WO2017093682A1 - Lighting system made from luciferase - Google Patents

Abstract

The invention relates to a contained lighting system which comprises a luciferase expression cassette inserted into a prokaryotic microorganism, as well as to the associated method for producing light.

Description

 LUMINOUS SYSTEM BASED ON LUCIFERASE

A bioluminescent system that includes a luciferase expression cassette inserted into a prokaryotic microorganism, as well as the associated light producing method.

 Bioluminescence is present in many phyla, particularly in the marine environment: bacteria, annelids, molluscs, dinoflagellates, fish, but also fungi and insects. Bioluminescent bacteria are widely found in marine and terrestrial environments.

 To date, at least 11 species of bacteria in four Gram-negative genera have been described: Vibrio, Photobacterium, Shewanella (Alteromonas) and Photorhabdus (Xenorhabdus). In all these species, the five genes responsible for bioluminescence are grouped in the lux operon.

 In these bacteria, bioluminescence is considered as the result of the oxidation of a reduced flavin mononucleotide (FMNH2) and a long-chain fatty aldehyde, catalyzed by luciferase. Bioluminescence is a cold light emission produced by biochemical reaction.

The luciferase enzyme is encoded by two heterodimer-forming subunits (luxAB), whereas the reductase, transferase and synthase peptides responsible for the aldehyde substrate biosynthesis in the luminescent reaction are encoded by three luxCDE genes respectively flanking luxAB genes, with transcription in the order luxCDABE. A number of additional lux genes have been identified in these bacteria, such as the luxG gene, but only luxA-E genes are essential for light biosynthesis (Meighen, E., (1993), The FASEB Journal 7: 1016-1022. Applications of bioluminescence have been developed for biochemistry, molecular biology and biotechnology (assaying various metabolites, reporter genes, labeled probes, detection of bacterial contaminations, etc.) and are powerful tools for avoiding the use of radioactive markers.

 An ELISA-type assay system for detecting toxicity or susceptibility to different microbial agents using bioluminescent bacteria has been previously described. This system relies on the use of transformed bacteria expressing luciferase under the control of an inducible promoter. Contacting the agents with toxic potential with the bioluminescent bacteria makes it possible to identify the toxic agents by causing the death of the bioluminescent bacteria, thus the disappearance of the light signal. Bioluminescent bacteria are grown in petri dishes.

 The Applicant has discovered that 1 lux operon of luminescent bacteria, inserted into microorganisms and maintained in a confined gelled medium could form a light generating system.

The subject of the invention is therefore a confined bioluminescent system comprising such a lux operon inserted in a microorganism. The advantage of a confined system is that it allows manipulation of the bioluminescence, that it can be transported and exposed without risk of escape of the culture medium and microorganisms. In addition, confinement avoids contamination of the system. From a regulatory point of view, the use of Class 1 genetically modified microorganisms (GMOs) outside a laboratory can only be achieved by maintaining the containment in such a way as to prevent any release of GMOs. A system confined in accordance with the invention can therefore be used as a bioluminescent object in private or public spaces. Another object of the invention is a light production method comprising such a system.

 These and other embodiments of the present invention will be readily apparent to those skilled in the art from the present disclosure.

DETAILED DESCRIPTION OF THE INVENTION

The practice of the present invention will employ, unless otherwise indicated, conventional methods of biochemistry and molecular biology. Such techniques are explained in the literature (Ausubel, FM, et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., Media, PA (1995), Sambrook, J., et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory (Cold

Spring Harbor, NY) (1989). In the description of the present invention, the following terms are defined as indicated below.

 The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof.

 Non-limiting examples of polynucleotides include a gene, a gene fragment, cDNA, recombinant polynucleotides, plasmids, vectors and DNA isolated from any sequence.

A polynucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (or uracil (U) when the polynucleotide is RNA). A "coding sequence" or a sequence that "codes" a selected polypeptide, is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences of (or "control elements"). A transcription termination sequence may be located 3 'to the coding sequence.

 Typical "control elements" include, but are not limited to, transcriptional regulators, such as promoters, transcriptional enhancers, and transcription termination signals.

 Promoters can include inducible promoters, repressible promoters and constitutive promoters.

 An "isolated polynucleotide" is a nucleic acid molecule separate and distinct from the entire organism with which the molecule is found in nature; or a nucleic acid molecule devoid, in whole or in part, of sequences normally associated with it in nature.

 A "polypeptide" is used in this broadest sense to refer to a compound of two or more amino acid subunits.

 "Functionally linked" refers to an arrangement of elements in which the components so described are configured to perform their usual function. Thus, a given promoter that is operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the appropriate enzymes are present.

 The regulatory elements of gene expression, including promoters or other control elements, are not necessarily contiguous to the coding sequence, as long as they function to drive the expression thereof.

For example, untranslated but transcribed intermediate sequences may be present between the promoter sequence and the coding sequence but the promoter sequence may still be considered as "operably linked" to the coding sequence. "Recombinant", as used herein to describe a nucleic acid molecule, means a DNA polynucleotide which by virtue of its origin or manipulation is not associated with all or part of the polynucleotide with which it is associated in nature, and / or is bound to a polynucleotide other than that to which it is bound in nature.

 The term "recombinant", as used with respect to a protein or polypeptide, means a polypeptide produced by the expression of a recombinant polynucleotide.

 "Recombinant bacteria", "host bacteria" are used interchangeably and refer to prokaryotic microorganisms that have been used as recipients for recombinant vectors or other transfer DNA, and include the progeny of the original microorganism that has been transformed.

 "Gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed or translated.

 "Coded by" refers to a nucleic acid sequence that encodes a polypeptide sequence.

 A "vector" is capable of transferring gene sequences to target cells (e.g., viral vectors, non-viral vectors, etc.).

As a general rule, "vector construct", "expression vector" and "gene transfer vector (s)" refer to any nucleic acid construct capable of directing the expression of one or more genes of interest and which can transfer gene sequences to target cells. Thus, these terms include cloning and expression vehicles, such as plasmids, as well as viral vectors. "Nucleic acid expression vector" refers to an assembly that is capable of directing the expression of a sequence or gene of interest.

 The nucleic acid expression vector comprises a promoter that is operably linked to the sequences or gene (s) of interest.

 Among the components of an expression cassette, the plasmid construct may comprise one or more bacterial origin (s) of replication, one or more selectable markers, a signal that allows the plasmid construct to exist as a single-stranded DNA (eg, an M13 origin of replication) and a multiple cloning site.

 An "expression cassette" includes any nucleic acid construct that contains the sequence (s) capable of being expressed in a cell.

 The expression cassettes may contain, in addition to the polynucleotide genes (s) or sequence (s) of interest, other regulatory or control elements.

 These cassettes are typically constructed in one

"vector", "expression vector", "nucleic acid expression vector" or "gene transfer vector" to transfer the expression cassette into target prokaryotic microorganisms.

 "Gram-negative" is a taxonomic characteristic referring to bacteria that are easily discolored with stains of standard Gram staining.

 "Visible light" is defined herein, unless otherwise indicated, as electromagnetic radiation having a wavelength of between about 400 nm and about 750 nm. When speaking of bioluminescence, the wavelength is generally between 450 and 550 nm.

A "light-generating protein" is defined as a protein or polypeptide capable of generating light through a chemical reaction (eg, bioluminescence, as generated by luciferase).

 The term "lux" refers to prokaryotic genes associated with luciferase and photon emission.

In a particular embodiment, the invention is a confined light system comprising, in a gelled nutrient medium:

 an expression cassette encoding luciferase inserted into a prokaryotic microorganism and

 an expression cassette encoding a luciferase substrate or an exogenous substrate of luciferase.

