WO2016205585A1 - Compositions and methods for detection of malaria parasite biomarkers - Google Patents

Compositions and methods for detection of malaria parasite biomarkers Download PDF

Info

Publication number
WO2016205585A1
WO2016205585A1 PCT/US2016/037968 US2016037968W WO2016205585A1 WO 2016205585 A1 WO2016205585 A1 WO 2016205585A1 US 2016037968 W US2016037968 W US 2016037968W WO 2016205585 A1 WO2016205585 A1 WO 2016205585A1
Authority
WO
WIPO (PCT)
Prior art keywords
proteins
antibody
pssp17
protein
pf3d7
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/037968
Other languages
French (fr)
Inventor
Dingyin TAO
Brenton MCGILL
Rhoel R. DINGLASAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Priority to US15/736,838 priority Critical patent/US12049494B2/en
Publication of WO2016205585A1 publication Critical patent/WO2016205585A1/en
Anticipated expiration legal-status Critical
Priority to ZA2018/00191A priority patent/ZA201800191B/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/20Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans from protozoa
    • C07K16/205Plasmodium
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39575Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from other living beings excluding bacteria and viruses, e.g. protozoa, fungi, plants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445Plasmodium
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56905Protozoa
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/44Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from protozoa
    • G01N2333/445Plasmodium
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the field of malaria. More specifically, the present invention provides methods and compositions useful for rapidly testing for malaria infection.
  • the present invention is based, at least in part, on the development of a non-invasive malaria rapid diagnostic test (RDT).
  • the test comprises the detection of female-specific gametocyte proteins in saliva.
  • the female-specific gametocyte protein biomarkers comprises PF3D7_1218800. This gene was originally referred to as "Plasmodium secreted ookinete protein 17, or PSOP17" and was referred to as such in previous scientific publications. However, given its expression in gametocytes, this annotation was no longer correct, and we refer to the protein herein as PSSP17, Plasmodium sexual stage protein 17.
  • the protein biomarker comprises PF3D7 0507800.
  • the present invention can also comprise the detection of histidine rich protein 2 (HRP2).
  • the female-specific gametocyte protein biomarkers include one or more of PF3D7_01 11300 (replication factor c protein, putative), PF3D7_0216700.1 (conserved
  • PF3D7_0310500 DEAD box helicase, putative
  • PF3D7_0318200 DNA-directed RNA polymerase II, putative
  • PF3D7_0401900 acyl-CoA synthetase (ACS6)
  • PF3D7_0419900 phosphatidylinositol 4-kinase, putative
  • PF3D7_0422300 alpha tubulin 2
  • PF3D7_0507800 conserved Plasmodium protein, unknown function
  • PF3D7 0508100 SET domain protein, putative (SET9)
  • PF3D7_0509400 RNA polymerase I (RNAPI)
  • PF3D7_0510100 conserved Plasmodium protein, unknown function
  • PF3D7 0511500 RNA pseudouridylate synthase, putative
  • PF3D7 0512600 Rab GTPase lb (Rablb)
  • PF3D7 0528700 peptidyl-prolyl cis-trans isomerase (CYP23)
  • PF3D7_0529800 conserved Plasmodium protein, unknown function
  • PF3D7 0610400 histone H3 (H3)
  • PF3D7 0632500 erythrocyte membrane protein 1, PfEMPl (VAR)
  • PF3D7_0704100 conserved Plasmodium membrane protein, unknown function
  • PF3D7_0705500 inositol-phosphate phosphatase, putative
  • PF3D7_0717900
  • PF3D7_0927200 zinc finger protein, putative
  • PF3D7_1015900 enolase (ENO)
  • PF3D7_1029000 (conserved Plasmodium protein, unknown function, pseudogene),
  • PF3D7 1034400 flavoprotein subunit of succinate dehydrogenase (SDHA)
  • PF3D7 1 102400 flavoprotein, putative
  • PF3D7 1 105600 translocon component PTEX88 (PTEX88)
  • PF3D7 1134700 DNA-directed RNA polymerase 1, subunit 2, putative
  • PF3D7_1142100 conserved Plasmodium protein, unknown function
  • PF3D7_1200200 rifin (RIF)
  • PF3D7_1202300 dinein heavy chain, putative
  • PF3D7_1207000 conserved Plasmodium protein, unknown function
  • PF3D7_1211800 polyubiquitin (PfpUB)
  • PF3D7_1215100 conserved Plasmodium protein, unknown function
  • PF3D7_1216000 seerine—tRNA ligase, putative
  • PF3D7_1216900 DNA-binding chaperone, putative
  • PF3D7 1218800 secreted ookine
  • PF3D7 1239900 vesicle fusion and protein sorting subunit 16, putative (VPS 16)
  • PF3D7_1318300 (conserved Plasmodium protein, unknown function)
  • PF3D7_1319200 (conserved Plasmodium protein, unknown function)
  • PF3D7_1325900 (conserved
  • Plasmodium protein, unknown function PF3D7_1327300 (conserved Plasmodium protein, unknown function), PF3D7 1337200 (1-deoxy-D-xylulose 5-phosphate synthase),
  • PF3D7_1337500 (conserved Plasmodium protein, unknown function), PF3D7_1342600 (myosin A (MyoA)), PF3D7_1353000 (tryptophan-rich antigen, pseudogene),
  • PF3D7 141 1400 plastid replication-repair enzyme (PREX)
  • PF3D7 1421300 conserved Plasmodium protein, unknown function
  • PF3D7_1434200 calmodulin (CAM)
  • PF3D7_1443800 zinc finger protein, putative
  • the present invention provides antibodies to PSSP17 that can be used in the methods and compositions described herein.
  • an antibody or fragment thereof specifically binds to the Plasmodium female-specific gametocyte biomarker protein, PSSP17.
  • Plasmodium species include P. falciparum, P. vivax, P. ovale, P. malariae and P. knowlesi.
  • the antibodies can specifically bind to PSSP17 from one or more of P. falciparum, P. vivax, P. ovale, P. malariae and P. knowlesi.
  • the antibodies specifically bind to SEQ ID NO:98 (P. vivax PSSP17).
  • the antibodies specifically bind to SEQ ID NO:99 (P. falciparum PSSP17).
  • an anti-PSSP17 antibody comprises a variable heavy chain comprising SEQ ID NO:20.
  • an anti-PSSP17 antibody comprises a variable light chain comprising SEQ ID NO:40.
  • an anti-PSSP17 antibody comprises (a) a variable heavy chain comprising SEQ ID NO:20; and (b) a variable light chain comprising SEQ ID NO:40.
  • an anti-PSSP17 antibody comprises a variable heavy chain comprising SEQ ID NO:60. In another embodiment, an anti-PSSP17 antibody comprises a variable light chain comprising SEQ ID NO: 80. In a further embodiment, an anti-PSSP17 antibody comprises (a) a variable heavy chain comprising SEQ ID NO:60; and (b) a variable light chain comprising SEQ ID NO: 80.
  • the variable heavy and light chains can be combined, e.g., the variable heavy chain from mAb 10E2B7 can be used in combination with the variable light chain from mAb 27C9B5, and vice versa.
  • variable heavy chain of an anti-PSSP17 antibody can also comprise the
  • a variable light chain of an anti-PSSP17 antibody can also comprise the CDRs shown in SEQ ID NOS:43, 45, and 47 (mAb 10E2B7) or SEQ ID NOS:83, 85 and 87 (mAb 27C9B5), or combinations of the foregoing.
  • an antibody comprises (a) a variable heavy chain comprising the complementarity determining regions (CDRs) shown in SEQ ID NOS:23, 25 and 27; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:43, 45 and 47.
  • an antibody comprises (a) a variable heavy chain comprising the CDRs shown in SEQ ID NOS:63, 65 and 67; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:83, 85 and 87.
  • the antibodies can further comprise any one or more of the framework regions described herein.
  • SEQ ID NOS: 9-88 provided in the sequence listing are embodiments of the present invention and can be used to design an anti-PSSP17 antibody.
  • the leader sequences described herein can be utilized.
  • composition e.g., kits
  • method claims can be utilized and practice with any of the antibody embodiments described herein.
  • kits can be used as described herein, specifically, to determine whether a subject has a malaria parasite (e.g., P. falciparum or P. vivax).
  • a kit comprises an anti-PSSP17 antibody described herein.
  • the antibody can comprise a detectable label or a label is provided in the kit and conjugated to the antibody by the end user.
  • a secondary antibody is provided that comprises a detectable label.
  • a kit comprises a second anti-PSSP17 antibody that can be labeled (or is pre-labeled) and used as a detection reagent.
  • a kit can comprise (a) at least one antibody that specifically binds PSSP17; and (b) a detection reagent for detecting the presence of PSSP17 in a saliva sample obtained from a subject suspected of having a malaria parasite.
  • the kit can further comprise an antibody that specifically binds histidine rich protein 2 (HRP2).
  • HRP2 histidine rich protein 2
  • the antibody can comprise a detectable label or a label is provided in the kit and conjugated to the antibody by the end user.
  • a secondary antibody is provided that comprises a detectable label.
  • a kit comprises a second anti-HRP2 antibody that can be labeled (or is pre-labeled) and used as a detection reagent.
  • a kit can further comprise (c) at least one antibody that specifically binds histidine rich protein 2 (HRP2); and (d) a detection reagent for detecting the presence of HRP2 in a saliva sample obtained from a subject suspected of having a malaria parasite.
  • kits can comprise a positive control for PSSP17, wherein the positive control is the amino acid sequence shown in SEQ ID NO: 8.
  • the kits comprising an anti-PSSP17 antibody comprise an antibody that specifically binds SEQ ID NO: 8.
  • the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising SEQ ID NO:20; and (b) a variable light chain comprising SEQ ID NO:40.
  • the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising SEQ ID NO:60; and (b) a variable light chain comprising SEQ ID NO:80.
  • the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising the complementarity determining regions (CDRs) shown in SEQ ID NOS:23, 25 and 27; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:43, 45 and 47.
  • the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising the CDRs shown in SEQ ID NOS:63, 65 and 67; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:83, 85 and 87.
  • kits of the present invention can further comprise a lateral flow immunoassay device.
  • the kit comprises a lateral flow strip.
  • the lateral flow strip can be used as part of a sandwich ELISA.
  • An antibody that specifically binds PSSP17 can be labeled with biotin and streptavidin can be deposited at the test line of the strip.
  • a second antibody that specifically binds PSSP17 can be used as a detection reagent. It can be pre- deposited on the strip itself or provided in the kit to be incubated with the sample (along with the primary PSSP17 antibody (i.e., capture reagent) prior to loading on to the lateral flow strip.
  • the antibodies can be labeled (e.g., with biotin for the capture reagent or with a detectable label for the detection reagent) by the user prior to incubation with the sample.
  • the antibodies pre-conjugated and/or pre-labeled.
  • IgG can be deposited at the control line of the lateral flow strip.
  • the kit can utilize many different forms of lateral flow and such embodiments are described herein and known to those of ordinary skill in the art.
  • a rapid diagnostic test kit for detection of the malaria parasite Plasmodium comprises (a) a plurality of capture reagents that bind to one or more of the proteins listed in FIG. 11 ; (b) a detection agent for detecting the presence of one or more of the proteins listed in FIG. 11 that bind to the capture reagents; (c) a container for collecting a sample from an individual; and (d) instructions for collecting a sample from the individual, incubating the plurality of capture reagents, detecting the presence of the capture reagents bound to the proteins.
  • the one or more proteins listed in FIG. 11 comprises PF3D7 1218800 (PSSP17).
  • kits 11 further comprises PF3D7 0507800.
  • the kit further comprises a capture reagent that binds to histidine rich protein 2 (HRP2).
  • the capture reagent is an antibody.
  • kits can further comprise a positive control protein comprising SEQ ID NO: 8.
  • the present invention provides methods for identifying whether a subject has a malaria parasite.
  • the subject can be asymptomatic or symptomatic for malaria. Such methods rely, in part, on the detection of a female-specific gametocyte protein in a saliva sample obtained from the subject.
  • the method can also comprise detecting HRP2.
  • a method for identifying the malaria parasite Plasmodium in a human subject comprises the steps of (a) incubating a saliva sample obtained from the subject with an antibody that specifically binds PSSP17, wherein the presence of PSSP17 creates one or more antibody:PSSP17 complexes; (b) applying a detection agent that detects the antibody- PSSP17 complexes; and (c) identifying the subject as having the malaria parasite
  • Plasmodium where the antibody-PSSP17 complexes are detected can be treated with anti- malarials.
  • anti-malarials can include, but are not limited to, quinine, chloroquine, amodiaquine, roguanil, chlorproguanil, proguanil, cycloquanil, pyrimethamine, sulfadoxine, pyrimethamine-sulfadoxine, pyrimethamine-dapsone, primaquine,
  • a method for treating a human subject identified as having the malaria parasite Plasmodium comprises the steps of (a) incubating a saliva sample obtained from the subject with an antibody that specifically binds PSSP17, wherein the presence of PSSP17 creates one or more antibody:PSSP17 complexes; (b) applying a detection agent that detects the antibody-PSSP17 complexes; and (c) administering a malaria treatment to the subject where the antibody-PSSP17 complexes are detected.
  • the present invention can be used to determine parasite clearance after drug treatment, specifically for stages that are responsible for transmission to mosquitoes.
  • compositions and methods of the present invention can be used across the globe for weekly screening in schools in malaria endemic countries:
  • Teachers/administrators can conduct weekly screening of all children across the high-risk age groups for malaria (typically ages 5-16 years across much of Sub-Saharan Africa, though the targeted population can change according to local malaria transmission. Children who are determined to be positive, yet asymptomatic, can be provided anti-malarials to clear the parasite reservoir. The choice of antimalarial used is dependent on national malaria control policies.
  • the present invention can also be used in routine screening in oil, logging, and plantation establishments in malaria endemic countries.
  • Clinical/human resources staff can collect samples from workers to prevent malaria incidence.
  • This screening method can be extended to workers' families and surrounding villages.
  • Individuals found to be harboring parasites can be provided anti-malarials.
  • compositions and methods of the present invention can further be used as a rapid test for epidemiological surveys/studies in developing countries by research groups
  • the present invention can also be used a rapid test for screening travelers entering into a country at known ports of entry (air, land, sea). This is especially important for countries that have reached the malaria elimination phase or have been verified to be "malaria-free" to prevent reintroduction. Screening can also be conducted in developed countries to screen carrier entry following holiday/work travel to malaria endemic countries.
  • the present invention can further be included as a component of a work travel kit for high-level members of multinational companies who are assigned to oversee operations in malaria endemic countries.
  • the present invention can be included as a component of a holiday travel kit for all members of society.
  • the kit allows for easy, unambiguous self- diagnosis/screening. The individual can either take anti-malarials included in the travel kit or obtained from a local dispensary.
  • FIG. 1A-1C Workflow for Plasmodium falciparum male and female protein partition analysis using proteomics and bioinformatics analysis.
  • Gametocyte sex ratios were determined using differential staining and microscopy. Improved R66 Giemsa is diluted 1 :40 in Sorensen buffer (pH 7.2) and used to stain a methanol-fixed, thin smear of stage V
  • PepArML and Maspectras2 The result is combined in PepArML by unsupervised machine learning and stored in Maspectras2 and queried for analysis. Proteome results are then compared to the P. berghei MS/MS male proteome and MS/MS female proteome as shown. This comparison is done by orthologous protein matches and a subtractive bioinformatics approach, producing partitioned proteomes for male and female gametocytes.
  • FIG. 2A-2H Summary of protein identifications from the reanalysis of Plasmodium berghei ANKA 2.34 Male and Female Gametocyte Proteomes and the current Stage V Plasmodium falciparum gametocyte proteomes for the NF54 isolate and Dd2 strain.
  • FIG. 3A-3H Results from the Systematic Subtractive Protein Bioinformatic
  • FIG. 4A-4B Analyses of GO molecular function and signatures of selection in male and female P. falciparum proteins.
  • A Enrichment analysis of GO molecular function terms in Plasmodium berghei and Plasmodium falciparum. Z-scores are shown as representation of enrichment, color coded as the key in top left comer. Histogram shows general distribution of enrichments across all samples. Histograms along columns show exact enrichment amounts. Column normalization for total proteins detected was performed by calculating total number of GO terms divided by total proteins detected. For simplicity, GO terms were reduced to 22 categories and enrichment calculated over these.
