WO2017051930A1 - Method of producing isoprenoid compound - Google Patents

Method of producing isoprenoid compound Download PDF

Info

Publication number
WO2017051930A1
WO2017051930A1 PCT/JP2016/079196 JP2016079196W WO2017051930A1 WO 2017051930 A1 WO2017051930 A1 WO 2017051930A1 JP 2016079196 W JP2016079196 W JP 2016079196W WO 2017051930 A1 WO2017051930 A1 WO 2017051930A1
Authority
WO
WIPO (PCT)
Prior art keywords
isoprenoid compound
synthase
seq
amino acid
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2016/079196
Other languages
French (fr)
Inventor
Yasushi Hoshino
Yoshinori Tajima
Hiroaki Rachi
Fumi OGATA
Joanna Yosifovna Katashkina
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ajinomoto Co Inc
Original Assignee
Ajinomoto Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from RU2015151182A external-priority patent/RU2015151182A/en
Application filed by Ajinomoto Co Inc filed Critical Ajinomoto Co Inc
Publication of WO2017051930A1 publication Critical patent/WO2017051930A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y205/00Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10Nitrogen as only ring hetero atom
    • C12P17/12Nitrogen as only ring hetero atom containing a six-membered hetero ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/007Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/99Oxidoreductases acting on the CH-OH group of donors (1.1) with other acceptors (1.1.99)
    • C12Y101/9901Glucose dehydrogenase (acceptor) (1.1.99.10)