 In another particular embodiment, the invention is a confined light system comprising, in a gelled nutrient medium, an expression cassette encoding luciferase and its substrate, inserted into a prokaryotic microorganism.

Such a light system is said to be "confined" because it makes it possible to contain the liquids, in particular the gelled medium and the bacteria. This confinement is an essential element of the invention because neither the medium nor the bacteria must be able to escape from the system. Although the system is confined, it is necessary that the microorganisms present in the gelled medium are in contact with the air. Indeed, oxygen is essential for the emission of light by microorganisms. Thus, the confined system can be in different variants. A first variant consists of a confined system in which the container is permeable to gases. A second variant consists of a system that is not permeable to gases but in which a sufficient quantity of air is present inside the gastight container. For example, a petri dish containing a nutrient medium in which the microorganisms are present and which would be hermetically sealed would contain a quantity of air sufficient to allow the emission of light. As an indication, an amount of air corresponding to at least 10% of the volume of the nutrient medium would be sufficient.

 In a particular embodiment, the invention relates to a light system comprising, in a gelled nutrient medium, an expression cassette of one or more genes encoding luciferase inserted into a prokaryotic microorganism, a substrate for luciferase, said system being confined in a gas permeable container.

 A variety of genes encoding luciferase have been identified and have been described in US Patents 5,670,356, US 5,604,123, US 5,618,722, US 5,650,289, US 5,641,641, US

5,229,285, US 5,292,658 or US 5,418,155.

 The synthesis of light in bioluminescent bacteria of natural origin is encoded by five essential genes. These genes are grouped into an operon (luxCDABE) that can be introduced into non-naturally bioluminescent bacteria to produce a bioluminescent phenotype.

 The luciferase enzyme is coded by two luxA and luxB subunits, while the enzymes responsible for the biosynthesis of its substrate, the aldehyde, are encoded by three luxC, luxD and luxE genes. Thus, a cassette encoding luciferase may contain the luxA gene or the luxA and luxB genes. As the substrate can rapidly diffuse across the cell membranes and considering that it is commercially available (for example, Sigma, France, for aldehyde), the introduction of the genes encoding the synthesis of this substrate

(luxCDE) are not essential for bioluminescence and may be substituted by the addition of the substrate exogenously. In a preferred embodiment, the sequences encoding the luxA, luxB, luxC, luxD and luxE genes are obtained from the Vibrio luminescent bacterium, preferably bacteria of the species Vibrio fischeri, Vibrio haweyi, and Vibrio harveyi. More preferably, the lux operon comes from Vibrio fischeri. These strains can be obtained from the Institute's Collection of Bacterial Strains.

Pasteur (France), or from the ATCC (USA).

 In this bacterium, luciferase is a heterodimer consisting of a 42kDa alpha subunit and a 37kDa beta subunit, encoded respectively by the luxA and luxB genes, while luxC, luxD and luxE encode the enzymes.

(fatty acid reductase, acyl transferase and acyl protein synthase) for the synthesis of tetradecanal, the substrate for luciferase. The enzyme expressed by luxD allows the conversion of a fatty acid to tetradecanal while the enzymes expressed by luxC / E allow the regeneration of tetradecanoic acid, produced during the bioluminescence reaction, tetradecanal substrate luciferase.

 In addition, in marine bacteria such as Vibrio fischeri, there is the presence of an additional gene, luxG, which follows the luxE gene. The deduced amino acid sequence of luxG is similar to that of Fre, E. coli flavin reductase. As a result, the luxG gene product could be a flavin reductase providing the FMNH- substrate for the luciferase reaction. However, the luxG gene product has never been expressed or characterized. Its function remains uncertain. The nucleotide sequences of the Vibrio fischeri lux operon genes are indicated in GenBank (accession numbers AY341062 for the luxCDABE operon (identified as SEQ ID N0.1 in the present application) and luxGAB X70289.1 ( identified as SEQ ID NO.2 in this application).

Luciferase production from Vibrio fischeri bacteria is optimal at 15-30 ° C. Beyond that, the enzyme is degraded. However, luciferase from some lux operons from other Bacteria, such as Vibrio campbellii, are thermostable at 37 ° C for example.

 Such genes encoding luciferase can be modified by the methods described herein to produce useful polypeptide expression sequences and / or cassettes.

 In one aspect, the invention comprises an expression cassette comprising a polynucleotide encoding the LuxA, LuxB, LuxC, LuxD and LuxE proteins, wherein the arrangement of the gene product coding sequences is preferably, but not necessarily in the following order 5 '- LuxC-LuxD-LuxA-LuxB-LuxE-3'.

 The luxABCDE expression cassettes express not only luciferase, but also the biosynthetic enzymes required for luciferase substrate synthesis. Thus, by including both the structural (luxA or luxAB) and substrate (luxCDE) genes, this expression cassette does not require the addition of exogenous substrate.

 In addition, it is possible to insert with the luxABCDE operon, the luxG gene, into the expression cassettes.

 Thus, in a preferred embodiment, the luciferase genes are the luxA, luxB genes, and the substrate genes are the luxC, luxD and luxE genes. In another embodiment, the luciferase genes are the luxA, luxB genes, and the substrate genes are the luxC, luxD, luxE and luxG genes.

Optionally, short DNA sequences comprising promoters or other transcription or translation regulators are inserted before the lux cassette.

In particular, one or more inducible promoters may be operably inserted before the lux cassette to place one or more lux operon genes under functional control of the one or more promoters. Suitable inducible promoters are, for example, the T7 promoter (inducible by isopropyl β-D1-thiogalactopyranoside (IPTG)), the pBAD promoter (arabinose inducible) or the pDawn / Dusk promoter (light inducible or dark). Preferably, the T7 promoter is used, operably linked, upstream of 1 lux operon.

 In another embodiment of the invention, non-inducible promoters may be used upstream of the lux cassette to place the expression cassette of one or more genes encoding luciferase under the control of said promoter.

 Such promoters are for example the promoter pOsmY, psAB or RpoS.

 The expression cassette is preferably capable of expressing gene products in the type of selected prokaryotic microorganism.

 In addition, in all these cassettes, the coding sequences of the gene products may comprise codons that are optimal for the expression of gene products in a host system into which the expression cassette is to be introduced.

 The expression cassettes described above can be integrated into the genome of a prokaryotic microorganism for example by CRISPR / Cas9 techniques, or extrachromosomally and thus confer the ability to produce light to a microorganism. prokaryote.

 In one embodiment, these cassettes are contained in expression vectors or shuttle vectors, preferably plasmids.

Thus, the invention uses a shuttle vector comprising at least: a) an expression cassette as described above; b) a polynucleotide encoding a selectable marker (eg, ampicillin or chloramphenicol) and c) a Gram negative origin of replication.

 Vectors containing the appropriate regulatory elements and multiple cloning sites are commercially available (e.g. Stratagene, La Jolla,

California; Clontech, Palo Alto, Calif.).

 One such example is the expression plasmid pRSET, sold by Thermo Fisher, USA. In one embodiment, the expression cassettes are introduced into prokaryotic microorganisms by transformation of the host, preferably Gram-negative bacteria, into the light system of the invention.

 Preferably, the prokaryotic microorganism is an enterobacterium, and even more preferably this bacterium is Escherichia coli.

 Preferably, the strain of E. coli BL21 (DE3) is used. This strain is available from New England Biolabs (France).

 In a preferred embodiment, the prokaryotic strain used to produce the bioluminescence is strain E.

Coli BL21 (DE3pLysS) transformed with the plasmid pT7-luxCDABE.

