WO2017011618A1 - Targeted nanoparticle conjugate and method for co-delivery of sirna and drug - Google Patents

Targeted nanoparticle conjugate and method for co-delivery of sirna and drug Download PDF

Info

Publication number
WO2017011618A1
WO2017011618A1 PCT/US2016/042191 US2016042191W WO2017011618A1 WO 2017011618 A1 WO2017011618 A1 WO 2017011618A1 US 2016042191 W US2016042191 W US 2016042191W WO 2017011618 A1 WO2017011618 A1 WO 2017011618A1
Authority
WO
WIPO (PCT)
Prior art keywords
sirna
antibody
drug
cancer
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/042191
Other languages
French (fr)
Inventor
Raghuraman Kannan
Srikar Raman
Anandhi UPENDRAN
Dhananjay SURESH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Missouri Columbia
University of Missouri St Louis
Original Assignee
University of Missouri Columbia
University of Missouri St Louis
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Missouri Columbia, University of Missouri St Louis filed Critical University of Missouri Columbia
Priority to US15/743,892 priority Critical patent/US10426842B2/en
Publication of WO2017011618A1 publication Critical patent/WO2017011618A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6807Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • A61K31/53771,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • a field of the invention is nanomaterials.
  • Example applications of the invention include in vivo treatments, including therapy of human cancer.
  • siRNA small interfering RNA
  • Antibodies that bind to specific biomarkers in the cell and also aide in retaining the stability of siRNA provide a partial solution for stable delivery, however they fail to deliver siRNA effectively to cytoplasm of the infected cells.
  • siRNA Small interfering RNA
  • a knockdown of an oncogene merely silences the gene of interest, and consequently facilitates the affected cancer cells to adapt and adopt a different pathway of survival.
  • a molecule complementing the siRNA for inducing inclusive toxicity needs to be delivered simultaneously and at appropriate proportions to the infected cells where the siRNA is delivered.
  • the essential parameters that govern effective delivery of siRNA can be categorized into (1) stability of siRNA, (2) targeting the siRNA, (3) effective gene silencing, and (4) cytotoxicity and off-target effects.
  • siRNA delivery Mirkin and co-workers reported AuNP functionalized with oligoethylene glycol-siRNA.
  • the conjugate showed specific and higher knockdown of luciferase in HeLa cells compared to transfection with lipofectamine. Subsequent induction of cytotoxins and cellular response was not a part of the study.
  • siRNA-antibody conjugates using
  • THIOMAB THIOMAB with various sets of antibodies and cell lines for targeted gene silencing.
  • Non-Small Cell Lung Cancer (NSCLC) NSCLC is diagnosed in an estimated 220,000 patients each year with five-year overall survival rates of 16 percent.
  • siRNA Short interfering RNA
  • siRNA is a well-known approach for effecting gene therapy to provide subsequent sensitization towards complementary therapeutic agents.
  • stable delivery of siRNA is a significant challenge due to its high degradation rate in the presence of serum proteins and enzymes.
  • nanoparticle-based carrier systems include retroviral vectors, liposomes, polymeric, and metallic nanop articles.
  • the physicochemical and surface properties of the particle were modified for delivering the siRNA to cytoplasm of the infected cells.
  • these nanoparticles suffer from serious limitations such as stability issues during synthesis, premature release in serum, inefficient endosomal escape, and interferon response.
  • oncogene knockdown alone has less impact on the cancer cell apoptosis since the cells tend to adopt another effector pathway for survival. Therefore, a need for complementary drug for initiating the apoptosis post knockdown is needed.
  • Cancer cells have several parallel working pathways, with one primary effector pathway coupled to several parallel effector pathways. The parallel pathways remain dormant until the working pathway is disrupted. Change in the protein expression levels upon knock down of oncogene present in the primary pathway results in change of downstream protein and gene expression levels regulated by complex cellular mechanism.
  • KRAS mutant adenocarcinoma of NSCLC remains undruggable. While mutations occur at variation position of KRAS, oncogenic effect at codon 12 (Glycine- 12 to Cysteine, G12C) of KRAS is the most commonly occurring mutation and yet to receive a dedicated drug. Although, in recent times, few attempts have been made for targeting G12C mutation through a small molecule inhibitor, RNAi therapy is emerging as a promising tool that could be applied across all types of mutations supplemented with currently approved drugs.
  • the present inventors have determined that depending on siRNA delivery through physical mixtures, electrostatic interaction of carrier vehicle and siRNA is not very effective.
  • the low effectiveness can be attributed to the lack of definitive structural properties, and also possibly due to agglomeration of particles.
  • retroviral vector strategy for the delivery of siRNA.
  • a retroviral vector carrying siRNA and functionalized with a targeting agent such as an antibody for targeting specific biomarkers is a synthetic challenge and has not been reported to this date to our knowledge.
  • a targeting agent such as an antibody for targeting specific biomarkers
  • ensuring the cytotoxin (such as for example, gefitinib) internalizes within all the cells altered by siRNA at appropriate relative proportions is difficult.
  • An off-target interferon response due to retroviral vector might also create an issue for clinical translation.
  • AXL receptor which is overexpressed in various types of cancers.
  • the AXL overexpression by some cancer cells has been reported in literature as a cause of cancer cells resistance to EGFR-targeting therapy.
  • AXL TAM receptor tyrosine kinase family; 140 kDa
  • AXL is linked to cancer proliferation, migration and cause the subsequent resistance to small molecule tyrosine kinase inhibitors.
  • AXL is also known to affect the PI3/Akt signaling pathways and induce a mutation in EGFR as a tyrosine kinase switch.
  • a nanoparticle conjugate comprising a small interfering RNA (siRNA) linked to an antibody that is bonded to the surface of a gelatin nanoparticle that physically encapsulates a drug.
  • This conjugate delivers the drug and siRNA simultaneously and selectively to a targeted cell, such as a cancer cell.
  • one end of siRNA may be coupled to an epidermal growth factor receptor (EGFR) targeting monoclonal antibody via a thio-ether bond, and a lysine functional group present on the antibody is bridged with carboxyl groups present on the gelatin nanoparticle.
  • the drug may comprise a tyrosine kinase inhibitor drug.
  • Some conjugates comprisecisplatin, oxaliplatin, gefitinib or erlotinib.
  • the siRNA may be a siRNA specific to mutant KRAS or siRNA specific to AXL.
  • Some conjugates comprise siRNA comprising 5'-GUUGGAGCUUGUGGCGUAGUUUU-3' (SEQ ID NO. 1) annealed with 5'- AACUACGCCACAAGCUCCAACUU-3' (SEQ ID NO. 2).
  • Some conjugates comprise siRNA comprising 5'- GGAACUGC AUGCUGAAUGAUU-3 ' (SEQ ID NO. 3) annealed with 5'-UCAUUCAGCAUGCAGUUCCUU-3' (SEQ ID NO. 4).
  • Methods of forming the nanoparticle conjugate comprise encapsulating the drug in the gelatin nanoparticle, bonding the antibody to the surface of the gelatin nanoparticle, and linking the siRNA to the antibody via a thio-ether bond.
  • Methods of disease treatment comprise adminstering to a patient a nanoconjugate comprising a small interfering RNA (siRNA) linked to an antibody bonded to the surface of a gelatin nanoparticle which encapsulates a drug.
  • the nanoconjugates can be used for treating cancer, including metastatic cancer.
  • Various cancers can be treated, including non-small lung carcinoma, brain tumor, colon cancer, head and neck cancer, prostate cancer, breast cancer or stomach cancer.
  • a patient is administered the nanoconjugate in which the drug is gefitinib, the antibody is EGFR-targeting antibody CETUXIMABTM and the siRNA comprises the oligonucleotide with SEQ ID NO. 1 annealed with the oligonucleotide with SEQ ID NO. 2.
  • the drug is gefitinib
  • the antibody is EGFR-targeting antibody CETUXIMABTM
  • the siRNA comprises the oligonucleotide with SEQ ID NO. 1 annealed with the
  • Fig. 1 is a schematic diagram of nRAGeD comprising a gelatin nanoparticle as a carrier.
  • the surface of the gelatin nanoparticle is functionalized with an antibody.
  • siRNA is covalently attached to the antibody via the thio-ether link.
  • the core of the gelatin nanoparticle contains a drug.
  • Fig.2A is a schematic representation of the TBN nanoconjugate consisting of a gelatin nanoparticle encapsulating gefitinib and surface functionalized with
  • Fig. 2B is a TEM image of gelatin
  • Fig. 2C is a TEM image of the TBN nanoconjugates.
  • Fig. 3 is a schematic diagram of the nRAGeD synthesis.
  • Fig. 4 is a graph reporting a hydrodynamic size of 200 ( ⁇ 10) nm for nRAGeD, as determined by the dynamic light scattering method using Malvern Zetasizer Nano ZS.
  • Fig. 5 reports a zeta potential for Gelatin NP (Gel NP) nanoparticles, an antibody functionalized Gelatin NP (Ab-Gel NP) nanoparticles, and nRAGeD (si-Ab- GelNP), determined by using Malvern Zetasizer Nano ZS.
  • Fig. 6 reports a change in the zeta potential upon surface functionalization and siRNA addition in nRAGeD.
  • Figs. 7A - 7C are TEM images of gelatin nanoparticles (Fig. 7A), antibody functionalized gelatin nanoparticles (Fig. 7B) and nRAGeD (Fig. 7C).
  • Figs. 8A-8C reprot siRNA loaded on nRAGeD by visual observation of a significant increase of the amount of siRNA labeled with Cy5 on nRAGeD (Fig. 8C) in comparison to siRNA solution (Fig. 8A) and Ab-Gel-nanoparticles (Fig. 8B).
  • Figs. 9A-9C are stability assays for nRAGeD.
  • Fig. 9A is a SDS-PAGE of the time related serum stability analysis.
  • Fig. 9B is a 30-day storage stability analysis of nRAGeD stored at -50°C.
  • Fig. 9C is an in vitro stability study of nRAGeD as analyzed by a hydrodynamic size in biological media.
  • Fig. 10 is florescence microscopy images of H23 cancer cells incubated with nRAGeD (Gel F iAb-siRNAcy5) or its analogues Gel F iAb-siRNA, Gel-Abcy5-siRNA, Gel-Ab-siRNAcy5, siRNAcy 5 and Abc y5 .
  • DAPI was used as a nuclear staining marker. Fluorescein is incorporated into nanoparticles. Cy5 is used for labelling an antibody and siRNA.
  • Fig. 11 is a flow cytometry analysis showing nRAGeD (siRNA- Ab-GelNP) is internalized by cancer cells almost 2 folds better as compared to transfected naked siRNA.
  • Figs. 12A is a Western blot analysis of protein expression in cancer cells treated with nRAGeD.
  • Fig. 12B is a densitometry analysis of the data from Fig. 12A.
  • Fig. 13 is a Western blot analysis for phosphorylated forms of pGABl (Y627) and pGABl (Y307).
  • Figs. 14A is a Western blot analysis of SHP2 protein and its phosphorylated forms.
  • Fig. 14B is a densitometry analysis of the Western blot of Fig. 14A.
  • Fig. 15 reports the MTT dose concentration of nanoparticles and its various analogues used for the in vitro toxicity in lung cancer cells.
  • Fig. 16 is an in vitro toxicity report for lung cancer cells treated with nRAGeD.
  • Fig. 17 is an in vitro cellular viability data after treatment with nRAGeD or control compositions.
  • Fig. 18 reports a synergistic effect of nRAGeD on decreasing the cell viability of cancer cells.
  • Fig. 19 reports in vitro cellular viability of cancer cells with KRAS G12C mutation transfected with mock siRNA followed by treatment with gefitinib.
  • Fig. 20 reports in vitro cellular viability of cancer cells with KRAS G12S mutation treated with nRAGeD carrying RAS G12C si-RNA.
  • Figs. 22A and 22B report an RT-PCR analysis for DUSP6 and NT5E in cancer cells treated with nRAGeD.
  • Fig. 23 is a schematic depicting the mechanism by which nRAGeD may bind to a cell surface receptor and then be internalized by the cell.
  • Figs. 24A-24C are a schematic depicting the effect of siRNA and gefitinib on the downstream protein regulation mechanism.
  • Fig. 24A shows the pathway in cancer cells with mutated RAS.
  • Fig. 24B shows the disruption of the RAS signaling pathway by siRNA.
  • Fig. 24C shows the further impediment of the cancer cells by gefitinib.
  • nRAGeD (abbreviated from "RNA -Antibody-Gelatin-Drug Nanoconjugate") and which comprises a small interfering RNA (siRNA) linked to an antibody that is bonded to the surface of a gelatin nanoparticle that physically encapsulates a drug.
  • the nRAGeD generally 10, comprises a gelatin nanoparticle (1) which encapsulates a drug (2) in the core (3) of the gelatin nanoparticle (1).
  • An antibody (4) is bonded to the surface of the gelatin particle (1).
  • the antibody (4) is covalently linked to a siRNA (5) by the thio-ether bond.
  • the nRAGeD nanoconjugate can be used as a drug for treating various diseases, including cancer, and in particular a metastatic cancer.
  • the nRAGeD can be also used in other treatment applications where it is desirable to deliver a drug selectively to a particular set of cells.
  • Suitable antibodies include monoclonal and polyclonal antibodies.
  • a humanized monoclonal antibody or its functional fragment is particularly preferred.
  • One suitable antibody includes an antibody specific to human Epithelial Growth Factor Receptor (EGFR).
  • EGFR Epithelial Growth Factor Receptor
  • One particularly preferred antibody is EGFR specific chimeric (mouse/human) monoclonal antibody available under the tradename CETUXIMABTM from Merck.
  • anticancer drugs such as platinum-based drugs, including cisplatin and oxaliplatin.
  • anticancer drugs such as platinum-based drugs, including cisplatin and oxaliplatin.
  • Two drugs that are particularly preferred are gefitinib (ZD 1839, N-(3-chloro-4-fluoro-phenyl)-7-methoxy-6-(3- morpholin-4-ylpropoxy)quinazolin-4-amine) and erlotinib hydrochloride (N-(3- ethynylphenyl)-6,7-bis(2-methoxyethoxy) quinazolin-4-amine).
  • siRNAs are suitable, including siRNA specific to a gene whose expression is upregulated in cancer cells.
  • Suitable siRNA are double-stranded RNA molecules, 20-25 base pairs in length with a sequence complementary to a gene whose transcription needs to be silenced.
  • Suitable siRNAs include those that selectively interfere with expression of genes mutated and/or overexpressed in cancer cells.
  • siRNAs specific to mutant KRAS including human KRAS with a point mutation in codon 12.
  • a particularly preferred KRAS siRNA is specific to KRAS with a point mutation G12C.
  • These siRNAs include the KRAS G12C siRNA obtained by annealing together sense oligonucleotide comprising, consisting essentially of or consisting of 5'-GUUGGAGCUUGUGGCGUAGUUUU-3' (SEQ ID NO. 1) with an antisense oligonucleotide comprising, consisting essentially of or consisting of 5'-AACUACGCCACAAGCUCCAACUU-3' (SEQ ID NO. 2).
  • SEQ ID NO. 1 can be modified with a disulfide (S-S) moiety.
  • siRNAs include the AXL siRNA obtained by annealing together sense oligonucleotide
  • oligonucleotide comprising, consisting essentially of or consisting of 5'- UCAUUCAGCAUGCAGUUCCUU-3' (SEQ ID NO. 4).
  • the 5' guanine in the oligonucleotide with SEQ ID NO. 3 can be modified with a disulfide (S-S) moiety.
  • S-S disulfide
  • Various gelatin types are suitable for obtaining the nanoparticle. A person of skill will understand that gelatin is a mixture of peptides and proteins produced by partial hydrolysis of collagen from different sources, such as for example pork skin and fish. The strength of gelatin is measured in "bloom.” Preferably, gelatin of 200 to 300 bloom is suitable for making the nRAGeD nanoconjugate. Gelatin 300 bloom is particularly preferred.