Definitions

  • the present invention relates to a method for
  • Natural rubber is a very important raw material in the industries for production of tire and rubber. While its demand will be expanded in future due to motorization mainly in emerging countries, it is not easy to increase agricultural farms in view of regulation for deforestation and competition with palm plantations. Thus, it is
  • Synthesized polyisoprene is available as a material in place of the natural rubber. Its raw material is an isoprene monomer (commonly and hereinafter referred to as "isoprene”) .
  • Isoprenoid compounds such as the isoprene (2-methyl-l, 3- butadiene) are mainly obtained by extracting from a C5 fraction obtained by cracking of naphtha.
  • an amount of produced isoprene tends to decrease and its supply is concerned.
  • Isoprenoid compounds such as isoprene can be any substance.
  • microorganisms biologically synthesized in microorganisms by utilizing dimethylallyl diphosphate (D APP) as a material.
  • D APP dimethylallyl diphosphate
  • the microorganisms may inherently possess a methylerythritol (MEP) pathway or a mevalonate (MVA) pathway as a DMAPP supplying pathway.
  • MEP methylerythritol
  • MVA mevalonate
  • these pathways can be introduced into the microorganisms by transforming the microorganisms with an expression vector or expression vectors for enzymes involved in these pathways.
  • Non-patent Literature 1 glucose is oxidized by a glucose dehydrogenase to form gluconate, and then the gluconate is oxidized by a glucose dehydrogenase to form gluconate.
  • Patent Literature 1 pyrroloquinoline quinone as a coenzyme is decreased are useful for producing L-amino acid.
  • Patent Literature 1 International Publication NON-PATENT LITERATURES
  • Non-Patent Literature 1 Irina G. Andreeva, Lyubov I. Golubeva, Tatiana M. Kuvaeva, Evgueni R. Gak, Joanna I. Katashkina and Sergey V. Mashko, FEMS Microbiology Letters 318(1), 55-60, 2011
  • the object of the present invention is to provide a method of efficiently producing an isoprenoid compound.
  • the present inventors have found that production of an isoprenoid compound can be promoted by blocking the 2-ketogluconate formation pathway, and the like. More specifically, the present inventors have found that the isoprenoid compound can be efficiently produced by culturing an isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate (DMAPP) or isopentenyl diphosphate (IPP) supplying pathway and a blocked 2-ketogluconate formation pathway in a culture medium, and the like, and have completed the present invention.
  • DMAPP dimethylallyl diphosphate
  • IPP isopentenyl diphosphate
  • the present invention is as follows.
  • dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway is a methylerythritol phosphate pathway.
  • dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway is a mevalonate pathway.
  • the isoprenoid compound-producing microorganism is a microorganism that is capable of synthesizing pyrroloquinoline quinone or using pyrroloquinoline quinone included in culture environment.
  • the isoprenoid compound-producing microorganism includes a heterogeneous expression unit comprising a polynucleotide encoding an isoprenoid compound-synthetic enzyme and a promoter
  • the isoprenoid compound-synthetic enzyme is an isoprene synthase, a geranyl diphosphate synthase, a farnesyl diphosphate synthase, a linalool synthase, or a limonene synthase.
  • microorganism belonging to the family Enterobacteriaceae is a bacterium belonging to the genus Pantoea.
  • An isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway and a blocked 2-ketogluconate formation pathway.
  • a method of producing a polyisoprene comprising:
  • polyisoprene is a cis-polyisoprene .
  • a rubber composition comprising the polymer as
  • FIG. 1 indicates a pAH162-Para-mvaES plasmid
  • FIG. 2 indicates a map of pAH162-mvaES
  • FIG. 3 indicates a plasmid for chromosome fixation of pAH162-MCS-mvaES.
  • FIG. 4 indicates a set of plasmids for chromosome fixation which possess an mvaES gene under transcription control of (A) Pii dD , (B) P pho c, or (C) P pst s;
  • FIG. 5 indicates an outline for construction of a pAH162-XattL-KmR-XattR vector
  • FIG. 6 indicates a pAH162-Ptac expression vector for chromosome fixation
  • FIG. 7 indicates codon optimization in a KDyl operon obtained by chemical synthesis
  • FIG. 8 indicates plasmids (A) pAH162-Tc-Ptac-KDyI and (B) pAH162-Km-Ptac-KDyI for chromosome fixation, which retain the KDyl operon with codon optimization;
  • FIG. 9 indicates a plasmid for chromosome fixation, which retains a mevalonate kinase gene derived from M.
  • FIG. 10 indicates maps of genome modifications of (A)
  • AampC : attBphi80/ (B) AampH : : attB ph i8o ⁇ and (C) Acrt : : attB ph i8o;
  • FIG. 11 indicates maps of genome modifications of (A) Acrt : :pAHl62-Ptac-mvk (X) and (B) Acrt : : Ptac-mvk (X) ;
  • FIG. 12 indicates maps of chromosome modifications of (A) AampH: :pAHl62-Km-Ptac-KDyI, (B) AampC : : pAH162-Km-Ptac- KDyl and (C) AampC : : Ptac-KDyl ;
  • FIG. 13 indicates maps of chromosome modifications of (A) AampH: : pAH162-Px-mvaES and (B) AampC: :pAH162-Px-mvaES;
  • FIG . 14 indicates (A) growth and (B) amounts of formed isoprene (mg/batch) in cultures of a phosphorus deficient type isoprenoid compound-producing microorganism in which glucose dehydrogenase gene (gcd gene) is disrupted (SWITCH- PphoC Agcd/ispSM) ; and
  • FIG. 15 indicates changes in accumulated gluconate in culture broth over time in a phosphorus deficient type isoprenoid compound-producing microorganism in which gcd gene is disrupted (SWITCH-PphoC Agcd/ispSM) .
  • the present invention provides a method of producing an isoprenoid compound, and an isoprenoid compound- producing microorganism modified to produce the isoprenoid compound in the method.
  • the isoprenoid compound includes one or more isoprene units which have the molecular formula (C 5 H 8 ) n .
  • precursor of the isoprene unit may be isopentenyl
  • pyrophosphate or dimethylallyl pyrophosphate. More than 30,000 kinds of isoprenoid compounds have been identified and new compounds have been identified. Isoprenoids are also known as terpenoids. The difference between terpenes and terpenoids is that terpenes are hydrocarbons, whereas terpenoids may contain additional functional groups.
  • terpenoid and “terpenoid compound” are used interchangeably. They refer to compounds that are capable of being derived from isopentenyl diphosphate or
  • Terpenes are classified by the number of isoprene units in the molecule: hemiterpenes (C5), monoterpenes (CIO), sesquiterpenes (C15), diterpenes (C20), sesterterpenes (C25) , triterpenes (C30), sesquarterpenes (C35) , tetraterpenes (C40), polyterpenes , norisoprenoids, for example.
  • monoterpenes include pinene, nerol, citral, camphor, menthol, limonene, carvone and linalool.
  • sesquiterpenes include nerolidol, valencene, nootkatone and farnesol.
  • diterpenes include phytol and vitamin Al .
  • Squalene is an example of a triterpene
  • carotene is a tetraterpene (Nature Chemical Biology 2, 674 - 681 (2006), Nature
  • the isoprenoid compound is an isoprene (monomer), a linalool (in the (R)- form known as licareol ( ( 3R) -3 , 7-dimethylocta-l , 6-dien-3- ol) and the (S)-form known as coriandrol ((3S)-3,7- dimethylocta-1, 6-dien-3-ol) , and a limonene ((4R)-(+)- limonene and (4S) -(-) -limonene) .
  • the method of the present invention comprises
  • the isoprenoid compound-producing microorganism has a dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway.
  • Dimethylallyl diphosphate (DMAPP) has been known to be a substrate of isoprene synthesis and a precursor of peptide glycan and an electron acceptor, such as menaquinone and the like, and to be essential for growth of microorganisms (Fujisaki et al . , J. Biochem., 1986; 99: 1137-1146) .
  • Examples of the dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway include a
  • MEP methylerythritol phosphate
  • MVA mevalonate
  • isoprenoid compound e.g., DMAPP is a substrate of isoprene synthesis
  • DMAPP is a substrate of isoprene synthesis
  • methylerythritol phosphate pathway and/or the mevalonate pathway may be enhanced in the isoprenoid compound- producing microorganism used in the present invention, as described later.
  • the isoprenoid compound-producing microorganism has a blocked 2-ketogluconate formation pathway.
  • glucose is oxidized by a glucose dehydrogenase (GCD) to form gluconate
  • GCD glucose dehydrogenase
  • isoprenoid compound-producing microorganism having a blocked 2-ketogluconate formation pathway can be obtained by reducing activity of one or more enzymes selected from the group consisting of the glucose dehydrogenase and gluconate 2-keto-dehydrogenase in an isoprenoid compound- producing microorganism.
  • the 2-ketogluconate formation pathway is blocked in the isoprenoid compound- producing microorganism by reducing enzymatic activity. That is, the isoprenoid compound-producing microorganism has the reduced enzymatic activity of one or more enzymes selected from the group consisting of the glucose
  • Examples of the reduced enzymatic activity in a microorganism include decrease and complete loss of an activity of an enzyme. Also, examples of the reduced enzymatic activity in a microorganism includes decrease and complete loss of an expression amount of an enzyme in a microorganism since such decrease or complete loss leads to decrease or complete loss of an enzymatic activity
  • the reduced enzymatic activity in a microorganism can be accomplished by, for example, disrupting a gene encoding the enzyme; a gene encoding a factor capable of regulating an expression or activity of the enzyme; an expression regulatory region such as a transcriptional regulatory region located
  • a translational regulatory region e.g.; promoter and Shine-Dalgarno (SD) sequence
  • an untranslated region e.g., promoter and Shine-Dalgarno (SD) sequence
  • the disruption of the above gene or region can be performed by modifying a genomic region corresponding to the gene or region so as to
  • Such a modification include, but are not limited to, deletion of a part or all of the genomic region, insertion of a polynucleotide into the genomic region, and replacement of the genomic region with another polynucleotide.
  • the isoprenoid compound-producing microorganism is preferably a microorganism that is capable of synthesizing pyrroloquinoline quinone (PQQ) or using PQQ included in culture environment.
  • PQQ pyrroloquinoline quinone
  • the isoprenoid compound-producing microorganism is preferably a microorganism having reduced activity of glucose dehydrogenase, and more preferably a microorganism having reduced activity of glucose dehydrogenase that uses PQQ as a coenzyme.
  • the isoprenoid compound-producing microorganism is a microorganism obtained by transforming a host
  • the microorganism is preferably modified to block the 2- ketogluconate formation pathway.
  • microorganism belonging to the family For example, microorganism belonging to the family
  • Enterobacteriaceae such as Escherichia coli has a gene encoding glucose dehydrogenase and produces GCD apoenzyme, but since the microorganism does not have production ability of PQQ, it does not have GCD activity in the absence of PQQ. However, it is known that if a foreign gene is expressed in a microbial cell, an alternative substance of PQQ is generated and the substance exhibits GCD activity (WO2006/183898 ) .
  • the above host microorganism "originally having GCD activity" includes microorganisms such as the microorganism belonging to the family
  • the formation pathway is preferably a modification to reduce the activity of the glucose dehydrogenase, and more
  • a modification to reduce the activity of the glucose dehydrogenase that uses PQQ as coenzyme can be performed so that GCD activity per cell of the modified microorganism is lower than that of an unmodified strain such as a wild type strain belonging to the family Enterobacteriaceae. For example, it may be confirmed that a molecular weight of GCD per cell or GCD activity per molecule of the modified strain is lower than those of the wild strain.
  • the GCD activity per cell of the modified strain and the wild strain can be compared, for example, by comparing GCD activity contained in cell extract composition of both strains cultured under the same condition. Examples of the wild type of the microorganism belonging to the family Enterobacteriaceae that can be used as comparison (control) may include Pantoea ananatis
  • the activity of the glucose dehydrogenase that uses PQQ as a coenzyme refers to an activity catalyzing the following reaction (the same meaning shall apply
  • the GCD activity can be measured, for example, on the basis of detection of generation of the reduced DCPIP through the following reactions by measuring absorbance in 600 nm ( JP2007-129965; the same meaning shall apply
  • the activity of the glucose dehydrogenase can be reduced by disrupting a gene encoding a glucose
  • gcd gene dehydrogenase
  • the gcd gene is preferably the one or more
  • polynucleotide selected from the group consisting of the following [x]-[z]:
  • the nucleotide sequence represented by SEQ ID NO: 59 includes a full length nucleotide sequence of the gcd gene from Pantoea ananatis .
  • the nucleotide sequence represented by SEQ ID NO: 59 can encode the amino acid sequence
  • nucleotide sequence represented by SEQ ID NO: 60, and the nucleotide sequence consisting of the nucleotide residues at positions 301 to 2691 (2688) can encode an amino acid sequence of GCD.
  • polynucleotide are the same as the corresponding polynucleotide
  • GCD is preferably one or more protein selected from the group consisting of the following [X]-[Z]:
  • [Y] a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 60, and has a GCD activity;
  • [Z] a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence represented by SEQ ID NO: 60, and has a GCD activity.
  • the amino acid sequence represented by SEQ ID NO: 60 can comprise the mature GCD.
  • the protein of [Y] or [Z] preferably has GCD activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the GCD activity of the protein comprising the above amino acid sequence when measured under the same condition.
  • the deletion, substitution, addition or insertion, and the identity of the amino acid are the same as the
  • the gcd gene can be cloned by synthesizing an
  • oligonucleotide based on these sequences, and carrying out PCR reaction using a chromosome of Pantoea ananatis as a template.
  • the gcd gene may be disrupted by homologous recombination.
  • a gene having for example 80% or more, preferably 90% or more, and more preferably 95% or more identity to the gcd gene on a chromosome may be used.
  • a gene that hybridizes under a stringent condition with the gcd gene on the chromosome may be used.
  • Example of the stringent condition may include washing once, preferably 2-3 times, at salt concentrations corresponding to lxSCC and 0.1% SDS, preferably 0. lxSCC and 0.1% SDS, at 60°C.
  • the gcd gene may be disrupted, for example, by
  • the disruption of each gene is preferably performed by genetic recombination.
  • Examples of the method using gene recombination may include deleting all or part of an expression regulatory region (e.g.; promoter region, coding region or non-coding region) or insertion a polynucleotide into the region by utilizing homologous recombination.
  • Disruption of the expression regulatory region can be performed preferably for one or more, more preferably two or more, further preferably three or more.
  • the region to be deleted may be an N- terminal region, an internal region or a C-terminal region, or even the entire coding region, so long as the function of the protein to be produced by the gene is reduced.
  • Reading frames at upstream and downstream of the region to be deleted are not the same.
  • the polynucleotide When a polynucleotide is inserted into a coding region, the polynucleotide may be inserted into any region of a target gene. However, insertion of a longer polynucleotide can more certainly disrupt the target gene. It is
  • Reading frames at upstream and downstream of the region to be deleted are not the same.
  • polynucleotide is not limited so long as the polynucleotide which reduces a function of the protein encoded by the target gene.
  • examples of it may include a
  • transposon carrying an antibiotic-resistant gene or a gene useful for L-amino acid production.
  • Examples of method of mutating the target gene on the chromosome may include the following method. First, a part of the target gene is deleted to produce a mutated gene that cannot produce a protein that can normally function. Next, a microorganism is transformed by the DNA containing the mutated gene to cause a homologous recombination between the mutated gene and the target gene on the
  • chromosome and thereby, replace the target gene on the chromosome to the mutated gene.
  • the protein encoded by the obtained mutated target gene even if it is produced, has a stereostructure different from that of a wild-type protein, and thus, the function thereof is reduced.
  • Such gene disruption based on gene replacement utilizing homologous recombination has been already established. Examples of it may include: methods using linear DNA such as the method called Red-driven integration (Datsenko, K. A, and Wanner, B. L. Proc. Natl. Acad. Sci . USA. 97: 6640-6645 (2000)), a method utilizing Red-driven integration in combination with the delivering system derived from ⁇ phage (Cho, E.
  • Decrease in transcription amount of a target gene can be confirmed by comparing amount of mRNA transcribed from the target gene with that in a wild strain or unmodified strain.
  • Examples of the method for evaluating the amount of mRNA may include northern hybridization and RT-PCR
  • the transcription amount may be decreased to any extent so long as it decreases compared with that observed in a wild strain or unmodified strain, and, for example, it is preferably decreased to at least 75% or less, 50% or less, 25% or less, or 10% or less, of that observed in a wild strain or unmodified strain,, and it is more preferable that the gene is not expressed at all.
  • Decrease in amount of a protein encoded by a target gene can be confirmed by Western blotting using an antibody that binds to the protein (Molecular cloning (Cold spring Harbor Laboratory Press, Cold spring Harbor (USA) , 2001 )) .
  • the amount of protein may be decreased to any extent so long as it decreases compared with that observed in a wild strain or unmodified strain, for example, it is preferably decreased to at least 75% or less, 50% or less, 25% or less, or 10% or less of that observed in a wild strain or
  • the protein is not produced at all (the activity is completely disappeared) .
  • Example of the method for decreasing the activity of GCD may include, besides the aforementioned genetic
  • microorganism belonging to the family Enterobacteriaceae enterobacterium such as a bacteria belonging to the genus Pantoea with ultraviolet irradiation or a mutagen used for usual mutagenesis treatment such as N-methyl-N' -nitro-N- nitrosoguanidine (NTG) or nitrous acid, and selecting a strain showing decreased GCD activity.
  • Enterobacteriaceae enterobacterium such as a bacteria belonging to the genus Pantoea with ultraviolet irradiation or a mutagen used for usual mutagenesis treatment such as N-methyl-N' -nitro-N- nitrosoguanidine (NTG) or nitrous acid, and selecting a strain showing decreased GCD activity.
  • the activity of GCD can also be reduced by reducing PQQ ability.
  • the PQQ synthesis ability can be reduced, for example, by deleting part or all of pqqABCDEF that is operon required for PQQ biosynthesis of (J. S. Velterop, P. W. Postma, J. Bacteriology 177(17): 5088-5098 (1995)).
  • the isoprenoid compound- producing microorganism can refer to a microorganism having an ability to produce an isoprenoid compound.
  • the isoprenoid compound-producing microorganism is a microorganism having an ability to produce an isoprenoid compound.
  • the isoprenoid compound-producing microorganism is a microorganism having an ability to produce an isoprenoid compound.
  • the isoprenoid compound-producing microorganism is a microorganism having an ability to produce an isoprenoid compound.
  • the isoprenoid compound-producing microorganism is a microorganism having an ability to produce an isoprenoid compound.
  • the isoprenoid compound-producing microorganism is a microorganism having an ability to produce an isoprenoid compound.
  • the isoprenoid compound-producing microorganism is a microorganism having an ability to produce an isoprenoid compound.
  • the isoprenoid compound-producing microorganism is an isoprene-producing microorganism, a linalool-producing microorganism, or a limonene-producing microorganism.
  • the isoprenoid compound-producing microorganism can refer to a microorganism transformed with an expression vector comprising the gene encoding an isoprenoid compound- synthetic enzyme.
  • the isoprenoid compound-synthetic enzyme refers to one or more enzymes involved in a synthesis of an isoprenoid compound.
  • isoprenoid compound- synthetic enzyme examples include an isoprene synthase, a geranyl diphosphate synthase, a farnesyl diphosphate synthase, a linalool synthase, amorpha-4 , 11-diene synthase, ⁇ - caryophyllene synthase, germacrene A synthase, 8-epicedrol synthase, valencene synthase, (+) - ⁇ -cadinene synthase, germacrene C synthase, (E) - ⁇ -farnesene synthase, casbene synthase, vetispiradiene synthase, 5-epi-aristolochene synthase, aristolochene synthase, humulene synthase, (E,E)- -farnesene synthase, (-)- ⁇ - ⁇ synthase, ⁇ -terpin
  • the isoprenoid compound-producing microorganism can be obtained by transforming a host microorganism with a vector for expressing the isoprenoid compound-synthetic enzyme such as the isoprene synthase, linalool synthase, geranyl diphosphate synthase, farnesyl diphosphate synthase, and limonene synthase.
  • the isoprene synthase may include the isoprene synthase derived from kudzu (Pueraria montana var. lobata) , poplar ⁇ Populus alba x Populus
  • linalool synthase may include the linalool synthase derived from hardy kiwi
  • frutescens var. crispa Perilla frutescens var. hirtella) , actinomycetes (Streptomyces clavuligerus) , bergamot mint (Mentha citrata) , lavender (Lavandula angustifolia) , sitka spruce (Picea sitchensis) , Norway spruce (Picea abies) , sweet annie (Artemisia annua) , lemon myrtle (Backhousia citriodora) , water mint (Mentha aquatica) , tomato (Solanum lycopersicum) , and apple (Malus domestics) .
  • Examples of the limonene synthase may include the limonene synthase derived from sitka spruce (Picea sitchensis) , grand fir ⁇ Abies grandis) , spearmint ⁇ Mentha spicata) , hemp ⁇ Cannabis sativa) , Norway spruce ⁇ Picea abies) , tomato ⁇ Solanum lycopersicum) , peppermint ⁇ Mentha X piperita) , Ricciocarpos natans, shiso ⁇ Perilla frutescens) , Agastache rugose, Unshu mikan ⁇ Citrus unshiu) , lemon ⁇ Citrus limon) , Schizonepeta tenuifolia, castor oil plant ⁇ Ricinus communis) , lavender ⁇ Lavandula angustifolia) .
  • diphosphate synthase and farnesyl diphosphate synthase may include the farnesyl diphosphate synthase derived from
  • Streptomyces sp. CL190 e.g., WO2007/029577A1
  • Bacillus stearothermophilus e.g., JP2000-245482
  • nucleic acid sequence such as a gene, a promoter, and the like, or an amino acid sequence such as a protein, can mean a
  • the vector for expressing the isoprenoid compound- synthetic enzyme refers to a vector comprising a gene encoding an isoprenoid compound-synthetic enzyme, and preferably the one or more polynucleotide selected from the group consisting of the following (a)-(x):
  • a polynucleotide comprising (i) the nucleotide sequence represented by SEQ ID NO: 2, (ii) the nucleotide sequence consisting of the nucleotide residues at positions 79 to 1725 in the nucleotide sequence represented by SEQ ID NO: 2, or (iii) the nucleotide sequence represented by SEQ ID NO : 3 ;
  • nucleotide sequence represented by SEQ ID NO: 5 (v) the nucleotide sequence consisting of the nucleotide residues at positions 115 to 1773 in the nucleotide sequence represented by SEQ ID NO: 5, or (vi) the nucleotide sequence represented by SEQ ID NO: 6;
  • a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (vi) , (v) or (vi) above, and encodes a protein having a linalool synthase activity;
  • a polynucleotide comprising (vii) the nucleotide sequence represented by SEQ ID NO: 62, (viii) the nucleotide sequence consisting of the nucleotide residues at positions 193 to 1905 in the nucleotide sequence represented by SEQ ID NO: 62, or (ix) the nucleotide sequence represented by SEQ ID NO: 63;
  • a polynucleotide comprising (x) the nucleotide sequence represented by SEQ ID NO: 65, (xi) the nucleotide sequence consisting of the nucleotide residues at positions 205 to 1914 in the nucleotide sequence represented by SEQ ID NO: 65, or (xii) the nucleotide sequence represented by SEQ ID NO: 65
  • (k) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (x) , (xi) or (xii) above, and encodes a protein having a limonene synthase activity;
  • a polynucleotide comprising (xiii) the nucleotide sequence represented by SEQ ID NO: 68, (xiv) the nucleotide sequence consisting of the nucleotide residues at positions 169 to 1800 in the nucleotide sequence represented by SEQ ID NO: 68, or (xv) the nucleotide sequence represented by SEQ ID NO: 69;
  • nucleotide sequence represented by SEQ ID NO: 71 (xvii) the nucleotide sequence consisting of the nucleotide residues at positions 154 to 1827 in the nucleotide sequence represented by SEQ ID NO: 71, or (xviii) the nucleotide sequence represented by SEQ ID NO: 72;
  • nucleotide sequence represented by SEQ ID NO: 74 (xx) the nucleotide sequence consisting of the nucleotide residues at positions 154 to 1821 in the nucleotide sequence represented by SEQ ID NO: 74, or (xxi) the nucleotide sequence represented by SEQ ID NO: 75;
  • a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (xix) , (xx) or (xxi) above, and encodes a protein having a limonene synthase activity;
  • a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (xxii) , or (xxiii) above, and encodes a protein having a geranyl diphosphate synthase activity and/or farnesyl diphosphate synthase activity; or
  • (x) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (xxii) , or (xxiii) above, and encodes a protein having a geranyl diphosphate synthase activity and/or a farnesyl diphosphate synthase activity.
  • the nucleotide sequence represented by SEQ ID NO: 2 is a full length nucleotide sequence of the linalool synthase gene from Actinidia arguta.
  • the nucleotide sequence represented by SEQ ID NO: 2 is a full length nucleotide sequence of the linalool synthase gene from Actinidia arguta.
  • SEQ ID NO: 2 can encode the amino acid
  • nucleotide sequence represented by SEQ ID NO:l a nucleotide sequence consisting of the nucleotide residues at positions 1 to 78 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide
  • nucleotide sequence represented by SEQ ID NO: 3 consists of a
  • nucleotide sequence in which codons found in the nucleotide sequence consisting of the nucleotide residues at positions 79 to 1725 in the nucleotide sequence represented by SEQ ID NO: 2 are modified, and a methionine codon is further added at 5' end.
  • the nucleotide sequence represented by SEQ ID NO: 5 is a full length nucleotide sequence of the linalool synthase gene from Coriandrum sativum.
  • the nucleotide sequence represented by SEQ ID NO: 5 can encode the amino acid sequence represented by SEQ ID NO: 4, a nucleotide sequence consisting of the nucleotide residues at positions 1 to 114 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide residues at positions 115 to 1773 (1770) can encode an amino acid sequence of mature linalool synthase.
  • the nucleotide sequence represented by SEQ ID NO: 6 consists of a nucleotide sequence in which codons found in the
  • nucleotide sequence consisting of the nucleotide residues at positions 115 to 1773 in the nucleotide sequence
  • SEQ ID NO: 5 are modified.
  • the nucleotide sequence represented by SEQ ID NO: 62 is a full length nucleotide sequence of the limonene synthase gene from Sitka spruce.
  • SEQ ID NO: 62 can encode the amino acid sequence represented by SEQ ID NO: 61, a nucleotide sequence consisting of the nucleotide residues .at positions 1 to 192 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide residues at positions 193 to 1905 (1902) can encode an amino acid sequence of mature limonene synthase.
  • the nucleotide sequence represented by SEQ ID NO: 63 consists of a nucleotide sequence in which codons found in the
  • nucleotide sequence consisting of the nucleotide residues at positions 193 to 1905 in the nucleotide sequence represented by SEQ ID NO: 62 are modified, and a methionine ' codon is further added at 5' end.
  • the nucleotide sequence represented by SEQ ID NO: 65 is a full length nucleotide sequence of the limonene synthase gene from Grand fir.
  • the nucleotide sequence represented by SEQ ID NO: 65 can encode the amino acid sequence
  • SEQ ID NO: 64 a nucleotide sequence
  • nucleotide sequence represented by SEQ ID NO: 66 consists of a nucleotide sequence in which codons found in the
  • nucleotide sequence consisting of the nucleotide residues at positions 205 to 1914 in the nucleotide sequence
  • SEQ ID NO: 65 are modified, and a methionine codon is further added at 5' end.
  • the nucleotide sequence represented by SEQ ID NO: 68 is a full length nucleotide sequence of the limonene synthase gene from spearmint.
  • the nucleotide sequence represented by SEQ ID NO: 68 can encode the amino acid sequence
  • SEQ ID NO: 67 a nucleotide sequence
  • nucleotide sequence represented by SEQ ID NO: 69 consists of a nucleotide sequence in which codons found in the
  • nucleotide sequence consisting of the nucleotide residues at positions 169 to 1800 in the nucleotide sequence
  • SEQ ID NO: 68 are modified, and a methionine codon is further added at 5' end.
  • the nucleotide sequence represented by SEQ ID NO: 71 is a full length nucleotide sequence of the limonene synthase gene from Unshu mikan.
  • the nucleotide sequence represented by SEQ ID NO: 71 can encode the amino acid sequence
  • SEQ ID NO: 70 a nucleotide sequence
  • nucleotide sequence represented by SEQ ID NO: 72 consists of a nucleotide sequence in which codons found in the
  • nucleotide sequence consisting of the nucleotide residues at positions 154 to 1827 in the nucleotide sequence
  • SEQ ID NO: 71 are modified, and a methionine codon is further added at 5' end.
  • the nucleotide sequence represented by SEQ ID NO: 74 is a full length nucleotide sequence of the limonene synthase gene from lemon.
  • the nucleotide sequence represented by SEQ ID NO: 74 is a full length nucleotide sequence of the limonene synthase gene from lemon.
  • SEQ ID NO: 74 can encode the amino acid sequence represented by SEQ ID NO: 73, a nucleotide sequence consisting of the nucleotide residues at positions 1 to 153 can encode a putative chloroplast localization signal, and the
  • nucleotide sequence consisting of the nucleotide residues at positions 154 to 1821 (1818) can encode an amino acid sequence of mature limonene synthase.
  • the nucleotide sequence represented by SEQ ID NO: 75 consists of a
  • nucleotide sequence in which codons found in the nucleotide sequence consisting of the nucleotide residues at positions 154 to 1821 in the nucleotide sequence represented by SEQ ID NO: 74 are modified, and a methionine codon is further added at 5' end.
  • the nucleotide sequence represented by SEQ ID NO: 7 is a nucleotide sequence of the farnesyl diphosphate synthase gene from Escherichia coli.
  • the nucleotide sequence represented by SEQ ID NO: 7 is a nucleotide sequence of the farnesyl diphosphate synthase gene from Escherichia coli.
  • SEQ ID NO: 8 consists of a nucleotide
  • the nucleotide sequence represented by SEQ ID NO: 7 can encode the amino acid sequence represented by SEQ ID NO: 89.
  • the nucleotide sequence represented by SEQ ID NO: 8 can encode the amino acid sequence represented by SEQ ID NO: 90.
  • the percent identity to the nucleotide sequence may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more.
  • the linalool synthase activity refers to an activity to produce linalool from geranyl diphosphate (GPP) (the same meaning shall apply hereinafter) .
  • the limonene synthase activity refers to an activity to produce limonene from GPP (the same meaning shall apply hereinafter) .
  • the farnesyl diphosphate synthase activity refers to an activity to produce farnesyl diphosphate from GPP (the same meaning shall apply hereinafter) .
  • the geranyl diphosphate synthase activity refers to an activity to produce geranyl
  • diphosphate from IPP and DMAPP (the same meaning shall apply hereinafter) .
  • the percent identity of the nucleotide sequences, and the percent identity of the amino acid sequences as described later can be determined using algorithm BLAST (Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)) by Karlin and Altschul, and FASTA (Methods Enzymol., 183, 63 (1990)) by Pearson.
  • the programs referred to as BLASTP and BLASTN were developed based on this algorithm BLAST (see
  • nucleotide sequences and amino acid sequences may be calculated using these programs with default setting. Also, for example, a numerical value obtained by
  • Lipman-Pearson method may be used as the homology of the amino acid sequences. The lowest value among the values derived from these calculations may be employed as the percent identity of the nucleotide sequences and the amino acid sequences.
  • stringent condition refers to a condition where a so-called specific hybrid is formed whereas a nonspecific hybrid is not formed. It is difficult to clearly quantify such a condition.
  • a condition is a condition where substantially the same polynucleotides having the high identity, for example, the polynucleotides having the percent identity described above hybridize each other whereas polynucleotides having the lower identity than above do not hybridize each other.
  • such a condition may include hybridization in 6xSCC (sodium chloride/sodium citrate) at about 45°C
  • DNA that hybridize each other may have identity of more than 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • the polynucleotides of the above (a)-(x) may be DNA or RNA that is obtainable from the corresponding DNA by substituting the nucleobase thymine to uracil, and are preferably DNA.
  • the vector for expressing the isoprenoid compound- synthetic enzyme refers also to a vector that expresses an isoprenoid compound-synthetic enzyme, and preferably a vector that expresses one or more protein selected from the group consisting of the following (A) - (X) :
  • (A) a protein comprising (i 1 ) the full length amino acid sequence represented by SEQ ID NO:l, or ( ⁇ ') the amino acid sequence consisting of the amino acid residues at positions 27 to 574 in the amino acid sequence represented by SEQ ID NO:l;
  • (B) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (i') or ( ⁇ '), and has a linalool synthase activity;
  • (C) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of ( ⁇ ') or
  • (D) a protein comprising (iii') the full length amino acid sequence represented by SEQ ID NO:4, or (iv 1 ) the amino acid sequence consisting of the amino acid residues at positions 39 to 590 in the amino acid sequence represented by SEQ ID NO: 4;
  • (E) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (iii 1 ) or (iv'), and has a linalool synthase activity
  • (F) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (iii') or (iv' ) , and has a linalool synthase activity
  • (G) a protein comprising ( ⁇ ' ) the full length amino acid sequence represented by SEQ ID NO: 61, or (vi') the amino acid sequence consisting of the amino acid residues at positions 65 to 634 in the amino acid sequence represented by SEQ ID NO: 61;
  • (H) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (v' ) or (vi'), and has a limonene synthase activity;
  • (I) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of ( ⁇ ') or (vi'), and has a limonene synthase activity;
  • (J) a protein comprising (vii 1 ) the full length amino acid sequence represented by SEQ ID NO: 64, or (viii') the amino acid sequence consisting of the amino acid residues at positions 69 to 637 in the amino acid sequence represented by SEQ ID NO: 64;
  • (K) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (vii 1 ) or (viii'), and has a limonene synthase activity;
  • (L) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (vii') or
  • (M) a protein comprising (ix 1 ) the full length amino acid sequence represented by SEQ ID NO: 67, or (ix') the amino acid sequence consisting of the amino acid residues at positions 57 to 599 in the amino acid sequence represented by SEQ ID NO: 67; (N) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (ix 1 ) or ( ⁇ '), and has a limonene synthase activity;
  • (0) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (ix') or ( ⁇ '), and has a limonene synthase activity;
  • (P) a protein comprising (xi ' ) the full length amino acid sequence represented by SEQ ID NO:70, or (xii 1 ) the amino acid sequence consisting of the amino acid residues at positions 52 to 608 in the amino acid sequence represented by SEQ ID NO: 70;
  • (Q) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (xi 1 ) or
  • (R) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (xi 1 ) or
  • (S) a protein comprising (xiii 1 ) the full length amino acid sequence represented by SEQ ID NO:73, or (xiv') the amino acid sequence consisting of the amino acid residues at positions 52 to 606 in the amino acid sequence represented by SEQ ID NO: 73;
  • T a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (xiii 1 ) or (xiv' ) , and has a limonene synthase activity;
  • (U) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (xiii') or (xiv' ) , and has a limonene synthase activity.
  • (X) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence, and has a geranyl diphosphate synthase activity and/or a farnesyl diphosphate synthase activity.
  • amino acid sequence consisting of the amino acid residues at positions 1 to 26 in the amino acid sequence represented by SEQ ID NO:l can comprise a putative
  • the amino acid sequence consisting of the amino acid residues at positions 27 to 574 in the amino acid sequence represented by SEQ ID NO:l can comprise the mature linalool synthase.
  • the sequence adding methionine residue at N- terminal is used.
  • the amino acid sequence consisting of the amino acid residues at positions 1 to 38 in the amino acid sequence represented by SEQ ID NO: 4 can comprise a putative chloroplast localization signal, and the amino acid
  • sequence consisting of the amino acid residues at positions 39 to 590 in the amino acid sequence represented by SEQ ID NO: 4 can comprise the mature linalool synthase.
  • amino acid sequence consisting of the amino acid residues at positions 1 to 64 in the amino acid sequence represented by SEQ ID NO: 61 can comprise a putative
  • the amino acid sequence consisting of the amino acid residues at positions 65 to 634 in the amino acid sequence represented by SEQ ID NO: 61 can comprise the mature limonene synthase.
  • the amino acid sequence consisting of the amino acid residues at positions 1 to 68 in the amino acid sequence represented by SEQ ID NO: 64 can comprise a putative chloroplast localization signal.
  • the amino acid sequence consisting of the amino acid residues at positions 69 to 637 in the amino acid sequence represented by SEQ ID NO: 64 can comprise the mature limonene synthase.
  • amino acid sequence consisting of the amino acid residues at positions 1 to 56 in the amino acid sequence represented by SEQ ID NO: 67 can comprise a putative chloroplast localization signal.
  • SEQ ID NO: 67 can comprise the mature
  • the amino acid sequence consisting of the amino acid residues at positions 1 to 51 in the amino acid sequence represented by SEQ ID NO: 70 can comprise a putative chloroplast localization signal.
  • the amino acid sequence consisting of the amino acid residues at positions 52 to 608 in the amino acid sequence represented by SEQ ID NO: 70 can comprise the mature limonene synthase.
  • the amino acid sequence consisting of the amino acid residues at positions 1 to 51 in the amino acid sequence represented by SEQ ID NO: 73 can comprise a putative chloroplast
  • the amino acid sequence consisting of the amino acid residues at positions 52 to 606 in the amino acid sequence represented by SEQ ID NO: 73 can comprise the mature limonene synthase.
  • the mature limonene When the mature limonene
  • synthase expression is carried out in microbes, in general, the sequence adding methionine residue at N-terminal is used.
  • the nucleotide sequence represented by SEQ ID NO: 89 can comprise mature geranyl diphosphate synthase and/or farnesyl diphosphate synthase.
  • the nucleotide sequence represented by SEQ ID NO: 90 can comprise mutated mature geranyl diphosphate and/or farnesyl diphosphate synthase (S80F) .
  • the percent identity to the amino acid sequence may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more.
  • Examples of the mutation of the amino acid residues may include deletion, substitution, addition and insertion of amino acid residues.
  • the mutation of one or several amino acids may be introduced into one region or multiple different regions in the amino acid sequence.
  • the term "one or several" indicates a range in which a three- dimensional structure and an activity of the protein are not impaired greatly. In the case of the protein, the number represented by "one or several" is, for example, 1 to 100, preferably 1 to 80, more preferably 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 1 to 5.
  • the above protein of (A) - (X) may have a methionine residue at the N-terminus.
  • the above protein of (A) - (X) may have a tag at the C-terminus for purification, such as a histidine tag.
  • the protein of (B) or (C) preferably has a linalool synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the linalool synthase activity of the protein comprising the amino acid sequence of either one of (i') or ( ⁇ ') above when measured under the same condition.
  • the protein of the protein of (E) or (F) preferably has a linalool synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the linalool synthase activity of the protein comprising the amino acid sequence of either one of (iii 1 ) or (iv' ) above when measured under the same condition.
  • the protein of (H) or (I) preferably has a
  • the protein of (K) or (L) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of ( ⁇ ') or (vi') above when measured under the same condition.
  • the protein of (K) or (L) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (vii 1 ) or (viii 1 ) above when measured, under the same condition.
  • the protein of (N) or (0) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (ix 1 ) or (x 1 ) above when measured under the same condition.
  • the protein of (Q) or (R) preferably has a limonene
  • the protein of (T) or (U) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (xiii 1 ) or (xiv 1 ) above when measured under the same condition.
  • the protein of (T) or (U) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (xiii 1 ) or (xiv 1 ) above when measured under the same condition.
  • the protein of (W) or (X) preferably has a geranyl diphosphate synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the geranyl diphosphate synthase activity of the protein comprising the amino acid sequence represented by SEQ ID NOs: 90 or 89, more preferably has geranyl diphosphate synthase activity and farnesyl diphosphate synthase
  • diphosphate synthase activity and farnesyl diphosphate synthase activity of the protein comprising the amino acid sequence represented by SEQ ID NOs: 90 or 89, when measured under the same condition.
  • the mutation may be introduced into sites in a catalytic domain and sites other than the catalytic domain as long as an objective activity is retained.
  • the positions of amino acid residues to be mutated in the protein, which is capable of retaining the objective activity, are understood by a person skilled in the art.
  • a person skilled in the art can recognize a correlation between structure and function, since a person skilled in the art can 1) compare the amino acid sequences of multiple proteins having the same type of activity (e.g., the amino acid sequence represented by SEQ ID NO:l, 4, 61, 64, 67, 71, or 74 and amino acid sequences of other isoprenoid compound-synthetic enzymes), 2) clarify regions that are relatively conserved and regions that are not relatively conserved, and then 3) predict regions capable of playing a functionally important role and regions incapable of playing a functionally important role from the regions that are relatively conserved and the regions that are not relatively conserved, respectively. Therefore, a person skilled in the art can identify the positions of the amino acid residues to be mutated in the amino acid sequence of the isoprenoid compound-synthetic enzyme .
  • substitution of the amino acid residue may be
  • “conservative substitution” refers to substitution of a certain amino acid residue with an amino acid residue having a similar side chain. Families of the amino acid residues having the similar side chain are well-known in the art. Examples of such families may include amino acids having a basic side chain (e.g., lysine, arginine,
  • amino acids having an acidic side chain e.g., aspartic acid, glutamic acid
  • amino acids having a non- charged polar side chain e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine
  • amino acids having a non-polar side chain e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • amino acids having a branched side chain at position ⁇ e.g., threonine, valine, isoleucine
  • amino acids having an aromatic side chain e.g., tyrosine, phenylalanine, tryptophan, histidine
  • amino acids having a hydroxyl group-containing side chain e.g., alkoxy, phenoxy group-containing side chain
  • the conservative substitution of the amino acids may be the substitution between aspartic acid and glutamic acid, the substitution among arginine, lysine and histidine, the substitution between tryptophan and phenylalanine, the substitution between phenylalanine and valine, the
  • the isoprenoid compound-producing microorganism can be obtained by transforming a host cell with an expression vector to express a gene encoding a desired protein such as the above isoprenoid compound-synthetic enzyme.
  • the isoprenoid compound-producing microorganism comprises an expression unit comprising a polynucleotide encoding the desired protein and a promoter operatively linked thereto, which are contained in the expression vector.
  • the expression unit may be a
  • the promoter are not inherent in the host cell.
  • the promoter may be homologous or heterologous to the polynucleotide encoding the desired protein.
  • the expression unit may further comprise additional elements such as a terminator, a ribosome-binding site, and a drug-resistance gene.
  • the expression unit may be DNA or RNA and is preferably DNA. Examples of the desired protein include, but are not limited to, a mevalonate kinase, an isoprene synthase, one or more enzymes involved in a methylerythritol phosphate pathway, and one or more enzymes involved in a mevalonate pathway.
  • operatively linked can mean that the nucleotide sequence of a regulatory region (s) is/are linked to the nucleotide sequence of a nucleic acid molecule or gene (that is, to polynucleotide) in a manner which allows for expression (e.g., enhanced, increased, constitutive, basal, antiterminated, . attenuated, deregulated, decreased or repressed expression) of the polynucleotide, so that a polynucleotide expression product encoded by the nucleotide sequence thereof is produced.
  • the vector for expressing the isoprenoid compound- synthetic enzyme may be an integrative vector or a non- integrative vector.
  • the gene encoding the isoprenoid compound-synthetic enzyme may be placed under the control of a constitutive promoter or inducible promoter. Examples of the constitutive promoter include the tac promoter, the lac promoter, the trp
  • the inducible promoter examples include a promoter which is inversely dependent on the growth-promoting agent described later.
  • the isoprenoid compound-producing microorganism may further express a mevalonate kinase in addition to the isoprenoid compound-synthetic enzyme. Therefore, the isoprenoid compound-producing microorganism may be
  • mevalonate kinase gene may include genes from microorganisms belonging to the genus
  • Methanosarcina such as Methanosarcina mazei
  • the genus Methanocella such as Methanocella paludicola
  • the genus Corynebacterium such as Corynebacterium variabile
  • the genus Methanosaeta such as Methanosaeta concilii
  • the genus Nitrosopumilus such as Nitrosopumilus maritimus .
  • the vector for expressing the mevalonate kinase may be an integrative vector or a non-integrative vector.
  • the gene encoding the mevalonate kinase may be placed under the control of a constitutive promoter or inducible promoter (e.g., the promoter which is