 In addition, the inventors have shown that the E. coli strain expressing luciferase can be modified so as to increase the intensity and duration of the bioluminescence produced by the strain. In particular, this effect was obtained by deletion of either the tnaA gene which codes for the tryptophanase, or of the hns gene which codes for the H-NS protein. The sequence of the tnaA gene corresponds to SEQ ID NO.3 and the hns gene sequence corresponds to SEQ ID NO.4.

In addition, the inventors have shown that the addition of the FRP gene (which encodes the FRP protein, a NADPH-flavin oxidoreductase) also makes it possible to increase the intensity and the duration of the bioluminescence produced by the strain. The sequence of the gene frp corresponds to SEQ ID NO.5.

 Thus, in a preferred embodiment, the strain used is E. coli strain BL21 (DE3pLysS) transformed with the plasmid pT7-luxCDABE and whose tnaA gene has been deleted or inactivated.

 In another preferred embodiment, the strain used is E. coli strain BL21 (DE3pLysS) transformed with the plasmid pT7-luxCDABE and whose hns gene has been deleted or inactivated.

 In yet another preferred embodiment, the strain used is E. coli strain BL21 (DE3pLysS) transformed with the plasmid pT7-luxCDABE and which expresses the FRP protein.

 Alternatively, the prokaryotic microorganism is a cyanobacterium. Preferably, the cyanobacterium strain used is Synechocystis. In particular, the strain Synechocystis PCC.6803 is available from ATCC (USA) under the reference No. 27184.

 Prokaryotic cell transformation methods are well known in the art (eg, Sambrook, et al.) And include, but are not limited to, calcium phosphate precipitation and electroporation.

 The light system of the invention thus preferably comprises an expression cassette of one or more lux genes of Vibrio fischeri under the control of at least one promoter, preferably an inducible promoter, and a substrate of luciferase, said cassette being inserted into a bacterium, preferably E. coli.

 This bacterium, once transformed by said cassette, is cultured in a holding medium comprising at least one gelling agent, water and IPTG.

The gelling agent may be, for example, agar-agar, orthophosphoric acid and its derivatives, acid alginic and derivatives, carrageenates or pectin. Preferably, the gelling agent is agar-agar.

 In one embodiment of the invention, the expression cassette is under the control of the T7 promoter, the bacterium is E. coliBL21 (DE3) and the maintenance medium contains

IPTG to induce the expression of luciferase proteins under the control of the T7 promoter.

 The holding medium is gelled at a rate of 6 to 8 grams of gelling agent per liter of medium. The gelling agent is preferably agar (Gibco, France). This makes it possible to avoid sedimentation of the bioluminescent bacteria within the light system. This holding medium is thus stored at 60 ° C., then at the time of use, is cooled to 39 ° C. for the addition of transformed bioluminescent bacteria and then rapidly inserted into the appropriate gas-permeable container before gelation and solidification of the medium. preferably at room temperature. This container can take various forms but is preferably transparent or almost transparent to allow the light emitted by the bacteria to pass through. Preferably, this container is made of a polymeric material. Even more preferentially, this polymeric material is polydimethylsiloxane or PDMS. This container can in particular take the form of a light column, a light stick. This container may also take the form of a capsule intended to be ingested for the functional exploration of a mouse for example.

The light production method comprises the steps of implementing a system that includes an expression cassette comprising one or more genes encoding luciferase inserted into a microorganism and a luciferase substrate, said system being confined as previously described. The following examples are intended to illustrate the invention without being limiting in nature.

DESCRIPTION OF THE FIGURES

Figure 1 is a schematic representation of the plasmid pT7-luxCDABE, which carries the entire lux operon of Vibrio fischeri under the control of the T7 promoter.

 Figure 2 is a graphical representation of the light intensity of the system of Example 4 of the invention as a function of time. The bioluminescent bacteria correspond to E. coli strain BL21 (DE3pLysS) transformed with the plasmid pT7-luxCDABE described in Example 2A).

 FIG. 3 is a graphic representation of the intensity of the bioluminescence produced as a function of time by the E. Coli strain described in Example 2B).

 FIG. 4 is a graphic representation of the intensity of the bioluminescence produced as a function of time by the E. Coli strain described in Example 2C).

 FIG. 5 is a graphical representation of the intensity of the bioluminescence produced as a function of time by the E. Coli strain described in Example 2D)

EXAMPLES

Example 1 Construction of plasmids carrying the lux operon

A) Plasmid pT7- luxCDABE:

 For the construction of this plasmid, the luxCDABE operon (accession number of the sequence in Genbank

: AY341062.2) was synthesized at ThermoFisher / Life Technologies, using their GeneArt TM service.

The product was amplified by polymerase chain reaction (PCR) using the primers: Meaning :

 TATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGA GATATACATATGGTATTCCAATGATAATTAATGGAATGATTCAAGATTTTGATAATTAT

(SEQ ID N0.6)

 And Inverse:

 CAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCAAGCTTTTAATCCTTGATATTCTT TTGTATGACATTAGCCATAGAG (SEQ ID N0.7)

 The PCR product was assembled by the Gibson assembly technique into the Xba I restriction expression vector RSET (Thermo Fisher) digested with restriction enzymes Xba I and

HindIII (Gibson DG, et al., (2009). "Enzymatic assembly of DNA molecules up to several hundred kilobases." Nature Methods 6 (5): 343-345.) Plasmid pOSM-luxCDABE

 The sequence pOsmY promoter:

 CTGGCACAGGAACGTTATCCGGACGTTCAGTTCCACCAGACCCGCGAGCATTAATTCT TGCCTCCAGGGCGCGGTAGTGGCGCCCTGTCAATTTCCCTTCCTTATTAGCCGCTTACGGAA TGTTCTTAAAACATTCACTTTTGCTTATGTTTTCGCTGATATCCCGAGCGGTTTCAAAATTG TGATCTATATTTAACAA (SEQ ID NO.12)

 was synthesized at ThermoFisher / Lifetechnologies, using their GeneArt TM service.

 The product was amplified by polymerase chain reaction (PCR) using the primers:

 Meaning:

 TCCCCGCGCGTTGGCCGATTCATTAATGCAGATCTCGATCCCGCGAAATCTGGCACAG GAACGTTATCCGGAC (SEQ ID NO.8)

 Antisense:

 TTGTTAAATATAGATCACAATTTTGAAACCGCTCGG (SEQ ID NO.9)

This PCR product and the PCR product containing 1 Lux operon above were assembled by the Gibso n assembly technique into the pRSET (Thermo Fisher) expression vector previously digested with BglII / HindIII. C) Plasmid pT7-luxCDABEG:

 For construction, the luxCDABE operon (sequence accession number in Genbank: AY341062.2) (SEQ ID NO.l) and luxG gene (sequence accession number in Genbank: X70289) (SEQ ID NO.2) were synthesized in the same way at Thermo Fisher / Life Technologies, using their GeneArt TM service.

 The product was amplified by polymerase chain reaction (PCR) using the primers:

 Meaning:

 TATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATA TACATATGGTATTCCAATGATAATTAATGGAATGATTCAAGATTTTGATAATTAT (SEQ

ID NO.10)

 Antisense:

CAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCAAGCTTTTATACGTATGCAAAAGCATCG GCAAACATCT (SEQ ID NO.11)

 The PCR product was assembled by the Gibson assembly technique into the RSET expression vector (Thermo Fisher) digested with restriction enzymes XbaI and HindIII.

 D) Preparation of a strain BL21 (DE3pLysS) -pT7-lux expressing the FRP protein.

