WO2017000058A1 - Modulation of cyp8b1 for the prevention and treatment of liver fibrosis and metabolic disorders - Google Patents

Modulation of cyp8b1 for the prevention and treatment of liver fibrosis and metabolic disorders Download PDF

Info

Publication number
WO2017000058A1
WO2017000058A1 PCT/CA2016/000181 CA2016000181W WO2017000058A1 WO 2017000058 A1 WO2017000058 A1 WO 2017000058A1 CA 2016000181 W CA2016000181 W CA 2016000181W WO 2017000058 A1 WO2017000058 A1 WO 2017000058A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligomer
liver
cyp8b1
disease
alcoholic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2016/000181
Other languages
French (fr)
Other versions
WO2017000058A8 (en
Inventor
Michael R. Hayden
Jay PATANKER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of British Columbia
Original Assignee
University of British Columbia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of British Columbia filed Critical University of British Columbia
Publication of WO2017000058A1 publication Critical patent/WO2017000058A1/en
Publication of WO2017000058A8 publication Critical patent/WO2017000058A8/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/18Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with another compound as one donor, and incorporation of one atom of oxygen (1.14.18)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Definitions

  • the present invention relates to compositions that reduce the expression of the Cyp8b1 gene.
  • the compositions are useful for the prevention and/or treatment of liver fibrosis, chronic liver disease, autoimmune heptatitis, chronic viral hepatitis, alcoholic liver disease, non-alcoholic fatty liver disease and nonalcoholic steatohepatitis.
  • the compositions are also useful for the prevention and treatment of metabolic syndrome, obesity and diabetes.
  • BA Hepatic bile acid
  • Sterol 12-a hydroxylase (Cyp8b1) acts in the neutral BA synthesis pathway and catalyzes the conversion of 7a-hydroxy-4-cholesten-3-one into 7a,12a-dihydroxy-4-cholesten-3-one [Lefebvre, P., ef al., Role of bile acids and bile acid receptors in metabolic regulation. Physiol Rev, 2009. 89(1): p. 147-91].
  • the biosynthetic end products of these two steroids are CA and CDCA, the relative levels of, which determine the hydrophobicity and biological properties of the bile pool [Jones, R.D., et al., Delineation of biochemical, molecular, and physiological changes accompanying bile acid pool size restoration in Cyp7a1(-/- ) mice fed low levels of cholic acid. Am J Physiol Gastrointest Liver Physiol, 2012. 303(2): p. G263-74; and Staels, B. and V.A. Fonseca, Bile acids and metabolic regulation: mechanisms and clinical responses to bile acid
  • Cyp8b1 is a liver-specific gene and no significant expression has been detected in other organs [Jones, R.D., ef a/., Delineation of biochemical, molecular, and physiological changes accompanying bile acid pool size restoration in Cyp7a1(-/-) mice fed low levels of cholic acid. Am J Physiol Gastrointest Liver Physiol, 2012. 303(2): p. G263-74]. Mice lacking Cyp8b1 are characterized by a complete absence of cholic acid (CA) and CA regulates the synthesis, intestinal absorption and hepatic storage of cholesterol.
  • CA cholic acid
  • the overall bile acid pool size is increased in Cyp8b1 knockout mice and is predominantly composed of CDCA and bile acids derived from CDCA such as ⁇ , ⁇ , ⁇ - muricholic acids (MCA) and ursodeoxycholic acid (UDCA).
  • CDCA ⁇ , ⁇ , ⁇ - muricholic acids
  • UDCA ursodeoxycholic acid
  • bile acids also act as signaling molecules, activating nuclear farnesoid X receptor (FXR) and G-protein coupled receptor (TGR5)
  • Non-alcoholic fatty liver disease is characterized by an excessive fat accumulation in the liver, termed hepatic steatosis. It is diagnosed as fat exceeding 5% of liver mass occurring due to oversupply of lipids that exceeds the rates of lipid oxidation and export by the liver.
  • NAFLD has become the most common liver disorder in the industrialized world affecting an estimated 150 million people worldwide and together with its downstream sequela, hepatic insulin resistance, is a major contributor to morbidity arising from metabolic disorders [Pagano, G., et al., Nonalcoholic steatohepatitis, insulin resistance, and metabolic syndrome: further evidence for an etiologic association. Hepatology, 2002. 35(2): p.
  • dyslipidemia may also manifest as an increase in circulating LDL cholesterol and triglycerides and a reduction in HDL cholesterol [Chatrath, H., R. Vuppalanchi, and N. Chalasani, Dyslipidemia in patients with nonalcoholic fatty liver disease. Semin Liver Dis, 2012. 32(1): p. 22- 9; and Kumar, R., et al., Clinicopathological characteristics and metabolic profiles of non-alcoholic fatty liver disease in Indian patients with normal body mass index: Do they differ from obese or overweight non-alcoholic fatty liver disease? Indian J Endocrinol Metab, 2013. 17(4): p. 665-71].
  • Cholesterol is a key component of cellular membranes and is crucial for normal cellular and tissue function.
  • Cellular cholesterol levels are controlled through a tightly regulated feedback system. Hepatic cholesterol metabolism is dysregulated in NAFLD patients with increased cholesterol biosynthesis caused by a transcriptional induction of genes involved in cholesterol biosynthesis [Chun, Y.S. , et al. , Cholesterol regulates HERG K+ channel activation by increasing phospholipase C betal expression. Channels (Austin), 2013. 7(4): p. 275-87]. Diets containing >0.5% of cholesterol or high cholesterol diet (HCD), are associated with accelerated fat accumulation in the hepatocytes [Almena, M. and I.
  • Free cholesterol i) potentiates triacylglycerol accumulation in hepatocytes causing steatosis, ii) sensitizes hepatic stellate cells to TGF- ⁇ leading to fibrosis and iii) activates Kupffer cell inflammatory pathways [Teratani, T., et al., A high-cholesterol diet exacerbates liver fibrosis in mice via accumulation of free cholesterol in hepatic stellate cells. Gastroenterology, 2012. 142(1): p.
  • Cyp8b1 ' ' Other studies with mice having a targeted disruption of Cyp8b1 (Cyp8b1 ' ' ) suggest a role for the enzyme's activity in metabolic syndrome and diabetes. Kaur and colleagues showed that the absence of Cyp8b1 correlated with increased GLP-1 release and improved ⁇ -cell function [Kaur, A., et a/. , Loss of Cyp8b1 improves glucose homeostasis by increasing GLP-1. Diabetes, 2015. 64(4): p. 1168-79].
  • CypBb 1' x ApoE 1' mice show reduced atherosclerotic plaques, owing to decreased levels of apolipoprotein B (ApoB)-containing lipoproteins in the plasma, reduced hepatic cholesteryl esters and enhanced bile acid synthesis [Slatis, K., et a/., Abolished synthesis of cholic acid reduces atherosclerotic development in apolipoprotein E knockout mice. J Lipid Res, 2010. 51(11): p. 3289-98].
  • ApoB apolipoprotein B
  • WO2010009534 discloses the identification of genes related to lipid metabolism, more particularly genes which are modulated in the absence of apolipoprotein A1 (ApoA1).
  • WO2010009534 provides 1) screening methods for the identification of compounds that modulate the activity and/or expression level of more or more high-density lipoprotein cholesterol (HDLc) related genes or encoded proteins identified herein; 2) methods of treating or preventing lipid metabolism associated diseases; 3) diagnostic methods and kits for detecting a predisposition to lipid metabolism associated diseases and disorders; 4) animal models for identifying compounds for treating, preventing or decreasing susceptibility to a lipid metabolism associated disease or a HDL- metabolism disease; and 5) HDLc related genes and encoded proteins.
  • HDLc high-density lipoprotein cholesterol
  • PCT patent application WO2014018375 describes embodiments that relate to the diagnosis, prevention and/or treatment of diseases related to abnormal lipid metabolism. More particularly, disclosed therein is the discovery in human subjects having elevated HDL of mutated human CYP8B1 encoding genes and their encoded proteins, and exploitation of this discovery for use in compositions and methods for the diagnosis, treatment and prevention of cardiovascular diseases, such as dyslipidemia, atherosclerosis, low HDL diseases and related disorders, including methods for identifying agents that modulate CYP8B1 activity.
  • cardiovascular diseases such as dyslipidemia, atherosclerosis, low HDL diseases and related disorders
  • kits for detecting, diagnosing, prognosing or determining a predisposition to diseases related to abnormal lipid metabolism, as well as CYP8B1 -directed screening assays, kits, antibodies, agents, nucleic acids, polypeptides, cells, vectors, transgenic animals and compositions.
  • the present invention provides methods of treating or preventing diabetes, obesity, metabolic syndrome, NAFLD or NASH in a subject, a method comprising administering a therapeutically effective amount of a sterol 12-a hydroxylase (Cyp8b1 ) inhibitor compound to a subject.
  • a sterol 12-a hydroxylase (Cyp8b1 ) inhibitor compound administered to a subject.
  • the Cyp8b1 inhibitor compound may be an interference oligonucleotide.
  • the compound may be an RNA interference, antisense compound or a locked- nucleic acid gapmer oligonucleotide.
  • the compound may be an oligonucleotide with substantial sequence similarity to SEQ ID NO: 1-2.
  • Illustrative embodiments of the present invention provide an oligomer of between 4 to 49 nucleobases in length which comprises a contiguous nucleotide sequence of a total of between 4 to 49 nucleotides, wherein the contiguous nucleotide sequence is targeted to hybridize to a portion of SEQ ID NO: 104:
  • CTTCCGCTACCGCCTGCATCCTACAGAGTGA (SEQ ID NO: 104), wherein the oligomer, when bound to the portion of SEQ ID NO: 104 reduces expression of Sterol 12-ct hydroxylase (Cyp8b1 ) in a cell or tissue.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is between 14 to 29 nucleotides in length.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is between 18 to 23 nucleotides in length.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is between 21 to 27 nucleotides in length.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the cell or tissue is a liver cell or a liver tissue.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer comprises a sequence selected from the group consisting of SEQ ID NOs 57 to 103, 105 and 106:
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is modified to include one ore more locked nucleic acid bases and one or more phosphorothioate modification.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the contiguous nucleotide sequence comprises nucleotide analogues.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has a modified internucleoside linkage.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the modified internucleoside linkage is a peptide- nucleic acid linkage, a morpholino linkage, a N3' to P5' phosphoramidate linkage, a methylphosphonate linkage or a phosphorothioate linkage.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has one or more modified sugar moiety.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the modified sugar moiety is 2 ' -O-alkyl oligoribonucleotide.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is a gapmer.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has a 2'MOE gapmer modification.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has a modified nucleobase.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the modified nucleobase is a 5-methyl pyrimidine or a 5- propynyl pyrimidine.
  • lllustrative embodiments of the present invention provide an oligomer described herein wherein the one or more nucleotide analogues comprise locked nucleic acids (LNA) units.
  • LNA locked nucleic acids
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the LNA units consist of beta-D- oxy-LNA monomers.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is selected from the group consisting of: 5' +G * +C*+T * +C * A*C * T*T*C*C * A * C * C*C*A*C * +T*+C*+C 3' (SEQ ID NO:1); and 5' +T * +T*+C*+A*T*C * T*C*G*C*T*G*A * G * G*G*+C * +A * +A3” (SEQ ID NO: 2), wherein '+' denotes a locked nucleic acid base and '*' indicates a
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer comprises a single stereoisomer.
  • Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer comprises a mixture of stereoisomers.
  • Illustrative embodiments of the present invention provide a pharmaceutical composition
  • a pharmaceutical composition comprising an oligomer described herein and a pharmaceutically acceptable diluent, carrier, salt or adjuvant.
  • Illustrative embodiments of the present invention provide a method of reducing the expression of Sterol 12-a hydroxylase (Cyp8b1) in a cell or tissue, comprising contacting the cell or tissue with an effective amount of an oligomer described herein or a pharmaceutical composition described herein.
  • Illustrative embodiments of the present invention provide a method described herein wherein the cell is within a tissue of a mammal.
  • Illustrative embodiments of the present invention provide a method of prophylactic treating or treating a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes, in a subject, comprising administering to the subject an effective amount of an oligomer described herein or administering a an effective amount of a pharmaceutical composition described herein, wherein the subject is currently suffering from or at risk for suffering from liver fibrosis.
  • a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes
  • Illustrative embodiments of the present invention provide a method of described herein wherein the subject is a mammal.
  • Illustrative embodiments of the present invention provide a method described herein wherein the mammal is a human.
  • Illustrative embodiments of the present invention provide use of an oligomer described herein for the treatment of a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • Illustrative embodiments of the present invention provide use of an oligomer described herein in the preparation of a medicament for the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • Illustrative embodiments of the present invention provide use of a pharmaceutical composition described herein for the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • Illustrative embodiments of the present invention provide a use described hierein wherein the disease is liver fibrosis.
  • Illustrative embodiments of the present invention provide an oligomer described herein for use in the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • Illustrative embodiments of the present invention provide a commercial package, comprising: a. an oligomer of any one of claims 1 to 21 ; and b.
  • a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
  • Illustrative embodiments of the present invention provide a commercial package described herein wherein the instructions are for the treatment of liver fibrosis.
  • Figure 1 Shows a comparison of whole livers and liver sections from mice that were fed normal chow (Chow) or a high-cholesterol diet (HCD). Right panel show the whole liver appearance of chow and HCD; center panel shows
  • B Oil Red O staining of 25 ⁇ cryosections of livers (400X) showing neutral lipid staining.
  • C Massons' trichrome staining of 10 ⁇ liver sections (200X) and analysis of collagen positive area, histogram: quantitation of collagen positive area, percent of total area. * p ⁇ 0.05, *** p ⁇ 0.0001 , mean ⁇ SEM, Mann-Whitney test.
  • Figure 2 (A) Representative micrographs (200X) from 9 control (+/+) and
  • Cyp8b1 knockout mice (-/-) fed 0.5% high cholesterol diet for 12 weeks.
  • C Representative western blot analysis of Calnexin as control and a-SMA proteins in +/+ and -/- liver homogenates, histogram: quantification of relative band densities from 4 control (+/+) and 4 Cyp8b1 knockout (-/--) liver homogenates relative to those of Calnexin.
  • Figure 8 Relative Cyp8b1 transcript levels in primary mouse hepatocytes upon 72h of treatment with two LNA gapmer hybrid oligonucleotides. Sequence Cyp8b1 (2_1) (SEQ ID NO:1) produced a 60% knockdown at the highest concentration tested. No differences in cell death were observed as measured with the LDH release assay at any of the concentrations.
  • Figure 9 shows Western blot analysis for Cyp8b1 or the Calnexin control following Cyp8b1 silencing in HepG2 cells using siRNAs: A) HDL2 si1 ; B) HDL2 si 101 ; C) HDL2 si 103; D) HDL2 si 109; E) HDL2 Dsi 2; and F) HDL2 Dsi 13.
  • Figure 10 shows Western blot analysis for Cyp8b1 or the Calnexin control following Cyp8b1 silencing in HepG2 cells using LNA gapmers: A) HDL2 LNA 1 ; and B) HDL2 LNA 3.
  • Figure 11 shows in vivo silencing with HDL2 LNA 500125 5'- ATCTCGCTGAGGGCA-3': A) Concentration dependent increase in fecal fat excretion; B) Enhanced fecal fat mass at 3mg/kg/day; C) Increased fecal cholesterol excretion; D) Body weight of mice before and after treatment with either HDL2 LNA or negative control LNA; and E) Hepatic Cyp8b1 protein levels and quantification.
  • Figure 12 shows lower fat mass and increased metabolic rate in Cyp8b1 knockout mice: A) graph of body weight in grams vs. time for both knockout and control; B) graph of body weight as a percentage vs. time for both knockout and control; C) graph of organ weight in grams of various organs for both knockout and control; D) graph of body composition in weight for fat mass, lean mass and body weight for both knockout and control; E) graph of food intake for day, night and total for both knockout and control; F) graph of oxygen consumption in milliliters per hour vs. time in hours for both knockout and control; G) graph of carbon dioxide production in milliliters per hour vs time in hours for both knockout and control; H) graph of respiratory exchange ratio vs.
  • Figure 13 shows lower hepatic damage and increased fecal cholesterol and fat excretion in Cyp8b1 knockout mice: A) graph showing AST in milliU/mL for both knockout and control; B) graph showing fecal dry weight in grams/day for both knock out and control; C) graph showing fecal lipid excretion in mg/day for both knockout and control; D) graph showing cholesterol excretion in mg/day for both knockout and control; and E) graph showing free fatty acids (FFA) excretion in ⁇ /day for both knockout and control.
  • FFA free fatty acids
  • Figure 14 A) shows two pie charts depicting the phylum level microbiota for cyp8b1 knockout mice and control mice; B) is a dendrogram distance tree of the microbiota; and C) shows bar graphs of the Genus level microbiota.
  • Figure 15 shows Mean free energy structure of the Hs_Cyp8b1 cDNA of minimum free energy of -577.70 kcal/mol; B) shows a plot depicting the interaction free energy (GREY) AGi and the energy needed to open existing structures in the longer sequence (BLACK) on the y-axis and nucleotide position on the x-axis; and C) shows the base pair probabilities of targeting sites.
  • a 'subject' refers to an animal or a mammal. Specific animals include rat, mouse, dog, cat, cow, sheep, horse, pig or primate. A subject may further be a human, alternatively referred to as a patient. A subject may further be a transgenic animal. A subject may further be a rodent, such as a mouse or a rat.
  • an 'inhibitor' refers to a drug, compound or an agent that restrains, retards, or otherwise causes inhibition of a physiological, chemical or enzymatic action or function.
  • An inhibitor may cause at least 5% decrease in enzyme activity.
  • An inhibitor may also refer to a drug, compound or agent that prevents or reduces the expression, transcription or translation of a gene or protein.
  • An inhibitor may reduce or prevent the function of a protein, for instance binding to and/or activating another protein or receptor.
  • An inhibitor may reduce or prevent the interaction of an enzyme or protein with another enzyme or protein.
  • compounds which are sterol 12-a hydroxylase (Cyp8b1) inhibitors are sterol 12-a hydroxylase (Cyp8b1) inhibitors.
  • Cyp8b1 or sterol 12-alpha hydroxlase refers to the polypeptide expression product of the Cyp8b1 gene, the human orthologue corresponding to EntrezGene # 1582, NCBI Reference Protein NP_004382.
  • Homologous Cyp8b1 enzymes are found in other species which bear sequence similarity to human Cyp8b1 and may thus find utility in the present invention, including but not limited to mouse (EntrezGene # 13124; NCBI Reference Protein NP_034142) and rat (EntrezGene # 81924; NCBI Reference Protein NP_1 12520.1).
  • the compounds of the invention may be RNA compounds, for instance RNA interference compounds.
  • the term 'RNA' or 'RNA compound' as used in the present invention includes RNA molecules, RNA segments and RNA fragments.
  • RNA may be single stranded, double stranded, synthetic, isolated, partially isolated, essentially pure or recombinant.
  • RNA interference compounds may be comprised of a single stereoisomer or a combination of selected stereoisomers.
  • RNA compounds may be naturally occurring, or they may be altered such that they differ from naturally occurring RNA compounds. Alterations may include addition, deletion, substitution or modification of existing nucleotides. Such nucleotides may be either naturally occurring, or non-naturally occurring nucleotides. Alterations may also involve addition of non-nucleotide material, for instance at the end or ends of an existing RNA compound, or at a site that is internal to the RNA compound (i.e. at one or more nucleotides).
  • RNA compounds of the invention are capable of target-specific modulation of gene expression and typically exert their effect either by mediating degradation of the mRNA products of the target gene, or by preventing protein translation from the mRNA of the target gene.
  • Such RNA compounds may thus also be referred to as 'RNA interference compounds'.
  • the overall effect of interference with mRNA function is modulation of expression of the product of a target gene.
  • 'modulation' means either inhibition or stimulation - i.e. either a decrease or an increase in expression.
  • This modulation can be measured in ways which are routine in the art, for example by Northern blot assay or reverse transcriptase PCR of mRNA expression, Western blot or ELISA assay of protein expression, or by immunoprecipitation assay of protein expression.
  • the RNA compounds are antisense RNA compounds.
  • Antisense RNA compounds are typically single stranded RNA compounds which bind to complementary RNA compounds, such as target mRNA molecules, and block translation from the complementary RNA
  • the antisense RNA compounds include any RNA compound with sufficient complementary homology to bind to the Cyp8b1 mRNA transcript causing a reduction in translation of Cyp8b1 protein.
  • the RNA compounds may be small interfering RNA (siRNA) compounds.
  • siRNA compounds are short double stranded RNA compounds between 4 and 49 nucleotides in length. More preferably, siRNA compounds are between 16 to 29 nucleotides in length, even more preferably between 18 to 23 nucleotides in length and most preferably between 21-23 nucleotides in length.
  • the siRNA compounds may include short nucleotide 'overhangs' on each end, which are single stranded extensions which are not paired with a complementary base on the opposite strand.
  • siRNA compounds of the present invention may be synthesized as individual strands which are subsequently annealed to produce the double stranded siRNA compound.
  • the siRNA compounds may derived from a short hairpin RNA
  • siRNA RNA
  • dicer a cellular enzyme that processes the longer RNA compounds to produce siRNA compounds.
  • siRNA compounds mediate RNA interference via an enzyme-dependent process in which the target mRNA is degraded, such that it can no longer be translated into its associated protein product.
  • the double stranded siRNA compounds are separated into single stranded molecules and integrated into an activated 'RISC complex'. After integration into the RISC, siRNAs base-pair to their target mRNA and induce cleavage of the mRNA, thereby preventing it from being used as a translation template.
  • the antisense compounds and siRNA compounds can be modified to enhance the stability of the oligonucleotides, particularly for in vivo use.
  • Oligomer as used herein is meant to encompass any nucleic acid silencing agent (for example, siRNA, miRNA, ASO in all of their modified forms as described herein) and compositions comprising the nucleic acid silencing agent.
  • An oligomer may act by hybridizing to a target sequence.
  • the term 'medicament' as used herein refers to a composition that may be administered to a patient or test subject and is capable of producing an effect in the patient or test subject.
  • the effect may be chemical, biological or physical, and the patient or test subject may be human, or a non-human animal, such as a rodent or transgenic mouse, or a dog, cat, cow, sheep, horse, hamster, guinea pig, rabbit or pig.
  • the medicament may be comprised of the effective chemical entity alone or in combination with a pharmaceutically acceptable excipient.
  • 'pharmaceutically acceptable excipient' may include any and all solvents, dispersion media, coatings, antibacterial, antimicrobial or antifungal agents, isotonic and absorption delaying agents, and the like that are
  • An excipient may be suitable for intravenous, intraperitoneal, intramuscular, subcutaneous, intrathecal, topical or oral administration.
  • An excipient may include sterile aqueous solutions or dispersions for extemporaneous preparation of sterile injectable solutions or dispersion. Use of such media for preparation of medicaments is known in the art [Remington, The Science and Practice of Pharmacy, Edited by Allen, Loyd V., Jr, 22nd edition, 2012, Pharmaceutical Press].
  • compositions or compounds according to some embodiments of the invention may be administered in any of a variety of known routes.
  • methods that may be suitable for the administration of a compound include orally, intravenous, inhalation, intramuscular, subcutaneous, intraperitoneal, intra-rectal or intra-vaginal suppository, sublingual, and the like.
  • the compounds of the present invention may be administered as a sterile aqueous solution, or may be administered in a fat-soluble excipient, or in another solution, suspension, patch, tablet or paste format as is appropriate.
  • Other agents may be included in combination with the compounds of the present invention to aid uptake or metabolism, or delay dispersion within the host, such as in a controlled-release formulation.
  • controlled release formulations will be known to those of skill in the art, and may include microencapsulation, embolism within a carbohydrate or polymer matrix, and the like.
  • Other methods known in the art for making formulations are found in, for example, "Remington's Pharmaceutical Sciences", (19th edition), ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa.; and Remington, The Science and Practice of Pharmacy, Edited by Allen, Loyd V., Jr, 22nd edition, 2012, Pharmaceutical Press]
  • Compounds and compositions as described herein or for use as described herein may be administered by means of a medical device or appliance such as an implant, graft, prosthesis, stent, etc.
  • implants may be devised which are intended to contain and release such compounds or compositions.
  • An example would be an implant made of a polymeric material adapted to release the compound over a period of time.
  • compositions or compounds of some embodiments of the invention may vary depending on the route of administration (oral, intravenous, or the like) and the form in which the composition or compound is administered (solution, controlled release or the like). Determination of appropriate dosages is within the ability of one of skill in the art.
  • an 'effective amount', a 'therapeutically effective amount', or a 'pharmacologically effective amount' of a medicament refers to an amount of a medicament present in such a concentration to result in a therapeutic level of drug delivered over the term that the drug is used. This may be dependent on mode of delivery, time period of the dosage, age, weight, general health, sex and diet of the subject receiving the medicament. Methods of determining effective amounts are known in the art.
  • the compounds of the invention may thus be coupled to a targeting moiety.
  • the compounds of the invention may be coupled to a cell uptake moiety.
  • the targeting moiety may also function as the cell uptake moiety.
  • Oligomer as used herein is meant to encompass any nucleic acid silencing agent (for example, siRNa, miRNA, ASO in all of their modified forms as described herein) and compositions comprising the nucleic acid silencing agent.
  • An oligomer may act by hybridizing to a target sequence.
  • a phosphorothioate oligonucleotide bond modification alters the
  • phosphate linkage by replacing one of the non-bridging oxygens with sulfur.
  • the introduction of phosphorothioate linkages alters the chemical properties of the oligonucleotide.
  • the addition of phosphorothioate linkages reduces nuclease degradation of the oligonucleotide, thereby increasing the half-life in situ. Accordingly, this modification is particularly useful for antisense
  • oligonucleotides which when introduced into cells or biological matrices can interact with target nucleic acids to silence the expression of a particular transcript. Oligonucleotides containing phosphorothioate linkages accomplish this feat either through direct blockage of translation or enabling enzymatic degradation of the target transcript (for example, via RNase H).