  • B Genetic diversity within a parasite population is represented by PiN across 25 parasite isolates from Senegal and divergence between parasite populations is represented by Fst when comparing the
  • FIG. 5A-5I Principal components analysis (PCA) and SSB analyses for the identification of P. falciparum male-specific proteins that are lost as a result of the Dd2 male development defect.
  • PCA Principal components analysis
  • SSB analyses for the identification of P. falciparum male-specific proteins that are lost as a result of the Dd2 male development defect.
  • A PCA was performed on Male and Female Specific P. falciparum stage V proteomes (Pf-M and Pf-F, respectively), two biological replicates (BR1 and BR2) from Dd2, three biological replicates (BR1 -3) from NF54, FSg v (3D7/NF54 stage V) and FSg 1-11 (3D7/NF54 stage I-II). Proteins with at least 10 spectral counts averaged across all proteomes were used for qualitative protein analysis.
  • B/C Stage-specific analyses identifies 354 putative P.
  • Stage-specific analysis identifies 843 gametocyte-specific proteins in the NF54 proteome (D), of which 216 are also present in Stage I/II and 627 are only expressed in more mature gametocyte stages (E). The same analysis identifies in Dd2 533 gametocyte-specific proteins
  • FIG. 7A-7C Western blots and immunohistochemistry using NF54 and Dd2 strains validate female stage V gametocyte specificity for two of three candidate protein markers.
  • A Western blots of total day 18 stage V gametocyte and synchronized trophozoite protein lysates using the respective antibodies along with anti-P. falciparum aldolase antibodies used as a loading control.
  • Western blots showed that PF3D7_1218800 and PF3D7_0309100 were present in female gametocytes (Dd2 is defective in mature male gametocyte development), yielding bands in gametocyte but not trophozoite samples for both NF54 and Dd2.
  • Antibodies to PF3D7_0906100 stain gametocytes and trophozoites from NF54 but primarily stains Dd2 gametocytes.
  • B Representative results for fluorescence immunohistochemistry of strain NF54 along with an isotype control. PF3D7_1218800 and PF3D7_0906100 were found to be female specific (green). PF3D7_0309100, which is an ortholog of a putative female specific protein in P. berghei is not sex-specific in P. falciparum.
  • C Representative results for fluorescence immunohistochemistry of strain Dd2 along with an isotype control.
  • PF3D7_1218800, PF3D7_0906100, and PF3D7_0309100 were all found to stain female parasites (green), as Dd2 fail to produce mature stage V male gametocytes.
  • Parasite sex was microscopically determined using published morphological characteristics of male and female gametocytes along with spatially distinct DAPI staining (blue) of DNA.
  • Female gametocytes have condensed DAPI staining whereas male gametocytes have diffused DAPI staining.
  • FIG. 8A-B To define the male and female proteomes of P. falciparum stage V gametocytes we employed a SSB work-flow using the re-analyzed P. berghei mature gametocyte proteome data as a reference. See FIG. 1C and FIGS. 3B-G.
  • FIG. 9A Expanding the Pf-Female protein list to include those that are not
  • FIG. 9B A comparison A comparison of the Dd2gV 528 stage-V specific protein list with the Pf-M (P. falciparum 529 male-specific) protein list identified 40 conserved proteins, which may include stage III male candidate markers.
  • FIG. 10 A PSMA reanalysis of the existing Plasmodium berghei male and female gametocyte proteome using the current iteration of the genome revealed that many sex- specific proteins were shared between males and females. The relative enrichment of unique peptides was examined in the respective male and female batches from the original study to determine the degree of expression of these shared proteins.
  • FIG. 11 Plasmodium falciparum proteins that were identified in pooled saliva from asymptomatic children 5-15 yrs of age from Yaounde, Cameroon (61 proteins).
  • FIG. 12A-12E Assay development for the analysis of saliva samples from
  • the lower image shows the rapid diagnostic test (RDT) made by Alere, i.e., the SD Bioline Malaria Ag Pf/Pan test used in Zambia.
  • RDT rapid diagnostic test
  • PF3D7_1218800 as a target biomarker for female gametocytes and a novel asexual protein, PF3D7 0507800, as potentially new biomarker for asymptomatic asexual carriage that we had originally confirmed to be present in the saliva of asymptomatic children from Cameroon (Tao, et al, unpublished) and designed a Multiple Reaction Monitoring MS assay.
  • 392 blinded samples total (350 from Cameroon/42 from Zambia), 392 had a strong signal for the internal standard peptide.
  • PAR is the peak area ratio of the target analyte's integrated peak area over internal standard's integrated peak area [2 pmol of internal standard in 10 ⁇ were injected per sample].
  • D The antibodies to PF3D7 1218800 recognize the target in saliva suggesting that a RDT is indeed possible for human saliva detection of gametocytes (12 ⁇ of 0.22 micron filtered saliva/well).
  • Sample from C166 is from an 11 year old child with 6 gametocytes ⁇ L.
  • Monoclonal antibody against PfHRP2 recognizes its target in the filtered but unconcentrated saliva. Paired blood smears were analyzed for gametocytes (sexual) and asexual parasite stages from each individual providing the saliva sample.
  • HRP2 does not ionize and cannot be detected by MS/MS, as evident in the lack of mass spectrometry evidence for this protein in PlasmoDB.
  • Each sample from Zambia (case numbers 21XXX) were analyzed by RDT at time of collection or by PCR for the Plasmodium cytochrome B gene from blood spots. All saliva samples were concentrated following buffer exchange. Expected M r for HRP2: 32.4 kDa, Apparent M r : 30-33 kDa.
  • HRP2 RDT positivity (Alere SD Bioline Malaria Ag Pf/Pan) or PCR positive/negative. B364, C020, CI 64 and CI 66 were analyzed by microscopy and are expected to be HRP2 positive.
  • FIG. 13 Comparative analysis of detection approaches used to identify asymptomatic carriers.
  • MRM analyses of saliva we calculated the Peak Area Ratio, which is the ratio of the target analyte's integrated peak area over internal standard's integrated peak area. From blood samples, we used the SD Bioline RDT, RTPCR amplification of the Pfs25 gametocyte transcript, PCR amplification of parasite cytochrome B (CytB) gene and microscopy.
  • FIG. 14A-14B Lateral Flow Immunoassay (LFIA) detection of the gametocyte specific proteins, PSSP17.
  • LFIA Lateral Flow Immunoassay
  • A Schematic for the gRAD LFIA (BioPorto, Denmark).
  • the readout in panel (B) is an image acquired by a camera phone.
  • FIG. 15A-15B Capture of PSSP17 in "spiked-in" samples of recombinant PSSP17 in malaria naive human saliva. Determine LOD using spiked-in samples.
  • A Recombinant PfHRP2 was spiked-in to naive human saliva and tested by the SMAART-HRP2 Lateral Flow Immunoassay (LFIA).
  • B Recombinant PSSP17 was spiked-in to 20 naive human saliva and tested by the SMAART-PSSP17 LFIA.
  • C control line.
  • T test line.
  • FIG. 16A-16B Capture of native PSSP17 from saliva samples collected from asymptomatic and symptomatic children in Cameroon. Determined LOD using field samples.
  • A PSSP17 was effectively captured from preserved, frozen saliva from three saliva samples from symptomatic children/young adults (5-19 years old) presenting at a clinic in Yaounde, Cameroon.
  • B PSSP17 was effectively captured from three preserved, frozen saliva samples from asymptomatic children from a primary school in Mfou, Cameroon. These tests used blinded samples. Control naive human saliva (+ HRP2) samples were analyzed in parallel.
  • FIG. 17A-17F Kit components.
  • FIG. 18 Cardbox kit schematic showing the cardboard strip holder insert for imaging strips.
  • FIGS. 19-21 Cardboard kit schematic for viewing strips.
  • FIG. 22 Recombinant PSSP17 in known concentrations for generating standard curve.
  • FIG. 23 Alignment of P. falciparum PSSP17 and its ortholog in P. vivax. Signal peptide shown as an arrow and the region used to raise monoclonal antibodies is shown as a bar.
  • FIG. 24 SMAART lateral flow immunoassay used to detect the presence of the P. vivax gametocyte PSSP17 in 10 ⁇ of unprocessed, blinded saliva from adults presenting at a clinic in Manaus, Brazil. Image was captured by camera phone and inverted.
  • C control line.
  • T test line.
  • the term "antigen” is generally used in reference to any substance that is capable of reacting with an antibody. More specifically, as used herein, the term “antigen” refers to a synthetic peptide, polypeptide, protein or fragment of a polypeptide or protein, or other molecule which elicits an antibody response in a subject, or is recognized and bound by an antibody.
  • biomarker refers to a molecule that is associated either quantitatively or qualitatively with a biological change.
  • biomarkers include polypeptides, proteins or fragments of a polypeptide or protein; and polynucleotides, such as a gene product, RNA or RNA fragment; and other body metabolites.
  • a “biomarker” means a compound that is differentially present in a biological sample from a subj ect or a group of subjects having a first phenotype (e.g., a subject having the malaria parasite Plasmodium) as compared to a biological sample from a subject or group of subjects having a second phenotype (e.g., a subj ect having the malaria parasite
  • a biomarker may be differentially present at any level, but is generally present at a level that is increased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 100%, by at least 110%, by at least 120%, by at least 130%, by at least 140%, by at least 150%, or more; or that is decreased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%
  • the differential presence of a biomarker can be characterized by a -fold change in level including, for example, a level that is increased by 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 2.0-fold, at least 2.5-fold, at least 3.0-fold, at least 3.5-fold, at least 4.0-fold, at least 5-fold, at least 5.5-fold, at least 6-fold, at least 6.5-fold, at least 7.0- fold, at least 7.5-fold, at least 8.0-fold, at least 9-fold, at least 10-fold, at least 1 1-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40- fold, or at least 50-fold; or that is decreased by 1.1 -fold, at least 1.2-fold
  • a biomarker is preferably differentially present at a level that is statistically significant (e.g., a p-value less than 0.05 and/or a q-value of less than 0.10 as determined using, for example, either Welch's T-test or Wilcoxon's rank-sum Test).
  • biomarker proteins refers to combinations of various biomarker proteins.
  • the term encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 15 , 16 , 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40 . . . N, where "N" is the total number of biomarker proteins in the particular embodiment.
  • the term also encompasses at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 15 , 16 , 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40 . . . N. It is understood that the recitation of biomarkers herein includes the phrase "one or more of the biomarkers and, in particular, includes the "at least 1, at least 2, at least 3" and so forth language in each recited embodiment of a biomarker panel.
  • binding which occurs between such paired species as enzyme/substrate, receptor/agonist, antibody/antigen, and lectin/carbohydrate which may be mediated by covalent or non-covalent interactions or a combination of covalent and non-covalent interactions.
  • the binding which occurs is typically electrostatic, hydrogen-bonding, or the result of lipophilic interactions. Accordingly, "specific binding” occurs between a paired species where there is interaction between the two which produces a bound complex having the characteristics of an antibody/antigen or enzyme/substrate interaction.
  • the specific binding is characterized by the binding of one member of a pair to a particular species and to no other species within the family of compounds to which the corresponding member of the binding member belongs.
  • an antibody typically binds to a single epitope and to no other epitope within the family of proteins.
  • specific binding between an antigen and an antibody will have a binding affinity of at least 10 "6 M.
  • the antigen and antibody will bind with affinities of at least 10 "7 M, 10 "8 M to 10 "9 M, 10 "10 M, 10 "11 M, or 10 "12 M.
  • the terms “specific binding” or “specifically binding” when used in reference to the interaction of an antibody and a protein or peptide means that the interaction is dependent upon the presence of a particular structure (i.e., the epitope) on the protein.
  • binding agent specific for or “binding agent that specifically binds” refers to an agent that binds to a biomarker and does not significantly bind to unrelated compounds.
  • binding agents that can be effectively employed in the disclosed methods include, but are not limited to, proteins and antibodies, such as monoclonal or polyclonal antibodies, or antigen-binding fragments thereof.
  • a binding agent binds a biomarker (e.g., a polypeptide biomarker) with an affinity constant of, for example, greater than or equal to about lxl 0 "6 M.
  • antibody is meant any immunoglobulin polypeptide, or fragment thereof, having immunogen binding ability.
  • antibody fragments include, but are not limited to, linear antibodies; single-chain antibody molecules; Fc or Fc' peptides, Fab and Fab fragments, and multi-specific antibodies formed from antibody fragments.
  • the terms also refer to fragments that bind an antigen of a target molecule (e.g., a biomarker protein described herein) and can be referred to as
  • antibody is used in reference to any immunoglobulin molecule that reacts with a specific antigen. It is intended that the term encompass any immunoglobulin (e.g., IgG, IgM, IgA, IgE, IgD, etc.) obtained from any source (e.g., humans, rodents, non-human primates, caprines, bovines, equines, ovines, etc.). Specific types/examples of antibodies include polyclonal, monoclonal, humanized, chimeric, human, or otherwise-human-suitable antibodies. "Antibodies” also includes any fragment or derivative of any of the herein described antibodies that specifically binds the target antigen.
  • immunoglobulin e.g., IgG, IgM, IgA, IgE, IgD, etc.
  • source e.g., humans, rodents, non-human primates, caprines, bovines, equines, ovines, etc.
  • epitopes or "antigenic determinant” are used interchangeably herein and refer to that portion of an antigen capable of being recognized and specifically bound by a particular antibody.
  • the antigen is a polypeptide
  • epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing.
  • An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
  • an antigenic determinant can compete with the intact antigen (i.e., the "immunogen” used to elicit the immune response) for binding to an antibody.
  • substantially identical is meant a protein or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein).
  • a sequence is at least 60%, more preferably 80% or 85%, and most preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
  • Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;
  • BLAST program may be used, with a probability score between e "3 and e "100 indicating a closely related sequence.
  • an effective amount is meant the amount of a required to ameliorate the symptoms of a disease relative to an untreated patient.
  • the effective amount of active compound(s) used to practice the present invention for therapeutic treatment of malaria varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.
  • malaria includes the art recognized condition known as "malaria” e.g., disorders which are caused by a protozoan of the genus Plasmodium. Malaria is generally characterized by symptoms such as headache, malaise, anemia, splenomegaly, and paroxyms with cold, hot, and wet stages and is transmitted by mosquitoes.
  • the protozoan is selected from the group consisting of: P. falciparum, P. vivax, P. ovale, P.
  • malaria treatment or anti-malarials include, but are not limited to, quinine, chloroquine, amodiaquine, roguanil, chlorproguanil, proguanil, cycloquanil, pyrimethamine, sulfadoxine, pyrimethamine-sulfadoxine, pyrimethamine-dapsone, primaquine, amopyroquine, chlorproquanil, quinidine, tetracycline, dapsone, doxycycline, clindamycin, sulphonamides, arteflene, mefloquine, halofantrine, bulaquine, artemisinin, artemether, arteether, atovaquone, lumefantrine, dihydroartemisinin, piperaquine, artesunate, pyronaridine, azithromycin, tafenoquine, trimethoprim, sulfamethoxazole, artemis
  • solid support refers to any composition and/or material that is capable of immobilizing a compound including, but not limited to, immobilizing an antibody (i.e., for example, an antibody that binds to an HRP2) or an antigen (i.e., for example, an HRP2 protein).
  • a solid support may include, but is not limited to, a membrane (e.g. a charged membrane), plastic, beads, strips, microtiter wells, microchannels, etc.
  • the malaria parasite biomarkers of the present invention can be detected and/or measured by immunoassay.
  • Immunoassay requires biospecific capture reagents/binding agent, such as antibodies, to capture the biomarkers. Many antibodies are available commercially. Antibodies also can be produced by methods well known in the art, e.g., by immunizing animals with the biomarkers. Biomarkers can be isolated from samples based on their binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to generate antibodies by methods well-known in the art.
  • the present invention contemplates traditional immunoassays including, for example, sandwich immunoassays including ELISA or fluorescence-based immunoassays, immunoblots, Western Blots (WB), as well as other enzyme immunoassays.
  • Nephelometry is an assay performed in liquid phase, in which antibodies are in solution. Binding of the antigen to the antibody results in changes in absorbance, which is measured.