 The expression of the FRP protein was obtained by transforming the bacteria with a pT7-luxCDABEG-FRP plasmid, by applying the same protocol as that described in Example 2A.

For construction, the luxCDABE operon (sequence accession number in Genbank: AY341062.2), luxG gene (sequence accession number in Genbank: X70289) and the gene frp (accession number of Genbank: the sequence in

Genbank: U08996.1) were synthesized in the same way at Thermo Fisher / Life Technologies, using their GeneArt TM service. The product was amplified by polymerase chain reaction (PCR) using the primers:

Meaning :

 TATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATA TACATATGGTATTCCAATGATAATTAATGGAATGATTCAAGATTTTGATAATTAT (SEQ

ID NO.6)

Antisense:

 CAGATTCCTTTCGGGCTTTGTTAGCAGCCGGATCAAGCTTTAGCGTTTTGCTAGCCCCTTAC TGTTCA (SEQ ID NO.16) The PCR product was assembled by the Gibson assembly technique into the RSET (Thermo Fisher) p expression vector digested with restriction enzymes XbaI and HindIII.

Example 2 Preparation of Recombinant Bioluminescent Bacteria

 Unless otherwise noted, the manipulation of bacteria, proteins, and nucleic acids has been accomplished using standard methods, as described in, for example, Sambrook, et al., And Ausubel, FM, et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., Media, PA (1995).

 Briefly, the plasmid pT7-luxCDABE of Example 1, comprising 1 Lux operon of Vibrio fischeri under the control of the constitutive T7 promoter of Xenorhabdus luminescens, was inserted into the bacterium E. coli BL21 (DE3pLysS) (Promega France). This bacterial strain allows the induction of the expression of phage T7 RNA polymerase by the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG).

A) Transformation of E. coli strain BL21 (DE3pLysS) using plasmid pT7-luxCDABE The bacterial culture was grown overnight in LB (Gibco, France) at 37 ° C. Five mL of each culture was used to inoculate a volume of 500 mL of fresh LB. After stirring at 37 ° C to OD 600 nm of about 0.6, the bacteria were chilled on ice for 30 min before being harvested by centrifugation at 3000g for 10 min at 4 ° C.

 The bacteria were taken up in 50 ml of CaC12 at 100 mM (Sigma, France) and placed on ice for 30 minutes.

 1 microliter of plasmid pT7-luxCDABE at a concentration of 100 mg / ml was added to 50 microliters of competent bacteria, then the bacteria were incubated for 5 to 10 minutes on ice, subjected to thermal shock at 42 ° C. for 45 seconds before be incubated again for 5 to 10 minutes on ice.

 Then, 250 microliters of LB was added and the tube was incubated for 1 hour at 37 ° C with shaking (800 rpm). The bacteria were then plated on an agar containing the ampicillin antibiotic selection at a rate of 100 mg / ml. The bacteria having integrated the plasmid are called BL21 (DE3pLysS) -pT7-lux

B) Preparation of a strain BL21 (DE3pLysS) -pT7-lux not expressing tryptophan.

 Such a strain was obtained by knockout technique to delete the gene coding for tryptophan. This strain was established using the GeneBridges Red / ET E. coli knockout kit.

 Day 1: Linear DNA was prepared for transformation using a selection marker PCR

(neo template provided in the Red / ET kit) with oligonucleotides containing the homologous arms. The expected size of the fragment was checked on an agarose gel (1737 base pair) and the DNA was purified. The oligonucleotides used for this amplification are as follows:

 TnaaF:

 AATATTCACAGGGATCACTGTAATTAAAATAAATGAAGGATTATGTAATGAATTAACCCTCA CTAAAGGGCG (SEQ ID NO.13)

 TnaaR:

 ACTCTGTAGTATTAATTAAACTTCTTTAAGTTTTGCGGTGAAGTGACGCATAATACGACTCA CTATAGGGCTC (SEQ ID NO.14)

 Day 2: Electrocompetent cells were prepared using one of the standard methods, well known to those skilled in the art. These competent cells were electroporated with the plasmid pRedET (ampicillin resistance, supplied with the kit). Since the origin of replication was temperature sensitive, the cells were recovered after electroporation at 30 ° C, then plated on ampicillin petri dishes, and incubated overnight at 30 ° C.

Day 3: The colonies containing pRedET were cultured for 12 hours (overnight) at 30 ° C.

Day 4: 1.4mL of LB medium were inoculated with 30uL of the pre-culture (overnight) and incubated for 2h at 30 ° C, until the OD ₆₀₀ approached 0.3. After incubation, arabinose was added to give a final concentration of 0.3-0.4%. The cells were then incubated with shaking at 37 ° C. for 45 min-1 h.

 The cells were again treated to make them competent for electroporation.

 200-400ng of linear fragment generated at day 1 were added to the electrocompetent cells. After electroporation (1350V - 5ms tap), cells were harvested and shaken at 37 ° C for 3 hours, then plated on petri dishes with kanamycin.

Day 5: The presence of the insertion was verified by PCR using the primers described above. C) Preparation of a strain BL21 (DE3pLysS) -pT7-lux not expressing the H-NS protein.

 Such a strain was obtained by knockout technique in order to delete the gene coding for the H-NS protein. The same protocol as that described in paragraph B has been implemented. The oligonucleotides used for the amplification are as follows:

 HsnF

 ATTATTACCTCAACAAACCACCCCAATATAAGTTTGAGATTACTACAATGAATTAACC CTCACTAAAGGGCG (SEQ ID NO.15)

 HnsR

 GATTTTAAGCAAGTGCAATCTACAAAAGATTATTGCTTGATCAGGAAATCTAATACGA CTCACTATAGGGCTC (SEQ ID NO.16)

Example 3: Preparation of cultures to be inserted into the container

 A) Erlenmeyer production

 The bioluminescent bacteria of Example 2 were amplified in culture at 37 ° C. with shaking at 170 rpm in 500 ml of modified pH7 culture medium containing 10 g / l of glucose, 13.6 g / l of KH 2 PO 4, 0.02 g. / L of CACL2, 0.2 g / L of MgSO 7H 2 O, 2 g / L of (NH 4) 2 SO 4 and 100 mg / L of ampicillin. This culture medium is transparent. It stains less bacteria during their growth than standard culture media (type LB).

The preculture was stopped when the optical density at 600 nm reached 0.8. After centrifugation at 3000 g for 30 minutes, the pellet was resuspended in 1 ml of demineralized water. 19mL of holding medium at pH7 containing 13.6 g / L of KH2PO4, 0.02 g / L of CACL2, 0.2 g / L of MgSO 7H 2 O, 2 g / L of (NH 4) 2 SO 4, 1 mM of IPTG, 0.005% of H2O2, 2g / L of (NH4) 2SO4, 6.2g / L of agar and 100mg / L of ampicillin were added. The Holding medium is transparent, contains IPTG to induce the expression of proteins allowing bioluminescence, 1Ή202 to allow oxygenation of the medium, increasing the brightness and agar to prevent sedimentation of bacteria. It solidifies / gels at room temperature. This medium is prepared and maintained at 60 ° C to keep it in liquid form. When bacteria are inserted, this medium is cooled to 39 ° C under precise control using a temperature probe and then added to the bacteria.

B) Bioreactor production

 The cultures are carried out in Applikon brand minibio-type reactors. The maximum volume of these tanks is 500mL but the working volume is 300mL.

 The agitation is provided by a shaft having 3 pale rushton type and aeration is via a microsparger.

 The culture medium (identical to that used in

Example 3A)) is sterilized by filtration with a cut-off point of 0.2 μπι via Flow filter unit 1000 μl aPES membrane from Thermofisher. The antibiotic was then added.

