WO2017053458A1 - Structure based design of therapeutics based on high-resolution structures of novel phosphatidylinositol-phosphate synthase (pips) constructs - Google Patents
Structure based design of therapeutics based on high-resolution structures of novel phosphatidylinositol-phosphate synthase (pips) constructs Download PDFInfo
- Publication number
- WO2017053458A1 WO2017053458A1 PCT/US2016/052925 US2016052925W WO2017053458A1 WO 2017053458 A1 WO2017053458 A1 WO 2017053458A1 US 2016052925 W US2016052925 W US 2016052925W WO 2017053458 A1 WO2017053458 A1 WO 2017053458A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cdp
- pips
- inositol phosphate
- phosphate
- proteoliposomes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
- A61P31/06—Antibacterial agents for tuberculosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1288—Transferases for other substituted phosphate groups (2.7.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/25—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving enzymes not classifiable in groups C12Q1/26 - C12Q1/66
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
Definitions
- the present invention relates to screening for compounds that disrupt the Mycobacterium tuberculosis (M. tuberculosis) inositol phosphate binding site and compounds identified as inhibitors of the Mycobacterial inositol phosphate binding site.
- the invention also relates more generally to screening for and identifying inhibitors of phosphatidylinositol-phosphate synthase (PIPS), and in particular to inhibitors of M. tuberculosis PIPS.
- PIPS phosphatidylinositol-phosphate synthase
- Antimicrobial resistance is reducing the availability of effective antimicrobial treatments worldwide.
- Resistant organisms including bacteria, fungi, viruses, and parasites, are able to withstand attack by antimicrobial medicines, so that standard treatments become ineffective. Infections by such resistant organisms persist increasing the risk of spreading to others.
- the evolution of resistant strains of organisms is a natural phenomenon that occurs when microorganisms are exposed to antimicrobial drugs, and resistant traits can be exchanged between certain types of bacteria. The misuse of antimicrobial medicines also accelerates the emergence of resistant organisms.
- Mycobacterium is a genus of Actinobacteria, given its own family, the Myeobacteriaceae.
- the genus includes pathogens known to cause serious diseases in mammals, including tuberculosis ⁇ Mycobacterium tuberculosis) and the classic Hansen's strain of leprosy ⁇ Mycobacterium leprae).
- Mycobacteria are gram-positive, aerobic and nonmotile bacteria (except for the species Mycobacterium marinum, which has been shown to be motile within macrophages) that are characteristically acid last rods that do not produce flagella, capsules or spores and do not grow on ordinary microbiological media. They are strict aerobes with nutritionally- exacting growth requirements, typically requiring an enriched medium for culturing. Mycobacteria comprise both slow-growing and fast-growing species. Fast-growing organisms, forming colonies in ⁇ 7 days, are generally regarded as non-pathogenic. The slow- growing organisms, however, are those of clinical interest, as they are causal agents of some chronic infections, including human tuberculosis (M.
- tuberculosis non-human tuberculosis (M. bovis), leprosy (M. leprae) and Johne's Disease ⁇ Mycobacterium avium siibsp. paratuberculosis; MAP).
- Mycobacteria have an outer membrane. They do not have capsules, and most do not form endospores.
- the distinguishing characteristic of all Mycobacterium species is that the cell wall is thicker than in many other bacteria, which is hydrophobic, waxy, and rich in mycolic acids/mycolates.
- the cell wall consists of the hydrophobic mycolate layer and a peptidoglycan layer held together by a polysaccharide, arabinogalactan.
- the cell wall makes a substantial contribution to the hardiness of this genus.
- the biosynthetic pathways of cell wall components have been identified as potential targets for new drugs for treating mycobacterial infections, no new drugs have been approved based on these cell wall targets for treating tuberculosis. Only one new drug has been approved by the FDA for treating tuberculosis in the last 40 years— Bedaquiline.
- the present invention relates to a method for identifying an inhibitor compound of Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS) comprising:
- identifying a test compound contacting the test compound with a membrane preparation comprising /PIPS reconstituted in proteoliposomes and incubating with labeled inositol phosphate, and measuring the incorporation of labeled inositol phosphate into the membrane preparation, wherein a decrease in incorporation of labeled inositol phosphate into the membrane preparation when compared to a control, indicates that the test compound is an M-PIPS inhibitor compound.
- the present invention relates to a method for identifying an inhibitor compound of CDP-DAG comprising:
- the present invention relates to a method for screening for compounds that inhibit the growth of Mycobacteria comprising:
- the test compound possesses a structure that indicates the ability of the test compound to bind to the Mycobacterial inositol phosphate binding site.
- the MrPIPS is selected from the group consisting of wild- type MrPIPS, mutant D93N MrPIPS, or mutant R195Q MrPIPS.
- the Mycobacterial PIPS is from Mycobacterium tuberculosis (MrPIPS j, Mycobacterium leprae, or Mycobacterium avium.
- kits are suitable for screening of test compounds for the ability to inhibit Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS), M-PIPS, and/or CDP-DAG.
- M-PIPS Mycobacterial phosphatidylinositol-phosphate synthase
- M-PIPS Mycobacterial phosphatidylinositol-phosphate synthase
- CDP-DAG CDP-DAG
- the present invention relates to a method for treating a Mycobacterial infection in a patient comprising administering an effective amount of an inhibitor compound identified as described herein.
- the Mycobacterial infection is caused by an organism selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium leprae, and Mycobacterium avium.
- the present invention relates to a method for inhibiting growth of Mycobacteria in a patient in need thereof, comprising administering an effective amount of an inhibitor compound identified as described herein.
- the Mycobacteria is selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium leprae, and Mycobacterium avium.
- the methods further comprise administering at least one additional antibacterial agent.
- the present invention relates to a kit for screening for inhibitors of Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS) comprising MrPIPS reconstituted in proteoliposomes, inositol phosphate, and a buffer.
- M-PIPS Mycobacterial phosphatidylinositol-phosphate synthase
- the MrPIPS is selected from the group consisting of wild-type MrPIPS, mutant D93N MrPIPS, or mutant R195Q MrPIPS.
- the kit comprises three types of reconstituted proteoliposomes: wild-type MrPIPS reconstituted proteoliposomes, mutant D93N M/PIPS reconstituted proteoliposomes, and mutant R195Q MrPIPS reconstituted proteoliposomes.
- the present invention relates to a kit for screening for compounds that inhibit the growth of Mycobacteria comprising CDP-DAG reconstituted in proteoliposomes, inositol phosphate, and a buffer.
- the butler is Bicine.
- Figures 1A-J show the design of A 2299- ?sPIPS fusion constructs. Ribbon representation of A/2299 ⁇ Fig. 1A & D), J3 ⁇ 4P1PS-A6N (Fig. IB & E), and fcPIPS-FL (Fig. 1C & F).
- the sequence derived from A 2299 is colored orange, with the exception of residues that were mutated to replicate the TM-extramembrane domain interface observed in the structure of A/2299 (green; two residues, F77 and L75 have side chains depicted in stick representation).
- ftvPIPS sequence is colored in light blue, and the linker is colored red (dark).
- the sequences of the RsPIPS-FL (SEQ ID NO: 71) (Fig.
- the juxtamembrane helix wraps around the TM domain (gray), forming a hydrophilic pocket that accommodates the polar CDP-glycerol donor, whereas in 3 ⁇ 4PIPS-FL (light blue) and 3 ⁇ 4PIPS-A6N (dark blue) it separates from the TM domain, forming a hydrophobic groove that shields the acyl chains of the CDP- diacylglycerol donor (Fig. II).
- Af/PIPSA6N which possesses a truncated juxtamembrane helix has compromised activity when compared with iPIPS-FL;
- A-ftPIPS-FL has comparable activity to iPIPS (no fusion), the protein without the fusion and without the interface mutations;
- fcPIPS-FL has significantly lower activity than the equivalent construct of the Mycobacterium tuberculosis protein (Fig. 1J).
- FIGS. 2A-B show the transmembrane architecture of Renibacterium salmoninarum, a PIP-synthase.
- PIP-synthases catalyze the transfer of a diacylglyceroi-substituted phosphate group (purple/red) from the CDP-DAG donor to the inositol phosphate acceptor (green), generating phosphatidylinositolphosphate (PIP) and CMP.
- PIP-synthases catalyze the transfer of a diacylglyceroi-substituted phosphate group (purple/red) from the CDP-DAG donor to the inositol phosphate acceptor (green), generating phosphatidylinositolphosphate (PIP) and CMP.
- PIP phosphatidylinositolphosphate
- FIG. 2B Structure of the fcPIPS-A6N homodimer in ribbon representation viewed from two orthogonal orientations (in the plane of the membrane on the left; towards the cytosol down the dimer axis on the right).
- One protomer is colored gray, and the helices of the other are depicted in spectral coloring, from blue/light (JMl) to red/dark shading (TM6).
- Figures 3A-D show transmembrane architecture of different groups of integral membrane CDP-APs with varying numbers of transmembrane helices.
- eukaryotic cardiolipin synthases and eukaryotic Pl-synthases are expected to possess six transmembrane helices but lack the N-terminal juxtamembrane helices, while the PIP-synthase, AIP-synthase, and bacterial PC/PE synthases (Fig. 3B) are predicted to adopt the same architecture as 3 ⁇ 4PIPS, with six transmembrane helices and a single N-terminal juxtamembrane helix.
- Eukaryotic CDP-APs that process a lipid acceptor, such as the eukaryotic PC/PE synthases Fig.
- Figures 4A-B are models showing a large interfacial cavity contains the active site of /faPIPS.
- Fig. 4A The structure of ?.sPIPS-A6N is shown in ribbon representation, with one protomer colored gray, and the other colored by the Kyte-Doolitle hydrophobicity scale 36 , from -4.5 (most polar, light blue), to 4.5 (most hydrophobic, orange).
- Two orthogonal representations are shown, on the left is a view in the plane of the membrane, and on the right is a view from the cytosol along the dimer axis.
- a transparent purple surface (calculated using the 3V server 37 ) delineates the borders of the interfacial cavity, which contains three sub-regions as follows: 1 , the inositol phosphate acceptor binding pocket; 2, the nucleotide binding pocket between TM2 and TM3; and 3, a hydrophobic groove between TM2 and JMl.
- Fig. 4B Detail of the active site viewed in the plane of the membrane, with side chains that contact the bound Mg 2+ and SO 4 2" ions labeled and depicted in stick representation.
- Figures 5A-C are structures showing CDP-DAG binding to i&PIPS-FL.
- CDP-DAG is depicted in purple, Mg + ions in light green. Side chains that contact CDP-DAG or Mg + are shown in stick representation.
- Figures 6A-B show homology of ft PIPS to iPIPS.
- Fig. 64 The structure of the transmembrane domain of RsPIPS-FL, shown in spacefill representation, is colored in light gray, with those residues that are identical in ⁇ /jfPIPS are shaded darker (red). CDP-DAG is shown in stick representation.
- Fig. 6B An alignment of rPIPS (SEQ ID NO: 75) and tf. PIPS (SEQ ID NO: 73) (generated using PROMALS3D 39 ), with identical residues highlighted with boxes.
- Figures 7A-H are graphs showing the K M of AfrPIPS (WT, P153V and R195Q) for inositol phosphate and CDP-DAG.
- Measurement of the activity of PIPS-FL WT No A/2299 fusion or interface mutations
- M?PIPS-FL WT with A/2299 fusion and interface mutations
- Figs. 7C-D M?PIPS-FL WT (with A/2299 fusion and interface mutations)
- PI 53V Figs. 7E-F
- R195Q Fig. 7G-H
- the mutations in Figs. 7E-H were carried out on the background of the AffPIPS-FL WT construct with A/2299 fusion and interface mutations.
- Figures 8A-E are homology models of MiPlPS (Fig. 8A), and graphs demonstrating functional characterization of selected point mutants. (Fig. 8B-E).
- FIG. 8A the A /PIPS shown in ribbon representation with one protomer in gray and the other in light blue, from two views, on the left viewed in the plane of the membrane and on the right from the cytosol, along the dimer axis.
- the substrates, CDP-DAG (purple) and inositol phosphate (black) are modeled based on the structures of 3 ⁇ 4PIPS-FL (in complex with CDP- DAG) and R.vPIPS- ⁇ (with bound SO 4 " ).
- the homology model was generated using the Phyre2 server " ' 8 , in one-to-one threading mode using the sequence of MiPIPS (Uniprot accession: P9WPG7) as the target and the structure of fe'PIPS-FL (with the A/2299 extramembrane domain excised) as the template.
- Selected residues which are predicted to participate in either inositol phosphate binding (R155, R195, S132, 135), CDP-DAG binding (P153, M69, D31), neither (L70), or catalysis (D93) are shown with side chains in stick representation and colored as in (Fig.
- FIG. 8B where the activity of point mutants at these positions for the MrPIPS-FL construct is shown compared to wild-type AfiPIPS-FL.
- FIG. 8C SO 4 "" (closed diamonds) and PO 4 " " (open circles) inhibit the activity of MiPIPS-FL with half- inhibitory concentrations of 44 mM and 22 mM respectively.
- FIG. 8D K M of MiPIPS-FL WT, R195Q and P153V for inositol phosphate (InsP; white) and CDP-DAG (stippled/gray).
- InsP L-wyoinositol- 1 -phosphate (inositol phosphate); CDP-DAG, CDP- dioleoylglyeerol.
- PIPS is essential for catalyzing the synthesis of phosphatidylinositol, which makes up the membrane of Mycobacteria.
- Combining genetically engineered PIPS and crystallography studies to generate structural information for the design of new therapeutics against Mycobacteria represents a novel and more specific approach to identify binding sites for Mycobacterial drug targets.
- the methods and data described herein identify binding sites which may serve as targets for developing therapeutics against Mycobacteria, more broadly for Actinobacteria, and in particular M. tuberculosis.
- the present invention relates to screening for compounds that disrupt the M. tuberculosis inositol phosphate binding site and compounds identified as inhibitors of the Mycobacterial inositol phosphate binding site.
- the invention also relates more generally to screening for and identifying inhibitors of PIPS, and in particular to inhibitors of M. tuberculosis PIPS.
- the present invention relates to methods of treatment or methods of inhibiting bacterial growth using any of the compounds identified as inhibitors of the Mycobacterial inositol phosphate binding site, and/or inhibitors of M. tuberculosis PIPS.
- phosphatidylinositol-based lipids play important roles in numerous aspects of intracellular signaling and in the anchoring of glycosylphosphatidylinositol (GPI) linked proteins to the membrane.
- GPI glycosylphosphatidylinositol
- PI phosphatidylinositol
- mycobacteria as well as some other bacterial genera, where it is required for the biosynthesis of key components of the cell wall.
- the cell walls of mycobacteria carry complex lipoglycans such as lipomannan and lipoarabinomannan, which are tethered to the membrane via a common PI anchor that constitutes their first building block 1 .
- PI synthases process myoinositol and CDP-diacylglycerol (CDP-DAG) to generate phosphatidylinositol directly in a single step 3 .
- CDP-DAG CDP-diacylglycerol
- Pl-biosynfhesis occurs in two steps. In the initial step, phosphatidylinositol-phosphate -synthases (PIP-synthases; Fig.
- PIP phosphatidylinositol-phosphate
- a homologous enzyme (AIP-synthase) has been characterized in archaea, which like the PIP-synthases uses inositol phosphate as the acceptor, but requires CDP-archaeol, an isoprene -based ether-linked lipid, as the donor instead of CDP-DAG 5"7 .
- Each of these enzymes is a member of the class I CDP-alcohol phosphotransferases (CDP-APs); class II CDP-APs are peripheral membrane proteins of an unrelated fold, and are not involved in PI biosynthesis (we will use the term CDP-APs as referred to class I family members only).
- CDP-APs are integral membrane enzymes that catalyze the transfer of a substituted phosphate group from a CDP-linked donor, CDP-DAG for PI and PIP biosynthesis, to an acceptor alcohol to generate a phosphodiester-linked product 3 ' 8,9 .
- PIP-synthases are the closest evolutionary relatives to A/2299 and A/DIPP-synthase 12 , an advantage for the crystal engineering approach utilized herein and which is described below.
- PIP- synthases bind CDP-DAG as donor substrate, a feature in common with eukaryotic PI and cardiolipin synthases, as well as all prokaryotic CDP-APs involved in glycerophospholipid biosynthesis.
- they have possible medical relevance, as genetic ablation of mycobacterial PIP-synthase is lethal' '. This, combined with the unique pathway used for Pl- synthesis in prokaryotes, positions PIP-synthase as an attractive future drug target' 4 '' ' ⁇
- Treating” or “treatment” of a state, disorder or condition includes:
- administering is used in its broadest sense to mean contacting a subject with a composition disclosed herein.
- antimicrobial activity means microbicidal or microbiostatic activity or a combination thereof, against one or more microorganisms.
- Microbicidal activity refers to the ability to kill or cause irreversible damage to a target microorganism.
- microbiostatic activity refers to the ability to inhibit the growth or proliferative ability of a target microorganism without necessarily killing or irreversibly damaging it.
- sequence identity refers to a relationship between two or more polypeptide sequences, as well as two or more polynucleotide sequences, namely a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing the given sequence to the reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by the match between strings of such sequences. Upon such alignment, sequence identity is ascertained on a position-by-position basis. For example, the sequences are “identical” at a particular position if at that position, the nucleotides or amino acid residues are identical.
- Sequence identity can be readily calculated by known methods, including but not limited to, those described in Computational Molecular Biology, Lesk, A. ., et., Oxford University Press. New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo et a!., Applied Math., 48: 1073 (1988), the teachings of which are incorporated herein by reference.
- nucleic acid is used herein to refer to a polymer of deoxynucleic ribose nucleic acids, as well as ribose nucleic acids.
- the term includes linear molecules, as well as covalently closed circular molecules. It includes single stranded molecules, as well as double stranded molecules.
- subject refers to a living organism having a central nervous system.
- subjects include, but are not limited to, human subjects or patients and companion animals.
- companion animals may include domesticated mammals (e.g., dogs, cats, horses), mammals with significant commercial value (e.g., dairy cows, beef cattle, sporting animals), mammals with significant scientific values (e.g., captive or free specimens of endangered species), or mammals that otherwise have value.
- Suitable subjects also include: mice, rats, dogs, cats, ungulates such as cattle, swine, sheep, horses, and goats, lagomorphs such as rabbits and hares, other rodents, and primates such as monkeys and apes.
- subjects may be diagnosed with a microbial infection, may be at risk for a microbial infection, or may be experiencing a microbial infection.
- Subjects may be of any age including new born, adolescence, adult, middle age, or elderly.
- terapéuticaally effective amount is used herein to mean an amount sufficient to increase to some beneficial degree, preferably to increase by at least about 1 to 100 percent, more preferably by at least about 5 to 95 percent, and more preferably by at least 8 percent or higher, healing or infection improvement as compared to untreated controls.
- An "effective amount” is a pharmaceutically-effective amount that is intended to qualify the amount of an agent or compound, that when administered to a subject, will achieve the goal of healing an infection site, inhibiting the growth of a microorganism, or otherwise benefiting the recipient environment.
- the method of reducing the growth or survival of microorganisms includes contacting a microorganism population with an antimicrobial agent of the present disclosure.
- the method may include first identifying a microorganism population.
- the methods disclosed herein include methods of inhibiting the survival or growth of a microorganism.
- the term "inhibit” includes a decrease in any detectable amount, for example, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 or more, and can be determined by methods known in the art.