  • the gene encoding the mevalonate kinase may be placed under the control of the constitutive promoter.
  • the constitutive promoter include the tac promoter, the lac promoter, the trp promoter, the trc promoter, the T7 promoter, the T5 promoter, the T3 promoter and the SP6 promoter.
  • the isoprenoid compound-producing microorganism used in the present invention as a host can be a bacterium or a fungus.
  • the bacterium may be a gram-positive bacterium or a gram-negative bacterium.
  • the isoprenoid compound- producing microorganism can be a microorganism belonging to the family Enterobacteriaceae, and particularly preferably a microorganism belonging to the family Enterobacteriaceae among microorganisms described later.
  • Examples of the gram-positive bacterium may include bacteria belonging to the genera Bacillus, Listeria,
  • Staphylococcus Streptococcus, Enterococcus, Clostridium, Corynebacterium, and Streptomyces .
  • Bacteria belonging to the genera Bacillus and Corynebacterium are preferable.
  • bacteria belonging to the genus Bacillus may include Bacillus subtilis, Bacillus anthracis, and Bacillus cereus. Bacillus subtilis is more preferable.
  • Corynebacterium may include Corynebacterium glutamicum, Corynebacterium efficiens, and Corynebacterium callunae. Corynebacterium glutamicum is more preferable.
  • Examples of the gram-negative bacterium may include bacteria belonging to the genera Escherichia, Pantoea, Salmonella, Vibrio, Serratia, and Enterobacter.
  • the bacteria belonging to the genera Escherichia, Pantoea and Enterobacter are preferable.
  • Escherichia coli is preferable as the bacterium belonging to the genus Escherichia.
  • Pantoea may include Pantoea ananatis, Pantoea stewartii, Pantoea agglomerans, and Pantoea citrea. Pantoea ananatis and Pantoea citrea are preferable. Strains exemplified in the European Patent Application Publication EP0952221 may be used as the bacteria belonging to the genus Pantoea. Examples of representative strains of the bacteria, belonging to the genus Pantoea may include Pantoea ananatis AJ13355 strain (FERM BP-6614) and Pantoea ananatis AJ13356 strain (FERM BP-6615) disclosed in the European Patent
  • Pantoea ananatis SC17 strain (FERM BP-11901), and Pantoea ananatis SC17(0) strain (Katashikina JI et al . , BMC Mol Biol 2009; 10: 34 VKPM B-9246) .
  • Examples of the bacteria belonging to the genus Enterobacter may include Enterobacter agglomerans and
  • Enterobacter aerogenes is
  • the bacterium belonging to the genus preferable as the bacterium belonging to the genus
  • the bacterial strains exemplified in the European Patent Application Publication EP0952221 may be used as the bacteria belonging to the genus Enterobacter. Examples of representative strains of the bacteria
  • Enterobacter belonging to the genus Enterobacter may include
  • Enterobacter agglomerans ATCC12287 strain Enterobacter aerogenes ATCC13048 strain
  • Enterobacter aerogenes Enterobacter aerogenes
  • NBRC12010 strain Biotechnol. Bioeng., 2007 Mar 27; 98(2) 340-348
  • Enterobacter aerogenes AJ110637 (FERM BP-10955) , and the like.
  • the Enterobacter aerogenes AJ110637 strain was deposited to International Patent Organism Depositary (IPOD), National Institute of Advanced Industrial Science and Technology (AIST) (Chuo No. 6, Higashi 1-1-1, Tsukuba City, Ibaraki Pref., JP, Postal code 305-8566; currently, International Patent Organism Depositary, National
  • Examples of the fungus may include microorganisms belonging to the genera Saccharomyces, Schizosaccharomyces, Yarrowia, Trichoderma, Aspergillus, Fusarium, and Mucor.
  • the microorganisms belonging to the genera Saccharomyces, Schizosaccharomyces, Yarrowia, or Trichoderma are examples of the fungus.
  • Examples of the microorganisms belonging to the genus Saccharomyces may include Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus,
  • Saccharomyces douglasii Saccharomyces kluyveri
  • Saccharomyces norbensis Saccharomyces oviformis.
  • Saccharomyces cerevisiae is preferable as the fungus belonging to the genus Saccharomyces .
  • Schizosaccharomyces pombe is preferable as the
  • microorganisms belonging to the genus Schizosaccharomyces are microorganisms belonging to the genus Schizosaccharomyces .
  • Yarrowia lypolytica is preferable as the
  • microorganisms belonging to the genus Yarrowia are microorganisms belonging to the genus Yarrowia .
  • Trichoderma harzianum examples of the microorganisms belonging to the genus Trichoderma may include Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma viride. Trichoderma reesei is preferable.
  • DMAPP dimethylallyl diphosphate
  • an expression vector that expresses an isopentenyl-diphosphate delta isomerase having an ability to convert isopentenyl having an ability to convert isopentenyl
  • IPP isoprenoid diphosphate
  • DMAPP dimethylallyl diphosphate
  • an expression vector that expresses an isopentenyl-diphosphate delta isomerase having both of an ability to convert IPP into DMAPP and an ability to convert DMAPP into isoprenoids may be introduced into the isoprenoid compound-producing microorganism.
  • the expression vector for such an enzyme may be an integrative vector or a non-integrative vector.
  • the expression vector for such an enzyme may express further a plurality of enzymes (e.g., one or more, two or more, three or more or four or more) involved in the mevalonate pathway and/or the methylerythritol phosphate pathway, and may be, for example, an expression vector for polycistronic mRNA. Origin of one or more enzymes involved in the mevalonate pathway and/or the methylerythritol phosphate pathway may be homologous or heterologous to the host. When the origin of the enzyme involved in the mevalonate pathway and/or the
  • methylerythritol phosphate pathway is heterologous to the host, for example, the host may be a bacterium as described above (e.g., Escherichia coli) and the enzyme involved in the mevalonate pathway may be derived from a fungus (e.g., Saccharomyces cerevisiae) .
  • the host inherently produces the enzyme involved in the
  • an expression vector to be introduced into the host may express an enzyme involved in the mevalonate pathway.
  • isomerase (EC: 5.3.3.2) may include Idilp (ACCESSION ID NP_015208), AT3G02780 (ACCESSION ID NP_186927 ) , AT5G16440 (ACCESSION ID NP_197148) and Idi ' (ACCESSION ID NP_417365) .
  • Idilp ACCESSION ID NP_015208
  • AT3G02780 ACCESSION ID NP_186927
  • AT5G16440 (ACCESSION ID NP_197148)
  • Idi ' (ACCESSION ID NP_417365)
  • isopentenyl-diphosphate delta isomerase may be placed under the control of the promoter which is inversely dependent on the growth-promoting agent.
  • Examples of the enzymes involved in the mevalonate (MVA) pathway may include mevalonate kinase (EC: 2.7.1.36; example 1, Ergl2p, ACCESSION ID NP_013935; example 2,
  • AT5G27450 AT5G27450, ACCESSION ID NP_001190411) , phosphomevalonate kinase (EC: 2.7.4.2; example 1, Erg8p, ACCESSION ID
  • NPJD13947 example 2, AT1G31910, ACCESSION ID NP_001185124
  • diphosphomevalonate decarboxylase EC: 4.1.1.33; example 1, Mvdlp, ACCESSION ID NP_014441; example 2, AT2G38700
  • ACCESSION ID NP_181404 example 3, AT3G54250, ACCESSION ID NP_566995), acetyl-CoA-C-acetyltransferase (EC: 2.3.1.9;
  • the gene(s) encoding one or more enzymes involved in the mevalonate ( VA) pathway may be placed under the control of the promoter which is inversely dependent on the growth-promoting agent.
  • methylerythritol phosphate (MEP) pathway may include 1- deoxy-D-xylulose-5-phosphate synthase (EC: 2.2.1.7, example
  • ACCESSION ID NP_566686 example 3, AT4G15560, ACCESSION ID NP_193291; example 4, AT5G11380, ACCESSION ID NP_001078570) ,
  • 2-C-methyl-D-erythritol kinase (EC: 2.7.1.148; example 1, IspE, ACCESSION ID NP_415726; example 2, AT2G26930,
  • ACCESSION ID NP_180261 2-C-methyl-D-erythritol-2 , 4- cyclodiphosphate synthase (EC: 4.6.1.12; example 1, IspF, ACCESSION ID NP_417226; example 2, AT1G63970, ACCESSION ID NP_564819) , l-hydroxy-2-methyl-2- (E) -butenyl-4-diphosphate synthase (EC: 1.17.7.1; example 1, IspG, ACCESSION ID NP_417010; example 2, AT5G60600, ACCESSION ID NP_001119467 ) , and 4-hydroxy-3-methyl-2-butenyl diphosphate reductase (EC: 1.17.1.2; example 1, IspH, ACCESSION ID NP_414570; example 2, AT4G34350, ACCESSION ID NP_567965) .
  • the gene(s) encoding one or more
  • pathway that synthesizes dimethylallyl diphosphate that is a building-block of the isoprenoid compound may also be introduced into the isoprenoid compound-producing microorganism.
  • Examples of such an enzyme may include l-deoxy-D-xylose-5- phosphate synthase that converts a pyruvate and D- glycelaldehyde-3-phosphate into l-deoxy-D-xylose-5- phosphate, isopentenyl diphosphate isomerase that converts isopentenyl diphosphate into dimethylallyl diphosphate, and the like.
  • dimethylallyl diphosphate may be placed under the control of the constitutive promoter or inducible promoter (e.g., the promoter which is inversely dependent on the growth- promoting agent) .
  • the transformation of a host with an expression vector containing the gene(s) described above can be carried out using one or more known methods. Examples of such methods may include a calcium chloride method using a microbial cell treated with calcium, an electroporation method, and the like.
  • the gene may also be introduced by infecting the microbial cell with a phage vector other than the plasmid vector .
  • the method of the present invention preferably a
  • the above step 1) corresponding to a growth phase of a microorganism and the above step 3) corresponding to a formation phase of the isoprenoid compound are separated.
  • the above step 2) corresponding to an induction phase of isoprenoid compound formation for transferring the microorganism from the growth phase to the formation phase of the isoprenoid compound.
  • the growth-promoting agent can refer to a factor essential for the growth of a microorganism or a factor having an activity of promoting the growth of the
  • microorganism which can be consumed by the microorganism, the consumption of which causes reduction of its amount in a culture medium, consequently loss or reduction of the growth of the microorganism.
  • the consumption of which causes reduction of its amount in a culture medium, consequently loss or reduction of the growth of the microorganism.
  • the degree of the growth of the microorganism can be
  • growth-promoting agent may include, but are not limited to, substances such as oxygen (gas); minerals such as ions of iron, magnesium, potassium and calcium; phosphorus compounds such as monophosphoric acid, diphosphoric acid, and polyphosphoric acid, or salt thereof; nitrogen
  • vitamins e.g., vitamin A, vitamin D, vitamin E, vitamin K, vitamin Bl, vitamin B2, vitamin B6, vitamin B12, niacin, pantothenic acid, biotin, ascorbic acid
  • amino acids e.g.,
  • alanine arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, leucine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine,
  • growth-promoting agent may be used or two or more kinds of growth-promoting agents may be used in combination in the method of the present invention.
  • the isoprenoid compound-producing microorganism is preferably a microorganism having an ability to grow depending on the growth-promoting agent and an ability to produce an isoprenoid compound depending on a promoter which is inversely dependent on the growth- promoting agent, on which an ability to synthesize the isoprenoid compound by an enzymatic reaction has been conferred.
  • Such an isoprenoid compound-producing microorganism is preferably a microorganism having an ability to grow depending on the growth-promoting agent and an ability to produce an isoprenoid compound depending on a promoter which is inversely dependent on the growth- promoting agent, on which an ability to synthesize the isoprenoid compound by an enzymatic reaction has been conferred.
  • microorganism can grow in the presence of the growth- promoting agent at concentration sufficient for the growth of the isoprenoid compound-producing microorganism.
  • the "sufficient concentration” can refer to that the growth-promoting agent is used at concentration which is effective for the growth of the isoprenoid compound- producing microorganism.
  • the expression "ability to produce an (the) isoprenoid compound depending on a promoter which is inversely depending on the growth-promoting agent” can mean that the isoprenoid compound cannot be produced at all or a producing efficiency of the isoprenoid compound is low in the presence of the growth-promoting agent at relatively high concentration whereas the isoprenoid compound can be produced or the producing efficiency of the isoprenoid compound is high in the presence of the growth- promoting agent at relatively low concentration or in the absence of the growth-promoting agent. Therefore, the isoprenoid compound-producing microorganism used preferably in the present invention can grow well but cannot produce the isoprenoid compound or exhibits low producing
  • the isoprenoid compound-producing microorganism preferably cannot grow well but can produce the isoprenoid compound and exhibit high producing efficiency of the isoprenoid compound in the presence of the growth-promoting agent at insufficient concentration or in the absence of the growth- promoting agent.
  • compound-synthetic enzyme of the isoprenoid compound- producing microorganism can be present under the control of a promoter which is inversely dependent on the growth- promoting agent.
  • promoter which is inversely dependent on the growth- promoting agent.
  • the inversely dependent on the growth-promoting agent can mean a promoter not having at all or having low transcription activity in the presence of the growth-promoting agent at relatively high concentration but having some or high transcription activity in the presence of the growth- promoting agent at relatively low concentration or in the absence of the growth-promoting agent. Therefore, the promoter which is inversely dependent on the growth- promoting agent can suppress the expression of the gene encoding an isoprenoid compound-synthetic enzyme in the presence of the growth-promoting agent at a concentration sufficient for the growth of the isoprenoid compound- producing microorganism whereas it can promote the
  • the isoprenoid compound-producing microorganism is under the control of the promoter which is inversely dependent on the growth-promoting agent.
  • a phosphorus deficiency-inducible promoter when the growth-promoting agent is a phosphorus compound, a phosphorus deficiency-inducible promoter can be utilized.
  • the expression "phosphorus deficiency-inducible promoter” can refer to a promoter that can promote the expression of a downstream gene at low concentration of phosphorus compound. The low
  • concentration of phosphorus compound can refer to a
  • the total phosphorus concentration under a phosphorus deficient condition may be 100 mg/L or less, 50 mg/L or less, 10 mg/L or less, 5 mg/L or less, 1 mg/L or less, 0.1 mg/L or less, or 0.01 mg/L or less. Examples of the
  • phosphorus deficiency-inducible promoter may include a promoter of the gene encoding alkali phosphatase (e.g., phoA) , a promoter of the gene encoding an acid phosphatase (e.g., phoC) , a promoter of the gene encoding a sensor histidine kinase (phoR) , a promoter of the gene encoding a response regulator (e.g., phoB) , and a promoter of the gene encoding a phosphorus uptake carrier (e.g., pstS) .
  • alkali phosphatase e.g., phoA
  • phoC acid phosphatase
  • phoR sensor histidine kinase
  • phoB a promoter of the gene encoding a response regulator
  • a promoter of the gene encoding a phosphorus uptake carrier e.g., pstS
  • the isoprenoid compound- producing microorganism is grown in the presence of the growth-promoting agent at sufficient concentration. More specifically, the isoprenoid compound-producing
  • microorganism can be grown by culturing the isoprenoid compound-producing microorganism in a culture medium in the presence of the growth-promoting agent at sufficient
  • the isoprenoid compound-producing microorganism can grow well in the presence of the phosphorus compound
  • a concentration of the phosphorus compound that is sufficient for the growth in step 1) is not particularly limited, and may be, for example, 200 mg/L or more, 300 mg/L or more, 500 mg/L or more, 1000 mg/L or more, or 2000 mg/L or more.
  • the concentration of the phosphorus compound for the growth may be, for example, 20 g/L or less, 10 g/L or less, or 5 g/L or less.
  • step 2) the production of the isoprenoid compound by the isoprenoid compound-producing microorganism is induced by decreasing the concentration of the growth- promoting agent. More specifically, the concentration of the growth-promoting agent can be decreased by decreasing an amount of the growth-promoting agent supplied into a culture medium. Even if the amount of the growth-promoting agent supplied into the culture medium is made constant throughout steps 1) and 2), the concentration of the growth-promoting agent can be decreased by utilizing the growth of the microorganism. In the early phase of the growth of the microorganism in step 1), the microorganism does not grow sufficiently and the number of the
  • concentration of the growth-promoting agent in the culture medium is relatively high in the early phase of the growth.
  • the microorganism grows
  • the concentration of the growth-promoting agent in the culture medium becomes relatively low in the late phase of the growth. As described above, when the constant amount of the growth-promoting agent continues to be supplied into the culture medium throughout steps 1) and 2), the
  • concentration of the growth-promoting agent in the culture medium is decreased in inverse proportion to the growth of the microorganism. This decreased concentration can be used as a trigger to induce the production of the
  • isoprenoid compound that is, the isoprene, linalool, and limonene
  • the growth-promoting agent when a phosphorus compound or an amino acid is used as the growth-promoting agent, the phosphorus compound or an amino acid is used as the growth-promoting agent.
  • concentration of the phosphorus compound or the amino acid in the culture medium, which can induce the production of the isoprenoid compound by the isoprenoid compound- producing microorganism can be, for example, 100 mg/L or less, 50 mg/L or less, or 10 mg/L or less.
  • the isoprenoid compound is produced by culturing the isoprenoid compound-producing microorganism. More specifically, the isoprenoid compound can be produced by culturing the isoprenoid compound- producing microorganism in the culture medium under the condition of step 2) where the concentration of the growth- promoting agent is decreased. The concentration of the growth-promoting agent in the culture medium can be
  • the concentration of the isoprenoid compound produced in the culture medium can be, for example, 600 ppm or more, 700 ppm or more, 800 ppm or more, or 900 ppm or more, for example, within 6 hours, 5, 4, or 3 hours after culturing the isoprenoid compound-producing microorganism in the culture medium under the condition of step 2) .
  • isoprenoid compound-producing microorganism in step 3) is set longer than that period of step 1) .
  • microorganism fails to maintain the ability to produce the isoprenoid compound. Thus, it is necessary to continuously add the inducer into culture medium. As the inducer may be expensive, the cost for producing the isoprenoid compound may become inappropriate. Therefore, the culturing a microorganism for a long period of time using the inducer in the formation phase of the isoprenoid compound is problematic in that the cost for producing the isoprenoid compound can be elevated depending on the duration of the cultivation period.
  • the period of time of step 3) can easily be made longer, differently from the conventional method that utilizes the inducer. In the method of the present invention, the longer the period of time of step 3) is made, the more isoprenoid compound can be produced.
  • isoprenoid compound produced in the liquid phase can be collected from the gas phase (fermentation gas) as
  • the isoprenoid compound can be collected from the gas phase by known methods.
  • Examples of the method of collecting the isoprenoid compound from the gas phase may include an absorption method, a cooling method, a pressure swing adsorption method (PSA method) , and a membrane separation method.
  • PSA method pressure swing adsorption method
  • the gas phase may be subjected to a
  • pretreatment such as dehydration, pressure elevating, pressure reducing, and the like, if necessary.
  • the method of the present invention may be combined with another method in terms of enhancing the amount of produced isoprenoid compound.
  • Examples of such a method may include a method of utilizing an environmental factor such as light (Pia Lindberg, Sungsoon Park, Anastasios elis, Metabolic Engineering 12 (2010) : 70-79) or
  • the culture medium used in the method of the present invention may contain a carbon source for producing the isoprenoid compound.
  • the carbon source may include
  • carbohydrates such as monosaccharides, disaccharides, oligosaccharides and polysaccharides; invert sugars
  • a CI compound such as methanol, formaldehyde, formate, carbon monoxide and carbon dioxide
  • oils such as corn oil, palm oil and soybean oil
  • acetate animal fats; animal oils; fatty acids such as saturated fatty acids and unsaturated fatty acids; lipids; phospholipids; glycerolipids ; glycerine fatty acid esters such as monoglyceride, diglyceride and triglyceride
  • polypeptides such as microbial proteins and plant proteins
  • renewable carbon sources such as hydrolyzed biomass carbon sources; yeast extracts, or combinations thereof.
  • inorganic ammonium salts such as ammonium sulfate, ammonium chloride and ammonium phosphate
  • organic nitrogen such as hydrolyzed soybeans, ammonia gas, ammonia water, and the like
  • the culture medium contains required substances such as vitamin Bl and L-homoserine, or the yeast extract and the like in an appropriate amount as an organic trace nutrient source.
  • potassium phosphate, magnesium sulfate, iron ion, manganese ion, and the like are added in a small amount if necessary.
  • present invention may be a natural medium or a synthesized medium as long as it contains the carbon source, the
  • Examples of the monosaccharide may include triose such as ketotriose (dihydroxyacetone) and aldotriose
  • ketotetrose erythrulose
  • aldotetrose erythrose, threose
  • pentose such as ketopentose (ribulose, xylulose) , aldopentose (ribose, arabinose, xylose, lyxose) and deoxysaccharide
  • hexose such as ketohexose
  • fructose, sorbose, tagatose aldohexose (allose, altrose, glucose, mannose, gulose, idose, galactose, talose) , and deoxysaccharide (fucose, fuculose, rhamnose) ; and heptose such as sedoheptulose .
  • C6 sugars such as fructose, mannose, galactose and glucose
  • C5 sugars such as xylose and arabinose are preferable.
  • disaccharide examples include sucrose, lactose, maltose, trehalose, turanose, and cellobiose.
  • oligosaccharide examples include
  • trisaccharides such as raffinose, melezitose and
  • maltotriose tetrasaccharides such as acarbose and
  • fructooligosaccharide FOS
  • GOS galactooligosaccharide
  • MOS mannan-oligosaccharide
  • polysaccharide may include glycogen, starch (amylose, amylopectin) , cellulose, dextrin, and glucan ( ⁇ -l , 3-glucan) , and starch and cellulose are
  • Examples of the microbial protein may include
  • polypeptides derived from a yeast or bacterium are polypeptides derived from a yeast or bacterium.
  • Examples of the plant protein may include polypeptides derived from soybean, corn, canola, Jatropha, palm, peanut, sunflower, coconut, mustard, cotton seed, palm kernel oil, olive, safflower, sesame and linseed.
  • Examples of the lipid may include substances
  • the oil can be the lipid that contains one or more saturated or unsaturated fatty acids of C4 or more and is liquid at room temperature, and examples of the oil may include lipids derived from soybean, corn, canola, Jatropha, palm, peanut, sunflower, coconut, mustard, cotton seed, palm kernel oil, olive, safflower, sesame, linseed, oily microbial cells, Chinese tallow tree, and a combination of two or more thereof.
  • Examples of the fatty acid may include compounds represented by a formula RCOOH ("R" represents a
  • hydrocarbon group having two or more carbon atoms hydrocarbon group having two or more carbon atoms
  • the unsaturated fatty acid is a compound having at least one double bond between two carbon atoms in the group "R" as described above, and examples of the unsaturated fatty acid may include oleic acid, vaccenic acid, linoleic acid, palmitelaidic acid and arachidonic acid.
  • the saturated fatty acid is a compound where the "R" is a saturated aliphatic group, and examples of the
  • saturated fatty acid may include docosanoic acid
  • those containing one or more C2 to C22 fatty acids are preferable as the fatty acid, and those containing C12 fatty acid, C14 ' fatty acid, C16 fatty acid, C18 fatty acid, C20 fatty acid and C22 fatty acid are more preferable.
  • the carbon source may include salts (e.g., isopropyl myristate) and derivatives of these fatty acids and salts of these derivatives.
  • salts e.g., isopropyl myristate
  • Examples of the salt may include lithium salts, potassium salts, sodium salts and so forth.
  • Examples of the carbon source may also include
  • carbohydrates such as glucose with lipids, oils, fats, fatty acids and glycerol fatty acid esters.
  • renewable carbon source may include hydrolyzed biomass carbon sources.
  • biomass carbon source may include cellulose-based substrates such as waste materials of woods, papers and pulps, leafy plants, and fruit pulps; and
  • partial plants such as stalks, grain particles, roots and tubers .
  • Examples of the plant to be used as the biomass carbon source may include corn, wheat, rye, sorghum, triticale, rice, millet, barley, cassava, legume such as pea, potato, sweet potato, banana, sugar cane and tapioca.
  • the carbon source When the renewable carbon source such as biomass is added to the culture medium, the carbon source can be pretreated.
  • the pretreatment may include an enzymatic pretreatment, a chemical pretreatment, and a combination of the enzymatic pretreatment and the chemical pretreatment.
  • renewable carbon source is entirely or partially hydrolyzed before being added to the culture medium.
  • Examples of the carbon source may also include the yeast extract and a combination of the yeast extract with the other carbon source such as glucose.
  • the combination of the yeast extract with the CI compound such as carbon dioxide and methanol is preferable.
  • the isoprenoid compound-producing microorganism in the method of the present invention, it is preferable to culture the isoprenoid compound-producing microorganism in a standard culture medium containing saline and nutrients.
  • the culture medium is not particularly limited, and examples of the culture medium may include ready-made general media that is commercially available such as Luria Bertani (LB) broth, Sabouraud dextrose (SD) broth, and yeast medium (YM) broth.
  • LB Luria Bertani
  • SD Sabouraud dextrose
  • yeast medium yeast medium
  • the cell medium contains
  • a standard cell culture condition is regulated as described above can be used as a culture condition for the isoprenoid compound-producing microorganism.
  • a culture temperature can be 20 to 40°C, and a pH value can be about 4.5 to about 9.5.
  • the isoprenoid compound-producing microorganism can be cultured under an aerobic, oxygen-free, or anaerobic
  • a known fermentation method such as a batch cultivation method, a feeding cultivation method or a continuous cultivation method can appropriately be used as a cultivation method.
  • the method of producing the polyisoprene according to the present invention comprises the following (I) and (II): (I) forming an isoprene by the method of the present invention; and
  • the step (I) can be performed in the same manner as in the method of producing an isoprenoid compound, such as the isoprene, linalool, or limonene, according to the present invention described above.
  • the polymerization of the isoprene in the step (II) can be performed by any method known in the art (e.g., synthesis methods such as addition polymerization in organic chemistry) .
  • the rubber composition of the present invention comprises a polymer derived from isoprene produced by the method for producing isoprene according to the present invention.
  • the polymer derived from isoprene may be a homopolymer (i.e., isoprene polymer, or polyisoprene) or a heteropolymer comprising isoprene and one or more monomer units other than the isoprene (e.g., a copolymer such as a block copolymer) .
  • the polymer derived from isoprene is a homopolymer (i.e., polyisoprene) produced by the method for producing polyisoprene according to the method of the present invention.
  • the rubber composition of the present invention may further comprise one or more polymers other than the above polymer, one or more rubber components, and/or other components.
  • the rubber composition of the present invention may further comprise one or more polymers other than the above polymer, one or more rubber components, and
  • composition of the present invention can be manufactured using the polymer derived from isoprene.
  • the rubber composition of the present invention can be prepared by mixing the polymer derived from isoprene with one or more polymers other than the above polymer, one or more rubber components, and/or other components such as a reinforcing filler, a crosslinking agent, a vulcanization accelerator and an antioxidant.
  • the tire of the present invention is manufactured by using the rubber composition of the present invention.
  • the rubber composition of the present invention may be applied to any portion of the tire without limitation, which may be selected as appropriate depending on the application thereof.
  • the rubber composition of the present invention may be used in a tread, a base tread, a sidewall, a side reinforcing rubber and a bead filler of a tire.
  • the tire can be manufactured by a conventional method. For example, a carcass layer, a belt layer, a tread layer, which are composed of unvulcanized rubber, and other members used for the production of usual tires are successively laminated on a tire molding drum, then the drum is withdrawn to obtain a green tire. Thereafter, the green tire is heated and vulcanized in accordance with an ordinary method, to thereby obtain a desired tire (e.g., a pneumatic tire) .
  • a desired tire e.g., a pneumatic tire
  • SWITCH- PphoC/IspSM SWITCH-PpstS/IspSM
  • SWITCH- Para/IspSM arabinose-inducible isoprenoid compound-producing microorganism
  • a nucleotide sequence and an amino acid sequence of mvaE encoding acetyl-CoA acetyltransferase and
  • Enterococcus faecalis have been already known (Accession number of nucleotide sequence: AF290092.1 , ( 1479..3890 ) , Accession number of amino acid sequence: AAG02439) (J.
  • nucleotide sequence is shown as SEQ ID NO: 22.
  • the mvaE gene was chemically synthesized, then was cloned into pUC57 (supplied from GenScript) , and the resulting plasmid was designated as pUC57-EFmvaE .
  • nucleotide sequence encoding hydroxymethylglutaryl- CoA synthase and derived from Enterococcus faecalis, and its amino acid sequence have been already known (Accession number of nucleotide sequence: AF290092.1, complement
  • Enterococcus faecalis and the nucleotide sequence of its gene are shown as SEQ ID NO: 23 and SEQ ID NO: 24,
  • EFmvaS This nucleotide sequence is shown as SEQ ID NO: 25.
  • the mvaS gene was chemically synthesized, then was cloned into pUC57 (supplied from GenScript) , and the resulting plasmid was designated as pUC57-EFmvaS .
  • An expression vector for arabinose-inducible gene upstream of the mevalonate pathway was constructed by the following procedure. PCR with plasmid pKD46 as the
  • PCR with plasmid pUC57-EFmvaE as the template was carried out using synthesized oligonucleotides shown as SEQ ID NO: 26 and SEQ ID NO: 27 as primers to obtain a PCR fragment containing Para composed of araC and an araBAD promoter derived from E. coli.
  • PCR with plasmid pUC57-EFmvaE as the template was carried out using
  • PCR with plasmid pUC57-EFmvaS as the template was carried out using synthesized oligonucleotides shown as SEQ ID NO: 30 and SEQ ID NO: 31 as primers to obtain a PCR fragment containing the EFmvaS gene.
  • PCR with plasmid pSTV-Ptac-Ttrp ( O2013069634A1 ) as the template was carried out using synthesized oligonucleotides shown as SEQ ID NO:
  • a reaction solution was prepared according to a composition attached to a kit, and DNA was amplified through 30 cycles of reactions at 98°C for 10 seconds, 55°C for 5 seconds and 72°C for one minute per kb. PCR with the purified PCR product
  • oligonucleotides shown as SEQ ID NO: 26 and SEQ ID NO: 29 as primers and PCR with the purified PCR product containing the EFmvaS gene and PCR product containing Ttrp as the template was carried out using synthesized oligonucleotides shown in SEQ ID NO: 30 and SEQ ID NO: 33 as primers.
  • a PCR product containing Para and the EFmvaE gene and a PCR product containing the EFmvaS gene and Ttrp were obtained.
  • a plasmid pMW219 (supplied from Nippon Gene Co., Ltd.) was digested with Smal according to a standard method.
  • the resulting plasmid was designated as pMW- Para-mvaES-Ttrp .
  • TcR-XattR vector Minaeva NI et al., BMC Biotechnol., 2008;
  • a set of plasmids for chromosome fixation, which retained the mvaES gene under the control of a different promoter was constructed.
  • a polylinker containing I-Scel, Xhol, Pstl and Sphl recognition sites was inserted into unique Hindlll recognition site located upstream of the mvaES gene.
  • annealing was carried out using the primers 1, 2 (Table 1) and polynucleotide kinase. After that the
  • pAH162-mvaES plasmid cleaved with Hindlll by a ligation reaction.
  • the resulting pAHl62-MCS-mvaES plasmid (FIG. 3) is convenient for cloning of a promoter while a desired orientation is kept before the mvaES gene.
  • DNA fragments retaining a regulatory region of a lldD, phoC and pstS genes were formed by PCR with genomic DNA from P.ananatis SC17(0) strain (Katashkina JI et al .
  • a Ptac promoter was inserted into a Hindlll-Sphl recognition site of the pAH162-AattL-Tc R -AattR vector
  • the DNA sequence including synthesized KDyl operon is shown in SEQ ID NO: 58.
  • the resulting plasmid pAH162-Tc-Ptac-KDyI retaining a Ptac- KDyl expression cassette is shown in FIG. 8(A).
  • AampC : attB P hi8o AampH : : attB P hiso Acrt : : Ptac-mvk ⁇ M.
  • flanked by a 40 bp region homologous to a target site in genome was carried out according to the previously
  • AampC : attB P hi8o
  • AampH : attB ph i8o via a genome DNA
  • tetracycline resistant gene tetRA as the marker.
  • Vector part of the pAH162-Ptac-mvk (M. paludicola) integrative plasmid including tetRA marker genes was eliminated using the reported pMW-intxis-cat helper plasmid (Katashkina JI et al., BMC Mol Biol., 2009; 10: 34).
  • SC17(0) AampH: : attB v eo AampC : : attB ⁇ o Acrt : : Ptac-mvk (M. paludicola) with deletion of the marker gene was obtained.
  • a map of the modified genome of Acrt : : Ptac-mvk (Af. paludicola) is shown in FIG. 11 (B) .
  • the pAH162-Km-Ptac-KDyI plasmid was integrated into a chromosome of SC17(0) AampH : : attB ⁇ p 8 o AampC : : attBcp 8 o
  • AampH integrated into AampH : : attB p80 or AampC : : attBcp 80 m were chosen.
  • pAH162-Px-mvaES (here, Px is one of the following regulatory regions: araC-P ara ⁇ E.coli), Pn d D, Pphoc, Ppsts) was inserted into the attB phi8 o site of SC17(0) AampC : : pAH162- Km-Ptac-KDyl AampH : : attB phi8 o Acrt : : Ptac-mvk (M. paludicola) and SC17(0) AampC : : attB phi80 AampH : : pAHl 62-Km-Ptac-KDyI
  • SWITCH-Px-l and SWITCH-Px-2 were obtained.
  • Maps of the modified chromosomes of AampH : : pAHl 62-Px-mvaES and AampC : : pAH162-Px-mvaES are shown in FIG. 13.
  • Electrocompetent cells of SWITCH strains were prepared accoridng to a standard method, and pSTV28-Ptac-IspSM
  • SWITCH- Para/IspSM SWITCH-Plld/IspSM
  • SWITCH-PpstS/IspS SWITCH-PphoC/IspSM.
  • the gcd gene in P. ananatis codes for glucose
  • Genomic DNA of the SC17(0)Agcd strain is isolated using the Wizard Genomic DNA Purification Kit (Promega) and electro-transformed into the marker-less derivative of the SWITCH-PphoC strain according to the previously described method [Katashkina JI et al., BMC Mol Biol. 2009; 10:34].
  • the SWITCH-PphoC-Agcd (KmR) strain is obtained.
  • the primers gcd-tl and gcd-t2 (Table 2) are used for PCR analysis of the obtained integrant.
  • a one liter volume fermenter was used for cultivation of isoprenoid compound-producing microorganisms (SWITCH- PphoC/IspSM and SWITCH-PphoCAgcd/IspS ) .
  • Glucose medium was conditioned in a composition shown in Table 3.
  • Each of these isoprenoid compound-producing microorganisms was applied onto an LB plate containing chloramphenicol (60 mg/L) , and cultured at 34°C for 16 hours.
  • 0.3 L of the glucose medium was added to the one liter volume fermenter, and microbial cells that had sufficiently grown on the one LB plate were inoculated thereto to start the cultivation.
  • pH was 7.0 (controlled with ammonia gas)
  • temperature was 30°C
  • a concentration of oxygen in culture medium (dissolved oxygen (DO) ) was measured using a galvanic type DO sensor SDOU model (ABLE Cooperation) , ' and was controlled with stirring so that a DO value was 5%.
  • DO dissolved oxygen
  • a glucose solution adjusted at 500 g/L was continuously added so that a concentration of glucose in the culture medium was 10 g/L or higher.
  • the DO value was measured at 600 nm using a spectrophotometer (HITACHI U- 2900) .
  • SWITCH-PphoC/IspSM and SWITCH-PphoCAgcd/IspSM consumed 63.9 g and 77.8 g of glucose, respectively.
  • Each 0.15 L was prepared for Group A and Group B and sterilized with heating at 115°C for 10 minutes. After cooling, Group A and Group B were mixed, and
  • chloramphenicol 60 mg/L was added thereto to use as the medium.
  • a phosphorus-deficient isoprenoid compound-producing microorganism expresses genes upstream of a mevalonate pathway with a phosphorus deficiency-inducible promoter. ⁇ Thus, when a concentration of phosphorus in the medium is equivalent to or below a certain concentration, an amount of produced isoprene is remarkably increased.
  • a concentration of isoprene in fermentation gas was measured using a multi-gas analyzer (supplied from GASERA, F10) .
  • Culture supernatant was diluted with pure water to 10 times, and filtrated through a 0.45 ⁇ filter followed by being analyzed according to the following method using a high performance liquid chromatograph ELITE LaChrom
  • Buffer 20 mM Bis-Tris aqueous solution containing 5 mM p- toluenesulfonic acid and 100 ⁇ EDTA
  • SWITCH-PphoC/IspSM and SWITCH-PphoCAgcd/IspSM were cultured according to the jar cultivation condition as described above, and amounts of produced isoprene were measured.
  • SWITCH-PphoC/IspSM exhibited a decreased O.D. value when production of isoprene was started (FIG.14 (A)), and accumulated 30.9 g/L of 2-ketogluconic acid in the cultivation for 48 hours (FIG.15).
  • SWITCH-PphoCAgcd/IspSM exhibited a constant O.D. value even after starting the production of isoprene (FIG.1 (A)), and an accumulated amount of 2-ketogluconic acid in the cultivation for 48 hours was 1.4 g/L, which was an extremely low amount
  • nucleotide sequence of opt_AaLINS is shown in SEQ ID NO: 3.
  • DNA in which a tac promoter region (deBoer, et al., (1983) Proc. Natl. Acad. Sci. USA., 80, 21-25) had been added to the opt_AaLINS gene was chemically synthesized, cloned into p H9 (supplied from Nippon Gene) and the resulting plasmid was designated as pMW119-Ptac-opt_AaLINS .
  • nucleotide sequence of opt_CsLINS is shown in SEQ ID NO: 6.
  • Farnesyl diphosphate synthase derived from Escherichia coli is encoded by an ispA gene (SEQ ID NO: 7) (Fujisaki S., et al. (1990) J. Biochem. (Tokyo) 108 : 995-1000) .
  • SEQ ID NO: 7 ispA gene (SEQ ID NO: 7) (Fujisaki S., et al. (1990) J. Biochem. (Tokyo) 108 : 995-1000) .
  • the ispA * gene was chemically synthesized, subsequently cloned into pMW119 (supplied from Nippon Gene) and the resulting plasmid was designated as pMW119-ispA * .
  • PCR with pMWH9-Ptac-opt_AaLINS as a template was carried out using primers shown in SEQ ID NO: 9 and SEQ ID NO: 11 to obtain a Ptac-opt_AaLINS fragment.
  • PCR with pMW119-ispA * as a template was carried out using primers shown in SEQ ID NO: 12 and SEQ ID NO: 13 to obtain an ispA * fragment.
  • the purified Ptac-opt_AaLINS fragment and ispA * fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes Pstl and Seal using In-Fusion HD cloning kit (supplied from
  • Clontech Clontech to construct pACYC177-Ptac-opt_AaLINS-ispA * .
  • PCR with pMWH9-Ptac-opt_CsLINS as a template was carried out using primers shown in SEQ ID NO: 9 and SEQ ID NO: 14 to obtain a Ptac-opt_CsLINS fragment.
  • PCR with pMW119-ispA * as a template was carried out using primers shown in SEQ ID NO: 15 and SEQ ID NO: 13 to obtain an ispA * fragment.
  • the purified Ptac-opt_CsLINS fragment and ispA * fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes Pstl and Seal using In-Fusion HD cloning kit (supplied from Clontech) to construct pACYC177-Ptac-opt_CsLINS-ispA * .
  • Competent cells of SWITCH-PphoC Aged were prepared, and pACYC177, pACYC177-Ptac-opt_AaLINS-ispA * or pACYC177- Ptac-opt_CsLINS-ispA * was introduced thereto by
  • SWITCH-PphoC competent cells of SWITCH-PphoC were prepared, and pACYC177, pACYC177-Ptac-opt_AaLINS-ispA * or pACYC177-Ptac-opt_CsLINS-ispA * was introduced thereto by electroporation. Resulting strains were designated as SWITCH-PphoC/pACYC177, SWITCH-PphoC/AaLINS-ispA * and
  • SWITCH-PphoC/CsLINS-ispA * SWITCH-PphoC/CsLINS-ispA * .
  • Example 3 Evaluation of ability to produce linalool by linalool synthase-expressing strains derived from SWITCH- PphoC strain
  • Subseguently 50 ⁇ , of a microbial cell suspension from each strain was evenly applied onto an LB plate containing 50 mg/L of kanamycin, and cultured at 34 °C for 16 hours.
  • the resulting microbial cells on the plate were picked up in an amount corresponding to about 1/4 of a loop part of a 10 ⁇ i ⁇ L inoculating loop (supplied from Thermo Fisher Scientific Inc.).
  • the picked up microbial cells were inoculated to 5 inL of fermentation medium described in Table 4 containing 50 mg/L of kanamycin in a test tube supplied from AGC
  • linalool concentrations in the isopropyl myristate and culture supernatant were measured under the following condition using a gas chromatograph GC-2025AF (supplied from Shimadzu Corporation) .
  • DB-5 supplied from Agilent, length 30 m, internal diameter 0.25 mm, thickness 0.25 ⁇
  • a linalool standard solution was prepared using a reagent Linalool (supplied from Wako Pure Chemical Industries Ltd.).
  • the concentration of linalool is shown as a value in terms of medium amount.
  • a mean value of results obtained from two test tubes is shown in Table 5.
  • Example 4 Evaluation of ability to produce linalool by linalool synthase-expressing strains derived from SWITCH- PphoC Aged strain
  • SWITCH-PphoC Aged/AaLINS-ispA * , SWITCH-PphoC Agcd/CsLINS-ispA * and SWITCH-PphoC
  • linalool concentrations in the isopropyl myristate and culture supernatant were measured under the following condition using a gas chromatograph GC-2025AF (supplied from Shimadzu Corporation) .
  • DB-5 supplied from Agilent, length 30 m, internal diameter 0.25 mm, thickness 0.25 ⁇
  • a linalool standard solution was prepared using a reagent Linalool (supplied from Wako Pure Chemical Industries Ltd.).
  • the concentration of linalool is shown as a value in terms of medium amount.
  • a mean value of results obtained from two test tubes is shown in Table 7. No linalool production was observed in the control strain having the introduced control vector pACYC177, whereas the linalool production was confirmed in SWITCH-PphoC Aged/AaLINS-ispA* and SWITCH-PphoC Agcd/CsLINS-ispA* strains.
  • PsLMS limonene synthase
  • opt_PsLMS chloroplast localization signal
  • SEQ ID " NO: 63 A nucleotide sequence of opt_PsLMS is shown in SEQ ID " NO: 63. After opt_PsLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_PsLMS .
  • a nucleotide sequence of opt_AgLMS is shown in SEQ ID NO: 66. After opt_AgLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was. designated as pUC57-opt_AgLMS . [0166]
  • MsLMS limonene synthase
  • a nucleotide sequence of opt_MsLMS is shown in SEQ ID NO: 69. After opt_MsLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_MsLMS .
  • a nucleotide sequence of opt_CuLMS is shown in SEQ ID NO: 72. After opt_CuLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_CuLMS .
  • C1LMS limonene synthase
  • opt_ClLMS A nucleotide sequence of opt_ClLMS is shown in SEQ ID NO: 75. After opt_ClLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_ClLMS .
  • PCR with pUC57-opt_PsLMS as a template was carried out using primers shown in SEQ ID NO: 76 and SEQ ID NO: 77. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 77 to obtain a Ptac-opt_PsLMS fragment. Further, PCR with
  • pMW119-ispA * as a template was carried out using primers shown in SEQ ID NO:79 and SEQ ID NO:80 to obtain an ispA * fragment.
  • the purified Ptac-opt_PsLMS fragment and ispA * fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
  • PCR with pUC57-opt_AgLMS as a template was carried out using primers shown in SEQ ID- O: 81 and SEQ ID NO:82. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 82 to obtain a Ptac-opt_AgL S fragment. Further, PCR with
  • pM 119-ispA * as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA * fragment.
  • the purified Ptac-opt_AgLMS fragment and ispA * fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
  • PCR with pUC57-opt_MsLMS as a template was carried out using primers shown in SEQ ID NO: 83 and SEQ ID NO: 84. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 84 to obtain a Ptac-opt_MsL S fragment. Further, PCR with
  • pMW119-ispA * as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA * fragment.
  • the purified Ptac-opt_MsLMS fragment and ispA * fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
  • PCR with pUC57-opt_CuLMS as a template was carried out using primers shown in SEQ ID NO: 85 and SEQ ID NO: 86. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 86 to obtain a Ptac-opt_CuLMS fragment. Further, PCR with
  • p W119-ispA * as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA * fragment.
  • the purified Ptac-opt_CuL S fragment and ispA * fragment were ligated to pACYC177 (supplied from Nippon
  • PCR with pUC57-opt_ClLMS as a template was carried out using primers shown in SEQ ID NO: 87 and SEQ ID NO: 88. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 88 to obtain a Ptac-opt_ClLMS fragment. Further, PCR with
  • pMW119-ispA * as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA * fragment.
  • the purified Ptac-opt_ClLMS fragment and ispA * fragment were ligated to pACYC177 (supplied from Nippon
  • Competent cells of SWITCH-PphoC Aged were prepared, and pACYC177, pACYC177-Ptac-opt_PsLMS-ispA * , pACYC177-Ptac- opt_AgLMS-ispA * , pACYC177-Ptac-opt_MsLMS-ispA% pACYC177- Ptac-opt_CuLMS-ispA * or pACYC177-Ptac-opt_ClLMS-ispA * was introduced thereto by electroporation .
  • SWITCH-PphoC Agcd/pACYC177 SWITCH-PphoC Agcd/PsLMS-ispA * , SWITCH-PphoC Agcd/AgLMS-ispA * , SWITCH- PphoC Agcd/MsLMS-ispA * , SWITCH-PphoC Agcd/CuLMS-ispA * and SWITCH-PphoC Agcd/ClLMS-ispA * .
  • Example 6 Evaluation of ability to produce limonene by limonene synthase-expressing strains derived from SWITCH- PphoC Aged strain
  • SWITCH-PphoC Agcd/PsLMS-ispA* SWITCH-PphoC Agcd/AgLMS-ispA*
  • SWITCH-PphoC Agcd/CuLMS-ispA* SWITCH-PphoC
  • the picked up microbial cells were inoculated to 1 mL of limonene fermentation medium described below Table 8 containing 50 mg/L of kanamycin in a head space vial (manufactured by Perkin Elmer, 22ml CLEAR CRIMP TOP VIAL cat # ⁇ 010423 ⁇ ) , and the vial was tightly sealed with a cap with a butyl rubber septum for the headspace vial (CRIMPS (Cat #B0104240) manufactured by Perkin Elmer) .
  • SWITCH-PphoC Agcd/pACYC177 SWITCH-PphoC Agcd/PsL S-ispA*, SWITCH-PphoC Agcd/AgL S-ispA* and SWITCH- PphoCAgcd/ sLMS-ispA* strains were cultured at 30°C on a reciprocal shaking culture apparatus at 120 rpm for 48 hours.
  • SWITCH-PphoC Agcd/pACYC177 , SWITCH-PphoC Agcd/CuLMS- ispA* and SWITCH-PphoC Agcd/ClLMS-ispA* strains were fermented with same manner, cultivation time of these strains were 72 hours.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The object of the present invention is to provide a method of efficiently producing an isoprenoid compound. More specifically, the present invention provides a method of producing an isoprenoid compound including culturing an isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway and a blocked 2-ketogluconate formation pathway in a culture medium to form the isoprenoid compound, and the isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway and a blocked 2-ketogluconate formation pathway.

