WO2017079699A1 - Multiplex high-resolution detection of micro-organism strains, related kits, diagnostics methods and screening assays - Google Patents

Multiplex high-resolution detection of micro-organism strains, related kits, diagnostics methods and screening assays Download PDF

Info

Publication number
WO2017079699A1
WO2017079699A1 PCT/US2016/060730 US2016060730W WO2017079699A1 WO 2017079699 A1 WO2017079699 A1 WO 2017079699A1 US 2016060730 W US2016060730 W US 2016060730W WO 2017079699 A1 WO2017079699 A1 WO 2017079699A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
ld
cell
nucleic acid
hypomorph
Prior art date
Application number
PCT/US2016/060730
Other languages
French (fr)
Inventor
Deborah Hung
Eachan JOHNSON
Brad POULSEN
Original Assignee
The Broad Institute, Inc.
The General Hospital Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US201562250610P priority Critical
Priority to US62/250,610 priority
Application filed by The Broad Institute, Inc., The General Hospital Corporation filed Critical The Broad Institute, Inc.
Publication of WO2017079699A1 publication Critical patent/WO2017079699A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18Testing for antimicrobial activity of a material
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/21Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Abstract

The present invention relates to multiplex high-resolution detection of micro-organism strains. It provides kits, diagnostics methods and screening assays.

Description

MULTIPLEX HIGH-RESOLUTION DETECTION OF MICRO-ORGANISM STRAINS, RELATED KITS, DIAGNOSTICS METHODS AND SCREENING

ASSAYS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claim the benefit of U.S. Provisional Application No. 62/250,610 filed November 4, 2015. The entire contents of the above-identified priority application are hereby fully incorporated herein by reference.

FEDERAL FUNDING LEGEND

[0002] This invention was made with government support under grant numbers 1R21AI098705-01 and 5R33AI098705-04 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE INVENTION

[0003] The present invention relates to the field of micro-organism strain detection and identification. It pertains to sets of primers, collection of double-stranded nucleic acid molecules, sets of probes and kits for such detection and identification, in particular for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strains. The present invention also relates to the field of diagnostics and screening assays, in particular assays for the identification of compounds with antibacterial properties.

BACKGROUND OF THE INVENTION

[0004] The National Institute of Health estimates that 70% of pathogenic bacteria have developed resistance to antibiotics and of the 1.7 million hospital-acquired infections in the United States per year, -99,000 cases result in death [Klevens, R.M., et al., Estimating health care-associated infections and deaths in U.S. hospitals, 2002. Public Health Rep, 2007. 122(2): p. 160-6]. Pseudomonas aeruginosa is among one of the most challenging of these pathogens with significant resistance, and is particularly prevalent in immunocompromised individuals such as patients with cystic fibrosis. By age 20, 60-70%) of cystic fibrosis patients develop a P. aeruginosa infection that often persists resulting in chronic infections until eventually succumbing to the infection (Folkesson, A., et al., Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: an evolutionary perspective. Nat Rev Microbiol, 2012. 10(12): p. 841-51). Due to its ability to evade current antibiotics or develop resistance, P. aeruginosa clinical strains are increasingly resistant to all current clinically relevant antibiotics (Hancock, R.E., Resistance mechanisms in Pseudomonas aeruginosa and other nonfermentative gram-negative bacteria. Clin Infect Dis, 1998. 27 Suppl 1 : p. S93-9., Strateva, T. and D. Yordanov, Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol, 2009. 58(Pt 9): p. 1133-48). New approaches for treating pseudomonal infections are paramount to overcoming antibiotic resistance thereby allowing cystic fibrosis patients longer and more comfortable lives. Unfortunately^ the current pipeline of antibiotics in general, but Gram-negative bacteria in particular, is alarmingly empty. Much of this failure is due to the incredible challenge of finding lead compounds against organisms such as P. aeruginosa for further development because of its intrinsic barriers and resistance to small molecules.

[0005] P. aeruginosa is inherently resistant to antibiotics due to many different factors (Nikaido, H., Multidrug resistance in bacteria. Annu Rev Biochem, 2009. 78: p. 119-46). Many isolates have acquired antibiotic resistance conferring elements through horizontal gene transfer of plasmids or chromosomally integrated transposons. Such acquired resistance mechanisms include inactivation of the antibiotic (e.g. β-lactams, aminoglycosides), modification of the molecular target (e.g. quinolones, streptomycin), and changes in intracellular drug concentration due to increased transport out of the cell by multidrug efflux pumps [Walsh, C, Antibiotics: actions, origins, resistance 2003]. While each of these antibiotic resistance mechanisms contributes to P. aeruginosa drug-resistance, its intrinsic cell impermeability, which is on the order of 100 times less permeable than that of another Gram negative organism such as E. coli (Nakae, T., Role of membrane permeability in determining antibiotic resistance in Pseudomonas aeruginosa. Microbiol Immunol, 1995. 39(4): p. 221-9.), is a major barrier in achieving bacterial death. This impermeability, coupled with numerous efflux systems, results in low intracellular drug concentrations that are insufficient to kill the cell. The P. aeruginosa genome contains 5570 open reading frames, 71 of which (by homology) are outer membrane proteins (OMPs) that regulate transport of small molecules in and out of the cell. Importantly, the outer cell membrane structure can be exploited as a target for effective bacterial killing. Natural innate defense mechanisms such as antimicrobial peptides target the outer membrane of the cell and have been reported to interact with OMPs [Lin, Y.M., et al., Outer membrane protein I of Pseudomonas aeruginosa is a target of cationic antimicrobial peptide/protein. J Biol Chem, 2010. 285(12): p. 8985- 94]. Furthermore, numerous antibiotics target enzymes involved in cell wall biosynthesis. Finally, a study recently reported the effective targeting of the essential OMP OstA by a peptidomimetic antibiotic in P. aeruginosa [9]. Thus, in order to address the significant hurdle created by the inability to find lead small molecule candidates against P. aeruginosa for antibiotic development, it is desirable to identify novel small molecule leads that combat the intrinsic resistance properties of P. aeruginosa by selectively targeting essential OMPs, thus bypassing the need for molecules to penetrate the cell wall and accumulate to sufficient concentrations for effective killing.

[0006] Further, Mycobacterium tuberculosis is a 9,000 year old plague and tuberculosis (TB) is the most deadly disease caused by a bacterium (Hershkovitz et al., PLoS ONE, 2008).

[0007] It would be desirable to identify new mechanism of actions for candidate antibacterial agents. This would be advantageous, because new drugs must be effective against resistant strains. Anti-bacterial agents that are effective according to new mechanisms minimize the overlap with resistance currently observed with known therapies. In order to do so, it would be desirable to be able to assay such novel mechanisms of action in order to screen for new targets.

[0008] Conventional target-based screening is advantageous in that the mechanism of action is known, activity assays are already available, and the lead development is well- informed. However, there are drawbacks, namely whole-cell activity remains unknown, and the target must remain stable (Kumar et al, PLoS ONE, 2012).

[0009] On the other hand, conventional whole-cell screening is advantageous in that it reflects whole-cell activity, and is easy to set up. However, disadvantages thereof include the fact that the mechanism of action is unknown, and lead development is conducted in a blind fashion (Stanley et al, ACS Chem Bio, 2012).

[0010] Finally, target-based whole-cell screening offer the advantages of pertaining to whole-cell activity combined with provided clues as to the mechanism of action (see, e.g., DeVito et al., Nature Biotechnology, 2002). However, there still are disadvantages, as the molecular biology might be difficult, there is still a requirement for an investigational follow up on the mechanism, and there may be off-target confounding effect.

[0011] Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention. SUMMARY OF THE INVENTION

[0012] The availability of multiple whole-cell target-based screens would be desirable, as this could improve knowledge on mechanism of action, and facilitate screening, in that the requirements for labor, time, and hence costs, increase linearly with the number of screens.

[0013] In certain example embodiments, a recombinant hypomorph microbial cell is provided that is recombinantly engineered to have reduced expression of one or more essential genes and further modified to comprise a strain specific nucleic acid identifier that identifies the hypomorph microbial cell. In certain example embodiments, the strain specific nucleic acid identifier is a non-naturally occurring nucleotide sequence. In certain example embodiments, the strain specific nucleic acid identifier is incorporated into the genome of the hypomorph microbial cell. The strain specific nucleic acid identifier may comprise, in a 5' to 3' direction, a first primer binding sight, a strain specific nucleic acid sequence, and a second primer binding site, wherein the hypomorph specific nucleic acid sequence identifies the one or more essential genes having reduced expression.

[0014] The recombinant hypomorph cell may be a bacterial cell, a fungal cell, a mycological cell, a protozoal cell, a nematode cell, a trematode cell, or a cestode cell. In certain example embodiments, the recombinant hypomorph is a bacterial cell. The bacterial cell may be an Eschericia, a Klebsiella, a Psuedomonas, a Staphylococcus, an Acinetobacter , a Candida, an Enterobacter, an Enter ococcus, a Proteus, a Streptococcus, or a Stenotrophomonas bacteria. In certain example embodiments, the cell is selected from the group consisting of Eschericia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Acinetobacter baumannii, Candida albicans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Proteus mirabalis, Streptococcus agalactiae, and Stenotrophomonas maltophila. In certain example embodiments, the cell is P. aeruginosa. In certain other example embodiments, the cell is a Mycobacterium. In certain example embodiments, the Mycobacterium is M. tuberculosis, M. avium-intracellulare, M. kansasii, M. fortuitum, M. chelonae, M. leprae, M. africanum, M. microti, M. avium paratuberculosis, M. intracellulare, M. scrofulaceum, M. xenopi, M. marinum, or Λ/. ulcerns.

[0015] In certain example embodiments, reduced expression of the one or more essential genes is achieved by recombinantly engineering the microbial cell so that one or more essential genes is under the control of a weak promoter. In certain example embodiments, the weak promoter may comprise a spacer sequence between the promoter and the RNA polymerase binding site. In certain other example embodiments, reduced expression of the one or more essential genes may be achieved by recombinantly engineering the cell such that the one or more essential genes further encodes a protein degradation signal that is appended to the expressed protein upon translation and that targets the protein expression product for degradation. In certain example embodiments, the protein degradation tag targets the protein for degradation by a clp-protease. In certain example embodiments, targeted protein degradation may be further enhanced by engineering the cell to further express a protease adapter protein. The protease adapter protein may be operatively linked to an inducible promoter.

[0016] In certain example embodiments, the one or more essential genes are genes whose expression products are localized to the cytoplasam, cytoplasmic membrane, periplasm, outer membrane, or extracellular space. In certain example embodiments, the one or more essential proteins are localized to the outer membrane. In certain example embodiments, the function of the essential gene expression product is outer membrane protein assembly, cell structure/outer membrane integrity, outer membrane protein chaperone/assembly, LPS biosynthesis, rod-shape structural protein, endonuclease, folate synthesis, cell wall synthesis, or leucyl-tRNA synthesis. In certain example embodiments, the one or more essential genes are selected from the group consisting of ostA, opr86, oprL, lolB, omlA, IppL, surA, lolA, tolB, tolA, mreC, IptA, IptD, IptE, dh/R, folP, murA, gyrA, IpcX, leuS and gcp. In certain other example embodiments, the one or more essential proteins are selected from the group consisting of ccsX, ctaC, eno, ft>a, folB, glcB, marP, mdh, mshC, murG, nadE, pstP, sucD, topA, ejpA, tpi, dlat, and mesJ.

[0017] In certain example embodiments, a set of hypomorph recombinant cells for use in various multiplex screening assays described further herein comprises a collection of the hypomorph recombinant cells described herein. In certain other example embodiments, a set of nucleic acid primer pairs for detecting and amplifying the hypomorph' s strain specific nucleic acid identifier comprises a first primer that binds to the first primer binding site of the strain specific nucleic acid identifier and a second primer that binds to the second primer binding site of the strain specific nucleic acid identifier. One or both of the primers may further comprise an origin-specific nucleic acid identifier specific to the individual discrete volume to which a given primer pair is delivered. One or both of the primers may also further comprise an experimental condition specific nucleic acid identifier sequence identifying the type of experimental conditions present in a given discrete volume. In certain example embodiments, the primers may further comprise a first and second sequencing primer binding site and/or a first and second sequencing adapter. [0018] In certain example embodiments, a multiplex method for whole-cell target-based screening of microbes comprises culturing each hypomorph microbial cell of a given set in different individual discrete volumes and under differing experimental conditions, then detecting the hypomorph microbial cells from the individual discrete volumes, where the failure to detect one or more hypomorph cells, or the detection of a decreased amount of one or more hypomorph cells relative to other hypomorph cells or a control, indicates susceptibility of the one or more hypomorph cells to the experimental condition. In certain example embodiments, detecting the hypomorph cells comprises amplifying the strain specific nucleic acid identifier using the nucleic acid primer pairs disclosed herein, sequencing the resulting amplicons, and determining an exact or relative number of reads where the sequencing reads can be deconvoluted based on the type of hypomorph cell the read originated from, the individual discrete volume the sequencing read originated from, and the experimental conditions present in that individual discrete volume. The absence of reduced amounts of a given hypomorph cell under a given set of experimental conditions indicates that susceptibility of the hypomorph to those experimental conditions. Further, the type of hypomorph, and the one or more essential genes whose expression was reduced therein, may further indicate a mechanism of action by which a given set of experimental conditions acts to render the hypomorph cell susceptible to those experimental conditions. Thus, the methods disclosed herein may be used to screen for novel target agents. In certain example embodiments, the target agents may be chemical agents. In certain other example embodiments, the chemical agents may be antibiotics.

[0019] The present invention also relates to a collection of double-stranded nucleic acid molecules for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strains, wherein each molecule may comprise an experimental conditions sequence; and a unique polynucleotide identifier.

[0020] The present invention also relates to a set of probes for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strains, wherein each probe may be a single stranded nucleic acid molecule as herein described.

[0021] The present invention also relates to a method for the diagnostic of a pathogenic infection, by multiplex high-resolution detection of micro-organism strains from a strain collection, wherein said method may comprise: providing a test sample from a patient; extracting exogenous nucleic acids from said test sample; and hybridizing said exogenous nucleic acids with a set of primers as herein described or a set of probes as herein described.

[0022] The present invention also relates to a method of generating and selecting a collection of hypomorph strains of a micro-organism population, which may comprise: generating a collection of strains of micro-organisms, wherein for each strain the level of expression of a unique gene is controlled by an exogenous promoter, whereby the level of expression of the unique gene is altered compared with the level of expression of the unique gene under its endogenous promoter, each strain of micro-organism having a unique polynucleotide identifier, whereby each unique polynucleotide identifier is configured for multiplex high-resolution detection of the corresponding strain amongst said collection of strains; outgrowing the generated strains of micro-organisms; and selecting the hypomorph strains of micro-organisms based on growth kinetics and the expression level of the unique gene, the expression level of the unique gene being indicative of the promoter strength.

[0023] The present invention also relates to a method of screening assay of a set of experimental conditions on a collection of strains of a micro-organism, which may comprise, for each strain: providing a collection of hypomorph micro-organism strains; preparing a pool of strains from said collection; subjecting said pool of strains to a set of experimental conditions; and performing multiplex high-resolution detection of the strains amongst said collection of strains.

[0024] The present invention also relates to a method for identifying a pathogenic microorganism with a set of primers as herein described or detection of double-stranded nucleic acid molecules as herein described or a collection of probes as herein described.

[0025] The present invention also relates to a kit for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strain.

[0026] The present invention also relates to a diagnostic kit for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strain.

[0027] It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as "comprises", "comprised", "comprising" and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean "includes", "included", "including", and the like; and that terms such as "consisting essentially of and "consists essentially of have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

[0028] These and other aspects, objects, features, and advantages of the example embodiments will become apparent to those having ordinary skill in the art upon consideration of the following detailed description and illustrated example embodiments.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 shows an illustrative protocol for Multiplexed Growth and Quantitation Using Illumina® Sequencing.

[0030] Figure 2 depicts outline for a Tn-seq based strategy for identifying essential genes m P. aeruginosa.

[0031] Figures 3-5 illustrate a strategy for creating P. aeruginosa hypomorph strains.

[0032] Figures 6-7 show that PA14 strains with DhfR and MurA knockdown

(hypomorphs) are hypersensitive to their respective drugs.

[0033] Figure 8 illustrates PA14 hypomorph screen reproducibility.

[0034] Figure 9 depicts a strategy for the generation of hypomorph strains of M tuberculosis.

[0035] Figure 10 shows that the strains obtained are hypersensitive to drugs targeting their gene of interest (dose response curves).

[0036] Figure 11 shows principle for multiplex detection of the invention.

[0037] Figure 12 illustrates that the method of the invention allows to reliably detect and count micro-organism cells

[0038] Figures 13-16 illustrates a screening method of the invention.

[0039] Figures 17-22 show results obtained with a pilot screen according to the invention.

[0040] Figure 23-26 show results obtained with a scale up screen of the invention.

[0041] Figure 27 provides a schematic of an example multiplex screening method for screening a chemical agent library in accordance with certain example embodiments.

[0042] Figure 28 provides a schematic of a multiplex assay for screening a chemical agent library using hypomorphs with DAS+4 mediated knockdown of essential gene products in accordance with certain example embodiments.

[0043] Figures 29 and 30 provided more details views of a BSL component of the overall assay depicting in Figure 28. [0044] Figure 31 list a set of example screening parameters to be optimized in the methods disclosed herein.

[0045] Figure 32 provides a schematic of an example assay design in accordance with certain example embodiments.

[0046] Figure 34 is a graph showing H37Rv growth in a 384-well format.

[0047] Figure 35 is a set of graphs comparing strong vs weak gene promoter growth phenotypes.

[0048] Figure 45 is process flow chart of an example analysis method for analyzing sequencing reads.

[0049] Figure 46 is an example process flow for identifying and developing new antimicrobial leads based on screening date obtain using the methods disclosed herein.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0050] For purpose of this invention, "amplification" means any method employing a primer and a polymerase capable of replicating a target sequence with reasonable fidelity. Amplification may be carried out by natural or recombinant DNA polymerases such as TaqGold™, T7 DNA polymerase, Klenow fragment of E. coli DNA polymerase, and reverse transcriptase. A preferred amplification method is PCR. In particular, the isolated RNA can be subjected to a reverse transcription assay that is coupled with a quantitative polymerase chain reaction (RT-PCR) in order to quantify the expression level of a sequence associated with a signaling biochemical pathway.

[0051] As used herein, a "collection" of strains comprises a plurality of strains. The collection may comprise one or more strains from one or more genera. It may also comprise one or more strains from one or more species. It may also comprise one or more strains from one or more genera, and one or more strains from one or more species. It may also comprise strains from a single genus or it may also comprise strains from a single species. Microorganisms are as described above. The collection of strains may comprise about at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 75, 80, 90 or 100 strains.

[0052] "Complementarity" refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non- traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%), and 100% complementary). "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

[0053] As used herein, a "double-stranded nucleic acid molecule" comprises a nucleic acid molecule comprises two strands that are at least partially or fully complementary. The two strands may be the same length, they may be hybridized or in a denatured state. Examples include ds-DNA (double-stranded DNA). Said double-stranded molecule may be obtained as an amplification product, such as a PCR amplification product.

[0054] As used herein, a "discrete volume" refers to a defined volume or space that can be defined by properties that prevent and/or inhibit migration of microbial cells, for example a volume or space defined by physical properties such as walls, for example the walls of a well, tube, or a surface of a droplet, which may be permeable or semipermeable. Exemplary discrete volumes or spaces useful in the disclosed methods include droplets (for example, microfluidic droplets and/or emulsion droplets), hydrogel beads or other polymer structures (for example poly-ethylene glycol di-acrylate beads or agarose beads), tissue slides (for example, fixed formalin paraffin embedded tissue slides with particular regions, volumes, or spaces defined by chemical, optical, or physical means), microscope slides with regions defined by depositing reagents in ordered arrays or random patterns, tubes (such as, centrifuge tubes, microcentrifuge tubes, test tubes, cuvettes, conical tubes, and the like), bottles (such as glass bottles, plastic bottles, ceramic bottles, Erlenmeyer flasks, scintillation vials and the like), wells on plates (such as wells in in 6, 12, 24, 96, 384, 1536-well format), pipettes, or pipette tips among others.

[0055] As used herein, "expression of a genomic locus" or "gene expression" is the process by which information from a gene is used in the synthesis of a functional gene product. The products of gene expression are often proteins, but in non-protein coding genes such as rRNA genes or tRNA genes, the product is functional RNA. The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea) and viruses to generate functional products to survive. As used herein "expression" of a gene or nucleic acid encompasses not only cellular gene expression, but also the transcription and translation of nucleic acid(s) in cloning systems and in any other context. As used herein, "expression" also refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.

[0056] As used herein, the term "genomic locus" or "locus" (plural loci) is the specific location of a gene or DNA sequence on a chromosome. A "gene" refers to stretches of DNA or RNA that encode a polypeptide or an RNA chain that has functional role to play in an organism and hence is the molecular unit of heredity in living organisms. For the purpose of this invention it may be considered that genes include regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0057] "High-throughput screening" (HTS) refers to a process that uses a combination of modern robotics, data processing and control software, liquid handling devices, and/or sensitive detectors, to efficiently process a large amount of (e.g., thousands, hundreds of thousands, or millions of) samples in biochemical, genetic or pharmacological experiments, either in parallel or in sequence, within a reasonably short period of time (e.g., days). Preferably, the process is amenable to automation, such as robotic simultaneous handling of 96 samples, 384 samples, 1536 samples or more. A typical HTS robot tests up to 100,000 to a few hundred thousand compounds per day. The samples are often in small volumes, such as no more than 1 mL, 500 μΐ, 200 μΐ, 100 μΐ, 50 μΐ or less. Through this process, one can rapidly identify active compounds, small molecules, antibodies, proteins or polynucleotides which modulate a particular biomolecular/genetic pathway. The results of these experiments provide starting points for further drug design and for understanding the interaction or role of a particular biochemical process in biology. Thus "high-throughput screening" as used herein does not include handling large quantities of radioactive materials, slow and complicated operator-dependent screening steps, and/or prohibitively expensive reagent costs, etc.

[0058] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.

[0059] As used herein, "multiplex" refers to experimental conditions that allow parallel processing of samples, for example in partially or fully pooled formats. Multiplex processing may include pooled processing. Multiplex PCR may refer to multiple PCR reactions within the same reactor (e.g. a tube or a well). Multiplex PCR may refer to the use of multiple possible primer pairs, and/or multiple probes, and/or to the amplification of multiple targets within the same reaction. Multiplex may also refer to cell culture conditions, namely that a plurality of microorganism strains can be processed in co-culture. For example, it is possible to grow a collection of strains within the same well or plate. Multiplex may also refer to detection method, wherein detection may be carried out in pooled format, such as for example, detection from pooled PCR-amplified samples. Thus, according to embodiments of the invention, it is possible to pool the strains for growth (multiplex growth), lyse cells and PCR in plate (possible multiplex PCR), then pool the wells, then process for quantification (multiplex detection by sequencing).

[0060] As used herein, a "primer" refers to a single-stranded nucleic acid molecule. It generally comprises a stretch of nucleotides, such deoxyribonucleotides. Part of all of the primer sequence may be used for the purpose of nucleic acid amplification, such as by PCR (polymerase china reaction). This means that said primer comprises or consists of a sequence that may be used for 'priming' (target hybridization) for subsequent elongation with a polymerase enzyme. Total length of the primer may vary. Examples of total length include about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80 nt. The part of the primer that may be used for priming in a PCR reaction may comprise or consist of a nucleotide stretch of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nt.

[0061] The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. The term also encompasses nucleic-acid-like structures with synthetic backbones, see, e.g., Eckstein, 1991; Baserga et al., 1992; Milligan, 1993; WO 97/03211; WO 96/39154; Mata, 1997; Strauss- Soukup, 1997; and Samstag, 1996. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.

[0062] As used herein, "probe" refers to any molecule capable of attaching and/or binding and/or hybridizing to a nucleic acid (i.e., for example, a barcode nucleic acid). For example, a capture probe may be an oligonucleotide or a primer. A probe may be a nucleic acid sequence, the nucleic acid being, for example, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA) or other non-naturally occurring nucleic acid. A collection of probes may comprise about at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 75, 80, 90 or 100 probes.

[0063] As used herein, a "set" of items comprises a plurality of items. For example, a set of primers of the invention may comprise at least about 96, 192, 384, n x 96 (with n being an integer) primers. The set of primers may include control primers such as positive and negative control primers. The set of primers may be configured for use with a given format for cell culture or cell growth, such as well plate formats, for example configured for use with 96 well-plates or 384-well plates.

[0064] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.

[0065] As used herein the term "variant" should be taken to mean the exhibition of qualities that differ, such as, but not limited to, genetic variations including SNPs, insertion deletion events, and the like.

Overview

[0066] The present invention provides multiple whole-cell target-based screens. Labor, time and costs are advantageously reduced by performing the screens in multiplex. The invention generally relies on the generation of a collection of hypomorph strains, namely a series of cells that are knocked down for an essential gene. An "essential gene" may be determined using the techniques described further herein, and is a gene for which loss of function is not tolerated within a given microbial cell. Thus, microbial cells that are modified to exhibit reduced expression of such genes (hypomorphs) exhibit increased sensitivity to agents that target the essential genes. Thus, use of such hypomorphs may be used to screen agents for anti-microbial activity, while at the same time providing insight into the mechanism of action of such agents. In some embodiments, the hypomorphs strains may be genetically barcoded (unique polynucleotide strain identifier), so as to allow individual cell detection and counting by sequencing. In some embodiments, genetic strain barcode is engineered, while in other embodiments, the strain barcode is endogenous (e.g. 16S gene).

[0067] Essential genes may be identified using genome-wide negative selection technology, for example, one that combines transposon mutagenesis with massively parallel sequencing (Tn-seq (Gallagher, L.A., J. Shendure, and C. Manoil, Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq. MBio, 2011. 2(1)) may be used to identify such genes. Importantly, in contrast to previous efforts which have largely identified essential genes in a single strain under lab growth conditions, the present invention defines essential genes across a set of different strains of P. aeruginosa (e.g. set of 20 strains) under a number of different growth conditions (e.g. 4) including urine, blood, rich media (LB), and minimal media (M9) to clearly define a core set of essential genes that represent possible gene targets across all clinical isolates under clinically relevant growth conditions. After generating and selecting for a transposon library on a particular growth condition, sequencing of transposon/chromosome junctions in surviving mutants leads to the identification of genes in which insertions are tolerated, while absent genes may be characterized as essential [Sassetti, CM., D.H. Boyd, and E.J. Rubin, Comprehensive identification of conditionally essential genes in mycobacteria. Proc Natl Acad Sci U S A, 2001. 98(22): p. 12712-7].

[0068] In certain example embodiments, the one or more essential genes are genes whose expression products are localized to the cytoplasam, cytoplasmic membrane, periplasm, outer membrane, or extracellular space. In certain example embodiments, the one or more essential proteins are localized to the outer membrane. In certain example embodiments, the function of the essential gene expression product is outer membrane protein assembly, cell structure/outer membrane integrity, outer membrane protein chaperone/assembly, LPS biosynthesis, rod-shape structural protein, endonuclease, folate synthesis, cell wall synthesis, or leucyl-tRNA synthesis. In certain example embodiments, the one or more essential genes are selected from the group consisting of ostA, opr86, oprL, lolB, omlA, IppL, surA, lolA, tolB, tolA, mreC, IptA, IptD, IptE, dhfR, fiolP, murA, gyrA, IpcX, leuS and gcp. In certain other example embodiments, the one or more essential proteins are selected from the group consisting of ccsX, ctaC, eno, fba, fiolB, glcB, marP, mdh, mshC, murG, nadE, pstP, sucD, topA, ejpA, tpi, dlat, and mesJ.

[0069] Once identified, hypomorph strains may be generated by recombinantly modifying a microbial cell to exhibit reduced expression of the essential gene. A different hypomorph strain may have reduced expression of a unique essential gene or a unqiue combination of essential genes. As such, a collection of hypomorph stains may be produced that can be screened in multiplex to identify agents with anti-microbial activity and to identify the target of said agents.

[0070] In one example embodiment, the hypomorph cell is generated by recombinantly modifying a microbial cell such that the one or more essential genes are under the control of a weak promoter. The term "hypomorph strain" may be used interchangeably herein with "hypomorph cell," and refers to a cell modified to have reduced expression of one or more essential genes. The hypomorph strain or cell may also be referred to a herein as "knock down." As used herein a "weak promoter" refers to a promoter that results in lowered expression of a gene product compared to expression of the gene product under the control of an endogenous promoter of the modified cell. In certain example embodiments, the endogenous promoter may reduce expression by 5%, 6%, 7%, 8%, 9% 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79% 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%), or 99% as compared to the endogenous promoter. Multiple hypomorph cells or strains may be generated encoding the same knock downed essential gene under the control of different promoters of differing strengths. In certain example embodiments, it may be useful to generate a promoter library with promoters of varying strengths, for example by varying the spacing between the promoter and the RNA polymerase binding site, in order to screen and select optimal assay conditions. In certain example embodiments, the weak promoters may be based on the promoters used to drive varying levels of GFP expression in E. coli and as described in Sauer et al. ( Nucleic Acids Res, 2011. 39(3): p. 1131-41). Alternatively, other promoters may be generated by modifying the spacing between the RNA polymerase binding site of the promoters.

[0071] Example weak promoters are disclosed in the following table.

Figure imgf000018_0001

* Sauer nomenclature /Nucleic Acids Res, 2011. 39(3): p. 1131-41). [0072] In certain other example embodiments, the hypomorph cell is generated by modifying one or more essential genes to encode a protein degradation tag that is appended to the expressed protein product, thus marking the protein for degradation by an endogenous degradation protein or system. The degradation tag may be any tag that marks the expressed protein and may depend on the species of microbial cell and the type of endogenous protein degradation system expressed in said microbial cell. In certain example embodiments, the degradation tag is a clp-protease tag. In certain example embodiments, the clp-protease tag is a DAS4+ tag. In certain example embodiments, the hypomorph may be further modified to express a protease adapter protein that facilitates recognition of degradation tags by a protease or protease complex, shuttles proteins expressing the degradation tag to a protease or protease complex, or activates a protease or protease complex. The shuttle protein may be under the control of a second promoter. The second promoter may be inducible. In certain example embodiments, the inducible promoter is a tetOn on tetOff promoter. In certain example embodiments, the protease adapter protein gene is sspB.

