WO2017044893A1 - Dna microscopy - Google Patents

Dna microscopy Download PDF

Info

Publication number
WO2017044893A1
WO2017044893A1 PCT/US2016/051164 US2016051164W WO2017044893A1 WO 2017044893 A1 WO2017044893 A1 WO 2017044893A1 US 2016051164 W US2016051164 W US 2016051164W WO 2017044893 A1 WO2017044893 A1 WO 2017044893A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
sequence
amplification
sequences
umi
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/051164
Other languages
French (fr)
Inventor
Feng Zhang
Joshua Asher WEINSTEIN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Massachusetts Institute of Technology
Broad Institute Inc
Original Assignee
Massachusetts Institute of Technology
Broad Institute Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Massachusetts Institute of Technology, Broad Institute Inc filed Critical Massachusetts Institute of Technology
Priority to US15/554,627 priority Critical patent/US11339390B2/en
Publication of WO2017044893A1 publication Critical patent/WO2017044893A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1065Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6841In situ hybridisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082Supracellular entities, e.g. tissue, organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/122Massive parallel sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/165Mathematical modelling, e.g. logarithm, ratio
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2543/00Reactions characterised by the reaction site, e.g. cell or chromosome
    • C12Q2543/10Reactions characterised by the reaction site, e.g. cell or chromosome the purpose being "in situ" analysis
    • C12Q2543/101Reactions characterised by the reaction site, e.g. cell or chromosome the purpose being "in situ" analysis in situ amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/179Nucleic acid detection characterized by the use of physical, structural and functional properties the label being a nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/50Detection characterised by immobilisation to a surface
    • C12Q2565/514Detection characterised by immobilisation to a surface characterised by the use of the arrayed oligonucleotides as identifier tags, e.g. universal addressable array, anti-tag or tag complement array
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns

Definitions

  • the present invention relates to DNA microscopy methods, in particular recording spatial distributions of DNA or RNA, or molecular targets tagged with DNA or RNA, in cells or biological tissue at cell-population, single-cell, or subcellular resolution by randomized barcoding of DNA or cDNA before and during in situ amplification.
  • Cellular phenotype is commonly characterized by mRNA expression profiling.
  • profiling cell populations in bulk discards all information pertaining to the associations of specific mRNA transcripts in individual cells.
  • pooled sequencing results in the separate characterizations of immunoglobulin heavy- and light-chains, peptides whose co- expression within a cell determines an immunoglobulin's antigen-specificity.
  • heavy- and light-chain mRNA produced by individual lymphocytes may be made to associate in the sequence of a polymerase chain reaction (PCR) product (Embleton MJ, et al. Nucleic Acids Res.
  • PCR polymerase chain reaction
  • High-throughput sequencing can identify large numbers of heavy- and light-chain variable regions (V H and V L ) in a given B-cell repertoire, but information about endogenous pairing of heavy and light chains is lost after bulk lysis of B-cell populations.
  • a way to retain this pairing information involves depositing single B cells (>5 x 10 4 capacity per experiment) in a high-density microwell plate (125 pl/well) and lysing (DeKosky BJ, et al. Nat Biotechnol. 2013 Feb;31(2): 166-9).
  • mRNA is then captured on magnetic beads, reverse transcribed and amplified by emulsion V H :V L linkage PCR and the linked transcripts are analyzed by Illumina high-throughput sequencing (DeKosky BJ, et al. Nat Biotechnol. 2013 Feb;31(2): 166-9).
  • RNA sequencing is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification.
  • RNA-Seq RNA sequencing
  • a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends (Shiroguchi K, et al. Proc Natl Acad Sci U S A. 2012 Jan 24; 109(4): 1347-52).
  • paired-end deep sequencing is applied to read the two barcodes and cDNA sequences.
  • RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence (Shiroguchi K, et al. Proc Natl Acad Sci U S A. 2012 Jan 24; 109(4): 1347-52).
  • the barcodes may be optimized to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome (Shiroguchi K, et al. Proc Natl Acad Sci U S A. 2012 Jan 24; 109(4): 1347-52).
  • Fluorescence in situ sequencing is a method that allows the acquisition of mRNA/cDNA sequences directly from within cell monolayers or fixed tissue (Lee JH et al. Science. 2014 Mar 21;343(6177): 1360-3). mRNA transcripts are reverse- transcribed into cDNA and fixed to the cellular matrix. mRNA is degraded, and the cDNA subsequently circularized so that polonies comprising long repeats of cDNA sequence may be formed by rolling circle amplification (RCA). SOLiD sequencing (sequencing by oligonucleotide ligation and detection) is then used to read out 30 bp reads that allow comparison with reference gene transcripts.
  • FISSEQ requires high-quality optics for each sample to be analyzed. Moreover, because of trade-offs between a microscope's depth-of-field and its imaging resolution, samples must be properly arranged on a two-dimensional plane to be analyzed.
  • the invention solves the challenge of sequencing DNA or RNA, or identifying molecular targets tagged with DNA or RNA, in non-dissociated fixed cells or sectioned or intact biological tissue at single-cell or subcellular resolution.
  • the present invention relates to randomized barcoding of nucleic acids before and during in situ amplification.
  • Random barcoding of nucleic acids before in situ amplification creates a UMI (unique molecular identifier) for nucleic acid template molecules.
  • Concatenation of nucleic acid-amplification products is accompanied by random-barcoding of concatenation events, generating unique event identifier's, or UEI's. Sequencing UMI's and UEI's and combining them generates a hierarchy of physical co-localization among groups of template nucleic acid molecules in the biological sample.
  • DNA microscopy may work with a single sample, and this sample may be non-canonical and idiosyncratic (such as, but not limited to, tumor tissue, lymphatic tissue or neural tissue);
  • image-capture is volumetric with no sectioning required;
  • the protocol stands alone and does not require specialized equipment;
  • the protocol uses commercialized DNA sequencers to provide high coverage of single template molecules, thereby enabling single-base resolution, low error rates, and high read lengths of gene sequences of interest.
  • FIG. 1 depicts a simplified bird's-eye view of the invention.
  • FIG. 2 provides a flowchart of the method's experimental structure.
  • RNA is denatured (chemically under acid- treatment and/or by heating).
  • Reverse transcription cDNA synthesis incorporates primers with randomized UMI nucleotides flanked by reverse-adapters (see Figs 3 and 4 for further detail). Residual primers from reverse transcription are degraded using a combination of enzymatic digestion (such as with Exonuclease I) and washing. Overlap-extension in situ PCR concatenates UMI-labeled amplicons together, and incorporates randomized UEI nucleotides between them. Reaction products are then prepared as libraries for NGS (Next Generation Sequencing).
  • NGS Next Generation Sequencing
  • FIG. 3 illustrates a Beacon-Target embodiment of the DNA Microscopy experimental flow for gene-specific amplification.
  • cDNA synthesis proceeds for beacon-transcripts with primers containing a beacon-specific sequence (1), a randomized UMI sequence (2), and a universal handle (3).
  • the cDNA product extends to include a new beacon-specific priming site (6).
  • cDNA from target-transcripts is synthesized with primers containing a target-specific sequence (4), a randomized UMI sequence (2), and a universal handle (5), with the product containing a new target-specific priming site (7).
  • Second-strand synthesis primers specific to priming sites (6) and (7) are added at a low concentration. These primers contain, on their 5 '-ends, short universal handles (8sh) and (9sh) with low melting temperatures.
  • PCR primers include a primer containing the universal handle (8) subsuming the short handle (8sh) and a primer containing the universal handle (9) subsuming the short handle (9sh), the latter containing on its 5' end an overlap-extension adapter sequence (10') and randomized nucleotides (2).
  • PCR primers further include a primer containing the universal handle (5) and a primer containing the universal handle (3) in addition to randomized nucleotides (2) and the overlap-extension adapter sequence (10), reverse-complementary to (10'), on its 5' end.
  • DNA amplification (iii) proceeds by thermocycling with a high primer-annealing temperature above the maximum for priming the short sequences (8sh) and (9sh). This results in a linear ⁇ i.e. constant) amplification rate of both beacon and target amplicons.
  • primer- annealing temperatures are lowered so that (8sh) and (9sh) may be primed, resulting in exponential amplification (iv).
  • reaction product elution (v) sequencing library preparations are prepared by amplifying from universal handles (1) and (5) to incorporate NGS adapters (vi). During this reaction, overlap-extension suppression is performed using the techniques listed in TABLE 1, individually or in combination. Example forward- and reverse-reads from the final NGS product are shown. The sequencing is then analyzed (FIG 5).
  • FIG 4 illustrates a Target-Target embodiment of DNA microscopy.
  • cross- linked products comprise repeats of the same structural unit.
  • Target-Target molecular microscopy follows the same experimental flow as Beacon-Target Molecular Microscopy, except that beacon gene transcripts are not amplified by their own primer sets (meaning that all amplified products are treated identically), permitting a UMFs concatenation both to other UMI's as well as to itself.
  • Two small sequences, (14) and (15) are inserted into reverse- transcription and second-strand synthesis primers, respectively, and these permit separate amplification of the two overlapping sides of the final cross-linked amplicon products (vi and viii).
  • interference-oligo technique TABLE 1, Turchaninova MA et al. Eur J Immunol. 2013 Sep;43(9):2507-15
  • the two amplification reactions are compared and matched based on shared UEI sequences (FIG 6).
  • FIG 5 illustrates the data-flow from Next Generation Sequence output for Beacon-Target DNA Microscopy.
  • FIG 6 illustrates the data-flow from Next Generation Sequence output for Target- Target DNA Microscopy.
  • FIG 7 illustrates UMI/UEI local-similarity hashing alignment in advance of EASL clustering. Sequences (which may correspond to either a library of UMI's or UEI' s) are first grouped by perfect identity. In Part 1, for sequences of full length L, L separate dictionaries are generated. In dictionary i, all sequences - each having had position i removed - are catalogued. In Part 2, all dictionaries are looped through, and all sequence associations that are found and recorded in a final list.
  • FIG. 8 depicts an EASL clustering iteration.
  • FIG. 9 depicts inferred positions of transcript sequences from a Beacon-Target DNA microscopy experiment.
  • FIG. 10 depicts one embodiment of reaction chamber preparation, which enables cell/tissue adhesion, sample imaging, and the DNA microscopy reaction.
  • FIG. 11 depicts inferred positions of transcript sequences from a Beacon-Target DNA microscopy experiment. Each dot corresponds to a UMI, and its color corresponds to the amplicon to which read-out sequence matches.
  • Embodiments disclosed herein are directed to DNA microscopy, a technology that efficiently generates DNA-sequence read-outs of tissue microstructure. In certain embodiments this is achieved by encoding into DNA the cellular co-localization and/or spatial distributions of arbitrary DNA/RNA sequences, or other biomolecules tagged with DNA/RNA sequences. Biomolecules are first tagged with randomized DNA or RNA sequences, called UMI's (unique molecular identifiers). These tags, which may incorporate the sequence of a targeted gene sequence, are amplified by PCR in situ with oligonucleotide primers.
  • DNA microscopy may be interchangeably referred to as molecular microscopy or volumetric imaging by proximal unique molecular identifiers ("UMI”) reaction (“VIPUR”) microscopy.
  • UMI proximal unique molecular identifiers
  • VIPUR proximal unique molecular identifiers
  • a unique molecular identifier is a randomized DNA sequence serving as a unique molecular identifier.
  • a unique event identifier is a randomized DNA sequence serving as a unique molecular identifier generally involved in overlap-extension.
  • UMI UMI
  • a-UID UMI
  • the first stage is UMI generation.
  • unique molecular identifiers which may be referred to as UMFs - label individual template molecules using at least 10 randomized bases.
  • This subsumes the in situ preparation, reverse transcription, and the disposal of residual reagents from each of these steps. Importantly, this disposal includes the use of multiple washes and Exonuclease I digestion, which rids the sample of free remaining single-stranded oligonucleotides (cDNA is protected by its duplexing with mRNA).
  • the second stage is UEI generation.
  • in situ PCR is run with overlap-extension adapters attached to the 5' end of two universal primers.
  • Overlap-extension occurs between those transcripts that have been reverse-transcribed as "beacons” and those transcripts that have been reverse-transcribed as "targets”.
  • Overlap-extension incorporates at least 10 random bases in between the two amplicons, and thereafter, as these concatemers are copied by further amplification, so too are these at least 10 bases.
  • the third stage is NGS library preparation. During this stage, in situ PCR products are extracted and amplified in such a way that they may be easily sequenced. A key part of this stage is preventing further formation of concatemers. To this end, this protocol makes use of "interference oligonucleotides" with 3'-phosphate caps [Turchaninova et al., Pairing of t-cell receptor chains via emulsion per. Eur J Immunol, 43(9):2507-2515, Sep 2013].
  • the present invention relates to the scalable analysis of DNA sequencing products from the DNA microscopy amplification reaction.
  • the scalable analysis involves two challenges, one being UMI/UEI error correction, the second being UMI position inference.
  • UMI/UEI error correction involves sequence-clustering of N UMI or UEI sequences, where N is large. If comparisons of these N sequences were computed directly, this would require N 2 comparisons.
  • a solution involves (1) reducing error correction to a clustering problem requiring only knowledge of nearest neighbors and (2) performing local similarity hashing to align UMI/UEI sequences to each other.
  • UMI position inference involves searching for an optimal positioning of NUMI's: a relative positioning problem that would similarly require N 2 comparisons per iteration of the optimization algorithm if this were computed directly.
  • optimization involves using the Barnes-Hut algorithm [A hierarchical o (n log n) force- calculation algorithm. Nature, 324:446(449, Dec 1986] for reducing the N 2 comparisons to N log N comparisons.
  • optimization comprises using the Fast Gauss Transform for reducing N 2 comparisons to N comparisons. (Greengard and Strain. The Fast Gauss Transform, SIAM Journal on Scientific and Statistical Computing, 1991).
  • reaction chambers are designed in order to maximally adhere cells while providing a thermally robust container for PCR thermocycling.
  • 3-aminopropyl)triethoxysilane or APTES (Sigma 440140)
  • APTES poly(ethylene glycol) triethoxysilane
  • APTES poly(ethylene glycol) triethoxysilane
  • a glass surface such as a 2% acetone solution
  • Bagasra O Protocols for the in situ PCR amplification and detection of mRNA and DNA sequences. Nat Protoc, 2(l l):2782-2795, 2007]
  • uncured PDMS is poured into petri dishes to a height of approximately 4.5 mm.
  • PDMS is cured, and 6 mm diameter holes are punched in a regular pattern and in sufficient number so that holes to be used as fluid reservoirs completely surround wells to be used for samples.
  • PDMS is then plasma-bonded to uncoated white glass slides (FIG 10). Glass chambers are subsequently silanized.
  • silanized glass beads are anchored into PCR-plate wells containing about 25 ⁇ of uncured PDMS. The plates are spun down and cured, such that the PDMS functions as an inert hydrophobic "glue". The tops of the silanized glass beads are then exposed for cell adhesion.
  • PDMS-embedded silanized glass beads or PDMS-bonded and silanized glass slides are assembled and UV sterilized under a laminar flow hood for 30 minutes.
  • a 1 : 100 dilution of fibronectin (Sigma Fl 141) in PBS is added at a volume of 40 ⁇ on top of the beads or 60 ⁇ on top of slides and incubated for 1 hour at room temperature.
  • BT-549 expressing RFP Cell Biolabs AKR-255
  • human cell line MDA-MB-231 expressing EGFP Cell Biolabs AKR-211
  • the cells may then be co- cultured for 36 hours.
  • Reverse transcription is performed with "target" primers (5)-(2)-(4)-GAPDH, (5)- (2)-(4)-GAPDH, and (5)-(2)-(4)-GAPDH and a "beacon” primer (3)-(2)-(l)-ACTB all added to 850 nM each, in a reaction containing dNTP (400 ⁇ ), Superase-In (1 U/ ⁇ , Life Technologies AM2696), DTT (4 mM), lx First-Strand Buffer, and Superscript III (10 U/ ⁇ , Life Technologies 18080-044). Reverse transcription is performed by incubating at 60 °C for 3 minutes, followed by 42 °C for 60 minutes.
  • In situ PCR reaction-mixes may be prepared as follows. HPLC-purified overlap- extension primers with acrydite-modified 5' ends (10')-(2)-(9) and (10)-(2)-(3) are added to final concentrations of 400 nM each, the primers (5) and (8) are added to final concentrations of 300 nM each, and the second-strand synthesis primers (9sh)-(7(-))-GAPDH, (9sh)-(7(-))- GFP, (9sh)-(7(-))-RFP, and (8sh)-(6(-))-ACTB are added to final concentrations of 30 nM each.