  • a biospecific capture reagent for the biomarker is attached to the surface of an MS probe, such as a pre-activated protein chip array. The biomarker is then specifically captured on the biochip through this reagent, and the captured biomarker is detected by mass spectrometry.
  • the expression levels of the biomarkers employed herein are quantified by immunoassay, such as enzyme-linked immunoassay (ELISA) technology.
  • the levels of expression of the biomarkers are determined by contacting the biological sample with antibodies, or antigen binding fragments thereof, that selectively bind to the biomarker; and detecting binding of the antibodies, or antigen binding fragments thereof, to the biomarkers.
  • the binding agents employed in the disclosed methods and compositions are labeled with a detectable moiety.
  • a binding agent and a detection agent are used, in which the detection agent is labeled with a detectable moiety.
  • the level of a biomarker in a sample can be assayed by contacting the biological sample with an antibody, or antigen binding fragment thereof, that selectively binds to the target biomarker (referred to as a capture molecule or antibody or a binding agent), and detecting the binding of the antibody, or antigen-binding fragment thereof, to the biomarker.
  • the detection can be performed using a second antibody to bind to the capture antibody complexed with its target biomarker.
  • a target biomarker can be an entire protein, or a variant or modified form thereof.
  • Kits for the detection of biomarkers as described herein can include pre-coated strip/plates, biotinylated secondary antibody, standards, controls, buffers, streptavidin-horse radish peroxidise (HRP), tetramethyl benzidine (TMB), stop reagents, and detailed instructions for carrying out the tests including performing standards.
  • HRP streptavidin-horse radish peroxidise
  • TMB tetramethyl benzidine
  • the present disclosure also provides methods for detecting the malaria parasite Plasmodium in a subject, wherein the levels of expression of the malaria parasite biomarkers in a biological sample are determined simultaneously.
  • methods comprise: (a) contacting a biological sample obtained from the subject with a plurality of binding agents that selectively bind to a plurality of biomarkers disclosed herein for a period of time sufficient to form binding agent-biomarker complexes; and (b) detecting binding of the binding agents to the plurality of biomarkers.
  • the detection of the biomarkers indicates the presence of the malaria parasite in the subject.
  • detection thereby determines the levels of expression of the biomarkers in the biological sample; and the method can further comprise (c) comparing the levels of expression of the plurality of biomarkers in the biological sample with predetermined threshold values, wherein levels of expression of at least one of the plurality of polypeptide biomarkers above or below the predetermined threshold values indicates, for example, the presence of the malaria parasite in the subject.
  • binding agents that can be effectively employed in such methods include, but are not limited to, antibodies or antigen- binding fragments thereof, aptamers, lectins and the like.
  • the present disclosure provides compositions that can be employed in the disclosed methods.
  • the present invention comprises a lateral flow assay.
  • a lateral flow device e.g., a strip
  • a binding agent e.g., a biotinylated mAb against PSSP17
  • the strip can further be designed to contain streptavidin at the test line.
  • the control line of the strip can comprise IgG.
  • the lateral flow device does not comprise a detection agent; the detection agent (and binding agent) can be added to the sample in a tube prior to being deposited on the lateral flow strip (or prior to placing the lateral flow strip into the sample tube).
  • compositions comprise a solid substrate and a plurality of binding agents immobilized on the substrate, wherein each of the binding agents is immobilized at a different, indexable, location on the substrate and the binding agents selectively bind to a plurality of biomarkers disclosed herein.
  • the locations are pre-determined.
  • the binding agents selectively bind to a plurality of biomarkers described herein. Binding agents that can be employed in such compositions include, but are not limited to, antibodies, or antigen-binding fragments thereof, aptamers, lectins and the like.
  • methods for assessing malaria in a subject comprising: (a) contacting a biological sample obtained from the subject with a composition disclosed herein for a period of time sufficient to form binding agent- polypeptide biomarker complexes; and (b) detecting binding of the plurality of binding agents to the plurality of polypeptide biomarkers.
  • detection thereby determines the levels of expression of the biomarkers in the biological sample; and the method can further comprise (c) comparing the levels of expression of the plurality of polypeptide biomarkers in the biological sample with predetermined threshold values, wherein levels of expression of at least one of the plurality of polypeptide biomarkers above or below the predetermined threshold values indicates malaria status in the subject.
  • any other suitable agent e.g., a peptide, an aptamer, or a small organic molecule
  • a biomarker of the present invention is optionally used in place of the antibody in the above described immunoassays.
  • an aptamer that specifically binds a biomarker and/or one or more of its breakdown products might be used.
  • Aptamers are nucleic acid-based molecules that bind specific ligands. Methods for making aptamers with a particular binding specificity are known as detailed in U. S. Patents No. 5,475,096; No. 5,670,637; No.
  • the assay performed on the biological sample can comprise contacting the biological sample with one or more capture agents (e.g., antibodies, peptides, aptamer, etc., combinations thereof) to form a biomarker: capture agent complex.
  • capture agents e.g., antibodies, peptides, aptamer, etc., combinations thereof
  • the complexes can then be detected and/or quantified.
  • a subject can then be identified as having the malaria parasite based on a comparison of the detected/quantified/measured levels of biomarkers to one or more reference controls as described herein.
  • a first, or capture, binding agent such as an antibody that specifically binds the biomarker of interest
  • a suitable solid phase substrate or carrier is immobilized on a suitable solid phase substrate or carrier.
  • the test biological sample is then contacted with the capture antibody and incubated for a desired period of time.
  • a second, detection, antibody that binds to a different, non-overlapping, epitope on the biomarker (or to the bound capture antibody) is then used to detect binding of the polypeptide biomarker to the capture antibody.
  • the detection antibody is preferably conjugated, either directly or indirectly, to a detectable moiety.
  • detectable moieties examples include, but are not limited to, cheminescent and luminescent agents; fluorophores such as fluorescein, rhodamine and eosin; radioisotopes; colorimetric agents; and enzyme-substrate labels, such as biotin.
  • the assay is a competitive binding assay, wherein labeled biomarker is used in place of the labeled detection antibody, and the labeled biomarker and any unlabeled biomarker present in the test sample compete for binding to the capture antibody.
  • the amount of biomarker bound to the capture antibody can be determined based on the proportion of labeled biomarker detected.
  • Solid phase substrates, or carriers, that can be effectively employed in such assays are well known to those of skill in the art and include, for example, 96 well microtiter plates, glass, paper, and microporous membranes constructed, for example, of nitrocellulose, nylon, polyvinylidene difluoride, polyester, cellulose acetate, mixed cellulose esters and
  • Suitable microporous membranes include, for example, those described in US Patent Application Publication no. US 2010/0093557 Al .
  • Methods for the automation of immunoassays are well known in the art and include, for example, those described in U. S. Patent Nos. 5,885,530, 4,981,785, 6, 159,750 and 5,358,691.
  • the presence of several different polypeptide biomarkers in a test sample can be detected simultaneously using a multiplex assay, such as a multiplex ELISA.
  • Multiplex assays offer the advantages of high throughput, a small volume of sample being required, and the ability to detect different proteins across a board dynamic range of concentrations.
  • a kit can be used to detect different proteins across a board dynamic range of concentrations.
  • such methods employ an array, wherein multiple binding agents (for example capture antibodies) specific for multiple biomarkers are immobilized on a substrate, such as a membrane, with each capture agent being positioned at a specific, predetermined, location on the substrate.
  • a substrate such as a membrane
  • Flow cytometric multiplex arrays in several different formats based on the utilization of, for example, flow cytometry, chemiluminescence or electron-chemiluminesence technology, can be used.
  • Flow cytometric multiplex arrays also known as bead-based multiplex arrays, include the Cytometric Bead Array (CBA) system from BD Biosciences (Bedford, Mass.) and multi- analyte profiling (xMAP®) technology from Luminex Corp. (Austin, Tex.), both of which employ bead sets which are distinguishable by flow cytometry. Each bead set is coated with a specific capture antibody.
  • CBA Cytometric Bead Array
  • xMAP® multi- analyte profiling
  • Fluorescence or streptavidin-labeled detection antibodies bind to specific capture antibody-biomarker complexes formed on the bead set. Multiple biomarkers can be recognized and measured by differences in the bead sets, with chromogenic or fluorogenic emissions being detected using flow cytometric analysis.
  • a multiplex ELISA from Quansys Biosciences (Logan, Utah) coats multiple specific capture antibodies at multiple spots (one antibody at one spot) in the same well on a 96-well microtiter plate. Chemiluminescence technology is then used to detect multiple biomarkers at the corresponding spots on the plate.
  • the biomarker biomarkers of the present invention may be detected by means of an electrochemicaluminescent assay developed by Meso Scale Discovery (Gaithersrburg, MD). Electrochemiluminescence detection uses labels that emit light when electrochemically stimulated. Background signals are minimal because the stimulation mechanism (electricity) is decoupled from the signal (light). Labels are stable, non-radioactive and offer a choice of convenient coupling chemistries. They emit light at -620 nm, eliminating problems with color quenching. See U.S. Patents No. 7,497,997; No. 7,491,540; No. 7,288,410; No. 7,036,946; No. 7,052,861; No. 6,977,722; No.
  • biomarkers of the present invention can be detected by other suitable methods. Detection paradigms that can be employed to this end include optical methods,
  • electrochemical methods voltametry and amperometry techniques
  • atomic force microscopy atomic force microscopy
  • radio frequency methods e.g., multipolar resonance spectroscopy.
  • optical methods in addition to microscopy, both confocal and non-confocal, are detection of fluorescence, luminescence, chemiluminescence, absorbance, reflectance, transmittance, and birefringence or refractive index (e.g., surface plasmon resonance, ellipsometry, a resonant mirror method, a grating coupler waveguide method or
  • Biochips generally comprise solid substrates and have a generally planar surface, to which a capture reagent (also called an adsorbent or affinity reagent) is attached. Frequently, the surface of a biochip comprises a plurality of addressable locations, each of which has the capture reagent bound there.
  • Protein biochips are biochips adapted for the capture of polypeptides. Many protein biochips are described in the art. These include, for example, protein biochips produced by Ciphergen Biosystems, Inc. (Fremont, CA.), Invitrogen Corp. (Carlsbad, CA), Affymetrix, Inc.
  • the present invention comprises a microarray chip. More specifically, the chip comprises a small wafer that carries a collection of binding agents bound to its surface in an orderly pattern, each binding agent occupying a specific position on the chip.
  • the set of binding agents specifically bind to each of the one or more one or more of the biomarkers described herein.
  • a few micro-liters of blood serum or plasma are dropped on the chip array.
  • Biomarker proteins present in the tested specimen bind to the binding agents specifically recognized by them.
  • Subtype and amount of bound mark is detected and quantified using, for example, a fluorescently-labeled secondary, subtype-specific antibody.
  • an optical reader is used for bound biomarker detection and quantification.
  • a system can comprise a chip array and an optical reader.
  • a chip is provided.
  • kits for qualifying malaria status which kits are used to detect the biomarkers described herein.
  • the kit is provided as a lateral flow immunoassay kit comprising antibodies to the biomarkers of the present invention including, but not limited to, PSSP17.
  • the kit may comprise a solid support, such as a chip, microtiter plate (e.g., a 96-well plate), bead, or resin having biomarker capture reagents attached thereon.
  • the kit may further comprise a means for detecting the biomarkers, such as antibodies, and a secondary antibody-signal complex such as horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody and tetramethyl benzidine (TMB) as a substrate for HRP.
  • HRP horseradish peroxidase
  • TMB tetramethyl benzidine
  • the kit may be provided as an immuno-chromatography strip comprising a membrane on which the antibodies are immobilized, and a means for detecting, e.g., gold particle bound antibodies, where the membrane, includes NC membrane and PVDF membrane.
  • the kit may comprise a plastic plate on which a sample application pad, gold particle bound antibodies temporally immobilized on a glass fiber filter, a nitrocellulose membrane on which antibody bands and a secondary antibody band are immobilized and an absorbent pad are positioned in a serial manner, so as to keep continuous capillary flow of the sample.
  • a patient can be diagnosed by adding a biological sample
  • a method which comprises the steps of: (i) collecting saliva from the patient; (ii) adding the saliva from patient to a diagnostic kit; and, (iii) detecting the biomarkers conjugated with antibodies.
  • the antibodies are brought into contact with the patient's saliva. If the biomarkers are present in the sample, the antibodies will bind to the sample, or a portion thereof.
  • saliva not be collected from the patient (i.e., it is already collected). Saliva samples can be collected from subject of varying ages.
  • the sample may comprise a blood, serum, sweat, tissue, urine or a clinical sample.
  • the kit can also comprise a washing solution or instructions for making a washing solution, in which the combination of the capture reagents and the washing solution allows capture of the biomarkers on the solid support for subsequent detection by, e.g., antibodies or mass spectrometry.
  • a kit can comprise instructions for suitable operational parameters in the form of a label or separate insert. For example, the instructions may inform a consumer about how to collect the sample, how to wash the probe or the particular biomarkers to be detected, etc.
  • the kit can comprise one or more containers with biomarker samples, to be used as standard(s) for calibration or normalization. Detection of the markers described herein may be accomplished using a lateral flow assay.
  • the malaria parasite biomarker proteins of the present invention can be detected and/or measured by immunoassay.
  • Immunoassay requires biospecific capture reagents, such as antibodies to capture the biomarkers. Many antibodies are available commercially.
  • Antibodies also can be produced by methods well known in the art, e.g., by immunizing animals with the malaria parasite biomarker proteins. Proteins can be isolated from samples based on their binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to generate antibodies by methods well-known in the art.
  • the present invention contemplates traditional immunoassays including, for example, sandwich immunoassays including ELISA or luminescence/fluorescence-based
  • a biospecific capture reagent for the biomarker is attached to the surface of an MS probe, such as a pre-activated protein chip array. The biomarker is then specifically captured on the biochip through this reagent, and the captured biomarker is detected by mass spectrometry.
  • any other suitable agent e.g., a peptide, an aptamer, or a small organic molecule
  • a biomarker of the present invention is optionally used in place of the antibody in the above described immunoassays.
  • an aptamer that specifically binds a malaria parasite biomarker proteins and/or one or more of its breakdown products might be used.
  • Aptamers are nucleic acid-based molecules that bind specific ligands. Methods for making aptamers with a particular binding specificity are known as detailed in U.S. Patents No. 5,475,096; No. 5,670,637; No. 5,696,249; No. 5,270, 163; No. 5,707,796; No. 5,595,877; No. 5,660,985; No. 5,567,588; No. 5,683,867; No. 5,637,459; and No. 6,011 ,020.
  • the assay performed on the biological sample can comprise contacting the biological sample with one or more capture agents (e.g., antibodies, peptides, aptamer, etc., combinations thereof) to form a biomarker: capture agent complex.
  • capture agents e.g., antibodies, peptides, aptamer, etc., combinations thereof
  • the complexes can then be detected and/or quantified.
  • a subject can then be identified as being asymptomatic or symptomatic for malaria based on the presence of the malaria parasite biomarker proteins in the sample or a comparison of the detected/quantified/measured levels of malaria parasite biomarker proteins to one or more reference controls as described herein.
  • the malaria parasite biomarker proteins of the present invention can be captured and concentrated using nano particles.
  • the proteins can be captured and concentrated using Nanotrap® technology (Ceres).
  • Nanosciences, Inc. Manassas, VA
  • the Nanotrap platform reduces pre-analytical variability by enabling biomarker enrichment, removal of high-abundance analytes, and by preventing degradation to highly labile analytes in an innovative, one-step collection workflow.
  • Multiple analytes sequestered from a single sample can be concentrated and eluted into small volumes to effectively amplify, up to 100-fold or greater depending on the starting sample volume (Shafagati, 2014; Shafagati, 2013; Longo, et al, 2009), resulting in substantial improvements to downstream analytical sensitivity.
  • kits for rapidly diagnosing malaria in asymptomatic and/or symptomatic individuals are provided.
  • the kit is provided as a 61 par point of care use malaria RDT.
  • the kit can comprise antibodies (or fragments that specifically bind) to the proteins described herein.