- Exemplary methods of detecting inhibition includes a determination by count, such as a bacterial culture or viral titer, or by evaluation of one or more symptoms associated with infection by a microorganism. Symptoms associated with infection by a microorganism are known in the art. Such symptoms are characteristic to a particular infectious microorganism and the resulting condition.
- a composition that can support growth or survival of a microorganism may be contacted with an effective amount of the antimicrobial agent in a variety of ways.
- the antimicrobial agent may be added directly to the food, it may be incorporated into the matrix of the packaging material or it may be coated onto the packaging material, in which case the antimicrobial agent may be released during storage, upon dissolution of the encapsulation material, contact with moisture or at a predetermined temperature.
- the composition is a body fluid, the antimicrobial agent may be added directly to the body fluid.
- a subject may be contacted with the antimicrobial agent in a variety of ways including, without limitation, administration using routes commonly known in the art.
- routes include oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, vaginal, dermal, transdermal (topical), transmucosal, intrathoracic, intrapulmonary and intranasal (respiratory) routes.
- the means of administration may be by injection, using a pump or any other appropriate mechanism.
- An antimicrobial agent disclosed herein may be administered to a subject in a single does, in multiple doses, in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled artisans.
- the administration of the antimicrobial agents may be essentially continuous over a pre-selected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
- the dosage to be administered to a subject may be any amount appropriate to reduce or prevent infection or to treat at least one symptom associated with the infection.
- Some factors that determine appropriate dosages are well known to those skilled in the art and may be addressed with routine experimentation. For example, determination of the physicochemical, toxicological and pharmacokinetic properties may be made using standard chemical and biological assays and through the use of mathematical modeling techniques known in the chemical, pharmacological and toxicological arts. The therapeutic utility and dosing regimen may be extrapolated from the results of such techniques and through the use of appropriate pharmacokinetic and pharmacodynamic models. Other factors will depend on individual patient parameters including age, physical condition, size, weight, the condition being treated, the severity of the condition, and any concurrent treatment. The dosage will also depend on the agent chosen and whether prevention or treatment is to be achieved, and if the agent is chemically modified.
- an antimicrobial agent disclosed herein may be administered as single or divided dosages. For example, of at least about 0.01 mg/kg to about 500 to 750 mg/kg, of at least about 0.01 mg kg to about 300 to 500 mg/kg, at least about 0.1 mg/kg to about 100 to 300 mg/kg or at least about 1 mg/kg to about 50 to 100 mg kg of body weight, although other dosages may provide beneficial results.
- the absolute weight of a given antimicrobial agent disclosed herein included in a unit dose may vary widely. For example, about 0.01 to about 2 g, or about 0.1 to about 500 mg, of at least one antimicrobial agent may be administered.
- the unit dosage may vary from about 0.01 g to about 50 g, from about 0.01 g to about 35 g, from about 0.1 g to about 25 g, from about 0.5 g to about 12 g, from about 0.5 g to about 8 g, from about 0.5 g to about 4 g, or from about 0.5 g to about 2 g.
- Daily doses of the antimicrobial agents may vary as well. Such daily doses may range, for example, from about 0.1 g day to about 50 g/day, from about 0.01 g day to about 25 g/day, from about 0.1 g/day to about 12 g/day, from about 0.5 g/day to about 8 g/day, from about 0.5 g/day to about 4 g/day, and from about 0.5 g/day to about 2 g/day.
- An antimicrobial agent may be used alone or in combination with a second medicament.
- the second medicament may be a known antimicrobial agent such as, but not limited to, a .beta. -lactam, macrolide or other antibiotics, e.g. Azithromycin, Doxycycline, Tetracycline, and Erythromycin; an antifungal agent such as clotrimazole, nystatin, fluconazole, ketoconazole, amphotericin B, caspofungin, or voriconazole; an agent effective against a protozoan such as, for example, Metronidazole or timidazole.
- a known antimicrobial agent such as, but not limited to, a .beta. -lactam, macrolide or other antibiotics, e.g. Azithromycin, Doxycycline, Tetracycline, and Erythromycin
- an antifungal agent such as clotrimazole, nystatin, fluconazole
- the second medicament may also be an antiviral agent such as Abacavir, Acyclovir, Amantadine, Didanosine, Emtricitabine, Enfuvirtide, Entecavir, Ganciclovir. Gardasil. Lamivudine, Nevirapine, Nelfinavir, Oseltamivir, Ribavirin, Rimantadine, Ritonavir, Stavudine, Valaciclovir, Vidarabine, Zalcitabine, and Zidovudine.
- the effective amount of the second medicament will follow the recommendations of the second medicament manufacturer, the judgment of the attending physician and will be guided by protocols and administrative factors for amounts and dosing as indicated in the PHYSICIAN'S DESK REFERENCE (as commonly known in the art).
- the effectiveness of the method of treatment may be assessed by monitoring the subject for signs or symptoms of the microbial infection as discussed above, as well as determining the presence or amount of microorganism present in the subject by methods known in the art.
- variant relates to nucleotide or amino acid sequences which have similar sequences and that function in the same way.
- Amino acid designations may include full name, three-letter, or single-letter designations as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
- an “immune response” refers to the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest.
- a response usually consists of the subject producing antibodies, B cells, helper T cells, suppressor T cells, regulatory T cells, and/or cytotoxic T cells directed specifically to an antigen or antigens included in the composition or vaccine of interest.
- vaccine refers to a composition comprising a cell or a cellular antigen, and optionally other pharmaceutically acceptable carriers, administered to stimulate an immune response in an animal, most preferably a human, specifically against the antigen and preferably to engender immunological memory that leads to mounting of a protective immune response should the subject encounter that antigen at some future time.
- Vaccines often include an adjuvant.
- a “therapeutically effective amount” means the amount of a compound that, when administered to an animal for treating a state, disorder or condition, is sufficient to effect such treatment.
- the “therapeutically effective amount” will vary depending on the compound, the disease and its severity and the age, weight, physical condition and responsiveness of the animal to be treated.
- compositions of the invention may include a "therapeutically effective amount” or a “prophylactically effective amount” of a compound of the invention.
- a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result.
- a therapeutically effective amount of a compound may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of a compound to elicit a desired response in the individual.
- a therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects.
- a “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
- the present invention provides a pharmaceutical composition or formulation comprising at least one active composition, or a pharmaceutically acceptable derivative thereof, in association with a pharmaceutically acceptable excipient, diluent and/or carrier.
- the excipient, diluent and/or carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
- compositions of the invention can be formulated for administration in any convenient way for use in human or veterinary medicine.
- the invention therefore includes within its scope pharmaceutical compositions comprising a product of the present invention that is adapted for use in human or veterinary medicine.
- the pharmaceutical composition is conveniently administered as an oral formulation.
- Oral dosage forms are well known in the art and include tablets, caplets, gelcaps. capsules, and medical foods. Tablets, for example, can be made by well-known compression techniques using wet, dry, or fluidized bed granulation methods.
- Such oral formulations may be presented for use in a conventional manner with the aid of one or more suitable excipients, diluents, and carriers.
- Pharmaceutically acceptable excipients assist or make possible the formation of a dosage form for a bioactive material and include diluents, binding agents, lubricants, glidants, disintegrants, coloring agents, and other ingredients.
- Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, ascorbic acid and esters of p-hydroxybenzoic acid.
- Antioxidants and suspending agents may be also used.
- An excipient is pharmaceutically acceptable if, in addition to performing its desired function, it is non-toxic, well tolerated upon ingestion, and does not interfere with absorption of bioactive materials.
- Acceptable excipients, diluents, and carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins (A. R. Gennaro edit. 2005). The choice of pharmaceutical excipient, diluent, and carrier can be selected with regard to the intended route of administration and standard pharmaceutical practice.
- the phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are "generally regarded as safe”, e.g., that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopeias for use in animals, and more particularly in humans.
- Patient or “subject” refers to mammals and includes human and veterinary subjects.
- the dosage of the therapeutic formulation will vary widely, depending upon the nature of the disease, the patient's medical history, the frequency of administration, the manner of administration, the clearance of the agent from the host, and the like.
- the initial dose may be larger, followed by smaller maintenance doses.
- the dose may be administered as infrequently as weekly or biweekly, or fractionated into smaller doses and administered daily, semi-weekly, etc., to maintain an effective dosage level.
- oral administration will require a higher dose than if administered intravenously.
- topical administration will include application several times a day, as needed, for a number of days or weeks in order to provide an effective topical dose.
- carrier refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions.
- the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant. and a colorant. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E. W. Martin.
- adjuvant refers to a compound or mixture that enhances the immune response to an antigen.
- An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specificaliy enhances the immune response (Hood et al., Immunology, Second Ed.. 1984, Benjamin/Cummings: Menlo Park, Calif., p. 384).
- a primary challenge with an antigen alone, in the absence of an adjuvant will fail to elicit a humoral or cellular immune response.
- Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, and potentially useful human adjuvants such as N-aeetyl-muramyl-L-threonyl- D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N- acety ⁇ muraniyl-L-aianyl-D-isoglutaminyl-L-alanine-2-( -2'-dipa ⁇ mitoy ⁇ -sn-glycero-3- hydroxyphosphoryloxy)-ethylamine, and BCG (bacille Calmette-Guerin).
- parenteral routes of administration are also possible.
- routes include intravenous, intra-arteriole, intramuscular, intradermal, subcutaneous, intraperitoneal, transmucosal, intranasal, rectal, vaginal, or transdermal routes.
- inactivated therapeutic formulations may be injected, e.g., intravascular, intratumor, subcutaneous, intraperitoneal, intramuscular, etc.
- kits comprising the components of the combinations of the invention in kit form.
- a kit of the present invention includes one or more components including, but not limited to ⁇ /jiPlPS reconstituted in proteoliposomes, inositol phosphate, and a buffer as discussed herein.
- kits for screening for inhibitors of Mycobacterial phosphatidylinositol-phosphate synthase include MrPIPS reconstituted in proteoliposomes, inositol phosphate, and a buffer.
- the MrPIPS can be wild-type MrPIPS, mutant D93N /PIPS, or mutant R195Q AftPlPS.
- all three types of reconstituted proteoliposomes wild-type MrPIPS reconstituted proteoliposomes. mutant D93N M/PIPS reconstituted proteoliposomes, and mutant R195Q MrPIPS reconstituted proteoliposomes will be supplied in separate containers in the kit.
- Kits also include those for screening for compounds that inhibit the growth of Mycobacteria comprising CDP-DAG reconstituted in proteoliposomes, inositol phosphate, and a butler.
- the buffer can be Bicine.
- control or test membranes can be formulated into a composition suitable and stable for transport and for passaging and utilizing for screening. Kits may include assay directions, buffers, etc.
- the kit can include a package insert including information concerning the compositions and storage of the kit.
- information concerning the compositions and storage of the kit For example, the following information regarding any combination of the embodiments described herein may be supplied in the insert: how supplied, proper storage conditions, references, manufacturer/distributor information and patent information.
- the present disclosure provides articles of manufacture and kits containing materials useful for treating the conditions described herein.
- the article of manufacture may include a container of a composition as described herein with a label.
- Suitable containers include, for example, bottles, vials, and test tubes.
- the containers may be formed from a variety of materials such as glass or plastic.
- the container may hold a composition having an antimicrobial agent disclosed herein, which is effective for inhibiting the growth of a microorganism or treating a condition caused by a microorganism.
- the label on the container may indicate that the composition is useful for treating specific conditions and may also indicate directions for administration.
- Example 1 Crystal engineering and structure determination.
- CDP-alcohol phosphotransferases with predicted involvement in phosphatidylinositol- phosphate synthesis were identified from fourteen prokaryotic organisms by homology to a template of known function.
- Example 2 Transmembrane architecture and active site in i3 ⁇ 4PIPS-A6N.
- fcPIPS adopts a homodimeric architecture similar to those previously observed in A/2299 and 4/DlPP-synthase (Fig. 2B), with each protomer possessing six TM helices surrounding a large polar cavity.
- Sequence alignment with eukaryotic CDP-APs that process a lipidic acceptor substrate, such as choline/ethanol amine phosphotransferase (CEPTl ; Fig. 3A-D) suggests that these eukaryotic enzymes may possess an additional 3-4 TM helices at the C -terminus, perhaps serving as an additional TM module to accommodate the bulkier, hydrophobic acceptor.
- the central polar cavity is located at the cytosolic boundary of the membrane, and contains three distinct regions, which together form the active site (Fig. 4A).
- the nucleotide binding site is delineated by TMs 1, 2 and 3, and is characterized by a signature sequence featuring eight absolutely conserved residues (D]X D2GiXxAR...G2 D-;xx D4 , five of which are located on TM2 and three on TM3.
- the first three of the conserved aspartate side chains coordinate a metal, and D 4 likely acts as the catalytic base.
- the four other signature amino acids either provide structural flexibility or line the binding site that accommodates the pyrimidine ring of the CDP 10 .
- TMs 4, 5 and 6 Proximal to the nucleotide-binding site, and within the membrane-spanning region is a pocket wedged between TMs 4, 5 and 6, which probably represents the inositol phosphate acceptor-binding cavity (Fig. 4A-B).
- Several conserved residues line this cavity, including two arginine residues (R153 and R191) that in the structure of R.vPIPS-A6N coordinate a S0 4 2" ion present at high concentration in the crystallization solution.
- R153 and R191 are absolutely conserved amongst all PIP-synthases, but not in eukaryotic PI synthases. From this data, we hypothesize that these residues R153 and R191 coordinate the phosphate of inositol phosphate, a moiety unique to PIP-synthases.
- Example 3 Structure of JfePIPS in complex with CDP-DAG.
- the structure of the complex of CDP-DAG bound to fcPIPS-FL revealed strong density for CDP, with the nucleotide ring wedged between TMs 2 and 3, and the diphosphate moiety coordinated by a bound magnesium ion that also interacts with conserved aspartate residues of the CDP-AP signature sequence (Fig. 4B).
- density was also observed for the acyl chains of the CDP- DAG, which lie against the TM region in a groove formed by JM1 , TM2 and TM5 (Figs. 5A- C).
- CDP-APs which have a small, hydrophilic pocket in this location, consistent with their preference for soluble donor moieties such as CDP-glycerol and CDP-inositol (Fig. II).
- the activity of /PIPS-FL is comparable to the activity of M/PIPS constructs lacking the extramembrane domain and interface mutations (Fig. 1J). All proteins tested expressed to comparable levels. Kinetic characterization of the construct lacking the extramembrane domain and interface mutations showed that the KM for inositol phosphate is somewhat lower for the engineered construct (122 ⁇ vs 243 ⁇ ), while the K for CDP-DAG is somewhat higher (238 ⁇ vs 60 ⁇ ; Fig. 7A-H). Importantly, the V max for the engineered construct is comparable to that for the unmodified protein (22 nmol PIP/min/mg protein vs 32nmol PIP/mg protein; Fig. 7A-H).
- Example 5 Functional characterization of Mf PIP-synthase.
- R195Q bound a significantly lower amount of substrate, compatible with its putative function in binding of inositol phosphate.
- Lysine K135 is located such that it may interact with the inositol ring, and the K135A mutation also resulted in a partial loss of activity.
- D31 a conserved residue on TM 1 which forms a hydrogen bond with the primary amine of CDP, to alanine, also severely compromised activity, but did not completely abolish it (Fig. 4a and 4b).
- This partial effect of the D31 A mutation is likely due to the fact that most of the residues in the CDP-AP signature sequence participate in binding of the nucleotide, and that T34, present in all CDP-APs as S or T as part of a conserved P(D N)xx(T/S) motif, also binds to the primary amine of the pyrimidine ring, and thus may compensate, at least in part, for the absence of the contribution from D31.
- CDP-alcohol phosphotransferases with predicted involvement in phosphatidylinositol- phosphate synthesis were identified from fourteen prokarvotic organisms by homology to a template of known function. Six mutations were introduced into each one (Fig. 1) to replicate the interface between the cytosolic and TM domains observed in the structure of A/2299, and the corresponding genes were synthesized (GenScript). Genes not bearing the mutations at the interface were PGR amplified from the matching genomes. The Uniprot IDs and species of the sequences identified were as follows: 1 : Q9F7Y9, Mycobacterium smegmalis; 2: G6X547, Mycobacterium abscessus; 3.
- PCR was used to amplify the bacterial expression vector pMCSG7 encoding A/2299 (with an N-terminai decahistidine tag and a TEV protease cleavage site), excluding the portion of the gene not encoding the N-terminal soluble domain.
- Gibson assembly 6 was used to fuse the genes encoding PIP-synthases to the linear fragment of the pMCSG7 -A/2299 vector. All point mutants of /P1PS were generated using the QuikChange site-directed mutagenesis kit (Agilent). Sequences of all primers used for cloning and mutagenesis are provided in Table 1.
- AiiPiPS-FL WT (for amplification Forward TTCCAATCCAATGCCATGAGCAAGCTGCCCTTC 37 from Mr genomic DNA) Reverse TATCCACTTCCAATGTCACCGGTCGCCCTTTCC 38 pMCSG7 vector Forward CATTGGAAGTGGATAACGGATCCG 39
- Table 1 Primers used for cloning and mutagenesis. Sequences are provided for primers used in initial cloning of /2299-PIPS (full-length) fusions and in site-directed mutagenesis to generate the additional 3 ⁇ 4PIPS and MiPIPS constructs. Regarding the primers used to produce the initial constructs, upper case letters indicate gene-specific sequences and lower case letters indicate sequences incorporated into the PCR product to generate the overlaps necessary for Gibson assembly. All primers are written from 5 r to 3 " . Membrane isolation and protein expression and purification.
- plasmids encoding PIP-synthases were transformed into BL21 (DE3) pLysS E. coli competent cells. Transformed cells were used to inoculate a starter culture (8 mL) of 2xYT medium supplemented with 100 ⁇ / ⁇ ampicillin and 50 ⁇ g/mL chloramphenicol. This culture was grown at 37°C overnight while shaking (240 rpm). The next day, the starter culture was used to inoculate 800 mL of 2xYT medium supplemented with 100 ⁇ g/mL ampicillin and 50 pg/mL chloramphenicol. Cultures were again grown at 37 C C while shaking (240 rpm).
- the shaker temperature was reduced to 22 °C, and fifteen minutes later protein expression was induced with a final concentration of 0.2 mM isopropyl ⁇ -D-l - thiogalactopyranoside (IPTG). After overnight induction at 22°C, cells were harvested by centrifugation at 4000 x g for 15 minutes at 4°C and stored at -80°C until needed. Cultures for large-scale protein expression were 800 mL in volume, while 15 mL cultures were grown similarly to test protein expression in small-scale.
- IPTG isopropyl ⁇ -D-l - thiogalactopyranoside
- frozen cell pellets were resuspended in lysis buffer containing 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 20 mM MgS0 , 10 pg/mL DNase I, 10 pg/mL RNase A, 1 mM TCEP, 1 mM P ' MSF, and Complete Mini EDTA- free protease inhibitor cocktail (Roche) used as described in instructions.
- Cells were lysed with an Emulsiflex C3 homogenizer (Avestin).
- Lysate was solubilized for 1.5 hours with 1% (w/v) n-dodecyl ⁇ -D-maltopyranoside (DDM, Anagrade, Affymetrix) in a volume of approximately 40 mL per cell pellet from 800 mL culture (-6 grams cells). Insoluble material was then pelleted by ultracentrifugation at 134,000 x g for 30 min at 4°C. Protein was purified from the supernatant by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). The soluble fraction was incubated with pre-equilibrated Ni-NTA beads (0.5 mL for 40 mL soluble fraction) for 2 hours.