  • nRAGeD nanoconjugate It is suitable for delivery of drugs to a particular population of cells without affecting other cells. This may be useful for delivering drugs that may be otherwise toxic or are unstable. For example, many cancer drugs which are highly efficient in eliminating cancer cells are also toxic to a patient. However, delivering such a drug tackled away in the core of the nRAGeD nanoconjugate specifically to cancer cells avoids or minimizes the damage to other non-cancer cells in a patient. Another technical advantage is the nRAGeD provides a highly efficient delivery for siRNA which otherwise degrade easily in the blood stream before reaching cells targeted for treatment.
  • the nRAGeD nanoconjugate provides a vehicle in which siRNA is protected from degradation.
  • the nRAGeD is a platform which delivers several drugs simultaneously to a cell targeted for treatment. This provides a particular advantage in cancer treatment where certain cancer cells, such as for example, cancer cells with mutated KRAS, are known to switch on an alternative survival pathway in response to a first anti-cancer drug that would otherwise sentence the cancer cell to apoptosis. Thus, a patient has to be treated with a second drug.
  • the nRAGeD nanoconjugate is useful for treating various cancer diseases, including non-small lung carcinoma, colon cancer, head and neck cancer, prostate cancer and breast cancer.
  • the suitable nRAGeD nanoconjugates include a gelatin nanoparticle (GelNP) encapsulating gefitinib (GelGEFNP).
  • the surface of the GelGEFNP nanoconjugate is functionalized with EGFR targeting antibody CETUXIMABTM which is conjugated to KRAS G12C specific siRNA such as for example, a duplex between the oligonucleotide with SEQ ID NO. 1 and the oligonucleotide with SEQ ID NO. 2, as shown in Figure 2A and referred to as the TBN nanoconjugate in Figure 2A.
  • An electronic microscope micrograph of the TBN nanoconjugate is shown in Figure 2C, while an electronic microscope micrograph of gelatin nanoparticles is shown in Figure 2B.
  • the TBN nanoconjugate is useful for treating various cancer diseases, including non-small lung carcinoma, colon cancer, head and neck cancer, prostate cancer and breast cancer.
  • Preferred embodiments also provide in vivo treatment methods.
  • the methods include adminsitering a nanoparticle conjugate, aslo referrred to as a nanoconjugate, of the invention for treatment of a disease to a patient.
  • the treatement can be a cancer treatement.
  • Various cancers can be treated with nRAGeD
  • nanoconjugates including non-small lung carcinoma, brain tumors, colon cancer, head and neck cancer, prostate cancer, breast cancer and stomach cancer.
  • Preferred nanoparticle conjugates of the invention provide for stable and targeted delivery of siRNA to diseased sites and also provide for transport of siRNA to the cell cytoplasm for effective gene therapy.
  • the siRNA is protected by antibodies on one side and a protein or polymeric nanoparticle on the other side that is capable of carrying its own payload within the core and deliver the ingredients to the cytoplasm of cells.
  • Preferred embodiments use gelatin nanoparticles that include an encapsulated drug, gefitinib.
  • an encapsulated drug gefitinib.
  • CETUXIMABTM an epidermal growth factor receptor (EGFR) targeting monoclonal antibody via a highly stable thio-ether bond.
  • a lysine functional group present on the antibody is bridged with carboxyl groups present on the gelatin nanoparticles.
  • the antibody and gelatin nanoparticles act as two protective layers of a sandwich, between which resides the siRNA.
  • a tyrosine kinase inhibitor drug, gefitinib is encapsulated within the core of each gelatin nanoparticle. The resulting nanocomplex delivers siRNA and drug at predetermined relative proportions for effective gene knockdown and concomitant cytotoxicity.
  • siRNA-antibody-gelatin-gefitinib nanoparticle platform concerns converting undruggable KRAS mutant cells to gefitinib sensitive cells by knocking down the KRAS oncogene. Upon the knockdown of KRAS oncogene, the cells adopt another effector pathway for survival that is responsible for sensitization towards gefitinib. Test results suggest a new modus-operandi for stable and targeted delivery of siRNA and drug for oncogene knockdown, gene therapy and drug delivery.
  • Preferred embodiment nanoparticle conjugates utilize a charge-reversible protein nanoparticles that comprise a physically encapsulated drug in the core and an antibody conjugated on the surface.
  • the siRNA of interest is linked to the surface conjugated antibody via a thio-ether bond to form an antibody-siRNA conjugate.
  • GelNPs can be prepared via a two-step desolvation process of a gelatin solution as shown in Figure 3. GelNPs can then be used to encapsulate a small molecule tyrosine-kinase inhibitor (TKI), gefitinib, or any other drug of choice. The resulting GelGEFNP nanoparticle can then be then used for binding antibody CETUXIMABTM or some other antibody or an antibody fragment via a lysine functional group present on the antibody with carboxyl groups present on the surface of gelatin nanoparticles.
  • TKI small molecule tyrosine-kinase inhibitor
  • lysine residues of the antibody can be then modified with thiol- siRNAKR by using NHS-Maleimide linker molecule (sulfo-SMCC) to obtain the final construct, RNA-Antibody-Gelatin-Drug Nanoconjugate (nRAGeD).
  • sulfo-SMCC NHS-Maleimide linker molecule
  • nRAGeD RNA-Antibody-Gelatin-Drug Nanoconjugate
  • Gelatin is specifically chosen as the carrier system for enzyme-triggered release of the constituents.
  • nRAGeD is a platform for targeted cell-specific delivery of a combination of siRNA and a drug for concomitant siRNA mediated oncogene knockdown and drug mediated cytotoxicity.
  • Preferred methods provide for the synthesis and characterization of nRAGeD to (i.) showcase its charge-reversal property, (ii.) demonstrate its ability to knock-down KRAS oncogene, and (iii.) convert un-druggable cells to drug sensitive and co-localize various constituents of the construct within the cells of interest. Also, without wishing to be bond by the theory, two probable intra-cellular delivery mechanisms of action for nRAGeD are idetnified and described.
  • nRAGeD begins by preparing a gelatin solution.
  • Gelatin nanoparticles (GelNP) are then produced by a two-step desolvation.
  • Gelatin particles can be loaded with a drug (not shown in Figure 3) during the second desolvation step.
  • Gelatin nanoparticles are then functionalized with an antibody Ab, resulting in Ab-Gel-NP nanoconjugate.
  • the lysine groups of the Ab are then reacted with sulfo- SMCC to generate a reactive maleimide end to which siRNA is then conjugated with thiol-maleimide link to form a nanoconjugate carrying siRNA and also a drug if the drug was incapsulated into a gelatin nanoparticle.
  • nRAGeD dispersed in deionized (DI) water have an average hydrodynamic diameter of 210 ⁇ 10 nm with a PDI less than or equal to 0.1.
  • the size of GelNPs with encapsulated gefitinib Gel(Gef) NPs remains the same and no significant increase in size is observed in comparison to gelatin nanoparticles not loadead with a drug.
  • siRNA delivery is a major hurdle for clinical translation. Not only is the encapsulation of siRNA within polymers or liposomes without degrading the siRNA during nanoparticle preparation is synthetically
  • siRNA-NP preparation availability of siRNA to the cells of interest for effective knockdown of concerned gene is governed by various factors which are difficult to predict or determine.
  • a direct exposure of siRNA to the surrounding environment by mere surface functionalization of siRNA on surface of the nanoparticles without an antibody leads to its rapid degradation by serum.
  • nRAGeD nanoconjugates overcome these challenges and protect siRNA from serum degradation without exposing siRNA to harsh chemical synthetic procedures of encapsulation.
  • an antibody is displayed on the surface of GelNPs is used for protecting siRNA from degradation.
  • the size and molecular weight of GelNPs (200nm) and antibody (152 KDa) is relatively very high compared to siRNA (14KDa).
  • siRNA functionalized to the antibody enables a stable and covalently attached sandwich system wherein the siRNA is embedded between GelNP and and an antibody.
  • siRNA incorporation to the nRAGeD nanoconjugate being the last step of synthetic procedure can be carried out in RNAse free water without subjection to harsh chemical methods, ensures degradation-free siRNA within the nanocomplex.
  • the pre-mature release of siRNA can be discounted for such systems since siRNA is not physically entrapped or coated.
  • siRNA chemically linked to nRAGeD via an antibody remains highly stable in blood serum with only a minimal degradation after 24 hours of serum exposure (Figure 9A).
  • Figure 9B there is only a minimum degradation after 30 days of storage at -50°C.
  • Fig. 9C no siginicant variation in hydrodynamic size was observed after nRAGeD nanoconjugates were exposed to a biological media up to 24 hours.
  • nRAGeD is effective as a siRNA delivery system.
  • nRAGeD suppresses efficently mutant KRAS and the RAS pathway in cancer cells.
  • treating cancer cells with nRAGeD which delivers to the cells gefitinib together with the KRAS G12C siRNA decreases the cell viability down to 5% in comparison to treating cells with the KRAS G12C siRNA first, followed by a separate treatment with gefitinib, where the cell viability is at 25%.
  • the combined treatment as delivered by nRAGeD has a synergistic effect.
  • the synergistic effect of nRAGeD in decreasing the viability of cancer cells is further supported by cell viability results shown in Figures 17, 18 and 19.
  • the nanoparticle conjugates of preferred emobdiments with siRNA conjugated to an antibody functionalized on the surface of a gelatin nanoparticle carrying a small molecule tyrosine kinase inhibitor or some other drug protects siRNA from degradation and targets delivery of siRNA to cells which display a biomarker selected for targeting.
  • Furthemore, the gelatin nanoparticles, used as the carrier system enable concomitant delivery of a drug within the cells of interest and target.
  • the platform allows loading predetermined and proportional amounts of an antibody, siRNA and drug within the carrier for effective targeting and high bioavailability to provide gene and combinational therapy.
  • the make up of an nRAGeD nanoparticle can be easily modified as per patient's needs wherein the siRNA, antibody and/or the encapsulated drug can be selected based on the nature and status of cancer in each individual patient.
  • a cancer treatment with nRAGeD may comprise an intravenous administration, where an nRAGeD nanoparticle is adminstered daily in a concentration ranging from 20 mg/kg of the patient's body weight to 250 mg/kg of the patient's body weight for a period of several days, typically from 3 to 6 days. A patient can then be monitored and tested for a decrease in cancer cells.
  • the nRAGeD treatment can be repeated in several rounds, each of the rounds comprising several concecutive days of administration. Under some treatment plans, a patient can be treated with about 100 mg of the nRAGeD nanoconjugate per day, for a total of 5 days.
  • Further treatment plans may include testing a patient to identify whether the patient's cancer cells express mutated KRAS and/or AXL. Suitable tests may include sequencing, PCR, quantitative real time PCR and/or protein anaysis. Based on the test results, a treatment plan may include synthesizing an si-RNA molecule specific for the type of a mutation identified in the patient, followed by preparing an nRAGeD
  • nRAGeD specificly designed for the patient's cancer cells.
  • nRAGeD may affect proteins in the RAS/RAF/MEK/ERK cascade.
  • quantitative real time PCR was performed to examine dual specificity phosphatase 6 (DUSP6) and CD73 gene expression levels.
  • DUSP6 is an important feedback loop as it exhibits antitumor profile through negative feedback regulation. An effect on the signaling cascade, therefore, must have an effect on DUSP6 levels.
  • transfected siRNA and nRAGeD cells showed downregulation of DUSP6 upon knockdown.
  • the RF values of DUSP6 post knockdown determined using real time qPCR for nanoparticle correlated well with that of transfected siRNA and was determined to be 0.17 and 0.1 for nRAGeD and siRNA respectively.
  • Ab-GelGEFNP devoid of siRNA showed the RF value of 0.73 indicating minimal or no effect on the gene regulation.
  • NT5E or CD73 is a predictive biomarker for overall patient's survival and progression free survival in patients harboring KRAS wild type or a KRAS mutation.
  • the inventors observe a significant increase in the CD73 expression levels for cancer cells treated with nRAGeD and no change for cancer cells transfected with siRNA or treated with Ab-GelGEFNP devoid of siRNA.
  • the CD73 RF value for cells treated with TBN was determined to be 3.64 compared to 1.07 and 0.95 for siRNA and Ab-GelGEFNP with no siRNA respectively, as shown in Figure 22B which reports the RF values determined by quantitative real time PCR indicates up regulation of NT5E gene expression for the H23 cells treated with TBN.
  • Cells treated with siRNA or CETUXIMABTM functionalized gelatin nanoparticles showed minimal or no change in expression levels compared to the untreated cells.
  • the increase in CD73 expression levels may be attributed to the presence of both siRNA and CETUXIMABTM in aRAGeD.
  • nRAGeD enters cells using a receptor mediated endocytosis and stays in endosomal vehicle. Subsequently, nRAGeD is released from endosomes, possibly due to the proton sponge effect to the cytosol. In the cytosol, siRNA forms the RISC complex and successfully knocks down mutant KRAS.
  • the inventors synthesized a targeted nRAGeD as an effective siRNA delivery system which can sensitize the KRAS mutant tumor cells to gefitinib if KRAS siRNA is used in nRAGeD.
  • Camouflaging siRNA between gelatin and antibody molecules in nRAGeD increases the stability of the siRNA. Indeed, serum stability and cytoplasmic delivery of siRNA present within nRAGeD are attributed to the synergistic effect of both Gel NP and an antibody.
  • the release of encapsulated gefitinib from nRAGeD primarily governed by degradation of gelatin matrix of the nanoparticle.
  • RISC RNA-induced silencing complex
  • nRAGeD Treatment with nRAGeD results in downregulation of pMEK present in the RAS pathway. In comparison with untreated cells, the relative down regulation of pMEK is found to be at least 2 times lower when we used nRAGeD.
  • Gel NP without siRNA has no effect on pMEK, thereby proving that knocking down the KRAS oncogene effectively decreases the RAS functioning pathway.
  • the RAS/MEK/ERK pathway is closely associated to PI3K/AKT pathway.
  • GABl Grb2 associated binder- 1
  • PI3K and GABl share intrinsic association via tyrosine domain phosphorylation of GABl on SHP2 binding motifs.
  • SHP2 negatively regulates PI3K activation through dephosphorylation of GABl phosphotyrosinases facilitating the activation of RAS for certain cases.
  • activated ERK results in phosphorylation of GABl (Grb2 associated binder 1) on serine and threonine residues adjacent to p85 PI3K binding sites and the nature of signaling dictates regulation levels of GAB-p85 PI3K complexes to control PI3K activity.
  • GABl Grb2 associated binder 1
  • HGF is highly expressed in the case of H23 cells strengthens our claims that ERK induces positive regulation of GAB 1 for associating with P85-PI3K via HGF mediation under normal conditions, disruption of which deactivates the PI3K/AKT pathway.
  • SHP2 is activated by complexing with phosphorylated GAB 1 that binds with EGFR through Grb2.
  • Tyr 627 domain is one of the predominant domains of pGABl wherein the complexing occurs.
  • Western blot results indicate an increase in the pGAB 1 (Tyr 627) after oncogene knockdown by TBN supporting our hypothesis that knockdown of KRAS oncogene arrests the MEK/ERK pathway, triggering a feedback loop wherein GAB1 dephosphorylation on serine and/or threonine residues occur, resulting in abrogation of AKT activity.