  • the antibodies specifically bind to a protein biomarker, which biomarkers include one or more of PF3D7 01 11300 (replication factor c protein, putative), PF3D7_0216700.1 (conserved Plasmodium protein, unknown function), PF3D7_0310500 (DEAD box helicase, putative), PF3D7_0318200 (DNA-directed RNA polymerase II, putative), PF3D7_0401900 (acyl-CoA synthetase (ACS6)), PF3D7_0419900 (phosphatidylinositol 4-kinase, putative),
  • PF3D7 01 11300 replication factor c protein, putative
  • PF3D7_0216700.1 conserved Plasmodium protein, unknown function
  • PF3D7_0310500 DEAD box helicase, putative
  • PF3D7_0318200 DNA-directed RNA polymerase II, putative
  • PF3D7_0422300 alpha tubulin 2
  • PF3D7_0507800 conserved Plasmodium protein, unknown function
  • PF3D7 0508100 SET domain protein, putative (SET9)
  • PF3D7_0509400 RNA polymerase I (RNAPI)
  • PF3D7_0510100 conserved Plasmodium protein, unknown function
  • PF3D7 0511500 RNA pseudouridylate synthase, putative
  • PF3D7 0512600 Rab GTPase lb (Rablb)
  • PF3D7 0528700 peptidyl-prolyl cis-trans isomerase (CYP23)
  • PF3D7_0529800 conserved Plasmodium protein, unknown function
  • PF3D7 0610400 histone H3 (H3)
  • PF3D7 0632500 erythrocyte membrane protein 1, PfEMPl (VAR)
  • PF3D7_0704100 conserved Plasmodium membrane protein, unknown function
  • PF3D7_0705500 inositol-phosphate phosphatase, putative
  • PF3D7_0717900
  • PF3D7_0927200 zinc finger protein, putative
  • PF3D7_1015900 enolase (ENO)
  • PF3D7_1029000 (conserved Plasmodium protein, unknown function, pseudogene),
  • PF3D7 1034400 flavoprotein subunit of succinate dehydrogenase (SDHA)
  • PF3D7 1 102400 flavoprotein, putative
  • PF3D7 1 105600 translocon component PTEX88 (PTEX88)
  • PF3D7 1134700 DNA-directed RNA polymerase 1, subunit 2, putative
  • PF3D7_1142100 conserved Plasmodium protein, unknown function
  • PF3D7_1200200 rifin (RIF)
  • PF3D7_1202300 dinein heavy chain, putative
  • PF3D7_1207000 conserved Plasmodium protein, unknown function
  • PF3D7_1211800 polyubiquitin (PfpUB)
  • PF3D7_1215100 conserved Plasmodium protein, unknown function
  • PF3D7_1216000 seerine—tRNA ligase, putative
  • PF3D7_1216900 DNA-binding chaperone, putative
  • PF3D7 1218800 secreted ookine
  • PF3D7 1239900 vesicle fusion and protein sorting subunit 16, putative (VPS 16)
  • PF3D7_1318300 (conserved Plasmodium protein, unknown function)
  • PF3D7_1319200 (conserved Plasmodium protein, unknown function)
  • PF3D7_1325900 (conserved
  • Plasmodium protein, unknown function PF3D7_1327300 (conserved Plasmodium protein, unknown function), PF3D7 1337200 (1-deoxy-D-xylulose 5-phosphate synthase),
  • PF3D7_1337500 (conserved Plasmodium protein, unknown function), PF3D7_1342600 (myosin A (MyoA)), PF3D7_1353000 (tryptophan-rich antigen, pseudogene),
  • PF3D7 141 1400 plastid replication-repair enzyme (PREX)
  • PF3D7 1421300 conserved Plasmodium protein, unknown function
  • PF3D7_1434200 calmodulin (CAM)
  • PF3D7_1443800 zinc finger protein, putative
  • the methods, compositions and kits of the present invention can comprise monoclonal antibodies, cGMP conjugated monoclonal antibodies, cGMP recombinant proteins, cGMP saliva collection vessels and stabilization buffers.
  • EXAMPLE 1 Sex-Partitioning of the Plasmodium falciparum .Stage V Gametocvte Proteome Provides Insight into Falciparum-Specific Cell Biology
  • gametocytes comprise only 0.1 -2% of the total body parasite load during active infection, and are only observed in the bloodstream in their mature (Stage V) form, with the first four developing stages sequestered in tissues.
  • Microscopy-based analysis for sex ratio determination and infectivity studies remains limited due to cost, training and suitability for population- wide studies.
  • light microscopy remains the gold standard for malaria diagnosis, the relatively low prevalence of circulating gametocytes makes it difficult to, accurately detect much less quantify these stages.
  • stage V gametocytes in the bloodstream alone as determined by thick smear microscopy does not imply infectivity to mosquitoes.
  • Ratios of male and female gametocytes in the blood circulation are generally skewed towards the female, but they can vary significantly based on co-infection, parasite and gametocyte density and host environmental factors and it is therefore hypothesized that this variation in sex ratios will influence mosquito infectivity.
  • mature gametocyte sex ratios can change during the course of infection in response to host cues or especially following antimalarial treatment resulting in an increase in the number of males.
  • P. falciparum NF54 gametocyte culture P. falciparum NF54 gametocyte culture.
  • P. falciparum gametocytes were cultured in RPMI-1640 containing HEPES and glutamine and supplemented with 10% human serum and hypoxanthine as described earlier (34).
  • P. falciparum NF54 strain was diluted to 0.5% mixed stage asexual parasites and 4% hematocrit in complete culture medium in six well plates. Plates were transferred to 37°C incubator and microaerophilic environment was created using desiccators as candle jar. Media was exchanged every day without the addition of new blood from day 1 to day 17 (culture maturation).
  • stage V To remove asexual stage parasites 50 mM N- acetylglucosamine was added to the culture media from day 8 (early stage gametocytes) until day 10. Blood smears were made every alternate day to monitor the progress of the culture and to determine gametocyte percent on day 18. Stage V gametocytes (stage V) were harvested from culture at day 17 post-gametocytogenesis initiation and isolated by passage through a LS-25 Midi MACS column (CS Miltenyi).
  • stage V gametocyte culture The production of stage V gametocytes was performed using a modified version of a previously described protocol (35).
  • Ten (10) mL cultures at 4% hematocrit and -5% ring parasitemia were sorbitol synchronized.
  • trophozoite cultures were transferred to a T75 flask to which complete media and red blood cells were added to create a 30mL culture with 2% hematocrit in each flask.
  • adding 50% old media and 50% new complete media stressed the newly reinvaded rings. Cultures were allowed to develop to late schizonts and then split into three T75 flasks evenly. Twenty (20) mLs of fresh media was then added to each flask.
  • SDT-lysis buffer including 4% (w/v) SDS, 100 mM Tris/HCl, 0.1 M DTT, pH 7.6, then boiled at 95 °C for 5 min. The supernatant was collected as membrane part protein fraction after centrifugation at 20,000 g for 5 min at 4°C.
  • Multi-Lane Combined In-gel Digestion MLCID
  • MLCID Multi-Lane Combined In-gel Digestion
  • NF54 parasites we used 3 lanes for the soluble protein fraction and 4 lanes for the membrane fraction, respectively, and each lane was loaded with 20 of sample under reducing conditions. After resolving on a 4-20% precast gradient gel (BioRad, Hercules, CA), the proteins were stained with Coomassie.
  • GiRBC soluble and membrane fractions were cut into 14 slices by combining 3 lanes (soluble) and 16 slices by combining 4 lanes (membrane). Both the soluble and membrane fractions from Dd2 were cut into 14 slices by combing 3 lanes. Gel slices were cut into l x l mm pieces prior to de-staining, reduction and alkylation, tryptic digestion and peptide extraction. The extracted peptides were lyophilized and then were re-suspended in 2% ACN, 97.9% water and 0.1 % formic acid buffer for LC-MS/MS analysis.
  • Peptides were loaded onto the enrichment column automatically by autosampler using 97% solvent A (0.1% formic acid in water) and 3% solvent B (0.1% formic acid in 90% acetonitrile) at a flow rate of 2 ⁇ / ⁇ . Elution of peptides from the analytical column was performed using a gradient starting at 97% A at 300 nL/min. The mobile phase was 3-10% B for 4 min, 10-35% B for 56 min, 35-99% for 2 min, and maintained at 99% B for 6 min, followed by re-equilibration of the column with 3% B for 10 min. Data dependent (autoMS2) mode was used for MS acquisition by Agilent 6520 Q-TOF in 2 GHz.
  • autoMS2 Data dependent
  • Precursor MS spectra were acquired from m/z 315 to 1700 and the top 4 peaks were selected for MS/MS analysis.
  • Product scans were acquired from m/z 50 to 1700 at a scan rate of 1.5/second.
  • a medium isolation width ( ⁇ 4 amu) was used, and a collision energy of slope 3.9 V/100 Da with a 2.9 V offset was applied for fragmentation.
  • a dynamic exclusion list was applied, with precursors excluded of 0.50 min after two MS/MS spectrum was acquired.
  • Mass spectrometry data search and analysis Each sample was further fractionated into 14 membrane and 14 soluble fractions.
  • Raw data from Dd2 sample runs (2 biological replicates, 217,165 MS/MS total spectra) and NF54 GiRBC sample runs (3 biological replicates, 497,006 MS/MS total spectra) was converted to mzXML format using Trapper (Institute for Systems Biology, Seattle, Washington).
  • a merged search was performed on the mzXML data for each fraction using the PepArML metasearch engine (36), which automatically conducts target and decoy searches using the following: Mascot (37), OMSSA (38) and Tandem (39) with native, K-score (40) and S-score pluggable scoring modules (41), and Inspect (42) with MS-GF spectral probability scoring (43).
  • the results were then combined using an unsupervised machine-learning strategy, and the peptide identification false discovery rates were estimated using identifications from the reversed decoy searches (44).
  • Proteins identified by single peptides were manually validated.
  • the data analysis pipeline meets all MIAPE standards (45) and the proteomics data have been deposited in the ProteomeExchange via the PRotein IDEntifications database (PRIDE) partner repository with the dataset identifier PXD000813 (46).
  • PRIDE PRotein IDEntifications database
  • the protein lists have also been uploaded to PlasmoDB (plasmodb.org).
  • Putative male-specific, female-specific, and sex-unspecific proteomes were generated by taking protein identifications unique to NF54 and Dd2, respectively.
  • These putative proteomes were then BLAST searched against the two previous datasets of Khan et al. and Silvestrini et al. (8, 11). In house developed Python scripts were used for BLAST automation, with an e-value cutoff of 0.01 and >40% identity for BLAST 2.2.20 homology search. In order to focus on the parasite proteome, all identified human proteins were excluded from this analysis.
  • Identified proteins were annotated by GeneDB (02, 2013); specifically, the Gene Ontology database was searched by BLAST homology for annotations.
  • the surface expressed (SE) proteins were predicted by searching for canonical signal peptides with the SignalP 4.1 Server (47).
  • Transmembrane domain information was obtained on all identified proteins by the transmembrane protein prediction tool TMHMM Server v. 2.0 (48).
  • the ⁇ SNP diversity statistic representing mean pairwise non-synonymous SNP diversity per site, was calculated for previously generated data within each genie region for a given population using the VCFtools—site-pi utility (49). For each pair of populations, the F st divergence statistic was calculated for each gene with the VCFtools implementation of Fst and weighted Fst estimators as described in Weir and Cockerham (50). Expression of recombinant proteins and generation of polyclonal antibodies for proteomic validation.
  • Each codon-optimized gene or gene fragment was used as a template for PCR along with the following primer sets (all 5' to 3'): PF3D7 0906100, F- CACCATGGGTAACAAAATTAGC (SEQ ID NO: l), R- TTTCAGGTTTTTGATACGTTCC (SEQ ID NO:2); PF3D7 1218800, F- CACCAAAATCGTGCTGTCCA (SEQ ID NO:3), R- ACCGAAGTAAATAAAACTCGGTTC (SEQ ID NO:4); PF3D7 0309100, F-
  • Each 20 ⁇ PCR reaction consisted of 0.25 ⁇ of DNA (200 ng/ ⁇ ), 4.0 ⁇ of 5x iProof DNA polymerase buffer, 0.4 ⁇ of dNTPs (lOmM each), 0.4 ⁇ each of forward and reverse primers (10 ⁇ ), 0.1 ⁇ of iProof DNA polymerase (2 U/ ⁇ ), and 14.85 ⁇ of sterile deionized water. Reaction conditions were 98°C for 2 minutes, followed by 40 cycles of 98°C for 15 seconds, 62°C for 25 seconds, and 72°C for 25 seconds.
  • Each overnight culture was then used to seed 50 mL of fresh LB+kanamycin (50 ⁇ g/mL), grown to an O.D.600a0.4, and then induced with arabinose (0.01%) for 6-8 hours at 37 °C.
  • Cells were harvested by centrifugation at 10,000 x g for 10 minutes, and the presence of recombinant protein from each expression was confirmed by western blot using mouse anti-His monoclonal Ab (Sigma).
  • the cell pellets were then processed for recombinant protein using BugBuster Reagent (Novagen) following the manufacturer's protocol for both soluble and insoluble fractions.
  • Recombinant protein was then purified by immobilized metal affinity chromatography (ProBond, Invitrogen) following the manufacturer's "hybrid” protocol for inclusion bodies and the "native" protocol for soluble protein. Following elution from the column, eluates positive for protein by Western blot were pooled and dialyzed overnight (3,500-10,000 Da MWCO) against imadozole-free elution buffer and then concentrated using diafiltration (3,000 Da MWCO).
  • mice were immunized with purified recombinant protein emulsified with incomplete Freund's adjuvant (Sigma) following a prime and 3 boosts at two week intervals. The mice were exsanguinated at the end of the immunization regimen to collect serum.
  • the Plasmodium falciparum stage V gametocyte proteome NF54 vs. Dd2.
  • NF54 West Africa
  • Dd2 has a defect in male gametocyte development resulting in arrested and morphologically altered male stages.
  • the genetic basis of this defect is at least in part, a mutation in the male development 1 (MDV-1) gene (16).
  • MDV-1 male development 1
  • Gametocytemia (Stage V) 0.09 0.06 0.05 0.07
  • the Dd2 clone has a defect in male gametocyte development.
  • the presence of Pre-Stage V gametocytes would complicate the partitioning of Dd2 proteins since male-specific markers in P. falciparum, e.g., alpha-tubulin II are expressed in pre-stage V females.
  • Pre-Stage V's we also ascertained the number of "tear drop” and "rectangular" forms, which have been hypothesized to be malformed male gametocytes. The contamination level with Pre-Stage V as well as these malformed parasites helped explain our Dd2 gametocyte proteome.
  • FIG. 2A We demonstrated highly consistent acquisition of the mixed-sex stage V gametocyte proteome (FIG. 2A), with greater than 95% reproducibility in protein identifications across biological replicates (FIG. 2A-B).
  • 1,703 mature NF54 stage V proteins including all the known and well-studied gametocyte surface markers such as P230, P48/45, P47 and the LCCL domain-containing (CCp) protein family of molecules (Table 1). Of these, 449 (26%) proteins were consistently and exclusively identified in the membrane fraction of each sample.
  • CCp LCCL domain-containing
  • NF54 and Dd2 have 1105 proteins in common, 598 NF54-specific proteins and 232 Dd2-specific proteins, which may include proteins emanating from the malformed, arrested male gametocytes (Table 2).
  • NF54 gametocyte stage V proteome (1703 proteins), which will be referred to in the text as DTg v , with the recently described P.
  • FSg v 2,031 proteins
  • FSg 1"11 1,427 proteins
  • FS Asx (1,345 proteins
  • the NF54 stage V proteome was comparable to the previously described 3D7/NF54 gametocyte stage V proteome (8), with 1,274 proteins found to be in common between the two NF54 datasets.
  • the Dd2 stage V proteome was also comparable to the FSg v proteome, with 1106 proteins in common (FIG. 2E).
  • *783 proteins are shared between membrane and soluble NF54 proteins and *621 proteins are shared between Dd2 membrane and soluble proteins. **1105 proteins are shared between Dd2 and NF54 proteins.
  • PSMA MASPECTRAS2 Analysis
  • PSMA PPepArML-Search MASPECTRAS2 Analysis
  • MDV1 male development gene 1
  • berghei mature gametocyte proteome data by PSMA has significantly improved the quality of this data set.