Description

DESCRIPTION
METHOD OF PRODUCING ISOPRENOID COMPOUND TECHNICAL FIELD
[0001]
The present invention relates to a method for
producing an isoprenoid compound, and the like. BACKGROUND ART
[0002]
Natural rubber is a very important raw material in the industries for production of tire and rubber. While its demand will be expanded in future due to motorization mainly in emerging countries, it is not easy to increase agricultural farms in view of regulation for deforestation and competition with palm plantations. Thus, it is
difficult to anticipate a yield increase of the natural rubber, and the balance of the demand and supply of the natural rubber is predicted to become tight. Synthesized polyisoprene is available as a material in place of the natural rubber. Its raw material is an isoprene monomer (commonly and hereinafter referred to as "isoprene") .
Isoprenoid compounds such as the isoprene (2-methyl-l, 3- butadiene) are mainly obtained by extracting from a C5 fraction obtained by cracking of naphtha. However in recent years, with the use of light feed crackers, an amount of produced isoprene tends to decrease and its supply is concerned. Also in recent years, since variation of oil price influences greatly, it is requested to
establish a system in which isoprene derived from non-oil sources is produced inexpensively in order to ensure the stable supply of isoprene. [0003]
Isoprenoid compounds such as isoprene can be
biologically synthesized in microorganisms by utilizing dimethylallyl diphosphate (D APP) as a material. The microorganisms may inherently possess a methylerythritol (MEP) pathway or a mevalonate (MVA) pathway as a DMAPP supplying pathway. Also, these pathways can be introduced into the microorganisms by transforming the microorganisms with an expression vector or expression vectors for enzymes involved in these pathways.
[0004]
Meanwhile, it is known that certain microorganisms form 2-ketogluconate under an aerobic condition (Non-patent Literature 1) . In a 2-ketogluconate formation pathway, glucose is oxidized by a glucose dehydrogenase to form gluconate, and then the gluconate is oxidized by a
gluconate 2-keto-dehydrogenase to form NADPH and 2- ketogluconate .
[0005]
In addition, it is known that microorganisms in which an activity of glucose dehydrogenase (an enzyme involved in the 2-ketogluconate formation pathway) utilizing
pyrroloquinoline quinone as a coenzyme is decreased are useful for producing L-amino acid (Patent Literature 1) .
[0006]
However, the relationship between the 2-ketogluconate formation pathway and the biological synthesis of the isoprenoid compound is not known. PRIOR ART REFERENCES PATENT LITERATURES
[0007]
Patent Literature 1: International Publication NON-PATENT LITERATURES
[0008]
Non-Patent Literature 1: Irina G. Andreeva, Lyubov I. Golubeva, Tatiana M. Kuvaeva, Evgueni R. Gak, Joanna I. Katashkina and Sergey V. Mashko, FEMS Microbiology Letters 318(1), 55-60, 2011
DISCLOSURE OF INVENTION PROBLEM TO BE SOLVED BY THE INVENTION
[0009]
The object of the present invention is to provide a method of efficiently producing an isoprenoid compound. MEANS FOR SOLVING PROBLEM
[0010]
As a result of an extensive study, the present inventors have found that production of an isoprenoid compound can be promoted by blocking the 2-ketogluconate formation pathway, and the like. More specifically, the present inventors have found that the isoprenoid compound can be efficiently produced by culturing an isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate (DMAPP) or isopentenyl diphosphate (IPP) supplying pathway and a blocked 2-ketogluconate formation pathway in a culture medium, and the like, and have completed the present invention.
[0011]
That is, the present invention is as follows.
[1] A method of producing an isoprenoid compound,
comprising culturing an isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway and a blocked 2- ketogluconate formation pathway in a culture medium to form the isoprenoid compound.
[2] The method as described above, wherein the 2- ketogluconate formation pathway is blocked by reducing a glucose dehydrogenase activity.
[3] The method as described above, wherein a gene encoding a glucose dehydrogenase is disrupted in the isoprenoid compound-producing microorganism.
[4] The method as described above, wherein the
dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway is a methylerythritol phosphate pathway.
[5] The method as described above, wherein the
dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway is a mevalonate pathway.
[6] The method as described above, wherein the isoprenoid compound-producing microorganism is a microorganism that is capable of synthesizing pyrroloquinoline quinone or using pyrroloquinoline quinone included in culture environment.
[7] The method as described above, wherein the isoprenoid compound-producing microorganism is cultured under an aerobic condition.
[8] The method as described above, wherein the isoprenoid compound-producing microorganism includes a heterogeneous expression unit comprising a polynucleotide encoding an isoprenoid compound-synthetic enzyme and a promoter
operatively linked thereto.
[9] The method as described above, wherein the isoprenoid compound-synthetic enzyme is an isoprene synthase, a geranyl diphosphate synthase, a farnesyl diphosphate synthase, a linalool synthase, or a limonene synthase.
[10] The method as described above, wherein the isoprenoid compound-producing microorganism is a microorganism
belonging to the family Enterobacteriaceae. [11] The method as described above, wherein the
microorganism belonging to the family Enterobacteriaceae is a bacterium belonging to the genus Pantoea.
[12] The method as described above, wherein the bacterium belonging to the genus Pantoea is Pantoea ananatis.
[13] The method as described above, wherein the isoprenoid compound is isoprene, linalool, or limonene.
[14] An isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway and a blocked 2-ketogluconate formation pathway.
[15] The microorganism as described above, wherein the 2- ketogluconate formation pathway is blocked by reducing a glucose dehydrogenase activity.
[16] A method of producing a polyisoprene comprising:
(I) forming the isoprene by the method according to the method described above; and
(II) polymerizing the isoprene to form the polyisoprene.
[17] The method as described above, wherein the
polyisoprene is a cis-polyisoprene .
[18] The method as described above, wherein the cis- polyisoprene has a purity of 95% (by weight) or more.
[19] A polymer derived from the isoprene produced by the method as described above.
[20] A rubber composition comprising the polymer as
described above.
[21] A tire manufactured by using the rubber composition as described above. EFFECT OF THE INVENTION
[0012]
According to the present invention, it is possible to produce an isoprenoid compound effectively. BRIEF DESCRIPTION OF DRAWINGS
[0013]
FIG. 1 indicates a pAH162-Para-mvaES plasmid
possessing an mvaES operon derived from E. faecalis under control of E. coli Para promoter and a repressor gene araC;
FIG. 2 indicates a map of pAH162-mvaES;
FIG. 3 indicates a plasmid for chromosome fixation of pAH162-MCS-mvaES.
FIG. 4 indicates a set of plasmids for chromosome fixation which possess an mvaES gene under transcription control of (A) PiidD, (B) Pphoc, or (C) Ppsts;
FIG. 5 indicates an outline for construction of a pAH162-XattL-KmR-XattR vector;
FIG. 6 indicates a pAH162-Ptac expression vector for chromosome fixation;
FIG. 7 indicates codon optimization in a KDyl operon obtained by chemical synthesis;
FIG. 8 indicates plasmids (A) pAH162-Tc-Ptac-KDyI and (B) pAH162-Km-Ptac-KDyI for chromosome fixation, which retain the KDyl operon with codon optimization;
FIG. 9 indicates a plasmid for chromosome fixation, which retains a mevalonate kinase gene derived from M.
paludicola;
FIG. 10 indicates maps of genome modifications of (A)
AampC : : attBphi80/ (B) AampH : : attBphi8o^ and (C) Acrt : : attBphi8o;
FIG. 11 indicates maps of genome modifications of (A) Acrt : :pAHl62-Ptac-mvk (X) and (B) Acrt : : Ptac-mvk (X) ;
FIG. 12 indicates maps of chromosome modifications of (A) AampH: :pAHl62-Km-Ptac-KDyI, (B) AampC : : pAH162-Km-Ptac- KDyl and (C) AampC : : Ptac-KDyl ;
FIG. 13 indicates maps of chromosome modifications of (A) AampH: : pAH162-Px-mvaES and (B) AampC: :pAH162-Px-mvaES; FIG . 14 indicates (A) growth and (B) amounts of formed isoprene (mg/batch) in cultures of a phosphorus deficient type isoprenoid compound-producing microorganism in which glucose dehydrogenase gene (gcd gene) is disrupted (SWITCH- PphoC Agcd/ispSM) ; and
FIG. 15 indicates changes in accumulated gluconate in culture broth over time in a phosphorus deficient type isoprenoid compound-producing microorganism in which gcd gene is disrupted (SWITCH-PphoC Agcd/ispSM) .
EMBODIMENTS FOR CARRYING OUT THE INVENTION
[0014]
The present invention provides a method of producing an isoprenoid compound, and an isoprenoid compound- producing microorganism modified to produce the isoprenoid compound in the method.
[0015]
The isoprenoid compound includes one or more isoprene units which have the molecular formula (C5H8)n. The
precursor of the isoprene unit may be isopentenyl
pyrophosphate or dimethylallyl pyrophosphate. More than 30,000 kinds of isoprenoid compounds have been identified and new compounds have been identified. Isoprenoids are also known as terpenoids. The difference between terpenes and terpenoids is that terpenes are hydrocarbons, whereas terpenoids may contain additional functional groups.
However, hereinafter, the terms "isoprenoid", "isoprenoid compound", "isoprenoid product", "terpene", "terpene
compound", "terpenoid", and "terpenoid compound" are used interchangeably. They refer to compounds that are capable of being derived from isopentenyl diphosphate or
dimethylallyl diphosphate. Terpenes are classified by the number of isoprene units in the molecule: hemiterpenes (C5), monoterpenes (CIO), sesquiterpenes (C15), diterpenes (C20), sesterterpenes (C25) , triterpenes (C30), sesquarterpenes (C35) , tetraterpenes (C40), polyterpenes , norisoprenoids, for example. Examples of monoterpenes include pinene, nerol, citral, camphor, menthol, limonene, carvone and linalool. Examples of sesquiterpenes include nerolidol, valencene, nootkatone and farnesol. Examples of diterpenes include phytol and vitamin Al . Squalene is an example of a triterpene, and carotene (provitamin Al) is a tetraterpene (Nature Chemical Biology 2, 674 - 681 (2006), Nature
Chemical Biology 5, 283 - 291 (2009) Nature Reviews
Microbiology 3, 937-947 (2005), Adv Biochem Eng Biotechmol (DOI: 10.1007/10_2014_288) . Preferably, the isoprenoid compound is an isoprene (monomer), a linalool (in the (R)- form known as licareol ( ( 3R) -3 , 7-dimethylocta-l , 6-dien-3- ol) and the (S)-form known as coriandrol ((3S)-3,7- dimethylocta-1, 6-dien-3-ol) , and a limonene ((4R)-(+)- limonene and (4S) -(-) -limonene) .
[0016]
The method of the present invention comprises
culturing an isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isopentenyl
diphosphate supplying pathway and a blocked 2-ketogluconate formation pathway in a culture medium to form the
isoprenoid compound.
[0017]
The isoprenoid compound-producing microorganism has a dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway. Dimethylallyl diphosphate (DMAPP) has been known to be a substrate of isoprene synthesis and a precursor of peptide glycan and an electron acceptor, such as menaquinone and the like, and to be essential for growth of microorganisms (Fujisaki et al . , J. Biochem., 1986; 99: 1137-1146) . Examples of the dimethylallyl diphosphate or isopentenyl diphosphate supplying pathway include a
methylerythritol phosphate (MEP) pathway and a mevalonate (MVA) pathway.
[0018]
IPP and DMAPP, which are building-block of the
isoprenoid compound (e.g., DMAPP is a substrate of isoprene synthesis) , is typically biosynthesized via either a methylerythritol phosphate pathway or a mevalonate pathway inherently or natively possessed by a microorganism.
Therefore, in the view point of DMAPP supply for
efficiently producing the isoprenoid compound, the
methylerythritol phosphate pathway and/or the mevalonate pathway may be enhanced in the isoprenoid compound- producing microorganism used in the present invention, as described later.
[0019]
The isoprenoid compound-producing microorganism has a blocked 2-ketogluconate formation pathway. In the 2- ketogluconate formation pathway, glucose is oxidized by a glucose dehydrogenase (GCD) to form gluconate, and then the gluconate is oxidized by a gluconate 2-keto-dehydrogenase to form NADPH and 2-ketogluconate. Therefore, the
isoprenoid compound-producing microorganism having a blocked 2-ketogluconate formation pathway can be obtained by reducing activity of one or more enzymes selected from the group consisting of the glucose dehydrogenase and gluconate 2-keto-dehydrogenase in an isoprenoid compound- producing microorganism. Preferably, the 2-ketogluconate formation pathway is blocked in the isoprenoid compound- producing microorganism by reducing enzymatic activity. That is, the isoprenoid compound-producing microorganism has the reduced enzymatic activity of one or more enzymes selected from the group consisting of the glucose
dehydrogenase and gluconate 2-keto-dehydrogenase , so that the 2-ketogluconate formation pathway is blocked in the microorganism.
[0020]
Examples of the reduced enzymatic activity in a microorganism include decrease and complete loss of an activity of an enzyme. Also, examples of the reduced enzymatic activity in a microorganism includes decrease and complete loss of an expression amount of an enzyme in a microorganism since such decrease or complete loss leads to decrease or complete loss of an enzymatic activity
possessed by the microorganism. The reduced enzymatic activity in a microorganism can be accomplished by, for example, disrupting a gene encoding the enzyme; a gene encoding a factor capable of regulating an expression or activity of the enzyme; an expression regulatory region such as a transcriptional regulatory region located
upstream to these genes and a translational regulatory region (e.g.; promoter and Shine-Dalgarno (SD) sequence); or an untranslated region. The disruption of the above gene or region can be performed by modifying a genomic region corresponding to the gene or region so as to
decrease or completely lose an expression or activity of the enzyme. Examples of such a modification include, but are not limited to, deletion of a part or all of the genomic region, insertion of a polynucleotide into the genomic region, and replacement of the genomic region with another polynucleotide.
[0021]
The isoprenoid compound-producing microorganism is preferably a microorganism that is capable of synthesizing pyrroloquinoline quinone (PQQ) or using PQQ included in culture environment.
[0022]
The isoprenoid compound-producing microorganism is preferably a microorganism having reduced activity of glucose dehydrogenase, and more preferably a microorganism having reduced activity of glucose dehydrogenase that uses PQQ as a coenzyme.
When the isoprenoid compound-producing microorganism is a microorganism obtained by transforming a host
microorganism originally having the 2-ketogluconate
formation pathway with an expression vector comprising the gene encoding an isoprenoid compound-synthetic enzyme, the microorganism is preferably modified to block the 2- ketogluconate formation pathway.
For example, microorganism belonging to the family
Enterobacteriaceae such as Escherichia coli has a gene encoding glucose dehydrogenase and produces GCD apoenzyme, but since the microorganism does not have production ability of PQQ, it does not have GCD activity in the absence of PQQ. However, it is known that if a foreign gene is expressed in a microbial cell, an alternative substance of PQQ is generated and the substance exhibits GCD activity (WO2006/183898 ) . The above host microorganism "originally having GCD activity" includes microorganisms such as the microorganism belonging to the family
Enterobacteriaceae that acquire GCD activity.
[0023]
The modification to block the 2-ketogluconate
formation pathway is preferably a modification to reduce the activity of the glucose dehydrogenase, and more
preferably, a modification to reduce the activity of the glucose dehydrogenase that uses PQQ as coenzyme. The modification can be performed so that GCD activity per cell of the modified microorganism is lower than that of an unmodified strain such as a wild type strain belonging to the family Enterobacteriaceae. For example, it may be confirmed that a molecular weight of GCD per cell or GCD activity per molecule of the modified strain is lower than those of the wild strain. The GCD activity per cell of the modified strain and the wild strain can be compared, for example, by comparing GCD activity contained in cell extract composition of both strains cultured under the same condition. Examples of the wild type of the microorganism belonging to the family Enterobacteriaceae that can be used as comparison (control) may include Pantoea ananatis
AJ13355 (FERM BP-6614), Pantoea ananatis SC17 strain (FERM BP-11901), and Pantoea ananatis SC17 (0) strain (Katashkina JI et al., BMC Mol Biol., 2009; 10: 34 VKPM B-9246) .
[0024]
The activity of the glucose dehydrogenase that uses PQQ as a coenzyme refers to an activity catalyzing the following reaction (the same meaning shall apply
hereinafter) .
[0025]
β-D-glucose + oxidized PQQ → D-5-gluconolactone + reduced PQQ
[0026]
The GCD activity can be measured, for example, on the basis of detection of generation of the reduced DCPIP through the following reactions by measuring absorbance in 600 nm ( JP2007-129965; the same meaning shall apply
hereinafter) .
[0027]
D-glucose + oxidized PMS → D-glucose-1 , 5-lactose + reduced PMS
reduced PMS + oxidized DCPIP → oxidized PMS + reduced DCPIP
PMS : phenazine methosulfate
DCPIP: 2,6- dichlorophenol- indophenol
[0028]
The activity of the glucose dehydrogenase can be reduced by disrupting a gene encoding a glucose
dehydrogenase (gcd gene) , a gene encoding a factor capable of regulating an expression or activity of GCD, or a transcriptional regulatory region located upstream to these genes.
[0029]
The gcd gene is preferably the one or more
polynucleotide selected from the group consisting of the following [x]-[z]:
[x] a polynucleotide comprising [i] the nucleotide sequence represented by SEQ ID NO: 59, or [ii] the nucleotide
sequence consisting of the nucleotide residues at positions 300 to 2691 in the nucleotide sequence represented by SEQ ID NO:59;
[y] a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of
[i] or [ii] above, and encodes a protein having a GCD activity; and
[z] a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of [i] or
[ii] above, and encodes a protein having a GCD activity.
[0030]
The nucleotide sequence represented by SEQ ID NO: 59 includes a full length nucleotide sequence of the gcd gene from Pantoea ananatis . The nucleotide sequence represented by SEQ ID NO: 59 can encode the amino acid sequence
represented by SEQ ID NO: 60, and the nucleotide sequence consisting of the nucleotide residues at positions 301 to 2691 (2688) can encode an amino acid sequence of GCD. The identity of the gene, the stringent condition and
polynucleotide are the same as the corresponding
definitions of the polynucleotide of (a) to (x) described below.
[0031]
GCD is preferably one or more protein selected from the group consisting of the following [X]-[Z]:
[X] a protein comprising the full length amino acid
sequence represented by SEQ ID NO: 60;
[Y] a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence represented by SEQ ID NO: 60, and has a GCD activity; or
[Z] a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence represented by SEQ ID NO: 60, and has a GCD activity.
[0032]
The amino acid sequence represented by SEQ ID NO: 60 can comprise the mature GCD. The protein of [Y] or [Z] preferably has GCD activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the GCD activity of the protein comprising the above amino acid sequence when measured under the same condition. The deletion, substitution, addition or insertion, and the identity of the amino acid are the same as the
corresponding definitions of the proteins of (A) to (U) described below.
[0033]
The gcd gene can be cloned by synthesizing an
oligonucleotide based on these sequences, and carrying out PCR reaction using a chromosome of Pantoea ananatis as a template. The gcd gene may be disrupted by homologous recombination. In this case, a gene having for example 80% or more, preferably 90% or more, and more preferably 95% or more identity to the gcd gene on a chromosome may be used. Also, a gene that hybridizes under a stringent condition with the gcd gene on the chromosome may be used. Example of the stringent condition may include washing once, preferably 2-3 times, at salt concentrations corresponding to lxSCC and 0.1% SDS, preferably 0. lxSCC and 0.1% SDS, at 60°C.
[0034]
The gcd gene may be disrupted, for example, by
deletion of an entire target gene and a upstream and downstream part of the target gene on a chromosome;
introducing a substitution of an amino acid (missense mutation) or a insertion of a terminating codon (nonsense mutation) ; or introducing frame shift mutation of addition or deletion one or two nucleotide (Journal of Biological Chemistry 272:8611-8617 (1997) Proceedings of the National Academy of Sciences, USA 95 5511-5515 (1998), Journal of Biological Chemistry 266, 20833-20839 (1991)).
[0035]
The disruption of each gene is preferably performed by genetic recombination. Examples of the method using gene recombination may include deleting all or part of an expression regulatory region (e.g.; promoter region, coding region or non-coding region) or insertion a polynucleotide into the region by utilizing homologous recombination.
[0036]
Disruption of the expression regulatory region can be performed preferably for one or more, more preferably two or more, further preferably three or more. In the deletion of the coding region, the region to be deleted may be an N- terminal region, an internal region or a C-terminal region, or even the entire coding region, so long as the function of the protein to be produced by the gene is reduced.
Generally, Deletion of a longer region can more certainly disrupt a target gene. It is preferable that Reading frames at upstream and downstream of the region to be deleted are not the same.
[0037]
When a polynucleotide is inserted into a coding region, the polynucleotide may be inserted into any region of a target gene. However, insertion of a longer polynucleotide can more certainly disrupt the target gene. It is
preferable that Reading frames at upstream and downstream of the region to be deleted are not the same. The
polynucleotide is not limited so long as the polynucleotide which reduces a function of the protein encoded by the target gene. However, examples of it may include a
transposon carrying an antibiotic-resistant gene or a gene useful for L-amino acid production.
[0038]
Examples of method of mutating the target gene on the chromosome may include the following method. First, a part of the target gene is deleted to produce a mutated gene that cannot produce a protein that can normally function. Next, a microorganism is transformed by the DNA containing the mutated gene to cause a homologous recombination between the mutated gene and the target gene on the
chromosome, and thereby, replace the target gene on the chromosome to the mutated gene. The protein encoded by the obtained mutated target gene, even if it is produced, has a stereostructure different from that of a wild-type protein, and thus, the function thereof is reduced. Such gene disruption based on gene replacement utilizing homologous recombination has been already established. Examples of it may include: methods using linear DNA such as the method called Red-driven integration (Datsenko, K. A, and Wanner, B. L. Proc. Natl. Acad. Sci . USA. 97: 6640-6645 (2000)), a method utilizing Red-driven integration in combination with the delivering system derived from λ phage (Cho, E. H., Gumport, R. I., Gardner, J. F. J. Bacteriol. 184: 5200-5203 (2002)) (WO2005/010175) ; a method using a plasmid having thermosensitive replication origin or a plasmid capable having conjugation transfer ability; or a method utilizing a suicide vector having no replication origin in a host (U.S. patent No. 6303383 or Japanese Patent Laid Open No. Hei5-007491) .
[0039]
Decrease in transcription amount of a target gene can be confirmed by comparing amount of mRNA transcribed from the target gene with that in a wild strain or unmodified strain. Examples of the method for evaluating the amount of mRNA may include northern hybridization and RT-PCR
(Molecular cloning (Cold spring Harbor Laboratory Press,
Cold spring Harbor (USA) , 2001 )) . The transcription amount may be decreased to any extent so long as it decreases compared with that observed in a wild strain or unmodified strain, and, for example, it is preferably decreased to at least 75% or less, 50% or less, 25% or less, or 10% or less, of that observed in a wild strain or unmodified strain,, and it is more preferable that the gene is not expressed at all.
[0040]
Decrease in amount of a protein encoded by a target gene can be confirmed by Western blotting using an antibody that binds to the protein (Molecular cloning (Cold spring Harbor Laboratory Press, Cold spring Harbor (USA) , 2001 )) . The amount of protein may be decreased to any extent so long as it decreases compared with that observed in a wild strain or unmodified strain, for example, it is preferably decreased to at least 75% or less, 50% or less, 25% or less, or 10% or less of that observed in a wild strain or
unmodified strain, and it is more preferable that the protein is not produced at all (the activity is completely disappeared) .
[0041]
Example of the method for decreasing the activity of GCD may include, besides the aforementioned genetic
manipulation techniques, a method of treating a
microorganism belonging to the family Enterobacteriaceae enterobacterium such as a bacteria belonging to the genus Pantoea with ultraviolet irradiation or a mutagen used for usual mutagenesis treatment such as N-methyl-N' -nitro-N- nitrosoguanidine (NTG) or nitrous acid, and selecting a strain showing decreased GCD activity.
[0042]
The activity of GCD can also be reduced by reducing PQQ ability. The PQQ synthesis ability can be reduced, for example, by deleting part or all of pqqABCDEF that is operon required for PQQ biosynthesis of (J. S. Velterop, P. W. Postma, J. Bacteriology 177(17): 5088-5098 (1995)).
[0043]
In the present invention, the isoprenoid compound- producing microorganism can refer to a microorganism having an ability to produce an isoprenoid compound. Preferably, the isoprenoid compound-producing microorganism is a
hemiterpene-producing microorganism, or monoterpene- producing microorganism. More preferably, the isoprenoid compound-producing microorganism is an isoprene-producing microorganism, a linalool-producing microorganism, or a limonene-producing microorganism. [0044]
The isoprenoid compound-producing microorganism can refer to a microorganism transformed with an expression vector comprising the gene encoding an isoprenoid compound- synthetic enzyme. The isoprenoid compound-synthetic enzyme refers to one or more enzymes involved in a synthesis of an isoprenoid compound. Examples of the isoprenoid compound- synthetic enzyme include an isoprene synthase, a geranyl diphosphate synthase, a farnesyl diphosphate synthase, a linalool synthase, amorpha-4 , 11-diene synthase, β- caryophyllene synthase, germacrene A synthase, 8-epicedrol synthase, valencene synthase, (+) -δ-cadinene synthase, germacrene C synthase, (E) -β-farnesene synthase, casbene synthase, vetispiradiene synthase, 5-epi-aristolochene synthase, aristolochene synthase, humulene synthase, (E,E)- -farnesene synthase, (-)-β-ρΐηβηθ synthase, γ-terpinene synthase, limonene cyclase, 1,8-cineole synthase, sabinene synthase, E-a-bisabolene synthase, (+) -bornyl diphosphate synthase, levopimaradiene synthase, abietadiene synthase, isopimaradiene synthase, (E) -γ-bisabolene synthase,
taxadiene synthase, copalyl diphosphate synthase, kaurene synthase, longifolene synthase, γ-humulene synthase, δ- selinene synthase, β-phellandrene synthase, limonene synthase, myrcene synthase, terpinolene synthase, (-)- camphene synthase, (+) -3-carene synthase, syn-copalyl diphosphate synthase, a-terpineol synthase, syn-pimara- 7,15-diene synthase, ent-sandaracopimaradiene synthase, stemar-13-ene synthase, Ε-β-ocimene synthase, S-linalool synthase, geraniol synthase, epi-cedrol synthase, a- zingiberene synthase, guaiadiene synthase, cascarilladiene synthase, cis-muuroladiene synthase, aphidicolan-16β-ο1 synthase, elizabethatriene synthase, santalol synthase, patchoulol synthase, gingerol synthase, cedrol synthase, sclareol synthase, copalol synthase, manool synthase, limonene monooxygenase, carveol dehydrogenase, and the isoprene synthase, geranyl diphosphate synthase, farnesyl diphosphate synthase, linalool synthase, and limonene synthase are preferred.
[0045]
The isoprenoid compound-producing microorganism can be obtained by transforming a host microorganism with a vector for expressing the isoprenoid compound-synthetic enzyme such as the isoprene synthase, linalool synthase, geranyl diphosphate synthase, farnesyl diphosphate synthase, and limonene synthase. Examples of the isoprene synthase may include the isoprene synthase derived from kudzu (Pueraria montana var. lobata) , poplar {Populus alba x Populus
tremula) , mucuna (Mucuna bracteata) , willow (Salix) , false acacia {Robinia pseudoacacia) , Japanese wisteria
(Wisterria) , eucalyptus (Eucalyptus globulus), and tea plant (Melaleuca alterniflora) (see, e.g., Evolution 67 (4), 1026-1040 (2013)). Examples of the linalool synthase may include the linalool synthase derived from hardy kiwi
(Actinidia arguta) , coriander (Coriandrum sativum) ,
silvervine (Actinidia polygama) , strawberry (Fragaria x ananassa) , fairy fans (Clarkia breweri) , thale cress
(Arabidopsis thaliana) , unshu mikan (Citrus unshiu Marc), shiso (Perilla hirtella; Perilla setoensis; Perilla
frutescens var. crispa; Perilla frutescens var. hirtella) , actinomycetes (Streptomyces clavuligerus) , bergamot mint (Mentha citrata) , lavender (Lavandula angustifolia) , sitka spruce (Picea sitchensis) , Norway spruce (Picea abies) , sweet annie (Artemisia annua) , lemon myrtle (Backhousia citriodora) , water mint (Mentha aquatica) , tomato (Solanum lycopersicum) , and apple (Malus domestics) . Examples of the limonene synthase may include the limonene synthase derived from sitka spruce (Picea sitchensis) , grand fir {Abies grandis) , spearmint {Mentha spicata) , hemp {Cannabis sativa) , Norway spruce {Picea abies) , tomato {Solanum lycopersicum) , peppermint {Mentha X piperita) , Ricciocarpos natans, shiso {Perilla frutescens) , Agastache rugose, Unshu mikan {Citrus unshiu) , lemon {Citrus limon) , Schizonepeta tenuifolia, castor oil plant {Ricinus communis) , lavender {Lavandula angustifolia) . Examples of the geranyl
diphosphate synthase and farnesyl diphosphate synthase may include the farnesyl diphosphate synthase derived from
Escherichia coll, Pantoea ananatis or Bacillus
stearothermophilus, the geranyl diphosphate synthase
derived from Streptomyces sp. CL190 (e.g., WO2007/029577A1) , Bacillus stearothermophilus (e.g., JP2000-245482) ,
Geobacillus stearothermophilus, grand fir (Abies grandis) , peppermint {Mentha X piperita) , Norway spruce (Picea abies), Madagascar periwinkle {Catharanthus roseus) ,
Arabidopsis {Arabidopsis thaliana) , snapdragon {Antirrhinum majus) or hop {Humulus lupulus) .
[0046]
The phrase "derived from" as used herein for a nucleic acid sequence such as a gene, a promoter, and the like, or an amino acid sequence such as a protein, can mean a
nucleic acid sequence or an amino acid sequence that are naturally or natively synthesized by a microorganism or can be isolated from the natural or wild-type microorganism.
[0047]
The vector for expressing the isoprenoid compound- synthetic enzyme refers to a vector comprising a gene encoding an isoprenoid compound-synthetic enzyme, and preferably the one or more polynucleotide selected from the group consisting of the following (a)-(x):
(a) a polynucleotide comprising (i) the nucleotide sequence represented by SEQ ID NO: 2, (ii) the nucleotide sequence consisting of the nucleotide residues at positions 79 to 1725 in the nucleotide sequence represented by SEQ ID NO: 2, or (iii) the nucleotide sequence represented by SEQ ID NO : 3 ;
(b) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of
(i) , (ii) or (iii) above, and encodes a protein having a linalool synthase activity;
(c) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (i) ,
(ii) , or (iii) above, and encodes a protein having a linalool synthase activity;
(d) a polynucleotide comprising (iv) the nucleotide
sequence represented by SEQ ID NO: 5, (v) the nucleotide sequence consisting of the nucleotide residues at positions 115 to 1773 in the nucleotide sequence represented by SEQ ID NO: 5, or (vi) the nucleotide sequence represented by SEQ ID NO: 6;
(e) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (vi) , (v) or (vi) above, and encodes a protein having a linalool synthase activity;
(f) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (vi) , (v) or (vi) above, and encodes a protein having a linalool synthase activity;
(g) a polynucleotide comprising (vii) the nucleotide sequence represented by SEQ ID NO: 62, (viii) the nucleotide sequence consisting of the nucleotide residues at positions 193 to 1905 in the nucleotide sequence represented by SEQ ID NO: 62, or (ix) the nucleotide sequence represented by SEQ ID NO: 63;
(h) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (vii) , (viii) or (ix) above, and encodes a protein having a limonene synthase activity;
(i) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (vii) , (viii) or (ix) above, and encodes a protein having a
limonene synthase activity;
(j) a polynucleotide comprising (x) the nucleotide sequence represented by SEQ ID NO: 65, (xi) the nucleotide sequence consisting of the nucleotide residues at positions 205 to 1914 in the nucleotide sequence represented by SEQ ID NO: 65, or (xii) the nucleotide sequence represented by SEQ ID
NO: 66;
(k) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (x) , (xi) or (xii) above, and encodes a protein having a limonene synthase activity;
(1) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (x) , (xi) or (xii) above, and encodes a protein having a
limonene synthase activity;
(m) a polynucleotide comprising (xiii) the nucleotide sequence represented by SEQ ID NO: 68, (xiv) the nucleotide sequence consisting of the nucleotide residues at positions 169 to 1800 in the nucleotide sequence represented by SEQ ID NO: 68, or (xv) the nucleotide sequence represented by SEQ ID NO: 69;
(n) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of
(xiii) , (xiv) or (xv) above, and encodes a protein having a limonene synthase activity;
(o) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (xiii) ,
(xiv) or (xv) above, and encodes a protein having a
limonene synthase activity;
(p) a polynucleotide comprising (xvi) the nucleotide
sequence represented by SEQ ID NO: 71, (xvii) the nucleotide sequence consisting of the nucleotide residues at positions 154 to 1827 in the nucleotide sequence represented by SEQ ID NO: 71, or (xviii) the nucleotide sequence represented by SEQ ID NO: 72;
(q) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of
(xvi) , (xvii) or (xviii) above, and encodes a protein having a limonene synthase activity;
(r) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (xvi) ,
(xvii) or (xviii) above, and encodes a protein having a limonene synthase activity;
(s) a polynucleotide comprising (xix) the nucleotide
sequence represented by SEQ ID NO: 74, (xx) the nucleotide sequence consisting of the nucleotide residues at positions 154 to 1821 in the nucleotide sequence represented by SEQ ID NO: 74, or (xxi) the nucleotide sequence represented by SEQ ID NO: 75;
(t) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (xix) , (xx) or (xxi) above, and encodes a protein having a limonene synthase activity; (u) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (xix) , (xx) or (xxi) above, and encodes a protein having a
limonene synthase activity;
(v) a polynucleotide comprising (xxii) the nucleotide sequence represented by SEQ ID NO: 7, or (xxiii) the
nucleotide sequence represented by SEQ ID NO: 8;