  • the stimulation cascades to phosphorylation at tyrosine domains of GAB 1 that induces association of GAB 1 to EGFR through SHP2 recruitment. It is thus possible that the adopted effector pathway of survival post oncogene knockdown is governed through EGFR downstream signaling via disrupted MAPK pathway. It is noteworthy to mention that SHP2 regulation has intrinsic relation with tyrosine kinase inhibitors.
  • Transfected siRNA may serve as a positive control in terms of oncogene knockdown but a negative control for EGFR blocking.
  • a nanoparticle without siRNA may serve as a positive control for EGFR blocking and as a negative control for oncogene knockdown. Understanding the effect of CETUXIMABTM may further explain the underlying mechanism.
  • DUSP6 is a cytoplasmic gene that plays a pivotal role in the spatiotemporal mechanism of ERK signaling.
  • the downregulation of DUSP6 is possibly due to inhibition of ERK based on several negative feedback mechanisms. Indeed, siRNA mediated knockdown affects the ERK pathway leading to the regulation of cytoplasmic genes.
  • siRNA mediated knockdown affects the ERK pathway leading to the regulation of cytoplasmic genes.
  • the effect of EGFR signaling on the gene regulation levels post oncogenic loss need to be monitored.
  • CD73 is a 70 kDa cell surface protein that plays an important role in physiology and pathophysiology of cells. CD73 expression levels remain unchanged with siRNA knockdown mediated by routine transfection as well as for cells transfected with Ab-GelGEFNP with and without siRNA. The result is in agreement with those obtained through protein regulation studies, since the mere knockdown using siRNA causes no impedance to EGFR causes no change in cellular mechanism operating under RAS/MAPK pathway, and therefore are independent of EGFR signaling. However, cells transfected with the TBN are rendered susceptible to change in mechanism as well as EGFR dependent signaling causing imbalance of receptor tyrosine kinases.
  • CD73 is overexpressed to compensate for the loss of EGFR caused by the nanoparticle. It is evident that standalone siRNA and cetuximab do not influence CD73 expression levels. Correlating these results, increased level of CD73 activity suggests a synergistic effect of CETUXIMABTM and oncogene knockdown. In the case of siRNA transfected cells, albeit there was loss of activity in RAS pathway, a parallel effector pathway governed by EGFR may have been adopted by the cells for survival. However, the nanoparticles experience EGF receptor mediated endocytosis for siRNA delivery, subsequent oncogene knockdown
  • nRAGeD comprising siRNA conjugated to an antibody surface functionalized on gelatin nanoparticles carrying a small molecule tyrosine kinase inhibitor
  • the platform protects siRNA from degradation and targets the delivery of siRNA to the desired biomarker on the cancer cell.
  • the gelatin nanoparticles, used as the carrier system enable concomitant delivery of a drug within the cells of interest. The platform allows loading predetermined and proportional amounts of an antibody, siRNA and drug within the gelatin nanoparticle carrier for effective targeting and high bioavailability.
  • GAB 1 plays a crucial role in the absence of gefitinib for cell survival even after oncogene knockdown.
  • the inventors also found that mutant KRAS oncogene knockdown impairs and alters the localization of SHP2, abrogating its complex formation with GABl in the presence of gefitinib leading to the apoptosis of the affected cells.
  • a two-step desolvation process was used to preapre gelatin nanoparticles.
  • 500mg of gelatin type A (bloom 300) was first dissolved in 10ml of De-Ionized (DI) Water at 50°C and subjected to first desolvation using rapid addition of acetone (20ml).
  • the precipitate was dissolved in 10ml of DI water (pH 2.75) and second desolvation using dropwise addition of acetone (3ml/min) was initiated. Transformation of the transparent solution to a milky white solution indicated successful desolvation and formation of nanoparticles.
  • DI De-Ionized
  • the nanoparticles were cross-linked with 200 ⁇ 1 of 25% glutardehyde.
  • the reaction was allowed overnight at 50 °C and the resulting
  • nanoparticulate solution was washed 5 times with DI water to remove excess
  • glutaraldehyde (20,000g fro 45 minutes per wash).
  • the carboxyl groups present on the surface of the GelNPs and Gel(Gef)NPs were activated using the EDC/NHS reaction. 10 mg of gelatin nanoparticles were suspended in MES buffer (pH4.5) at a concentration 5 mg/ml. Activation was performed at room temperature for 3.5 hours under constant shaking (850 RPM). The activated nanoparticles were washed to remove excess
  • EDC/NHS (20,000g for 20 minutes).
  • the activated nanoparticles were resuspended in 2 ml PBS (pH 6.7 -7.0) containing 600ul of CETUXIMABTM (2mg/ml) for conjugating the antibody on the surface of the nanoparticles to form CETUXIMABTM conjugated GelNPs (Ab-GelNPs or Ab-Gel(Gef)NPs).
  • the pH of the solution was maintained at 7.
  • the excess antibody was removed through centrifugal separation.
  • the supernatant and the precipitate dispersed in PBS were analyzed for antibody quantification using the Bradford assay with appropriate controls.
  • nRAGeD homogeneous resuspension. lOOug of Sulfo-SMCC was added to the solution and the reaction was allowed for 3hrs at room temperature. Post conversion of lysine residues on antibody with the SMCC linker, 50ul of 50uM thiol-siRNA, such as for example KRAS G12C thiol-siRNA, was added to the solution for linking the maleimide end of the linker to the thiol end of the siRNA to form nRAGeD.
  • 50uM thiol-siRNA such as for example KRAS G12C thiol-siRNA
  • KRAS G12C siRNA was obtained by annealing equal molar amounts of the sense oligonucleotide with SEQ ID NO. 1 with the antisense oligonucleotide with SEQ ID NO. 2 in PBS buffer.
  • KRAS G12C siRNA was functionalized with a sulfide (S-S) moeity, thereby providing KRAS G12C thiol-siRNA.
  • AXL siRNA was obtained by annealing equal molar amounts of the sense oligonucleotide with SEQ ID NO. 3 with the antisense oligonucleotide with SEQ ID NO. 4 in PBS buffer.
  • AXL siRNA was functionalized with a sulfide (S-S) moeity, thereby providing KRAS G12C thiol-siRNA.
  • CETUXIMABTM Monoclonal Antibody, CETUXIMABTM, was conjugated to the surface of GelNPs or Gel(Gef)NPs.
  • the lysine moiety present on the antibody was used to link with the carboxyl groups present on the gelatin.
  • the amount of antibody conjugated to the nanoparticles was determined using the Bradford Assay. It was determined that 45 ( ⁇ 5) ⁇ g of cetuximab was present on the surface of the nanoparticles.
  • the percentage of antibody conjugation changed proportionally with the relative initial amount of GelNPs for all 5 experiments carried out for reproducibility (amount of CETUXIMABTM was kept constant at 600 ⁇ ).
  • siRNA loaded on the nanocomplex was carried out using absorption spectroscopy.
  • the supernatant of complex after centrifugation (20,000g, 20mins) was analyzed for characteristic 280nm peak of siRNA using UV-V is absorption spectroscopy and percentage of siRNA bound to the nanoparticle was determined to be 98 ( ⁇ 1) %.
  • cy5-labeled siRNA was used to determine the conjugation efficiency using florescence spectroscopy. Post centrifugal separation, the suspension was subjected to fluorescence spectroscopy with emission at 670nm.
  • siRNA in the nRAGeD nanoconjugate was analyzed by using SDS-PAGE gel electrophoresis.
  • the nanoparticles with appropriate controls including naked siRNA, gelatin nanoparticles and CETUXIMABTM were subjected to a 10% serum solution.
  • the suspension were aliquoted and refrigerated at -50 °C.
  • the solutions were then subjected to SDS- PAGE and presence of siRNA was detected using nucleic acid staining dye GelRed.
  • a time related serum stability analysis using SDS- PAGE reveals highly stable siRNA present on the nRAGeD.
  • the lane description for Fig. 9 is as follows: 1- Ohr, 2- 0.5hr, 3- lhr, 4- 2hr, 5- 4hr, 6- 12hr, 7- 24hr and 8- naked siRNA at 0 hr in DI water.
  • the lower band in lane 1 corresponds to free siRNA and siRNA cleaved from nRAGeD by serum solution. The band disappears within 30 mins indicating the short stability of free siRNA in serum.
  • nanoparticles had degradation profile similar to naked siRNA.
  • siRNA chemically bound to nRAGeD were highly stable with minimal degradation for 24hrs.
  • siRNA sandwiched between antibody and gelatin nanoparticle or siRNA engulfed within antibody is protected from serum enzymes.
  • An antibody, with a molecular weight of 152KDa can completely mask and protect the relatively small 14KDa oligonucleotide.
  • the various analogues are as follows: (1) GelflNP-Ab-siRNAcy5, (2) Gel fl NP-Ab-siRNA, (3) GelNP-Ab c ⁇ -siRNA, (4) Gel NP-Ab-siPvNA C y5, (5) siRNA cy5 and (6) Ab cy5 .
  • H23 cells were seeded in 6- well plates (5 x 10 5 cells/well). Cells were grown on a poly-L-lysine treated glass coverslip. 100 ul of each samples (Analogues 1, 2, 3, 4 and 5) were incubated for 4 hours at 37°C in serum free media. After treatment, resulting cover slips were washed with PBS (IX) to remove unbound particles and microscopic slides were prepared with DAPI nuclear stain. Slides were imaged using a polarized dark-field fluorescence microscope at 20X and recorded.
  • H23 cells were independently incubated with (i) siRNAcy5 along with transfecting agent (TA-siRNAcy5); (ii) Gel NP-Ab-siRNAcy5; or (iii) Ab-siRNAcy5 for 4 hours ( Figure 11). After 4 hours, the cells were repeatedly washed to remove surface adhered molecules and were trypsinized. Subsequently, the cells were analyzed using flow cytometry and the results showed internalization in the following order: Gel NP- Ab-siRNAcy5 > TA-siRNAcy5 > Ab-siRNAcy5. The amount of siRNA internalized through was at least two fold higher than transfected siRNA (Figure 11).
  • nRAGeD is as an effective siRNA delivery system. It is important to ensure that internalized nanoparticle is present in the cytoplasm and knocks down the KRAS gene as intended and regulates the appropriate protein levels.
  • H23 cell line harboring KRAS mutation at G12C was used.
  • nRAGeD The effect of nRAGeD on the RAS/RAF/MEK/ERK cascade was studied.
  • Untreated H23 cells exhibit phosphorylated downstream proteins in two effector pathways.
  • RAS activates downstream effector enzymes enabling cell proliferation and survival through phosphorylation of RAF. This phosphorylation in- turn activates mitogen activated protein kinase (MEK/MAPK) that is responsible for activation of ERK.
  • MEK/MAPK mitogen activated protein kinase
  • RAS has been found to activate PI3K effector pathway leading to phosphorylated AKT.
  • FIG. 12a is a Western Blot analysis which shows expression of proteins pMEK, MEK, pACT, AKT, pEGFR, EGFR and KRAS in H23 cancer cells treated with nRAGeD in comparison to H23 not treated or treated with KRAS siRNA alone.
  • Figure 12B a significant downregulation of phosphorylated MEK and AKT is observed in cancer cells treated with nRAGeD.
  • the Western blot analysis was performed as follows. Cells were seeded at a density of 1 x 10 6 cells/ml and incubated for overnight at 37°C in 5% CO 2 atmosphere. Nanoparticle and relevant control samples were incubated in serum free media for the period of 72 hrs. For control experiments, siRNA transfection (240 nM) was performed using TransIT-X2 dynamic delivery system transfecting agent (Minis Bio) as per manufacturer's instructions. Whole-cell lysates were prepared using Triton X 100 lysis buffer with MS-SAFE protease and phosphatase cocktail inhibitor (Sigma- Aldrich) and the protein concentration was equalized by Bicinchoninic acid assay (Sigma-Aldrich). Proteins were separated by 4-15% SDS-PAGE (Bio-Rad) and were transferred onto nitrocellulose membranes (GenScript).
  • Membranes were incubated with primary antibody overnight, were washed and incubated with secondary antibody.
  • Primary antibodies used for western blotting are rabbit polyclonal anti- -actin, rabbit monoclonal anti-AKT, rabbit monoclonal anti- phospho-AKT, rabbit polyclonal anti-MEKl/2, rabbit polyclonal anti-phospho-MEKl/2, rabbit monoclonal anti-EGFR, rabbit monoclonal anti-phospho-EGFR, rabbit monoclonal anti-SHP2, rabbit polyclonal anti-phospho-SHP2 (Tyr542), rabbit polyclonal anti- phospho-SHP2 (Tyr580), rabbit monoclonal anti-phospho-GAB 1 (Tyr627), rabbit polyclonal anti-phospho-GAB 1 (Tyr307), all from Cell Signaling and mouse monoclonal anti-KRAS from Santa Cruz Biotech.
  • the membranes were developed with peroxidase- labeled anti-mouse or anti-rabbit
  • the IC50 value of gefitinib for H23 cell line was determined to be 50 ⁇ .
  • transfected siRNA (4 ⁇ , dose corresponding to 50 ⁇ gefitinib) did not cause any cytotoxicity and the viability of cells remained 100%, suggesting oncogenic disruption alters the effector pathway, but does not lead to apoptosis.
  • A549 human adenocarcinoma epithelial cells were grown in RPMI 1640 medium supplemented with 4.5 g/L D-glucose, 25 mM HEPES, 0.11 g/L sodium pyruvate, 1.5 g/L sodium bicarbonate, 2 mM L-glutamine, 10% heat- inactivated fetal bovine serum (Altlanta Biologicals, USA) and 0.1% v/v gentamycin.
  • MTT assay was performed by incubating various samples including the nanoparticle of interest on H23 and A549 cells.
  • the concentrations were normalized with respect to gefitinib concentration for all samples (50 ⁇ , 5 ⁇ , 0.5 ⁇ , 0.05 ⁇ , 0.005 ⁇ and 0 ⁇ ). For samples that did not contain gefitinib, weight of gelatin nanoparticles was used for normalization. Each sample was analyzed in triplicate. After 24 hours of incubation, 10 ⁇ of MTT solution (ATCC, USA) was added and the plate was incubated at 37 ° C for 4 hours. Crystals formed were dissolved in 100 ⁇ solubilizing buffer and the plates were kept at 25 ° C for 2 hours. The intensity of the color developed after addition of the solubilizing buffer was measured using Biotek Cytation 3 spectrophotometer at 570 nm.
  • the controls used for cytotoxicity assay include gefitinib, transfected siRNA with and without gefitinib (siRNA (TA)+gef, siRNA (TA)), cetuximab (Ab), cetuximab-siRNA (Ab-siRNA) with and without gefitinib, gelatin nanoparticles (Gel NP), gefitinib encapsulated gelatin nanoparticles (GelGEFNP), and mock siRNA with gefitinib (see Figures 15, 17, and 19). No significant changes in cell toxicity relative to nRAGeD were found in the case of controls.
  • in vitro cellular viability data was obtained after treatment with gefitinib, siRNA(TA), siRNA(TA)+Gef, or Ab-siRNA(TA)+Gef on KRAS mutant H23 cells.
  • Transfected siRNA showed no toxicity to the cells.
  • cells transfected with siRNA and subsequently treated with gefitinib exhibited viability of 30% at 5 ⁇ gefitinib concentration.
  • Ab-siRNA conjugate upon transfection and treatment with gefitinib showed cell viability of 5% at 50 ⁇ gefitinib concentration. Results indicated post oncogene knockdown, H23 cells get sensitized toward gefitinib.
  • Figure 19 reports in vitro cellular viability of H23 cells transfected with mock siRNA followed by treatment with gefitinib. Results indicate minimal change in viability for mock siRNA compared to the viability of cells treated with gefitinib.
  • KRAS G12C siRNA is highly specific for cancers with this particular point mutation.
  • the safety study was conducted in five normal mice by repeated intravenous (IV) injection of the nRAGeD nanoconstruct (80 mg/Kg body weight) for three consecutive days, followed by euthanasia. During treatment, animals did not show any abnormal behavior. Subsequently, major organs were collected and histopathology was performed. The histology analysis as shown in Figure 21 indicated no signs of toxicity showing good tolerance for nRAGeD nanoconjugates.
  • Dual specificity phosphatase 6 (DUSP6) is an ETS-regulated negative feedback mediator of oncogenic ERK signaling in lung cancer cells. Carcinogenesis 31, 577-586, doi:10.1093/carcin/bgq020 (2010).
  • Cigarette smoking induces overexpression of hepatocyte growth factor in type II pneumocytes and lung cancer cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Nanotechnology (AREA)
  • Cell Biology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