  • phosphorothioate linkage creates a chiral center at each bond, which may result in multiple isomers of the oligonucleotide generated during synthesis and the isomers may have differential characteristics and functional properties. However, much of the isomer effects may be mitigated through careful positioning of the modifications or by using additional modifications in conjunction with the phosphorothioate bonds.
  • One or more of the phosphodiester linkages of the oligonucleotide moiety may be modified by replacing one or both of the two bridging oxygen atoms of the linkage with analogues such as -NH, -CH2, or -S.
  • analogues such as -NH, -CH2, or -S.
  • Other oxygen analogues known in the art may also be used.
  • modified oligonucleotide as used herein is meant to include
  • oligonucleotides that are substituted or modified.
  • primary bases adenine, guanine, cytosine, and thymine, or other natural bases such as inosine, deoxyinosine, and hypoxanthine
  • isosteric purine 2 ' deoxy- furanoside analogues, 2 ' -deoxynebularine or 2 ' deoxyxanthosine, or other purine and pyrimidine analogues such as 5-methyl pyrimidine or a 5-propynyl pyrimidine may also be utilized to improve stability and target hybridization.
  • a "modified sugar” as used herein when discussing an oligonucleotide moiety a sugar modified or replaced so as to be ribose, glucose, sucrose, or galactose, or any other sugar.
  • the oligonucleotide may have one or more of its sugars substituted or modified in its 2' position, i.e. 2 ' alkyl or 2'-0- alkyl.
  • An example of a 2 ' -O-alkyl sugar is a 2 ' -O-methylribonucleotide.
  • the oligonucleotide may have one or more of its sugars substituted or modified to form an a-anomeric sugar.
  • “Second-generation" oligonucleotides as used herein may be defined as oligonucleotides that are resistant to degradation by cellular nucleases and capable of hybridizing specifically to their target precursor mRNA or mRNA with equal or higher affinity than first generation ASOs.
  • An example of a 2 nd generation ASO is a 2'-0-(2-Methoxyethyl)-RNA (2' OE gapmer modification).
  • a 2'-MOE or a 2'OMe gapmer With a 2'-MOE or a 2'OMe gapmer the 5' and 3' ends may have 2'-MOE modified nucleotides to protect against degradation, but the gap between the 5' and 3' ends may be unmodified phosphodiester or phosphorothioate linkages that are substrates for RNase H.
  • Numerous other chemical modifications have been developed to improve ASOs. For example, morpholino, N3' to P5'
  • LNA Locked Nucleic Acid
  • RNA analog in which the ribose ring is connected by a methylene bridge between the 2'-0 and 4'-C atoms thus "locking" the ribose ring in the ideal conformation for Watson-Crick binding.
  • LNA oligonucleotides may be made shorter than traditional DNA or RNA oligonucleotides. LNA oligonucleotides are especially useful to detect small or highly similar targets.
  • nucleic acid silencing agent refers to a composition that acts in a sequence specific manner to effect a reduction in the level of a product (a "gene product") of a given nucleic acid sequence (e.g. a 'gene').
  • the reduction may be effected by interference with any of the processing of a pre- mRNA following transcription from the DNA of a cell or subject (e.g. splicing, 5' capping, 5' or 3' processing, or export of the processed mRNA to the cytoplasm) or by interference with translation of a mature mRNA, or by specific, directed destruction of the pre-mRNA or mature mRNA.
  • Antisense (ASO) and RNA interference (RNAi - effected by short interfering RNA, or siRNA) are two examples of such methods; microRNA (miRNA) is another.
  • An antisense oligonucleotide is an oligonucleotide that is
  • the nucleosides comprising an ASO may be purine or pyrimidine nucleosides, or a combination of purine and pyrimidine nucleosides, connected by an internucleoside linkage.
  • ASOs are described generally in, for example, Crooke 2004. Annu. Rev. Med 55:61-95; and in Curr Mol Med 4:465- 487.
  • siRNA is a short (20-30 nucleotide) double-stranded RNA (or modified RNA) molecule that may effect a reduction in the level of a gene product by allowing for specific destruction of mRNA via the RNA interference pathway.
  • the specific mRNA is degraded in the cytoplasm by the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • An miRNA is a short (20-30 nucleotide) single-stranded RNA molecule that may effect a reduction in the level of a gene product.
  • An miRNA is complementary to a part of an mRNA, either a coding region or a non-translated region (e.g. 5' untranslated region (UTR), 3' UTR).
  • a DNA ASO commonly referred to simply as an ASO, is a short (12-50 nucleotide) single stranded DNA (or modified DNA) molecule that may effect a reduction in the level of a gene product by inducing specific destruction of pre-mRNA or mRNA via RNase H-mediated cleavage.
  • the specific pre-mRNA or mRNA can be degraded in the nucleus and/or the cytoplasm by induction of RNAseH cleavage of DNA-RNA heteroduplexes.
  • a DNA ASO commonly referred to simply as an ASO, is a short (12-50 nucleotide) single stranded DNA (or modified DNA) molecule that may effect a reduction in the level of a gene product by inducing specific destruction of pre-mRNA or mRNA via RNase H-mediated cleavage.
  • the specific pre-mRNA or mRNA can be degraded in the nucleus and/or the cytoplasm by induction of RNAseH cleavage of DNA-RNA heteroduplexes.
  • nucleoside' refers to a molecule of ribose or deoxyribose sugar bonded through carbon-1 of the sugar ring to a nitrogenous base.
  • nitrogenous bases include purines such as adenine, guanine, 6-thioguanine, hypoxanthine, xanthine, and pyrimidines such as cytosine, thymine and uracil.
  • purine nucleosides examples include adenosine (A), guanosine (G), inosine (I), 2'-O-methyl-inosine, 2'-O-methyl-adenosine, 2'-O-methyl-guanine, 2- chlorodeoxyadenosine, 7-halo-7-deaza-adenosine, 7-halo-7-deaza-guanine, 7- propyne-7-deaza adenosine, 7-propyne-7-deaza-guanine, 2-amino-adenosine, 7- deazainosine, 7- thia-7,9-dideazainosine, formycin B, 8-Azainosine, 9- deazainosine, allopurinol riboside, 8-bromo-inosine, 8-chloroinosine, 7-deaza-2- deoxy-xanthosine, 7-Deaza-8-aza-adenosine, 7-d
  • pyrimidine nucleosides examples include deoxyuridine (dU), uridine (U), cytidine (C), deoxycytidine (dC), thymidine (T), deoxythymidine (dT), 5-fluoro-uracil, 5-bromouracil, 2'-0-methyl-uridine, 2'-0-methyl cytidine, 5- iodouracil, 5-methoxy-ethoxy-methyl-uracil, 5-propynyl deoxyuridine,
  • pseudoisocytidine 5-azacytidine, 5-(1-propynyl)cytidine, 2'-deoxypseudouridine, 4-thio-deoxythymidine, 4-thio-deoxyuridine, and the like, and other substituted pyrimidines as disclosed in Freier et al,1997 (Nucleic Acids Res. 25:4429-4443).
  • Purine or pyrimidine nucleosides also include phosphoramidite derivatives used in oligonucleotide synthesis using standard methods.
  • Nucleoside also includes nucleosides having substituted ribose sugars (bicyclic or otherwise).
  • Some representative patents and publications that teach the preparation of non-bicyclic modified sugars include, but are not limited to, U.S. Patents: 4,981 ,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811 ; 5,576,427; 5,591 ,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; 5,700,920; and 6,600,032; and WO 2005/121371.
  • Some representative patents and publications that teach the preparation of bicyclic modified sugars include, but are not limited to, 'locked nucleic acids', such as those described in WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 0148190, WO 02/28875, WO 03/006475, WO 03/09547, WO 2004/083430, US 6,268,490, US 6,794499, US 7,034,133.
  • Other examples of substituted ribose sugars are described in, for example, Freier, 1997 (Nucleic Acids Res. 25:4429-4443) and Herdewijn et al., 2000. (Antisense Nucleic Acid Drug Dev 10:297-310) both of which are incorporated by reference herein.
  • a 'nucleotide' refers to a nucleoside having an internucleoside linkage group bonded through the carbon-5 of the sugar ring, usually a mono-, di- or triphosphate, and may be suitable for enzymatic polymerization.
  • the nucleotides may be phosphoramidites, suitable for non-enzymatic polymerization or synthesis of nucleic acid polymers.
  • An internucleoside linkage group refers to a group capable of coupling two nucleosides, as part of an oligonucleotide backbone. Examples of
  • internucleoside linkage groups are described by Praseuth et al (Biochimica et Biophysica Acta 1489:181-206) and Summerton et al 1997. (Antisense and Nucleic Acid Drug Dev 7:187-195), both of which are incorporated herein by reference.
  • modified linkage groups modified ribose sugars or nitrogenous bases in an oligonucleotide may reduce the rate of hydrolysis of the oligonucleotide in vitro or in vivo.
  • Gapmer or "gap oligomer”, as used herein, refers to a chimeric oligomer having a central portion (a "gap") flanked by 3' and 5' "wings", wherein the gap has a modification that is different as compared to each of the wings.
  • modifications may include nucleobase, monomeric linkage, and sugar modifications as well as the absence of a modification (such as unmodified RNA or DNA).
  • a gapmer may be as simple as RNA wings separated by a DNA gap.
  • the nucleotide linkages in the wings may be different than the nucleotide linkages in the gap.
  • each wing comprises nucleotides with high affinity modifications and the gap comprises nucleotides that do not comprise that modification.
  • the nucleotides in the gap and the nucleotides in the wings may have high affinity modifications, but the high affinity modifications in the gap are different than the high affinity modifications in each of the wings.
  • the modifications in the wings may confer resistance to cleavage by endogenous nucleases, including RNaseH, while the modifications in the gap may be substrates for RNase H.
  • the modifications in the wings may confer resistance to cleavage by endogenous nucleases, including RNaseH, while the modifications in the gap may be substrates for
  • the modifications in the wings may be the same or different from one another.
  • the nucleotides in the gap may be unmodified and nucleotides in the wings may be modified.
  • a gapmer has a wing-gap-wing ratio, which may be represented numerically (wing#-gap#-wing#).
  • the gapmer may be symmetric (for example, 9-13-9, 9-12-9, 9-11-9, 9-10-9, 9-9-9, 9-8-9, 9-7-9, 9-6-9, 9-5-9, 9- 4-9, 9-3-9, 9-2-9, 9-1-9, 8-15-8, 8-14-8, 8-13-8, 8-12-8, 8-11-8, 8-10-8, 8-9-8, 8-
  • the gapmer may be asymmetric (for example, 8-13-9, 8-12-9, 8-11-9, 8-10-9, 8-9-9, 8-8-9, 8-7-9, 8-6- 9, 8-5-9, 8-4-9, 8-3-9, 8-2-9, 8-1-9, 7-15-8, 7-14-8, 7-13-8, 7-12-8, 7-11-8, 7-10-8, 7-9-8, 7-8-8, 7-7-8, 7-6-8, 7-5-8, 7-4-8, 7-3-8, 7-2-8, 7-1-8, 6-15-7, 6-14-7, 6-13-
  • a chimeric antisense oligonucleotide with a deoxy gap region which is greater than 10 nucleotides in length may be referred as a "gap-widened antisense oligonucleotide".
  • the wing regions may be one to eight high-affinity modified nucleotides in length.
  • the gap-widened antisense oligonucleotides may be 12 to 30 nucleotides in length capable of having, for example, various wing- gap-wing ratio may be selected from: 2-15-1 , 1-15-2, 1-14-3, 3-14-1 , 1-13-4, 4- 13-1 , 2-13-3, 3-13-2, 1-12-5, 5-12-1 , 2-12-4, 4-12-2, 3-12-3, 1-11-6, 6-11-1, 2-11- 5, 5-11-2, 3-11-4, 4-11-3, 2-16-1 , 1-16-2, 1-15-3, 3-15-1 , 2-15-2, 1-14-4, 4-14-1 , 2-14-3, 3-14-2, 1-13-5, 5-13-1 , 2-13-4, 4-13-2, 3-13-3, 1-12-6, 6-12-1 , 2-12-5, 5- 12-2, 3-12-4, 4-12-3, 1-11-7, 7-11-1, 2-11 -6, 6-11-2, 3-11-5, 5-11 -3, 4-11 -4, 1 -18-
  • high-affinity modification in relation to a nucleotide refers to a nucleotide having at least one modified nucleobase, internucleoside linkage or sugar moiety, such that the modification increases the affinity of an antisense compound comprising the modified nucleotide to a target nucleic acid.
  • High-affinity modifications include, but are not limited to, bicyclic nucleic acid (BNA)s, LNAs and 2 -MOE.
  • the desirable potency and toxicity characteristics may be obtained by selecting the nucleotide modifications, nucleotide analogues, modified inter-nucleoside linkages, including one or more modified sugar moieties and/or a gapmer wing-gap-wing ratio (for example, see US20100197762).
  • Massons' Trichrome Mice were sacrificed and livers were immediately fixed in 4% PFA overnight and later paraffin embedded. 10 micron slices of the paraffin embedded livers were made and stained with the Massons' Trichrome staning kit (Thermo Scientific, Canada) as per manufacturer's instructions.
  • Oil Red O Mice were sacrificed and livers were immediately snap frozen in liquid nitrogen. 25 micron cryosections were prepared from OCT fixed livers on a cryotome and stained with 0.5% Oil red O in isopropanol (Sigma Aldrich, MO, USA).
  • mice were sacrificed and livers were immediately fixed in 4% PFA overnight and later paraffin embedded. 20 micron sections were prepared and processed for staining of alpha- smooth muscle actin (Abeam, MA, USA) using fluorescently tagged secondary antibody. Images were taken on an Olympus fluroscence microscope.
  • Tissues were weighed and lysed in PBS and homogenized using the bead homogenization method.
  • the lipids were extracted using Folch's solvent extraction method. Triglycerides and total cholesterol was measured
  • liver collagen Hepatic levels of collagen were measured as previously described
  • mice Primary hepatocytes from mice were isolated as previously described. Briefly, forward perfusion of the liver by cannulating the portal vein with a 23 X 3/4th butterfly cannula and sequential perfusion with Hanks balanced salt solution containing EDTA and later with collagenase type IV in Dulbeccos minimum essential medium (D EM) was performed in anesthetized mice. Digested hepatocytes were triturated, centrifuged, sieved and cultured on collagen coated plates at a density of 60,000 cell per cm2. Two hours after attachment, cells were washed and maintained in DMEM:F12 medium without serum. For the silencing experiments, cells were treated in growth medium with the two LNAs oligonucleotides of the following sequence:
  • '+' in the sequence denotes a locked nucleic acid base and '*' indicates a phosphorothioate modification.
  • Example 1- High cholesterol diet leads to NAFLD and steatohepatitis
  • Wild type C57BI6J mice were fed a high cholesterol diet (HCD) of chow diet supplemented with 0.5% (w/w) cholesterol for 12 weeks. This led to an induction of steatosis and continuation of the diet for up to 16 weeks led to the development of fibrosis.
  • HCD fed mice have a 12 fold induction in steatosis area. Liver sections were stained with Oil Red O to reveal neutral lipids and as shown in Figure 1 B, HCD feeding led to a significant increase in Oil Red O-positivity. Liver sections were stained using Massons' Trichrome to reveal collagen which revealed a 24 fold induction in collagen positive area (Figure 1C). This model was used as a standard model for the study of NAFLD / NASH in all following studies.
  • Example 2 Cyp8b1 knockout mice on HCD have reduced steatosis, hepatic triglycerides and cholesterol.
  • Cyp8b1 knockout and control mice were fed HCD for 16 weeks and NAFLD and NASH development was analyzed. Representative micrographs from 9 knockout and 9 control mice are shown in Figure 2A, and analysis of steatosis area in Figure 2B indicates that Cyp8b1 knockout mice are protected from steatosis as compared to wild type mice. The amount of hepatic triglyceride (Figure 3A) and total cholesterol accumulation in Cyp8b1 knockout mice is significantly reduced compared with control mice ( Figure 3B).
  • Example 3 - Cyp8b1 knockout mice have reduced collagen deposition and reduced liver fibrosis.
  • the liver sections were stained with Masons' Trichrome to reveal collagen (blue), which was quantified and found to be reduced in Cyp8b1 knockout mice ( Figure 4A).
  • the total amount of 4-hydroxyproline was estimated biochemically from liver homogenates and expressed in terms collagen/g liver tissue.
  • Cyp8b1 knockout mice had significantly lower amount of collagen per g. liver tissue compared with control mice ( Figure 4B).
  • a-smooth muscle actin serves as a marker for stellate cell activation. Therefore, liver sections from control and Cyp8b1 knockout mice were stained with anti- a-SMA antibody and the positive area was quantified. Cyp8b1 knockout mice had significantly reduced a-SMA positive area ( Figure 5A and B). Quantification of a-SMA protein from western blot also revealed significantly reduced a-SMA positivity in Cyp8b1 knockout mice compared with controls ( Figure 5C).
  • Example 4 Cyp8b1 knockout mice have reduced inflammation.
  • Example 5 - FXR target genes are downregulated in the livers of Cyp8b1 knockout mice.
  • FXR target genes such as bile salt export pump (Bsep), ATP- binding cassette, sub-family B (MDR/TAP), member 1 (Mdr3), Hepatic lipase (Lipc), phospholipid transfer protein (Pltp) and apolipoprotein C2 (ApoC2) were downregulated in Cyp8b1 knockout mice livers compared with controls ( Figure 7A).
  • Bsep bile salt export pump
  • MDR/TAP sub-family B
  • Mdr3 Hepatic lipase
  • Lipc phospholipid transfer protein
  • Pltp phospholipid transfer protein
  • ApoC2 apolipoprotein C2
  • Cyp8b1 (2_1) 5' +G * +C * +T*+C*A * C*T*T*C*C*A*C*C * C*A * C * +T*+C*+C * +C 3'
  • mice and treatments Twelve, 17 week old, C57BI6J female mice were divided into two groups and were given ad libitum access to water and a diet supplemented with 0.5% w/w cholesterol (high cholesterol diet [HCD], TD10401 ; Harlan Diets, Madison, Wl).
  • HCD high cholesterol diet
  • One group received 3mg/kg of negative control LNA Gapmer of the sequence 5'-AACACGTCTATACGC-3' and the other group received 3mg/kg of HDL2_LNA_500125 LNA Gapmer of the sequence 5'-ATCTCGCTGAGGGCA-3'.
  • the Gapmers were administered intraperitoneally for 5 consecutive days in physiological saline.
  • a set of 3 additional mice were administered 2, 4 and 5 mg/kg of the HDL2_LNA_500125 LNA Gapmer for the same duration of time.
  • the LNA Gapmers were commercially produced such that the three 5' and 3' nucleotides were locked nucleic acids and each nucleotide was phosphorothioate modified.
  • Gapmer oligobnucleotides were commercially produced and purified using anion-exchange HPLC to meet in vivo grade puriety by Exiqon (Vedbaek, Denmark).
  • fecal pellets were collected over 72 h from mice that were fed HCD. Lipids were extracted from lyophilized, pulverized feces using chloroform: methanol: NP40 (7:11 :0.1) in a volume 20 times the weight of the sample. Lipid extracts were then air dried and weighed to calculate the fat mass. Extracts were resuspended in 200 ⁇ sterile phosphate-buffered saline containing 1% Triton X 100, followed by enzymatic quantification of total cholesterol using biochemical kits according to manufacturer's instructions (Infinity, Thermo Scientific, Middleton, VA). siRNA transfections and cell culture:
  • HepG2 cells (ATCC HB-8065TM) were split and plated at a cell density of 4X10 5 cell per well of a 12 well plate. Cells were cultured in incubators 37°C with 5% CO2 in Dulbecco's minimum essential medium (DMEM) (Gibco ThermoFisher Scientific, Burlington, ON), supplemented with 10% fetal calf serum and antibiotics.
  • DMEM Dulbecco's minimum essential medium
  • the cells Once the cells reached 80% confluence, they were transfected using the designated sequence of siRNA / LNA Gapmers using the Lipfectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA) in the Opti MEM reduced serum medium (Gibco, ThermoFisher Scientific, Burlington, ON) for 48 hours. At the end of 48 hours, the cells were lysed in 50 ⁇ _ RIPA buffer (Sigma Aldrich, St. Louis, MO) and the protein concentration from the lysates was measured using the BCA protein quantification kit. Proteins were resolved using 10% polyacrylamide gels and western blotting was performed as described above. The amount of Cyp8b1 protein was detected using anti-Cyp8b1 antibody (Abeam, catalogue number ab191910) in conjunction with anti-rabbit secondary antibody.
  • Lipfectamine RNAiMAX transfection reagent Invitrogen, Carlsbad, CA
  • Opti MEM reduced serum medium Gibco, ThermoFis
  • Dsi2 5'-TGGGAGCCCCCTCTGGACAAGGGT-3' (SEQ ID NO: 53) 5'-ACCCTTGTCCAGAGGGGGCTCCCA-3' (SEQ ID NO: 54)
  • Cholesterol lowering drugs such as statins in combination with Ezetimibe to inhibit absorption, were recently shown to reduce NASH related pathology in a mouse model (Rooyen, D. M. Van, Gan, L. T., Yeh, M. M., Haigh, W. G., Larter, C. Z., loannou, G., Farrell, G. C. (2013). Pharmacological cholesterol lowering reverses fibrotic NASH in obese, diabetic mice with metabolic syndrome. Journal of Hepatology, 59(1), 144-152. http://doi.org/10.1016/i.ihep.2013.02.024). This has driven the support for a renewed consideration of statin prescription to patients with NAFLD (Egan, M., Prasad, S., Medicine, M. F., & Hickner, J.
  • Example 8 Lower fat mass and increased metabolic rate in Cyp8b1 knockout mice and Lower hepatic damage and increased fecal cholesterol and fat excretion in Cyp8b1 knockout mice
  • mice were purchased from the University of California, Davis, Knockout Mouse Project (KOMP) repository (Cyp8b1tm1 (KOMP)Vlcg).
  • Cyp8b1 +/+ (control) and Cyp8br /_ (knockout) mice were obtained by breeding Cyp8b1 +/" mice.
  • This study used male and female mice, aged 3-6 months. The mice had ad libitum access to water and were fed a diet supplemented with 0.5% w/w cholesterol (high cholesterol diet [HCD], TD10401 ; Harlan Diets, Madison, Wl) for 12 - 16 weeks or methionine choline- deficient diet [MCD], A02082002B ; Research Diets, New Brunswick, NJ.
  • HCD high cholesterol diet
  • MCD methionine choline- deficient diet
  • mice were fasted for 4h (7:00 A.M.-11 :00 A.M.) before the procedure. Blood for all experiments was drawn from the medial saphenous vein in EDTA coated capillary tubes. All experiments were approved by the University of British Columbia Animal Care Committee.
  • Biochemical parameters Levels of plasma triglycerides (TG), cholesterol (C) and cholesterol ester (CE) were performed using enzymatic kits according to manufacturer's protocols (Infinity, Thermo Scientific, Middleton, VA). Levels of lactate dehydrogense (LDH), were measured from the media after incubation of primary hepatocytes with LPS or TNF at indicated concentration and time using the LDH cytotoxicity assay kit according to manufacturer's instructions (Thermo Scientific, Middleton, CA). The levels of serum aspartate aminotransferase (AST) and alanine were determined using commercially available kits from Sigma Aldrich, St. Louis, MO. Hepatic and cellular TG, C and CE estimation:
  • TG, C and CE concentrations were determined from lipid extracts of liver lysates or cultured cells using enzymatic kits as mentioned above. Briefly, liver samples from Cyp8b1 +/+ and Cyp8b _ mice were weighed, homogenized, and lipids were extracted in chloroform: methanol: NP40 (7:11 :0.1) in a volume 20 times the weight of the sample. Lipid extracts were then air dried and
  • fecal pellets were collected over 72 h from mice that were fed HCD. Lipids were extracted from lyophilized, pulverized feces using chloroform: methanol: NP40 (7:11 :0.1) as described for tissues above. Total cholesterol in the feces was measured using biochemical kits followed by spectrophotometric quantification.
  • KCs Kupffer cells
  • mice were anesthetized using a single terminal dose of Avertin (250 mg/kg), the portal vein was exposed and cannulated using a 23G x 3 ⁇ 4" butterfly cannula (BD, Vacutainer #367297) and the inferior vena cava was incised to allow outflow.
  • the liver was perfused with Hanks balanced salt solution containing HEPES and devoid of Calcium at 9mlJminute after which the solution was changed to Ca and Mg free, low glucose (1g/L) DMEM containing 100-125 CDU/ml of Collagenase type IV (Sigma
  • the cell pellet was resuspended in DMEM: F12 supplemented with 10% FBS and filtered through 70 pm cell strainer, washed, counted and plated on collagen coated (5 pg rat tail collagen/cm 2 ) plates at a density of 3.75 * 10 3 cells/cm 2 .
  • Non-adherent cells were washed-off 4 hours after plating and cells were cultured in DMEM: F12 containing 10% fetal calf serum and antibiotics overnight.
  • DMEM F12 containing 10% fetal calf serum and antibiotics overnight.
  • the supernatant was centrifuged at 2430 rpm to collect the cells.
  • the cell pellet was washed twice in cold DMEM: F12 and then resuspended in DMEM: F12 with 10% FBS and subjected to differential adhesion on non-tissue culture treated plates. Unattached cells were washed after 1 hour of incubation and adherent cells were detached using Trypsin-EDTA (0.25%), washed, counted and cultured at 5000-10000 cells/ well in DMEM: F12 with 10% FCS on tissue-culture plates overnight. Both, hepatocytes and KCs were used in experiments the following day. Media, antibiotics and FBS were purchased from Gibco, ThermoFisher Scientific, Burlington, ON.
  • chemiluminescence detection reagent GE Healthcare, Piscataway, NJ / Thermo Scientific, Rockford IL.
  • Antibodies against smooth muscle actin alpha 2 (aSMA), fatty acid synthase (FAS), Sterol 12-a hydroxylase (CYP8B1), sterol regulatory element binding protein (SREBP)-1 and 2 were purchased from Abeam,
  • Example 9 Favourable alterations in gut Microbiota of Cyp8b1-/- mice.
  • Gut microbiota composition in turn influences hepatic tolerance and immune-suppression.
  • recent data strongly indicates that dietary cholesterol directly induces inflammation and reduces barrier function in the intestine (Progatzky, F., Sangha, N. J., Yoshida, N., McBrien, M., Cheung, J., Shia, A., Dallman, M. J. (2014). Dietary cholesterol directly induces acute inflammasome-dependent intestinal inflammation. Nature Communications, 5, 5864.). Therefore, we hypothesized that the absence of CA and the associated changes in BA composition in Cyp8b1-/- mice and the reduced uptake of cholesterol, would alter the gut microbial community structure and inflammation in the gut.
  • the pyrosequencing and bioinformatics analysis of bacterial 16S rRNA was performed by the commercial vendor and service provider, Microbiome Insights Inc, Vancouver, BC, using samples from the jejunum of Cyp8b1+/+ and Cyp8b1 -/- mice after 12 weeks of HCD diet.
  • Bacterial DNA was isolated from the intestines using standardized protocols for the PowerSoil Extraction kit (Mo Bio Laboratories, Qiagen,
  • Purified DNA was amplified using dual-barcoded primers targeting the V4 region of the 16S rRNA gene. Amplicons were subjected to 2 x 250 paired-end sequencing on a MiSeq. Additional wet-lab protocols, including library
  • Cyp8b1 +/+ and Cyp8b1-/- mice were analyzed using the 16S rDNA variable region 4 (V4) amplicon sequencing method. Analysis revealed phylum and genus level changes in microbial composition of the jenunum in Cyp8b1-/- mice
  • Microbiol87269-283. At the genus level, we identified a huge increase in the proportion of Allobaculum (18 fold increase). The levels of Allobaculum negatively correlate with body weight and plasma leptin levels and positively correlate with lifespan (Zhang, C, Li, S., Yang, L, Huang, P., Li, W., Wang, S., & Zhao, G. (2013). Structural modulation of gut microbiota in life-long calorie- restricted mice. Nature Communications, 4, 1-10.).
  • a given single stranded nucleic acid molecule has a high propensity to form secondary structures by establishing intra-molecular base pairing.
  • the simple complimentary Watson-Crick rules for base pairing and GU pairing dictate the formation of ordered helices and less ordered loops within the
  • RNA. 10(8): 1178-1190 Dynamic algorithms have been developed that can predict with greater accuracy the secondary structure of a given nucleic acid sequence. Importantly, free energy minimization alone is sufficient to predict 40% of potential base pairing(Mathews, D. (2004) Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization. RNA. 10(8): 1178-1190,). This, together with
  • RNA. 10(8): 1178-1 90 Based on these criteria a freely accessible web-based program suite, The ViennaRNA Web Service has been developed and can be accessed here: http://rna.tbi.univie.ac.at/The website provides number of prediction tools which reveal the thermodynamic properties and emergent base-pairing probabilities leading to the secondary structure of a given RNA molecule.
  • RNAUp tool is then employed to predict the interaction free energy and the energy needed to open an existing secondary structure in the given sequence(Lorenz, R. et al., 2011 ViennaRNA Package 2.0. Algorithms Mol Biol.6: 26 )(Gruber et al., 2008 The Vienna RNA Websuite. Nucleic Acids Res. July 1 ; 36: W70-W74).
  • RNAeval tool was used to get a detailed thermodynamic description (loop free-energy decomposition) of the cDNA sequence of the human CYP8B1 mRNA. This permits the generation of the secondary structure shown in Figure 15A.
  • the probability of base-pairing for each nucleotide is color coded shown in the scale / legend below with blue indicating a base pairing probability of 0 and red indicating maximum probability of 1.
  • RNAup tool was used to determine the required interaction free energy for various regions within the secondary structure shown in Figure 15B. Based on this regions of interest were identified marked as shown Figure 15C (sequences marked with boxes). The regions of interest were then utilized to derive the desired sequences of targeting molecules for each of the different strategies outlined in the tables below after applying constraints against sequence homology using simple BLAST search and high GC content.
  • LNA locked nucleic acid
  • PS phosphorothioate modification
  • LNA locked nucleic acid
  • PS phosphorothioate modification