[0073] The hypomorph cells disclosed herein are further modified to include a strain specific nucleic aid identifier or barcode. A nucleic acid identifier or barcode may be an artificial sequence have a length of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides, and can be in single- or double-stranded form. Each hypomorph is assigned a unique barcode that identifies the hypomorph from other hypomorph strains and provides information on the species and the essential gene or combination of essential genes that are knocked down in a given strain. The strain specific nucleic acid identifier may further comprise a first primer binding site and a second primer binding site. The first and second primer binding sites provide two regions that hybridize to a corresponding set of amplification primers that may be used to amplify the strain specific nucleic acid identifier. The resulting amplicons may then be sequenced. The number of reads of a given hypomorph' s strain specific nucleic acid identifier is tied to the amount of a that hypomorph in a given sample. As demonstrated further below, sequencing reads function as a proxy for OD6oo values and provide a measure of the abundance of a given hypomorph in a sample. Thus, the relative amounts of a given hypomorph in a sample or volume may be determined in the methods further disclosed herein via sequencing.

[0074] In certain aspects, the embodiments disclosed herein are directed to the nucleic acid primers used to amplify the above strain specific nucleic acid identifiers. In certain example embodiments, the first primer and second primer binding site used in the strain specific nucleic acid identifiers are the same. Thus, the target binding site for the first and second primers may be the same for all hypomorph strains. The first and second primers, however, may further include additional sequences that are incorporated into amplicons during amplification reactions using the first and second primers. In certain example embodiments, one of the primers may include an origin specific barcode. The origin specific barcode is used to identify a discrete volume from which a given hypomorph sequencing read originated. Thus, all primer pairs delivered to a given sample or discrete volume will have the same origin specific barcode. In this way, all sequencing reads originating from the same sample or discrete volume may be identified. The origin specific barcode may be included on the first primer or the second primer. In certain example embodiments, the first or second primer may further include a experimental condition specific barcode. This barcode is uniquely assigned to the experimental conditions being tested in a given sample or discrete volume. Samples may be tested in multiplicate so each sample receiving the same experimental conditions will receive primers encoding different origin specific barcodes but the same experimental condition barcodes. Collectively, the strain specific barcodes, origin specific barcodes, and experimental condition barcodes can be used to identify, via the sequencing of amplicons, to determine the identity and relative amounts of all hypomorphs originating from the same sample or discrete volume, and the experimental conditions tested in that particular sample or discrete volume. In certain example embodiments, the first primer and second primer may further comprise a first primer sequencing primer binding site and/or first sequencing adapter and a second primer sequencing binding site and/or second sequencing adapter respectively. Accordingly, the resulting amplicons will incorporate sequencing primer binding sites and sequencing adapters. In certain other example embodiments, the sequencing primer binding sites and sequencing adapter may be appended to the amplicons via ligation after amplification.

[0075] Microbial cells that may be used to generate hypomorphs include bacterial cells, fungal cells, mycological cells, protozoal cells, nematode cells, trematode cells, or cestode cells. In certain example embodiments, the microbial cells are bacterial cells. The bacterial cells may include, but are not limited to, Bordetella, Bacillis, Borrelia, Brucella, Campylobacter, Chlamydia, Clamydophila, Clostridium, Corynebacterium, Enterococcus, Escherichia, Francisella, Haemophilus, Helicobacter, Legionella, Leptospira, Listeria, Mycobacterium, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Staphylococcus, Streptococcus, Treponema, Vibrio, and Yersinia. In certain example embodiments, the bacterial cells are Eschericia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Acinetobacter baumannii, Candida albicans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Proteus mirabalis, Streptococcus agalactiae, and Stenotrophomonas maltophila. In certain other example embodiments, the bacterial cell is Pseudomonas aeruginosa. In certain other example embodiments, the bacterial cell is a Mycobacterium. The Mycobacterium may include, but is not limited to, M. tuberculosis, M. avium-intracellulare, M. kansasii, M. fortuitum, M. chelonae, M. leprae, M. africanum, M. microti, M. avium paratuberculosis, M. intracellulare, M. scrofulaceum, M. xenopi, M. marinum, and M. ulcerans. In one example embodiment, the microbial cell is M tuberculosis.

[0076] In certain example embodiments, the microbial cell is a fungal cell. The fungal cells used may include, but are not limited to, Candida, Aspergillus, Cryptococcus, Histoplasma, Pneumocystis, and Stachybotrys. In certain example embodiments, the microbial cell may be a protozoa including, but not limited to, Entamoeba histolytica, Dientamoeba fragilis, Giardia lamblia, Trichomonas vaginalis, Balantidium coli, Naegleria fowleri, Acanthamoeba, Plasmodium falciparium, P. malariae, P. ovale, P. vivax, Isospora belli, Cryptosporidium parvum, Cyclospora cayetanensis, Enterocytozoon nieneusi, Babesia microti, Toxoplasma gondii, L. donovani, L. tropica, L. braziliensis, Trypanosoma gambiense, T. rhodesiense, T. cruzi, and Penumocystis jiroveci. In certain example embodiments, the microbial cell may be a nematode including, but not limited to, Enterobius vermicularis, Ascaris lumbricoides, Toxocara canis, Toxocara cati, Baylisascaris procyonis, Ancylostoma duodenale, Necator americnaus, Strongyloides stercoralis, Ancylostoma braziliense, Trichuris trichiura, Trichinella spiralis, Wuchereria bancrofti, Brugia malaya, Loa loa, Onchocerca volvulus, Dracunculus medinensis, Capillaria philippinensis. In certain example embodiments, the microbial cell may be a trematode including, but not limited to, Fasciolopsis buski, Fasciola hepatica, Opisthorchis sinensis, Paragonimus westermani, P. kellicotti, Schistosoma mansoni, S. japonicum, and S. haematobium. In certain example embodiments, the microbial cell may be a cestode including, but not limited to, Taenia solium, T. saginata, Diphyllobothrium latum, Dipylidium caninum, Echinococcus granulosis, E. multilocularis, and Hymenolepis nana.

[0077] The hypomorph cells disclosed herein may be used to screen a series of experimental conditions. As described above, a hypomorph strain will exhibit hypersensitivity to a set of experimental conditions that target the essential genes or combination of essential genes knocked down in that hypomorph. Therefore, assessing the amount of multiple hypomorph strains exposed to the same experimental conditions can help identify potential targets for further validation, for example, as anti-microbial agents.

[0078] Each hypomorph strain is cultured in an individual discrete volume. In certain example embodiments, the discrete volume is the well of a microplate. Each well is then exposed to a different set of experimental conditions. The experimental conditions may comprise exposure to different test agents, combinations of test agents, or different concentrations of test agents or combinations of test agents. For example, the methods disclosed herein may be used to screen a chemical library for anti-microbial activity. The experimental conditions may further comprise assessment under different physical growth conditions such as different growth media, different pH, different temperatures, different atmospheric pressures, different atmospheric 02 concentrations, different atmospheric C02 concentrations, or a combination thereof.

[0079] After a sufficient time period, and as dictated by the experimental conditions to be assessed, the cells are lysed and the strain specific barcodes are amplified using the primers disclosed herein. As noted above, the primer pairs delivered to each volume will comprise the appropriate origin specific and experimental condition specific conditions barcodes for each discrete volume. The resulting amplicons are then sequenced, for example, using next generation sequencing.

[0080] The sequencing reads are then mapped to the corresponding experimental conditions, discrete volumes, and hypomorph strains. Analysis may be conducted on the resulting sequencing read data to determine the amount of different hypomorphs in each discrete volume. If a hypomorph is missing or demonstrates less abundance than other hypomorph strains or a control condition, this then indicates both potential anti-microbial activity as well as identifying the knockdown essential genes as the potential target for exhibiting the anti-microbial effect. An example process flow for analyzing the sequencing read data is shown in Figure 46. In certain example embodiments, the sequencing count data may be analyzed as if a negative binomial marginal distribution (NB) and a generalized linear model (GLM).

[0081] The present application also may be utilized in conjunction with other assays that detect and identify bacteria and fungi (see, e.g., the LightCycler® SeptiFast Test MGRADE assay kit; and Bravo et al., International Society for Infectious Diseases, May 2011 Volume 15, Issue 5, Pages e326-e331).

[0082] Advantageously according to the invention, the detection may be carried out by nucleic acid sequencing, preferably quantitative or semi-quantitative nucleic acid sequencing. This allows to determine the presence (or absence) of a given nucleic acid sequence in a pool of nucleic acids. For example, one may determine the presence of a double-stranded nucleic acid molecule as per the invention, by determining its nucleotide sequence. Within said determined sequence, it is then possible to identify stretches of nucleotides of interest. For example, within a given double-stranded nucleic acid molecule, sequencing allows to identify presence of a given unique polynucleotide identifier (thus allowing the identification of the corresponding micro-organism strain), and/or presence of a given polynucleotide sequence indicative of given growth conditions, such as a first polynucleotide or 5 '-polynucleotide sequence identifying a culture plate or a polynucleotide or 5 '-polynucleotide sequence identifying a well within a plate (thus allowing the identification of the corresponding growth conditions). As a result, detection may advantageously allow, in a multiplex fashion, to determine the presence or absence of a given micro-organism strain that was cultured in given growth conditions.

[0083] Embodiments of the invention include sequences (both polynucleotide or polypeptide) which may comprise homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue or nucleotide, with an alternative residue or nucleotide) that may occur i.e., like-for-like substitution in the case of amino acids such as basic for basic, acidic for acidic, polar for polar, etc. Nonhomologous substitution may also occur i.e., from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.

[0084] Hybridization can be performed under conditions of various stringency. Suitable hybridization conditions for the practice of the present invention are such that the recognition interaction between the probe and sequences associated with a signaling biochemical pathway is both sufficiently specific and sufficiently stable. Conditions that increase the stringency of a hybridization reaction are widely known and published in the art. See, for example, (Sambrook, et al., (1989); Nonradioactive In Situ Hybridization Application Manual, Boehringer Mannheim, second edition). The hybridization assay can be formed using probes immobilized on any solid support, including, but are not limited to, nitrocellulose, glass, silicon, and a variety of gene arrays. A preferred hybridization assay is conducted on high-density gene chips as described in U.S. Patent No. 5,445,934. [0085] Examples of the labeling substance which may be employed include labeling substances known to those skilled in the art, such as fluorescent dyes, enzymes, coenzymes, chemiluminescent substances, and radioactive substances. Specific examples include radioisotopes (e.g., 32P, 14C, 1251, 3H, and 1311), fluorescein, rhodamine, dansyl chloride, umbelliferone, luciferase, peroxidase, alkaline phosphatase, β-galactosidase, β-glucosidase, horseradish peroxidase, glucoamylase, lysozyme, saccharide oxidase, microperoxidase, biotin, and ruthenium. In the case where biotin is employed as a labeling substance, preferably, after addition of a biotin-labeled antibody, streptavidin bound to an enzyme (e.g., peroxidase) is further added.

[0086] Advantageously, the label is a fluorescent label. Examples of fluorescent labels include, but are not limited to, Atto dyes, 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS); 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4-anilino-l-naphthyl)maleimide; anthranilamide; BODIPY; Brilliant Yellow; coumarin and derivatives; coumarin, 7-amino-4- methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanine dyes; cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5'5"- dibromopyrogallol-sulfonaphthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'- isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'- disulfonic acid; 5-[dimethylamino]naphthalene-l -sulfonyl chloride (DNS, dansylchloride); 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives; eosin, eosin isothiocyanate, erythrosin and derivatives; erythrosin B, erythrosin, isothiocyanate; ethidium; fluorescein and derivatives; 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2- yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein, fluorescein, fluorescein isothiocyanate, QFITC, (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelliferoneortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives: pyrene, pyrene butyrate, succinimidyl 1 -pyrene; butyrate quantum dots; Reactive Red 4 (Cibacron.TM. Brilliant Red 3B-A) rhodamine and derivatives: 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); Ν,Ν,Ν',Ν' tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid; terbium chelate derivatives; Cy3; Cy5; Cy5.5; Cy7; IRD 700; IRD 800; La Jolta Blue; phthalo cyanine; and naphthalo cyanine.

[0087] The fluorescent label may be a fluorescent protein, such as blue fluorescent protein, cyan fluorescent protein, green fluorescent protein, red fluorescent protein, yellow fluorescent protein or any photoconvertible protein. Colormetric labeling, bioluminescent labeling and/or chemiluminescent labeling may further accomplish labeling. Labeling further may include energy transfer between molecules in the hybridization complex by perturbation analysis, quenching, or electron transport between donor and acceptor molecules, the latter of which may be facilitated by double stranded match hybridization complexes. The fluorescent label may be a perylene or a terrylen. In the alternative, the fluorescent label may be a fluorescent bar code.

[0088] In an advantageous embodiment, the label may be light sensitive, wherein the label is light-activated and/or light cleaves the one or more linkers to release the molecular cargo. The light-activated molecular cargo may be a major light-harvesting complex (LHCII). In another embodiment, the fluorescent label may induce free radical formation.

[0089] In an advantageous embodiment, agents may be uniquely labeled in a dynamic manner (see, e.g., international patent application serial no. PCT/US2013/61182 filed September 23, 2012). The unique labels are, at least in part, nucleic acid in nature, and may be generated by sequentially attaching two or more detectable oligonucleotide tags to each other and each unique label may be associated with a separate agent. A detectable oligonucleotide tag may be an oligonucleotide that may be detected by sequencing of its nucleotide sequence and/or by detecting non-nucleic acid detectable moieties to which it may be attached.

[0090] The oligonucleotide tags may be detectable by virtue of their nucleotide sequence, or by virtue of a non-nucleic acid detectable moiety that is attached to the oligonucleotide such as, but not limited to, a fluorophore, or by virtue of a combination of their nucleotide sequence and the nonnucleic acid detectable moiety.

[0091] In some embodiments, a detectable oligonucleotide tag may comprise one or more nonoligonucleotide detectable moieties. Examples of detectable moieties may include, but are not limited to, fluorophores, microparticles including quantum dots (Empodocles, et al., Nature 399: 126-130, 1999), gold nanoparticles (Reichert et al., Anal. Chem. 72:6025-6029, 2000), biotin, DNP (dinitrophenyl), fucose, digoxigenin, haptens, and other detectable moieties known to those skilled in the art. In some embodiments, the detectable moieties may be quantum dots. Methods for detecting such moieties are described herein and/or are known in the art.

[0092] Thus, detectable oligonucleotide tags may be, but are not limited to, oligonucleotides which may comprise unique nucleotide sequences, oligonucleotides which may comprise detectable moieties, and oligonucleotides which may comprise both unique nucleotide sequences and detectable moieties.

[0093] A unique label may be produced by sequentially attaching two or more detectable oligonucleotide tags to each other. The detectable tags may be present or provided in a plurality of detectable tags. The same or a different plurality of tags may be used as the source of each detectable tag may be part of a unique label. In other words, a plurality of tags may be subdivided into subsets and single subsets may be used as the source for each tag.

[0094] In some embodiments, a detectable oligonucleotide tag may comprise one or more non-oligonucleotide detectable moieties. Examples of detectable moieties include, but are not limited to, fluorophores, microparticles including quantum dots (Empodocles, et al., Nature 399: 126-130, 1999), gold nanoparticles (Reichert et al., Anal. Chem. 72:6025-6029, 2000), biotin, DNP (dinitrophenyl), fucose, digoxigenin, haptens, and other detectable moieties known to those skilled in the art. In some embodiments, the detectable moieties are quantum dots. Methods for detecting such moieties are described herein and/or are known in the art.

[0095] A unique nucleotide sequence may be a nucleotide sequence that is different (and thus distinguishable) from the sequence of each detectable oligonucleotide tag in a plurality of detectable oligonucleotide tags. A unique nucleotide sequence may also be a nucleotide sequence that is different (and thus distinguishable) from the sequence of each detectable oligonucleotide tag in a first plurality of detectable oligonucleotide tags but identical to the sequence of at least one detectable oligonucleotide tag in a second plurality of detectable oligonucleotide tags. A unique sequence may differ from other sequences by multiple bases (or base pairs). The multiple bases may be contiguous or non-contiguous. Methods for obtaining nucleotide sequences (e.g., sequencing methods) are described herein and/or are known in the art.

[0096] In some embodiments, detectable oligonucleotide tags comprise one or more of a ligation sequence, a priming sequence, a capture sequence, and a unique sequence (optionally referred to herein as an index sequence). A ligation sequence is a sequence complementary to a second nucleotide sequence which allows for ligation of the detectable oligonucleotide tag to another entity which may comprise the second nucleotide sequence, e.g., another detectable oligonucleotide tag or an oligonucleotide adapter. A priming sequence is a sequence complementary to a primer, e.g., an oligonucleotide primer used for an amplification reaction such as, but not limited to, PCR. A capture sequence is a sequence capable of being bound by a capture entity. A capture entity may be an oligonucleotide which may comprise a nucleotide sequence complementary to a capture sequence, e.g. a second detectable oligonucleotide tag. A capture entity may also be any other entity capable of binding to the capture sequence, e.g. an antibody, hapten or peptide. An index sequence is a sequence which may comprise a unique nucleotide sequence and/or a detectable moiety as described above.

[0097] The present invention is particularly useful for discovery methods. For example, growth conditions may include the presence of a given candidate compound, such as a candidate agent in a screen for antibacterial agents. The methods of the invention allow to determine the presence of a given strain in given growth conditions, for a multiplicity of strains and a multiplicity of growth conditions. The invention thus makes it possible to screen a multiplicity of candidate compounds, at varying concentrations, on a plurality of microorganism strains. The method is multiplexed, so that throughput is high: it is made possible to screen a high number of strains, e.g. more than 20, 50, 75, 100, 200, 300, 400 or 500 strains. Said strains may be tested against a high number of candidate compounds, such as more than 1,000, 2,000, 5,000, 10,000, 15,000, 20,000, 25,000, 30,000, 40,000 or 50,000 candidate compounds. Compounds may be tested at carrying concentrations. For example, it is possible to establish dose-response profiles for a given compound. The screens may be validated using known antibacterial agents (positive controls) and/or unmutated strains. Controls may be used for inhibition or specificity (e.g. respectively rifampin and trimethoprim for P. aeruginosa). The invention also allows the identification of candidate compounds that are either specific or with broader spectrum activity.

[0098] The methods of the inventions may be conducted in duplicate, triplicate or multi- plicate, etc. This may increase robustness of the methods or confirm reproducibility, for example by detecting experimental errors, etc.

[0099] Detection of the gene expression level can be conducted in real time in an amplification assay. In one aspect, the amplified products can be directly visualized with fluorescent DNA-binding agents including, but not limited to, DNA intercalators and DNA groove binders. Because the amount of the intercalators incorporated into the double-stranded DNA molecules is typically proportional to the amount of the amplified DNA products, one can conveniently determine the amount of the amplified products by quantifying the fluorescence of the intercalated dye using conventional optical systems in the art. DNA- binding dye suitable for this application include SYBR green, SYBR blue, DAPI, propidium iodine, Hoeste, SYBR gold, ethidium bromide, acridines, proflavine, acridine orange, acriflavine, fluorcoumanin, ellipticine, daunomycin, chloroquine, distamycin D, chromomycin, homidium, mithramycin, ruthenium polypyridyls, anthramycin, and the like.

[0100] In another aspect, other fluorescent labels, such as sequence specific probes, can be employed in the amplification reaction to facilitate the detection and quantification of the amplified products. Probe-based quantitative amplification relies on the sequence-specific detection of a desired amplified product. It utilizes fluorescent, target-specific probes (e.g., TaqMan® probes) resulting in increased specificity and sensitivity. Methods for performing probe-based quantitative amplification are well established in the art and are taught in U.S. Patent No. 5,210,015.

[0101] Sequencing may be performed on any high-throughput platform with read-length (either single- or paired-end) sufficient to cover both template and cross-linking event UIDs. Methods of sequencing oligonucleotides and nucleic acids are well known in the art (see, e.g., W093/23564, WO98/28440 and W098/13523; U.S. Pat. Nos. 5,525,464; 5,202,231; 5,695,940; 4,971,903; 5,902,723; 5,795,782; 5,547,839 and 5,403,708; Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463 (1977); Drmanac et al., Genomics 4: 114 (1989); Koster et al., Nature Biotechnology 14: 1123 (1996); Hyman, Anal. Biochem. 174:423 (1988); Rosenthal, International Patent Application Publication 761107 (1989); Metzker et al., Nucl. Acids Res. 22:4259 (1994); Jones, Biotechniques 22:938 (1997); Ronaghi et al., Anal. Biochem. 242:84 (1996); Ronaghi et al., Science 281 :363 (1998); Nyren et al., Anal. Biochem. 151 :504 (1985); Canard and Arzumanov, Gene 11 : 1 (1994); Dyatkina and Arzumanov, Nucleic Acids Symp Ser 18: 117 (1987); Johnson et al., Anal. Biochem.136: 192 (1984); and Elgen and Rigler, Proc. Natl. Acad. Sci. USA 91(13):5740 (1994), all of which are expressly incorporated by reference).

[0102] The sample may be a biological sample, for example a blood, buccal, cell, cerebrospinal fluid, mucus, saliva, semen, tissue, tumor, feces, urine, or vaginal sample. It may be obtained from an animal, a plant or a fungus. The animal may be a mammal. The mammal may be a primate. The primate may be a human. In other embodiments, the sample may be an environmental sample, such as water or soil.

[0103] The present invention also relates to methods of high throughput screening HTS of a compound diversity oriented synthesis library using MTEP against the mixture of pooled screening strains. Advantageously, the compound libraries of the Broad Institute are contemplated for screening (https://www.broadinstitute.org/scientific- community/science/programs/csoft/therapeutics-platform/compound-libraries). Advantageously, the compounds may have antibacterial properties. The compounds may be or resemble β-Lactam antibiotics: penicillin G, penicillin V, cloxacilliin, dicloxacillin, methicillin, nafcillin, oxacillin, ampicillin, amoxicillin, bacampicillin, azlocillin, carbenicillin, mezlocillin, piperacillin, and ticarcillin; Aminoglycosides: amikacin, gentamicin, kanamycin, neomycin, netilmicin, and streptomycin; Tobramycin Macrolides: azithromycin, clarithromycin erythromycin, lincomycin, and clindamycin; Tetracyclines: demeclocycline, doxycycline, minocycline, oxytetracycline, tetracycline quinolones: cinoxacin, nalidixic acid Fluoroquinolones: ciprofloxacin, enoxacin, grepafloxacin, levofloxacin, lomefloxacin, norfloxacin, ofloxacin, and sparfloxacin; Trovafloxicin polypeptides: bacitracin, colistin, and polymyxin B; Sulfonamides: sulfisoxazole, sulfamethoxazole, sulfadiazine, sulfamethizole, and sulfacetamide; or Miscellaneous Antibacterial Agents: trimethoprim, sulfamethazole, chloramphenicol, vancomycin, metronidazole, quinupristin, dalfopristin, rifampin, spectinomycin, nitrorurantoin.

[0104] As used herein, a "kit" refers to one or more elements as described herein, that may be accompanied by instructions or directions for use.

[0105] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds. (1987)).

[0106] The present invention also relates to a computer system involved in carrying out the methods of the invention relating to both computations and sequencing.

[0107] A computer system (or digital device) may be used to receive, transmit, display and/or store results, analyze the results, and/or produce a report of the results and analysis. A computer system may be understood as a logical apparatus that can read instructions from media (e.g. software) and/or network port (e.g. from the internet), which can optionally be connected to a server having fixed media. A computer system may comprise one or more of a CPU, disk drives, input devices such as keyboard and/or mouse, and a display (e.g. a monitor). Data communication, such as transmission of instructions or reports, can be achieved through a communication medium to a server at a local or a remote location. The communication medium can include any means of transmitting and/or receiving data. For example, the communication medium can be a network connection, a wireless connection, or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present invention can be transmitted over such networks or connections (or any other suitable means for transmitting information, including, but not limited to, mailing a physical report, such as a print-out) for reception and/or for review by a receiver. The receiver can be, but is not limited to, an individual, or electronic system (e.g. one or more computers, and/or one or more servers).

[0108] In some embodiments, the computer system may comprise one or more processors. Processors may be associated with one or more controllers, calculation units, and/or other units of a computer system, or implanted in firmware as desired. If implemented in software, the routines may be stored in any computer readable memory such as in RAM, ROM, flash memory, a magnetic disk, a laser disk, or other suitable storage medium. Likewise, this software may be delivered to a computing device via any known delivery method including, for example, over a communication channel such as a telephone line, the internet, a wireless connection, etc., or via a transportable medium, such as a computer readable disk, flash drive, etc. The various steps may be implemented as various blocks, operations, tools, modules and techniques which, in turn, may be implemented in hardware, firmware, software, or any combination of hardware, firmware, and/or software. When implemented in hardware, some or all of the blocks, operations, techniques, etc. may be implemented in, for example, a custom integrated circuit (IC), an application specific integrated circuit (ASIC), a field programmable logic array (FPGA), a programmable logic array (PLA), etc.

[0109] A client-server, relational database architecture can be used in embodiments of the invention. A client-server architecture is a network architecture in which each computer or process on the network is either a client or a server. Server computers are typically powerful computers dedicated to managing disk drives (file servers), printers (print servers), or network traffic (network servers). Client computers include PCs (personal computers) or workstations on which users run applications, as well as example output devices as disclosed herein. Client computers rely on server computers for resources, such as files, devices, and even processing power. In some embodiments of the invention, the server computer handles all of the database functionality. The client computer can have software that handles all the front-end data management and can also receive data input from users.

[0110] A machine readable medium which may comprise computer-executable code may take many forms, including, but not limited to, a tangible storage medium, a carrier wave medium or physical transmission medium. Non-volatile storage media include, for example, optical or magnetic disks, such as any of the storage devices in any computer(s) or the like, such as may be used to implement the databases, etc. shown in the drawings. Volatile storage media include dynamic memory, such as main memory of such a computer platform. Tangible transmission media include coaxial cables; copper wire and fiber optics, including the wires that comprise a bus within a computer system. Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications. Common forms of computer-readable media therefore include, for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch cards paper tape, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables or links transporting such a carrier wave, or any other medium from which a computer may read programming code and/or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.

[0111] The subject computer-executable code can be executed on any suitable device which may comprise a processor, including a server, a PC, or a mobile device such as a smartphone or tablet. Any controller or computer optionally includes a monitor, which can be a cathode ray tube ("CRT") display, a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display, etc.), or others. Computer circuitry is often placed in a box, which includes numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and others. The box also optionally includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements. Inputting devices such as a keyboard, mouse, or touch-sensitive screen, optionally provide for input from a user. The computer can include appropriate software for receiving user instructions, either in the form of user input into a set of parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations.

[0112] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined in the appended claims. [0113] The invention may be further understood with reference to the following set of numbered clauses:

1. A set of primers configured for multiplex high-resolution detection of microorganism strains amongst a strain collection,

wherein each micro-organism strain comprises a unique polynucleotide identifier, wherein each primer comprises: a first polynucleotide sequence indicative of experimental conditions, and a second polynucleotide sequence configured for the amplification and subsequent detection of said unique polynucleotide identifier.

2. The set of primers of clause 1, wherein the unique polynucleotide identifier is configured for identification of strain or species.

3. The set of primers of clause 1 or 2, wherein the unique polynucleotide identifier is configured for identification of strain by nucleic acid sequencing.

4. The set of primers of any one of clauses 1-3, wherein the unique polynucleotide identifier is flanked by upstream and downstream respective flanking sequences.

5. The set of primers of any one of clauses 1-4, wherein the multiplex high- resolution detection comprises absolute or relative quantification.

6. The set of primers of any one of clauses 1-5, wherein the first polynucleotide sequence comprises a 5'- polynucleotide sequence.

7. The set of primers of any one of clauses 1-6, wherein the second polynucleotide sequence comprises a 3 '-polynucleotide sequence.

8. The set of primers of any one of clauses 1-7, wherein experimental conditions comprise growth conditions. 9. The set of primers of any one of clauses 1-8, wherein the first polynucleotide sequence identifies a culture plate or a well within a culture plate, the culture plate or the well within the culture plate being indicative of predetermined experimental conditions.

10. The set of primers of any one of clauses 1-9, wherein the set of primers comprises: a first subset of primers with a first polynucleotide sequence identifying a culture plate and a second subset of primers with a first polynucleotide sequence identifying a well within a plate.

11. The set of primers of any one of clauses 1-10, wherein the set of primers comprises one or more pairs of primers.

12. The pair of primers of clause 11, wherein each pair comprises: a primer with a first polynucleotide sequence identifying a culture plate adjacent to a second polynucleotide sequence which is the upstream flanking sequence; and a primer with a first polynucleotide sequence identifying a well within a culture plate adjacent to a second polynucleotide sequence which is the downstream flanking sequence.

13. The pair of primers of clause 11, wherein each pair comprises a primer with a first polynucleotide sequence identifying a culture plate adjacent to a second polynucleotide sequence which is the downstream flanking sequence; and a primer with a first polynucleotide sequence identifying a well within a culture plate adjacent to a second polynucleotide sequence which is the upstream flanking sequence.

14. The set of primers of any one of clauses 1-11, wherein the set of primers comprises a first subset of primers with a first polynucleotide sequence identifying a culture plate adjacent to a second polynucleotide sequence which is the downstream flanking sequence; and a second subset of primers with a first polynucleotide sequence identifying a well within a culture plate adjacent to a second polynucleotide sequence which is the upstream flanking sequence.

15. The set of primers of any one of clauses 1-14, wherein the wherein the first polynucleotide sequence is about 4 to about 25 nt long. 16. The set of primers of any one of clauses 1-15, wherein the first polynucleotide sequence is about 8 to about 20 nt long.