 The inoculum was prepared from colonies taken from an agar medium. We collected an isolated colony for a preculture Erlen. The non-baffled 250 mL Erlenmeyer contains 25 mL of medium. It was shaken overnight at 37 ° C and 200 rpm which are the standard conditions for E. coli strains in the laboratory. After one night of culture, the OD was 3.4 in the Erlenmeyer flask. The target OD in the fermenters at T0 was 0.2. There was therefore a factor of 17. The inoculum removed was therefore 17 mL in 283 mL of fresh medium.

 The culture parameters were defined according to the usual standards for E cultures. Coli, namely:

-Temperature: 37 ° C. - pH: 6.8 regulated with either 10% H2S04 or soda

5M.

 p02: 20%. E.Coli cultures may have high oxygen requirements, so there is a triple cascade for regulating this parameter:

1) Stirring from 300 to 800 rpm

2) Airflow of 0.150 to 0.3 L.min ^-1

3) Oxygen from 0 to 0.075L.min ^_1

 In order to keep it in the best possible state, at the end of the cultivation, the entire volume is centrifuged in the 500 ml conical bottom jars. 10 minutes at 4700 rpm are sufficient to recover almost all of the biomass.

 The supernatant was taken out and the biomass pellet placed at 4 ° C. at the end of the centrifugation.

 The pellet may be stored for up to 15 days at 4 ° C before being solidified with the maintenance medium (previously described) without observing a significant loss in the luminescence produced during induction.

 The same protocol was applied to 2L, 30L and 300L bioreactor cultures. The cultures obtained are homogeneous and functional.

Example 4: Insertion of Bioluminescent Bacteria into the Container

 Due to the solidification / gelation of the holding medium, all steps of insertion of the bacteria must be done quickly.

Briefly, an empty syringe (20mL) was preheated with a 40mm long needle, 1.2mm OD and 0.8mm ID at 40 ° C for 30 minutes, 20mL of holding medium containing the bioluminescent bacteria was inserted. of Example 3 (at a concentration of 0.5x109 bacteria / ml) in the pre-heated syringe, and then injected into the container which is an envelope made of PDMS (polydimethylsiloxane). The air from the container was removed using another syringe. This system can be stored at 4 ° C for several days or can be used directly after injection. Bioluminescence began a few hours after induction as soon as the constituents were synthesized by the bacteria.

Example 5: Observed bioluminescence and illumination time In this example, the positive control is the content of a Glowstick TM stick (http://www.glowstick.com/band-flo/50-bracelets.html) diluted with water. Briefly, a Glowstick bracelet has been prepared by "breaking" it to activate the emission of light. It was then opened to recover the contents in an eppendorf tube of 1.5mL. 250 ml of this solution was added to 750 ml of water in another 1.5 ml eppendorf tube.

A) Bioluminescence observed with E. Coli strain BL21 (DE3pLysS) -pT7-lux

 In this example, the positive control is the content of a Glowstick TM stick (http://www.glowstick.com/strap-fluo/50-bracelets.html) diluted 1/4 with water. Briefly, a Glowstick bracelet has been prepared by "breaking" it to activate the emission of light. It was then opened to recover the contents in an eppendorf tube of 1.5mL. 250 μl of this solution were added to 750 μl of water in another eppendorf tube of 1.5 ml.

The PDMS container of Example 4, containing 20 μl of bioluminescent bacteria as described in Example 2A at a concentration of 0.5xl0 ⁹ bacteria / ml, was compared to the Glowstick (Figure 2).

All measurements were taken from a cameraNikon D5000 with interval timer option (1 photo every 30 minutes). The samples were placed 1m from the lens.

 The photos were converted to grayscale and analyzed with the Fiji software that quantifies the intensity of a zone in terms of pixel on a scale of 0 to 255. The intensity observed directly after injection has shown a gradual increase and regular bioluminescence, which started 5 hours after injection. The results are presented in Figure 2 and show that the bioluminescence reaches a plateau after 17-18h and remains of the same intensity for about ten hours.

B) Bioluminescence observed with E. coli strain

BL21 (DE3pLysS) -pT7-lux deleted from the tnaA gene.

 Normal bacteria (control, black circle) and deleted tnaA gene (round white) bacteria were prepared as previously described with pT7-lux.

In place of the PDMS container of Example 4, 24-well microplates were used with 1mL of gelled bacteria per well. All measurements were performed on a white 24-well microplate, from a TECAN, SPARK 10M plate reader with the following parameters: 1 photo every 10 minutes, with an integration time of 10 ms, on the mode of bioluminescence. The results are shown in Figure 3 and show that the bioluminescence is well above the control value. It is maximum after about 5 hours and remains of the same intensity until about 12h before gradually decreasing. These results show the positive effect of suppressing tryptophanase expression on the intensity and duration of bioluminescence produced during induction. C) Bioluminescence observed with E. coli strain

BL21 (DE3pLysS) -pT7-lux deleted gene hns

Normal bacteria (control, black circle) and deleted hns gene bacteria (round white) were prepared as previously described with pT7-lux. In place of the PDMS container of Example 4, 24-well microplates were used with 1mL of gelled bacteria per well. All measurements were performed on a white 24-well microplate, from a TECAN plate reader,

SPARK 10M with the following parameters: 1 reading every 10 minutes, with an integration time of 10 ms, on the bioluminescence mode.

The results are shown in Figure 4 and show that the bioluminescence is well above the control value. It is maximum after about 5 hours and decreases gradually over time. These results show the positive effect of suppressing the expression of the H-NS protein on the intensity and duration of the bioluminescence produced during induction.

D) Bioluminescence observed with E. coli strain BL21 (DE3pLysS) -pT7-lux expressing the FRP protein.

The expression of the FRP is obtained by bringing the gene frp on the same plasmid as LuxCDABEG, or on a second plasmid. The FRP gene codes for FRP, an NADPH-flavin oxidoreductase that catalyzes the NADPH-dependent reduction reaction of FMN to FMNH ₂ . This FRP is involved in bioluminescence by bringing FMNH ₂ to luciferase.

 The evaluation of the bioluminescence was carried out in liquid medium by applying the following protocol:

Day 1: Bacteria were prepared with pT7-lux-FRP as Example 2A, but with plasmid pT7-lux-FRP. These bacteria appear as white circles. Control bacteria comprising pT7-lux were prepared as in Example 2A. These control bacteria appear as black circles).

A preculture was prepared by supplementing the 250 μl of bacteria with 5 ml of LB medium + 100 mg / L ampicillin. The bacteria were incubated at 37 ° C overnight.

Day 2: Each transformation was placed in triplicate in a 96-well microplate, 180 μL of culture medium comprising 100 μg / L of ampicillin and 1 μM IPTG with 20 μl of preculture grown overnight.

All measurements were performed on a white 96-well microplate, from a TECAN, SPARK 10M plate reader with the following parameters: 1 reading every 10 minutes, with an integration time of 10 ms, on the mode of bioluminescence. Between each reading, the microplate was automatically shaken by SPARK 10M with 90 rpm orbital shaking.

The results are shown in Figure 5 and show that the bioluminescence is well above the value of the

control. It is maximum between 8h and 15h.

These results show that the expression of FRP results in an increase in the intensity and duration of the

luminescence produced during induction.