- DDM n-dodecyl ⁇ -D-maltopyranoside
- the beads were washed with 10 column volumes of 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 0.1% (w/v) DDM, and 60 mM imidazole pH 7.5.
- the protein was then eluted from the beads with 5 column volumes of 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 0.05% (w/v) DDM, and 300 mM imidazole pH 7.5.
- Ni-NTA elutions were dialyzed overnight in a Slide-A-Lyzer dialysis cassette (Thermo Scientific) at 4°C in the presence of TEV protease ( 150 pL at 3 mg mL) to cleave the decahistidine tag.
- the dialysis buffer consisted of 20 mM HEPES-NaOH pH 7.0, 200 mM NaCl, and 0.05% (w/v) DDM. The next day, the sample was removed from the dialysis cassette and purified again using washed Ni-NTA to remove TEV protease, cleaved decahistidine tags, and any non-cleaved protein.
- Flow-through containing purified cleaved protein was subjected to size-exclusion chromatography (SEC) using a Superose 12 column (GE Healthcare) in a buffer of 20 mM HEPES -NaOH pH 7.0, 200 mM NaCl, 0.025% (w/v) DDM, and 1 mM tris(2- carboxyethyl)phosphine hydrochloride (TCEP-HCl). Protein eluted as a sharp monodisperse peak, as could be judged by monitoring A280. Approximately 0.75 mg of purified protein could be obtained from an 800 mL bacterial culture.
- Small-scale initial protein expression tests were performed similarly using 100 mg quantities of cells from a 15 mL culture. Lysis was performed using a tip soiiicator (3 x 5 s pulses with 5 s cooling intervals between pulses), and purification proceeded until the first immobilized metal- affinity chromatography step, after which the Ni-NTA elutions were mixed with 6x SDS loading buffer and run on 12% or 14% SDS-PAGE gels to identify expressing PIP-synthase constructs.
- frozen cell pellets were resuspended in lysis buffer containing 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 20 mM MgS0 4 , 10 pg/mL DNase I, 10 pg/mL RNase A, 1 mM TCEP, 1 mM PMSF, and Complete Mini EDTA-free protease inhibitor cocktail (Roche) used as described in instructions.
- Cells were lysed with an Emulsiflex C3 homogenizer (Avestin). The membrane fraction was pelleted by ultracentrifugation at 134,000 x g for 30 min at 4°C.
- membranes were resuspended by homogenization in a high salt buffer containing 20 mM HEPES-NaOH pH 7.5, 500mM NaCl, 20mM MgS0 4 , 10 pg/mL DNase I, 10 pg/mL RNase A, 1 mM TCEP, 1 mM PMSF, and Complete Mini EDTA-free protease inhibitor cocktail (Roche).
- the membrane fraction was pelleted once again by ultracentrifugation at 134,000 x g for 30 min at 4°C.
- Membranes were then resuspended by homogenization in storage buffer containing 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 20 mM MgS0 4 , and ImM TCEP. If required, resuspended membranes were solubilized for 1.5 hours with 1 % (w/v) DDM. Protein purification was carried out as described above.
- E. coli polar lipid extract (Avanti) and phosphatdiylcholine (PC, Avanti) were mixed in a 3: 1 ratio (w/w) by dissolving in chloroform. Chloroform was removed under a stream of nitrogen gas to obtain a thin layer of dry lipids. Lipids were resuspended in buffer containing 100 mM HEPES, pH 7.5 and 1.5% (w/v) l-O-n-Octyi-P-D-glucopyranoside (OG, Anagrade, Affymetrix) and the detergent was removed by dialysis against 1 L of 100 mM HEPES, pH 7.5.
- OG l-O-n-Octyi-P-D-glucopyranoside
- the resulting liposomes were divided into aliquotes, frozen in liquid nitrogen and stored at -80°C.
- the protocol used was adapted from Rigaud. J.L., et al, .
- the concentration of thawed liposomes was adjusted to 10 mg/mL with lOOmM HEPES, pH 7.5, 0.11% (w/v) Triton X-100 was added to the liposome-containing solution and mixed by vortexing. Protein, purified as previously described, was then added in a ratio of 1 :80 (0.125 mg protein to 10 mg lipid). The mixture was incubated at room temperature with agitation for 15 minutes.
- Bio-Beads SM-2 60 mg of pretreated and equilibrated Bio-Beads SM-2 (BioRad) were added to the mixture and incubated at room temperature for 1 hour under constant agitation. An additional 60 mg of Bio-Beads were then added to the mixture and incubated at room temperature for 1 hour under constant agitation. Then, 120 mg of Bio- Beads were added to the mixture and incubated overnight at 4°C with under constant agitation, after which proteoliposomes were separated and removed from the Bio-Beads by careful pipetting.
- proteoliposomes The concentration of proteoliposomes was adjusted by ultracentriiugation (148,000 x g for 30 minutes at 4°C) and resuspension in the correct volume of buffer (100 mM HEPES, pH 7.5). Proteoliposomes were divided into aliquotes, flash frozen in liquid nitrogen and stored at -80°C.
- Frozen recombinant cells of E. coli expressing PIP-synthase constructs (approx. 2 g), grown as described above, were suspended in 5 mL buffer A (50 mM Tris-HCl, pH 7.6, 10 mM MgCl 2 , 5 mM ⁇ -mercaptoethanol) and disrupted by sonication (5 x 60 s pulses with 60 s cooling intervals between pulses). Cell debris and unbroken cells were separated by centrifugation ( 10,000 x g, 10 mm, 4°C), and membrane fractions were obtained by centrifugation of the supernatant at 100,000 x g for 2 h at 4°C. The membrane fractions were suspended in 0.5 mL of buffer A and frozen at -20°C until use.
- buffer A 50 mM Tris-HCl, pH 7.6, 10 mM MgCl 2 , 5 mM ⁇ -mercaptoethanol
- sonication 5 x 60 s pulses
- L-mvo-[' 4 C]inositol-l-phosphate was prepared from [ 1" *C(U)]glucose (Perkin Elmer Life Sciences) using hexokinase of Thermoproteus tenax and L-myo-inositol-l-phosphate synthase (TPS) of Archaeoglobus fulgidus.
- E. coli cells harboring the hexokinase or the ips genes were grown in LB medium at 37°C supplemented with 100 pg/mL ampicillin to an optical density of 0.5 at 600 nm, and protein expression was induced for 4 hours with 1 mM 1PTG 1 '.
- Partial purification of recombinant hexokinase and TPS was perfonned by heating the cell extracts for 30 min at 90°C and 60°C, respectively, followed by centrifugation to remove denatured proteins.
- the production of [ C]glucose-6-phosphate was carried out in a reaction mixture containing the recombinant hexokinase, [ 14 C(U)jglucose (3.7 MBq/336 nmol), 10 mM glucose, 5 mM ATP, 50 mM Tris-HCI (pH 7.6) and 10 mM MgCl 2 .
- the reaction mixture was centrifuged (10,000 x g, 10 min, 4°C), and the resulting supernatant was added to a reaction mixture containing the recombinant IPS, 5 mM NAD + and 50 mM Tris-HCl (pH 7.6). After incubation at 85.5°C for 1 h, and centrifugation (10,000 x g, 10 min, 4°C), the resulting supernatant was treated with activated charcoal to eliminate residual nucleotides, and then filtered through a 10 kDa Omega Nanosep filter (Pall Life Sciences, Hampshire, UK) to remove proteins.
- the filtrate contained h-myo- [ l4 C]inositol-l-phosphate, [ !4 CJglucose-6-phosphate and [ 1 C]glucose.
- h-myo- [ 14 CJinositol-l - phosphate present in the preparation was quantified after TLC separation and used as a substrate for assays of PIP-synthase activity.
- the reaction mixtures contained the membrane fraction (200 ⁇ g of total membrane protein as determined by the Bradford method) of E. coli expressing PIPS constructs, 6.5 ⁇ L-m> ! o[ i4 C] inositol- 1 -phosphate, 161 ⁇ of cold inositol phosphate prepared as described above, 0.4 mM CDP-dioleo lgiycerol (Avanti Polar Lipids), 10 mM MgCb, 10 mM ⁇ -mercaptoethanol, 1% (w/v) 3-[(3-cholamidopropyl)dimethylammonio]-l- propanesulfonate (CHAPS) and 50 mM Bicine buffer (pH 8.0).
- the membrane fraction 200 ⁇ g of total membrane protein as determined by the Bradford method
- CDP-dioleo lgiycerol Adi Polar Lipids
- 10 mM MgCb 10 mM ⁇ -mercaptoethanol
- the reaction was started by addition of the membrane fraction.
- the mixtures were incubated at 37°C during 1 h and reactions were stopped by addition of 1 mL of 0.1 M HC1 in methanol.
- the mixtures were transferred to glass tubes containing 1.5 mL 0.1 M HC1 in methanol and 2.5 mL CHCL.
- the partition into aqueous and organic layers was carried out with addition of 2.15 mL MgCl 2 (1M, pH 2).
- the organic layer was removed and washed twice with 0.1 M HC1, methanol/1 M MgCi 2 (1:0.8, v/v).
- the radiolabeled product in the organic layer was quantified using a liquid scintillation counter (Beckman LS 6500).
- the K M of AffPIPS was assessed in reaction mixtures (final volume, 200 L) containing 2 mM CDP-dioleoylglyceroi, 10 mM MgCl 2 , 10 mM ⁇ - mercaptoethanol, 1% (w/v) CHAPS, 50 mM Bicine buffer (pH 8.0), 9 ⁇ L-myo- [ !4 C]inositol-l-phosphate plus different concentrations of cold inositol phosphate (final concentrations of 38 ⁇ to 1 mM for WT and P153V, and 38 ⁇ to 4 mM for R195Q).
- the mixtures were pre-incubated for 3 min at 37°C and the reactions initiated by addition of the membrane fraction of E. coli expressing M/PIPS (200 ⁇ g of total membrane protein) and stopped at different time points by addition of 1 mL of 0.1 M HQ in methanol.
- the extraction and quantification of the radiolabeled product was performed as described above. These experiments were performed in duplicate.
- the K M of A//PIPS (WT, R195Q and P153V) for CDP-DAG was performed in reaction mixtures (final volume, 200 ⁇ ,) containing 1 mM of inositol phosphate (from which 9 ⁇ was L-mvo-[ ,4 C]inositoi-l-phospate), 10 mM MgCl 2 , 10 mM ⁇ -mercaptoethanol, 1% (w/v) CHAPS. 50 mM Bicine buffer (pH 8.0), plus different concentrations of CDP- dioleoylglycerol (ranging from 50 to 2000 ⁇ ). The mixtures were pre-incubated for 3 min at 37 °C and the reactions initiated by addition of the membrane fraction of E.
- L-myo-[ 14 C]inositol-l -phosphate -binding assays were carried out in reaction mixtures (final volume, 100 ⁇ _) containing fPIPS (WT, D93N or R195Q) reconstituted in proteoliposornes (9 ⁇ g of protein), 2 mM MgCl ? , 40 uM inositol phosphate (of which 16 ⁇ was L-rayo-[ 14 C]inositol-l -phospate) and 50 mM Bicine buffer (pH 8.0). The mixtures were pre-incubated for 3 min at 37°C absent ligand, the reactions initiated by addition of inositol phosphate and stopped after 10 min.
- the binding assay mixtures were passed over HAWP 02500 filters (Millipore), and unbound L-myo-[ Cjinositol-1 -phosphate was separated from the bound by washing three times with 600 uL of 50 mM Bicine buffer (pH 8.0). Bound L- myo-[' 4 C]inositol-l-phosphate was quantified by liquid scintillation counting.
- the effect of CDP-DAG on the binding of inositol phosphate to AffPIPS was investigated by pre- inco orating 200 ⁇ CDP-DAG in the proteoliposomes used in each reaction mixture.
- Crystals were grown at room temperature (22°C) in lipidic cubic phase, using as host lipid either monooiein alone (NuChek Prep) or a mixture of 2% CDP-dioleoyiglycerol (Avanti Polar Lipids) and 98% monooiein by mass.
- the mixture of CDP-dioleoyiglycerol and monooiein was prepared the day before it was needed, and involved dissolving CDP- dioleoyiglycerol in chloroform, adding it to molten monooiein in the appropriate amount to generate a 2:98 ratio by mass, vortexing, and then evaporating the chloroform with argon gas first and then overnight in a vacuum desiccator.
- Protein from peak fractions from SEC was concentrated to 35-40 mg/mL (estimated by Ajgonm) for crystallization using a centrifugal concentrator (Millipore) with a 100 kDa MWCO.
- Concentrated protein was mixed with molten lipid in a 1 : 1.5 (w/w) ratio of proteimlipid using coupled syringes.
- a Mosquito LCP (TTP Labtech) robot was used to dispense a typical volume of 50-75 nL of protein/lipid mixture onto a 96-well glass sandwich plate, which was covered with 750 nL precipitant solution and sealed with a glass cover slip. Glass sandwich plates were stored in a 22 °C incubator.
- Crystals appeared after 1-2 days and grew to full size in about 1 week. Crystals grew in (a) 20% (v/v) PEG 400, 0.1 M MES pH 6.7, 0.2 M lithium sulfate (3 ⁇ 4P1PS-A6N) and (b) 30% (v/v) PEG 300, 0.1 M MES pH 6.0, 0.1 M sodium chloride, 0.1 M magnesium chloride (3 ⁇ 4PIPS-FL in 2% CDP-DAG/98% monooiein). A tungsten carbide glass-cutter (Hampton Research) was used to cut and remove the glass cover slip, and crystals were harvested using 20-100 pm MicroLoops and MicroMounts (MiTeGen).
- Crystals were flash- cooled directly in liquid nitrogen without additional cryoprotection.
- R. PIPS- ⁇ 6 ⁇ crystallizes in space group P 2] 2j 2, with unit cell parameters (A) a - 48.63, b— 94.07. c - 103.92, with one protomer in the asymmetric unit, and diffraction to 2.5 A.
- Diffraction data were collected on beamlines 24-lD-C and 24-ID-E at the Advanced Photon Source (Argonne, IL). The data were indexed, integrated, scaled and merged using XDS 28 and AIMLESS 29 .
- the structure of fcPIPS- ⁇ 6 ⁇ was solved by molecular replacement using PHASER' 0 , searching separately for the extramembrane and transmembrane domains of ⁇ /2299 (PDB ID 406M).
- the final dataset includes data collected from four isomorphous crystals. After density modification using PARRO , the model was manually corrected and completed using Coot' 2 , and refined using the PHENIX crystallographic software package'', alternating between cycles of manual building in Coot and refinement in PHENIX.
- the final foPIPS- ⁇ 6 ⁇ model has an R WO rk Rfre e of 0.2284/0.2520.
- the structure of foPIPS-FL was solved by molecular replacement using PHASER, searching separately for four copies each of the extramembrane and transmembrane domains from the structure of /3 ⁇ 4PIPS-A6N.
- Density modification including noncrystallographic averaging, was performed using PARROT, and the model was completed following the same protocol as for the structure of fcPIPS- ⁇ 6 ⁇ , using the structure of J3 ⁇ 4P1PS- ⁇ 6 ⁇ as a reference model for the generation of restraints 4 , in addition to the application of noncrystallographic symmetry based torsion angle restraints and secondary structure restraints, giving a model with a final W ori free of 0.2801/0.2997. All protein structure figures were prepared using UCSF Chimera". In the structure of 3 ⁇ 4PIPS- ⁇ 6 ⁇ , many partially-ordered lipid molecules were readily apparent in the electron density map. As no head groups or identifying features were discernabie in the density, all lipids were modeled as isolated alkyl chains and assigned the residue code UNL, the PDB-recommended code for all unidentified ligands.
- CDP-APs The defining step in glycerophospholipid biosynthesis is catalyzed by CDP-APs. These constitute a large and diverse family of membrane -embedded enzymes characterized by a signature sequence containing eight absolutely conserved amino acids, and 6- 10 predicted TM segments. The stmcture of the CDP-AP RsPIPS reported here exhibits a homodimeric, six-TM architecture similar" to those described for A/2299 and A/DIPP- synthase* 0 '".
- CDP-APs that utilize a soluble acceptor substrate such as inositol or inositol phosphate, irrespective of the nature - hydrophobic or hydrophilic - of the CDP-attached donor (Fig. 3A-C).
- a soluble acceptor substrate such as inositol or inositol phosphate
- Fig. 3A-C the nature of the CDP-attached donor
- CDP-APs that utilize a lipidic acceptor, such as eukaryotic PE and PC synthases typically have three or four additional TM helices at the C-terminus (Fig. 3A-C), which are likely required to accommodate the acyl chains of the bulky hydrophobic acceptor substrate.
- the structure of 3 ⁇ 4PIPS confirms the locations of the acceptor and donor-substituent binding pockets described in the structure of A/2299, and identifies a pair of conserved arginine residues (R153 and R191), as involved in the specific recognition of inositol phosphate.
- Sequence alignment of fcPIPS with human choline/ethanolamine phosphotransferase (CEPTl; Fig. 3D), a CDP-AP that utilizes a lipid acceptor shows that an RxxR motif containing R153 aligns to a motif previously identified in CEPTl as a determinant of acceptor specificity" ' '. Based on these data, we propose that the locations of the acceptor and donor sites are conserved across the entire CDP-AP family, regardless of the identity of the substrates.
- a unique feature of the structure of 3 ⁇ 4P1PS when compared with A/2299 and AfDIPP- synthase is the presence of a hydrophobic crevice between JM1, TM2 and TM5 (Fig. 4A and Fig. II), which in the structure of foPIPS-FL accommodates the lipid substrate (Fig. 5).
- This groove is directly exposed to the bulk lipid, providing a pathway for lateral diffusion of CDP- DAG into the active site.
- the nucleotide is wedged between TM2 and TM3 in a pocket, which is also lined by TM1.
- the CDP interacts with residues from the signature sequence on TM2 and TM3.
- D29 and T32 part of a conserved P(D/ )xx(T/S) motif at the start of TM1, form hydrogen bonds with polar substituents of the pyrimidine ring. Given the absolute conservation of residues lining the nucleotide-binding pocket, we anticipate this mode of binding will be universally conserved.
- Phosphatidylinositol is an essential lipid for mycobacteria, providing the anchor and first building block of major constituents of their cell wall 1 .
- Genetic ablation of PIP-synthase in Mycobacterium smegmatis leads to a loss of ceil viability 13 .
- the structure of 3 ⁇ 4PIPS provides a high-homology model for Ai/PIPS (40% identity; Fig. 6A-B).
- CDP-DAG binding is a prerequisite for inositol phosphate binding (and hence catalysis) implies that A-ftPIPS follows a sequential ordered bi-bi reaction mechanism in which CDP-DAG binds first, followed by inositol phosphate, and the likely formation of a reactive phosphoryl intermediate through the action of an aspartate residue (D 4 in the signature sequence) acting as a catalytic base, in this case D93.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Pulmonology (AREA)
- Biomedical Technology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to screening for compounds that disrupt the Mycobacterium tuberculosis (M. tuberculosis) inositol phosphate binding site and compounds identified as inhibitors of the Mycobacterial inositol phosphate binding site. In certain embodiments, the invention also relates more generally to screening for and identifying inhibitors of PIPS, and in particular to inhibitors of M. tuberculosis PIPS.
