WO2017066175A1 - Protected dna templates for gene modification and increased homologous recombination in cells and methods of use - Google Patents
Protected dna templates for gene modification and increased homologous recombination in cells and methods of use Download PDFInfo
- Publication number
- WO2017066175A1 WO2017066175A1 PCT/US2016/056404 US2016056404W WO2017066175A1 WO 2017066175 A1 WO2017066175 A1 WO 2017066175A1 US 2016056404 W US2016056404 W US 2016056404W WO 2017066175 A1 WO2017066175 A1 WO 2017066175A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polynucleotide
- cell
- dna
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/905—Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
- C12N9/222—Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Definitions
- the disclosure relates to the field of molecular biology, in particular, to methods for altering the genome of a cell. Specifically, this invention pertains to the use of protected DNA templates in combination with guide polynucleotide/ Cas complexes for genetic modification in cells and organisms.
- sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named CL6641 WOPCT2_SEQLISTING.txt created on October 07, 2016 and having a size 188 kilobytes and is filed concurrently with the specification.
- the sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.
- Gene knock-outs mostly have been carried out through homologous recombination (HR), a technique applicable across a wide array of organisms from bacteria to mammals. Inserting DNA sequences into a genome resulting in genetic "knock-in”, can also be performed by HR.
- HR homologous recombination
- Genome-editing techniques such as designer zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), homing meganucleases, or guided Cas9 systems are available for producing targeted genome perturbations.
- compositions and methods are provided for modifying a nucleotide sequence in the genome of a cell.
- the methods and compositions employ a guide polynucleotide, a protected polynucleotide modification template and a Cas endonuclease to modify a nucleotide sequence and/or to increase the frequency of homologous directed repair.
- the methods can further be used to decrease the frequency of off-site integration of any modification template.
- the present disclosure also describes methods for selecting a cell comprising a modified target site in its genome and methods for selecting a cell comprising a polynucleotide of interest inserted into a target site in its genome.
- the method comprises a method for selecting a cell comprising a modified nucleotide sequence in its genome, the method comprising: a.) providing a guide polynucleotide, at least one protected polynucleotide modification template and a Cas endonuclease to a cell, wherein said Cas endonuclease and guide polynucleotide can form a complex capable of introducing a single or double-strand break at a target site in genome of said cell, wherein said protected polynucleotide modification template comprises at least one nucleotide modification of said nucleotide sequence; and, b.) selecting a cell from step (a) comprising said modified nucleotide sequence.
- the protected polynucleotide modification template can be a linear polynucleotide comprising at least one protection molecule at its 5' end, 3' end, or both 5' and 3' ends or it can be a circular molecule.
- the protection molecule can be selected from the group consisting of an alkane spacer, a fluorophore, a NHS ester, a Digoxigen, a Cholesteryl-TEG, a C6, a C12, a Hexynyl, Oxtadiynyl dUTP, a Biotin, a Dithiol, an inverted Dideoxy-T modification or any one combination thereof.
- the protected polynucleotide modification template can be a double stranded linear molecule comprising at least one phosphorothiate bond at the 5' end of at least one strand.
- the protected polynucleotide modification template can be a double stranded linear molecule comprising a 3 carbon alkaline spacer on the 5' end of each strand.
- the at least one nucleotide modification of the protected polynucleotide template can be selected from the group consisting of (i) a replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, and (iv) any combination of (i) - (iii).
- the method further comprises determining the frequency of Homologous Directed Repair (HDR) and Non-Homologous End Joining (NHEJ) in said cell.
- HDR Homologous Directed Repair
- NHEJ Non-Homologous End Joining
- the method further comprises determining the frequency of off-site integration of the protected polynucleotide modification template in said cell.
- the frequency of off-site integration of the protected polynucleotide modification template in said cell can be decreased when compared to the frequency of off-site integration derived from a control method having all the same components and steps as said method except for using an unprotected (control) polynucleotide modification template.
- the method comprises a method for selecting a cell comprising a polynucleotide of interest inserted into a target site in its genome, the method comprising: a) providing a guide polynucleotide, a protected polynucleotide donor DNA and a Cas endonuclease to a cell, wherein said Cas endonuclease and guide polynucleotide can form a complex capable of introducing a single or double-strand break at a target site in the genome of said cell, wherein said protected polynucleotide donor DNA comprises a polynucleotide of interest to be inserted into the genome of said cell; and, b) selecting a cell from step (a) comprising a polynucleotide of interest inserted into a target site in its genome.
- nucleic acid constructs yeast, fungi, microorganisms, plants, plant cells, explants, seeds and grain having an altered target site or altered polynucleotide of interest produced by the methods described herein. Additional embodiments of the methods and compositions of the present disclosure are shown herein.
- Figure 1 depicts the structure of a high throughput gRNA cloning cassette (for example, but not limiting to, SEQ ID NO: 12 on pRF291 .
- the cassette is composed of a promoter (shown in solid black), DNA encoding a 5' ribozyme (shown in solid gray), a counter selection cassette flanked by two restriction sites (shown in horizontal line fill), a DNA encoding the CER domain (shown as CER) and a transcriptional terminator (dot fill).
- VT variable targeting domain with the correct overhanging ends
- the counterselection cassette horizontal stripe fill
- VT domain Vertical stripe
- Figure 2 depicts a variable targeting domain duplex (SEQ ID NO: 19 and SEQ ID NO:20)for use with the high-throughput plasmid pRF291 comprising SEQ ID NO: 19 and SEQ ID NO:20)
- Figure 3A-3D depicts different polynucleotide modification templates.
- Figure 3A depicts the wild type (WT) CAN1 locus with the CAN1 open reading frame (Vertical stripe fill) flanked by Homology arm 1 (Solid black fill) and Homology arm 2 (Diagonal stripe fill).
- Figure 3B depicts an unprotected (unmodified) polynucleotide modification template composed of two homology arms (Arm 1 , solid black fill and Arm 2, diagonal stripe fill).
- Figure 3C depicts an protected polynucleotide modification template composed of two homology arms (Arm 1 , solid black fill and Arm 2, diagonal stripe fill) with the 5' and 3' ends containing a desired modification (protection) to the DNA (dot fill).
- Figure 3D depicts a protected polynucleotide modification template composed of two homology arms (Arm 1 , solid black fill and Arm 2, diagonal stripe fill) that has been made into a circular molecule.
- Figure 4 Example PCR of the URA3 locus from cells treated with pRF437 showing colonies containing indel mutations with a band at the expected size for the WT URA3 locus and colonies containing deletion of the URA3 ORF by HDR containing the expected smaller band.
- CAN1 gene, Yarrowia lipolytica 23 pRF303 24 canl upstream homology arm 25
- Can1 polynucleotide modification template 34 C3S forward with /5SpC3/ upstream of first 5'base (A) listed in SEQ ID NO:35
- URA3 locus Yarrowia lipolytica 56 ura3-1 target site, Yarrowia lipolytica 57 ura3-1 F 58 ura3-1 R 59
- compositions and methods are provided for modifying a nucleotide sequence in the genome of a cell.
- the methods and compositions employ a guide polynucleotide, a protected polynucleotide modification template and a Cas endonuclease to modify a nucleotide sequence and/or to increase the frequency of homologous directed repair.
- the methods can further be used to decrease the frequency if off-site integration of any modification template.
- NHEJ Non-Homologous End Joining
- HDR Homology Directed Repair
- cell herein refers to any type of cell such as a prokaryotic or eukaryotic cell.
- a eukaryotic cell has a nucleus and other membrane-enclosed structures (organelles), whereas a prokaryotic cell lacks a nucleus.
- a cell in certain embodiments can be a mammalian cell or non-mammalian cell.
- Non-mammalian cells can be eukaryotic or prokaryotic.
- a non-mammalian cell herein can refer to a microbial cell or cell of a non-mammalian multicellular organism such as a plant, insect, nematode, avian species, amphibian, reptile, or fish.
- a microbial cell herein can refer to a fungal cell (e.g. , yeast cell), prokaryotic cell, protist cell (e.g. , algal cell), euglenoid cell, stramenopile cell, or oomycete cell, for example.
- a prokaryotic cell herein can refer to a bacterial cell or archaeal cell, for example.
- yeast refers to fungal species that predominantly exist in unicellular form. Yeast can alternatively be referred to as "yeast cells". A yeast herein can be characterized as either a conventional yeast or non-conventional yeast, for example.
- model yeast herein generally refers to Saccharomyces or Schizosaccharomyces yeast species.
- Conventional yeast in certain embodiments are yeast that favor homologous recombination (HR) DNA repair processes over repair processes mediated by non-homologous end-joining (NHEJ).
- HR homologous recombination
- NHEJ non-homologous end-joining
- non-conventional yeast refers to any yeast that is not a "conventional” ("model") yeast such as a Saccharomyces (e.g., S. cerevisiae, which is also known as budding yeast, baker's yeast, and/or brewer's yeast) or Schizosaccharomyces (e.g., S. pombe, which is also known as fission yeast) species.
- a non-conventional yeast in certain aspects herein can be one that reproduces asexually (anamorphic) or sexually (teleomorphic).
- non-conventional yeast herein typically exist in unicellular form, certain types of these yeast may optionally be able to form pseudohyphae (strings of connected budding cells).
- a non-conventional yeast may be haploid or diploid, and/or may have the ability to exist in either of these ploidy forms.
- Non-conventional yeast are described in Non-Conventional Yeasts in Genetics, Biochemistry and Biotechnology: Practical Protocols (K. Wolf, K.D. Breunig, G. Barth, Eds., Springer-Verlag, Berlin, Germany, 2003) and Spencer et al. (Appl. Microbiol. Biotechnol. 58: 147-156), which are incorporated herein by reference.
- Non-conventional yeast in certain embodiments may additionally (or alternatively) be yeast that favor NHEJ DNA repair processes over repair processes mediated by HR. Definition of a non-conventional yeast along these lines - preference of NHEJ over HR - is further disclosed by Chen et al. (PLoS ONE 8:e57952), which is incorporated herein by reference. Preferred non-conventional yeast herein are those of the genus Yarrowia (e.g., Yarrowia lipolytica).
- CRISPR loci Clustered Regularly Interspaced Short Palindromic Repeats (also known as SPIDRs-SPacer Interspersed Direct Repeats) constitute a family of DNA loci.
- CRISPR loci consist of short and highly conserved DNA repeats (typically 24 to 40 bp, repeated from 1 to 140 times - also referred to as CRISPR-repeats) which are partially palindromic.
- the repeated sequences (usually specific to a species) are interspaced by variable sequences of constant length (typically 20 to 58 bp depending on the CRISPR locus (WO2007/025097, published March 1 , 2007).
- CRISPR clustered regularly interspaced short palindromic repeats
- Cas CRISPR-associated systems
- WO2007/025097 published March 1 , 2007.
- the type II CRISPR/Cas system from bacteria employs a crRNA (CRISPR RNA) and tracrRNA (trans-activating CRISPR RNA) to guide the Cas endonuclease to its DNA target.
- the crRNA contains a region complementary to one strand of the double strand DNA target and a region that base pairs with the tracrRNA (trans-activating CRISPR RNA) forming a RNA duplex that directs the Cas endonuclease to cleave the DNA target.
- Cas gene includes a gene that is generally coupled, associated or close to, or in the vicinity of flanking CRISPR loci.
- the terms "Cas gene”, “CRISPR-associated (Cas) gene” are used interchangeably herein.
- a comprehensive review of the Cas protein family is presented in Haft et al. (2005) Computational Biology, PLoS Comput Biol 1 (6): e60. doi: 10.1371 /journal.pcbi.0010060.
- 41 CRISPR- associated (Cas) gene families are described, in addition to the four previously known gene families. It shows that CRISPR systems belong to different classes, with different repeat patterns, sets of genes, and species ranges.
- the number of Cas genes at a given CRISPR locus can vary between species.
- Cas endonuclease refers to a protein encoded by a Cas (CRISPR-associated) gene.
- a Cas endonuclease when in complex with a suitable polynucleotide component, is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific DNA target sequence.
- guide polynucleotide/Cas endonuclease complex As used herein, the terms “guide polynucleotide/Cas endonuclease complex”, “guide polynucleotide/Cas endonuclease system”, “ guide polynucleotide/Cas complex”, “guide polynucleotide/Cas system”, “guided Cas system” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease that are capable of forming a complex, wherein said guide polynucleotide/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site.
- a guide polynucleotide/Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the four known CRISPR systems (Horvath and Barrangou, Science 327: 167-170) such as a type I, II, or III CRISPR system.
- a Cas endonuclease unwinds the DNA duplex at the target sequence and optionally cleaves at least one DNA strand, as mediated by recognition of the target sequence by a polynucleotide (such as, but not limited to, a crRNA or guide RNA) that is in complex with the Cas protein.
- a Cas endonuclease typically occurs if the correct protospacer-adjacent motif (PAM) is located at or adjacent to the 3' end of the DNA target sequence.
- a Cas protein herein may lack DNA cleavage or nicking activity, but can still specifically bind to a DNA target sequence when complexed with a suitable RNA component.
- a guide polynucleotide/Cas endonuclease complex can cleave one or both strands of a DNA target sequence.
- a guide polynucleotide/Cas endonuclease complex that can cleave both strands of a DNA target sequence typically comprises a Cas protein that has all of its endonuclease domains in a functional state (e.g. , wild type endonuclease domains or variants thereof retaining some or all activity in each endonuclease domain).
- a wild type Cas protein e.g.
- a Cas9 protein disclosed herein is a suitable example of a Cas endonuclease that can cleave both strands of a DNA target sequence.
- a Cas9 protein comprising functional RuvC and HNH nuclease domains is an example of a Cas protein that can cleave both strands of a DNA target sequence.
- a guide polynucleotide/Cas endonuclease complex that can cleave one strand of a DNA target sequence can be characterized herein as having nickase activity (e.g. , partial cleaving capability).
- a Cas nickase typically comprises one functional endonuclease domain that allows the Cas to cleave only one strand (i.e. , make a nick) of a DNA target sequence.
- a Cas9 nickase may comprise (i) a mutant, dysfunctional RuvC domain and (ii) a functional HNH domain (e.g. , wild type HNH domain).
- a Cas9 nickase may comprise (i) a functional RuvC domain (e.g. , wild type RuvC domain) and (ii) a mutant, dysfunctional HNH domain.
- Non-limiting examples of Cas9 nickases suitable for use herein are disclosed by Gasiunas et al.
- a pair of Cas9 nickases can be used to increase the specificity of DNA targeting. In general, this can be done by providing two Cas9 nickases that, by virtue of being associated with RNA components with different guide sequences, target and nick nearby DNA sequences on opposite strands in the region for desired targeting. Such nearby cleavage of each DNA strand creates a double strand break (i.e. , a DSB with single-stranded overhangs), which is then recognized as a substrate for non- homologous-end-joining, NHEJ (leading to indel formation) or homologous recombination, HR.
- NHEJ non- homologous-end-joining
- HR homologous recombination
- Each nick in these embodiments can be at least about 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 (or any integer between 5 and 100) bases apart from each other, for example.
- One or two Cas9 nickase proteins herein can be used in a Cas9 nickase pair.
- a Cas9 nickase with a mutant RuvC domain, but functioning HNH domain i.e. , Cas9 HNH+/RuvC-
- Cas9 HNH+/RuvC- could be used (e.g. , Streptococcus pyogenes Cas9 HNH+/RuvC-).
- Each Cas9 nickase e.g. , Cas9 HNH+/RuvC-
- a Cas protein can be part of a fusion protein comprising one or more heterologous protein domains (e.g. , 1 , 2, 3, or more domains in addition to the Cas protein).
- a fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains, such as between Cas and a first heterologous domain.
- protein domains that may be fused to a Cas protein herein include, without limitation, epitope tags (e.g. , histidine [His], V5, FLAG, influenza hemagglutinin [HA], myc, VSV-G, thioredoxin [Trx]), reporters (e.g.
- GST glutathione-5-transferase
- HRP horseradish peroxidase
- CAT chloramphenicol acetyltransferase
- CAT beta-galactosidase
- GUS chloramphenicol acetyltransferase
- luciferase green fluorescent protein [GFP], HcRed, DsRed, cyan fluorescent protein [CFP], yellow fluorescent protein [YFP], blue fluorescent protein [BFP]
- domains having one or more of the following activities methylase activity, demethylase activity, transcription activation activity (e.g. , VP16 or VP64), transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.
- a Cas protein can also be in fusion with a protein that binds DNA molecules or other molecules, such as maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD), GAL4A DNA binding domain, and herpes simplex virus (HSV) VP16.
- MBP maltose binding protein
- S-tag S-tag
- DBD Lex A DNA binding domain
- GAL4A DNA binding domain GAL4A DNA binding domain
- HSV herpes simplex virus
- a Cas protein herein can be from any of the following genera: Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Haloarcula, Methanobacteriumn, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thernioplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifrx, Porphvromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myrococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium
- a Cas protein herein can be encoded, for example, by any of SEQ ID NOs:462-465, 467-472, 474- 477, 479-487, 489-492, 494-497, 499-503, 505-508, 510-516, or 517-521 as disclosed in U.S. Appl. Publ. No. 2010/0093617, which is incorporated herein by reference.
- a guide polynucleotide/Cas endonuclease complex in certain embodiments can bind to a DNA target site sequence, but does not cleave any strand at the target site sequence.
- Such a complex may comprise a Cas protein in which all of its nuclease domains are mutant, dysfunctional.
- a Cas9 protein herein that can bind to a DNA target site sequence, but does not cleave any strand at the target site sequence may comprise both a mutant, dysfunctional RuvC domain and a mutant, dysfunctional HNH domain.
- a Cas protein herein that binds, but does not cleave, a target DNA sequence can be used to modulate gene expression, for example, in which case the Cas protein could be fused with a transcription factor (or portion thereof) (e.g. , a repressor or activator, such as any of those disclosed herein).
- a transcription factor or portion thereof
- a repressor or activator such as any of those disclosed herein.
- the Cas endonuclease gene can be a gene encoding a Type II Cas9 endonuclease , such as but not limited to, Cas9 genes listed in SEQ ID NOs: 462, 474, 489, 494, 499, 505, and 518 of WO2007/025097published March 1 , 2007, and incorporated herein by reference.
- the Cas endonuclease gene can be operably linked to a SV40 nuclear targeting signal upstream of the Cas codon region and a bipartite VirD2 nuclear localization signal (Tinland et al. (1992) Proc. Natl. Acad. Sci. USA 89:7442-6) downstream of the Cas codon region.
- Cas9 (formerly referred to as Cas5, Csn1 , or Csx12) herein refers to a Cas endonuclease of a type II CRISPR system that forms a complex with a crNucleotide and a tracrNucleotide, or with a single guide polynucleotide, for specifically recognizing and cleaving all or part of a DNA target sequence.
- Cas9 protein comprises a RuvC nuclease domain and an HNH (H- N-H) nuclease domain, each of which can cleave a single DNA strand at a target sequence (the concerted action of both domains leads to DNA double-strand cleavage, whereas activity of one domain leads to a nick).
- the RuvC domain comprises subdomains I, II and III, where domain I is located near the N- terminus of Cas9 and subdomains II and III are located in the middle of the protein, flanking the HNH domain (Hsu et al, Cell 157: 1262-1278).
- a type II CRISPR system includes a DNA cleavage system utilizing a Cas9 endonuclease in complex with at least one polynucleotide component.
- a Cas9 can be in complex with a
- a Cas9 can be in complex with a single guide RNA.
- the amino acid sequence of a Cas9 protein described herein, as well as certain other Cas proteins herein, may be derived from a Streptococcus (e.g., S. pyogenes,
- S. pneumoniae S. thermophilus
- S. agalactiae S. parasanguinis
- S. oralis S. salivarius
- S. macacae S. dysgalactiae
- S. anginosus S. constellatus
- S. pseudoporcinus S. mutans
- Listeria e.g., L. innocua
- Spiroplasma e.g., S. apis, S. syrphidicola
- Peptostreptococcaceae Atopobium
- Porphyromonas e.g., P. catoniae
- Prevotella e.g., P. intermedia
- Veillonella Treponema (e.g., T. socranskii, T. denticola), Capnocytophaga, Finegoldia (e.g., F. magna), Coriobacteriaceae (e.g., C. bacterium), Olsenella (e.g., O. profusa), Haemophilus (e.g., H. sputorum, H. pittmaniae), Pasteurella (e.g., P. bettyae), Olivibacter (e.g., O. sitiensis), Epilithonimonas (e.g., E. tenax), Mesonia (e.g., M. mobilis), Lactobacillus (e.g., L plantarum), Bacillus (e.g., B. cereus), Aquimarina (e.g., A. muelleri),
- Chryseobacterium e.g., C. palustre
- Bacteroides e.g., B. graminisolvens
- Neisseria e.g., Neisseria
- a Cas9 protein can be any of the Cas9 proteins disclosed in Chylinski et al. (RNA Biology 10:726-737), which is incorporated herein by reference.
- sequence of a Cas9 protein herein can comprise, for example, any of the Cas9 amino acid sequences disclosed in GenBank Accession Nos. G3ECR1 (S. thermophilus), WP_026709422, WP_027202655, WP_027318179, WP_027347504, WP_027376815, WP_027414302, WP_027821588, WP_027886314, WP_027963583, WP_028123848, WP_028298935, Q03JI6 (S. thermophilus), EGP66723, EGS38969, EGV05092, EHI65578 (S.
- EIC75614 (S. oralis), EID22027 (S. constellatus), EIJ6971 1 , EJP22331 (S. oralis), EJP26004 (S. anginosus), EJP30321 , EPZ44001 (S. pyogenes), EPZ46028 (S. pyogenes), EQL78043 (S. pyogenes), EQL78548 (S. pyogenes), ERL1051 1 , ERL12345, ERL19088 (S. pyogenes), ESA57807 (S. pyogenes), ESA59254 (S.
- ESU85303 S. pyogenes
- ETS96804 UC75522, EGR87316 (S. dysgalactiae), EGS33732, EGV01468 (S. oralis), EHJ52063 (S. macacae), EID26207 (S. oralis), EID33364, EIG27013 (S. parasanguinis), EJF37476, EJ019166 (Streptococcus sp. BS35b), EJU16049, EJU32481 , YP_006298249, ERF61304, ERK04546, ETJ95568 (S.
- agalactiae TS89875, ETS90967 (Streptococcus sp. SR4), ETS92439, EUB27844 (Streptococcus sp. BS21 ), AFJ08616, EUC82735 (Streptococcus sp. CM6), EWC92088, EWC94390, EJP25691 , YP_008027038, YP_008868573, AGM26527, AHK22391 , AHB36273, Q927P4, G3ECR1 , or Q99ZW2 (S. pyogenes), which are incorporated by reference.
- a variant of any of these Cas9 protein sequences may be used, but should have specific binding activity, and optionally endonucleolytic activity, toward DNA when associated with an RNA component herein.
- Such a variant may comprise an amino acid sequence that is at least about 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the reference Cas9.
- a Cas9 protein herein can be encoded by any of SEQ ID NOs:462 (S. thermophilus), 474 (S. thermophilus), 489 (S. agalactiae), 494 (S. agalactiae), 499 (S. mutans), 505 (S. pyogenes), or 518 (S. pyogenes) as disclosed in U.S. Appl. Publ. No. 2010/0093617 (incorporated herein by reference), for example.
- a Cas9 protein may comprise an amino acid sequence that is at least about 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the foregoing amino acid sequences, for example.
- Such a variant Cas9 protein should have specific binding activity, and optionally cleavage or nicking activity, toward DNA when associated with an RNA component herein.
- the origin of a Cas protein used herein may be from the same species from which the RNA component(s) is derived, or it can be from a different species.
- an RGEN comprising a Cas9 protein derived from a Streptococcus species (e.g., S. pyogenes or S. thermophilus) may be complexed with at least one RNA component having a sequence (e.g., crRNA repeat sequence, tracrRNA sequence) derived from the same Streptococcus species.
- the origin of a Cas protein used herein may be from a different species from which the RNA component(s) is derived (the Cas protein and RNA component(s) may be heterologous to each other); such heterologous Cas/RNA component RGENs should have DNA targeting activity.
- Determining binding activity and/or endonucleolytic activity of a Cas protein herein toward a specific target DNA sequence may be assessed by any suitable assay known in the art, such as disclosed in U.S. Patent No. 8697359, which is disclosed herein by reference.
- Cas protein activity can be determined by expressing a Cas protein and suitable RNA component in a non-conventional yeast that has been provided a donor DNA comprising a sequence homologous to a sequence in, at or near the target site. The presence of donor DNA sequence at the target site (such as would be predicted by successful HR between the donor and target sequences) would indicate that targeting occurred.
- a Cas protein herein such as a Cas9 typically further comprises a heterologous nuclear localization sequence (NLS).
- a heterologous NLS amino acid sequence herein may be of sufficient strength to drive accumulation of a Cas protein in a detectable amount in the nucleus of a yeast cell herein, for example.