17. The set of primers of any one of clauses 1-16, wherein the first polynucleotide sequence comprises any one of the below sequences, or the reverse complement thereof:

Primer Name Sequence

Al ATCGACTG (SEQ. I.D. No. 11)

B l GCTAGCAG (SEQ. I.D. No. 12)

CI TACTCTCC (SEQ. I.D. No. 13)

D l TGACAGCA (SEQ. I.D. No. 14)

El GCAGGTTG (SEQ. I.D. No. 15)

Fl TTCCAGCT (SEQ. I.D. No. 16)

Gl TAGTTAGC (SEQ. I.D. No. 17)

H I AGCGCTAA (SEQ. I.D. No. 18)

A2 CGGTTCTT (SEQ. I.D. No. 19)

B2 TAGCATTG (SEQ. I.D. No. 20)

C2 AATTCAAC (SEQ. I.D. No. 21)

D2 TTCACAGA (SEQ. I.D. No. 22)

E2 GCTCTCTT (SEQ. I.D. No. 23)

F2 TGACTTGG (SEQ. I.D. No. 24)

G2 TATGGTTC (SEQ. I.D. No. 25)

H2 CACTAGCC (SEQ. I.D. No. 26)

A3 AACCTCTT (SEQ. I.D. No. 27)

B3 CTACATTG (SEQ. I.D. No. 28)

C3 GCGATTAC (SEQ. I.D. No. 29)

D3 AATTGGCC (SEQ. I.D. No. 30)

E3 AATTGCTT (SEQ. I.D. No. 31)

F3 TTGGTCTG (SEQ. I.D. No. 32)

G3 CATCCTGG (SEQ. I.D. No. 33)

H3 GGATTAAC (SEQ. I.D. No. 34)

A4 CGCATATT (SEQ. I.D. No. 35)

B4 TCATTCGA (SEQ. I.D. No. 36)

C4 GTCCAATC (SEQ. I.D. No. 37)

D4 CTTGGTCA (SEQ. I.D. No. 38)

E4 CCAACGCT (SEQ. I.D. No. 39)

F4 TCCACTTC (SEQ. I.D. No. 40)

G4 AATCTCCA (SEQ. I.D. No. 41)

H4 GTCTGCAC (SEQ. I.D. No. 42)

A5 CTGCTCCT (SEQ. I.D. No. 43)

B5 TTAGCCAG (SEQ. I.D. No. 44)

C5 GCTGATTC (SEQ. I.D. No. 45)

D5 GAATCGAC (SEQ. I.D. No. 46) E5 AGTCACCT (SEQ. I.D. No. 47)

F5 CACGATTC (SEQ. I.D. No. 48)

G5 GCTCCGAT (SEQ. I.D. No. 49)

H5 CTTGGCTT (SEQ. I.D. No. 50)

A6 GCTGCACT (SEQ. I.D. No. 51)

B6 GAACTTCG (SEQ. I.D. No. 52)

C6 CTGTATTC (SEQ. I.D. No. 53)

D6 ATATCCGA (SEQ. I.D. No. 54)

E6 TTGTCCAT (SEQ. I.D. No. 55)

F6 AGTAAGTC (SEQ. I.D. No. 56)

G6 GAATATCA (SEQ. I.D. No. 57)

H6 CAACTGAT (SEQ. I.D. No. 58)

A7 CCTGTCAT (SEQ. I.D. No. 59)

B7 GACGGTTA (SEQ. I.D. No. 60)

C7 CTATTAGC (SEQ. I.D. No. 61)

D7 TCCAACCA (SEQ. I.D. No. 62)

E7 CTGGCTAT (SEQ. I.D. No. 63)

F7 GCGGACTT (SEQ. I.D. No. 64)

G7 CCATCACA (SEQ. I.D. No. 65)

H7 GGCAATAC (SEQ. I.D. No. 66)

A8 CACTTCAT (SEQ. I.D. No. 67)

B8 CAAGCTTA (SEQ. I.D. No. 68)

C8 AGGTACCA (SEQ. I.D. No. 69)

D8 TCCATAAC (SEQ. I.D. No. 70)

E8 GTCCTCAT (SEQ. I.D. No. 71)

F8 AGTACTGC (SEQ. I.D. No. 72)

G8 CTTGAATC (SEQ. I.D. No. 73)

H8 CCAACTAA (SEQ. I.D. No. 74)

A9 AATACCAT (SEQ. I.D. No. 75)

B9 GCGATATT (SEQ. I.D. No. 76)

C9 GAACGCTA (SEQ. I.D. No. 77)

D9 CTGACATC (SEQ. I.D. No. 78)

E9 GCCACCAT (SEQ. I.D. No. 79)

F9 CGACTCTC (SEQ. I.D. No. 80)

G9 TGCTATTA (SEQ. I.D. No. 81)

H9 CTTCTGGC (SEQ. I.D. No. 82)

A10 ATGAATTA (SEQ. I.D. No. 83)

B IO TACTCCAG (SEQ. I.D. No. 84)

C IO ATCATACC (SEQ. I.D. No. 85)

D 10 CCTCTAAC (SEQ. I.D. No. 86)

E10 ATCTTCTC (SEQ. I.D. No. 87)

F10 CAGCTCAC (SEQ. I.D. No. 88)

G10 GGTTATCT (SEQ. I.D. No. 89)

H10 TCCGCATA (SEQ. I.D. No. 90) Al l TGCTTCAC (SEQ. I.D. No. 91)

B l l GCTTCCTA (SEQ. I.D. No. 92)

Cl l GACCATCT (SEQ. I.D. No. 93)

D l l CTGGTATT (SEQ. I.D. No. 94)

El l TTAATCAC (SEQ. I.D. No. 95)

Fl l CGCGAATA (SEQ. I.D. No. 96)

Gi l GCTCACCA (SEQ. I.D. No. 97)

Hl l TCATGTCT (SEQ. I.D. No. 98)

A12 ATCCTTAA (SEQ. I.D. No. 99)

B 12 TTCTTGGC (SEQ. I.D. No. 100)

C12 CATCACTT (SEQ. I.D. No. 101)

D 12 CGAACTTC (SEQ. I.D. No. 102)

E12 GACATTAA (SEQ. I.D. No. 103)

F12 TTCACCTT (SEQ. I.D. No. 104)

G12 CCAATCTG (SEQ. I.D. No. 105)

H12 CGACAGTT (SEQ. I.D. No. 106)

Plate 1 AAGTAGAG (SEQ. I.D. No. 107)

Plate2 CATGCTTA (SEQ. I.D. No. 108)

Plate3 GCACATCT (SEQ. I.D. No. 109)

Plate4 TGCTCGAC (SEQ. I.D. No. 110)

Plate5 AGCAATTC (SEQ. I.D. No. Ill)

Plate6 AGTTGCTT (SEQ. I.D. No. 112)

Plate7 CCAGTTAG (SEQ. I.D. No. 113)

Plate8 TTGAGCCT (SEQ. I.D. No. 114)

Plate9 ACACGATC (SEQ. I.D. No. 115)

Plate 10 GGTCCAGA (SEQ. I.D. No. 116)

Plate 11 GTATAACA (SEQ. I.D. No. 117)

Plate 12 TTCGCTGA (SEQ. I.D. No. 118)

Plate 13 AACTTGAC (SEQ. I.D. No. 119)

Plate 14 CACATCCT (SEQ. I.D. No. 120)

Plate 15 TCGGAATG (SEQ. I.D. No. 121)

Plate 16 AAGGATGT (SEQ. I.D. No. 122)

Platel7 CGCGCGGT (SEQ. I.D. No. 123)

Plate 18 TCTGGCGA (SEQ. I.D. No. 124)

Plate 19 CATAGCGA (SEQ. I.D. No. 125)

Plate20 CAGGAGCC (SEQ. I.D. No. 126)

Plate21 TGTCGGAT (SEQ. I.D. No. 127)

Plate22 ATTATGTT (SEQ. I.D. No. 128)

Plate23 CCTACCAT (SEQ. I.D. No. 129)

Plate24 TACTTAGC (SEQ. I.D. No. 130)

Plate25 CATGATCG (SEQ. I.D. No. 131)

Plate26 AGGATCTA (SEQ. I.D. No. 132)

Plate27 GACAGTAA (SEQ. I.D. No. 133)

Plate28 CCTATGCC (SEQ. I.D. No. 134) Plate29 TCGCCTTG (SEQ. I.D. No. 135)

Plate30 ATAGCGTC (SEQ. I.D. No. 136)

Plate31 GAAGAAGT (SEQ. I.D. No. 137)

Plate32 ATTCTAGG (SEQ. I.D. No. 138)

Plate33 CGTTACCA (SEQ. I.D. No. 139)

Plate34 GTCTGATG (SEQ. I.D. No. 140)

Plate35 TTACGCAC (SEQ. I.D. No. 141)

Plate36 TTGAATAG (SEQ. I.D. No. 142)

Plate37 AAGACACT (SEQ. I.D. No. 143)

Plate38 CAGCAAGG (SEQ. I.D. No. 144)

Plate39 TCCAGCAA (SEQ. I.D. No. 145)

Plate40 CCAGAGCT (SEQ. I.D. No. 146)

Plate41 TCCTTGGT (SEQ. I.D. No. 147)

Plate42 AGGTTATC (SEQ. I.D. No. 148)

Plate43 GTCATCTA (SEQ. I.D. No. 149)

Plate44 CCTTCGCA (SEQ. I.D. No. 150)

Plate45 TCTCGGTC (SEQ. I.D. No. 151)

Plate46 ATTGTCTG (SEQ. I.D. No. 152)

Plate47 GAACCTAG (SEQ. I.D. No. 153)

Plate48 TAATGAAC (SEQ. I.D. No. 154)

Plate49 AACGCATT (SEQ. I.D. No. 155)

Plate50 CAACTCTC (SEQ. I.D. No. 156)

PlateS 1 CTGTAATC (SEQ. I.D. No. 157)

Plate52 TAAGCACA (SEQ. I.D. No. 158)

Plate53 AATGTTCT (SEQ. I.D. No. 159)

Plate54 CAGCGGTA (SEQ. I.D. No. 160)

Plate55 GACCAGGA (SEQ. I.D. No. 161)

Plate56 TATCCAGG (SEQ. I.D. No. 162)

Plate57 ACAGGTAT (SEQ. I.D. No. 163)

Plate58 CCAACATT (SEQ. I.D. No. 164)

Plate59 GCCGTCGA (SEQ. I.D. No. 165)

Plate60 TATCTGCC (SEQ. I.D. No. 166)

Plate61 ACTAAGAC (SEQ. I.D. No. 167)

Plate62 CGCCTTCC (SEQ. I.D. No. 168)

Plate63 GCCTAGCC (SEQ. I.D. No. 169)

Plate64 TGCTGCTG (SEQ. I.D. No. 170)

Plate65 AGGTAAGG (SEQ. I.D. No. 171)

Plate66 CTAACTCG (SEQ. I.D. No. 172)

Plate67 GTAACATC (SEQ. I.D. No. 173)

Plate68 TGTAATCA (SEQ. I.D. No. 174)

Plate69 ATTATCAA (SEQ. I.D. No. 175)

Plate70 CTATGCGT (SEQ. I.D. No. 176)

Plate71 GTCCACAG (SEQ. I.D. No. 177)

Plate72 TTGTCTAT (SEQ. I.D. No. 178) Plate73 AACAATGG (SEQ. I.D. No. 179)

Plate74 ATTCCTCT (SEQ. I.D. No. 180)

Plate75 GAAGGAAG (SEQ. I.D. No. 181)

Plate76 TCGCTAGA (SEQ. I.D. No. 182)

Plate77 ACAGTTGA (SEQ. I.D. No. 183)

Plate78 CAATAGTC (SEQ. I.D. No. 184)

Plate79 GACCGTTG (SEQ. I.D. No. 185)

Plate80 TCTGCAAG (SEQ. I.D. No. 186)

Plate81 ACTGTATC (SEQ. I.D. No. 187)

Plate82 CTACCAGG (SEQ. I.D. No. 188)

Plate83 GACCTAAC (SEQ. I.D. No. 189)

Plate84 TGCAAGTA (SEQ. I.D. No. 190)

Plate85 AGCATGGA (SEQ. I.D. No. 191)

Plate86 CGCTATGT (SEQ. I.D. No. 192)

Plate87 GATATCCA (SEQ. I.D. No. 193)

Plate88 TGTAACTC (SEQ. I.D. No. 194)

Plate89 AGGTCGCA (SEQ. I.D. No. 195)

Plate90 CTGCGGAT (SEQ. I.D. No. 196)

Plate91 ACCAACTG (SEQ. I.D. No. 197)

Plate92 TTAATCAG (SEQ. I.D. No. 198)

Plate93 AGGTGCGA (SEQ. I.D. No. 199)

Plate94 CTGTGGCG (SEQ. I.D. No. 200)

Plate95 GCCGCAAC (SEQ. I.D. No. 201)

Plate96 TTATATCT (SEQ. I.D. No. 202)

18. The set of primers of any one of clauses 1-17, wherein first polynucleotide sequence further comprises a 5'-GC-sequence.

19. The set of primers of any one of clauses 1-18, wherein the second polynucleotide sequence is at least about 15 or about 20 nt long.

20. The set of primers of any one of clauses 1-19, wherein the second polynucleotide sequence is at least about 25 nt long.

21. The set of primers of any one of clauses 1-20, wherein the unique polynucleotide identifier is an exogenous polynucleotide identifier, flanked by upstream and downstream respective flanking sequences common for all strains of the strain collection; wherein the set of primers comprises a first subset of primers, the second polynucleotide sequence of which is the upstream flanking sequence; and

wherein the set of primers comprises a second subset of primers, the second polynucleotide sequence of which is the downstream flanking sequence.

22. The set of primers of any one of clauses 1-21, wherein the second polynucleotide sequence comprises any one of the below sequences, or the reverse complement thereof:

5' Flank

TATTTATGCAGAGGCCGAGG

(SEQ. LD. No. 203)

3 ' Flank Sequence

GGATTATTCATACCGTCCCA.

(SEQ. LD. No. 204)

23. The set of primers of any one of clauses 1-22, wherein the each comprises any one of the below sequences, or the reverse complement thereof:

5' Primer Sequence (GC + Well BC + 5'Flank)

GCATCGACTGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 205

G

GCGCTAGCAGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 206

G

GCTACTCTCCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 207

GCTGACAGCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 208

G

GCGCAGGTTGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 209

G

GCTTCCAGCTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 210

G

GCTAGTTAGCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 211

G

GCAGCGCTAATATTTATGCAGAGGCCGAG SEQ. LD. NO. 212

G

GCCGGTTCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 213

GCTAGCATTGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 214

G

GCAATTCAACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 215

G

GCTTCACAGATATTTATGCAGAGGCCGAG SEQ. LD. NO. 216 G

GCGCTCTCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 217 GCTGACTTGGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 218 G

GCTATGGTTCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 219 G

GCCACTAGCCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 220 G

GCAACCTCTTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 221 G

GCCTACATTGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 222 G

GCGCGATTACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 223 G

GCAATTGGCCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 224 G

GCAATTGCTTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 225 G

GCTTGGTCTGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 226 G

GCCATCCTGGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 227 G

GCGGATTAACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 228 G

GCCGCATATTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 229 G

GCTCATTCGATATTTATGCAGAGGCCGAG SEQ. LD. NO. 230 G

GCGTCCAATCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 231 G

GCCTTGGTCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 232 G

GCCCAACGCTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 233 G

GCTCCACTTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 234 GCAATCTCCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 235 G

GCGTCTGCACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 236 G

GCCTGCTCCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 237 GCTTAGCCAGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 238 G

GCGCTGATTCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 239 G

GCGAATCGACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 240 G

GCAGTCACCTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 241 G

GCCACGATTCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 242 G GCGCTCCGATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 243 G

GCCTTGGCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 244 GCGCTGCACTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 245 G

GCGAACTTCGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 246 G

GCCTGTATTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 247 GCATATCCGATATTTATGCAGAGGCCGAG SEQ. LD. NO. 248 G

GCTTGTCCATTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 249 GCAGTAAGTCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 250 G

GCGAATATCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 251 G

GCCAACTGATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 252 G

GCCCTGTCATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 253 G

GCGACGGTTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 254 G

GCCTATTAGCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 255 G

GCTCCAACCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 256 G

GCCTGGCTATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 257 G

GCGCGGACTTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 258 G

GCCCATCACATATTTATGCAGAGGCCGAG SEQ. LD. NO. 259 G

GCGGCAATACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 260 G

GCCACTTCATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 261 G

GCCAAGCTTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 262 G

GCAGGTACCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 263 G

GCTCCATAACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 264 G

GCGTCCTCATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 265 G

GCAGTACTGCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 266 G

GCCTTGAATCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 267 G

GCCCAACTAATATTTATGCAGAGGCCGAG SEQ. LD. NO. 268 G

GCAATACCATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 269 G

GCGCGATATTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 270 G

GCGAACGCTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 271 G

GCCTGACATCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 272 G

GCGCCACCATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 273 G

GCCGACTCTCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 274 G

GCTGCTATTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 275 G

GCCTTCTGGCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 276 G

GCATGAATTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 277 G

GCTACTCCAGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 278 G

GCATCATACCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 279 G

GCCCTCTAACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 280 G

GCATCTTCTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 281 GCCAGCTCACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 282 G

GCGGTTATCTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 283 G

GCTCCGCATATATTTATGCAGAGGCCGAG SEQ. LD. NO. 284 G

GCTGCTTCACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 285 G

GCGCTTCCTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 286 G

GCGACCATCTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 287 G

GCCTGGTATTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 288 G

GCTTAATCACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 289 G

GCCGCGAATATATTTATGCAGAGGCCGAG SEQ. LD. NO. 290 G

GCGCTCACCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 291 G

GCTCATGTCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 292 GCATCCTTAATATTTATGCAGAGGCCGAG SEQ. LD. NO. 293 G

GCTTCTTGGCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 294 GCCATCACTTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 295 G GCCGAACTTCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 296 G

GCGACATTAATATTTATGCAGAGGCCGAG SEQ. LD. NO. 297 G

GCTTCACCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 298 GCCCAATCTGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 299 G

GCCGACAGTTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 300 G

3' Primer Sequence (GC + Plate BC + Rev.

comp. of 3' Flank)

GCCTCTACTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 301 GCTAAGCATGTGGGACGGTATGAATAATC SEQ. LD. NO. 302

C

GCAGATGTGCTGGGACGGTATGAATAATC SEQ. LD. NO. 303

C

GCGTCGAGCATGGGACGGTATGAATAATC SEQ. LD. NO. 304

C

GCGAATTGCTTGGGACGGTATGAATAATC SEQ. LD. NO. 305

C

GCAAGCAACTTGGGACGGTATGAATAATC SEQ. LD. NO. 306

C

GCCTAACTGGTGGGACGGTATGAATAATC SEQ. LD. NO. 307

C

GCAGGCTCAATGGGACGGTATGAATAATC SEQ. LD. NO. 308

C

GCGATCGTGTTGGGACGGTATGAATAATC SEQ. LD. NO. 309

C

GCTCTGGACCTGGGACGGTATGAATAATC SEQ. LD. NO. 310

C

GCTGTTATACTGGGACGGTATGAATAATCC SEQ. LD. NO. 311 GCTCAGCGAATGGGACGGTATGAATAATC SEQ. LD. NO. 312

C

GCGTCAAGTTTGGGACGGTATGAATAATC SEQ. LD. NO. 313

C

GCAGGATGTGTGGGACGGTATGAATAATC SEQ. LD. NO. 314

C

GCCATTCCGATGGGACGGTATGAATAATC SEQ. LD. NO. 315

C

GCACATCCTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 316 GCACCGCGCGTGGGACGGTATGAATAATC SEQ. LD. NO. 317

C

GCTCGCCAGATGGGACGGTATGAATAATC SEQ. LD. NO. 318

C

GCTCGCTATGTGGGACGGTATGAATAATCC SEQ. LD. NO. 319 GCGGCTCCTGTGGGACGGTATGAATAATCC SEQ. LD. NO. 320 GCATCCGACATGGGACGGTATGAATAATCC SEQ. LD. NO. 321 GCAACATAATTGGGACGGTATGAATAATCC SEQ. LD. NO. 322 GCATGGTAGGTGGGACGGTATGAATAATCC SEQ. LD. NO. 323 GCGCTAAGTATGGGACGGTATGAATAATCC SEQ. I.D. NO. 324

GCCGATCATGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 325

GCTAGATCCTTGGGACGGTATGAATAATCC SEQ. I.D. NO. 326

GCTTACTGTCTGGGACGGTATGAATAATCC SEQ. I.D. NO. 327

GCGGCATAGGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 328

GCCAAGGCGATGGGACGGTATGAATAATCC SEQ. I.D. NO. 329

GCGACGCTATTGGGACGGTATGAATAATCC SEQ. I.D. NO. 330

GCACTTCTTCTGGGACGGTATGAATAATCC SEQ. I.D. NO. 331

GCCCTAGAATTGGGACGGTATGAATAATCC SEQ. I.D. NO. 332

GCTGGTAACGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 333

GCCATCAGACTGGGACGGTATGAATAATCC SEQ. I.D. NO. 334

GCGTGCGTAATGGGACGGTATGAATAATCC SEQ. I.D. NO. 335

GCCTATTCAATGGGACGGTATGAATAATCC SEQ. I.D. NO. 336

GCAGTGTCTTTGGGACGGTATGAATAATCC SEQ. I.D. NO. 337

GCCCTTGCTGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 338

GCTTGCTGGATGGGACGGTATGAATAATCC SEQ. I.D. NO. 339

GCAGCTCTGGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 340

GCACCAAGGATGGGACGGTATGAATAATCC SEQ. I.D. NO. 341

GCGATAACCTTGGGACGGTATGAATAATCC SEQ. I.D. NO. 342

GCTAGATGACTGGGACGGTATGAATAATCC SEQ. I.D. NO. 343

GCTGCGAAGGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 344

GCGACCGAGATGGGACGGTATGAATAATCC SEQ. I.D. NO. 345

GCCAGACAATTGGGACGGTATGAATAATCC SEQ. I.D. NO. 346

GCCTAGGTTCTGGGACGGTATGAATAATCC SEQ. I.D. NO. 347

GCGTTCATTATGGGACGGTATGAATAATCC SEQ. I.D. NO. 348

GC A ATGC GTTTGGGACGGT ATGA AT A ATC C SEQ. I.D. NO. 349

GCGAGAGTTGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 350

GCGATTACAGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 351

GCTGTGCTTATGGGACGGTATGAATAATCC SEQ. I.D. NO. 352

GCAGAACATTTGGGACGGTATGAATAATCC SEQ. I.D. NO. 353

GCTACCGCTGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 354

GCTCCTGGTCTGGGACGGTATGAATAATCC SEQ. I.D. NO. 355

GCCCTGGATATGGGACGGTATGAATAATCC SEQ. I.D. NO. 356

GCATACCTGTTGGGACGGTATGAATAATCC SEQ. I.D. NO. 357

GCAATGTTGGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 358

GCTCGACGGCTGGGACGGTATGAATAATCC SEQ. I.D. NO. 359

GCGGCAGATATGGGACGGTATGAATAATCC SEQ. I.D. NO. 360

GCGTCTTAGTTGGGACGGTATGAATAATCC SEQ. I.D. NO. 361

GCGGAAGGCGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 362

GCGGCTAGGCTGGGACGGTATGAATAATCC SEQ. I.D. NO. 363

GCCAGCAGCATGGGACGGTATGAATAATCC SEQ. I.D. NO. 364

GCCCTTACCTTGGGACGGTATGAATAATCC SEQ. I.D. NO. 365

GCCGAGTTAGTGGGACGGTATGAATAATCC SEQ. I.D. NO. 366

GCGATGTTACTGGGACGGTATGAATAATCC SEQ. I.D. NO. 367 GCTGATTACATGGGACGGTATGAATAATCC SEQ. LD. NO. 368

GCTTGATAATTGGGACGGTATGAATAATCC SEQ. LD. NO. 369

GCACGCATAGTGGGACGGTATGAATAATCC SEQ. LD. NO. 370

GCCTGTGGACTGGGACGGTATGAATAATCC SEQ. LD. NO. 371

GCATAGACAATGGGACGGTATGAATAATCC SEQ. LD. NO. 372

GCCCATTGTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 373

GCAGAGGAATTGGGACGGTATGAATAATCC SEQ. LD. NO. 374

GCCTTCCTTCTGGGACGGTATGAATAATCC SEQ. LD. NO. 375

GCTCTAGCGATGGGACGGTATGAATAATCC SEQ. LD. NO. 376

GCTCAACTGTTGGGACGGTATGAATAATCC SEQ. LD. NO. 377

GCGACTATTGTGGGACGGTATGAATAATCC SEQ. LD. NO. 378

GCCAACGGTCTGGGACGGTATGAATAATCC SEQ. LD. NO. 379

GCCTTGCAGATGGGACGGTATGAATAATCC SEQ. LD. NO. 380

GCGATACAGTTGGGACGGTATGAATAATCC SEQ. LD. NO. 381

GCCCTGGTAGTGGGACGGTATGAATAATCC SEQ. LD. NO. 382

GCGTT AGGTC TGGGACGGT ATGAATA ATC C SEQ. LD. NO. 383

GCTACTTGCATGGGACGGTATGAATAATCC SEQ. LD. NO. 384

GCTCCATGCTTGGGACGGTATGAATAATCC SEQ. LD. NO. 385

GCACATAGCGTGGGACGGTATGAATAATCC SEQ. LD. NO. 386

GCTGGATATCTGGGACGGTATGAATAATCC SEQ. LD. NO. 387

GCGAGTTACATGGGACGGTATGAATAATCC SEQ. LD. NO. 388

GCTGCGACCTTGGGACGGTATGAATAATCC SEQ. LD. NO. 389

GCATCCGCAGTGGGACGGTATGAATAATCC SEQ. LD. NO. 390

GCCAGTTGGTTGGGACGGTATGAATAATCC SEQ. LD. NO. 391

GCCTGATTAATGGGACGGTATGAATAATCC SEQ. LD. NO. 392

GCTCGCACCTTGGGACGGTATGAATAATCC SEQ. LD. NO. 393

GCCGCCACAGTGGGACGGTATGAATAATCC SEQ. LD. NO. 394

GCGTTGCGGCTGGGACGGTATGAATAATCC SEQ. LD. NO. 395

GCAGATATAATGGGACGGTATGAATAATCC SEQ. LD. NO. 396 5' Primer Sequence (no more GC+ Well BC +

5'Flank)

ATCGACTGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 397

GCTAGCAGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 398

TACTCTCCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 399

TGACAGCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 400 G

GCAGGTTGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 401

TTCCAGCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 402

TAGTTAGCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 403

AGCGCTAATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 404

CGGTTCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 405

TAGCATTGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 406

AATTCAACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 407

TTCACAGATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 408 GCTCTCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 409

TGACTTGGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 410

TATGGTTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 411

CACTAGCCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 412

AACCTCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 413

CTACATTGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 414

GCGATTACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 415

AATTGGCCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 416

AATTGCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 417

TTGGTCTGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 418

CATCCTGGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 419

GGATTAACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 420

CGCATATTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 421

TCATTCGATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 422

GTCCAATCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 423

CTTGGTCATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 424

CCAACGCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 425

TCCACTTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 426

AATCTCCATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 427

GTCTGCACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 428

CTGCTCCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 429

TTAGCCAGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 430

GCTGATTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 431

GAATCGACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 432

AGTCACCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 433

CACGATTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 434

GCTCCGATTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 435

CTTGGCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 436

GCTGCACTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 437

GAACTTCGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 438

CTGTATTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 439

ATATCCGATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 440

TTGTCCATTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 441

AGTAAGTCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 442

G

GAATATCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 443 G

CAACTGATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 444 G

CCTGTCATTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 445

GACGGTTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 446

G

CTATTAGCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 447

TCCAACCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 448

G CTGGCTATTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 449

GCGGACTTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 450

G

CCATCACATATTTATGCAGAGGCCGAG SEQ. LD. NO. 451 G

GGCAATACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 452 G

CACTTCATTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 453

CAAGCTTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 454

G

AGGTACCATATTTATGCAGAGGCCGAG SEQ. LD. NO. 455 G

TCCATAACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 456 G

GTCCTCATTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 457

AGTACTGCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 458

G

CTTGAATCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 459

CCAACTAATATTTATGCAGAGGCCGAG SEQ. LD. NO. 460

G

AATACCATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 461 G

GCGATATTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 462 G

GAACGCTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 463 G

CTGACATCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 464 G

GCCACCATTATTTATGCAGAGGCCGAG SEQ. LD. NO. 465 G

CGACTCTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 466

TGCTATTATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 467

CTTCTGGCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 468

ATGAATTATATTTATGCAGAGGCCGAG SEQ. LD. NO. 469

G

TACTCCAGTATTTATGCAGAGGCCGAG SEQ. LD. NO. 470 G

ATCATACCTATTTATGCAGAGGCCGAG SEQ. LD. NO. 471 G

CCTCTAACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 472 ATCTTCTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 473 CAGCTCACTATTTATGCAGAGGCCGAG SEQ. LD. NO. 474 G

GGTTATCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 475

TCCGCATATATTTATGCAGAGGCCGAG SEQ. LD. NO. 476

G

TGCTTCACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 477 GCTTCCTATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 478 GACCATCTTATTTATGCAGAGGCCGAG SEQ. LD. NO. 479 G

CTGGTATTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 480

TTAATCACTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 481

CGCGAATATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 482

GCTCACCATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 483

TCATGTCTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 484

ATCCTTAATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 485

TTCTTGGCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 486

CATCACTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 487

CGAACTTCTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 488

GACATTAATATTTATGCAGAGGCCGAGG SEQ. LD. NO. 489

TTCACCTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 490

CCAATCTGTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 491

CGACAGTTTATTTATGCAGAGGCCGAGG SEQ. LD. NO. 492

3' Primer Sequence (GC + Plate BC + Rev.

comp. of 3' Flank)

CTCTACTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 493

TAAGCATGTGGGACGGTATGAATAATC SEQ. LD. NO. 494

C

AGATGTGCTGGGACGGTATGAATAATC SEQ. LD. NO. 495 C

GTCGAGCATGGGACGGTATGAATAATC SEQ. LD. NO. 496 C

GAATTGCTTGGGACGGTATGAATAATC SEQ. LD. NO. 497 C

AAGCAACTTGGGACGGTATGAATAATC SEQ. LD. NO. 498 C

CTAACTGGTGGGACGGTATGAATAATC SEQ. LD. NO. 499 C

AGGCTCAATGGGACGGTATGAATAATC SEQ. LD. NO. 500 C

GATCGTGTTGGGACGGTATGAATAATCC SEQ. LD. NO. 501

TCTGGACCTGGGACGGTATGAATAATCC SEQ. LD. NO. 502

TGTTATACTGGGACGGTATGAATAATCC SEQ. LD. NO. 503

TCAGCGAATGGGACGGTATGAATAATCC SEQ. LD. NO. 504

GTCAAGTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 505

AGGATGTGTGGGACGGTATGAATAATCC SEQ. LD. NO. 506

CATTCCGATGGGACGGTATGAATAATCC SEQ. LD. NO. 507

ACATCCTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 508

ACCGCGCGTGGGACGGTATGAATAATCC SEQ. LD. NO. 509

TCGCCAGATGGGACGGTATGAATAATC SEQ. LD. NO. 510

C

TCGCTATGTGGGACGGTATGAATAATCC SEQ. LD. NO. 511

GGCTCCTGTGGGACGGTATGAATAATC SEQ. LD. NO. 512

C

ATCCGACATGGGACGGTATGAATAATC SEQ. LD. NO. 513 C

AACATAATTGGGACGGTATGAATAATC SEQ. LD. NO. 514 C

ATGGTAGGTGGGACGGTATGAATAATC SEQ. LD. NO. 515 C

GCTAAGTATGGGACGGTATGAATAATC SEQ. LD. NO. 516 C

CGATCATGTGGGACGGTATGAATAATC SEQ. LD. NO. 517 C

TAGATCCTTGGGACGGTATGAATAATCC SEQ. LD. NO. 518 TTACTGTCTGGGACGGTATGAATAATCC SEQ. LD. NO. 519 GGCATAGGTGGGACGGTATGAATAATC SEQ. LD. NO. 520 C

CAAGGCGATGGGACGGTATGAATAATC SEQ. LD. NO. 521 C

GACGCTATTGGGACGGTATGAATAATC SEQ. LD. NO. 522 C

ACTTCTTCTGGGACGGTATGAATAATCC SEQ. LD. NO. 523

CCTAGAATTGGGACGGTATGAATAATC SEQ. LD. NO. 524

C

TGGTAACGTGGGACGGTATGAATAATC SEQ. LD. NO. 525 C

CATCAGACTGGGACGGTATGAATAATC SEQ. LD. NO. 526 C

GTGCGTAATGGGACGGTATGAATAATC SEQ. LD. NO. 527 C

CTATTCAATGGGACGGTATGAATAATCC SEQ. LD. NO. 528

AGTGTCTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 529

CCTTGCTGTGGGACGGTATGAATAATCC SEQ. LD. NO. 530

TTGCTGGATGGGACGGTATGAATAATC SEQ. LD. NO. 531

C

AGCTCTGGTGGGACGGTATGAATAATC SEQ. LD. NO. 532 C

ACCAAGGATGGGACGGTATGAATAATC SEQ. LD. NO. 533 C

GATAACCTTGGGACGGTATGAATAATC SEQ. LD. NO. 534 C

TAGATGACTGGGACGGTATGAATAATC SEQ. LD. NO. 535 C

TGCGAAGGTGGGACGGTATGAATAATC SEQ. LD. NO. 536 C

GACCGAGATGGGACGGTATGAATAATC SEQ. LD. NO. 537 C

CAGACAATTGGGACGGTATGAATAATC SEQ. LD. NO. 538 C

CTAGGTTCTGGGACGGTATGAATAATCC SEQ. LD. NO. 539 GTTCATTATGGGACGGTATGAATAATCC SEQ. LD. NO. 540 AATGCGTTTGGGACGGTATGAATAATC SEQ. LD. NO. 541 C GAGAGTTGTGGGACGGTATGAATAATC SEQ. LD. NO. 542

C

GATTACAGTGGGACGGTATGAATAATC SEQ. LD. NO. 543

C

TGTGCTTATGGGACGGTATGAATAATCC SEQ. LD. NO. 544

AGAACATTTGGGACGGTATGAATAATC SEQ. LD. NO. 545

C

TACCGCTGTGGGACGGTATGAATAATC SEQ. LD. NO. 546

C

TCCTGGTCTGGGACGGTATGAATAATCC SEQ. LD. NO. 547

CCTGGATATGGGACGGTATGAATAATC SEQ. LD. NO. 548

C

ATACCTGTTGGGACGGTATGAATAATCC SEQ. LD. NO. 549

AATGTTGGTGGGACGGTATGAATAATC SEQ. LD. NO. 550

C

TCGACGGCTGGGACGGTATGAATAATC SEQ. LD. NO. 551

C

GGCAGATATGGGACGGTATGAATAATC SEQ. LD. NO. 552

C

GTCTTAGTTGGGACGGTATGAATAATCC SEQ. LD. NO. 553

GGAAGGCGTGGGACGGTATGAATAATC SEQ. LD. NO. 554

C

GGC T AGGC TGGGACGGT ATG A AT A ATC SEQ. LD. NO. 555

C

CAGCAGCATGGGACGGTATGAATAATC SEQ. LD. NO. 556

C

CCTTACCTTGGGACGGTATGAATAATCC SEQ. LD. NO. 557

CGAGTTAGTGGGACGGTATGAATAATC SEQ. LD. NO. 558

C

GATGTTACTGGGACGGTATGAATAATC SEQ. LD. NO. 559

C

TGATTACATGGGACGGTATGAATAATC SEQ. LD. NO. 560

C

TTGATAATTGGGACGGTATGAATAATCC SEQ. LD. NO. 561

ACGCATAGTGGGACGGTATGAATAATC SEQ. LD. NO. 562

C

CTGTGGACTGGGACGGTATGAATAATC SEQ. LD. NO. 563

C

ATAGACAATGGGACGGTATGAATAATC SEQ. LD. NO. 564

C

CCATTGTTTGGGACGGTATGAATAATCC SEQ. LD. NO. 565

AGAGGAATTGGGACGGTATGAATAATC SEQ. LD. NO. 566

C

CTTCCTTCTGGGACGGTATGAATAATCC SEQ. LD. NO. 567

TCTAGCGATGGGACGGTATGAATAATC SEQ. LD. NO. 568

C

TCAACTGTTGGGACGGTATGAATAATCC SEQ. LD. NO. 569

GACTATTGTGGGACGGTATGAATAATC SEQ. LD. NO. 570

C CAACGGTCTGGGACGGTATGAATAATC SEQ. LD. NO. 571

C

CTTGCAGATGGGACGGTATGAATAATC SEQ. LD. NO. 572

C

GATACAGTTGGGACGGTATGAATAATC SEQ. LD. NO. 573

C

CCTGGTAGTGGGACGGTATGAATAATC SEQ. LD. NO. 574

C

GTTAGGTCTGGGACGGTATGAATAATC SEQ. LD. NO. 575

C

TACTTGCATGGGACGGTATGAATAATCC SEQ. LD. NO. 576

TCCATGCTTGGGACGGTATGAATAATCC SEQ. LD. NO. 577

ACATAGCGTGGGACGGTATGAATAATC SEQ. LD. NO. 578

C

TGGATATCTGGGACGGTATGAATAATC SEQ. LD. NO. 579

C

GAGTTACATGGGACGGTATGAATAATC SEQ. LD. NO. 580

C

TGCGACCTTGGGACGGTATGAATAATC SEQ. LD. NO. 581

C

ATCCGCAGTGGGACGGTATGAATAATC SEQ. LD. NO. 582

C

CAGTTGGTTGGGACGGTATGAATAATC SEQ. LD. NO. 583

C

CTGATTAATGGGACGGTATGAATAATC SEQ. LD. NO. 584

C

TCGCACCTTGGGACGGTATGAATAATCC SEQ. LD. NO. 585

CGCCACAGTGGGACGGTATGAATAATC SEQ. LD. NO. 586

C

GTTGCGGCTGGGACGGTATGAATAATC SEQ. LD. NO. 587

C

AGATATAATGGGACGGTATGAATAATC SEQ. LD. NO. 588

C

24. The set of primers of any one of clauses 1-23, wherein the unique polynucleotide identifier comprises an endogenous polynucleotide identifier.

25. The set of primers of any one of clauses 1-24, wherein the unique polynucleotide identifier comprises a 16S sequence.

26. The set of primers of any one of clauses 1-25, wherein the set of primers comprises primers for detection of a 16S sequence. 27. The set of primers of clause 26, wherein the set of primers is a pair of primers and wherein each pair of primers comprises a second polynucleotide sequence configured for strain-specific 16S detection.

28. The set of primers of any one of clauses 1-27, wherein the second polynucleotide sequence comprises any one of the below sequences, or the reverse complement thereof:

Figure imgf000052_0001
SEQ. LD. NO. 599

519R GWATTACCGCGGCKGC Universal Turner et

TG al. 1999

SEQ. LD. NO. 600

CYA781R GACTACWGGGGTATCT Cyanobacteria Nubel et

AATCCCWTT al. 1997

SEQ. LD. NO. 601

CD [R] CTTGTGCGGGCCCCCGT Universal Rudi et al.

CAATTC 1997

SEQ. LD. NO. 602

902R GTCAATTCITTTGAGTTT Bacteria exc. Hodkinson

YARYC plastids & & Lutzoni

SEQ. LD. NO. 603 Cyanobacteria 2009

904R CCCCGTCAATTCITTTGA Bacteria exc. Hodkinson

GTTTYAR plastids & & Lutzoni

SEQ. LD. NO. 604 Cyanobacteria 2009

907R CCGTCAATTCMTTTRAG Universal Lane et al.

TTT 1991

SEQ. LD. NO. 605

1100R AGGGTTGCGCTCGTTG Bacteria Turner et

SEQ. LD. NO. 606 al. 1999

1185mR GAYTTGACGTCATCCM Bacteria exc. Hodkinson

SEQ. LD. NO. 607 plastids & & Lutzoni

Cyanobacteria 2009

1185aR GAYTTGACGTCATCCA Lichen- Hodkinson

SEQ. LD. NO. 608 associated & Lutzoni

Rhizobiales 2009

1381R CGGTGTGTACAAGRCC Bacteria exc. Hodkinson

YGRGA Asterochloris & Lutzoni

SEQ. LD. NO. 609 sp. plastids 2009

1381bR CGGGCGGTGTGTACAA Bacteria exc. Hodkinson

GRCCYGRGA Asterochloris & Lutzoni

SEQ. LD. NO. 610 sp. plastids 2009

1391R GACGGGCGGTGTGTRC Universal Turner et

A al. 1999

SEQ. LD. NO. 611

1492R (1) GGTTACCTTGTTACGAC Universal Turner et

TT al. 1999

SEQ. LD. NO. 612

1492R (s) ACCTTGTTACGACTT Universal Lane et al.

SEQ. LD. NO. 613 1991 29. The set of primers of any one of clauses 1-28, wherein the second polynucleotide sequence comprises any one of the below sequences, or the reverse complement thereof:

F: 5 ' - AAGGGGC ATGATGACTTGAC-3 '

R: 5'-GAGATGTCGGTTCCCTTGTG-3'

F: 5 ' -TCCTACGGGAGGC AGC AGT-3 '

R: 5'-GGACTACCAGGGTATCTAATCCTGTT-3' .

30. The set of primers of any one of clauses 1-29, wherein the growth conditions comprise temperature, exposure to one or more chemical or biological agent, time duration of each exposure, concentration of each chemical or biological agent, or any combination thereof.

31. A collection of double-stranded nucleic acid molecules for multiplex high- resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strains, wherein each molecule comprises an experimental conditions sequence; and a unique polynucleotide identifier.

32. The collection of double-stranded nucleic acid molecules of clause 31, wherein detection comprises absolute or relative quantification.

33. The collection of double-stranded nucleic acid molecules of any one of clauses 31-32, wherein experimental conditions comprise growth conditions.

34. The collection of double-stranded nucleic acid molecules of any one of clauses 31-33, wherein the unique polynucleotide identifier comprises an exogenous or endogenous polynucleotide sequence.

35. The collection of double-stranded nucleic acid molecules of any one of clauses 31-34 wherein the unique polynucleotide identifier comprises an exogenous polynucleotide identifier flanked by upstream and downstream respective flanking sequences common for all strains of the strain collection.

36. The collection of double-stranded nucleic acid molecules of any one of clauses 31-35, wherein the double-stranded nucleic acid molecules comprises any one of the below sequences or the reverse complement thereof:

Primer Name Sequence (SEQ ID NOs. 11-202)

Al ATCGACTG

B l GCTAGCAG

CI TACTCTCC

D l TGACAGCA

El GCAGGTTG

Fl TTCCAGCT

Gl TAGTTAGC

HI AGCGCTAA

A2 CGGTTCTT

B2 TAGCATTG

C2 AATTCAAC

D2 TTCACAGA

E2 GCTCTCTT

F2 TGACTTGG

G2 TATGGTTC

H2 CACTAGCC

A3 AACCTCTT

B3 CTACATTG

C3 GCGATTAC

D3 AATTGGCC

E3 AATTGCTT

F3 TTGGTCTG

G3 CATCCTGG

H3 GGATTAAC

A4 CGCATATT

B4 TCATTCGA

C4 GTCCAATC

D4 CTTGGTCA

E4 CCAACGCT

F4 TCCACTTC

G4 AATCTCCA

H4 GTCTGCAC

A5 CTGCTCCT

B5 TTAGCCAG

C5 GCTGATTC D5 GAATCGAC

E5 AGTCACCT

F5 CACGATTC

G5 GCTCCGAT

H5 CTTGGCTT

A6 GCTGCACT

B6 GAACTTCG

C6 CTGTATTC

D6 ATATCCGA

E6 TTGTCCAT

F6 AGTAAGTC

G6 GAATATCA

H6 CAACTGAT

A7 CCTGTCAT

B7 GACGGTTA

C7 CTATTAGC

D7 TCCAACCA

E7 CTGGCTAT

F7 GCGGACTT

G7 CCATCACA

H7 GGCAATAC

A8 CACTTCAT

B8 CAAGCTTA

C8 AGGTACCA

D8 TCCATAAC

E8 GTCCTCAT

F8 AGTACTGC

G8 CTTGAATC

H8 CCAACTAA

A9 AATACCAT

B9 GCGATATT

C9 GAACGCTA

D9 CTGACATC

E9 GCCACCAT

F9 CGACTCTC

G9 TGCTATTA

H9 CTTCTGGC

A10 ATGAATTA

B IO TACTCCAG

CIO ATCATACC

D 10 CCTCTAAC

E10 ATCTTCTC

F10 CAGCTCAC

G10 GGTTATCT H10 TCCGCATA

Al l TGCTTCAC

Bl l GCTTCCTA

Cl l GACCATCT

Dl l CTGGTATT

El l TTAATCAC

Fl l CGCGAATA

Gi l GCTCACCA

Hl l TCATGTCT

A12 ATCCTTAA

B12 TTCTTGGC

C12 CATCACTT

D12 CGAACTTC

E12 GACATTAA

F12 TTCACCTT

G12 CCAATCTG

H12 CGACAGTT

Plate 1 AAGTAGAG

Plate2 CATGCTTA

Plate3 GCACATCT

Plate4 TGCTCGAC

Plate5 AGCAATTC

Plate6 AGTTGCTT

Plate7 CCAGTTAG

Plate8 TTGAGCCT

Plate9 ACACGATC

PlatelO GGTCCAGA

Plate 11 GTATAACA

Platel2 TTCGCTGA

Plate 13 AACTTGAC

Platel4 CACATCCT

Plate 15 TCGGAATG

Platel6 AAGGATGT

Platel7 CGCGCGGT

Plate 18 TCTGGCGA

Plate 19 CATAGCGA

Plate20 CAGGAGCC

Plate21 TGTCGGAT

Plate22 ATTATGTT

Plate23 CCTACCAT

Plate24 TACTTAGC

Plate25 CATGATCG

Plate26 AGGATCTA

Plate27 GACAGTAA Plate28 CCTATGCC Plate29 TCGCCTTG Plate30 ATAGCGTC Plate31 GAAGAAGT Plate32 ATTCTAGG Plate33 CGTTACCA Plate34 GTCTGATG Plate35 TTACGCAC Plate36 TTGAATAG Plate37 AAGACACT Plate38 CAGCAAGG Plate39 TCCAGCAA Plate40 CCAGAGCT Plate41 TCCTTGGT Plate42 AGGTTATC Plate43 GTCATCTA Plate44 CCTTCGCA Plate45 TCTCGGTC Plate46 ATTGTCTG Plate47 GAACCTAG Plate48 TAATGAAC Plate49 AACGCATT Plate50 CAACTCTC Plate51 CTGTAATC Plate52 TAAGCACA Plate53 AATGTTCT Plate54 CAGCGGTA Plate55 GACCAGGA Plate56 TATCCAGG Plate57 ACAGGTAT Plate58 CCAACATT Plate59 GCCGTCGA Plate60 TATCTGCC Plate61 ACTAAGAC Plate62 CGCCTTCC Plate63 GCCTAGCC Plate64 TGCTGCTG Plate65 AGGTAAGG Plate66 CTAACTCG Plate67 GTAACATC Plate68 TGTAATCA Plate69 ATTATCAA Plate70 CTATGCGT Plate71 GTCCACAG Plate72 TTGTCTAT

Plate73 AACAATGG

Plate74 ATTCCTCT

Plate75 GAAGGAAG

Plate76 TCGCTAGA

Plate77 ACAGTTGA

Plate78 CAATAGTC

Plate79 GACCGTTG

Plate80 TCTGCAAG

Plate81 ACTGTATC

Plate82 CTACCAGG

Plate83 GACCTAAC

Plate84 TGCAAGTA

Plate85 AGCATGGA

Plate86 CGCTATGT

Plate87 GATATCCA

Plate88 TGTAACTC

Plate89 AGGTCGCA

Plate90 CTGCGGAT

Plate91 ACCAACTG

Plate92 TTAATCAG

Plate93 AGGTGCGA

Plate94 CTGTGGCG

Plate95 GCCGCAAC

Plate96 TTATATCT

5' Flank

TATTTATGCAGAGGCCGAGG

3' Flank Sequence SEQ ID NO: 203

GGATTATTCATACCGTCCCA.

5' Primer Sequence (GC + Well BC + 5Tlank) SEQ

ID NO. 204

(SEQ ID NOs. 205-300)

GCATCGACTGTATTTATGCAGAGGCCGAGG

GCGCTAGCAGTATTTATGCAGAGGCCGAGG

GCTACTCTCCTATTTATGCAGAGGCCGAGG

GCTGACAGCATATTTATGCAGAGGCCGAGG

GCGCAGGTTGTATTTATGCAGAGGCCGAGG

GCTTCCAGCTTATTTATGCAGAGGCCGAGG

GCTAGTTAGCTATTTATGCAGAGGCCGAGG

GCAGCGCTAATATTTATGCAGAGGCCGAGG

GCCGGTTCTTTATTTATGCAGAGGCCGAGG

GCTAGCATTGTATTTATGCAGAGGCCGAGG

GCAATTCAACTATTTATGCAGAGGCCGAGG

GCTTCACAGATATTTATGCAGAGGCCGAGG GCGCTCTCTTTATTTATGCAGAGGCCGAGG

GCTGACTTGGTATTTATGCAGAGGCCGAGG

GCTATGGTTCTATTTATGCAGAGGCCGAGG

GCCACTAGCCTATTTATGCAGAGGCCGAGG

GCAACCTCTTTATTTATGCAGAGGCCGAGG

GCCTACATTGTATTTATGCAGAGGCCGAGG

GCGCGATTACTATTTATGCAGAGGCCGAGG

GCAATTGGCCTATTTATGCAGAGGCCGAGG

GCAATTGCTTTATTTATGCAGAGGCCGAGG

GCTTGGTCTGTATTTATGCAGAGGCCGAGG

GCCATCCTGGTATTTATGCAGAGGCCGAGG

GCGGATTAACTATTTATGCAGAGGCCGAGG

GCCGCATATTTATTTATGCAGAGGCCGAGG

GCTCATTCGATATTTATGCAGAGGCCGAGG

GCGTCCAATCTATTTATGCAGAGGCCGAGG

GCCTTGGTCATATTTATGCAGAGGCCGAGG

GCCCAACGCTTATTTATGCAGAGGCCGAGG

GCTCCACTTCTATTTATGCAGAGGCCGAGG

GCAATCTCCATATTTATGCAGAGGCCGAGG

GCGTCTGCACTATTTATGCAGAGGCCGAGG

GCCTGCTCCTTATTTATGCAGAGGCCGAGG

GCTTAGCCAGTATTTATGCAGAGGCCGAGG

GCGCTGATTCTATTTATGCAGAGGCCGAGG

GCGAATCGACTATTTATGCAGAGGCCGAGG

GCAGTCACCTTATTTATGCAGAGGCCGAGG

GCCACGATTCTATTTATGCAGAGGCCGAGG

GCGCTCCGATTATTTATGCAGAGGCCGAGG

GCCTTGGCTTTATTTATGCAGAGGCCGAGG

GCGCTGCACTTATTTATGCAGAGGCCGAGG

GCGAACTTCGTATTTATGCAGAGGCCGAGG

GCCTGTATTCTATTTATGCAGAGGCCGAGG

GCATATCCGATATTTATGCAGAGGCCGAGG

GCTTGTCCATTATTTATGCAGAGGCCGAGG

GCAGTAAGTCTATTTATGCAGAGGCCGAGG

GCGAATATCATATTTATGCAGAGGCCGAGG

GCCAACTGATTATTTATGCAGAGGCCGAGG

GCCCTGTCATTATTTATGCAGAGGCCGAGG

GCGACGGTTATATTTATGCAGAGGCCGAGG

GCCTATTAGCTATTTATGCAGAGGCCGAGG

GCTCCAACCATATTTATGCAGAGGCCGAGG

GCCTGGCTATTATTTATGCAGAGGCCGAGG

GCGCGGACTTTATTTATGCAGAGGCCGAGG

GCCCATCACATATTTATGCAGAGGCCGAGG

GCGGCAATACTATTTATGCAGAGGCCGAGG GCCACTTCATTATTTATGCAGAGGCCGAGG

GCCAAGCTTATATTTATGCAGAGGCCGAGG

GCAGGTACCATATTTATGCAGAGGCCGAGG

GCTCCATAACTATTTATGCAGAGGCCGAGG

GCGTCCTCATTATTTATGCAGAGGCCGAGG

GCAGTACTGCTATTTATGCAGAGGCCGAGG

GCCTTGAATCTATTTATGCAGAGGCCGAGG

GCCCAACTAATATTTATGCAGAGGCCGAGG

GCAATACCATTATTTATGCAGAGGCCGAGG

GCGCGATATTTATTTATGCAGAGGCCGAGG

GCGAACGCTATATTTATGCAGAGGCCGAGG

GCCTGACATCTATTTATGCAGAGGCCGAGG

GCGCCACCATTATTTATGCAGAGGCCGAGG

GCCGACTCTCTATTTATGCAGAGGCCGAGG

GCTGCTATTATATTTATGCAGAGGCCGAGG

GCCTTCTGGCTATTTATGCAGAGGCCGAGG

GCATGAATTATATTTATGCAGAGGCCGAGG

GCTACTCCAGTATTTATGCAGAGGCCGAGG

GCATCATACCTATTTATGCAGAGGCCGAGG

GCCCTCTAACTATTTATGCAGAGGCCGAGG

GCATCTTCTCTATTTATGCAGAGGCCGAGG

GCCAGCTCACTATTTATGCAGAGGCCGAGG

GCGGTTATCTTATTTATGCAGAGGCCGAGG

GCTCCGCATATATTTATGCAGAGGCCGAGG

GCTGCTTCACTATTTATGCAGAGGCCGAGG

GCGCTTCCTATATTTATGCAGAGGCCGAGG

GCGACCATCTTATTTATGCAGAGGCCGAGG

GCCTGGTATTTATTTATGCAGAGGCCGAGG

GCTTAATCACTATTTATGCAGAGGCCGAGG

GCCGCGAATATATTTATGCAGAGGCCGAGG

GCGCTCACCATATTTATGCAGAGGCCGAGG

GCTCATGTCTTATTTATGCAGAGGCCGAGG

GCATCCTTAATATTTATGCAGAGGCCGAGG

GCTTCTTGGCTATTTATGCAGAGGCCGAGG

GCCATCACTTTATTTATGCAGAGGCCGAGG

GCCGAACTTCTATTTATGCAGAGGCCGAGG

GCGACATTAATATTTATGCAGAGGCCGAGG

GCTTCACCTTTATTTATGCAGAGGCCGAGG

GCCCAATCTGTATTTATGCAGAGGCCGAGG

GCCGACAGTTTATTTATGCAGAGGCCGAGG

3' Primer Sequence (GC + Plate BC + Rev. comp. of 3' Flank) (SEQ ID NOs. 301-396)

GCCTCTACTTTGGGACGGTATGAATAATCC GCTAAGCATGTGGGACGGTATGAATAATCC GCAGATGTGCTGGGACGGTATGAATAATCC

GCGTCGAGCATGGGACGGTATGAATAATCC

GCGAATTGCTTGGGACGGTATGAATAATCC

GCAAGCAACTTGGGACGGTATGAATAATCC

GCCTAACTGGTGGGACGGTATGAATAATCC

GCAGGCTCAATGGGACGGTATGAATAATCC

GCGATCGTGTTGGGACGGTATGAATAATCC

GCTCTGGACCTGGGACGGTATGAATAATCC

GCTGTTATACTGGGACGGTATGAATAATCC

GCTCAGCGAATGGGACGGTATGAATAATCC

GCGTCAAGTTTGGGACGGTATGAATAATCC

GCAGGATGTGTGGGACGGTATGAATAATCC

GCCATTCCGATGGGACGGTATGAATAATCC

GCACATCCTTTGGGACGGTATGAATAATCC

GCACCGCGCGTGGGACGGTATGAATAATCC

GCTCGCCAGATGGGACGGTATGAATAATCC

GCTCGCTATGTGGGACGGTATGAATAATCC

GCGGCTCCTGTGGGACGGTATGAATAATCC

GCATCCGACATGGGACGGTATGAATAATCC

GCAACATAATTGGGACGGTATGAATAATCC

GCATGGTAGGTGGGACGGTATGAATAATCC

GCGCTAAGTATGGGACGGTATGAATAATCC

GCCGATCATGTGGGACGGTATGAATAATCC

GCTAGATCCTTGGGACGGTATGAATAATCC

GCTTACTGTCTGGGACGGTATGAATAATCC

GCGGCATAGGTGGGACGGTATGAATAATCC

GCCAAGGCGATGGGACGGTATGAATAATCC

GCGACGCTATTGGGACGGTATGAATAATCC

GCACTTCTTCTGGGACGGTATGAATAATCC

GCCCTAGAATTGGGACGGTATGAATAATCC

GCTGGTAACGTGGGACGGTATGAATAATCC

GCCATCAGACTGGGACGGTATGAATAATCC

GCGTGCGTAATGGGACGGTATGAATAATCC

GCCTATTCAATGGGACGGTATGAATAATCC

GCAGTGTCTTTGGGACGGTATGAATAATCC

GCCCTTGCTGTGGGACGGTATGAATAATCC

GCTTGCTGGATGGGACGGTATGAATAATCC

GCAGCTCTGGTGGGACGGTATGAATAATCC

GCACCAAGGATGGGACGGTATGAATAATCC

GCGATAACCTTGGGACGGTATGAATAATCC

GCTAGATGACTGGGACGGTATGAATAATCC

GCTGCGAAGGTGGGACGGTATGAATAATCC

GCGACCGAGATGGGACGGTATGAATAATCC

GCCAGACAATTGGGACGGTATGAATAATCC GCCTAGGTTCTGGGACGGTATGAATAATCC

GCGTTCATTATGGGACGGTATGAATAATCC

GCAATGCGTTTGGGACGGTATGAATAATCC

GCGAGAGTTGTGGGACGGTATGAATAATCC

GCGATTACAGTGGGACGGTATGAATAATCC

GCTGTGCTTATGGGACGGTATGAATAATCC

GCAGAACATTTGGGACGGTATGAATAATCC

GCTACCGCTGTGGGACGGTATGAATAATCC

GCTCCTGGTCTGGGACGGTATGAATAATCC

GCCCTGGATATGGGACGGTATGAATAATCC

GCATACCTGTTGGGACGGTATGAATAATCC

GCAATGTTGGTGGGACGGTATGAATAATCC

GCTCGACGGCTGGGACGGTATGAATAATCC

GCGGCAGATATGGGACGGTATGAATAATCC

GCGTCTTAGTTGGGACGGTATGAATAATCC

GCGGAAGGCGTGGGACGGTATGAATAATCC

GCGGCTAGGCTGGGACGGTATGAATAATCC

GCCAGCAGCATGGGACGGTATGAATAATCC

GCCCTTACCTTGGGACGGTATGAATAATCC

GCCGAGTTAGTGGGACGGTATGAATAATCC

GCGATGTTACTGGGACGGTATGAATAATCC

GCTGATTACATGGGACGGTATGAATAATCC

GCTTGATAATTGGGACGGTATGAATAATCC

GCACGCATAGTGGGACGGTATGAATAATCC

GCCTGTGGACTGGGACGGTATGAATAATCC

GCATAGACAATGGGACGGTATGAATAATCC

GCCCATTGTTTGGGACGGTATGAATAATCC

GCAGAGGAATTGGGACGGTATGAATAATCC

GCCTTCCTTCTGGGACGGTATGAATAATCC

GCTCTAGCGATGGGACGGTATGAATAATCC

GCTCAACTGTTGGGACGGTATGAATAATCC

GCGACTATTGTGGGACGGTATGAATAATCC

GCCAACGGTCTGGGACGGTATGAATAATCC

GCCTTGCAGATGGGACGGTATGAATAATCC

GCGATACAGTTGGGACGGTATGAATAATCC

GCCCTGGTAGTGGGACGGTATGAATAATCC

GCGTTAGGTCTGGGACGGTATGAATAATCC

GCTACTTGCATGGGACGGTATGAATAATCC

GCTCCATGCTTGGGACGGTATGAATAATCC

GCACATAGCGTGGGACGGTATGAATAATCC

GCTGGATATCTGGGACGGTATGAATAATCC

GCGAGTTACATGGGACGGTATGAATAATCC

GCTGCGACCTTGGGACGGTATGAATAATCC

GCATCCGCAGTGGGACGGTATGAATAATCC GCCAGTTGGTTGGGACGGTATGAATAATCC GCCTGATTAATGGGACGGTATGAATAATCC GCTCGCACCTTGGGACGGTATGAATAATCC GCCGCCACAGTGGGACGGTATGAATAATCC GCGTTGCGGCTGGGACGGTATGAATAATCC GCAGATATAATGGGACGGTATGAATAATCC