Provided are nanoparticle conjugates comprising a drug encapsulated in a gelatin nanoparticle the surface of which is functionalized with an antibody to which a siRNA is linked. Methods with the nanoconjugates for treating diseases are provided as well.

Description

TARGETED NANOPARTICLE CONJUGATE AND METHOD FOR
CO-DELIVERY OF SIRNA AND DRUG
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of priority to US Provisional Patent Application 62/192,782, filed July 15, 2015, the entire disclosure of which is
incorporated herein by reference.
TECHNICAL FIELD
A field of the invention is nanomaterials. Example applications of the invention include in vivo treatments, including therapy of human cancer.
BACKGROUND
Stable and targeted delivery of small interfering RNA (siRNA) to diseased sites has been a key obstacle for clinical translation of siRNA based therapeutics.
Transport of siRNA to cytoplasm for effecting gene therapy is another obstacle.
Antibodies that bind to specific biomarkers in the cell and also aide in retaining the stability of siRNA provide a partial solution for stable delivery, however they fail to deliver siRNA effectively to cytoplasm of the infected cells.
Small interfering RNA (siRNA) is a promising therapeutic route for several infected cell diseases. In the case of cancer, it is known that standalone siRNA does not cause cytotoxicity to cells to the extent that infected cells are completely eliminated. A knockdown of an oncogene merely silences the gene of interest, and consequently facilitates the affected cancer cells to adapt and adopt a different pathway of survival. For definitive cytotoxic action, a molecule complementing the siRNA for inducing inclusive toxicity needs to be delivered simultaneously and at appropriate proportions to the infected cells where the siRNA is delivered. Conversion of an un-druggable ailment to a drug responsive one through simultaneous delivery of siRNA and cytotoxin to infected cells will pave way for using siRNA therapy for drug-resistant diseases. Indeed, the efficacy would be higher when this complementarily paired system is targeted towards specific biomarkers present on the surface of the infected cells.
In accordance to numerous publications on the delivery of siRNA, the essential parameters that govern effective delivery of siRNA can be categorized into (1) stability of siRNA, (2) targeting the siRNA, (3) effective gene silencing, and (4) cytotoxicity and off-target effects. For stable siRNA delivery, Mirkin and co-workers reported AuNP functionalized with oligoethylene glycol-siRNA. The study showed that the OEG performed two essential functions in combination with gold nanoparticles; namely, polyvalency for inducing proton sponge effect, and relatively higher stability of siRNA in serum. The conjugate showed specific and higher knockdown of luciferase in HeLa cells compared to transfection with lipofectamine. Subsequent induction of cytotoxins and cellular response was not a part of the study. For targeting siRNA to specific biomarkers, Cuellar et al. studied siRNA-antibody conjugates (using
THIOMAB) with various sets of antibodies and cell lines for targeted gene silencing.
The authors reported that, although the conjugates were very well defined with high targeting potential, the gene silencing aspect was not very effective for several cases. The reason for ineffective gene silencing was due to a relatively low proton- sponge effect for endosomal escape of siRNA. Again, subsequent cytotoxicity related studies were not a part of the work.
Non-Small Cell Lung Cancer (NSCLC) NSCLC is diagnosed in an estimated 220,000 patients each year with five-year overall survival rates of 16 percent.
A recent report confirmed that 16 percent of NSCLC patients carry oncogenic KRAS mutation. A potent drug targeted against KRAS mutation has not yet been developed and the objective response rate with the current standard of care is just three percent. An earlier report had suggested siRNA therapy renders the undruggable KRAS mutant cells to become susceptible to Tyrosine Kinase Inhibitors (TKI). Short interfering RNA (siRNA) is a well-known approach for effecting gene therapy to provide subsequent sensitization towards complementary therapeutic agents. However, stable delivery of siRNA is a significant challenge due to its high degradation rate in the presence of serum proteins and enzymes.
To overcome this challenge, several nanoparticle-based carrier systems have been attempted and those include retroviral vectors, liposomes, polymeric, and metallic nanop articles. In these reported studies the physicochemical and surface properties of the particle were modified for delivering the siRNA to cytoplasm of the infected cells. Unfortunately, these nanoparticles suffer from serious limitations such as stability issues during synthesis, premature release in serum, inefficient endosomal escape, and interferon response. Importantly, oncogene knockdown alone has less impact on the cancer cell apoptosis since the cells tend to adopt another effector pathway for survival. Therefore, a need for complementary drug for initiating the apoptosis post knockdown is needed. Indeed, drugging cells separately and exogenously post oncogene knockdown has been reported earlier. A combined delivery system wherein, co-delivery of a drug along with siRNA to impede growth and survival of the cell has also been attempted. The relevance of the combined delivery is to ensure the complementary drug enters the same cells that are affected by siRNA at a predetermined appropriate proportion and time for causing cellular apoptosis. However, incorporation of siRNA (with minimal degradation) with a drug and a biomarker-targeting antibody into a single platform is synthetically challenging. Thus, stable and targeted delivery with
concomitant cytotoxic action to cancer cells continues to be at early exploratory stages.
Significant efforts have been made to understand the downstream effect of oncogene knockdown mediated via siRNA. Cancer cells have several parallel working pathways, with one primary effector pathway coupled to several parallel effector pathways. The parallel pathways remain dormant until the working pathway is disrupted. Change in the protein expression levels upon knock down of oncogene present in the primary pathway results in change of downstream protein and gene expression levels regulated by complex cellular mechanism.
This mode of intra-cellular functioning adaptation evolves to drug resistance within cancer cells that are previously responding to therapy. On the other hand, KRAS mutant adenocarcinoma of NSCLC remains undruggable. While mutations occur at variation position of KRAS, oncogenic effect at codon 12 (Glycine- 12 to Cysteine, G12C) of KRAS is the most commonly occurring mutation and yet to receive a dedicated drug. Although, in recent times, few attempts have been made for targeting G12C mutation through a small molecule inhibitor, RNAi therapy is emerging as a promising tool that could be applied across all types of mutations supplemented with currently approved drugs.
The present inventors have determined that depending on siRNA delivery through physical mixtures, electrostatic interaction of carrier vehicle and siRNA is not very effective. The low effectiveness can be attributed to the lack of definitive structural properties, and also possibly due to agglomeration of particles.
To date, no drug has been discovered which can inhibit the mutant KRAS for effecting therapy. Also, kinetics involved in the RAS pathway is highly complex and interlinked with several other intracellular pathways to assist in cell proliferation. Effect of cytotoxicity induction post oncogene knockdown was reported by Sunaga et al. for KRAS mutant NSCLC. In their report, un-druggable lung adenocarcinoma with K-Ras mutation showed sensitivity to a tyrosine kinase inhibitor (gefitinib) after knocking down K-Ras oncogene with retroviral vector carrying siRNA. The report is also one of the few wherein it was determined that post-knockdown, the NSCLC cells adopted an alternate downstream pathway for survival. The downstream Ras pathway upon knock-down of KRAS mutant gene decreased the protein level expression of the Ras pathway
downstream protein pMEK, and also affected pAKT. The protein down-regulation effected an increase in pEGFR which is absent in the otherwise untreated cells, suggesting an alternate route of cellular mechanism. However, two main challenges limit the translation of retroviral vector strategy for the delivery of siRNA. Firstly, a retroviral vector carrying siRNA and functionalized with a targeting agent such as an antibody for targeting specific biomarkers is a synthetic challenge and has not been reported to this date to our knowledge. Secondly, ensuring the cytotoxin (such as for example, gefitinib) internalizes within all the cells altered by siRNA at appropriate relative proportions is difficult. An off-target interferon response due to retroviral vector might also create an issue for clinical translation.
Another cancer treatment target is AXL receptor which is overexpressed in various types of cancers. The AXL overexpression by some cancer cells has been reported in literature as a cause of cancer cells resistance to EGFR-targeting therapy. AXL (TAM receptor tyrosine kinase family; 140 kDa) is linked to cancer proliferation, migration and cause the subsequent resistance to small molecule tyrosine kinase inhibitors. AXL is also known to affect the PI3/Akt signaling pathways and induce a mutation in EGFR as a tyrosine kinase switch.
SUMMARY OF THE INVENTION
Provided is a nanoparticle conjugate comprising a small interfering RNA (siRNA) linked to an antibody that is bonded to the surface of a gelatin nanoparticle that physically encapsulates a drug. This conjugate delivers the drug and siRNA simultaneously and selectively to a targeted cell, such as a cancer cell. In the conjugate, one end of siRNA may be coupled to an epidermal growth factor receptor (EGFR) targeting monoclonal antibody via a thio-ether bond, and a lysine functional group present on the antibody is bridged with carboxyl groups present on the gelatin nanoparticle. The drug may comprise a tyrosine kinase inhibitor drug. Some conjugates comprisecisplatin, oxaliplatin, gefitinib or erlotinib. In the conjugate, the siRNA may be a siRNA specific to mutant KRAS or siRNA specific to AXL. Some conjugates comprise siRNA comprising 5'-GUUGGAGCUUGUGGCGUAGUUUU-3' (SEQ ID NO. 1) annealed with 5'- AACUACGCCACAAGCUCCAACUU-3' (SEQ ID NO. 2). Some conjugates comprise siRNA comprising 5'- GGAACUGC AUGCUGAAUGAUU-3 ' (SEQ ID NO. 3) annealed with 5'-UCAUUCAGCAUGCAGUUCCUU-3' (SEQ ID NO. 4).
Methods of forming the nanoparticle conjugate are provided as well, and comprise encapsulating the drug in the gelatin nanoparticle, bonding the antibody to the surface of the gelatin nanoparticle, and linking the siRNA to the antibody via a thio-ether bond.
Methods of disease treatment are also provided and comprise adminstering to a patient a nanoconjugate comprising a small interfering RNA (siRNA) linked to an antibody bonded to the surface of a gelatin nanoparticle which encapsulates a drug. The nanoconjugates can be used for treating cancer, including metastatic cancer. Various cancers can be treated, including non-small lung carcinoma, brain tumor, colon cancer, head and neck cancer, prostate cancer, breast cancer or stomach cancer. In some methods of treatment, a patient is administered the nanoconjugate in which the drug is gefitinib, the antibody is EGFR-targeting antibody CETUXIMAB™ and the siRNA comprises the oligonucleotide with SEQ ID NO. 1 annealed with the oligonucleotide with SEQ ID NO. 2. These patients can be tested for KRAS mutations prior to the administration of the nanoconjugate.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 is a schematic diagram of nRAGeD comprising a gelatin nanoparticle as a carrier. The surface of the gelatin nanoparticle is functionalized with an antibody. siRNA is covalently attached to the antibody via the thio-ether link. The core of the gelatin nanoparticle contains a drug.
Fig.2A is a schematic representation of the TBN nanoconjugate consisting of a gelatin nanoparticle encapsulating gefitinib and surface functionalized with
CETUXIMAB™ conjugated with siRNA. Fig. 2B is a TEM image of gelatin
nanop articles. Fig. 2C is a TEM image of the TBN nanoconjugates. Fig. 3 is a schematic diagram of the nRAGeD synthesis.
Fig. 4 is a graph reporting a hydrodynamic size of 200 (±10) nm for nRAGeD, as determined by the dynamic light scattering method using Malvern Zetasizer Nano ZS.
Fig. 5 reports a zeta potential for Gelatin NP (Gel NP) nanoparticles, an antibody functionalized Gelatin NP (Ab-Gel NP) nanoparticles, and nRAGeD (si-Ab- GelNP), determined by using Malvern Zetasizer Nano ZS.
Fig. 6 reports a change in the zeta potential upon surface functionalization and siRNA addition in nRAGeD.
Figs. 7A - 7C are TEM images of gelatin nanoparticles (Fig. 7A), antibody functionalized gelatin nanoparticles (Fig. 7B) and nRAGeD (Fig. 7C).
Figs. 8A-8C reprot siRNA loaded on nRAGeD by visual observation of a significant increase of the amount of siRNA labeled with Cy5 on nRAGeD (Fig. 8C) in comparison to siRNA solution (Fig. 8A) and Ab-Gel-nanoparticles (Fig. 8B).
Figs. 9A-9C are stability assays for nRAGeD. Fig. 9A is a SDS-PAGE of the time related serum stability analysis. Fig. 9B is a 30-day storage stability analysis of nRAGeD stored at -50°C. Fig. 9C is an in vitro stability study of nRAGeD as analyzed by a hydrodynamic size in biological media.
Fig. 10 is florescence microscopy images of H23 cancer cells incubated with nRAGeD (GelFiAb-siRNAcy5) or its analogues GelFiAb-siRNA, Gel-Abcy5-siRNA, Gel-Ab-siRNAcy5, siRNAcy5 and Abcy5. DAPI was used as a nuclear staining marker. Fluorescein is incorporated into nanoparticles. Cy5 is used for labelling an antibody and siRNA.
Fig. 11 is a flow cytometry analysis showing nRAGeD (siRNA- Ab-GelNP) is internalized by cancer cells almost 2 folds better as compared to transfected naked siRNA. Figs. 12A is a Western blot analysis of protein expression in cancer cells treated with nRAGeD. Fig. 12B is a densitometry analysis of the data from Fig. 12A.
Fig. 13 is a Western blot analysis for phosphorylated forms of pGABl (Y627) and pGABl (Y307).
Figs. 14A is a Western blot analysis of SHP2 protein and its phosphorylated forms. Fig. 14B is a densitometry analysis of the Western blot of Fig. 14A.
Fig. 15 reports the MTT dose concentration of nanoparticles and its various analogues used for the in vitro toxicity in lung cancer cells.
Fig. 16 is an in vitro toxicity report for lung cancer cells treated with nRAGeD.
Fig. 17 is an in vitro cellular viability data after treatment with nRAGeD or control compositions.
Fig. 18 reports a synergistic effect of nRAGeD on decreasing the cell viability of cancer cells.
Fig. 19 reports in vitro cellular viability of cancer cells with KRAS G12C mutation transfected with mock siRNA followed by treatment with gefitinib.
Fig. 20 reports in vitro cellular viability of cancer cells with KRAS G12S mutation treated with nRAGeD carrying RAS G12C si-RNA.
Fig. 21 is a photomicrograph of H&E stained sections of mouse organs (n = 5) treated with nRAGeD.
Figs. 22A and 22B report an RT-PCR analysis for DUSP6 and NT5E in cancer cells treated with nRAGeD.
Fig. 23 is a schematic depicting the mechanism by which nRAGeD may bind to a cell surface receptor and then be internalized by the cell.
Figs. 24A-24C are a schematic depicting the effect of siRNA and gefitinib on the downstream protein regulation mechanism. Fig. 24A shows the pathway in cancer cells with mutated RAS. Fig. 24B shows the disruption of the RAS signaling pathway by siRNA. Fig. 24C shows the further impediment of the cancer cells by gefitinib.
DETAILED DESCRIPTION
Provided is a nanoparticle conjugate which is referred to as nRAGeD (abbreviated from "RNA -Antibody-Gelatin-Drug Nanoconjugate") and which comprises a small interfering RNA (siRNA) linked to an antibody that is bonded to the surface of a gelatin nanoparticle that physically encapsulates a drug. As shown in Fig. 1, the nRAGeD, generally 10, comprises a gelatin nanoparticle (1) which encapsulates a drug (2) in the core (3) of the gelatin nanoparticle (1). An antibody (4) is bonded to the surface of the gelatin particle (1). The antibody (4) is covalently linked to a siRNA (5) by the thio-ether bond. The nRAGeD nanoconjugate can be used as a drug for treating various diseases, including cancer, and in particular a metastatic cancer. The nRAGeD can be also used in other treatment applications where it is desirable to deliver a drug selectively to a particular set of cells.
Various antibodies are contemplated, including an antibody that selectively recognizes and binds a receptor and/or cell surface marker displayed at the cell surface. The antibody can be an antibody or an antibody fragment which selectively recognizes and binds with high affinity and specificity to a receptor and/or cell surface marker expressed at the surface of a cancer cell. Suitable antibodies include monoclonal and polyclonal antibodies. A humanized monoclonal antibody or its functional fragment is particularly preferred. One suitable antibody includes an antibody specific to human Epithelial Growth Factor Receptor (EGFR). One particularly preferred antibody is EGFR specific chimeric (mouse/human) monoclonal antibody available under the tradename CETUXIMAB™ from Merck. Various drugs are contemplated, including anticancer drugs such as platinum-based drugs, including cisplatin and oxaliplatin. Two drugs that are particularly preferred are gefitinib (ZD 1839, N-(3-chloro-4-fluoro-phenyl)-7-methoxy-6-(3- morpholin-4-ylpropoxy)quinazolin-4-amine) and erlotinib hydrochloride (N-(3- ethynylphenyl)-6,7-bis(2-methoxyethoxy) quinazolin-4-amine).
Various siRNAs are suitable, including siRNA specific to a gene whose expression is upregulated in cancer cells. Suitable siRNA are double-stranded RNA molecules, 20-25 base pairs in length with a sequence complementary to a gene whose transcription needs to be silenced. Suitable siRNAs include those that selectively interfere with expression of genes mutated and/or overexpressed in cancer cells.
Particularly preferred are siRNAs specific to mutant KRAS, including human KRAS with a point mutation in codon 12. A particularly preferred KRAS siRNA is specific to KRAS with a point mutation G12C. These siRNAs include the KRAS G12C siRNA obtained by annealing together sense oligonucleotide comprising, consisting essentially of or consisting of 5'-GUUGGAGCUUGUGGCGUAGUUUU-3' (SEQ ID NO. 1) with an antisense oligonucleotide comprising, consisting essentially of or consisting of 5'-AACUACGCCACAAGCUCCAACUU-3' (SEQ ID NO. 2). The 5' guanine in the oligonucleotide with SEQ ID NO. 1 can be modified with a disulfide (S-S) moiety.
Another preferred siRNA is a siRNA specific for AXL. These siRNAs include the AXL siRNA obtained by annealing together sense oligonucleotide
comprising, consisting essentially of or consisting of 5'-
GGAACUGCAUGCUGAAUGAUU (SEQ ID NO. 3) with an antisense oligonucleotide comprising, consisting essentially of or consisting of 5'- UCAUUCAGCAUGCAGUUCCUU-3' (SEQ ID NO. 4). The 5' guanine in the oligonucleotide with SEQ ID NO. 3 can be modified with a disulfide (S-S) moiety. Various gelatin types are suitable for obtaining the nanoparticle. A person of skill will understand that gelatin is a mixture of peptides and proteins produced by partial hydrolysis of collagen from different sources, such as for example pork skin and fish. The strength of gelatin is measured in "bloom." Preferably, gelatin of 200 to 300 bloom is suitable for making the nRAGeD nanoconjugate. Gelatin 300 bloom is particularly preferred.