(w) a polynucleotide that comprises a nucleotide sequence having 90% or more identity to the nucleotide sequence of (xxii) , or (xxiii) above, and encodes a protein having a geranyl diphosphate synthase activity and/or farnesyl diphosphate synthase activity; or
(x) a polynucleotide that hybridizes under a stringent condition with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of (xxii) , or (xxiii) above, and encodes a protein having a geranyl diphosphate synthase activity and/or a farnesyl diphosphate synthase activity.
[0048]
The nucleotide sequence represented by SEQ ID NO: 2 is a full length nucleotide sequence of the linalool synthase gene from Actinidia arguta. The nucleotide sequence
represented by SEQ ID NO: 2 can encode the amino acid
sequence represented by SEQ ID NO:l, a nucleotide sequence consisting of the nucleotide residues at positions 1 to 78 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide
residues at positions 79 to 1725 (1722) can encode an amino acid sequence of mature linalool synthase. The nucleotide sequence represented by SEQ ID NO: 3 consists of a
nucleotide sequence in which codons found in the nucleotide sequence consisting of the nucleotide residues at positions 79 to 1725 in the nucleotide sequence represented by SEQ ID NO: 2 are modified, and a methionine codon is further added at 5' end.
The nucleotide sequence represented by SEQ ID NO: 5 is a full length nucleotide sequence of the linalool synthase gene from Coriandrum sativum. The nucleotide sequence represented by SEQ ID NO: 5 can encode the amino acid sequence represented by SEQ ID NO: 4, a nucleotide sequence consisting of the nucleotide residues at positions 1 to 114 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide residues at positions 115 to 1773 (1770) can encode an amino acid sequence of mature linalool synthase. The nucleotide sequence represented by SEQ ID NO: 6 consists of a nucleotide sequence in which codons found in the
nucleotide sequence consisting of the nucleotide residues at positions 115 to 1773 in the nucleotide sequence
represented by SEQ ID NO: 5 are modified.
[0049]
The nucleotide sequence represented by SEQ ID NO: 62 is a full length nucleotide sequence of the limonene synthase gene from Sitka spruce. The nucleotide sequence
represented by SEQ ID NO: 62 can encode the amino acid sequence represented by SEQ ID NO: 61, a nucleotide sequence consisting of the nucleotide residues .at positions 1 to 192 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide residues at positions 193 to 1905 (1902) can encode an amino acid sequence of mature limonene synthase. The nucleotide sequence represented by SEQ ID NO: 63 consists of a nucleotide sequence in which codons found in the
nucleotide sequence consisting of the nucleotide residues at positions 193 to 1905 in the nucleotide sequence represented by SEQ ID NO: 62 are modified, and a methionine' codon is further added at 5' end.
The nucleotide sequence represented by SEQ ID NO: 65 is a full length nucleotide sequence of the limonene synthase gene from Grand fir. The nucleotide sequence represented by SEQ ID NO: 65 can encode the amino acid sequence
represented by SEQ ID NO: 64, a nucleotide sequence
consisting of the nucleotide residues at positions 1 to 204 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide residues at positions 205 to 1914 (1911) can encode an amino acid sequence of mature limonene synthase. The nucleotide sequence represented by SEQ ID NO: 66 consists of a nucleotide sequence in which codons found in the
nucleotide sequence consisting of the nucleotide residues at positions 205 to 1914 in the nucleotide sequence
represented by SEQ ID NO: 65 are modified, and a methionine codon is further added at 5' end.
The nucleotide sequence represented by SEQ ID NO: 68 is a full length nucleotide sequence of the limonene synthase gene from spearmint. The nucleotide sequence represented by SEQ ID NO: 68 can encode the amino acid sequence
represented by SEQ ID NO: 67, a nucleotide sequence
consisting of the nucleotide residues at positions 1 to 168 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide residues at positions 169 to 1800 (1797) can encode an amino acid sequence of mature limonene synthase. The nucleotide sequence represented by SEQ ID NO: 69 consists of a nucleotide sequence in which codons found in the
nucleotide sequence consisting of the nucleotide residues at positions 169 to 1800 in the nucleotide sequence
represented by SEQ ID NO: 68 are modified, and a methionine codon is further added at 5' end.
The nucleotide sequence represented by SEQ ID NO: 71 is a full length nucleotide sequence of the limonene synthase gene from Unshu mikan. The nucleotide sequence represented by SEQ ID NO: 71 can encode the amino acid sequence
represented by SEQ ID NO: 70, a nucleotide sequence
consisting of the nucleotide residues at positions 1 to 153 can encode a putative chloroplast localization signal, and the nucleotide sequence consisting of the nucleotide residues at positions 154 to 1827 (1824) can encode an amino acid sequence of mature limonene synthase. The nucleotide sequence represented by SEQ ID NO: 72 consists of a nucleotide sequence in which codons found in the
nucleotide sequence consisting of the nucleotide residues at positions 154 to 1827 in the nucleotide sequence
represented by SEQ ID NO: 71 are modified, and a methionine codon is further added at 5' end.
The nucleotide sequence represented by SEQ ID NO: 74 is a full length nucleotide sequence of the limonene synthase gene from lemon. The nucleotide sequence represented by
SEQ ID NO: 74 can encode the amino acid sequence represented by SEQ ID NO: 73, a nucleotide sequence consisting of the nucleotide residues at positions 1 to 153 can encode a putative chloroplast localization signal, and the
nucleotide sequence consisting of the nucleotide residues at positions 154 to 1821 (1818) can encode an amino acid sequence of mature limonene synthase. The nucleotide sequence represented by SEQ ID NO: 75 consists of a
nucleotide sequence in which codons found in the nucleotide sequence consisting of the nucleotide residues at positions 154 to 1821 in the nucleotide sequence represented by SEQ ID NO: 74 are modified, and a methionine codon is further added at 5' end. [0050]
The nucleotide sequence represented by SEQ ID NO: 7 is a nucleotide sequence of the farnesyl diphosphate synthase gene from Escherichia coli. The nucleotide sequence
represented by SEQ ID NO: 8 consists of a nucleotide
sequence in which codons found in the nucleotide sequence represented by SEQ ID NO: 7 are modified, and has a mutation of the serine codon into the phenylalanine codon (S80F mutation) . It has been known that the protein which is encoded by this mutated farnesyl diphosphate synthase gene has an improved function as geranyl diphosphate synthase {Reiling KK et al.(2004) Biotechnol Bioeng. 87(2) 200-212).
The nucleotide sequence represented by SEQ ID NO: 7 can encode the amino acid sequence represented by SEQ ID NO: 89. The nucleotide sequence represented by SEQ ID NO: 8 can encode the amino acid sequence represented by SEQ ID NO: 90.
[0051]
The percent identity to the nucleotide sequence may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more. The linalool synthase activity refers to an activity to produce linalool from geranyl diphosphate (GPP) (the same meaning shall apply hereinafter) . The limonene synthase activity refers to an activity to produce limonene from GPP (the same meaning shall apply hereinafter) . The farnesyl diphosphate synthase activity refers to an activity to produce farnesyl diphosphate from GPP (the same meaning shall apply hereinafter) . The geranyl diphosphate synthase activity refers to an activity to produce geranyl
diphosphate from IPP and DMAPP (the same meaning shall apply hereinafter) .
[0052]
The percent identity of the nucleotide sequences, and the percent identity of the amino acid sequences as described later can be determined using algorithm BLAST (Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)) by Karlin and Altschul, and FASTA (Methods Enzymol., 183, 63 (1990)) by Pearson. The programs referred to as BLASTP and BLASTN were developed based on this algorithm BLAST (see
http://www.ncbi.nlm.nih.gov). Thus, the percent identity of the nucleotide sequences and the amino acid sequences may be calculated using these programs with default setting. Also, for example, a numerical value obtained by
calculating similarity as a percentage at a setting of
"unit size to compare=2" using the full length of a
polypeptide portion encoded in ORF with the software
GENETYX Ver. 7.0.9 from Genetyx Corporation employing
Lipman-Pearson method may be used as the homology of the amino acid sequences. The lowest value among the values derived from these calculations may be employed as the percent identity of the nucleotide sequences and the amino acid sequences.
[0053]
The "stringent condition" refers to a condition where a so-called specific hybrid is formed whereas a nonspecific hybrid is not formed. It is difficult to clearly quantify such a condition. However, to cite a case, such a condition is a condition where substantially the same polynucleotides having the high identity, for example, the polynucleotides having the percent identity described above hybridize each other whereas polynucleotides having the lower identity than above do not hybridize each other.
Specifically, such a condition may include hybridization in 6xSCC (sodium chloride/sodium citrate) at about 45°C
followed by one or two or more washings in 0.2xSCC and 0.1% SDS at 50 to 65°C. DNA that hybridize each other may have identity of more than 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0054]
The polynucleotides of the above (a)-(x) may be DNA or RNA that is obtainable from the corresponding DNA by substituting the nucleobase thymine to uracil, and are preferably DNA.
[0055]
The vector for expressing the isoprenoid compound- synthetic enzyme refers also to a vector that expresses an isoprenoid compound-synthetic enzyme, and preferably a vector that expresses one or more protein selected from the group consisting of the following (A) - (X) :
(A) a protein comprising (i1) the full length amino acid sequence represented by SEQ ID NO:l, or (ϋ') the amino acid sequence consisting of the amino acid residues at positions 27 to 574 in the amino acid sequence represented by SEQ ID NO:l;
(B) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (i') or (ϋ'), and has a linalool synthase activity;
(C) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (ί') or
(ϋ'), and has a linalool synthase activity;
(D). a protein comprising (iii') the full length amino acid sequence represented by SEQ ID NO:4, or (iv1) the amino acid sequence consisting of the amino acid residues at positions 39 to 590 in the amino acid sequence represented by SEQ ID NO: 4;
(E) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (iii1) or (iv'), and has a linalool synthase activity; (F) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (iii') or (iv' ) , and has a linalool synthase activity;
(G) a protein comprising (ν' ) the full length amino acid sequence represented by SEQ ID NO: 61, or (vi') the amino acid sequence consisting of the amino acid residues at positions 65 to 634 in the amino acid sequence represented by SEQ ID NO: 61;
(H) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (v' ) or (vi'), and has a limonene synthase activity;
(I) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (ν') or (vi'), and has a limonene synthase activity;
(J) a protein comprising (vii1) the full length amino acid sequence represented by SEQ ID NO: 64, or (viii') the amino acid sequence consisting of the amino acid residues at positions 69 to 637 in the amino acid sequence represented by SEQ ID NO: 64;
(K) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (vii1) or (viii'), and has a limonene synthase activity;
(L) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (vii') or
(viii1), and has a limonene synthase activity;
(M) a protein comprising (ix1) the full length amino acid sequence represented by SEQ ID NO: 67, or (ix') the amino acid sequence consisting of the amino acid residues at positions 57 to 599 in the amino acid sequence represented by SEQ ID NO: 67; (N) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (ix1) or (χ'), and has a limonene synthase activity;
(0) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (ix') or (χ'), and has a limonene synthase activity;
(P) a protein comprising (xi ' ) the full length amino acid sequence represented by SEQ ID NO:70, or (xii1) the amino acid sequence consisting of the amino acid residues at positions 52 to 608 in the amino acid sequence represented by SEQ ID NO: 70;
(Q) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (xi1) or
(xii'), and has a limonene synthase activity;
(R) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (xi1) or
(xii'), and has a limonene synthase activity;
(S) a protein comprising (xiii1) the full length amino acid sequence represented by SEQ ID NO:73, or (xiv') the amino acid sequence consisting of the amino acid residues at positions 52 to 606 in the amino acid sequence represented by SEQ ID NO: 73;
(T) a protein that comprises an amino acid sequence having 90% or more identity to the amino acid sequence of (xiii1) or (xiv' ) , and has a limonene synthase activity; or
(U) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence of (xiii') or (xiv' ) , and has a limonene synthase activity.
(V) a protein comprising the full length amino acid
sequence represented by SEQ ID NO: 89 or 90; (W) a protein that comprises an amino acid sequence having 90% or more identity to the above amino acid sequence, and has a geranyl diphosphate synthase activity and/or a farnesyl diphosphate synthase activity; or
(X) a protein that comprises an amino acid sequence having a deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence, and has a geranyl diphosphate synthase activity and/or a farnesyl diphosphate synthase activity.
[0056]
The amino acid sequence consisting of the amino acid residues at positions 1 to 26 in the amino acid sequence represented by SEQ ID NO:l can comprise a putative
chloroplast localization signal. The amino acid sequence consisting of the amino acid residues at positions 27 to 574 in the amino acid sequence represented by SEQ ID NO:l can comprise the mature linalool synthase. When the mature linalool synthase expression is carried out in microbes, in general, the sequence adding methionine residue at N- terminal is used. The amino acid sequence consisting of the amino acid residues at positions 1 to 38 in the amino acid sequence represented by SEQ ID NO: 4 can comprise a putative chloroplast localization signal, and the amino acid
sequence consisting of the amino acid residues at positions 39 to 590 in the amino acid sequence represented by SEQ ID NO: 4 can comprise the mature linalool synthase.
[0057]
The amino acid sequence consisting of the amino acid residues at positions 1 to 64 in the amino acid sequence represented by SEQ ID NO: 61 can comprise a putative
chloroplast localization signal. The amino acid sequence consisting of the amino acid residues at positions 65 to 634 in the amino acid sequence represented by SEQ ID NO: 61 can comprise the mature limonene synthase. The amino acid sequence consisting of the amino acid residues at positions 1 to 68 in the amino acid sequence represented by SEQ ID NO: 64 can comprise a putative chloroplast localization signal. The amino acid sequence consisting of the amino acid residues at positions 69 to 637 in the amino acid sequence represented by SEQ ID NO: 64 can comprise the mature limonene synthase. The amino acid sequence
consisting of the amino acid residues at positions 1 to 56 in the amino acid sequence represented by SEQ ID NO: 67 can comprise a putative chloroplast localization signal. The amino acid sequence consisting of the amino acid residues at positions 57 to 599 in the amino acid sequence
represented by SEQ ID NO: 67 can comprise the mature
limonene synthase. The amino acid sequence consisting of the amino acid residues at positions 1 to 51 in the amino acid sequence represented by SEQ ID NO: 70 can comprise a putative chloroplast localization signal. The amino acid sequence consisting of the amino acid residues at positions 52 to 608 in the amino acid sequence represented by SEQ ID NO: 70 can comprise the mature limonene synthase. The amino acid sequence consisting of the amino acid residues at positions 1 to 51 in the amino acid sequence represented by SEQ ID NO: 73 can comprise a putative chloroplast
localization signal. The amino acid sequence consisting of the amino acid residues at positions 52 to 606 in the amino acid sequence represented by SEQ ID NO: 73 can comprise the mature limonene synthase. When the mature limonene
synthase expression is carried out in microbes, in general, the sequence adding methionine residue at N-terminal is used.
[0058]
The nucleotide sequence represented by SEQ ID NO: 89 can comprise mature geranyl diphosphate synthase and/or farnesyl diphosphate synthase. The nucleotide sequence represented by SEQ ID NO: 90 can comprise mutated mature geranyl diphosphate and/or farnesyl diphosphate synthase (S80F) .
[0059]
The percent identity to the amino acid sequence may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more.
[0060]
Examples of the mutation of the amino acid residues may include deletion, substitution, addition and insertion of amino acid residues. The mutation of one or several amino acids may be introduced into one region or multiple different regions in the amino acid sequence. The term "one or several" indicates a range in which a three- dimensional structure and an activity of the protein are not impaired greatly. In the case of the protein, the number represented by "one or several" is, for example, 1 to 100, preferably 1 to 80, more preferably 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 1 to 5. The above protein of (A) - (X) may have a methionine residue at the N-terminus. The above protein of (A) - (X) may have a tag at the C-terminus for purification, such as a histidine tag.
[0061]
The protein of (B) or (C) preferably has a linalool synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the linalool synthase activity of the protein comprising the amino acid sequence of either one of (i') or (ϋ') above when measured under the same condition. The protein of the protein of (E) or (F) preferably has a linalool synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the linalool synthase activity of the protein comprising the amino acid sequence of either one of (iii1) or (iv' ) above when measured under the same condition.
[0062]
The protein of (H) or (I) preferably has a
limonenesynthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (ν') or (vi') above when measured under the same condition. The protein of (K) or (L) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (vii1) or (viii1) above when measured, under the same condition. The protein of (N) or (0) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (ix1) or (x1) above when measured under the same condition. The protein of (Q) or (R) preferably has a limonene
synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (xi') or (χϋ') above when measured under the same condition. The protein of (T) or (U) preferably has a limonene synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the limonene synthase activity of the protein comprising the amino acid sequence of either one of (xiii1) or (xiv1 ) above when measured under the same condition. [0063]
The protein of (W) or (X) preferably has a geranyl diphosphate synthase activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the geranyl diphosphate synthase activity of the protein comprising the amino acid sequence represented by SEQ ID NOs: 90 or 89, more preferably has geranyl diphosphate synthase activity and farnesyl diphosphate synthase
activity that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the geranyl
diphosphate synthase activity and farnesyl diphosphate synthase activity of the protein comprising the amino acid sequence represented by SEQ ID NOs: 90 or 89, when measured under the same condition.
[0064]
In the above protein, the mutation may be introduced into sites in a catalytic domain and sites other than the catalytic domain as long as an objective activity is retained. The positions of amino acid residues to be mutated in the protein, which is capable of retaining the objective activity, are understood by a person skilled in the art. Specifically, a person skilled in the art can recognize a correlation between structure and function, since a person skilled in the art can 1) compare the amino acid sequences of multiple proteins having the same type of activity (e.g., the amino acid sequence represented by SEQ ID NO:l, 4, 61, 64, 67, 71, or 74 and amino acid sequences of other isoprenoid compound-synthetic enzymes), 2) clarify regions that are relatively conserved and regions that are not relatively conserved, and then 3) predict regions capable of playing a functionally important role and regions incapable of playing a functionally important role from the regions that are relatively conserved and the regions that are not relatively conserved, respectively. Therefore, a person skilled in the art can identify the positions of the amino acid residues to be mutated in the amino acid sequence of the isoprenoid compound-synthetic enzyme .
[0065]
When the amino acid residue is mutated by substitution, the substitution of the amino acid residue may be
conservative substitution. As used herein, the term
"conservative substitution" refers to substitution of a certain amino acid residue with an amino acid residue having a similar side chain. Families of the amino acid residues having the similar side chain are well-known in the art. Examples of such families may include amino acids having a basic side chain (e.g., lysine, arginine,
histidine) , amino acids having an acidic side chain (e.g., aspartic acid, glutamic acid) , amino acids having a non- charged polar side chain (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine) , amino acids having a non-polar side chain (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , amino acids having a branched side chain at position β (e.g., threonine, valine, isoleucine), amino acids having an aromatic side chain (e.g., tyrosine, phenylalanine, tryptophan, histidine) , amino acids having a hydroxyl group-containing side chain (e.g., alkoxy, phenoxy group-containing side chain) (e.g., serine, threonine, tyrosine) , and amino acids having a sulfur-containing side chain (e.g., cysteine, methionine). Preferably, the conservative substitution of the amino acids may be the substitution between aspartic acid and glutamic acid, the substitution among arginine, lysine and histidine, the substitution between tryptophan and phenylalanine, the substitution between phenylalanine and valine, the
substitution among leucine, isoleucine and alanine, and the substitution between glycine and alanine.
[0066]
The isoprenoid compound-producing microorganism can be obtained by transforming a host cell with an expression vector to express a gene encoding a desired protein such as the above isoprenoid compound-synthetic enzyme. The isoprenoid compound-producing microorganism comprises an expression unit comprising a polynucleotide encoding the desired protein and a promoter operatively linked thereto, which are contained in the expression vector. In the expression unit, one of the polynucleotide encoding the desired protein and the promoter is not inherent in the host cell. Therefore, the expression unit may be a
heterogenous expression unit. Preferably, both the
polynucleotide encoding the desired protein and the
promoter are not inherent in the host cell. The promoter may be homologous or heterologous to the polynucleotide encoding the desired protein. The expression unit may further comprise additional elements such as a terminator, a ribosome-binding site, and a drug-resistance gene. The expression unit may be DNA or RNA and is preferably DNA. Examples of the desired protein include, but are not limited to, a mevalonate kinase, an isoprene synthase, one or more enzymes involved in a methylerythritol phosphate pathway, and one or more enzymes involved in a mevalonate pathway. The term "operatively linked" can mean that the nucleotide sequence of a regulatory region (s) is/are linked to the nucleotide sequence of a nucleic acid molecule or gene (that is, to polynucleotide) in a manner which allows for expression (e.g., enhanced, increased, constitutive, basal, antiterminated, . attenuated, deregulated, decreased or repressed expression) of the polynucleotide, so that a polynucleotide expression product encoded by the nucleotide sequence thereof is produced.
[0067]
The vector for expressing the isoprenoid compound- synthetic enzyme may be an integrative vector or a non- integrative vector. In the expression vector, the gene encoding the isoprenoid compound-synthetic enzyme may be placed under the control of a constitutive promoter or inducible promoter. Examples of the constitutive promoter include the tac promoter, the lac promoter, the trp
promoter, the trc promoter, the T7 promoter, the T5
promoter, the T3 promoter, and the SP6 promoter. Examples of the inducible promoter include a promoter which is inversely dependent on the growth-promoting agent described later.
[0068]
The isoprenoid compound-producing microorganism may further express a mevalonate kinase in addition to the isoprenoid compound-synthetic enzyme. Therefore, the isoprenoid compound-producing microorganism may be
transformed with a vector for expressing the mevalonate kinase. Examples of the mevalonate kinase gene may include genes from microorganisms belonging to the genus
Methanosarcina such as Methanosarcina mazei, the genus Methanocella such as Methanocella paludicola, the genus Corynebacterium such as Corynebacterium variabile, the genus Methanosaeta such as Methanosaeta concilii, and the genus Nitrosopumilus such as Nitrosopumilus maritimus . The vector for expressing the mevalonate kinase may be an integrative vector or a non-integrative vector. In the expression vector, the gene encoding the mevalonate kinase may be placed under the control of a constitutive promoter or inducible promoter (e.g., the promoter which is
inversely dependent on the growth-promoting agent) .
Specifically, the gene encoding the mevalonate kinase may be placed under the control of the constitutive promoter. Examples of the constitutive promoter include the tac promoter, the lac promoter, the trp promoter, the trc promoter, the T7 promoter, the T5 promoter, the T3 promoter and the SP6 promoter.
[0069]
The isoprenoid compound-producing microorganism used in the present invention as a host can be a bacterium or a fungus. The bacterium may be a gram-positive bacterium or a gram-negative bacterium. The isoprenoid compound- producing microorganism can be a microorganism belonging to the family Enterobacteriaceae, and particularly preferably a microorganism belonging to the family Enterobacteriaceae among microorganisms described later.
[0070]
Examples of the gram-positive bacterium may include bacteria belonging to the genera Bacillus, Listeria,
Staphylococcus, Streptococcus, Enterococcus, Clostridium, Corynebacterium, and Streptomyces . Bacteria belonging to the genera Bacillus and Corynebacterium are preferable.
Examples of the bacteria belonging to the genus Bacillus may include Bacillus subtilis, Bacillus anthracis, and Bacillus cereus. Bacillus subtilis is more preferable.
Examples of the bacteria belonging to the genus
Corynebacterium may include Corynebacterium glutamicum, Corynebacterium efficiens, and Corynebacterium callunae. Corynebacterium glutamicum is more preferable.
[0071]
Examples of the gram-negative bacterium may include bacteria belonging to the genera Escherichia, Pantoea, Salmonella, Vibrio, Serratia, and Enterobacter. The bacteria belonging to the genera Escherichia, Pantoea and Enterobacter are preferable.
Escherichia coli is preferable as the bacterium belonging to the genus Escherichia.
Examples of the bacteria belonging to the genus
Pantoea may include Pantoea ananatis, Pantoea stewartii, Pantoea agglomerans, and Pantoea citrea. Pantoea ananatis and Pantoea citrea are preferable. Strains exemplified in the European Patent Application Publication EP0952221 may be used as the bacteria belonging to the genus Pantoea. Examples of representative strains of the bacteria, belonging to the genus Pantoea may include Pantoea ananatis AJ13355 strain (FERM BP-6614) and Pantoea ananatis AJ13356 strain (FERM BP-6615) disclosed in the European Patent
Application Publication EP0952221, Pantoea ananatis SC17 strain (FERM BP-11901), and Pantoea ananatis SC17(0) strain (Katashikina JI et al . , BMC Mol Biol 2009; 10: 34 VKPM B-9246) . Examples of the bacteria belonging to the genus Enterobacter may include Enterobacter agglomerans and
Enterobacter aerogenes . Enterobacter aerogenes is
preferable as the bacterium belonging to the genus
Enterobacter. The bacterial strains exemplified in the European Patent Application Publication EP0952221 may be used as the bacteria belonging to the genus Enterobacter. Examples of representative strains of the bacteria
belonging to the genus Enterobacter may include
Enterobacter agglomerans ATCC12287 strain, Enterobacter aerogenes ATCC13048 strain, Enterobacter aerogenes
NBRC12010 strain (Biotechnol. Bioeng., 2007 Mar 27; 98(2) 340-348), Enterobacter aerogenes AJ110637 (FERM BP-10955) , and the like. The Enterobacter aerogenes AJ110637 strain was deposited to International Patent Organism Depositary (IPOD), National Institute of Advanced Industrial Science and Technology (AIST) (Chuo No. 6, Higashi 1-1-1, Tsukuba City, Ibaraki Pref., JP, Postal code 305-8566; currently, International Patent Organism Depositary, National
Institute of Technology and Evaluation (IPOD NITE) , #120, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, 292-0818, Japan) as of August 22, 2007, and was transferred to the
international deposition based on the Budapest Treaty on March 13, 2008, and the deposit number FERM BP-10955 was given thereto.
[0072]
Examples of the fungus may include microorganisms belonging to the genera Saccharomyces, Schizosaccharomyces, Yarrowia, Trichoderma, Aspergillus, Fusarium, and Mucor. The microorganisms belonging to the genera Saccharomyces, Schizosaccharomyces, Yarrowia, or Trichoderma are
preferable.
Examples of the microorganisms belonging to the genus Saccharomyces may include Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus,
Saccharomyces douglasii, Saccharomyces kluyveri,
Saccharomyces norbensis, and Saccharomyces oviformis.
Saccharomyces cerevisiae is preferable as the fungus belonging to the genus Saccharomyces .
Schizosaccharomyces pombe is preferable as the
microorganisms belonging to the genus Schizosaccharomyces .
Yarrowia lypolytica is preferable as the
microorganisms belonging to the genus Yarrowia .
Examples of the microorganisms belonging to the genus Trichoderma may include Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma viride. Trichoderma reesei is preferable.
[0073] The pathway to synthesize dimethylallyl diphosphate (DMAPP) that is a building-block of the isoprenoid compound (e.g., the substrate of the isoprene synthase) may further be enhanced in the isoprenoid compound-producing
microorganism. For such an enhancement, an expression vector that expresses an isopentenyl-diphosphate delta isomerase having an ability to convert isopentenyl
diphosphate (IPP) into dimethylallyl diphosphate (DMAPP) may be introduced into the isoprenoid compound-producing microorganism. Alternatively, an expression vector that expresses an isopentenyl-diphosphate delta isomerase having both of an ability to convert IPP into DMAPP and an ability to convert DMAPP into isoprenoids may be introduced into the isoprenoid compound-producing microorganism.
An expression vector that expresses one or more
enzymes involved in the mevalonate pathway and/or
methylerythritol phosphate pathway associated with
formation of IPP and/or DMAPP may also be introduced into the isoprenoid compound-producing microorganism. The expression vector for such an enzyme may be an integrative vector or a non-integrative vector. The expression vector for such an enzyme may express further a plurality of enzymes (e.g., one or more, two or more, three or more or four or more) involved in the mevalonate pathway and/or the methylerythritol phosphate pathway, and may be, for example, an expression vector for polycistronic mRNA. Origin of one or more enzymes involved in the mevalonate pathway and/or the methylerythritol phosphate pathway may be homologous or heterologous to the host. When the origin of the enzyme involved in the mevalonate pathway and/or the
methylerythritol phosphate pathway is heterologous to the host, for example, the host may be a bacterium as described above (e.g., Escherichia coli) and the enzyme involved in the mevalonate pathway may be derived from a fungus (e.g., Saccharomyces cerevisiae) . In addition, when the host inherently produces the enzyme involved in the
methylerythritol phosphate pathway, an expression vector to be introduced into the host may express an enzyme involved in the mevalonate pathway.
[0074]
Examples of the isopentenyl-diphosphate delta
isomerase (EC: 5.3.3.2) may include Idilp (ACCESSION ID NP_015208), AT3G02780 (ACCESSION ID NP_186927 ) , AT5G16440 (ACCESSION ID NP_197148) and Idi ' (ACCESSION ID NP_417365) . In the expression vector, the gene encoding the
isopentenyl-diphosphate delta isomerase may be placed under the control of the promoter which is inversely dependent on the growth-promoting agent.
[0075]
Examples of the enzymes involved in the mevalonate (MVA) pathway may include mevalonate kinase (EC: 2.7.1.36; example 1, Ergl2p, ACCESSION ID NP_013935; example 2,
AT5G27450, ACCESSION ID NP_001190411) , phosphomevalonate kinase (EC: 2.7.4.2; example 1, Erg8p, ACCESSION ID
NPJD13947; example 2, AT1G31910, ACCESSION ID NP_001185124 ) , diphosphomevalonate decarboxylase (EC: 4.1.1.33; example 1, Mvdlp, ACCESSION ID NP_014441; example 2, AT2G38700,
ACCESSION ID NP_181404; example 3, AT3G54250, ACCESSION ID NP_566995), acetyl-CoA-C-acetyltransferase (EC: 2.3.1.9;
example 1, ErglOp, ACCESSION ID NP_015297; example 2,
AT5G47720, ACCESSION ID NP_001032028 ; example 3, AT5G48230, ACCESSION ID NP_568694), hydroxymethylglutaryl-CoA synthase (EC: 2.3.3.10; example 1, Ergl3p, ACCESSION ID NP_013580; example 2, AT4G11820, ACCESSION ID NP_192919; example 3, MvaS, ACCESSION ID AAG02438), hydroxymethylglutaryl-CoA reductase (EC: 1.1.1.34; example 1, Hmg2p, ACCESSION ID NP_013555; ' example 2, Hmglp, ACCESSION ID NP_013636;
example 3, AT1G76490, ACCESSION ID NP_177775; example 4, AT2G17370, ACCESSION ID NP_179329, EC: 1.1.1.88, example, MvaA, ACCESSION ID P13702), and acetyl-CoA-C- acetyltransferase/hydroxymethylglutaryl-CoA reductase (EC: 2.3.1.9/1.1.1.34, example, MvaE, ACCESSION ID AAG02439) . In the expression vector, the gene(s) encoding one or more enzymes involved in the mevalonate ( VA) pathway (e.g., phosphomevalonate kinase, diphosphomevalonate decarboxylase, acetyl-CoA-C-acetyltransferase/hydroxymethylglutaryl-CoA reductase, and hydroxymethylglutaryl-CoA synthase) may be placed under the control of the promoter which is inversely dependent on the growth-promoting agent.
[0076]
Examples of the enzymes involved in the
methylerythritol phosphate (MEP) pathway may include 1- deoxy-D-xylulose-5-phosphate synthase (EC: 2.2.1.7, example
1, Dxs, ACCESSION ID NP_414954; example 2, AT3G21500,
ACCESSION ID NP_566686; example 3, AT4G15560, ACCESSION ID NP_193291; example 4, AT5G11380, ACCESSION ID NP_001078570) ,
1-deoxy-D-xylulose-5-phosphate reductoisomerase (EC:
1.1.1.267; example 1, Dxr, ACCESSION ID NP_414715; example
2, AT5G62790, ACCESSION ID NP_001190600 ) , 4- diphosphocytidyl-2-C-methyl-D-erythritol synthase (EC:
2.7.7.60; example 1, IspD, ACCESSION ID NP_417227; example 2, AT2G02500, ACCESSION ID NP_565286) , 4 -diphosphocytidyl-
2-C-methyl-D-erythritol kinase (EC: 2.7.1.148; example 1, IspE, ACCESSION ID NP_415726; example 2, AT2G26930,
ACCESSION ID NP_180261), 2-C-methyl-D-erythritol-2 , 4- cyclodiphosphate synthase (EC: 4.6.1.12; example 1, IspF, ACCESSION ID NP_417226; example 2, AT1G63970, ACCESSION ID NP_564819) , l-hydroxy-2-methyl-2- (E) -butenyl-4-diphosphate synthase (EC: 1.17.7.1; example 1, IspG, ACCESSION ID NP_417010; example 2, AT5G60600, ACCESSION ID NP_001119467 ) , and 4-hydroxy-3-methyl-2-butenyl diphosphate reductase (EC: 1.17.1.2; example 1, IspH, ACCESSION ID NP_414570; example 2, AT4G34350, ACCESSION ID NP_567965) . In the expression vector, the gene(s) encoding. one or more enzymes involved in the methylerythritol phosphate (MEP) pathway may be placed under the control of the promoter which is inversely dependent on the growth-promoting agent.