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Obesity (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Provided are oligomers, methods, uses and pharmaceutical compositions for reducing the expression of Sterol 12-α hydroxylase (Cyp8b1 ) in a cell or tissue with an oligomer described herein in a biologically effective amount sufficient for the treatment of liver fibrosis. The oligomer may be between 4 to 49 nucleobases in length which comprises a contiguous nucleotide sequence of a total of between 4 to 49 nucleotides, wherein the contiguous nucleotide sequence is targeted to hybridize to a portion of SEQ ID NO: 104: wherein the oligomer, when bound to the portion of SEQ ID NO: 104 reduces expression of Sterol 12-α hydroxylase (Cyp8b1 ) in a cell or tissue.

Description

MODULATION OF CYP8B1 FOR THE PREVENTION AND TREATMENT OF LIVER FIBROSIS AND METABOLIC DISORDERS
TECHNICAL FIELD
The present invention relates to compositions that reduce the expression of the Cyp8b1 gene. The compositions are useful for the prevention and/or treatment of liver fibrosis, chronic liver disease, autoimmune heptatitis, chronic viral hepatitis, alcoholic liver disease, non-alcoholic fatty liver disease and nonalcoholic steatohepatitis. The compositions are also useful for the prevention and treatment of metabolic syndrome, obesity and diabetes.
BACKGROUND
Hepatic bile acid (BA) metabolism is closely linked to the regulation of cholesterol homeostasis and the digestion and absorption of fat through the intestine. The conversion of cholesterol to BAs and the biliary secretion of cholesterol are the two significant pathways for elimination of excessive cholesterol from the body. The immediate products of the BA synthetic pathways in humans are the primary BAs, cholic acid (CA) and chenodeoxycholic acid (CDCA). Sterol 12-a hydroxylase (Cyp8b1) acts in the neutral BA synthesis pathway and catalyzes the conversion of 7a-hydroxy-4-cholesten-3-one into 7a,12a-dihydroxy-4-cholesten-3-one [Lefebvre, P., ef al., Role of bile acids and bile acid receptors in metabolic regulation. Physiol Rev, 2009. 89(1): p. 147-91]. The biosynthetic end products of these two steroids are CA and CDCA, the relative levels of, which determine the hydrophobicity and biological properties of the bile pool [Jones, R.D., et al., Delineation of biochemical, molecular, and physiological changes accompanying bile acid pool size restoration in Cyp7a1(-/- ) mice fed low levels of cholic acid. Am J Physiol Gastrointest Liver Physiol, 2012. 303(2): p. G263-74; and Staels, B. and V.A. Fonseca, Bile acids and metabolic regulation: mechanisms and clinical responses to bile acid
sequestration. Diabetes Care, 2009. 32 Suppl 2: p. S237-45]. Cyp8b1 is a liver-specific gene and no significant expression has been detected in other organs [Jones, R.D., ef a/., Delineation of biochemical, molecular, and physiological changes accompanying bile acid pool size restoration in Cyp7a1(-/-) mice fed low levels of cholic acid. Am J Physiol Gastrointest Liver Physiol, 2012. 303(2): p. G263-74]. Mice lacking Cyp8b1 are characterized by a complete absence of cholic acid (CA) and CA regulates the synthesis, intestinal absorption and hepatic storage of cholesterol. The overall bile acid pool size is increased in Cyp8b1 knockout mice and is predominantly composed of CDCA and bile acids derived from CDCA such as α, β, ω- muricholic acids (MCA) and ursodeoxycholic acid (UDCA). In addition to surfactant properties, bile acids also act as signaling molecules, activating nuclear farnesoid X receptor (FXR) and G-protein coupled receptor (TGR5)
[Lefebvre, P., et al., Role of bile acids and bile acid receptors in metabolic regulation. Physiol Rev, 2009. 89(1): p. 147-91]. Note that different bile acids have opposing effects on FXR activation. Cholic acid is an FXR agonist, whereas α, β, ω- MCA and UDCA are FXR antagonists and inhibition of FXR shows beneficial effects in human obesity [Mueller, M., ef al., Ursodeoxycholic acid exerts farnesoid X receptor-antagonistic effects on bile acid and lipid metabolism in morbid obesity. J Hepatol, 2015. 62(6): p. 1398-404; and Sayin, S.I., er a/., Gut microbiota regulates bile acid metabolism by reducing the levels of tauro-beta- muricholic acid, a naturally occurring FXR antagonist. Cell Metab, 2013. 17(2): p. 225-35]. The functional activation of TGR5 in the intestinal L-cells releases the incretin hormone, glucagon-like peptide -1 (GLP-1) and GLP-1 mimetic drugs improve steatosis in mouse models of NAFLD [Liu, J., et al., GLP-1 receptor agonists: effects on the progression of non-alcoholic fatty liver disease. Diabetes Metab Res Rev, 2015. 31(4): p. 329-35].
Non-alcoholic fatty liver disease (NAFLD) is characterized by an excessive fat accumulation in the liver, termed hepatic steatosis. It is diagnosed as fat exceeding 5% of liver mass occurring due to oversupply of lipids that exceeds the rates of lipid oxidation and export by the liver. NAFLD has become the most common liver disorder in the industrialized world affecting an estimated 150 million people worldwide and together with its downstream sequela, hepatic insulin resistance, is a major contributor to morbidity arising from metabolic disorders [Pagano, G., et al., Nonalcoholic steatohepatitis, insulin resistance, and metabolic syndrome: further evidence for an etiologic association. Hepatology, 2002. 35(2): p. 367-72; and Perry, R.J., ef a/., The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes. Nature, 2014. 510(7503): p. 84-91]. There is no consensus on the predominant source of hepatic lipids in NAFLD and there are no treatments available to date. In a certain proportion of individuals a simple steatosis can progress to steato-hepatitis or non-alcoholic steatohepatitis (NASH) characterized by increased inflammation and fibrosis of the liver. The build-up of toxic levels of certain lipids, especially cholesterol has been linked to the progression to NASH. In individuals with NAFLD, dyslipidemia may also manifest as an increase in circulating LDL cholesterol and triglycerides and a reduction in HDL cholesterol [Chatrath, H., R. Vuppalanchi, and N. Chalasani, Dyslipidemia in patients with nonalcoholic fatty liver disease. Semin Liver Dis, 2012. 32(1): p. 22- 9; and Kumar, R., et al., Clinicopathological characteristics and metabolic profiles of non-alcoholic fatty liver disease in Indian patients with normal body mass index: Do they differ from obese or overweight non-alcoholic fatty liver disease? Indian J Endocrinol Metab, 2013. 17(4): p. 665-71].
Cholesterol is a key component of cellular membranes and is crucial for normal cellular and tissue function. Cellular cholesterol levels are controlled through a tightly regulated feedback system. Hepatic cholesterol metabolism is dysregulated in NAFLD patients with increased cholesterol biosynthesis caused by a transcriptional induction of genes involved in cholesterol biosynthesis [Chun, Y.S. , et al. , Cholesterol regulates HERG K+ channel activation by increasing phospholipase C betal expression. Channels (Austin), 2013. 7(4): p. 275-87]. Diets containing >0.5% of cholesterol or high cholesterol diet (HCD), are associated with accelerated fat accumulation in the hepatocytes [Almena, M. and I. Merida, Shaping up the membrane: diacylglycerol coordinates spatial orientation of signaling. Trends Biochem Sci, 2011. 36(11): p. 593-603; and Teratani, T., et al., A high-cholesterol diet exacerbates liver fibrosis in mice via accumulation of free cholesterol in hepatic stellate cells. Gastroenterology, 2012. 142(1): p. 152-164.e10]. Dietary sterol overload, the liver increases the synthesis of free fatty acids via de novo lipogenesis, a prerequisite to minimize the free cholesterol toxicity by esterification into cholesteryl esters [Almena, M. and I. Merida, Shaping up the membrane: diacylglycerol coordinates spatial orientation of signaling. Trends Biochem Sci, 2011. 36(11): p. 593-603; Teratani, T., et al., A high-cholesterol diet exacerbates liver fibrosis in mice via
accumulation of free cholesterol in hepatic stellate cells. Gastroenterology, 2012. 142(1): p. 152-164. e10; and Kumashiro, N., et al., Cellular mechanism of insulin resistance in nonalcoholic fatty liver disease. Proc Natl Acad Sci U S A, 2011. 108(39): p. 16381-5].
In humans, an increase in hepatic free cholesterol clearly distinguishes simple NAFLD from NASH [Ginsberg, H.N., Is the slippery slope from steatosis to steatohepatitis paved with triglyceride or cholesterol? Cell Metab, 2006. 4(3): p. 179-81 ; and Tomita, K., et al. , Free cholesterol accumulation in hepatic stellate cells: mechanism of liver fibrosis aggravation in nonalcoholic steatohepatitis in mice. Hepatology, 2014. 59(1): p. 154-69]. Free cholesterol alone is sufficient to cause the three major pathological transitions in the liver, leading to the progression of NAFLD to NASH. Free cholesterol, i) potentiates triacylglycerol accumulation in hepatocytes causing steatosis, ii) sensitizes hepatic stellate cells to TGF-β leading to fibrosis and iii) activates Kupffer cell inflammatory pathways [Teratani, T., et al., A high-cholesterol diet exacerbates liver fibrosis in mice via accumulation of free cholesterol in hepatic stellate cells. Gastroenterology, 2012. 142(1): p. 152-164.e10; Tomita, K., et al., Free cholesterol accumulation in hepatic stellate cells: mechanism of liver fibrosis aggravation in nonalcoholic steatohepatitis in mice. Hepatology, 2014. 59(1): p. 154-69; and van der Veen, J.N., et al. , Cholesterol feeding strongly reduces hepatic VLDL-triglyceride production in mice lacking the liver X receptor alpha. J Lipid Res, 2007. 48(2): p. 337-47]. In addition, mitochondrial free cholesterol accumulation leads to an induction of apoptosis in hepatocytes, leading to further inflammatory cell infiltration. Other studies with mice having a targeted disruption of Cyp8b1 (Cyp8b1' ') suggest a role for the enzyme's activity in metabolic syndrome and diabetes. Kaur and colleagues showed that the absence of Cyp8b1 correlated with increased GLP-1 release and improved β-cell function [Kaur, A., et a/. , Loss of Cyp8b1 improves glucose homeostasis by increasing GLP-1. Diabetes, 2015. 64(4): p. 1168-79]. CypBb 1' x ApoE1' mice show reduced atherosclerotic plaques, owing to decreased levels of apolipoprotein B (ApoB)-containing lipoproteins in the plasma, reduced hepatic cholesteryl esters and enhanced bile acid synthesis [Slatis, K., et a/., Abolished synthesis of cholic acid reduces atherosclerotic development in apolipoprotein E knockout mice. J Lipid Res, 2010. 51(11): p. 3289-98].
PCT patent application WO2010009534 discloses the identification of genes related to lipid metabolism, more particularly genes which are modulated in the absence of apolipoprotein A1 (ApoA1). Thus, WO2010009534 provides 1) screening methods for the identification of compounds that modulate the activity and/or expression level of more or more high-density lipoprotein cholesterol ( HDLc) related genes or encoded proteins identified herein; 2) methods of treating or preventing lipid metabolism associated diseases; 3) diagnostic methods and kits for detecting a predisposition to lipid metabolism associated diseases and disorders; 4) animal models for identifying compounds for treating, preventing or decreasing susceptibility to a lipid metabolism associated disease or a HDL- metabolism disease; and 5) HDLc related genes and encoded proteins.
PCT patent application WO2014018375 describes embodiments that relate to the diagnosis, prevention and/or treatment of diseases related to abnormal lipid metabolism. More particularly, disclosed therein is the discovery in human subjects having elevated HDL of mutated human CYP8B1 encoding genes and their encoded proteins, and exploitation of this discovery for use in compositions and methods for the diagnosis, treatment and prevention of cardiovascular diseases, such as dyslipidemia, atherosclerosis, low HDL diseases and related disorders, including methods for identifying agents that modulate CYP8B1 activity. Accordingly there are provided methods for detecting, diagnosing, prognosing or determining a predisposition to diseases related to abnormal lipid metabolism, as well as CYP8B1 -directed screening assays, kits, antibodies, agents, nucleic acids, polypeptides, cells, vectors, transgenic animals and compositions.
SUMMARY
The present invention provides methods of treating or preventing diabetes, obesity, metabolic syndrome, NAFLD or NASH in a subject, a method comprising administering a therapeutically effective amount of a sterol 12-a hydroxylase (Cyp8b1 ) inhibitor compound to a subject.
The Cyp8b1 inhibitor compound may be an interference oligonucleotide. The compound may be an RNA interference, antisense compound or a locked- nucleic acid gapmer oligonucleotide. The compound may be an oligonucleotide with substantial sequence similarity to SEQ ID NO: 1-2.
Illustrative embodiments of the present invention provide an oligomer of between 4 to 49 nucleobases in length which comprises a contiguous nucleotide sequence of a total of between 4 to 49 nucleotides, wherein the contiguous nucleotide sequence is targeted to hybridize to a portion of SEQ ID NO: 104:
ATGGTTCTCTGGGGTCCAGTGCTGGGAGCTCTGCTGGTGGTCATTGCTGGA ACCTGTG CCTGCCAGGGATGCTCCGACAACGCAGGCCATGGGAGCCCCCTCTGGACAAGGGTACCG TGCCCTGGCTTGGCCATGCCATGGCTTTCCGGAAGAATATGTTTGAATTTCTGAAGCGC ATGAGGACCAAGCATGGGGATGTGTTCACAGTGCAGCTAGGGGGCCAGTAC TCACCTT CGTCATGGACCCCCTCTCCTTTGGCTCCATCCTCAAGGACACACAGAGAAAi^CTAGACT TTGGGCAATATGCAAAAAAACTGGTGCTGAAGGTATTTGGATACCGTTCAGTGCAAGGG GACCATGAGATGATACACTCAGCCAGCACCAAGCATCTGAGGGGGGATGGCTTGAAGGA TCTTAATGAGACCATGCTGGACAGCCTGTCCTTTGTAATGCTGACGTCCAAAGGCTGGA GTCTGGATGCCAGTTGCTGGCATGAGGACAGCCTCTTTCGCTTCTGCTATTACATCTTG TTCACAGCTGGCTACCTGAGCTTGTTCGGCTACACGAAGGACAAGGAGCAGGACCTGCT ACAGGCAGGAGAGTTATTCATGGAGTTCCGCAAGTTTGACCTTCTTTTCCCAAGGTTTG TCTACTCCCTGCTGTGGCCCCGGGAGTGGCTAGAAGTGGGCCGACTCCAGCGTCTCTTT CACAAGATGCTCTCCGTGAGCCACAGCCAGGAGAAGGAGGGCATCAGCAAC GGCTGGG CAACATGCTTCAGTTTCTGAGGGAGCAGGGGGTACCCTCAGCTATGCAGGACAAGTTCA ACTTCATGATGCTCTGGGCCTCCCAGGGGAACACGGGGCCTACCTCTTTCTGGGCCCTC TTGTACCTCCTGAAGCACCCAGAAGCTATTCGGGCTGTGAGGGAGGAAGCTACCCAGGT CCTGGGTGAGGCCAGGCTGGAGACCAAGCAGTCCTTTGCCTTCAAACTCGGTGCCCTGC AACACACCCCAGTTCTAGACAGCGTGGTGGAGGAGACGCTGCGGCTGAGGGCTGCACCC ACCCTCCTCAGGTTGGTTCATGAAGACTATACCCTGAAGATGTCCAGTGGGCAGGAGTA TCTGTTCCGCCATGGAGACATCCTGGCCCTCTTTCCCTACCTCTCAGTGCACATGGACC CTGACATCCACCCTGAGCCCACCGTCTTCAAGTACGATCGCTTCCTCAACCCTAATGGC AGCCGGAAAGTGGACTTCTTCAAGACAGGCAAGAAGATCCACCACTACACC7!,TGCCCTG GGGTTCGGGCGTTTCCATCTGCCCTGGGAGGTTCTTTGCACTCAGTGAGGTGAAGCTCT TTATCCTGCTTATGGTCACACACTTTGACTTAGAGTTGGTGGACCCTGACACACCACTA CCCCATGTTGACCCGCAGCGCTGGGGTTTTGGCACCATGCAGCCCAGCCACGATGTGCG
CTTCCGCTACCGCCTGCATCCTACAGAGTGA (SEQ ID NO: 104), wherein the oligomer, when bound to the portion of SEQ ID NO: 104 reduces expression of Sterol 12-ct hydroxylase (Cyp8b1 ) in a cell or tissue.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is between 14 to 29 nucleotides in length.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is between 18 to 23 nucleotides in length.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is between 21 to 27 nucleotides in length.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the cell or tissue is a liver cell or a liver tissue.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer comprises a sequence selected from the group consisting of SEQ ID NOs 57 to 103, 105 and 106:
SEQ ID
Sequence 5'-3'
NO
57 CGGAAGAATATGTTTGAATTTCT
58 TGGGCAATATGCAAAAAAACTGG
59 AATGAGACCATGCTGGACAGCCT
60 CCGCAAGTTTGACCTTCTTTTCC
61 GGGCAACATGCTTCAGTTTCTGA SEQ ID
Sequence 5'-3'
NO
62 AGGAC AAG T T C AAC T T C AT GAT G
63 GCCCTCTTGTACCTCCTGAAGCA
64 CTCCTCAGGTTGGTTCATGAAGA
65 AAGAC TAT AC C C T GAAG AT GT C C
66 T C AT G AAG AC T AT ACC C T GAAGA
67 CCGGAAAGTGGACTTCTTCAAGA
68 GTGAAGCTCTTTATCCTGCTTAT
69 CACACACTTTGACTTAGAGTTGG
70 AGTGCTGGGAGCTCTGCTGGTGGTCAT
71 ATGCCATGGCTTTCCGGAAGAATATGT
72 CGTCATGGACCCCCTCTCCTTTGGCTC
73 ACTTTGGGCAATATGCAAAAAAACTGG
74 ATGGCTTGAAGGATCTTAATGAGACCA
75 AATGAGACCATGCTGGACAGCCTGTCC
76 TGGAGTTCCGCAAGTTTGACCTTCTTT
77 ACATGCTTCAGTTTCTGAGGGAGCAGG
78 ACCCTCAGCTATGCAGGACAAGTTCAA
79 CTCTTGTACCTCCTGAAGCACCCAGAA
80 CTGCGGCTGAGGGCTGCACCCACCCTC
81 GAAGACTATACCCTGAAGATGTCCAGT
82 ATGGCAGCCGGAAAGTGGACTTCTTCA
83 TCCACTACACCATGCCCTGGGGTTCGG
84 TGAAGCTCTTTATCCTGCTTATGGTCAC
85 G AC T T AG AGT T GGT GG AC C C T G AC AC A
86 TCCAGTGCTGGGAG
87 CCGGAAGAATATGT
88 ACAGAGAAAACTAG
89 ATGGCTTGAAGGAT
90 ATGCTGGACAGCCT
91 TGGAGTTCCGCAAG
92 TCTGAGGGAGCAGG
93 CAGCTATGCAGGAC
94 GTTCAACTTCATGA
95 TTGTACCTCCTGAA
96 AGAAGCTATTCGGG
97 GGCTGAGGGCTGCA
98 TCCTCAGGTTGGTT
99 AC TAT AC C C T GAAG
100 AAAGTGGACTTCTT
101 TACACCATGCCCTG
102 TGAAGCTCTTTATC
103 ACTTAGAGTTGGTG SEQ ID
Sequence 5'-3'
NO
105 GCTCACTTCCACCCACTCCC
106 TTCATCTCGCTGAGGGCAAA
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is modified to include one ore more locked nucleic acid bases and one or more phosphorothioate modification.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the contiguous nucleotide sequence comprises nucleotide analogues.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has a modified internucleoside linkage.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the modified internucleoside linkage is a peptide- nucleic acid linkage, a morpholino linkage, a N3' to P5' phosphoramidate linkage, a methylphosphonate linkage or a phosphorothioate linkage.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has one or more modified sugar moiety.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the modified sugar moiety is 2 ' -O-alkyl oligoribonucleotide.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is a gapmer.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has a 2'MOE gapmer modification.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer has a modified nucleobase.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the modified nucleobase is a 5-methyl pyrimidine or a 5- propynyl pyrimidine. lllustrative embodiments of the present invention provide an oligomer described herein wherein the one or more nucleotide analogues comprise locked nucleic acids (LNA) units.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the LNA units consist of beta-D- oxy-LNA monomers.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer is selected from the group consisting of: 5' +G*+C*+T*+C*A*C*T*T*C*C*A*C*C*C*A*C*+T*+C*+C*+C 3' (SEQ ID NO:1); and 5' +T*+T*+C*+A*T*C*T*C*G*C*T*G*A*G*G*G*+C*+A*+A*+A3" (SEQ ID NO: 2), wherein '+' denotes a locked nucleic acid base and '*' indicates a
phosphorothioate modification.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer comprises a single stereoisomer.
Illustrative embodiments of the present invention provide an oligomer described herein wherein the oligomer comprises a mixture of stereoisomers.
Illustrative embodiments of the present invention provide a pharmaceutical composition comprising an oligomer described herein and a pharmaceutically acceptable diluent, carrier, salt or adjuvant.
Illustrative embodiments of the present invention provide a method of reducing the expression of Sterol 12-a hydroxylase (Cyp8b1) in a cell or tissue, comprising contacting the cell or tissue with an effective amount of an oligomer described herein or a pharmaceutical composition described herein.