5' Primer Sequence (No more GC + Well BC + 5'Flank) (SEQ ID NOs. 397-492)

ATCGACTGTATTTATGCAGAGGCCGAGG

GCTAGCAGTATTTATGCAGAGGCCGAGG

TACTCTCCTATTTATGCAGAGGCCGAGG

TGACAGCATATTTATGCAGAGGCCGAGG

GCAGGTTGTATTTATGCAGAGGCCGAGG

TTCCAGCTTATTTATGCAGAGGCCGAGG

TAGTTAGCTATTTATGCAGAGGCCGAGG

AGCGCTAATATTTATGCAGAGGCCGAGG

CGGTTCTTTATTTATGCAGAGGCCGAGG

TAGCATTGTATTTATGCAGAGGCCGAGG

AATTCAACTATTTATGCAGAGGCCGAGG

TTCACAGATATTTATGCAGAGGCCGAGG

GCTCTCTTTATTTATGCAGAGGCCGAGG

TGACTTGGTATTTATGCAGAGGCCGAGG

TATGGTTCTATTTATGCAGAGGCCGAGG

CACTAGCCTATTTATGCAGAGGCCGAGG

AACCTCTTTATTTATGCAGAGGCCGAGG

CTACATTGTATTTATGCAGAGGCCGAGG

GCGATTACTATTTATGCAGAGGCCGAGG

AATTGGCCTATTTATGCAGAGGCCGAGG

AATTGCTTTATTTATGCAGAGGCCGAGG

TTGGTCTGTATTTATGCAGAGGCCGAGG

CATCCTGGTATTTATGCAGAGGCCGAGG

GGATTAACTATTTATGCAGAGGCCGAGG

CGCATATTTATTTATGCAGAGGCCGAGG

TCATTCGATATTTATGCAGAGGCCGAGG

GTCCAATCTATTTATGCAGAGGCCGAGG

CTTGGTCATATTTATGCAGAGGCCGAGG

CCAACGCTTATTTATGCAGAGGCCGAGG

TCCACTTCTATTTATGCAGAGGCCGAGG

AATCTCCATATTTATGCAGAGGCCGAGG

GTCTGCACTATTTATGCAGAGGCCGAGG

CTGCTCCTTATTTATGCAGAGGCCGAGG

TTAGCCAGTATTTATGCAGAGGCCGAGG

GCTGATTCTATTTATGCAGAGGCCGAGG

GAATCGACTATTTATGCAGAGGCCGAGG AGTCACCTTATTTATGCAGAGGCCGAGG

CACGATTCTATTTATGCAGAGGCCGAGG

GCTCCGATTATTTATGCAGAGGCCGAGG

CTTGGCTTTATTTATGCAGAGGCCGAGG

GCTGCACTTATTTATGCAGAGGCCGAGG

GAACTTCGTATTTATGCAGAGGCCGAGG

CTGTATTCTATTTATGCAGAGGCCGAGG

ATATCCGATATTTATGCAGAGGCCGAGG

TTGTCCATTATTTATGCAGAGGCCGAGG

AGTAAGTCTATTTATGCAGAGGCCGAGG

GAATATCATATTTATGCAGAGGCCGAGG

CAACTGATTATTTATGCAGAGGCCGAGG

CCTGTCATTATTTATGCAGAGGCCGAGG

GACGGTTATATTTATGCAGAGGCCGAGG

CTATTAGCTATTTATGCAGAGGCCGAGG

TCCAACCATATTTATGCAGAGGCCGAGG

CTGGCTATTATTTATGCAGAGGCCGAGG

GCGGACTTTATTTATGCAGAGGCCGAGG

CCATCACATATTTATGCAGAGGCCGAGG

GGCAATACTATTTATGCAGAGGCCGAGG

CACTTCATTATTTATGCAGAGGCCGAGG

CAAGCTTATATTTATGCAGAGGCCGAGG

AGGTACCATATTTATGCAGAGGCCGAGG

TCCATAACTATTTATGCAGAGGCCGAGG

GTCCTCATTATTTATGCAGAGGCCGAGG

AGTACTGCTATTTATGCAGAGGCCGAGG

CTTGAATCTATTTATGCAGAGGCCGAGG

CCAACTAATATTTATGCAGAGGCCGAGG

AATACCATTATTTATGCAGAGGCCGAGG

GCGATATTTATTTATGCAGAGGCCGAGG

GAACGCTATATTTATGCAGAGGCCGAGG

CTGACATCTATTTATGCAGAGGCCGAGG

GCCACCATTATTTATGCAGAGGCCGAGG

CGACTCTCTATTTATGCAGAGGCCGAGG

TGCTATTATATTTATGCAGAGGCCGAGG

CTTCTGGCTATTTATGCAGAGGCCGAGG

ATGAATTATATTTATGCAGAGGCCGAGG

TACTCCAGTATTTATGCAGAGGCCGAGG

ATCATACCTATTTATGCAGAGGCCGAGG

CCTCTAACTATTTATGCAGAGGCCGAGG

ATCTTCTCTATTTATGCAGAGGCCGAGG

CAGCTCACTATTTATGCAGAGGCCGAGG

GGTTATCTTATTTATGCAGAGGCCGAGG

TCCGCATATATTTATGCAGAGGCCGAGG TGCTTCACTATTTATGCAGAGGCCGAGG

GCTTCCTATATTTATGCAGAGGCCGAGG

GACCATCTTATTTATGCAGAGGCCGAGG

CTGGTATTTATTTATGCAGAGGCCGAGG

TTAATCACTATTTATGCAGAGGCCGAGG

CGCGAATATATTTATGCAGAGGCCGAGG

GCTCACCATATTTATGCAGAGGCCGAGG

TCATGTCTTATTTATGCAGAGGCCGAGG

ATCCTTAATATTTATGCAGAGGCCGAGG

TTCTTGGCTATTTATGCAGAGGCCGAGG

CATCACTTTATTTATGCAGAGGCCGAGG

CGAACTTCTATTTATGCAGAGGCCGAGG

GACATTAATATTTATGCAGAGGCCGAGG

TTCACCTTTATTTATGCAGAGGCCGAGG

CCAATCTGTATTTATGCAGAGGCCGAGG

CGACAGTTTATTTATGCAGAGGCCGAGG

3' Primer Sequence (GC + Plate BC + Rev. comp. of

3' Flank) (SEQ ID NOs. 493-588)

CTCTACTTTGGGACGGTATGAATAATCC

TAAGCATGTGGGACGGTATGAATAATCC

AGATGTGCTGGGACGGTATGAATAATCC

GTCGAGCATGGGACGGTATGAATAATCC

GAATTGCTTGGGACGGTATGAATAATCC

AAGCAACTTGGGACGGTATGAATAATCC

CTAACTGGTGGGACGGTATGAATAATCC

AGGCTCAATGGGACGGTATGAATAATCC

GATCGTGTTGGGACGGTATGAATAATCC

TCTGGACCTGGGACGGTATGAATAATCC

TGTTATACTGGGACGGTATGAATAATCC

TCAGCGAATGGGACGGTATGAATAATCC

GTCAAGTTTGGGACGGTATGAATAATCC

AGGATGTGTGGGACGGTATGAATAATCC

CATTCCGATGGGACGGTATGAATAATCC

ACATCCTTTGGGACGGTATGAATAATCC

ACCGCGCGTGGGACGGTATGAATAATCC

TCGCCAGATGGGACGGTATGAATAATCC

TCGCTATGTGGGACGGTATGAATAATCC

GGCTCCTGTGGGACGGTATGAATAATCC

ATCCGACATGGGACGGTATGAATAATCC

AACATAATTGGGACGGTATGAATAATCC

ATGGTAGGTGGGACGGTATGAATAATCC

GCTAAGTATGGGACGGTATGAATAATCC

CGATCATGTGGGACGGTATGAATAATCC

TAGATCCTTGGGACGGTATGAATAATCC TTACTGTCTGGGACGGTATGAATAATCC

GGCATAGGTGGGACGGTATGAATAATCC

CAAGGCGATGGGACGGTATGAATAATCC

GACGCTATTGGGACGGTATGAATAATCC

ACTTCTTCTGGGACGGTATGAATAATCC

CCTAGAATTGGGACGGTATGAATAATCC

TGGTAACGTGGGACGGTATGAATAATCC

CATCAGACTGGGACGGTATGAATAATCC

GTGCGTAATGGGACGGTATGAATAATCC

CTATTCAATGGGACGGTATGAATAATCC

AGTGTCTTTGGGACGGTATGAATAATCC

CCTTGCTGTGGGACGGTATGAATAATCC

TTGCTGGATGGGACGGTATGAATAATCC

AGCTCTGGTGGGACGGTATGAATAATCC

ACCAAGGATGGGACGGTATGAATAATCC

GATAACCTTGGGACGGTATGAATAATCC

TAGATGACTGGGACGGTATGAATAATCC

TGCGAAGGTGGGACGGTATGAATAATCC

GACCGAGATGGGACGGTATGAATAATCC

CAGACAATTGGGACGGTATGAATAATCC

CTAGGTTCTGGGACGGTATGAATAATCC

GTTCATTATGGGACGGTATGAATAATCC

AATGCGTTTGGGACGGTATGAATAATCC

GAGAGTTGTGGGACGGTATGAATAATCC

GATTACAGTGGGACGGTATGAATAATCC

TGTGCTTATGGGACGGTATGAATAATCC

AGAACATTTGGGACGGTATGAATAATCC

TACCGCTGTGGGACGGTATGAATAATCC

TCCTGGTCTGGGACGGTATGAATAATCC

CCTGGATATGGGACGGTATGAATAATCC

ATACCTGTTGGGACGGTATGAATAATCC

AATGTTGGTGGGACGGTATGAATAATCC

TCGACGGCTGGGACGGTATGAATAATCC

GGCAGATATGGGACGGTATGAATAATCC

GTCTTAGTTGGGACGGTATGAATAATCC

GGAAGGCGTGGGACGGTATGAATAATCC

GGCTAGGCTGGGACGGTATGAATAATCC

CAGCAGCATGGGACGGTATGAATAATCC

CCTTACCTTGGGACGGTATGAATAATCC

CGAGTTAGTGGGACGGTATGAATAATCC

GATGTTACTGGGACGGTATGAATAATCC

TGATTACATGGGACGGTATGAATAATCC

TTGATAATTGGGACGGTATGAATAATCC

ACGCATAGTGGGACGGTATGAATAATCC CTGTGGACTGGGACGGTATGAATAATCC

ATAGACAATGGGACGGTATGAATAATCC

CCATTGTTTGGGACGGTATGAATAATCC

AGAGGAATTGGGACGGTATGAATAATCC

CTTCCTTCTGGGACGGTATGAATAATCC

TCTAGCGATGGGACGGTATGAATAATCC

TCAACTGTTGGGACGGTATGAATAATCC

GACTATTGTGGGACGGTATGAATAATCC

CAACGGTCTGGGACGGTATGAATAATCC

CTTGCAGATGGGACGGTATGAATAATCC

GATACAGTTGGGACGGTATGAATAATCC

CCTGGTAGTGGGACGGTATGAATAATCC

GTTAGGTCTGGGACGGTATGAATAATCC

TACTTGCATGGGACGGTATGAATAATCC

TCCATGCTTGGGACGGTATGAATAATCC

ACATAGCGTGGGACGGTATGAATAATCC

TGGATATCTGGGACGGTATGAATAATCC

GAGTTACATGGGACGGTATGAATAATCC

TGCGACCTTGGGACGGTATGAATAATCC

ATCCGCAGTGGGACGGTATGAATAATCC

CAGTTGGTTGGGACGGTATGAATAATCC

CTGATTAATGGGACGGTATGAATAATCC

TCGCACCTTGGGACGGTATGAATAATCC

CGCCACAGTGGGACGGTATGAATAATCC

GTTGCGGCTGGGACGGTATGAATAATCC

AGATATAATGGGACGGTATGAATAATCC

37. The collection of double-stranded nucleic acid molecules of any one of clauses 31-36, wherein the unique polynucleotide identifier comprises any one of the below nucleotide sequences:

Figure imgf000069_0001
38. The collection of double-stranded nucleic acid molecules of any one of clauses 31-37, wherein the collection is obtainable by PCR amplification using the set of primers of any one of clauses 1-30.

39. The collection of double-stranded nucleic acid molecules of any one of clauses 31-38, wherein each molecule further comprises any one of the below adapter sequences: P5 Adapter

AATGATACGGCGACCACCGA (SEQ. LD. No. 5)

AATGATACGGCGACCACCGAGATCT (SEQ. LD. No. 648)

AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTACACGACGCTCTT CCGATCT (SEQ. LD. No. 3)

Illumina Sequencing Primers

ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ. LD. No. 649)

ACACTCTTTCCCTACACGACGCTCTTCCGATCTGC (SEQ. LD. No. 650)

P7 Adapter

CAAGCAGAAGACGGCATACGA (SEQ. LD. No. 6)

TCGTATGCCGTCTTCTGCTTG (SEQ. LD. No. 651)

CAAGCAGAAGACGGCATACGAGCTCTTCCGATC (SEQ. LD. No. 652)

GATCGGAAGAGCATCTCGTATGCCGTCTTCTGCTTG (SEQ. LD. No. 653)

40. The collection of double-stranded nucleic acid molecules of any one of clauses 31-39, wherein each molecule is about 150 to about 500 bp.

41. The collection of double-stranded nucleic acid molecules of any one of clauses 31-40, wherein each molecule is about 150 to about 300 bp.

42. A collection of probes, wherein the probes comprise denatured double- stranded nucleic acid molecules amplified by the set of primers of any one of clauses 1-30.

43. A set of probes for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strains, wherein each probe is a single stranded nucleic acid molecule from a collection of any one of clauses 1-30. 44. A set of primers of any one of clauses 1-30 or set of probes of any one of clauses 42 or 43 for use in diagnostics.

45. A method for the diagnostic of a pathogenic infection, by multiplex high- resolution detection of micro-organism strains from a strain collection, wherein said method comprises:

providing a test sample from a patient;

extracting exogenous nucleic acids from said test sample; and

hybridizing said exogenous nucleic acids with the set of primers of any one of clauses 1-30 or set of probes of any one of clauses 42 or 43.

46. A method of generating and selecting a collection of hypomorph strains of a micro-organism population, comprising:

generating a collection of strains of micro-organisms, wherein for each strain the level of expression of a unique gene is controlled by an exogenous promoter, whereby the level of expression of the unique gene is altered compared with the level of expression of the unique gene under its endogenous promoter, each strain of microorganism having a unique polynucleotide identifier, whereby each unique polynucleotide identifier is configured for multiplex high-resolution detection of the corresponding strain amongst said collection of strains;

outgrowing the generated strains of micro-organisms; and

selecting the hypomorph strains of micro-organisms based on growth kinetics and the expression level of the unique gene, the expression level of the unique gene being indicative of the promoter strength.

47. The method of clause 46, wherein detection comprises absolute or relative quantification.

48. The method of any one of clauses 46 or 47, wherein the exogenous promoter reduces the level expression of a unique gene by 2-10 times the level expression of the unique gene under its endogenous promoter.

49. The method of any one of clauses 46-48, wherein generating the collection of strains comprises replacing the endogenous promoter of the unique gene. 50. The method of any one of clauses 46-49, wherein generating the collection of strains comprises:

integrating an engineered copy of the unique gene into the genome of the organism population, the engineered copy comprising the unique gene and an exogenous promoter and

deleting the endogenous copy of the unique gene from the genome of the organism population.

51. The method of any one of clauses 46-50, further comprising generating and selecting a set of promoters and selecting the exogenous promoters.

52. The method of any one of clauses 46-51, wherein generating the set of promoters comprises:

generating a set of candidate promoters;

generating a collection of tested strains of a micro-organism population, wherein for each tested strain a marker-coding polynucleotide sequence and one of the candidate promoters operatively linked to the marker-coding polynucleotide sequence are integrated into the genome of the micro-organism population;

measuring expression of the marker of each tested strains; and

selecting the promoters based on marker expression.

53. The method of clause 52, wherein the marker is a color marker.

54. The method of clause 53, wherein the color marker is GFP.

55. The method of any one of clauses 52-54, wherein the marker-coding polynucleotide sequence is integrated at the attTn7 site.

56. The method of clause 55, wherein integration is by a mini-Tn7 suicide vector.

57. The method of any one of clauses 46-56, wherein generating a set of candidate promoters comprises selecting a first set of variable promoters based on their ability to promote marker expression in one model micro-organism, wherein the variable promoters are obtained through random mutation on common nucleic sequences. 58. The method of clause 57, wherein the common nucleic sequences comprise the - 35 and - 10 RNA Pol binding sequences.

59. The method of any one of clauses 57-58, wherein the other nucleic sequences are the nucleic sequence between - 35 and - 10 RNA Pol binding sequences.

60. The method of any one of clauses 57-59, wherein generating the set of candidate promoters further comprises generating a second set of variable promoters from the first set by altering other nucleic sequences.

61. The method of any one of clauses 46-60, wherein the micro-organism population comprises a pathogenic micro-organism population.

62. The method of clause 61, wherein the pathogenic micro-organism population is or was derived from a bacterial cell, or a fungus cell.

63. The method of clause 62, wherein the bacterial cell is a Gram negative or Gram positive bacterial cell.

64. The method of clause 62, wherein the pathogenic micro-organism population is or was derived from Acinetabacter baumanii, Klebsiella pneumonaie, Enterobacteriaceae spp., Pseudomonas aeruginosa, Staphylococcus aureus or My cobacteriium tuberculosis.

65. The method of any one of clauses 46-64, wherein the unique polynucleotide identifier comprises an exogenous or endogenous polynucleotide sequence.

66. The method of any one of clauses 46-65, wherein the unique polynucleotide identifier comprises an exogenous polynucleotide identifier flanked by upstream and downstream respective flanking sequences common for all strains of the strain collection.

67. The method of any one of clauses 46-66, wherein the unique polynucleotide identifier comprises an endogenous polynucleotide identifier. 68. The method of any one of clauses 46-67, wherein the unique polynucleotide identifier comprises a 16S sequence.

The method of clause 68, wherein the 16S sequence comprises any one below sequences, or the reverse complement thereof:

Figure imgf000074_0001
904R CCCCGTCAATTCITTTGAGTTTYAR Bacteria exc. Hodkinson plastids & & Lutzoni Cyanobacteria 2009

907R CCGTCAATTCMTTTRAGTTT Universal Lane et al.

1991

1100R AGGGTTGCGCTCGTTG Bacteria Turner et al. 1999

1185mR GAYTTGACGTCATCCM Bacteria exc. Hodkinson plastids & & Lutzoni Cyanobacteria 2009

1185aR GAYTTGACGTCATCCA Lichen- Hodkinson associated & Lutzoni Rhizobiales 2009

1381R CGGTGTGTACAAGRCCYGRGA Bacteria exc. Hodkinson

Asterochloris & Lutzoni sp. plastids 2009

1381bR CGGGCGGTGTGTACAAGRCCYGRGA Bacteria exc. Hodkinson

Asterochloris & Lutzoni sp. plastids 2009

1391R GACGGGCGGTGTGTRCA Universal Turner et al. 1999

1492R (1) GGTTACCTTGTTACGACTT Universal Turner et al. 1999

1492R (s) ACCTTGTTACGACTT Universal Lane et al.

1991

70. A collection of hypomorph strains of a micro-organism population obtainable by the method of any one of clauses 46-69.

71. A method of screening assay of a set of experimental conditions on a collection of strains of a micro-organism, comprising, for each strain:

providing a collection of hypomorph micro-organism strains;

preparing a pool of strains from said collection;

subjecting said pool of strains to a set of experimental conditions; and

performing multiplex high-resolution detection of the strains amongst said collection of strains. 72. The method of clause 71, wherein experimental conditions comprise growth conditions.

73. The method of any one of clauses 71-72, wherein the method further comprises PCR-detection or sequencing.

74. The method of any one of clauses 71-73, wherein detection comprises absolute or relative quantification.

75. The method of any one of clauses 71-74, wherein the collection of hypomorph strains comprises the collection of clause 70.

76. The method of any one of clauses 71-75, wherein the detection is performed with the set of primers of any one of clauses 1-30 or detection of double-stranded nucleic acid molecules of any one of clauses 31-41 or collection of probes of any one of clauses 42- 43.

77. The method of any one of clauses 71-76, wherein the experimental or growth conditions comprise temperature, exposure to a chemical or biological agent, time duration of each exposure, concentration of each chemical or biological agent, or any combination thereof.

78. The method of any one of clauses 71-77, further comprising pooling all hypomorph genotypes of the strain before subjecting them to a set of experimental conditions.

79. The method of any one of clauses 71-78, further comprising prior to pooling the hypomorph genotypes of the strain, outgrowing the hypomorph genotypes of the strain under conditions that repress hypomorph phenotype expression so that phenotype close to that of the wild type of the strain is obtained for all hypomorph genotypes of the strain.

80. The method of any one of clauses 71-79, wherein the exogenous promoter comprises a Tet-on promoter and wherein the method further comprises prior to pooling all hypomorph genotypes strain, outgrowing the hypomorph genotypes of the strain with tetracycline, a tetracycline derivative, doxycycline or anhydrotetracycline. 81. The method of clause 80, wherein the strain is outgrown with anhydrotetracycline at a concentration of about 300 to about 700 μg/mL.

82. The method of clause 81, wherein the strain is outgrown with anhydrotetracycline at a concentration of about 400 to about 600 μg/mL.

83. The method of clause 81, wherein the strain is outgrown with anhydrotetracycline at a concentration of about 450 to about 550 μg/mL.

84. The method of clause 81, wherein the strain is outgrown with anhydrotetracycline at a concentration of about 500 μg/mL.

85. The method of any one of clauses 80-84, wherein the strain is outgrown with anhydrotetracycline for 18 to 78 hours.

86. The method of any one of clauses 80-84, wherein the strain is outgrown with anhydrotetracycline for 48 to 72 hours.

87. The method of any one of clauses 71-86, wherein the experimental or growth condition comprises exposure to a chemical or biological agent at an effective concentration, wherein the micro-organism is a pathogen, and wherein analyzing all hypomorph genotypes of all strains comprises determining the effectiveness of the chemical or biological agent to control or stop proliferation of the hypomorph genotype.

88. The method of any one of clauses 71-87, wherein the experimental or growth condition comprises exposure to a chemical or biological agent at a range of values of concentration, wherein the micro-organism is a pathogen, and wherein analyzing all hypomorph genotypes of all strains comprises determining a value of effective concentration of the chemical or biological agent to control or stop proliferation of the hypomorph genotype.

89. The method of any one of clauses 87-88, wherein determining the effectiveness of the chemical or biological agent to control or stop proliferation of the hypomorph genotype comprises determining at least one of IC50 value of the chemical or biological agent and MIC90 value of the chemical or biological agent for each hypomorph genotype, the IC50 or MIC90 value being indicative of the effectiveness of the chemical or biological agent to control or stop proliferation of the hypomorph genotype.

90. The method of any one of clauses 71-89, wherein analyzing all hypomorph genotypes of all strains further comprises

determining the specificity of the chemical or biological agent to the strains and identifying a chemical or biological agent specific to a group of hypomorph genotypes or to only one hypomorph genotype.

91. The method of any one of clauses 71-90, further comprising PCR amplifying the unique polynucleotide identifier using a set of primers of any one of clauses 1-30.

92. The method of clause 91, wherein PCR amplification comprises about 15 to about 30 cycles.

93. The method of clause 91, wherein PCR amplification comprises about 17 to about 25 cycles.

94. The method of clause 91, wherein PCR amplification comprises about 22 cycles.

95. A method for identifying a compound or compound structure with antibacterial property, comprising the method of assay of any one of clauses 71-94.

96. The method of clause 95, wherein the antibacterial compound comprises a chemical or biological agent.

97. The method of clause 95, wherein the antibacterial compound comprises a bactericidal or bacteriostatic agent.

98. A method for identifying a pathogenic micro-organism with the set of primers of any one of clauses 1-30 or detection of double-stranded nucleic acid molecules of any one of clauses 31-41 or collection of probes of any one of clauses 42-43. 99. A kit for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strain.

100. A diagnostic kit for multiplex high-resolution detection of micro-organism strains amongst a strain collection and for multiplex identification of given growth conditions of said micro-organism strain.

101. The kit of any one of clause 99-100, wherein detection comprises absolute or relative quantification.

102. The kit of any one of clauses 99-101, wherein said kit comprises the set of primers of any one of clauses 1-30, the double-stranded nucleic acid molecules of any one of clauses 31-41 or the collection of probes of any one of clauses 42-43.

[0114] The present invention will be further illustrated in the following Examples which are given for illustration purposes only and are not intended to limit the invention in any way.

EXAMPLES

Example 1: Outline and Principle of Identification of Essential Proteins in Pseudomonas aeruginosa

[0115] The present inventors have performed Tn-seq on 20 different strains including 5 strains from cystic fibrosis patients isolated at Children's Hospital Boston, as well as strains isolated from urine, blood, ocular infections, ventilator-associated pneumonia, and the environment. The present inventors have constructed Illumina Tn-seq libraries from each transposon library, which are sequenced in collaboration with the Broad Institute Genome Sequencing Center for Infectious Diseases (GSCID) [Gallagher, L.A., J. Shendure, and C. Manoil, Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq. MBio, 2011. 2(1); Gawronski, J.D., et al., Tracking insertion mutants within libraries by deep sequencing and a genome-wide screen for Haemophilus genes required in the lung. Proc Natl Acad Sci U S A, 2009. 106(38): p. 16422-7.]. Illumina TnSeq sequence data for P. aeruginosa PAOl and PA14 can be compared with the published genome sequences of these strains. In addition, whole genome sequencing and assembly on the 18 strains for which genomes do not currently exist are performed. Thus, Tn-seq libraries for every strain may be compared with the reference genome of the parent strain to determine essentiality. It is then expected to define the common essential genes across all 80 strain and growth condition combinations; these common essential genes should represent the highest probability targets for effective novel antimicrobials. Previous studies have estimated 335 essential gene candidates in LB media alone in strain PA14, which is consistent with our findings for growth of strain PA14 on LB media [Liberati, N.T., et al., Comparing insertion libraries in two Pseudomonas aeruginosa strains to assess gene essentiality. Methods Mol Biol, 2008. 416: p. 153-69.]. From preliminary studies, inventors found that the number of essential genes required for growth under all 4 conditions, reduces the number candidates down to 265 essential genes:

PA14 essential genes in LB, M9, Blood, and Urine

Figure imgf000080_0001

[0116] Putative essential genes are as follows

PA14 Identifier Gene Localization Function

PA14 07770 ostA OM membrane impermeability

Hypothetica

PA14 12210 OM

I Unknown; membrane/LPS biogenesis?

PA14 17150 opr86 OM outer membrane protein assembly

PA14 51710 oprL OM outer membrane integrity

Hypothetica

PA14 57920 OM

I Unknown

PA14 61740 MB OM outer membrane protein assembly/chaperone

PA14 63030 omlA OM outer membrane protein assembly

PA14 69660 IppL OM LPS biosynthesis

PA14 07760 surA Peri outer membrane protein assembly

PA14 30310 lolA Peri outer membrane protein assembly/chaperone

PA14 51720 tolB Peri outer membrane integrity

PA14 51730 tolA Peri/IM outer membrane integrity

PA14 58130 mreC Peri rod-shape structural protein

PA14 07570 gcp Extra endonuclease; cell wall biosynthesis? [0117] Within the set of 265 genes there are five that have been shown to be outer membrane localized. This list includes ostA, tolA, oprL, omlA, and IppL.

Example 2: Outline and Principle of a High-Throughput Chemical Screen for Multiplexed Targeting of Essential Proteins (MTEP) in Pseudomonas aeruginosa

[0118] Engineering hypersusceptible strains (hypomorph strains): Strain PA14 is engineered so that the expression of selected essential genes may be lowered using a 'weaker' promoter. For each essential gene, one may create a strain using published methods by chromosomally integrating a new gene copy into the attTn7 site using mini-Tn7 (Choi, K.H. and H.P. Schweizer, mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nat Protoc, 2006. 1(1): p. 153-61) driven by the weak promoter followed by two-step homologous recombination with sacB counter selection to delete the endogenous gene copy (Choi, K.H. and H.P. Schweizer, An improved method for rapid generation of unmarked Pseudomonas aeruginosa deletion mutants. BMC Microbiol, 2005. 5: p. 30). It is possible to use a promoter library of varying strengths that was developed to drive GFP expression in E. coli (Davis, J.H., A.J. Rubin, and R.T. Sauer, Design, construction and characterization of a set of insulated bacterial promoters. Nucleic Acids Res, 2011. 39(3): p. 1131-41). Using these promoters, along with additional ones that were created by modifying the spacing between the RNA polymerase binding sites of the promoters, inventors have tested their efficacy by chromosomally integrating GFP into P. aeruginosa PA 14. The weakest promoter that provides the lowest tolerable level of the protein that still yields a viable bacterium may be used for each essential gene to create a hypersensitive strain. It is also proposed to construct control strains by knocking out dihydrofolate reductase dhfir (which is the target of trimethoprim), dihydropteroate synthetase dhps (which is the target of sulfamethoxazole), murA (which is the target of fosfomycin) and ostA (which is the OMP target of POL7001 [Srinivas, N., et al., Peptidomimetic antibiotics target outer-membrane biogenesis in Pseudomonas aeruginosa. Science, 2010. 327(5968): p. 1010-3.]). Then, it is possible to measure the MIC for each of these compounds against their respective strains compared to wild-type PA14. It is expected that the engineered strains be sensitized to the corresponding antibiotic that targets the respective gene product. Inventors have successfully created a dhfr knockdown using this method, which is more sensitive to trimethoprim than the wild-type PA14 strain.