Description
STRUCTURE BASED DESIGN OF THERAPEUTICS BASED ON HIGH- RESOLUTION STRUCTURES OF NOVEL PHOSPHA TIDYLINOSITOL- PHOSPHATE SYNTHASE (PIPS) CONSTRUCTS
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims priority to U.S. Provisional Patent Application Serial No. 62/221 ,356 filed September 21 , 2015, which is incorporated herein by reference in its entirety.
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on September 20, 2016, is named 01001 -003791-WO0_ SL.txt and is 29,644 bytes in size.
GRANT INFORMATION
This invention was made with United States Government support under NIH-NIGMS grant U54, GM095315, and R01 GM1 1 1980, awarded by the National Institutes of Health. The Government has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates to screening for compounds that disrupt the Mycobacterium tuberculosis (M. tuberculosis) inositol phosphate binding site and compounds identified as inhibitors of the Mycobacterial inositol phosphate binding site. In certain embodiments, the invention also relates more generally to screening for and identifying inhibitors of phosphatidylinositol-phosphate synthase (PIPS), and in particular to inhibitors of M. tuberculosis PIPS.
BACKGROUND OF THE INVENTION
Antimicrobial resistance is reducing the availability of effective antimicrobial treatments worldwide. Resistant organisms, including bacteria, fungi, viruses, and parasites, are able to withstand attack by antimicrobial medicines, so that standard treatments become ineffective. Infections by such resistant organisms persist increasing the risk of spreading to others. The evolution of resistant strains of organisms is a natural phenomenon that occurs when microorganisms are exposed to antimicrobial drugs, and resistant traits can be
exchanged between certain types of bacteria. The misuse of antimicrobial medicines also accelerates the emergence of resistant organisms.
With the decrease in effective antimicrobial treatments due to the emergence of resistant organisms, new antimicrobial therapeutics are needed. The number of new antimicrobial therapies developed and approved has steadily decreased in the past three decades, leaving even fewer options to treat resistant organisms.
Certain families of bacteria are more prone to exhibiting resistance to treatments because of the extended course of disease, including Mycobacteria. Mycobacterium is a genus of Actinobacteria, given its own family, the Myeobacteriaceae. The genus includes pathogens known to cause serious diseases in mammals, including tuberculosis {Mycobacterium tuberculosis) and the classic Hansen's strain of leprosy {Mycobacterium leprae).
Mycobacteria are gram-positive, aerobic and nonmotile bacteria (except for the species Mycobacterium marinum, which has been shown to be motile within macrophages) that are characteristically acid last rods that do not produce flagella, capsules or spores and do not grow on ordinary microbiological media. They are strict aerobes with nutritionally- exacting growth requirements, typically requiring an enriched medium for culturing. Mycobacteria comprise both slow-growing and fast-growing species. Fast-growing organisms, forming colonies in <7 days, are generally regarded as non-pathogenic. The slow- growing organisms, however, are those of clinical interest, as they are causal agents of some chronic infections, including human tuberculosis (M. tuberculosis), non-human tuberculosis (M. bovis), leprosy (M. leprae) and Johne's Disease {Mycobacterium avium siibsp. paratuberculosis; MAP).
Mycobacteria have an outer membrane. They do not have capsules, and most do not form endospores. The distinguishing characteristic of all Mycobacterium species is that the cell wall is thicker than in many other bacteria, which is hydrophobic, waxy, and rich in mycolic acids/mycolates. The cell wall consists of the hydrophobic mycolate layer and a peptidoglycan layer held together by a polysaccharide, arabinogalactan. The cell wall makes a substantial contribution to the hardiness of this genus. Even though the biosynthetic pathways of cell wall components have been identified as potential targets for new drugs for treating mycobacterial infections, no new drugs have been approved based on these cell wall
targets for treating tuberculosis. Only one new drug has been approved by the FDA for treating tuberculosis in the last 40 years— Bedaquiline.
With the decrease in effective antimicrobial treatments due to the emergence of resistant organisms, new antimicrobial therapeutics are needed. The number of new antimicrobial therapies developed and approved has steadily decreased in the past three decades, leaving even fewer options to treat resistant organisms.
Accordingly, a need exists for new screening methods for identifying anti- mycobacterial treatments and therapeutics having broad spectrum antimicrobial activity. Moreover, a need exists for effectively inhibiting the growth and spread of harmful microorganisms.
SUMMARY OF THE INVENTION
In additional embodiments, the present invention relates to a method for identifying an inhibitor compound of Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS) comprising:
identifying a test compound; contacting the test compound with a membrane preparation comprising /PIPS reconstituted in proteoliposomes and incubating with labeled inositol phosphate, and measuring the incorporation of labeled inositol phosphate into the membrane preparation, wherein a decrease in incorporation of labeled inositol phosphate into the membrane preparation when compared to a control, indicates that the test compound is an M-PIPS inhibitor compound.
In additional embodiments, the present invention relates to a method for identifying an inhibitor compound of CDP-DAG comprising:
a) contacting a test compound with a membrane preparation comprising CDP-DAG reconstituted in proteoliposomes and incubating with labeled inositol phosphate,
b) measuring the incorporation of labeled inositol phosphate into the membrane preparation, wherein a decrease in incorporation of labeled inositol phosphate into the membrane preparation when compared to a control, indicates that the test compound is a CDP-DAG inhibitor compound.
In certain embodiments, the present invention relates to a method for screening for compounds that inhibit the growth of Mycobacteria comprising:
a) contacting a test compound with a membrane preparation comprising fPIPS reconstituted in proteoliposomes and incubating with labeled inositol phosphate,
b) measuring the incorporation of labeled inositol phosphate into the membrane preparation, wherein a decrease in incorporation of labeled inositol phosphate into the membrane preparation when compared to a control, indicates that the test compound is an M- PIPS inhibitor compound.
In certain embodiments, the test compound possesses a structure that indicates the ability of the test compound to bind to the Mycobacterial inositol phosphate binding site.
In additional embodiments, the MrPIPS is selected from the group consisting of wild- type MrPIPS, mutant D93N MrPIPS, or mutant R195Q MrPIPS.
In yet further embodiments, the Mycobacterial PIPS is from Mycobacterium tuberculosis (MrPIPS j, Mycobacterium leprae, or Mycobacterium avium.
As described herein, the methods and kits are suitable for screening of test compounds for the ability to inhibit Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS), M-PIPS, and/or CDP-DAG.
In certain embodiments, the present invention relates to a method for treating a Mycobacterial infection in a patient comprising administering an effective amount of an inhibitor compound identified as described herein. In certain embodiments, the Mycobacterial infection is caused by an organism selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium leprae, and Mycobacterium avium.
In certain embodiments, the present invention relates to a method for inhibiting growth of Mycobacteria in a patient in need thereof, comprising administering an effective amount of an inhibitor compound identified as described herein.
In certain embodiments, the Mycobacteria is selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium leprae, and Mycobacterium avium.
In certain embodiments, the methods further comprise administering at least one additional antibacterial agent.
In certain embodiments, the present invention relates to a kit for screening for inhibitors of Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS) comprising MrPIPS reconstituted in proteoliposomes, inositol phosphate, and a buffer. In certain embodiments, the MrPIPS is selected from the group consisting of wild-type MrPIPS, mutant D93N MrPIPS, or mutant R195Q MrPIPS.
In certain embodiments, the kit comprises three types of reconstituted proteoliposomes: wild-type MrPIPS reconstituted proteoliposomes, mutant D93N M/PIPS reconstituted proteoliposomes, and mutant R195Q MrPIPS reconstituted proteoliposomes.
In certain embodiments, the present invention relates to a kit for screening for compounds that inhibit the growth of Mycobacteria comprising CDP-DAG reconstituted in proteoliposomes, inositol phosphate, and a buffer. In certain embodiments, the butler is Bicine.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-J show the design of A 2299- ?sPIPS fusion constructs. Ribbon representation of A/2299 {Fig. 1A & D), J¾P1PS-A6N (Fig. IB & E), and fcPIPS-FL (Fig. 1C & F). The sequence derived from A 2299 is colored orange, with the exception of residues that were mutated to replicate the TM-extramembrane domain interface observed in the structure of A/2299 (green; two residues, F77 and L75 have side chains depicted in stick representation). ftvPIPS sequence is colored in light blue, and the linker is colored red (dark). The sequences of the RsPIPS-FL (SEQ ID NO: 71) (Fig. 1G) and ¾PIPS-A6N (SEQ ID NO: 72) (Fig. 1H) constructs are indicated or colored as in panels A-F, with the addition that the CDP-AP signature sequence is indicated as bold (or color version is highlighted and underlined in white). In A/2299, the juxtamembrane helix (orange) wraps around the TM domain (gray), forming a hydrophilic pocket that accommodates the polar CDP-glycerol donor, whereas in ¾PIPS-FL (light blue) and ¾PIPS-A6N (dark blue) it separates from the TM domain, forming a hydrophobic groove that shields the acyl chains of the CDP- diacylglycerol donor (Fig. II). Af/PIPSA6N, which possesses a truncated juxtamembrane helix has compromised activity when compared with iPIPS-FL; A-ftPIPS-FL has comparable activity to iPIPS (no fusion), the protein without the fusion and without the interface mutations; fcPIPS-FL has significantly lower activity than the equivalent construct of the Mycobacterium tuberculosis protein (Fig. 1J).
Figures 2A-B show the transmembrane architecture of Renibacterium salmoninarum, a PIP-synthase. (Fig. 2A) PIP-synthases catalyze the transfer of a diacylglyceroi-substituted phosphate group (purple/red) from the CDP-DAG donor to the inositol phosphate acceptor (green), generating phosphatidylinositolphosphate (PIP) and CMP. (Fig. 2B) Structure of the fcPIPS-A6N homodimer in ribbon representation viewed from two orthogonal orientations (in the plane of the membrane on the left; towards the cytosol down the dimer axis on the right). One protomer is colored gray, and the helices of the other are depicted in spectral coloring, from blue/light (JMl) to red/dark shading (TM6).
Figures 3A-D show transmembrane architecture of different groups of integral membrane CDP-APs with varying numbers of transmembrane helices. Some CDP-APs, (Fig. 3A), like PgsA, eukaryotic cardiolipin synthases and eukaryotic Pl-synthases, are expected to possess six transmembrane helices but lack the N-terminal juxtamembrane helices, while the PIP-synthase, AIP-synthase, and bacterial PC/PE synthases (Fig. 3B) are predicted to adopt the same architecture as ¾PIPS, with six transmembrane helices and a single N-terminal juxtamembrane helix. Eukaryotic CDP-APs that process a lipid acceptor, such as the eukaryotic PC/PE synthases (Fig. 3C), are predicted to adopt an architecture consisting of the same core architecture as RsPIPS, with six transmembrane helices (light blue/diagonals) and one juxtamembrane helix (dark blue/cross hatch), with an additional 3 or 4 transmembrane helices (green/stippled). In Figs. 3A-C, the location of the CDP-AP signature sequence between TM2 and TM3 is represented by an asterisk. (Fig. 3D) A sequence alignment of i¾PIPS (SEQ ID NO: 73 ) (generated using PROMALS3D39 followed by manual editing) with human choline/ethanolamine phosphotransferase (HsCEPTl (SEQ ID NO: 74)), with the extra three transmembrane helices, as predicted by TMHMM2.040 highlighted in green (with boxes 7-9), and the borders of the transmembrane helices observed in the /¾PIPS structure delineated in blue (clear boxing).
Figures 4A-B are models showing a large interfacial cavity contains the active site of /faPIPS. (Fig. 4A) The structure of ?.sPIPS-A6N is shown in ribbon representation, with one protomer colored gray, and the other colored by the Kyte-Doolitle hydrophobicity scale36, from -4.5 (most polar, light blue), to 4.5 (most hydrophobic, orange). Two orthogonal representations are shown, on the left is a view in the plane of the membrane, and on the right is a view from the cytosol along the dimer axis. A transparent purple surface (calculated using the 3V server37) delineates the borders of the interfacial cavity, which contains three sub-regions as follows: 1 , the inositol phosphate acceptor binding pocket; 2, the nucleotide binding pocket between TM2 and TM3; and 3, a hydrophobic groove between TM2 and JMl. (Fig. 4B) Detail of the active site viewed in the plane of the membrane, with side chains that contact the bound Mg2+ and SO4 2" ions labeled and depicted in stick representation.
Figures 5A-C are structures showing CDP-DAG binding to i&PIPS-FL. The structure of ¾PIPS-FL. depicted in ribbon representation and colored as in Fig. 1, is shown in three different views (Fig. 5A-C) superimposed on a transparent "Stromboli black" spacefill model (upper panels), with matching magnified insets of boxed regions below
(lower panels). CDP-DAG is depicted in purple, Mg + ions in light green. Side chains that contact CDP-DAG or Mg + are shown in stick representation.
Figures 6A-B show homology of ft PIPS to iPIPS. (Fig. 64) The structure of the transmembrane domain of RsPIPS-FL, shown in spacefill representation, is colored in light gray, with those residues that are identical in Λ/jfPIPS are shaded darker (red). CDP-DAG is shown in stick representation. (Fig. 6B) An alignment of rPIPS (SEQ ID NO: 75) and tf. PIPS (SEQ ID NO: 73) (generated using PROMALS3D39), with identical residues highlighted with boxes.
Figures 7A-H are graphs showing the KM of AfrPIPS (WT, P153V and R195Q) for inositol phosphate and CDP-DAG. Measurement of the activity of PIPS-FL WT (No A/2299 fusion or interface mutations) (Figs. 7A-B), M?PIPS-FL WT (with A/2299 fusion and interface mutations) (Figs. 7C-D), PI 53V (Figs. 7E-F), and R195Q (Fig. 7G-H) in the presence of varying concentrations of either inositol phosphate (Inositol-lP) (Figs. 7A, C, E, and G) or CDP-DAG (Figs. 7B, D, F, and H). The mutations in Figs. 7E-H were carried out on the background of the AffPIPS-FL WT construct with A/2299 fusion and interface mutations.
Figures 8A-E are homology models of MiPlPS (Fig. 8A), and graphs demonstrating functional characterization of selected point mutants. (Fig. 8B-E). In Fig. 8A the A /PIPS shown in ribbon representation with one protomer in gray and the other in light blue, from two views, on the left viewed in the plane of the membrane and on the right from the cytosol, along the dimer axis. The substrates, CDP-DAG (purple) and inositol phosphate (black), are modeled based on the structures of ¾PIPS-FL (in complex with CDP- DAG) and R.vPIPS-ΔόΝ (with bound SO4" ). The homology model was generated using the Phyre2 server"'8, in one-to-one threading mode using the sequence of MiPIPS (Uniprot accession: P9WPG7) as the target and the structure of fe'PIPS-FL (with the A/2299 extramembrane domain excised) as the template. Selected residues which are predicted to participate in either inositol phosphate binding (R155, R195, S132, 135), CDP-DAG binding (P153, M69, D31), neither (L70), or catalysis (D93) are shown with side chains in stick representation and colored as in (Fig. 8B), where the activity of point mutants at these positions for the MrPIPS-FL construct is shown compared to wild-type AfiPIPS-FL. (Fig. 8C) SO4 "" (closed diamonds) and PO4 "" (open circles) inhibit the activity of MiPIPS-FL with half- inhibitory concentrations of 44 mM and 22 mM respectively. (Fig. 8D) KM of MiPIPS-FL WT, R195Q and P153V for inositol phosphate (InsP; white) and CDP-DAG (stippled/gray).
Abbreviations: InsP, L-wyoinositol- 1 -phosphate (inositol phosphate); CDP-DAG, CDP- dioleoylglyeerol. (Fig. 8E) Quantification of bound L-myo-[14C]inositol-l-phosphate after incubation of liposomes containing 9 μ° MiPIPS-FL (WT. D93N, R195Q, or empty liposome control) in the presence and absence of 200 μΜ CDP-DAG with 40 μΜ L-myo- [14C]inositol- 1 -phosphate. Measurement errors were quantified as standard error of the mean (n=3).
DETAILED DESCRIPTION
PIPS is essential for catalyzing the synthesis of phosphatidylinositol, which makes up the membrane of Mycobacteria. Combining genetically engineered PIPS and crystallography studies to generate structural information for the design of new therapeutics against Mycobacteria represents a novel and more specific approach to identify binding sites for Mycobacterial drug targets. The methods and data described herein identify binding sites which may serve as targets for developing therapeutics against Mycobacteria, more broadly for Actinobacteria, and in particular M. tuberculosis.
In certain embodiments, the present invention relates to screening for compounds that disrupt the M. tuberculosis inositol phosphate binding site and compounds identified as inhibitors of the Mycobacterial inositol phosphate binding site. In certain embodiments, the invention also relates more generally to screening for and identifying inhibitors of PIPS, and in particular to inhibitors of M. tuberculosis PIPS. Additionally, in certain embodiments, the present invention relates to methods of treatment or methods of inhibiting bacterial growth using any of the compounds identified as inhibitors of the Mycobacterial inositol phosphate binding site, and/or inhibitors of M. tuberculosis PIPS.
In eukaryotes, phosphatidylinositol-based lipids (phosphoinositides) play important roles in numerous aspects of intracellular signaling and in the anchoring of glycosylphosphatidylinositol (GPI) linked proteins to the membrane. In prokaryotes, phosphatidylinositol (PI) is produced by mycobacteria, as well as some other bacterial genera, where it is required for the biosynthesis of key components of the cell wall. For example, the cell walls of mycobacteria carry complex lipoglycans such as lipomannan and lipoarabinomannan, which are tethered to the membrane via a common PI anchor that constitutes their first building block1. In Mycobacterium tuberculosis, these lipids function as important virulence factors and modulators of the host immune response
Eukaryotic PI synthases process myoinositol and CDP-diacylglycerol (CDP-DAG) to generate phosphatidylinositol directly in a single step3. In prokaryotes. Pl-biosynfhesis occurs in two steps. In the initial step, phosphatidylinositol-phosphate -synthases (PIP-synthases; Fig. 1 A) generate phosphatidylinositol-phosphate (PIP) using L-wyoinositol- l -phosphate (inositol phosphate) as the acceptor alcohol and CDP-DAG as the donor substrate; subsequently, the terminal phosphate is removed by an as-yet-unidentified phosphatase to yield PI . A homologous enzyme (AIP-synthase) has been characterized in archaea, which like the PIP-synthases uses inositol phosphate as the acceptor, but requires CDP-archaeol, an isoprene -based ether-linked lipid, as the donor instead of CDP-DAG5"7. Each of these enzymes is a member of the class I CDP-alcohol phosphotransferases (CDP-APs); class II CDP-APs are peripheral membrane proteins of an unrelated fold, and are not involved in PI biosynthesis (we will use the term CDP-APs as referred to class I family members only). All (class I) CDP-APs are integral membrane enzymes that catalyze the transfer of a substituted phosphate group from a CDP-linked donor, CDP-DAG for PI and PIP biosynthesis, to an acceptor alcohol to generate a phosphodiester-linked product3'8,9.