- An NLS may comprise one (monopartite) or more (e.g. , bipartite) short sequences (e.g. , 2 to 20 residues) of basic, positively charged residues (e.g. , lysine and/or arginine), and can be located anywhere in a Cas amino acid sequence but such that it is exposed on the protein surface.
- An NLS may be operably linked to the N-terminus or C-terminus of a Cas protein herein, for example.
- Two or more NLS sequences can be linked to a Cas protein, for example, such as on both the N- and C-termini of a Cas protein.
- suitable NLS sequences herein include those disclosed in U.S. Patent Nos. 6660830 and 7309576 (e.g. , Table 1 therein), which are both incorporated herein by reference.
- the Cas endonuclease can comprise a modified form of the Cas9 polypeptide.
- the modified form of the Cas9 polypeptide can include an amino acid change (e.g. , deletion, insertion, or substitution) that reduces the naturally-occurring nuclease activity of the Cas9 protein.
- the modified form of the Cas9 protein has less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1 % of the nuclease activity of the corresponding wild-type Cas9 polypeptide (US patent application US20140068797 A1 , published on March 6, 2014).
- the modified form of the Cas9 polypeptide has no substantial nuclease activity and is referred to as catalytically “inactivated Cas9” or “deactivated cas9 (dCas9).”
- Catalytically inactivated Cas9 variants include Cas9 variants that contain mutations in the HNH and RuvC nuclease domains. These catalytically inactivated Cas9 variants are capable of interacting with sgRNA and binding to the target site in vivo but cannot cleave either strand of the target DNA.
- a catalytically inactive Cas9 can be fused to a heterologous sequence (US patent application US20140068797 A1 , published on March 6, 2014).
- Suitable fusion partners include, but are not limited to, a polypeptide that provides an activity that indirectly increases transcription by acting directly on the target DNA or on a polypeptide (e.g. , a histone or other DNA-binding protein) associated with the target DNA.
- Additional suitable fusion partners include, but are not limited to, a polypeptide that provides for methy transferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity, or demyristoylation activity.
- Further suitable fusion partners include, but are not limited to, a polypeptide that directly provides for increased transcription of the target nucleic acid (e.g.
- a catalytically inactive Cas9 can also be fused to a Fokl nuclease to generate double strand breaks (Guilinger et al. Nature biotechnology, volume 32, number 6, June 2014).
- Any guided endonuclease can be used in the methods disclosed herein.
- Such endonucleases include, but are not limited to Cas9 and Cpf1 endonucleases.
- Many endonucleases have been described to date that can recognize specific PAM sequences (see for example -US patent applicationl 4/77271 1 filed March 12, 2014 and Zetsche B et al. 2015. Cell 163, 1013) and cleave the target DNA at a specific positions. It is understood that based on the methods and embodiments described herein utilizing a guided Cas system one can now tailor these methods such that they can utilize any guided endonuclease system.
- the terms "functional variant”, "Variant that is functionally equivalent” and “functionally equivalent variant” of a Cas endonuclease are used interchangeably herein, and refer to a variant of the Cas endonuclease of the present disclosure in which the ability to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break in) the target site is retained. Fragments and variants can be obtained via methods such as site-directed mutagenesis and synthetic construction.
- the Cas endonuclease gene includes a Yarrowia codon optimized Streptococcus pyogenes Cas9 gene that can recognize any genomic sequence of the form N(12-30)NGG can in principle be targeted or a Cas9 endonuclease originated from an organism selected from the group consisting of Brevibacillus laterosporus, Lactobacillus reuteri Mlc3, Lactobacillus rossiae DSM 15814, Pediococcus pentosaceus SL4, Lactobacillus nodensis JCM 14932, Sulfurospirillum sp.
- the Cas endonuclease can be provided to a cell by any method known in the art, for example, but not limited to transient introduction methods, transfection and/or topical application or indirectly via recombination constructs.
- Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain, and include restriction endonucleases that cleave DNA at specific sites without damaging the bases. Restriction endonucleases include Type I, Type II, Type III, and Type IV endonucleases, which further include subtypes. In the Type I and Type III systems, both the methylase and restriction activities are contained in a single complex.
- Endonucleases also include meganucleases, also known as homing endonucleases (HEases), which like restriction endonucleases, bind and cut at a specific recognition site, however the recognition sites for meganucleases are typically longer, about 18 bp or more (patent application WO-PCT PCT/US 12/30061 filed on March 22, 2012). Meganucleases have been classified into four families based on conserved sequence motifs, the families are the LAGLIDADG, GIY-YIG, H-N-H, and His-Cys box families. These motifs participate in the coordination of metal ions and hydrolysis of phosphodiester bonds.
- HEases homing endonucleases
- HEases are notable for their long recognition sites, and for tolerating some sequence polymorphisms in their DNA substrates.
- the naming convention for meganuclease is similar to the convention for other restriction endonuclease.
- Meganucleases are also characterized by prefix F-, I-, or PI- for enzymes encoded by free-standing ORFs, introns, and inteins, respectively.
- One step in the recombination process involves polynucleotide cleavage at or near the recognition site. This cleaving activity can be used to produce a double-strand break.
- recombinase is from the Integrase or Resolvase families.
- TAL effector nucleases are a new class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a non-conventional yeast or other organism.
- Zinc finger nucleases ZFNs are engineered double- strand break inducing agents comprised of a zinc finger DNA binding domain and a double-strand-break-inducing agent domain. Recognition site specificity is conferred by the zinc finger domain, which typically comprising two, three, or four zinc fingers, for example having a C2H2 structure, however other zinc finger structures are known and have been engineered.
- Zinc finger domains are amenable for designing polypeptides which specifically bind a selected polynucleotide recognition sequence.
- ZFNs include an engineered DNA-binding zinc finger domain linked to a non-specific endonuclease domain, for example nuclease domain from a Type Ms endonuclease such as Fokl. Additional functionalities can be fused to the zinc-finger binding domain, including transcriptional activator domains, transcription repressor domains, and methylases. In some examples, dimerization of nuclease domain is required for cleavage activity.
- Each zinc finger recognizes three consecutive base pairs in the target DNA. For example, a 3 finger domain recognized a sequence of 9 contiguous nucleotides, with a dimerization requirement of the nuclease, two sets of zinc finger triplets are used to bind an 18 nucleotide recognition sequence.
- the term "guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease and enables the Cas endonuclease to recognize, bind to, and optionally cleave a DNA target site.
- the guide polynucleotide can be a single molecule or a double molecule.
- the guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence).
- the guide polynucleotide can comprise at least one nucleotide, phosphodiester bond or linkage modification such as, but not limited, to Locked Nucleic Acid (LNA), 5-methyl dC, 2,6- Diaminopurine, 2'-Fluoro A, 2'-Fluoro U, 2'-O-Methyl RNA, phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5' to 3' covalent linkage resulting in circularization.
- LNA Locked Nucleic Acid
- 5-methyl dC 2,6- Diaminopurine
- 2'-Fluoro A 2,6- Diaminopurine
- 2'-Fluoro U 2'-Fluoro U
- 2'-O-Methyl RNA phosphorothioate bond
- a guide polynucleotide that solely comprises ribonucleic acids is also referred to as a "guide RNA” or "gRNA” ( See also U.S. Patent Application US 2015-0082478 A1 , published on March 19, 2015 and US 2015-0059010 A1 , published on February 26, 2015, both are hereby incorporated in its entirety by reference).
- the guide polynucleotide can be a double molecule (also referred to as duplex guide polynucleotide) comprising a crNucleotide sequence and a tracrNucleotide sequence.
- the crNucleotide includes a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that can hybridize to a nucleotide sequence in a target DNA and a second nucleotide sequence (also referred to as a tracr mate sequence) that is part of a Cas endonuclease recognition (CER) domain.
- VT domain Variable Targeting domain
- CER Cas endonuclease recognition
- the tracr mate sequence can hybridized to a tracrNucleotide along a region of complementarity and together form the Cas endonuclease recognition domain or CER domain.
- the CER domain is capable of interacting with a Cas endonuclease polypeptide.
- the crNucleotide and the tracrNucleotide of the duplex guide polynucleotide can be RNA, DNA, and/or RNA-DNA- combination sequences.
- the crNucleotide molecule of the duplex guide polynucleotide is referred to as "crDNA” (when composed of a contiguous stretch of DNA nucleotides) or "crRNA” (when composed of a contiguous stretch of RNA nucleotides), or “crDNA- RNA” (when composed of a combination of DNA and RNA nucleotides).
- the crNucleotide can comprise a fragment of the cRNA naturally occurring in Bacteria and Archaea.
- the size of the fragment of the cRNA naturally occurring in Bacteria and Archaea that can be present in a crNucleotide disclosed herein can range from, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides.
- the tracrNucleotide is referred to as "tracrRNA” (when composed of a contiguous stretch of RNA nucleotides) or "tracrDNA” (when composed of a contiguous stretch of DNA nucleotides) or “tracrDNA-RNA” (when composed of a combination of DNA and RNA nucleotides.
- the RNA that guides the RNA/ Cas9 endonuclease complex is a duplexed RNA comprising a duplex crRNA-tracrRNA.
- the tracrRNA (trans-activating CRISPR RNA) contains, in the 5'-to-3' direction, (i) a sequence that anneals with the repeat region of CRISPR type II crRNA and (ii) a stem loop-containing portion (Deltcheva et al. , Nature 471 :602-607).
- the duplex guide polynucleotide can form a complex with a Cas endonuclease, wherein said guide polynucleotide/Cas endonuclease complex (also referred to as a guide polynucleotide/Cas endonuclease system) can direct the Cas endonuclease to a genomic target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) into the target site.
- a guide polynucleotide/Cas endonuclease system can direct the Cas endonuclease to a genomic target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) into the target site.
- the guide polynucleotide can also be a single molecule (also referred to as single guide polynucleotide) comprising a crNucleotide sequence linked to a tracrNucleotide sequence.
- the single guide polynucleotide comprises a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that can hybridize to a nucleotide sequence in a target DNA and a Cas endonuclease recognition domain (CER domain), that interacts with a Cas endonuclease polypeptide.
- VT domain Variable Targeting domain
- CER domain Cas endonuclease recognition domain
- domain it is meant a contiguous stretch of nucleotides that can be RNA, DNA, and/or RNA-DNA-combination sequence.
- the VT domain and /or the CER domain of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA-combination sequence.
- the single guide polynucleotide being comprised of sequences from the crNucleotide and the tracrNucleotide may be referred to as "single guide RNA” (when composed of a contiguous stretch of RNA nucleotides) or "single guide DNA” (when composed of a contiguous stretch of DNA nucleotides) or “single guide RNA-DNA” (when composed of a combination of RNA and DNA nucleotides).
- the single guide polynucleotide can form a complex with a Cas endonuclease, wherein said guide polynucleotide/Cas endonuclease complex (also referred to as a guide polynucleotide/Cas endonuclease system) can direct the Cas endonuclease to a genomic target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the target site.
- a guide polynucleotide/Cas endonuclease system can direct the Cas endonuclease to a genomic target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the target site.
- variable targeting domain or "VT domain” is used interchangeably herein and includes a nucleotide sequence that can hybridize (is complementary) to one strand (nucleotide sequence) of a double strand DNA target site.
- the % complementation between the first nucleotide sequence domain (VT domain ) and the target sequence can be at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
- variable targeting domain can be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides.
- the variable targeting domain can be composed of a DNA sequence, a RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.
- CER domain of a guide polynucleotide
- CER domain includes a nucleotide sequence that interacts with a Cas endonuclease polypeptide.
- a CER domain comprises a tracrNucleotide mate sequence followed by a tracrNucleotide sequence.
- the CER domain can be composed of a DNA sequence, a RNA sequence, a modified DNA sequence, a modified RNA sequence (see for example US 2015-0059010 A1 , published on February 26, 2015, incorporated in its entirety by reference herein), or any combination thereof.
- the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence.
- the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can be at least 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98
- the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a tetraloop sequence, such as, but not limiting to a GAAA tetraloop sequence.
- Nucleotide sequence modification of the guide polynucleotide, VT domain and/or CER domain can be selected from, but not limited to , the group consisting of a 5' cap, a 3' polyadenylated tail, a riboswitch sequence, a stability control sequence, a sequence that forms a dsRNA duplex, a modification or sequence that targets the guide poly nucleotide to a subcellular location, a modification or sequence that provides for tracking , a modification or sequence that provides a binding site for proteins , a Locked Nucleic Acid (LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine nucleotide, a 2'-Fluoro A nucleotide, a 2'-Fluoro U nucleotide; a 2'-0-Methyl RNA nucleotide, a phosphorothioate bond, linkage to a cholesterol
- LNA
- the additional beneficial feature is selected from the group of a modified or regulated stability, a subcellular targeting, tracking, a fluorescent label, a binding site for a protein or protein complex, modified binding affinity to complementary target sequence, modified resistance to cellular degradation, and increased cellular permeability.
- RNA, crRNA or tracrRNA are used interchangeably herein, and refer to a portion or subsequence of the guide RNA, crRNA or tracrRNA , respectively, of the present disclosure in which the ability to function as a guide RNA, crRNA or tracrRNA, respectively, is retained.
- RNA, crRNA or tracrRNA are used interchangeably herein, and refer to a variant of the guide RNA, crRNA or tracrRNA, respectively, of the present disclosure in which the ability to function as a guide RNA, crRNA or tracrRNA, respectively, is retained.
- single guide RNA and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to a tracrRNA (trans-activating CRISPR RNA).
- CRISPR RNA crRNA
- variable targeting domain linked to a tracr mate sequence that hybridizes to a tracrRNA
- trans-activating CRISPR RNA trans-activating CRISPR RNA
- the single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR/Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site.
- guide RNA/Cas endonuclease complex refers to at least one RNA component and at least one Cas endonuclease that are capable of forming a complex, wherein said guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site.
- RNA component of an RGEN contains a ribonucleotide sequence that is complementary to a strand of a DNA target sequence. This complementary RNA sequence is also referred to herein as a "variable targeting domain" sequence.
- a guide RNA/Cas endonuclease complex herein can comprise Cas protein(s) and suitable RNA component(s) of any of the four known CRISPR systems (Horvath and Barrangou, Science 327: 167-170) such as a type I, II, or III CRISPR system.
- a guide RNA/Cas endonuclease complex can comprise a Type II Cas9 endonuclease and at least one RNA component (e.g.
- the guide polynucleotide can be introduced into a cell transiently, as single stranded polynucleotide or a double stranded polynucleotide, using any method known in the art such as, but not limited to, particle bombardment, Agrobacterium transformation or topical applications.
- the guide polynucleotide can also be introduced indirectly into a cell by introducing a recombinant DNA molecule (via methods such as, but not limited to, particle bombardment or Agrobacterium transformation) comprising a heterologous nucleic acid fragment encoding a guide polynucleotide, operably linked to a specific promoter that is capable of transcribing the guide RNA in said cell.
- the specific promoter can be, but is not limited to, a RNA polymerase III promoter, which allow for transcription of RNA with precisely defined, unmodified, 5'- and 3'-ends (DiCarlo et al., Nucleic Acids Res. 41 : 4336-4343; Ma et al., Mol. Ther. Nucleic Acids 3:e161 ).
- target site refers to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, or any other DNA molecule in the genome (including chromosomal, choloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide/Cas endonuclease complex can recognize, bind to, and optionally nick or cleave .
- the target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature.
- endogenous target sequence and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell.
- Cells include, but are not limited to, human, non- human, animal, bacterial, archaeal, fungal, insect, yeast, non-conventional yeast, plant cells, plants, seeds as well as microorganisms produced by the methods described herein.
- An "artificial target site” or “artificial target sequence” are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a cell. Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a cell but be located in a different position (i.e. , a non-endogenous or non-native position) in the genome of a cell.
- an "altered target site”, “altered target sequence”, “modified target site”, “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence.
- Such "alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i) - (iii).
- the length of the target DNA sequence can vary, and includes, for example, target sites that are at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length. It is further possible that the target site can be palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand.
- the nick/cleavage site can be within the target sequence or the nick/cleavage site could be outside of the target sequence.
- the cleavage could occur at nucleotide positions immediately opposite each other to produce a blunt end cut or, in other Cases, the incisions could be staggered to produce single-stranded overhangs, also called "sticky ends", which can be either 5' overhangs, or 3' overhangs.
- Active variants of genomic target sites can also be used. Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the given target site, wherein the active variants retain biological activity and hence are capable of being recognized and cleaved by an Cas endonuclease.
- Assays to measure the single or double-strand break of a target site by an endonuclease are known in the art and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites.
- An "episome” herein refers to a DNA molecule that can exist in a yeast cell autonomously (can replicate and pass on to daughter cells) apart from the chromosomes of the yeast cell.
- Episomal DNA can be either native or heterologous to a yeast cell. Examples of native episomes herein include mitochondrial DNA (mtDNA). Examples of heterologous episomes herein include plasmids and yeast artificial chromosomes (YACs).
- a "protospacer adjacent motif" herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide/Cas endonuclease system described herein.
- the Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence.
- the sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used.
- the PAM sequence can be of any length but is typically 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.
- RNA polymerase II RNA polymerase II transcribes mRNA in eukaryotes.
- Messenger RNA capping occurs generally as follows: The most terminal 5' phosphate group of the mRNA transcript is removed by RNA terminal phosphatase, leaving two terminal phosphates.
- guanosine monophosphate is added to the terminal phosphate of the transcript by a guanylyl transferase, leaving a 5 -5' triphosphate-linked guanine at the transcript terminus. Finally, the 7-nitrogen of this terminal guanine is methylated by a methyl transferase.
- RNA having, for example, a 5'-hydroxyl group instead of a 5' -cap Such RNA can be referred to as "uncapped RNA", for example. Uncapped RNA can better accumulate in the nucleus following transcription, since 5'-capped RNA is subject to nuclear export. One or more RNA components herein are uncapped.
- ribozyme and "ribonucleic acid enzyme” are used interchangeably herein.
- a ribozyme refers to one or more RNA sequences that form secondary, tertiary, and/or quaternary structure(s) that can cleave RNA at a specific site.
- a ribozyme herein can be a hammerhead (HH) ribozyme, hepatitis delta virus (HDV) ribozyme, group I intron ribozyme, RnaseP ribozyme, or hairpin ribozyme, for example.
- HH hammerhead
- HDV hepatitis delta virus
- a ribozyme includes a "self-cleaving ribozyme” that is capable of cleaving RNA at a cis-site relative to the ribozyme sequence (i.e., auto-catalytic, or self- cleaving).
- the general nature of ribozyme nucleolytic activity has been described (e.g. , Lilley, Biochem. Soc. Trans. 39:641 -646).
- a "hammerhead ribozyme” (HHR) herein may comprise a small catalytic RNA motif made up of three base-paired stems and a core of highly conserved, non-complementary nucleotides that are involved in catalysis. Pley et al.
- RNA 18:871 -885 disclose hammerhead ribozyme structure and activity.
- Other non-limiting examples of ribozymes herein include Varkud satellite (VS) ribozymes, glucosamine-6-phosphate activated ribozymes (glmS), and CPEB3 ribozymes.
- VS Varkud satellite
- glmS glucosamine-6-phosphate activated ribozymes
- CPEB3 ribozymes discloses information pertaining to ribozyme structure and activity.
- Examples of ribozymes that should be suitable for use herein include ribozymes disclosed in EP0707638 and U.S. Patent Nos. 6063566, 5580967, 5616459, and 5688670, which are incorporated herein by reference.
- a hammerhead ribozyme herein may comprise a "minimal hammerhead" sequence as disclosed by Scott et al. (Cell 81 :991 -1002, incorporated herein by reference), for example.
- a hammerhead ribozyme may be a type I, type II, or type III hammerhead ribozyme, for example, as disclosed in Hammann et al. (RNA 18:871 - 885), which is incorporated herein by reference.
- Multiple means for identifying DNA encoding a hammerhead ribozyme are disclosed in Hammann et al. , which can be utilized accordingly herein.
- a hammerhead ribozyme herein may be derived from a virus, viroid, plant virus satellite RNA, prokaryote (e.g. , Archaea, cyanobacteria, acidobacteria), or eukaryote such as a plant (e.g. , Arabidopsis thaliana, carnation), protist (e.g. , amoeba, euglenoid), fungus (e.g. , Aspergillus, Y. lipolytica), amphibian (e.g. , newt, frog), schistosome, insect (e.g. , cricket), mollusc, mammal (e.g. , mouse, human), or nematode, for example.
- prokaryote e.g. , Archaea, cyanobacteria, acidobacteria
- eukaryote such as a plant (e.g.
- a hammerhead ribozyme herein typically comprises three base-paired helices, each respectively referred to as helix I, II and III, separated by short linkers of conserved sequences.
- the three types of hammerhead ribozymes (l-lll) are generally based on which helix the 5' and 3' ends of the ribozyme are comprised in. For example, if the 5' and 3' ends of a hammerhead ribozyme sequence contribute to stem I, then it can be referred to as a type I hammerhead ribozyme.
- type I can be found in the genomes of prokaryotes, eukaryotes and RNA plant pathogens, whereas type II hammerhead ribozymes have only been described in prokaryotes, and type III hammerhead ribozymes are mostly found in plants, plant pathogens and prokaryotes.
- a hammerhead ribozyme in certain embodiments is a type I hammerhead ribozyme.
- sequence encoding a hammerhead ribozyme can comprise at least about 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, or 150 (or any integer between 40 and 150) nucleotides, 40-100 nucleotides, or 40-60 nucleotides.
- the method comprises a method of targeting an RNA-guided endonuclease (RGEN) to a target site sequence on a chromosome or episome in a non-conventional yeast, said method comprising providing to said yeast a first recombinant DNA construct comprising a DNA sequence encoding a Cas endonuclease, a protected polynucleotide modification template, and at least a second recombinant DNA construct comprising a DNA sequence encoding a ribozyme upstream of an RNA component, wherein the RNA transcribed from the second recombinant DNA construct autocatalytically removes the ribozyme to yield said RNA component , wherein the RNA component and the Cas9 endonuclease can form an RGEN that can bind to all or part of the target site sequence.
- RGEN RNA-guided endonuclease
- a DNA polynucleotide comprising a ribozyme-guide RNA cassette could comprise a suitable transcription termination sequence downstream of the guide RNA component sequence.
- transcription termination sequences useful herein are disclosed in U.S. Pat. Appl. Publ. No. 2014/0186906, which is herein incorporated by reference.
- an S. cerevisiae Sup4 gene transcription terminator sequence can be used.
- Such embodiments typically do not comprise a ribozyme sequence located downstream from a ribozyme-RNA component cassette.
- such embodiments typically comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, or more residues following the end of the RNA component sequence, depending on the choice of terminator sequence.
- additional residues can be all U residues, or at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% U residues, for example, depending on the choice of terminator sequence.
- a ribozyme sequence (e.g., hammerhead or HDV ribozyme) can be 3' of (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides) the RNA component sequence; the RNA component sequence in such embodiments is flanked by upstream and downstream ribozymes.
- a 3' ribozyme sequence can be positioned accordingly such that it cleaves itself from the RNA component sequence; such cleavage would render a transcript ending exactly at the end of the RNA component sequence, or with 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or more residues following the end of the RNA component sequence, for example.
- DNA targeting herein may be the specific introduction of a knock-out, edit, or knock-in at a particular DNA sequence, such as in a chromosome or plasm id of a cell.
- DNA targeting can be performed herein by cleaving one or both strands at a specific DNA sequence in a cell with a Cas protein associated with a suitable polynucleotide component. Such DNA cleavage, if a double-strand break (DSB), can prompt NHEJ or HDR processes which can lead to modifications at the target site.
- DSB double-strand break
- a knock-out represents a DNA sequence of a cell that has been rendered partially or completely inoperative by targeting with a Cas protein; such a DNA sequence prior to knock-out could have encoded an amino acid sequence, or could have had a regulatory function (e.g., promoter), for example.
- a knock-out may be produced by an indel (insertion or deletion of nucleotide bases in a target DNA sequence through NHEJ), or by specific removal of sequence that reduces or completely destroys the function of sequence at or near the targeting site.
- An indel may be of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more bases, for example.
- An indel in certain embodiments can be even larger, at least about 20, 30, 40, 50, 60, 70, 80, 90, or 100 bases If an indel is introduced within an open reading frame (ORF) of a gene, oftentimes the indel disrupts wild type expression of protein encoded by the ORF by creating a frameshift mutation.
- ORF open reading frame
- the guide polynucleotide/Cas endonuclease system can be used in combination with a co-delivered polynucleotide modification template to allow for editing (modification) of a genomic nucleotide sequence of interest.
- a co-delivered polynucleotide modification template to allow for editing (modification) of a genomic nucleotide sequence of interest.