  • the reaction further contains dNTP (200 nM), MgC12 (1.6 mM), 40.8 mg/ml 2-arm thiolated PEG (Laysan Bio SH-PEG-SH-3400-1GR), 55 mg/ml 4-arm acrylated PEG (Laysan Bio PEG-ACRL-10K-1GR), lx PCR buffer (without magnesium), 0.5 ug/ul BSA, 8% glycerol, and 1 :250 dilution Platinum Taq DNA polymerase (Life Technologies 10966018).
  • the reaction solution is mixed by pipetting, ensuring no bubbles, and a hydrogel left to form for 35 minutes at room temperature.
  • thermocycling is performed as follows: 95 °C 2 min, 10 X (95 °C 30 s, 68 °C 1 min), 2 x (95 °C 30 s, 55 °C 30 s, 68 °C 1 min), 16 X (95 °C 30 s, 60 °C 30 s, 68 °C 1 min), 68 °C 1 min, 4 °C. Reactions are transferred on ice to -20 °C, where they can be stored until NGS library preparation.
  • Samples may be thawed on ice, and hydrogel dissolution may be performed by adding 1 part dissolving-reagent (460 mM KOH, 100 mM EDTA, 42 mM DTT) per 5 parts hydrogel. Samples may be left to incubate at 4 °C for 2 hours for the reagent to diffuse in, after which it may be heated to 72 °C for 5 minutes, and then cooled back down. Stop solution (made by adding 400 ⁇ 1 M HC1 to 600 ⁇ 1 M Tris-HCl pH 7.5) may be added in the equivalent volume as the dissolving-reagent, and samples may be immediately mixed by pipetting.
  • dissolving-reagent 460 mM KOH, 100 mM EDTA, 42 mM DTT
  • Proteinase-K mix may be prepared as 0.36% Tween-20 and 360 ⁇ g/ml proteinase K (Sigma P4850) in 10 mM Tris-HCl pH 8. 4 parts of proteinase-k mix may be added per 10 parts neutralized sample and then mixed by pipetting. Samples may be incubated at 50 °C for 25 minutes, and then transferred to ice. Samples may be diluted 1 :2 in 10 mM Tris-HCl pH 8, mixed by pipetting, and transferred to a new set of wells, where they may be purified by the AMPURE XP protocol, using an addition of 0.65 volumes of AMPURE XP beads. Samples may be eluted into 35 ⁇ 10 mM Tris-HCl pH 8.
  • Interference oligonucleotide-mix [Turchaninova et al., Pairing of t-cell receptor chains via emulsion per. Eur J Immunol, 43(9):2507-2515, Sep 2013] consisting of the oligos lOT-OEc-P: TTTTTTTTTTTATTCCCATGGCGCGCCA/3Phos/ (SEQ ID NO: 15) and 10T-OE-P: TTTTTTTTTTGGCGCGCCATGGGAATAA/3Phos/ (SEQ ID NO: 16) at final concentrations of 50 ⁇ each may be prepared in advance.
  • Re-amplification may be performed by adding (in 15 ⁇ sample + 15 ⁇ master-mix reactions) interference oligonucleotides to final concentrations of 3.2 ⁇ each, the primers CCCACTTCTCTCGACGCTCTTCCGATCT (SEQ ID NO: 17) and (12)-(5) to final concentrations of 300 nM each, MgS04 to final concentration 1.5 mM, dNTP to final concentration 0.2 mM, lx HiFi PCR buffer (without magnesium), and 1 :250 dilution Platinum Taq HiFi (Life Technologies 11304-011). Reactions may be thermocycled 95 °C 2 min, 20 X (95 °C 30 s, 68 °C 2 min), and then stored at 4 °C.
  • samples may be purified by the AMPURE XP protocol, using an addition of 0.65 volumes of AMPURE XP beads.
  • a final last-stage amplification may be performed with primers (l'(long)) and (12)-(5) and at final concentrations of 300 nM each, MgS0 4 to final concentration 2 mM, dNTP to final concentration 0.2 mM, lx HiFi PCR buffer (without magnesium), and 1 :250 dilution Platinum Taq HiFi (Life Technologies 11304-011).
  • Reactions may be thermocycled 95 °C 2 min, 5 X (95 °C 30 s, 58 °C 30 s, 68 °C 2 min), 5 X (95 °C 30 s, 68 °C 2 min), 68 °C 5 min, 4 °C.
  • Each sequencing-read is comprised of three types of segments: "primers”, “UMFs” or “UEFs”, and "amplicons”.
  • the form this takes on as a paired-end read is illustrated in FIG. 3.
  • Beacon UMFs, target UMFs, and UEFs are separated from each other into distinct analyses. These are analyzed and grouped in order to eliminate sequencing and PCR error using an algorithm, here called extended abundance single-linkage (EASL) clustering, which is analogous to the Watershed Algorithm for image processing (FIG 8).
  • EASL extended abundance single-linkage
  • the EASL clustering algorithm is designed for rapid identification of UMI/UEI sequence-clusters based on single-mismatch alignments alone. EASL presupposes that a sequence is more likely to occur in the dataset the nearer it is to its correct form.
  • EASL initiates by grouping every UMI/UEI (of the same type and within the same data-set) by perfect identity, and read-abundance is assigned to each UMF/UEI sequence by the number of reads identically grouped in this manner. Each pair of UMFs or UEFs (of the same type and within the same data-set) is compared in an un-gapped alignment.
  • UMFUEI i (directionally) links to UMI/UEI j if and only if the read-abundance of UMI/UEI i is greater than or equal to the read-abundance of UMI/UEI j. In order to accelerate this process local similar hashing may be used (FIG. 8).
  • Read number densities, or RND's are calculated for each UMI/UEI sequence by summing read-abundances belonging both to the sequence itself and all sequences (of equal or lower abundance) it links to.
  • the UMI/UEI with the largest RND initiates clustering as the first cluster-seed. All UMI/UEI' s to which this seed links by the aforementioned criterion are accepted into its cluster, all UMI/UEFs to which these newly accepted UMI/UEFs link are accepted as well, and so on. In this way, single-linkage clusters are formed in which the linkages themselves are not always bidirectional.
  • the algorithm proceeds to the UMFUEI with the next largest RND that has not already been accepted into a cluster.
  • the same cluster-assembly proceeds among all un-assigned UMFs or UEFs.
  • the algorithm terminates.
  • This rate equation provides the foundation to build maximum likelihood estimates (MLE) of positions, given the observed rates of UEI formation - which is really the summation of rates, — ' ! - ' i ' ⁇ over the duration of the experiment.
  • MLE maximum likelihood estimates
  • Applicants can use the normalized frequency of concatenation between UMFs / and j , i ⁇ ⁇ '' U: ⁇ (where each ".” represents summation over an index) to calculate the likelihood of a solution wherein n tj unique UEFs occur between beacon UMI / and target UMI /:
  • the first term can be calculated quickly, because of the sparse nature of the matrix n tj .
  • the second term requires special treatment, because explicit evaluation would otherwise require an 0 ⁇ Nbeacon X N ta rget) calculation at every MLE-maximization iteration.
  • the Fast Gauss Transform is therefore used [Greengard and Strain. The fast Gauss Transform, SIAM Journal on Scientific and Statistical Computing, 1991].
  • Fixation of cells or tissue may involve the use of cross-linking agents, such as formaldehyde, and may involve embedding cells or tissue in a paraffin wax or polyacrylamide support matrix (Chung K, et al. Nature. 2013 May 16; 497(7449): 322-7).
  • cross-linking agents such as formaldehyde
  • Amplification may involve thermocycling or isothermal amplification (such as through the methods RPA or LAMP). Concatenation may involve overlap-extension PCR or use of ligase, recombinase, or transposase to associate multiple amplification products with each other.
  • amplification means any method employing a primer and a polymerase capable of replicating a target sequence with art recognized standards of fidelity.
  • Amplification may be carried out by natural or recombinant DNA polymerases such as TaqGoldTM, T7 DNA polymerase, Klenow fragment of E.coli DNA polymerase, and reverse transcriptase.
  • a preferred amplification method is PCR.
  • the isolated RNA can be subjected to a reverse transcription assay that is coupled with a quantitative polymerase chain reaction (RT-PCR) in order to quantify the expression level of a sequence associated with a signaling biochemical pathway.
  • RT-PCR quantitative polymerase chain reaction
  • Detection of the gene expression level can be conducted in real time in an amplification assay.
  • the amplified products can be directly visualized with fluorescent DNA-binding agents including but not limited to DNA intercalators and DNA groove binders. Because the amount of the intercalators incorporated into the double-stranded DNA molecules is typically proportional to the amount of the amplified DNA products, one can conveniently determine the amount of the amplified products by quantifying the fluorescence of the intercalated dye using conventional optical systems in the art.
  • DNA- binding dyes suitable for this application include SYBR green, SYBR blue, DAPI, propidium iodine, Hoeste, SYBR gold, ethidium bromide, acridines, proflavine, acridine orange, acriflavine, fluorcoumanin, ellipticine, daunomycin, chloroquine, distamycin D, chromomycin, homidium, mithramycin, ruthenium polypyridyls, anthramycin, and the like.
  • probe-based quantitative amplification relies on the sequence-specific detection of a desired amplified product.
  • Such methods utilize fluorescent, target-specific probes (e.g., TaqMan® probes) resulting in increased specificity and sensitivity.
  • Methods for performing probe-based quantitative amplification are well established in the art and are taught, for example, in U.S. Patent No. 5,210,015.
  • Sequencing may be performed on any high-throughput platform with read-length (either single- or paired-end) sufficient to cover both template molecule identifiers (UMI's) and concatenation event identifiers (UEFs).
  • UMI's template molecule identifiers
  • UEFs concatenation event identifiers
  • Methods of sequencing oligonucleotides and nucleic acids are well known in the art (see, e.g., W093/23564, WO98/28440 and W098/13523; U.S. Pat. Nos. 5,525,464; 5,202,231; 5,695,940; 4,971,903; 5,902,723; 5,795,782; 5,547,839 and 5,403,708; Sanger et al., Proc. Natl. Acad.
  • the present invention may be applied to (1) single-cell transcriptomics: cDNA synthesized from mRNA is barcoded and concatenated during in situ amplification, (2) single-cell proteomics: cDNA or DNA synthesized from RNA- or DNA-tagged antibodies of one or multiple specificities maps the abundance and distributions of different protein- antigens and (3) whole-tissue transcriptomic/proteomic mapping (DNA microscopy): using the frequency of cross-contamination between cells to determine their physical proximity, and via applications (1) single-cell transcriptomics and (2) single-cell proteomics, determining the global spatial distribution of mRNA, protein, or other biomolecules in a biological sample. This may be used, for example, to screen for anti-cancer/pathogen immunoglobulins (by analyzing co-localization of B-cells and T-cells within affected tissue) for immunotherapy.
  • Table 1 Techniques for overlap-extension suppression during library preparation.
  • Table 2 List of primer-sequences for Beacon-Target embodiment.
  • the number of random nucleotides in primers beginning with are determined by either the expected diversity of template cDNA molecules being amplified (for UMI diversity, in the case of (5)-(2)-X and (3)-(2)-X) or the expected diversity required to uniquely identify overlap-extension events (for UEI diversity, in the case of (10)-(2)-X and (10')-(2)-X).
  • "XXXXXXXXX" for primer (12)-(5) represents the sample barcode (which is non-random), and is represented by NNNNNNNN in the attached Sequence Listing
  • polynucleotide refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown.
  • polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • loci locus defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched poly
  • a polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • wild type is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
  • variable should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.
  • nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • Complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non- traditional types.
  • a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%), and 100% complementary).
  • Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • Substantially complementary refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
  • stringent conditions for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.
  • Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner.
  • the complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these.
  • a hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme.
  • a sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.
  • genomic locus or “locus” (plural loci) is the specific location of a gene or DNA sequence on a chromosome.
  • a “gene” refers to stretches of DNA or RNA that encode a polypeptide or an RNA chain that has functional role to play in an organism and hence is the molecular unit of heredity in living organisms.
  • genes include regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences.
  • a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.
  • expression of a genomic locus or “gene expression” is the process by which information from a gene is used in the synthesis of a functional gene product.
  • the products of gene expression are often proteins, but in non-protein coding genes such as rRNA genes or tRNA genes, the product is functional RNA.
  • the process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea) and viruses to generate functional products to survive.
  • expression of a gene or nucleic acid encompasses not only cellular gene expression, but also the transcription and translation of nucleic acid(s) in cloning systems and in any other context.
  • expression also refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins.
  • Transcripts and encoded polypeptides may be collectively referred to as "gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • sequence identity is related to sequence homology. Homology comparisons may be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs may calculate percent (%) homology between two or more sequences and may also calculate the sequence identity shared by two or more amino acid or nucleic acid sequences.
  • Sequence homologies may be generated by any of a number of computer programs known in the art, for example BLAST or FASTA, etc.
  • a suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S. A; Devereux et al., 1984, Nucleic Acids Research 12:387).
  • Examples of other software than may perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 ibid - Chapter 18), FASTA (Atschul et al., 1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison tools.
  • BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999 ibid, pages 7-58 to 7-60). However it is preferred to use the GCG Bestfit program. % homology may be calculated over contiguous sequences, i.e., one sequence is aligned with the other sequence and each amino acid or nucleotide in one sequence is directly compared with the corresponding amino acid or nucleotide in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.
  • the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension. Calculation of maximum % homology therefore first requires the production of an optimal alignment, taking into consideration gap penalties.
  • a suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (Devereux et al., 1984 Nuc. Acids Research 12 p387). Examples of other software than may perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 Short Protocols in Molecular Biology, 4th Ed. - Chapter 18), FASTA (Altschul et al., 1990 J. Mol. Biol. 403-410) and the GE EWORKS suite of comparison tools.
  • BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program.
  • a new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol Lett. 1999 174(2): 247-50; FEMS Microbiol Lett. 1999 177(1): 187-8 and the website of the National Center for Biotechnology information at the website of the National Institutes for Health). Although the final % homology may be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison.
  • a scaled similarity score matrix is generally used that assigns scores to each pair-wise comparison based on chemical similarity or evolutionary distance.
  • An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs.
  • GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table, if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
  • percentage homologies may be calculated using the multiple alignment feature in DNASISTM (Hitachi Software), based on an algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237-244).