Structure reports on CDP-APs from Archaeoglobus fulgidus (Af), a protein termed A/2299 and a di-mvo-inositol-phosphate phosphate synthase (A/DIPP-synthase) have offered a first glimpse of the transmembrane (TM) architecture and catalytic machinery of this enzyme family10'* ' . However, neither A/2299 nor A/DIPP-synthase process lipids, leaving unanswered the key question of how membrane-embedded substrates are recruited and processed by CDP-APs, to generate glvcerophospholipids such as PI and PIP. To understand this process at a molecular level, we decided to focus on the PIP-synthases for several reasons. First, they are the closest evolutionary relatives to A/2299 and A/DIPP-synthase12, an advantage for the crystal engineering approach utilized herein and which is described below. Second, PIP- synthases bind CDP-DAG as donor substrate, a feature in common with eukaryotic PI and cardiolipin synthases, as well as all prokaryotic CDP-APs involved in glycerophospholipid biosynthesis. Third, they have possible medical relevance, as genetic ablation of mycobacterial PIP-synthase is lethal' '. This, combined with the unique pathway used for Pl- synthesis in prokaryotes, positions PIP-synthase as an attractive future drug target' 4'''\
The crystal structures of PIP-synthase from Renibacterium salmoninarum (Rs), in the apo form and with bound CDP-DAG to 2.5 and 3.6 A resolution, respectively have been determined and are described herein. These structures show how CDP-DAG binds to the enzyme, and reveal the molecular" determinants of substrate specificity and catalysis.
Functional assays performed on PIP-synthase from Mycobacterium tuberculosis, which is 40%-identical to the ortholog from Renibacterium salmoninarum, and a target for the development of novel anti-tuberculosis drugs, illustrate the proposed mechanism of substrate binding and catalysis. These results provide both a structural and a functional framework to investigate and understand phosphatidylinositol-phosphate biosynthesis, as well as to screen and design inhibitors of the pathway which would be expected to be effective against a broad group of prokaryotic organisms, including the Actinobacteria and Archaebacteria.
General Methods and Definitions
In accordance with the present invention, there may be numerous tools and techniques within the skill of the art, such as those commonly used in molecular immunology, cellular immunology, pharmacology, and microbiology. See, e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Bonifacino et al. eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc. : Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, N.J.; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, N.J.
"Treating" or "treatment" of a state, disorder or condition includes:
(1) preventing or delaying the appearance of clinical symptoms of the state, disorder, or condition developing in a person who may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical symptoms of the state, disorder or condition; or
(2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical symptom, sign, or test, thereof; or
(3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms or signs.
The benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician.
As used herein, "administering" is used in its broadest sense to mean contacting a subject with a composition disclosed herein.
As used herein, the term "antimicrobial activity" means microbicidal or microbiostatic activity or a combination thereof, against one or more microorganisms. Microbicidal activity refers to the ability to kill or cause irreversible damage to a target microorganism. Microbiostatic activity refers to the ability to inhibit the growth or proliferative ability of a target microorganism without necessarily killing or irreversibly damaging it.
As used herein, the term "identity" or "sequence identity" refers to a relationship between two or more polypeptide sequences, as well as two or more polynucleotide sequences, namely a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing the given sequence to the reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by the match between strings of such sequences. Upon such alignment, sequence identity is ascertained on a position-by-position basis. For example, the sequences are "identical" at a particular position if at that position, the nucleotides or amino acid residues are identical. The total number of such position identities is then divided by the total number of nucleotides or residues in the reference sequence to give percent (%) sequence identity. Sequence identity can be readily calculated by known methods, including but not limited to, those described in Computational Molecular Biology, Lesk, A. ., et., Oxford University Press. New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo et a!., Applied Math., 48: 1073 (1988), the teachings of which are incorporated herein by reference.
As used herein, the term "inhibit" means a decrease in any amount including, without limitation, a 5%, 10%, 15%, 20%, 25%, 30%, 35%. 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%.
The term "nucleic acid" is used herein to refer to a polymer of deoxynucleic ribose nucleic acids, as well as ribose nucleic acids. The term includes linear molecules, as well as covalently closed circular molecules. It includes single stranded molecules, as well as double stranded molecules.
As used herein, "subject" refers to a living organism having a central nervous system. In particular, subjects include, but are not limited to, human subjects or patients and companion animals. Exemplary companion animals may include domesticated mammals (e.g., dogs, cats, horses), mammals with significant commercial value (e.g., dairy cows, beef cattle, sporting animals), mammals with significant scientific values (e.g., captive or free specimens of endangered species), or mammals that otherwise have value. Suitable subjects also include: mice, rats, dogs, cats, ungulates such as cattle, swine, sheep, horses, and goats, lagomorphs such as rabbits and hares, other rodents, and primates such as monkeys and apes. In some aspects, subjects may be diagnosed with a microbial infection, may be at risk for a microbial infection, or may be experiencing a microbial infection. Subjects may be of any age including new born, adolescence, adult, middle age, or elderly.
The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to increase to some beneficial degree, preferably to increase by at least about 1 to 100 percent, more preferably by at least about 5 to 95 percent, and more preferably by at least 8 percent or higher, healing or infection improvement as compared to untreated controls. An "effective amount" is a pharmaceutically-effective amount that is intended to qualify the amount of an agent or compound, that when administered to a subject, will achieve the goal of healing an infection site, inhibiting the growth of a microorganism, or otherwise benefiting the recipient environment.
The method of reducing the growth or survival of microorganisms includes contacting a microorganism population with an antimicrobial agent of the present disclosure. The method may include first identifying a microorganism population.
The methods disclosed herein include methods of inhibiting the survival or growth of a microorganism. The term "inhibit" includes a decrease in any detectable amount, for example, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 or more, and can be determined by methods known in the art. Exemplary methods of detecting inhibition includes a determination by count, such as a bacterial culture or viral titer, or by evaluation of one or more symptoms associated with infection by a microorganism. Symptoms associated with
infection by a microorganism are known in the art. Such symptoms are characteristic to a particular infectious microorganism and the resulting condition.
A composition that can support growth or survival of a microorganism may be contacted with an effective amount of the antimicrobial agent in a variety of ways. For example, if the composition is a food item, the antimicrobial agent may be added directly to the food, it may be incorporated into the matrix of the packaging material or it may be coated onto the packaging material, in which case the antimicrobial agent may be released during storage, upon dissolution of the encapsulation material, contact with moisture or at a predetermined temperature. If the composition is a body fluid, the antimicrobial agent may be added directly to the body fluid.
A subject may be contacted with the antimicrobial agent in a variety of ways including, without limitation, administration using routes commonly known in the art. Such routes include oral, parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), rectal, vaginal, dermal, transdermal (topical), transmucosal, intrathoracic, intrapulmonary and intranasal (respiratory) routes. The means of administration may be by injection, using a pump or any other appropriate mechanism.
An antimicrobial agent disclosed herein may be administered to a subject in a single does, in multiple doses, in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled artisans. The administration of the antimicrobial agents may be essentially continuous over a pre-selected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
The dosage to be administered to a subject may be any amount appropriate to reduce or prevent infection or to treat at least one symptom associated with the infection. Some factors that determine appropriate dosages are well known to those skilled in the art and may be addressed with routine experimentation. For example, determination of the physicochemical, toxicological and pharmacokinetic properties may be made using standard chemical and biological assays and through the use of mathematical modeling techniques known in the chemical, pharmacological and toxicological arts. The therapeutic utility and dosing regimen may be extrapolated from the results of such techniques and through the use of appropriate pharmacokinetic and pharmacodynamic models. Other factors will depend on individual patient parameters including age, physical condition, size, weight, the condition
being treated, the severity of the condition, and any concurrent treatment. The dosage will also depend on the agent chosen and whether prevention or treatment is to be achieved, and if the agent is chemically modified.
The precise amount to be administered to a subject will be the responsibility of the attending physician. However, to achieve the desired effects, an antimicrobial agent disclosed herein may be administered as single or divided dosages. For example, of at least about 0.01 mg/kg to about 500 to 750 mg/kg, of at least about 0.01 mg kg to about 300 to 500 mg/kg, at least about 0.1 mg/kg to about 100 to 300 mg/kg or at least about 1 mg/kg to about 50 to 100 mg kg of body weight, although other dosages may provide beneficial results.
The absolute weight of a given antimicrobial agent disclosed herein included in a unit dose may vary widely. For example, about 0.01 to about 2 g, or about 0.1 to about 500 mg, of at least one antimicrobial agent may be administered. Alternatively, the unit dosage may vary from about 0.01 g to about 50 g, from about 0.01 g to about 35 g, from about 0.1 g to about 25 g, from about 0.5 g to about 12 g, from about 0.5 g to about 8 g, from about 0.5 g to about 4 g, or from about 0.5 g to about 2 g.
Daily doses of the antimicrobial agents may vary as well. Such daily doses may range, for example, from about 0.1 g day to about 50 g/day, from about 0.01 g day to about 25 g/day, from about 0.1 g/day to about 12 g/day, from about 0.5 g/day to about 8 g/day, from about 0.5 g/day to about 4 g/day, and from about 0.5 g/day to about 2 g/day.
An antimicrobial agent may be used alone or in combination with a second medicament. The second medicament may be a known antimicrobial agent such as, but not limited to, a .beta. -lactam, macrolide or other antibiotics, e.g. Azithromycin, Doxycycline, Tetracycline, and Erythromycin; an antifungal agent such as clotrimazole, nystatin, fluconazole, ketoconazole, amphotericin B, caspofungin, or voriconazole; an agent effective against a protozoan such as, for example, Metronidazole or timidazole. The second medicament may also be an antiviral agent such as Abacavir, Acyclovir, Amantadine, Didanosine, Emtricitabine, Enfuvirtide, Entecavir, Ganciclovir. Gardasil. Lamivudine, Nevirapine, Nelfinavir, Oseltamivir, Ribavirin, Rimantadine, Ritonavir, Stavudine, Valaciclovir, Vidarabine, Zalcitabine, and Zidovudine. The effective amount of the second medicament will follow the recommendations of the second medicament manufacturer, the judgment of the attending physician and will be guided by protocols and administrative
factors for amounts and dosing as indicated in the PHYSICIAN'S DESK REFERENCE (as commonly known in the art).
The effectiveness of the method of treatment may be assessed by monitoring the subject for signs or symptoms of the microbial infection as discussed above, as well as determining the presence or amount of microorganism present in the subject by methods known in the art.
The term "variant" relates to nucleotide or amino acid sequences which have similar sequences and that function in the same way.
Amino acid designations may include full name, three-letter, or single-letter designations as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
An "immune response" refers to the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Such a response usually consists of the subject producing antibodies, B cells, helper T cells, suppressor T cells, regulatory T cells, and/or cytotoxic T cells directed specifically to an antigen or antigens included in the composition or vaccine of interest.
As used herein, the term "vaccine" refers to a composition comprising a cell or a cellular antigen, and optionally other pharmaceutically acceptable carriers, administered to stimulate an immune response in an animal, most preferably a human, specifically against the antigen and preferably to engender immunological memory that leads to mounting of a protective immune response should the subject encounter that antigen at some future time. Vaccines often include an adjuvant.
A "therapeutically effective amount" means the amount of a compound that, when administered to an animal for treating a state, disorder or condition, is sufficient to effect such treatment. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, physical condition and responsiveness of the animal to be treated.
The compositions of the invention may include a "therapeutically effective amount" or a "prophylactically effective amount" of a compound of the invention. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary,
to achieve the desired therapeutic result. A therapeutically effective amount of a compound may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of a compound to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
While it is possible to use a composition provided by the present invention for therapy as is, it may be preferable to administer it in a pharmaceutical formulation, e.g., in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice. Accordingly, in one aspect, the present invention provides a pharmaceutical composition or formulation comprising at least one active composition, or a pharmaceutically acceptable derivative thereof, in association with a pharmaceutically acceptable excipient, diluent and/or carrier. The excipient, diluent and/or carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
The compositions of the invention can be formulated for administration in any convenient way for use in human or veterinary medicine. The invention therefore includes within its scope pharmaceutical compositions comprising a product of the present invention that is adapted for use in human or veterinary medicine.
In a preferred embodiment, the pharmaceutical composition is conveniently administered as an oral formulation. Oral dosage forms are well known in the art and include tablets, caplets, gelcaps. capsules, and medical foods. Tablets, for example, can be made by well-known compression techniques using wet, dry, or fluidized bed granulation methods.
Such oral formulations may be presented for use in a conventional manner with the aid of one or more suitable excipients, diluents, and carriers. Pharmaceutically acceptable excipients assist or make possible the formation of a dosage form for a bioactive material and include diluents, binding agents, lubricants, glidants, disintegrants, coloring agents, and other ingredients. Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, ascorbic
acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used. An excipient is pharmaceutically acceptable if, in addition to performing its desired function, it is non-toxic, well tolerated upon ingestion, and does not interfere with absorption of bioactive materials.
Acceptable excipients, diluents, and carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins (A. R. Gennaro edit. 2005). The choice of pharmaceutical excipient, diluent, and carrier can be selected with regard to the intended route of administration and standard pharmaceutical practice.
As used herein, the phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are "generally regarded as safe", e.g., that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopeias for use in animals, and more particularly in humans.
"Patient" or "subject" refers to mammals and includes human and veterinary subjects.
The dosage of the therapeutic formulation will vary widely, depending upon the nature of the disease, the patient's medical history, the frequency of administration, the manner of administration, the clearance of the agent from the host, and the like. The initial dose may be larger, followed by smaller maintenance doses. The dose may be administered as infrequently as weekly or biweekly, or fractionated into smaller doses and administered daily, semi-weekly, etc., to maintain an effective dosage level. In some cases, oral administration will require a higher dose than if administered intravenously. In some cases, topical administration will include application several times a day, as needed, for a number of days or weeks in order to provide an effective topical dose.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as
carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant. and a colorant. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
As used herein, the term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specificaliy enhances the immune response (Hood et al., Immunology, Second Ed.. 1984, Benjamin/Cummings: Menlo Park, Calif., p. 384). Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, and potentially useful human adjuvants such as N-aeetyl-muramyl-L-threonyl- D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N- acety{muraniyl-L-aianyl-D-isoglutaminyl-L-alanine-2-( -2'-dipa{mitoy{-sn-glycero-3- hydroxyphosphoryloxy)-ethylamine, and BCG (bacille Calmette-Guerin). Preferably, the adjuvant is pharmaceutically acceptable.
In the case of the present invention, parenteral routes of administration are also possible. Such routes include intravenous, intra-arteriole, intramuscular, intradermal, subcutaneous, intraperitoneal, transmucosal, intranasal, rectal, vaginal, or transdermal routes. If desired, inactivated therapeutic formulations may be injected, e.g., intravascular, intratumor, subcutaneous, intraperitoneal, intramuscular, etc.
Kits
The present invention also provides kits comprising the components of the combinations of the invention in kit form. A kit of the present invention includes one or more components including, but not limited to Λ/jiPlPS reconstituted in proteoliposomes, inositol phosphate, and a buffer as discussed herein.
In one embodiment, a kit includes additional compounds/composition of the invention or a pharmaceutical composition thereof in one container (e.g., in a sterile glass or plastic vial) and a second composition in another container (e.g.. in a sterile glass or plastic vial).
In certain embodiments, kits for screening for inhibitors of Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS) include MrPIPS reconstituted in proteoliposomes, inositol phosphate, and a buffer.
The MrPIPS can be wild-type MrPIPS, mutant D93N /PIPS, or mutant R195Q AftPlPS.
In certain embodiments, all three types of reconstituted proteoliposomes: wild-type MrPIPS reconstituted proteoliposomes. mutant D93N M/PIPS reconstituted proteoliposomes, and mutant R195Q MrPIPS reconstituted proteoliposomes will be supplied in separate containers in the kit.
Kits also include those for screening for compounds that inhibit the growth of Mycobacteria comprising CDP-DAG reconstituted in proteoliposomes, inositol phosphate, and a butler. The buffer can be Bicine. In certain embodiments, control or test membranes can be formulated into a composition suitable and stable for transport and for passaging and utilizing for screening. Kits may include assay directions, buffers, etc.
The kit can include a package insert including information concerning the compositions and storage of the kit. For example, the following information regarding any combination of the embodiments described herein may be supplied in the insert: how supplied, proper storage conditions, references, manufacturer/distributor information and patent information.
The present disclosure provides articles of manufacture and kits containing materials useful for treating the conditions described herein. The article of manufacture may include a container of a composition as described herein with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container may hold a composition having an antimicrobial agent disclosed herein, which is effective for inhibiting the growth of a microorganism or treating a condition caused by a microorganism. The label on the container may indicate that the composition is useful for treating specific conditions and may also indicate directions for administration.
EXAMPLES
Example 1: Crystal engineering and structure determination.
CDP-alcohol phosphotransferases with predicted involvement in phosphatidylinositol- phosphate synthesis were identified from fourteen prokaryotic organisms by homology to a template of known function.
Initial attempts to express and crystallize several mycobacterial PIP-synthases and close bacterial homologs were unsuccessful. It was reasoned that this might be due, at least in part, to the lack of a crystal-contact forming soluble domain. Unlike most other CDP-APs, both Archaeoglob s fulgidus enzymes A/2299 and A/DIPP-synthase have an N-terminal cytosolic cytidylyltransferase-like domain16'1 ', which provided the essential contacts in the crystal lattice between layers of molecules10. It was further reasoned that the A/2299 extramembrane domain might be able to improve the performance in crystallization experiments of other CDP-APs. To test this hypothesis, chimeric constructs were generated by fusing the A/2299 cytosolic domain to the N-terminus of fourteen different PIP-synthases. We also introduced mutations at six positions in all fourteen PIP-synthase sequences to mimic the interface between soluble and TM domains observed in the structure of A/2299 (Fig. 1A-J). Attachment of this domain led to a significant increase in expression levels for all the constructs tested, and proteins from several species of mycobacteria and bacteria yielded crystals by the lipidic cubic phase technique .
We determined the structure of a chimeric construct of PIP-synthase from Renibacterium salmoninanim (RsPIPS) - the causative agent for bacterial kidney disease in salmonids, a major threat to these species worldwide19- in which the first six residues of the fcPIPS sequence were deleted (¾PIPS-A6N; Fig. 1A-J). Crystals of RsPIPS-ΔόΝ diffracted x-rays to 2.5 A resolution, and the structure was solved by molecular replacement using the cytidylyltransferase-like domain of A/2299 as a search model. Subsequently, we determined the structure of a construct containing the complete RsPIPS sequence (absent the initiating methionine; ¾PIPS-FL) in complex with CDP-DAG at 3.6 A resolution, again by molecular replacement, in this instance using ¾PIPS-A6N as search model (Fig. lA-J).
In both structures, the relative disposition of the ¾PIPS and A/2299 domains is very similar to that observed in the structure of A/2299. Of the six mutations introduced at the RsPIPS -A/2299 interface, two appear particularly important in limiting flexibility between the
two domains. L75 and F77, which are both located in the loop between TM2 and TM3, are buried in hydrophobic pockets on the surface of the cytidylyltransferase-like domain, replicating the interactions observed in the crystal structure of A/2299 (Fig. 1A-J).
Example 2: Transmembrane architecture and active site in i¾PIPS-A6N. fcPIPS adopts a homodimeric architecture similar to those previously observed in A/2299 and 4/DlPP-synthase (Fig. 2B), with each protomer possessing six TM helices surrounding a large polar cavity. Sequence alignment with eukaryotic CDP-APs that process a lipidic acceptor substrate, such as choline/ethanol amine phosphotransferase (CEPTl ; Fig. 3A-D) suggests that these eukaryotic enzymes may possess an additional 3-4 TM helices at the C -terminus, perhaps serving as an additional TM module to accommodate the bulkier, hydrophobic acceptor.