- a "modified nucleotide” or “edited nucleotide” refers to a nucleotide sequence of interest that comprises at least one alteration when compared to its non-modified nucleotide sequence. Such "alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i) - (iii).
- polynucleotide modification template includes a polynucleotide that comprises at least one nucleotide modification when compared to the nucleotide sequence to be edited.
- a nucleotide modification can be at least one nucleotide substitution (replacement of at least one nucleotide), one nucleotide addition (insertion of at least one nucleotide), a deletion of at least one nucleotide, or any combination thereof.
- the polynucleotide modification template can further comprise homologous nucleotide sequences flanking the at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.
- a polynucleotide modification template that does not comprise a protection at its 5' or 3' end is referred to as an "unprotected polynucleotide modification template".
- protected polynucleotide modification template or " protected polynucleotide editing template” are used interchangeably herein and include a polynucleotide modification template molecule that has at least one modification (referred to as a protection or protection molecule) at at least one end (its 5' end, or its 3' end, or both its 5' and 3' end).
- a protection at the 5' or 3' end includes any modification to the polynucleotide modification template that renders the template more stable (protected) as is evidence by increased HDR, decreased NHEJ, or decreased off-site integration, or any one combination thereof.
- the protection molecule can alter template stability by protecting the template from exonucleases within the cell and/or alter the ability of the template to act as a substrate for non-homologous end-joining (NHEJ).
- NHEJ non-homologous end-joining
- the protected polynucleotide modification templates may interact better with the proteins of homology directed repair or more poorly with the proteins of non-homologous end- joining when compared to the unprotected polynucleotide donor.
- a protected polynucleotide can be a single stranded or double stranded linear or circular molecule.
- a circular template also contains protected (modified) ends as the typical 5' phosphate group and 3' hydroxyl group of a linear DNA molecule are replaced with phosphodiester bonds to the next 5' or 3' base in a circular molecule.
- the polynucleotide modification template can be incorporated (for example via NHEJ) into other spontaneous locations of DNA damage.
- the incorporation of a fragment of DNA via NHEJ has a final DNA ligation step where the 5' phosphate and 3' hydroxyl group of the DNA ends are being joined.
- a suitable 5' phosphate group may not be available or may be blocked by modifications, thereby preventing off-site integration of the template.
- the term "increased" as used herein may refer to a quantity or activity that is at least about 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 % ,22% , 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200%, or 250% more than the quantity or activity for which the increased quantity or activity is being compared.
- Non-limiting examples of protected polynucleotide modification templates are circular DNA polynucleotide modification templates (with no available double strand ends), linear double stranded DNA polynucleotide modification templates comprising at least one protection molecule consisting of a three carbon alkane spacer on the 5' end of each strand, and linear polynucleotide modification templates comprising at least one protection molecule consisting of at least 1 , 2, 3, 4, or five 5' most phophodiester bonds replaced with phosphorothioate bonds on each strand.
- protected polynucleotide modification templates include templates comprising protection molecules such as, but not limited to, an alkane spacer, a fluorophore, a NHS ester, a Digoxigen, a Cholesteryl-TEG, a C6, a C12, a Hexynyl, an Oxtadiynyl dUTP, a Biotin, a Dithiol, an inverted Dideoxy-T modification, or any one combination thereof.
- protection molecules such as, but not limited to, an alkane spacer, a fluorophore, a NHS ester, a Digoxigen, a Cholesteryl-TEG, a C6, a C12, a Hexynyl, an Oxtadiynyl dUTP, a Biotin, a Dithiol, an inverted Dideoxy-T modification, or any one combination thereof.
- the disclosure describes a method for selecting a cell comprising a modified nucleotide sequence in its genome, the method comprising: a.) providing a guide polynucleotide, a protected polynucleotide modification template and a Cas endonuclease to a cell, wherein said Cas endonuclease and guide polynucleotide can form a complex capable of introducing a single or double-strand break at a target site in genome of said cell, wherein said protected polynucleotide modification template comprises at least one nucleotide modification of said nucleotide sequence; and, b.) selecting a cell from step (a) comprising said modified nucleotide sequence.
- the method can further comprise determining the frequency of Homologous Directed Repair (HDR) and Non-Homologous End Joining (NHEJ) in said cell.
- HDR Homologous Directed Repair
- NHEJ Non-Homologous End
- the frequency of HDR can be increased by at least about 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 % ,22% , 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200%, or 250% when compared to the frequency of HDR derived from a control method having all the same components and steps as the method described herein except for using an unprotected (control) polynucleotide modification template.
- the frequency of NHEJ can be decreased by at least about 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 % ,22% , 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% when compared to the frequency of NHEJ derived from a control method having all the same components and steps as the method of described herein except for using an unprotected (control) polynucleotide modification template.
- the disclosure describes a method for editing a nucleotide sequence in the genome of a cell, the method comprising providing a guide polynucleotide, a protected polynucleotide modification template, and at least one Cas endonuclease to a cell, wherein the Cas endonuclease is capable of introducing a single or double-strand break at a target sequence in the genome of said cell, wherein said polynucleotide modification template includes at least one nucleotide modification of said nucleotide sequence.
- the nucleotide to be edited can be located within or outside a target site recognized and cleaved by a Cas endonuclease.
- the at least one nucleotide modification is not a modification at a target site recognized and cleaved by a Cas endonuclease.
- Cells include, but are not limited to, human, non-human, animal, bacterial, archaeal, fungal, microbial, insect, yeast, and plant cells, plants, seeds, as well as microorganisms produced by the methods described herein.
- yeast herein include conventional yeast and non-conventional yeast.
- Conventional yeast in certain embodiments are yeast that favor homologous recombination (HR) DNA repair processes over repair processes mediated by non-homologous end-joining (NHEJ).
- yeast herein include species of the genera Saccharomyces (e.g., S. cerevisiae, which is also known as budding yeast, baker's yeast, and/or brewer's yeast; S. bayanus; S.
- Plant cells include cells selected from the group consisting of maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, turfgrass, or switchgrass, soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis, and safflower cells.
- a non-conventional yeast herein is not a conventional yeast such as a Saccharomyces (e.g., S. cerevisiae) or Schizosaccharomyces (e.g., S. pombe) species.
- Non-conventional yeast in certain embodiments can be yeast that favor NHEJ DNA repair processes over repair processes mediated by HR.
- Conventional yeasts such as S. cerevisiae and S.
- pombe typically exhibit specific integration of donor DNA with short flanking homology arms (30-50 bp) with efficiencies routinely over 70%, whereas non-conventional yeasts such as Pichia pastoris, Pichia stipitis, Hansenula polymorpha, Yarrowia lipolytica and Kluyveromyces lactis usually show specific integration with similarly structured donor DNA at efficiencies of less than 1 % (Chen et al. , PLoS ONE 8:e57952).
- a preference for HR processes can be gauged, for example, by transforming yeast with a suitable donor DNA and determining the degree to which it is specifically recombined with a genomic site predicted to be targeted by the donor DNA.
- NHEJ or low preference for HR
- Assays for determining the rate of specific (HR-mediated) and/or random (NHEJ-mediated) integration of DNA in yeast are known in the art (e.g., Ferreira and Cooper, Genes Dev. 18:2249-2254; Corrigan et al. , PLoS ONE 8:e69628; Weaver et al. , Proc. Natl. Acad. Sci. U. S.A. 78:6354-6358; Keeney and Boeke, Genetics 136:849-856).
- non-conventional yeast herein can (i) exhibit a rate of specific targeting by a suitable donor DNA having 30-50 bp flanking homology arms of less than about 1 %, 2%, 3%, 4%, 5%, , 6%, 7%, or 8%, for example, and/or (ii) exhibit a rate of random integration of the foregoing donor DNA of more than about 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, or 75%, for example.
- rates of (i) specific targeting and/or (ii) random integration of a suitable donor DNA can characterize a non-conventional yeast as it exists before being provided an RGEN as disclosed herein.
- An aim for providing an RGEN to a non-conventional yeast in certain embodiments is to create site-specific DNA single-strand breaks (SSB) or double- strand breaks (DSB) for biasing the yeast toward HR at the specific site.
- SSB site-specific DNA single-strand breaks
- DSB double- strand breaks
- providing a suitable RGEN in a non-conventional yeast typically should allow the yeast to exhibit an increased rate of HR with a particular donor DNA.
- Such an increased rate can be at least about 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold higher than the rate of HR in a suitable control (e.g.
- the methods and compositions described herein employ a guide polynucleotide, a protected polynucleotide modification template and a Cas endonuclease to modify a nucleotide sequence and/or to increase the frequency of homologous directed repair.
- the protected polynucleotide template can comprise two homology arms separated by at least one heterologous gene expression cassette. The methods can further be used to decrease the frequency if off-site integration of any modification template.
- the disclosure describes a method for selecting a microbial cell comprising a modified nucleotide sequence in its genome, the method comprising a) providing a guide polynucleotide, at least one protected polynucleotide modification template and a Cas endonuclease to a cell, wherein said Cas endonuclease and guide polynucleotide can form a complex capable of introducing a single or double-strand break at a target site in genome of said cell, wherein said protected polynucleotide modification template comprises at least one nucleotide modification of said nucleotide sequence; b) selecting a cell from step (a) comprising said modified nucleotide sequence, and c) further determining the frequency of off-site integration of the protected polynucleotide modification template in said cell.
- the frequency of off-site integration of the protected polynucleotide modification template in said cell can be decreased by 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 % ,22% , 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%or 100% when compared to the frequency of off-site integration derived from a control method having all the same components as the methods described herein except for using an unprotected (control) polynucleotide modification template.
- knock-in represents the replacement or insertion of a DNA sequence at a specific DNA sequence in cell by targeting with a Cas protein (by HR, wherein a suitable donor DNA polynucleotide is also used).
- Examples of knock-ins are a specific insertion of a heterologous amino acid coding sequence in a coding region of a gene, or a specific insertion of a transcriptional regulatory element in a genetic locus.
- compositions can be employed to obtain a cell or organism having a polynucleotide of interest inserted in a target site for a Cas endonuclease. Such methods can employ homologous recombination to provide integration of the polynucleotide of Interest at the target site.
- a polynucleotide of interest is provided to the organism cell in a donor DNA construct.
- donor DNA or “donor polynucleotide” is a DNA construct that comprises a polynucleotide of interest to be inserted into the target site of a Cas endonuclease.
- the donor DNA construct can further comprise a first and a second region of homology that flank the polynucleotide of Interest.
- the first and second regions of homology of the donor DNA share homology to a first and a second genomic region, respectively, present in or flanking the target site of the cell or organism genome.
- homology is meant DNA sequences that are similar.
- a "region of homology to a genomic region” that is found on the donor DNA is a region of DNA that has a similar sequence to a given "genomic region" in the cell or organism genome.
- a region of homology can be of any length that is sufficient to promote homologous recombination at the cleaved target site.
- the region of homology can comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5- 50, 5-55, 5-60, 5-65, 5- 70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5- 500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1 100, 5-1200, 5-1300, 5-1400, 5-1500, 5- 1600, 5-1700, 5-1800, 5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5- 2600, 5-2700, 5-2800, 5-2900, 5-3000, 5-3100 or more bases in length such that the region of homology has sufficient homology to undergo homologous recombination with the corresponding genomic region.
- “Sufficient homology” indicates that two polynucleotide sequences have sufficient structural similarity to act as substrates for a homologous recombination reaction.
- the structural similarity includes overall length of each polynucleotide fragment, as well as the sequence similarity of the polynucleotides. Sequence similarity can be described by the percent sequence identity over the whole length of the sequences, and/or by conserved regions comprising localized similarities such as contiguous nucleotides having 100% sequence identity, and percent sequence identity over a portion of the length of the sequences.
- the amount of homology or sequence identity shared by a target and a donor polynucleotide can vary and includes total lengths and/or regions having unit integral values in the ranges of about 1 -20 bp, 20-50 bp, 50-100 bp, 75-150 bp, 100-250 bp, 150-300 bp, 200-400 bp, 250-500 bp, 300-600 bp, 350-750 bp, 400-800 bp, 450-900 bp, 500-1000 bp, 600-1250 bp, 700-1500 bp, 800-1750 bp, 900-2000 bp, 1 -2.5 kb, 1 .5-3 kb, 2-4 kb, 2.5-5 kb, 3-6 kb, 3.5-7 kb, 4-8 kb, 5-10 kb, or up to and including the total length of the target site.
- ranges include every integer within the range, for example, the range of 1 -20 bp includes 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 and 20 bps.
- the amount of homology can also described by percent sequence identity over the full aligned length of the two polynucleotides which includes percent sequence identity of about at least 50%, 55%, 60%, 65%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
- Sufficient homology includes any combination of polynucleotide length, global percent sequence identity, and optionally conserved regions of contiguous nucleotides or local percent sequence identity, for example sufficient homology can be described as a region of 75-150 bp having at least 80% sequence identity to a region of the target locus. Sufficient homology can also be described by the predicted ability of two polynucleotides to specifically hybridize under high stringency conditions, see, for example, Sambrook et al. , (1989) Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, NY); Current Protocols in Molecular Biology, Ausubel et al. , Eds (1994) Current Protocols, (Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.); and, Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, (Elsevier, New York).
- a donor DNA polynucleotide can have two homologous sequences separated by a sequence that is heterologous to sequence at a target site. These two homologous sequences of such a donor polynucleotide can be referred to as "homology arms", which flank the heterologous sequence. HR between a target site and a donor polynucleotide with two homology arms typically results in the replacement of a sequence at the target site with the heterologous sequence of the donor polynucleotide (target site sequence located between DNA sequences homologous to the homology arms of the donor polynucleotide is replaced by the heterologous sequence of the donor polynucleotide).
- the arms can be separated by 1 or more nucleotides (i.e. , the heterologous sequence in the donor polynucleotide can be at least 1 nucleotide in length).
- Various HR procedures that can be performed in a non-conventional yeast herein are disclosed, for example, in DNA Recombination: Methods and Protocols: 1 st Edition (H. Tsubouchi, Ed. , Springer-Verlag, New York, 201 1 ), which is incorporated herein by reference.
- genomic region is a segment of a chromosome in the genome of a cell that is present on either side of the target site or, alternatively, also comprises a portion of the target site.
- the genomic region can comprise at least 5- 10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5- 50, 5-55, 5-60, 5-65, 5- 70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5-800, 5-900, 5- 1000, 5-1 100, 5-1200, 5-1300, 5-1400, 5-1500, 5-1600, 5-1700, 5-1800, 5-1900, 5- 2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5-2800. 5-2900, 5- 3000, 5-3100 or more bases such that the genomic region has sufficient homology to undergo homologous recombination with the
- Polynucleotides of interest and/or traits can be stacked together in a complex trait locus as described in US-2013-0263324-A1 , published 03 Oct 2013 and in PCT/US13/22891 , published January 24, 2013, both applications are hereby incorporated by reference.
- the guide polynucleotide/Cas9 endonuclease system described herein provides for an efficient system to generate double strand breaks and allows for traits to be stacked in a complex trait locus.
- the guide polynucleotide/Cas endonuclease system can be used for introducing one or more polynucleotides of interest or one or more traits of interest into one or more target sites by providing one or more guide polynucleotides, one or more Cas endonucleases, and optionally one or more donor DNAs to a cell, ((as described in US patent application No. 14/463,687, file August 20, 2014, incorporated by reference herein
- the structural similarity between a given genomic region and the corresponding region of homology found on the donor DNA can be any degree of sequence identity that allows for homologous recombination to occur.
- the amount of homology or sequence identity shared by the "region of homology" of the donor DNA and the "genomic region” of the organism genome can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, such that the sequences undergo homologous recombination
- the region of homology on the donor DNA can have homology to any sequence flanking the target site. While in some embodiments the regions of homology share significant sequence homology to the genomic sequence immediately flanking the target site, it is recognized that the regions of homology can be designed to have sufficient homology to regions that may be further 5' or 3' to the target site. In still other embodiments, the regions of homology can also have homology with a fragment of the target site along with downstream genomic regions. In one embodiment, the first region of homology further comprises a first fragment of the target site and the second region of homology comprises a second fragment of the target site, wherein the first and second fragments are dissimilar.
- homologous recombination includes the exchange of DNA fragments between two DNA molecules at the sites of homology.
- the frequency of homologous recombination is influenced by a number of factors. Different organisms vary with respect to the amount of homologous recombination and the relative proportion of homologous to non-homologous recombination. Generally, the length of the region of homology affects the frequency of homologous recombination events: the longer the region of homology, the greater the frequency. The length of the homology region needed to observe homologous recombination is also species- variable.
- Homology-directed repair is a mechanism in cells to repair double- stranded and single stranded DNA breaks.
- Homology-directed repair includes homologous recombination (HR) and single-strand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem . 79: 181 -21 1 ).
- HR homologous recombination
- SSA single-strand annealing
- Other forms of HDR include single-stranded annealing (SSA) and breakage-induced replication, and these require shorter sequence homology relative to HR.
- Homology-directed repair at nicks can occur via a mechanism distinct from HDR at double-strand breaks (Davis and Maizels. PNAS (0027-8424), 1 1 1 (10), p. E924-E932.
- Homologous recombination has also been accomplished in other organisms. For example, at least 150-200 bp of homology was required for homologous recombination in the parasitic protozoan Leishmania (Papadopoulou and Dumas, (1997) Nucleic Acids Res 25:4278-86). In the filamentous fungus Aspergillus nidulans, gene replacement has been accomplished with as little as 50 bp flanking homology (Chaveroche et al., (2000) Nucleic Acids Res 28:e97). Targeted gene replacement has also been demonstrated in the ciliate Tetrahymena thermophila (Gaertig et al.
- NHEJ Non-Homologous-End-Joining
- Episomal DNA molecules can also be ligated into the double-strand break, for example, integration of T-DNAs into chromosomal double-strand breaks (Chilton and Que, (2003) Plant Physiol 133:956-65; Salomon and Puchta, (1998) EMBO J 17:6086- 95).
- gene conversion pathways can restore the original structure if a homologous sequence is available, such as a homologous chromosome in non-dividing somatic cells, or a sister chromatid after DNA replication (Molinier et al. , (2004) Plant Cell 16:342-52).
- Ectopic and/or epigenic DNA sequences may also serve as a DNA repair template for homologous recombination (Puchta, (1999) Genetics 152: 1 173-81 ).
- the double-strand break can be repaired by homologous recombination between homologous DNA sequences.
- gene conversion pathways can restore the original structure if a homologous sequence is available, such as a homologous chromosome in non-dividing somatic cells, or a sister chromatid after DNA replication (Molinier et al. , (2004) Plant Cell 16:342-52).
- Ectopic and/or epigenic DNA sequences may also serve as a DNA repair template for homologous recombination (Puchta, (1999) Genetics 152: 1 173-81 ).
- DNA double-strand breaks appear to be an effective factor to stimulate homologous recombination pathways (Puchta et al. , (1995) Plant Mol Biol 28:281 -92; Tzfira and White, (2005) Trends Biotechnol 23:567-9; Puchta, (2005) J Exp Bot 56: 1 - 14).
- DNA-breaking agents a two- to nine-fold increase of homologous recombination was observed between artificially constructed homologous DNA repeats in plants (Puchta et al. , (1995) Plant Mol Biol 28:281 -92).
- experiments with linear DNA molecules demonstrated enhanced homologous recombination between plasmids (Lyznik et al., (1991 ) Mol Gen Genet 230:209-18).
- the donor DNA may be introduced by any means known in the art.
- the donor DNA may be provided by any transformation method known in the art including, for example, Agrobacterium-mediated transformation or biolistic particle bombardment.
- the donor DNA may be present transiently in the cell or it could be introduced via a viral replicon.
- the method comprises a method for selecting a cell comprising a modified nucleotide sequence in its genome, the method comprising: a.) providing a guide polynucleotide, a protected polynucleotide modification template and a Cas endonuclease to a cell, wherein said Cas endonuclease and guide polynucleotide can form a complex capable of introducing a single or double-strand break at a target site in genome of said cell, wherein said protected polynucleotide modification template comprises at least one nucleotide modification of said nucleotide sequence; and, b.) selecting a cell from step (a) comprising said modified nucleotide sequence.
- the protected polynucleotide modification template can be a linear polynucleotide comprising at least one protection molecule at its 5' end, 3' end, or both 5' and 3' ends or it can be a circular molecule.
- the protection molecule can be selected from the group consisting of an alkane spacer, a fluorophore, a NHS ester, a Digoxigen, a Cholesteryl-TEG, a C6, a C12, a Hexynyl, Oxtadiynyl dUTP, a Biotin, a Dithiol, an inverted Dideoxy-T modification or any one combination thereof.
- the protected polynucleotide modification template can be a double stranded linear molecule comprising at least one phosphorothiate bond at the 5' end of at least one strand.
- the protected polynucleotide modification template can be a double stranded linear molecule comprising a 3 carbon alkaline spacer on the 5' end of each strand.
- the at least one nucleotide modification of the protected polynucleotide template can be selected from the group consisting of (i) a replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, and (iv) any combination of (i) - (iii).
- the methods and compositions described herein employ a guide polynucleotide, a protected polynucleotide modification template and a Cas endonuclease and can be used for genome engineering (such as introducing polynucleotides of interest, editing genes or modifying gened that are part of a metabolic pathway.
- Methods described herein can be used for metabolic pathway engineering (metabolic engineering) and/or to produce recombinant microbial cells that have been genetically engineered.
- the recombinant microbial cell in certain embodiments may be one that has been genetically engineered by deleting genes for metabolic engineering using the methods described herein.
- the recombinant microbial cell in certain embodiments may be one that has been genetically engineered to produce an increased amount of total lipids and/or fatty acids such as PUFAs.
- a fatty acid or PUFA biosynthetic pathway, or portion thereof may be introduced to the organism by inserting coding sequences for certain pathway enzymes, such as fatty acid desaturases and elongases.
- One or a combination of the following enzymes may be genetically introduced to the oleaginous yeast cell to provide a PUFA biosynthetic pathway therein: delta-4 desaturase, delta-5 desaturase, delta-6 desaturase, delta- 12 desaturase, delta-15 desaturase, delta-17 desaturase, delta-9 desaturase, delta-8 desaturase, delta-9 elongase, C14/16 elongase, C16/18 elongase, C18/20 elongase, C20/22 elongase.
- delta-4 desaturase delta-5 desaturase
- delta-6 desaturase delta- 12 desaturase
- delta-15 desaturase delta-17 desaturase
- delta-9 desaturase delta-8 desaturase
- delta-9 elongase C14/16 elongase
- C16/18 elongase C18/20 elongase
- Example PUFA biosynthetic pathways may contain both a delta-9 elongase and delta- 8 desaturase (e.g. , refer to U.S. Pat. Appl. Publ. No. 201 1 -0055973, herein incorporated by reference), or both a delta-6 desaturase and delta-6 elongase.
- the recombinant microbial cell may be modified to have increased total lipids and/or PUFA levels by introducing or deleting genes, other than those encoding desaturases or elongases, that regulate fatty acid biosynthesis.
- the recombinant microbial cell in certain embodiments may be a Yarrowia cell that produces an oil comprising at least 28 percent EPA measured as a weight percent of the dry cell weight and that comprise a down-regulation of an endogenous polynucleotide sequence encoding Sou2 sorbitol utilization protein, and at least one polynucleotide sequence encoding an active LPCAT enzyme comprising at least one amino acid mutation in a membrane-bound O-acyltransferase motif.
- PCT/US2013/07895 filed December 18, 2013, herein incorporated by reference.
- the recombinant microbial cell can be a cell of a yeast, mold, fungus, oomycete, bacteria, algae, stramenopile, or protist (e.g., euglenoid).
- the recombinant microbial cell is an oleaginous microbial cell, such as an oleaginous yeast cell.
- oleaginous yeast include species of the genera Yarrowia, Candida, Rhodotorula, Rhodosporidium, Cryptococcus, Trichosporon and Lipomyces. More specific examples of oleaginous yeast include Rhodosporidium toruloides, Lipomyces starkeyii, L.
- fungal cells in certain embodiments include species of the genera Fusarium (e.g. , Fusarium lateritium), Mortierella (e.g. , Mortierella alpina) and Mucor (e.g. , Mucor rouxii and Mucor circinelloides).
- the microbial cell can be of the genera Entomophthora, Pythium and Porphyridium in other embodiments of the disclosed invention.
- Polynucleotides of interest are further described herein and include polynucleotides reflective of the commercial markets and interests of those involved in the development of the crop. Crops and markets of interest change, and as developing nations open up world markets, new crops and technologies will emerge also. In addition, as our understanding of agronomic traits and characteristics such as yield and heterosis increase, the choice of genes for genetic engineering will change accordingly. [0121] Further provided are methods for identifying at least one cell, comprising in its genome, a polynucleotide of interest integrated at the target site. A variety of methods are available for identifying those cells with insertion into the genome at or near to the target site without using a screenable marker phenotype.