Illustrative embodiments of the present invention provide a method described herein wherein the cell is within a tissue of a mammal.
Illustrative embodiments of the present invention provide a method of prophylactic treating or treating a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes, in a subject, comprising administering to the subject an effective amount of an oligomer described herein or administering a an effective amount of a pharmaceutical composition described herein, wherein the subject is currently suffering from or at risk for suffering from liver fibrosis.
Illustrative embodiments of the present invention provide a method of described herein wherein the subject is a mammal.
Illustrative embodiments of the present invention provide a method described herein wherein the mammal is a human.
Illustrative embodiments of the present invention provide use of an oligomer described herein for the treatment of a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
Illustrative embodiments of the present invention provide use of an oligomer described herein in the preparation of a medicament for the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
Illustrative embodiments of the present invention provide use of a pharmaceutical composition described herein for the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
Illustrative embodiments of the present invention provide a use described hierein wherein the disease is liver fibrosis.
Illustrative embodiments of the present invention provide an oligomer described herein for use in the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
Illustrative embodiments of the present invention provide a commercial package, comprising: a. an oligomer of any one of claims 1 to 21 ; and b.
instructions for the treatment of a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
Illustrative embodiments of the present invention provide a commercial package described herein wherein the instructions are for the treatment of liver fibrosis.
Other aspects and features of the present invention will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 : (A) Shows a comparison of whole livers and liver sections from mice that were fed normal chow (Chow) or a high-cholesterol diet (HCD). Right panel show the whole liver appearance of chow and HCD; center panel shows
Massons' Trichrome staining of 10μΜ liver sections (200X); and right panel shows the steatosis area of the liver. The histogram shows the quantitation of the steatosis area, as a percentage of total area (B) Oil Red O staining of 25μΜ cryosections of livers (400X) showing neutral lipid staining. (C) Massons' trichrome staining of 10μΜ liver sections (200X) and analysis of collagen positive area, histogram: quantitation of collagen positive area, percent of total area. * p<0.05, *** p<0.0001 , mean ± SEM, Mann-Whitney test.
Figure 2: (A) Representative micrographs (200X) from 9 control (+/+) and
9 Cyp8b1 knockout mice (-/-) fed 0.5% high cholesterol diet for 12 weeks. (B) Representative micrographs (200X) from livers stained for Massons' Trichrome and analysis of steatosis area. The histogram shows a quantitation of the steatosis area (as a percentage of total area). n= 8-9, *** p<0.001 , mean ± SEM, Mann-Whitney test.
Figure 3: (A) Total triglyceride levels and (B) total cholesterol levels from the livers of control (+/+) and Cyp8b1 knockout mice (-/-) fed 0.5% high cholesterol diet for 12 weeks, n = 4, *** p<0.001 and ** p<0.01 , Student's t-test.
Figure 4: (A) Representative micrographs (200X) from livers stained for Massons' Trichrome and analysis of collagen positive area, histogram: collagen positive area (percent of total area). n= 8-9, * p<0.05, mean ± SEM, Mann- Whitney test. (B) Biochemical estimation of total collagen in the livers of 4 control (+/+) and 5 Cyp8b1 knockout mice (-/-) fed HCD.* p<0.05, mean ± SEM,
Students t-test.
Figure 5: (A) Representative micrographs (200X) from livers stained for cr- SMA (Red) and nuclei (blue = DAPI) and the analysis of a-SMA positive area from 5 control (+/+) and 5 Cyp8b1 knockout mice (-/-) livers, (B) histogram: a- SMA positive area (percent of total area). n= 5, ** p<0.01 , mean ± SEM, Mann- Whitney test. (C) Representative western blot analysis of Calnexin as control and a-SMA proteins in +/+ and -/- liver homogenates, histogram: quantification of relative band densities from 4 control (+/+) and 4 Cyp8b1 knockout (-/--) liver homogenates relative to those of Calnexin. (D) Hepatic mRNA expression of various fibrotic genes relative to Cyclophilin. n = 4, mean ± SEM, *p<0.05, randomization and bootstrapping tests.
Figure 6: (A) Representative micrographs (400X) from livers stained for Massons' Trichrome and analysis of inflammatory infiltrates (groups of dense eosinophilic nuclei marked yellow) in control (+/+) and Cyp8b1 knockout (-/-) livers from mice fed HCD. (B) Inflammation scores based on numbers of infiltrating leucocytes invading the liver parenchyma in control (+/+) and Cyp8b1 knockout (-/-) livers, n = 5-6, mean ± SEM, *** p < 0.0001 , Mann-Whitney test. (C) mRNA expression of various inflammatory genes relative to Cyclophilin as house-keeping control, from the livers of control and Cyp8b1 knockout mice fed HCD. n = 4, mean + SEM, *p<0.05, randomization and bootstrapping tests. Figure 7: (A) mRNA expression of various FXR target genes relative to Cyclophilin as house-keeping control, from the livers of control (+/+) and Cyp8b1 knockout (-/-) mice fed HCD. n = 4, mean ± SEM, *p<0.05, randomization and bootstrapping tests. (B) mRNA expression of FXR target genes Bsep and Mdr3 and lipogenic genes Fas and Scd1 in isolated primary steatotic hepatocytes treated with 5, 50 and 100 micro molar alpha-muricholic acid, n = 3, mean ± SEM, ns =not significant, *p<0.05, **p<0.01 and ***p<0.001. Students' t-test.
Figure 8: Relative Cyp8b1 transcript levels in primary mouse hepatocytes upon 72h of treatment with two LNA gapmer hybrid oligonucleotides. Sequence Cyp8b1 (2_1) (SEQ ID NO:1) produced a 60% knockdown at the highest concentration tested. No differences in cell death were observed as measured with the LDH release assay at any of the concentrations.
Figure 9 shows Western blot analysis for Cyp8b1 or the Calnexin control following Cyp8b1 silencing in HepG2 cells using siRNAs: A) HDL2 si1 ; B) HDL2 si 101 ; C) HDL2 si 103; D) HDL2 si 109; E) HDL2 Dsi 2; and F) HDL2 Dsi 13.
Figure 10 shows Western blot analysis for Cyp8b1 or the Calnexin control following Cyp8b1 silencing in HepG2 cells using LNA gapmers: A) HDL2 LNA 1 ; and B) HDL2 LNA 3.
Figure 11 shows in vivo silencing with HDL2 LNA 500125 5'- ATCTCGCTGAGGGCA-3': A) Concentration dependent increase in fecal fat excretion; B) Enhanced fecal fat mass at 3mg/kg/day; C) Increased fecal cholesterol excretion; D) Body weight of mice before and after treatment with either HDL2 LNA or negative control LNA; and E) Hepatic Cyp8b1 protein levels and quantification.
Figure 12 shows lower fat mass and increased metabolic rate in Cyp8b1 knockout mice: A) graph of body weight in grams vs. time for both knockout and control; B) graph of body weight as a percentage vs. time for both knockout and control; C) graph of organ weight in grams of various organs for both knockout and control; D) graph of body composition in weight for fat mass, lean mass and body weight for both knockout and control; E) graph of food intake for day, night and total for both knockout and control; F) graph of oxygen consumption in milliliters per hour vs. time in hours for both knockout and control; G) graph of carbon dioxide production in milliliters per hour vs time in hours for both knockout and control; H) graph of respiratory exchange ratio vs. time in hours for both knockout and control and a second graph of mean respiratory exchange ratio during the day and during the night for both knockout and control; I) graph of energy expenditure in kilocalories per hour vs. time in hours for both knockout and control; and J) graph of locomotor activity in counts vs. time in hours for both knockout and control and a second graph of locomotor activity in counts during the day and during the night and total locomotor counts for both knockout and control.
Figure 13 shows lower hepatic damage and increased fecal cholesterol and fat excretion in Cyp8b1 knockout mice: A) graph showing AST in milliU/mL for both knockout and control; B) graph showing fecal dry weight in grams/day for both knock out and control; C) graph showing fecal lipid excretion in mg/day for both knockout and control; D) graph showing cholesterol excretion in mg/day for both knockout and control; and E) graph showing free fatty acids (FFA) excretion in μηιοΙ/day for both knockout and control.
Figure 14 A) shows two pie charts depicting the phylum level microbiota for cyp8b1 knockout mice and control mice; B) is a dendrogram distance tree of the microbiota; and C) shows bar graphs of the Genus level microbiota.
Figure 15 A) shows Mean free energy structure of the Hs_Cyp8b1 cDNA of minimum free energy of -577.70 kcal/mol; B) shows a plot depicting the interaction free energy (GREY) AGi and the energy needed to open existing structures in the longer sequence (BLACK) on the y-axis and nucleotide position on the x-axis; and C) shows the base pair probabilities of targeting sites.
DETAILED DESCRIPTION
Any terms not directly defined herein shall be understood to have the meanings commonly associated with them as understood within the art of the invention. As employed throughout the specification, the following terms, unless otherwise indicated, shall be understood to have the following meanings. As used herein a 'subject' refers to an animal or a mammal. Specific animals include rat, mouse, dog, cat, cow, sheep, horse, pig or primate. A subject may further be a human, alternatively referred to as a patient. A subject may further be a transgenic animal. A subject may further be a rodent, such as a mouse or a rat.
As used herein, an 'inhibitor' refers to a drug, compound or an agent that restrains, retards, or otherwise causes inhibition of a physiological, chemical or enzymatic action or function. An inhibitor may cause at least 5% decrease in enzyme activity. An inhibitor may also refer to a drug, compound or agent that prevents or reduces the expression, transcription or translation of a gene or protein. An inhibitor may reduce or prevent the function of a protein, for instance binding to and/or activating another protein or receptor. An inhibitor may reduce or prevent the interaction of an enzyme or protein with another enzyme or protein. According to certain embodiments of the invention, there are provided compounds which are sterol 12-a hydroxylase (Cyp8b1) inhibitors.
The term Cyp8b1 or sterol 12-alpha hydroxlase refers to the polypeptide expression product of the Cyp8b1 gene, the human orthologue corresponding to EntrezGene # 1582, NCBI Reference Protein NP_004382. Homologous Cyp8b1 enzymes are found in other species which bear sequence similarity to human Cyp8b1 and may thus find utility in the present invention, including but not limited to mouse (EntrezGene # 13124; NCBI Reference Protein NP_034142) and rat (EntrezGene # 81924; NCBI Reference Protein NP_1 12520.1).
The compounds of the invention may be RNA compounds, for instance RNA interference compounds. The term 'RNA' or 'RNA compound' as used in the present invention includes RNA molecules, RNA segments and RNA fragments. RNA may be single stranded, double stranded, synthetic, isolated, partially isolated, essentially pure or recombinant. RNA interference compounds may be comprised of a single stereoisomer or a combination of selected stereoisomers. RNA compounds may be naturally occurring, or they may be altered such that they differ from naturally occurring RNA compounds. Alterations may include addition, deletion, substitution or modification of existing nucleotides. Such nucleotides may be either naturally occurring, or non-naturally occurring nucleotides. Alterations may also involve addition of non-nucleotide material, for instance at the end or ends of an existing RNA compound, or at a site that is internal to the RNA compound (i.e. at one or more nucleotides).
The RNA compounds of the invention are capable of target-specific modulation of gene expression and typically exert their effect either by mediating degradation of the mRNA products of the target gene, or by preventing protein translation from the mRNA of the target gene. Such RNA compounds may thus also be referred to as 'RNA interference compounds'. The overall effect of interference with mRNA function is modulation of expression of the product of a target gene. In the context of this invention, 'modulation' means either inhibition or stimulation - i.e. either a decrease or an increase in expression. This modulation can be measured in ways which are routine in the art, for example by Northern blot assay or reverse transcriptase PCR of mRNA expression, Western blot or ELISA assay of protein expression, or by immunoprecipitation assay of protein expression.
In some embodiments of the invention, the RNA compounds are antisense RNA compounds. Antisense RNA compounds are typically single stranded RNA compounds which bind to complementary RNA compounds, such as target mRNA molecules, and block translation from the complementary RNA
compounds by sterically interfering with the normal translational machinery. This process is usually passive, in that it does not require or involve additional enzymes to mediate the RNA interference process. Specific targeting of antisense RNA compounds to inhibit the expression of a desired gene may generally involve designing the antisense RNA compound to have a homologous, complementary sequence to the desired gene. Perfect homology is not necessary for the RNA interference effect. In one embodiment of the invention, the antisense RNA compounds include any RNA compound with sufficient complementary homology to bind to the Cyp8b1 mRNA transcript causing a reduction in translation of Cyp8b1 protein. In other embodiments of the invention, the RNA compounds may be small interfering RNA (siRNA) compounds. Typically, siRNA compounds are short double stranded RNA compounds between 4 and 49 nucleotides in length. More preferably, siRNA compounds are between 16 to 29 nucleotides in length, even more preferably between 18 to 23 nucleotides in length and most preferably between 21-23 nucleotides in length. The siRNA compounds may include short nucleotide 'overhangs' on each end, which are single stranded extensions which are not paired with a complementary base on the opposite strand. The
overhangs would preferably be on the 3' end of each strand of the siRNA compound, and are typically 1-3 nucleotides in length. The siRNA compounds of the present invention may be synthesized as individual strands which are subsequently annealed to produce the double stranded siRNA compound.
Alternately, the siRNA compounds may derived from a short hairpin RNA
(shRNA) molecule, or from a longer RNA compound, which has been processed by the cellular enzyme called dicer, which processes the longer RNA compounds to produce siRNA compounds. Generally, siRNA compounds mediate RNA interference via an enzyme-dependent process in which the target mRNA is degraded, such that it can no longer be translated into its associated protein product. Not being bound by theory, the double stranded siRNA compounds are separated into single stranded molecules and integrated into an activated 'RISC complex'. After integration into the RISC, siRNAs base-pair to their target mRNA and induce cleavage of the mRNA, thereby preventing it from being used as a translation template.
The antisense compounds and siRNA compounds can be modified to enhance the stability of the oligonucleotides, particularly for in vivo use.
Numerous examples of methods for designing and optimizing antisense RNA compounds are found in the journal literature [Peek, A.S. and M.A. Behlke,
Design of active small interfering RNAs. Curr Opin Mol Ther, 2007. 9(2): p. 110- 8; Patzel, V., In silico selection of active siRNA. Drug Discov Today, 2007. 12(3- 4): p. 139-48; and Pan, W.H. and G.A. Clawson, Identifying accessible sites in RNA: the first step in designing antisense reagents. Curr Med Chem, 2006. 13(25): p. 3083-103]. Perfect sequence complementarity is not necessary for the siRNA compound or antisense compound to modulate expression of the target gene. The present invention provides non-limiting examples of locked nucleic acid gapmer oligonucleotides which modulate the expression of Cyp8b1 and are thus Cyp8b1 inhibitors.
Oligomer" as used herein is meant to encompass any nucleic acid silencing agent (for example, siRNA, miRNA, ASO in all of their modified forms as described herein) and compositions comprising the nucleic acid silencing agent. An oligomer may act by hybridizing to a target sequence.
The term 'medicament' as used herein refers to a composition that may be administered to a patient or test subject and is capable of producing an effect in the patient or test subject. The effect may be chemical, biological or physical, and the patient or test subject may be human, or a non-human animal, such as a rodent or transgenic mouse, or a dog, cat, cow, sheep, horse, hamster, guinea pig, rabbit or pig. The medicament may be comprised of the effective chemical entity alone or in combination with a pharmaceutically acceptable excipient.
The term 'pharmaceutically acceptable excipient' may include any and all solvents, dispersion media, coatings, antibacterial, antimicrobial or antifungal agents, isotonic and absorption delaying agents, and the like that are
physiologically compatible. An excipient may be suitable for intravenous, intraperitoneal, intramuscular, subcutaneous, intrathecal, topical or oral administration. An excipient may include sterile aqueous solutions or dispersions for extemporaneous preparation of sterile injectable solutions or dispersion. Use of such media for preparation of medicaments is known in the art [Remington, The Science and Practice of Pharmacy, Edited by Allen, Loyd V., Jr, 22nd edition, 2012, Pharmaceutical Press].
Compositions or compounds according to some embodiments of the invention may be administered in any of a variety of known routes. Examples of methods that may be suitable for the administration of a compound include orally, intravenous, inhalation, intramuscular, subcutaneous, intraperitoneal, intra-rectal or intra-vaginal suppository, sublingual, and the like. The compounds of the present invention may be administered as a sterile aqueous solution, or may be administered in a fat-soluble excipient, or in another solution, suspension, patch, tablet or paste format as is appropriate. Other agents may be included in combination with the compounds of the present invention to aid uptake or metabolism, or delay dispersion within the host, such as in a controlled-release formulation. Examples of controlled release formulations will be known to those of skill in the art, and may include microencapsulation, embolism within a carbohydrate or polymer matrix, and the like. Other methods known in the art for making formulations are found in, for example, "Remington's Pharmaceutical Sciences", (19th edition), ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa.; and Remington, The Science and Practice of Pharmacy, Edited by Allen, Loyd V., Jr, 22nd edition, 2012, Pharmaceutical Press]