  • DNASISTM Hagachi Software
  • CLUSTAL Higgins DG & Sharp PM (1988), Gene 73(1), 237-244
  • Embodiments of the invention include sequences (both polynucleotide or polypeptide) which may comprise homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue or nucleotide, with an alternative residue or nucleotide) that may occur i.e., like-for-like substitution in the case of amino acids such as basic for basic, acidic for acidic, polar for polar, etc.
  • Nonhomologous substitution may also occur i.e., from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.
  • Z ornithine
  • B diaminobutyric acid ornithine
  • O norleucine ornithine
  • pyriylalanine pyriylalanine
  • thienylalanine thienylalanine
  • naphthylalanine phenylglycine
  • Hybridization can be performed under conditions of various stringency. Suitable hybridization conditions for the practice of the present invention are such that the recognition interaction between the probe and sequences associated with a signaling biochemical pathway is both sufficiently specific and sufficiently stable. Conditions that increase the stringency of a hybridization reaction are widely known and published in the art. See, for example, (Sambrook, et al., (1989); Nonradioactive In Situ Hybridization Application Manual, Boehringer Mannheim, second edition).
  • the hybridization assay can be formed using probes immobilized on any solid support, including but are not limited to nitrocellulose, glass, silicon, and a variety of gene arrays. A preferred hybridization assay is conducted on high-density gene chips as described in U.S. Patent No. 5,445,934.
  • the nucleotide probes are conjugated to a detectable label.
  • Detectable labels suitable for use in the present invention include any composition detectable by photochemical, biochemical, spectroscopic, immunochemical, electrical, optical or chemical means.
  • a wide variety of appropriate detectable labels are known in the art, which include fluorescent or chemiluminescent labels, radioactive isotope labels, enzymatic or other ligands.
  • a fluorescent label or an enzyme tag such as digoxigenin, ⁇ -galactosidase, urease, alkaline phosphatase or peroxidase, avidin/biotin complex.
  • the detection methods used to detect or quantify the hybridization intensity will typically depend upon the label selected above.
  • radiolabels may be detected using photographic film or a phosphoimager.
  • Fluorescent markers may be detected and quantified using a photodetector to detect emitted light.
  • Enzymatic labels are typically detected by providing the enzyme with a substrate and measuring the reaction product produced by the action of the enzyme on the substrate; and finally colorimetric labels are detected by simply visualizing the colored label.
  • labeling substance examples include labeling substances known to those skilled in the art, such as fluorescent dyes, enzymes, coenzymes, chemiluminescent substances, and radioactive substances. Specific examples include
  • radioisotopes e.g., P, C, I, H, and I
  • fluorescein e.g., P, C, I, H, and I
  • fluorescein e.g., fluorescein
  • rhodamine e.g., dansyl chloride
  • umbelliferone e.g., luciferase
  • peroxidase alkaline phosphatase
  • ⁇ -galactosidase ⁇ -glucosidase
  • horseradish peroxidase glucoamylase
  • lysozyme saccharide oxidase
  • microperoxidase e.g., peroxidase
  • the label is a fluorescent label.
  • fluorescent labels include, but are not limited to, Atto dyes, 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS); 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4-anilino-l-naphthyl)maleimide; anthranilamide; BODIPY; Brilliant Yellow; coumarin and derivatives; coumarin, 7-amino-4- methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanine dyes;
  • the fluorescent label may be a fluorescent protein, such as blue fluorescent protein, cyan fluorescent protein, green fluorescent protein, red fluorescent protein, yellow fluorescent protein or any photoconvertible protein. Colormetric labeling, bioluminescent labeling and/or chemiluminescent labeling may further accomplish labeling. Labeling further may include energy transfer between molecules in the hybridization complex by perturbation analysis, quenching, or electron transport between donor and acceptor molecules, the latter of which may be facilitated by double stranded match hybridization complexes.
  • the fluorescent label may be a perylene or a terrylen. In the alternative, the fluorescent label may be a fluorescent bar code.
  • the label may be light sensitive, wherein the label is light-activated and/or light cleaves the one or more linkers to release the molecular cargo.
  • the light-activated molecular cargo may be a major light-harvesting complex (LHCII).
  • the fluorescent label may induce free radical formation.
  • agents may be uniquely labeled in a dynamic manner (see, e.g., international patent application serial no. PCT/US2013/61182 filed September 23, 2012).
  • the unique labels are, at least in part, nucleic acid in nature, and may be generated by sequentially attaching two or more detectable oligonucleotide tags to each other and each unique label may be associated with a separate agent.
  • a detectable oligonucleotide tag may be an oligonucleotide that may be detected by sequencing of its nucleotide sequence and/or by detecting non-nucleic acid detectable moieties to which it may be attached.
  • the oligonucleotide tags may be detectable by virtue of their nucleotide sequence, or by virtue of a non-nucleic acid detectable moiety that is attached to the oligonucleotide such as but not limited to a fluorophore, or by virtue of a combination of their nucleotide sequence and the nonnucleic acid detectable moiety.
  • a detectable oligonucleotide tag may comprise one or more nonoligonucleotide detectable moieties.
  • detectable moieties may include, but are not limited to, fluorophores, microparticles including quantum dots (Empodocles, et al., Nature 399: 126-130, 1999), gold nanoparticles (Reichert et al., Anal. Chem. 72:6025-6029, 2000), biotin, DNP (dinitrophenyl), fucose, digoxigenin, haptens, and other detectable moieties known to those skilled in the art.
  • the detectable moieties may be quantum dots. Methods for detecting such moieties are described herein and/or are known in the art.
  • detectable oligonucleotide tags may be, but are not limited to, oligonucleotides which may comprise unique nucleotide sequences, oligonucleotides which may comprise detectable moieties, and oligonucleotides which may comprise both unique nucleotide sequences and detectable moieties.
  • a unique label may be produced by sequentially attaching two or more detectable oligonucleotide tags to each other.
  • the detectable tags may be present or provided in a plurality of detectable tags.
  • the same or a different plurality of tags may be used as the source of each detectable tag may be part of a unique label.
  • a plurality of tags may be subdivided into subsets and single subsets may be used as the source for each tag.
  • a detectable oligonucleotide tag comprises one or more non-oligonucleotide detectable moieties.
  • detectable moieties include, but are not limited to, fluorophores, microparticles including quantum dots (Empodocles, et al., Nature 399: 126-130, 1999), gold nanoparticles (Reichert et al., Anal. Chem. 72:6025-6029, 2000), biotin, DNP (dinitrophenyl), fucose, digoxigenin, haptens, and other detectable moieties known to those skilled in the art.
  • the detectable moieties are quantum dots. Methods for detecting such moieties are described herein and/or are known in the art.
  • detectable oligonucleotide tags may be, but are not limited to, oligonucleotides comprising unique nucleotide sequences, oligonucleotides comprising detectable moieties, and oligonucleotides comprising both unique nucleotide sequences and detectable moieties.
  • a unique nucleotide sequence may be a nucleotide sequence that is different (and thus distinguishable) from the sequence of each detectable oligonucleotide tag in a plurality of detectable oligonucleotide tags.
  • a unique nucleotide sequence may also be a nucleotide sequence that is different (and thus distinguishable) from the sequence of each detectable oligonucleotide tag in a first plurality of detectable oligonucleotide tags but identical to the sequence of at least one detectable oligonucleotide tag in a second plurality of detectable oligonucleotide tags.
  • a unique sequence may differ from other sequences by multiple bases (or base pairs). The multiple bases may be contiguous or non-contiguous. Methods for obtaining nucleotide sequences (e.g., sequencing methods) are described herein and/or are known in the art.
  • detectable oligonucleotide tags comprise one or more of a ligation sequence, a priming sequence, a capture sequence, and a unique sequence (optionally referred to herein as an index sequence).
  • a ligation sequence is a sequence complementary to a second nucleotide sequence which allows for ligation of the detectable oligonucleotide tag to another entity comprising the second nucleotide sequence, e.g., another detectable oligonucleotide tag or an oligonucleotide adapter.
  • a priming sequence is a sequence complementary to a primer, e.g., an oligonucleotide primer used for an amplification reaction such as but not limited to PCR.
  • a capture sequence is a sequence capable of being bound by a capture entity.
  • a capture entity may be an oligonucleotide comprising a nucleotide sequence complementary to a capture sequence, e.g. a second detectable oligonucleotide tag.
  • a capture entity may also be any other entity capable of binding to the capture sequence, e.g. an antibody or peptide.
  • An index sequence is a sequence comprising a unique nucleotide sequence and/or a detectable moiety as described above.
  • “Complementary” is a term which is used to indicate a sufficient degree of complementarity between two nucleotide sequences such that stable and specific binding occurs between one and preferably more bases (or nucleotides, as the terms are used interchangeably herein) of the two sequences. For example, if a nucleotide in a first nucleotide sequence is capable of hydrogen bonding with a nucleotide in second nucleotide sequence, then the bases are considered to be complementary to each other. Complete (i.e., 100%) complementarity between a first nucleotide sequence and a second nucleotide is preferable, but not required for ligation, priming, or capture sequences. [0107] The present invention also relates to a computer system involved in carrying out the methods of the invention relating to both computations and sequencing.
  • a computer system may be used to receive, transmit, display and/or store results, analyze the results, and/or produce a report of the results and analysis.
  • a computer system may be understood as a logical apparatus that can read instructions from media (e.g. software) and/or network port (e.g. from the internet), which can optionally be connected to a server having fixed media.
  • a computer system may comprise one or more of a CPU, disk drives, input devices such as keyboard and/or mouse, and a display (e.g. a monitor).
  • Data communication such as transmission of instructions or reports, can be achieved through a communication medium to a server at a local or a remote location.
  • the communication medium can include any means of transmitting and/or receiving data.
  • the communication medium can be a network connection, a wireless connection, or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present invention can be transmitted over such networks or connections (or any other suitable means for transmitting information, including but not limited to mailing a physical report, such as a print-out) for reception and/or for review by a receiver.
  • the receiver can be but is not limited to an individual, or electronic system (e.g. one or more computers, and/or one or more servers).
  • the computer system comprises one or more processors.
  • Processors may be associated with one or more controllers, calculation units, and/or other units of a computer system, or implanted in firmware as desired.
  • the routines may be stored in any computer readable memory such as in RAM, ROM, flash memory, a magnetic disk, a laser disk, or other suitable storage medium.
  • this software may be delivered to a computing device via any known delivery method including, for example, over a communication channel such as a telephone line, the internet, a wireless connection, etc., or via a transportable medium, such as a computer readable disk, flash drive, etc.
  • the various steps may be implemented as various blocks, operations, tools, modules and techniques which, in turn, may be implemented in hardware, firmware, software, or any combination of hardware, firmware, and/or software.
  • some or all of the blocks, operations, techniques, etc. may be implemented in, for example, a custom integrated circuit (IC), an application specific integrated circuit (ASIC), a field programmable logic array (FPGA), a programmable logic array (PLA), etc.
  • a client-server, relational database architecture can be used in embodiments of the invention.
  • a client-server architecture is a network architecture in which each computer or process on the network is either a client or a server.
  • Server computers are typically powerful computers dedicated to managing disk drives (file servers), printers (print servers), or network traffic (network servers).
  • Client computers include PCs (personal computers) or workstations on which users run applications, as well as example output devices as disclosed herein.
  • Client computers rely on server computers for resources, such as files, devices, and even processing power.
  • the server computer handles all of the database functionality.
  • the client computer can have software that handles all the front-end data management and can also receive data input from users.
  • a machine readable medium comprising computer-executable code may take many forms, including but not limited to, a tangible storage medium, a carrier wave medium or physical transmission medium.
  • Non-volatile storage media include, for example, optical or magnetic disks, such as any of the storage devices in any computer(s) or the like, such as may be used to implement the databases, etc. shown in the drawings.
  • Volatile storage media include dynamic memory, such as main memory of such a computer platform.
  • Tangible transmission media include coaxial cables; copper wire and fiber optics, including the wires that comprise a bus within a computer system.
  • Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications.
  • RF radio frequency
  • IR infrared
  • Common forms of computer-readable media therefore include for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD or DVD- ROM, any other optical medium, punch cards paper tape, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables or links transporting such a carrier wave, or any other medium from which a computer may read programming code and/or data.
  • Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.
  • the subject computer-executable code can be executed on any suitable device comprising a processor, including a server, a PC, or a mobile device such as a smartphone or tablet.
  • a controller or computer optionally includes a monitor, which can be a cathode ray tube ("CRT") display, a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display, etc.), or others.
  • Computer circuitry is often placed in a box, which includes numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and others.
  • the box also optionally includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements.
  • Inputting devices such as a keyboard, mouse, or touch-sensitive screen, optionally provide for input from a user.
  • the computer can include appropriate software for receiving user instructions, either in the form of user input into a set of parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Algebra (AREA)
  • Mathematical Analysis (AREA)
  • Mathematical Optimization (AREA)
  • Mathematical Physics (AREA)