Various technical advantages are provided by the present nRAGeD nanoconjugate. It is suitable for delivery of drugs to a particular population of cells without affecting other cells. This may be useful for delivering drugs that may be otherwise toxic or are unstable. For example, many cancer drugs which are highly efficient in eliminating cancer cells are also toxic to a patient. However, delivering such a drug tackled away in the core of the nRAGeD nanoconjugate specifically to cancer cells avoids or minimizes the damage to other non-cancer cells in a patient. Another technical advantage is the nRAGeD provides a highly efficient delivery for siRNA which otherwise degrade easily in the blood stream before reaching cells targeted for treatment.
The nRAGeD nanoconjugate provides a vehicle in which siRNA is protected from degradation. In addition, the nRAGeD is a platform which delivers several drugs simultaneously to a cell targeted for treatment. This provides a particular advantage in cancer treatment where certain cancer cells, such as for example, cancer cells with mutated KRAS, are known to switch on an alternative survival pathway in response to a first anti-cancer drug that would otherwise sentence the cancer cell to apoptosis. Thus, a patient has to be treated with a second drug.
The nRAGeD nanoconjugate is useful for treating various cancer diseases, including non-small lung carcinoma, colon cancer, head and neck cancer, prostate cancer and breast cancer.
The suitable nRAGeD nanoconjugates include a gelatin nanoparticle (GelNP) encapsulating gefitinib (GelGEFNP). The surface of the GelGEFNP nanoconjugate is functionalized with EGFR targeting antibody CETUXIMAB™ which is conjugated to KRAS G12C specific siRNA such as for example, a duplex between the oligonucleotide with SEQ ID NO. 1 and the oligonucleotide with SEQ ID NO. 2, as shown in Figure 2A and referred to as the TBN nanoconjugate in Figure 2A. An electronic microscope micrograph of the TBN nanoconjugate is shown in Figure 2C, while an electronic microscope micrograph of gelatin nanoparticles is shown in Figure 2B. The TBN nanoconjugate is useful for treating various cancer diseases, including non-small lung carcinoma, colon cancer, head and neck cancer, prostate cancer and breast cancer.
Preferred embodiments also provide in vivo treatment methods. The methods include adminsitering a nanoparticle conjugate, aslo referrred to as a nanoconjugate, of the invention for treatment of a disease to a patient. The treatement can be a cancer treatement. Various cancers can be treated with nRAGeD
nanoconjugates, including non-small lung carcinoma, brain tumors, colon cancer, head and neck cancer, prostate cancer, breast cancer and stomach cancer.
Preferred nanoparticle conjugates of the invention provide for stable and targeted delivery of siRNA to diseased sites and also provide for transport of siRNA to the cell cytoplasm for effective gene therapy. In preferred embodiments nanoparticle conjugates, the siRNA is protected by antibodies on one side and a protein or polymeric nanoparticle on the other side that is capable of carrying its own payload within the core and deliver the ingredients to the cytoplasm of cells.
Preferred embodiments use gelatin nanoparticles that include an encapsulated drug, gefitinib. To carry siRNA, one end of siRNA is coupled to
CETUXIMAB™, an epidermal growth factor receptor (EGFR) targeting monoclonal antibody via a highly stable thio-ether bond. A lysine functional group present on the antibody is bridged with carboxyl groups present on the gelatin nanoparticles. The antibody and gelatin nanoparticles act as two protective layers of a sandwich, between which resides the siRNA. In addition, a tyrosine kinase inhibitor drug, gefitinib, is encapsulated within the core of each gelatin nanoparticle. The resulting nanocomplex delivers siRNA and drug at predetermined relative proportions for effective gene knockdown and concomitant cytotoxicity.
The utility of siRNA-antibody-gelatin-gefitinib nanoparticle platform concerns converting undruggable KRAS mutant cells to gefitinib sensitive cells by knocking down the KRAS oncogene. Upon the knockdown of KRAS oncogene, the cells adopt another effector pathway for survival that is responsible for sensitization towards gefitinib. Test results suggest a new modus-operandi for stable and targeted delivery of siRNA and drug for oncogene knockdown, gene therapy and drug delivery.
Preferred embodiment nanoparticle conjugates utilize a charge-reversible protein nanoparticles that comprise a physically encapsulated drug in the core and an antibody conjugated on the surface. The siRNA of interest is linked to the surface conjugated antibody via a thio-ether bond to form an antibody-siRNA conjugate.
In particular preferred emobdimenets, for minimal exposure of siRNA to synthetic procedures, positively charged gelatin nanoparticles (GelNP) are used as the starting material. GelNPs can be prepared via a two-step desolvation process of a gelatin solution as shown in Figure 3. GelNPs can then be used to encapsulate a small molecule tyrosine-kinase inhibitor (TKI), gefitinib, or any other drug of choice. The resulting GelGEFNP nanoparticle can then be then used for binding antibody CETUXIMAB™ or some other antibody or an antibody fragment via a lysine functional group present on the antibody with carboxyl groups present on the surface of gelatin nanoparticles.
Other lysine residues of the antibody can be then modified with thiol- siRNAKR by using NHS-Maleimide linker molecule (sulfo-SMCC) to obtain the final construct, RNA-Antibody-Gelatin-Drug Nanoconjugate (nRAGeD). Gelatin is specifically chosen as the carrier system for enzyme-triggered release of the constituents.
Other polymers such as PLGA are good for controlled release systems. However, it is difficult to enzymatically trigger the release of the encapsulated drugs for such polymeric systems. Gelatin is prone to enzymatic degradation. This property can be exploited for delivering low doses of drugs confined within its matrix; as the drug molecules are not released until the gelatin matrix degrades. Also, positively charged gelatin nanoparticles turn negative post-surface modification with an antibody-siRNA complex, thereby providing the useful charge reversal property-an essential requirement for inducing a pH imbalance in endosomes to cause a proton-sponge effect and
consequent endosomal escape of nRAGeD into the cell cytoplasm.
In this invention, it has been demonstrated that nRAGeD is a platform for targeted cell-specific delivery of a combination of siRNA and a drug for concomitant siRNA mediated oncogene knockdown and drug mediated cytotoxicity.
Preferred methods provide for the synthesis and characterization of nRAGeD to (i.) showcase its charge-reversal property, (ii.) demonstrate its ability to knock-down KRAS oncogene, and (iii.) convert un-druggable cells to drug sensitive and co-localize various constituents of the construct within the cells of interest. Also, without wishing to be bond by the theory, two probable intra-cellular delivery mechanisms of action for nRAGeD are idetnified and described.
As shown in Figure 3, the synthesis of nRAGeD begins by preparing a gelatin solution. Gelatin nanoparticles (GelNP) are then produced by a two-step desolvation. Gelatin particles can be loaded with a drug (not shown in Figure 3) during the second desolvation step.
Gelatin nanoparticles are then functionalized with an antibody Ab, resulting in Ab-Gel-NP nanoconjugate. The lysine groups of the Ab are then reacted with sulfo- SMCC to generate a reactive maleimide end to which siRNA is then conjugated with thiol-maleimide link to form a nanoconjugate carrying siRNA and also a drug if the drug was incapsulated into a gelatin nanoparticle.
As shown in Figure 4, nRAGeD dispersed in deionized (DI) water have an average hydrodynamic diameter of 210 ± 10 nm with a PDI less than or equal to 0.1. The size of GelNPs with encapsulated gefitinib Gel(Gef) NPs remains the same and no significant increase in size is observed in comparison to gelatin nanoparticles not loadead with a drug.
Zeta potential (ζ) measurements of GelNPs suspended in DI water indicate ζ of +18mV. As shown in Figures 5 and 6, the ζ did not change with the encapsulated gefitinib, indicating surface properties of GelNPs remain unchanged. However, a significant change is Zeta potential was observed for nRAGeD nanoparticles which became negatively charged.
As shown in micrographs of Figures 7A, 7B and 7C obtained with an electronic microscope, no significant change in the size or shape of nanoparticles was observed post-surface modifications. Compare TEM images of gelatin nanoparticles (Fig. 7A), antibody functionalized gelatin nanoparticles (Fig. 7B), and nRAGeD (Fig. 7C).
A delivery of siRNA to cells of interest is a major hurdle for clinical translation. Not only is the encapsulation of siRNA within polymers or liposomes without degrading the siRNA during nanoparticle preparation is synthetically
challenging, but post siRNA-NP preparation, availability of siRNA to the cells of interest for effective knockdown of concerned gene is governed by various factors which are difficult to predict or determine. A direct exposure of siRNA to the surrounding environment by mere surface functionalization of siRNA on surface of the nanoparticles without an antibody leads to its rapid degradation by serum.
The inventors have unexpectedly discovered that nRAGeD nanoconjugates overcome these challenges and protect siRNA from serum degradation without exposing siRNA to harsh chemical synthetic procedures of encapsulation. In the nRAGeD nanoconjugate, an antibody is displayed on the surface of GelNPs is used for protecting siRNA from degradation. The size and molecular weight of GelNPs (200nm) and antibody (152 KDa) is relatively very high compared to siRNA (14KDa). siRNA functionalized to the antibody enables a stable and covalently attached sandwich system wherein the siRNA is embedded between GelNP and and an antibody. Furthermore, siRNA incorporation to the nRAGeD nanoconjugate, being the last step of synthetic procedure can be carried out in RNAse free water without subjection to harsh chemical methods, ensures degradation-free siRNA within the nanocomplex. The pre-mature release of siRNA can be discounted for such systems since siRNA is not physically entrapped or coated.
As shown in Figures 9A-9C, siRNA chemically linked to nRAGeD via an antibody remains highly stable in blood serum with only a minimal degradation after 24 hours of serum exposure (Figure 9A). As shown in Figure 9B, there is only a minimum degradation after 30 days of storage at -50°C. As shown in Fig. 9C, no siginicant variation in hydrodynamic size was observed after nRAGeD nanoconjugates were exposed to a biological media up to 24 hours.
Another techincal advantage is reported in Figure 11 showing that the amount of siRNA internalized by cancer cells when siRNA is a part of the nRAGeD nanoconjugate is at least two fold higher than when cancer cells are transfected with naked siRNA. Thus, nRAGeD is effective as a siRNA delivery system.
As shown in Figures 12A, 12B, 13, 14A and 14B, nRAGeD suppresses efficently mutant KRAS and the RAS pathway in cancer cells.
As shown in Figure 16, treating cancer cells with nRAGeD which delivers to the cells gefitinib together with the KRAS G12C siRNA decreases the cell viability down to 5% in comparison to treating cells with the KRAS G12C siRNA first, followed by a separate treatment with gefitinib, where the cell viability is at 25%. Thus, the combined treatment as delivered by nRAGeD has a synergistic effect.
The synergistic effect of nRAGeD in decreasing the viability of cancer cells is further supported by cell viability results shown in Figures 17, 18 and 19. The nanoparticle conjugates of preferred emobdiments with siRNA conjugated to an antibody functionalized on the surface of a gelatin nanoparticle carrying a small molecule tyrosine kinase inhibitor or some other drug protects siRNA from degradation and targets delivery of siRNA to cells which display a biomarker selected for targeting. Furthemore, the gelatin nanoparticles, used as the carrier system, enable concomitant delivery of a drug within the cells of interest and target. The platform allows loading predetermined and proportional amounts of an antibody, siRNA and drug within the carrier for effective targeting and high bioavailability to provide gene and combinational therapy.
The make up of an nRAGeD nanoparticle can be easily modified as per patient's needs wherein the siRNA, antibody and/or the encapsulated drug can be selected based on the nature and status of cancer in each individual patient.
A cancer treatment with nRAGeD may comprise an intravenous administration, where an nRAGeD nanoparticle is adminstered daily in a concentration ranging from 20 mg/kg of the patient's body weight to 250 mg/kg of the patient's body weight for a period of several days, typically from 3 to 6 days. A patient can then be monitored and tested for a decrease in cancer cells. The nRAGeD treatment can be repeated in several rounds, each of the rounds comprising several concecutive days of administration. Under some treatment plans, a patient can be treated with about 100 mg of the nRAGeD nanoconjugate per day, for a total of 5 days.
Further treatment plans may include testing a patient to identify whether the patient's cancer cells express mutated KRAS and/or AXL. Suitable tests may include sequencing, PCR, quantitative real time PCR and/or protein anaysis. Based on the test results, a treatment plan may include synthesizing an si-RNA molecule specific for the type of a mutation identified in the patient, followed by preparing an nRAGeD
comprising an anti-cancer small molecule drug encapsulted in a gelatin nanoparticle and functionalized with an antibody linked to the surface of the nanoparticle and linking the siRNA to the bonded antibody. The patient is then treated with the nRAGeD specificly designed for the patient's cancer cells.
Without wishing to be bound by any theory, the inventors also disclose a mechanism by which nRAGeD may affect proteins in the RAS/RAF/MEK/ERK cascade. In this inquiry, quantitative real time PCR was performed to examine dual specificity phosphatase 6 (DUSP6) and CD73 gene expression levels. DUSP6 is an important feedback loop as it exhibits antitumor profile through negative feedback regulation. An effect on the signaling cascade, therefore, must have an effect on DUSP6 levels.
As shown in Figure 22A, transfected siRNA and nRAGeD cells showed downregulation of DUSP6 upon knockdown. The RF values of DUSP6 post knockdown determined using real time qPCR for nanoparticle correlated well with that of transfected siRNA and was determined to be 0.17 and 0.1 for nRAGeD and siRNA respectively. In contrast, Ab-GelGEFNP devoid of siRNA, showed the RF value of 0.73 indicating minimal or no effect on the gene regulation. The results suggest a post-oncogene knockdown, loss of activity in the MEK/ERK cascade has a direct impact on the gene regulation of DUSP6, as shown in Figure 22A which reports the RF values determined by quantitative real time PCR and indicates the downregulation of DUSP6 gene expression for the H23 cells treated with siRNA and nRAGeD.
NT5E or CD73 is a predictive biomarker for overall patient's survival and progression free survival in patients harboring KRAS wild type or a KRAS mutation. As sown in Figure 22B, the inventors observe a significant increase in the CD73 expression levels for cancer cells treated with nRAGeD and no change for cancer cells transfected with siRNA or treated with Ab-GelGEFNP devoid of siRNA. The CD73 RF value for cells treated with TBN was determined to be 3.64 compared to 1.07 and 0.95 for siRNA and Ab-GelGEFNP with no siRNA respectively, as shown in Figure 22B which reports the RF values determined by quantitative real time PCR indicates up regulation of NT5E gene expression for the H23 cells treated with TBN. Cells treated with siRNA or CETUXIMAB™ functionalized gelatin nanoparticles showed minimal or no change in expression levels compared to the untreated cells. The increase in CD73 expression levels may be attributed to the presence of both siRNA and CETUXIMAB™ in aRAGeD.
The inventors postulate that the mechanism of release of nRAGeD from endosomes to cytosol as shown in Figure 23 and the concomitant effect on gene and protein regulation. As shown in Figure 23, nRAGeD enters cells using a receptor mediated endocytosis and stays in endosomal vehicle. Subsequently, nRAGeD is released from endosomes, possibly due to the proton sponge effect to the cytosol. In the cytosol, siRNA forms the RISC complex and successfully knocks down mutant KRAS.
The inventors synthesized a targeted nRAGeD as an effective siRNA delivery system which can sensitize the KRAS mutant tumor cells to gefitinib if KRAS siRNA is used in nRAGeD. Camouflaging siRNA between gelatin and antibody molecules in nRAGeD increases the stability of the siRNA. Indeed, serum stability and cytoplasmic delivery of siRNA present within nRAGeD are attributed to the synergistic effect of both Gel NP and an antibody. The release of encapsulated gefitinib from nRAGeD primarily governed by degradation of gelatin matrix of the nanoparticle.
However, exposure or release of siRNA to form the RNA-induced silencing complex (RISC) can occur in two ways, either through the surface degradation of Gel NP that subsequently releases Ab-siRNA conjugate forming RISC or via direct complexation of RISC with siRNA present on the nanoparticle, as shown in Figure 23.
Treatment with nRAGeD results in downregulation of pMEK present in the RAS pathway. In comparison with untreated cells, the relative down regulation of pMEK is found to be at least 2 times lower when we used nRAGeD. The downregulation of the downstream proteins mediated by nRAGeD showed a similar response as that of transfected siRNA. Gel NP without siRNA has no effect on pMEK, thereby proving that knocking down the KRAS oncogene effectively decreases the RAS functioning pathway. The RAS/MEK/ERK pathway is closely associated to PI3K/AKT pathway. With 802 interactive proteins involved in the PI3K signaling and over 2000 proteins in the case of MAPK pathway, several cross talk points exist between PI3K/AKT and RAS/MAPK pathway. Among these proteins, Grb2 associated binder- 1 (GAB l) has been previously identified as an important adaptor protein playing central role in various cell responses. Specifically, GABl is found to be functionally active docking protein for several downstream signaling pathways including EGFR. PI3K and GABl share intrinsic association via tyrosine domain phosphorylation of GABl on SHP2 binding motifs. SHP2 negatively regulates PI3K activation through dephosphorylation of GABl phosphotyrosinases facilitating the activation of RAS for certain cases. In others, activated ERK results in phosphorylation of GABl (Grb2 associated binder 1) on serine and threonine residues adjacent to p85 PI3K binding sites and the nature of signaling dictates regulation levels of GAB-p85 PI3K complexes to control PI3K activity.
In the case of H23 cells, pAKT is reduced with downregulation of pMEK and pERK. The result suggests that the feedback loop of MAPK with PI3K is possibly governed by GAB 1 phosphorylation on serine and threonine residues and not via SHP2- PI3K binding prior to RAS oncogene knockdown. The silencing of activated ERK signaling by RAS oncogene knockdown disrupts the formation of GAB-P85 PI3K complex by negatively affecting serine and threonine phosphorylation levels of GABl. This negative feedback results in arresting PI3K pathway and downregulating AKT activity in the case of H23 cells. The fact that HGF is highly expressed in the case of H23 cells strengthens our claims that ERK induces positive regulation of GAB 1 for associating with P85-PI3K via HGF mediation under normal conditions, disruption of which deactivates the PI3K/AKT pathway.