  • PSMA Systematic Subtractive Protein Bioinformatics analysis
  • To define the male and female proteomes ofP. falciparum stage V gametocytes we employed a SSB work-flow using the re-analyzedP. berghei mature gametocyte proteome data as a reference (FIG. 1C, FIG. 8). This approach is based on the assumption that sexual development is fundamentally evolutionarily conserved across the genus, although not all proteins will sex-partition similarly between the different lineages.
  • Step 1 We curated the Dd2 proteome by first identifying Dd2 proteins that are conserved in the maleP. berghei PSMA (ANKA-M) dataset and generating a new list of male-subtracted proteins, i.e., female-enriched proteins (Dd2-FE; 1258 proteins). The male proteins that are shared with Dd2 are set aside (Dd2-M; 79 proteins) (FIG. 4B).
  • Step 2 This set was then combined with the mixed-sex protein list from NF54 to identify proteins that are conserved between Dd2-FE and NF54 and are likely to be enriched in female specific proteins (Dd2-FE/NF54; 1045 proteins; FIG. 4C). The proteins that are excluded from the overlap are then used to generate a list of likely male-enriched proteins (NF54-ME; 658 proteins) and Dd2-FE specific proteins (Dd2-FE-SP; 213 proteins) (FIG. 4C).
  • Step 3 The NF54-ME protein list is then used to search theP. berghei male-specific gametocyte protein list (ANKA-M; 366 proteins) to identify orthologs by BLAST (FIG. 4D).
  • P. falciparum NF54 proteins with syntenic matches in the male P. berghei list are likely to be genus conserved and male-specific (NF54-M; 155 proteins).
  • the NF54-ME proteins that do not have matches are likely to be NF54-specific proteins (NF54-SP; 503 proteins).
  • Step 4 The Dd2-FE/NF54 (1045) protein list was used to search the P. berghei Female-specific gametocyte protein list (ANKA-F; 418 proteins) to identify orthologs by BLAST. This analysis identified 181 proteins conserved between the two datasets, and 864 proteins that are Dd2-FE/NF54-specific and 237 proteins that are specific to P. berghei females (FIG. 4E).
  • Step 5 The NF54-ME list (male-enriched, 658 proteins) was used to determine if there are proteins that are conserved with the ANKA-F (female, 418 proteins) list. We surprisingly found 60 proteins that are conserved between ANKA-F and the putative male- enriched NF54-ME protein subset. Following the comparison, we noted that 598 proteins are likely to be highly enriched with male-specific P. falciparum proteins.
  • NF54-M or "M2" list male-specific, 155 proteins
  • ANKA-F male, 418 proteins
  • PBANKA_050730 was already found to be shared in berghei males and females so it would naturally not partition in P. falciparum, since the male- and female- specific berghei lists were used to guide the assembly of the male and female lists in P.
  • NIMA related kinase- 4 (NEK4, PF3D7_0719200) and LCCL/CCp3 (PF3D7_1407000) proteins are conserved between P. berghei and P. falciparum female gametocytes.
  • NIMA related kinase 2 (NEK2, PF3D7_0525900) partitioned to females.
  • a functional NEK2 has been shown to be essential for human/murine parasite development in the mosquito and its expression appears to be female gametocyte specific (24).
  • the ortholog of the P. berghei female-specific Dynein heavy chain (PF3D7 0729900) did not partition to either sex.
  • P28 which is expressed as a transcript in gametocytes and only translated during gametogenesis, was identified in the female proteome. Although there are clearly differences in the conditions of gametocyte cultures as opposed to in vivo development, which may lead to the misexpression of P28 protein, it is also possible that female gametocyte activation may have occurred during cell harvest. Our data however, clearly supports the current hypothesis that P28 is female-specific. Approximately 46% of the 299 proteins (138) are conserved proteins with unknown function and represent a rich set of potential female markers for subsequent study.
  • the analysis identified GO term enrichment in female proteins for RNA binding and processing as well as for protein translation, relating to the translational repression mechanism that allows or just-in-time protein expression in the female gamete.
  • the relevance of other enriched functions such as particular enzymatic activities in male (kinase, phosphatase) and female gametocyte proteins (transferase, isomerase, and oxidoreductase) remains to be determined.
  • All the major transmission blocking vaccine candidates i.e., Pfs25, P47 and P230
  • Pfs25, P47 and P230 are not exposed to the human immune system during infection (unless the infected RBCs are cleared) but become functional upon mosquito infection when they present on the gamete and/or ookinete surface and interact with host factors.
  • P47 has an important role in immune evasion that contributes to the differential susceptibility of A. gambiae M and S strains to P.
  • Senegalese population we calculated SNP ⁇ (N) for each gene based on a sequence comparison of a total of 25 sequenced parasite isolates (28). SNP ⁇ (N) quantifies the number of pairwise non-synonymous differences amongst the set of strains analyzed. As a measure for positive selection between populations, we also calculated Fst for each gene by comparing the genetic diversity within the African parasite population with the diversity in the PNG parasite population. As predicted, P47 showed one of the highest Fst levels amongst all the male and female proteins (FIG. 4B). Interestingly, the female gametocyte marker and major vaccine candidate Pfs25 has an even higher value, reflecting strong positive selection potentially due to selection of gamete recognition and compatibility.
  • sex-specific proteins are encoded by genes with high Fst such as the male-specific gene PF3D7 1430800 and the female-specific gene PF3D7 J 358400. Except for one gene encoding a conserved hypothetical male protein PF3D7_0313600, the sex-specific gene set shows significantly lower diversity within the African population than known markers of balancing selection such as MSP1 or SERA5. This would suggest that none of the male and female-specific proteins described here interact with the human immune system, either because these proteins are not present on the infected RBC surface or because of their low abundance during human infection.
  • falciparum female-specific protein list (291 proteins, FIG. 5C), we filtered out proteins that are also found in the FS Asx (1345 proteins) set to identify 177 stage V-specific female proteins (FIG. 9B).
  • FS Asx 1345 proteins
  • FIG. 9B stage V-specific female proteins
  • NIMA related kinases NEK2 (PF3D7_0525900) and NEK4 (PF3D7_0719200) are also found in this list and categorized as female-specific proteins as well. There are 95 male-specific proteins present in this list, including the two dynein heavy chain proteins (PF3D7 1122900 and PF3D7 0905300). This short list of proteins represents a pool of well-studied targets that may be used to specifically select stage III gametocytes from culture.
  • stage-specific male/female protein markers as an indicator for stage transition and to investigate the stage-specific Dd2 defect. Since Dd2 is defective in the production of mature, stage V male gametocytes (15), we hypothesized that the Dd2 proteome is more enriched in the stage I-II gametocytes, representing the small subset of rectangular and tear-drop forms that we had described from the Dd2 culture (Table 2).
  • Dd2 stage V gametocyte dataset into stage specific proteins
  • Dd2g v Dd2 gametocyte stage V proteome (1,337 proteins), referred to as Dd2g v
  • FS Asx and FSg 1"11 datasets 804 proteins were conserved between FS Asx and Dd2g v datasets (FIG. 5F).
  • 603 Dd2 trophozoite- conserved proteins are also found in the NF54 trophozoite-conserved subset.
  • These 603 proteins comprise 56% of the total Dd2g v proteome, and may similarly represent proteins that are conserved between trophozoite and stage V gametocytes, or contaminating proteins that remain present in the GlcNAc-treated culture.
  • 189 proteins were found in the FSg 1"11 dataset as well (FIG. 5C, indicating that these proteins are expressed early in gametocytogenesis and remain present on female stage V gametocytes.
  • Dd2 we found 344 proteins that are stage V-specific. Of these stage V proteins, 227 proteins (66%, 227/344) were identified in the membrane fraction, 62%
  • Dd2 is defective in producing morphologically distinct stage V males
  • 2 proteins PF3D7_0508200 and PF3D7_1215100 had corresponding transcript markers for immature gametocytes (29), and were also thus absent from the stage V-specific Pf-M protein list (109 proteins).
  • PF3D7_1404200 had a corresponding mature (stage V) gametocyte transcript marker.
  • the remaining 69 proteins may represent a pool of candidate stage IV -V male gametocyte markers. Indeed, we found that of the 10 proteins with corresponding stage-specific transcript markers, 5 were mature stage V gametocyte proteins, and 3 corresponded to young (stage I) or immature (II-IV) gametocytes. Two of the 10 proteins were predicted to be ring-stage specific, which are likely contaminants in the sample and the last protein did not have a predicted profile that was captured by the defined stages used in the Joice, et al. (2013) study (29).
  • PF3D7_0309100 were selected based on their predicted female-specificity using the ANKA male and female proteomes.
  • stage specificity of these antibodies was tested by staining NF54 male and female gametocytes (FIG. 5) and noted that antibodies for all three proteins stained fully "falciform" stage V gametocytes from day 17 cultures.
  • PF3D7_0309100 appears to differentiate falciform from stage IV -V transitioning
  • Anti-PF3D7_0309100 antibodies appear to be highly specific to gametocytes in both NF54 and Dd2.
  • PF3D7 0906100 also referred to as a putative Developmental Protein was identified in our Dd2 stage V gametocyte protein list and in the Trophozoite protein list (8) and was therefore not included in any of the stage V specific male and female protein lists.
  • PBANKA_041520 was included in the Female-specific protein list for P. berghei, a close examination of the spectral data revealed that it was identified by a single peptide only in a single replicate batch of purified females. It is likely that this protein exists in both males and females in P. berghei.
  • PIESP2 is a putative exported parasite-infected erythrocyte surface protein, with a predicted PEXEL motif, in stage V gametocytes.
  • PIESP2 was notable in that transcript for this protein is virtually absent in stages I-II and stage V gametocytes (PlasmoDB) and it was also found to be potentially on the RBC membrane surface in asexuals and during liver stage development .
  • EXAMPLE 2 Development of a Rapid Diagnostic Test (RDT) for Asymptomatic Gametocyte Carriers.
  • RDT Rapid Diagnostic Test
  • Plasmodium falciparum sexual stage gametocyte parasites do not cause disease but are critical for transmission of the malaria parasite through the mosquito vector from one human to another. To date, no simple point of care diagnostic to identify gametocyte carriers and individuals with sub-microscopic asexual stage parasitemia exists. Current rapid diagnostic tests (RDTs) do not have enough sensitivity to identify such carriers. PCR is the only commonly used method for identifying, but it is costly and cannot be done in a rural health clinic in malaria endemic regions throughout the world. Current RDTs use blood as the biological sample source and in many countries in malaria endemic countries, cultural blood taboos exist, thereby limiting the usefulness of sampling blood from individuals who are not sick but are carriers. The present inventors have identified malaria parasite biomarkers for parasite carriage in the saliva of asymptomatic children in Cameroon and Zambia. Antibodies have been developed that can identify the sexual stage gametocyte in human saliva.
  • saliva is used as a biological source for parasite protein biomarkers (DNA has been the primary target).
  • Antibodies non-monoclonal
  • saliva can already identify female-specific gametocyte proteins in saliva. No other group has been able to identify unequivocally more than 3-4 parasite proteins in saliva.
  • the present inventors have identified 61 parasite proteins.
  • the GCF is a serum ultrafiltrate tissue fluid that seeps into the gingival sulcus from gingival connective tissue and the vasculature through thin sulcular epithelia. Periodontitis-related inflammation results in the further thinning of the sulcular epithelial membrane barrier. In turn, this results in an increase in GCF and an increase in serum transudate, including red cells and neutrophils.
  • Gingivitis or periodontitis in general is widespread in developing countries.
  • a low cost, non-invasive RDT with greater sensitivity is needed in malaria endemic countries, especially in those countries where current control methods are working. These countries are entering the pre-elimination phase and as they progress, the epidemiology of the disease changes from sick to carrier state. The current RDTs do not work in identifying these carriers. As described herein, the present inventors have generated the sex-specific
  • the present inventors identified a female-specific, gametocyte protein across several samples.
  • the present inventors also have developed antibodies against this protein and demonstrated its sex and stage specificity.
  • 392 saliva samples have been collected from asymptomatic children and comprehensively analyzed.
  • the target female gametocyte protein has been identified in > 90% of the samples.
  • the present inventors have identified the target protein in about 12 microliters of saliva (unconcentrated) from several samples using the antibodies by western blot. They have also demonstrated the identification of the HRP2 protein from Plasmodium falciparum asexual stages in about 12 microliters of unconcentrated saliva samples by commercially available monoclonal antibodies on a western blot.
  • PCR/RTPCR have been collected and analyzed.
  • the present inventors were able to identify asymptomatic carriers using the antibody to probe the human saliva at a level matching PCR/RTPCR.
  • Blood samples that were analyzed using a current RDT were found to be negative, but positive by PCR and western blot.
  • MS/MS analytical approach using a quadrupole time-of-flight (QTOF) instrument at a sensitivity of -10-33 gametocytes ⁇ L (33 saliva digested peptides spiked with different amount of gametocytes protein digested peptides) and have surpassed the expected number of parasite-specific proteins that can be detected and identified in an artificial saliva sample containing serial dilutions of stage V gametocyte culture-derived parasite proteins.
  • QTOF quadrupole time-of-flight
  • MRM- MS LC-Multiple Reaction Monitoring MS
  • Paired blood samples for each of the 338 blinded samples from Cameroon included thick and thin blood smears and 100 ⁇ of finger-prick blood that was stored in RNAlater.
  • the blood films were initially analyzed by microscopy at the time of collection and we subsequently determined if we can detect the presence of gametocytes in individuals that are microscopy negative by RTPCR amplification of the Pfs25 transcript (Bousema, et al, 2011; Mlambo, et al, 2008).
  • EXAMPLE 3 Synthetic Gene Sequence for PSSP17 that is Codon-Optimized for E. coli Expression
  • PSSP17 P. falciparum gametocyte diagnostic biomarker, PSSP17 (PlasmoDB.org accession #: PF3D7 1218800), which is a 39.6 kDa protein (394 amino acids) that is translated from a 1050 bp mRNA transcript.
  • the natural sequence is published on PlasmoDB.org and can be accessed using that number.
  • the protein was then used to generate mouse and rabbit antibody against PSSP17 that exhibited high specificity for the target biomarker. It is envisioned that a quality and process controlled Research Cell Bank (RCB) is developed to ensure that the synthetic sequence-derived recombinant subunit PSSP17 can be made in large quantities for use as a positive control.
  • the RCB is used as the seed line for downstream process development of clinical diagnostic grade material.
  • the recombinant subunit protein is used to generate both a capture and detection monoclonal antibody for the saliva-based RDT for every production lot. The epitopes recognized by the monoclonal antibodies are mapped against the recombinant subunit protein and the antibodies themselves are sequenced.
  • the recombinant subunit protein is also provided as a critical component of the RDT kit as a positive control.
  • Positive controls do not exist for the currently available RDTs that are being used to diagnose symptomatic malaria.
  • These control proteins have been identified by the Foundation of Innovative New Diagnostics, the WHO, and Roll Back Malaria Program as a critical tool to allow organizations of health and end users in malaria-endemic countries to conduct random quality checks of RDT lots, many of which have been in storage for protracted periods of time and under different temperatures. It is therefore envisioned that, in particular embodiments, a lyophilized, highly standardized positive control is provided with each lot of the RDTs to ensure that RDTs from a given production lot are performing as claimed.
  • SMAART Saliva-based Malaria Asymptomatic & Asexual Rapid Test
  • the current sensitivity of SMAART is Europium chelate, visible fluorescence detection of 2-12 parasites ⁇ L. Importantly, the current rapid diagnostic tests deployed in the field and that detect only asexual, malaria parasite antigens in the field have a sensitivity of about 200 parasites ⁇ L of blood.
  • FIG. 14 shows the Lateral Flow Immunoassay (LFIA) detection of the gametocyte specific proteins, PSSP17.
  • LFIA Lateral Flow Immunoassay
  • the readout in panel (B) is an image acquired by a camera phone.
  • a phone application can convert the image into an inverted grayscale file that can perform relative quantification (densitometry) on the visible testy bands.
  • FIG. 15. shows capture of PSSP17 in "spiked-in" samples of recombinant PSSP17 in malaria naive human saliva. Determine LOD using spiked-in samples.