- Such methods can be viewed as directly analyzing a target sequence to detect any change in the target sequence, including but not limited to PCR methods, sequencing methods, nuclease digestion, Southern blots, and any combination thereof. See, for example, US Patent Application 12/147,834, herein incorporated by reference to the extent necessary for the methods described herein.
- Polynucleotides/polypeptides of interest include, but are not limited to, microbial metabolic pathway genes, herbicide-resistance coding sequences, insecticidal coding sequences, nematicidal coding sequences, antimicrobial coding sequences, antifungal coding sequences, antiviral coding sequences, abiotic and biotic stress tolerance coding sequences, or sequences modifying plant traits such as yield, grain quality, nutrient content, starch quality and quantity, nitrogen fixation and/or utilization, fatty acids, and oil content and/or composition.
- genes of interest include, for example, those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins. More specific categories of transgenes, for example, include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, fertility or sterility, grain characteristics, and commercial products. Genes of interest include, generally, those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting kernel size, sucrose loading, and the like that can be stacked or used in combination with other traits, such as but not limited to herbicide resistance, described herein.
- Agronomically important traits such as oil, starch, and protein content can be genetically altered in addition to using traditional breeding methods. Modifications include increasing content of oleic acid, saturated and unsaturated oils, increasing levels of lysine and sulfur, providing essential amino acids, and also modification of starch. Hordothionin protein modifications are described in U.S. Patent Nos. 5,703,049, 5,885,801 , 5,885,802, and 5,990,389, herein incorporated by reference.
- the polynucleotide of interest may also comprise antisense sequences complementary to at least a portion of the messenger RNA (mRNA) for a targeted gene sequence of interest.
- Antisense nucleotides are constructed to hybridize with the corresponding mRNA. Modifications of the antisense sequences may be made as long as the sequences hybridize to and interfere with expression of the corresponding mRNA. In this manner, antisense constructions having 70%, 80%, or 85% sequence identity to the corresponding antisense sequences may be used. Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or greater may be used.
- polynucleotide of interest may also be used in the sense orientation to suppress the expression of endogenous genes in an organism of interest.
- Methods for suppressing gene expression in microorganisms and plants using polynucleotides in the sense orientation are known in the art. See, U.S. Patent Nos. 5,283, 184 and 5,034,323; herein incorporated by reference.
- the polynucleotide of interest can also be a phenotypic marker.
- a phenotypic marker is screenable or a selectable marker that includes visual markers and selectable markers whether it is a positive or negative selectable marker. Any phenotypic marker can be used.
- a selectable or screenable marker comprises a DNA segment that allows one to identify, or select for or against a molecule or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like.
- selectable markers include, but are not limited to, DNA segments that comprise restriction enzyme sites; DNA segments that encode products which provide resistance against otherwise toxic compounds including antibiotics, such as, spectinomycin, ampicillin, kanamycin, tetracycline, Basta, neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT)); DNA segments that encode products which are otherwise lacking in the recipient cell (e.g. , tRNA genes, auxotrophic markers); DNA segments that encode products which can be readily identified (e.g.
- phenotypic markers such as ⁇ -galactosidase, GUS; fluorescent proteins such as green fluorescent protein (GFP), cyan (CFP), yellow (YFP), red (RFP), and cell surface proteins); the generation of new primer sites for PCR (e.g. , the juxtaposition of two DNA sequence not previously juxtaposed), the inclusion of DNA sequences not acted upon or acted upon by a restriction endonuclease or other DNA modifying enzyme, chemical, etc. ; and, the inclusion of a DNA sequences required for a specific modification (e.g., methylation) that allows its identification.
- a specific modification e.g., methylation
- Additional selectable markers include genes that confer resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4- dichlorophenoxyacetate (2,4-D). See for example, Yarranton, (1992) Curr Opin Biotech 3:506-1 1 ; Christopherson et al., (1992) Proc. Natl. Acad. Sci.
- Selection methods for use herein are resistance to kanamycin, hygromycin and the amino glycoside G418, as well as ability to grow on media lacking uracil, leucine, lysine, tryptophan or histidine.
- 5-fluoroorotic acid (5- fluorouracil-6-carboxylic acid monohydrate [5-FOA]) is used for selection of yeast Ura ⁇ mutants (U.S. Pat. Appl. Publ. No. 2009-0093543), or a native acetohydroxyacid synthase (or acetolactate synthase; E.C. 4.1.3.18) that confers sulfonyl urea herbicide resistance (Intl. Appl.
- gene expression may be controlled by altering the following: the nature of the relevant promoter and terminator sequences; the number of copies of the cloned gene; whether the gene is plasmid-borne or integrated into the genome of the host cell; the final cellular location of the synthesized foreign protein; the efficiency of translation in the host organism; the intrinsic stability of the cloned gene protein within the host cell; and the codon usage within the cloned gene, such that its frequency approaches the frequency of preferred codon usage of the host cell.
- Promoters useful to drive expression of heterologous genes in microbial host cells are numerous and known to those skilled in the art. Expression can be accomplished in an induced or constitutive fashion. Induced expression can be accomplished by inducing the activity of a regulatable promoter operably linked to the gene of interest, while constitutive expression can be achieved by the use of a constitutive promoter operably linked to the gene of interest. Virtually any promoter (i.e., native, synthetic, or chimeric) capable of directing expression of a gene is suitable, although transcriptional and translational regulatory regions from the host species may be particularly useful.
- the terminator can be derived from the 3' region of the gene from which the promoter was obtained or from a different gene.
- a large number of terminators are known and function satisfactorily in a variety of hosts, when utilized both in the same and different genera and species from which they were derived.
- the terminator usually is selected more as a matter of convenience rather than because of any particular property.
- the terminator is derived from a yeast gene.
- the terminator can also be synthetic, as one of skill in the art can utilize available information to design and synthesize a terminator. A terminator may be unnecessary, but it is preferred.
- promoters and terminators for use in a recombinant microbial host cell of the genus Yarrowia are those taught in U.S. Pat. Appl. Publ. Nos. 2009-0093543, 2010-0068789, 201 1-0059496, 2012-0252079, 2012-0252093, 2013- 0089910 and 2013-0089911 , all of which are incorporated herein by reference.
- the transgenes, recombinant DNA molecules, DNA sequences of interest, and polynucleotides of interest can be comprise one or more DNA sequences for gene silencing.
- Methods for gene silencing involving the expression of DNA sequences in cells and organisms include, but are not limited to, cosuppression, antisense suppression, double-stranded RNA (dsRNA) interference, hairpin RNA (hpRNA) interference, intron-containing hairpin RNA (ihpRNA) interference, transcriptional gene silencing, and micro RNA (miRNA) interference
- nucleic acid means a polynucleotide and includes a single or a double-stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides.
- nucleic acid sequence RNA sequence
- nucleic acid fragment a polymer of RNA and/or DNA that is single- or double-stranded, optionally containing synthetic, non- natural, or altered nucleotide bases.
- Nucleotides are referred to by their single letter designation as follows: “A” for adenosine or deoxyadenosine (for RNA or DNA, respectively), “C” for cytosine or deoxycytosine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purines (A or G), “Y” for pyrimidines (C or T), “K” for G or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide (e.g., N can be A, C, T, or G, if referring to a DNA sequence; N can be A, C, U, or G, if referring to an RNA sequence). Any RNA sequence (e.g., crRNA, tracrRNA, gRNA) disclosed herein may be encoded by a suitable DNA
- ORF Open reading frame
- fragment that is functionally equivalent and “functionally equivalent subfragment” are used interchangeably herein. These terms refer to a portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme.
- the fragment or subfragment can be used in the design of genes to produce the desired phenotype in a microbe or plant. Genes can be designed for use in suppression by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the sense or antisense orientation relative to a promoter sequence.
- the term "conserved domain” or "motif” means a set of amino acids conserved at specific positions along an aligned sequence of evolutionarily related proteins. While amino acids at other positions can vary between homologous proteins, amino acids that are highly conserved at specific positions indicate amino acids that are essential to the structure, the stability, or the activity of a protein. Because they are identified by their high degree of conservation in aligned sequences of a family of protein homologues, they can be used as identifiers, or "signatures", to determine if a protein with a newly determined sequence belongs to a previously identified protein family.
- polypeptide and polypeptide sequences, variants thereof, and the structural relationships of these sequences can be described by the terms “homology”, “homologous”, “substantially identical”, “substantially similar” and “corresponding substantially” which are used interchangeably herein. These refer to polypeptide or nucleic acid fragments wherein changes in one or more amino acids or nucleotide bases do not affect the function of the molecule, such as the ability to mediate gene expression or to produce a certain phenotype. These terms also refer to modification(s) of nucleic acid fragments that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. These modifications include deletion, substitution, and/or insertion of one or more nucleotides in the nucleic acid fragment.
- Substantially similar nucleic acid sequences encompassed may be defined by their ability to hybridize (under moderately stringent conditions, e.g., 0.5X SSC, 0.1 % SDS, 60°C) with the sequences exemplified herein, or to any portion of the nucleotide sequences disclosed herein and which are functionally equivalent to any of the nucleic acid sequences disclosed herein.
- Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post- hybridization washes determine stringency conditions.
- sequences include reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
- Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
- stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a probe will selectively hybridize to its target sequence in an in vitro hybridization assay. Stringent conditions are sequence- dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
- stringent conditions will be those in which the salt concentration is less than about 1 .5 M Na ion, typically about 0.01 to 1 .0 M Na ion concentration (or other salt(s)) at pH 7.0 to 8.3, and at least about 30°C for short probes (e.g. , 10 to 50 nucleotides) and at least about 60°C for long probes (e.g. , greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.5X to 1 X SSC at 55 to 60°C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
- sequence identity or “identity” in the context of nucleic acid or polypeptide sequences refers to the nucleic acid bases or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
- the term "percentage of sequence identity” refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the results by 100 to yield the percentage of sequence identity.
- percent sequence identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from 50% to 100%. These identities can be determined using any of the programs described herein.
- Sequence alignments and percent identity or similarity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the MegAlignTM program of the LASERGENE bioinformatics computing suite (DNASTAR Inc. , Madison, Wl).
- sequence analysis software is used for analysis, that the results of the analysis will be based on the "default values" of the program referenced, unless otherwise specified.
- default values will mean any set of values or parameters that originally load with the software when first initialized.
- Clustal V method of alignment corresponds to the alignment method labeled Clustal V (described by Higgins and Sharp, (1989) CABIOS 5: 151 -153;
- sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 (GCG, Accelrys, San Diego, CA) using the following parameters: % identity and % similarity for a nucleotide sequence using a gap creation penalty weight of 50 and a gap length extension penalty weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using a GAP creation penalty weight of 8 and a gap length extension penalty of 2, and the BLOSUM62 scoring matrix (Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89: 10915).
- GAP uses the algorithm of Needleman and Wunsch, (1970) J Mol Biol 48:443-53, to find an alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps, using a gap creation penalty and a gap extension penalty in units of matched bases.
- BLAST is a searching algorithm provided by the National Center for Biotechnology Information (NCBI) used to find regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches to identify sequences having sufficient similarity to a query sequence such that the similarity would not be predicted to have occurred randomly. BLAST reports the identified sequences and their local alignment to the query sequence.
- any integer amino acid identity from 50% to 100% may be useful in describing the present disclosure, such as 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
- Gene includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
- “Native gene” refers to a gene as found in nature with its own regulatory sequences.
- a “mutated gene” is a gene that has been altered through human intervention. Such a “mutated gene” has a sequence that differs from the sequence of the corresponding non-mutated gene by at least one nucleotide addition, deletion, or substitution. In certain embodiments of the disclosure, the mutated gene comprises an alteration that results from a guide polynucleotide/Cas endonuclease system as disclosed herein.
- a mutated cell is a cell comprising a mutated gene.
- a "targeted mutation” is a mutation in a native gene that was made by altering a target sequence within the native gene using a method involving a double-strand-break-inducing agent that is capable of inducing a double-strand break in the DNA of the target sequence as disclosed herein or known in the art.
- the guide RNA/Cas endonuclease induced targeted mutation can occur in a nucleotide sequence that is located within or outside a genomic target site that is recognized and cleaved by a Cas endonuclease.
- gene as it applies to a cell encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondria, or plastid) of the cell.
- a "codon-modified gene” or “codon-preferred gene” or “codon-optimized gene” is a gene having its frequency of codon usage designed to mimic the frequency of preferred codon usage of the host cell.
- An "allele” is one of several alternative forms of a gene occupying a given locus on a chromosome. When all the alleles present at a given locus on a chromosome are the same, that organism is homozygous at that locus. If the alleles present at a given locus on a chromosome differ, that organism is heterozygous at that locus.
- Coding sequence refers to a polynucleotide sequence which codes for a specific amino acid sequence.
- regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to: promoters, translation leader sequences, 5' untranslated sequences, 3' untranslated sequences, introns, polyadenylation target sequences, RNA processing sites, effector binding sites, and stem-loop structures.
- a promoter is a region of DNA involved in recognition and binding of RNA polymerase and other proteins to initiate transcription.
- the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
- An "enhancer” is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue- specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, and/or comprise synthetic DNA segments.
- promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters”.
- a "strong promoter” as used herein refers to a promoter that can direct a relatively large number of productive initiations per unit time, and/or is a promoter driving a higher level of gene transcription than the average transcription level of the genes in a cell.
- a plant promoter is a promoter capable of initiating transcription in a plant cell, for a review of plant promoters, see, Potenza et al., (2004) In Vitro Cell Dev Biol 40: 1 - 22.
- Constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in W099/43838 and U.S. Patent No.
- Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
- the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
- Chemical-inducible promoters include, but are not limited to, the maize ln2-2 promoter, activated by benzene sulfonamide herbicide safeners (De Veylder et al., (1997) Plant Cell Physiol 38:568-77), the maize GST promoter (GST-ll-27, WO93/01294), activated by hydrophobic electrophilic compounds used as pre-emergent herbicides, and the tobacco PR-1 a promoter (Ono et al., (2004) Biosci Biotechnol Biochem 68:803-7) activated by salicylic acid.
- steroid-responsive promoters see, for example, the glucocorticoid-inducible promoter (Schena et al. , (1991 ) Proc. Natl. Acad. Sci. USA 88: 10421 -5; McNellis et ai , (1998) Plant J 14:247-257); tetracycline- inducible and tetracycline-repressible promoters (Gatz et al. , (1991 ) Mol Gen Genet 227:229-37; U.S. Patent Nos. 5,814,618 and 5,789, 156).
- Tissue-preferred promoters can be utilized to target enhanced expression within a particular plant tissue.
- Tissue-preferred promoters include, for example, Kawamata et al. , (1997) Plant Cell Physiol 38:792-803; and Guevara-Garcia et al. , (1993) Plant J 4:495-505.
- Seed-preferred promoters include both seed-specific promoters active during seed development, as well as seed-germinating promoters active during seed germination. See, Thompson et al. , (1989) BioEssays 10: 108.
- inducible promoter refers to promoters that selectively express a coding sequence or functional RNA in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and/or developmental signals.
- inducible or regulated promoters include, for example, promoters induced or regulated by light, heat, stress, flooding or drought, salt stress, osmotic stress, phytohormones, wounding, or chemicals such as ethanol, abscisic acid (ABA), jasmonate, salicylic acid, or safeners.
- ABA abscisic acid
- a stress- inducible is RD29A promoter (Kasuga et al.
- Translation leader sequence refers to a polynucleotide sequence located between the promoter sequence of a gene and the coding sequence.
- the translation leader sequence is present in the mRNA upstream of the translation start sequence.
- the translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (e.g., Turner and Foster, (1995) Mol Biotechnol 3:225-236).
- RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence.
- RNA transcript When the RNA transcript is a perfect complimentary copy of the DNA sequence, it is referred to as the primary transcript or pre-mRNA.
- a RNA transcript is referred to as the mature RNA or mRNA when it is a RNA sequence derived from post- transcriptional processing of the primary transcript pre mRNAt.
- Messenger RNA or “mRNA” refers to the RNA that is without introns and that can be translated into protein by the cell.
- cDNA refers to a DNA that is complementary to, and synthesized from, a mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into double-stranded form using the Klenow fragment of DNA polymerase I.
- Sense RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro.
- Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA, and that blocks the expression of a target gene (see, e.g., U.S. Patent No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
- RNA refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.
- complement and “reverse complement” are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
- control cell and "suitable control cell” are used interchangeably herein and may be referenced with respect to a cell in which a particular modification (e.g., over- expression of a polynucleotide, down-regulation of a polynucleotide) has been made (i.e., an "experimental cell”).
- a control cell may be any cell that does not have or does not express the particular modification of the experimental cell.
- a control cell may be an untransformed wild type cell or may be genetically transformed but does not express the genetic transformation.
- a control cell may be a direct parent of the experimental cell, which direct parent cell does not have the particular modification that is in the experimental cell.
- a control cell may be a parent of the experimental cell that is removed by one or more generations.
- a control cell may be a sibling of the experimental cell, which sibling does not comprise the particular modification that is present in the experimental cell.
- operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other.
- a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter).
- Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
- the complementary RNA regions can be operably linked, either directly or indirectly, 5' to the target mRNA, or 3' to the target mRNA, or within the target mRNA, or a first complementary region is 5' and its complement is 3' to the target mRNA.
- PCR or "polymerase chain reaction” is a technique for the synthesis of specific DNA segments and consists of a series of repetitive denaturation, annealing, and extension cycles. Typically, a double-stranded DNA is heat denatured, and two primers complementary to the 3' boundaries of the target segment are annealed to the DNA at low temperature, and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a "cycle".
- the term "recombinant” refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis, or manipulation of isolated segments of nucleic acids by genetic engineering techniques.
- Plasmid refers to an extra chromosomal element often carrying genes that are not part of the central metabolism of the cell, and usually in the form of double-stranded DNA.
- Such elements may be autonomously replicating sequences, genome integrating sequences, phage, or nucleotide sequences, in linear or circular form, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a polynucleotide of interest into a cell.
- Transformation cassette refers to a specific vector containing a gene and having elements in addition to the gene that facilitates transformation of a particular host cell.
- Expression cassette refers to a specific vector containing a gene and having elements in addition to the gene that allow for expression of that gene in a host.
- transformation refers to the transfer of a nucleic acid molecule into a host organism.
- the nucleic acid molecule may be a plasmid that replicates autonomously, or it may integrate into the genome of the host organism.
- the terms "recombinant DNA molecule”, “recombinant construct”, “expression construct”, “ construct”, “construct”, and “recombinant DNA construct” are used interchangeably herein.
- a recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not all found together in nature.
- a construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- Such a construct may be used by itself or may be used in conjunction with a vector. If a vector is used, then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells.
- expression refers to the production of a functional end- product (e.g., an mRNA, guide RNA, or a protein) in either precursor or mature form.
- a functional end- product e.g., an mRNA, guide RNA, or a protein
- the term "providing” includes providing a nucleic acid (e.g. , expression construct) or peptide, polypeptide or protein to a cell.
- Providing includes reference to the incorporation of a nucleic acid or polypeptide into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell.
- Providing includes reference to stable or transient transformation methods, transfection, transduction, microinjection, electroporation, viral methods, Agrobacterium-med ⁇ ated transformation, ballistic particle acceleration as well as sexually crossing.
- "providing” in the context of inserting a nucleic acid fragment e.g.
- a recombinant DNA construct/expression construct, guide RNA, guide DNA, template DNA, donor DNA) into a cell includes “transfection” or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g. , transfected mRNA).
- a variety of methods are known for contacting, providing, and/or introducing a composition (such as a nucleotide sequence, a peptide or a polypeptide) into an organisms including stable transformation methods, transient transformation methods, virus-mediated methods, sexual crossing and sexual breeding.
- Stable transformation indicates that the introduced polynucleotide integrates into the genome of the organism and is capable of being inherited by progeny thereof.
- Transient transformation indicates that the introduced composition is only temporarily expressed or present in the organism.
- Protocols for contacting, providing, introducing polynucleotides and polypeptides to cells or organisms include microinjection (Crossway et al. , (1986) Biotech niques 4:320-34 and U.S. Patent No. 6,300,543), meristem transformation (U.S. Patent No. 5,736,369), electroporation (Riggs et al. , (1986) Proc. Natl. Acad. Sci. USA 83:5602-6, Agrobacterium-med ated transformation (U.S. Patent Nos. 5,563,055 and 5,981 ,840), direct gene transfer (Paszkowski et al.
- polynucleotides may be introduced into cells or organisms by contacting cells or organisms with a virus or viral nucleic acids.
- such methods involve incorporating a polynucleotide within a viral DNA or RNA molecule.
- a polypeptide of interest may be initially synthesized as part of a viral polyprotein, which is later processed by proteolysis in vivo or in vitro to produce the desired recombinant protein.
- Methods for introducing polynucleotides into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known, see, for example, U.S. Patent Nos.
- Transient transformation methods include, but are not limited to, the introduction of polypeptides, such as a double-strand break inducing agent, directly into the organism, the introduction of polynucleotides such as DNA and/or RNA polynucleotides, and the introduction of the RNA transcript, such as an mRNA encoding a double-strand break inducing agent, into the organism.
- polypeptides such as a double-strand break inducing agent
- polynucleotides such as DNA and/or RNA polynucleotides
- the introduction of the RNA transcript such as an mRNA encoding a double-strand break inducing agent
- Nucleid acids and proteins can be provided to a cell by any method known in the art such as, but not limited to, methods using molecules to facilitate the uptake of anyone or all components of a guided Cas system (protein and/or nucleic acids), such as cell-penetrating peptides, nanocariers. See also US201 10035836 Nanocarier based plant transfection and transduction, and EP 2821486 A1 , Method of introducing nucleic acid into plant cells, incorporated herein by reference.
- a guided Cas system protein and/or nucleic acids
- Providing a guide RNA/Cas endonuclease complex to a cell includes providing the individual components of said complex to the cell either directly or via recombination constructs, and includes providing the whole complex to the cell as well.
- “Mature” protein refers to a post-translationally processed polypeptide (i.e. , one from which any pre- or pro-peptides present in the primary translation product have been removed).
- "Precursor” protein refers to the primary product of translation of mRNA (i.e. , with pre- and propeptides still present). Pre- and propeptides may be but are not limited to intracellular localization signals.
- “Stable transformation” refers to the transfer of a nucleic acid fragment into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance.
- “transient transformation” refers to the transfer of a nucleic acid fragment into the nucleus, or other DNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance.
- Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" organisms.
- Plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny of the same.
- Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
- Plant parts include differentiated and undifferentiated tissues including, but not limited to roots, stems, shoots, leaves, pollens, seeds, tumor tissue and various forms of cells and culture (e.g., single cells, protoplasts, embryos, and callus tissue).
- the plant tissue may be in plant or in a plant organ, tissue or cell culture.
- plant organ refers to plant tissue or a group of tissues that constitute a morphologically and functionally distinct part of a plant.
- gene refers to the entire complement of genetic material (genes and non-coding sequences) that is present in each cell of an organism, or virus or organelle; and/or a complete set of chromosomes inherited as a (haploid) unit from one parent. "Progeny” comprises any subsequent generation of a plant.
- a transgenic plant includes, for example, a plant which comprises within its genome a heterologous polynucleotide introduced by a transformation step.
- the heterologous polynucleotide can be stably integrated within the genome such that the polynucleotide is passed on to successive generations.
- the heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct.
- a transgenic plant can also comprise more than one heterologous polynucleotide within its genome. Each heterologous polynucleotide may confer a different trait to the transgenic plant.
- a heterologous polynucleotide can include a sequence that originates from a foreign species, or, if from the same species, can be substantially modified from its native form.
- Transgenic can include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
- the alterations of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods, by the genome editing procedure described herein that does not result in an insertion of a foreign polynucleotide, or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation are not intended to be regarded as transgenic.
- a fertile plant is a plant that produces viable male and female gametes and is self- fertile. Such a self-fertile plant can produce a progeny plant without the contribution from any other plant of a gamete and the genetic material contained therein.
- Male-sterile plants include plants that do not produce male gametes that are viable or otherwise capable of fertilization.
- Female-sterile plants include plants that do not produce female gametes that are viable or otherwise capable of fertilization. It is recognized that male-sterile and female-sterile plants can be female-fertile and male- fertile, respectively.
- a male fertile (but female sterile) plant can produce viable progeny when crossed with a female fertile plant and that a female fertile (but male sterile) plant can produce viable progeny when crossed with a male fertile plant.
- yeasts such as Saccharomyces cerevisiae and Schizosaccharomyces pombe typically exhibit specific integration of donor DNA with short flanking homology arms (30-50 bp) with efficiencies routinely over 70%
- non-conventional yeasts such as Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, Pichia stipitis and Kluyveromyces lactis usually show specific integration with similarly structured donor DNA at efficiencies of less than 1 % (Chen et al., PLoS ONE 8:e57952).
- a preference for HR processes can be gauged, for example, by transforming yeast with a suitable donor DNA and determining the degree to which it is specifically recombined with a genomic site predicted to be targeted by the donor DNA.