Surprisingly, no effect on cell viability with 100% cell survival is observed with disruption of the RAS/MEK/ERK pathway post RAS oncogene knockdown (for both cell transfected with siRNA or Gel NP without gefitinib). Addition of gefitinib to siRNA treated cells, however, shows a considerable effect on the viability of cancer cells, more so for the nRAGeD compared to transfected siRNA.
One question that still needs to be addressed is the functional mechanism of the H23 cells for survival with knocked-down RAS oncogene, and in effect, with arrested the MAPK and PI3K pathways. Tyrosine phosphorylation of GAB 1 can effectively associate with EGFR. With inability of GAB 1 to form complexes with p85 PI3K due to loss in serine phosphorylation, GAB 1 can effectively regulate EGFR signaling through several positive feedback loops. One possibility is that association of GAB 1 with EGFR by recruiting SHP2 and cascading EGFR downstream signaling. In the case of
downstream EGFR, SHP2 is activated by complexing with phosphorylated GAB 1 that binds with EGFR through Grb2. Tyr 627 domain is one of the predominant domains of pGABl wherein the complexing occurs. Indeed, Western blot results indicate an increase in the pGAB 1 (Tyr 627) after oncogene knockdown by TBN supporting our hypothesis that knockdown of KRAS oncogene arrests the MEK/ERK pathway, triggering a feedback loop wherein GAB1 dephosphorylation on serine and/or threonine residues occur, resulting in abrogation of AKT activity.
The stimulation cascades to phosphorylation at tyrosine domains of GAB 1 that induces association of GAB 1 to EGFR through SHP2 recruitment. It is thus possible that the adopted effector pathway of survival post oncogene knockdown is governed through EGFR downstream signaling via disrupted MAPK pathway. It is noteworthy to mention that SHP2 regulation has intrinsic relation with tyrosine kinase inhibitors.
Impaired SHP2 functioning or altered localization of SHP2 causes sensitivity to gefitinib. The results suggest that alteration of SHP2 localization caused by recruitment through GAB 1 causes disruption of EGF downstream signaling. Addition of gefitinib impairs the functioning of SHP2 and disables complex formation with GAB1, thereby abrogating the already disrupted MAPK pathway, leading to apoptosis of cells, as shown in Figures 24A and 24B which show the effect of siRNA and gefitinib on the downstream protein regulation mechanism.
In Figure 24A, the effector pathway in the presence of oncogenic RAS mutation in H23 cells is shown. In Figure 24B, the disruption of RAS downstream through siRNA mediated oncogene knockdown affects regular functioning of the
RAF/MEK/ERK pathway leading disrupted functioning through MAPK pathway caused by alerted localization of impaired SHP2. In Figure 24C, addition of gefitinib impedes the recruitment of SHP2 by GAB 1 leading to the abrogation of the already disrupted MAPK pathway and eventual apoptosis of the affected cells.
Transfected siRNA may serve as a positive control in terms of oncogene knockdown but a negative control for EGFR blocking. Conversely, a nanoparticle without siRNA may serve as a positive control for EGFR blocking and as a negative control for oncogene knockdown. Understanding the effect of CETUXIMAB™ may further explain the underlying mechanism.
DUSP6 is a cytoplasmic gene that plays a pivotal role in the spatiotemporal mechanism of ERK signaling. The downregulation of DUSP6 is possibly due to inhibition of ERK based on several negative feedback mechanisms. Indeed, siRNA mediated knockdown affects the ERK pathway leading to the regulation of cytoplasmic genes. However, the effect of EGFR signaling on the gene regulation levels post oncogenic loss need to be monitored.
CD73 is a 70 kDa cell surface protein that plays an important role in physiology and pathophysiology of cells. CD73 expression levels remain unchanged with siRNA knockdown mediated by routine transfection as well as for cells transfected with Ab-GelGEFNP with and without siRNA. The result is in agreement with those obtained through protein regulation studies, since the mere knockdown using siRNA causes no impedance to EGFR causes no change in cellular mechanism operating under RAS/MAPK pathway, and therefore are independent of EGFR signaling. However, cells transfected with the TBN are rendered susceptible to change in mechanism as well as EGFR dependent signaling causing imbalance of receptor tyrosine kinases.
For balancing the requisite EGFR expression, CD73 is overexpressed to compensate for the loss of EGFR caused by the nanoparticle. It is evident that standalone siRNA and cetuximab do not influence CD73 expression levels. Correlating these results, increased level of CD73 activity suggests a synergistic effect of CETUXIMAB™ and oncogene knockdown. In the case of siRNA transfected cells, albeit there was loss of activity in RAS pathway, a parallel effector pathway governed by EGFR may have been adopted by the cells for survival. However, the nanoparticles experience EGF receptor mediated endocytosis for siRNA delivery, subsequent oncogene knockdown
accompanied with loss of activity in the primary effector pathway. The simultaneous disruption of several interdependent pathways and downstream effector proteins, i.e. RAS/MEK/ERK, PI3K/AKT, GAB1 and SHP2, may be the reason for significant change in cellular gene and protein expression levels leading to sensitization towards small molecule tyrosine kinase inhibitor.
nRAGeD comprising siRNA conjugated to an antibody surface functionalized on gelatin nanoparticles carrying a small molecule tyrosine kinase inhibitor, is highly suitable for the siRNA mediated therapy. Interestingly, the platform protects siRNA from degradation and targets the delivery of siRNA to the desired biomarker on the cancer cell. Also, the gelatin nanoparticles, used as the carrier system, enable concomitant delivery of a drug within the cells of interest. The platform allows loading predetermined and proportional amounts of an antibody, siRNA and drug within the gelatin nanoparticle carrier for effective targeting and high bioavailability.
Using nRAGeD as a therapeutic drug, the inventors have determined that GAB 1 plays a crucial role in the absence of gefitinib for cell survival even after oncogene knockdown. The inventors also found that mutant KRAS oncogene knockdown impairs and alters the localization of SHP2, abrogating its complex formation with GABl in the presence of gefitinib leading to the apoptosis of the affected cells.
The invention will be now described in more detail by the way of the following non-limiting examples.
Example 1. Synthesis of nRAGeD Nanoconjugates.
A two-step desolvation process was used to preapre gelatin nanoparticles. 500mg of gelatin type A (bloom 300) was first dissolved in 10ml of De-Ionized (DI) Water at 50°C and subjected to first desolvation using rapid addition of acetone (20ml). The precipitate was dissolved in 10ml of DI water (pH 2.75) and second desolvation using dropwise addition of acetone (3ml/min) was initiated. Transformation of the transparent solution to a milky white solution indicated successful desolvation and formation of nanoparticles.
After 10 minutes, the nanoparticles were cross-linked with 200μ1 of 25% glutardehyde. The reaction was allowed overnight at 50 °C and the resulting
nanoparticulate solution was washed 5 times with DI water to remove excess
glutaraldehyde (20,000g fro 45 minutes per wash).
For preparation of gefitinib encapsulation, lmg of gefitinib hydrochloride dissolved in DI water was added during the second desolvation process prior to acetone addition. The nanoparticles were then resuspended in DI water and stored at 4°C.
For CETUXIMAB™ conjugation, the carboxyl groups present on the surface of the GelNPs and Gel(Gef)NPs were activated using the EDC/NHS reaction. 10 mg of gelatin nanoparticles were suspended in MES buffer (pH4.5) at a concentration 5 mg/ml. Activation was performed at room temperature for 3.5 hours under constant shaking (850 RPM). The activated nanoparticles were washed to remove excess
EDC/NHS (20,000g for 20 minutes). The activated nanoparticles were resuspended in 2 ml PBS (pH 6.7 -7.0) containing 600ul of CETUXIMAB™ (2mg/ml) for conjugating the antibody on the surface of the nanoparticles to form CETUXIMAB™ conjugated GelNPs (Ab-GelNPs or Ab-Gel(Gef)NPs). The pH of the solution was maintained at 7. The excess antibody was removed through centrifugal separation. The supernatant and the precipitate dispersed in PBS were analyzed for antibody quantification using the Bradford assay with appropriate controls.
For siRNA functionalization, 7mg of Ab-GelNPs (or Ab-Gel(Gef)NPs) were suspended in RNAse free water (pH 7) and sonicated for few seconds for
homogeneous resuspension. lOOug of Sulfo-SMCC was added to the solution and the reaction was allowed for 3hrs at room temperature. Post conversion of lysine residues on antibody with the SMCC linker, 50ul of 50uM thiol-siRNA, such as for example KRAS G12C thiol-siRNA, was added to the solution for linking the maleimide end of the linker to the thiol end of the siRNA to form nRAGeD.
KRAS G12C siRNA was obtained by annealing equal molar amounts of the sense oligonucleotide with SEQ ID NO. 1 with the antisense oligonucleotide with SEQ ID NO. 2 in PBS buffer. KRAS G12C siRNA was functionalized with a sulfide (S-S) moeity, thereby providing KRAS G12C thiol-siRNA.
AXL siRNA was obtained by annealing equal molar amounts of the sense oligonucleotide with SEQ ID NO. 3 with the antisense oligonucleotide with SEQ ID NO. 4 in PBS buffer. AXL siRNA was functionalized with a sulfide (S-S) moeity, thereby providing KRAS G12C thiol-siRNA.
The excess sulfo-smcc was removed by washing with RNAse-free water prior to siRNA addition. Cy5-labelled siRNA was used for quantifying conjugation efficiency of siRNA to the antibody present on Ab-GelNPs (or Ab-Gel(Gef)NPs) using florescence spectroscopy. The nanoconstruct precipitate after conjugation with siRNA was washed and dispersed in RNAse-free water. Example 2. Characterization of nRAGeD Nanoconjugates.
Direct estimation of the amount of gefitinib encapsulated within the nanoparticles was carried out using absorption spectroscopy. 1ml of the synthesized nanoparticles containing lmg/ml of gelatin nanoparticles was completely degraded using 2mg/ml of protease. The degraded solution was centrifuged at 20,000g for 30 minutes to ensure no precipitation of particles. The solution was then passed through lOKDa Amicon filters (lOOOOg for 10 minutes) the filtrate was characterized for determining the Gefitinib content using absorption spectroscopy at 331 nm. The gefitinib standard curve was then used to determine the concentration of the analyzed filtrate.
Determination of the encapsulation efficiency of gefitinib within the nanoparticles and percent drug loading was characterized using UV-Vis spectroscopy as reported earlier for gefitinib and GelNPs. Gel(Gef)NPs at concentration of 2mg/ml dispersed in DI water was subjected to protease degradation. The translucent solution turned transparent after 1 hr indicating collapse of gelatin nanoparticles. To ensure that the particles are completely degraded, the solution was centrifuged at 20,000g for 20 mins and absence of a nanop articulate precipitate indicated complete degradation of the matrix. The solution was then passed through 0.2 μιη filter and the filtrate was analyzed for characteristic 331 nm absorption peak. Gefitinib calibration curve was used as reference. Analysis revealed 40% encapsulation efficiency with 5μg of gefitinib per mg of Gel(Gef)NPs.
Monoclonal Antibody, CETUXIMAB™, was conjugated to the surface of GelNPs or Gel(Gef)NPs. The lysine moiety present on the antibody was used to link with the carboxyl groups present on the gelatin. The amount of antibody conjugated to the nanoparticles was determined using the Bradford Assay. It was determined that 45 (±5) μg of cetuximab was present on the surface of the nanoparticles. The percentage of antibody conjugation changed proportionally with the relative initial amount of GelNPs for all 5 experiments carried out for reproducibility (amount of CETUXIMAB™ was kept constant at 600 μ ).
However, normalization of an antibody conjugated with per mg of Gel NPs remained constant at 45 (±5) μg per mg of Gel NPs. The hydrodynamic size of the antibody conjugated nanoparticles did not show any significant change and was determined to be 210 nm. See Figure 4. TEM images however appeared relatively well resolved in the case of Ab-Gel(Gef) NPs compared to Gel(gef) NPs, as shown in Figure 7. This could be due to the increase of the surface density of the nanoconstruct leading to a relatively higher contrast for the Ab-Gel NPs compared to GelNPs. The ζ of Ab- GelNPs or Ab-Gel (Get) NPs (in DI Water), however, showed a drastic change post surface modification. The ζ changed to -12mV from +18mV confirming nanoparticle surface alteration. See Figures 5 and 6.
Estimation of siRNA loaded on the nanocomplex was carried out using absorption spectroscopy. The supernatant of complex after centrifugation (20,000g, 20mins) was analyzed for characteristic 280nm peak of siRNA using UV-V is absorption spectroscopy and percentage of siRNA bound to the nanoparticle was determined to be 98 (±1) %. To ensure the high functionalization efficiency, cy5-labeled siRNA was used to determine the conjugation efficiency using florescence spectroscopy. Post centrifugal separation, the suspension was subjected to fluorescence spectroscopy with emission at 670nm. Using the manufacturer's Extinction coefficient (367,569 L.moH.cm"1), the fluorescence signal obtained was consistent with earlier results and revealed ~ 98.5% conjugation. The supernatant had negligible fluorescence signal. Visual observation of characteristic blue color of Cy5 present on the nanoconstruct pellet and absence of the color in the supernatant also confirmed the high siRNA conjugation as shown in Fig. 8A showing cy-siRNA solution in comparison to Ab-Gel-NP solution of Fig. 8B and nRAGeD in Fig. 8C. Absolute number of si RNA, antibodies and TKIs per GelNP is listed in
Table 1.
Concentration of which component comprising nRAGeD
Figure imgf000029_0001
Stability of siRNA in the nRAGeD nanoconjugate was analyzed by using SDS-PAGE gel electrophoresis. The nanoparticles with appropriate controls including naked siRNA, gelatin nanoparticles and CETUXIMAB™ were subjected to a 10% serum solution. At predetermined time intervals (0, 0.5, 1, 2, 4, 8 and 24 hr), the suspension were aliquoted and refrigerated at -50 °C. The solutions were then subjected to SDS- PAGE and presence of siRNA was detected using nucleic acid staining dye GelRed.
The use of the thio-ether bond for complexing siRNA to the antibody present on the gelatin nanoparticles renders it uncleavable from the nanoconstruct. Any gelatin degradation agent such as protease or antibody disruption would have adverse effect on siRNA quality. Therefore, the stability study of the siRNA was based on the direct GelRed nucleic acid staining of the siRNA present on the nanocomplex.
For in vitro stability studies, an aliquot of each sample containing 75 pmoles of siRNA was analyzed by 4-15 % polyacrylamide gel electrophoresis (PAGE, BioRad, 100V for 60 minutes) using Tris borate EDTA running buffer. The gels were then stained with GelRed (Thermo Scientific, USA) and imaged using UV trans- illumination light filter and image analysis was performed using Biorad Laboratories Image Lab v.3.0.
As shown in Figure 9A, a time related serum stability analysis using SDS- PAGE reveals highly stable siRNA present on the nRAGeD. The lane description for Fig. 9 is as follows: 1- Ohr, 2- 0.5hr, 3- lhr, 4- 2hr, 5- 4hr, 6- 12hr, 7- 24hr and 8- naked siRNA at 0 hr in DI water. The lower band in lane 1 corresponds to free siRNA and siRNA cleaved from nRAGeD by serum solution. The band disappears within 30 mins indicating the short stability of free siRNA in serum.
As also shown in Figure 9A, unbound or electrostatically bound
nanoparticles had degradation profile similar to naked siRNA. However, siRNA chemically bound to nRAGeD were highly stable with minimal degradation for 24hrs. siRNA sandwiched between antibody and gelatin nanoparticle or siRNA engulfed within antibody is protected from serum enzymes. An antibody, with a molecular weight of 152KDa can completely mask and protect the relatively small 14KDa oligonucleotide.
In addition, a 30-day stability analysis of the nanoparticle stored at -50°C showed minimal degradation (Figure 9B). In vitro stability studies of nRAGeD as analyzed by hydrodynamic size in biological media containing 10% serum showed no significant variations in the diameter of the nanoparticles until 24 hr time points (Figure 9C).
Example 3. Treatment of Cancer Cells with nRAGeD Nanoconjugates.
To understand the cellular internalization capability, Gel NP encapsulated with fluorescein (fl) dye (GelflNP) and siRNA labeled with cy5 dye (siRNAcy5) were used for detection with two different fluorescent signals. The internalization study was performed in the KRAS mutant H23 non-small cell lung cancer cell line. The internalization was analyzed using fluorescence microscopy (Figure 10). The H23 cells were incubated with various analogues of the nanoconjugate. For simplicity, dyes, Fluorescein (fl) and Cy5 (cy5) functionalized to the corresponding ingredient of the nanoparticle is depicted through subscript. The various analogues are as follows: (1) GelflNP-Ab-siRNAcy5, (2) GelflNP-Ab-siRNA, (3) GelNP-Abc^-siRNA, (4) Gel NP-Ab-siPvNACy5, (5) siRNAcy5 and (6) Abcy5. H23 cells were seeded in 6- well plates (5 x 105 cells/well). Cells were grown on a poly-L-lysine treated glass coverslip. 100 ul of each samples (Analogues 1, 2, 3, 4 and 5) were incubated for 4 hours at 37°C in serum free media. After treatment, resulting cover slips were washed with PBS (IX) to remove unbound particles and microscopic slides were prepared with DAPI nuclear stain. Slides were imaged using a polarized dark-field fluorescence microscope at 20X and recorded.
As shown in Figure 10, co-localization of siRNAcy5 and GelflNP was confirmed by two fluorescence signals emanating from cells. The figure shows co- localization of cy5 labelled siRNA and fluorescein encapsulated gelatin nanoparticles in H23 cells. Appropriate controls with and without fluorescein or cy5 were used. All images were recorded at 20X magnification. This confirms that nRAGeD delivers its drug load to cancer cells.
To estimate the relative amount of siRNA internalization within cells, a flow cytometry analysis was performed.
H23 cells were independently incubated with (i) siRNAcy5 along with transfecting agent (TA-siRNAcy5); (ii) Gel NP-Ab-siRNAcy5; or (iii) Ab-siRNAcy5 for 4 hours (Figure 11). After 4 hours, the cells were repeatedly washed to remove surface adhered molecules and were trypsinized. Subsequently, the cells were analyzed using flow cytometry and the results showed internalization in the following order: Gel NP- Ab-siRNAcy5 > TA-siRNAcy5 > Ab-siRNAcy5. The amount of siRNA internalized through was at least two fold higher than transfected siRNA (Figure 11). The results showed that nRAGeD is as an effective siRNA delivery system. It is important to ensure that internalized nanoparticle is present in the cytoplasm and knocks down the KRAS gene as intended and regulates the appropriate protein levels. In order to understand downstream protein level regulation before and after oncogene knockdown, H23 cell line harboring KRAS mutation at G12C was used.
The effect of nRAGeD on the RAS/RAF/MEK/ERK cascade was studied. Untreated H23 cells exhibit phosphorylated downstream proteins in two effector pathways. In first pathway, RAS activates downstream effector enzymes enabling cell proliferation and survival through phosphorylation of RAF. This phosphorylation in- turn activates mitogen activated protein kinase (MEK/MAPK) that is responsible for activation of ERK. In second effector pathway, RAS has been found to activate PI3K effector pathway leading to phosphorylated AKT.