  • Recombinant PfHRP2 was spiked-in to naive human saliva and tested by the SMAART-HRP2 Lateral Flow Immunoassay (LFIA).
  • Recombinant PbMIF an irrelevant parasite protein
  • Recombinant PSSP17 was spiked-in to 20 naive human saliva and tested by the SMAART-PSSP17 LFIA.
  • Recombinant HRP2 was used as a spiked-in control.
  • LOD for PSSP17 was ⁇ 5 ng/mL (approximately 3-12 gametocytes ⁇ L of blood), whereas the LOD for PfHRP2 was 25 ng/mL.
  • the reaction time was -15-20 minutes, and analyte concentration dependent. Fluorescence images were captured by camera phone and inverted. C, control line. T, test line.
  • FIG. 16 Shows the capture of native PSSP17 from saliva samples collected from asymptomatic and symptomatic children in Cameroon. Determined LOD using field samples.
  • A PSSP17 was effectively captured from preserved, frozen saliva from three saliva samples from symptomatic children/young adults (5-19 years old) presenting at a clinic in Yaounde, Cameroon.
  • B PSSP17 was effectively captured from three preserved, frozen saliva samples from asymptomatic children from a primary school in Mfou, Cameroon. These tests used blinded samples. Control naive human saliva (+ HRP2) samples were analyzed in parallel.
  • SMAART can potentially be faster (parallel analysis of samples) and more sensitive than the 30+mins/slide "gold standard” microscopy (i.e., ⁇ 16 parasites ⁇ L blood).
  • SMS9 weakly positive
  • gram-negative, RDT-positive samples by microscopy are routinely found to be gram-positive by PCR.
  • the kit comprises ten (10) 1.2 ml microdilution tubes (Light Labs) containing lyophilized, biotinylated mAb 10E2.B7 for capture and EuChelate nanoparticle-conjugated mAb 27C9.B5 (FIG. 17A-B).
  • the kit can also comprise ten (10) microdilution tubes containing lyophilized anti-PfHRP2 capture and detection mAbs (Arista Biologicals) (FIG. 17A-B).
  • the kit can further comprise twenty (20) Lateral flow strips (FIG. 17C). Twenty (20) medicine cups (30 mL, Sarstedt, FIG.
  • saliva collection devices are provided for saliva collection by drool method and twenty (20) sterile, 1.5 ml fine tip transfer pipette for transferring -15 ⁇ of saliva (FIG. 17E) from the medicine cup to the microdilution tubes.
  • the above components can be further partnered with saliva collection devices from many manufacturers, e.g., Oasis Diagnostics Pure- SalTM device (FIG. 17F), Thermo Fisher Scientific's Oral Eze® device, DNA Genotek's OraGene® device or any derivation of the same or similar platforms.
  • small medicine cups such as those that are included in the kit can be used to collect saliva as per the described collection method below.
  • disposable paper or plastic cups that are available can be used in lieu of a medicine cup or a specific saliva collection device.
  • the strips are striped with streptavidin at the test line and anti-mouse IgG in the control line. Twenty (20) strips are provided with a dropper of sample dilution buffer (SDB) enough for 20 reactions (FIG. 17C).
  • SDB sample dilution buffer
  • the kit can further comprise a strip holder insert (e.g., cardboard) for imaging 10 strips at a time (FIG. 18).
  • the box containing the kit components can also serve as the viewing box for 10 strips from different individuals that are analyzed at the same time (FIGS. 19-21).
  • a battery powered 395 nm (51W equivalent/2000 lumens) LED UV flashlight is provided (FIG. 19).
  • a 395 nm 9 UV LED flashlight is provided.
  • a battery powered 395 nm 4W UV flashlight (including 4AA batteries and a replacement bulb) is provided (FIG. 20).
  • An amber filter sheet sticker (Epak Electronics, Ltd. (United Kingdom)) is provided with each box to allow for camera phone image acquisition (FIG. 21). A filter is not required for visualization by eye.
  • Antibody Conjugation Antibody immobilization procedure was adapted from previously published methods (Xiaofei Yuan et al. 2012; Etvi Juntunen et al. 2012).
  • 30 MPs in 120 MES buffer was combined with ⁇ 5 ⁇ .
  • EDC to achieve an EDC:COOH stoichiometric ratio of 1.
  • the reaction was incubated for 20 min and then 125 borate buffer (200 mM) and 50 ⁇ , of 27C9.B5 (94 ⁇ g/mL) were added to achieve 1.354mg Ab/M2 of MP surface area. Reaction was incubated for 1 h. MPs were then centrifuged.
  • Anti-PF3D7_1218800 mAb 27C9.B5 IgG was covalently coupled to carboxylate- modified polystyrene microparticles (MPs, 1% w/v) with 0.099nm diameter, 37 A2 parking area, and Europium (Ill)-chelate (Thermo Fisher Scientific).
  • MPs carboxylate- modified polystyrene microparticles
  • Ill Europium
  • l-Ethyl-3-(3- Dimethylaminopropyl) Carbodiimide Hydrochloride EDC, Thermo Fisher Scientific
  • Coupling reactions were performed using 200 mM and 20 mM sodium tetraborate decahydrate buffer (pH 9), as well as 25mM MES buffer (pH 6.1).
  • LFIA strips are then activated by a LOFTEK® 51 UV LED handheld Flashlight 395 nM and imaged using an amber filter and an iPhone 5s 8 megapixel (MP) camera. All the UV LED hand held flashlights will work with the LFIA. However, any smart phone with a camera with >8 MP can be used for image acquisition. Android-based smart phones will allow for image analysis as described below. It is anticipated that working with cell phone manufacturers that a UV LED flash open can be utilized.
  • Image acquisition by a camera phone would allow for analysis of the image in grayscale using image analysis algorithms akin to those that have been developed for MATLAB, ImageJ and "reader" software in R.
  • the fluorescence image is first converted into grayscale and the intensity (pixel) of the Test line is compared to the Control line.
  • the intensity can be compared to a stored value for intensity based on readings using a standard curve with recombinant PSSP17 in known concentrations (FIG. 22).
  • Negative control saliva was spiked with the irrelevant P. falciparum HRP2 protein and analyzed with the PSSP17 lateral flow strips. Serial dilutions of recombinant PfPSSP17 were spiked into uninfected, naive human saliva to generate a standard that allows for the measurement of pixel intensity for the test and control lines and a comparison of the ratio of test/control line for each standard.
  • An android-based app can be developed for image analysis. For all assays, only 10 of spiked-saliva were analyzed. Limit of detection for the assay is -50 pg of PSSP17. The 100 ng/mL strip takes about 4-5 mins to "develop”. The 10 ng/mL strip takes about 20 mins to develop.
  • Each strip can be dried and stored in the dark to further improve image acquisition and analysis up to 1 month following collection. Drying the strip for longer than 30 mins can greatly improve test control intensity for samples with lower abundance of the biomarker. Images acquired by camera phone can be uploaded to a local ministry of health cloud data repository or a cloud drive in another country, to facilitate real-time surveillance data reporting, cataloging and analysis.
  • Plasmodium falciparum PSSP17 (Pfpsspl7) and its ortholog in P. vivax (Pvpsspl7) share 80% amino acid (aa) sequence identity (FIG. 23). Importantly, the region (bar) used to raise monoclonal antibodies for detection and capture of PSSP17 from human saliva has 87% (102/117 aa) sequence identity. Signal peptide is shown as an arrow for Pfpsspl7 (as determined by SignalP v. 4.1 algorithm). It is expected that the compositions and methods of the present invention can be used to detect P. ovale, P. malariae and P. knowlesi.
  • the SMAART Lateral Flow Immunoassay prototype can detect the presence of the P. vivax gametocyte PSSP17 in 10 ⁇ of unprocessed, blinded saliva from adults presenting at a clinic in Manaus, Brazil. See FIG. 24. Image was captured by camera phone and inverted. Of the 9 saliva samples tested, four (4) were positive (red arrows) at the test line (T). Once unblinded, the samples were found to be from individuals who are were found to be positive by microscopy for asexual blood stages of P. vivax upon patient intake at the clinic (Day 1, left panel). However, given the difficulty in identifying P. vivax gametocytes,
  • P. vivax gametocytes are present in the blood at the same time as asexual stages during the primary attack, which is quite different from P. falciparum. Although P. vivax gametocytes appear very early in infection and represent less than 2% of the total parasite biomass, they are also short-lived. Individuals presenting at a clinic with symptomatic malaria may or may have detectable gametocytes in their blood, since they would presumably be at different stages of the infection cycle. The same individuals were treated with Primaquine and re-screened at Day 7 (right panel) following treatment. The patients were all microscopy-negative following drug treatment. However, we determined that saliva from patient #2 appeared to remain faintly positive for P.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Botany (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to the field of malaria. More specifically, the present invention provides methods and compositions useful for rapidly testing for malaria infection. In one embodiment, a method for identifying the malaria parasite Plasmodium in a human subject comprises the steps of (a) incubating a saliva sample obtained from the subject with an antibody that specifically binds PSSP17, wherein the presence of PSSP17 creates one or more antibody:PSSP17 complexes; (b) applying a detection agent that detects the antibody-PSSP17 complexes; and (c) identifying the subject as having the malaria parasite Plasmodium where the antibody-PSSP17 complexes are detected.

Description

COMPOSITIONS AND METHODS FOR DETECTION OF MALARIA PARASITE
BIOMARKERS
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 62/180,705, filed June 17, 2015, which is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
The present invention relates to the field of malaria. More specifically, the present invention provides methods and compositions useful for rapidly testing for malaria infection.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
This application contains a sequence listing. It has been submitted electronically via EFS-Web as an ASCII text file entitled "P13038-04_ST25.txt." The sequence listing is 40,507 bytes in size, and was created on June 16, 2016. It is hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
Malaria control efforts have yielded significant progress toward reducing the burden of malaria. An estimated 274 million fewer cases and 1.1 million fewer malaria-related deaths were reported in the last decade (WHO, 2013). However, expanding drug resistance, the cost of sustained control efforts and the risk of malaria resurgence in countries that have reached the pre-elimination phase have resulted in the generation of road maps on how to maintain the momentum toward reaching the goal of elimination and eradication (WHO, 2007; Alonso, et al, 2011; malERA Consultative Group 2011).
Individuals presenting with malaria symptoms must have the diagnosis confirmed by expert microscopy or RDT prior to treatment. Malaria RDTs detect specific Plasmodium antigens in blood and commonly use one or more of three target antigens: histidine-rich protein 2 (HRP2), lactate dehydrogenase (LDH) and aldolase. HRP2 is expressed only by Plasmodium falciparum (Pf) and is the most widely used target antigen. LDH and aldolase are expressed across all Plasmodium species but appear to have lower diagnostic accuracy among current RDTs that incorporate these two antigens (FIND, 2012). In fact, a recent comparative analysis of WHO-qualified RDTs demonstrated significant variability in performance for many of the widely used RDTs (WHO, 2013). Of the 42 RDTs that qualified for the study, only four had detection rates above 90% at the WHO recommended lower limit of detection (200 parasites^L) (Perkins et al, 2008).
As national malaria control programs consider strategies and tools to support malaria elimination (malERA Consultative Group, 2011), it is imperative that the malaria community reassess diagnostic research priorities in pre-elimination settings because the epidemiology of malaria changes significantly as regions transition from control to pre-elimination phase activities (Cotter, 2013). Infections become localized in defined geographic areas and are more frequently imported from higher-transmission regions. Importantly, a larger proportion of ongoing transmission is attributed to low parasite density and subclinical infection, which are not readily detected by currently available RDTs or microscopy (Bottius, et al, 1996;
Laishram, et al, 2013; FIND report 2012 Round 4). As such, it has been argued that passive case detection strategies based at health care facilities need to be augmented with active infection (asymptomatic) detection strategies using more sensitive diagnostic tools.
SUMMARY OF THE INVENTION
The present invention is based, at least in part, on the development of a non-invasive malaria rapid diagnostic test (RDT). The test comprises the detection of female-specific gametocyte proteins in saliva. In one embodiment, the female-specific gametocyte protein biomarkers comprises PF3D7_1218800. This gene was originally referred to as "Plasmodium secreted ookinete protein 17, or PSOP17" and was referred to as such in previous scientific publications. However, given its expression in gametocytes, this annotation was no longer correct, and we refer to the protein herein as PSSP17, Plasmodium sexual stage protein 17. In another embodiment, the protein biomarker comprises PF3D7 0507800. The present invention can also comprise the detection of histidine rich protein 2 (HRP2). In further embodiments, the female-specific gametocyte protein biomarkers include one or more of PF3D7_01 11300 (replication factor c protein, putative), PF3D7_0216700.1 (conserved
Plasmodium protein, unknown function), PF3D7_0310500 (DEAD box helicase, putative), PF3D7_0318200 (DNA-directed RNA polymerase II, putative), PF3D7_0401900 (acyl-CoA synthetase (ACS6)), PF3D7_0419900 (phosphatidylinositol 4-kinase, putative),
PF3D7_0422300 (alpha tubulin 2), PF3D7_0507800 (conserved Plasmodium protein, unknown function), PF3D7 0508100 (SET domain protein, putative (SET9)),
PF3D7_0509400 (RNA polymerase I (RNAPI)), PF3D7_0510100 (conserved Plasmodium protein, unknown function), PF3D7 0511500 (RNA pseudouridylate synthase, putative), PF3D7 0512600 (Rab GTPase lb (Rablb)), PF3D7 0528700 (peptidyl-prolyl cis-trans isomerase (CYP23)), PF3D7_0529800 (conserved Plasmodium protein, unknown function), PF3D7 0610400 (histone H3 (H3)), PF3D7 0632500 (erythrocyte membrane protein 1, PfEMPl (VAR)), PF3D7_0704100 (conserved Plasmodium membrane protein, unknown function), PF3D7_0705500 (inositol-phosphate phosphatase, putative), PF3D7_0717900 (thioredoxin-like protein), PF3D7_0720700 (phosphoinositide-binding protein, putative), PF3D7_0818900 (heat shock protein 70 (HSP70)), PF3D7_0831700 (heat shock protein 70 (HSP70-x)), PF3D7 0903200 (Rab GTPase 7 (Rab7)), PF3D7 0904100 (adapter-related protein, putative), PF3D7_0906100 (developmental protein, putative), PF3D7_0907200 (GTPase activator, putative), PF3D7 0917900 (heat shock protein 70 (HSP70-2)),
PF3D7_0927200 (zinc finger protein, putative), PF3D7_1015900 (enolase (ENO)),
PF3D7_1029000 (conserved Plasmodium protein, unknown function, pseudogene),
PF3D7 1034400 (flavoprotein subunit of succinate dehydrogenase (SDHA)),
PF3D7 1 102400 (flavoprotein, putative), PF3D7 1 105600 (translocon component PTEX88 (PTEX88)), PF3D7 1134700 (DNA-directed RNA polymerase 1, subunit 2, putative), PF3D7_1142100 (conserved Plasmodium protein, unknown function), PF3D7_1200200 (rifin (RIF)), PF3D7_1202300 (dynein heavy chain, putative), PF3D7_1207000 (conserved Plasmodium protein, unknown function), PF3D7_1211800 (polyubiquitin (PfpUB)), PF3D7_1215100 (conserved Plasmodium protein, unknown function), PF3D7_1216000 (serine—tRNA ligase, putative), PF3D7_1216900 (DNA-binding chaperone, putative), PF3D7 1218800 (secreted ookinete protein, putative (PSSP17)), PF3D7 1231 100 (Rab GTPase 2 (RAB2)), PF3D7 1235700 (ATP synthase subunit beta, mitochondrial),
PF3D7 1239900 (vesicle fusion and protein sorting subunit 16, putative (VPS 16)),
PF3D7 1313500 (conserved Plasmodium membrane protein, unknown function),
PF3D7_1318300 (conserved Plasmodium protein, unknown function), PF3D7_1319200 (conserved Plasmodium protein, unknown function), PF3D7_1325900 (conserved
Plasmodium protein, unknown function), PF3D7_1327300 (conserved Plasmodium protein, unknown function), PF3D7 1337200 (1-deoxy-D-xylulose 5-phosphate synthase),
PF3D7_1337500 (conserved Plasmodium protein, unknown function), PF3D7_1342600 (myosin A (MyoA)), PF3D7_1353000 (tryptophan-rich antigen, pseudogene),
PF3D7 141 1400 (plastid replication-repair enzyme (PREX)), PF3D7 1421300 (conserved Plasmodium protein, unknown function), PF3D7_1434200 (calmodulin (CAM)),
PF3D7_1443800 (zinc finger protein, putative), and PF3D7_1452200
(aminomethyltransferase, putative).
