Dihydroisoquinolines as novel phosphodiesterase inhibitors
WO2003049702A2 (en) * 2001-12-10 2003-06-19 Amgen Inc. Vanilloid receptor ligands and their use in treatments

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE REGISTRY; CHEMICAL ABSTRA [online] 29 January 2009 (2009-01-29), XP002714593, retrieved from REGISTRY Database accession no. 1097582-82-5 *
J.-J. YOON ET AL: "High-Throughput Screening--Based Identification of Paramyxovirus Inhibitors", JOURNAL OF BIOMOLECULAR SCREENING, vol. 13, no. 7, 1 July 2008 (2008-07-01), pages 591 - 608, XP055133058, ISSN: 1087-0571, DOI: 10.1177/1087057108321089 *
NITSCHE CHRISTOPH ET AL: "Arylcyanoacrylamides as inhibitors of the Dengue and West Nile virus proteases", BIOORGANIC & MEDICINAL CHEMISTRY, PERGAMON, GB, vol. 19, no. 24, 25 October 2011 (2011-10-25), pages 7318 - 7337, XP028597165, ISSN: 0968-0896, DOI: 10.1016/J.BMC.2011.10.061 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN120022271A (en) * 2025-04-10 2025-05-23 中国医学科学院病原生物学研究所 Application of a small molecule compound in the preparation of antiviral drugs
CN120022271B (en) * 2025-04-10 2025-12-02 中国医学科学院病原生物学研究所 Application of a small molecule compound in the preparation of antiviral drugs

Similar Documents

Publication Publication Date Title
AU2014225052B2 (en) Novel nucleoside phosphoramidate compound and use thereof
Benmansour et al. Novel 2-phenyl-5-[(E)-2-(thiophen-2-yl) ethenyl]-1, 3, 4-oxadiazole and 3-phenyl-5-[(E)-2-(thiophen-2-yl) ethenyl]-1, 2, 4-oxadiazole derivatives as dengue virus inhibitors targeting NS5 polymerase
JP4722487B2 (en) Novel coumarins, their carboxamide derivatives, preparation methods, compositions, and uses
JP5463592B2 (en) Novel compounds as adenosine A1 receptor antagonists
Saudi et al. Synthetic strategy and antiviral evaluation of diamide containing heterocycles targeting dengue and yellow fever virus
JP2003507473A (en) Telomerase inhibitors and methods of use thereof
Jeong et al. Synthesis and in-vitro evaluation of 2-amino-4-arylthiazole as inhibitor of 3D polymerase against foot-and-mouth disease (FMD)
KR101338510B1 (en) Pharmaceutical composition for preventing or treating hepatitis, liver cirrhosis, or liver cnacer comprising aminoquinolone derivatives
PT1682129E (en) N-thiazol-2-yl-benzamide derivatives
CN114989079A (en) RIPK1 kinase target inhibitor and medical application thereof
WO2022268145A1 (en) Amide compound, and preparation method therefor and pharmaceutical use thereof
CN106866548B (en) 6-cyclohexylmethylpyrimidinone HIV reverse transcriptase inhibitor, its preparation method and application
WO2017102014A1 (en) Propenamide thiophene derivatives as flavivirus inhibitors and their use
KR102063286B1 (en) Novel Hydroxamic Acid Incorporating Quinazolin-4(3H)-ones as Histone Deacetylase Inhibitors and Anticancer Composition Comprising the Same
WO2000033837A2 (en) Myt1 kinase inhibitors
Fang et al. Design, synthesis, and evaluation of 3‐((4‐(t‐Butyl)‐2‐(2‐benzylidenehydrazinyl) thiazol‐5‐yl) methyl) quinolin‐2 (1H)‐ones as neuraminidase inhibitors
Jiang et al. Synthesis and antiviral activity of a series of novel N-phenylbenzamide and N-phenylacetophenone compounds as anti-HCV and anti-EV71 agents
EP1794157B1 (en) 2-acylaminothiazole derivatives
CN104321321A (en) Novel bicyclic thiazole compounds
KR101630243B1 (en) Novel compounds, pharmaceutically acceptable salts thereof or optical isomer thereof, preparation method thereof and pharmaceutical composition for prevention or treatment of the viral diseases containing the same as an active ingredient
WO2004037166A2 (en) Therapeutic guanidines
ES2630068T3 (en) Coumarin derivative
KR102055369B1 (en) Novel 3/4-((Substitutedbenzamidophenoxy)methyl)-N-hydroxybenzamides/propenamides and its use
CN104003954B (en) 1,2,5-oxadiazole-2 oxide analogue, and preparation method and application thereof
KR101194995B1 (en) Novel 4-phenyl-benzimidazole or 4-phenyl-benzoxazole derivates or pharmaceutically acceptable salts thereof, preparation method thereof and pharmaceutical compositions for antivirus containing the same as an active gredient

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15816747

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15816747

Country of ref document: EP

Kind code of ref document: A1