The PI3K/AKT signaling network that runs parallel to RAS/MAPK pathway is known to have several points of interaction with each other influencing inter- signal transduction. The disruption of RAS signaling with oncogene knockdown results in downregulation of primary downstream protein pMEK as well as parallel pathway protein pAKT. The results indicate a direct intrinsic relation between the two pathways primarily governed by RAS as shown in Figures 12A and 12B by Western Blot analysis. Figure 12a is a Western Blot analysis which shows expression of proteins pMEK, MEK, pACT, AKT, pEGFR, EGFR and KRAS in H23 cancer cells treated with nRAGeD in comparison to H23 not treated or treated with KRAS siRNA alone. As reported in Figure 12B, a significant downregulation of phosphorylated MEK and AKT is observed in cancer cells treated with nRAGeD.
The Western blot analysis was performed as follows. Cells were seeded at a density of 1 x 106 cells/ml and incubated for overnight at 37°C in 5% CO2 atmosphere. Nanoparticle and relevant control samples were incubated in serum free media for the period of 72 hrs. For control experiments, siRNA transfection (240 nM) was performed using TransIT-X2 dynamic delivery system transfecting agent (Minis Bio) as per manufacturer's instructions. Whole-cell lysates were prepared using Triton X 100 lysis buffer with MS-SAFE protease and phosphatase cocktail inhibitor (Sigma- Aldrich) and the protein concentration was equalized by Bicinchoninic acid assay (Sigma-Aldrich). Proteins were separated by 4-15% SDS-PAGE (Bio-Rad) and were transferred onto nitrocellulose membranes (GenScript).
Membranes were incubated with primary antibody overnight, were washed and incubated with secondary antibody. Primary antibodies used for western blotting are rabbit polyclonal anti- -actin, rabbit monoclonal anti-AKT, rabbit monoclonal anti- phospho-AKT, rabbit polyclonal anti-MEKl/2, rabbit polyclonal anti-phospho-MEKl/2, rabbit monoclonal anti-EGFR, rabbit monoclonal anti-phospho-EGFR, rabbit monoclonal anti-SHP2, rabbit polyclonal anti-phospho-SHP2 (Tyr542), rabbit polyclonal anti- phospho-SHP2 (Tyr580), rabbit monoclonal anti-phospho-GAB 1 (Tyr627), rabbit polyclonal anti-phospho-GAB 1 (Tyr307), all from Cell Signaling and mouse monoclonal anti-KRAS from Santa Cruz Biotech. The membranes were developed with peroxidase- labeled anti-mouse or anti-rabbit IgG (Cell Signaling Tech.) using enhanced
chemiluminescence substrate (Pierce) and imaged on Fujifilm LAS-3000 imaging system. Actin protein levels were used as a control for adequacy of equal protein loading. Protein expression levels were quantified by densitometry analysis.
Additional Western blot analysis was performed to detect phosphorylation of GAB 1. As shown in Figure 13, GAB1 and pGABl at Tyr 627 was found to be upregulated upon treatment with nRAGeD while no substantial difference was found for pGAB 1-307.
Another Western blot analysis was performed for SHP2, pSHP2 (Y542) and pSHP2 (Y580) as shown in Figures 14A and 14B. As shown by Western blot (Figure 14A) and calculated by its densitometry analysis (Figure 14B) SHP2, pSHP2 (Y542) and pSHP2 (Y580) remained unchanged after treatment with Gel NP (without gefitinib). However, a significant downregulation was found in the presence of gefitinib for the cells transfected with siRNA or treated with nRAGeD. In Figure 14 A, treatment on KRAS mutated H23 cells was performed by either transfecting cells with siRNA or by delivering siRNA using a gelatin nanoparticle not loaded with gefitinib did not show any effect on SHP2 and p-SHP2. However, in the presence of gefitinib, pSHP2 (Y542), pSHP2 (Y580) and SHP2 protein were downregulated indicating impaired SHP2 function - a probable cause of H23 cell apoptosis after oncogene knockdown. This result is confirmed by the densitometry image analysis of Figure 14B using BioRad Image lab V.3 was carried out to quantify the proteins.
Considering downregulation of downstream-phosphorylated proteins, the cell viability of H23 cells (MTT assay) after knocking down the RAS pathway was then investigated. For comparison of various individual components of the nanoparticle, the cell toxicity data was normalized with gefitinib concentration and the corresponding concentration of appropriate controls are shown in Figure 15.
The IC50 value of gefitinib for H23 cell line was determined to be 50 μΜ. Interestingly, transfected siRNA (4 μΜ, dose corresponding to 50 μΜ gefitinib) did not cause any cytotoxicity and the viability of cells remained 100%, suggesting oncogenic disruption alters the effector pathway, but does not lead to apoptosis.
When nRAGeD was used, the IC50 value drastically reduced by 20 fold to 2.5 μΜ, and complete loss of cell viability was found for nanoparticle containing 5 μΜ of gefitinib, as shown in Figure 16 which shows the cell viability of the nanoparticles at 5 μΜ gefitinib concentration was 5% compared to 25% viability for cells transfected with siRNA followed by gefitinib treatment.
This in vitro cytotoxicity analysis was performed according to the following protocol. H23 human adenocarcinoma non-small cell lung cancer cells
(ATCC, USA) and A549 human adenocarcinoma epithelial cells (ATCC, USA) were grown in RPMI 1640 medium supplemented with 4.5 g/L D-glucose, 25 mM HEPES, 0.11 g/L sodium pyruvate, 1.5 g/L sodium bicarbonate, 2 mM L-glutamine, 10% heat- inactivated fetal bovine serum (Altlanta Biologicals, USA) and 0.1% v/v gentamycin.
Cells were cultured in a humidified atmosphere of 95% air and 5% CO2 at 37 °C (Thermo Scientific, USA). For determining in vitro cytotoxicity, the MTT assay was performed by incubating various samples including the nanoparticle of interest on H23 and A549 cells.
The concentrations were normalized with respect to gefitinib concentration for all samples (50 μΜ, 5 μΜ, 0.5 μΜ, 0.05 μΜ, 0.005 μΜ and 0 μΜ). For samples that did not contain gefitinib, weight of gelatin nanoparticles was used for normalization. Each sample was analyzed in triplicate. After 24 hours of incubation, 10 μΐ of MTT solution (ATCC, USA) was added and the plate was incubated at 37 °C for 4 hours. Crystals formed were dissolved in 100 μΐ solubilizing buffer and the plates were kept at 25 °C for 2 hours. The intensity of the color developed after addition of the solubilizing buffer was measured using Biotek Cytation 3 spectrophotometer at 570 nm.
Viability of the cells transfected with various samples was then calculated by considering the untreated cells as 100% viable.
The controls used for cytotoxicity assay include gefitinib, transfected siRNA with and without gefitinib (siRNA (TA)+gef, siRNA (TA)), cetuximab (Ab), cetuximab-siRNA (Ab-siRNA) with and without gefitinib, gelatin nanoparticles (Gel NP), gefitinib encapsulated gelatin nanoparticles (GelGEFNP), and mock siRNA with gefitinib (see Figures 15, 17, and 19). No significant changes in cell toxicity relative to nRAGeD were found in the case of controls.
As shown in Figure 17, in vitro cellular viability data was obtained after treatment with gefitinib, siRNA(TA), siRNA(TA)+Gef, or Ab-siRNA(TA)+Gef on KRAS mutant H23 cells. Transfected siRNA showed no toxicity to the cells. However, cells transfected with siRNA and subsequently treated with gefitinib, exhibited viability of 30% at 5 μΜ gefitinib concentration. Ab-siRNA conjugate upon transfection and treatment with gefitinib showed cell viability of 5% at 50μΜ gefitinib concentration. Results indicated post oncogene knockdown, H23 cells get sensitized toward gefitinib.
As shown in Figure 18, in vitro cellular viability of individual components of nRAGeD and physical mixture of all components together on H23 cells showed minimal cytotoxicity indicating the toxicity caused specifically by a combination of drugs delivered by nRAGeD in H23 cells. Thus, there is a synergistic effect of drugs provided by nRAGeD.
Figure 19 reports in vitro cellular viability of H23 cells transfected with mock siRNA followed by treatment with gefitinib. Results indicate minimal change in viability for mock siRNA compared to the viability of cells treated with gefitinib.
The treatment effect observed in H23 cells was not observed in other epithelial cancer cells A549 which harbor the G12S mutation in KRAS, as shown in Figure 20. Thus, KRAS G12C siRNA is highly specific for cancers with this particular point mutation.
The effect of the oncogene knockdown on gene expression of DUSP6 and NT5E genes were observed by quantitative real-time RT-PCR. Initially H23 cells (1x106 cells/well) were treated with 4 samples including untreated, GelNP-Ab, GelNP-Ab-siRNA and siRNA (transfection agent). RNA was extracted through standard RNA extraction protocol. cDNA was synthesized from RNA extracted from the treated cells. The quality and the concentration of the extracted RNA was determined using bioanalyzer. 18sRNA was used as an reference gene (housekeeping gene) for data normalization. Primers and probes for all genes were purchased from Integrated DNA Technologies (IDT). PCR was performed in a reaction volume of 20 μΐ containing 2 μΐ cDNA using the Gene Amp 7700 Sequence Detection System. The comparative Ct protocol was followed to determine the relative expression levels. These results are showin in Figures 22 A and 22B. Example 4. Treatment of a mammal with nRAGeD Nanoconjugates.
The safety study was conducted in five normal mice by repeated intravenous (IV) injection of the nRAGeD nanoconstruct (80 mg/Kg body weight) for three consecutive days, followed by euthanasia. During treatment, animals did not show any abnormal behavior. Subsequently, major organs were collected and histopathology was performed. The histology analysis as shown in Figure 21 indicated no signs of toxicity showing good tolerance for nRAGeD nanoconjugates.
All animal experiments were conducted in accordance with Freimann Life Science Center guidelines for humane animal treatment. In vivo dose safety studies of TBN were performed in normal mice. nRaGeD (80mg/Kg of body weight) was suspended in PBS and administered via tail vein for 3 consecutive days. Animals were monitored for any changes in behavior and no changes in behavor was noticed. After 3 days, animals were sacrificed and vital organs collected, tissues fixed in formalin, stained with H&E for histology.
REFERENCES
1 Jemal, A., Siegel, R., Xu, J. & Ward, E. Cancer statistics, 2010. CA: a cancer journal for clinicians 60, 277-300 (2010).
2 Mao, C. etal. KRAS mutations and resistance to EGFR-TKIs treatment in patients with non-small cell lung cancer: a metaanalysis of 22 studies. Lung cancer (Amsterdam, Netherlands) 69, 272-278 (2010).
3 Sunaga, N. et al. Knockdown of Oncogenic KRAS in Non-Small Cell Lung Cancers Suppresses Tumor Growth and Sensitizes Tumor Cells to Targeted Therapy. Molecular Cancer Therapeutics 10, 336-346, doi:10.1158/1535-7163.mct- 10-0750 (2011).
4 Buyens, K. et al. Liposome based systems for systemic siRNA delivery: Stability in blood sets the requirements for optimal carrier design. Journal of Controlled Release 158, 362-370, doi:10.1016/j.jconrel.2011.10.009 (2012).
5 Ding, Y. et al. Gold Nanoparticles for Nucleic Acid Delivery. Molecular Therapy 22, 1075-1083, doi:10.1038/mt.2014.30 (2014).
6 Whitehead, K. A., Langer, R. & Anderson, D. G. Knocking down barriers: advances in siRNA delivery. Nature Reviews Drug Discovery 8, 129-138, doi:10.1038/nrd2742 (2009).
7 Giljohann, D. A., Seferos, D. S., Prigodich, A. E., Patel, P. C. & Mirkin, C. A. Gene Regulation with Polyvalent siRNA- Nanoparticle Conjugates. Journal of the American Chemical Society 131, 2072-2073, doi:10.1021/ja808719p (2009).
8 Oh, Y.-K. & Park, T. G. siRNA delivery systems for cancer treatment. Advanced Drug Delivery Reviews 61, 850-862, doi:10.1016/j.addr.2009.04.018 (2009).
9 Gilleron, J. et al. Image-based analysis of lipid nanoparticle-mediated siRNA delivery, intracellular trafficking and endosomal escape. Nature Biotechnology 31, 638-646, doi:10.1038/nbt.2612 (2013).
10 Liu, P., Xu, B., Li, J. & Lu, H. BAG3 gene silencing sensitizes leukemic cells to bortezomib-induced apoptosis. FEBS Letters
583, 401-406, doi:10.1016/j.febslet.2008.12.032 (2009).
11 Liu, X. et al. Survivin gene silencing sensitizes prostate cancer cells to selenium growth inhibition. BMC Cancer 10, No pp given, doi:10.1186/1471-2407-10-418 (2010). Wei, L. et al. Knockdown of cancerous inhibitor of protein phosphatase 2A may sensitize NSCLC cells to cisplatin. Cancer Gene Therapy 21, 194-199, doi:10.1038/cgt.2014.18 (2014).
Saraswathy M, G. S. Recent developments in the co-delivery of siRNA and small molecule anticancer drugs for cancer treatment. Materials Today 17, 298-306 (2014).
Aleman, L M., Doench, J. & Sharp, P. A. Comparison of siRNA-induced off-target RNA and protein effects. Rna 13, 385- 395, doi:10.1261/rna.352507 (2007).
Aksamitiene, E., Kiyatkin, A. & Kholodenko, B. N. Cross-talk between mitogenic Ras/MAPK and survival PI3K/Akt pathways: a fine balance. Biochemical Society Transactions 40, 139-146, doi:10.1042/bst20110609 (2012).
Yun, C.-H. et al. The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP. Proceedings of the National Academy of Sciences of the United States of America 105, 2070-2075, doi:10.1073/pnas.0709662105 (2008).
Baker, N. M. & Der, C. J. Cancer Drug for an 'undruggable' protein. Nature (London, United Kingdom) 497, 577-578, doi:10.1038/naturel2248 (2013).
Rosell, R. et al. Prognostic impact of mutated K-ras gene in surgically resected non-small cell lung cancer patients. Oncogene 8, 2407-2412 (1993).
Huang, C, Li, M., Chen, C. & Yao, Q. Small interfering RNA therapy in cancer: mechanism, potential targets, and clinical applications. Expert Opinion on Therapeutic Targets 12, 637-645, doi:10.1517/14728222.12.5.637 (2008).
Ostrem, J. M., Peters, U., Sos, M. L, Wells, J. A. & Shokat, K. M. K-Ras(G12C) inhibitors allosterically control GTP affinity and effector interactions. Nature (London, United Kingdom) 503, 548-551, doi:10.1038/naturel2796 (2013).
Coester, C. J., Langer, K., Von Briesen, H. & Kreuter, J. Gelatin nanoparticles by two step desolvation-a new preparation method, surface modifications and cell uptake. Journal of Microencapsulation 17, 187-193 (2000).
Balthasar, S. et al. Preparation and characterisation of antibody modified gelatin nanoparticles as drug carrier system for uptake in lymphocytes. Biomaterials 26, 2723-2732, doi:10.1016/j.biomaterials.2004.07.047 (2005).
Faivre, L. etal. A simple HPLC-UV method for the simultaneous quantification of gefitinib and erlotinib in human plasma. Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences 879, 2345-2350, doi:10.1016/j.jchromb.2011.06.026 (2011).
Hickerson, R. P. et al. Stability Study of Unmodified siRNA and Relevance to Clinical Use. Oligonucleotides 18, 345-354, doi:10.1089/oli.2008.0149 (2008).
Alakhova, D. Y. & Kabanov, A. Y. Drug Delivery in Oncology. From Basic Research to Cancer Therapy. 3 Volumes. Edited by Felix Kratz, Peter Senter and Henning Steinhagen. Vol. 53 (2014).
Derfus, A. M., Chen, A. A., Min, D.-H., Ruoslahti, E. & Bhatia, S. N. Targeted Quantum Dot Conjugates for siRNA Delivery. Bioconjugate Chemistry 18, 1391-1396, doi:10.1021/bc060367e (2007).
Zugasti, O. et al. Raf-MEK-Erk cascade in anoikis is controlled by Racl and Cdc42 via Akt. Molecular and Cellular Biology 21, 6706-6717, doi:10.1128/mcb.21.19.6706-6717.2001 (2001).
Schmid, K. et al. EGFR/KRAS/BRAF mutations in primary lung adenocarcinomas and corresponding locoregional lymph node metastases. Clinical cancer research : an off icial journal of the American Association for Cancer Research 15, 4554- 4560 (2009).
Ochi, N. et al. Src mediates ERK reactivation in gefitinib resistance in non-small cell lung cancer. Experimental Cell Research 322, 168-177, doi:10.1016/j.yexcr.2014.01.007 (2014).
Li, H. et al. Blocking the PI3K/AKT and MEK/ERK signaling pathways can overcome Gefitinib-resistance in non-small cell lung cancer cell lines. Advances in Medical Sciences 56, 275-284, doi:10.2478/vl0039-011-0043-x (2011).
Schneeberger Valentina, E. et al. Inhibition of SHP2 suppresses mutant EGFR-induced lung tumors in transgenic mouse model of lung adenocarcinoma. Oncotarget 6, 6191-6202 (2015).
Bermudez, O. et al. Post-transcriptional regulation of the DUSP6/MKP-3 phosphatase by MEK/ERK signaling and hypoxia. Journal of Cellular Physiology 226, 276-284, doi:10.1002/jcp.22339 (2010).
Zhang, Z. et al. Dual specificity phosphatase 6 (DUSP6) is an ETS-regulated negative feedback mediator of oncogenic ERK signaling in lung cancer cells. Carcinogenesis 31, 577-586, doi:10.1093/carcin/bgq020 (2010).
Zhi, X. et al. Potential prognostic biomarker CD73 regulates epidermal growth factor receptor expression in human breast cancer. IUBMB Life 64, 911-920, doi:10.1002/iub.l086 (2012).
Giubellino, A., Burke, T. R. & Bottaro, D. P. Grb2 signaling in cell motility and cancer. Expert Opinion on Therapeutic Targets 12, 1021-1033, doi:10.1517/14728222.12.8.1021 (2008).
Cai, T., Nishida, K., Hirano, T. & Khavari, P. A. GAB1 and SHP-2 promote Ras/MAPK regulation of epidermal growth and differentiation. Journal of Cell Biology 159, 103-112, doi:10.1083/jcb.200205017 (2002).
Zhang, S. Q. et al. Receptor-specific regulation of phosphatidylinositol 3'-kinase activation by the protein tyrosine phosphatase SHP2. Molecular and Cellular Biology 22, 4062-4072, doi:10.1128/mcb.22.12.4062-4072.2002 (2002). Derman, M. P., Cunha, M. J., Barros, E. J. G., Nigam, S. K. & Cantley, L. G. HGF-mediated chemotaxis and tubulogenesis require activation of the phosphatidylinositol 3-kinase. American Journal of Physiology 268, F1211-F1217 (1995). Yu, C. F., Liu, Z.-X. & Cantley, L. G. ERK negatively regulates the epidermal growth factor-mediated interaction of GAB1 and the phosphatidylinositol 3-kinase. Journal of Biological Chemistry 277, 19382-19388, doi:10.1074/jbc.M200732200 (2002).
Chen, J. -T. et al. Cigarette smoking induces overexpression of hepatocyte growth factor in type II pneumocytes and lung cancer cells. American Journal of Respiratory Cell and Molecular Biology 34, 264-273, doi:10.1165/rcmb.2005-0117OC (2006).
Chiang, Y.-Y. Hepatocyte growth factor induces hypoxia-related interleukin-8 expression in lung adenocarcinoma cells. Molecular Carcinogenesis 48, 662-670, doi:10.1002/mc.20521 (2009).
Hoeben, A., Martin, D., Clement, P. M., Cools, J. & Gutkind, J. S. Role of GRB2-associated binder 1 in epidermal growth factor receptor-induced signaling in head and neck squamous cell carcinoma. International Journal of Cancer 132, 1042- 1050, doi:10.1002/ijc.27763 (2013).
Jeannot, V. et al. The PI3K/AKT pathway promotes gefitinib resistance in mutant KRAS lung adenocarcinoma by a deacetylase-dependent mechanism. International Journal of Cancer 134, 2560-2571, doi:10.1002/ijc.28594 (2014). Yuan, T. L. & Cantley, L. C. PI3K pathway alterations in cancer: variations on a theme. Oncogene 27, 5497-5510, doi:10.1038/onc.2008.245 (2008).
Gu, H. & Neel, B. G. The GAB in signal transduction. Trends in Cell Biology 13, 122-130, doi:10.1016/s0962- 8924(03)00002-3 (2003).
Lazzara, M. J. et al. Impaired SHP2-mediated extracellular signal-regulated kinase activation contributes to gefitinib sensitivity of lung cancer cells with epidermal growth factor receptor-activating mutations. Cancer Research 70, 3843- 3850, doi:10.1158/0008-5472.can-09-3421 (2010).
Furcht, C. M., Munoz Rojas, A. R., Nihalani, D. & Lazzara, M. J. Diminished functional role and altered localization of SHP2 in non-small cell lung cancer cells with EGFR-activating mutations. Oncogene 32, 2346-2355, doi:10.1038/onc.2012.240 (2013).
Bermudez, O., Marchetti, S., Pages, G. & Gimond, C. Post-translational regulation of the ERK phosphatase DUSP6/MKP3 by the mTOR pathway. Oncogene 27, 3685-3691, doi:10.1038/sj.onc.l211040 (2008).
Various features of the invention are set forth in the appended claims.