The present invention provides antibodies to PSSP17 that can be used in the methods and compositions described herein. In one embodiment, an antibody or fragment thereof specifically binds to the Plasmodium female-specific gametocyte biomarker protein, PSSP17. Plasmodium species include P. falciparum, P. vivax, P. ovale, P. malariae and P. knowlesi. The antibodies can specifically bind to PSSP17 from one or more of P. falciparum, P. vivax, P. ovale, P. malariae and P. knowlesi. In a specific embodiment, the antibodies specifically bind to SEQ ID NO:98 (P. vivax PSSP17). In another embodiment, the antibodies specifically bind to SEQ ID NO:99 (P. falciparum PSSP17).
In certain embodiments, the present invention provides an antibody or fragment thereof that specifically binds SEQ ID NO: 8, which is the synthetic gene sequences that is codon optimized for E. coli expression. This sequence was also used as the antigen for creating the monoclonal antibodies designated as 10E2B7 and 27C9B5. In a specific embodiment, an anti-PSSP17 antibody comprises a variable heavy chain comprising SEQ ID NO:20. In another embodiment, an anti-PSSP17 antibody comprises a variable light chain comprising SEQ ID NO:40. In a further embodiment, an anti-PSSP17 antibody comprises (a) a variable heavy chain comprising SEQ ID NO:20; and (b) a variable light chain comprising SEQ ID NO:40.
In another specific embodiment, an anti-PSSP17 antibody comprises a variable heavy chain comprising SEQ ID NO:60. In another embodiment, an anti-PSSP17 antibody comprises a variable light chain comprising SEQ ID NO: 80. In a further embodiment, an anti-PSSP17 antibody comprises (a) a variable heavy chain comprising SEQ ID NO:60; and (b) a variable light chain comprising SEQ ID NO: 80. The variable heavy and light chains can be combined, e.g., the variable heavy chain from mAb 10E2B7 can be used in combination with the variable light chain from mAb 27C9B5, and vice versa.
A variable heavy chain of an anti-PSSP17 antibody can also comprise the
complementarity determining regions (CDRs) shown in SEQ ID NOS:24, 25, and 27 (mAb 10E2B7) or SEQ ID NOS:63, 65 and 67 (mAb 27C9B5), or combinations of the foregoing. In other embodiments, a variable light chain of an anti-PSSP17 antibody can also comprise the CDRs shown in SEQ ID NOS:43, 45, and 47 (mAb 10E2B7) or SEQ ID NOS:83, 85 and 87 (mAb 27C9B5), or combinations of the foregoing.
Thus, in particular embodiments, an antibody comprises (a) a variable heavy chain comprising the complementarity determining regions (CDRs) shown in SEQ ID NOS:23, 25 and 27; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:43, 45 and 47. In other embodiments, an antibody comprises (a) a variable heavy chain comprising the CDRs shown in SEQ ID NOS:63, 65 and 67; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:83, 85 and 87. The antibodies can further comprise any one or more of the framework regions described herein. It is understood that SEQ ID NOS: 9-88 provided in the sequence listing are embodiments of the present invention and can be used to design an anti-PSSP17 antibody. For recombinant expression of the antibodies, the leader sequences described herein can be utilized. It is also understood that the composition (e.g., kits) and method claims can be utilized and practice with any of the antibody embodiments described herein.
In another aspect, the present invention provides kits. The kits can be used as described herein, specifically, to determine whether a subject has a malaria parasite (e.g., P. falciparum or P. vivax). In one embodiment, a kit comprises an anti-PSSP17 antibody described herein. The antibody can comprise a detectable label or a label is provided in the kit and conjugated to the antibody by the end user. Alternatively, a secondary antibody is provided that comprises a detectable label. In other embodiments, a kit comprises a second anti-PSSP17 antibody that can be labeled (or is pre-labeled) and used as a detection reagent. Thus, in one embodiment, a kit can comprise (a) at least one antibody that specifically binds PSSP17; and (b) a detection reagent for detecting the presence of PSSP17 in a saliva sample obtained from a subject suspected of having a malaria parasite.
In another embodiment, the kit can further comprise an antibody that specifically binds histidine rich protein 2 (HRP2). The antibody can comprise a detectable label or a label is provided in the kit and conjugated to the antibody by the end user. Alternatively, a secondary antibody is provided that comprises a detectable label. In other embodiments, a kit comprises a second anti-HRP2 antibody that can be labeled (or is pre-labeled) and used as a detection reagent. Thus, in another embodiment, a kit can further comprise (c) at least one antibody that specifically binds histidine rich protein 2 (HRP2); and (d) a detection reagent for detecting the presence of HRP2 in a saliva sample obtained from a subject suspected of having a malaria parasite.
In other embodiments, the kits can comprise a positive control for PSSP17, wherein the positive control is the amino acid sequence shown in SEQ ID NO: 8. In specific embodiments, the kits comprising an anti-PSSP17 antibody comprise an antibody that specifically binds SEQ ID NO: 8. In a more specific kit embodiment, the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising SEQ ID NO:20; and (b) a variable light chain comprising SEQ ID NO:40. In another kit embodiment, the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising SEQ ID NO:60; and (b) a variable light chain comprising SEQ ID NO:80. In yet another kit embodiment, the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising the complementarity determining regions (CDRs) shown in SEQ ID NOS:23, 25 and 27; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:43, 45 and 47. In a further kit embodiment, the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising the CDRs shown in SEQ ID NOS:63, 65 and 67; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:83, 85 and 87.
The kits of the present invention can further comprise a lateral flow immunoassay device. In certain embodiments, the kit comprises a lateral flow strip. The lateral flow strip can be used as part of a sandwich ELISA. An antibody that specifically binds PSSP17 can be labeled with biotin and streptavidin can be deposited at the test line of the strip. A second antibody that specifically binds PSSP17 can be used as a detection reagent. It can be pre- deposited on the strip itself or provided in the kit to be incubated with the sample (along with the primary PSSP17 antibody (i.e., capture reagent) prior to loading on to the lateral flow strip. In one embodiment, the antibodies can be labeled (e.g., with biotin for the capture reagent or with a detectable label for the detection reagent) by the user prior to incubation with the sample. Alternatively, the antibodies pre-conjugated and/or pre-labeled. In a further embodiment, IgG can be deposited at the control line of the lateral flow strip. Indeed, the kit can utilize many different forms of lateral flow and such embodiments are described herein and known to those of ordinary skill in the art.
In a specific embodiment, a rapid diagnostic test kit for detection of the malaria parasite Plasmodium comprises (a) a plurality of capture reagents that bind to one or more of the proteins listed in FIG. 11 ; (b) a detection agent for detecting the presence of one or more of the proteins listed in FIG. 11 that bind to the capture reagents; (c) a container for collecting a sample from an individual; and (d) instructions for collecting a sample from the individual, incubating the plurality of capture reagents, detecting the presence of the capture reagents bound to the proteins. In another specific embodiment, the one or more proteins listed in FIG. 11 comprises PF3D7 1218800 (PSSP17). In yet another embodiment, the one or more proteins listed in FIG. 11 further comprises PF3D7 0507800. In other embodiments, the kit further comprises a capture reagent that binds to histidine rich protein 2 (HRP2). In particular embodiments, the capture reagent is an antibody. The kits can further comprise a positive control protein comprising SEQ ID NO: 8.
In another aspect, the present invention provides methods for identifying whether a subject has a malaria parasite. The subject can be asymptomatic or symptomatic for malaria. Such methods rely, in part, on the detection of a female-specific gametocyte protein in a saliva sample obtained from the subject. The method can also comprise detecting HRP2. In one embodiment, a method for identifying the malaria parasite Plasmodium in a human subject comprises the steps of (a) incubating a saliva sample obtained from the subject with an antibody that specifically binds PSSP17, wherein the presence of PSSP17 creates one or more antibody:PSSP17 complexes; (b) applying a detection agent that detects the antibody- PSSP17 complexes; and (c) identifying the subject as having the malaria parasite
Plasmodium where the antibody-PSSP17 complexes are detected. Subject identified as having a malaria parasite (e.g., P. falciparum, P. vivax, or the like) can be treated with anti- malarials. The choice of anti-malarial depends on the malaria control policies of the nation where the subject is located. Such anti -malarials can include, but are not limited to, quinine, chloroquine, amodiaquine, roguanil, chlorproguanil, proguanil, cycloquanil, pyrimethamine, sulfadoxine, pyrimethamine-sulfadoxine, pyrimethamine-dapsone, primaquine,
amopyroquine, chlorproquanil, quinidine, tetracycline, dapsone, doxycycline, clindamycin, sulphonamides, arteflene, mefloquine, halofantrine, bulaquine, artemisinin, artemether, arteether, atovaquone, lumefantrine, dihydroartemisinin, piperaquine, artesunate, pyronaridine, azithromycin, tafenoquine, trimethoprim, sulfamethoxazole, artemisone, ferroquine, fosmidomycin, tinidazole, naphthoquine, methylene blue, (+)-erythromefioquine, tert-butyl isoquine, trioxaquine, an endoperoxide, a dihydrofolate reductase inhibitor, or a dihydroorotate dehydrogenase inhibitorA
Thus, in other embodiments, a method for treating a human subject identified as having the malaria parasite Plasmodium comprises the steps of (a) incubating a saliva sample obtained from the subject with an antibody that specifically binds PSSP17, wherein the presence of PSSP17 creates one or more antibody:PSSP17 complexes; (b) applying a detection agent that detects the antibody-PSSP17 complexes; and (c) administering a malaria treatment to the subject where the antibody-PSSP17 complexes are detected. In particular embodiments, the present invention can be used to determine parasite clearance after drug treatment, specifically for stages that are responsible for transmission to mosquitoes.
Furthermore, the compositions and methods of the present invention can be used across the globe for weekly screening in schools in malaria endemic countries:
Teachers/administrators can conduct weekly screening of all children across the high-risk age groups for malaria (typically ages 5-16 years across much of Sub-Saharan Africa, though the targeted population can change according to local malaria transmission. Children who are determined to be positive, yet asymptomatic, can be provided anti-malarials to clear the parasite reservoir. The choice of antimalarial used is dependent on national malaria control policies.
The present invention can also be used in routine screening in oil, logging, and plantation establishments in malaria endemic countries. Clinical/human resources staff can collect samples from workers to prevent malaria incidence. This screening method can be extended to workers' families and surrounding villages. Individuals found to be harboring parasites can be provided anti-malarials.
The compositions and methods of the present invention can further be used as a rapid test for epidemiological surveys/studies in developing countries by research groups
(government/academic) to estimate subclinical carriage prevalence. Furthermore, clinicians can use the rapid test in private practice in developing and developed countries for patients.
The present invention can also be used a rapid test for screening travelers entering into a country at known ports of entry (air, land, sea). This is especially important for countries that have reached the malaria elimination phase or have been verified to be "malaria-free" to prevent reintroduction. Screening can also be conducted in developed countries to screen carrier entry following holiday/work travel to malaria endemic countries.
The present invention can further be included as a component of a work travel kit for high-level members of multinational companies who are assigned to oversee operations in malaria endemic countries. In addition, the present invention can be included as a component of a holiday travel kit for all members of society. The kit allows for easy, unambiguous self- diagnosis/screening. The individual can either take anti-malarials included in the travel kit or obtained from a local dispensary.
BRIEF DESCRIPTION OF THE FIGURES FIG. 1A-1C. Workflow for Plasmodium falciparum male and female protein partition analysis using proteomics and bioinformatics analysis. (A) Gametocyte sex ratios were determined using differential staining and microscopy. Improved R66 Giemsa is diluted 1 :40 in Sorensen buffer (pH 7.2) and used to stain a methanol-fixed, thin smear of stage V
(mature) gametocytes from a gametocyte culture. Gametocytes can be differentiated according to five classical parameters (Carter & Graves, 1988) as well as by differential Giemsa staining patterns. Males (M) appear pink with no distinct nucleus and females (F) appear blue with a distinct nucleus. (B) Proteomics workflow. Soluble and membrane proteins were extracted for Multi-Lane Combined In-gel Digestion (MLCID, see methods) prior to Chip-based nano-HPLC MS/MS analysis. (C) Bioinformatics workflow. LC MS/MS data from NF54 and Dd2 is searched on PepArML meta search engine with 6 search engines. P. berghei MS/MS male proteome and MS/MS female proteome is also uploaded to
PepArML and Maspectras2. The result is combined in PepArML by unsupervised machine learning and stored in Maspectras2 and queried for analysis. Proteome results are then compared to the P. berghei MS/MS male proteome and MS/MS female proteome as shown. This comparison is done by orthologous protein matches and a subtractive bioinformatics approach, producing partitioned proteomes for male and female gametocytes.
FIG. 2A-2H. Summary of protein identifications from the reanalysis of Plasmodium berghei ANKA 2.34 Male and Female Gametocyte Proteomes and the current Stage V Plasmodium falciparum gametocyte proteomes for the NF54 isolate and Dd2 strain.
Reproducibility of the analyses of the P. falciparum NF54 samples is shown. Three biological replicates for P. falciparum NF54 preparations were analyzed by MS. The 1090 proteins identified from analysis of all replicates were considered for statistical analysis. (A) Peptides per identified protein for each biological replicate (B) and spectra per identified protein for each biological replicate. Normalized peptide count and spectral count were analyzed by one-way ANOVA with Geisser-Greenhouse correction method. Average values are plotted with error bars of 95% CI. (C). Male and Female P. berghei protein identification following the re-analysis of the published dataset. Out of 1546 total unique protein identification 762 proteins were in common between P. berghei male and P. berghei female at 1% spectra FDR (minimum one unique peptide for a protein, see methods for single peptide validation details) and 5% peptide FDR for a protein. We found that 366 proteins were specific for male P. berghei and 418 proteins were P. berghei female specific. (D). P.
falciparum NF54 and Dd2 protein identification. There were 1105 proteins in common between 1703 Pf NF54 and 1337 Pf Dd2 total protein identification at 1% spectra FDR (minimum one unique peptide for a protein, see methods for single peptide validation details) and 5% peptide FDR for a protein. We observed that 598 proteins were NF54-specific and 232 proteins were Dd2-specific. (E)-(F). Proteins in common between NF54, Dd2 and FSgv data. 74% Pf. NF54 proteins were present in the Silvestrini gametocyte stage V and 82% of the Pf. Dd2 proteins were stage V proteins in accordance with the Silvestrini stage V data.
FIG. 3A-3H. Results from the Systematic Subtractive Protein Bioinformatic
Approach (SSB). (A) Male and Female P. berghei protein identification following the re- analysis of the published dataset. (Refer to FIG. 2) (B-G) Detail overlap results from FIG. 8. (H) Partitioned P. falciparum male (174) and female (258) specific proteins.
FIG. 4A-4B. Analyses of GO molecular function and signatures of selection in male and female P. falciparum proteins. (A) Enrichment analysis of GO molecular function terms in Plasmodium berghei and Plasmodium falciparum. Z-scores are shown as representation of enrichment, color coded as the key in top left comer. Histogram shows general distribution of enrichments across all samples. Histograms along columns show exact enrichment amounts. Column normalization for total proteins detected was performed by calculating total number of GO terms divided by total proteins detected. For simplicity, GO terms were reduced to 22 categories and enrichment calculated over these. (B) Genetic diversity within a parasite population is represented by PiN across 25 parasite isolates from Senegal and divergence between parasite populations is represented by Fst when comparing the
Senegalese isolates with a set of parasite strains from Papua New Guinea (PNG). Several as yet uncharacterized sex-specific genes (i.e., PF3D7 1430800 and PF3D7 013160O) show high levels of divergence suggesting that they are under strong diversifying selection.