In fcPIPS, the central polar cavity is located at the cytosolic boundary of the membrane, and contains three distinct regions, which together form the active site (Fig. 4A). The nucleotide binding site is delineated by TMs 1, 2 and 3, and is characterized by a signature sequence featuring eight absolutely conserved residues (D]X D2GiXxAR...G2 D-;xx D4 , five of which are located on TM2 and three on TM3. The first three of the conserved aspartate side chains coordinate a metal, and D4 likely acts as the catalytic base. The four other signature amino acids either provide structural flexibility or line the binding site that accommodates the pyrimidine ring of the CDP10.
Proximal to the nucleotide-binding site, and within the membrane-spanning region is a pocket wedged between TMs 4, 5 and 6, which probably represents the inositol phosphate acceptor-binding cavity (Fig. 4A-B). Several conserved residues line this cavity, including two arginine residues (R153 and R191) that in the structure of R.vPIPS-A6N coordinate a S04 2" ion present at high concentration in the crystallization solution. R153 and R191 are absolutely conserved amongst all PIP-synthases, but not in eukaryotic PI synthases. From this data, we hypothesize that these residues R153 and R191 coordinate the phosphate of inositol phosphate, a moiety unique to PIP-synthases.
Directly above the nucleotide-binding site, a gap between JM1 and TM2 was observed, creating a hydrophobic groove that is open to the membrane. In contrast, the structures of 4/2299 and A/DIPP-synthase displayed a small, hydrophilic pocket in this region, which in the case of 4/2299 was shown to accommodate the glycerol moiety of the
CDP-glycerol donor. The difference in the nature of the donor substrate, CDP-DAG for R. PIPS and CDP-glycerol for A/2299 is most likely responsible for the differences observed in the architecture of the donor-substituent site in these two enzymes.
Example 3: Structure of JfePIPS in complex with CDP-DAG.
We initially engineered ¾PIPS chimeric constructs with alternative junctions to the N-terminal domain (Fig. 1A-H), and crystals were obtained of two of these. sPIPS-A6N and fcPIPS-FL. The crystals of ¾PIPS-A6N diffracted well in the apo-state (2.5A). but attempts to obtain co-crystal structures with CDP-DAG were unsuccessful. In contrast, although crystals of ¾PIPS-FL only diffracted to lower resolution (3.6A), a structure of the complex with CDP-DAG was obtained readily. The structure of the complex of CDP-DAG bound to fcPIPS-FL revealed strong density for CDP, with the nucleotide ring wedged between TMs 2 and 3, and the diphosphate moiety coordinated by a bound magnesium ion that also interacts with conserved aspartate residues of the CDP-AP signature sequence (Fig. 4B). In all four protomers in the asymmetric unit, density was also observed for the acyl chains of the CDP- DAG, which lie against the TM region in a groove formed by JM1 , TM2 and TM5 (Figs. 5A- C). This groove is entirely absent in the two previous structures of CDP-APs, which have a small, hydrophilic pocket in this location, consistent with their preference for soluble donor moieties such as CDP-glycerol and CDP-inositol (Fig. II).
Example 4: Functional validation of crystallization constructs.
Functional characterization of RiPIPS-FL, performed by measuring incorporation of L-myo-t^CJinositol-l -phosphate into membranes derived from ¾PIPS-FL-expressing E. coli cells, revealed that although this enzyme from Renihacleri m salmoninamm exhibits significant Mg2+-dependent PIP-synthase activity (Fig. 1J), we judged the activity level to be too low to provide the basis for a reliable assay system. By contrast, equivalent constructs of the close PIP-synthase homolog from Mycobacterium tuberculosis ( rPIPS; 40% identity to RsPIPS) showed robust specific activity (Fig. 1 J). We therefore used MrPIPS, which has high homology to i¾PlPS in its active site region (Fig. 6A-B), as an assay system for structure- based functional characterization of PIP-synthases.
Functional characterization of the chimeric A-fflPIPS proteins revealed that the activity of rPIPS-A6N was substantially lower than that of A//PIPS-FL (Fig. 1J). We hypothesize that this diminished activity of M/PIPS-ΔόΝ is due to compromised binding of CDP-DAG, as
JM1 is truncated and distorted in R.vPIPS-A6N, potentially interfering with CDP-DAG binding (Fig. II). This could provide an explanation as to why we were unable to obtain the structure of fcPIPS-ΔόΝ in complex with its cognate lipid substrate. The length of the linker appears to be the primary cause of the reduced activity of the Δ6Ν construct, not the addition of the A/2299 domain, nor the interface mutations. Indeed, the activity of /PIPS-FL is comparable to the activity of M/PIPS constructs lacking the extramembrane domain and interface mutations (Fig. 1J). All proteins tested expressed to comparable levels. Kinetic characterization of the construct lacking the extramembrane domain and interface mutations showed that the KM for inositol phosphate is somewhat lower for the engineered construct (122 μΜ vs 243 μΜ), while the K for CDP-DAG is somewhat higher (238 μΜ vs 60 μΜ; Fig. 7A-H). Importantly, the Vmax for the engineered construct is comparable to that for the unmodified protein (22 nmol PIP/min/mg protein vs 32nmol PIP/mg protein; Fig. 7A-H). These data suggest that our addition of a crystallization chaperone fusion combined with engineering of the interface between the two domains, prerequisites for successful crystallization and structure determination, did not substantially impact the capability of the enzyme to function as compared to the WT protein.
Example 5: Functional characterization of Mf PIP-synthase.
We selected mutants expected to have compromised substrate-binding or catalytic activity based on residue conservation, and based on our structures of RsPIPS. These mutations are displayed on a homology model of M/PIPS (Fig. 8A), the enzyme used in our functional assay. All mutants analyzed were expressed at levels comparable to WT AffPIPS- FL. Mutation to alanine in MtPlPS of the two arginine residues (R.155 and R195) that bind to SO4"" in the ¾PIPS structure (R153 and R191 ) led to severely compromised activity (Fig. 8B), consistent with disruption of the inositol phosphate binding site. Both Ρ04"~ and S04 ~~ inhibit activity at concentrations well below those used for crystallization (Fig. 8C), consistent with competition between binding of SC¼2~ and the phosphate group of inositol phosphate. More subtle substitutions (R/Q) at the same positions (R155 and R195) also resulted in substantial reduction in enzymatic activity (Fig. 8B). Kinetic characterization of inositol phosphate and CDP-DAG-dependent activity of R195Q (Fig. 8D), which retains ~40% of WT activity, demonstrated that the mutation had only a mild effect on the K for CDP-DAG (236 μΜ for WT; 329 μΜ for R195Q), while severely impairing K,w for inositol phosphate (122 μΜ for WT; 1208 μΜ for R195Q). Comparison of WT and R195A proteins
extracted and purified from isolated membranes with a non-ionic detergent, showed that both proteins are membrane inserted and have the same elution profile on size exclusion chromatography, strongly suggesting that this point mutation does not compromise folding. Direct single point measurements of L-myo-[14CJinositol-l-phosphate binding to liposome- ineorporated R195Q, WT and D93N (D4) M/PIPS-FL proteins were carried out to differentiate the direct effects of these mutations on inositol phosphate affinity from other mechanisms by which catalysis could be impaired (Fig. 8E). These assays were carried out in the presence and absence of CDP-DAG. Intriguingly, inositol phosphate binding was strictly CDP-DAG dependent (Fig. 8E).
Determination of the fraction of [1 C]phosphatidylinositol phosphate in the liposomes after the binding assay was carried out to assess the catalytic activity of the proteins under these conditions. The only sample exhibiting any detectable level of catalytic activity was the WT construct in the presence of CDP-DAG, for which nearly all of the radioactive inositol phosphate above the background level was incorporated in the lipophilic PIP and therefore found in the organic phase (77.8 +/- 0.6 pmol / assay). The amount of inositol phosphate bound in total was comparable to wild type for the D93N mutant, consistent with the role of this residue in catalysis, as opposed to substrate recognition. In contrast, R195Q bound a significantly lower amount of substrate, compatible with its putative function in binding of inositol phosphate. Alanine mutagenesis of a conserved serine (S I 32) that also interacts with the fcPIPS-bound SO4' reduced activity as well, albeit to a lesser extent. Lysine K135 is located such that it may interact with the inositol ring, and the K135A mutation also resulted in a partial loss of activity.
Furthermore, mutation in M/PIPS of P153W, a conserved residue on TM5. which stacks against one of the aliphatic chains of CDP-DAG, resulted in nearly complete loss of enzymatic activity, consistent with a loss of CDP-DAG binding due to obstruction of the lipid-binding groove by the larger tryptophan side chain (Fig. 8A and 8B). In agreement with this hypothesis, substitution of P153 with alanine had minimal effects on activity, while substitution with valine resulted in a partial defect in activity. Kinetic characterization of P153V (Fig. 8D) showed VmiLX to be substantially decreased, consistent with an effect of this mutation on the catalytic efficiency of the enzyme. Unexpectedly, the KM for inositol phosphate was increased, whilst the KM for CDP-DAG was decreased for this mutant, possibly suggestive of a more complex role of P153, critically located at the CDP-DAG entrance to the active site, and two residues in sequence away from R 155, one of the two key
inositol phosphate binding residues. Mutation of another residue, L70W, near the groove but oriented away from it, did not affect activity (Fig. 8A and 8B), while substitution of the directly adjacent M69, which contacts CDP-DAG from TM2, by tryptophan resulted in severely impaired activity. Substitution with residues similarly sized or smaller than the native methionine did not compromise activity (Fig. 8A and 8B). Mutation of D31, a conserved residue on TM 1 which forms a hydrogen bond with the primary amine of CDP, to alanine, also severely compromised activity, but did not completely abolish it (Fig. 4a and 4b). This partial effect of the D31 A mutation is likely due to the fact that most of the residues in the CDP-AP signature sequence participate in binding of the nucleotide, and that T34, present in all CDP-APs as S or T as part of a conserved P(D N)xx(T/S) motif, also binds to the primary amine of the pyrimidine ring, and thus may compensate, at least in part, for the absence of the contribution from D31.
Finally, even a conservative D to N mutation at the site of the putative catalytic base, D93 (the fourth aspartate in the signature sequence) resulted in near complete abrogation of CDP-AP activity (Fig. 8A and 8B), without compromising substrate binding (Fig 8E).
Methods
Target identification and cloning.
CDP-alcohol phosphotransferases with predicted involvement in phosphatidylinositol- phosphate synthesis were identified from fourteen prokarvotic organisms by homology to a template of known function. Six mutations were introduced into each one (Fig. 1) to replicate the interface between the cytosolic and TM domains observed in the structure of A/2299, and the corresponding genes were synthesized (GenScript). Genes not bearing the mutations at the interface were PGR amplified from the matching genomes. The Uniprot IDs and species of the sequences identified were as follows: 1 : Q9F7Y9, Mycobacterium smegmalis; 2: G6X547, Mycobacterium abscessus; 3. K0UMF3, Mycobacterium fortuitum subsp. fortuitum; 4. R4N892, Mycobacterium avium subsp. paratuberculosis: 5. D5MTP6, Mycobacterium marinum; 6. Q7D6W6, Mycobacterium tuberculosis: 7. H6MZX4, Gordonia polyisoprenivorans 8. QOSIEO, Rhodococcus sp. (strain RHAl); 9. Q5YTD3, Nocardia farcinica; 10. D9UX52, Streptomyces sp. AA4; 1 1. F5XFI2, Microlunatus phosphovorus; 12. K9B2F1, Brevibacterium casei; 13. A9WSF5, Renibacterium salmoninarum; 14. K1ENZ2, Janibacter hoylei. PCR was used to amplify the bacterial expression vector pMCSG7 encoding A/2299 (with an N-terminai decahistidine tag and a TEV protease cleavage site),
excluding the portion of the gene not encoding the N-terminal soluble domain. Gibson assembly"6 was used to fuse the genes encoding PIP-synthases to the linear fragment of the pMCSG7 -A/2299 vector. All point mutants of /P1PS were generated using the QuikChange site-directed mutagenesis kit (Agilent). Sequences of all primers used for cloning and mutagenesis are provided in Table 1.
TABLE 1
Λ/fPlPS with no fusion or interface mutations ID
NO:
AiiPiPS-FL WT (for amplification Forward TTCCAATCCAATGCCATGAGCAAGCTGCCCTTC 37 from Mr genomic DNA) Reverse TATCCACTTCCAATGTCACCGGTCGCCCTTTCC 38 pMCSG7 vector Forward CATTGGAAGTGGATAACGGATCCG 39
Reverse GGCATTGG ATTGG A AGTAC AGGTT 40
Table 1: Primers used for cloning and mutagenesis. Sequences are provided for primers used in initial cloning of /2299-PIPS (full-length) fusions and in site-directed mutagenesis to generate the additional ¾PIPS and MiPIPS constructs. Regarding the primers used to produce the initial constructs, upper case letters indicate gene-specific sequences and lower case letters indicate sequences incorporated into the PCR product to generate the overlaps necessary for Gibson assembly. All primers are written from 5r to 3".
Membrane isolation and protein expression and purification.
For protein overexpression, plasmids encoding PIP-synthases, generated as described above, were transformed into BL21 (DE3) pLysS E. coli competent cells. Transformed cells were used to inoculate a starter culture (8 mL) of 2xYT medium supplemented with 100 μ^/ηιί ampicillin and 50 μg/mL chloramphenicol. This culture was grown at 37°C overnight while shaking (240 rpm). The next day, the starter culture was used to inoculate 800 mL of 2xYT medium supplemented with 100 μg/mL ampicillin and 50 pg/mL chloramphenicol. Cultures were again grown at 37CC while shaking (240 rpm). Once the ODfioo reached 1.0 (after about three hours), the shaker temperature was reduced to 22 °C, and fifteen minutes later protein expression was induced with a final concentration of 0.2 mM isopropyl β-D-l - thiogalactopyranoside (IPTG). After overnight induction at 22°C, cells were harvested by centrifugation at 4000 x g for 15 minutes at 4°C and stored at -80°C until needed. Cultures for large-scale protein expression were 800 mL in volume, while 15 mL cultures were grown similarly to test protein expression in small-scale.
For large-scale purification of PIP-synthases, frozen cell pellets were resuspended in lysis buffer containing 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 20 mM MgS0 , 10 pg/mL DNase I, 10 pg/mL RNase A, 1 mM TCEP, 1 mM P'MSF, and Complete Mini EDTA- free protease inhibitor cocktail (Roche) used as described in instructions. Cells were lysed with an Emulsiflex C3 homogenizer (Avestin). Lysate was solubilized for 1.5 hours with 1% (w/v) n-dodecyl^-D-maltopyranoside (DDM, Anagrade, Affymetrix) in a volume of approximately 40 mL per cell pellet from 800 mL culture (-6 grams cells). Insoluble material was then pelleted by ultracentrifugation at 134,000 x g for 30 min at 4°C. Protein was purified from the supernatant by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). The soluble fraction was incubated with pre-equilibrated Ni-NTA beads (0.5 mL for 40 mL soluble fraction) for 2 hours. The beads were washed with 10 column volumes of 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 0.1% (w/v) DDM, and 60 mM imidazole pH 7.5. The protein was then eluted from the beads with 5 column volumes of 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 0.05% (w/v) DDM, and 300 mM imidazole pH 7.5. Ni-NTA elutions were dialyzed overnight in a Slide-A-Lyzer dialysis cassette (Thermo Scientific) at 4°C in the presence of TEV protease ( 150 pL at 3 mg mL) to cleave the decahistidine tag. The dialysis buffer consisted of 20 mM HEPES-NaOH pH 7.0, 200 mM NaCl, and 0.05% (w/v) DDM. The next day, the sample was removed from the dialysis cassette and purified again using washed Ni-NTA to remove TEV protease, cleaved decahistidine tags, and any non-cleaved
protein. Flow-through containing purified cleaved protein was subjected to size-exclusion chromatography (SEC) using a Superose 12 column (GE Healthcare) in a buffer of 20 mM HEPES -NaOH pH 7.0, 200 mM NaCl, 0.025% (w/v) DDM, and 1 mM tris(2- carboxyethyl)phosphine hydrochloride (TCEP-HCl). Protein eluted as a sharp monodisperse peak, as could be judged by monitoring A280. Approximately 0.75 mg of purified protein could be obtained from an 800 mL bacterial culture.
Small-scale initial protein expression tests were performed similarly using 100 mg quantities of cells from a 15 mL culture. Lysis was performed using a tip soiiicator (3 x 5 s pulses with 5 s cooling intervals between pulses), and purification proceeded until the first immobilized metal- affinity chromatography step, after which the Ni-NTA elutions were mixed with 6x SDS loading buffer and run on 12% or 14% SDS-PAGE gels to identify expressing PIP-synthase constructs.
For isolation of membranes, frozen cell pellets were resuspended in lysis buffer containing 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 20 mM MgS04, 10 pg/mL DNase I, 10 pg/mL RNase A, 1 mM TCEP, 1 mM PMSF, and Complete Mini EDTA-free protease inhibitor cocktail (Roche) used as described in instructions. Cells were lysed with an Emulsiflex C3 homogenizer (Avestin). The membrane fraction was pelleted by ultracentrifugation at 134,000 x g for 30 min at 4°C. To remove water-soluble proteins, membranes were resuspended by homogenization in a high salt buffer containing 20 mM HEPES-NaOH pH 7.5, 500mM NaCl, 20mM MgS04, 10 pg/mL DNase I, 10 pg/mL RNase A, 1 mM TCEP, 1 mM PMSF, and Complete Mini EDTA-free protease inhibitor cocktail (Roche). The membrane fraction was pelleted once again by ultracentrifugation at 134,000 x g for 30 min at 4°C. Membranes were then resuspended by homogenization in storage buffer containing 20 mM HEPES-NaOH pH 7.5, 200 mM NaCl, 20 mM MgS04, and ImM TCEP. If required, resuspended membranes were solubilized for 1.5 hours with 1 % (w/v) DDM. Protein purification was carried out as described above.
Preparation of liposomes and proteoliposomes.
E. coli polar lipid extract (Avanti) and phosphatdiylcholine (PC, Avanti) were mixed in a 3: 1 ratio (w/w) by dissolving in chloroform. Chloroform was removed under a stream of nitrogen gas to obtain a thin layer of dry lipids. Lipids were resuspended in buffer containing 100 mM HEPES, pH 7.5 and 1.5% (w/v) l-O-n-Octyi-P-D-glucopyranoside (OG, Anagrade, Affymetrix) and the detergent was removed by dialysis against 1 L of 100 mM HEPES, pH
7.5. The resulting liposomes were divided into aliquotes, frozen in liquid nitrogen and stored at -80°C. For protein incorporation into liposomes, the protocol used was adapted from Rigaud. J.L., et al, . The concentration of thawed liposomes was adjusted to 10 mg/mL with lOOmM HEPES, pH 7.5, 0.11% (w/v) Triton X-100 was added to the liposome-containing solution and mixed by vortexing. Protein, purified as previously described, was then added in a ratio of 1 :80 (0.125 mg protein to 10 mg lipid). The mixture was incubated at room temperature with agitation for 15 minutes. 60 mg of pretreated and equilibrated Bio-Beads SM-2 (BioRad) were added to the mixture and incubated at room temperature for 1 hour under constant agitation. An additional 60 mg of Bio-Beads were then added to the mixture and incubated at room temperature for 1 hour under constant agitation. Then, 120 mg of Bio- Beads were added to the mixture and incubated overnight at 4°C with under constant agitation, after which proteoliposomes were separated and removed from the Bio-Beads by careful pipetting. The concentration of proteoliposomes was adjusted by ultracentriiugation (148,000 x g for 30 minutes at 4°C) and resuspension in the correct volume of buffer (100 mM HEPES, pH 7.5). Proteoliposomes were divided into aliquotes, flash frozen in liquid nitrogen and stored at -80°C.