Abstract

The present invention relates to DNA microscopy methods to record the cellular co- localization and/or spatial distributions of arbitrary nucleic acid sequences, or other biomolecules tagged with nucleic sequences. The method involves sequence-components which may identify the targeted sequences-of-interest themselves and/or spatial beacons relative to which their distances are measured.

Description

DNA MICROSCOPY
RELATED APPLICATIONS AND/OR INCORPORATION BY REFERENCE
[0001] Reference is made to international patent application Serial No. PCT/US14/61077 filed October 17, 2014, which published as international patent publication No. WO 2015/058052 on April 23, 2015, and claims benefit of and priority to US provisional patent application Serial No. 61/892,766 filed October 18, 2013.
[0002] The foregoing applications, and all documents cited therein or during their prosecution ("appln cited documents") and all documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to DNA microscopy methods, in particular recording spatial distributions of DNA or RNA, or molecular targets tagged with DNA or RNA, in cells or biological tissue at cell-population, single-cell, or subcellular resolution by randomized barcoding of DNA or cDNA before and during in situ amplification.
FEDERAL FUNDING LEGEND
[0004] This invention was made with government support under Grant No. MH100706 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
[0005] Cellular phenotype is commonly characterized by mRNA expression profiling. However, in heterogeneous populations of cells, profiling cell populations in bulk discards all information pertaining to the associations of specific mRNA transcripts in individual cells. In immunoglobulin-producing lymphocytes, for example, pooled sequencing results in the separate characterizations of immunoglobulin heavy- and light-chains, peptides whose co- expression within a cell determines an immunoglobulin's antigen-specificity. To resolve this, heavy- and light-chain mRNA produced by individual lymphocytes may be made to associate in the sequence of a polymerase chain reaction (PCR) product (Embleton MJ, et al. Nucleic Acids Res. 1992 August 11; 20(15): 3831-3837). In this method, cells from two clonal populations were fixed and permeabilized, their heavy- and light-chain mRNA reverse transcribed to cDNA, and the cDNA amplified by PCR with primers containing reverse- complementary overhangs which allowed heavy- and light-chain PCR product to concatenate during the reaction. The fidelity of chimeric heavy/light chain PCR product to the original intracellular co-localization could then be verified either using fluorescent primers using fluorescence microscopy or by screening of bacterial colonies transfected with chimeric PCR product. (Embleton MJ, et al. Nucleic Acids Res. 1992 August 11; 20(15): 3831-3837).
[0006] High-throughput sequencing can identify large numbers of heavy- and light-chain variable regions (VH and VL) in a given B-cell repertoire, but information about endogenous pairing of heavy and light chains is lost after bulk lysis of B-cell populations. A way to retain this pairing information involves depositing single B cells (>5 x 104 capacity per experiment) in a high-density microwell plate (125 pl/well) and lysing (DeKosky BJ, et al. Nat Biotechnol. 2013 Feb;31(2): 166-9). mRNA is then captured on magnetic beads, reverse transcribed and amplified by emulsion VH:VL linkage PCR and the linked transcripts are analyzed by Illumina high-throughput sequencing (DeKosky BJ, et al. Nat Biotechnol. 2013 Feb;31(2): 166-9).
[0007] RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. To mitigate these complications to allow truly digital RNA- Seq, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends (Shiroguchi K, et al. Proc Natl Acad Sci U S A. 2012 Jan 24; 109(4): 1347-52). After PCR, paired-end deep sequencing is applied to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence (Shiroguchi K, et al. Proc Natl Acad Sci U S A. 2012 Jan 24; 109(4): 1347-52). The barcodes may be optimized to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome (Shiroguchi K, et al. Proc Natl Acad Sci U S A. 2012 Jan 24; 109(4): 1347-52).
[0008] Prior technologies, such as those described above, to identify the contents of individual cells required their dissociation so that they may be analyzed individually. In the case of structurally fragile cell types, such as neurons, this generally required severing whole cell parts, such as dendrites that branch from the main cell body.
[0009] Fluorescence in situ sequencing, or FISSEQ, is a method that allows the acquisition of mRNA/cDNA sequences directly from within cell monolayers or fixed tissue (Lee JH et al. Science. 2014 Mar 21;343(6177): 1360-3). mRNA transcripts are reverse- transcribed into cDNA and fixed to the cellular matrix. mRNA is degraded, and the cDNA subsequently circularized so that polonies comprising long repeats of cDNA sequence may be formed by rolling circle amplification (RCA). SOLiD sequencing (sequencing by oligonucleotide ligation and detection) is then used to read out 30 bp reads that allow comparison with reference gene transcripts. In order to resolve individual transcripts, signals are suppressed so that polonies are sufficiently sparse to be distinguished from one another optically. FISSEQ requires high-quality optics for each sample to be analyzed. Moreover, because of trade-offs between a microscope's depth-of-field and its imaging resolution, samples must be properly arranged on a two-dimensional plane to be analyzed.
[0010] Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention.
SUMMARY OF THE INVENTION
[0011] The invention solves the challenge of sequencing DNA or RNA, or identifying molecular targets tagged with DNA or RNA, in non-dissociated fixed cells or sectioned or intact biological tissue at single-cell or subcellular resolution.
[0012] The present invention relates to randomized barcoding of nucleic acids before and during in situ amplification. Random barcoding of nucleic acids before in situ amplification creates a UMI (unique molecular identifier) for nucleic acid template molecules. Concatenation of nucleic acid-amplification products is accompanied by random-barcoding of concatenation events, generating unique event identifier's, or UEI's. Sequencing UMI's and UEI's and combining them generates a hierarchy of physical co-localization among groups of template nucleic acid molecules in the biological sample. [0013] Advantages of the present invention is that (a) DNA microscopy may work with a single sample, and this sample may be non-canonical and idiosyncratic (such as, but not limited to, tumor tissue, lymphatic tissue or neural tissue); (b) image-capture is volumetric with no sectioning required; (c) the protocol stands alone and does not require specialized equipment; (d) the protocol uses commercialized DNA sequencers to provide high coverage of single template molecules, thereby enabling single-base resolution, low error rates, and high read lengths of gene sequences of interest.
[0014] Accordingly, it is an object of the invention to not encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product.
[0015] It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as "comprises", "comprised", "comprising" and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean "includes", "included", "including", and the like; and that terms such as "consisting essentially of and "consists essentially of have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
[0016] These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings.
[0018] FIG. 1 depicts a simplified bird's-eye view of the invention.
[0019] FIG. 2 provides a flowchart of the method's experimental structure. Following sample fixation and membrane permeabilization, RNA is denatured (chemically under acid- treatment and/or by heating). Reverse transcription (cDNA synthesis) incorporates primers with randomized UMI nucleotides flanked by reverse-adapters (see Figs 3 and 4 for further detail). Residual primers from reverse transcription are degraded using a combination of enzymatic digestion (such as with Exonuclease I) and washing. Overlap-extension in situ PCR concatenates UMI-labeled amplicons together, and incorporates randomized UEI nucleotides between them. Reaction products are then prepared as libraries for NGS (Next Generation Sequencing).
[0020] FIG. 3 illustrates a Beacon-Target embodiment of the DNA Microscopy experimental flow for gene-specific amplification. Following cell fixation and permeabilization (i), cDNA synthesis proceeds for beacon-transcripts with primers containing a beacon-specific sequence (1), a randomized UMI sequence (2), and a universal handle (3). The cDNA product extends to include a new beacon-specific priming site (6). cDNA from target-transcripts is synthesized with primers containing a target-specific sequence (4), a randomized UMI sequence (2), and a universal handle (5), with the product containing a new target-specific priming site (7). Following exonuclease I treatment (ii), the in situ overlap- extension PCR reaction is prepared. Second-strand synthesis primers specific to priming sites (6) and (7) are added at a low concentration. These primers contain, on their 5 '-ends, short universal handles (8sh) and (9sh) with low melting temperatures. PCR primers include a primer containing the universal handle (8) subsuming the short handle (8sh) and a primer containing the universal handle (9) subsuming the short handle (9sh), the latter containing on its 5' end an overlap-extension adapter sequence (10') and randomized nucleotides (2). PCR primers further include a primer containing the universal handle (5) and a primer containing the universal handle (3) in addition to randomized nucleotides (2) and the overlap-extension adapter sequence (10), reverse-complementary to (10'), on its 5' end. Initially, DNA amplification (iii) proceeds by thermocycling with a high primer-annealing temperature above the maximum for priming the short sequences (8sh) and (9sh). This results in a linear {i.e. constant) amplification rate of both beacon and target amplicons. Subsequently, primer- annealing temperatures are lowered so that (8sh) and (9sh) may be primed, resulting in exponential amplification (iv). The reaction results in overlap-extension between amplicon molecules, leading to both the monomeric and dimeric/concatemer products shown. In these products, UMI' s retain information on template molecules of origin, and newly incorporated randomized nucleotides comprise UEI' s that label unique cross-linking {i.e. overlap- extension) events. After reaction product elution (v), sequencing library preparations are prepared by amplifying from universal handles (1) and (5) to incorporate NGS adapters (vi). During this reaction, overlap-extension suppression is performed using the techniques listed in TABLE 1, individually or in combination. Example forward- and reverse-reads from the final NGS product are shown. The sequencing is then analyzed (FIG 5).
[0021] FIG 4 illustrates a Target-Target embodiment of DNA microscopy. Here, cross- linked products comprise repeats of the same structural unit. Target-Target molecular microscopy follows the same experimental flow as Beacon-Target Molecular Microscopy, except that beacon gene transcripts are not amplified by their own primer sets (meaning that all amplified products are treated identically), permitting a UMFs concatenation both to other UMI's as well as to itself. Two small sequences, (14) and (15), are inserted into reverse- transcription and second-strand synthesis primers, respectively, and these permit separate amplification of the two overlapping sides of the final cross-linked amplicon products (vi and viii). During library preparation, because both sides of the amplicon are identical, interference-oligo technique (TABLE 1, Turchaninova MA et al. Eur J Immunol. 2013 Sep;43(9):2507-15) may be used to suppress late-stage overlap-extension. The two amplification reactions are compared and matched based on shared UEI sequences (FIG 6).
[0022] FIG 5 illustrates the data-flow from Next Generation Sequence output for Beacon-Target DNA Microscopy.
[0023] FIG 6 illustrates the data-flow from Next Generation Sequence output for Target- Target DNA Microscopy.
[0024] FIG 7 illustrates UMI/UEI local-similarity hashing alignment in advance of EASL clustering. Sequences (which may correspond to either a library of UMI's or UEI' s) are first grouped by perfect identity. In Part 1, for sequences of full length L, L separate dictionaries are generated. In dictionary i, all sequences - each having had position i removed - are catalogued. In Part 2, all dictionaries are looped through, and all sequence associations that are found and recorded in a final list.
[0025] FIG. 8 depicts an EASL clustering iteration.
[0026] FIG. 9 depicts inferred positions of transcript sequences from a Beacon-Target DNA microscopy experiment.
[0027] FIG. 10 depicts one embodiment of reaction chamber preparation, which enables cell/tissue adhesion, sample imaging, and the DNA microscopy reaction.
[0028] FIG. 11 depicts inferred positions of transcript sequences from a Beacon-Target DNA microscopy experiment. Each dot corresponds to a UMI, and its color corresponds to the amplicon to which read-out sequence matches. DETAILED DESCRIPTION OF THE INVENTION
[0029] Embodiments disclosed herein are directed to DNA microscopy, a technology that efficiently generates DNA-sequence read-outs of tissue microstructure. In certain embodiments this is achieved by encoding into DNA the cellular co-localization and/or spatial distributions of arbitrary DNA/RNA sequences, or other biomolecules tagged with DNA/RNA sequences. Biomolecules are first tagged with randomized DNA or RNA sequences, called UMI's (unique molecular identifiers). These tags, which may incorporate the sequence of a targeted gene sequence, are amplified by PCR in situ with oligonucleotide primers. These primers both direct the concatenation of PCR products, retaining their original UMI tags, as well as insert UEFs (unique event identifiers) to label each concatenation event uniquely. Because UMI-tagged PCR products must diffuse in order to concatenate, the UEI frequency between any two UMFs is a function of the distance between the original UMI tags from which they were copied. By precisely quantifying concatenation frequencies using high-throughput DNA sequencing, biomolecules identities, abundances, positions, and local tissue densities may therefore be inferred. DNA microscopy thereby allows DNA molecules it generates to encode the physical forms {i.e. the image) of the specimens from which they originate. A general overview of the present invention, as it relates to mapping images of gene transcripts, is presented in FIG. 1.
[0030] DNA microscopy may be interchangeably referred to as molecular microscopy or volumetric imaging by proximal unique molecular identifiers ("UMI") reaction ("VIPUR") microscopy.
[0031] As used herein, a unique molecular identifier (UMI) is a randomized DNA sequence serving as a unique molecular identifier.
[0032] As used herein, a unique event identifier (UEI) is a randomized DNA sequence serving as a unique molecular identifier generally involved in overlap-extension.
[0033] The terms of UMI and a-UID may be used interchangeably.
[0034] The terms of UEI and β-UID may be used interchangeably.
[0035] The bulk of the experimental phase of DNA microscopy can be broken down into 3 distinct stages.
[0036] The first stage is UMI generation. During this stage, unique molecular identifiers - which may be referred to as UMFs - label individual template molecules using at least 10 randomized bases. This subsumes the in situ preparation, reverse transcription, and the disposal of residual reagents from each of these steps. Importantly, this disposal includes the use of multiple washes and Exonuclease I digestion, which rids the sample of free remaining single-stranded oligonucleotides (cDNA is protected by its duplexing with mRNA).
[0037] The second stage is UEI generation. During this stage, in situ PCR is run with overlap-extension adapters attached to the 5' end of two universal primers. Overlap-extension occurs between those transcripts that have been reverse-transcribed as "beacons" and those transcripts that have been reverse-transcribed as "targets". Overlap-extension incorporates at least 10 random bases in between the two amplicons, and thereafter, as these concatemers are copied by further amplification, so too are these at least 10 bases.
[0038] The third stage is NGS library preparation. During this stage, in situ PCR products are extracted and amplified in such a way that they may be easily sequenced. A key part of this stage is preventing further formation of concatemers. To this end, this protocol makes use of "interference oligonucleotides" with 3'-phosphate caps [Turchaninova et al., Pairing of t-cell receptor chains via emulsion per. Eur J Immunol, 43(9):2507-2515, Sep 2013].
[0039] The present invention relates to the scalable analysis of DNA sequencing products from the DNA microscopy amplification reaction. The scalable analysis involves two challenges, one being UMI/UEI error correction, the second being UMI position inference.
[0040] UMI/UEI error correction involves sequence-clustering of N UMI or UEI sequences, where N is large. If comparisons of these N sequences were computed directly, this would require N2 comparisons. A solution involves (1) reducing error correction to a clustering problem requiring only knowledge of nearest neighbors and (2) performing local similarity hashing to align UMI/UEI sequences to each other.
[0041] UMI position inference involves searching for an optimal positioning of NUMI's: a relative positioning problem that would similarly require N2 comparisons per iteration of the optimization algorithm if this were computed directly. In one example embodiment, optimization involves using the Barnes-Hut algorithm [A hierarchical o (n log n) force- calculation algorithm. Nature, 324:446(449, Dec 1986] for reducing the N2 comparisons to N log N comparisons. In another example embodiment, optimization comprises using the Fast Gauss Transform for reducing N2 comparisons to N comparisons. (Greengard and Strain. The Fast Gauss Transform, SIAM Journal on Scientific and Statistical Computing, 1991).
[0042] In preparation for the experiment, reaction chambers are designed in order to maximally adhere cells while providing a thermally robust container for PCR thermocycling. For the former criterion, (3-aminopropyl)triethoxysilane, or APTES (Sigma 440140), may be used to preliminarily silanize a glass surface, such as a 2% acetone solution [Bagasra O. Protocols for the in situ PCR amplification and detection of mRNA and DNA sequences. Nat Protoc, 2(l l):2782-2795, 2007], thereby coating it with covalently-linked, positively charged functional groups. In one embodiment, uncured PDMS is poured into petri dishes to a height of approximately 4.5 mm. PDMS is cured, and 6 mm diameter holes are punched in a regular pattern and in sufficient number so that holes to be used as fluid reservoirs completely surround wells to be used for samples. PDMS is then plasma-bonded to uncoated white glass slides (FIG 10). Glass chambers are subsequently silanized. In another embodiment silanized glass beads are anchored into PCR-plate wells containing about 25 μΐ of uncured PDMS. The plates are spun down and cured, such that the PDMS functions as an inert hydrophobic "glue". The tops of the silanized glass beads are then exposed for cell adhesion.
[0043] The following cell plating protocol may be followed. PDMS-embedded silanized glass beads or PDMS-bonded and silanized glass slides are assembled and UV sterilized under a laminar flow hood for 30 minutes. After washing once with lx PBS, a 1 : 100 dilution of fibronectin (Sigma Fl 141) in PBS is added at a volume of 40 μΐ on top of the beads or 60 μΐ on top of slides and incubated for 1 hour at room temperature. Immediately after removing BT-549 expressing RFP (Cell Biolabs AKR-255) and the human cell line MDA-MB-231 expressing EGFP (Cell Biolabs AKR-211) may be plated in each. The cells may then be co- cultured for 36 hours.