- a preference for NHEJ (or low preference for HR), for example, would be manifest if such an assay yielded a high degree of random integration of the donor DNA in the yeast genome.
- Assays for determining the rate of specific (HR-mediated) and/or random (NHEJ-mediated) integration of DNA in yeast are known in the art (e.g., Ferreira and Cooper, Genes Dev. 18:2249-2254; Corrigan et al., PLoS ONE 8:e69628; Weaver et al., Proc. Natl. Acad. Sci. U.S.A. 78:6354-6358; Keeney and Boeke, Genetics 136:849-856).
- non-conventional yeast herein can (i) exhibit a rate of specific targeting by a suitable template or donor DNA having 30-50 bp flanking homology arms of less than about 1 %, 2%, 3%, 4%, 5%,, 6%, 7%, or 8%, for example, and/or (ii) exhibit a rate of random integration of the foregoing donor DNA of more than about 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, or 75%, for example.
- These rates of (i) specific targeting and/or (ii) random integration of a suitable template or donor DNA can characterize a non-conventional yeast as it exists before being provided a guided Cas system as disclosed herein.
- Non-limiting examples of non-conventional yeast herein include yeasts of the following genera: Yarrowia, Pichia, Schwanniomyces, Kluyveromyces, Arxula, Trichosporon, Candida, Ustilago, Torulopsis, Zygosaccharomyces, Trigonopsis, Cryptococcus, Rhodotorula, Phaffia, Sporobolomyces, and Pachysolen.
- a suitable example of a Yarrowia species is Y. lipolytica.
- Suitable examples of Pichia species include P. pastoris, P. methanolica, P. stipitis, P. anomala and P. angusta.
- Suitable examples of Schwanniomyces species include S.
- Kluyveromyces species include K. lactis, K. marxianus, K. fragilis, K. drosophilarum, K. thermotolerans, K. phaseolosporus, K. vanudenii, K. waltii, K. africanus and K. polysporus.
- Suitable examples of Arxula species include A. adeninivorans and A. terrestre.
- Suitable examples of Trichosporon species include T.
- Candida species include C. albicans, C. ascalaphidarum, C. amphixiae, C. antarctica, C. argentea, C. atlantica, C. atmosphaerica, C. blattae, C. bromeliacearum, C. carpophila, C. carvajalis, C. cerambycidarum, C. chauliodes, C. corydali, C. dosseyi, C. dubliniensis, C. ergatensis, C. fructus, C. glabrata, C. fermentati, C. guilliermondii, C.
- Ustilago species include U. avenae, U. esculenta, U. hordei, U. maydis, U. nuda and U. tritici.
- Torulopsis species include T. geochares, T. azyma, T. glabrata and T. Candida.
- Zygosaccharomyces species include Z. bailii, Z. bisporus, Z.
- Trigonopsis species include T. variabilis.
- Suitable examples of Cryptococcus species include C. laurentii, C. albidus, C. neoformans, C. gattii, C. uniguttulatus, C. adeliensis, C. aerius, C. albidosimilis, C. antarcticus, C. aquaticus, C. ater, C. bhutanensis, C. consortionis, C. curvatus, C. phenolicus, C. skinneri, C. terreus and C. vishniacci.
- Rhodotorula species include R. acheniorum, R. tula, R. acuta,
- R. bacarum R. benthica, R. biourgei, R. bogoriensis, R. bronchialis, R. buffonii, R. calyptogenae, R. chungnamensis, R. cladiensis, R. corallina, R. cresolica, R. crocea,
- R. taiwanensis R. taiwaniana, R. taiwaniana, R. terpenoidalis, R. terrea, R. texensis, R. tokyoensis,
- Phaffia species include P. rhodozyma.
- Phaffia species include P. rhodozyma.
- Sporobolomyces species include S. alborubescens, S. bannaensis, S. beijingensis, S. bischofiae, S. clavatus, S. coprosmae, S. coprosmicola, S. corallinus, S. dimmenae,
- Pachysolen species include P. tannophilus.
- Yarrowia Iipoiytica examples include the following isolates available from the American Type Culture Collection (ATCC, Manassas, VA): strain designations ATCC #20362, #8862, #8661 , #8662, #9773, #15586, #16617, #16618, #18942, #18943, #18944, #18945, #201 14, #20177, #20182, #20225, #20226, #20228, #20327, #20255, #20287, #20297, #20315, #20320, #20324, #20336, #20341 , #20346, #20348, #20363, #20364, #20372, #20373, #20383, #20390, #20400, #20460, #20461 , #20462, #20496, #20510, #20628, #20688, #20774, #20775, #20776, #20777, #20778, #207
- a Y. lipolytica may be oleaginous (e.g., produce at least 25% of its dry cell weight as oil) and/or produce one or more polyunsaturated fatty acids (e.g. , omega-6 or omega-3). Such oleaginy may be a result of the yeast being genetically engineered to produce an elevated amount of lipids compared to its wild type form. Examples of oleaginous Y. lipolytica strains are disclosed in U.S. Pat. Appl. Publ. Nos. 2009/0093543, 2010/0317072, 2012/0052537 and 2014/0186906, which are herein incorporated by reference.
- Embodiments disclosed herein for non-conventional yeast can also be applied to other microorganisms such as fungi.
- Fungi in certain embodiments can be fungi that favor NHEJ DNA repair processes over repair processes mediated by HR.
- a fungus herein can be a Basidiomycetes, Zygomycetes, Chytridiomycetes, or Ascomycetes fungus.
- filamentous fungi herein include those of the genera Trichoderma, Chrysosporium, Thielavia, Neurospora (e.g. , N. crassa, N. sitophila), Cryphonectria (e.g. , C. parasitica), Aureobasidium (e.g. , A.
- Penicillium e.g. , P. bilaiae, P. camemberti, P. candidum, P. chrysogenum, P. expansum, P. funiculosum, P. glaucum, P. marneffei, P. roqueforti, P. verrucosum, P. viridicatum
- Gibberella e.g. , G. acuminata, G. avenacea, G. baccata, G. circinata, G.
- cyanogena G. fujikuroi, G. intricans, G. pulicaris, G. stilboides, G. tricincta, G. zeae), Myceliophthora, Mucor (e.g. , M. rouxii, M. circinelloides), Aspergillus (e.g. , A. niger, A. oryzae, A. nidulans, A. flavus, A. lentulus, A. terreus, A. clavatus, A. fumigatus), Fusarium (e.g. , F. graminearum, F. oxysporum, F. bubigenum, F. solani, F.
- Mucor e.g. , M. rouxii, M. circinelloides
- Aspergillus e.g. , A. niger, A. oryzae, A. nidulans, A. flavus
- fungi oxysporum, F. verticillioides, F. proliferatum, F. venenatum), and Humicola, and anamorphs and teleomorphs thereof.
- the genus and species of fungi herein can be defined, if desired, by morphology as disclosed in Barnett and Hunter (Illustrated Genera of Imperfect Fungi, 3rd Edition, Burgess Publishing Company, 1972).
- a fungus can optionally be characterized as a pest/pathogen, such as a pest/pathogen of an animal (e.g. , human).
- Trichoderma species in certain aspects herein include T. aggressivum, T. amazonicum, T. asperellum, T. atroviride, T. aureoviride, T. austrokoningii, T. brevicompactum, T. candidum, T. caribbaeum, T. catoptron, T. cremeum, T. ceramicum, T. cerinum, T. chlorosporum, T. chromospermum, T. cinnamomeum, T. citrinoviride, T. crassum, T. cremeum, T. dingleyeae, T. dorotheae, T. effusum, T. erinaceum, T.
- estonicum T. fertile, T. gelatinosus, T. ghanense, T. hamatum, T. harzianum, T. helicum, T. intricatum, T. konilangbra, T. koningii, T. koningiopsis, T. longibrachiatum, T. longipile, T. minutisporum, T. oblongisporum, T. ovalisporum, T. petersenii, T. phyllostahydis, T. piluliferum, T. pleuroticola, T. pleurotum, T. polysporum, T. pseudokoningii, T. pubescens, T. reesei, T.
- Trichoderma species herein can be cultivated and/or manipulated as described in Trichoderma: Biology and Applications (P.K. Mukherjee et al. , Eds. , CABI, Oxfordshire, UK, 2013), for example, which is incorporated herein by reference.
- a microbial cell in certain embodiments is an algal cell.
- an algal cell can be from any of the following: Chlorophyta (green algae), Rhodophyta (red algae), Phaeophyceae (brown algae), Bacillariophycaeae (diatoms), and Dinoflagellata (dinoflagellates).
- An algal cell can be of a microalgae (e.g. , phytoplankton, microphytes, or planktonic algae) or macroalgae (kelp, seaweed) in other aspects.
- an algal cell herein can be a Porphyra (purple laver), Paimaria species such as P.
- palmata (dulse), Arthrospira species such as A. platensis ⁇ spirulina), Chlorella (e.g. , C. protothecoides), a Chondrus species such as C. crispus (Irish moss), Aphanizomenon, Sargassum, Cochayuyo, Botryococcus (e.g. , B. braunii), Dunaliella (e.g. , D. tertiolecta), Gracilaria, Pleurochrysis (e.g. , P.
- An algal species herein can be cultivated and/or manipulated as described in Thompson (Algal Cell Culture. Encyclopedia of Life Support System (EOLSS), Biotechnology Vol 1 , available at eolss.net/sample-chapters internet site), for example, which is incorporated herein by reference.
- EOLSS Algal Cell Culture. Encyclopedia of Life Support System
- Biotechnology Vol 1 available at eolss.net/sample-chapters internet site
- a protist cell herein can be selected from the class Ci!iata (e.g., the genera Tetrahymena, Paramecium, Colpidium, Colpoda, Glaucoma, Piatyophrya, Vorticeila, Potomacus, Pseudocohnilembus ; Euploies, Engelmaniella, and Styionichia), the subphy!um Mastigophora (flagellates), the class Phytomastigophorea (e.g., the genera Eugiena, Astasia, Haematococcus, and Crypthecodinium), the class Zoomastigophorea, the superclass Rhizopoda, the class Lobosea (e.g., the genus Amoeba), and the class Eumycetozoea (e.g., the genera Dictyostelium and Physarum), for example.
- the class Ci!iata e.g., the genera Tetrahymena, Para
- protist species herein can be cultivated and/or manipulated as described in ATCC® Protistology Culture Guide: tips and techniques for propagating protozoa and algae (2013, available at American Type Culture Collection internet site), for example, which is incorporated herein by reference.
- a protist can optionally be characterized as a pest/pathogen of a plant or animal (e.g., human) in certain embodiments.
- a bacterial cell in certain embodiments can be those in the form of cocci, bacilli, spirochetes, spheroplasts, protoplasts, etc.
- Other non-limiting examples of bacteria include those that are Gram-negative and Gram-positive.
- Still other non-limiting examples of bacteria include those of the genera Salmonella (e.g., S. typhi, S. enteritidis), Shigella (e.g., S. dysenteriae), Escherichia (e.g., E.
- Arcanobacterium Actinomyces, Rhodococcus, Listeria (e.g., L. monocytogenes), Erysipelothrix, Gardnerella, Neisseria (e.g., N. meningitidis, N. gonorrhoeae), Campylobacter, Arcobacter, Wolinella, Helicobacter (e.g., H. pylori), Achromobacter, Acinetobacter, Agrobacterium (e.g., A.
- tumefaciens Alcaligenes, Chryseomonas, Comamonas, Eikenella, Flavimonas, Flavobacterium, Moraxella, Oligella, Pseudomonas (e.g. , P.
- aeruginosa Shewanella, Weeksella, Xanthomonas, Bordetella, Franciesella, Brucella, Legionella, Afipia, Bartonella, Calymmatobacterium, Cardiobacterium, Streptobacillus, Spirillum, Peptostreptococcus, Peptococcus, Sarcinia, Coprococcus, Ruminococcus, Propionibacterium, Mobil uncus, Bifidobacterium, Eubacterium, Lactobacillus (e.g. , L. lactis, L. acidophilus), Rothia, Clostridium (e.g. , C. botulinum, C.
- Bordetella Franciesella, Brucella, Legionella, Afipia, Bartonella
- Calymmatobacterium Cardiobacterium, Streptobacillus, Spirillum, Peptostreptococcus, Peptococcus, Sarcinia, Coprococcus
- Perfringens Bacteroides, Porphyromonas, Prevoteiia, Fusobacterium, Biiophiia, Leptotrichia, Wolinella, Acidaminococcus, Megasphaera, Veiioneiia, Norcardia, Actinomadura, Norcardiopsis, Streptomyces, Micropolysporas, Thermoactinomycetes, Mycobacterium (e.g. , M. tuberculosis, M. bovis, M. leprae), Treponema, Borrelia (e.g. , B. burgdorferi), Leptospira, and Chlamydiae.
- M. tuberculosis e.g. , M. bovis, M. leprae
- Treponema e.g. , B. burgdorferi
- Leptospira e.g. , Chlamydiae.
- a bacteria can optionally be characterized as a pest/pathogen of a plant or animal (e.g. , human) in certain embodiments.
- Bacteria can be comprised in a mixed microbial population (e.g., containing other bacteria, or containing yeast and/or other bacteria) in certain embodiments.
- An archaeal cell in certain embodiments can be from any Archaeal phylum, such as Euryarchaeota, Crenarchaeota, Nanoarchaeota, Korarchaeota, Aigarchaeota, or Thaumarchaeota.
- Archaeal cells herein can be extremophilic (e.g. , able to grow and/or thrive in physically or geochemically extreme conditions that are detrimental to most life), for example.
- extremophilic archaea include those that are thermophilic (e.g. , can grow at temperatures between 45-122 °C), hyperthermophilic (e.g.
- archaeal species include those of the genera Halobacterium (e.g. , H. volcanii), Sulfolobus (e.g. , S. solfataricus, S. acidocaldarius), Thermococcus (e.g. , T. alcaliphilus, T. celer, T. chitonophagus, T.
- Halobacterium e.g. , H. volcanii
- Sulfolobus e.g. , S. solfataricus, S. acidocaldarius
- Thermococcus e.g. , T. alcaliphilus, T. celer, T. chitonophagus, T.
- Methanocaldococcus e.g. , M. thermolithotrophicus, M. jannaschii
- Methanococcus e.g. , M. maripaludis
- Methanothermobacter e.g. , M. marburgensis, M. thermautotrophicus
- Archaeoglobus e.g. , A. fulgidus
- Nitrosopumilus e.g. , N. maritimus
- Metallosphaera e.g. , M.
- Mammalian cells in certain embodiments can be human, non-human primate (e.g. , monkey, ape), rodent (e.g. , mouse, rat, hamster, guinea pig), rabbit, dog, cat, cow, pig, horse, goat, or sheep cells.
- rodent e.g. , mouse, rat, hamster, guinea pig
- rabbit dog, cat, cow, pig, horse, goat, or sheep cells.
- Other examples of mammalian cells herein include primary epithelial cells (e.g.
- keratinocytes e.g., 293 embryonic kidney cells, HeLa cervical epithelial cells, PER-C6 retinal cells, MDBK, CRFK, MDCK, CHO, BeWo, Chang cells, Detroit 562, Hep-2, KB, LS 180, LS 174T, NCI-H-548, RPMI 2650, SW-13, T24, WI-28 VA13, 2RA, WISH, BS-C-I, LLC-MK2, Clone M-3, RAG, TCMK-1 , LLC-PK1 , PK-15, GH1 , GH3, L2, LLC-RC 256, MH1 C1 , XC, MDOK, VSW, TH-I, B1 cells); any epithelial, mesenchymal (e.g., 293 embryonic kidney cells, HeLa cervical epithelial cells, PER-C6 retinal cells, MDBK, CRFK, MDCK, CHO, BeWo, Chang cells, Detroit 562, He
- fibroblast neural, or muscular cell from any tissue or organ (e.g. , skin, heart; liver; kidney; colon; intestine; esophagus; stomach; neural tissue such as brain or spinal cord; lung; vascular tissue; lymphoid tissue such as lymph gland, adenoid, tonsil, bone marrow, or blood; spleen); and fibroblast or fibroblast-like cell lines (e.g.
- a cell can be of any pathogen and/or pest of an animal or plant.
- pathogens/pests include various types of bacteria, fungi, yeast, protists, nematodes, and insects. Those skilled in the art would recognize examples of such pathogens/pests disclosed above.
- a centimorgan is the distance between two linked genes, markers, target sites, loci, or any pair thereof, wherein 1 % of the products of meiosis are recombinant.
- a centimorgan is equivalent to a distance equal to a 1 % average recombination frequency between the two linked genes, markers, target sites, loci, or any pair thereof.
- the guide RNA/Cas system described herein is especially useful for genome engineering, especially microbial and plant genome engineering, in circumstances where nuclease off-target cutting can be toxic to the targeted cells.
- an expression-optimized Cas9 gene is stably integrated into the target genome, e.g. Yarrowia's genome. Expression of the Cas9 gene is under control of a promoter, e.g. a Yarrowia promoter,.
- the Cas9 protein is not able to cut DNA and therefore its presence in the cell should have little or no consequence.
- a key advantage of the guide RNA/Cas system described herein is the ability to create and maintain a cell line or organism capable of efficient expression of the Cas9 protein with little or no consequence to cell viability.
- a guide RNA/Cas system mediating gene targeting can be used in methods for directing transgene insertion and / or for producing complex transgenic trait loci comprising multiple transgenes in a fashion similar as disclosed in WO2013/0198888 (published August 1 , 2013) where instead of using a double strand break inducing agent to introduce a gene of interest, a guide RNA/Cas system as disclosed herein is used.
- a complex transgenic trait locus includes a genomic locus that has multiple transgenes genetically linked to each other.
- the transgenes can be bred as a single genetic locus (see, for example, U.S. patent application 13/427, 138) or PCT application PCT/US2012/030061.
- Chromosomal intervals that correlate with a phenotype or trait of interest can be identified.
- a variety of methods well known in the art are available for identifying chromosomal intervals.
- the boundaries of such chromosomal intervals are drawn to encompass markers that will be linked to the gene controlling the trait of interest.
- the chromosomal interval is drawn such that any marker that lies within that interval (including the terminal markers that define the boundaries of the interval) can be used as a marker for northern leaf blight resistance.
- the chromosomal interval comprises at least one QTL, and furthermore, may indeed comprise more than one QTL.
- QTL quantitative trait locus
- An "allele of a QTL" can comprise multiple genes or other genetic factors within a contiguous genomic region or linkage group, such as a haplotype.
- An allele of a QTL can denote a haplotype within a specified window wherein said window is a contiguous genomic region that can be defined, and tracked, with a set of one or more polymorphic markers.
- a haplotype can be defined by the unique fingerprint of alleles at each marker within the specified window.
- Proteins may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known. For example, amino acid sequence variants of the protein(s) can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations include, for example, Kunkel, (1985) Proc. Natl. Acad. Sci. USA 82:488-92; Kunkel et a/. , (1987) Meth Enzymol 154:367-82; U.S. Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein.
- amino acid substitutions not likely to affect biological activity of the protein are found, for example, in the model of Dayhoff et al., (1978) Atlas of Protein Sequence and Structure (Natl Biomed Res Found, Washington, D.C.). Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be preferable. Conservative deletions, insertions, and amino acid substitutions are not expected to produce radical changes in the characteristics of the protein, and the effect of any substitution, deletion, insertion, or combination thereof can be evaluated by routine screening assays. Assays for double-strand-break-inducing activity are known and generally measure the overall activity and specificity of the agent on DNA substrates containing target sites.
- a variety of methods are known for the introduction of nucleotide sequences and polypeptides into an organism, including, for example, transformation, sexual crossing, and the introduction of the polypeptide, DNA, or mRNA into the cell.
- Methods for contacting, providing, and/or introducing a composition into various organisms are known and include but are not limited to, stable transformation methods, transient transformation methods, virus-mediated methods, and sexual breeding.
- Stable transformation indicates that the introduced polynucleotide integrates into the genome of the organism and is capable of being inherited by progeny thereof.
- Transient transformation indicates that the introduced composition is only temporarily expressed or present in the organism.
- Protocols for introducing polynucleotides and polypeptides into plants may vary depending on the type of plant or plant cell targeted for transformation, such as monocot or dicot.
- Suitable methods of introducing polynucleotides and polypeptides into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al. , (1986) Biotech niques 4:320-34 and U.S. Patent No. 6,300,543), meristem transformation (U.S. Patent No. 5,736,369), electroporation (Riggs et al. , (1986) Proc. Natl. Acad. Sci. USA 83:5602-6, Agrobacterium-med ated transformation (U.S. Patent Nos. 5,563,055 and 5,981 ,840), direct gene transfer (Paszkowski et al.
- polynucleotides may be introduced into plants by contacting plants with a virus or viral nucleic acids.
- such methods involve incorporating a polynucleotide within a viral DNA or RNA molecule.
- a polypeptide of interest may be initially synthesized as part of a viral polyprotein, which is later processed by proteolysis in vivo or in vitro to produce the desired recombinant protein.
- Methods for introducing polynucleotides into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known, see, for example, U.S. Patent Nos.
- Transient transformation methods include, but are not limited to, the introduction of polypeptides, such as a double-strand break inducing agent, directly into the organism, the introduction of polynucleotides such as DNA and/or RNA polynucleotides, and the introduction of the RNA transcript, such as an mRNA encoding a double-strand break inducing agent, into the organism.
- polypeptides such as a double-strand break inducing agent
- polynucleotides such as DNA and/or RNA polynucleotides
- the introduction of the RNA transcript such as an mRNA encoding a double-strand break inducing agent
- the term "dicot” refers to the subclass of angiosperm plants also knows as “dicotyledoneae” and includes reference to whole plants, plant organs (e.g. , leaves, stems, roots, etc.), seeds, plant cells, and progeny of the same.
- Plant cell as used herein includes, without limitation, seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.
- crossing means the fusion of gametes via pollination to produce progeny (i.e. , cells, seeds, or plants).
- progeny i.e. , cells, seeds, or plants.
- the term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, i.e. , when the pollen and ovule (or microspores and megaspores) are from the same plant or genetically identical plants).
- introgression refers to the transmission of a desired allele of a genetic locus from one genetic background to another.
- introgression of a desired allele at a specified locus can be transmitted to at least one progeny plant via a sexual cross between two parent plants, where at least one of the parent plants has the desired allele within its genome.
- transmission of an allele can occur by recombination between two donor genomes, e.g. , in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome.
- the desired allele can be, e.g., a transgene, a modified (mutated or edited) native allele, or a selected allele of a marker or QTL.
- Vectors and constructs include circular plasmids, and linear polynucleotides, comprising a polynucleotide of interest and optionally other components including linkers, adapters, regulatory or analysis.
- a recognition site and/or target site can be contained within an intron, coding sequence, 5' UTRs, 3' UTRs, and/or regulatory regions.
- Any plant can be used, including monocot and dicot plants.
- monocot plants that can be used include, but are not limited to, corn (Zea mays), rice ⁇ Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g.
- pearl millet Piero millet
- proso millet Piero millet
- foxtail millet Setaria italica
- finger millet Eleusine coracana
- wheat Triticum aestivum
- sugarcane Saccharum spp.
- oats A vena
- barley Hordeum
- switchgrass Panicum virgatum
- pineapple Ananas comosus
- banana Musa spp.
- palm ornamentals, turfgrasses, and other grasses.
- Examples of dicot plants that can be used include, but are not limited to, soybean (Glycine max), canola (Brassica napus and B.
- campestris alfalfa (Medicago sativa), tobacco (Nicotiana tabacum), Arabidopsis (Arabidopsis thaliana), sunflower (Helianthus annuus), cotton (Gossypium arboreum), and peanut (Arachis hypogaea), tomato (Solanum lycopersicum), potato (Solanum tuberosum) etc.
- compositions and methods disclosed herein are as follows: 1. A method for selecting a cell comprising a modified nucleotide sequence in its genome, the method comprising
- the protected polynucleotide modification template is a linear polynucleotide comprising at least one protection molecule at its 5' end, 3' end, or both 5' and 3' ends.
- the protection molecule is selected from the group consisting of an alkane spacer, a fluorophore, a NHS ester, a Digoxigen, a Cholesteryl-TEG, a C6, a C12, a Hexynyl, Oxtadiynyl dUTP, a Biotin, a Dithiol, an inverted Dideoxy-T modification or any one combination thereof.
- said protected polynucleotide modification template is a single stranded or double stranded linear molecule comprising at least one phosphorothiate bond at the 5' end of at least one strand.
- said protected polynucleotide modification template is a single stranded or double stranded linear molecule comprising a 3 carbon alkaline spacer on the 5' end of each strand.
- the at least one nucleotide modification of the protected polynucleotide template is selected from the group consisting of (i) a replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, and (iv) any combination of (i) - (iii).