Preparation of cell-free homogenates for functional assays.
Frozen recombinant cells of E. coli expressing PIP-synthase constructs (approx. 2 g), grown as described above, were suspended in 5 mL buffer A (50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM β-mercaptoethanol) and disrupted by sonication (5 x 60 s pulses with 60 s cooling intervals between pulses). Cell debris and unbroken cells were separated by centrifugation ( 10,000 x g, 10 mm, 4°C), and membrane fractions were obtained by centrifugation of the supernatant at 100,000 x g for 2 h at 4°C. The membrane fractions were suspended in 0.5 mL of buffer A and frozen at -20°C until use.
Preparation of L-mj0-[14C]inositol-l-phosphate.
L-mvo-['4C]inositol-l-phosphate was prepared from [1"*C(U)]glucose (Perkin Elmer Life Sciences) using hexokinase of Thermoproteus tenax and L-myo-inositol-l-phosphate synthase (TPS) of Archaeoglobus fulgidus. E. coli cells harboring the hexokinase or the ips genes were grown in LB medium at 37°C supplemented with 100 pg/mL ampicillin to an optical density of 0.5 at 600 nm, and protein expression was induced for 4 hours with 1 mM 1PTG1 '. Partial purification of recombinant hexokinase and TPS was perfonned by heating the cell extracts for 30 min at 90°C and 60°C, respectively, followed by centrifugation to remove
denatured proteins. The production of [ C]glucose-6-phosphate was carried out in a reaction mixture containing the recombinant hexokinase, [14C(U)jglucose (3.7 MBq/336 nmol), 10 mM glucose, 5 mM ATP, 50 mM Tris-HCI (pH 7.6) and 10 mM MgCl2. After 1 h of incubation at 70°C, the reaction mixture was centrifuged (10,000 x g, 10 min, 4°C), and the resulting supernatant was added to a reaction mixture containing the recombinant IPS, 5 mM NAD+ and 50 mM Tris-HCl (pH 7.6). After incubation at 85.5°C for 1 h, and centrifugation (10,000 x g, 10 min, 4°C), the resulting supernatant was treated with activated charcoal to eliminate residual nucleotides, and then filtered through a 10 kDa Omega Nanosep filter (Pall Life Sciences, Hampshire, UK) to remove proteins. The filtrate contained h-myo- [l4C]inositol-l-phosphate, [!4CJglucose-6-phosphate and [1 C]glucose. h-myo- [14CJinositol-l - phosphate present in the preparation was quantified after TLC separation and used as a substrate for assays of PIP-synthase activity.
Measurement of PIP-synthase activity.
The reaction mixtures (final volume, 200 μΐ) contained the membrane fraction (200 μg of total membrane protein as determined by the Bradford method) of E. coli expressing PIPS constructs, 6.5 μΜ L-m>!o[i4C] inositol- 1 -phosphate, 161 μΜ of cold inositol phosphate prepared as described above, 0.4 mM CDP-dioleo lgiycerol (Avanti Polar Lipids), 10 mM MgCb, 10 mM β-mercaptoethanol, 1% (w/v) 3-[(3-cholamidopropyl)dimethylammonio]-l- propanesulfonate (CHAPS) and 50 mM Bicine buffer (pH 8.0). The reaction was started by addition of the membrane fraction. The mixtures were incubated at 37°C during 1 h and reactions were stopped by addition of 1 mL of 0.1 M HC1 in methanol. The mixtures were transferred to glass tubes containing 1.5 mL 0.1 M HC1 in methanol and 2.5 mL CHCL. The partition into aqueous and organic layers was carried out with addition of 2.15 mL MgCl2 (1M, pH 2). The organic layer was removed and washed twice with 0.1 M HC1, methanol/1 M MgCi2 (1:0.8, v/v). The radiolabeled product (in the organic layer) was quantified using a liquid scintillation counter (Beckman LS 6500). To study the effect of PO4 3 and SO4" on PIP-synthase activity, different concentrations of each compound (ranging from 1 to 200 mM, in the form of K2HP04 and K2SC¼) were added to the reaction mixture containing 200 μg of total membrane protein of E. coli expressing MtPIPS-WT, 6.5 μΜ h-myo- [i4C]inositol- 1-phosphate. 161 μΜ M of cold inositol phosphate. 0.4 mM CDP-dioleoylglycerol, 10 mM MgCl2, 10 mM P-mercaptoethanol, 1% (w/v) CHAPS and 50 mM Bicine buffer (pH 8.0). The reaction mixtures were incubated at 37°C for 1 h and the extraction and quantification of
the radiolabeled product was assessed as mentioned above. These functional assays were performed in triplicate.
Assessment of KM of fPIPS for inositol phosphate.
The KM of AffPIPS (WT, R195Q and P153V) was assessed in reaction mixtures (final volume, 200 L) containing 2 mM CDP-dioleoylglyceroi, 10 mM MgCl2, 10 mM β- mercaptoethanol, 1% (w/v) CHAPS, 50 mM Bicine buffer (pH 8.0), 9 μΜ L-myo- [!4C]inositol-l-phosphate plus different concentrations of cold inositol phosphate (final concentrations of 38 μΜ to 1 mM for WT and P153V, and 38 μΜ to 4 mM for R195Q).
The mixtures were pre-incubated for 3 min at 37°C and the reactions initiated by addition of the membrane fraction of E. coli expressing M/PIPS (200 μg of total membrane protein) and stopped at different time points by addition of 1 mL of 0.1 M HQ in methanol. The extraction and quantification of the radiolabeled product was performed as described above. These experiments were performed in duplicate.
Assessment tKM of AfrPIPS for CDP-dioleoylglycerol.
The KM of A//PIPS (WT, R195Q and P153V) for CDP-DAG was performed in reaction mixtures (final volume, 200 ΐ,) containing 1 mM of inositol phosphate (from which 9 μΜ was L-mvo-[,4C]inositoi-l-phospate), 10 mM MgCl2, 10 mM β-mercaptoethanol, 1% (w/v) CHAPS. 50 mM Bicine buffer (pH 8.0), plus different concentrations of CDP- dioleoylglycerol (ranging from 50 to 2000 μΜ). The mixtures were pre-incubated for 3 min at 37 °C and the reactions initiated by addition of the membrane fraction of E. coli expressing /PIPS (200 μg of protein) and stopped at different time points by addition of 1 mL of 0.1 M HC1 in methanol. The extraction and quantification of the radiolabeled product was performed as described above. These experiments were performed in duplicate.
Binding assays with L-myo-[1 C]inositol-l-phosphate.
L-myo-[14C]inositol-l -phosphate -binding assays were carried out in reaction mixtures (final volume, 100 μΙ_) containing fPIPS (WT, D93N or R195Q) reconstituted in proteoliposornes (9 μg of protein), 2 mM MgCl?, 40 uM inositol phosphate (of which 16 μΜ was L-rayo-[14C]inositol-l -phospate) and 50 mM Bicine buffer (pH 8.0). The mixtures were pre-incubated for 3 min at 37°C absent ligand, the reactions initiated by addition of inositol phosphate and stopped after 10 min. The binding assay mixtures were passed over HAWP
02500 filters (Millipore), and unbound L-myo-[ Cjinositol-1 -phosphate was separated from the bound by washing three times with 600 uL of 50 mM Bicine buffer (pH 8.0). Bound L- myo-['4C]inositol-l-phosphate was quantified by liquid scintillation counting. The effect of CDP-DAG on the binding of inositol phosphate to AffPIPS was investigated by pre- inco orating 200 μΜ CDP-DAG in the proteoliposomes used in each reaction mixture. Assays and quantification of bound L-myo- [ ^Cjinositol-l -phosphate were performed as described above. Assays on empty liposomes to calculate background were also performed as described above for proteoliposomes. These binding assays were performed in triplicate.
Crystallization.
Crystals were grown at room temperature (22°C) in lipidic cubic phase, using as host lipid either monooiein alone (NuChek Prep) or a mixture of 2% CDP-dioleoyiglycerol (Avanti Polar Lipids) and 98% monooiein by mass. The mixture of CDP-dioleoyiglycerol and monooiein was prepared the day before it was needed, and involved dissolving CDP- dioleoyiglycerol in chloroform, adding it to molten monooiein in the appropriate amount to generate a 2:98 ratio by mass, vortexing, and then evaporating the chloroform with argon gas first and then overnight in a vacuum desiccator. Protein from peak fractions from SEC was concentrated to 35-40 mg/mL (estimated by Ajgonm) for crystallization using a centrifugal concentrator (Millipore) with a 100 kDa MWCO. Concentrated protein was mixed with molten lipid in a 1 : 1.5 (w/w) ratio of proteimlipid using coupled syringes. A Mosquito LCP (TTP Labtech) robot was used to dispense a typical volume of 50-75 nL of protein/lipid mixture onto a 96-well glass sandwich plate, which was covered with 750 nL precipitant solution and sealed with a glass cover slip. Glass sandwich plates were stored in a 22 °C incubator. Crystals appeared after 1-2 days and grew to full size in about 1 week. Crystals grew in (a) 20% (v/v) PEG 400, 0.1 M MES pH 6.7, 0.2 M lithium sulfate (¾P1PS-A6N) and (b) 30% (v/v) PEG 300, 0.1 M MES pH 6.0, 0.1 M sodium chloride, 0.1 M magnesium chloride (¾PIPS-FL in 2% CDP-DAG/98% monooiein). A tungsten carbide glass-cutter (Hampton Research) was used to cut and remove the glass cover slip, and crystals were harvested using 20-100 pm MicroLoops and MicroMounts (MiTeGen). Crystals were flash- cooled directly in liquid nitrogen without additional cryoprotection. R. PIPS- Δ6Ν crystallizes in space group P 2] 2j 2, with unit cell parameters (A) a - 48.63, b— 94.07. c - 103.92, with one protomer in the asymmetric unit, and diffraction to 2.5 A. fe'PIPS-FL crystallizes in space group P 2U with unit cell parameters (A) a = 89.00, b - 62.49, c - 169.76, Δ = 99.77°, with two dimers in the asymmetric unit, and diffraction to 3.6 A.
Data collection and structure determination.
Diffraction data were collected on beamlines 24-lD-C and 24-ID-E at the Advanced Photon Source (Argonne, IL). The data were indexed, integrated, scaled and merged using XDS28 and AIMLESS29. The structure of fcPIPS- Δ6Ν was solved by molecular replacement using PHASER'0, searching separately for the extramembrane and transmembrane domains of Λ/2299 (PDB ID 406M). The final dataset includes data collected from four isomorphous crystals. After density modification using PARRO , the model was manually corrected and completed using Coot'2, and refined using the PHENIX crystallographic software package'', alternating between cycles of manual building in Coot and refinement in PHENIX. The final foPIPS- Δ6Ν model has an RWOrk Rfree of 0.2284/0.2520. The structure of foPIPS-FL was solved by molecular replacement using PHASER, searching separately for four copies each of the extramembrane and transmembrane domains from the structure of /¾PIPS-A6N. Density modification, including noncrystallographic averaging, was performed using PARROT, and the model was completed following the same protocol as for the structure of fcPIPS- Δ6Ν, using the structure of J¾P1PS- Δ6Ν as a reference model for the generation of restraints 4, in addition to the application of noncrystallographic symmetry based torsion angle restraints and secondary structure restraints, giving a model with a final Wori free of 0.2801/0.2997. All protein structure figures were prepared using UCSF Chimera". In the structure of ¾PIPS- Δ6Ν, many partially-ordered lipid molecules were readily apparent in the electron density map. As no head groups or identifying features were discernabie in the density, all lipids were modeled as isolated alkyl chains and assigned the residue code UNL, the PDB-recommended code for all unidentified ligands.
Space group P2, a = 89.00 a = 48.63
b = 62.49
Unit cell b = 94.069
c = 169.76 c = 103.92
β= 99.77
Total reflections 320975 (21993) 78622 (18367)
Unique reflections 16784 (1453) 21268 (1996)
Multiplicit 19.0(13.6 3.7 (3.8)
Completeness (%) 98.2 (84.5) 98.9 (97.9)
Mean IZsigma(I) 9.9(1.7) 5.0(1.4)
Wilson B-factor 43.74 79.46 p 0.267 (1.654) 0.252 (0.930)
"merge
0.281 (1.775) 0.294 (1.087)
Rmeas
CC(l/2) 0.999 (0.636) 0.991 (0.616)
Resolution where I/sigma(I) 2.59 3.89 drops below 2.0 (overall)
Resolution where IZsigina(I) 2.50 4.09 drops below 2.0 (along h)
Resolution where I/sigmad) 3.25 4.09 drops below 2.0 (along k)
Resolution where IZsigina(I) 2.61 3.62 drops below 2.0 (along I)
Resolution where CC(l/2) 2.50 3.62 drops below 0.5 (overall)
Resolution where CC(l/2) 2.50 3.84 drops below 0.5 (along h)
Resolution where CC(l/2) 3.34 4.05 drops below 0.5 (along k)
Resolution where CC(l/2) 2.59 3.62 drops below 0.5 (along I)
Reflections used in 16891 (1453) 21268 ( 1986) refinement
824 (58) 1043 (1 17)
Reflections used for R-f'ree
0.2284 (0.3326) 0.2801 (0.391 8)
Rwork
0.2520 (0.3627) 0.2997 (0.4246)
Rfree
Number of non-hydrogen 2952 10845 atoms
2586 10350 macromolecules ligands 333 495
338 1358
Protein residues
RMS(bonds) 0.003 0.004
0.72 1 .07
RMS(angles)
Ramachandran favored (% ) 98 97
2
Ramachandran allowed (%) 1.9
Ramachandran outliers (%) 0 0.1
1 .8
Rotamer outliers (%) 1.7
2.87 8.53
Clashscore
Average B-factor 70.55 76.53
70.89 77. 17 macromolecules ligands 69.59 63.13
solvent 53.66
2
Number of TLS groups
Statistics for the highest-resolution shell are shown in parentheses.
*Coordinates and stmcture factors have been deposited in the Protein Data Bank under the accession codes 5D91 ( sPI PS-ΔδΝ) and 5D92 ( sPIPS-FL).
Discussion
The defining step in glycerophospholipid biosynthesis is catalyzed by CDP-APs. These constitute a large and diverse family of membrane -embedded enzymes characterized by a signature sequence containing eight absolutely conserved amino acids, and 6- 10 predicted TM segments. The stmcture of the CDP-AP RsPIPS reported here exhibits a homodimeric, six-TM architecture similar" to those described for A/2299 and A/DIPP- synthase*0'". This architecture appears to be conserved amongst all the CDP-AP family members that utilize a soluble acceptor substrate such as inositol or inositol phosphate, irrespective of the nature - hydrophobic or hydrophilic - of the CDP-attached donor (Fig. 3A-C). These include all characterized prokaryotic CDP-APs, as well as eukaryotic PI synthases. In contrast, CDP-APs that utilize a lipidic acceptor, such as eukaryotic PE and PC synthases, typically have three or four additional TM helices at the C-terminus (Fig. 3A-C), which are likely required to accommodate the acyl chains of the bulky hydrophobic acceptor substrate.
Fusion of foPIPS to a crystallization chaperone derived from the extramembrane domain of A/2299 was instrumental in obtaining diffracting crystals. The employment of crystallization chaperones is a well-established technique for obtaining crystals of otherwise recalcitrant membrane proteins and has enjoyed particularly extensive use in the field of G- protein coupled receptor crystallography"1. We believe that the extramembrane domain of A/ 299 may prove a valuable addition to the complement of membrane protein crystallization chaperones, although further studies are necessary to demonstrate the general-purpose utility of this fusion partner.
The structure of ¾PIPS confirms the locations of the acceptor and donor-substituent binding pockets described in the structure of A/2299, and identifies a pair of conserved arginine residues (R153 and R191), as involved in the specific recognition of inositol phosphate. Sequence alignment of fcPIPS with human choline/ethanolamine
phosphotransferase (CEPTl; Fig. 3D), a CDP-AP that utilizes a lipid acceptor, shows that an RxxR motif containing R153 aligns to a motif previously identified in CEPTl as a determinant of acceptor specificity"''. Based on these data, we propose that the locations of the acceptor and donor sites are conserved across the entire CDP-AP family, regardless of the identity of the substrates.
A unique feature of the structure of ¾P1PS when compared with A/2299 and AfDIPP- synthase is the presence of a hydrophobic crevice between JM1, TM2 and TM5 (Fig. 4A and Fig. II), which in the structure of foPIPS-FL accommodates the lipid substrate (Fig. 5). This groove is directly exposed to the bulk lipid, providing a pathway for lateral diffusion of CDP- DAG into the active site. The nucleotide is wedged between TM2 and TM3 in a pocket, which is also lined by TM1. The CDP interacts with residues from the signature sequence on TM2 and TM3. In addition, D29 and T32, part of a conserved P(D/ )xx(T/S) motif at the start of TM1, form hydrogen bonds with polar substituents of the pyrimidine ring. Given the absolute conservation of residues lining the nucleotide-binding pocket, we anticipate this mode of binding will be universally conserved.
Phosphatidylinositol is an essential lipid for mycobacteria, providing the anchor and first building block of major constituents of their cell wall1. Genetic ablation of PIP-synthase in Mycobacterium smegmatis leads to a loss of ceil viability13. This observation, combined with the unique substrate requirements of MfPIPS, positions this enzyme as a plausible target for the development of novel anti-tuberculosis therapeutics. The structure of ¾PIPS provides a high-homology model for Ai/PIPS (40% identity; Fig. 6A-B). Functional characterization of PIP-synthase on MfPIPS was conducted as described herein, due to its higher intrinsic medical interest and the low specific activity of the native fcPIPS enzyme (Supplementary Fig. lj). The conserved pocket that accommodates the inositol phosphate acceptor provides a potentially attractive site for future structure-based drug design for two reasons. Firstly, inositol phosphate is not recognized by eukaryotie CDP-APs. Secondly, the affinity of /PIPS for inositol phosphate is relatively low (Fig. 8D), making displacement by a putative inhibitor more feasible. Mutation of either of the two conserved arginine residues (R155 and R195) in this pocket resulted in impaired enzymatic activity. Based on this data, we hypothesize that these two residues are responsible for binding of the phosphate of inositol phosphate. Interestingly, although mutation of R195 to a glutamine resulted in severely compromised activity and an increased KM for inositol phosphate, the binding of inositol phosphate to liposome -incorporated R195Q was reduced only to a moderate degree (Fig 8E),
suggesting R195 may play an additional role in the reaction mechanism beyond its contribution to inositol phosphate affinity, potentially in positioning this substrate appropriately for catalysis. Mutation of residues that line the diacylglycerol-binding groove on either TM2 or TM5 to bulky tryptophans also compromised enzymatic activity of /PIPS, presumably by obstructing the groove that accommodates the acyl chains of CDP-DAG. We suggest that similar mutations in an ancestral lipid-processing CDP-AP may have contributed to the evolution of polar-osmolyte generating CDP-APsli, like /DIPP-synthase, providing a plausible explanation for the existence of an integral membrane enzyme that processes exclusively soluble products and substrates.