[0044] After culturing, growth medium is removed and cells are washed once with lx PBS. Initial pre-reverse transcription treatments may follow Lee et al. [Highly multiplexed subcellular RNA sequencing in situ. Science, 343(6177): 1360( 1363, Mar 2014]. Cells are fixed in 4% formaldehyde (Sigma F8775) in lx PBS for 15 minutes at room temperature. Formaldehyde is aspirated and replaced by 3x PBS, and left for 10 minutes. Samples are washed twice for 10 minutes in lx PBS, and then permeablized with a solution of 0.25% Triton X-100 (Sigma 93443) in lx PBS for 15 minutes. Samples are then aspirated, washed twice with lx PBS, and then treated with 0.1 N HC1 for 2 minutes and washed an additional three times in lx PBS.
[0045] In the following portion of the protocol, primer-names are used in reference to TABLE 2.
[0046] Reverse transcription is performed with "target" primers (5)-(2)-(4)-GAPDH, (5)- (2)-(4)-GAPDH, and (5)-(2)-(4)-GAPDH and a "beacon" primer (3)-(2)-(l)-ACTB all added to 850 nM each, in a reaction containing dNTP (400 μΜ), Superase-In (1 U/μΙ, Life Technologies AM2696), DTT (4 mM), lx First-Strand Buffer, and Superscript III (10 U/μΙ, Life Technologies 18080-044). Reverse transcription is performed by incubating at 60 °C for 3 minutes, followed by 42 °C for 60 minutes. Samples are subsequently kept on ice, until washed twice with lx PBS, followed by an additional wash with water. Immediately afterward, Exonuclease I digestion is performed in a reaction containing lx Exonuclease I buffer (NEB B0293S) and 1.4 U/μΙ Exonuclease I (NEB M0293L), incubated for 40 minutes at 37 °C. Samples are then washed three times in lx PBS for 1 minute each, and left at 4 °C until addition of in situ PCR-mixes.
[0047] In situ PCR reaction-mixes may be prepared as follows. HPLC-purified overlap- extension primers with acrydite-modified 5' ends (10')-(2)-(9) and (10)-(2)-(3) are added to final concentrations of 400 nM each, the primers (5) and (8) are added to final concentrations of 300 nM each, and the second-strand synthesis primers (9sh)-(7(-))-GAPDH, (9sh)-(7(-))- GFP, (9sh)-(7(-))-RFP, and (8sh)-(6(-))-ACTB are added to final concentrations of 30 nM each. The reaction further contains dNTP (200 nM), MgC12 (1.6 mM), 40.8 mg/ml 2-arm thiolated PEG (Laysan Bio SH-PEG-SH-3400-1GR), 55 mg/ml 4-arm acrylated PEG (Laysan Bio PEG-ACRL-10K-1GR), lx PCR buffer (without magnesium), 0.5 ug/ul BSA, 8% glycerol, and 1 :250 dilution Platinum Taq DNA polymerase (Life Technologies 10966018). The reaction solution is mixed by pipetting, ensuring no bubbles, and a hydrogel left to form for 35 minutes at room temperature. Afterward thermocycling is performed as follows: 95 °C 2 min, 10 X (95 °C 30 s, 68 °C 1 min), 2 x (95 °C 30 s, 55 °C 30 s, 68 °C 1 min), 16 X (95 °C 30 s, 60 °C 30 s, 68 °C 1 min), 68 °C 1 min, 4 °C. Reactions are transferred on ice to -20 °C, where they can be stored until NGS library preparation.
[0048] Samples may be thawed on ice, and hydrogel dissolution may be performed by adding 1 part dissolving-reagent (460 mM KOH, 100 mM EDTA, 42 mM DTT) per 5 parts hydrogel. Samples may be left to incubate at 4 °C for 2 hours for the reagent to diffuse in, after which it may be heated to 72 °C for 5 minutes, and then cooled back down. Stop solution (made by adding 400 μΐ 1 M HC1 to 600 μΐ 1 M Tris-HCl pH 7.5) may be added in the equivalent volume as the dissolving-reagent, and samples may be immediately mixed by pipetting.
[0049] Proteinase-K mix may be prepared as 0.36% Tween-20 and 360 μg/ml proteinase K (Sigma P4850) in 10 mM Tris-HCl pH 8. 4 parts of proteinase-k mix may be added per 10 parts neutralized sample and then mixed by pipetting. Samples may be incubated at 50 °C for 25 minutes, and then transferred to ice. Samples may be diluted 1 :2 in 10 mM Tris-HCl pH 8, mixed by pipetting, and transferred to a new set of wells, where they may be purified by the AMPURE XP protocol, using an addition of 0.65 volumes of AMPURE XP beads. Samples may be eluted into 35 μΐ 10 mM Tris-HCl pH 8.
[0050] Interference oligonucleotide-mix [Turchaninova et al., Pairing of t-cell receptor chains via emulsion per. Eur J Immunol, 43(9):2507-2515, Sep 2013] consisting of the oligos lOT-OEc-P: TTTTTTTTTTTATTCCCATGGCGCGCCA/3Phos/ (SEQ ID NO: 15) and 10T-OE-P: TTTTTTTTTTGGCGCGCCATGGGAATAA/3Phos/ (SEQ ID NO: 16) at final concentrations of 50 μΜ each may be prepared in advance. Re-amplification may be performed by adding (in 15 μΐ sample + 15 μΐ master-mix reactions) interference oligonucleotides to final concentrations of 3.2 μΜ each, the primers CCCACTTCTCTCGACGCTCTTCCGATCT (SEQ ID NO: 17) and (12)-(5) to final concentrations of 300 nM each, MgS04 to final concentration 1.5 mM, dNTP to final concentration 0.2 mM, lx HiFi PCR buffer (without magnesium), and 1 :250 dilution Platinum Taq HiFi (Life Technologies 11304-011). Reactions may be thermocycled 95 °C 2 min, 20 X (95 °C 30 s, 68 °C 2 min), and then stored at 4 °C. Later, samples may be purified by the AMPURE XP protocol, using an addition of 0.65 volumes of AMPURE XP beads. A final last-stage amplification may be performed with primers (l'(long)) and (12)-(5) and at final concentrations of 300 nM each, MgS04 to final concentration 2 mM, dNTP to final concentration 0.2 mM, lx HiFi PCR buffer (without magnesium), and 1 :250 dilution Platinum Taq HiFi (Life Technologies 11304-011). Reactions may be thermocycled 95 °C 2 min, 5 X (95 °C 30 s, 58 °C 30 s, 68 °C 2 min), 5 X (95 °C 30 s, 68 °C 2 min), 68 °C 5 min, 4 °C.
[0051] Each sequencing-read is comprised of three types of segments: "primers", "UMFs" or "UEFs", and "amplicons". The form this takes on as a paired-end read is illustrated in FIG. 3. Beacon UMFs, target UMFs, and UEFs are separated from each other into distinct analyses. These are analyzed and grouped in order to eliminate sequencing and PCR error using an algorithm, here called extended abundance single-linkage (EASL) clustering, which is analogous to the Watershed Algorithm for image processing (FIG 8).
[0052] The EASL clustering algorithm is designed for rapid identification of UMI/UEI sequence-clusters based on single-mismatch alignments alone. EASL presupposes that a sequence is more likely to occur in the dataset the nearer it is to its correct form.
[0053] EASL initiates by grouping every UMI/UEI (of the same type and within the same data-set) by perfect identity, and read-abundance is assigned to each UMF/UEI sequence by the number of reads identically grouped in this manner. Each pair of UMFs or UEFs (of the same type and within the same data-set) is compared in an un-gapped alignment. UMFUEI i (directionally) links to UMI/UEI j if and only if the read-abundance of UMI/UEI i is greater than or equal to the read-abundance of UMI/UEI j. In order to accelerate this process local similar hashing may be used (FIG. 8).
[0054] Read number densities, or RND's, are calculated for each UMI/UEI sequence by summing read-abundances belonging both to the sequence itself and all sequences (of equal or lower abundance) it links to. The UMI/UEI with the largest RND initiates clustering as the first cluster-seed. All UMI/UEI' s to which this seed links by the aforementioned criterion are accepted into its cluster, all UMI/UEFs to which these newly accepted UMI/UEFs link are accepted as well, and so on. In this way, single-linkage clusters are formed in which the linkages themselves are not always bidirectional.
[0055] Once no further assignments can be made to the first cluster, the algorithm proceeds to the UMFUEI with the next largest RND that has not already been accepted into a cluster. The same cluster-assembly proceeds among all un-assigned UMFs or UEFs. When no un-assigned UMI/UEI remains, the algorithm terminates.
[0056] The iteration of the EASL algorithm is illustrated in FIG. 8.
[0057] The number of N's to use in a UMI/UEI will depend on the expected diversity of molecules and/or events being tagged. Assuming an upper-bound for this diversity is known, the question reduces to the so-called "birthday-problem". Given a UMF/UEI length f: , the probability that two randomly-drawn UMFs or UEFs will match (assuming uniform base- f ..; f \ "^
distributions) is ¾! ,t
[0058] Similarly, the probability that there will be another UMI/UEI within 1 bp is ... ., I ·-;-· M "
/ i m :::: —
[0059] The probability that no two UMFs or UEFs out of N will overlap in this way is
Proh(0 overlap) ^ ( ! - ¾(£))(! - - - - (1 - i N -----
[0060] If * i:M; >' is defined through the relation
1/2 = (1 - ¾.(£)) (i ----- 2J¾ (£)} - - (I. - - i)PM) then ^« \ · . is the maximum diversity of templates beyond which it becomes likely that at least 1 pair of UMI/UEI sequences will be within 1 bp of one another. For ■· = 21, the number currently used in experiments, " A ! ■ However, this is only for single target gene sequences. For a set of sequence frequencies i l f **** * * * (normalized to sum to one) of S distinct sequence-types labeled by UMI's, the probability that two randomly
\ \ - „,2
selected sequences will be the same is ~~ i ¾ . This measure also known as Simpson's diversity index, affects the calculation above by multiplying more diverse and distributed the opulation of sequences, the smaller the produc
Figure imgf000014_0001
t and the larger the value of
Figure imgf000014_0002
[0061] It should moreover be noted that the picture is far simpler for UEFs than for UMI's. Because a UEI brings together exactly two UMI's, two UEFs that are grouped together will get one vote as to which pair of UMI's they associate (assigned via read- plurality). Therefore, the less abundant indistinguishable UEI will simply be ignored. From here it can be determined that the UEI diversity is far closer to the upper limit of that which is physically possible (¾ , or in the case of oligos in TABLE 2, where the UEFs have 20 N- nucleotides, ¾i ") without substantial problems.
[0062] Verifying the suffciency of UMI/UEI length boils down to comparing those found in different experiments (something that also helps in tracking cross-contamination). Once abundance filters (> 2 reads) and composition filters (75% maximum majority for a single base) are applied, little if any overlap has been observed in any of the runs analyzed.
[0063] Consider the diffusion profile of products of a single UMI with index /', centered at position x;, during an amplification experiment. This can be written
Figure imgf000014_0003
where d is the dimensionality (of space), D is the diffusion constant, and A = log 2/ At where At is the time-scale of a PCR cycle. The rate of crosslink product formation between UMI's i and with the same diffusion constant will then be the volume-integral (2)
Figure imgf000014_0004
[0064] This rate equation provides the foundation to build maximum likelihood estimates (MLE) of positions, given the observed rates of UEI formation - which is really the summation of rates, — '!-' i ' ^ over the duration of the experiment. Here an MLE solution was developed, which is time-independent.
[0065] For the time-independent MLE, the approximation is considered where, in some units of space ^ ^·**~Λ ^ } (: ' " '· = The amplification constants Ai and Aj may be interpretted as free parameters belonging to each UMI that account for discrepancies both in amplification efficiency and other sources of over- and under-sampling.
[0066] Applicants can use the normalized frequency of concatenation between UMFs / and j , i < ·'' U:~ (where each "." represents summation over an index) to calculate the likelihood of a solution wherein ntj unique UEFs occur between beacon UMI / and target UMI /:
Pro ({;¾} ¾}| {¾}) ex J]
Figure imgf000015_0001
[0067] The gradient is now calculated for the log-probability from Equation (5)
~ iiij log Wij n... log w,. and its gradient with respect to some attribute (either position or amplification constant) or a UMI k:
Figure imgf000015_0002
100681 In the above, the first term can be calculated quickly, because of the sparse nature of the matrix ntj. The second term requires special treatment, because explicit evaluation would otherwise require an 0{Nbeacon X Ntarget) calculation at every MLE-maximization iteration. The Fast Gauss Transform is therefore used [Greengard and Strain. The fast Gauss Transform, SIAM Journal on Scientific and Statistical Computing, 1991].
[0069] Fixation of cells or tissue may involve the use of cross-linking agents, such as formaldehyde, and may involve embedding cells or tissue in a paraffin wax or polyacrylamide support matrix (Chung K, et al. Nature. 2013 May 16; 497(7449): 322-7).
[0070] Amplification may involve thermocycling or isothermal amplification (such as through the methods RPA or LAMP). Concatenation may involve overlap-extension PCR or use of ligase, recombinase, or transposase to associate multiple amplification products with each other.
[0071] For purpose of this invention, amplification means any method employing a primer and a polymerase capable of replicating a target sequence with art recognized standards of fidelity. Amplification may be carried out by natural or recombinant DNA polymerases such as TaqGold™, T7 DNA polymerase, Klenow fragment of E.coli DNA polymerase, and reverse transcriptase. A preferred amplification method is PCR. In particular, the isolated RNA can be subjected to a reverse transcription assay that is coupled with a quantitative polymerase chain reaction (RT-PCR) in order to quantify the expression level of a sequence associated with a signaling biochemical pathway.
[0072] Detection of the gene expression level can be conducted in real time in an amplification assay. In one aspect, the amplified products can be directly visualized with fluorescent DNA-binding agents including but not limited to DNA intercalators and DNA groove binders. Because the amount of the intercalators incorporated into the double-stranded DNA molecules is typically proportional to the amount of the amplified DNA products, one can conveniently determine the amount of the amplified products by quantifying the fluorescence of the intercalated dye using conventional optical systems in the art. DNA- binding dyes suitable for this application include SYBR green, SYBR blue, DAPI, propidium iodine, Hoeste, SYBR gold, ethidium bromide, acridines, proflavine, acridine orange, acriflavine, fluorcoumanin, ellipticine, daunomycin, chloroquine, distamycin D, chromomycin, homidium, mithramycin, ruthenium polypyridyls, anthramycin, and the like.
[0073] In another aspect, other fluorescent labels such as sequence specific probes can be employed in the amplification reaction to facilitate the detection and quantification of the amplified products. Probe-based quantitative amplification relies on the sequence-specific detection of a desired amplified product. Such methods utilize fluorescent, target-specific probes (e.g., TaqMan® probes) resulting in increased specificity and sensitivity. Methods for performing probe-based quantitative amplification are well established in the art and are taught, for example, in U.S. Patent No. 5,210,015.
[0074] Sequencing may be performed on any high-throughput platform with read-length (either single- or paired-end) sufficient to cover both template molecule identifiers (UMI's) and concatenation event identifiers (UEFs). Methods of sequencing oligonucleotides and nucleic acids are well known in the art (see, e.g., W093/23564, WO98/28440 and W098/13523; U.S. Pat. Nos. 5,525,464; 5,202,231; 5,695,940; 4,971,903; 5,902,723; 5,795,782; 5,547,839 and 5,403,708; Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463 (1977); Drmanac et al., Genomics 4: 114 (1989); Koster et al., Nature Biotechnology 14: 1123 (1996); Hyman, Anal. Biochem. 174:423 (1988); Rosenthal, International Patent Application Publication 761107 (1989); Metzker et al., Nucl. Acids Res. 22:4259 (1994); Jones, Biotechniques 22:938 (1997); Ronaghi et al., Anal. Biochem. 242:84 (1996); Ronaghi et al., Science 281 :363 (1998); Nyren et al., Anal. Biochem. 151 :504 (1985); Canard and Arzumanov, Gene 11 : 1 (1994); Dyatkina and Arzumanov, Nucleic Acids Symp Ser 18: 117 (1987); Johnson et al., Anal. Biochem.136: 192 (1984); and Elgen and Rigler, Proc. Natl. Acad. Sci. USA 91(13):5740 (1994), all of which are expressly incorporated by reference).
[0075] The present invention may be applied to (1) single-cell transcriptomics: cDNA synthesized from mRNA is barcoded and concatenated during in situ amplification, (2) single-cell proteomics: cDNA or DNA synthesized from RNA- or DNA-tagged antibodies of one or multiple specificities maps the abundance and distributions of different protein- antigens and (3) whole-tissue transcriptomic/proteomic mapping (DNA microscopy): using the frequency of cross-contamination between cells to determine their physical proximity, and via applications (1) single-cell transcriptomics and (2) single-cell proteomics, determining the global spatial distribution of mRNA, protein, or other biomolecules in a biological sample. This may be used, for example, to screen for anti-cancer/pathogen immunoglobulins (by analyzing co-localization of B-cells and T-cells within affected tissue) for immunotherapy.
Table 1: Techniques for overlap-extension suppression during library preparation.
Figure imgf000017_0001
Table 2: List of primer-sequences for Beacon-Target embodiment. The number of random nucleotides in primers beginning with are determined by either the expected diversity of template cDNA molecules being amplified (for UMI diversity, in the case of (5)-(2)-X and (3)-(2)-X) or the expected diversity required to uniquely identify overlap-extension events (for UEI diversity, in the case of (10)-(2)-X and (10')-(2)-X). "XXXXXXXX" for primer (12)-(5) represents the sample barcode (which is non-random), and is represented by NNNNNNNN in the attached Sequence Listing
Figure imgf000018_0001
[0076] The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. The term also encompasses nucleic-acid-like structures with synthetic backbones, see, e.g., Eckstein, 1991; Baserga et al., 1992; Milligan, 1993; WO 97/03211; WO 96/39154; Mata, 1997; Strauss- Soukup, 1997; and Samstag, 1996. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
[0077] As used herein the term "wild type" is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
[0078] As used herein the term "variant" should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature.
[0079] The terms "non-naturally occurring" or "engineered" are used interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
[0080] "Complementarity" refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non- traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%), and 100% complementary). "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
[0081] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.
[0082] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.
[0083] As used herein, the term "genomic locus" or "locus" (plural loci) is the specific location of a gene or DNA sequence on a chromosome. A "gene" refers to stretches of DNA or RNA that encode a polypeptide or an RNA chain that has functional role to play in an organism and hence is the molecular unit of heredity in living organisms. For the purpose of this invention it may be considered that genes include regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.
[0084] As used herein, "expression of a genomic locus" or "gene expression" is the process by which information from a gene is used in the synthesis of a functional gene product. The products of gene expression are often proteins, but in non-protein coding genes such as rRNA genes or tRNA genes, the product is functional RNA. The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea) and viruses to generate functional products to survive. As used herein "expression" of a gene or nucleic acid encompasses not only cellular gene expression, but also the transcription and translation of nucleic acid(s) in cloning systems and in any other context. As used herein, "expression" also refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
[0085] As described in aspects of the invention, sequence identity is related to sequence homology. Homology comparisons may be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs may calculate percent (%) homology between two or more sequences and may also calculate the sequence identity shared by two or more amino acid or nucleic acid sequences.