[0077]
Further, a gene encoding the enzyme involved in the mevalonate pathway or the methylerythritol phosphate
pathway that synthesizes dimethylallyl diphosphate that is a building-block of the isoprenoid compound (e.g., the substrate of the isoprene synthase) may also be introduced into the isoprenoid compound-producing microorganism.
Examples of such an enzyme may include l-deoxy-D-xylose-5- phosphate synthase that converts a pyruvate and D- glycelaldehyde-3-phosphate into l-deoxy-D-xylose-5- phosphate, isopentenyl diphosphate isomerase that converts isopentenyl diphosphate into dimethylallyl diphosphate, and the like. In the expression vector, the gene encoding the enzyme involved in the mevalonate pathway or the
methylerythritol phosphate pathway that synthesizes
dimethylallyl diphosphate may be placed under the control of the constitutive promoter or inducible promoter (e.g., the promoter which is inversely dependent on the growth- promoting agent) .
[0078]
The transformation of a host with an expression vector containing the gene(s) described above can be carried out using one or more known methods. Examples of such methods may include a calcium chloride method using a microbial cell treated with calcium, an electroporation method, and the like. The gene may also be introduced by infecting the microbial cell with a phage vector other than the plasmid vector .
[0079]
The method of the present invention preferably
comprises the following 1) to 3) :
1) culturing an isoprenoid compound-producing microorganism in the presence of a growth-promoting agent at a sufficient concentration to grow the isoprenoid compound-producing microorganism;
2) decreasing the concentration of the growth-promoting agent to induce production of the isoprenoid compound by the isoprenoid compound-producing microorganism; and
3) culturing the isoprenoid compound-producing
microorganism to produce the isoprenoid compound.
[0080]
In the view point of efficient production of an isoprenoid compound, the above step 1) corresponding to a growth phase of a microorganism and the above step 3) corresponding to a formation phase of the isoprenoid compound are separated. The above step 2) corresponding to an induction phase of isoprenoid compound formation for transferring the microorganism from the growth phase to the formation phase of the isoprenoid compound.
[0081]
The growth-promoting agent can refer to a factor essential for the growth of a microorganism or a factor having an activity of promoting the growth of the
microorganism, which can be consumed by the microorganism, the consumption of which causes reduction of its amount in a culture medium, consequently loss or reduction of the growth of the microorganism. For example, when the
growth-promoting agent in a certain amount is used, a microorganism continues to grow until the growth-promoting agent in that amount is consumed, but once the growth- promoting agent is entirely consumed, the microorganism cannot grow or the growth rate can decrease. Therefore, the degree of the growth of the microorganism can be
regulated by the growth-promoting agent. Examples of such a growth-promoting agent may include, but are not limited to, substances such as oxygen (gas); minerals such as ions of iron, magnesium, potassium and calcium; phosphorus compounds such as monophosphoric acid, diphosphoric acid, and polyphosphoric acid, or salt thereof; nitrogen
compounds such as ammonia, nitrate, nitrite, nitrogen (gas), and urea; sulfur compounds such as ammonium sulfate and thiosulfuric acid; and nutrients such as vitamins (e.g., vitamin A, vitamin D, vitamin E, vitamin K, vitamin Bl, vitamin B2, vitamin B6, vitamin B12, niacin, pantothenic acid, biotin, ascorbic acid), and amino acids (e.g.,
alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, leucine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine,
selenocysteine ) . One kind of growth-promoting agent may be used or two or more kinds of growth-promoting agents may be used in combination in the method of the present invention.
[0082]
When the method of the present invention comprises the above steps 1) to 3), the isoprenoid compound-producing microorganism is preferably a microorganism having an ability to grow depending on the growth-promoting agent and an ability to produce an isoprenoid compound depending on a promoter which is inversely dependent on the growth- promoting agent, on which an ability to synthesize the isoprenoid compound by an enzymatic reaction has been conferred. Such an isoprenoid compound-producing
microorganism can grow in the presence of the growth- promoting agent at concentration sufficient for the growth of the isoprenoid compound-producing microorganism. Here, the "sufficient concentration" can refer to that the growth-promoting agent is used at concentration which is effective for the growth of the isoprenoid compound- producing microorganism. The expression "ability to produce an (the) isoprenoid compound depending on a promoter which is inversely depending on the growth-promoting agent" can mean that the isoprenoid compound cannot be produced at all or a producing efficiency of the isoprenoid compound is low in the presence of the growth-promoting agent at relatively high concentration whereas the isoprenoid compound can be produced or the producing efficiency of the isoprenoid compound is high in the presence of the growth- promoting agent at relatively low concentration or in the absence of the growth-promoting agent. Therefore, the isoprenoid compound-producing microorganism used preferably in the present invention can grow well but cannot produce the isoprenoid compound or exhibits low producing
efficiency of the isoprenoid compound in the presence of the growth-promoting agent' at sufficient concentration. The isoprenoid compound-producing microorganism preferably cannot grow well but can produce the isoprenoid compound and exhibit high producing efficiency of the isoprenoid compound in the presence of the growth-promoting agent at insufficient concentration or in the absence of the growth- promoting agent.
[0083]
When the method of the present invention comprises the above steps 1) to 3), a gene encoding an isoprenoid
compound-synthetic enzyme of the isoprenoid compound- producing microorganism can be present under the control of a promoter which is inversely dependent on the growth- promoting agent. The expression "promoter which is
inversely dependent on the growth-promoting agent" can mean a promoter not having at all or having low transcription activity in the presence of the growth-promoting agent at relatively high concentration but having some or high transcription activity in the presence of the growth- promoting agent at relatively low concentration or in the absence of the growth-promoting agent. Therefore, the promoter which is inversely dependent on the growth- promoting agent can suppress the expression of the gene encoding an isoprenoid compound-synthetic enzyme in the presence of the growth-promoting agent at a concentration sufficient for the growth of the isoprenoid compound- producing microorganism whereas it can promote the
expression of the gene encoding an isoprenoid compound- synthetic enzyme in the presence of the growth-promoting agent at the concentration insufficient for the growth of the isoprenoid compound-producing microorganism or in the absence of the growth-promoting agent. Specifically, the isoprenoid compound-producing microorganism is under the control of the promoter which is inversely dependent on the growth-promoting agent.
[0084]
For example, when the growth-promoting agent is a phosphorus compound, a phosphorus deficiency-inducible promoter can be utilized. The expression "phosphorus deficiency-inducible promoter" can refer to a promoter that can promote the expression of a downstream gene at low concentration of phosphorus compound. The low
concentration of phosphorus compound can refer to a
condition where a (free) phosphorus concentration is 100 mg/L or less. The expression "phosphorus" is synonymous to the expression "phosphorus compound", and they can be used in exchangeable manner. The concentration of total
phosphorus is able to quantify by decomposing total kinds of phosphorus compounds in liquid to phosphorus in the form of orthophosphoric acid by strong acid or oxidizing agent. The total phosphorus concentration under a phosphorus deficient condition may be 100 mg/L or less, 50 mg/L or less, 10 mg/L or less, 5 mg/L or less, 1 mg/L or less, 0.1 mg/L or less, or 0.01 mg/L or less. Examples of the
phosphorus deficiency-inducible promoter may include a promoter of the gene encoding alkali phosphatase (e.g., phoA) , a promoter of the gene encoding an acid phosphatase (e.g., phoC) , a promoter of the gene encoding a sensor histidine kinase (phoR) , a promoter of the gene encoding a response regulator (e.g., phoB) , and a promoter of the gene encoding a phosphorus uptake carrier (e.g., pstS) .
[0085]
In the above step 1) , the isoprenoid compound- producing microorganism is grown in the presence of the growth-promoting agent at sufficient concentration. More specifically, the isoprenoid compound-producing
microorganism can be grown by culturing the isoprenoid compound-producing microorganism in a culture medium in the presence of the growth-promoting agent at sufficient
concentration.
[0086]
For example, when a phosphorus compound is used as the growth-promoting agent, the isoprenoid compound-producing microorganism can grow well in the presence of the
phosphorus compound at a sufficient concentration, and thus, the phosphorus compound can act as the growth-promoting agent. When the growth-promoting agent is the phosphorus compound, a concentration of the phosphorus compound that is sufficient for the growth in step 1) is not particularly limited, and may be, for example, 200 mg/L or more, 300 mg/L or more, 500 mg/L or more, 1000 mg/L or more, or 2000 mg/L or more. The concentration of the phosphorus compound for the growth may be, for example, 20 g/L or less, 10 g/L or less, or 5 g/L or less.
[0087]
In the above step 2), the production of the isoprenoid compound by the isoprenoid compound-producing microorganism is induced by decreasing the concentration of the growth- promoting agent. More specifically, the concentration of the growth-promoting agent can be decreased by decreasing an amount of the growth-promoting agent supplied into a culture medium. Even if the amount of the growth-promoting agent supplied into the culture medium is made constant throughout steps 1) and 2), the concentration of the growth-promoting agent can be decreased by utilizing the growth of the microorganism. In the early phase of the growth of the microorganism in step 1), the microorganism does not grow sufficiently and the number of the
microorganism in the culture medium is small. Thus, a consumption of the growth-promoting agent by the
microorganism is relatively low. Therefore, the
concentration of the growth-promoting agent in the culture medium is relatively high in the early phase of the growth. On the other hand, in the late phase of the growth of the microorganism in step 1) , the microorganism grows
sufficiently and the number of the microorganism is large, and thus, the consumption of the growth-promoting agent by the microorganism is relatively high. Therefore, the concentration of the growth-promoting agent in the culture medium becomes relatively low in the late phase of the growth. As described above, when the constant amount of the growth-promoting agent continues to be supplied into the culture medium throughout steps 1) and 2), the
concentration of the growth-promoting agent in the culture medium is decreased in inverse proportion to the growth of the microorganism. This decreased concentration can be used as a trigger to induce the production of the
isoprenoid compound (that is, the isoprene, linalool, and limonene) by the isoprenoid compound-producing
microorganism.
[0088]
For example, when a phosphorus compound or an amino acid is used as the growth-promoting agent, the
concentration of the phosphorus compound or the amino acid in the culture medium, which can induce the production of the isoprenoid compound by the isoprenoid compound- producing microorganism, can be, for example, 100 mg/L or less, 50 mg/L or less, or 10 mg/L or less.
[0089]
In the above step 3) , the isoprenoid compound is produced by culturing the isoprenoid compound-producing microorganism. More specifically, the isoprenoid compound can be produced by culturing the isoprenoid compound- producing microorganism in the culture medium under the condition of step 2) where the concentration of the growth- promoting agent is decreased. The concentration of the growth-promoting agent in the culture medium can be
maintained at the concentration described in step 2) above in order to make the production of the isoprenoid compound by the isoprenoid compound-producing microorganism possible. In step 3) , the concentration of the isoprenoid compound produced in the culture medium can be, for example, 600 ppm or more, 700 ppm or more, 800 ppm or more, or 900 ppm or more, for example, within 6 hours, 5, 4, or 3 hours after culturing the isoprenoid compound-producing microorganism in the culture medium under the condition of step 2) .
[0090]
In the method of the present invention, it is also possible that the period of time of culturing the
isoprenoid compound-producing microorganism in step 3) is set longer than that period of step 1) . In the
conventional method which utilizes an inducer to obtain the isoprenoid compound in a higher amount, it is necessary to culture a microorganism for a long period of time using the inducer in the formation phase of the isoprenoid compound. However, when the cultivation is continued for a long period of time, the inducer is decomposed, and the
microorganism fails to maintain the ability to produce the isoprenoid compound. Thus, it is necessary to continuously add the inducer into culture medium. As the inducer may be expensive, the cost for producing the isoprenoid compound may become inappropriate. Therefore, the culturing a microorganism for a long period of time using the inducer in the formation phase of the isoprenoid compound is problematic in that the cost for producing the isoprenoid compound can be elevated depending on the duration of the cultivation period. On the other hand, in the method of the present invention not using a particular substance such as the inducer in step 3) , it is not necessary to consider the decomposition of the particular substance, and the conventional problem that the cultivation for a long period of time in the formation phase of the isoprenoid compound causes the elevation of the cost for producing the
isoprenoid compound does not occur. Therefore, in the method of the present invention, the period of time of step 3) can easily be made longer, differently from the conventional method that utilizes the inducer. In the method of the present invention, the longer the period of time of step 3) is made, the more isoprenoid compound can be produced.
[0091]
When an isoprenoid compound is produced in the system comprising the liquid phase and the gas phase, the
isoprenoid compound produced in the liquid phase can be collected from the gas phase (fermentation gas) as
described above. The isoprenoid compound can be collected from the gas phase by known methods. Examples of the method of collecting the isoprenoid compound from the gas phase may include an absorption method, a cooling method, a pressure swing adsorption method (PSA method) , and a membrane separation method. Before being subjected to these methods, the gas phase may be subjected to a
pretreatment such as dehydration, pressure elevating, pressure reducing, and the like, if necessary.
[0092]
The method of the present invention may be combined with another method in terms of enhancing the amount of produced isoprenoid compound. Examples of such a method may include a method of utilizing an environmental factor such as light (Pia Lindberg, Sungsoon Park, Anastasios elis, Metabolic Engineering 12 (2010) : 70-79) or
temperature (Norma A Valdez-Cruz, Luis Caspeta, Nestor 0 Perez, Octavio T Ramirez, Mauricio A Truj illo-Roldan,
Microbial Cell Factories 2010,9:1), change of pH (EP
1233068 A2), addition of surfactant (JP 11009296 A), and auto-inducible expression system (WO2013/151174 ) .
[0093]
The culture medium used in the method of the present invention may contain a carbon source for producing the isoprenoid compound. The carbon source may include
carbohydrates such as monosaccharides, disaccharides, oligosaccharides and polysaccharides; invert sugars
obtained by hydrolyzing sucrose; glycerol; compounds having one carbon atom (hereinafter referred to as a CI compound) such as methanol, formaldehyde, formate, carbon monoxide and carbon dioxide; oils such as corn oil, palm oil and soybean oil; acetate; animal fats; animal oils; fatty acids such as saturated fatty acids and unsaturated fatty acids; lipids; phospholipids; glycerolipids ; glycerine fatty acid esters such as monoglyceride, diglyceride and triglyceride; polypeptides such as microbial proteins and plant proteins; renewable carbon sources such as hydrolyzed biomass carbon sources; yeast extracts, or combinations thereof. For a nitrogen source, inorganic ammonium salts such as ammonium sulfate, ammonium chloride and ammonium phosphate, organic nitrogen such as hydrolyzed soybeans, ammonia gas, ammonia water, and the like can be used. It is desirable that the culture medium contains required substances such as vitamin Bl and L-homoserine, or the yeast extract and the like in an appropriate amount as an organic trace nutrient source. In addition thereto, potassium phosphate, magnesium sulfate, iron ion, manganese ion, and the like are added in a small amount if necessary. The culture medium used in the
present invention may be a natural medium or a synthesized medium as long as it contains the carbon source, the
nitrogen source, inorganic ions, and optionally the other organic trace ingredients.
[0094]
Examples of the monosaccharide may include triose such as ketotriose (dihydroxyacetone) and aldotriose
(glyceraldehyde) ; tetrose such as ketotetrose (erythrulose) and aldotetrose (erythrose, threose) ; pentose such as ketopentose (ribulose, xylulose) , aldopentose (ribose, arabinose, xylose, lyxose) and deoxysaccharide
(deoxyribose) ; hexose such as ketohexose (psichose,
fructose, sorbose, tagatose) , aldohexose (allose, altrose, glucose, mannose, gulose, idose, galactose, talose) , and deoxysaccharide (fucose, fuculose, rhamnose) ; and heptose such as sedoheptulose . C6 sugars such as fructose, mannose, galactose and glucose; and C5 sugars such as xylose and arabinose are preferable.
Examples of the disaccharide may include sucrose, lactose, maltose, trehalose, turanose, and cellobiose.
Sucrose and lactose are preferable.
Examples of the oligosaccharide may include
trisaccharides such as raffinose, melezitose and
maltotriose; tetrasaccharides such as acarbose and
stachyose; and other oligosaccharides such as
fructooligosaccharide (FOS) , galactooligosaccharide (GOS) and mannan-oligosaccharide (MOS) .
Examples of the polysaccharide may include glycogen, starch (amylose, amylopectin) , cellulose, dextrin, and glucan ( β-l , 3-glucan) , and starch and cellulose are
preferable .
[0095]
Examples of the microbial protein may include
polypeptides derived from a yeast or bacterium.
Examples of the plant protein may include polypeptides derived from soybean, corn, canola, Jatropha, palm, peanut, sunflower, coconut, mustard, cotton seed, palm kernel oil, olive, safflower, sesame and linseed.
[0096]
Examples of the lipid may include substances
containing one or more saturated or unsaturated fatty acids of C4 or more. [0097]
The oil can be the lipid that contains one or more saturated or unsaturated fatty acids of C4 or more and is liquid at room temperature, and examples of the oil may include lipids derived from soybean, corn, canola, Jatropha, palm, peanut, sunflower, coconut, mustard, cotton seed, palm kernel oil, olive, safflower, sesame, linseed, oily microbial cells, Chinese tallow tree, and a combination of two or more thereof.
[0098]
Examples of the fatty acid may include compounds represented by a formula RCOOH ("R" represents a
hydrocarbon group having two or more carbon atoms) .
The unsaturated fatty acid is a compound having at least one double bond between two carbon atoms in the group "R" as described above, and examples of the unsaturated fatty acid may include oleic acid, vaccenic acid, linoleic acid, palmitelaidic acid and arachidonic acid.
The saturated fatty acid is a compound where the "R" is a saturated aliphatic group, and examples of the
saturated fatty acid may include docosanoic acid,
eicosanoic acid, octadecanoic acid, hexadecanoic acid, tetradecanoic acid (myristate) , and dodecanoic acid.
Among them, those containing one or more C2 to C22 fatty acids are preferable as the fatty acid, and those containing C12 fatty acid, C14' fatty acid, C16 fatty acid, C18 fatty acid, C20 fatty acid and C22 fatty acid are more preferable.
The carbon source may include salts (e.g., isopropyl myristate) and derivatives of these fatty acids and salts of these derivatives. Examples of the salt may include lithium salts, potassium salts, sodium salts and so forth.
[0099] Examples of the carbon source may also include
combinations of carbohydrates such as glucose with lipids, oils, fats, fatty acids and glycerol fatty acid esters.
[ [0100]
Examples of the renewable carbon source may include hydrolyzed biomass carbon sources.
Examples of the biomass carbon source may include cellulose-based substrates such as waste materials of woods, papers and pulps, leafy plants, and fruit pulps; and
partial plants such as stalks, grain particles, roots and tubers .
Examples of the plant to be used as the biomass carbon source may include corn, wheat, rye, sorghum, triticale, rice, millet, barley, cassava, legume such as pea, potato, sweet potato, banana, sugar cane and tapioca.
[0101]
When the renewable carbon source such as biomass is added to the culture medium, the carbon source can be pretreated. Examples of the pretreatment may include an enzymatic pretreatment, a chemical pretreatment, and a combination of the enzymatic pretreatment and the chemical pretreatment.
It is preferred that the renewable carbon source is entirely or partially hydrolyzed before being added to the culture medium.
[0102]
Examples of the carbon source may also include the yeast extract and a combination of the yeast extract with the other carbon source such as glucose. The combination of the yeast extract with the CI compound such as carbon dioxide and methanol is preferable.
[0103]
In the method of the present invention, it is preferable to culture the isoprenoid compound-producing microorganism in a standard culture medium containing saline and nutrients.
The culture medium is not particularly limited, and examples of the culture medium may include ready-made general media that is commercially available such as Luria Bertani (LB) broth, Sabouraud dextrose (SD) broth, and yeast medium (YM) broth. The medium suitable for the cultivation of the specific host can be selected
appropriately for the use.
[0104]
It is desirable that the cell medium contains
appropriate minerals, salts, supplemental elements, buffers, and ingredients known for those skilled in the art to be suitable for the cultivation and to facilitate the
production of the isoprenoid compound in addition to the appropriate carbon source.
[0105]
A standard cell culture condition is regulated as described above can be used as a culture condition for the isoprenoid compound-producing microorganism.
A culture temperature can be 20 to 40°C, and a pH value can be about 4.5 to about 9.5.
The isoprenoid compound-producing microorganism can be cultured under an aerobic, oxygen-free, or anaerobic
condition depending on a nature of the host for the
isoprenoid compound-producing microorganism. A known fermentation method such as a batch cultivation method, a feeding cultivation method or a continuous cultivation method can appropriately be used as a cultivation method.
[0106]
The method of producing the polyisoprene according to the present invention comprises the following (I) and (II): (I) forming an isoprene by the method of the present invention; and
(II) polymerizing the isoprene to form a polyisoprene .
[0107]
The step (I) can be performed in the same manner as in the method of producing an isoprenoid compound, such as the isoprene, linalool, or limonene, according to the present invention described above. The polymerization of the isoprene in the step (II) can be performed by any method known in the art (e.g., synthesis methods such as addition polymerization in organic chemistry) .
[0108]
Method for producing a rubber composition
The rubber composition of the present invention comprises a polymer derived from isoprene produced by the method for producing isoprene according to the present invention. The polymer derived from isoprene may be a homopolymer (i.e., isoprene polymer, or polyisoprene) or a heteropolymer comprising isoprene and one or more monomer units other than the isoprene (e.g., a copolymer such as a block copolymer) . Preferably, the polymer derived from isoprene is a homopolymer (i.e., polyisoprene) produced by the method for producing polyisoprene according to the method of the present invention. The rubber composition of the present invention may further comprise one or more polymers other than the above polymer, one or more rubber components, and/or other components. The rubber
composition of the present invention can be manufactured using the polymer derived from isoprene. For example, the rubber composition of the present invention can be prepared by mixing the polymer derived from isoprene with one or more polymers other than the above polymer, one or more rubber components, and/or other components such as a reinforcing filler, a crosslinking agent, a vulcanization accelerator and an antioxidant.
[0109]
Method for producing a tire
The tire of the present invention is manufactured by using the rubber composition of the present invention. The rubber composition of the present invention may be applied to any portion of the tire without limitation, which may be selected as appropriate depending on the application thereof. For example, the rubber composition of the present invention may be used in a tread, a base tread, a sidewall, a side reinforcing rubber and a bead filler of a tire. The tire can be manufactured by a conventional method. For example, a carcass layer, a belt layer, a tread layer, which are composed of unvulcanized rubber, and other members used for the production of usual tires are successively laminated on a tire molding drum, then the drum is withdrawn to obtain a green tire. Thereafter, the green tire is heated and vulcanized in accordance with an ordinary method, to thereby obtain a desired tire (e.g., a pneumatic tire) .
EXAMPLES
[0110]
Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited to the following Examples.
[0111]
Reference Example 1: Construction of microaerobically inducible isoprenoid compound-producing microorganism
(SWITCH-Plld/IspSM) , phosphate deficiency-inducible
isoprenoid compound-producing microorganism (SWITCH- PphoC/IspSM, SWITCH-PpstS/IspSM) and arabinose-inducible isoprenoid compound-producing microorganism (SWITCH- Para/IspSM)
1-1) Construction of pMW-Para-mvaES-Ttrp
1-1-1) Chemical synthesis of mvaES gene derived from
Enterococcus faecalis
A nucleotide sequence and an amino acid sequence of mvaE encoding acetyl-CoA acetyltransferase and
hydroxymethylglutaryl-CoA reductase and derived from
Enterococcus faecalis have been already known (Accession number of nucleotide sequence: AF290092.1 , ( 1479..3890 ) , Accession number of amino acid sequence: AAG02439) (J.
Bacteriol. 182 (15), 4319-4327 (2000)). The amino acid sequence of the mvaE protein derived from Enterococcus faecalis and the nucleotide sequence of its gene are shown as SEQ ID NO: 20 and SEQ ID NO: 21, respectively. In order to efficiently express the mvaE gene in E. coli, an mvaE gene in which codon usage in E. coli had been optimized was designed, and. this was designated as EFmvaE. This
nucleotide sequence is shown as SEQ ID NO: 22. The mvaE gene was chemically synthesized, then was cloned into pUC57 (supplied from GenScript) , and the resulting plasmid was designated as pUC57-EFmvaE .
[0112]
1-1-2) Chemical synthesis of mvaS gene derived from
Enterococcus faecalis
A nucleotide sequence encoding hydroxymethylglutaryl- CoA synthase and derived from Enterococcus faecalis, and its amino acid sequence have been already known (Accession number of nucleotide sequence: AF290092.1, complement
(142..1293), Accession number of amino acid sequence:
AAG02438) (J. Bacteriol. 182(15), 4319-4327 (2000)). The amino acid sequence of the mvaS protein derived from
Enterococcus faecalis and the nucleotide sequence of its gene are shown as SEQ ID NO: 23 and SEQ ID NO: 24,
respectively. In order, to efficiently express the mvaS gene in E. coli, an mvaS gene in which the codon usage in E. coli had been optimized was designed, and this was
designated as EFmvaS. This nucleotide sequence is shown as SEQ ID NO: 25. The mvaS gene was chemically synthesized, then was cloned into pUC57 (supplied from GenScript) , and the resulting plasmid was designated as pUC57-EFmvaS .
[0113]
1-1-3) Construction of expression vector for arabinose- inducible navaES
An expression vector for arabinose-inducible gene upstream of the mevalonate pathway was constructed by the following procedure. PCR with plasmid pKD46 as the
template was carried out using synthesized oligonucleotides shown as SEQ ID NO: 26 and SEQ ID NO: 27 as primers to obtain a PCR fragment containing Para composed of araC and an araBAD promoter derived from E. coli. PCR with plasmid pUC57-EFmvaE as the template was carried out using
synthesized oligonucleotides shown as SEQ ID NO: 28 and SEQ ID NO: 29 as primers to obtain a PCR fragment containing the EFmvaE gene. PCR with plasmid pUC57-EFmvaS as the template was carried out using synthesized oligonucleotides shown as SEQ ID NO: 30 and SEQ ID NO: 31 as primers to obtain a PCR fragment containing the EFmvaS gene. PCR with plasmid pSTV-Ptac-Ttrp ( O2013069634A1 ) as the template was carried out using synthesized oligonucleotides shown as SEQ ID
NO: 32 and SEQ ID NO: 33 as primers to obtain a PCR fragment containing a Ttrp sequence. Prime Star polymerase
(supplied from Takara Bio Inc.) was used for PCR for
obtaining these four PCR fragments. A reaction solution was prepared according to a composition attached to a kit, and DNA was amplified through 30 cycles of reactions at 98°C for 10 seconds, 55°C for 5 seconds and 72°C for one minute per kb. PCR with the purified PCR product
containing Para and PCR product cobtaining the EFmvaE gene as the template was carried out using synthesized
oligonucleotides shown as SEQ ID NO: 26 and SEQ ID NO: 29 as primers, and PCR with the purified PCR product containing the EFmvaS gene and PCR product containing Ttrp as the template was carried out using synthesized oligonucleotides shown in SEQ ID NO: 30 and SEQ ID NO: 33 as primers. As a result, a PCR product containing Para and the EFmvaE gene and a PCR product containing the EFmvaS gene and Ttrp were obtained. A plasmid pMW219 (supplied from Nippon Gene Co., Ltd.) was digested with Smal according to a standard method. pMW219 after being digested with Smal was ligated to the purified PCR product containing Para and the EFmvaE gene and the purified PCR product containing the EFmvaS gene and Ttrp using In-Fusion HD Cloning Kit (supplied from
Clontech) . The resulting plasmid was designated as pMW- Para-mvaES-Ttrp .
[0114]
1-2) Construction of the integrative conditionally
replicated plasmids carrying genes of upper and lower mevalonate pathways
1-2-1) Construction of plasmids containing the mvaES gene under the control of a different promoter
To construct the integrative plasmids carrying genes of upper and lower mevalonate pathways the pAHl62-AattL-
TcR-XattR vector (Minaeva NI et al., BMC Biotechnol., 2008;
8: 63) was used.
[0115]
Kpnl-Sall fragment of pMW-Para-mvaES-Ttrp was cloned into Sphl-Sall recognition sites of pAHl 62-AattL-TcR-AattR. As a result, the pAH162-Para-mvaES plasmid carrying mvaES operon from E. faecalis under control of the E. coli Para promoter and repressor gene araC have been constructed (FIG.
1) -
[0116]
In order to obtain a variant of promoter-deficient operon, an Ecll36II-SalI fragment of p W219-Para-mvaES-Ttrp was subcloned into the same integrative vector. A map of the resulting plasmid is shown in FIG. 2.
[0117]
A set of plasmids for chromosome fixation, which retained the mvaES gene under the control of a different promoter was constructed. For this purpose, a polylinker containing I-Scel, Xhol, Pstl and Sphl recognition sites was inserted into unique Hindlll recognition site located upstream of the mvaES gene. In order to accomplish this purpose, annealing was carried out using the primers 1, 2 (Table 1) and polynucleotide kinase. After that the
resulting double-stranded DNA fragment was 5'
phosphorylated with polynucleotide kinase and the resulting phosphorylated fragment was inserted into a pAH162-mvaES plasmid cleaved with Hindlll by a ligation reaction. The resulting pAHl62-MCS-mvaES plasmid (FIG. 3) is convenient for cloning of a promoter while a desired orientation is kept before the mvaES gene. DNA fragments retaining a regulatory region of a lldD, phoC and pstS genes were formed by PCR with genomic DNA from P.ananatis SC17(0) strain (Katashkina JI et al . , BMC Mol Biol., 2009; 10: 34) as the template using primers 3 and 4, primers 5 and 6, and primers 7 and 8 (Table 1) , respectively, and cloned into an appropriate restriction enzyme recognition site of pAH162- MCS-mvaES. The resulting plasmids are shown in FIG. 4.
The cloned promoter fragments were sequenced and confirmed to exactly correspond to predicted nucleotide sequences. [0118]
1-2-2) Construction of pAH162-Km-Ptac-KDyI plasmid for chromosome fixation
An Aatll-Apal fragment of pAH162-AattL-TcR-AattR containing a tetAR gene (Minaeva NI et al.,B C Biotechnol., 2008; 8: 63) was replaced with a DNA fragment obtained by PCR with a pUC4K plasmid (Taylor LA and Rose RE., Nucleic Acids Res., 16, 358, 1988) as the template using the primers 9 and 10 (Table 1) . As a result, pAH162-AattL-KmR- AattR was obtained (FIG. 5) .
[0119]
A Ptac promoter was inserted into a Hindlll-Sphl recognition site of the pAH162-AattL-TcR-AattR vector
(Minaeva NI et al.,BMC Biotechnol., 2008; 8: 63). As a result, an expression vector pAH162-Ptac for the chromosome fixation was constructed. The cloned promoter fragment was sequenced and confirmed to be the sequence as designed. A map of pAH162-Ptac is shown in FIG. 6.
[0120]
A DNA fragment that retained a PMK, MVD and yldl genes derived from S. cerevisiae, in which rare codons had been replaced with synonimous codons, and had been synthesized by ATG Service Gene (Russia) (FIG. 7) was subcloned into a Sphl-Kpnl restriction enzyme recognition site of the vector pAH162-Ptac for the chromosome fixation. The DNA sequence including synthesized KDyl operon is shown in SEQ ID NO: 58. The resulting plasmid pAH162-Tc-Ptac-KDyI retaining a Ptac- KDyl expression cassette is shown in FIG. 8(A).
Subsequently, for the purpose of replacing a drug resistant marker gene, a Notl-Kpnl fragment of pAH162-Tc-Ptac-KDyI retaining the tetAR gene was replaced with a corresponding fragment of pAHl62-AattL-KmR-AattR. As a result, a plasmid pAHl62-Km-Ptac-KDyI having a kanamycin resistant gene, kan as a marker was obtained (FIG. 8 (B) ) .
[0121]
A chemically synthesized DNA fragment containing a coding region of a putative mvk gene derived from SANAE (for full-length genomic sequence, see GenBank Accession
Number AP011532) that was strain of Methanocella paludicola, which had been ligated to a classical SD sequence, was cloned into a Pstl-Kpnl recognition site of the above integrative expression vector pAH162-Ptac. A map of the plasmid for the chromosome fixation retaining the mvk gene is shown in FIG. 9.
[0122]
1-3) Construction of recipient strain SC17(0)
AampC : : attBPhi8o AampH : : attBPhiso Acrt : : Ptac-mvk {M.
paludicola)
Using two-stage technique including λ-Red dependent integration- of a PCR amplified DNA fragment containing the kan gene flanked by attLphi8o and attRPhiso and 40 bp