- the method of embodiment 1 further determining the frequency of Homologous Directed Repair (HDR) and Non-Homologous End Joining (NHEJ) in said cell.
- HDR Homologous Directed Repair
- NHEJ Non-Homologous End Joining
- a method for selecting a cell comprising a polynucleotide of interest inserted into a target site in its genome comprising:
- step (b) selecting a cell from step (a) comprising a polynucleotide of interest inserted into a target site in its genome.
- a method for selecting a microbial cell comprising a polynucleotide of interest inserted into a target site in its genome comprising:
- step (a) selecting a microbial cell from step (a) comprising a polynucleotide of interest inserted into a target site in its genome.
- the cell is selected from the group consisting of human, non-human, animal, bacterial, archaeal, fungal, insect, yeast, non-conventional yeast, plant and microbial cells.
- yeast is a member of a genus selected from the group consisting of Yarrowia, Pichia, Schwanniomyces, Kluyveromyces, Arxula, Trichosporon, Candida, Ustilago, Torulopsis, Zygosaccharomyces, Trigonopsis, Cryptococcus, Rhodotorula, Phaffia, Sporobolomyces, and Pachysolen.
- This example discusses the use of single guide RNAs (sgRNAs) that are flanked on the 5' end by a hepatitis delta virus (HDV) ribozyme.
- sgRNAs single guide RNAs
- HDV hepatitis delta virus
- the Yarrowia codon optimized Cas9 gene was fused to a Yarrowia constitutive promoter, FBA1 (SEQ ID NO: 4), by standard molecular biology techniques.
- FBA1 Yarrowia constitutive promoter
- An example of a Yarrowia codon optimized Cas9 expression cassette containing the FBA1 promoter and the Yarrowia optimized Cas9-NLS fusion is shown in SEQ ID NO: 5.
- the Cas9 expression cassette was cloned into the plasmid pZuf resulting in pZufCas9 (SEQ ID NO 6).
- Plasmid pZuf-Cas9CS (SEQ ID NO: 6) was mutagenized using Agilent QuickChange and the following primers Aarl-removal-1
- the modified Aar1 -Cas9CS gene (SEQ ID NO: 10) was cloned as a Ncol/Notl fragment from pRF109 (SEQ ID NO: 9) into the Ncol/Notl site of pZufCas9CS (SEQU ID NO: 6) replacing the existing Cas9 gene (SEQ ID NO: 2) with the Aar1 - Cas9 gene (SEQ ID NO: 10) generating pRF141 (SEQ ID NO: 1 1 ).
- the high throughput variable targeting domain (VT) cloning cassette ( Figure 1 , SEQ ID NO: 12) is composed of the yl52 promoter (SEQ ID NO: 13), the DNA sequence encoding the HDV ribozyme (SEQ ID NO: 14), the Escherichia coli counterselection cassette rpsL (SEQ ID NO: 15), the DNA encoding the Cas9 CER domain (SEQ ID NO: 16) and the S. cerevisiae SUP4 terminator (SEQ ID NO: 17). Flanking the ends of the high-throughput cloning cassette (SEQ ID NO: 12) are Pad and Clal restriction enzyme recognition sites.
- the high-throughput cloning cassette (SEQ ID NO: 12) was cloned into the Pacl/Clal sites of pRF141 (SEQ ID NO: 1 1 ) to generate pRF291 (SEQ ID NO 14).
- the rpsL counterselection cassette (SEQ ID NO: 15) contains a WT copy of the E. coli rpsL gene with its native promoter and terminator. rpsL encodes the S12 ribosomal protein subunit (Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, 1987 American Society of Microbiology). Some mutations in the S12 subunit cause resistance to the antibiotic streptomycin (Ozaki, M. , et al.
- Cloning a variable targeting domain into pRF291 requires two partially complimentary oligonucleotides that when annealed they contain the desired variable targeting domain as well as the correct overhangs for cloning into the two Aarl sites present in the high-throughput cloning cassette.
- Can1 -1 F AATGGGACtcaaacgattacccaccctcGTTT, SEQ ID NO: 19
- Can1 -1 R TCTAAAACgagggtgggtaatcgtttgaGTCC, SEQ ID NO: 20
- Can1 -1 target site SEQ ID NO: 22
- SEQ ID NO: 23 Yarrowia lipolytica
- Can1 -1 F (SEQ ID NO: 19) and Can1 -1 R (SEQ ID NO: 20) were mixed at a final concentration of 50 ⁇ each in a single tube, heated to 95°C for 5 minutes and cooled to 25°C at 0.1 °C/min to anneal the two oligonucleotides to form a small duplex DNA molecule ( Figure 2).
- a single tube digestion/ligation reaction was created containing 50 ng of pRF291 , 2.5 ⁇ of the small duplex DNA composed of Can1 -1 F (SEQ ID NO: 19) and Can1 -1 R (SEQ ID NO: 20), 1x T4 ligase buffer (50 mM Tris-HCI, 10 mM MgC , 1 mM ATP, 10 mM DTT pH 7.5), 0.5 ⁇ Aarl oligonucleotide, 2 units Aarl, 40 units T4 DNA ligase in a 20 ⁇ final volume.
- a second control reaction lacking the duplexed Can1 -1 F and Can1 -1 R duplex was also assembled. The reactions were incubated at 37°C for 30 minutes.
- pRF291 containing the Can1 -1 variable targeting domain replacing the counterselection cassette created a recombinant Can1 -1 gRNA expression cassette (SEQ ID NO: 19) containing the yl52 promoter (SEQ ID NO: 13) fused to the DNA encoding the HDV ribozyme (SEQ ID NO: 14) fused to the DNA encoding the Can1 -1 variable targeting domain (SEQ ID NO: 21 ) fused to the DNA encoding the CER domain (SEQ ID NO: 16) fused to the SUP4 terminator (SEQ ID NO: 17).
- the plasmid containing this construct, pRF303 (SEQ ID NO: 24) was used to target the CAN1 gene (SEQ ID NO: 23) of Yarrowia lipolytica with Cas9.
- protected polynucleotide editing templates provides a method of increasing the frequency of HDR repair of Cas9/gRNA generated DSBs decreasing the number of events that must be screened to find an event with the desired edit.
- This example describes the generation of three different types of polynucleotide modification template molecules that have modified ends that renders them less prone to degradation, referred to as "protected polynucleotide modification templates”.
- protected polynucleotide modification templates can potentially alter template stability by protecting the template from exonuclease activity within the cell and/or alter the ability of the template to act as a substrate for non-homologous end-joining (NHEJ).
- NHEJ non-homologous end-joining
- the editing template will contain the two homology arms linked with no intervening sequence ( Figure 3B)
- the three types of protected polynucleotide modification templates are 1 ) a circular DNA template with no available double strand ends (Figure 3D) a linear double stranded DNA template modified with a three carbon alkane spacer on the 5' end of each strand ( Figure 3C), and 3) a linear double stranded DNA template with the five 5' most phophodiester bonds replaced with phosphorothioate bonds on each strand ( Figure 3C).
- a unprotected (unmodified) polynucleotide modification template was generated by making two PCR products, one, the 629 bp ending 2 bp 5' of the CAN1 open reading frame (SEQ ID NO: 25) which was amplified from Yarrowia lipolytica ATCC20362 genomic DNA using standard techniques (primers used, GGGAAGCTTGCTACGTTAGGAGAAGACGC (forward, SEQ ID NO: 26) and GGAGAGAGCGTCGGGAGTGGTCGGATGGATGGACG (reverse, SEQ ID NO:27)).
- the reverse primer adds 17 nucleotides complementary to the sequence 37 bp 3' of the CAN1 open reading frame and the forward primer adds a 5' HinDIII recognition site.
- the second PCR product consisting of 637 bp starting 37 basepairs 3' of the CAN1 open-reading frame (SEQ ID NO: 28). This PCR product was amplified from Yarrowia lipolytica ATCC20362 genomic DNA using standard techniques (primers used, CGTCTCCATCCATCCGACCACTCCCGACGCTCTCTCC (forward, SEQ ID NO: 29) and CCATACATCCTTCCACCACTGC (reverse, SEQ ID NO: 30)).
- the forward primer adds the 20 nucleotides complementary to the region ending 2 bp 5' of the CAN1 open reading frame.
- Both the upstream (SEQ ID NO: 25) and the downstream PCR product (SEQ ID NO:28) were purified using Zymo clean and concentrate columns. 10ng of each PCR product were mixed in a new PCR reaction.
- the 3' 37 nucleotides of the upstream product is identical to the 5' 37 nucleotides of the downstream product.
- the upstream and downstream fragments were used to prime each other creating a single product representing the unprotected polynucleotide modification template (SEQ ID NO: 31 ) by synthesis from overlapping ends containing both the upstream and downstream sequences (Horton et al (2013) Biotechniques 54(3): 129-133) ( Figure 3B).
- the complete non-protected (control) polynucleotide modification template was digested with HinDIII and cloned into the HinDIII site of pUC18 (SEQ ID NO: 32) using standard techniques generating plasmid pRF80 (SEQ ID NO: 33).
- the plasmid pRF80 represents a double stranded circular protected polynucleotide modification template ( Figure 3D) comprising a 1210 bp DNA fragment (SEQ ID NO: 34) that when used as a template for homology directed repair (HDR) will lead to the deletion of the entire CAN1 open reading frame.
- Linear protected polynucleotide modification templates were generated from the cloned template contained on pRF80 (SEQ ID NO: 33).
- the template contained on pRF80 was PCR amplified using standard techniques and chemically synthesized, modified oligonucleotides as primers (IDT).
- a linear protected polynucleotide modification template with the 5' ends modified with an alkane spacer
- the template from pRF80 was amplified (primers used /5SpC3/AGCTTGCTACGTTAGGAGAA, forward (SEQ ID NO: 35) and /5SpC3/TATGAGCTTATCCTGTATCG, reverse (SEQ ID NO:36)) to generate a 1215bp PCR containing the CAN1 ORF deletion template (SEQ ID NO: 34) with 5' alkane spacers on the 5' end of each strand.
- a second linear protected polynucleotide modification template was generated in essentially the same manner using pRF80 (SEQ ID NO: 33) as a PCR template.
- the linear template was amplified with chemically synthesized primers (IDT) in which the five 5' most phosphodiester bonds have been replaced with phosphorothioate bonds ( * ) (primers used; A * G * C * T * T * GCTACGTTAGGAGAA, forward (SEQ ID NO: 37) and T * A * T * G * A * GCTTATCCTGTATCG, reverse (SEQ ID NO: 38)).
- the resulting product is the 1215bp CAN1 deletion protected polynucleotide modification template (SEQ ID NO: 31 ) containing five phosphorothioate bonds at the 5' most ends of each strand.
- An unmodified (unprotected, control) template was amplified from pRF80 using chemically synthesized oligonucleotide primers with no modifications and standard techniques (primers used, AGCTTGCTACGTTAGGAGAA, forward (SEQ ID NO: 40) and TATGAGCTTATCCTGTATCG, reverse (SEQ ID NO: 41 ) to yield an unprotected 1215bp linear CAN1 deletion polynucleotide modification template (editing template) (SEQ ID NO: 31 ).
- PCR reactions of linear templates were purified using Zymo clean and concentrate 25 columns and eluted in 25 ⁇ of 10mM Tris 1 mM EDTA pH8.0.
- Yarrowia lipolytica cells were transformed with targeting plasmids in the presence and absence of protected and unprotected (unmodified) polynucleotide modification templates to determine the effect of using a protected template (instead of an unprotected (control) template) on HDR and NHEJ frequency.
- Increases in HDR frequencies and the simultaneous decrease in NHEJ frequency would greatly decrease the NHEJ-derived background present in typical Cas9/gRNA gene editing experiments.
- Cells were phenotypically scored for Canavanine resistance to determine overall targeting efficiency (representative of NHEJ frequency + HDR frequency).
- Colony PCR of the CAN1 locus SEQ ID NO: 39 was performed to determine frequency of repair of the Cas9/gRNA generated double-strand break by HDR and NHEJ.
- a uracil auxotrophic strain of Yarrowia lipolytica ATCC20362 was grown for 24 hours on YPD medium plates (Teknova) at 30°C. 1 loop of cells were resuspended in transformation buffer (35% polyethylene glycol average molecular weight of 3550, 100 mM lithium acetate, 100 mM dithiothreitol, 10 mM Tris, 1 mM EDTA pH 6.0).
- 100 ⁇ of cell suspension was mixed with 100 ng of either pRF291 (SEQ ID NO: 18) (Cas9 expression, no gRNA) or pRF303 (SEQ ID NO: 24) (Cas9 expression, Can1 -1 gRNA expression) with either no polynucleotide modification template, 1 g unprotected linear polynucleotide modification template (SEQ ID NO: 31 ), 1 g C3S protected linear polynucleotide modification template (template comprising a 3 carbon alkaline spacer at the 5' end of SEQ ID NO: 31 ), 1 g PT protected linear polynucleotide modification template (template comprising a phosphorothiate bond at the first five 5' nucleotides of SEQ ID NO: 31 ) or 5 g of a circular protected polynucleotide modification template , pRF80 (SEQ ID NO 33) .
- pRF291 SEQ ID NO: 18
- pRF303
- Transformation mixtures were incubated at 39°C for 1 hour at 800 RPM. Transformation mixtures were plated on complete minimal medium plates lacking uracil (Teknova) to select for cells transformed with plasm id DNA. Plates were incubated at 30°C for 48 hours. 24 colonies from each transformation were streak purified on complete minimal plates lacking uracil (Teknova) for single colonies. 4 single colonies from each streak purified colony (96 for each transformation) were patched to complete minimal plates lacking arginine containing 60pg/ml L-canavanine. L-canavanine is toxic to cells with a functional CAN1 gene which is an importer of arginine and L-canavanine to the cells.
- L-canavanine The mode of action of L- canavanine is well known (Rosenthal G.A., The Biological effects and mode of action of L-Canavanine, a structural analog of L-arginine, The quarterly review of biology, volume 52, 1977, 155-178).
- the frequency of Canavanine resistance by transformation treatment is given in Table 2.
- Table 2 Canavanine resistance by transformation treatment.
- Results represent the average and standard deviation for at least two independent repeats in each case Each experimental repeat screened a total of 80 colonies.
- the colony PCR result would give a band similar in size to the WT CAN1 locus at an apparent size of 2125 bp (SEQ ID NO: 44). If the Cas9/gRNA generated double-strand break had been repaired using the unprotected or protected modification templates, the PCR would generate a smaller CAN1 locus product 392bp indicating the deletion of the entire open-reading frame (SEQ ID NO: 45).
- Colony PCR was performed on all canavanine resistant colonies from cells transformed with pRF303 in the presence or absence of the template and the fraction of cells where the Cas9/gRNA generated double-strand break was repaired via HDR or NHEJ with the polynucleotide modification template was determined (Table 3).
- Table 3 Frequency of HDR of Cas9/gRNA generated double strand break by polynucleotide modification template type.
- non-replicating protected templates provide substantial increases in the fraction of breaks repaired via HDR with 200% and 140% of the frequency of unprotected linear polynucleotide modification templates.
- NHEJ is the predominate DNA DSB repair pathway in most eukaryotic cells including Yarrowia lipolytica.
- the use of protected DNA modification templates increases the frequency of HDR repair of Cas9/gRNA generated DSBs by as much as 2 fold, allowing for screening a smaller number of events to find the correct, template repair of the DSB.
- Relative copy number analysis was performed on colonies from cells treated with pRF303 (SEQ ID NO: 24) and a linear control polynucleotide modification polynucleotide (SEQ ID NO: 34), the linear protected polynucleotide modification template, PT (SEQ ID NO: 34), and the circular protected polynucleotide modification template, pRF80 (SEQ ID NO: 33). If the polynucleotide modification template is only incorporated during the HDR of the Cas9/gRNA double strand break at the CAN1 locus (SEQ ID NO: 39) the cell will only carry a single copy of the copy number analysis fragment (SEQ ID NO: 46).
- genomic DNA was isolate from colonies that scored positive for HDR of the Can1 -1 Cas9/gRNA targeted double strand break using standard techniques.
- Reactions were run in TaqMAN universal PCR master mix (ABI life technologies) on a life technologies Quant Studio 7 instrument using the following cycling conditions 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds, 60°C for 1 minute. 6FAM fluorescence from the probes was monitored through the 40 cycles of the PCR and Ct values were collected. Relative gene copy number was determined by the AACt method (User Bulletin #2 ABI PRISM 7700 Sequence Detection System (Updated 2001 )). Briefly, TEF1 Ct values were used to normalize the data for differences in cell copy number between genomic DNA samples. Genomic DNA from a wildtype strain was used as a reference for the relative quantification for the CAN1 copy number fragment (SEQ ID NO: 46).
- Copy number analysis was performed using a qPCR target that was present both in the CAN1 locus of Yarrowia lipolytica as well as present on all polynucleotide modification templates (protected and unprotected). If the polynucleotide modification template was used for HDR of the CAN1 locus in the cells, the copy number of the target will remain 1 . If the polynucleotide editing template was also inserted elsewhere in the Yarrowia genome the copy number will be at least 2 indicating the copy present in the CAN1 locus and the copy of the polynucleotide editing template inserted by NHEJ elsewhere in the genome.
- Both the unprotected linear polynucleotide modification template and the PT template yield approximately 60% of colonies with a single copy of the CAN1 polynucleotide modification template indicating that the polynucleotide modification template was used for HDR of the Cas9/gRNA generated DSB but did not integrate in the genome Table 4).
- the circular protected polynucleotide modification template, pRF80 demonstrated 100 percent of the colonies with only a single copy of the CAN1 locus indicating that the circular template was only used for HDR of the Cas9/gRNA generated break at Can1 -1 and was not integrated elsewhere in the chromosome.
- the protected polynucleotide modification templates gave superior results compared to unprotected polynucleotide modification templates in surprising ways.
- Linear protected templates in which the five 5' phosphodiester bonds on each strand have been replaced with phosphorothioate bonds give more than twice as many colonies with the Cas9/gRNA generated DSB repaired via HDR than an unprotected template without causing a change in the integration of the linear template elsewhere in the chromosome.
- the URA3 gene of Yarrowia lipolytica is targeted for precise genome editing using a protected polynucleotide editing template that is part of a circular DNA molecule containing the Cas9 expression cassette and the sgRNA expression cassette.
- Plasmid pRF434 (SEQ ID NO: 54) was constructed by replacing the URA3 selectable marker present in pRF291 (SEQ ID NO: 18) between the Pad and Pmel restriction sites with a hygromycin resistance expression cassette (SEQ ID NO: 55). This plasmid allows the high throughput cloning of variable targeting domains in the same fashion as pRF291 ( Figure 1 ). Within the Yarrowia lipolytica URA3 locus (SEQ ID NO: 56) exists the target site Ura3-1 (SEQ ID NO: 57).
- Ura3-1 F SEQ ID NO: 58
- URA3-1 R SEQ ID NO: 59
- Ura3-1 F SEQ ID NO: 58
- Ura3-1 R SEQ ID NO: 59
- a single tube digestion/ligation reaction was created containing 50 ng of pRF434, 2.5 ⁇ of the small duplex DNA composed of Ura3-1 F (SEQ ID NO: 58) and Ura3-1 R (SEQ ID NO: 59), 1x T4 ligase buffer (50mM Tris-HCI, 10 mM MgCI 2 , 1 mM ATP, 10 mM DTT pH 7.5), 0.5 ⁇ Aarl oligonucleotide, 2 units Aarl, 40 units T4 DNA ligase in a final volume of 20 ⁇ .
- a control reaction lacked the small DNA duplex of Ura3-1 F (SEQ ID NO: 58) and URA3-1 R (SEQ ID NO: 59).
- pRF434 SEQ ID NO: 54
- the presence of pRF434 (SEQ ID NO: 54) containing the high-throughput cloning cassette yielded colonies phenotypically resistant to ampicillin but sensitive to streptomycin due to the counterselection cassette and do not form colonies in the presence of streptomycin.
- the counterselection cassette was removed via the Aarl enzyme and the Ura3-1 duplex DNA was ligated into the site (removing the Aarl recognition sites) the transformed cells have an ampicillin-resistant, streptomycin-resistant phenotype and form colonies in the presence of ampicillin and streptomycin.
- pRF434 (SEQ ID NO: 54) containing the DNA encoding the Ura3-1 variable targeting domain in the Aarl sites creates a recombinant HDV-sgRNA expression cassette containing the yl52 promoter (SEQ ID NO: 13) fused to the DNA encoding the HDV ribozyme (SEQ ID NO: 14) fused to the DNA encoding the Ura3-1 VT domain (SEQ ID NO: 60) fused to the DNA encoding the CER domain (SEQ ID NO: 16), fused to the SUP4 terminator (SEQ ID NO 17).
- the plasmid containing this construct, pRF421 (SEQ ID NO: 61 ) was used to target the URA3 locus (SEQ ID NO: 56) of Yarrowia lipolytica.
- the construct was cloned into the EcoRI/HinDIII sites of pUC18 (SEQ ID NO: 32) generating plasmid pRF263 (SEQ ID NO: 65).
- the polynucleotide editing template was amplified from pRF263 using primers HY007 (SEQ ID NO: 66) and oligo 297 (SEQ ID NO: 67) to generate the URA3 deletion polynucleotide modification template flanked by 5' and 3' EcoRI sites (SEQ ID NO: 68).
- the EcoRI flanked URA3 deletion polynucleotide editing template was cloned into the EcoRI site of pRF421 (SEQ ID NO: 61 ) to generate pRF437 (SEQ ID NO: 69).
- Prototrophic Yarrowia lipolytica ATCC20362 cells were grown for 24 hours on YPD medium plates (Teknova) at 30°C. 1 loop of cells were resuspended in transformation buffer (35% polyethylene glycol average molecular weight of 3550, 100 mM lithium acetate, 100 mM dithiothreitol, 10 mM Tris, 1 mM EDTA pH 6.0). 100 ⁇ of cell suspension was mixed with 100ng of either pRF421 (SEQ ID NO: 61 ), pRF434 (SEQ ID NO: 54), pRF437 (SEQ ID NO: 69), or no DNA. Cells were heat shocked at 39°C 800RPM for 1 hour.
- YPD medium 1 ml of YPD medium (Teknova) was added to each transformation.
- Cells were grown at 30°C 220RPM for 4 hours to allow expression of the hygromycin resistance cassette.
- Cells were plated on YPD medium containing 250 mg/L of hygromycin sulfate (calbiochem). Colonies were allowed to form at 30°C. 48 colonies from each transformation (with the exception of no DNA which had 0 colonies) were patched to YPD medium plates (Teknova) and CM plates containing 450 mg/L 5-fluoroorotic acid (5FOA). 5FOA selects against cells with a functional URA3 gene.
- 5FOA 5-fluoroorotic acid
- Results represent the average and range for two independent repeats in each case. Each replicate screened at least 48 colonies.
- the presence of the protected polynucleotide modification template within the context of the Cas9/sgRNA plasmid did not affect the frequency of targeting at the URA3 locus using a sgRNA containing the Ura3-1 variable targeting domain (Table 5).
- the frequency of 5FOA resistance represents total targeting frequency and includes mutants generated by repair of the Cas9/gRNA DSB by the NHEJ pathway and the HDR pathway.
- PCR amplification of the URA3 locus in 5FOA resistant colonies was performed using oligonucleotide primers 308 (SEQ ID NO: 70) and 309 (SEQ ID NO: 71 ).
- Cas9/sgRNA breaks repaired by the NHEJ pathway result in the deletion or insertion of a few nucleotides resulting in small indels and when the entire locus is amplified the product appears WT (SEQ ID NO: 56) in size (1714bp).
- the amplified URA3 locus is reduced in size (859bp) (SEQ ID NO: 72) due to deletion of the URA3 open reading frame.
- An example of the PCR of 5FOA resistant colonies from cells transformed with pRF437 (SEQ ID NO:69) is shown in Figure 4.