[0086] Sequence homologies may be generated by any of a number of computer programs known in the art, for example BLAST or FASTA, etc. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S. A; Devereux et al., 1984, Nucleic Acids Research 12:387). Examples of other software than may perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 ibid - Chapter 18), FASTA (Atschul et al., 1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999 ibid, pages 7-58 to 7-60). However it is preferred to use the GCG Bestfit program. % homology may be calculated over contiguous sequences, i.e., one sequence is aligned with the other sequence and each amino acid or nucleotide in one sequence is directly compared with the corresponding amino acid or nucleotide in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues. Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion may cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without unduly penalizing the overall homology or identity score. This is achieved by inserting "gaps" in the sequence alignment to try to maximize local homology or identity. However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - may achieve a higher score than one with many gaps. "Affinity gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties may, of course, produce optimized alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example, when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension. Calculation of maximum % homology therefore first requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (Devereux et al., 1984 Nuc. Acids Research 12 p387). Examples of other software than may perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 Short Protocols in Molecular Biology, 4th Ed. - Chapter 18), FASTA (Altschul et al., 1990 J. Mol. Biol. 403-410) and the GE EWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol Lett. 1999 174(2): 247-50; FEMS Microbiol Lett. 1999 177(1): 187-8 and the website of the National Center for Biotechnology information at the website of the National Institutes for Health). Although the final % homology may be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pair-wise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table, if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
[0087] Alternatively, percentage homologies may be calculated using the multiple alignment feature in DNASISTM (Hitachi Software), based on an algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237-244). Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.
[0088] Embodiments of the invention include sequences (both polynucleotide or polypeptide) which may comprise homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue or nucleotide, with an alternative residue or nucleotide) that may occur i.e., like-for-like substitution in the case of amino acids such as basic for basic, acidic for acidic, polar for polar, etc. Nonhomologous substitution may also occur i.e., from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.
[0089] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R.I. Freshney, ed. (1987)).
[0090] Hybridization can be performed under conditions of various stringency. Suitable hybridization conditions for the practice of the present invention are such that the recognition interaction between the probe and sequences associated with a signaling biochemical pathway is both sufficiently specific and sufficiently stable. Conditions that increase the stringency of a hybridization reaction are widely known and published in the art. See, for example, (Sambrook, et al., (1989); Nonradioactive In Situ Hybridization Application Manual, Boehringer Mannheim, second edition). The hybridization assay can be formed using probes immobilized on any solid support, including but are not limited to nitrocellulose, glass, silicon, and a variety of gene arrays. A preferred hybridization assay is conducted on high-density gene chips as described in U.S. Patent No. 5,445,934.
[0091] For a convenient detection of the probe-target complexes formed during the hybridization assay, the nucleotide probes are conjugated to a detectable label. Detectable labels suitable for use in the present invention include any composition detectable by photochemical, biochemical, spectroscopic, immunochemical, electrical, optical or chemical means. A wide variety of appropriate detectable labels are known in the art, which include fluorescent or chemiluminescent labels, radioactive isotope labels, enzymatic or other ligands. In preferred embodiments, one will likely desire to employ a fluorescent label or an enzyme tag, such as digoxigenin, β-galactosidase, urease, alkaline phosphatase or peroxidase, avidin/biotin complex.
[0092] The detection methods used to detect or quantify the hybridization intensity will typically depend upon the label selected above. For example, radiolabels may be detected using photographic film or a phosphoimager. Fluorescent markers may be detected and quantified using a photodetector to detect emitted light. Enzymatic labels are typically detected by providing the enzyme with a substrate and measuring the reaction product produced by the action of the enzyme on the substrate; and finally colorimetric labels are detected by simply visualizing the colored label.
[0093] Examples of the labeling substance which may be employed include labeling substances known to those skilled in the art, such as fluorescent dyes, enzymes, coenzymes, chemiluminescent substances, and radioactive substances. Specific examples include
32 14 125 3 131
radioisotopes (e.g., P, C, I, H, and I), fluorescein, rhodamine, dansyl chloride, umbelliferone, luciferase, peroxidase, alkaline phosphatase, β-galactosidase, β-glucosidase, horseradish peroxidase, glucoamylase, lysozyme, saccharide oxidase, microperoxidase, biotin, and ruthenium. In the case where biotin is employed as a labeling substance, preferably, after addition of a biotin-labeled antibody, streptavidin bound to an enzyme (e.g., peroxidase) is further added.
[0094] Advantageously, the label is a fluorescent label. Examples of fluorescent labels include, but are not limited to, Atto dyes, 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid; acridine and derivatives: acridine, acridine isothiocyanate; 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS); 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4-anilino-l-naphthyl)maleimide; anthranilamide; BODIPY; Brilliant Yellow; coumarin and derivatives; coumarin, 7-amino-4- methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanine dyes; cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5'5"- dibromopyrogallol-sulfonaphthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'- isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'- disulfonic acid; 5-[dimethylamino]naphthalene-l-sulfonyl chloride (DNS, dansylchloride); 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives; eosin, eosin isothiocyanate, erythrosin and derivatives; erythrosin B, erythrosin, isothiocyanate; ethidium; fluorescein and derivatives; 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2- yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein, fluorescein, fluorescein isothiocyanate, QFITC, (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelliferoneortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives: pyrene, pyrene butyrate, succinimidyl 1 -pyrene; butyrate quantum dots; Reactive Red 4 (Cibacron.TM. Brilliant Red 3B-A) rhodamine and derivatives: 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); Ν,Ν,Ν',Ν' tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid; terbium chelate derivatives; Cy3; Cy5; Cy5.5; Cy7; IRD 700; IRD 800; La Jolta Blue; phthalo cyanine; and naphthalo cyanine
[0095] The fluorescent label may be a fluorescent protein, such as blue fluorescent protein, cyan fluorescent protein, green fluorescent protein, red fluorescent protein, yellow fluorescent protein or any photoconvertible protein. Colormetric labeling, bioluminescent labeling and/or chemiluminescent labeling may further accomplish labeling. Labeling further may include energy transfer between molecules in the hybridization complex by perturbation analysis, quenching, or electron transport between donor and acceptor molecules, the latter of which may be facilitated by double stranded match hybridization complexes. The fluorescent label may be a perylene or a terrylen. In the alternative, the fluorescent label may be a fluorescent bar code.
[0096] In an advantageous embodiment, the label may be light sensitive, wherein the label is light-activated and/or light cleaves the one or more linkers to release the molecular cargo. The light-activated molecular cargo may be a major light-harvesting complex (LHCII). In another embodiment, the fluorescent label may induce free radical formation.
[0097] In an advantageous embodiment, agents may be uniquely labeled in a dynamic manner (see, e.g., international patent application serial no. PCT/US2013/61182 filed September 23, 2012). The unique labels are, at least in part, nucleic acid in nature, and may be generated by sequentially attaching two or more detectable oligonucleotide tags to each other and each unique label may be associated with a separate agent. A detectable oligonucleotide tag may be an oligonucleotide that may be detected by sequencing of its nucleotide sequence and/or by detecting non-nucleic acid detectable moieties to which it may be attached.
[0098] The oligonucleotide tags may be detectable by virtue of their nucleotide sequence, or by virtue of a non-nucleic acid detectable moiety that is attached to the oligonucleotide such as but not limited to a fluorophore, or by virtue of a combination of their nucleotide sequence and the nonnucleic acid detectable moiety.
[0099] In some embodiments, a detectable oligonucleotide tag may comprise one or more nonoligonucleotide detectable moieties. Examples of detectable moieties may include, but are not limited to, fluorophores, microparticles including quantum dots (Empodocles, et al., Nature 399: 126-130, 1999), gold nanoparticles (Reichert et al., Anal. Chem. 72:6025-6029, 2000), biotin, DNP (dinitrophenyl), fucose, digoxigenin, haptens, and other detectable moieties known to those skilled in the art. In some embodiments, the detectable moieties may be quantum dots. Methods for detecting such moieties are described herein and/or are known in the art.
[0100] Thus, detectable oligonucleotide tags may be, but are not limited to, oligonucleotides which may comprise unique nucleotide sequences, oligonucleotides which may comprise detectable moieties, and oligonucleotides which may comprise both unique nucleotide sequences and detectable moieties.
[0101] A unique label may be produced by sequentially attaching two or more detectable oligonucleotide tags to each other. The detectable tags may be present or provided in a plurality of detectable tags. The same or a different plurality of tags may be used as the source of each detectable tag may be part of a unique label. In other words, a plurality of tags may be subdivided into subsets and single subsets may be used as the source for each tag.
[0102] In some embodiments, a detectable oligonucleotide tag comprises one or more non-oligonucleotide detectable moieties. Examples of detectable moieties include, but are not limited to, fluorophores, microparticles including quantum dots (Empodocles, et al., Nature 399: 126-130, 1999), gold nanoparticles (Reichert et al., Anal. Chem. 72:6025-6029, 2000), biotin, DNP (dinitrophenyl), fucose, digoxigenin, haptens, and other detectable moieties known to those skilled in the art. In some embodiments, the detectable moieties are quantum dots. Methods for detecting such moieties are described herein and/or are known in the art.
[0103] Thus, detectable oligonucleotide tags may be, but are not limited to, oligonucleotides comprising unique nucleotide sequences, oligonucleotides comprising detectable moieties, and oligonucleotides comprising both unique nucleotide sequences and detectable moieties.
[0104] A unique nucleotide sequence may be a nucleotide sequence that is different (and thus distinguishable) from the sequence of each detectable oligonucleotide tag in a plurality of detectable oligonucleotide tags. A unique nucleotide sequence may also be a nucleotide sequence that is different (and thus distinguishable) from the sequence of each detectable oligonucleotide tag in a first plurality of detectable oligonucleotide tags but identical to the sequence of at least one detectable oligonucleotide tag in a second plurality of detectable oligonucleotide tags. A unique sequence may differ from other sequences by multiple bases (or base pairs). The multiple bases may be contiguous or non-contiguous. Methods for obtaining nucleotide sequences (e.g., sequencing methods) are described herein and/or are known in the art.
[0105] In some embodiments, detectable oligonucleotide tags comprise one or more of a ligation sequence, a priming sequence, a capture sequence, and a unique sequence (optionally referred to herein as an index sequence). A ligation sequence is a sequence complementary to a second nucleotide sequence which allows for ligation of the detectable oligonucleotide tag to another entity comprising the second nucleotide sequence, e.g., another detectable oligonucleotide tag or an oligonucleotide adapter. A priming sequence is a sequence complementary to a primer, e.g., an oligonucleotide primer used for an amplification reaction such as but not limited to PCR. A capture sequence is a sequence capable of being bound by a capture entity. A capture entity may be an oligonucleotide comprising a nucleotide sequence complementary to a capture sequence, e.g. a second detectable oligonucleotide tag. A capture entity may also be any other entity capable of binding to the capture sequence, e.g. an antibody or peptide. An index sequence is a sequence comprising a unique nucleotide sequence and/or a detectable moiety as described above.
[0106] "Complementary" is a term which is used to indicate a sufficient degree of complementarity between two nucleotide sequences such that stable and specific binding occurs between one and preferably more bases (or nucleotides, as the terms are used interchangeably herein) of the two sequences. For example, if a nucleotide in a first nucleotide sequence is capable of hydrogen bonding with a nucleotide in second nucleotide sequence, then the bases are considered to be complementary to each other. Complete (i.e., 100%) complementarity between a first nucleotide sequence and a second nucleotide is preferable, but not required for ligation, priming, or capture sequences. [0107] The present invention also relates to a computer system involved in carrying out the methods of the invention relating to both computations and sequencing.
[0108] A computer system (or digital device) may be used to receive, transmit, display and/or store results, analyze the results, and/or produce a report of the results and analysis. A computer system may be understood as a logical apparatus that can read instructions from media (e.g. software) and/or network port (e.g. from the internet), which can optionally be connected to a server having fixed media. A computer system may comprise one or more of a CPU, disk drives, input devices such as keyboard and/or mouse, and a display (e.g. a monitor). Data communication, such as transmission of instructions or reports, can be achieved through a communication medium to a server at a local or a remote location. The communication medium can include any means of transmitting and/or receiving data. For example, the communication medium can be a network connection, a wireless connection, or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present invention can be transmitted over such networks or connections (or any other suitable means for transmitting information, including but not limited to mailing a physical report, such as a print-out) for reception and/or for review by a receiver. The receiver can be but is not limited to an individual, or electronic system (e.g. one or more computers, and/or one or more servers).
[0109] In some embodiments, the computer system comprises one or more processors. Processors may be associated with one or more controllers, calculation units, and/or other units of a computer system, or implanted in firmware as desired. If implemented in software, the routines may be stored in any computer readable memory such as in RAM, ROM, flash memory, a magnetic disk, a laser disk, or other suitable storage medium. Likewise, this software may be delivered to a computing device via any known delivery method including, for example, over a communication channel such as a telephone line, the internet, a wireless connection, etc., or via a transportable medium, such as a computer readable disk, flash drive, etc. The various steps may be implemented as various blocks, operations, tools, modules and techniques which, in turn, may be implemented in hardware, firmware, software, or any combination of hardware, firmware, and/or software. When implemented in hardware, some or all of the blocks, operations, techniques, etc. may be implemented in, for example, a custom integrated circuit (IC), an application specific integrated circuit (ASIC), a field programmable logic array (FPGA), a programmable logic array (PLA), etc.
[0110] A client-server, relational database architecture can be used in embodiments of the invention. A client-server architecture is a network architecture in which each computer or process on the network is either a client or a server. Server computers are typically powerful computers dedicated to managing disk drives (file servers), printers (print servers), or network traffic (network servers). Client computers include PCs (personal computers) or workstations on which users run applications, as well as example output devices as disclosed herein. Client computers rely on server computers for resources, such as files, devices, and even processing power. In some embodiments of the invention, the server computer handles all of the database functionality. The client computer can have software that handles all the front-end data management and can also receive data input from users.
[0111] A machine readable medium comprising computer-executable code may take many forms, including but not limited to, a tangible storage medium, a carrier wave medium or physical transmission medium. Non-volatile storage media include, for example, optical or magnetic disks, such as any of the storage devices in any computer(s) or the like, such as may be used to implement the databases, etc. shown in the drawings. Volatile storage media include dynamic memory, such as main memory of such a computer platform. Tangible transmission media include coaxial cables; copper wire and fiber optics, including the wires that comprise a bus within a computer system. Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications. Common forms of computer-readable media therefore include for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD or DVD- ROM, any other optical medium, punch cards paper tape, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables or links transporting such a carrier wave, or any other medium from which a computer may read programming code and/or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.
[0112] The subject computer-executable code can be executed on any suitable device comprising a processor, including a server, a PC, or a mobile device such as a smartphone or tablet. Any controller or computer optionally includes a monitor, which can be a cathode ray tube ("CRT") display, a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display, etc.), or others. Computer circuitry is often placed in a box, which includes numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and others. The box also optionally includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements. Inputting devices such as a keyboard, mouse, or touch-sensitive screen, optionally provide for input from a user. The computer can include appropriate software for receiving user instructions, either in the form of user input into a set of parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations.
[0113] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined in the appended claims.
[0114] The present invention will be further illustrated in the following Examples which are given for illustration purposes only and are not intended to limit the invention in any way.
[0115] Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.