[0119] Multiplexed screening assay: a method is proposed where all strains are screened simultaneously in multiplex by pooling them for growth. To accomplish this, inventors genetically barcode each pooled strain by inserting a 76 bp sequence encoding a unique 24 bp barcode with two PCR primer-flanking regions (26 bp each) into each mutant. This allows to amplify the barcoded region and use next-generation Illumina sequencing to identify and quantitate the barcode/strain within the pooled population. Inventors also barcode wild-type strains of PA14 and other organisms (E. coli, S. aureus, K. pneumoniae, A. baumannii and the fungus C. albicans) that may also serve as controls within the screen to determine the spectrum of activity of any hit. Molecules which kill both bacterial and fungal strains are likely to be non-specific, perhaps membrane disrupting, toxic compounds which are of little interest. These 10 constructed control strains, including their known antibiotics, may be used for assay development. The general method may involve seeding the control strains into a well with compound or DMSO control (in LB media), allowing growth to occur for a determined amount of time, lysing the cells to release their DNA, PCR amplification of barcodes from lysates using plate and well barcodes for pooling, ligation of Illumina sequencing adapters, and finally demultiplexing and counting the number of reads of each strain following Illumina sequencing.

Example 3: Multiplexed Targeting of Essential Proteins (MTEP) Screen for Essential Outer Membrane Proteins (OMPs)

[0120] Having optimized the assay for control screening strains, inventors engineer screening strains targeting the candidate list from Example 1 and optimize the assay against the total collection of screening strains for MTEP. First, inventors use the methods of Example 2 to engineer and barcode screening strains for the knockdown of the genes encoding essential OMPs identified in Example 1. This forms the screening population, which may include barcoded wild-type PA14, E. coli, S. aureus, K. pneumoniae, Acinetobacter, C. albicans, and one control engineered strain (dhfr, dhps, or murA) and essential OMP engineered knockdown screening strains (hypomorph strains, including lptD). Inventors confirm the MTEP method and that Illumina sequencing can clearly measure the census of each mutant in a pooled population and detect reduction in a subset of targeted screening strains. Initially, inventors pilot the screen on a 2,000 compound library from the Broad Institute chemical library collection. One may then screen the library in duplicate, using controls used in Example 2 to determine the robustness of the assay and its readiness for large-scale screening. Given the low number of compounds, inventors anticipate that this pilot is predominantly to assess the performance of the screen and do not necessarily anticipate obtaining any specific hits. Once pilot screen is optimized, inventors perform chemical HTS of a unique 40,000 compound diversity oriented synthesis library from the Broad Institute using MTEP against the mixture of pooled screening strains engineered in Example 2. The screen is performed in duplicate in 384-well format to identify hits that can be classified as described above. Assuming a hit rate of -1%, inventors pick 400 hits for target confirmation, dose-response testing, and toxicity to eukaryotic cells. In collaboration with synthetic chemists, inventors chemically optimize these compounds with the goal of initially generating at least 60-80 analogues in order to increase both the solubility and the potency against multiple clinical strains of P. aeruginosa. Furthermore, inventors identify the exact mechanism of action and protein-binding sites by the compounds using various biochemical and biophysical techniques, depending on the target identity.

Example 4: Exemplary Primers, Double-stranded Nucleic Acid Molecules and Probes

[0121] An example of primer has one of the following structures:

• 5 '-[sequencing sequence] -[A/T]- [first polynucleotide sequence]-[second polynucleotide sequence] -3'

• 5'-[Illumina P5 + Primer sequence] -[A/T] -[Well barcode] -[5 '(upstream) flanking region]-3'

• 5'-[Illumina P7 + Primer sequence]-[A/T]-[Plate barcode]-[3' (downstream) flanking region]-

3'

• 5'-[Illumina P5 + Primer sequence] -[A/T] -[Plate barcode]-[5'(upstream) flanking region]-3'

• 5'-[Illumina P7 + Primer sequence] -[A/T] -[well barcode] -[3' (downstream) flanking region] -

3'

• 5'-[Illumina P7 + Primer sequence] -[A/T] -[Well barcode] -[5 '(upstream) flanking region]-3'

• 5'-[Illumina P5 + Primer sequence]-[A/T]-[Plate barcode]-[3' (downstream) flanking region]-

3'

• 5'-[Illumina P7 + Primer sequence] -[A/T] -[Plate barcode]-[5'(upstream) flanking region]-3'

• 5'-[Illumina P + Primer sequence] -[A/T] -[well barcode] -[3' (downstream) flanking region] -3'

[0122] Primer pairs may be as follows:

• 5'-[Illumina P5 + Primer sequence] -[A/T] -[Well barcode]-[5'(upstream) flanking region]-3' and

5'-[Illumina P7 + Primer sequence]-[A/T]-[Plate barcode]-[3' (downstream) flanking region]-

3'

• 5'-[Illumina P5 + Primer sequence]-[A/T]-[Plate barcode] -[5 '(upstream) flanking region]-3' and

5'-[Illumina P7 + Primer sequence] -[A/T] -[well barcode] -[3' (downstream) flanking region] -

3' • 5'-[Illumina P7 + Primer sequence] -[A/T]- [Well barcode]-[5'(upstream) flanking region]-3' and

5'-[Illumina P5 + Primer sequence]-[A/T]-[Plate barcode]-[3' (downstream) flanking region]-

3'

• 5'-[Illumina P7 + Primer sequence]-[A/T]-[Plate barcode] -[5 '(upstream) flanking region]-3' and

5'-[Illumina P + Primer sequence] -[A/T] -[well barcode]-[3' (downstream) flanking region]- 3'.

3] Double stranded nucleic acid and probes may have the following structure:

• 5 '-[sequencing sequence] -[A/T] -[first polynucleotide sequence] -[second polynucleotide sequence]-[strain unique polynucleotide identifier] -[second polynucleotide sequence] -[first polynucleotide sequence] -[T/A]- [sequencing sequence] -3'

• 5 '-[sequencing sequence]-[A/T]-[well barcode] -[second polynucleotide sequence]- [strain unique polynucleotide identifier] -[second polynucleotide sequence] -[plate barcode] - [T/A] -[sequencing sequence]-3'

• 5 '-[sequencing sequence] -[A/T] -[plate barcode] -[second polynucleotide sequence]- [strain unique polynucleotide identifier] -[second polynucleotide sequence]-[well barcode]- [T/A]- [sequencing sequence]-3'

• 5 '-[Alumina P5 + Primer sequence] -[A/T] -[first polynucleotide sequence] -[second polynucleotide sequence] -[strain unique polynucleotide identifier] -[second polynucleotide sequence] -[first polynucleotide sequence]- [T/A] -[Illumina P7 + Primer sequence]-3'

• 5 '-[Illumina P7 + Primer sequence] -[A/T] -[first polynucleotide sequence] -[second polynucleotide sequence] -[strain unique polynucleotide identifier] -[second polynucleotide sequence] -[first polynucleotide sequence] -[T/A] -[Illumina P5 + Primer sequence]-3'

• 5'-[Illumina P5 + Primer sequence] -[A/T] -[well barcode] -[second polynucleotide sequence]- [strain unique polynucleotide identifier] -[second polynucleotide sequence] -[plate barcode] - [T/A] -[Illumina P7 + Primer sequence] -3'

• 5'-[Illumina P5 + Primer sequence] -[A/T] -[plate barcode] -[second polynucleotide sequence]- [strain unique polynucleotide identifier] -[second polynucleotide sequence]-[well barcode]- [T/A]- [Illumina P7 + Primer sequence] -3'

• 5'-[Illumina P7 + Primer sequence] -[A/T] -[well barcode] -[second polynucleotide sequence]- [strain unique polynucleotide identifier] -[second polynucleotide sequence] -[plate barcode] - [T/A] -[Illumina P5 + Primer sequence] -3'

• 5'-[Illumina P7 + Primer sequence] -[A/T] -[plate barcode] -[second polynucleotide sequence]- [strain unique polynucleotide identifier] -[second polynucleotide sequence]-[well barcode]- [T/A]- [Illumina P5 + Primer sequence] -3' • 5 '-[sequencing sequence] -[A/T]- [first polynucleotide sequence] -[5 '(upstream) flanking region] -[strain unique polynucleotide identifier] -[3' (downstream) flanking region] -[first polynucleotide sequence] -[T/A]- [sequencing sequence] -3'

• 5 '-[sequencing sequence] -[A/T] -[well barcode] -[5 '(upstream) flanking region] -[strain unique polynucleotide identifier] -[3' (downstream) flanking region] -[plate barcode]- [T/A] - [sequencing sequence]-3'

• 5 '-[sequencing sequence] -[A/T] -[plate barcode] -[5 '(upstream) flanking region] -[strain unique polynucleotide identifier] -[3' (downstream) flanking region]-[well barcode] -[T/A] - [sequencing sequence]-3'

• 5'-[Illumina P5 + Primer sequence] -[A/T] -[first polynucleotide sequence] -[5 '(upstream) flanking region] -[strain unique polynucleotide identifier] -[3' (downstream) flanking region]- [first polynucleotide sequence]- [T/A] -[Alumina P7 + Primer sequence]-3'

• 5'-[Illumina P7 + Primer sequence] -[A/T] -[first polynucleotide sequence] -[5 '(upstream) flanking region] -[strain unique polynucleotide identifier] -[3' (downstream) flanking region]- [first polynucleotide sequence]- [T/A] -[Alumina P5 + Primer sequence]-3'

• 5 '-[Alumina P5 + Primer sequence] -[A/T] -[well barcode] -[5 '(upstream) flanking region] - [strain unique polynucleotide identifier] -[3' (downstream) flanking region] -[plate barcode]- [T/A]- [Alumina P7 + Primer sequence] -3'

• 5'-[Illumina P5 + Primer sequence] -[A/T] -[plate barcode] -[5 '(upstream) flanking region]- [strain unique polynucleotide identifier] -[3' (downstream) flanking region] -[well barcode] - [T/A] -[Alumina P7 + Primer sequence] -3'

• 5 '-[Alumina P7 + Primer sequence] -[A/T] -[well barcode] -[5 '(upstream) flanking region] - [strain unique polynucleotide identifier] -[3' (downstream) flanking region] -[plate barcode]- [T/A]- [Alumina P5 + Primer sequence] -3'

• 5'-[Illumina P7 + Primer sequence]-[A/T]-[plate barcode]-[5'(upstream) flanking region]-[3' (downstream) flanking region]-[well barcode] -[T/A] -[Alumina P5 + Primer sequence]-3'

Example 5: Exemplary Protocol for Multiplexed Growth and Quantitation Using Illumina Sequencing

[0124] The protocol is illustrated at Figure 1 in the form of a flow chart. In green, Well BC is a well bar code (identifier) that is in overhang before the first PCR cycle. Plate BC is a plate bar code (identifier) that is in overhang before the first PCR cycle. The strain bar code is the strain unique polynucleotide identifier. The darkened regions are identified for the PCR amplification of the unique strain identifier. These regions may be common to a subset or the entire set of strains (e.g. when the strain BC is non-endogenous, i.e. engineered, its flanking regions may be selected so as to be common to several strains, thereby being advantageous for the PCR amplification of the strain bar codes in the pool). Alternatively, these regions may correspond to an endogenous strain locus, such as 16S.

Multiplexed Growth

Day 1

a. Start cultures in LB, grow overnight

Day 2

a. Subculture all cultures in LB at varying levels to cover the range of quickly vs. slow growing strains (i.e. if all strains are at stationary phase and grow at standard rates, 1/100, 1/200, and 1/500 for 3-6 hours should be sufficient)

b. Measure OD600 once cultures are in mid log phase by removing 200μ1 and placing in 96- well plate (Conversion: 1.56 x 200ul OD from plate = 1ml OD cuvette)

c. Aim to seed 200 CFU/well of each strain, therefore 6,666 CFU/mL. Slow growers may be seeded at higher concentrations. Do not exceed 500,000 CFU/mL.

d. Make IX of this by pooling each strain into 1.5L LB medium for 96 plates.

e. Add 30μ1 to all wells containing compound at bottom of plate using ThermoCombi liquid dispenser

f. Pulse spin whole plate to 200g for 1 second

g. Grow at 37°C for 12 hours in large Tupperware with wet paper towels at the bottom with plastic lid but no sealing tape. If possible, do not stack plates. If inevitable, 4 plates per stack is the recommended maximum.

Notes

OD to CFU/ml conversions. OD600 = 1 is equivalent to:

lxlO9 CFU/ml for Gram(-) bacteria

6xl08 CFU/ml for ^. aureus

3xl07 CFU/ml for C. albicans

Cell lysis

Day 3

a. Seal plate with Bio-Rad plate sealer B, heat at 65°C in preheated incubator for 30 minutes b. Let plate cool to room temperature (approx. 10 minutes; this prevents moisture buildup on seal)

c. Freeze plate at -80°C for >15 minutes to indefinitely.

Day 4 a. Thaw plate at room temperature on bench; be sure it is completely thawed (thawed wells are more clear from underneath). It is advised, not to spin plates at this point.

b. Optional: use plate shaker for 30 seconds and measure OD600. Z'-factors should be >0.7. c. Add 30μ1 of 2X lysis buffer to each well, incubate in Tupperware humidity chamber at 37°C for 1 hour

d. Add ΙΟμΙ of ProK solution, incubate in humidity chamber at 37°C for 1 hour

e. Potential pause point: seal and freeze at -80°C. Upon thawing, continue to f.

f. Spin plate at lOOOg for 5 minutes

g. Remove 20μ1 lysate add to 384 well PCR plate; be sure to not allow tips to touch the bottom of the plate.

h. Seal both plates with a Bio-Rad microseal B seal and store remaining lysate at -80°C. i. Heat denature the 20μ1 lysate that has been transferred to the PCR plate in a thermocycler at 95°C for 2 minutes, cool to 4°C. This denatures the proK. This is the template ready for PCR, and should be frozen at -20°C with a seal.

qPCR of lysate and controls to estimate PCR control spike-in

Day 5

a. Prepare a template 96-well plate of PCR spike-in standards (control vector or annealed oligos) serially diluted 10-fold with a range of 0.000001-1 ng/μΐ for vector and 0.0001- ΙΟΟρΜ for oligos.

b. Using Bio-Rad CFX384, perform qPCR in 13μ1 reactions as follows:

- 4.5μ1 Η20

- 6.5 μΐ of 2X Mastermix (Bio-Rad iTaq SYBR)

- 1 μΐ of 6.5uM Primer Well Al and Primer Plate 1 Mix (500nM final)

Ι μΐ of heat-killed template (in all but 48 wells) OR Ι μΐ of PCR spike-in standards from a.

c. PCR cycling conditions:

- 98°C for 5 mins

- 98°C for l5s

60°C for 60s, measure signal

Cycle 35 times

d. Make a standard curve for the spike-in controls

e. Average all heat-killed template wells and determine the amount of spike-in control relates to standard curves f. Divide this number by # strains in pool; adding this amount per PCR reaction shall give equal number of reads as each strain

g. Multiply this amount by number of PCR reactions to be completed for the mastermix below (Section 4)

h. Use 0.5X, IX, 2X, 5X to encompass multiple scenarios

PCR of lysate

Day 6

a. Create a mastermix for 13μ1 reactions as follows:

- 2.6μ1 5X Q5 Reaction Buffer

- 0.26μ1 lOmM dNTPs

0.13 μΐ Q5-Hotstart Polymerase

- X μΐ control #1, 2, 3, 4

- X μΐ H20

- Ι μΐ of 6.5uM Primer Mix (500nM final)

1 μΐ of heat-killed template (in all but 48 wells)

b. Aliquot 11 μΐ of the PCR Mastermix before adding 1 μΐ primers followed by lul template c. PCR cycling conditions:

- Initial: 98°C for 2.5 mins

- 10-20 Cycles: 98°C for 10s

- 60°C for 20s

- 72°C for 20s

Final extension: 72°C for 2 minutes

PCR cleanup

a. Pool all samples and PCR cleanup using Qiagen MinElute PCR Purification Kit (this allows for >70bp fragments, according to the invention, it is typically expected 92bp at this point

b. Depending on # of samples, split into multiple columns. 1 column handles 5μg; 1 per 384 wells is generous.

c. Follow Qiagen' s protocol with an added PE wash

d. Elute in ΙΟμΙ EB (NOT H20), repeat to maximize DNA (20μ1 total per column) e. Pause point: Store at -20°C. Keep Ι μΐ for bioanalyzer (dilute in 9μ1 EB). DNA should also be visible by Nanodrop at this point at a concentration of lOng/μΙ if you have 200ng. Note: genomic DNA is expected to be heavily present. 5' phosphorylation

Day 7

a. Performed in a thermocycler

b. Use T4 Polynucleotide Kinase from NEB

With loss of volume assume 16μ1 left per column

Heat at 70°C for lOmins, then ice quickly

Add 2μ1 10X T4 ligase buffer (not kinase buffer because the ligase buffer has the required lOmM ATP)

- Add 2μ1 T4PNK enzyme (10U)

Vortex briefly and spin

- 37°C for 30 minutes

c. PCR purify using the Qiagen MinElute PCR Purification Kit as in Step 3 and according to the Qiagen protocol with the following modifications: include a extra PB wash after binding; elute in ΙΟμΙ EB twice.

3' A overhang addition

a. Performed in a thermocycler

b. Use Klenow from NEB (Taq is also an option but is performed at 72°C)

Assume 18 μΐ left

- Add 5 μΐ NEBNext dA-Tailing Buffer 1 OX, 3ul Klenow Fragment (3 ' -5 ' exo") and 24μ1 H20 (50μ1 total volume). Incubate 30mins at 37°C

c. PCR purify using the Qiagen MinElute PCR Purification Kit as in Step 3 and according to the Qiagen protocol with the following modifications: include a extra PB wash after binding; elute in ΙΟμΙ EB twice.

Illumina Y-adapter ligation

a. Construct stocks of Illumina Y-adapters

Mix equal volumes of ΙΟΟμΜ P5 Adapter and ΙΟΟμΜ of the 5'phosphorylated P7 Adapter

Heat to 95°C for 2 minutes, and decrease temperature to 25°C at a rate of 1°C /minute.

b. Ligate adapters to PCR product using the Blunt/TA Ligation Master Mix. This is the NEB preferred TA ligase and is deemed NGS compatible.

Assume 18 μΐ left - Add 4μ1 of 50μΜ Y-adapter (probably overkill but it works), 22ul Blunt/TA Master Mix (44 μΐ total volume)

15 minutes RT then ice

c. Perform 0.45X then 1.2X SPRI cleanup (2-step SPRI removes gDNA)

- Bring volume up to 200uL with H20 (ie add 156μ1)

- Add 0.45X of this volume of AMPureXP SPRI beads to the sample (90μ1), mix well by pipetting >10 times, incubate 10 minutes at RT

Magnetize for 5 minutes, remove supernatant and place in new tube

- Add 1.2X AMPureXP SPRI beads to the sample minus the 0.45X SPRI you already added. Based on original volume of 200μ1, 1.2X would be 240μ1 - 90μ1 = 150μ1 new beads. Mix well by pipetting >10 times, incubate 10 minutes at RT Magnetize for 5 minutes, discard supernatant

Add 80% fresh EtOH to cover beads, incubate 1 minute, repeat

Dry in hood until beads are cracked

- Elute in 20μΙ, EB

d. Quantify sample using Bioanalyzer, should be 188bp (runs at 205-280bp if Y-ends with broad peaks)

e. Quantify using KAPA Library Quantification Kit (need 4nM minimum for Illumina) f. Sequence on Illumina platform of your choice with custom primer and SRI 00 or continue to step 9 below.

PCR cleanup of ends - OPTIONAL

a. This cleans the ends (not Y-shaped) and also allows you to increase concentration if required

b. Use NEBNext 2X MasterMix and your template to perform 2-10 PCR cycles, depending on required amount (possibly assume to lose at least half during cleanup, so do 2 cycles more than you think you need)

c. Setup a single 50μ1 reaction per library as follows:

2.5 μ1 10uM P5 Amplification primer

2.5 μ1 lOuM P7 Amplification primer

- 25 μΐ 2X Master Mix

15 μΐ Library

- 5μ1 Η20

Split this into 4x12.5 μ1 aliquots to prevent jackpotting - Initial: 98°C 60s

- 2-10 Cycles: 98°C 10s, 65°C 20s, 72°C 20s

Final Extension: 72°C 2 mins

d. Pool 12.5μ1 reactions together, raise volume to ΙΟΟμΙ (add 50μΙ. H20)

e. Add 120μ1 SPRI beads for 1.2X SPRI cleanup

f. Magnetize for 5 minutes, discard supernatant

g. Add 80% fresh EtOH to cover beads, incubate 1 minute, repeat

h. Dry in hood until beads are cracked

i. Elute in 20μί EB

j . Quantify sample using Bioanalyzer, should be 188bp

k. Quantify sample using KAPA kit

1. Sequence on Illumina platform of your choice with custom primer and SRI 00

Buffers and Primer Sequences

2X Lysis Buffer (250ml):

237.75ml H20

6.25ml Triton X-100 (1.25% at working concentration)

5mL 1M Tris pH8 (lOmM at working concentration) lml 0.5M EDTA (ImM at working concentration)

0.22μιη filter sterilize

Right before use, add the following enzymes (per ml of 2X Lysis Buffer):

If S. aureus is present: 1.7μ1 of Lysostaphin (from O. lU/ml stock)

For Gram(-) and many Gram(+): ΙΟμΙ of Lysozyme (from 50mg/ml stock)

If C. albicans is present: 50μ1 of 1M DTT and 5μ1 of Zymolyase (from 2mg/ml stock)

ProK Buffer:

4.337mL H20

45 μΐ 1M Tris pH8 (filter sterilized)

118μ1 800U/mL ProK

Vortex well since ProK is in glycerol. Makes 4.5 ml, enough for a single 384 well plate. This makes a 21U/ml solution to be added. 3U/mL working solution.

Primers:

Name Sequence

Primer 'Well ΑΓ GCXXXXXXXXTATTTATGCAGAGGCCGAGG

(X's are unique barcode - strain identifier) (SEQ. I.D. No. 1) Primer 'Plate Γ GCXXXXXXXXTGGGACGGTATGAATAATCC

(X's are unique barcode - strain identifier) (SEQ. I.D. No. 2)

P5 Adapter

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

(Synthesize phosphorothioate bond between 3' C and T; HPLC purify; underlined anneals with P7) (SEQ. I.D. No. 3)

P7 Adapter GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG

(Synthesize with 5' phosphorylation; HPLC purify; underlined anneals with P5) (SEQ. I.D. No. 4)

P5 Amp AATGATACGGCGACCACCGA (SEQ. I.D. No. 5)

P7 Amp CAAGCAGAAGACGGCATACGA (SEQ. I.D. No. 6)

Example 6: Creating hypomorphic P. aeruginosa strains and uses thereof for screening

[0125] Figure 2 depicts outline for a Tn-seq based strategy for identifying essential genes in P. aeruginosa. A comparison between P. aeruginosa strains PA14 and PAOl identified 334 common essential proteins (Liberati, N.T. et al. PNAS (2006)). Common essential genes were identified across 13 P. aeruginosa strains and 4 different solid media: LB, Blood, M9, Urine.

[0126] By using 3 independent matings, it is possible to generate >300,000 insertions on each media.

[0127] Figure 3 illustrates a strategy for creating knockdown strains and developing variable promoters for use in P. aeruginosa. Inventors obtained a library of 8 variable promoters that were selected based on GFP expression in E. coli after randomly mutating the -35 and -10 RNA Pol binding regions (Davis & Sauer, Nucleic Acids Research 2011) PA14- GFP strains were created by integrating each promoter driving GFP at the attTn7 site using the mini-Tn7 suicide vector (Choi & Schweizer, Nature Protocols 2006). The library of 8 promoters was expanded by altering the 17bp region. Results are shown on Figure 4 (levels of GFP fluorescence).

[0128] Figure 5 illustrates the use of variable promoters for generating and selecting hypomorph strains. The waves indicate the strength of the promoters: low strength at the top, with increasing strength going down the figure. Advantageously according to the invention, the OMP under the control of the test promoters is also coupled to a strain barcode (unique strain identifier, noted BC in green). In this example, the endogenous copy of the OMP was knocked down, leaving the version under the test promoters. Survival of the strain indicates replacement with a weak promoter, with sufficient level of expression.

[0129] This leads to the generation of the following strains: [0130] 3 cytosolic control genes are targeted:

dhfR (dihydrofolate reductase), target of trimethoprim

dhpS (dihydropteroate synthase), target of sulfamethoxazole

murA (UDP-N-acetylglucosamine-3-enolpyruvyltransf erase) target of fosfomy

+ 17 essential OM and periplasmic proteins

[0131] 8 different promoters are used, leading to a total of 160 PA14 strains.

[0132] Examples of such strains are as follows:

Gene Localization Promoter

oprL OM P2

IppL OM P12

MB OM P8

gcp Extra P7

CONTROLS

dhfR Cytosol P9

murA Cytosol P7

[0133] Results show that DhfR and MurA knockdown strains (hypomorphs) are hypersensitive to their respective drugs, as illustrated by Figure 6. Figure 7 show that DhfR knockdown PA14 strain displays dose-response to trimethoprim. This validates the hypomorph-based approach for a screen.

[0134] The strains can then be used in a screen for anti -bacterial compounds. A pilot screen was performed against 2240 compounds:

Screened 2240 compounds in duplicate using the SPECTRUM collection of known drug components, natural products, and bioactive agents;

Final screening concentration of 23.5 μΜ

Sixteen 384-well plates grown for 12 hours, cells were lysed and barcodes were amplified

Libraries of the barcodes were sequenced on Illumina HiSeq 2500 v3 Rapid Mode

221,600,000 reads (an average of 1800 reads per strain per well)

Data was deconvoluted using Fastx-toolkit to separate plate, well, and strain barcodes and reads were counted

[0135] Results from this pilot screen were as follows

/½ ^ , ideally > 0.5 ideally < 0.15

Table. Summary of multiplexed pilot screen of 2240 compounds

Species/S Z'-factor" CV # of Hits* Hit Rate (%) Specific Hitsc train

A. 0.67 0.08 18 0.80

baumanni

i

E. coli 0.72 0.10 27 1.21

P. 0.68 0.04 16 0.71

aeruginos

a PA 14

PA14 6 0.49 0.10 19 0.85 1

dhfR

PA14 6 0.63 0.08 26 1.16 6

murA

PA14 6 0.55 0.04 16 0.71

gcp

PA14 6 0.52 0.09 16 0.71

lolB

PA14 6 0.54 0.12 21 0.94 3

oprL

" Values from an average of three growth plates

b The number of hits as determined by impairing growth <10% relative to DMSO, in

duplicate

c The number of hits solely impairing growth of the single PA14 knock-down strain

[0136] Reproducibility is illustrated by results on Figure 8.

[0137] As a summary, in this Example:

Inventors identified 387 essential genes in PA14 in four different media;

Inventors selected 17 genes for knockdown targeting, consisting of outer membrane, periplasmic, and extracellular proteins;

Inventors optimized a library of variable promoters for use in P. aeruginosa;

Inventors constructed 8 essential gene knockdowns (hypomorphs strains), including dhfR and murA cytosolic controls that are hypersensitive to trimethoprim and fosfomycin, respectively;

A multiplexed growth of barcoded strains method was developed using Illumina sequencing as a readout;

A pilot screen of 2,240 compounds in duplicate was performed, and specific hits for 5/8 knockdown strains were obtained.

[0138] Pilot screen of the present example is scaled up to 50,000 compounds against the combination of 25 bacterial species and strains. Example 7: Creating hypomorphic M. tuberculosis strains and uses thereof for screening

[0139] Figure 9 depicts a strategy for the generation of hypomorph strains of M tuberculosis.

[0140] Figure 10 shows that the strains obtained are hypersensitive to drugs targeting their gene of interest (dose response curves).

[0141] Figure 11 shows principle for multiplex detection of the invention. Plate well contains several strains. After lysis, PCR can be performed using the primer set of the invention. The strain barcode (unique strain identifier) may be multiplex amplified using primers having amplification sequences PCR-F and PCR-R (such as flanking sequences). The primers also comprise overhang sequences that include polynucleotide sequence indicative of experimental conditions (well barcode = well BC, plate barcode = plate BC), as well as sequences configured for subsequent DNA sequencing (Illumina P5, P7, SBS3, SBS12 for example). This leads to a collection of double stranded nucleic acid molecule of the invention (P5-SBS3-Plate BC-PCRF-Strain BC- PCRR-SBS12-Well BC-P7).

[0142] Results shown on Figure 12 illustrate that the method of the invention allows to reliably detect and count micro-organism cells: the method of the invention provides for a reliable cell 'census', barcode (strain identifier) is a reliable indication of OD600 (Barcoded H37Rv strains were mixed spanning 3 logs in triplicate in a single pool OD600 was measured after dilution before mixing to compare with read counts: Barcode count is a reliable proxy for OD600).

[0143] Figure 13 illustrates a screening method of the invention.

[0144] Figure 14 shows a part I of the screening: hypomorph strains are outgrown in presence of anhydrotetracycline (ate) so as to obtain a hypomorph phenotype. Outgrowth is then performed in well format, before generating by multiplex PCR the collections of ds DNA molecules of the invention as per a part II of the screening method, exemplified on Figure 15.

[0145] Figure 16 shows a part III of the screening method comprising data processing.