Finally, measurements of the binding of inositol phosphate to liposomes containing incorporated /PIPS-FL (WT and D93N) in the presence and absence of CDP-DAG showed that binding of inositol phosphate is strictly CDP-DAG dependent, and that the D93N mutation, while it almost completely abrogated activity of the enzyme, does not substantially impact substrate affinity (Fig 8E). The observation that CDP-DAG binding is a prerequisite for inositol phosphate binding (and hence catalysis) implies that A-ftPIPS follows a sequential ordered bi-bi reaction mechanism in which CDP-DAG binds first, followed by inositol phosphate, and the likely formation of a reactive phosphoryl intermediate through the action of an aspartate residue (D4 in the signature sequence) acting as a catalytic base, in this case D93.
Based on the structural data presented herein, it is expected that a number of compounds can be tested for their ability to inhibit CDP-DAG binding in a suitable binding assay as described above, indicating which compound would be able to disrupt or inhibit Mycobacterial PIPS, and thus serve as a useful inhibitor of Mycobacterial or even more broadly, Actinobacterial growth.
References
1. Umesiri, F. E., Sanki, A. K., Boucau, J., Ronning, D. R. & Sucheck, S. J. Recent
advances toward the inhibition of mAG and LAM synthesis in Mycobacterium tuberculosis. Med Res Rev 30, 290-326 (2010).
2. Angala, S. K., Belardinelli, J. M„ Huc-Claustre, E.. Wheat, W. H. & Jackson, M. The cell envelope glycoconjugates of Mycobacterium tuberculosis. Crit. Rev. Biochem. Mol. Biol. 1-39 (2014). doi: 10.3109/10409238.2014.925420
Fischl, A. S. & Carman, G. M. Phosphatidylinositol biosynthesis in Saccharomyces cerevisiae: purification and properties of microsome-associated phosphatidylinositol synthase. J. Bacterial 154, 304-311 (1983). Morii, H., Ogavva, M., Fukuda, K., Taniguchi, H. & Koga, Y. A revised biosynthetic pathway for phosphatidylinositol in Mycobacteria. J. Biochem. 148, 593-602 (2010). Daiyasu, H. el al. A study of archaeal enzymes involved in polar lipid synthesis linking amino acid sequence information, genomic contexts and lipid composition. Archaea 1, 399- 10 (2005). Borges, N. et al. Biosynthetic pathways of inositol and glycerol phosphodiesters used by the hyperthermophile Archaeoglobus fulgidus in stress adaptation. J. Bacterid. 188, 8128-8135 (2006). Morii, H., Kiyonari, S., Ishino, Y. & Koga, Y. A Novel Biosynthetic Pathway of Archaetidyl-myo-inositol via Archaetidyl-myo-inositol Phosphate from CDP-archaeol and D-Glucose 6-Phosphate in Methanoarchaeon Methanothermobacter
thermautotrophicus Ceils. Journal of Biological Chemistry 284, 30766-30774 (2009). Carman, G. M. & Belunis, C. J. Phosphatidylglycerophosphate synthase activity in Saccharomyces cerevisiae. Can. J. Microbiol. 29, 1452-1457 (1983). Bae-Lee, M. S. & Carman, G. M. Phosphatidylserine synthesis in Saccharomyces cerevisiae. Purification and characterization of membrane-associated
phosphatidylserine synthase. J Biol Chein 259, 10857-10862 (1984). Sciara, G. el al. Structural basis for catalysis in a CDP-alcohol phosphotransferase. Nat Comms 5, 4068 (2014). Nogly, P. et al. X-ray structure of a CDP-alcohol phosphatidyltransferase membrane enzyme and insights into its catalytic mechanism. Nat Comms 5, 4169 (2014). Goncalves, L. G. et al. Evolution of the biosynthesis of di-myo-inositol phosphate, a marker of adaptation to hot marine environments. Environmental Microbiology 14, 691-701 (201 1). Jackson, M., Crick, D. C. & Brennan, P. J. Phosphatidylinositol is an essential phospholipid of mycobacteria. J Biol Chem 275, 30092-30099 (2000).
Salman, M., Lonsdale, J. T., Besra, G. S. & Brennan, P. J. Phosphatidyiinositol synthesis in mycobacteria. Biochim. Biophys. Acta 1436, 437-450 (1999). Morii, H. et al. Studies of inositol 1 -phosphate analogues as inhibitors of the phosphatidylinositol phosphate synthase in mycobacteria. J. Biochem. 153, 257-266 (2013). Brito, J. A.. Borges. N., Vonrhein, C. Santos. H. & Archer, M. Crystal structure of Archaeoglobus fulgidus CTP:inositol-l-phosphate cytidylyltransferase, a key enzyme for di-myo-inositol-phosphate synthesis in (hyper)thermophiles. J. Bacteriol. 193, 2177-2185 (201 1 ). Rodrigues, M. V. et al. Bifunctional CTP:inositol-l -phosphate
cytidylyltransferase/CDP-inositol:inositol-l -phosphate transferase, the key enzyme for di-myo-inositol-phosphate synthesis in several (hyper)thermophiles. J. Bacteriol, 189, 5405-5412 (2007). Caffrey, M. Crystallizing membrane proteins for structure determination: use of lipidic mesophases. Annu. Rev. Biophys. 38, 29-51 (2009). Fryer, J. L. & Sanders, J. E. Bacterial kidney disease of saimonid fish. Annu. Rev. Microbiol. 35, 273-298 (1981). Williams, J. G. & McMaster, C. R. Scanning alanine mutagenesis of the CDP-alcohol phosphotransferase motif of Saccharomyces cerevisiae cholinephosphotransferase. / Biol Chan 273, 13482-13487 (1998). Chun, E. et al. Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors. Structure 20, 967-976 (2012). Henneberry, A. L., Wright, M. M. & McMaster, C. R. The major sites of cellular phospholipid synthesis and molecular determinants of Fatty Acid and lipid head group specificity. Molecular Biology of the Cell 13, 3148-3161 (2002). Dutt, A. & Dowhan, W. Purification and characterization of a membrane-associated phosphatidylserine synthase from Bacillus hcheniformis. Biochemistry 24, 1073-1079 (1985).
Hirabayashi, T., Larson, T. J. & Dowhan, W. Membrane-associated
phosphatidylglycerophosphate synthetase from Escherichia coli: purification by substrate affinity chromatography on cytidine 5'-diphospho-l,2-diacyl-sn-glycerol sepharose. Biochemistry 15, 5205-5211 (1976). Aktas, M. el at Enzymatic properties and substrate specificity of a bacterial phosphatidylcholine synthase. FEBS J 281, 3523-3541 (2014). Gibson, D. G. et a Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Melh 6, 343-345 (2009). Rigaud, J. L., Pitard, B. & Levy, D. Reconstitution of membrane proteins into liposomes: application to energy-transducing membrane proteins. Biochim. Biophys. Acta 1231, 223-246 (1995). Kabsch, W. XDS. Acta Crystallogr. D Biol Crystallogr. 66, 125-132 (2010). Evans, P. R. & Murshudov, G. N. research papers. Acta Cryst (2013). D69, 1204-1214 [doi lOA 107/80907444913000061] 1-11 (2013). doi: 10.1107/S0907444913000061 Mccoy, A. J. et at Phaser cr stallographic software. J Appl Crystallogr 40, 658-674 (2007). Cowtan, K. Recent developments in classical density modification. Acta Crystallogr. D Biol. Crystallogr. 66, 470-478 (2010). Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486-501 (2010). Adams, P. D. et a PHENIX: a comprehensive Python-based system for
macromolecular structure solution. Ada Crystallogr. D Biol. Crystallogr. 66, 213-221 (2010). Headd, J. J. et at Use of knowledge-based restraints in phenix.refine to improve macromolecular refinement at low resolution. Acta Cryst (2012). D68, 381-390
[doi: 10.1107/S0907444911047834] 1-10 (2012). doi: 10.1 107/S090744491 1047834 Pettersen, E. F. et at UCSF Chimera— a visualization system for exploratory research and analysis. J Comput Client 25, 1605-1612 (2004). Kyte, J. & Doolittle, R. F. A simple method for displaying the hydropathic character of
a protein. J. Mol. Biol 157, 105-132 (1982).
37. Voss, N. R. & Gerstein, M. 3V: cavity, channel and cleft volume calculator and
extractor. Nucleic Acids Research 38, W555-62 (2010).
38. Kelley, L. A. & Sternberg, M. J. E. Protein structure prediction on the Web: a case study using the Phyre server. Nature Protocols 4, 363-371 (2009).
39. Pei, }., Kim, B.-H. & Grishin, N. V. PROMALS3D: a tool for multiple protein sequence and structure alignments. Nucleic Acids Research 36, 2295-2300 (2008).
40. Krogh, A., Larsson, B Heijne, von, G. & Sonnhammer, E. L. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes./. Mol. Biol. 305, 567-580 (2001).
Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The invention is defined by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. The specific embodiments described herein, including the following examples, are offered by way of example only, and do not by their details limit the scope of the invention.
All references cited herein are incorporated by reference to the same extent as if each individual publication, database entry (e.g. Genbank sequences or GenerD entries), patent application, or patent, was specifically and individually indicated to be incorporated by reference. This statement of incorporation by reference is intended by Applicants, pursuant to 37 C.F.R. § 1.57(b)( 1), to relate to each and every individual publication, database entry (e.g. Genbank sequences or GenelD entries), patent application, or patent, each of which is clearly identified in compliance with 37 C.F.R. § 1.57(b)(2), even if such citation is not immediately adjacent to a dedicated statement of incorporation by reference. The inclusion of dedicated statements of incorporation by reference, if any, within the specification does not in any way weaken this general statement of incorporation by reference. Citation of the references herein is not intended as an admission that the reference is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing
description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.
Claims
1. A method for identifying an inhibitor compound of Mycobacterial phosphatidylinositol-phosphate synthase (M-P1PS) comprising:
identifying a test compound; contacting the test compound with a membrane preparation comprising /PIPS reconstituted in proteoliposomes and incubating with labeled inositol phosphate, and measuring the incorporation of labeled inositol phosphate into the membrane preparation, wherein a decrease in incorporation of labeled inositol phosphate into the membrane preparation when compared to a control, indicates that the test compound is a M-PIPS inhibitor compound.
2. The method of claim 1, wherein the test compound possesses a structure that indicates the ability of the test compound to bind to the Mycobacterial inositol phosphate binding site.
3. The method of claim 1 , wherein the iPIPS is selected from the group consisting of wild-type MiPIPS, mutant D93N MMPS, or mutant R195Q MrPIPS.
4. The method of claim 1 , wherein the Mycobacterial PIPS is from Mycobacterium tuberculosis, Mycobacterium leprae, or Mycobacterium avium.
5. A method lor identifying an inhibitor compound of CDP-DAG comprising:
a) contacting a test compound with a membrane preparation comprising CDP-DAG reconstituted in proteoliposomes and incubating with labeled inositol phosphate,
b) measuring the incorporation of labeled inositol phosphate into the membrane preparation, wherein a decrease in incorporation of labeled inositol phosphate into the membrane preparation when compared to a control, indicates that the test compound is a CDP-DAG inhibitor compound.
6. A method for screening for compounds that inhibit the growth of Mycobacteria comprising:
a) contacting a test compound with a membrane preparation comprising M/PIPS reconstituted in proteoliposomes and incubating with labeled inositol phosphate,
b) measuring the incorporation of labeled inositol phosphate into the membrane preparation, wherein a decrease in incorporation of labeled inositol phosphate into the
membrane preparation when compared to a control, indicates that the test compound is a M- PIPS inhibitor compound.
7. The method of claim 6, wherein the M/P1PS is selected from the group consisting of wild-type fPIPS, mutant D93N MrPIPS, or mutant R195Q rPIPS.
8. A method for inhibiting growth of Mycobacteria in a patient in need thereof, comprising administering an eiiective amount of an inhibitor compound identified by the method of claim 1 , claim 5, or claim 6.
9. The method of claim 8, wherein the Mycobacteria is selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium leprae, and Mycobacterium avium.
10. The method of claim 8, further comprising administering at least one additional antibacterial agent.
1 1. A kit for screening for inhibitors of Mycobacterial phosphatidylinositol-phosphate synthase (M-PIPS) comprising M/PIPS reconstituted in proteoliposomes, inositol phosphate, and a buffer.
12. The kit of claim 1 1, wherein the buffer is Bicine.
13. The kit of claim 11. wherein the M/PIPS is selected from the group consisting of wild- type MrPIPS, mutant D93N iPIPS, or mutant R195Q iPIPS.
14. The kit of claim 1 1 , comprising three types of reconstituted proteoliposomes: wild- type MrPIPS reconstituted proteoliposomes, mutant D93N MrPIPS reconstituted proteoliposomes, and mutant R195Q M/PIPS reconstituted proteoliposomes.
15. A kit for screening for compounds that inhibit the growth of Mycobacteria comprising CDP-DAG reconstituted in proteoliposomes, inositol phosphate, and a buffer.
16. The kit of claim 15, wherein the buffer is Bicine.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562221356P | 2015-09-21 | 2015-09-21 | |
| US62/221,356 | 2015-09-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017053458A1 true WO2017053458A1 (en) | 2017-03-30 |
Family
ID=58387199
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/052925 Ceased WO2017053458A1 (en) | 2015-09-21 | 2016-09-21 | Structure based design of therapeutics based on high-resolution structures of novel phosphatidylinositol-phosphate synthase (pips) constructs |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017053458A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116910454A (en) * | 2023-08-11 | 2023-10-20 | 博博科技(嘉兴)有限公司 | BCG signal sign state monitoring method based on Markov chain model |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002022138A1 (en) * | 2000-09-15 | 2002-03-21 | Cubist Pharmaceuticals, Inc. | Antibacterial agents and methods of identification |
| US20100130382A1 (en) * | 2008-11-26 | 2010-05-27 | Nippon Telegraph And Telephone Corporation | Liposome, Proteoliposome, Biochip, and Method for Producing Liposome and Proteoliposome |
-
2016
- 2016-09-21 WO PCT/US2016/052925 patent/WO2017053458A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002022138A1 (en) * | 2000-09-15 | 2002-03-21 | Cubist Pharmaceuticals, Inc. | Antibacterial agents and methods of identification |
| US20100130382A1 (en) * | 2008-11-26 | 2010-05-27 | Nippon Telegraph And Telephone Corporation | Liposome, Proteoliposome, Biochip, and Method for Producing Liposome and Proteoliposome |
Non-Patent Citations (4)
| Title |
|---|
| *SCIARA ET AL.: "Structural basis for catalysis in a CDP-alcohol phosphotransferase", NAT COMMUN, vol. 5, no. 4068, 13 June 2014 (2014-06-13), pages 1 - 10, XP055370610 * |
| CLARKE ET AL.: "Structural basis for phosphatidylinositol-phosphate biosynthesis", NAT COMMUN, vol. 6, no. 8505, 16 October 2015 (2015-10-16), pages 1 - 11, XP055370612 * |
| MORII ET AL.: "A revised biosynthetic pathway for phosphatidylinositol in Mycobacteria", J BIOCHEM, vol. 148, 26 August 2010 (2010-08-26), pages 593 - 602, XP055370609 * |
| MORII ET AL.: "Studies of inositol 1-phosphate analogues as inhibitors of the phosphatidylinositol phosphate synthase in mycobacteria", J BIOCHEM., vol. 153, no. 3, 5 December 2012 (2012-12-05), pages 257 - 266, XP055370602 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116910454A (en) * | 2023-08-11 | 2023-10-20 | 博博科技(嘉兴)有限公司 | BCG signal sign state monitoring method based on Markov chain model |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Clarke et al. | Structural basis for phosphatidylinositol-phosphate biosynthesis | |
| Pearce et al. | Identification of substrates of the Mycobacterium tuberculosis proteasome | |
| Banerjee et al. | FlaF is a β-sandwich protein that anchors the archaellum in the archaeal cell envelope by binding the S-layer protein | |
| Tran et al. | Periplasmic cleavage and modification of the 1-phosphate group of Helicobacter pylori lipid A | |
| Steinfels et al. | Characterization of YvcC (BmrA), a multidrug ABC transporter constitutively expressed in Bacillus subtilis | |
| Ahn et al. | A hydrocarbon ruler measures palmitate in the enzymatic acylation of endotoxin | |
| Movahedzadeh et al. | The Mycobacterium tuberculosis ino1 gene is essential for growth and virulence | |
| Barreteau et al. | Functional and structural characterization of PaeM, a colicin M-like bacteriocin produced by Pseudomonas aeruginosa | |
| Bartling et al. | Crystal structure and acyl chain selectivity of Escherichia coli LpxD, the N-acyltransferase of lipid A biosynthesis | |
| Fage et al. | Crystallographic study of the phosphoethanolamine transferase EptC required for polymyxin resistance and motility in Campylobacter jejuni | |
| Kattke et al. | Structure and mechanism of TagA, a novel membrane-associated glycosyltransferase that produces wall teichoic acids in pathogenic bacteria | |
| Hu et al. | Structure of the type VI secretion phospholipase effector Tle1 provides insight into its hydrolysis and membrane targeting | |
| Wang et al. | Structure of the DNA-binding domain of the response regulator PhoP from Mycobacterium tuberculosis | |
| Basavannacharya et al. | ATP-dependent MurE ligase in Mycobacterium tuberculosis: biochemical and structural characterisation | |
| Zhang et al. | Core component EccB1 of the Mycobacterium tuberculosis type VII secretion system is a periplasmic ATPase | |
| Peterhoff et al. | A comprehensive analysis of the geranylgeranylglyceryl phosphate synthase enzyme family identifies novel members and reveals mechanisms of substrate specificity and quaternary structure organization | |
| Gulati et al. | Differential recognition of Vibrio parahaemolyticus OmpU by Toll-like receptors in monocytes and macrophages for the induction of proinflammatory responses | |
| Ghachi et al. | Crystal structure and biochemical characterization of the transmembrane PAP2 type phosphatidylglycerol phosphate phosphatase from Bacillus subtilis | |
| Nadler et al. | Cycling of Etk and Etp phosphorylation states is involved in formation of group 4 capsule by Escherichia coli | |
| Wierzbicki et al. | Functional and structural studies on the Neisseria gonorrhoeae GmhA, the first enzyme in the glycero‐manno‐heptose biosynthesis pathways, demonstrate a critical role in lipooligosaccharide synthesis and gonococcal viability | |
| Cavazos et al. | Structure of the sensor domain of Mycobacterium tuberculosis PknH receptor kinase reveals a conserved binding cleft | |
| Olatunji et al. | Structural basis of the membrane intramolecular transacylase reaction responsible for lyso-form lipoprotein synthesis | |
| WO2017053458A1 (en) | Structure based design of therapeutics based on high-resolution structures of novel phosphatidylinositol-phosphate synthase (pips) constructs | |
| Bhattacharyya et al. | Crystal structure of Staphylococcal dual specific inositol monophosphatase/NADP (H) phosphatase (SAS2203) delineates the molecular basis of substrate specificity | |
| Goins et al. | Structural basis for lipid binding and mechanism of the Mycobacterium tuberculosis Rv3802 phospholipase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16849526 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16849526 Country of ref document: EP Kind code of ref document: A1 |