Compounds and compositions as described herein or for use as described herein may be administered by means of a medical device or appliance such as an implant, graft, prosthesis, stent, etc. Also, implants may be devised which are intended to contain and release such compounds or compositions. An example would be an implant made of a polymeric material adapted to release the compound over a period of time.
The dosage of the compositions or compounds of some embodiments of the invention may vary depending on the route of administration (oral, intravenous, or the like) and the form in which the composition or compound is administered (solution, controlled release or the like). Determination of appropriate dosages is within the ability of one of skill in the art. As used herein, an 'effective amount', a 'therapeutically effective amount', or a 'pharmacologically effective amount' of a medicament refers to an amount of a medicament present in such a concentration to result in a therapeutic level of drug delivered over the term that the drug is used. This may be dependent on mode of delivery, time period of the dosage, age, weight, general health, sex and diet of the subject receiving the medicament. Methods of determining effective amounts are known in the art. It is understood that it could be potentially beneficial to restrict delivery of the compounds of the invention to the target tissue or cell in which inhibition of Cyp8b1 is desired, such as the liver for example. It is also understood that it may be desirable to target the compounds of the invention to a desired tissue or cell type. The compounds of the invention may thus be coupled to a targeting moiety. The compounds of the invention may be coupled to a cell uptake moiety. The targeting moiety may also function as the cell uptake moiety.
"Oligomer" as used herein is meant to encompass any nucleic acid silencing agent (for example, siRNa, miRNA, ASO in all of their modified forms as described herein) and compositions comprising the nucleic acid silencing agent. An oligomer may act by hybridizing to a target sequence.
A phosphorothioate oligonucleotide bond modification alters the
phosphate linkage by replacing one of the non-bridging oxygens with sulfur. The introduction of phosphorothioate linkages alters the chemical properties of the oligonucleotide. In particular, the addition of phosphorothioate linkages reduces nuclease degradation of the oligonucleotide, thereby increasing the half-life in situ. Accordingly, this modification is particularly useful for antisense
oligonucleotides, which when introduced into cells or biological matrices can interact with target nucleic acids to silence the expression of a particular transcript. Oligonucleotides containing phosphorothioate linkages accomplish this feat either through direct blockage of translation or enabling enzymatic degradation of the target transcript (for example, via RNase H).
Although phosphorothioate linkages provide improved half-life, the introduction of these linkages into an oligonucleotide may also introduce limitations to their function as antisense oligonucleotides. Each
phosphorothioate linkage creates a chiral center at each bond, which may result in multiple isomers of the oligonucleotide generated during synthesis and the isomers may have differential characteristics and functional properties. However, much of the isomer effects may be mitigated through careful positioning of the modifications or by using additional modifications in conjunction with the phosphorothioate bonds.
One or more of the phosphodiester linkages of the oligonucleotide moiety may be modified by replacing one or both of the two bridging oxygen atoms of the linkage with analogues such as -NH, -CH2, or -S. Other oxygen analogues known in the art may also be used.
A "modified oligonucleotide" as used herein is meant to include
oligonucleotides that are substituted or modified. In addition to the naturally occurring primary bases adenine, guanine, cytosine, and thymine, or other natural bases such as inosine, deoxyinosine, and hypoxanthine, there are numerous other modifications. For example, isosteric purine 2 ' deoxy- furanoside analogues, 2 ' -deoxynebularine or 2 ' deoxyxanthosine, or other purine and pyrimidine analogues such as 5-methyl pyrimidine or a 5-propynyl pyrimidine may also be utilized to improve stability and target hybridization.
A "modified sugar" as used herein when discussing an oligonucleotide moiety, a sugar modified or replaced so as to be ribose, glucose, sucrose, or galactose, or any other sugar. Alternatively, the oligonucleotide may have one or more of its sugars substituted or modified in its 2' position, i.e. 2 ' alkyl or 2'-0- alkyl. An example of a 2 ' -O-alkyl sugar is a 2 ' -O-methylribonucleotide.
Furthermore, the oligonucleotide may have one or more of its sugars substituted or modified to form an a-anomeric sugar.
"Second-generation" oligonucleotides as used herein may be defined as oligonucleotides that are resistant to degradation by cellular nucleases and capable of hybridizing specifically to their target precursor mRNA or mRNA with equal or higher affinity than first generation ASOs. An example of a 2nd generation ASO is a 2'-0-(2-Methoxyethyl)-RNA (2' OE gapmer modification). With a 2'-MOE or a 2'OMe gapmer the 5' and 3' ends may have 2'-MOE modified nucleotides to protect against degradation, but the gap between the 5' and 3' ends may be unmodified phosphodiester or phosphorothioate linkages that are substrates for RNase H. Numerous other chemical modifications have been developed to improve ASOs. For example, morpholino, N3' to P5'
phosphoramidate, and methylphosphonate chemical modifications are known in the art (N. Dias, and C. A. Stein 2002). Furthermore, peptide nucleic acids (PNAs) may also be used. "LNA" as used herein refers to a Locked Nucleic Acid, which is an RNA analog in which the ribose ring is connected by a methylene bridge between the 2'-0 and 4'-C atoms thus "locking" the ribose ring in the ideal conformation for Watson-Crick binding. When incorporated into a DNA or RNA oligonucleotide LNAs make the pairing with a complementary nucleotide strand more rapid and increases the stability of the resulting duplex. LNA oligonucleotides have better thermal stability when hybridized to a complementary DNA or RNA strand.
Furthermore, LNA oligonucleotides may be made shorter than traditional DNA or RNA oligonucleotides. LNA oligonucleotides are especially useful to detect small or highly similar targets.
A "nucleic acid silencing agent" or an "agent" refers to a composition that acts in a sequence specific manner to effect a reduction in the level of a product (a "gene product") of a given nucleic acid sequence (e.g. a 'gene'). The reduction may be effected by interference with any of the processing of a pre- mRNA following transcription from the DNA of a cell or subject (e.g. splicing, 5' capping, 5' or 3' processing, or export of the processed mRNA to the cytoplasm) or by interference with translation of a mature mRNA, or by specific, directed destruction of the pre-mRNA or mature mRNA. Antisense (ASO) and RNA interference (RNAi - effected by short interfering RNA, or siRNA) are two examples of such methods; microRNA (miRNA) is another.
An antisense oligonucleotide (ASO) is an oligonucleotide that is
complementary to a specific RNA sequence, and when hybridized to this specific sequence, interferes with processing or translation of the RNA or triggers degradation of the specific RNA by enzymatic pathways (for example, RNAse H- dependent degradation). The nucleosides comprising an ASO may be purine or pyrimidine nucleosides, or a combination of purine and pyrimidine nucleosides, connected by an internucleoside linkage. ASOs are described generally in, for example, Crooke 2004. Annu. Rev. Med 55:61-95; and in Curr Mol Med 4:465- 487. An siRNA is a short (20-30 nucleotide) double-stranded RNA (or modified RNA) molecule that may effect a reduction in the level of a gene product by allowing for specific destruction of mRNA via the RNA interference pathway. The specific mRNA is degraded in the cytoplasm by the RNA-induced silencing complex (RISC). An miRNA is a short (20-30 nucleotide) single-stranded RNA molecule that may effect a reduction in the level of a gene product. An miRNA is complementary to a part of an mRNA, either a coding region or a non-translated region (e.g. 5' untranslated region (UTR), 3' UTR). The miRNA may anneal to form a double-stranded complex and trigger degradation in a process similar to that of siRNA. Translation may also be disrupted by miRNA. A DNA ASO, commonly referred to simply as an ASO, is a short (12-50 nucleotide) single stranded DNA (or modified DNA) molecule that may effect a reduction in the level of a gene product by inducing specific destruction of pre-mRNA or mRNA via RNase H-mediated cleavage. The specific pre-mRNA or mRNA can be degraded in the nucleus and/or the cytoplasm by induction of RNAseH cleavage of DNA-RNA heteroduplexes. A DNA ASO, commonly referred to simply as an ASO, is a short (12-50 nucleotide) single stranded DNA (or modified DNA) molecule that may effect a reduction in the level of a gene product by inducing specific destruction of pre-mRNA or mRNA via RNase H-mediated cleavage. The specific pre-mRNA or mRNA can be degraded in the nucleus and/or the cytoplasm by induction of RNAseH cleavage of DNA-RNA heteroduplexes.
The term 'nucleoside' refers to a molecule of ribose or deoxyribose sugar bonded through carbon-1 of the sugar ring to a nitrogenous base. Examples of nitrogenous bases include purines such as adenine, guanine, 6-thioguanine, hypoxanthine, xanthine, and pyrimidines such as cytosine, thymine and uracil. Examples of purine nucleosides include adenosine (A), guanosine (G), inosine (I), 2'-O-methyl-inosine, 2'-O-methyl-adenosine, 2'-O-methyl-guanine, 2- chlorodeoxyadenosine, 7-halo-7-deaza-adenosine, 7-halo-7-deaza-guanine, 7- propyne-7-deaza adenosine, 7-propyne-7-deaza-guanine, 2-amino-adenosine, 7- deazainosine, 7- thia-7,9-dideazainosine, formycin B, 8-Azainosine, 9- deazainosine, allopurinol riboside, 8-bromo-inosine, 8-chloroinosine, 7-deaza-2- deoxy-xanthosine, 7-Deaza-8-aza-adenosine, 7-deaza-8-aza-guanosine, 7- deaza-8-aza-deoxyadenosine, 7-deaza-8-aza-deoxyguanosine, 7-deaza- adenosine, 7-deaza-guanosine, 7-deaza-deoxyadenosine, 7-deaza- deoxyguanosine, 8-amino-adenosine, 8-amino-deoxyadenosine, 8-amino- guanosine, 8-amino-deoxyguanosine,3-deaza-deoxyadenosine, 3-deaza- adenosine, 6-thio-deoxyguanosine, and the like, and other purine nucleosides as described in Freier et al 1997 (Nucleic Acids Res. 25:4429-4443), incorporated herein by reference. Examples of pyrimidine nucleosides include deoxyuridine (dU), uridine (U), cytidine (C), deoxycytidine (dC), thymidine (T), deoxythymidine (dT), 5-fluoro-uracil, 5-bromouracil, 2'-0-methyl-uridine, 2'-0-methyl cytidine, 5- iodouracil, 5-methoxy-ethoxy-methyl-uracil, 5-propynyl deoxyuridine,
pseudoisocytidine, 5-azacytidine, 5-(1-propynyl)cytidine, 2'-deoxypseudouridine, 4-thio-deoxythymidine, 4-thio-deoxyuridine, and the like, and other substituted pyrimidines as disclosed in Freier et al,1997 (Nucleic Acids Res. 25:4429-4443). Purine or pyrimidine nucleosides also include phosphoramidite derivatives used in oligonucleotide synthesis using standard methods.
"Nucleoside" also includes nucleosides having substituted ribose sugars (bicyclic or otherwise). Some representative patents and publications that teach the preparation of non-bicyclic modified sugars include, but are not limited to, U.S. Patents: 4,981 ,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811 ; 5,576,427; 5,591 ,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; 5,700,920; and 6,600,032; and WO 2005/121371. Some representative patents and publications that teach the preparation of bicyclic modified sugars include, but are not limited to, 'locked nucleic acids', such as those described in WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 0148190, WO 02/28875, WO 03/006475, WO 03/09547, WO 2004/083430, US 6,268,490, US 6,794499, US 7,034,133. Other examples of substituted ribose sugars are described in, for example, Freier, 1997 (Nucleic Acids Res. 25:4429-4443) and Herdewijn et al., 2000. (Antisense Nucleic Acid Drug Dev 10:297-310) both of which are incorporated by reference herein.
A 'nucleotide' refers to a nucleoside having an internucleoside linkage group bonded through the carbon-5 of the sugar ring, usually a mono-, di- or triphosphate, and may be suitable for enzymatic polymerization. In other examples, the nucleotides may be phosphoramidites, suitable for non-enzymatic polymerization or synthesis of nucleic acid polymers.
An internucleoside linkage group refers to a group capable of coupling two nucleosides, as part of an oligonucleotide backbone. Examples of
internucleoside linkage groups are described by Praseuth et al (Biochimica et Biophysica Acta 1489:181-206) and Summerton et al 1997. (Antisense and Nucleic Acid Drug Dev 7:187-195), both of which are incorporated herein by reference. For example, phosphodiester (P04-), phosphorothioate (P03s-), phosphoramidate (Ν3'-Ρ5') (P03NH) and methylphosphonate (P03CH3), peptidic linkages ("PNA"), and the like; see, for example, US Patent 5969118. Inclusion of such modified linkage groups, modified ribose sugars or nitrogenous bases in an oligonucleotide may reduce the rate of hydrolysis of the oligonucleotide in vitro or in vivo.
"Gapmer" or "gap oligomer", as used herein, refers to a chimeric oligomer having a central portion (a "gap") flanked by 3' and 5' "wings", wherein the gap has a modification that is different as compared to each of the wings. Such modifications may include nucleobase, monomeric linkage, and sugar modifications as well as the absence of a modification (such as unmodified RNA or DNA). Accordingly, a gapmer may be as simple as RNA wings separated by a DNA gap. In some cases, the nucleotide linkages in the wings may be different than the nucleotide linkages in the gap. In certain embodiments, each wing comprises nucleotides with high affinity modifications and the gap comprises nucleotides that do not comprise that modification. Alternatively, the nucleotides in the gap and the nucleotides in the wings may have high affinity modifications, but the high affinity modifications in the gap are different than the high affinity modifications in each of the wings. The modifications in the wings may confer resistance to cleavage by endogenous nucleases, including RNaseH, while the modifications in the gap may be substrates for RNase H. The modifications in the wings may confer resistance to cleavage by endogenous nucleases, including RNaseH, while the modifications in the gap may be substrates for
RNase H. The modifications in the wings may be the same or different from one another. The nucleotides in the gap may be unmodified and nucleotides in the wings may be modified. A gapmer has a wing-gap-wing ratio, which may be represented numerically (wing#-gap#-wing#). The gapmer may be symmetric (for example, 9-13-9, 9-12-9, 9-11-9, 9-10-9, 9-9-9, 9-8-9, 9-7-9, 9-6-9, 9-5-9, 9- 4-9, 9-3-9, 9-2-9, 9-1-9, 8-15-8, 8-14-8, 8-13-8, 8-12-8, 8-11-8, 8-10-8, 8-9-8, 8-
8- 8, 8-7-8, 8-6-8, 8-5-8, 8-4-8, 8-3-8, 8-2-8, 8-1-8, 7-15-7, 7-14-7, 7-13-7, 7-12-7, 7-11-7, 7-10-7, 7-9-7, 7-8-7, 7-7-7, 7-6-7, 7-5-7, 7-4-7, 7-3-7, 7-2-7, 7-1-7, 6-15-
6, 6-14-6, 6-13-6, 6-12-6, 6-11-6, 6-10-6, 6-9-6, 6-8-6, 6-7-6, 6-6-6, 6-5-6, 6-4-6, 6-3-6, 6-2-6, 6-1-6, 5-15-5, 5-14-5, 5-13-5, 5-12-5, 5-11-5, 5-10-5, 5-9-5, 5-8-5, 5-7-5, 5-6-5, 5-5-5, 5-4-5, 5-3-5, 5-2-5, 5-1-5, 4-17-4, 4-16-4, 4-15-4, 4-14-4, 4- 13-4, 4-12-4, 4-11-4, 4-10-4, 4-9-4, 4-8-4, 4-7-4, 4-6-4, 4-5-4, 4-4-4, 4-3-4, 3-24- 3, 3-23-3, 3-22-3, 3-21-3, 3-20-3, 3-19-3, 3-18-3, 3-17-3, 3-16-3, 3-15-3, 3-14-3, 3-13-3, 3-12-3, 3-11-3, 3-10-3, 3-9-3, 3-8-3, 3-7-3, 3-6-3, 3-5-3, 3-4-3, 2-26-2, 2- 25-2, 2-24-2, 2-22-2, 2-21-2, 2-20-2, 2-19-2, 2-18-2, 2-17-2, 2-16-2, 2-15-2, 2-14- 2, 2-13-2, 2-12-2, 2-11-2, 2-10-2, 2-9-2, 2-8-2, 2-7-2, 2-6-2, 2-5-2, 1-26-1 , 1-25-1 , 1-24-1 , 1-22-1 , 1-21-1 , 1-20-1 , 1-19-1 , 1-18-1 , 1-17-1 , 1-16-1 , 1-15-1 , 1-14-1 , 1- 13-1 , 1-12-1 , 1-11-1 , 1-10-1 , 1-9-1 , 1-8-1 or 1-7-1). The gapmer may be asymmetric (for example, 8-13-9, 8-12-9, 8-11-9, 8-10-9, 8-9-9, 8-8-9, 8-7-9, 8-6- 9, 8-5-9, 8-4-9, 8-3-9, 8-2-9, 8-1-9, 7-15-8, 7-14-8, 7-13-8, 7-12-8, 7-11-8, 7-10-8, 7-9-8, 7-8-8, 7-7-8, 7-6-8, 7-5-8, 7-4-8, 7-3-8, 7-2-8, 7-1-8, 6-15-7, 6-14-7, 6-13-
7, 6-12-7, 6-11-7, 6-10-7, 6-9-7, 6-8-7, 6-7-7, 6-6-7, 6-5-7, 6-4-7, 6-3-7, 6-2-7, 6- 1-7, 5-15-6, 5-14-6, 5-13-6, 5-12-6, 5-11-6, 5-10-6, 5-9-6, 5-8-6, 5-7-6, 5-6-6, 5- 5-6, 5-4-6, 5-3-6, 5-2-6, 5-1-6, 4-15-5, 4-14-5, 4-13-5, 4-12-5, 4-11-5, 4-10-5, 4-
9- 5, 4-8-5, 4-7-5, 4-6-5, 4-5-5, 4-4-5, 4-3-5, 4-2-5, 4-1-5, 3-17-4, 3-16-4, 3-15-4, 3-14-4, 3-13-4, 3-12-4, 3-11 -4, 3-10-4, 3-9-4, 3-8-4, 3-7-4, 3-6-4, 3-5-4, 3-4-4, 3-
3-4, 2-24-3, 2-23-3, 2-22-3, 2-21-3, 2-20-3, 2-19-3, 2-18-3, 2-17-3, 2-16-3, 2-15- 3, 2-14-3, 2-13-3, 2-12-3, 2-11-3, 2-10-3, 2-9-3, 2-8-3, 2-7-3, 2-6-3, 2-5-3, 2-4-3, 1-26-2, 1-25-2, 1-24-2, 1-22-2, 1-21-2, 1-20-2, 1-19-2, 1-18-2, 1-17-2, 1-16-2, 1- 15-2, 1-14-2, 1-13-2, 1-12-2, 1-11-2, 1-10-2, 1-9-2, 1-8-2, 1-7-2, 3-26-1 , 3-25-1 , 3-24-1 , 3-22-1 , 3-21-1 , 3-20-1 , 3-19-1 , 3-18-1 , 3-17-1 , 3-16-1 , 3-15-1 , 3-14-1 , 4- 13-1 , 4-12-1 , 4-11-1 , 4-10-1 , 3-9-1 , 3-8-1 or 4-7-1 ). A chimeric antisense oligonucleotide with a deoxy gap region which is greater than 10 nucleotides in length may be referred as a "gap-widened antisense oligonucleotide". The wing regions may be one to eight high-affinity modified nucleotides in length. The gap-widened antisense oligonucleotides may be 12 to 30 nucleotides in length capable of having, for example, various wing- gap-wing ratio may be selected from: 2-15-1 , 1-15-2, 1-14-3, 3-14-1 , 1-13-4, 4- 13-1 , 2-13-3, 3-13-2, 1-12-5, 5-12-1 , 2-12-4, 4-12-2, 3-12-3, 1-11-6, 6-11-1, 2-11- 5, 5-11-2, 3-11-4, 4-11-3, 2-16-1 , 1-16-2, 1-15-3, 3-15-1 , 2-15-2, 1-14-4, 4-14-1 , 2-14-3, 3-14-2, 1-13-5, 5-13-1 , 2-13-4, 4-13-2, 3-13-3, 1-12-6, 6-12-1 , 2-12-5, 5- 12-2, 3-12-4, 4-12-3, 1-11-7, 7-11-1, 2-11 -6, 6-11-2, 3-11-5, 5-11 -3, 4-11 -4, 1 -18-
1 , 1-17-2, 2-17-1, 1-16-3, 1-16-3, 2-16-2, 1-15-4, 4-15-1 , 2-15-3, 3-15-2, 1-14-5, 5-14-1 , 2-14-4, 4-14-2, 3-14-3, 1-13-6, 6-13-1 , 2-13-5, 5-13-2, 3-13-4, 4-13-3, 1-
12- 7, 7-12-1 , 2-12-6, 6-12-2, 3-12-5, 5-12-3, 4-12-4, 1-11-8, 8-11-1 , 2-11-7, 7-11-
2, 3-11-6, 6-11-3, 4-11-5, 5-11-4, 1-18-1 , 1-17-2, 2-17-1 , 1-16-3, 3-16-1 , 2-16-2, 1-15-4, 4-15-1 , 2-15-3, 3-15-2, 1-14-5, 2-14-4, 4-14-2, 3-14-3, 1-13-6, 6-13-1 , 2-
13- 5, 5-13-2, 3-13-4, 4-13-3, 1-12-7, 7-12-1 , 2-12-6, 6-12-2, 3-12-5, 5-12-3, 4-12- 4, 1-11-8, 8-11-1, 2-11-7, 7-11-2, 3-11-6, 6-11-3, 4-11-5, 5-11-4, 1-19-1 , 1-18-2, 2-18-1 , 1-17-3, 3-17-1 , 2-17-2, 1-16-4, 4-16-1 , 2-16-3, 3-16-2, 1-15-5, 2-15-4, 4-