[0146] A pilot screen was performed as described, with

26 strains

o M. tuberculosis H37Rv (a M. tuberculosis wild type strain which is a virulent clinical isolate)

o 25 knockdowns strains (hypomorphs)

2000 compounds (candidate for screening) o Reported in literature as Mtb-inhibitors;

o Confirmed as inhibitors (data not shown);

o 4-point dose-response (0.3-10 μΜ) in duplicate.

sults:

o By-plate-by-strain Z'-factors > 0.5;

o Coefficient of variability < 10%;

o 420,000 data points;

o Hit rate:

Type 10 μΜ 3 μΜ 1 μ.Μ 0.3 μΜ

Inactive 66% 87% 94% 98%

All-killer 0.9% 0.06% 0% 0%

Hit > 1 strain selectively 0.6% 0.06% 0.2% 0%

Hit only 1 strain selectively 2% 0.4% 0.3% 0.06% ο Figures 17-22 show results, in particular illustrate the high reproducibility obtained, validates the method with respect to positive controls with compounds trimethoprim and rifampin, highlight robustness of the statistical performance of the method demonstrate detection of differential inhibition, and demonstrate high validation rate,

a conclusion:

o This illustrates a method to multiplex at least 26 strains;

o Data are very reproducible;

o statistically significant results can be detected;

o Validation rate is very high;

o Resulting data contain mechanism of action information.

A scale up method was performed:

strains

o M. tuberculosis H37Rv

o 25 knockdowns

,000 compounds

o Library constructed from commercial and in-house collections

o Chosen to be as diverse as possible

o 50 μΜ in duplicate Results:

o By-plate-by-strain Z'-factors > 0.5

o Coefficient of variability < 10%

o 2,600,000 data points

o Hit rates:

Type Rate

All-killer 0.5% H37Rv-killer 0.3%

Single strain killer, not H37Rv 0.5%

The method allows to identify compounds that would otherwise be missed.

Results are also shown on Figure 23-26, showing high reproducibility and screen performance.

[0148] As a conclusion:

Inventors explored the potential of multiplexing target-based whole-cell screens;

Invention allows to get target information with every hit of a chemical inhibitor screen;

Pilot screen of 2000 "known actives" was shown to be robust;

Scale-up to 50,000 compounds was shown reproducible;

Invention allows to identify new and known chemical and biological insight.

[0149] The method of the invention may be further applied to:

Continue scaling up: 100 strains vs 2000 and 50,000 compound screens;

Build reference data with wide range of compounds of known mechanism of action;

Apply supervised machine learning to aid target ID of new hits;

Follow up hits and confirm targets.

Example 8: 16S primer sequences

[0150] - 16S primers for Mycobacterium smegmatis:

[0151] F: 5 ' - AAGGGGC ATGATGACTTGAC-3 ' (SEQ. I.D. No. 7)

[0152] R: 5'-GAGATGTCGGTTCCCTTGTG-3' (SEQ. I.D. No. 8)

[0153] primers for Mycobacterium tuberculosis (from Nadkarni 2002 https://www.ncbi.nlm.nih.gov/pubmed/11782518):

[0154] F: 5 ' -TCCTACGGGAGGC AGC AGT-3 ' (SEQ. I.D. No. 9)

[0155] R: 5'-GGACTACCAGGGTATCTAATCCTGTT-3' (SEQ. I.D. No. 10) Example 9: Gates Multplex TB assay protocol Materials Required

A. Strains

Grou 2 strains

Figure imgf000098_0001
2 screen

Deg- efpA native 2 screen H20 hyg/zeo/strep

Deg- tpi 38 6 screen C68 hyg/zeo/strep

Deg- dlat 38 10 screen C73 hyg/zeo/strep

Deg- gap 38 2 screen C63 hyg/zeo/strep

Deg- fum Phsp60 10 screen C80 hyg/zeo/strep pth- syntheti Deg- FLAG c 2 screen H21 hyg/strep

syntheti Trans- hyg/kan/zeo/str ndhA c screen C83 ep

syntheti Trans- prcBA c screen C84 hyg/kan/strep syntheti Trans- atpDC c screen C81 hyg/zeo/strep

B. Reagents

• Difco Middlebrook 7H9 powder

• OADC Enrichment

• Acetate

• T ween- 80

• Tyloxapol

• Hygromycin

• Rifampicin

• Trimethoprim

• Streptomycin

• Kanamycin

• Zeocin

• Anhydrotetracycline

• P5 and P7 primers pre-mixed at 5 uM in 384-well PCR plates

• NEB Q5 Hot Start Polymerase

• dNTPs

• DMSO

Control plasmids: 1 = tag 8090, 2 = tag 1180

Figure imgf000099_0001

Agilent High Sensitivity DNA Analysis Kit

Vesphene

Bleach • Selection agents for strains. Selection listed on strain spreadsheet.

• Hyg 5C^g/ml

• Strep 2(^g/ml

• Kan 15μg/ml

• Zeocin 25μg/ml

Library construction/PCR primers

Figure imgf000100_0001
p7_8 CAAGCAGAAGACGGCATACGAGATAGA AGAATCA GTGATTCT

ATCACGTGACTGGAGTTCAGACGTGTG C SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 673

CATAGCGT No. 672

SEQ. LD. No. 671

p7_9 CAAGCAGAAGACGGCATACGAGATAGG AGGATTT AAAATCCT

ATTTTGTGACTGGAGTTCAGACGTGTGC T SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 676

ATAGCGT No. 675

SEQ. LD. No. 674

p7_10 CAAGCAGAAGACGGCATACGAGATAGT AGTTAGT GACTAACT

TAGTCGTGACTGGAGTTCAGACGTGTGC C SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 679

ATAGCGT No. 678

SEQ. LD. No. 677

p7_l l CAAGCAGAAGACGGCATACGAGATAGT AGTTGAG CCTCAACT

TGAGGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 682

CATAGCGT No. 681

SEQ. LD. No. 680

p7_12 CAAGCAGAAGACGGCATACGAGATATA ATAACGC CGCGTTAT

ACGCGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 685

CATAGCGT No. 684

SEQ. LD. No. 683

p7_13 CAAGCAGAAGACGGCATACGAGATATC ATCAAGG TCCTTGAT

AAGGAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 688

CATAGCGT No. 687

SEQ. LD. No. 686

p7_14 CAAGCAGAAGACGGCATACGAGATATC ATCGTTG CCAACGAT

GTTGGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 691

CATAGCGT No. 690

SEQ. LD. No. 689

p7_15 CAAGCAGAAGACGGCATACGAGATATT ATTGGAC AGTCCAAT

GGACTGTGACTGGAGTTCAGACGTGTG T SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 694

CATAGCGT No. 693

SEQ. LD. No. 692

p7_16 CAAGCAGAAGACGGCATACGAGATCAA CAAGCGG GCCGCTTG

GCGGCGTGACTGGAGTTCAGACGTGTG C SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 697 CATAGCGT No. 696

SEQ. LD. No. 695

p7_17 CAAGCAGAAGACGGCATACGAGATCAC CACGCTC TGAGCGTG

GCTCAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 700

CATAGCGT No. 699

SEQ. LD. No. 698

p7_18 CAAGCAGAAGACGGCATACGAGATCAG CAGTTTG ACAAACTG

TTTGTGTGACTGGAGTTCAGACGTGTGC T SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 703

ATAGCGT No. 702

SEQ. LD. No. 701

p7_19 CAAGCAGAAGACGGCATACGAGATCAT CATCGCG TCGCGATG

CGCGAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 706

CATAGCGT No. 705

SEQ. LD. No. 704

p7_20 CAAGCAGAAGACGGCATACGAGATCCA CCACACC CGGTGTGG

CACCGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 709

CATAGCGT No. 708

SEQ. LD. No. 707

p7_21 CAAGCAGAAGACGGCATACGAGATCCA CCACTGT GACAGTGG

CTGTCGTGACTGGAGTTCAGACGTGTGC C SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 712

ATAGCGT No. 711

SEQ. LD. No. 710

p7_22 CAAGCAGAAGACGGCATACGAGATCCC CCCACAA GTTGTGGG

ACAACGTGACTGGAGTTCAGACGTGTG C SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 715

CATAGCGT No. 714

SEQ. LD. No. 713

p7_23 CAAGCAGAAGACGGCATACGAGATCCC CCCGTAT TATACGGG

GTATAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 718

CATAGCGT No. 717

SEQ. LD. No. 716

p7_24 CAAGCAGAAGACGGCATACGAGATCCC CCCTAGT GACTAGGG

TAGTCGTGACTGGAGTTCAGACGTGTGC C SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 721

ATAGCGT No. 720

SEQ. LD. No. 719 p7_25 CAAGCAGAAGACGGCATACGAGATCCG CCGTACG CCGTACGG

TACGGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 724

CATAGCGT No. 723

SEQ. LD. No. 722

p7_26 CAAGCAGAAGACGGCATACGAGATCGA CGACGAA CTTCGTCG

CGAAGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 727

CATAGCGT No. 726

SEQ. LD. No. 725

p7_27 CAAGCAGAAGACGGCATACGAGATCTG CTGACCG GCGGTCAG

ACCGCGTGACTGGAGTTCAGACGTGTG C SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 730

CATAGCGT No. 729

SEQ. LD. No. 728

p7_28 CAAGCAGAAGACGGCATACGAGATGCA GCAGTGC CGCACTGC

GTGCGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 733 CATAGCGT SEQ. LD. No. 731 No. 732

p7_29 CAAGCAGAAGACGGCATACGAGATGCT GCTAGGA ATCCTAGC

AGGATGTGACTGGAGTTCAGACGTGTG T SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 736

CATAGCGT No. 735

SEQ. LD. No. 734

p7_30 CAAGCAGAAGACGGCATACGAGATGCT GCTCCAG TCTGGAGC

CCAGAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 739

CATAGCGT No. 738

SEQ. LD. No. 737

p7_31 CAAGCAGAAGACGGCATACGAGATGTC GTCCGTC TGACGGAC

CGTCAGTGACTGGAGTTCAGACGTGTG A SEQ. SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA LD. No. 742

CATAGCGT 741

SEQ. LD. No. 740

p7_32 CAAGCAGAAGACGGCATACGAGATGTG GTGGGTT GAACCCAC

GGTTCGTGACTGGAGTTCAGACGTGTGC C SEQ. SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC LD. No. 745

ATAGCGT 744

SEQ. LD. No. 743

p7_33 CAAGCAGAAGACGGCATACGAGATGTG GTGTGGA CTCCACAC

TGGAGGTGACTGGAGTTCAGACGTGTG G SEQ. SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA LD. No. 748 CATAGCGT 747 SEQ. LD. No. 746

p7_34 CAAGCAGAAGACGGCATACGAGATGTT GTTAAGA CTCTTAAC

A AGAGGTGAC TGG AGTTC AGAC GTGTG G SEQ. SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA LD. No. 751 CATAGCGT 750

SEQ. LD. No. 749

p7_35 CAAGCAGAAGACGGCATACGAGATGTT GTTCCGG CCCGGAAC

CCGGGGTGACTGGAGTTCAGACGTGTG G SEQ. SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA LD. No. 754

CATAGCGT 753

SEQ. LD. No. 752

p7_36 CAAGCAGAAGACGGCATACGAGATGTT GTTGGGT AACCCAAC

GGGTTGTGACTGGAGTTCAGACGTGTG T SEQ. SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA LD. No. 757

CATAGCGT 756

SEQ. LD. No. 755

p7_37 CAAGCAGAAGACGGCATACGAGATTAC TACCATG ACATGGTA

CATGTGTGACTGGAGTTCAGACGTGTGC T SEQ. SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC LD. No. 760

ATAGCGT 759

SEQ. LD. No. 758

p7_38 CAAGCAGAAGACGGCATACGAGATTAC TACGGGC CGCCCGTA

GGGCGGTGACTGGAGTTCAGACGTGTG G SEQ. SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA LD. No. 763

CATAGCGT 762

SEQ. LD. No. 761

p7_39 CAAGCAGAAGACGGCATACGAGATTCA TCAATCA GTGATTGA

ATCACGTGACTGGAGTTCAGACGTGTG C SEQ. SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA LD. No. 766

CATAGCGT 765

SEQ. LD. No. 764

p7_40 CAAGCAGAAGACGGCATACGAGATTCA TCATACC TGGTATGA

TACCAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 769

CATAGCGT No. 768

SEQ. LD. No. 767

p7_41 CAAGCAGAAGACGGCATACGAGATTCC TCCGGTT CAACCGGA

GGTTGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 772

CATAGCGT No. 771

SEQ. LD. No. 770

p7_42 CAAGCAGAAGACGGCATACGAGATTGA TGACTTG ACAAGTCA CTTGTGTGACTGGAGTTCAGACGTGTGC T SEQ. LD. No. TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 775 ATAGCGT No. 774

SEQ. LD. No. 773

p7_43 CAAGCAGAAGACGGCATACGAGATTGC TGCTGCT GAGCAGCA

TGCTCGTGACTGGAGTTCAGACGTGTGC C SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 778

ATAGCGT No. 777

SEQ. LD. No. 776

p7_44 CAAGCAGAAGACGGCATACGAGATTGT TGTAGAC GGTCTACA

AGACCGTGACTGGAGTTCAGACGTGTG C SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 781 C ATAGCGT No. 780

SEQ. LD. No. 779

p7_45 CAAGCAGAAGACGGCATACGAGATTTA TTACGTT CAACGTAA

CGTTGGTGACTGGAGTTCAGACGTGTGC G SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 784

ATAGCGT No. 783

SEQ. LD. No. 782

p7_46 CAAGCAGAAGACGGCATACGAGATTTC TTCGCGG TCCGCGAA

GCGGAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 787 C ATAGCGT No. 786

SEQ. LD. No. 785

p7_47 CAAGCAGAAGACGGCATACGAGATTTG TTGATCG CCGATCAA

ATCGGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 790 C ATAGCGT No. 789

SEQ. LD. No. 788

p7_48 CAAGCAGAAGACGGCATACGAGATTTT TTTGCAG ACTGCAAA

GCAGTGTGACTGGAGTTCAGACGTGTG T SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 793 C ATAGCGT No. 792

SEQ. LD. No. 791

P7_49 CAAGCAGAAGACGGCATACGAGATCAG CAGTCGA ATCGACTG

TCGATGTGACTGGAGTTCAGACGTGTGC T SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 796

ATAGCGT No. 795

SEQ. LD. No. 794

P7_50 CAAGCAGAAGACGGCATACGAGATCTG CTGCTAG GCTAGCAG

CTAGCGTGACTGGAGTTCAGACGTGTG C SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 799 C ATAGCGT No. 798 SEQ. LD. No. 797

P7_51 CAAGCAGAAGACGGCATACGAGATGGA GGAGAGT TACTCTCC

GAGTAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 802

CATAGCGT No. 801

SEQ. LD. No. 800

P7_52 CAAGCAGAAGACGGCATACGAGATTGC TGCTGTC TGACAGCA

TGTCAGTGACTGGAGTTCAGACGTGTGC A SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 805

ATAGCGT No. 804

SEQ. LD. No. 803

P7_53 CAAGCAGAAGACGGCATACGAGATCAA CAACCTG GCAGGTTG

CCTGCGTGACTGGAGTTCAGACGTGTGC C SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 808

ATAGCGT No. 807

SEQ. LD. No. 806

P7_54 CAAGCAGAAGACGGCATACGAGATAGC AGCTGGA TTCCAGCT

TGGAAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 811

CATAGCGT No. 810

SEQ. LD. No. 809

P7_55 CAAGCAGAAGACGGCATACGAGATGCT GCTAACT TAGTTAGC

AACTAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 814

CATAGCGT No. 813

SEQ. LD. No. 812

P7 56 CAAGCAGAAGACGGCATACGAGATTTA TTAGCGC AGCGCTAA

GCGCTGTGACTGGAGTTCAGACGTGTG T SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 817

CATAGCGT No. 816

SEQ. LD. No. 815

P7_57 CAAGCAGAAGACGGCATACGAGATAAG AAGAACC CGGTTCTT

AACCGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 820

CATAGCGT No. 820

SEQ. LD. No. 818

P7_58 CAAGCAGAAGACGGCATACGAGATCAA CAATGCT TAGCATTG

TGCTAGTGACTGGAGTTCAGACGTGTGC A SEQ. LD. No.

TCTTCCGATCTTAAAGCAGCGTATCCAC SEQ. LD. 823

ATAGCGT No. 822

SEQ. LD. No. 821

P7 59 CAAGCAGAAGACGGCATACGAGATGTT GTTGAAT AATTCAAC GAATTGTGACTGGAGTTCAGACGTGTG T SEQ. LD. No. CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 826

CATAGCGT No. 825

SEQ. LD. No. 824

P7 60 CAAGCAGAAGACGGCATACGAGATTCT TCTGTGA TTCACAGA

GTGAAGTGACTGGAGTTCAGACGTGTG A SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 829

CATAGCGT No. 828

SEQ. LD. No. 827

P7 61 CAAGCAGAAGACGGCATACGAGATAAG AAGAGA GCTCTCTT

AGAGCGTGACTGGAGTTCAGACGTGTG GC SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 832

CATAGCGT No. 831

SEQ. LD. No. 830

P7_62 CAAGCAGAAGACGGCATACGAGATCCA CCAAGTC TGACTTGG

AGTCAGTGACTGGAGTTCAGACGTGTG A AAGAGAGC CTCTTCCGATCTTAAAGCAGCGTATCCA AAGAGA SEQ. LD. No. CATAGCGT AAGAGAGC GC 835

SEQ. LD. No. 833 SEQ. LD.

No. 834

P7 63 CAAGCAGAAGACGGCATACGAGATGAA GAACCAT TATGGTTC

CCATAGTGACTGGAGTTCAGACGTGTG A AAGAGAGC CTCTTCCGATCTTAAAGCAGCGTATCCA AAGAGA SEQ. LD. No. CATAGCGT AAGAGAGC GC 838

SEQ. LD. No. 836 SEQ. LD.

No. 837

P7_64 CAAGCAGAAGACGGCATACGAGATGGC GGCTAGT CACTAGCC

TAGTGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 841

CATAGCGT No. 840

SEQ. LD. No. 839

P7 65 CAAGCAGAAGACGGCATACGAGATAAG AAGAGGT AACCTCTT

AGGTTGTGACTGGAGTTCAGACGTGTG T SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 844

CATAGCGT No. 843

SEQ. LD. No. 842

P7 66 CAAGCAGAAGACGGCATACGAGATCAA CAATGTA CTACATTG

TGTAGGTGACTGGAGTTCAGACGTGTG G SEQ. LD. No.

CTCTTCCGATCTTAAAGCAGCGTATCCA SEQ. LD. 847

CATAGCGT No. 846

SEQ. LD. No. 845

P5 or plate primers (100 allow for 100 96-well or 25 384-well plates) (IDT ieHPLC purified) Name Sequence index (direct)

Sl-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATCGTACG

CTACACGACGCTCTTCCGATCTATCGTACGATCTTGT SEQ. LD. No. GGAAAGGACGA 849 SEQ. LD. No. 848

S2-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ACTATCTG

CTACACGACGCTCTTCCGATCTACTATCTGGATCTTG SEQ. LD. No. TGGAAAGGACGA 851 SEQ. LD. No. 850

S3-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TAGCGAGT

CTACACGACGCTCTTCCGATCTTAGCGAGTCGATCTT SEQ. LD. No. GTGGAAAGGACGA 853 SEQ. LD. No. 852

S4-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTGCGTGT

CTACACGACGCTCTTCCGATCTCTGCGTGTACGATCT SEQ. LD. No. TGTGGAAAGGACGA 855 SEQ. LD. No. 854

S5-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TCATCGAG

CTACACGACGCTCTTCCGATCTTCATCGAGATCTTGT SEQ. LD. No. GGAAAGGACGA 857 SEQ. LD. No. 856

S6-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CGTGAGTG

CTACACGACGCTCTTCCGATCTCGTGAGTGGATCTTG SEQ. LD. No. TGGAAAGGACGA 859 SEQ. LD. No. 858

S7-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GGATATCT

CTACACGACGCTCTTCCGATCTGGATATCTCGATCTT SEQ. LD. No. GTGGAAAGGACGA 861 SEQ. LD. No. 860

S8-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GACACCGT

CTACACGACGCTCTTCCGATCTGACACCGTACGATCT SEQ. LD. No. TGTGGAAAGGACGA 863 SEQ. LD. No. 862

S9-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTACTATA

CTACACGACGCTCTTCCGATCTCTACTATAATCTTGT SEQ. LD. No. GGAAAGGACGA 865 SEQ. LD. No. 864

S10-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CGTTACTA

CTACACGACGCTCTTCCGATCTCGTTACTAGATCTTG SEQ. LD. No.

TGGAAAGGACGA 867 SEQ. LD. No. 866

Sl l-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AGAGTCAC

CTACACGACGCTCTTCCGATCTAGAGTCACCGATCTT SEQ. LD. No. GTGGAAAGGACGA 869 SEQ. LD. No. 868

S12-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TACGAGAC

CTACACGACGCTCTTCCGATCTTACGAGACACGATC SEQ. LD. No. TTGTGGAAAGGACGA 871 SEQ. LD. No. 870

S13-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ACGTCTCG

CTACACGACGCTCTTCCGATCTACGTCTCGATCTTGT SEQ. LD. No. GGAAAGGACGA 873 SEQ. LD. No. 872

S14-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TCGACGAG

CTACACGACGCTCTTCCGATCTTCGACGAGGATCTTG SEQ. LD. No. TGGAAAGGACGA 875 SEQ. LD. No. 874

S15-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GATCGTGT

CTACACGACGCTCTTCCGATCTGATCGTGTCGATCTT SEQ. LD. No. GTGGAAAGGACGA 877 SEQ. LD. No. 876

S16-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTCAGATA

CTACACGACGCTCTTCCGATCTGTCAGATAACGATCT SEQ. LD. No. TGTGGAAAGGACGA 879 SEQ. LD. No. 878

S17-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ACGACGTG

CTACACGACGCTCTTCCGATCTACGACGTGATCTTGT SEQ. LD. No. GGAAAGGACGA 881 SEQ. LD. No. 880

S18-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATATACAC

CTACACGACGCTCTTCCGATCTATATACACGATCTTG SEQ. LD. No. TGGAAAGGACGA 883 SEQ. LD. No. 882

S19-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CGTCGCTA

CTACACGACGCTCTTCCGATCTCGTCGCTACGATCTT SEQ. LD. No. GTGGAAAGGACGA 885 SEQ. LD. No. 884

S20-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTAGAGCT

CTACACGACGCTCTTCCGATCTCTAGAGCTACGATCT SEQ. LD. No. TGTGGAAAGGACGA 887 SEQ. LD. No. 886 S21-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GCTCTAGT CTACACGACGCTCTTCCGATCTGCTCTAGTATCTTGT SEQ. LD. No. GGAAAGGACGA 889 SEQ. LD. No. 888

S22-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GACACTGA

CTACACGACGCTCTTCCGATCTGACACTGAGATCTTG SEQ. LD. No. TGGAAAGGACGA 891 SEQ. LD. No. 890

S23-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGCGTACG

CTACACGACGCTCTTCCGATCTTGCGTACGCGATCTT SEQ. LD. No. GTGGAAAGGACGA 893 SEQ. LD. No. 892

S24-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TAGTGTAG

CTACACGACGCTCTTCCGATCTTAGTGTAGACGATCT SEQ. LD. No. TGTGGAAAGGACGA 885 SEQ. LD. No. 894

S25-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AAGCAGCA

CTACACGACGCTCTTCCGATCTAAGCAGCAATCTTGT SEQ. LD. No. GGAAAGGACGA 897 SEQ. LD. No. 896

S26-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ACGCGTGA

CTACACGACGCTCTTCCGATCTACGCGTGAGATCTTG SEQ. LD. No. TGGAAAGGACGA 899 SEQ. LD. No. 898

S27-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CGATCTAC

CTACACGACGCTCTTCCGATCTCGATCTACCGATCTT SEQ. LD. No. GTGGAAAGGACGA 901 SEQ. LD. No. 900

S28-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGCGTCAC

CTACACGACGCTCTTCCGATCTTGCGTCACACGATCT SEQ. LD. No. TGTGGAAAGGACGA 903 SEQ. LD. No. 902

S29-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTCTAGTG

CTACACGACGCTCTTCCGATCTGTCTAGTGATCTTGT SEQ. LD. No. GGAAAGGACGA 905 SEQ. LD. No. 904

S30-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTAGTATG

CTACACGACGCTCTTCCGATCTCTAGTATGGATCTTG SEQ. LD. No. TGGAAAGGACGA 907 SEQ. LD. No. 906

S31-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GATAGCGT CTACACGACGCTCTTCCGATCTGATAGCGTCGATCTT SEQ. LD. No.

GTGGAAAGGACGA 909

SEQ. LD. No. 908

S32-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TCTACACT

CTACACGACGCTCTTCCGATCTTCTACACTACGATCT SEQ. LD. No. TGTGGAAAGGACGA 911 SEQ. LD. No. 910

S33-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AACTCTCG

CTACACGACGCTCTTCCGATCTAACTCTCGATCTTGT SEQ. LD. No. GGAAAGGACGA 913 SEQ. LD. No. 912

S34-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ACTATGTC

CTACACGACGCTCTTCCGATCTACTATGTCGATCTTG SEQ. LD. No. TGGAAAGGACGA 915 SEQ. LD. No. 914

S35-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AGTAGCGT

CTACACGACGCTCTTCCGATCTAGTAGCGTCGATCTT SEQ. LD. No. GTGGAAAGGACGA 917 SEQ. LD. No. 916

S36-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CAGTGAGT

CTACACGACGCTCTTCCGATCTCAGTGAGTACGATCT SEQ. LD. No. TGTGGAAAGGACGA 919 SEQ. LD. No. 918

S37-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CGTACTCA

CTACACGACGCTCTTCCGATCTCGTACTCAATCTTGT SEQ. LD. No. GGAAAGGACGA 921 SEQ. LD. No. 920

S38-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTACGCAG

CTACACGACGCTCTTCCGATCTCTACGCAGGATCTTG SEQ. LD. No. TGGAAAGGACGA 923 SEQ. LD. No. 922

S39-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GGAGACTA

CTACACGACGCTCTTCCGATCTGGAGACTACGATCTT SEQ. LD. No. GTGGAAAGGACGA 925 SEQ. LD. No. 924

S40-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTCGCTCG

CTACACGACGCTCTTCCGATCTGTCGCTCGACGATCT SEQ. LD. No.

TGTGGAAAGG 927

ACGA

SEQ. LD. No. 926

S41-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTCGTAGT CTACACGACGCTCTTCCGATCTGTCGTAGTATCTTGT SEQ. LD. No.