Sequence listing

<110> GLOWEE

<120> Luciferase light system

 <130> GLW1 PCT

<150> FR15 / 61672

<151> 2015-12-01

<160> 17

 <170> BiSSAP 1.2

<210> 1

<211> 3191

<212> DNA

 <213> Aliivibrio fischeri

<220>

 <221> source

<222> 1..3191

 <223> / organism = "Aliivibrio fischeri"

 / mol_type = "genomic DNA"

<400> SEQ ID NO.1

aagataagtt tttagttttt gtcccatagt taaaaggaaa ttatatgaaa gatgaaagtg 60

ctttttttac gattgatcac attatcaagc ttgataatgg tcagtctatc cgagtttggg 120

aaacactccc taaaaaaaac gtaccagaga aaaaacatac aatacttatt gcttcgggtt 180

ttgctagaag aatggatcat tttgcaggtc ttgctgagta tttatctact aacggttttc 240

atgtcattcg ctacgattct ttgcatcatg ttggattaag cagtggatgt ataaatgaat 300

ttacgatgtc gattggaaaa aatagcctgc ttacagtcgt agattggctt aaagagcatg 360

gtgtcgaacg aatagggctg attgctgcta gtttgtcagc gagaatcgct tatgaggtag 420

taaataaaat taaattatca tttttaatta cggccgtagg tgtcgttaat cttagagata 480

cattagaaaa agcattggag tatgactatt tgcaattacc tatttcagat ctaccagaag 540

atcttgactt tgaaggtcat aatttaggag ctgaggtctt tgttacagat tgctttaaac 600

ataaatggga cacattagac tcgacactta gtggtgttaa aggattaacg attccattta 660

ttgcttttac tgcaaacgat gatagctggg taaagcaaag tgaagttata gagctcattg 720

atagtattga atctaataat tgtaagctct attcgctaat tggaagttca catgatcttg 780

gggaaaattt ggttgtatta agaaattttt atcaatcagt aacgaaggca gctttagcat 840

tagatgttgg tttattggat ttagatatag atattattga acctcgattt gaggacgtta 900

caagtattac tgttaaggag cgtagattaa aaaatgaaat tgaaaatgaa ttattagaat 960

tagcttaatt aaataaaatc accaaaaagg aatagagtat gaagtttgga aatatttgtt 1020

tttcgtatca accaccaggt gaaactcata agcaagtaat ggatcgcttt gttcgacttg 1080

gtatcgcctc agaggaagta ggctttgata catattggac cttagaacat cattttacag 1140

agtttggtct cacgggaaat ttatttgttg ctgcggcaaa tctgttagga agaactaaaa 1200

cattaaatgt tggtactatg ggggttgtta ttccaacagc tcatcctgtt cgacaattag 1260

aagacgtttt attattagat caaatgtcga aagggcgttt taattttgga accgttcgag 1320

ggctatacca taaagatttt cgagtatttg gtgttgatat ggaagagtct cgagcgatta 1380

ctcaaaattt ctaccagatg ataatggaaa gcttacaaac aggaacagtt agttctgata 1440

gtgattatat ccagttccct aatgtagatg tgtatcctaa agtatattct aaaaatgttc 1500

caacgtgtat gactgctgag tccgcaagta cgacagaatg gctagcaata caagggctac 1560

caatggttct tagttggatt attggtacta atgaaaaaaa agcacagatg gaactctata 1620

atgaaattgc gacagaatat ggccatgaca tatctaaaat agatcattgt atgacttata 1680

tttgctctgt tgatgatgat gcacaaaagg cgcaagatgt ttgtcgggag tttctgaaaa 1740

attggtatga ttcatatgta aatgcgacca atatctttaa tgatagcaat caaactcgtg 1800

gttatgatta tcataaaggc caatggcgtg attttgtttt acaaggacat acaaacacta 1860

atcgacgtgt tgattatagc aatggtatta accctgtagg cactcctgag cagtgtattg 1920

aaataattca acgtgatatt gatgcgacgg gtattacaaa cattacatgc ggatttgaag 1980

ctaatggaac tgaagatgaa ataatagctt ccatgcgacg ctttatgaca caagtcgctc 2040

ctttcttaaa agaacctaaa taaattactt atttgatact agagataata aggaacaagt 2100

tatgaaattt ggattatttt ttctaaactt tcagaaagat ggaataacat ctgaagaaac 2160

gttggataat atggtaaaga ctgtcacgtt aattgattca actaaatatc attttaatac 2220

tgcctttgtt aatgagcatc atttttcaaa aaatggtatt gttggagcac ctattaccgc 2280

Attacatatt ggttcattaa atcaagtaat 2340

taccacccat caccctgtac gtgtagcaga agaagccagt ttattagatc aaatgtcaga 2400

ggggcgcttt attctcggtt ttagtgactg cgaaagtgat ttcgaaatgg agttttttaa 2460

acgtcacatt ccatcaaggc aacaacaatt tgaagcatgc tatgaaataa ttaatgacgc 2520

Attattacaca ggttattgtc atccccaaaa tgatttttat gattttccaa aggtttcaat 2580

taatccacac tgttacagtg ataatgggcc taagcaatat gtatccgcaa catcaaaaga 2640

agtcgtcatg tgggcagcga aaaaggcact gcctttaaca tttaagtggg aggataattt 2700

agaaaccaaa gagcgttatg caattctata taataaaaca gcacaacaat atggtgttga 2760

tatttcggat gttgatcatc aattaactgt aattgcgaac ttaaattctg atagaagtac 2820

ggctcaagaa gaagtgagag aatacttaaa agactatatc actgaaactt accctcaaat 2880

ggacagggat gaaaaaatta actgtattat tgaagagaat gcagtagggt ctcatgatga 2940

ctattatgaa tcgataaaat tagcggtgga aaaaacaggg tctaaaaata ttttattatc 3000

ctttgagtca atggctgatt ttaagggggt aaaagaaatt attgatatgt tgaaccaaaa 3060

aattgaaaag aatctaccct aataaaatta agggcaattt atatattaga ttgccttttt 3120

tgcatttctg ttgatattag gtgttattgg agaggggatg gtatgactgt tcatactgaa 3180

t cL t cL cL cL cLC [cL cL cL

 3191

<210> 2

 <211> 1397

<212> DNA

 <213> Aliivibrio fischeri

<220>

<221> source

<222> 1..1397

 <223> / organism = "Aliivibrio fischeri"

 / mol_type = "genomic DNA" <400> SEQ ID NO .2

aagcttatga aatagataaa atacttctgt aaatacagac acaaaaggca acgttatgat 60

ttctaaatgg gcaaagcgat tcttccaaat ggctgaatta gtcggttctt ggagtaaaga 120

tccgtcaact caagttggtg cagtaatcac taagcataac cgtattgttt ctgttggatt 180

taatggctac ccgcatggtg tatctgacag cgcagatact gatgagcgcg aaattaaata 240

tttaaaaacg cttcatgctg aagaaaatgc cattttattt gctaaacgcg atttagaagg gtgtgatatt tgggttactc acttcccgtg cccaaattgt gcagcaaaaa tcatccaaac 360