Claims

1. A nanoparticle conjugate comprising a small interfering RNA (siRNA) linked to an antibody that is bonded to the surface of a gelatin nanoparticle that physically encapsulates a drug.
2. The conjugate of claim 1, wherein one end of siRNA is coupled to an epidermal growth factor receptor (EGFR) targeting monoclonal antibody via a thio-ether bond and a lysine functional group present on the antibody is bridged with carboxyl groups present on the gelatin nanoparticle.
3. The conjugate of claim 1, wherein the drug comprises a tyrosine kinase inhibitor drug.
4. The conjugate of claim 1, wherein the drug is selected from the group consisting of cisplatin, oxaliplatin, gefitinib, and erlotinib.
5. The conjugate of claim 1, wherein the siRNA is selected from the group consisting of a siRNA specific to mutant KRAS and siRNA specific to AXL.
6. The conjugate of claim 1, wherein the siRNA is specific for KRAS with a point mutation in codon 12.
7. The conjugate of claim 1, wherein the siRNA comprises 5'- GUUGGAGCUUGUGGCGUAGUUUU-3' (SEQ ID NO. 1) annealed with 5'- AACUACGCCACAAGCUCCAACUU-3' (SEQ ID NO. 2).
8. The conjugate of claim 7, wherein 5' guanine in the oligonucleotide with SEQ ID NO. 1 is modified with the disulfide (S-S) moiety.
9. The conjugate of claim 1, wherein the si-RNA comprises 5'- GGAACUGCAUGCUGAAUGAUU (SEQ ID NO. 3) annealed with 5'- UCAUUCAGCAUGCAGUUCCUU-3' (SEQ ID NO. 4).
10. The conjugate of claim 9, wherein 5' guanine in the oligonucleotide with SEQ ID NO. 1 is modified with the disulfide (S-S) moiety.
11. The conjugate of claim 1 , wherein the gelatin particle is prepared from gelatin 300 bloom by the two-step desolvation process.
12. A method of forming a nanoparticle conjugate of claim 1, the method comprising encapsulating the drug in the gelatin nanoparticle, bonding the antibody to the surface of the gelatin nanoparticle, and linking the siRNA to the antibody via a thio-ether bond.
13. A method of disease treatment, the method comprising adminstering to a patient a nanoconjugate comprising a small interfering RNA (siRNA) linked to an antibody bonded to the surface of a gelatin nanoparticle which encapsulates a drug.
14. The method of claim 13, wherein the disease is a metastatic cancer.
15. The method of claim 13 , wherein the disease is a cancer selected from the group consisting of non-small lung carcinoma, brain tumor, colon cancer, head and neck cancer, prostate cancer, breast cancer and stomach cancer.
16. The method of claim 13, wherein the patient is administered the nanoconjugate in which the drug is gefitinib, the antibody is EGFR-targeting antibody CETUXIMAB™ and the siRNA comprises the oligonucleotide with SEQ ID NO. 1 annealed with the oligonucleotide with SEQ ID NO. 2.
17. The method of claim 13, wherein the patient is tested for KRAS mutations prior to the administration of the nanoconjugate.
PCT/US2016/042191 2015-07-15 2016-07-14 Targeted nanoparticle conjugate and method for co-delivery of sirna and drug Ceased WO2017011618A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/743,892 US10426842B2 (en) 2015-07-15 2016-07-14 Targeted nanoparticle conjugate and method for co-delivery of siRNA and drug

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562192782P 2015-07-15 2015-07-15
US62/192,782 2015-07-15

Publications (1)

Publication Number Publication Date
WO2017011618A1 true WO2017011618A1 (en) 2017-01-19

Family

ID=57757581

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/042191 Ceased WO2017011618A1 (en) 2015-07-15 2016-07-14 Targeted nanoparticle conjugate and method for co-delivery of sirna and drug

Country Status (2)

Country Link
US (1) US10426842B2 (en)
WO (1) WO2017011618A1 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018183944A1 (en) * 2017-03-31 2018-10-04 The Curators Of The University Of Missouri Compositions for the treatment of drug-resistant tumors and methods of use thereof
WO2019118818A1 (en) * 2017-12-14 2019-06-20 Janssen Biotech, Inc. Targeting with fibronectin type iii like domain molecules
WO2019175845A3 (en) * 2018-03-15 2020-03-05 Levim Biotech Llp Antibody-biomolecule conjugates linked through multifunctional macromolecule and uses thereof
WO2020234868A1 (en) * 2019-05-17 2020-11-26 Silenseed Ltd. Compositions and methods for reducing perineural invasion and pain
US11299534B2 (en) 2016-12-14 2022-04-12 Janssen Biotech, Inc. CD8A-binding fibronectin type III domains
US11345739B2 (en) 2016-12-14 2022-05-31 Janssen Biotech, Inc CD137 binding fibronectin type III domains
US11447539B2 (en) 2016-12-14 2022-09-20 Janssen Biotech, Inc. PD-L1 binding fibronectin type III domains
US11628222B2 (en) 2019-10-14 2023-04-18 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US11781138B2 (en) 2019-10-14 2023-10-10 Aro Biotherapeutics Company FN3 domain-siRNA conjugates and uses thereof
US12037379B2 (en) 2021-04-14 2024-07-16 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US12239710B2 (en) 2021-04-14 2025-03-04 Aro Biotherapeutics Company FN3 domain-siRNA conjugates and uses thereof
US12491255B2 (en) 2019-10-14 2025-12-09 Aro Biotherapeutics Company EPCAM binding fibronectin type III domains

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3024936B1 (en) 2013-07-25 2019-09-04 Exicure, Inc. Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
WO2016028940A1 (en) * 2014-08-19 2016-02-25 Northwestern University Protein/oligonucleotide core-shell nanoparticle therapeutics
CR20170181A (en) 2014-10-06 2017-05-31 Exicure Inc ANTI-TNF COMPOUNDS
US11213593B2 (en) 2014-11-21 2022-01-04 Northwestern University Sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
EP4302834A3 (en) 2016-07-12 2024-07-17 Revolution Medicines, Inc. 2,5-disubstituted 3-methyl pyrazines and 2,5,6-trisubstituted 3-methyl pyrazines as allosteric shp2 inhibitors
WO2018039629A2 (en) 2016-08-25 2018-03-01 Northwestern University Micellar spherical nucleic acids from thermoresponsive, traceless templates
JP7240319B2 (en) 2017-01-23 2023-03-15 レヴォリューション・メディスンズ,インコーポレイテッド Bicyclic compounds as allosteric SHP2 inhibitors
KR20190110588A (en) 2017-01-23 2019-09-30 레볼루션 메디슨즈, 인크. Pyridine Compounds as Allosteric SHP2 Inhibitors
WO2018209270A1 (en) 2017-05-11 2018-11-15 Northwestern University Adoptive cell therapy using spherical nucleic acids (snas)
CA3074690A1 (en) * 2017-09-07 2019-03-14 Revolution Medicines, Inc. Shp2 inhibitor compositions and methods for treating cancer
TW201930292A (en) 2017-10-12 2019-08-01 美商銳新醫藥公司 Pyridine, pyrazine, and triazine compounds as allosteric SHP2 inhibitors
JP7361693B2 (en) 2017-12-15 2023-10-16 レヴォリューション・メディスンズ,インコーポレイテッド Polycyclic compounds as allosteric SHP2 inhibitors

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100286241A1 (en) * 2007-09-18 2010-11-11 Intradigm Corporation Compositions comprising k-ras sirna and methods of use
WO2011014457A1 (en) * 2009-07-27 2011-02-03 Genentech, Inc. Combination treatments
US20110229580A1 (en) * 2010-03-22 2011-09-22 Indian Institute of Technology Bombay, School of Biosciences and Bioengineering Compositions and methods for nano-in-micro particles
WO2012143508A1 (en) * 2011-04-20 2012-10-26 Spheritech Ltd Cross-linked poly-e-lysine particles
WO2013078271A1 (en) * 2011-11-21 2013-05-30 Immunogen, Inc. Method of treatment of tumors that are resistant to egfr therapies by egfr antibody cytotoxic agent conjugate
WO2014002108A1 (en) * 2012-06-27 2014-01-03 Amrita Vishwa Vidyapeetham University A core-shell nanostructure on the basis of proteins with corresponding therapeutic agents
US20140105828A1 (en) * 2012-10-15 2014-04-17 Emory University Nanoparticles caring nucleic acid cassettes for expressing rna

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130195752A1 (en) * 2012-02-01 2013-08-01 Regents Of The University Of Minnesota Functionalized nanoparticles and methods of use thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100286241A1 (en) * 2007-09-18 2010-11-11 Intradigm Corporation Compositions comprising k-ras sirna and methods of use
WO2011014457A1 (en) * 2009-07-27 2011-02-03 Genentech, Inc. Combination treatments
US20110229580A1 (en) * 2010-03-22 2011-09-22 Indian Institute of Technology Bombay, School of Biosciences and Bioengineering Compositions and methods for nano-in-micro particles
WO2012143508A1 (en) * 2011-04-20 2012-10-26 Spheritech Ltd Cross-linked poly-e-lysine particles
WO2013078271A1 (en) * 2011-11-21 2013-05-30 Immunogen, Inc. Method of treatment of tumors that are resistant to egfr therapies by egfr antibody cytotoxic agent conjugate
WO2014002108A1 (en) * 2012-06-27 2014-01-03 Amrita Vishwa Vidyapeetham University A core-shell nanostructure on the basis of proteins with corresponding therapeutic agents
US20140105828A1 (en) * 2012-10-15 2014-04-17 Emory University Nanoparticles caring nucleic acid cassettes for expressing rna

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAUMER ET AL.: "Antibody-Mediated Delivery of Anti-KRAS-siRNA In Vivo Overcomes Therapy Resistance in Colon Cancer", CLINICAL CANCER RESEARCH, vol. 21, 15 March 2015 (2015-03-15), pages 1383 - 1394, XP055346326 *
BRAND ET AL.: "AXL Mediates Resistance to Cetuximab Therapy", CANCER RESEARCH, vol. 74, 15 September 2014 (2014-09-15), pages 5152 - 5164, XP055346328 *
MING ET AL.: "Bioconjugates for targeted delivery of therapeutic oligonucleotides", ADVANCED DRUG DELIVERY REVIEWS, vol. 87, 29 June 2015 (2015-06-29), pages 81 - 89, XP055346329 *
SRIKAR ET AL.: "Targeted nanoconjugate codelivering siRNA and tyrosine kinase inhibitor to KRAS mutant NSCLC dissociates GAB1-SHP2 post oncogene knockdown", SCIENTIFIC REPORTS, vol. 6, 17 August 2016 (2016-08-17), pages 1 - 14, XP055346330 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12559541B2 (en) 2016-12-14 2026-02-24 Janssen Biotech, Inc. CD8A-binding fibronectin type III domains
US12258385B2 (en) 2016-12-14 2025-03-25 Janssen Biotech, Inc. CD137 binding fibronectin type III domains
US11932680B2 (en) 2016-12-14 2024-03-19 Janssen Biotech, Inc. CD8A-binding fibronectin type III domains
US11299534B2 (en) 2016-12-14 2022-04-12 Janssen Biotech, Inc. CD8A-binding fibronectin type III domains
US11345739B2 (en) 2016-12-14 2022-05-31 Janssen Biotech, Inc CD137 binding fibronectin type III domains
US11447539B2 (en) 2016-12-14 2022-09-20 Janssen Biotech, Inc. PD-L1 binding fibronectin type III domains
US11576873B2 (en) 2017-03-31 2023-02-14 The Curators Of The University Of Missouri Compositions for the treatment of drug-resistant tumors and methods of use thereof
WO2018183944A1 (en) * 2017-03-31 2018-10-04 The Curators Of The University Of Missouri Compositions for the treatment of drug-resistant tumors and methods of use thereof
EP3724127A4 (en) * 2017-12-14 2021-09-08 Janssen Biotech, Inc. Targeting with fibronectin type iii like domain molecules
WO2019118818A1 (en) * 2017-12-14 2019-06-20 Janssen Biotech, Inc. Targeting with fibronectin type iii like domain molecules
WO2019175845A3 (en) * 2018-03-15 2020-03-05 Levim Biotech Llp Antibody-biomolecule conjugates linked through multifunctional macromolecule and uses thereof
WO2020234868A1 (en) * 2019-05-17 2020-11-26 Silenseed Ltd. Compositions and methods for reducing perineural invasion and pain
US11628222B2 (en) 2019-10-14 2023-04-18 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US11781138B2 (en) 2019-10-14 2023-10-10 Aro Biotherapeutics Company FN3 domain-siRNA conjugates and uses thereof
US12491255B2 (en) 2019-10-14 2025-12-09 Aro Biotherapeutics Company EPCAM binding fibronectin type III domains
US12589159B2 (en) 2019-10-14 2026-03-31 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US12037379B2 (en) 2021-04-14 2024-07-16 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US12239710B2 (en) 2021-04-14 2025-03-04 Aro Biotherapeutics Company FN3 domain-siRNA conjugates and uses thereof

Also Published As

Publication number Publication date
US10426842B2 (en) 2019-10-01
US20180200381A1 (en) 2018-07-19

Similar Documents

Publication Publication Date Title
US10426842B2 (en) Targeted nanoparticle conjugate and method for co-delivery of siRNA and drug
Xiao et al. Combining p53 mRNA nanotherapy with immune checkpoint blockade reprograms the immune microenvironment for effective cancer therapy
Zhang et al. Glioblastoma therapy using codelivery of cisplatin and glutathione peroxidase targeting siRNA from iron oxide nanoparticles
Wu et al. Synergistic cisplatin/doxorubicin combination chemotherapy for multidrug-resistant cancer via polymeric nanogels targeting delivery
Lang et al. Targeted co-delivery of the iron chelator deferoxamine and a HIF1α inhibitor impairs pancreatic tumor growth
Okamoto et al. Systemic administration of siRNA with anti-HB-EGF antibody-modified lipid nanoparticles for the treatment of triple-negative breast cancer
Xu et al. Multifunctional envelope-type siRNA delivery nanoparticle platform for prostate cancer therapy
Younis et al. A multifunctional lipid-based nanodevice for the highly specific codelivery of sorafenib and midkine siRNA to hepatic cancer cells
Wu et al. Multi-functionalized carbon dots as theranostic nanoagent for gene delivery in lung cancer therapy
Gu et al. Nanodiamond-mediated delivery of a G9a inhibitor for hepatocellular carcinoma therapy
Shah et al. Targeted nanomedicine for suppression of CD44 and simultaneous cell death induction in ovarian cancer: an optimal delivery of siRNA and anticancer drug
Woitok et al. Lipid-encapsulated siRNA for hepatocyte-directed treatment of advanced liver disease
Srikar et al. Targeted nanoconjugate co-delivering siRNA and tyrosine kinase inhibitor to KRAS mutant NSCLC dissociates GAB1-SHP2 post oncogene knockdown
Modi et al. Targeting of follicle stimulating hormone peptide-conjugated dendrimers to ovarian cancer cells
Schiroli et al. Effective in vivo topical delivery of siRNA and gene silencing in intact corneal epithelium using a modified cell-penetrating peptide
Shukla et al. Multifunctional hybrid nanoconstructs facilitate intracellular localization of doxorubicin and genistein to enhance apoptotic and anti-angiogenic efficacy in breast adenocarcinoma
Melamed et al. Polyethylenimine–spherical nucleic acid nanoparticles against Gli1 reduce the Chemoresistance and Stemness of Glioblastoma Cells
Leake et al. RLIP76 regulates PI3K/Akt signaling and chemo-radiotherapy resistance in pancreatic cancer
Kotcherlakota et al. Restoration of p53 function in ovarian cancer mediated by gold nanoparticle-based EGFR targeted gene delivery system
Peng et al. Tumor-derived extracellular vesicles enable tumor tropism chemo-genetherapy for local immune activation in triple-negative breast cancer
Liang et al. Targeted-delivery of siRNA via a polypeptide-modified liposome for the treatment of gp96 over-expressed breast cancer
Kumar et al. Targeting of EGFR, VEGFR2, and Akt by engineered dual drug encapsulated mesoporous silica–gold nanoclusters sensitizes tamoxifen-resistant breast cancer
Qi et al. Targeting CD133+ laryngeal carcinoma cells with chemotherapeutic drugs and siRNA against ABCG2 mediated by thermo/pH-sensitive mesoporous silica nanoparticles
US20130052731A1 (en) HUMANIZED LEWIS-Y SPECIFIC ANTIBODY-BASED DELIVERY OF DICER SUBSTRATE siRNA (D-siRNA) AGAINST STAT3
Chen et al. Catcher in the rel: nanoparticles-antibody conjugate as NF-κB nuclear translocation blocker

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16825153

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16825153

Country of ref document: EP

Kind code of ref document: A1