15- 2, 3-15-3, 1-14-6, 6-14-1 , 2-14-5, 5-14-2, 3-14 4-14-3, 1-13-7, 7-13-1, 2-13- 6, 6-13-2, 3-13-5, 5-13-3, 4-13-4, 1-12-8, 8-12-1 , 2-12-7, 7-12-2, 3-12-6, 6-12-3,
4-12-5, 5-12-4, 2-11-8, 8-11 -2, 3-11 -7, 7-11 -3, 4-11 -6, 6-11 -4, 5-11 -5, 1 -20-1 , 1 - 19-2, 2-19-1 , 1-18-3, 3-18-1 , 2-18-2, 1-17-4, 4-17-1 , 2-17-3, 3-17-2, 1-16-5, 2-16- 4, 4-16-2, 3-16-3, 1-15-6, 6-15-1 , 2-15-5, 5-15-2, 3-15-4, 4-15-3, 1-14-7, 7-14-1 , 2-14-6, 6-14-2, 3-14-5, 5-14-3, 4-14-4, 1-13-8, 8-13-1 , 2-13-7, 7-13-2, 3-13-6, 6- 13-3, 4-13-5, 5-13-4, 2-12-8, 8-12-2, 3-12-7, 7-12-3, 4-12-6, 6-12-4, 5-12-5, 3-11- 8, 8-11-3, 4-11-7, 7-11-4, 5-11-6, 6-11-5, 1-21-1 , 1-20-2, 2-20-1 , 1-20-3, 3-19-1 ,
2- 19-2, 1-18-4, 4-18-1 , 2-18-3, 3-18-2, 1-17-5, 2-17-4, 4-17-2, 3-17-3, 1-16-6, 6-
16- 1 , 2-16-5, 5-16-2, 3-16-4, 4-16-3, 1-15-7, 7-15-1 , 2-15-6, 6-15-2, 3-15-5, 5-15-
3, 4-15-4, 1-14-8, 8-14-1, 2-14-7, 7-14-2, 3-14-6, 6-14-3, 4-14-5, 5-14-4, 2-13-8, 8-13-2, 3-13-7, 7-13-3, 4-13-6, 6-13-4, 5-13-5, 1-12-10, 10-12-1 , 2-12-9, 9-12-2,
3- 12-8, 8-12-3, 4-12-7, 7-12-4, 5-12-6, 6-12-5, 4-11-8, 8-11-4, 5-11-7, 7-11-5, 6- 11-6, 1-22-1 , 1-21-2, 2-21-1 , 1-21-3, 3-20-1 , 2-20-2, 1-19-4, 4-19-1 , 2-19-3, 3-19- 2, 1-18-5, 2-18-4, 4-18-2, 3-18-3, 1-17-6, 6-17-1 , 2-17-5, 5-17-2, 3-17-4, 4-17-3, 1-16-7, 7-16-1 , 2-16-6, 6-16-2, 3-16-5, 5-16-3, 4-16-4, 1-15-8, 8-15-1 , 2-15-7, 7- 15-2, 3-15-6, 6-15-3, 4-15-5, 5-15-4, 2-14-8, 8-14-2, 3-14-7, 7-14-3, 4-14-6, 6-14- 4, 5-14-5, 3-13-8, 8-13-3, 4-13-7, 7-13-4, 5-13-6, 6-13-5, 4-12-8, 8-12-4, 5-12-7, 7-12-5, 6-12-6, 5-11-8, 8-11-5, 6-11-7, or 7-11-6. The gap-widened antisense oligonucleotides may have a 2-16-2, 3-14-3, or 4-12-4 wing-gap-wing ratio.
As used herein, the term "high-affinity modification" in relation to a nucleotide refers to a nucleotide having at least one modified nucleobase, internucleoside linkage or sugar moiety, such that the modification increases the affinity of an antisense compound comprising the modified nucleotide to a target nucleic acid. High-affinity modifications include, but are not limited to, bicyclic nucleic acid (BNA)s, LNAs and 2 -MOE. Furthermore, the desirable potency and toxicity characteristics may be obtained by selecting the nucleotide modifications, nucleotide analogues, modified inter-nucleoside linkages, including one or more modified sugar moieties and/or a gapmer wing-gap-wing ratio (for example, see US20100197762).
Examples
The following examples are illustrative of some of the embodiments of the invention described herein. These examples do not limit the spirit or scope of the invention in any way.
Methods
Histochemical staining:
Massons' Trichrome: Mice were sacrificed and livers were immediately fixed in 4% PFA overnight and later paraffin embedded. 10 micron slices of the paraffin embedded livers were made and stained with the Massons' Trichrome staning kit (Thermo Scientific, Canada) as per manufacturer's instructions.
Oil Red O: Mice were sacrificed and livers were immediately snap frozen in liquid nitrogen. 25 micron cryosections were prepared from OCT fixed livers on a cryotome and stained with 0.5% Oil red O in isopropanol (Sigma Aldrich, MO, USA).
Immunofluorescence staining:
Mice were sacrificed and livers were immediately fixed in 4% PFA overnight and later paraffin embedded. 20 micron sections were prepared and processed for staining of alpha- smooth muscle actin (Abeam, MA, USA) using fluorescently tagged secondary antibody. Images were taken on an Olympus fluroscence microscope.
Western blotting:
Livers from HCD-fed control and Cp8b1 knockout mice were homogenized in radioimmunoprecipitation assay buffer and whole cell lysates were prepared and solubilized in Laemmli sample buffer. Proteins were resolved on self-cast 10% polyacrylamide gels and blotted onto PVDF membranes, blocked with 5% bovine serum albumin and probed with the polyclonal anti-alpha-smooth muscle actin antibody (Abeam, MA, USA) or the anti-Calnexin polyclonal primary antibody (Santa Cruz biotechnologies, CA, USA) overnight. After incubation with horseradish peroxidase-conjugated secondary antibody (Invitrogen, Carlsbad, CA), the immunoreactive proteins were detected using the enhanced
chemiluminescence detection reagent (GE Healthcare, Piscataway, NJ) on the BioRad Chemidoc.
Biochemical estimations:
Tissues were weighed and lysed in PBS and homogenized using the bead homogenization method. The lipids were extracted using Folch's solvent extraction method. Triglycerides and total cholesterol was measured
enzymatically using commercial kits (Infinity, Thermo Scientific, VA, USA).
Estimation of liver collagen: Hepatic levels of collagen were measured as previously described
[Mueller, M., et al., Ursodeoxycholic acid exerts farnesoid X receptor-antagonistic effects on bile acid and lipid metabolism in morbid obesity. J Hepatol, 2015. 62(6): p. 1398-404]. Briefly, liver tissues were homogenized in 2N NaOH and autoclaved for 25 min. The hydrolyzates were cooled to room temperature and filtered through Whatmann filter paper No. 1 to remove particulate matter.
Standard dilutions of 4-hydroxyproline (Sigma Aldrich, GmbH, Germany), samples and blanks in acetate-citrate buffer pH 6.5 were mixed in freshly prepared chloramine T and allowed to react at room temperature for 25 min. Color development was achieved by the addition of fresh Ehrlich's aldehyde reagent and incubation at 65°C for 20 min. Absorbances were measured at 550 nm. Results were plotted as mg collagen/g liver using the following formula: g collagen = (g 4-hydroxyproline / ml)* dilution factor * conversion factor(7:5) Quantitative Real time PCR:
Total RNA was isolated from tissues using an RNA extraction kit (Qiagen, Toronto, Ontario, Canada) and from islets using the RNeasy kit (Life
Technologies, Burlington, Ontario, Canada). One microgram of RNA was used to synthesize cDNA using the Superscript III First-Strand Synthesis kit (Life
Technologies). Primers were purchased from IDT Canada and the sequences used for measuring gene expression were as follows:
Name SEQ ID NO: Forward SEQ ID NO: Reverse
ATGGGCTGTGATC GTCTTCCCAATAAGCAT
Cd36 3 4
GGAACTG GTCTCC
ACAGTTGGCACAA CCTTCCATTTCAGTGTT
Gpatl 5 6
TAGACG I I I GCAGA
GGAGGTGGTGAT TGGGTAATCCATAGAG
Fas 7 8
AGCCGGTAT CCCAG
TTCTTGCGATACA CGGGATTGAATGTTCTT
Scd1 9 10
CTCTGGTGC GTCGT
GCTCCTCTTAGGG CCACGTCTCACCATTG
Col1a1 11 12
GCCACT GGG
CTGTAACATGGAA CCATAGCTGAACTGAA
Col3a1 13 14
ACTGGGGAAA AACCACC
GCAACTCGGACCT CGGCCCGTGATGAGAA
Timpl 15 16
GGTCATAA ACT Name SEQ ID NO: Forward SEQ ID NO: Reverse
TCAGAGCCAAAGC GCCGTGTAGATAAACT
Timp2 17 18
AGTGAGC CGATGTC
GTCCCAGACATCA TCGGATACTTCAGCGT
aSMA 19 20
GGGAGTAA CAGGA
GACGTGGAACTG I I GG I GG I I I I GAG I
TNFa 21 22
GCAGAAGAG GTGAG
ATGAACGCTACAC CCATCCTTTTGCCAGTT
Infg 23 24
ACTGCATC CCTC
GCAACTGTTCCTG A I C I I I I GGGG I CCG I
IL1b 25 26
AACTCAACT CAACT
TAGTCCTTCCTAC TTGGTCCTTAGCCACTC
IL6 27 28
CCCAA I I I CC CTTC
TCTGACTCAGTGA CCCATAAACATCAGCC
Bsep 29 30
TTCTTCGCA AGTTGT
TGGGTCCCAAGG GCTCCAAGACTTCACA
Shp 31 32
AGTATGC CAGTG
ATGGGGTCTCGGT GTCTTCTGGTACAGGT
ApoC2 33 34
TCTTCCT C I I I GG
CTGACAGGATGCC CGCAGGTAATCCCAGA
ApoE 35 36
TAGCCG AGC
CAG C AGTC AGTGT A I GGC I C I I I I A I CGGC
Mdr3 37 38
GCTTACAA CTCA
CGCAAAGGGCCA GCCCCCATCATATAAG
Pltp 39 40
C I I I I ACTA AACCAG
ATGGGAAATCCCC GTGCTGAGGTCTGAGA
Heplip 41 42
TCCAAATCT CGA
Primary mouse hepatocvte isolation and LNA mediated inhibition:
Primary hepatocytes from mice were isolated as previously described. Briefly, forward perfusion of the liver by cannulating the portal vein with a 23 X 3/4th butterfly cannula and sequential perfusion with Hanks balanced salt solution containing EDTA and later with collagenase type IV in Dulbeccos minimum essential medium (D EM) was performed in anesthetized mice. Digested hepatocytes were triturated, centrifuged, sieved and cultured on collagen coated plates at a density of 60,000 cell per cm2. Two hours after attachment, cells were washed and maintained in DMEM:F12 medium without serum. For the silencing experiments, cells were treated in growth medium with the two LNAs oligonucleotides of the following sequence:
Cyp8b1(2_1) 5' +G*+C*+T*+C*A*C*T*T*C*C*A*C*C*C*A*C*+T*+C*+C*+C 3'
(SEQ ID NO:1) Cyp8b1 (2_3) 5' +T*+T*+C*+A*T*C*T*C*G*C*T*G*A*G*G*G*+C*+A*+A*+A3'
(SEQ ID NO: 2)
for 72h after which cells were harvested and mRNA was isolated and processed for Quantitative Real time PCR as above. '+' in the sequence denotes a locked nucleic acid base and '*' indicates a phosphorothioate modification.
Example 1- High cholesterol diet leads to NAFLD and steatohepatitis
Wild type C57BI6J mice were fed a high cholesterol diet (HCD) of chow diet supplemented with 0.5% (w/w) cholesterol for 12 weeks. This led to an induction of steatosis and continuation of the diet for up to 16 weeks led to the development of fibrosis. As shown in Figure 1A, HCD fed mice have a 12 fold induction in steatosis area. Liver sections were stained with Oil Red O to reveal neutral lipids and as shown in Figure 1 B, HCD feeding led to a significant increase in Oil Red O-positivity. Liver sections were stained using Massons' Trichrome to reveal collagen which revealed a 24 fold induction in collagen positive area (Figure 1C). This model was used as a standard model for the study of NAFLD / NASH in all following studies.
Example 2 - Cyp8b1 knockout mice on HCD have reduced steatosis, hepatic triglycerides and cholesterol.
Cyp8b1 knockout and control mice were fed HCD for 16 weeks and NAFLD and NASH development was analyzed. Representative micrographs from 9 knockout and 9 control mice are shown in Figure 2A, and analysis of steatosis area in Figure 2B indicates that Cyp8b1 knockout mice are protected from steatosis as compared to wild type mice. The amount of hepatic triglyceride (Figure 3A) and total cholesterol accumulation in Cyp8b1 knockout mice is significantly reduced compared with control mice (Figure 3B).
Example 3 - Cyp8b1 knockout mice have reduced collagen deposition and reduced liver fibrosis. The liver sections were stained with Masons' Trichrome to reveal collagen (blue), which was quantified and found to be reduced in Cyp8b1 knockout mice (Figure 4A). The total amount of 4-hydroxyproline was estimated biochemically from liver homogenates and expressed in terms collagen/g liver tissue. Cyp8b1 knockout mice had significantly lower amount of collagen per g. liver tissue compared with control mice (Figure 4B).
The activation of hepatic stellate cells leads to fibrotic gene expression and a-smooth muscle actin (a-SMA) serves as a marker for stellate cell activation. Therefore, liver sections from control and Cyp8b1 knockout mice were stained with anti- a-SMA antibody and the positive area was quantified. Cyp8b1 knockout mice had significantly reduced a-SMA positive area (Figure 5A and B). Quantification of a-SMA protein from western blot also revealed significantly reduced a-SMA positivity in Cyp8b1 knockout mice compared with controls (Figure 5C). A Q-RT PCR analysis of gene expression of fibrotic markers revealed that Cyp8b1 knockout mice had a significantly reduced expression of Tissue Inhibitor Of Metalloproteinases (T/mp)-1 , Timp2, collagen, type I, alpha 1 (Col1a1) and α-SMA (Figure 5D).
Example 4 - Cyp8b1 knockout mice have reduced inflammation.
Liver sections from Massons' Trichrome were analyzed for inflammatory cell infiltration defined as 3 or more dense eosinophilic nuclei invading the hepatic parenchyma. Analysis revealed a reduced inflammatory score for Cyp8b1 knockout mice compared with controls (Figure 6A and B). A Q-RT PCR analysis of gene expression of inflammatory markers revealed that Cyp8b1 knockout mice had a significant reduction in the expression of interleukin 1 β (111 β) (Figure 6B)
Example 5 - FXR target genes are downregulated in the livers of Cyp8b1 knockout mice.
To test whether the relative enrichment of FXR antagonistic bile acids such as α, β, ω-MCA and UDCA have functional impact on hepatic FXR activation, the gene expression of FXR target genes in Cyp8b1 knockout and control livers was quantified. Analysis revealed that most of the well
characterized FXR target genes such as bile salt export pump (Bsep), ATP- binding cassette, sub-family B (MDR/TAP), member 1 (Mdr3), Hepatic lipase (Lipc), phospholipid transfer protein (Pltp) and apolipoprotein C2 (ApoC2) were downregulated in Cyp8b1 knockout mice livers compared with controls (Figure 7A). To directly measure the effects exerted by the altered bile acid composition of Cyp8b1 knockout mice on hepatocyte gene expression, primary mouse hepatocytes isolated from wild type C57bl_6J mice fed HCD were treated for 16 weeks and FXR target gene expression was measured. Analysis revealed that a- MCA dose dependently repressed the transcripts of not only Bsep and Mdr3 but also 2 important lipogeneic genes Fas and Scd1, UDCA and β-MCA were used as positive controls in these experiments (Figure 7B). Example 6 - Locked nucleic acid (LNAVDNA hybrid oligonucleotides targeting Cyp8b1 leads to a dose dependent knockdown.
To test whether Cyp8b1 expression yields to antisense oligonucleotide (ASO)- mediated knockdown, two LNA/DNA hybrid gapmer ASOs were designed and tested on mouse hepatocytes. Unassisted delivery of one of the LNA (SEQ ID NO: 1) produces a dose-dependent knockdown of up to 60% after 72h of treatment (Figure 8).
Cyp8b1 (2_1) 5' +G*+C*+T*+C*A*C*T*T*C*C*A*C*C*C*A*C*+T*+C*+C*+C 3'
(SEQ ID NO:1)
Cyp8b1 (2_3) 5' +T*+T*+C*+A*T*C*T*C*G*C*T*G*A*G*G*G*+C*+A*+A*+A3'
(SEQ ID NO: 2)
Where '+' in the sequence denotes a locked nucleic acid base and '*' indicates a phosphorothioate modification.
Example 7 - in vivo knockdown Study
Mice and treatments: Twelve, 17 week old, C57BI6J female mice were divided into two groups and were given ad libitum access to water and a diet supplemented with 0.5% w/w cholesterol (high cholesterol diet [HCD], TD10401 ; Harlan Diets, Madison, Wl). One group received 3mg/kg of negative control LNA Gapmer of the sequence 5'-AACACGTCTATACGC-3' and the other group received 3mg/kg of HDL2_LNA_500125 LNA Gapmer of the sequence 5'-ATCTCGCTGAGGGCA-3'. The Gapmers were administered intraperitoneally for 5 consecutive days in physiological saline. A set of 3 additional mice were administered 2, 4 and 5 mg/kg of the HDL2_LNA_500125 LNA Gapmer for the same duration of time. The LNA Gapmers were commercially produced such that the three 5' and 3' nucleotides were locked nucleic acids and each nucleotide was phosphorothioate modified. Gapmer oligobnucleotides were commercially produced and purified using anion-exchange HPLC to meet in vivo grade puriety by Exiqon (Vedbaek, Denmark).
Measurement of fecal fat mass and cholesterol excretion:
For the estimation of fecal excretion of dietary cholesterol, fecal pellets were collected over 72 h from mice that were fed HCD. Lipids were extracted from lyophilized, pulverized feces using chloroform: methanol: NP40 (7:11 :0.1) in a volume 20 times the weight of the sample. Lipid extracts were then air dried and weighed to calculate the fat mass. Extracts were resuspended in 200 μΙ sterile phosphate-buffered saline containing 1% Triton X 100, followed by enzymatic quantification of total cholesterol using biochemical kits according to manufacturer's instructions (Infinity, Thermo Scientific, Middleton, VA). siRNA transfections and cell culture:
HepG2 cells (ATCC HB-8065™) were split and plated at a cell density of 4X105 cell per well of a 12 well plate. Cells were cultured in incubators 37°C with 5% CO2 in Dulbecco's minimum essential medium (DMEM) (Gibco ThermoFisher Scientific, Burlington, ON), supplemented with 10% fetal calf serum and antibiotics. Once the cells reached 80% confluence, they were transfected using the designated sequence of siRNA / LNA Gapmers using the Lipfectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA) in the Opti MEM reduced serum medium (Gibco, ThermoFisher Scientific, Burlington, ON) for 48 hours. At the end of 48 hours, the cells were lysed in 50 μΙ_ RIPA buffer (Sigma Aldrich, St. Louis, MO) and the protein concentration from the lysates was measured using the BCA protein quantification kit. Proteins were resolved using 10% polyacrylamide gels and western blotting was performed as described above. The amount of Cyp8b1 protein was detected using anti-Cyp8b1 antibody (Abeam, catalogue number ab191910) in conjunction with anti-rabbit secondary antibody.
Sequences used for silencing:
All sequences were purchased from IDT technologies (Coralville, IO). LNA Gapmers were purchased from Exiqon (Vedbaek, Denmark).
HDL2 LNA 1
5'GGGAGTGGCTAGAAGTGGGC-3' (SEQ ID NO: 43)
HDL2 LNA 3
5'TTTGCACTCAGTGAGGTGAA3' (SEQ ID NO: 44)
HDL2 si 1
5'-CTGAAGCACCCAGAAGCTATT-3' (SEQ ID NO: 45)
5'-AATAGCTTCTGGGTGCTTCAG-3' (SEQ ID NO: 46)
HDL2 si101
5'-AATTCAAACATATTCTTCCGG-3' (SEQ ID NO: 47)
5'-GGAAGAATATGTTTGAATTTC-3' (SEQ ID NO: 48)
HDL2 si103
5'-AGTTTTTTTGCATATTGCCCA-3' ((SEQ ID NO: 49)
5'-GGCAATATGCAAAAAAACTGG-3' (SEQ ID NO: 50)
HDL2 si109
5'-TTGAAGAAGTCCACTTTCCGG-3' (SEQ ID NO: 51)
5'-GGAAAGTGGACTTCTTCAAGA -3' (SEQ ID NO: 52)
Dsi2 5'-TGGGAGCCCCCTCTGGACAAGGGT-3' (SEQ ID NO: 53) 5'-ACCCTTGTCCAGAGGGGGCTCCCA-3' (SEQ ID NO: 54)
Dsi13
5'-GGTTGGTTCATGAAGACTATACCCT-3' (SEQ ID NO: 55)
5'- AGGGTATAGTCTTCATGAACCAACC-3' (SEQ ID NO: 56)
Results:
Results are displayed visually in Figures 9, 10 and 11.
Cholesterol lowering drugs such as statins in combination with Ezetimibe to inhibit absorption, were recently shown to reduce NASH related pathology in a mouse model (Rooyen, D. M. Van, Gan, L. T., Yeh, M. M., Haigh, W. G., Larter, C. Z., loannou, G., Farrell, G. C. (2013). Pharmacological cholesterol lowering reverses fibrotic NASH in obese, diabetic mice with metabolic syndrome. Journal of Hepatology, 59(1), 144-152. http://doi.org/10.1016/i.ihep.2013.02.024). This has driven the support for a renewed consideration of statin prescription to patients with NAFLD (Egan, M., Prasad, S., Medicine, M. F., & Hickner, J.
(2011). Statins for patients with nonalcoholic fatty liver? The Journal of Family Practice, 60(9), 536-538.). Previous studies have shown that the absence of CA and relative enrichment of MCA alters the hydrophobicity of bile in Cyp8b1-/- mice, that leads to reduced intestinal absorption of lipids, especially of cholesterol (Kaur, A., Patankar, JV., de Haan, W., Ruddle, P., Wijesekara, N., Groen, AK., Verchere, CB., Singaraja, RR., Hayden, MR. 2015. "Loss of Cyp8b1 improves glucose homeostasis by increasing GLP-1." Diabetes 64 (4): 1168- 1179). Therefore it is hypothesized that the Cyp8b1-/- mice would be resistant to the non-alcoholic steatohepatitis.
Example 8 - Lower fat mass and increased metabolic rate in Cyp8b1 knockout mice and Lower hepatic damage and increased fecal cholesterol and fat excretion in Cyp8b1 knockout mice
Animals and diets: Cyp8b1+/" mice were purchased from the University of California, Davis, Knockout Mouse Project (KOMP) repository (Cyp8b1tm1 (KOMP)Vlcg).
Cyp8b1+/+ (control) and Cyp8br/_ (knockout) mice were obtained by breeding Cyp8b1+/" mice. This study used male and female mice, aged 3-6 months. The mice had ad libitum access to water and were fed a diet supplemented with 0.5% w/w cholesterol (high cholesterol diet [HCD], TD10401 ; Harlan Diets, Madison, Wl) for 12 - 16 weeks or methionine choline- deficient diet [MCD], A02082002B ; Research Diets, New Brunswick, NJ. For experiments involving fasting, mice were fasted for 4h (7:00 A.M.-11 :00 A.M.) before the procedure. Blood for all experiments was drawn from the medial saphenous vein in EDTA coated capillary tubes. All experiments were approved by the University of British Columbia Animal Care Committee.