aggaatttca aaagtatatt gccctgaaca gactgaagac ttcttatctc gttggggtga 420

aaaaatccaa gttagccaag atatgttttc tcaggcggga gttgaagtca cttggttacc 480

cttggacata ttgaaataat aaaaaagccg gattaataat ctggcttttt atattctctt 540

tatacgtatg caaaagcatc ggcaaacatc tgttctgact ttgctttttt ctcttcaatt 600

aatttttctt ttgctgtttt agccatcatg aagggcccac aaacataaat atcaaaatgg 660

gctagatccg taaaatcttc cattacagca tcaagaaccg tacctttttt tcctatccat 720

tcttcacttt tatcttcgat aacaggaata taatgaagat ttttgttatt tagtgataat 780

tccaataact cttcgtcttc atacaaaaga gaactgtttt ttactcccca gtaaagataa 840

atatcttgag gtatattccg atttaagcaa ttggttagaa tgctatttat atatgataaa 900

cctgtacctc ccgcaattaa tagcaatggg ttattacttt cagaccgtaa ccaagcgttt 960

ccatggggag catctaactc aattgcgact tcctcaacaa gagcatcgac aaaatattcg 1020

ataatatcca atgagcagtc tttattcgaa ctaccaatat gcaattctat ttcgtgattt 1080

tttgtcgggc aattcgcaat tgaaaaagga cattttttcc cattaatcgt gaccattaca 1140

aattgtccag cgatgaactt tattggtgaa tttacagtaa taaatacctt atatatatta 1200

ttttttatcg atgctaaaac tatctttgaa actctgccat caacaatcat aacttaatcc 1260

tttatattct tttgtatgac attcgccata gagagcgcgc atcctttttg cgcacgtgta 1320

tttaagcgcc gaacaatctc aacggttacc cctgggtaag gatctggttc tctaatttct 1380

tttacaatac cgatatc

<210> 3

<211> 1416

1397

 <212> DNA

 <213> Escherichia coli

<220>

 <221> source

<222> 1..1416

 <223> / organism = "Escherichia coli"

/ mol type = "genomic DNA" <400> SEQ ID N0.3

atggaaaact ttaaacatct ccctgaaccg ttccgcattc gtgttattga gccagtaaaa

60

cgtaccactc gcgcttatcg tgaagaggca attattaaat ccggtatgaa cccgttcctg 120

ctggatagcg aagatgtttt tatcgattta ctgaccgaca gcggcaccgg ggcggtgacg 180

cagagcatgc aggctgcgat gatgcgcggc gacgaagcct acagcggcag tcgtagctac 240

tatgcgttag ccgagtcagt gaaaaatatc tttggttatc aatacaccat tccgactcac 300

cagggccgtg gcgcagagca aatctatatt ccggtactga ttaaaaaacg cgagcaggaa 360

aaaggcctgg atcgcagcaa aatggtggcg ttctctaact atttctttga taccacgcag 420

ggccatagcc agatcaacgg ctgtaccgtg cgtaacgtct atatcaaaga agccttcgat 480

acggcgtgc gttacgactt taaaggcaac tttgaccttg agggattaga acgcggtatt 540

gaagaagttg gtccgaataa cgtgccgtat atcgttgcaa ccatcaccag taactctgca 600

ggtggtcagc cggtttcact ggcaaactta aaagcgatgt acagcatcgc gaagaaatac 660

tccgcgcgc tttgctgaaa acgcctattt catcaagcag 720

cgtgaagcag aatacaaaga ctggaccatc gagcagatca cccgcgaaac ctacaaatat 780

gccgatatgc tggcgatgtc cgccaagaaa gatgcgatgg tgccgatggg cggcctgctg 840

tgcatgaaag acgacagctt ctttgatgtg tacaccgagt gcagaaccct ttgcgtggtg 900

caggaaggct tcccgacata tggcggcctg gaaggcggcg cgatggagcg tctggcggta 960

ggtctgtatg acggcatgaa tctcgactgg ctggcttatc gtatcgcgca ggtacagtat 1020

ctggtcgatg gtctggaaga gattggcgtt gtctgccagc aggcgggcgg tcacgcggca 1080

ttcgttgatg ccggtaaact gttgccgcat atcccggcag accagttccc ggcacaggcg 1140

ctggcctgcg agctgtataa agtcgccggt atccgtgcgg tagaaattgg ctctttcctg 1200

ttaggccgcg atccgaaaac cggtaaacaa ctgccatgcc cggctgaact gctgcgttta 1260

accctccgc gcgcaacata tactcaaaca catatggact tcattattga agcctttaaa 1320

catgtgaaag agaacgcggc gaatattaaa ggattaacct ttacgtacga accgaaagta 1380

ttgcgtcact tcaccgcaaa acttaaagaa gtttaa

1416

<210> 4 <211> 414

 <212> DNA

 <213> Escherichia coli

<220>

<221> source

 <222> 1..414

 <223> / organism = "Escherichia coli"

 / mol_type = "genomic DNA" <400> SEQ ID NO .4

atgagcgaag cacttaaaat tctgaacaac atccgtactc ttcgtgcgca ggcaagagaa 60

tgtacacttg aaacgctgga agaaatgctg gaaaaattag aagttgttgt taacgaacgt 120

cgcgaagaag aaagcgcggc tgctgctgaa gttgaagagc gcactcgtaa actgcagcaa 180

tatcgcgaaa tgctgatcgc tgacggtatt gacccgaacg aactgctgaa tagccttgct 240

gccgttaaat ctggcaccaa agctaaacgt gctcagcgtc cggcaaaata tagctacgtt 300

gacgaaaacg gcgaaactaa aacctggact ggccaaggcc gtactccagc tgtaatcaaa 360

aaagcaatgg atgagcaagg taaatccctc gacgatttcc tgatcaagca ataa

414

<210> 5

 <211> 989

<212> DNA

 <213> Vibrio harveyi

<220>

<221> source

<222> 1.989

<223> / organism = "Vibrio harveyi"

 / mol_type = "genomic DNA" <400> SEQ ID NO.

gtttacgctc ccaataaatg ccgttatggt gaagattcag ccaaatagaa ccactcttca 60

ggaagccaga acatcatgaa caatacgatt gaaaccattc ttgctcatcg ctctatccga 120

aaattcaccg cagttcctat tactgatgaa caaagacaaa ccatcattca agcaggttta 180

gctgcgtctt cttctagtat gcttcaagtc gtctcaatcg ttcgagtgac tgactctgaa 240

aagcgtaacg aattggctca atttgctggt aaccaagctt atgttgaaag tgcggctgag 300

ttcttagtgt tttgtattga ttatcagcgc catgcaacca tcaatcctga tgtacaggca 360

gactttacag aactaactct gattgagca gtagattctg gaatcatggc acaaaactgc 420

ttgcttgcag ccgagtctat gggattaggt ggcgtatata ttggaggact aaggaatagc 480

gcagctcaag ttgatgagct attgggctta ccggaaaata gcgcggtgtt gtttggtatg 540

tgcttagggc atcccgatca aaatcccgaa gtaaagccac gcctacctgc acatgtggtt 600

gttcatgaaa atcaatacca agagctaaat ttagatgata ttcagagcta cgatcaaact 660

atgcaagcgt attatgcgag ccgtacaagc aatcaaaaac tgagtacatg gtcgcaagaa 720

gtcactggga agcttgctgg tgagtcgcga cctcatattc tgccgtactt gaacagtaag 780

gggctagcaa aacgctaata tcattgaaat gatggtttgt tgtatgaaat cgttcatcaa 840

acctcactt tgttgaaccc acatcatatt ttgaccatac gctgccaact ttctggcaaa 900

accataacaa agcgctattg actcagaaca aaaaacacga catacatcac attttaaaac 960

aaagcaatca ctttgttgaa cccacatca

989

<210> 6

 <211> 117

<212> DNA

 <213> Artificial Sequence

<220>

<221> source

<222> 1.117

 <223> / organism = "Artificial Sequence"

 / Note = "pT7-lucCDABE"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.6

tatagggaga ccacaacggt ttccctctag aaataatttt gtttaacttt aagaaggaga 60

tatacatatg gtattccaat gataattaat ggaatgattc aagattttga taattat 117

<210> 7

<211> 80

<212> DNA

 <213> Artificial Sequence

<220>

 <221> source

<222> 1..80

 <223> / organism = "Artificial Sequence"