- Table 6 HDR using protected polynucleotide editing templates.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2018538537A JP7011590B2 (en) | 2015-10-12 | 2016-10-11 | Protected DNA template and method of use for increased intracellular gene recombination and homologous recombination |
| AU2016338785A AU2016338785B2 (en) | 2015-10-12 | 2016-10-11 | Protected DNA templates for gene modification and increased homologous recombination in cells and methods of use |
| EP16791150.2A EP3362560B1 (en) | 2015-10-12 | 2016-10-11 | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use |
| US15/761,899 US20180273979A1 (en) | 2015-10-12 | 2016-10-11 | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use |
| CA2999050A CA2999050C (en) | 2015-10-12 | 2016-10-11 | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use |
| BR112018007351-2A BR112018007351B1 (en) | 2015-10-12 | 2016-10-11 | MICROBIAL CELL SELECTION METHODS |
| EP22189338.1A EP4144844B1 (en) | 2015-10-12 | 2016-10-11 | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use |
| DK16791150.2T DK3362560T3 (en) | 2015-10-12 | 2016-10-11 | PROTECTED DNA TEMPLATES FOR GENE MODIFICATION AND ENHANCED HOMOLOGOUS RECOMBINATION IN CELLS AND METHODS THEREOF |
| KR1020187012640A KR102628801B1 (en) | 2015-10-12 | 2016-10-11 | Protective DNA templates and methods of use for intracellular genetic modification and increased homologous recombination |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562240140P | 2015-10-12 | 2015-10-12 | |
| US62/240,140 | 2015-10-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017066175A1 true WO2017066175A1 (en) | 2017-04-20 |
Family
ID=57233846
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/056404 Ceased WO2017066175A1 (en) | 2015-10-12 | 2016-10-11 | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20180273979A1 (en) |
| EP (2) | EP4144844B1 (en) |
| JP (1) | JP7011590B2 (en) |
| KR (1) | KR102628801B1 (en) |
| AU (1) | AU2016338785B2 (en) |
| CA (1) | CA2999050C (en) |
| DK (2) | DK4144844T3 (en) |
| FI (1) | FI4144844T3 (en) |
| WO (1) | WO2017066175A1 (en) |
Cited By (46)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| WO2019143077A1 (en) * | 2018-01-22 | 2019-07-25 | 경상대학교산학협력단 | Method for increasing efficiency of homologous recombination-based gene editing in plant |
| WO2019157326A1 (en) | 2018-02-08 | 2019-08-15 | Zymergen Inc. | Genome editing using crispr in corynebacterium |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| CN111836825A (en) * | 2018-01-11 | 2020-10-27 | 科沃施种子欧洲股份两合公司 | Optimized plant CRISPR/CPF1 system |
| US20200370070A1 (en) * | 2017-11-17 | 2020-11-26 | The Johns Hopkins University | Compositions and methods for efficient genome editing |
| WO2020236967A1 (en) | 2019-05-20 | 2020-11-26 | The Broad Institute, Inc. | Random crispr-cas deletion mutant |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| WO2021041922A1 (en) | 2019-08-30 | 2021-03-04 | The Broad Institute, Inc. | Crispr-associated mu transposase systems |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11352647B2 (en) | 2016-08-17 | 2022-06-07 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11591601B2 (en) | 2017-05-05 | 2023-02-28 | The Broad Institute, Inc. | Methods for identification and modification of lncRNA associated with target genotypes and phenotypes |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US12123033B2 (en) | 2019-10-24 | 2024-10-22 | Integrated Dna Technologies, Inc. | Modified double-stranded donor templates |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12215382B2 (en) | 2019-03-01 | 2025-02-04 | The General Hospital Corporation | Liver protective MARC variants and uses thereof |
| US12254959B2 (en) | 2019-07-03 | 2025-03-18 | Integrated Dna Technologies, Inc. | Identification, characterization, and quantitation of CRISPR-introduced double-stranded DNA break repairs |
| WO2025059533A1 (en) | 2023-09-13 | 2025-03-20 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US12264323B2 (en) | 2018-12-17 | 2025-04-01 | The Broad Institute, Inc. | CRISPR CPF1 direct repeat variants |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12499971B2 (en) | 2016-09-28 | 2025-12-16 | The Broad Institute, Inc. | Systematic screening and mapping of regulatory elements in non-coding genomic regions, methods, compositions, and applications thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12534714B2 (en) | 2019-03-18 | 2026-01-27 | The Broad Institute, Inc. | Type VII CRISPR proteins and systems |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI851534B (en) | 2016-12-22 | 2024-08-11 | 美商英特利亞醫療公司 | Compositions and methods for treating alpha-1 antitrypsin deficiency |
| CN113825834A (en) * | 2019-03-11 | 2021-12-21 | 索伦托药业有限公司 | Improved process for DNA construct integration using RNA-guided endonuclease |
| KR102767511B1 (en) * | 2024-05-29 | 2025-02-17 | 충북대학교 산학협력단 | Lactic acid bacteria and gram-positive bacteria genetic recombination method using the CRISPR/Cas system |
Citations (67)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4873192A (en) | 1987-02-17 | 1989-10-10 | The United States Of America As Represented By The Department Of Health And Human Services | Process for site specific mutagenesis without phenotypic selection |
| US4880741A (en) | 1983-10-06 | 1989-11-14 | Pfizer Inc. | Process for transformation of Yarrowia lipolytica |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5034323A (en) | 1989-03-30 | 1991-07-23 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5071764A (en) | 1983-10-06 | 1991-12-10 | Pfizer Inc. | Process for integrative transformation of yarrowia lipolytica |
| US5107065A (en) | 1986-03-28 | 1992-04-21 | Calgene, Inc. | Anti-sense regulation of gene expression in plant cells |
| WO1993001294A1 (en) | 1991-07-02 | 1993-01-21 | Zeneca Limited | Plant-derived enzyme and dna sequences, and uses thereof |
| US5240855A (en) | 1989-05-12 | 1993-08-31 | Pioneer Hi-Bred International, Inc. | Particle gun |
| US5268463A (en) | 1986-11-11 | 1993-12-07 | Jefferson Richard A | Plant promoter α-glucuronidase gene construct |
| US5283184A (en) | 1989-03-30 | 1994-02-01 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5316931A (en) | 1988-02-26 | 1994-05-31 | Biosource Genetics Corp. | Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes |
| US5322783A (en) | 1989-10-17 | 1994-06-21 | Pioneer Hi-Bred International, Inc. | Soybean transformation by microparticle bombardment |
| US5324646A (en) | 1992-01-06 | 1994-06-28 | Pioneer Hi-Bred International, Inc. | Methods of regeneration of Medicago sativa and expressing foreign DNA in same |
| US5399680A (en) | 1991-05-22 | 1995-03-21 | The Salk Institute For Biological Studies | Rice chitinase promoter |
| US5466785A (en) | 1990-04-12 | 1995-11-14 | Ciba-Geigy Corporation | Tissue-preferential promoters |
| EP0707638A1 (en) | 1992-12-04 | 1996-04-24 | Innovir Laboratories, Inc. | Regulatable nucleic acid therapeutic and methods of use thereof |
| US5563055A (en) | 1992-07-27 | 1996-10-08 | Pioneer Hi-Bred International, Inc. | Method of Agrobacterium-mediated transformation of cultured soybean cells |
| US5569597A (en) | 1985-05-13 | 1996-10-29 | Ciba Geigy Corp. | Methods of inserting viral DNA into plant material |
| US5580967A (en) | 1994-05-13 | 1996-12-03 | The Scripps Research Institute | Optimized catalytic DNA-cleaving ribozymes |
| US5602321A (en) | 1992-11-20 | 1997-02-11 | Monsanto Company | Transgenic cotton plants producing heterologous polyhydroxy(e) butyrate bioplastic |
| US5604121A (en) | 1991-08-27 | 1997-02-18 | Agricultural Genetics Company Limited | Proteins with insecticidal properties against homopteran insects and their use in plant protection |
| US5608144A (en) | 1994-08-12 | 1997-03-04 | Dna Plant Technology Corp. | Plant group 2 promoters and uses thereof |
| US5608149A (en) | 1990-06-18 | 1997-03-04 | Monsanto Company | Enhanced starch biosynthesis in tomatoes |
| US5608142A (en) | 1986-12-03 | 1997-03-04 | Agracetus, Inc. | Insecticidal cotton plants |
| US5616459A (en) | 1990-07-16 | 1997-04-01 | The Public Health Research Institute Of The City Of New York, Inc. | Selection of ribozymes that efficiently cleave target RNA |
| US5659026A (en) | 1995-03-24 | 1997-08-19 | Pioneer Hi-Bred International | ALS3 promoter |
| US5688670A (en) | 1994-09-01 | 1997-11-18 | The General Hospital Corporation | Self-modifying RNA molecules and methods of making |
| US5703049A (en) | 1996-02-29 | 1997-12-30 | Pioneer Hi-Bred Int'l, Inc. | High methionine derivatives of α-hordothionin for pathogen-control |
| US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
| US5789156A (en) | 1993-06-14 | 1998-08-04 | Basf Ag | Tetracycline-regulated transcriptional inhibitors |
| US5814618A (en) | 1993-06-14 | 1998-09-29 | Basf Aktiengesellschaft | Methods for regulating gene expression |
| US5879918A (en) | 1989-05-12 | 1999-03-09 | Pioneer Hi-Bred International, Inc. | Pretreatment of microprojectiles prior to using in a particle gun |
| US5885802A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High methionine derivatives of α-hordothionin |
| US5885801A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High threonine derivatives of α-hordothionin |
| US5886244A (en) | 1988-06-10 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| US5889191A (en) | 1992-12-30 | 1999-03-30 | Biosource Technologies, Inc. | Viral amplification of recombinant messenger RNA in transgenic plants |
| US5932782A (en) | 1990-11-14 | 1999-08-03 | Pioneer Hi-Bred International, Inc. | Plant transformation method using agrobacterium species adhered to microprojectiles |
| WO1999043838A1 (en) | 1998-02-24 | 1999-09-02 | Pioneer Hi-Bred International, Inc. | Synthetic promoters |
| US5981840A (en) | 1997-01-24 | 1999-11-09 | Pioneer Hi-Bred International, Inc. | Methods for agrobacterium-mediated transformation |
| US5990389A (en) | 1993-01-13 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | High lysine derivatives of α-hordothionin |
| US6063566A (en) | 1994-05-13 | 2000-05-16 | The Scripps Research Institute | Catalytic RNA molecules |
| US6177611B1 (en) | 1998-02-26 | 2001-01-23 | Pioneer Hi-Bred International, Inc. | Maize promoters |
| US6300543B1 (en) | 1996-07-08 | 2001-10-09 | Pioneer Hi-Bred International, Inc. | Transformation of zygote, egg or sperm cells and recovery of transformed plants from isolated embryo sacs |
| US6660830B1 (en) | 1996-03-26 | 2003-12-09 | Razvan T Radulescu | Peptides with antiproliferative properties |
| WO2006052870A2 (en) | 2004-11-04 | 2006-05-18 | E.I. Dupont De Nemours And Company | High eicosapentaenoic acid producing strains of yarrowia lipolytica |
| WO2007025097A2 (en) | 2005-08-26 | 2007-03-01 | Danisco A/S | Use |
| US7309576B2 (en) | 2002-04-12 | 2007-12-18 | O'dowd Brian F | Method of identifying transmembrane protein-interacting compounds |
| US20090093543A1 (en) | 2007-10-03 | 2009-04-09 | E. I. Du Pont De Nemours And Company | Optimized strains of yarrowia lipolytica for high eicosapentaenoic acid production |
| US20100068789A1 (en) | 2004-11-04 | 2010-03-18 | E. I. Du Pont De Nemours And Company | Ammonium transporter promoters for gene expression in oleaginous yeast |
| US20100317072A1 (en) | 2009-06-16 | 2010-12-16 | E. I. Du Pont De Nemours And Company | Optimized strains of yarrowia lipolytica for high eicosapentaenoic acid production |
| US20110035836A1 (en) | 2007-06-07 | 2011-02-10 | Agriculture And Agri-Food Canada | Nanocarrier based plant transfection and transduction |
| US20110055973A1 (en) | 2006-10-23 | 2011-03-03 | E.I.Dupont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US20110059496A1 (en) | 2003-06-25 | 2011-03-10 | E. I. Du Pont De Nemours And Company | Glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate mutase promoters for gene expression in oleaginous yeast |
| US20120052537A1 (en) | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Recombinant microbial host cells for high eicosapentaenoic acid production |
| US20120252079A1 (en) | 2011-03-31 | 2012-10-04 | E I Du Pont De Nemours And Company | Yarrowia diacylglycerol acyltransferase promoter regions for gene expression in yeast |
| US20120252093A1 (en) | 2011-04-01 | 2012-10-04 | E I Du Pont De Nemours And Company | Yarrowia esterase/lipase promoter regions for gene expression in yeast |
| US20130089910A1 (en) | 2011-04-05 | 2013-04-11 | E I Du Pont De Nemours And Company | Yarrowia n-alkane-hydroxylating cytochrome p450 promoter regions for gene expression in yeast |
| US20130089911A1 (en) | 2011-04-07 | 2013-04-11 | E I Du Pont De Nemours And Company | Yarrowia peroxisomal 2,4-dienoyl-coa reductase promoter regions for gene expression in yeast |
| US20130198888A1 (en) | 2012-01-27 | 2013-08-01 | E.I. Du Pont De Nemours And Company | Methods and compositions for generating complex trait loci |
| US20130263324A1 (en) | 2011-03-23 | 2013-10-03 | E.I. Du Pont De Nemours And Company | Methods for producing a complex transgenic trait locus |
| US20140068797A1 (en) | 2012-05-25 | 2014-03-06 | University Of Vienna | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| US20140189896A1 (en) | 2012-12-12 | 2014-07-03 | Feng Zhang | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20140186906A1 (en) | 2012-12-21 | 2014-07-03 | E I Du Pont De Nemours And Company | Recombinant microbial cells that produce at least 28% eicosapentaenoic acid as dry cell weight |
| EP2821486A1 (en) | 2012-02-27 | 2015-01-07 | Riken | Method of introducing nucleic acid into plant cells |
| US20150059010A1 (en) | 2013-08-22 | 2015-02-26 | Pioneer Hi-Bred International Inc | Genome modification using guide polynucleotide/cas endonuclease systems and methods of use |
| WO2016094867A1 (en) * | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Protected guide rnas (pgrnas) |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3693691B2 (en) | 1993-12-30 | 2005-09-07 | 株式会社リコー | Image processing device |
| JP3302257B2 (en) | 1995-03-31 | 2002-07-15 | ヒューレット・パッカード・カンパニー | Tape drive device |
| IT1306207B1 (en) * | 1999-01-15 | 2001-05-30 | Biopolo S C A R L | PRODUCTION OF HETEROLOGICAL PROTEINS FROM ZYGOSACCHAROMYCES BAILII. |
| DE10119005A1 (en) * | 2001-04-18 | 2002-10-24 | Roche Diagnostics Gmbh | Process for protein expression starting from stabilized linear short DNA in cell-free in vitro transcription / translation systems with exonuclease-containing lysates or in a cellular system containing exonucleases |
| KR100528293B1 (en) | 2002-11-15 | 2005-11-15 | 삼성전자주식회사 | Microwave oven and cleaning control method thereof |
| CA2720903C (en) * | 2008-04-14 | 2019-01-15 | Sangamo Biosciences, Inc. | Linear donor constructs for targeted integration |
| US8991013B2 (en) | 2011-06-02 | 2015-03-31 | Happy Captain Pty Ltd. | Extendable handle |
| CA2845312A1 (en) | 2011-08-01 | 2013-02-07 | Tagged, Inc. | Systems and methods for asynchronous distributed database management |
| US8991113B2 (en) | 2011-08-10 | 2015-03-31 | Dl Manufacturing | Loading dock sealing apparatus and method |
| KR101323332B1 (en) | 2012-01-06 | 2013-10-29 | 삼성메디슨 주식회사 | Apparatus and method for realizing synchronization image |
-
2016
- 2016-10-11 EP EP22189338.1A patent/EP4144844B1/en active Active
- 2016-10-11 KR KR1020187012640A patent/KR102628801B1/en active Active
- 2016-10-11 AU AU2016338785A patent/AU2016338785B2/en active Active
- 2016-10-11 WO PCT/US2016/056404 patent/WO2017066175A1/en not_active Ceased
- 2016-10-11 DK DK22189338.1T patent/DK4144844T3/en active
- 2016-10-11 US US15/761,899 patent/US20180273979A1/en not_active Abandoned
- 2016-10-11 DK DK16791150.2T patent/DK3362560T3/en active
- 2016-10-11 FI FIEP22189338.1T patent/FI4144844T3/en active
- 2016-10-11 CA CA2999050A patent/CA2999050C/en active Active
- 2016-10-11 JP JP2018538537A patent/JP7011590B2/en active Active
- 2016-10-11 EP EP16791150.2A patent/EP3362560B1/en active Active
Patent Citations (74)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4880741A (en) | 1983-10-06 | 1989-11-14 | Pfizer Inc. | Process for transformation of Yarrowia lipolytica |
| US5071764A (en) | 1983-10-06 | 1991-12-10 | Pfizer Inc. | Process for integrative transformation of yarrowia lipolytica |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5569597A (en) | 1985-05-13 | 1996-10-29 | Ciba Geigy Corp. | Methods of inserting viral DNA into plant material |
| US5107065A (en) | 1986-03-28 | 1992-04-21 | Calgene, Inc. | Anti-sense regulation of gene expression in plant cells |
| US5268463A (en) | 1986-11-11 | 1993-12-07 | Jefferson Richard A | Plant promoter α-glucuronidase gene construct |
| US5608142A (en) | 1986-12-03 | 1997-03-04 | Agracetus, Inc. | Insecticidal cotton plants |
| US4873192A (en) | 1987-02-17 | 1989-10-10 | The United States Of America As Represented By The Department Of Health And Human Services | Process for site specific mutagenesis without phenotypic selection |
| US5889190A (en) | 1988-02-26 | 1999-03-30 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
| US5866785A (en) | 1988-02-26 | 1999-02-02 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
| US5316931A (en) | 1988-02-26 | 1994-05-31 | Biosource Genetics Corp. | Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes |
| US5589367A (en) | 1988-02-26 | 1996-12-31 | Biosource Technologies, Inc. | Recombinant plant viral nucleic acids |
| US5886244A (en) | 1988-06-10 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | Stable transformation of plant cells |
| US5034323A (en) | 1989-03-30 | 1991-07-23 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5283184A (en) | 1989-03-30 | 1994-02-01 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5879918A (en) | 1989-05-12 | 1999-03-09 | Pioneer Hi-Bred International, Inc. | Pretreatment of microprojectiles prior to using in a particle gun |
| US5240855A (en) | 1989-05-12 | 1993-08-31 | Pioneer Hi-Bred International, Inc. | Particle gun |
| US5322783A (en) | 1989-10-17 | 1994-06-21 | Pioneer Hi-Bred International, Inc. | Soybean transformation by microparticle bombardment |
| US5466785A (en) | 1990-04-12 | 1995-11-14 | Ciba-Geigy Corporation | Tissue-preferential promoters |
| US5608149A (en) | 1990-06-18 | 1997-03-04 | Monsanto Company | Enhanced starch biosynthesis in tomatoes |
| US5616459A (en) | 1990-07-16 | 1997-04-01 | The Public Health Research Institute Of The City Of New York, Inc. | Selection of ribozymes that efficiently cleave target RNA |
| US5932782A (en) | 1990-11-14 | 1999-08-03 | Pioneer Hi-Bred International, Inc. | Plant transformation method using agrobacterium species adhered to microprojectiles |
| US5399680A (en) | 1991-05-22 | 1995-03-21 | The Salk Institute For Biological Studies | Rice chitinase promoter |
| WO1993001294A1 (en) | 1991-07-02 | 1993-01-21 | Zeneca Limited | Plant-derived enzyme and dna sequences, and uses thereof |
| US5604121A (en) | 1991-08-27 | 1997-02-18 | Agricultural Genetics Company Limited | Proteins with insecticidal properties against homopteran insects and their use in plant protection |
| US5324646A (en) | 1992-01-06 | 1994-06-28 | Pioneer Hi-Bred International, Inc. | Methods of regeneration of Medicago sativa and expressing foreign DNA in same |
| US5563055A (en) | 1992-07-27 | 1996-10-08 | Pioneer Hi-Bred International, Inc. | Method of Agrobacterium-mediated transformation of cultured soybean cells |
| US5602321A (en) | 1992-11-20 | 1997-02-11 | Monsanto Company | Transgenic cotton plants producing heterologous polyhydroxy(e) butyrate bioplastic |
| EP0707638A1 (en) | 1992-12-04 | 1996-04-24 | Innovir Laboratories, Inc. | Regulatable nucleic acid therapeutic and methods of use thereof |
| US5889191A (en) | 1992-12-30 | 1999-03-30 | Biosource Technologies, Inc. | Viral amplification of recombinant messenger RNA in transgenic plants |
| US5990389A (en) | 1993-01-13 | 1999-11-23 | Pioneer Hi-Bred International, Inc. | High lysine derivatives of α-hordothionin |
| US5789156A (en) | 1993-06-14 | 1998-08-04 | Basf Ag | Tetracycline-regulated transcriptional inhibitors |
| US5814618A (en) | 1993-06-14 | 1998-09-29 | Basf Aktiengesellschaft | Methods for regulating gene expression |
| US6063566A (en) | 1994-05-13 | 2000-05-16 | The Scripps Research Institute | Catalytic RNA molecules |
| US5580967A (en) | 1994-05-13 | 1996-12-03 | The Scripps Research Institute | Optimized catalytic DNA-cleaving ribozymes |
| US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
| US5608144A (en) | 1994-08-12 | 1997-03-04 | Dna Plant Technology Corp. | Plant group 2 promoters and uses thereof |
| US5688670A (en) | 1994-09-01 | 1997-11-18 | The General Hospital Corporation | Self-modifying RNA molecules and methods of making |
| US5659026A (en) | 1995-03-24 | 1997-08-19 | Pioneer Hi-Bred International | ALS3 promoter |
| US5885802A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High methionine derivatives of α-hordothionin |
| US5885801A (en) | 1995-06-02 | 1999-03-23 | Pioneer Hi-Bred International, Inc. | High threonine derivatives of α-hordothionin |
| US5703049A (en) | 1996-02-29 | 1997-12-30 | Pioneer Hi-Bred Int'l, Inc. | High methionine derivatives of α-hordothionin for pathogen-control |
| US6660830B1 (en) | 1996-03-26 | 2003-12-09 | Razvan T Radulescu | Peptides with antiproliferative properties |
| US6072050A (en) | 1996-06-11 | 2000-06-06 | Pioneer Hi-Bred International, Inc. | Synthetic promoters |
| US6300543B1 (en) | 1996-07-08 | 2001-10-09 | Pioneer Hi-Bred International, Inc. | Transformation of zygote, egg or sperm cells and recovery of transformed plants from isolated embryo sacs |
| US5981840A (en) | 1997-01-24 | 1999-11-09 | Pioneer Hi-Bred International, Inc. | Methods for agrobacterium-mediated transformation |
| WO1999043838A1 (en) | 1998-02-24 | 1999-09-02 | Pioneer Hi-Bred International, Inc. | Synthetic promoters |
| US6177611B1 (en) | 1998-02-26 | 2001-01-23 | Pioneer Hi-Bred International, Inc. | Maize promoters |
| US7309576B2 (en) | 2002-04-12 | 2007-12-18 | O'dowd Brian F | Method of identifying transmembrane protein-interacting compounds |
| US20110059496A1 (en) | 2003-06-25 | 2011-03-10 | E. I. Du Pont De Nemours And Company | Glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate mutase promoters for gene expression in oleaginous yeast |