sequences homologous to a target chromosome site
(Katashkina JI et al., BMC Mol Biol., 2009; 10: 34), and subsequent phage phi80 Int/Xis dependent removal of the kanamycin resistant marker (Andreeva IG et al., FEMS
Microbiol Lett., 2011; 318(1): 55-60), chromosomal
modifications of AampH : : attBphi8o and AampC : : attBphi8o was introduced into P. ananatis SC17(0) strain in a stepwise fashion. SC17(0) is a λ-Red resistant derivative of P.
ananatis AJ13355 (Katashkina JI et al., BMC Mol Biol.,
2009; 10: 34); an annotated full-length genomic sequence of P. ananatis AJ13355 is available as PRJDA162073 or GenBank Accession Numbers AP012032.1 and AP012033.1. Using
pMWattphi plasmid [Minaeva NI et al., BMC
Biotechnol . , 2008 ; 8 : 63] as the template and using primers 11 and 12, and primers 13 and 14 (Table 1) as the primers, DNA fragments used for integration into an ampH and ampC gene regions, respectively, were formed. The primers 15 and 16, and the primers 17 and 18 (Table 1) were used to verify the resulting chromosome modifications by PCR.
[0123]
In parallel, a derivative of P. ananatis SC17(0) retaining an attB site of phi80 phage in place of a crt operon located on pEA320 320 kb megaplasmid that was a part of P. ananatis AJ13355 genome was constructed. In order to obtain this strain, λ-Red dependent integration of PCR- amplified DNA fragment retaining attLphi8o-kan-attRPhi8o
flanked by a 40 bp region homologous to a target site in genome was carried out according to the previously
described technique (Katashkina JI et al., BMC ol Biol., 2009; 10: 34). Therefore, a DNA fragment to be used in the replacement of the crt operon with attLphi8o-kan-attRphi8o was amplified in the reaction using the primers 19 and 20
(Table 1). A pM attphi plasmid (Minaeva NI et al., BMC Biotechnol., 2008; 8: 63) was used as template in this reaction. The resulting integrated product was designated as SC17(0) Acrt : : attLphi80"kan-attRPhi8o · The primers 21 and 22 (Table 1) were used to verify the chromosome structure of SC17(0) Acrt: rattLphieo-kan-attRphiso by PCR. The
kanamycin resistance marker was removed from the
constructed strain according to the reported technique using a pAH129-cat helper plasmid (Andreeva IG et al., FEMS Microbiol Lett., 2011; 318(1): 55-60). The
Oligonucleotides 21 and 22 were used to verify the
resulting SC17(0) Acrt : : attBphi8o strain by PCR. Maps of genome-modified products, AampC : : attBphi8o, AampH : : attBphi80 and Acrt : : attBphieo are shown in FIG. 10 (A), (B) and (C) , respectively.
[0124] The aforementioned pAH162-Ptac-mvk {M. paludicola) plasmid was integrated into an attBphi8o site of SC17(0) Acrt : : attBphiBo according to the reported protocol (Andreeva IG et al., FEMS Microbiol Lett., 2011; 318(1): 55-60). The integration of the plasmid was confirmed by the polymerase chain reaction using the primers 21 and 23 and the primers 22 and 24 (Table 1). As a result, SC17(0) Acrt : : pAH162- Ptac-mvk (M. paludicola) strain was obtained. A map of the modified genome of Acrt : :pAH162-Ptac-mvk (M. paludicola) is shown in FIG. 11(A).
Subsequently, a genetic trait of SC17 (0) Acrt : : pAH162- Ptac-mvk (M. paludicola) was transferred to SC17(0)
AampC : : attBPhi8o AampH : : attBphi8o via a genome DNA
electroporation method (Katashkina JI et al., BMC Mol Biol., 2009; 10: 34). The resulting strain utilizes a
tetracycline resistant gene, tetRA as the marker. Vector part of the pAH162-Ptac-mvk (M. paludicola) integrative plasmid including tetRA marker genes was eliminated using the reported pMW-intxis-cat helper plasmid (Katashkina JI et al., BMC Mol Biol., 2009; 10: 34). As a result, SC17(0) AampH: : attBveo AampC : : attB^o Acrt : : Ptac-mvk (M. paludicola) with deletion of the marker gene was obtained. A map of the modified genome of Acrt : : Ptac-mvk (Af. paludicola) is shown in FIG. 11 (B) .
[0125]
1-4) Construction of set of SWITCH strains
The pAH162-Km-Ptac-KDyI plasmid was integrated into a chromosome of SC17(0) AampH : : attB<p8o AampC : : attBcp8o
Acrt : : Ptac-mvk (M. paludicola ) /pAH123-cat strain according to the reported protocol (Andreeva IG et al . , FEMS
Microbiol Lett. 2011; 318(1): 55-60). The cells were seeded on an LB agar containing 50 mg/L of kanamycin. A grown KmR clone was examined by PCR reaction using the primers 11 and 15 and the primers 11 and 17 (Table 1) .
Strains retaining the pAH162-Km-Ptac-KDyI plasmid
integrated into AampH : : attBp80 or AampC : : attBcp80m were chosen. Maps of the modified chromosomes of AampH: :pAH162-Km-Ptac- KDyl, AampC: :pAH162-Km-Ptac-KDyI and AampC : : Ptac-KDyl are shown in FIG. 12(A), (B) and (C) .
pAH162-Px-mvaES (here, Px is one of the following regulatory regions: araC-Para {E.coli), PndD, Pphoc, Ppsts) was inserted into the attBphi8o site of SC17(0) AampC : : pAH162- Km-Ptac-KDyl AampH : : attBphi8o Acrt : : Ptac-mvk (M. paludicola) and SC17(0) AampC : : attBphi80 AampH : : pAHl 62-Km-Ptac-KDyI
Acrt :: Ptac-mvk (M. paludicola) recipient strains using a pAH123-cat helper plasmid according to the reported
protocol (Andreeva IG et al., FEMS Microbiol Lett., 2011; 318(1): 55-60). As a result, two sets of strains
designated as SWITCH-Px-l and SWITCH-Px-2 were obtained.
Maps of the modified chromosomes of AampH : : pAHl 62-Px-mvaES and AampC : : pAH162-Px-mvaES are shown in FIG. 13.
[0126]
Table 1. Primer sequences utilized in Reference Example 1
Name Sequence 5'-> 3'
1 Linker-F AGCm¾GGGM'A C-¾GGCT^ ID NO:34)
2 Linker-R AGCTTGCATGCCTGCIAGCTCGftGATTACCCTGTTATCCCTA^(SEQ ID NO: 35)
3 lldD5'CAS TTTTTAAGCTTTAGGGATAAC^^ (SEQ ID
NO: 36)
4 lldD3'CAS TTTTTAAGCTTGCATGCCTGCAGTATTTAATAGAATCAGG?rAG(SEQ ID NO: 37)
5 phoC5'CAS TTTTTAAGCTTTAGGGATAACAGGGTAATCTCGAGTGGATAACCTCAT^ (SEQ ID
NO: 38)
6 phoC3'CAS T TTTAAGCTTGCATGCCrGCAGTTGATGTCTGAT^ (SEQ ID NO: 39)
7 pstS5'CAS T TTTAAGCTTTAGGGATAACAGGGTAATCTCGAGAG^ (SEQ ID
NO: 0)
8 pstS3'CAS TTTTTAAGCTTGCATGCCTGCAGAGGGGAGAAAAGTCAGGCTAA(SEQ ID NO: 41)
9 n67 TGCGAAGACGTCCTCGTGAAGAAGGTGTTGCTG (SEQ ID NO: 42)
10 n68 TGCGAAGGGCCCCGTTGTGTCTCAAAATCTCTGATG (SEQ ID NO: 43)
11 ampH- attL- ATGCGCACTCCTTACGTACTGGCTCTACTGGTTTCTTTGCGAAAGGTCATTTTTCCTGA^ phi80 TGCTCACA(SEQ ID NO: 4)
Figure imgf000075_0001
4 pR-test GATTGGTGGTTGAATTGTCCGTAAC(SEQ ID NO: 7)
[0127]
1-5) Introduction of isoprene synthase expression plasmid
Electrocompetent cells of SWITCH strains were prepared accoridng to a standard method, and pSTV28-Ptac-IspSM
(WO2013/179722) that was an expression vector for isoprene synthase derived from mucuna was introduced thereto by the electroporation . The resulting isoprenoid compound- producing microorganisms were designated as SWITCH- Para/IspSM, SWITCH-Plld/IspSM, SWITCH-PpstS/IspS , and SWITCH-PphoC/IspSM.
[0128]
Example 1: Evaluation of cultivation of SWITCH-PphoC
Agcd/IspSM
The gcd gene in P. ananatis codes for glucose
dehydrogenase, and it has been known that P. ananatis accumulates gluconate during aerobic growth (Andreeva IG et al., FEMS Microbiol Lett. 2011 May;318 (1) : 55-60) The SC17(0)Agcd strain in which gcd gene is disrupted is constructed using ARed-dependent integration of DNA fragments obtained in PCRs with the primers gcd-attL and gcd-attR (Table 2) and pMW118-attL-kan-attR plasmid
[Minaeva NI et al., BMC Biotechnol. 2008; 8:63] as a
template. To verify the integrant, the primers gcd-tl and gcd-t2 (Table 2) are used.
[0129]
Genomic DNA of the SC17(0)Agcd strain is isolated using the Wizard Genomic DNA Purification Kit (Promega) and electro-transformed into the marker-less derivative of the SWITCH-PphoC strain according to the previously described method [Katashkina JI et al., BMC Mol Biol. 2009; 10:34]. As a result, the SWITCH-PphoC-Agcd (KmR) strain is obtained. The primers gcd-tl and gcd-t2 (Table 2) are used for PCR analysis of the obtained integrant. The kanamycin
resistant marker gene is obtained according to the standard AInt/Xis-mediated procedure [Katashkina JI et al., BMC Mol Biol. 2009; 10:34]. The obtained strain is designated as SWITCH-PphoC Aged strain.
[0130]
Table 2. Primer List
Figure imgf000076_0001
[0131]
1-1) Introduction of isoprene synthase expression plasmid Competent cells of SWITCH-PphoC Aged strain was
prepared according to a standard method, and pSTV28-Ptac- IspSM (WO2013/179722 ) that was an expression vector for isoprene synthase derived from mucuna was introduced thereto by the electroporation. The resulting isoprenoid compound-producing microorganisms were designated as
SWITCH-PphoC Agcd/IspSM.
[0132]
1-2) Condition for jar cultivation of isoprenoid compound- producing microorganism
A one liter volume fermenter was used for cultivation of isoprenoid compound-producing microorganisms (SWITCH- PphoC/IspSM and SWITCH-PphoCAgcd/IspS ) . Glucose medium was conditioned in a composition shown in Table 3. Each of these isoprenoid compound-producing microorganisms was applied onto an LB plate containing chloramphenicol (60 mg/L) , and cultured at 34°C for 16 hours. 0.3 L of the glucose medium was added to the one liter volume fermenter, and microbial cells that had sufficiently grown on the one LB plate were inoculated thereto to start the cultivation. As a culture condition, pH was 7.0 (controlled with ammonia gas) , temperature was 30°C, and ventilation at 150
mL/minute was carried out. When aerobic cultivation was carried out, a concentration of oxygen in culture medium (dissolved oxygen (DO) ) was measured using a galvanic type DO sensor SDOU model (ABLE Cooperation) ,' and was controlled with stirring so that a DO value was 5%. During the cultivation, a glucose solution adjusted at 500 g/L was continuously added so that a concentration of glucose in the culture medium was 10 g/L or higher. The DO value was measured at 600 nm using a spectrophotometer (HITACHI U- 2900) . In the cultivation for 48 hours, SWITCH-PphoC/IspSM and SWITCH-PphoCAgcd/IspSM consumed 63.9 g and 77.8 g of glucose, respectively.
[0133]
Table 3. Composition of glucose medium Group A (Final concentration)
Glucose 80 g/L
MgS04-7aq 2.0 g/L
Group B
(NH4)2S04 2.0 g/L
KH2P04 2.0 g/L
FeS04-7aq 20 mg/L
MnS04- 5aq 20 mg/L
Yeast Extract 4.0 g/L
[0134]
Each 0.15 L was prepared for Group A and Group B and sterilized with heating at 115°C for 10 minutes. After cooling, Group A and Group B were mixed, and
chloramphenicol (60 mg/L) was added thereto to use as the medium.
[0135]
1-3) Method of inducing isoprene production phase
A phosphorus-deficient isoprenoid compound-producing microorganism expresses genes upstream of a mevalonate pathway with a phosphorus deficiency-inducible promoter. ■ Thus, when a concentration of phosphorus in the medium is equivalent to or below a certain concentration, an amount of produced isoprene is remarkably increased.
[0136]
1-4) Method of measuring isoprene concentration in
fermentation gas
A concentration of isoprene in fermentation gas was measured using a multi-gas analyzer (supplied from GASERA, F10) .
[0137]
1-5) Method of measuring gluconic acid concentration in medium
Culture supernatant was diluted with pure water to 10 times, and filtrated through a 0.45 μπι filter followed by being analyzed according to the following method using a high performance liquid chromatograph ELITE LaChrom
(Hitachi High Technologies) .
[0138]
<Separation condition>
Columns: Shim-pack SCR-102H (8 mm I.D.x300 mm L) , tandemly connected two columns
Guard column: SCR-102H (6 mm I.D.x50 mm L)
Mobile phase: 5 mM p-toluenesulfonic acid
Flow: 0.8 mL/minute
Temperature: 50°C
Injection volume: 10 μL
[0139]
<Detection condition>
Buffer: 20 mM Bis-Tris aqueous solution containing 5 mM p- toluenesulfonic acid and 100 μΜ EDTA
Flow: 0.8 mL/minute
Detector: CDD-10 AD polarity + response SLOW, temperature: 53°C (column temperature: +3°C) ; scale 1*24 S/cm
[0140]
1-6) Amount of produced isoprene in jar cultivation of isoprenoid compound-producing microorganisms (SWITCH- PphoC/IspSM and SWITCH-PphoCAgcd/IspSM)
The isoprenoid compound-producing microorganisms (SWITCH-PphoC/IspSM and SWITCH-PphoCAgcd/IspSM) were cultured according to the jar cultivation condition as described above, and amounts of produced isoprene were measured. SWITCH-PphoC/IspSM exhibited a decreased O.D. value when production of isoprene was started (FIG.14 (A)), and accumulated 30.9 g/L of 2-ketogluconic acid in the cultivation for 48 hours (FIG.15). SWITCH-PphoCAgcd/IspSM exhibited a constant O.D. value even after starting the production of isoprene (FIG.1 (A)), and an accumulated amount of 2-ketogluconic acid in the cultivation for 48 hours was 1.4 g/L, which was an extremely low amount
(FIG.15). The amounts of isoprene produced in the
cultivation for 48 hours were 1771 mg and 2553 mg in
S ITCH-PphoC/IspSM and SWITCH-PphoCAgcd/IspSM, respectively
(FIG.14(B)). From this result, it was shown that the production of 2-ketogluconic acid was suppressed while the amount of produced isoprene was increased in SWITCH- PphoCAgcd/IspSM.
[0141]
Example 2: Construction of expression plasmid for linalool synthase
2-1) Acquisition of linalool synthase gene derived from Actinidia arguta (hardy kiwifruit)
A nucleotide sequence (GenBank accession number:
GQ338153) and an amino acid sequence (GenPept accession number: ADD81294) of a linalool synthase (AaLINS) gene derived from Actinidia arguta have been already known
(Chen,X.et al., (2010) Functional Plant Biology, 37, 232- 243) . The amino acid sequence of a linalool synthase protein and the nucleotide sequence of its gene derived from Actinidia arguta are shown in SEQ ID NO:l and SEQ ID NO: 2, respectively. In order to efficiently express the AaLINS gene, codons were optimized, an AaLINS gene in which a chloroplast localization signal had been cleaved was designed, and this was designated as opt_AaLINS. A
nucleotide sequence of opt_AaLINS is shown in SEQ ID NO: 3. DNA in which a tac promoter region (deBoer, et al., (1983) Proc. Natl. Acad. Sci. USA., 80, 21-25) had been added to the opt_AaLINS gene was chemically synthesized, cloned into p H9 (supplied from Nippon Gene) and the resulting plasmid was designated as pMW119-Ptac-opt_AaLINS .
[0142] 2-2) Acquisition of linalool synthase gene derived from Coriandrum sativum (coriander)
A nucleotide sequence (GenBank accession number:
KF700700) and an amino acid sequence (GenPept accession number: AHC54051) of a linalool synthase (CsLINS) gene derived from Coriandrum sativum have been already known (Galata M et al., (2014) Phytochemistry, 102, 64-73). The amino acid sequence of a linalool synthase protein and the nucleotide sequence of its gene derived from Coriandrum sativum are shown in SEQ ID NO: 4 and SEQ ID NO: 5,
respectively. In order to efficiently express the CsLINS gene, codons were optimized, a CsLINS gene in which the chloroplast localization signal had been cleaved was designed, and this was designated as opt_CsLINS. A
nucleotide sequence of opt_CsLINS is shown in SEQ ID NO: 6. DNA in which the tac promoter region (deBoer, et al.,
(1983) Proc. Natl. Acad. Sci. USA., 80, 21-25) had been added to the opt_CsLINS gene was chemically synthesized, cloned into pMW119 (supplied from Nippon Gene) , and the resulting plasmid was designated as pM 119-Ptac-opt_CsLINS .
[0143]
2-3) Acquisition of mutated farnesyl diphosphate synthase gene derived from Escherichia coli
Farnesyl diphosphate synthase derived from Escherichia coli is encoded by an ispA gene (SEQ ID NO: 7) (Fujisaki S., et al. (1990) J. Biochem. (Tokyo) 108 : 995-1000) . A
mutation which increases a concentration of geranyl
diphosphate in microbial cells has been demonstrated in farnesyl diphosphate synthase derived from Bacillus
stearothemophilus (Narita K. , et al. (1999) J Biochem
126 (3) : 566-571) . Based on this finding, the similar mutant has been also produced in farnesyl diphosphate synthase derived from Escherichia coli {Reiling KK et al. (2004) Biotechnol Bioeng. 87(2) 200-212) . In order to efficiently express an ispA mutant (S80F) gene having a high activity for producing geranyl diphosphate, a sequence in which the codons were optimized was designed and designated as ispA*. A nucleotide sequence of ispA* is shown in SEQ ID NO: 8.
The ispA* gene was chemically synthesized, subsequently cloned into pMW119 (supplied from Nippon Gene) and the resulting plasmid was designated as pMW119-ispA* .
[0144]
2-4) Construction of co-expression plasmid for opt_AaLINS and ispA* genes
PCR with pMWH9-Ptac-opt_AaLINS as a template was carried out using primers shown in SEQ ID NO: 9 and SEQ ID NO: 11 to obtain a Ptac-opt_AaLINS fragment. Further, PCR with pMW119-ispA* as a template was carried out using primers shown in SEQ ID NO: 12 and SEQ ID NO: 13 to obtain an ispA* fragment. The purified Ptac-opt_AaLINS fragment and ispA* fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes Pstl and Seal using In-Fusion HD cloning kit (supplied from
Clontech) to construct pACYC177-Ptac-opt_AaLINS-ispA*.
[0145]
2-5) Construction of co-expression plasmid for opt_CsLINS and ispA* genes
PCR with pMWH9-Ptac-opt_CsLINS as a template was carried out using primers shown in SEQ ID NO: 9 and SEQ ID NO: 14 to obtain a Ptac-opt_CsLINS fragment. Further, PCR with pMW119-ispA* as a template was carried out using primers shown in SEQ ID NO: 15 and SEQ ID NO: 13 to obtain an ispA* fragment. The purified Ptac-opt_CsLINS fragment and ispA* fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes Pstl and Seal using In-Fusion HD cloning kit (supplied from Clontech) to construct pACYC177-Ptac-opt_CsLINS-ispA* .
[0146]
2-6) Preparation of linalool production strains
Competent cells of SWITCH-PphoC Aged were prepared, and pACYC177, pACYC177-Ptac-opt_AaLINS-ispA* or pACYC177- Ptac-opt_CsLINS-ispA* was introduced thereto by
electroporation . Resulting strains, were designated as SWITCH-PphoC Agcd/pACYC177, SWITCH-PphoC Agcd/AaLINS-ispA* and SWITCH-PphoC Agcd/CsLINS-ispA* .
[0147]
Meanwhile, competent cells of SWITCH-PphoC were prepared, and pACYC177, pACYC177-Ptac-opt_AaLINS-ispA* or pACYC177-Ptac-opt_CsLINS-ispA* was introduced thereto by electroporation. Resulting strains were designated as SWITCH-PphoC/pACYC177, SWITCH-PphoC/AaLINS-ispA* and
SWITCH-PphoC/CsLINS-ispA* .
[0148]
Example 3: Evaluation of ability to produce linalool by linalool synthase-expressing strains derived from SWITCH- PphoC strain
Microbial cells of SWITCH-PphoC/AaLINS-ispA*, SWITCH- PphoC/CsLINS-ispA* and SWITCH-PphoC/pACYC177 strains obtained in Example 2 in glycerol stock were thawed.
Subseguently 50 μΐ, of a microbial cell suspension from each strain was evenly applied onto an LB plate containing 50 mg/L of kanamycin, and cultured at 34 °C for 16 hours. The resulting microbial cells on the plate were picked up in an amount corresponding to about 1/4 of a loop part of a 10 \i~L inoculating loop (supplied from Thermo Fisher Scientific Inc.). The picked up microbial cells were inoculated to 5 inL of fermentation medium described in Table 4 containing 50 mg/L of kanamycin in a test tube supplied from AGC
Techno Glass Co., Ltd. (diameter x length x thickness=25x200xl .2 mm), and cultured at 30°C on a reciprocal shaking culture apparatus at 120 rpm for 24 hours .
[0149]
Table 4. Fermentation medium for SWITCH-PphoC, host strain for production of linalool
Group A
D-Glucose 40 g/L
gS0 -7H20 1 g/L
Not adjusted pH, AC 115°C, 10 minutes
Group B
(NH4)2S04 20 g/L
KH2P04 0.5 g/L
Yeast extract 2 g/L
FeS0 -7H20 0.01 g/L
MnS04-5H20 0.01 g/L
After adjusting pH to 7.0 with KOH, AC 115°C, 10 minutes
Group C
CaC03 20 g/L
Dry-heat sterilization 180°C, 2 hours
[0150]
After the sterilization, the above Groups A, B and C were mixed. Then, 1 mL of isopropyl myristate (Tokyo Chemical Industry Co., Ltd.) was added to 5 mL of the fermentation medium dispensed in the test tube.
[0151]
Twenty-four hours after starting the cultivation, the concentrations of linalool in the isopropyl myristate and culture supernatant were measured under the following condition using a gas chromatograph GC-2025AF (supplied from Shimadzu Corporation) . DB-5 (supplied from Agilent, length 30 m, internal diameter 0.25 mm, thickness 0.25 μπι) was used as a column, and a linalool standard solution was prepared using a reagent Linalool (supplied from Wako Pure Chemical Industries Ltd.).
[0152]
Temperature in vaporization chamber 360.0°C
Injection amount 1.0 L
Injection mode Split 1:10
Carrier gas He
Control mode Line velocity Pressure 125.5 kPa
Total flow 20.5 mL/minute Column flow 1.59 mL/minute Line velocity 36.3 cm/sec
Purge flow 3.0 mL/minute
[0153]
Column oven temperature program Total time 21.5 minutes Rate (°C/minute) Temperature (°C) Hold time (min)
65.0 5.0
5.0 105.0 0.5
35.0 297.5 2.5
Detector temperature 375.0°C
Detector FID
Make-up gas He (30.0 mL/min)
Hydrogen flow 40.0 mL/min
Air 400.0 mL/min
[0154]
The concentration of linalool is shown as a value in terms of medium amount. A mean value of results obtained from two test tubes is shown in Table 5.
[0155]
Table 5. Accumulation of linalool when linalool synthase derived from Coriandrum sativum and linalool synthase derived from Actinidia arguta were introduced Strain O.D. (620nm) Linalool (mg/L)
SWITCH-PphoC/pACYC177 17.5 0.0
SWITCH-PphoC/CsLINS-ispA* 25.8 0.7
SWITCH-PphoC/AaLINS-ispA* 26.4 805.3
[0156]
Example 4: Evaluation of ability to produce linalool by linalool synthase-expressing strains derived from SWITCH- PphoC Aged strain
Microbial cells of SWITCH-PphoC Aged/AaLINS-ispA*, SWITCH-PphoC Agcd/CsLINS-ispA* and SWITCH-PphoC
Agcd/pACYC177 strains obtained in Example 2 in glycerol stock were thawed. Subsequently 50 \i of a microbial cell suspension from each strain was evenly applied onto an LB plate containing 50 mg/L of kanamycin, and cultured at 34°C for 16 hours. The resulting microbial cells on the plate were picked up in an amount corresponding to about 1/4 of a loop part of a 10 pL inoculating loop (supplied from Thermo Fisher Scientific Inc.). The picked up microbial cells were inoculated to 5 mL of fermentation medium described in Table 6 containing 50 mg/L of kanamycin in a test tube supplied from AGC Techno Glass Co., Ltd. (diameter x length x thickness=25x200xl .2 mm), and cultured at 30°C on a reciprocal shaking culture apparatus at 120 rpm for 24 hours .
[0157]
Table 6. Fermentation medium for SWITCH-PphoC Aged, host strain for production of linalool
Group A
D-Glucose 40 g/L
MgS0 -7H20 1 g/L
Not adjusted pH, AC 115°C, 10 minutes
Group B
(NH4)2S04 20 g/L
KH2P0 0.5 g/L Yeast extract 2 g/L
FeS04-7H20 0.01 g/L
nS04-5H20 0.01 g/L
After adjusting pH to 7.0 with KOH, AC 10 minutes
Group C
CaC03 20 g/L
Dry-heat sterilization 180°C, 2 hours
[0158]
After the sterilization, the above Groups A, B and C were mixed. Then, 1 mL of isopropyl myristate (Tokyo Chemical Industry Co., Ltd.) was added to 5 mL of the fermentation medium dispensed in the test tube.
[0159]
Twenty-four hours after starting the cultivation, the concentrations of linalool in the isopropyl myristate and culture supernatant were measured under the following condition using a gas chromatograph GC-2025AF (supplied from Shimadzu Corporation) . DB-5 (supplied from Agilent, length 30 m, internal diameter 0.25 mm, thickness 0.25 μιη) was used as a column, and a linalool standard solution was prepared using a reagent Linalool (supplied from Wako Pure Chemical Industries Ltd.).
[0160]
Temperature in vaporization chamber 360.0°C
Injection amount 1.0 μL
Injection mode Split 1:10
Carrier gas He
Control mode Line velocity
Pressure 125.5 kPa
Total flow 20.5 mL/minute
Column flow 1.59 mL/minute Line velocity 36.3 cm/sec 17
Purge flow 3.0 mL/minute
[0161]
Column oven temperature program Total time 21.5 minutes
Rate (°C/minute) Temperature (°C) Hold time (min)
65.0 5.0
5.0 105.0 0.5
35.0 297.5 2.5
Detector temperature 375.0°C
Detector FID
Make-up gas He (30.0 mL/min)
Hydrogen flow 40.0 mL/min
Air 400.0 mL/min
[0162]
The concentration of linalool is shown as a value in terms of medium amount. A mean value of results obtained from two test tubes is shown in Table 7. No linalool production was observed in the control strain having the introduced control vector pACYC177, whereas the linalool production was confirmed in SWITCH-PphoC Aged/AaLINS-ispA* and SWITCH-PphoC Agcd/CsLINS-ispA* strains.
[0163]
Table 7. Accumulation of linalool when linalool synthase derived from Coriandrum sativum and linalool synthase derived from Actinidia arguta were introduced
Figure imgf000088_0001
[0164]
Example 5
5-1) Acquisition of limonene synthase gene derived from Picea sitchensis (Sitka spruce)
A nucleotide sequence (GenBank accession number:
DQ195275.1) and an amino acid sequence (GenPept accession number: ABA86248.1.) of a limonene synthase (PsLMS) gene derived from Picea sitchensis have been already known. The amino acid sequence of a limonene synthase protein and the nucleotide sequence of its gene derived from P. sitchensis are shown in SEQ ID NO: 61 and SEQ ID NO: 62, respectively. In order to efficiently express the PsLMS gene, its
secondary structure was resolved and codons were optimized so that the codon usage was same as it in P. ananatis .
Moreover, its chloroplast localization signal was cleaved. An obtained gene was designated as opt_PsLMS . A nucleotide sequence of opt_PsLMS is shown in SEQ ID "NO: 63. After opt_PsLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_PsLMS .
[0165]
5-2) Acquisition of limonene synthase gene derived from Abies grandis (Grand fir)
A nucleotide sequence (GenBank accession number:
AF006193.1) and an amino acid sequence (GenPept accession number: AAB70907.1.) of a limonene synthase (AgLMS) gene derived from Abies grandis have been already known. The amino acid sequence of a limonene synthase protein and the nucleotide sequence of its gene derived from A. grandis are shown in SEQ ID NO: 64 and SEQ ID NO: 65, respectively. In order to efficiently express the AgLMS gene, its secondary structure was resolved and codons were optimized so that the codon usage was same as it in P. ananatis . Moreover, its chloroplast localization signal was cleaved. An obtained gene was designated as opt_AgLMS . A nucleotide sequence of opt_AgLMS is shown in SEQ ID NO: 66. After opt_AgLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was. designated as pUC57-opt_AgLMS . [0166]
5-3) Acquisition of limonene synthase gene derived from Mentha spicata (spearmint)
A nucleotide sequence (GenBank accession number:
L13459.1) and an amino acid sequence (GenPept accession number: AAC37366.1.) of a limonene synthase (MsLMS) gene derived from Mentha spicata have been already known. The amino acid sequence of a limonene synthase protein and the nucleotide sequence of its gene derived from M. spicata are shown in SEQ ID NO: 67 and SEQ ID NO: 68, respectively. In order to efficiently express the MsLMS gene, its secondary structure was resolved and codons were optimized so that the codon usage was same as it in P. ananatis . Moreover, its chloroplast localization signal was cleaved. An obtained gene was designated as opt_MsLMS. A nucleotide sequence of opt_MsLMS is shown in SEQ ID NO: 69. After opt_MsLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_MsLMS .
[0167]
5-4) Acquisition of limonene synthase gene derived from Citrus unshiu (Unshu mikan)
A nucleotide sequence (GenBank accession number:
AB110637.1) and an amino acid sequence (GenPept accession number: BAD27257.1) of a limonene synthase (CuLMS) gene derived from Citrus unshiu have been already known. The amino acid sequence of a limonene synthase protein and the nucleotide sequence of its gene derived from C. unshiu are shown in SEQ ID NO: 70 and SEQ ID NO: 71, respectively. In order to efficiently express the CuLMS gene, its secondary structure was resolved and codons were optimized so that the codon usage was same as it in P. ananatis . Moreover, its chloroplast localization signal was cleaved. An obtained gene was designated as opt_CuLMS . A nucleotide sequence of opt_CuLMS is shown in SEQ ID NO: 72. After opt_CuLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_CuLMS .
[0168]
5-5) Acquisition of limonene synthase gene derived from Citrus limon (lemon)
A nucleotide sequence (GenBank accession number:
AF514287.1) and an amino acid sequence (GenPept accession number: AAM53944.1) of a limonene synthase (C1LMS) gene derived from Citrus limon have been already known. The amino acid sequence of a limonene synthase protein and the nucleotide sequence of its gene derived from C. limon are shown in SEQ ID NO: 73 and SEQ ID NO: 74, respectively. In order to efficiently express the C1LMS gene, its secondary structure was resolved and codons were optimized so that the codon usage was same as it in P. ananatis . Moreover, its chloroplast localization signal was cleaved. An
obtained gene was designated as opt_ClLMS. A nucleotide sequence of opt_ClLMS is shown in SEQ ID NO: 75. After opt_ClLMS gene was chemically synthesized, cloned into pUC57 (supplied from GenScript) and the resulting plasmid was designated as pUC57-opt_ClLMS .
[0169]
5-6) Construction of co-expression plasmid for opt_PsLMS and ispA* genes
PCR with pUC57-opt_PsLMS as a template was carried out using primers shown in SEQ ID NO: 76 and SEQ ID NO: 77. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 77 to obtain a Ptac-opt_PsLMS fragment. Further, PCR with
pMW119-ispA* as a template was carried out using primers shown in SEQ ID NO:79 and SEQ ID NO:80 to obtain an ispA* fragment. The purified Ptac-opt_PsLMS fragment and ispA* fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
construct pACYC177-Ptac-opt_PsLMS-ispA* .
[0170]
5-7) Construction of co-expression plasmid for opt_AgL S and ispA* genes
PCR with pUC57-opt_AgLMS as a template was carried out using primers shown in SEQ ID- O: 81 and SEQ ID NO:82. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 82 to obtain a Ptac-opt_AgL S fragment. Further, PCR with
pM 119-ispA* as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA* fragment. The purified Ptac-opt_AgLMS fragment and ispA* fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
construct pACYC177-Ptac-opt_AgLMS-ispA* .
[0171]
5-8) Construction of co-expression plasmid for opt_ sLMS and ispA* genes
PCR with pUC57-opt_MsLMS as a template was carried out using primers shown in SEQ ID NO: 83 and SEQ ID NO: 84. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 84 to obtain a Ptac-opt_MsL S fragment. Further, PCR with
pMW119-ispA* as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA* fragment. The purified Ptac-opt_MsLMS fragment and ispA* fragment were ligated to pACYC177 (supplied from Nippon Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
construct pACYC177-Ptac-opt_MsLMS-ispA* .
[0172]
5-9) Construction of co-expression plasmid for opt_CuLMS and ispA* genes
PCR with pUC57-opt_CuLMS as a template was carried out using primers shown in SEQ ID NO: 85 and SEQ ID NO: 86. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 86 to obtain a Ptac-opt_CuLMS fragment. Further, PCR with
p W119-ispA* as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA* fragment. The purified Ptac-opt_CuL S fragment and ispA* fragment were ligated to pACYC177 (supplied from Nippon
Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
construct pACYC177-Ptac-opt_CuLMS-ispA* .
[0173]
5-10) Construction of co-expression plasmid for opt_ClL S and ispA* genes
PCR with pUC57-opt_ClLMS as a template was carried out using primers shown in SEQ ID NO: 87 and SEQ ID NO: 88. Then, PCR with obtained PCR fragment as a template was carried out using primers shown in SEQ ID NO: 78 and SEQ ID NO: 88 to obtain a Ptac-opt_ClLMS fragment. Further, PCR with
pMW119-ispA* as a template was carried out using primers shown in SEQ ID NO: 79 and SEQ ID NO: 80 to obtain an ispA* fragment. The purified Ptac-opt_ClLMS fragment and ispA* fragment were ligated to pACYC177 (supplied from Nippon
Gene) digested with restriction enzymes PstI and Seal using In-Fusion HD cloning kit (supplied from Clontech) to
construct pACYC177-Ptac-opt_ClLMS-ispA* . [0174]
5-11) Preparation of limonene production strains
Competent cells of SWITCH-PphoC Aged were prepared, and pACYC177, pACYC177-Ptac-opt_PsLMS-ispA*, pACYC177-Ptac- opt_AgLMS-ispA*, pACYC177-Ptac-opt_MsLMS-ispA% pACYC177- Ptac-opt_CuLMS-ispA* or pACYC177-Ptac-opt_ClLMS-ispA* was introduced thereto by electroporation . Resulting strains were designated as SWITCH-PphoC Agcd/pACYC177 , SWITCH-PphoC Agcd/PsLMS-ispA*, SWITCH-PphoC Agcd/AgLMS-ispA*, SWITCH- PphoC Agcd/MsLMS-ispA*, SWITCH-PphoC Agcd/CuLMS-ispA* and SWITCH-PphoC Agcd/ClLMS-ispA*.
[0175]
Example 6: Evaluation of ability to produce limonene by limonene synthase-expressing strains derived from SWITCH- PphoC Aged strain
Microbial cells of SWITCH-PphoC Agcd/PsLMS-ispA* , SWITCH-PphoC Agcd/AgLMS-ispA*, SWITCH-PphoC Agcd/MsLMS- ispA*, SWITCH-PphoC Agcd/CuLMS-ispA* , SWITCH-PphoC
Agcd/ClLMS-ispA* and SWITCH-PphoC Agcd/pACYC177 strains obtained in Example 5 in glycerol stock were thawed.
Subsequently 10 μΐ. of a microbial cell suspension from each strain was evenly applied onto an LB plate containing 50 mg/L of kanamycin, and cultured at 34°C for 16 hours. The resulting microbial cells on the plate were picked up in an amount corresponding to about 1 of a loop part of a Nunc™ disposable 1 pL inoculating loop (supplied from Thermo Fisher Scientific Inc.). The picked up microbial cells were inoculated to 1 mL of limonene fermentation medium described below Table 8 containing 50 mg/L of kanamycin in a head space vial (manufactured by Perkin Elmer, 22ml CLEAR CRIMP TOP VIAL cat #Β010423β) , and the vial was tightly sealed with a cap with a butyl rubber septum for the headspace vial (CRIMPS (Cat #B0104240) manufactured by Perkin Elmer) . SWITCH-PphoC Agcd/pACYC177 , SWITCH-PphoC Agcd/PsL S-ispA*, SWITCH-PphoC Agcd/AgL S-ispA* and SWITCH- PphoCAgcd/ sLMS-ispA* strains were cultured at 30°C on a reciprocal shaking culture apparatus at 120 rpm for 48 hours. SWITCH-PphoC Agcd/pACYC177 , SWITCH-PphoC Agcd/CuLMS- ispA* and SWITCH-PphoC Agcd/ClLMS-ispA* strains were fermented with same manner, cultivation time of these strains were 72 hours.
[0176]
Table 8. Fermentation medium for limonene production (final concentration)
Group A
D-Glucose 4 g/L
MgS04- 7H20 1 g/L
Not adjusted pH, AC 115°C, 10 minutes
Group B
(NH4)2S04 10 g/L
Yeast extract 50 mg/L
FeS04-7H20 5 mg/L
nS04-5H20 5 mg/L
Not adjusted. pH, AC 115°C, 10 minutes
Group C
MES 20 rtiM
After adjusting pH to 7.0 with NaOH, sterilized by filtration
[0177]
After the sterilization, the above Groups A, B and C were mixed.
[0178]
After completion of . cultivation, limonene concentration in a head space vial was measured by the gas chromatograph mass spectrometer (GCMS-QP2010 manufactured by Shimadzu Corporation) with head space sampler
(TurboMatrix 40 manufactured by Perkin Elmer) . Detailed analytical condition was shown in below. For GC column, HP- 5ms Ultra Inert (Agilent) was used and limonene standard liquid was prepared with limonene reagent (Tokyo Kasei Kogyo) .
[0179]
Headspace sampler
Injection time: 0.02 minute
Oven temperature: 80°C
Needle temperature: 80°C
Transfer temperature: 80°C
GC cycle time: 5 minutes
Pressurization time: 3.0 minutes
Pull-up time: 0.2 minutes
Heat retention time: 5 minutes
Carrier gas pressure (high purity helium) : 124 kPa
[0180]
Gas chromatography part
Carrier gas : He
Temperature in vaporization chamber 200.0°C
Temperature condition 175°C (constant temperature)
[0181]
Mass spectrometry part
Temperature in ion source 250°C
Temperature in interface 250°C
Electric voltage for detector 0.1 kV
Detection ion molecular weight 68
Auxiliary ion molecular weight 93
Filament lighting time 2.0 - 3.5 min [0182]
The concentration of limonene is shown as a value in terms of medium amount. A mean value of results obtained from two vials is shown in Tables 9 and 10. No limonene production was observed in the control strain having the introduced control vector pACYC177, whereas the limonene production was confirmed in S ITCH-PphoC Agcd/PsL S-ispA* , SWITCH-PphoC Agcd/AgL S-ispA* , SWITCH-PphoC Agcd/ sLMS- ispA*, SWITCH-PphoC Agcd/CuLMS-ispA* , and SWITCH-PphoC Agcd/ClL S-ispA* strains.
[0183]
Table 9. Accumulation of limonene when limonene synthase derived from Picea sitchensis, Abies grandis and Mentha spicata were introduced
Figure imgf000097_0001
[0184] .
Table 10. Accumulation of limonene when limonene synthase derived from Citrus unshiu and Citrus limon were introduced
Figure imgf000097_0002
[0185]
While the invention has been described in detail with reference to preferred embodiments thereof, it will be apparent to the person skilled in the art that various changes can be made, and equivalents employed, without departing from the scope of the invention. All the cited references herein are incorporated by reference as a part of this application.
INDUSTRIAL APPLICABILITY
[0186]
The method of the present invention is useful for the production of an isoprenoid compound.