Analysis of body composition and energy metabolism
Lean and fat mass were quantified by EchoMRI-100 (Echo Medical
Systems, Houston, TX, USA) with quantitative magnetic resonance-based method.
For simultaneous measurement of multiple metabolic parameters, mice were housed in PhenoMaster metabolic cages (TSE Systems, Bad Homberg, Germany) for 4 consecutive days. All calculated values for V02, VC02, RER, locomotor activity, food intake and water intake are based on measurements obtained over 60 hours post-acclimatization. Mice were allowed to acclimatize for at least 24 hours in the metabolic cages prior to actual data collection. Oxygen consumption (VO2) and carbon dioxide production (VCO2) were measured. Respiratory exchange ratio (RER) was calculated as RER = VCO2A 02 and energy expenditure (EE) as EE = 3.185 x VO2 + 1.232 x VCO2. Locomotor activity was tracked by the total counts of infra-red beam breaks. Food and water intakes were monitored through weight sensors. Biochemical parameters: Levels of plasma triglycerides (TG), cholesterol (C) and cholesterol ester (CE) were performed using enzymatic kits according to manufacturer's protocols (Infinity, Thermo Scientific, Middleton, VA). Levels of lactate dehydrogense (LDH), were measured from the media after incubation of primary hepatocytes with LPS or TNF at indicated concentration and time using the LDH cytotoxicity assay kit according to manufacturer's instructions (Thermo Scientific, Middleton, CA). The levels of serum aspartate aminotransferase (AST) and alanine were determined using commercially available kits from Sigma Aldrich, St. Louis, MO. Hepatic and cellular TG, C and CE estimation:
TG, C and CE concentrations were determined from lipid extracts of liver lysates or cultured cells using enzymatic kits as mentioned above. Briefly, liver samples from Cyp8b1+/+ and Cyp8b _ mice were weighed, homogenized, and lipids were extracted in chloroform: methanol: NP40 (7:11 :0.1) in a volume 20 times the weight of the sample. Lipid extracts were then air dried and
resuspended in 200 μΙ sterile phosphate-buffered saline followed by enzymatic quantification.
Fecal excretion of dietary cholesterol:
For the estimation of fecal excretion of dietary cholesterol, fecal pellets were collected over 72 h from mice that were fed HCD. Lipids were extracted from lyophilized, pulverized feces using chloroform: methanol: NP40 (7:11 :0.1) as described for tissues above. Total cholesterol in the feces was measured using biochemical kits followed by spectrophotometric quantification.
Isolation, culture and treatment of primary hepatocytes and Kupffer cells (KCs):
Hepatocytes were isolated after portal cannulation and collagenase perfusion of the liver as previously published. Briefly, mice were anesthetized using a single terminal dose of Avertin (250 mg/kg), the portal vein was exposed and cannulated using a 23G x ¾" butterfly cannula (BD, Vacutainer #367297) and the inferior vena cava was incised to allow outflow. The liver was perfused with Hanks balanced salt solution containing HEPES and devoid of Calcium at 9mlJminute after which the solution was changed to Ca and Mg free, low glucose (1g/L) DMEM containing 100-125 CDU/ml of Collagenase type IV (Sigma
#C5138, St. Louis, MO) and antibiotics (100 U/mL penicillin, 100 pg/mL streptomycin). A digestion time of 8-10 minutes was allowed depending on the size of the liver and the degree of steatohepatitis with steatohepatitic livers requiring longer. The in situ digested livers were then carefully excised from the body cavity and cells were dissociated, collagenase activity was inhibited using ice cold DMEM: F12 supplemented with 10% fetal bovine serum (FBS) and filtered through a 480 mm stainless steel wire mesh. Followed by a low speed centrifugation, the cell pellet was resuspended in DMEM: F12 supplemented with 10% FBS and filtered through 70 pm cell strainer, washed, counted and plated on collagen coated (5 pg rat tail collagen/cm2) plates at a density of 3.75* 103 cells/cm2. Non-adherent cells were washed-off 4 hours after plating and cells were cultured in DMEM: F12 containing 10% fetal calf serum and antibiotics overnight. For the isolation of KCs from the non-parenchymal fraction, perfused and digested livers were centrifuged at 50 x g and the supernatant was reserved. The supernatant was centrifuged at 2430 rpm to collect the cells. The cell pellet was washed twice in cold DMEM: F12 and then resuspended in DMEM: F12 with 10% FBS and subjected to differential adhesion on non-tissue culture treated plates. Unattached cells were washed after 1 hour of incubation and adherent cells were detached using Trypsin-EDTA (0.25%), washed, counted and cultured at 5000-10000 cells/ well in DMEM: F12 with 10% FCS on tissue-culture plates overnight. Both, hepatocytes and KCs were used in experiments the following day. Media, antibiotics and FBS were purchased from Gibco, ThermoFisher Scientific, Burlington, ON.
Western blotting:
Livers from HCD-fed Cyp8b1+ + and Cyp8b1"A mice were homogenized in radioimmunoprecipitation assay buffer and whole cell lysates were prepared and solubilized in Laemmli sample buffer. Proteins were resolved on self-made agarose gels of appropriate percentage using reagents from commercial providers, blotted onto Polyvinylidene fluoride membranes, blocked with 5% bovine serum albumin / dried milk powder and probed with the appropriate polyclonal primary antibodies overnight. After incubation with anti-host Ig horseradish peroxidase-conjugated secondary antibodies (Invitrogen, Carlsbad, CA), the immunoreactive proteins were detected using the enhanced
chemiluminescence detection reagent (GE Healthcare, Piscataway, NJ / Thermo Scientific, Rockford IL). Antibodies against smooth muscle actin alpha 2 (aSMA), fatty acid synthase (FAS), Sterol 12-a hydroxylase (CYP8B1), sterol regulatory element binding protein (SREBP)-1 and 2 were purchased from Abeam,
Cambridge, MA. Antibody against Calnexin was purchased from Santa Cruz Biotechnology, Santa Cruz, CA. Relative densities of protein of interest versus housekeeping protein Calnexin were calculated from the percent area under the curve generated using Image J.
Results are displayed visually in Figures 12 and 13. As shown in Figure
13, a 4 fold increase in fecal lipid excretion (Figure 13C) and a 2.8 fold increase in fecal cholesterol excretion (Figure 13D) in Cyp8b1-/- mice was observed compared with Cyp8b1+/+ mice. The reduction in cholesterol absorption and the repression of hepatic DNL clearly contribute to the reduction in the susceptibility to steatohepatitis of Cyp8b1 -/- mice.
Example 9 - Favourable alterations in gut Microbiota of Cyp8b1-/- mice.
The pool size and composition of BA greatly influences the composition of gut microbiota (Hofmann, A. F., & Eckmann, L. (2006). How bile acids confer gut mucosal protection against bacteria. Pnas, 703(10), 4333-4334.
http://doi.org/ 0.1073/pnas.0600780103). The obstruction of bile flow causes small intestinal bacterial overgrowth and a compromised epithelial barrier, which can be reversed by oral administration of bile acids (Inagaki, T., Moschetta, A., Lee, Y.-K., Peng, L, Zhao, G., Downes, M., Kliewer, S. A. (2006). Regulation of antibacterial defense in the small intestine by the nuclear bile acid receptor.
PNAS, 703(10), 3920-5.). Gut microbiota composition in turn influences hepatic tolerance and immune-suppression. Moreover, recent data strongly indicates that dietary cholesterol directly induces inflammation and reduces barrier function in the intestine (Progatzky, F., Sangha, N. J., Yoshida, N., McBrien, M., Cheung, J., Shia, A., Dallman, M. J. (2014). Dietary cholesterol directly induces acute inflammasome-dependent intestinal inflammation. Nature Communications, 5, 5864.). Therefore, we hypothesized that the absence of CA and the associated changes in BA composition in Cyp8b1-/- mice and the reduced uptake of cholesterol, would alter the gut microbial community structure and inflammation in the gut.
Analysis of gut microbiota:
The pyrosequencing and bioinformatics analysis of bacterial 16S rRNA was performed by the commercial vendor and service provider, Microbiome Insights Inc, Vancouver, BC, using samples from the jejunum of Cyp8b1+/+ and Cyp8b1 -/- mice after 12 weeks of HCD diet.
Sample Preparation
Bacterial DNA was isolated from the intestines using standardized protocols for the PowerSoil Extraction kit (Mo Bio Laboratories, Qiagen,
Carlsbad, CA), which has been previously validated for samples in our lab.
Purified DNA was amplified using dual-barcoded primers targeting the V4 region of the 16S rRNA gene. Amplicons were subjected to 2 x 250 paired-end sequencing on a MiSeq. Additional wet-lab protocols, including library
normalization and PhiX% spike-in, are included in Kozich et al. (2013).
Sequence curation and analysis
We sequenced 16S rRNA gene V4 amplicons generated from 14 mouse intestine samples on a MiSeq. MiSeq-generated Fastq files were quality-filtered and clustered into 97% similarity operational taxonomic units (OTUs) using the mothur software package [http://www.mothur.org]. We obtained 87,116 high- quality reads and 2,305 OTUs (including those occurring once with a count of 1 , or singletons).
Taxonomic composition
High quality reads were classified using Greengenes v. 13_8 as the reference database. We aggregated OTUs into phylum-level and genus-level taxa and plotted the relative abundance of the most abundant taxa. In the figure legends, "Other" represents unclassified and lower-abundance taxa. Results:
The microbiota composition of the small intestines from HCD fed
Cyp8b1 +/+ and Cyp8b1-/- mice were analyzed using the 16S rDNA variable region 4 (V4) amplicon sequencing method. Analysis revealed phylum and genus level changes in microbial composition of the jenunum in Cyp8b1-/- mice
(Figures 14A-C). We calculated the ecological similarity represented in Figure 14 B, using Pearsons correlation. The analysis showed that Cyp8b1-/- mice have distinct gut microbial communities. At the phylum level (Figure 14A), Cyp8b1-/- mice showed an increase in the fermicute to bacteroidetes ratio. The levels of fermicutes were increased whereas those of bacteriodetes were reduced. These changes are characteristic of those seen in lean mice or mice that have undergone weight loss (Zhang, C, Li, S., Yang, L, Huang, P., Li, W., Wang, S., & Zhao, G. (2013). Structural modulation of gut microbiota in life-long calorie- restricted mice. Nature Communications, 4, 1-10.). The proportions of
cholesterol degrading phyla, Acidobacteria and Actinobacteria, increased in Cyp8b1-/- mice from 1% to 2% and from 2% to 6% respectively, compared with those in Cyp8b1+/+ mice (Casabon, I. (2014). Actinobacterial Acyl Coenzyme A Synthetases Involved in Steroid, J. Bacteriol 796(3), 579-587.; and Casabon, I., Crowe, A. M., Liu, J., & Eltis, L. D. (2013). FadD3 is an acyl-CoA synthetase that initiates catabolism of cholesterol rings C and D in actinobacteria. Mol
Microbiol87269-283.). At the genus level, we identified a huge increase in the proportion of Allobaculum (18 fold increase). The levels of Allobaculum negatively correlate with body weight and plasma leptin levels and positively correlate with lifespan (Zhang, C, Li, S., Yang, L, Huang, P., Li, W., Wang, S., & Zhao, G. (2013). Structural modulation of gut microbiota in life-long calorie- restricted mice. Nature Communications, 4, 1-10.). Interestingly, the levels of Bifidobacterium, a cholesterol-owering probiotic microbial phylum, were also increased in Cyp8b1-/- mice (6 fold increase) (Zanotti, I., Turroni, F., Piemontese, A., Mancabelli, L., Milani, C, Viappiani, A., Sinderen, D. Van. (2015). Evidence for cholesterol-lowering activity by Bifidobacterium bifidum PRL2010 through gut microbiota modulation, 6813-6829.; and Bordoni, A., Amaretti, A., Leonardi, A., Boschetti, E., Danesi, F., Matteuzzi, D., ... Rossi, M. (2013). Cholesterol-lowering probiotics : in vitro selection and in vivo testing of bifidobacteria, 8273-8281). These changes are indicative of beneficial alterations in the composition of gut microbiota of Cyp8b1-/- mice. Example 10 - Sequences for different targeting strategies:
mRNA secondary structure prediction:
A given single stranded nucleic acid molecule has a high propensity to form secondary structures by establishing intra-molecular base pairing. The simple complimentary Watson-Crick rules for base pairing and GU pairing dictate the formation of ordered helices and less ordered loops within the
molecule(Mathews, D. (2004) Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization. RNA. 10(8): 1178-1190). Dynamic algorithms have been developed that can predict with greater accuracy the secondary structure of a given nucleic acid sequence. Importantly, free energy minimization alone is sufficient to predict 40% of potential base pairing(Mathews, D. (2004) Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization. RNA. 10(8): 1178-1190,). This, together with
considerations of entropy of stacking co-axial helices separated by single base pair mismatches yields a high degree of confidence in prediction of secondary mRNA structures(Mathews, D (2004) Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization. RNA. 10(8): 1178-1 90). Based on these criteria a freely accessible web-based program suite, The ViennaRNA Web Service has been developed and can be accessed here: http://rna.tbi.univie.ac.at/The website provides number of prediction tools which reveal the thermodynamic properties and emergent base-pairing probabilities leading to the secondary structure of a given RNA molecule. The RNAUp tool is then employed to predict the interaction free energy and the energy needed to open an existing secondary structure in the given sequence(Lorenz, R. et al., 2011 ViennaRNA Package 2.0. Algorithms Mol Biol.6: 26 )(Gruber et al., 2008 The Vienna RNA Websuite. Nucleic Acids Res. July 1 ; 36: W70-W74).
The RNAeval tool was used to get a detailed thermodynamic description (loop free-energy decomposition) of the cDNA sequence of the human CYP8B1 mRNA. This permits the generation of the secondary structure shown in Figure 15A. The probability of base-pairing for each nucleotide is color coded shown in the scale / legend below with blue indicating a base pairing probability of 0 and red indicating maximum probability of 1. RNAup tool was used to determine the required interaction free energy for various regions within the secondary structure shown in Figure 15B. Based on this regions of interest were identified marked as shown Figure 15C (sequences marked with boxes). The regions of interest were then utilized to derive the desired sequences of targeting molecules for each of the different strategies outlined in the tables below after applying constraints against sequence homology using simple BLAST search and high GC content. siRNA (21 nucleotides + 2 overhang)
SEQ ID
Base pair position Sequence 5'-3'
NO
57 148 CGGAAGAATATGTTTGAATTTCT
58 402 TGGGCAATATGCAAAAAAACTGG
59 419 AATGAGACCATGCTGGACAGCCT
60 618 CCGCAAGTTTGACCTTCTTTTCC
61 765 GGGCAACATGCTTCAGTTTCTGA
62 815 AGGAC AAGT T C AAC T T CAT GAT G
63 879 GCCCTCTTGTACCTCCTGAAGCA siRNA (21 nucleotides + 2 overhang)
SEQ ID
Base pair position Sequence 5'-3' NO
64 1065 CTCCTCAGGTTGGTTCATGAAGA
65 1085 AAGACTATACCCTGAAGATGTCC
66 1080 T CAT G AAGAC AT AC C C T GAAGA
67 1242 CCGGAAAGTGGACTTCTTCAAGA
68 1347 GTGAAGCTCTTTATCCTGCTTAT
69 1373 C AC AC AC T T T G AC T T AGAGT T GG
Figure imgf000048_0001
Gapmer anti-sense oligonucleotides of the configuration (4X) LNA -(6X) PS -
(4X)LNA
LNA = locked nucleic acid; PS = phosphorothioate modification
SEQ ID
Base pair position Sequence 5'-3'
NO:
86 15 TCCAGTGCTGGGAG
87 147 CCGGAAGAATATGT
88 279 ACAGAGAAAACTAG
89 401 ATGGCTTGAAGGAT
90 427 ATGCTGGACAGCCT
91 610 TGGAGTTCCGCAAG
92 782 TCTGAGGGAGCAGG
93 805 CAGCTATGCAGGAC Gapmer anti-sense oligonucleotides of the configuration (4X) LNA -(6X) PS -
(4X)LNA
LNA = locked nucleic acid; PS = phosphorothioate modification
SEQ ID
Base pair position Sequence 5'-3' NO:
94 822 GTTCAACTTCATGA
95 885 TTGTACCTCCTGAA
96 906 AGAAGCTATTCGGG
97 1045 GGCTGAGGGCTGCA
98 1066 TCCTCAGGTTGGTT
99 1087 AC TA AC C C T GAAG
100 1245 AAAGTGGACTTCTT
101 1284 TACACCATGCCCTG
102 1348 TGAAGCTCTTTATC
103 1384 ACTTAGAGTTGGTG
> Hs_CYP8B1 cDNA sequence (SEQ ID NO: 104)
ATGGTTCTCTGGGGTCCAGTGCTGGGAGCTCTGCTGGTGGTCATTGCTGGATACCTGTG CCTGCCAGGGATGCTCCGACAACGCAGGCCATGGGAGCCCCCTCTGGACAAGGGTACCG TGCCCTGGCTTGGCCATGCCATGGCTTTCCGGAAGAATATGTTTGAATTTCTGAAGCGC ATGAGGACCAAGCATGGGGATGTGTTCACAGTGCAGCTAGGGGGCCAGTACTTCACCTT CGTCATGGACCCCCTCTCCTTTGGCTCCATCCTCAAGGACACACAGAGAAAACTAGACT TTGGGCAATATGCAAAAAAACTGGTGCTGAAGGTATTTGGATACCGTTCAGTGCAAGGG GACCATGAGATGATACACTCAGCCAGCACCAAGCATCTGAGGGGGGATGGCTTGAAGGA TCTTAATGAGACCATGCTGGACAGCCTGTCCTTTGTAATGCTGACGTCCAAAGGCTGGA GTCTGGATGCCAGTTGCTGGCATGAGGACAGCCTCTTTCGCTTCTGCTATTACATCTTG TTCACAGCTGGCTACCTGAGCTTGTTCGGCTACACGAAGGACAAGGAGCAGGACCTGCT ACAGGCAGGAGAGTTATTCATGGAGTTCCGCAAGTTTGACCTTCTTTTCCCAAGGTTTG TCTACTCCCTGCTGTGGCCCCGGGAGTGGCTAGAAGTGGGCCGACTCCAGCGTCTCTTT CACAAGATGCTCTCCGTGAGCCACAGCCAGGAGAAGGAGGGCATCAGCAACTGGCTGGG CAACATGCTTCAGTTTCTGAGGGAGCAGGGGGTACCCTCAGCTATGCAGGACAAGTTCA ACTTCATGATGCTCTGGGCCTCCCAGGGGAACACGGGGCCTACCTCTTTCTGGGCCCTC TTGTACCTCCTGAAGCACCCAGAAGCTATTCGGGCTGTGAGGGAGGAAGCTACCCAGGT CCTGGGTGAGGCCAGGCTGGAGACCAAGCAGTCCTTTGCCTTCAAACTCGGTGCCCTGC AACACACCCCAGTTCTAGACAGCGTGGTGGAGGAGACGCTGCGGCTGAGGGCTGCACCC ACCCTCCTCAGGTTGGTTCATGAAGACTATACCCTGAAGATGTCCAGTGGGCAGGAGTA TCTGTTCCGCCATGGAGACATCCTGGCCCTCTTTCCCTACCTCTCAGTGCACATGGACC CTGACATCCACCCTGAGCCCACCGTCTTCAAGTACGATCGCTTCCTCAACCCTAATGGC AGCCGGAAAGTGGACTTCTTCAAGACAGGCAAGAAGATCCACCACTACACCATGCCCTG GGGTTCGGGCGTTTCCATCTGCCCTGGGAGGTTCTTTGCACTCAGTGAGGTGAAGCTCT TTATCCTGCTTATGGTCACACACTTTGACTTAGAGTTGGTGGACCCTGACACACCACTA CCCCATGTTGACCCGCAGCGCTGGGGTTTTGGCACCATGCAGCCCAGCCACGATGTGCG CTTCCGCTACCGCCTGCATCCTACAGAGTGA Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. Furthermore, numeric ranges are provided so that the range of values is recited in addition to the individual values within the recited range being specifically recited in the absence of the range. The word "comprising" is used herein as an open-ended term, substantially equivalent to the phrase "including, but not limited to", and the word "comprises" has a corresponding meaning. As used herein, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a thing" includes more than one such thing. Citation of references herein is not an admission that such references are prior art to the present invention. Furthermore, material appearing in the background section of the specification is not an admission that such material is prior art to the invention. Any priority document(s) are incorporated herein by reference as if each individual priority document were specifically and individually indicated to be incorporated by reference herein and as though fully set forth herein. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings.