| WO2006052870A2 (en) | 2004-11-04 | 2006-05-18 | E.I. Dupont De Nemours And Company | High eicosapentaenoic acid producing strains of yarrowia lipolytica |
| US20100068789A1 (en) | 2004-11-04 | 2010-03-18 | E. I. Du Pont De Nemours And Company | Ammonium transporter promoters for gene expression in oleaginous yeast |
| WO2007025097A2 (en) | 2005-08-26 | 2007-03-01 | Danisco A/S | Use |
| US20100093617A1 (en) | 2005-08-26 | 2010-04-15 | Rodolphe Barrangou | Use |
| US20110055973A1 (en) | 2006-10-23 | 2011-03-03 | E.I.Dupont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US20110035836A1 (en) | 2007-06-07 | 2011-02-10 | Agriculture And Agri-Food Canada | Nanocarrier based plant transfection and transduction |
| US20090093543A1 (en) | 2007-10-03 | 2009-04-09 | E. I. Du Pont De Nemours And Company | Optimized strains of yarrowia lipolytica for high eicosapentaenoic acid production |
| US20100317072A1 (en) | 2009-06-16 | 2010-12-16 | E. I. Du Pont De Nemours And Company | Optimized strains of yarrowia lipolytica for high eicosapentaenoic acid production |
| US20120052537A1 (en) | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Recombinant microbial host cells for high eicosapentaenoic acid production |
| US20130263324A1 (en) | 2011-03-23 | 2013-10-03 | E.I. Du Pont De Nemours And Company | Methods for producing a complex transgenic trait locus |
| US20120252079A1 (en) | 2011-03-31 | 2012-10-04 | E I Du Pont De Nemours And Company | Yarrowia diacylglycerol acyltransferase promoter regions for gene expression in yeast |
| US20120252093A1 (en) | 2011-04-01 | 2012-10-04 | E I Du Pont De Nemours And Company | Yarrowia esterase/lipase promoter regions for gene expression in yeast |
| US20130089910A1 (en) | 2011-04-05 | 2013-04-11 | E I Du Pont De Nemours And Company | Yarrowia n-alkane-hydroxylating cytochrome p450 promoter regions for gene expression in yeast |
| US20130089911A1 (en) | 2011-04-07 | 2013-04-11 | E I Du Pont De Nemours And Company | Yarrowia peroxisomal 2,4-dienoyl-coa reductase promoter regions for gene expression in yeast |
| US20130198888A1 (en) | 2012-01-27 | 2013-08-01 | E.I. Du Pont De Nemours And Company | Methods and compositions for generating complex trait loci |
| EP2821486A1 (en) | 2012-02-27 | 2015-01-07 | Riken | Method of introducing nucleic acid into plant cells |
| US20140068797A1 (en) | 2012-05-25 | 2014-03-06 | University Of Vienna | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| US20140189896A1 (en) | 2012-12-12 | 2014-07-03 | Feng Zhang | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20140186906A1 (en) | 2012-12-21 | 2014-07-03 | E I Du Pont De Nemours And Company | Recombinant microbial cells that produce at least 28% eicosapentaenoic acid as dry cell weight |
| US20150059010A1 (en) | 2013-08-22 | 2015-02-26 | Pioneer Hi-Bred International Inc | Genome modification using guide polynucleotide/cas endonuclease systems and methods of use |
| WO2015026886A1 (en) | 2013-08-22 | 2015-02-26 | E. I. Du Pont De Nemours And Company | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US20150082478A1 (en) | 2013-08-22 | 2015-03-19 | E I Du Pont De Nemours And Company | Plant genome modification using guide rna/cas endonuclease systems and methods of use |
| WO2016094867A1 (en) * | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Protected guide rnas (pgrnas) |
Non-Patent Citations (174)
| Title |
|---|
| "Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology", 1987, AMERICAN SOCIETY OF MICROBIOLOGY |
| "Plant Cell, Tissue, and Organ Culture: Fundamental Methods", 1995, SPRINGER-VERLAG, article TOMES ET AL.: "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment" |
| AUSTIN ET AL., NAT. GENETICS, vol. 36, pages 921 - 924 |
| AUSUBEL ET AL.,: "Current Protocols in Molecular Biology", 1994, CURRENT PROTOCOLS |
| AYAL HENDEL ET AL: "Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells", NATURE BIOTECHNOLOGY, vol. 33, no. 9, 29 June 2015 (2015-06-29), US, pages 985 - 989, XP055233915, ISSN: 1087-0156, DOI: 10.1038/nbt.3290 * |
| AYARES ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 5199 - 203 |
| BAIM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 5072 - 6 |
| BARNETT; HUNTER: "Illustrated Genera of Imperfect Fungi, 3rd Edition,", 1972, BURGESS PUBLISHING COMPANY |
| BLEUYARD ET AL., DNA REPAIR, vol. 5, 2006, pages 1 - 12 |
| BONIN, PH.D. THESIS, 1993 |
| BRONSON, J BIOL CHEM, vol. 269, 1994, pages 27155 - 8 |
| BROWN ET AL., CELL, vol. 49, 1987, pages 603 - 12 |
| BYTEBIER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 5345 - 9 |
| CAPECCHI, TRENDS GENET, vol. 5, 1989, pages 70 - 6 |
| CHAVEROCHE ET AL., NUCLEIC ACIDS RES, vol. 28, 2000, pages E97 |
| CHEN ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 48, 1997, pages 232 - 235 |
| CHEN ET AL., PLOS ONE, vol. 8, pages E57952 |
| CHILTON; QUE, PLANT PHYSIOL, vol. 133, 2003, pages 956 - 65 |
| CHRISTENSEN ET AL., PLANT MOL BIOL, vol. 18, 1992, pages 675 - 89 |
| CHRISTOPHERSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 6314 - 8 |
| CHRISTOU ET AL., PLANT PHYSIOL, vol. 87, 1988, pages 671 - 4 |
| CHRISTOU; FORD, ANNALS BOTANY, vol. 75, 1995, pages 407 - 13 |
| CHYLINSKI ET AL., RNA BIOLOGY, vol. 10, pages 726 - 737 |
| CORRIGAN ET AL., PLOS ONE, vol. 8, pages E69628 |
| CROSSWAY ET AL., BIOTECHNIQUES, vol. 4, 1986, pages 320 - 34 |
| CROSSWAY ET AL., MOL GEN GENET, vol. 202, 1986, pages 179 - 85 |
| DATTA ET AL., BIOTECHNOLOGY, vol. 8, 1990, pages 736 - 40 |
| DAVIS; MAIZELS, PNAS, vol. 111, no. 10, pages E924 - E932 |
| DAYHOFF ET AL.,: "Atlas of Protein Sequence and Structure", 1978, NATL BIOMED RES FOUND |
| DE ALMEIDA ET AL., MOL GEN GENETICS, vol. 218, 1989, pages 78 - 86 |
| DE VEYLDER ET AL., PLANT CELL PHYSIOL, vol. 38, 1997, pages 568 - 77 |
| DE WET ET AL.: "The Experimental Manipulation of Ovule Tissues", 1985, LONGMAN, pages: 197 - 209 |
| DEGENKOLB ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 35, 1991, pages 1591 - 5 |
| DELTCHEVA ET AL., NATURE, vol. 471, pages 602 - 607 |
| DEUSCHLE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 5400 - 4 |
| DEUSCHLE ET AL., SCIENCE, vol. 248, 1990, pages 480 - 3 |
| D'HALLUIN ET AL., CELL, vol. 4, 1992, pages 1495 - 505 |
| D'HALLUIN ET AL., PLANT CELL, vol. 4, 1992, pages 1495 - 505 |
| DICARLO ET AL., NUCLEIC ACIDS RES., vol. 41, pages 4336 - 4343 |
| DRAY; GLOOR, GENETICS, vol. 147, 1997, pages 689 - 99 |
| ELLEN PREDIGER: "Modifications that block nuclease degradation", 14 January 2014 (2014-01-14), XP002765968, Retrieved from the Internet <URL:https://www.idtdna.com/pages/decoded/decoded-articles/core-concepts/decoded/2014/01/14/modification-highlight-modifications-that-block-nuclease-degradation> [retrieved on 20170116] * |
| FERREIRA; COOPER, GENES DEV., vol. 18, pages 2249 - 2254 |
| FIGGE ET AL., CELL, vol. 52, 1988, pages 713 - 22 |
| FINER; MCMULLEN, IN VITRO CELL DEV BIOL, vol. 27P, 1991, pages 175 - 82 |
| FROMM ET AL., BIOTECHNOLOGY, vol. 8, 1990, pages 833 - 9 |
| FROMM, BIOTECHNOLOGY, vol. 8, 1990, pages 833 - 9 |
| FUERST ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2549 - 53 |
| GAMBORG & PHILLIPS: "Plant Cell, Tissue, and Organ Culture: Fundamental Methods", 1995, article TOMES ET AL.: "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment" |
| GASIUNAS ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 109, pages E2579 - E2586 |
| GATZ ET AL., MOL GEN GENET, vol. 227, 1991, pages 229 - 37 |
| GILL ET AL., NATURE, vol. 334, 1988, pages 721 - 4 |
| GOLIC ET AL., NUCLEIC ACIDS RES, vol. 25, 1997, pages 3665 |
| GOSSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547 - 51 |
| GOSSEN, PH.D. THESIS, 1993 |
| GREEN, M. R.; SAMBROOK, J.: "Molecular Cloning: A Laboratory Manual, fourth edition", 2012, COLD SPRING HARBOR LABORATORY PRESS |
| GUEVARA-GARCIA ET AL., PLANT J, vol. 4, 1993, pages 495 - 505 |
| GUILINGER ET AL., NATURE BIOTECHNOLOGY, vol. 32, no. 6, June 2014 (2014-06-01) |
| HAFT ET AL., COMPUTATIONAL BIOLOGY, PLOS COMPUT BIOL, vol. 1, no. 6, 2005, pages E60 |
| HALFTER ET AL., MOL GEN GENET, vol. 231, 1992, pages 186 - 93 |
| HAMMANN ET AL., RNA, vol. 18, pages 871 - 885 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
| HEPLER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 2176 - 80 |
| HIGGINS ET AL., COMPUT APPL BIOSCI, vol. 8, 1992, pages 189 - 191 |
| HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151 - 153 |
| HILLEN; WISSMAN, TOPICS MOL STRUC BIOL, vol. 10, 1989, pages 143 - 62 |
| HLAVKA ET AL.: "Handbook of Experimental Pharmacology", vol. 78, 1985, SPRINGER-VERLAG |
| HOOYKAAS-VAN SLOGTEREN ET AL., NATURE, vol. 311, 1984, pages 763 - 4 |
| HORTON ET AL., BIOTECHNIQUES, vol. 54, no. 3, 2013, pages 129 - 133 |
| HORVATH; BARRANGOU, SCIENCE, vol. 327, pages 167 - 170 |
| HOURDA; PASZKOWSKI, MOL GEN GENET, vol. 243, 1994, pages 106 - 11 |
| HSU ET AL., CELL, vol. 157, pages 1262 - 1278 |
| HU ET AL., CELL, vol. 48, 1987, pages 555 - 66 |
| HUSH ET AL., J CELL SCI, vol. 107, 1994, pages 775 - 84 |
| INGELBRECHT ET AL., PLANT CELL, vol. 1, 1989, pages 671 - 680 |
| JINEK ET AL., SCIENCE, vol. 337, pages 816 - 821 |
| JONES ET AL., EMBO J, vol. 4, 1985, pages 2411 - 2418 |
| K. WOLF, K.D. BREUNIG, G. BARTH,: "Non-Conventional Yeasts in Genetics, Biochemistry and Biotechnology: Practical Protocols", 2003, SPRINGER-VERLAG |
| KAEPPLER ET AL., PLANT CELL REP, vol. 9, 1990, pages 415 - 8 |
| KAEPPLER ET AL., PLANT CELL, vol. 9, 1990, pages 415 - 8 |
| KAEPPLER ET AL., THEOR APPL GENET, vol. 84, 1992, pages 560 - 6 |
| KARGINOV; HANNON, MOL. CELL, vol. 37, pages 7 - 19 |
| KASUGA ET AL., NATURE BIOTECHNOL., vol. 17, 1999, pages 287 - 91 |
| KAWAMATA ET AL., PLANT CELL PHYSIOL, vol. 38, 1997, pages 792 - 803 |
| KEELER; GLOOR, MOL CELL BIOL, vol. 17, 1997, pages 627 - 34 |
| KEENEY; BOEKE, GENETICS, vol. 136, pages 849 - 856 |
| KIRIK ET AL., EMBO J, vol. 19, 2000, pages 5562 - 6 |
| KLEIN ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 559 - 63 |
| KLEIN ET AL., PLANT PHYSIOL, vol. 91, 1988, pages 440 - 4 |
| KLEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 4305 - 9 |
| KLEIN, PLANT PHYSIOL, vol. 91, 1988, pages 440 - 4 |
| KLEINSCHNIDT ET AL., BIOCHEMISTRY, vol. 27, 1988, pages 1094 - 104 |
| KUNKEL, METH ENZYMOL, vol. 154, 1987, pages 367 - 82 |
| KUNKEL, PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 488 - 92 |
| LABOW ET AL., MOL CELL BIOL, vol. 10, 1990, pages 3343 - 56 |
| LAST ET AL., THEOR APPL GENET, vol. 81, 1991, pages 581 - 8 |
| LEDERBERG, J.: "Streptomycin resistance; a genetically recessive mutation", J BACTERIOL, vol. 61, no. 5, 1951, pages 549 - 550 |
| LI ET AL., PLANT CELL REP, vol. 12, 1993, pages 250 - 5 |
| LIEBER, ANNU. REV. BIOCHEM, vol. 79, 2010, pages 181 - 211 |
| LILLEY, BIOCHEM. SOC. TRANS., vol. 39, pages 641 - 646 |
| LISKAY ET AL., GENETICS, vol. 115, 1987, pages 161 - 7 |
| LYZNIK ET AL., MOL GEN GENET, vol. 230, 1991, pages 209 - 18 |
| MA ET AL., MOL. THER. NUCLEIC ACIDS, vol. 3, pages E161 |
| MCCABE ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 923 - 6 |
| MCCREATH ET AL., NATURE, vol. 405, 2000, pages 1066 - 9 |
| MCELROY ET AL., PLANT CELL, vol. 2, 1990, pages 163 - 71 |
| MCNELLIS ET AL., PLANT J, vol. 14, 1998, pages 247 - 257 |
| METHODS IN ENZYMOLOGY, vol. 194, 1991, pages 186 - 187 |
| MILLER ET AL., NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 143 - 148 |
| MOLINIER ET AL., PLANT CELL, vol. 16, 2004, pages 342 - 52 |
| NASSIF; ENGELS, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 1262 - 6 |
| NEEDLEMAN; WUNSCH, J MOL BIOL, vol. 48, 1970, pages 443 - 53 |
| NOMURA ET AL., PLANT SCI, vol. 44, 1986, pages 53 - 8 |
| NUCLEIC ACIDS RES, vol. 22, 1994, pages 5391 - 8 |
| NUCLEIC ACIDS RES, vol. 25, 1997, pages 4278 - 86 |
| ODELL ET AL., NATURE, vol. 313, 1985, pages 810 - 2 |
| OFFRINGA ET AL., EMBO J, vol. 9, 1990, pages 3077 - 84 |
| OFFRINGA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 7346 - 50 |
| OKAMURO; GOLDBERG: "The Biochemistry of Plants", vol. 115, 1989, ACADEMIC PRESS, pages: 1 - 82 |
| OLIVA ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 36, 1992, pages 913 - 9 |
| ONO ET AL., BIOSCI BIOTECHNOL BIOCHEM, vol. 68, 2004, pages 803 - 7 |
| OSJODA ET AL., NAT BIOTECHNOL, vol. 14, 1996, pages 745 - 50 |
| OZAKI, M. ET AL.: "Identification and functional characterization of the protein controlled by the streptomycin-resistant locus in E. coli.", NATURE, vol. 222, no. 5191, 1969, pages 333 - 339 |
| P.K. MUKHERJEE ET AL.,: "Trichoderma: Biology and Applications", 2013, CABI |
| PACHER ET AL., GENETICS, vol. 175, 2007, pages 21 - 9 |
| PASZKOWSKI ET AL., EMBO J, vol. 3, 1984, pages 2717 - 22 |
| PASZKOWSKI ET AL., EMBO J, vol. 7, 1988, pages 4021 - 6 |
| PELLAGATTI ANDREA ET AL: "Application of CRISPR/Cas9 genome editing to the study and treatment of disease", ARCHIVES OF TOXICOLOGY, vol. 89, no. 7, July 2015 (2015-07-01), pages 1023 - 1034, XP002765969 * |
| PLANT MOL BIOL, vol. 12, 1989, pages 619 - 32 |
| PLEY ET AL., NATURE, vol. 372, pages 68 - 74 |
| POTENZA ET AL., IN VITRO CELL DEV BIOL, vol. 40, 2004, pages 1 - 22 |
| PUCHTA ET AL., PLANT MOL BIOL, vol. 28, 1995, pages 281 - 92 |
| PUCHTA, GENETICS, vol. 152, 1999, pages 1173 - 81 |
| PUCHTA, J EXP BOT, vol. 56, 2005, pages 1 - 14 |
| REINES ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 1917 - 21 |
| REZNIKOFF, MOL MICROBIOL, vol. 6, 1992, pages 2419 - 22 |
| RIGGS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 5602 - 6 |
| RISSEEUW ET AL., PLANT J, vol. 7, 1995, pages 109 - 19 |
| ROSENTHAL G.A.: "The Biological effects and mode of action of L-Canavanine, a structural analog of L-arginine", THE QUARTERLY REVIEW OF BIOLOGY, vol. 52, 1977, pages 155 - 178 |
| RUBNITZ; SUBRAMANI, MOL CELL BIOL, vol. 4, 1984, pages 2253 - 8 |
| S. W. CHO ET AL: "Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases", GENOME RESEARCH, vol. 24, no. 1, 19 November 2013 (2013-11-19), US, pages 132 - 141, XP055227885, ISSN: 1088-9051, DOI: 10.1101/gr.162339.113 * |
| SADOWSKI, FASEB, vol. 7, 1993, pages 760 - 7 |
| SALOMON; PUCHTA, EMBO J, vol. 17, 1998, pages 6086 - 95 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SANFORD ET AL., PARTICULATE SCIENCE AND TECHNOLOGY, vol. 5, 1987, pages 27 - 37 |
| SAPRANAUSKAS ET AL., NUCLEIC ACIDS RES., vol. 39, pages 9275 - 9282 |
| SAUER, CURR OP BIOTECHNOL, vol. 5, 1994, pages 521 - 7 |
| SCHENA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 10421 - 5 |
| SCHUBERT ET AL., J. BACTERIOL., vol. 170, 1988, pages 5837 - 5847 |
| SCOTT ET AL., CELL, vol. 81, pages 991 - 1002 |
| SHEN; HUANG, GENETICS, vol. 112, 1986, pages 441 - 57 |
| SIEBERT; PUCHTA, PLANT CELL, vol. 14, 2002, pages 1121 - 31 |
| SINGER ET AL., CELL, vol. 31, 1982, pages 25 - 33 |
| SINGH ET AL., THEOR APPL GENET, vol. 96, 1998, pages 319 - 24 |
| SPENCER ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 58, pages 147 - 156 |
| SUGAWARA; HABER, MOL CELL BIOL, vol. 12, 1992, pages 563 - 75 |
| THOMPSON ET AL., BIOESSAYS, vol. 10, 1989, pages 108 |
| THOMPSON: "Encyclopedia of Life Support System (EOLSS)", vol. 1, article "Algal Cell Culture." |
| TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes", 1993, ELSEVIER |
| TINLAND ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 7442 - 6 |
| TURNER; FOSTER, MOL BIOTECHNOL, vol. 3, 1995, pages 225 - 236 |
| TZFIRA; WHITE, TRENDS BIOTECHNOL, vol. 23, 2005, pages 567 - 9 |
| VELTEN ET AL., EMBO J, vol. 3, 1984, pages 2723 - 30 |
| WALKER; GAASTRA: "Techniques in Molecular Biology", 1983, MACMILLAN PUBLISHING COMPANY |
| WATSON ET AL.: "Recombinant DNA, 2nd Ed.,", 1992, WH FREEMAN & CO. |
| WATT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 4768 - 72 |
| WEAVER ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 78, pages 6354 - 6358 |
| WEISSINGER ET AL., ANN REV GENET, vol. 22, 1988, pages 421 - 77 |
| WET ET AL.: "The Experimental Manipulation of Ovule Tissues", 1985, LONGMAN, pages: 197 - 209 |
| WYBORSKI ET AL., NUCLEIC ACIDS RES, vol. 19, 1991, pages 4647 - 53 |
| YAO ET AL., CELL, vol. 71, 1992, pages 63 - 72 |
| YARRANTON, CURR OPIN BIOTECH, vol. 3, 1992, pages 506 - 11 |
| ZAMBRETTI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 3952 - 6 |
| ZETSCHE B ET AL., CELL, vol. 163, 2015, pages 1013 |
Cited By (85)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11352647B2 (en) | 2016-08-17 | 2022-06-07 | The Broad Institute, Inc. | Crispr enzymes and systems |
| US12559774B2 (en) | 2016-08-17 | 2026-02-24 | The Broad Institute, Inc. | CRISPR enzymes and systems |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12499971B2 (en) | 2016-09-28 | 2025-12-16 | The Broad Institute, Inc. | Systematic screening and mapping of regulatory elements in non-coding genomic regions, methods, compositions, and applications thereof |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11591601B2 (en) | 2017-05-05 | 2023-02-28 | The Broad Institute, Inc. | Methods for identification and modification of lncRNA associated with target genotypes and phenotypes |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US20200370070A1 (en) * | 2017-11-17 | 2020-11-26 | The Johns Hopkins University | Compositions and methods for efficient genome editing |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| CN111836825A (en) * | 2018-01-11 | 2020-10-27 | 科沃施种子欧洲股份两合公司 | Optimized plant CRISPR/CPF1 system |
| US12098374B2 (en) | 2018-01-11 | 2024-09-24 | KWS SAAT SE & Co. KGaA | Optimized plant CRISPR/CPF1 systems |
| CN111630175B (en) * | 2018-01-22 | 2023-08-18 | 庆尚大学校产学协力团 | Method for Improving Gene Editing Efficiency Based on Homologous Recombination in Plants |
| WO2019143077A1 (en) * | 2018-01-22 | 2019-07-25 | 경상대학교산학협력단 | Method for increasing efficiency of homologous recombination-based gene editing in plant |
| CN111630175A (en) * | 2018-01-22 | 2020-09-04 | 庆尚大学校产学协力团 | Methods for improving gene editing efficiency in plants based on homologous recombination |
| US11542530B2 (en) | 2018-01-22 | 2023-01-03 | Industry-Academic Cooperation Foundation Gyeongsang National University | Method for increasing efficiency of homologous recombination-based gene editing in plant |
| WO2019157326A1 (en) | 2018-02-08 | 2019-08-15 | Zymergen Inc. | Genome editing using crispr in corynebacterium |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12264323B2 (en) | 2018-12-17 | 2025-04-01 | The Broad Institute, Inc. | CRISPR CPF1 direct repeat variants |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12215382B2 (en) | 2019-03-01 | 2025-02-04 | The General Hospital Corporation | Liver protective MARC variants and uses thereof |
| US12534714B2 (en) | 2019-03-18 | 2026-01-27 | The Broad Institute, Inc. | Type VII CRISPR proteins and systems |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| WO2020236967A1 (en) | 2019-05-20 | 2020-11-26 | The Broad Institute, Inc. | Random crispr-cas deletion mutant |
| US12254959B2 (en) | 2019-07-03 | 2025-03-18 | Integrated Dna Technologies, Inc. | Identification, characterization, and quantitation of CRISPR-introduced double-stranded DNA break repairs |
| WO2021041922A1 (en) | 2019-08-30 | 2021-03-04 | The Broad Institute, Inc. | Crispr-associated mu transposase systems |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12123033B2 (en) | 2019-10-24 | 2024-10-22 | Integrated Dna Technologies, Inc. | Modified double-stranded donor templates |
| EP4048803A4 (en) * | 2019-10-24 | 2024-11-13 | Integrated Dna Technologies, Inc. | MODIFIED DOUBLE-STRANDED DONOR TEMPLATES |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| WO2025059533A1 (en) | 2023-09-13 | 2025-03-20 | The Broad Institute, Inc. | Crispr enzymes and systems |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112018007351A2 (en) | 2018-10-23 |
| DK4144844T3 (en) | 2025-11-24 |
| EP4144844A1 (en) | 2023-03-08 |
| CA2999050A1 (en) | 2017-04-20 |
| JP2018530352A (en) | 2018-10-18 |
| FI4144844T3 (en) | 2025-11-24 |
| KR20180056772A (en) | 2018-05-29 |
| AU2016338785A1 (en) | 2018-04-12 |
| DK3362560T3 (en) | 2022-11-07 |
| CA2999050C (en) | 2024-05-28 |
| EP3362560A1 (en) | 2018-08-22 |
| KR102628801B1 (en) | 2024-01-25 |
| EP3362560B1 (en) | 2022-08-10 |
| EP4144844B1 (en) | 2025-09-10 |
| JP7011590B2 (en) | 2022-02-10 |
| AU2016338785B2 (en) | 2022-07-14 |
| US20180273979A1 (en) | 2018-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3362560B1 (en) | Protected dna templates for gene modification and increased homologous recombination in cells and methods of use | |
| JP7160891B2 (en) | Methods and compositions for polymerase II (Pol-II)-based guide RNA expression | |
| US20190300877A1 (en) | Methods and compositions for t-rna based guide rna expression | |
| US20180362961A1 (en) | Methods and compositions for enhanced nuclease-mediated genome modification and reduced off-target site effects | |
| US20220177900A1 (en) | Genome modification using guide polynucleotide/cas endonuclease systems and methods of use | |
| Svitashev et al. | Targeted mutagenesis, precise gene editing, and site-specific gene insertion in maize using Cas9 and guide RNA | |
| JP2021151275A (en) | Methods and Compositions for Marker-Free Genome Modification | |
| US20230392135A1 (en) | Engineered cas endonuclease variants for improved genome editing | |
| JP2018531024A6 (en) | Methods and compositions for marker-free genome modification | |
| EP3180425A1 (en) | Genetic targeting in non-conventional yeast using an rna-guided endonuclease | |
| CN111465689A (en) | CAS9 variants and methods of use | |
| KR20250023504A (en) | CAS endonuclease and guide RNA variants with improved efficiency | |
| BR112018007351B1 (en) | MICROBIAL CELL SELECTION METHODS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16791150 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2999050 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2018538537 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2016338785 Country of ref document: AU Date of ref document: 20161011 Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112018007351 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20187012640 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2016791150 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 112018007351 Country of ref document: BR Kind code of ref document: A2 Effective date: 20180412 |