Claims

1. A method of producing an isoprenoid compound,
comprising culturing an isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isoprentenyl diphosphate supplying pathway and a blocked 2- ketogluconate formation pathway in a culture medium to form the isoprenoid compound.
2. The method according to claim 1, wherein the 2- ketogluconate formation pathway is blocked by reducing a glucose dehydrogenase activity.
3. The method according to claim 1 or 2 , wherein a gene encoding a glucose dehydrogenase is disrupted in the isoprenoid compound-producing microorganism.
4. The method according to any one of claims 1 to 3 , wherein the dimethylallyl diphosphate or isoprentenyl diphosphate supplying pathway is a methylerythritol
phosphate pathway.
5. The method according to any one of claims 1 to 4 , wherein the dimethylallyl diphosphate or isoprentenyl diphosphate supplying pathway is a mevalonate pathway.
6. The method according to any one of claims 1 to 5, wherein the isoprenoid compound-producing microorganism is a microorganism that is capable of synthesizing
pyrroloquinoline quinone or using pyrroloquinoline quinone included in culture environment.
7. The method according to any one of claims 1 to 6, wherein the isoprenoid compound-producing microorganism is cultured under an aerobic condition.
8. The method according to any one of claims 1 to 7 , wherein the isoprenoid compound-producing microorganism includes a heterogeneous expression unit comprising a polynucleotide encoding an isoprenoid compound-synthetic enzyme and a promoter operatively linked thereto.
9. The method according to claim 8, wherein the
isoprenoid compound-synthetic enzyme is an isoprene
synthase, a geranyl diphosphate synthase, a farnesyl diphosphate synthase, a linalool synthase, or a limonene synthase .
10. The method according to any one of claims 1 to 9, wherein the isoprenoid compound-producing microorganism is a microorganism belonging to the family En eroiiacteriaceae .
11. The method according to claim 10, wherein the
microorganism belonging to the family En erojba teriaceae is a bacterium belonging to the genus Pantoea.
12. The method according to claim 11, wherein the
bacterium belonging to the genus Pantoea is Pantoea
ananatis .
13. The method according to any one of claims 1 to 12, wherein the isoprenoid compound is isoprene, linalool, or 1imonene .
14. An isoprenoid compound-producing microorganism that has a dimethylallyl diphosphate or isopentenyl diphosphate
15. The microorganism according to claim 14, wherein the 2-ketogluconate formation pathway is blocked by reducing a glucose dehydrogenase activity.
PCT/JP2016/079196 2015-09-25 2016-09-26 Method of producing isoprenoid compound Ceased WO2017051930A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
RU2015141011 2015-09-25
RU2015141011 2015-09-25
RU2015151182 2015-11-27
RU2015151182A RU2015151182A (en) 2015-11-27 2015-11-27 METHOD FOR PRODUCING ISOPRENOID COMPOUND

Publications (1)

Publication Number Publication Date
WO2017051930A1 true WO2017051930A1 (en) 2017-03-30

Family

ID=58386096

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2016/079196 Ceased WO2017051930A1 (en) 2015-09-25 2016-09-26 Method of producing isoprenoid compound

Country Status (1)

Country Link
WO (1) WO2017051930A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3354730A4 (en) * 2015-09-25 2019-06-19 Ajinomoto Co., Inc. PROCESS FOR PRODUCING LINALOL
EP3354731A4 (en) * 2015-09-25 2019-06-26 Ajinomoto Co., Inc. LINALOOL COMPOSITION AND METHOD FOR PRODUCING THE SAME
WO2020071538A1 (en) 2018-10-05 2020-04-09 Ajinomoto Co., Inc. Method for producing target substance by bacterial fermentation
WO2023010143A3 (en) * 2021-07-30 2023-03-16 The Board Of Trustees Of The Leland Stanford Junior University Genetically-encoded volatile synthetic biomarkers for breath-based cancer detection

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090023182A1 (en) * 2007-07-18 2009-01-22 Schilling Christophe H Complementary metabolizing organisms and methods of making same
WO2014100726A2 (en) * 2012-12-21 2014-06-26 Danisco Us Inc. Production of isoprene, isoprenoid, and isoprenoid precursors using an alternative lower mevalonate pathway
US20140273144A1 (en) * 2013-03-15 2014-09-18 Amyris, Inc. Use of phosphoketolase and phosphotransacetylase for production of acetyl-coenzyme a derived compounds
EP2857509A1 (en) * 2012-05-30 2015-04-08 Bridgestone Corporation Isoprene synthase and polynucleotide encoding same, and method for producing isoprene monomer
WO2015076392A1 (en) * 2013-11-22 2015-05-28 味の素株式会社 Modified isoprene synthase

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090023182A1 (en) * 2007-07-18 2009-01-22 Schilling Christophe H Complementary metabolizing organisms and methods of making same
EP2857509A1 (en) * 2012-05-30 2015-04-08 Bridgestone Corporation Isoprene synthase and polynucleotide encoding same, and method for producing isoprene monomer
WO2014100726A2 (en) * 2012-12-21 2014-06-26 Danisco Us Inc. Production of isoprene, isoprenoid, and isoprenoid precursors using an alternative lower mevalonate pathway
US20140273144A1 (en) * 2013-03-15 2014-09-18 Amyris, Inc. Use of phosphoketolase and phosphotransacetylase for production of acetyl-coenzyme a derived compounds
WO2015076392A1 (en) * 2013-11-22 2015-05-28 味の素株式会社 Modified isoprene synthase

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ANDREEVA IRINA G. ET AL.: "Identification of Pantoea ananatis gene encoding membrane pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase and pqqABCDEF operon essential for PQQ biosynthesis", FEMS MICROBIOL. LETT., vol. 318, 2011, pages 55 - 60, XP055370623 *
CHEN XIUYIN ET AL.: "Characterisation of an (S)-linalool synthase from kiwifruit (Actinidia arguta) that catalyses the first committed step in the production of floral lilac compounds", F UNCTIONAL PLANT BIOLOGY, vol. 37, no. 3, 2010, pages 232 - 243, XP055370649 *
FUJISAKI SHINGO ET AL.: "Cloning and Nucleotide Sequence of the ispA Gene Responsible for Farnesyl Diphosphate Synthase Activity in Escherichia coli", J. BIOCHEM., vol. 108, no. 6, 1990, pages 995 - 1000, XP002920112 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3354730A4 (en) * 2015-09-25 2019-06-19 Ajinomoto Co., Inc. PROCESS FOR PRODUCING LINALOL
EP3354731A4 (en) * 2015-09-25 2019-06-26 Ajinomoto Co., Inc. LINALOOL COMPOSITION AND METHOD FOR PRODUCING THE SAME
US10870866B2 (en) 2015-09-25 2020-12-22 Ajinomoto Co., Inc. Method of producing linalool using a microorganism
US10941420B2 (en) 2015-09-25 2021-03-09 Ajinomoto Co., Inc. Linalool composition and method of producing therefor
WO2020071538A1 (en) 2018-10-05 2020-04-09 Ajinomoto Co., Inc. Method for producing target substance by bacterial fermentation
US11965198B2 (en) 2018-10-05 2024-04-23 Ajinomoto Co., Inc. Method for producing target substance by bacterial fermentation
WO2023010143A3 (en) * 2021-07-30 2023-03-16 The Board Of Trustees Of The Leland Stanford Junior University Genetically-encoded volatile synthetic biomarkers for breath-based cancer detection

Similar Documents

Publication Publication Date Title
US10870866B2 (en) Method of producing linalool using a microorganism
JP6254728B2 (en) Isoprene synthase, polynucleotide encoding the same, and method for producing isoprene monomer
US20210403954A1 (en) Method of producing isoprenoid compound
US10941420B2 (en) Linalool composition and method of producing therefor
US8962296B2 (en) Isoprene synthase and gene encoding the same, and method for producing isoprene monomer
US10184137B2 (en) Method of producing isoprene monomer
US9890373B2 (en) Modified isoprene synthase
EP3075843B1 (en) Method for producing isoprene monomer
JP2017104099A (en) Method for producing limonene
WO2018147446A1 (en) Production method for isoprenoid compound

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16848718

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16848718

Country of ref document: EP

Kind code of ref document: A1