GGAAAGGACGA 929

SEQ. LD. No. 928

S42-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TAGCAGAC

CTACACGACGCTCTTCCGATCTTAGCAGACGATCTTG SEQ. LD. No. TGGAAAGGACGA 931 SEQ. LD. No. 930

S43-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TCATAGAC

CTACACGACGCTCTTCCGATCTTCATAGACCGATCTT SEQ. LD. No. GTGGAAAGGACGA 933 SEQ. LD. No. 932

S44-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TCGCTATA

CTACACGACGCTCTTCCGATCTTCGCTATAACGATCT SEQ. LD. No. TGTGGAAAGGACGA 935 SEQ. LD. No. 934

S45-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AAGTCGAG

CTACACGACGCTCTTCCGATCTAAGTCGAGATCTTGT SEQ. LD. No. GGAAAGGACGA 937 SEQ. LD. No. 936

S46-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATACTTCG

CTACACGACGCTCTTCCGATCTATACTTCGGATCTTG SEQ. LD. No. TGGAAAGGACGA 939 SEQ. LD. No. 938

S47-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AGCTGCTA

CTACACGACGCTCTTCCGATCTAGCTGCTACGATCTT SEQ. LD. No. GTGGAAAGGACGA 941 SEQ. LD. No. 940

S48-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CATAGAGA

CTACACGACGCTCTTCCGATCTCATAGAGAACGATC SEQ. LD. No. TTGTGGAAAGGACGA 943 SEQ. LD. No. 942

S49-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GCTAATAG

CTACACGACGCTCTTCCGATCTGCTAATAGATCTTGT SEQ. LD. No. GGAAAGGACGA 945 SEQ. LD. No. 944

S50-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGGTTGGA

CTACACGACGCTCTTCCGATCTTGGTTGGAGATCTTG SEQ. LD. No. TGGAAAGGACGA 947 SEQ. LD. No. 946

S51-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATAGCCAG

CTACACGACGCTCTTCCGATCTATAGCCAGCGATCTT SEQ. LD. No. GTGGAAAGGACGA 949

SEQ. LD. No. 948

S52-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GAGCCAGT

CTACACGACGCTCTTCCGATCTGAGCCAGTACGATC SEQ. LD. No. TTGTGGAAAGGACGA 951 SEQ. LD. No. 950

S53-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGTGATGG

CTACACGACGCTCTTCCGATCTTGTGATGGATCTTGT SEQ. LD. No. GGAAAGGACGA 953 SEQ. LD. No. 952

S54-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTATTGCC

CTACACGACGCTCTTCCGATCTGTATTGCCGATCTTG SEQ. LD. No. TGGAAAGGACGA 955 SEQ. LD. No. 954

S55-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATGAAGTG

CTACACGACGCTCTTCCGATCTATGAAGTGCGATCTT SEQ. LD. No. GTGGAAAGGACGA 957 SEQ. LD. No. 956

S56-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TAAGCTTG

CTACACGACGCTCTTCCGATCTTAAGCTTGACGATCT SEQ. LD. No. TGTGGAAAGGACGA 959 SEQ. LD. No. 958

S57-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGGTACCT

CTACACGACGCTCTTCCGATCTTGGTACCTATCTTGT SEQ. LD. No. GGAAAGGACGA 961 SEQ. LD. No. 960

S58-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTTATGGA

CTACACGACGCTCTTCCGATCTGTTATGGAGATCTTG SEQ. LD. No. TGGAAAGGACGA 963 SEQ. LD. No. 962

S59-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATGAGGAC

CTACACGACGCTCTTCCGATCTATGAGGACCGATCTT SEQ. LD. No. GTGGAAAGGACGA 965 SEQ. LD. No. 964

S60-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GCAGTACT

CTACACGACGCTCTTCCGATCTGCAGTACTACGATCT SEQ. LD. No. TGTGGAAAGGACGA 967 SEQ. LD. No. 966

S61-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTTGAATC

CTACACGACGCTCTTCCGATCTCTTGAATCATCTTGT SEQ. LD. No. GGAAAGGACGA 969 SEQ. LD. No. 968

S62-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CCAACTAA

CTACACGACGCTCTTCCGATCTCCAACTAAGATCTTG SEQ. LD. No. TGGAAAGGACGA 971 SEQ. LD. No. 970

S63-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AATACCAT

CTACACGACGCTCTTCCGATCTAATACCATCGATCTT SEQ. LD. No. GTGGAAAGGACGA 973 SEQ. LD. No. 972

S64-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ACCTATGC

CTACACGACGCTCTTCCGATCTACCTATGCACGATCT SEQ. LD. No. TGTGGAAAGGACGA 975 SEQ. LD. No. 974

S65-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GAACGCTA

CTACACGACGCTCTTCCGATCTGAACGCTAATCTTGT SEQ. LD. No. GGAAAGGACGA 977 SEQ. LD. No. 976

S66-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTGACATC

CTACACGACGCTCTTCCGATCTCTGACATCGATCTTG SEQ. LD. No. TGGAAAGGACGA 979 SEQ. LD. No. 978

S67-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GCCACCAT

CTACACGACGCTCTTCCGATCTGCCACCATCGATCTT SEQ. LD. No. GTGGAAAGGACGA 981 SEQ. LD. No. 980

S68-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CGACTCTC

CTACACGACGCTCTTCCGATCTCGACTCTCACGATCT SEQ. LD. No. TGTGGAAAGGACGA 983 SEQ. LD. No. 982

S69-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGCTATTA

CTACACGACGCTCTTCCGATCTTGCTATTAATCTTGT SEQ. LD. No. GGAAAGGACGA 985 SEQ. LD. No. 984

S70-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTTCTGGC

CTACACGACGCTCTTCCGATCTCTTCTGGCGATCTTG SEQ. LD. No. TGGAAAGGACGA 987 SEQ. LD. No. 986

S71-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATGAATTA

CTACACGACGCTCTTCCGATCTATGAATTACGATCTT SEQ. LD. No. GTGGAAAGGACGA 989 SEQ. LD. No. 988 S72-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TACTCCAG CTACACGACGCTCTTCCGATCTTACTCCAGACGATCT SEQ. LD. No. TGTGGAAAGGACGA 991 SEQ. LD. No. 990

S73-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATCATACC

CTACACGACGCTCTTCCGATCTATCATACCATCTTGT SEQ. LD. No. GGAAAGGACGA 993 SEQ. LD. No. 992

S74-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CCTCTAAC

CTACACGACGCTCTTCCGATCTCCTCTAACGATCTTG SEQ. LD. No. TGGAAAGGACGA 995 SEQ. LD. No. 994

S75-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC ATCTTCTC

CTACACGACGCTCTTCCGATCTATCTTCTCCGATCTT SEQ. LD. No. GTGGAAAGGACGA 997 SEQ. LD. No. 996

S76-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CAGCTCAC

CTACACGACGCTCTTCCGATCTCAGCTCACACGATCT SEQ. LD. No. TGTGGAAAGGACGA 999 SEQ. LD. No. 998

S77-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GGTTATCT

CTACACGACGCTCTTCCGATCTGGTTATCTATCTTGT SEQ. LD. No. GGAAAGGACGA 1001 SEQ. I.D. No. 1000

S78-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TCCGCATA

CTACACGACGCTCTTCCGATCTTCCGCATAGATCTTG SEQ. LD. No. TGGAAAGGACGA 1003 SEQ. I.D. No. 1002

S79-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGCTTCAC

CTACACGACGCTCTTCCGATCTTGCTTCACCGATCTT SEQ. LD. No. GTGGAAAGGACGA 1005 SEQ. I.D. No. 1004

S80-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GCTTCCTA

CTACACGACGCTCTTCCGATCTGCTTCCTAACGATCT SEQ. LD. No. TGTGGAAAGGACGA 1007 SEQ. I.D. No. 1006

S81-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTAATCGC

CTACACGACGCTCTTCCGATCTGTAATCGCATCTTGT SEQ. LD. No. GGAAAGGACGA 1009 SEQ. I.D. No. 1008

S82-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GGCCAATT CTACACGACGCTCTTCCGATCTGGCCAATTGATCTTG SEQ. LD. No.

TGGAAAGGACGA 1011

SEQ. LD. No. 1010

S83-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AAGCAATT

CTACACGACGCTCTTCCGATCTAAGCAATTCGATCTT SEQ. LD. No. GTGGAAAGGACGA 1013 SEQ. LD. No. 1012

S84-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CAGACCAA

CTACACGACGCTCTTCCGATCTCAGACCAAACGATC SEQ. LD. No. TTGTGGAAAGGACGA 1015 SEQ. LD. No. 1014

S85-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CCAGGATG

CTACACGACGCTCTTCCGATCTCCAGGATGATCTTGT SEQ. LD. No. GGAAAGGACGA 1017 SEQ. LD. No. 1016

S86-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTTAATCC

CTACACGACGCTCTTCCGATCTGTTAATCCGATCTTG SEQ. LD. No. TGGAAAGGACGA 1019 SEQ. LD. No. 1018

S87-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AATATGCG

CTACACGACGCTCTTCCGATCTAATATGCGCGATCTT SEQ. LD. No. GTGGAAAGGACGA 1021 SEQ. LD. No. 1020

S88-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TCGAATGA

CTACACGACGCTCTTCCGATCTTCGAATGAACGATCT SEQ. LD. No. TGTGGAAAGGACGA 1023 SEQ. LD. No. 1022

S89-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GATTGGAC

CTACACGACGCTCTTCCGATCTGATTGGACATCTTGT SEQ. LD. No. GGAAAGGACGA 1025 SEQ. LD. No. 1024

S90-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGACCAAG

CTACACGACGCTCTTCCGATCTTGACCAAGGATCTTG SEQ. LD. No. TGGAAAGGACGA 1027 SEQ. LD. No. 1026

S91-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AGCGTTGG

CTACACGACGCTCTTCCGATCTAGCGTTGGCGATCTT SEQ. LD. No. GTGGAAAGGACGA 1029 SEQ. LD. No. 1028

S92-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GAAGTGGA

CTACACGACGCTCTTCCGATCTGAAGTGGAACGATC SEQ. LD. No. TTGTGGAAAGGACGA 1031

SEQ. LD. No. 1030

S93-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGGAGATT

CTACACGACGCTCTTCCGATCTTGGAGATTATCTTGT SEQ. LD. No. GGAAAGGACGA 1033 SEQ. LD. No. 1032

S94-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GTGCAGAC

CTACACGACGCTCTTCCGATCTGTGCAGACGATCTTG SEQ. LD. No. TGGAAAGGACGA 1035 SEQ. LD. No. 1034

S95-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GCGCTATT

CTACACGACGCTCTTCCGATCTGCGCTATTCGATCTT SEQ. LD. No. GTGGAAAGGACGA 1037 SEQ. LD. No. 1036

S96-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AAGAGATT

CTACACGACGCTCTTCCGATCTAAGAGATTACGATC SEQ. LD. No. TTGTGGAAAGGACGA 1039 SEQ. LD. No. 1038

S97-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC TGTGCATT

CTACACGACGCTCTTCCGATCTTGTGCATTATCTTGT SEQ. LD. No. GGAAAGGACGA 1041 SEQ. LD. No. 1040

S98-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC GATCGCGT

CTACACGACGCTCTTCCGATCTGATCGCGTGATCTTG SEQ. LD. No. TGGAAAGGACGA 1043 SEQ. LD. No. 1042

S99-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC AAGATAGT

CTACACGACGCTCTTCCGATCTAAGATAGTCGATCTT SEQ. LD. No. GTGGAAAGGACGA 1045 SEQ. LD. No. 1044

S100-p5 AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTCCCAGT

CTACACGACGCTCTTCCGATCTCTCCCAGTACGATCT SEQ. LD. No. TGTGGAAAGGACGA 1047 SEQ. LD. No. 1046

C. Disposable equipment

Ink well culture bottle

Corning roller bottle (Corning, 490cm2)

Corning 384 well clear plates Corning brand #3701 Corning 96-well clear bottom plate (3370)

Aerosol Barrier Tips

Nalgene Reservoirs, 300mL convoluted bottom

Tupperware (6-1/4" x 8-5/8" x 5-7/8" h)

50mL BD Falcon tubes

Kimtech shop towels

Eppendorf twintec 384-well PCR plates

Eppendorf twintec 96-well PCR plates

2. Strain expansion

1. Strain pools are organized by group (Screening group 1, group 2, group 3 and group 4).

2. In the BSL3 laboratory start a growth for each strain in a separate inkwell containing 10ml 7H9+OADC supplemented with selection agents and 500ng/ml ATC. Selective agents listed in strain table above. Inoculate with the full cryovial volume for an approximately 1 : 10 inoculation.

3. Incubate in 37°C cabinet for 3-5 days until OD6oo > 0.3

4. Supplement AHT every 4th day by adding to SOOng/μΙ final concentration.

Assay setup

1. Prior to the day of the assay, prepare assay-ready plates by pre-aliquotting the control compounds and compound library in duplicate into clear Corning 384-well plates (#3701).

2. On the day of or before the assay, outside the BL3 lab, use the Bravo to add 20μΙ. of fresh 7H9-0 ADC-acetate (without ATC and selective agents) to each well of each 384-well assay -ready plate. For compounds that could not be prepared as assay-ready plates, instead aliquot 20μΙ. of 7H9 into empty plates and then pin compound into that media. Bring these plates into the BL3.

3. Take ODs of expanded strains by transferring ΙΟΟμΙ of each ink well culture to the wells of a Corning 96-well plate (#3370). Read the OD6oo using the Molecular Devices M5 spectrophotometer.

4. Use the "mix calc.xlsx" spreadsheet to calculate how much of each strain to add to pool for the volume of the given assay. 8ml of diluted culture pool at an OD of 0.005 is required for each assay plate, plus ~50-100mL to account for reservoir dead volume. 5. Add the calculated volume of each strain to a 50mL conical Falcon tube. Bring to 40mL with fresh 7H9. Wash cells with 7H9 three times (spin at 3500RPM for lOmin in Beckman Allegra Centrifuge, remove supernatant, and resuspend pellet in fresh 7H9).

6. Prepare a roller bottle containing the full calculated volume of 7H9 required for the assay. After the final wash, pipette a small volume from the roller bottle to the conical tube to resuspend the washed pellet, then transfer it back to the roller bottle. This is the diluted culture pool.

7. Use a pipettor to fill a reservoir on the Bravo deck with diluted culture pool. Delid the assay plates and place them in the BenchCel stacker. Prepare the Bravo deck with 96LT tips and a vesphene wash reservoir.

8. Use Bravo protocol "384w inoculate" to transfer 20μΙ. of culture per well to assay plates.

9. Put a kimtech shop towel dampened with H20 in the bottom of each tupperware

container to guard against evaporation. Re-lid assay plates, wipe the exteriors with 1% vesphene, and seal them 8 to a tupperware.

10. Incubate in 37°C cabinetfor 14 days.

Collecting the assay

1. Seal each plate with foil, pressing with a finger to ensure each well is thoroughly sealed. Replace the lid.

2. Double-bag plates in sets of 4, sterilizing the exteriors of the plates and bags with 1% vesphene.

3. Bake plates for 2 hours at 80°C to heat-kill cultures. The oven holds a maximum of 64 plates simultaneously. After baking, plates are considered sterile and safe to remove from the BL3 lab.

4. Store sealed plates at -80°C in Rm 2070 freezer.

Library construction

PCR

1. Spin baked 384-well plates in tabletop centrifuge at 2000rpm for 1 minute to remove condensation from seal.

2. Prepare a lysis solution of 20% DMSO with tag_8090 control plasmid:

o 800 mL dH20 ο 200 mL DMSO

o 500 μL· tag_8090 control plasmid (3.4 pg/μΐ.)

Run each plate through Bravo protocol " 1 - mix lysis and transfer (long)". 40μΙ. of lysis solution is aspirated from a reservoir and dispensed into the baked plate. The plate is mixed thoroughly, then 20μΙ. is transferred to a 384-well twintec PCR plate. Heat the template aliquot in the thermocycler at 98°C for 10 min. Store template at - 80°C when not in use.

. Prepare PCR master mix according to table (volumes appropriate for 16 PCR plates). Dispense 510μΙ. per well to rows A-F, columns 1-1 1 of a 96-well block.

Figure imgf000120_0001

. Dispense 7.75 μΙ_, of master mix to wells C2-N23 of 16 384-well twintec PCR plates using Bravo protocol "2 - add master mix to 384 per". (From here forward, columns 1 & 24 and rows A, B, O, & P will be left empty to discard potential edge effects from the growth plate.)

. Aliquot 1.25 μΙ_, of p5/p7 primer mix (5μΜ each) to PCR reactions using Bravo protocol "3 - add primer to 384 per".

. Aliquot 1 μΙ_, of boiled template to PCR reactions using Bravo protocol "4 - add template to 384 per".

. Run PCRs on the following thermocycler protocol:

Figure imgf000120_0002
Figure imgf000121_0001

10. Pool 2.8μL from each well of PCR plates using Bravo protocol "5 - pool per plates into reservoir".

SPRI

1. Allow SPRI reagent to warm to room temperature.

2. Mix 2mL of PCR pool with an equal volume of SPRI reagent. Pipette slowly up and down -10 times to thoroughly mix.

3. Incubate at room temperature for 20 min.

4. Dispense 500μΙ. of solution into each of two sterile Eppendorf microtubes in the magnet rack.

5. Incubate on the magnet for 3 min.

6. Aspirate and discard the supernatant, being careful not to disturb the pelleted beads.

7. Repeat steps 4-6 until all of the solution has been cleared.

8. Still on the magnet, wash each tube 3 times with 80% EtOH: add 900 μΐ., incubate for 30s, then aspirate and discard the supernatant.

9. Leave the tubes open on the magnet for 15 min to dry. Pipet off any excess EtOH from the bottom of the tubes.

10. Remove the tubes from the magnet. Thoroughly resuspend the beads from the first tube in 250μΙ. dH20 by pipetting up and down. Transfer the resuspended solution to the second tube and resuspend those beads as well.

11. Incubate the resuspended solution off the magnet for 20 min at room temperature.

12. Return the tube to the magnet. Incubate for 3 min. Keep the supernatant and discard the beads.

13. Save ΙΟμΙ. of eluent for quality control. Add equal volume of fresh SPRI beads to the remaining -240 μΙ_, and mix thoroughly as in step 2.

14. Repeat steps 3-9, but this time in a single Eppendorf tube. Repeat steps 10-12, this time eluting in a final volume of 75 μΐ..

Bioanalyzer

1. Dilute 2μΙ. of the purified library to 20μΙ. with dH20. Perform similar 1 : 10 dilutions for the unpurified PCR pool and the lx-purified sample you set aside in SPRI step 13. 2. Run an Agilent bioanalyzer chip with the diluted samples. The purified library sample will provide quantification and quality assurance. The other two samples will provide further quality control.

3. If the library looks clean («1% lOObp primer vs 200bp product) and has a good

yield, prepare a 40μΙ. dilution at lOnM to submit to walk-up sequencing.

4. If the library looks unclean, then repeat a cycle of SPRI and verify quality with a new bioanalyzer chip.

[0156] All publications, patents, and patent application mentioned herein are incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

[0157] Various modifications and variations of the described methods, compositions, and kits of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known customary practice within the art to which the invention pertains and may be applied to the features herein before set forth.

Claims

WHAT IS CLAIMED IS:
1. A recombinant hypomorph microbial cell recombinantly engineered to have reduced expression of one or more essential genes and further comprises a strain specific nucleic acid identifier that identifies the hypomorph microbial cell.
2. The recombinant hypomorph microbial cell of claim 1, wherein the strain specific nucleic acid identifier is incorporated into a genome of the hypomorph microbial cell.
3. The recombinant hypomorph microbial cell of claim 1 or claim 2, wherein the strain specific nucleic acid identifier comprises, in a 5' to 3' direction, a first primer binding site, a hypomorph specific nucleic acid sequence, and a second primer binding site, wherein the hypomorph specific nucleic acid sequence identifies the one or more essential genes having reduced expression.
4. The recombinant hypomorph microbial cell of claim 3, wherein the first primer binding site and second primer binding site are independently between 5 and 50 base pairs in length.
5. The recombinant hypomorph microbial cell of any one of claims 1 to 4, wherein the unique nucleic acid identifier is between 5 and 100 base pairs in length.
6. The recombinant hypomorph microbial cell of any one of claims 1 to 5, wherein the cell is recombinantly engineered so that the one or more essential genes are under the control of a weak promoter.
7. The recombinant hypomorph microbial cell of claim 6, wherein the weak promoter further comprises a spacer sequence between the promoter and the ribozyme binding site.
8. The recombinant hypomorph microbial cell of claim 7, wherein the spacer sequence is between 2 and 25 base pairs.
9. The recombinant hypomorph microbial cell of claim 6 or claim 7, wherein the weak promoter is a Sauer promoter.
10. The recombinant hypomorph microbial cell of any claims 1 to 9, wherein the cell is a bacterial cell, a fungal cell, a mycological cell, a protozoal cell, a nematode cell, a trematode cell, or a cestode cell.
11. The recombinant hypomorph microbial cell of claim 10, wherein the cell is a bacterial cell.
12. The recombinant hypomorph microbial cell of claim 11, wherein the bacterial cell is selected from the group consisting of Eschericia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Acinetobacter baumannii, Candida albicans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Proteus mirabalis, Streptococcus agalactiae, and Stenotrophomonas maltophila.
13. The recombinant hypomorph microbial cell of claim 12, wherein the cell is P. aeruginosa.
14. The recombinant hypomorph microbial cell of claim 11, wherein the cell is a Mycobacterium.
15. The recombinant hypomorph microbial cell of claim 14, wherein the cell is M tuberculosis, M. avium-intracellulare, M. kansasii, M. fortuitum, M. chelonae, M. leprae, M. africanum, M. microti, M. avium paratuberculosis, M. intracellulare, M. scrofulaceum, M. xenopi, M. marinum, or M. ulcerans.
16. The recombinant hypomorph microbial cell of any one of claims 1 to 15, wherein the cell is recombinantly engineered so that the one or more essential genes encode a protein degradation tag that is appended to the gene expression product upon translation.
17. The recombinant hypomorph microbial cell of claim 16, wherein the protein degradation tag targets the protein for degradation by a clp-protease.
18. The recombinant hypomorph microbial cell of claim 17, wherein the protein degradation tag is DAS+4.
19. The recombinant hypomorph microbial cell of claim 17 or claim 18, wherein the cell is further recombinantly engineered to express a protease adapter protein under the control of an inducible promoter.
20. The recombinant hypomorph microbial cell of claim 19, wherein the protease adapter protein is sspB.
21. The recombinant hypomorph microbial cell of any one of claims 1 to 20, wherein the one or more essential genes encode proteins that are localized to the cytoplasm, cytoplasmic membrane, periplasm, outer membrane, or extracellular space.
22. The recombinant hypomorph microbial cell of claim 21, wherein the one or more essential genes are localized to the outer membrane.
23. The recombinant hypomorph microbial cell of claim 21, wherein the one or more essential genes are selected from the group consisting of ostA, opr86, oprL, MB, omlA, IppL, surA, MA, MB, MA, mreC, and gcp.
24. The recombinant hypomorph microbial cell of claim 21, wherein the one or more essential genes are selected from the group consisting of ccsX, ctaC, eno, βα, folB, glcB, marP, mdh, mshC, murG, nadE, pstP, sucD, topA, ejpA, tpi, dlat, and mesJ.
25. A collection of hypomorph recombinant cells comprising recombinant hypomorph microbial cells of any one of claims 1 to 24, where each individual recombinant cell of a given species is recombinantly engineered to have reduced expression of a different essential gene or combination of essential genes.
26. Nucleic acid primer pairs configured to bind to and amplify the unique nucleic acid identifier of the recombinant hypomorph microbial cells in the set of claim 25.
27. The nucleic acid primer pairs of claim 26, wherein a first primer in the nucleic acid primer pair binds to the first primer binding site in the recombinant hypomorph microbial cell and a second primer of the nucleic acid primer pair binds to the second primer binding site in the recombinant hypomorph microbial cell.
28. The nucleic acid primer pairs of claim 27, wherein the first and/or second primer further comprises an origin specific nucleic acid identifier that identifies the individual discrete volume from which one or more hypomorph strains are detected.
29. The nucleic acid primer pairs of claim 28, wherein the first and/or second primer further comprises an experimental condition specific nucleic acid identifier that identifies the experimental conditions to which the hypomorph cells were exposed.
30. The nucleic acid primer pairs of any one of claims 26 to 29, further comprising a first sequencing primer binding site and first sequencing adapter on the first primer, and a second sequencing primer binding site and a second sequencing adapter on the second primer.
31. A multiplex method for whole-cell target-based screening of microbes, comprising:
culturing recombinant hypomorph microbial cells of the set of claim 25 in individual discrete volumes;
exposing each individual discrete volume, or a sub-set of individual discrete volumes, to a set of different experimental conditions; and
detecting the recombinant hypomorph microbial cells from the individual discrete volumes, wherein failure to detect one or more recombinant hypomorph microbial cells, or detection of a decreased amount of one or more recombinant hypomorph microbial cells relative to other recombinant hypomorph microbial cells or a control, indicates susceptibility of the one or more recombinant hypomorph microbial cells to the experimental condition.
32. The method of claim 31, wherein the failure to detect one or more recombinant hypomorph microbial cells, or detection of a decreased amount of one or more recombinant hypomorph microbial cells relative to other recombinant hypomorph microbial cells or a control, further indicates one or more mechanisms of action by which the one or more hypomorph cells are rendered susceptible to the experimental condition.
33. The method of claim 31 or claim 32, wherein detecting the recombinant hypomorph microbial cells comprises:
amplifying, using the set of nucleic acid primer pairs of any one of claims 26 to 29, the strain specific nucleic acid identifier of each hypomorph strain obtaining amplicons;
ligating a first sequencing primer and sequencing adapter to a first end of the amplicons resulting from the amplifying step and a second sequencing primer and a second sequencing adapter to a second end of the amplicons resulting from the amplifying step; sequencing the amplicons resulting from the ligating step to generate a set of sequencing reads; and
determining an abundance of each hypomorph strain based on the number of sequencing reads for each strain specific nucleic acid identifier.
34. The method of claim 31 or claim 32, wherein detecting the recombinant hypomorph microbial cells comprises:
amplifying, using the nucleic acid primer pairs of claim 30, the strain specific nucleic acid identifier of each strain;
sequencing the amplicons resulting from the amplifying step to generate a set of sequencing reads; and
determining an amount of each recombinant hypomorph microbial cell based on the number of sequenced reads for each strain specific nucleic acid identifier.
35. The method of claim 33 or claim 34, wherein the set of nucleic acid primer pairs is according to claim 29, and wherein each sequencing read from the same individual discrete volume is identified by the origin specific nucleic acid identifier, and the experimental condition of each hypomorph is determined by the experimental condition specific nucleic acid identifier.
36. The method of any one of claim 33 to 35, further comprising pooling all individual discrete volumes prior to amplifying the strain specific nucleic acid identifiers.
37. The method of any one of claims 31 to 36, wherein the individual discrete volume is a well of a multi-well culture plate.
38. The method of any one of claims 31 to 37, wherein the different experimental conditions comprises exposure to different test agents, combinations of test agents, or different concentrations of test agents or combinations of test agents.
39. The method of claim 38, wherein the test agent is a chemical agent.
40. The method of claim 39, wherein the chemical agent is an antibiotic.
41. The method of any one of claims 31 to 40, wherein the different experimental conditions further comprise different physical growth conditions.
42. The method of claim 41, wherein the different physical growth conditions comprise different growth media, different pH, different temperatures, different atmospheric pressures, different atmospheric 02 concentrations, different atmospheric C02 concentrations, or a combination thereof.
43. A kit comprising the set of hypomorph recombinant cells of claim 25, the nucleic acid primer pairs of any one of claims 26 to 30, or both.
44. The kit of claim 43, further comprising a set of double stranded nucleic acid sequences comprising forward and reverse sequencing primer binding sites, first and second sequencing adapters, or both.
45. The kit of claim 44 or claim 44, further comprising ligation reagents for ligating the double-stranded nucleic acid sequences to amplicons generated using the nucleic acid primers of any one of claims 26 to 30.
PCT/US2016/060730 2015-11-04 2016-11-04 Multiplex high-resolution detection of micro-organism strains, related kits, diagnostics methods and screening assays WO2017079699A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US201562250610P true 2015-11-04 2015-11-04
US62/250,610 2015-11-04

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US15/773,895 US20180327806A1 (en) 2015-11-04 2016-11-04 Multiplex high-resolution detection of micro-organism strains, related kits, diagnostics methods and screening assays

Publications (1)

Publication Number Publication Date
WO2017079699A1 true WO2017079699A1 (en) 2017-05-11

Family

ID=58662883

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/060730 WO2017079699A1 (en) 2015-11-04 2016-11-04 Multiplex high-resolution detection of micro-organism strains, related kits, diagnostics methods and screening assays

Country Status (2)

Country Link
US (1) US20180327806A1 (en)
WO (1) WO2017079699A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10266886B2 (en) 2016-12-09 2019-04-23 The Broad Institute, Inc. CRISPR effector system based diagnostics

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997043449A1 (en) * 1996-05-15 1997-11-20 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for sequencing large nucleic acid segments and compositions for large sequencing projects
US6518035B1 (en) * 1998-06-02 2003-02-11 Rosetta Inpharmatics, Inc. Targeted methods of drug screening using co-culture methods
US6991900B2 (en) * 2000-06-28 2006-01-31 California Institute Of Technology Methods for identifying an essential gene in a prokaryotic microorganism
US7732417B2 (en) * 2000-03-16 2010-06-08 Cold Spring Harbor Laboratory Methods and compositions for RNA interference using recombinant Dicer and Argonaut
WO2010141143A2 (en) * 2009-04-21 2010-12-09 Vivocure, Inc. Engineered avirulent bacteria strains and use in medical treatments

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997043449A1 (en) * 1996-05-15 1997-11-20 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for sequencing large nucleic acid segments and compositions for large sequencing projects
US6518035B1 (en) * 1998-06-02 2003-02-11 Rosetta Inpharmatics, Inc. Targeted methods of drug screening using co-culture methods
US7732417B2 (en) * 2000-03-16 2010-06-08 Cold Spring Harbor Laboratory Methods and compositions for RNA interference using recombinant Dicer and Argonaut
US6991900B2 (en) * 2000-06-28 2006-01-31 California Institute Of Technology Methods for identifying an essential gene in a prokaryotic microorganism
WO2010141143A2 (en) * 2009-04-21 2010-12-09 Vivocure, Inc. Engineered avirulent bacteria strains and use in medical treatments

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10266886B2 (en) 2016-12-09 2019-04-23 The Broad Institute, Inc. CRISPR effector system based diagnostics
US10266887B2 (en) 2016-12-09 2019-04-23 The Broad Institute, Inc. CRISPR effector system based diagnostics

Also Published As

Publication number Publication date
US20180327806A1 (en) 2018-11-15

Similar Documents

Publication Publication Date Title
Malorny et al. Standardization of diagnostic PCR for the detection of foodborne pathogens
Jadhav et al. Methods used for the detection and subtyping of Listeria monocytogenes
Genilloud et al. Current approaches to exploit actinomycetes as a source of novel natural products
Garcillán-Barcia et al. The diversity of conjugative relaxases and its application in plasmid classification
Bertelli et al. Rapid bacterial genome sequencing: methods and applications in clinical microbiology
Pallen et al. High-throughput sequencing and clinical microbiology: progress, opportunities and challenges
Marsh Terminal restriction fragment length polymorphism (T-RFLP): an emerging method for characterizing diversity among homologous populations of amplification products
Wang et al. Specific and rapid detection of foodborne Salmonella by loop-mediated isothermal amplification method
Courtois et al. Quantification of bacterial subgroups in soil: comparison of DNA extracted directly from soil or from cells previously released by density gradient centrifugation
CN104619894B (en) Compositions and methods of negative selection of non-desired nucleic acid sequence
Cowan et al. Metagenomic gene discovery: past, present and future
Sun et al. Tag-encoded FLX amplicon pyrosequencing for the elucidation of microbial and functional gene diversity in any environment
Frye et al. DNA microarray detection of antimicrobial resistance genes in diverse bacteria
Yokouchi et al. Whole‐metagenome amplification of a microbial community associated with scleractinian coral by multiple displacement amplification using ϕ29 polymerase
Agari et al. Transcription profile of Thermus thermophilus CRISPR systems after phage infection
EP2430188B1 (en) A method and kit for detecting antibiotic resistant bacteria
US9850525B2 (en) CAS9-based isothermal method of detection of specific DNA sequence
Handschur et al. Preanalytic removal of human DNA eliminates false signals in general 16S rDNA PCR monitoring of bacterial pathogens in blood
Neufeld et al. Serial analysis of ribosomal sequence tags (SARST): a high‐throughput method for profiling complex microbial communities
WO2002072773A3 (en) Methods and compositions for amplification of rna sequences
Wolk et al. PCR–electrospray ionization mass spectrometry: the potential to change infectious disease diagnostics in clinical and public health laboratories
Tomlinson et al. Development and evaluation of a one‐hour DNA extraction and loop‐mediated isothermal amplification assay for rapid detection of phytoplasmas
Lee et al. In vitro selection of Escherichia coli O157: H7-specific RNA aptamer
Glynn et al. Current and emerging molecular diagnostic technologies applicable to bacterial food safety
JP2010524454A (en) The method for the detection and analysis of antibiotic-resistant bacteria, compositions, and kits

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16863132

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16863132

Country of ref document: EP

Kind code of ref document: A1