Claims

What is claimed is:
1. An oligomer of between 4 to 49 nucleobases in length which comprises a contiguous nucleotide sequence of a total of between 4 to 49 nucleotides, wherein the contiguous nucleotide sequence is targeted to hybridize to a portion of SEQ ID NO: 104:
ATGGTTCTCTGGGGTCCAGTGCTGGGAGCTCTGCTGGTGGTCATTGCTGGATACCTGTG CCTGCCAGGGATGCTCCGACAACGCAGGCCATGGGAGCCCCCTCTGGACAAGGGTACCG TGCCCTGGCTTGGCCATGCCATGGCTTTCCGGAAGAATATGTTTGAATTTCTGAAGCGC ATGAGGACCAAGCATGGGGATGTGTTCACAGTGCAGCTAGGGGGCCAGTACTTCACCTT CGTCATGGACCCCCTCTCCTTTGGCTCCATCCTCAAGGACACACAGAGAAAACTAGACT TTGGGCAATATGCAAAAAAACTGGTGCTGAAGGTATTTGGATACCGTTCAGTGCAAGGG GACCATGAGATGATACACTCAGCCAGCACCAAGCATCTGAGGGGGGATGGCTTGAAGGA TCTTAATGAGACCATGCTGGACAGCCTGTCCTTTGTAATGCTGACGTCCAAAGGCTGGA GTCTGGATGCCAGTTGCTGGCATGAGGACAGCCTCTTTCGCTTCTGCTATTACATCTTG TTCACAGCTGGCTACCTGAGCTTGTTCGGCTACACGAAGGACAAGGAGCAGGACCTGCT ACAGGCAGGAGAGTTATTCATGGAGTTCCGCAAGTTTGACCTTCTTTTCCCAAGGTTTG TCTACTCCCTGCTGTGGCCCCGGGAGTGGCTAGAAGTGGGCCGACTCCAGCGTCTCTTT CACAAGATGCTCTCCGTGAGCCACAGCCAGGAGAAGGAGGGCATCAGCAACTGGCTGGG CAACATGCTTCAGTTTCTGAGGGAGCAGGGGGTACCCTCAGCTATGCAGGACAAGTTCA ACTTCATGATGCTCTGGGCCTCCCAGGGGAACACGGGGCCTACCTCTTTCTGGGCCCTC TTGTACCTCCTGAAGCACCCAGAAGCTATTCGGGCTGTGAGGGAGGAAGCTACCCAGGT CCTGGGTGAGGCCAGGCTGGAGACCAAGCAGTCCTTTGCCTTCAAACTCGGTGCCCTGC AACACACCCCAGTTCTAGACAGCGTGGTGGAGGAGACGCTGCGGCTGAGGGCTGCACCC ACCCTCCTCAGGTTGGTTCATGAAGACTATACCCTGAAGATGTCCAGTGGGCAGGAGTA TCTGTTCCGCCATGGAGACATCCTGGCCCTCTTTCCCTACCTCTCAGTGCACATGGACC CTGACATCCACCCTGAGCCCACCGTCTTCAAGTACGATCGCTTCCTCAACCCTAATGGC AGCCGGAAAGTGGACTTCTTCAAGACAGGCAAGAAGATCCACCACTACACCATGCCCTG GGGTTCGGGCGTTTCCATCTGCCCTGGGAGGTTCTTTGCACTCAGTGAGGTGAAGCTCT TTATCCTGCTTATGGTCACACACTTTGACTTAGAGTTGGTGGACCCTGACACACCACTA CCCCATGTTGACCCGCAGCGCTGGGGTTTTGGCACCATGCAGCCCAGCCACGATGTGCG CTTCCGCTACCGCCTGCATCCTACAGAGTGA (SEQ ID NO: 104)
wherein the oligomer, when bound to the portion of SEQ ID NO: 104 reduces expression of Sterol 12-a hydroxylase (Cyp8b1) in a cell or tissue.
2. The oligomer of claim 1 wherein the oligomer is between 14 to 29 nucleotides in length.
3. The oligomer of claim 1 or 2 wherein the oligomer is between 18 to 23 nucleotides in length.
4. The oligomer of any one of claims 1 to 3 wherein the oligomer is between 21 to 27 nucleotides in length.
5. The oligomer of any one of claims 1 to 4 wherein the cell or tissue is a liver cell or a liver tissue.
6. The oligomer of any one of claims 1 to 5 wherein the oligomer comprises a sequence selected from the group consisting of SEQ ID NOs 57 to 103, 105 and 106:
SEQ ID
Sequence 5'-3'
NO
57 CGGAAGAATATGTTTGAATTTCT
58 TGGGCAATATGCAAAAAAACTGG
59 AATGAGACCATGCTGGACAGCCT
60 CCGCAAGTTTGACCTTCTTTTCC
61 GGGCAACATGCTTCAGTTTCTGA
62 AGGACAAGTTCAACTTCATGATG
63 GCCCTCTTGTACCTCCTGAAGCA
64 CTCCTCAGGTTGGTTCATGAAGA
65 AAGACTATACCCTGAAGATGTCC
66 TCATGAAGAC ATACCCTG AGA
67 CCGGAAAGTGGACTTCTTCAAGA
68 GTGAAGCTCTTTATCCTGCTTAT
69 CACACACTTTGACTTAGAGTTGG
70 AGTGCTGGGAGCTCTGCTGGTGGTCAT SEQ ID
Sequence 5'-3'
NO
71 AT GC CAT GGCTTTCC GGAAGAAT AT GT
72 CGTCATGGACCCCCTCTCCTTTGGCTC
73 ACTTTGGGCAATATGCAAAAAAACTGG
74 ATGGCTTGAAGGATCTTAATGAGACCA
75 AATGAGACCATGCTGGACAGCCTGTCC
76 TGGAGTTCCGCAAGTTTGACCTTCTTT
77 ACATGCTTCAGTTTCTGAGGGAGCAGG
78 ACCCTCAGCTATGCAGGACAAGTTCAA
79 CTCTTGTACCTCCTGAAGCACCCAGAA
80 CTGCGGCTGAGGGCTGCACCCACCCTC
81 GAAGACTATACCCTGAAGATGTCCAGT
82 ATGGCAGCCGGAAAGTGGACTTCTTCA
83 TCCACTACACCATGCCCTGGGGTTCGG
84 TGAAGCTCTTTATCCTGCTTATGGTCAC
85 GACTTAGAGTTGGTGGACCCTGACACA
86 TCCAGTGCTGGGAG
87 CCGGAAGAATATGT
88 ACAGAGAAAACTAG
89 ATGGCTTGAAGGAT
90 ATGCTGGACAGCCT
91 TGGAGTTCCGCAAG
92 TCTGAGGGAGCAGG
93 CAGCTATGCAGGAC
94 GTTCAACTTCATGA
95 TTGTACCTCCTGAA
96 AGAAGCTATTCGGG
97 GGCTGAGGGCTGCA
98 TCCTCAGGTTGGTT
99 ACTATACCCTGAAG
100 AAAGTGGACTTCTT
101 TACACCATGCCCTG
102 TGAAGCTCTTTATC
103 ACTTAGAGTTGGTG
105 GCTCACTTCCACCCACTCCC
106 TTCATCTCGCTGAGGGCAAA
7. The oligomer of claim 6 wherein the oligomer is modified to include one ore more locked nucleic acid bases and one or more phosphorothioate modification.
8. The oligomer of any one of claims 1 to 7 wherein the contiguous nucleotide sequence comprises nucleotide analogues.
9. The oligomer of any one of claims 1 to 8 wherein the oligomer has a modified internucleoside linkage.
10. The oligomer of claim 9 wherein the modified internucleoside linkage is a peptide-nucleic acid linkage, a morpholino linkage, a N3' to P5' phosphoramidate linkage, a methylphosphonate linkage or a phosphorothioate linkage.
11. The oligomer of any one of claims 1 to 10 wherein the oligomer has one or more modified sugar moiety.
12. The oligomer of claim 11 wherein the modified sugar moiety is 2 ' -O-alkyl oligoribonucleotide.
13. The oligomer of any one of claims 1 to 12 wherein the oligomer is a gapmer.
14. The oligomer of claim 13 wherein the oligomer has a 2' OE gapmer modification.
15. The oligomer of any one of claims 1 to 14 wherein the oligomer has a modified nucleobase.
16 The oligomer of claim 15 wherein the modified nucleobase is a 5-methyl pyrimidine or a 5- propynyl pyrimidine.
17. The oligomer of claim 16 wherein the one or more nucleotide analogues comprise locked nucleic acids (LNA) units.
18. The oligomer according to claim 16 or 17 wherein the LNA units consist of beta-D- oxy-LNA monomers.
19. The oligomer of claim 7 wherein the oligomer is selected from the group consisting of:
5' +G*+C*+T*+C*A*C*T*T*C*C*A*C*C*C*A*C*+T*+C*+C*+C 3' (SEQ ID NO:1 ); and
5' +T*+T*+C*+A*T*C*T*C*G*C*T*G*A*G*G*G*+C*+A*+A*+A3' (SEQ ID NO: 2) wherein '+' denotes a locked nucleic acid base and '*' indicates a phosphorothioate modification.
20. The oligomer of any one of claims 1 to 19 wherein the oligomer comprises a single stereoisomer.
21. The oligomer of any one of claims 1 to 19 wherein the oligomer comprises a mixture of stereoisomers.
22. A pharmaceutical composition comprising the oligomer of any one of claims 1 to 21 and a pharmaceutically acceptable diluent, carrier, salt or adjuvant.
23. A method of reducing the expression of Sterol 12-a hydroxylase (Cyp8b1) in a cell or tissue, comprising contacting the cell or tissue with an effective amount of an oligomer of any one of claims 1 to 21 or a pharmaceutical composition of claim 22.
24. The method of claim 23 wherein the cell is within a tissue of a mammal.
25. A method of prophylactic treating or treating a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes, in a subject, comprising administering to the subject an effective amount of an oligomer of any one of claims 1 to 21 or administering a an effective amount of a pharmaceutical composition of claim 22, wherein the subject is currently suffering from or at risk for suffering from liver fibrosis.
26. The method of claim 25 wherein the subject is a mammal.
27. The method of claim 24 or 25 wherein the mammal is a human.
28. Use of an oligomer of any one of claims 1 to 21 for the treatment of a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
29. Use of an oligomer of any one of claims 1 to 21 in the preparation of a medicament for the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, nonalcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
30. Use of a pharmaceutical composition of claim 22 for the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
31. The use of claim 29 or 30 wherein the disease is liver fibrosis.
32. An oligomer of any one of claims 1 to 21 for use in the treatment of a disease selected from the group consisting of Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
33. A commercial package, comprising:
a. an oligomer of any one of claims 1 to 21 ; and
b. instructions for the treatment of a disease selected from the group consisting of: Liver fibrosis, Chronic liver disease, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, liver fibrosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, obesity, and diabetes.
34. The commercial package of claim 33 wherein the instructions are for the treatment of liver fibrosis.
PCT/CA2016/000181 2015-06-29 2016-06-29 Modulation of cyp8b1 for the prevention and treatment of liver fibrosis and metabolic disorders Ceased WO2017000058A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562185885P 2015-06-29 2015-06-29
US62/185,885 2015-06-29

Publications (2)

Publication Number Publication Date
WO2017000058A1 true WO2017000058A1 (en) 2017-01-05
WO2017000058A8 WO2017000058A8 (en) 2017-10-19

Family

ID=57607389

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2016/000181 Ceased WO2017000058A1 (en) 2015-06-29 2016-06-29 Modulation of cyp8b1 for the prevention and treatment of liver fibrosis and metabolic disorders

Country Status (1)

Country Link
WO (1) WO2017000058A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004083430A2 (en) * 2003-03-21 2004-09-30 Santaris Pharma A/S SHORT INTERFERING RNA (siRNA) ANALOGUES
US20110054005A1 (en) * 2004-05-11 2011-03-03 Yuki Naito Polynucleotides for causing RNA interference and method for inhibiting gene expression using the same
WO2014018375A1 (en) * 2012-07-23 2014-01-30 Xenon Pharmaceuticals Inc. Cyp8b1 and uses thereof in therapeutic and diagnostic methods

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004083430A2 (en) * 2003-03-21 2004-09-30 Santaris Pharma A/S SHORT INTERFERING RNA (siRNA) ANALOGUES
US20110054005A1 (en) * 2004-05-11 2011-03-03 Yuki Naito Polynucleotides for causing RNA interference and method for inhibiting gene expression using the same
WO2014018375A1 (en) * 2012-07-23 2014-01-30 Xenon Pharmaceuticals Inc. Cyp8b1 and uses thereof in therapeutic and diagnostic methods

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KAUR, A. ET AL.: "Loss of Cyp8b1 improves glucose homeostasis by increasing GLP-1.", DIABETES, vol. 64, no. 4, April 2015 (2015-04-01), pages 1168 - 1179, XP055340030, ISSN: 1939-327X *

Also Published As

Publication number Publication date
WO2017000058A8 (en) 2017-10-19

Similar Documents

Publication Publication Date Title
JP6743106B2 (en) Regulation of hepatitis B virus (HBV) expression
US9566293B2 (en) Oral delivery of therapeutically effective LNA oligonucleotides
CN105814204B (en) Regulation of angiopoietin-like 3 expression
JP6272290B2 (en) Compounds and methods for modulating the expression of APOB
EP2421970B1 (en) Pharmaceutical compositions for treatment of hcv patients that are non-responders to interferon
JP2020074784A (en) Compositions and methods for modulating angiopoietin-like factor 3 expression
EP3666896A1 (en) Therapeutic inhibition of lactate dehydrogenase and agents therefor
CN101553236A (en) Compounds and methods for modulating expression of GCCR
EP3210611A2 (en) Methods of treating vascular inflammatory disorders
US9404113B2 (en) Antisense modulation of PTP1B expression
WO2017161172A1 (en) Methods of modulating keap1
US20110293653A1 (en) Antagonists of mir-155 for the treatment of inflammatory liver disease
WO2012027601A2 (en) Methods targeting mir-33 micrornas for regulating lipid metabolism
US20210010004A1 (en) Inhibition of polyomavirus replication
WO2017000058A1 (en) Modulation of cyp8b1 for the prevention and treatment of liver fibrosis and metabolic disorders
EP2382992A1 (en) Pharmaceutical composition for treating obesity or diabetes
US12221491B2 (en) PSMD9 inhibitors for the treatment of hepatic lipid dysregulation
JP7530106B2 (en) Nucleic acid complex for regulating IHH expression
WO2025195381A1 (en) Sirna targeting inhbe gene expression, and conjugate and use thereof
KR20240009973A (en) IL-34 antisense agonists and methods of using the same
CN119384501A (en) Oligonucleotides
HK40032494A (en) Modulation of angiopoietin-like 3 expression
HK40033664A (en) Modulation of angiopoietin-like 3 expression
HK1136221A (en) Compounds and methods for modulating expression of gccr
HK1195074B (en) Antisense modulation of ptp1b expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16816876

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16816876

Country of ref document: EP

Kind code of ref document: A1