Claims

WHAT IS CLAIMED IS:
1. A method for recording cellular co-localization and/or spatial distributions of nucleic acid sequences and/or biomolecules tagged with a nucleic acid in non-dissociated cells or fixed tissue comprising :
(a) labeling nucleic acid sequences with unique molecular identifiers (UMFs), wherein the labeling comprises adding at least one UMI to each nucleic acid being analyzed, wherein at least one UMI identifies targeted sequences or biomolecules of interest and wherein after extraction and amplification, all reads from the targeted sequence are identified as originating from individually distinguishable sources, wherein at least one UMI identifies beacon sequences or biomolecules that are widely expressed, represented within the sample and wherein after extraction and amplification, all reads from the beacon sequence or biomolecules are identified as originating from individually distinguishable sources, wherein the labeling is random or drawn from a pool of pre-defined nucleic acid sequences, thereby generating uniquely labeled target or beacon nucleic acid sequences or biomolecules;
(b) in situ amplification of the template of nucleic acid sequences using homogenous heating of the entire sample or selective heating using directed infrared light sources to amplify only selected regions of interest;
(c) overlap-extension of two or more uniquely labeled template amplification products with at least one unique event identifier (UEI), wherein the labeling is random or drawn from a pool of pre-defined nucleic acid sequences, thereby generating uniquely labeled nucleic acid sequence-records of in situ association events;
(d) paired-end sequencing and amplification of the uniquely labeled products from
(c), and
(e) hashing sequences from (d) into bins that restrict comparisons only to feasibly similar sequence-pairs by independent clustering of UMI' s and UEFs; and
(f) inferring an image of recorded cellular co-localization and/or spatial distributions of nucleic acid sequences and/or biomolecules tagged with a nucleic acid in a non-dissociated cell.
2. The method of claim 1, wherein the nucleic acid is DNA.
3. The method of claim 2, wherein the DNA is complementary DNA (cDNA).
4. The method of claim 1, wherein the nucleic acid is RNA.
5. The method of any one of claims 1-4, wherein the cell is fixed and permeabilized.
6. The method of any one of claims 1-5, wherein the at least one UMI is a completely random or computationally designed error correcting 10 to 50 mer between a gene-specific and adapter region of a primer used for reverse transcription.
7. The method of any one of claims 1-6, further comprising concatenation amplification products of steps (b) and/or (c).
8. The method of claim 13, wherein the concatenation further comprises an additional UEI-labeling step.
9. The method of any one of claims 1-8, wherein the amplification comprises thermocycling or isothermal amplification.
10. The method of any one of claims 1-9 wherein the amplification occurs in solution, in a hydrogel, or on a solid support.
11. The method of any one of claims 7-10, wherein the concatenation comprises overlap extension polymerase chain reaction.
12. The method of any one of claims 7-10, wherein the concatenation comprises associating multiple amplification products with a ligase, recombinase, or transposase.
13. The method of any one of claims 1-12, further comprising sequencing of the nucleic acid sequences.
PCT/US2016/051164 2015-09-11 2016-09-09 Dna microscopy Ceased WO2017044893A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/554,627 US11339390B2 (en) 2015-09-11 2016-09-09 DNA microscopy methods

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562217639P 2015-09-11 2015-09-11
US62/217,639 2015-09-11

Publications (1)

Publication Number Publication Date
WO2017044893A1 true WO2017044893A1 (en) 2017-03-16

Family

ID=58240188

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/051164 Ceased WO2017044893A1 (en) 2015-09-11 2016-09-09 Dna microscopy

Country Status (2)

Country Link
US (1) US11339390B2 (en)
WO (1) WO2017044893A1 (en)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018195878A1 (en) * 2017-04-27 2018-11-01 深圳华大基因股份有限公司 Dna identifier and use thereof
WO2019210268A2 (en) 2018-04-27 2019-10-31 The Broad Institute, Inc. Sequencing-based proteomics
WO2020228788A1 (en) * 2019-05-15 2020-11-19 深圳华大生命科学研究院 Array and method for detecting spatial information of nucleic acids
SE1950648A1 (en) * 2019-06-03 2020-12-04 Di Wu Method for creating a cDNA sequencing library
EP3684949A4 (en) * 2017-09-22 2021-06-23 University of Washington IN-SITU COMBINATORY MARKING OF CELLULAR MOLECULES
EP3872190A1 (en) 2020-02-26 2021-09-01 Antibodies-Online GmbH A method of using cut&run or cut&tag to validate crispr-cas targeting
US20220033897A1 (en) * 2020-07-31 2022-02-03 Singleron Biotechnologies Inc. High throughput analysis of fixed cells
US11332736B2 (en) 2017-12-07 2022-05-17 The Broad Institute, Inc. Methods and compositions for multiplexing single cell and single nuclei sequencing
US11339390B2 (en) 2015-09-11 2022-05-24 The Broad Institute, Inc. DNA microscopy methods
EP4001429A1 (en) 2020-11-16 2022-05-25 Antibodies-Online GmbH Analysis of crispr-cas binding and cleavage sites followed by high-throughput sequencing (abc-seq)
EP3891297A4 (en) * 2018-12-03 2022-09-07 California Institute of Technology IN SITU READING OF DNA BARCODES
US11555216B2 (en) 2014-11-14 2023-01-17 University Of Washington Methods and kits for labeling cellular molecules
EP4298240B1 (en) 2021-03-30 2024-06-26 Pixelgen Technologies Ab Spatial mapping by serial primer extension
US12163189B2 (en) 2019-11-27 2024-12-10 University Of Washington Method for preparation and high-throughput microbial single-cell RNA sequencing of bacteria
US12404545B1 (en) 2019-10-28 2025-09-02 Pixelgen Technologies Ab Method for making a physical map of binding events that are on or on cells
WO2025224311A1 (en) * 2024-04-25 2025-10-30 Cubase Bio Ab Methods, uses and kits for the construction of spatial networks

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114126476B (en) 2019-04-23 2025-09-09 Encodia公司 Method for spatial analysis of proteins and related kits
WO2025240905A1 (en) 2024-05-17 2025-11-20 The Broad Institute, Inc. Imaging-free high-resolution spatial macromolecule abundance reconstruction

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8718351B2 (en) * 2003-08-15 2014-05-06 Massachusetts Institute Of Technology Systems and methods for volumetric tissue scanning microscopy
WO2015058052A1 (en) * 2013-10-18 2015-04-23 The Broad Institute Inc. Spatial and cellular mapping of biomolecules in situ by high-throughput sequencing

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120003657A1 (en) * 2010-07-02 2012-01-05 Samuel Myllykangas Targeted sequencing library preparation by genomic dna circularization
WO2014047556A1 (en) 2012-09-21 2014-03-27 The Broad Institute, Inc. Compositions and methods for long insert, paired end libraries of nucleic acids in emulsion droplets
WO2016138496A1 (en) * 2015-02-27 2016-09-01 Cellular Research, Inc. Spatially addressable molecular barcoding
WO2017044893A1 (en) 2015-09-11 2017-03-16 The Broad Institute, Inc. Dna microscopy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8718351B2 (en) * 2003-08-15 2014-05-06 Massachusetts Institute Of Technology Systems and methods for volumetric tissue scanning microscopy
WO2015058052A1 (en) * 2013-10-18 2015-04-23 The Broad Institute Inc. Spatial and cellular mapping of biomolecules in situ by high-throughput sequencing
US20160265046A1 (en) * 2013-10-18 2016-09-15 The Broad Institute Inc. Spatial and cellular mapping of biomolecules in situ by high-throughput sequencing

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12252735B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12252733B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12305220B2 (en) 2014-11-14 2025-05-20 University Of Washington Methods and kits for labeling cellular molecules
US12305221B2 (en) 2014-11-14 2025-05-20 University Of Washington Methods and kits for labeling cellular molecules
US12305219B2 (en) 2014-11-14 2025-05-20 University Of Washington Methods and kits for labeling cellular molecules
US12180536B2 (en) 2014-11-14 2024-12-31 University Of Washington Methods and kits for labeling cellular molecules
US12252737B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12252736B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12252734B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12247248B2 (en) 2014-11-14 2025-03-11 University Of Washington Methods and kits for labeling cellular molecules
US12247247B2 (en) 2014-11-14 2025-03-11 University Of Washington Methods and kits for labeling cellular molecules
US11555216B2 (en) 2014-11-14 2023-01-17 University Of Washington Methods and kits for labeling cellular molecules
US11639519B1 (en) 2014-11-14 2023-05-02 University Of Washington Methods and kits for labeling cellular molecules
US12227793B2 (en) 2014-11-14 2025-02-18 University Of Washington Methods and kits for labeling cellular molecules
US11634751B2 (en) 2014-11-14 2023-04-25 University Of Washington Methods and kits for labeling cellular molecules
US12195786B2 (en) 2014-11-14 2025-01-14 University Of Washington Methods and kits for labeling cellular molecules
US12043864B2 (en) 2014-11-14 2024-07-23 University Of Washington Methods and kits for labeling cellular molecules
US11987838B2 (en) 2014-11-14 2024-05-21 University Of Washington Methods and kits for labeling cellular molecules
US11339390B2 (en) 2015-09-11 2022-05-24 The Broad Institute, Inc. DNA microscopy methods
WO2018195878A1 (en) * 2017-04-27 2018-11-01 深圳华大基因股份有限公司 Dna identifier and use thereof
US12252731B2 (en) 2017-09-22 2025-03-18 University Of Washington In situ combinatorial labeling of cellular molecules
US11680283B2 (en) 2017-09-22 2023-06-20 University Of Washington In situ combinatorial labeling of cellular molecules
EP4421183A3 (en) * 2017-09-22 2024-11-27 University of Washington In situ combinatorial labeling of cellular molecules
US12371735B2 (en) 2017-09-22 2025-07-29 University Of Washington In situ combinatorial labeling of cellular molecules
EP3684949A4 (en) * 2017-09-22 2021-06-23 University of Washington IN-SITU COMBINATORY MARKING OF CELLULAR MOLECULES
US12252730B2 (en) 2017-09-22 2025-03-18 University Of Washington In situ combinatorial labeling of cellular molecules
US12234501B2 (en) 2017-09-22 2025-02-25 Universty Of Washington In situ combinatorial labeling of cellular molecules
US11332736B2 (en) 2017-12-07 2022-05-17 The Broad Institute, Inc. Methods and compositions for multiplexing single cell and single nuclei sequencing
WO2019210268A2 (en) 2018-04-27 2019-10-31 The Broad Institute, Inc. Sequencing-based proteomics
EP3891297A4 (en) * 2018-12-03 2022-09-07 California Institute of Technology IN SITU READING OF DNA BARCODES
US12516373B2 (en) 2018-12-03 2026-01-06 California Institute Of Technology In situ readout of DNA barcodes
US12516446B2 (en) 2019-05-15 2026-01-06 Bgi Shenzhen Array and method for detecting spatial information of nucleic acids
CN114207105A (en) * 2019-05-15 2022-03-18 深圳华大生命科学研究院 Array for detecting nucleic acid spatial information and detection method
WO2020228788A1 (en) * 2019-05-15 2020-11-19 深圳华大生命科学研究院 Array and method for detecting spatial information of nucleic acids
US12577559B2 (en) 2019-06-03 2026-03-17 Di Wu Method for creating a cDNA sequencing library
SE543469C2 (en) * 2019-06-03 2021-03-02 Di Wu Method for creating a cDNA sequencing library
SE1950648A1 (en) * 2019-06-03 2020-12-04 Di Wu Method for creating a cDNA sequencing library
US12404545B1 (en) 2019-10-28 2025-09-02 Pixelgen Technologies Ab Method for making a physical map of binding events that are on or on cells
US12163189B2 (en) 2019-11-27 2024-12-10 University Of Washington Method for preparation and high-throughput microbial single-cell RNA sequencing of bacteria
EP3872190A1 (en) 2020-02-26 2021-09-01 Antibodies-Online GmbH A method of using cut&run or cut&tag to validate crispr-cas targeting
US20220033897A1 (en) * 2020-07-31 2022-02-03 Singleron Biotechnologies Inc. High throughput analysis of fixed cells
EP4001429A1 (en) 2020-11-16 2022-05-25 Antibodies-Online GmbH Analysis of crispr-cas binding and cleavage sites followed by high-throughput sequencing (abc-seq)
US12416040B2 (en) 2021-03-30 2025-09-16 Pixelgen Technologies Ab Spatial mapping by serial primer extension
EP4298240B1 (en) 2021-03-30 2024-06-26 Pixelgen Technologies Ab Spatial mapping by serial primer extension
WO2025224311A1 (en) * 2024-04-25 2025-10-30 Cubase Bio Ab Methods, uses and kits for the construction of spatial networks

Also Published As

Publication number Publication date
US20180187183A1 (en) 2018-07-05
US11339390B2 (en) 2022-05-24

Similar Documents

Publication Publication Date Title
US11339390B2 (en) DNA microscopy methods
EP3058091B1 (en) Spatial and cellular mapping of biomolecules in situ by high-throughput sequencing
US20230323426A1 (en) Single cell whole genome libraries and combinatorial indexing methods of making thereof
US12529092B2 (en) In-situ spatial transcriptomics
US12123056B2 (en) Surface concatemerization of templates
EP3737774B1 (en) Method for analyzing nucleic acid
KR102628035B1 (en) Single cell whole genome library for methylation sequencing
US9944924B2 (en) Polynucleotide modification on solid support
US8778609B1 (en) Methods for analyzing nucleic acids
JP6789935B2 (en) Sequencing from multiple primers to increase the speed and density of the data
US20220042097A1 (en) In-situ spatial transcriptomics and proteomics
HK40046037B (en) Surface concatamerization of templates
NZ749719B2 (en) Single cell whole genome libraries and combinatorial indexing methods of making thereof
HK40046037A (en) Surface concatamerization of templates
HK40002427B (en) Single cell whole genome libraries and combinatorial indexing methods of making thereof
HK40002427A (en) Single cell whole genome libraries and combinatorial indexing methods of making thereof
HK1244846B (en) Surface concatamerization of templates

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16845225

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16845225

Country of ref document: EP

Kind code of ref document: A1