 / note = "Primer R - pT7-luxCDABE"

/ mol type = "unassigned DNA" <400> SEQ ID N0.7

cagcttcctt tcgggctttg ttagcagccg gatcaagctt ttaatccttg atattctttt 60

gtatgacatt agccatagag

80

 <210> 8

<211> 73

<212> DNA

 <213> Artificial Sequence

<220>

 <221> source

<222> 1.73

 <223> / organism = "Artificial Sequence"

 / note = "Primer F - pOSM-luxCDABE"

 / mol type = "unassigned DNA"

<400> SEQID NO.8

tccccgcgcg ttggccgatt cattaatgca gatctcgatc ccgcgaaatc tggcacagga 60

acgttatccg gac

<210> 9

<211> 36

<212> DNA

 <213> Artificial Sequence

<220>

 <221> source

<222> 1.36

 <223> / organism = "Artificial Sequence"

 / note = "Primer R - pOSM-luxCDABE"

 / mol_type = "unassigned DNA"

 73

 <400> SEQ ID NO.9

ttgttaaata tagatcacaa ttttgaaacc gctcgg

36

<210> 10

<211> 117

<212> DNA

 <213> Artificial Sequence

<220>

<221> source

<222> 1.117

 <223> / organism = "Artificial Sequence"

 / note = "Primer F- pT7-luxCDABEG"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.10

tatagggaga ccacaacggt ttccctctag aaataatttt gtttaacttt aagaaggaga 60 tatacatatg gtattccaat gataattaat ggaatgattc aagattttga taattat 117

 <210> 11

<211> 72

<212> DNA

 <213> Artificial Sequence

<220>

 <221> source

<222> 1.72

<223> / organism = "Artificial Sequence"

 / note = "Primer R - pT7-luxCDABEG"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.11

cagcttcctt tcgggctttg ttagcagccg gatcaagctt ttatacgtat gcaaaagcat 60

cggcaaacat and

72

 <210> 12

<211> 199

<212> DNA

 <213> Artificial Sequence

<220>

 <223> pOSM Promoter

<400> 12

 CTGGCACAGGAACGTTATCCGGACGTTCAGTTCCACCAGACCCGCGAGCATTAATTCTTGCCTCCA GGGCGCGGTAGTGGCGCCCTGTCAATTTCCCTTCCTTATTAGCCGCTTACGGAATGTTCTTAAAAC ATTCACTTTTGCTTATGTTTTCGCTGATATCCCGAGCGGTTTCAAAATTGTGATCTATATTTAACA

AT

<210> 13

<211> 72

<212> DNA

 <213> Artificial Sequence

<220>

 <221> source

<222> 1.72

 <223> / organism = "Artificial Sequence"

 / note = "Primer F - tnaA gene"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.13

aatatteaca gggatcactg taattaaaat aaatgaagga ttatgtaatg aattaaccct 60

cactaaaggg cg

<210> 14

<211> 73

<212> DNA

 <213> Artificial Sequence

<220> <221> source

72

Page 10

 <222> 1.73

<223> / organism = "Artificial Sequence"

 / note = "Primer R - tnaA gene"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.14

actctgtagt attaattaaa cttctttaag ttttgcggtg aagtgacgca taatacgact 60

cactataggg ctc

73

 <210> 15

<211> 72

<212> DNA

 <213> Artificial Sequence

<220>

 <221> source

<222> 1.72

 <223> / organism = "Artificial Sequence"

 / note = "Primer F - hns gene"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.15

attattacct caacaaacca ccccaatata agtttgagat tactacaatg aattaaccct 60

cactaaaggg cg

72

 <210> 16

<211> 73

<212> DNA

<213> Artificial Sequence

<220>

 <221> source

<222> 1.73

 <223> / organism = "Artificial Sequence"

 / note = "Primer R - hns gene"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.16

gattttaagc aagtgcaatc tacaaaagat tattgcttga tcaggaaatc taatacgact 60

cactataggg ctc

<210> 17

<211> 58 <212> DNA

73

 <213> Artificial Sequence

<220>

 <221> source

<222> 1..58

 <223> / organism = "Artificial Sequence"

 / note = "Primer R- T7-luxCDABEG"

 / mol_type = "unassigned DNA"

<400> SEQ ID NO.17

cagattcctt tcgggctttg ttagcagccg gatcaagctt tagcgttttg ctagcccc 58

Claims

1. Confined light system comprising, in a gelled nutrient medium:

 a) an expression cassette encoding luciferase inserted into a prokaryotic microorganism, and

 b) an expression cassette encoding a luciferase substrate or an exogenous substrate of luciferase.

 2. Light system according to claim 1, wherein the luciferase and its substrate are encoded by the same expression cassette.

 3. Light system according to claim 1 or 2, wherein the nutrient medium is confined in a gas-tight container and containing an amount of air for the emission of light by the microorganism.

 The light system of claim 1 or 2, wherein the nutrient medium is confined in a gas permeable container.

 The light system of claim 4, wherein the container is made of a polymeric material, preferably polydimethylsiloxane.

 6. Light system according to one of claims 1 to 5, wherein the prokaryotic microorganism is a Gram- bacterium.

 7. Light system according to claim 6, wherein the prokaryotic microorganism is an enterobacteria, preferably E. coli.

8. Light system according to claim 6, wherein the prokaryotic microorganism is a cyanobacterium, preferably Synechocystis.

The light system of any one of claims 1 to 8, wherein the expression cassette is integrated into the genome of the prokaryotic microorganism.

 10. Light system according to any one of claims 1 to 8, wherein the (or) cassette (s) of expression is (are) extrachromosomal (s).

 11. Light system according to claim 10, wherein the expression cassette (s) is (are) contained in an expression vector, preferably a plasmid.

 12. Light system according to any one of claims 1 to 11, wherein the (or) expression cassette (s) is (are) under the control of an inducible promoter.

 The light system according to any of claims 1 to 12, wherein the inducible promoter is selected from T7, pBAD or pDawn / Dusk promoters.

 The light system of claim 13, wherein the inducible promoter is T7.

 15. Light system according to any one of claims 1 to 12, wherein the (or) expression cassette (s) is (are) under the control of a non-inducible promoter.

 The light system of claim 15, wherein the non-inducible promoter is selected from the pOsmY, psAB and RpoS promoters.

17. Light system according to any one of claims 1 to 16, wherein the luciferase gene (s) and its substrate is (are) derived from the bacterium Vibrio Fischeri.

The light system of claim 16, wherein the luciferase genes are the luxA, luxB genes, and the substrate genes are the luxC, luxD and luxE genes.

 The light system of claim 16, wherein the luciferase genes are the luxA, luxB genes, and the substrate genes are the luxC, luxD, luxE and luxG genes.

 20. Light system according to one of claims 7 or 9 to 19, wherein the microorganism is an E. coli bacterium, and said bacterium does not express the protein tryptophanase.

 21. Light system according to one of claims 7 or 9 to 19, wherein the microorganism is an E. coli bacterium, and said bacterium does not express the H-NS protein.

 22. Lighting system according to one of claims 7 or

9-19, wherein the microorganism is an E. coli bacterium, and said bacterium expresses the FRP protein.

 23. The light system according to any of claims 1 to 22, wherein the gelled medium contains from 4 to 10 grams per liter of a gelling agent.

 24. The light system of claim 23, wherein the gelled medium contains from 6 to 8 grams per liter of a gelling agent.

 25. The light system according to any one of claims 1 to 24, wherein the gelling agent is

Agar.

 26. A method of producing light implemented by means of a system as described in any one of claims 1 to 25.