FIG. 5A-5I. Principal components analysis (PCA) and SSB analyses for the identification of P. falciparum male-specific proteins that are lost as a result of the Dd2 male development defect. (A) PCA was performed on Male and Female Specific P. falciparum stage V proteomes (Pf-M and Pf-F, respectively), two biological replicates (BR1 and BR2) from Dd2, three biological replicates (BR1 -3) from NF54, FSgv (3D7/NF54 stage V) and FSg 1-11 (3D7/NF54 stage I-II). Proteins with at least 10 spectral counts averaged across all proteomes were used for qualitative protein analysis. (B/C) Stage-specific analyses identifies 354 putative P. falciparum-specific male (B) and 177 female (C) gametocyte proteins. (D-G) Stage-specific analysis identifies 843 gametocyte-specific proteins in the NF54 proteome (D), of which 216 are also present in Stage I/II and 627 are only expressed in more mature gametocyte stages (E). The same analysis identifies in Dd2 533 gametocyte-specific proteins
(F) of which 189 are present in Stage I/II while 344 are only expressed in Stage III and later
(G) . (H/I) Stage-specificity of male and female Dd2 proteins reveals limited overlap between Stage I/II and conserved male P. falciparum proteins (H), but significant overlap and between
Dd2 Stage III-V and P. falciparum-specific female proteins (I).
FIG. 6. Immunofluorescence analysis and validation of antibodies elicited against putative male- and female-specific gametocyte stage V proteins. Antibodies were raised in mouse against PF3D7_1218800, PF3D7_0390100 and PF3D7_0906100. Lower panel, cartoon depicting the various stages of NF54 gametocyte development, especially stages IV and V, which we predict would be the primary stage present in a day 18 gametocyte culture. Gametocytes that are labeled V are considered mature stage V parasites, and those labeled V, are considered complete "falciform" (crescent) shaped stage V gametocytes. EB, Evans blue counter stain for protein, and appear red. GV (gametocyte stage V marker antibodies) are detected with Alexa488-conjugated secondary antibodies and appear green. DAPI stains nuclear DNA and appears blue. Scale bar=10 μηι.
FIG. 7A-7C. Western blots and immunohistochemistry using NF54 and Dd2 strains validate female stage V gametocyte specificity for two of three candidate protein markers. (A) Western blots of total day 18 stage V gametocyte and synchronized trophozoite protein lysates using the respective antibodies along with anti-P. falciparum aldolase antibodies used as a loading control. Western blots showed that PF3D7_1218800 and PF3D7_0309100 were present in female gametocytes (Dd2 is defective in mature male gametocyte development), yielding bands in gametocyte but not trophozoite samples for both NF54 and Dd2.
Antibodies to PF3D7_0906100 stain gametocytes and trophozoites from NF54 but primarily stains Dd2 gametocytes. (B) Representative results for fluorescence immunohistochemistry of strain NF54 along with an isotype control. PF3D7_1218800 and PF3D7_0906100 were found to be female specific (green). PF3D7_0309100, which is an ortholog of a putative female specific protein in P. berghei is not sex-specific in P. falciparum. (C) Representative results for fluorescence immunohistochemistry of strain Dd2 along with an isotype control. PF3D7_1218800, PF3D7_0906100, and PF3D7_0309100 were all found to stain female parasites (green), as Dd2 fail to produce mature stage V male gametocytes. Parasite sex was microscopically determined using published morphological characteristics of male and female gametocytes along with spatially distinct DAPI staining (blue) of DNA. Female gametocytes have condensed DAPI staining whereas male gametocytes have diffused DAPI staining.
FIG. 8A-B. To define the male and female proteomes of P. falciparum stage V gametocytes we employed a SSB work-flow using the re-analyzed P. berghei mature gametocyte proteome data as a reference. See FIG. 1C and FIGS. 3B-G.
FIG. 9A. Expanding the Pf-Female protein list to include those that are not
2 stage V-specific (to capture putative stage III-IV proteins) does not result in additional 'female hits' in the Dd2gIII-V 523 list.
FIG. 9B. A comparison A comparison of the Dd2gV 528 stage-V specific protein list with the Pf-M (P. falciparum 529 male-specific) protein list identified 40 conserved proteins, which may include stage III male candidate markers.
FIG. 10. A PSMA reanalysis of the existing Plasmodium berghei male and female gametocyte proteome using the current iteration of the genome revealed that many sex- specific proteins were shared between males and females. The relative enrichment of unique peptides was examined in the respective male and female batches from the original study to determine the degree of expression of these shared proteins.
FIG. 11. Plasmodium falciparum proteins that were identified in pooled saliva from asymptomatic children 5-15 yrs of age from Yaounde, Cameroon (61 proteins).
FIG. 12A-12E. Assay development for the analysis of saliva samples from
asymptomatic children from Cameroon and Zambia. (A) Immunofluorescence assays of Plasmodium falciparum stage V gametocytes (GcV) stained by mouse antibodies(green) raised against the respective proteins, which were previously determined to be female- specific gametocyte proteins since these are orthologs of P. berghei female gametocyte proteins. DAPI stains nuclear DNA and appears blue. (B) Saliva collection (2 mL total volume/individual) using the saliva collection device developed by DNA genotek was conducted in schools among asymptomatic children 5-15 years old (pictured) or at homes in Zambia (not shown). The lower image shows the rapid diagnostic test (RDT) made by Alere, i.e., the SD Bioline Malaria Ag Pf/Pan test used in Zambia. (C) We moved ahead with PF3D7_1218800 as a target biomarker for female gametocytes and a novel asexual protein, PF3D7 0507800, as potentially new biomarker for asymptomatic asexual carriage that we had originally confirmed to be present in the saliva of asymptomatic children from Cameroon (Tao, et al, unpublished) and designed a Multiple Reaction Monitoring MS assay. We found that of the 392 blinded samples total (350 from Cameroon/42 from Zambia), 392 had a strong signal for the internal standard peptide. We were then able to calculate the proportion of positive saliva samples. PAR is the peak area ratio of the target analyte's integrated peak area over internal standard's integrated peak area [2 pmol of internal standard in 10 μΐ were injected per sample]. (D) The antibodies to PF3D7 1218800 recognize the target in saliva suggesting that a RDT is indeed possible for human saliva detection of gametocytes (12 μΐ of 0.22 micron filtered saliva/well). Sample from C166 is from an 11 year old child with 6 gametocytes^L. Monoclonal antibody against PfHRP2 recognizes its target in the filtered but unconcentrated saliva. Paired blood smears were analyzed for gametocytes (sexual) and asexual parasite stages from each individual providing the saliva sample.C020 sample is concentrated following buffer exchange from 1 mL of saliva but only 12 μΐ of material was loaded. All other samples are filtered saliva only. Samples (red font): From an initial collection in Cameroon (unblinded samples). B345 had <100 asexual parasites/ul of blood (below detection sensitivity of RDTs). Expected Mr for gametocyte protein: 39.6 kDa / Expected Mr for HRP2: 32.4 kDa. (E) Anti-PfHRP2 mAb recognizes HRP2 in filtered, concentrated saliva sample 15 μg loaded/well. Note that HRP2 does not ionize and cannot be detected by MS/MS, as evident in the lack of mass spectrometry evidence for this protein in PlasmoDB. Each sample from Zambia (case numbers 21XXX) were analyzed by RDT at time of collection or by PCR for the Plasmodium cytochrome B gene from blood spots. All saliva samples were concentrated following buffer exchange. Expected Mr for HRP2: 32.4 kDa, Apparent Mr: 30-33 kDa. HRP2 RDT positivity (Alere SD Bioline Malaria Ag Pf/Pan) or PCR positive/negative. B364, C020, CI 64 and CI 66 were analyzed by microscopy and are expected to be HRP2 positive. Blue (+) indicate positive for both gametocytes and asexuals by microscopy. The western blot suggests that antibody-mediated detection of HRP2 or PF3D7 1218800 (gametocyte protein) approaches the sensitivity of PCR and better than the gold standard microscopic identification.
FIG. 13. Comparative analysis of detection approaches used to identify asymptomatic carriers. We compared the ability of anti-PSSP17 antibodies to detect antigen in 12 μΐ of filtered but unconcentrated saliva proteins (12 μg/well) with MRM-based mass spectrometry, RDT, RTPCR, PCR and microscopy. For MRM analyses of saliva, we calculated the Peak Area Ratio, which is the ratio of the target analyte's integrated peak area over internal standard's integrated peak area. From blood samples, we used the SD Bioline RDT, RTPCR amplification of the Pfs25 gametocyte transcript, PCR amplification of parasite cytochrome B (CytB) gene and microscopy.
FIG. 14A-14B. Lateral Flow Immunoassay (LFIA) detection of the gametocyte specific proteins, PSSP17. (A) Schematic for the gRAD LFIA (BioPorto, Denmark). The readout in panel (B) is an image acquired by a camera phone.
FIG. 15A-15B. Capture of PSSP17 in "spiked-in" samples of recombinant PSSP17 in malaria naive human saliva. Determine LOD using spiked-in samples. (A) Recombinant PfHRP2 was spiked-in to naive human saliva and tested by the SMAART-HRP2 Lateral Flow Immunoassay (LFIA). (B) Recombinant PSSP17 was spiked-in to 20 naive human saliva and tested by the SMAART-PSSP17 LFIA. C, control line. T, test line.
FIG. 16A-16B. Capture of native PSSP17 from saliva samples collected from asymptomatic and symptomatic children in Cameroon. Determined LOD using field samples. (A) PSSP17 was effectively captured from preserved, frozen saliva from three saliva samples from symptomatic children/young adults (5-19 years old) presenting at a clinic in Yaounde, Cameroon. (B) PSSP17 was effectively captured from three preserved, frozen saliva samples from asymptomatic children from a primary school in Mfou, Cameroon. These tests used blinded samples. Control naive human saliva (+ HRP2) samples were analyzed in parallel. FIG. 17A-17F. Kit components.
FIG. 18. Cardbox kit schematic showing the cardboard strip holder insert for imaging strips.
FIGS. 19-21. Cardboard kit schematic for viewing strips.
FIG. 22. Recombinant PSSP17 in known concentrations for generating standard curve.
FIG. 23. Alignment of P. falciparum PSSP17 and its ortholog in P. vivax. Signal peptide shown as an arrow and the region used to raise monoclonal antibodies is shown as a bar.
FIG. 24. SMAART lateral flow immunoassay used to detect the presence of the P. vivax gametocyte PSSP17 in 10 μΐ of unprocessed, blinded saliva from adults presenting at a clinic in Manaus, Brazil. Image was captured by camera phone and inverted. C, control line. T, test line.
DETAILED DESCRIPTION OF THE INVENTION
It is understood that the present invention is not limited to the particular methods and components, etc., described herein, as these may vary. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a "protein" is a reference to one or more proteins, and includes equivalents thereof known to those skilled in the art and so forth.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Specific methods, devices, and materials are described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
All publications cited herein are hereby incorporated by reference including all journal articles, books, manuals, published patent applications, and issued patents. In addition, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided. The definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention. I. Definitions
As used herein, the term "antigen" is generally used in reference to any substance that is capable of reacting with an antibody. More specifically, as used herein, the term "antigen" refers to a synthetic peptide, polypeptide, protein or fragment of a polypeptide or protein, or other molecule which elicits an antibody response in a subject, or is recognized and bound by an antibody.
As used herein, the term "biomarker" refers to a molecule that is associated either quantitatively or qualitatively with a biological change. Examples of biomarkers include polypeptides, proteins or fragments of a polypeptide or protein; and polynucleotides, such as a gene product, RNA or RNA fragment; and other body metabolites. In certain
embodiments, a "biomarker" means a compound that is differentially present in a biological sample from a subj ect or a group of subjects having a first phenotype (e.g., a subject having the malaria parasite Plasmodium) as compared to a biological sample from a subject or group of subjects having a second phenotype (e.g., a subj ect having the malaria parasite
Plasmodium). A biomarker may be differentially present at any level, but is generally present at a level that is increased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 100%, by at least 110%, by at least 120%, by at least 130%, by at least 140%, by at least 150%, or more; or that is decreased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, or by 100% (i.e., absent). Alternatively, the differential presence of a biomarker can be characterized by a -fold change in level including, for example, a level that is increased by 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 2.0-fold, at least 2.5-fold, at least 3.0-fold, at least 3.5-fold, at least 4.0-fold, at least 5-fold, at least 5.5-fold, at least 6-fold, at least 6.5-fold, at least 7.0- fold, at least 7.5-fold, at least 8.0-fold, at least 9-fold, at least 10-fold, at least 1 1-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40- fold, or at least 50-fold; or that is decreased by 1.1 -fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 2.0-fold, at least 2.5-fold, at least 3.0-fold, at least 3.5- fold, at least 4.0-fold, at least 5-fold, at least 5.5-fold, at least 6-fold, at least 6.5-fold, at least 7.0-fold, at least 7.5-fold, at least 8.0-fold, at least 9-fold, at least 10-fold, at least 1 1-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17- fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, or at least 50-fold. A biomarker is preferably differentially present at a level that is statistically significant (e.g., a p-value less than 0.05 and/or a q-value of less than 0.10 as determined using, for example, either Welch's T-test or Wilcoxon's rank-sum Test).
The term "one or more of refers to combinations of various biomarker proteins. The term encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 15 , 16 , 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40 . . . N, where "N" is the total number of biomarker proteins in the particular embodiment. The term also encompasses at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 15 , 16 , 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40 . . . N. It is understood that the recitation of biomarkers herein includes the phrase "one or more of the biomarkers and, in particular, includes the "at least 1, at least 2, at least 3" and so forth language in each recited embodiment of a biomarker panel.
The terms "specifically binds to," "specific for," and related grammatical variants refer to that binding which occurs between such paired species as enzyme/substrate, receptor/agonist, antibody/antigen, and lectin/carbohydrate which may be mediated by covalent or non-covalent interactions or a combination of covalent and non-covalent interactions. When the interaction of the two species produces a non-covalently bound complex, the binding which occurs is typically electrostatic, hydrogen-bonding, or the result of lipophilic interactions. Accordingly, "specific binding" occurs between a paired species where there is interaction between the two which produces a bound complex having the characteristics of an antibody/antigen or enzyme/substrate interaction. In particular, the specific binding is characterized by the binding of one member of a pair to a particular species and to no other species within the family of compounds to which the corresponding member of the binding member belongs. Thus, for example, an antibody typically binds to a single epitope and to no other epitope within the family of proteins. In some embodiments, specific binding between an antigen and an antibody will have a binding affinity of at least 10"6 M. In other embodiments, the antigen and antibody will bind with affinities of at least 10"7 M, 10"8 M to 10"9 M, 10"10 M, 10"11 M, or 10"12 M. As used herein, the terms "specific binding" or "specifically binding" when used in reference to the interaction of an antibody and a protein or peptide means that the interaction is dependent upon the presence of a particular structure (i.e., the epitope) on the protein.
As used herein, the terms "binding agent specific for" or "binding agent that specifically binds" refers to an agent that binds to a biomarker and does not significantly bind to unrelated compounds. Examples of binding agents that can be effectively employed in the disclosed methods include, but are not limited to, proteins and antibodies, such as monoclonal or polyclonal antibodies, or antigen-binding fragments thereof. In certain embodiments, a binding agent binds a biomarker (e.g., a polypeptide biomarker) with an affinity constant of, for example, greater than or equal to about lxl 0"6 M.
By "antibody" is meant any immunoglobulin polypeptide, or fragment thereof, having immunogen binding ability. As used herein, the terms "antibody fragments", "fragment", or "fragment thereof refer to a portion of an intact antibody. Examples of antibody fragments include, but are not limited to, linear antibodies; single-chain antibody molecules; Fc or Fc' peptides, Fab and Fab fragments, and multi-specific antibodies formed from antibody fragments. In most embodiments, the terms also refer to fragments that bind an antigen of a target molecule (e.g., a biomarker protein described herein) and can be referred to as
"antigen-binding fragments." As used herein, the term "antibody" is used in reference to any immunoglobulin molecule that reacts with a specific antigen. It is intended that the term encompass any immunoglobulin (e.g., IgG, IgM, IgA, IgE, IgD, etc.) obtained from any source (e.g., humans, rodents, non-human primates, caprines, bovines, equines, ovines, etc.). Specific types/examples of antibodies include polyclonal, monoclonal, humanized, chimeric, human, or otherwise-human-suitable antibodies. "Antibodies" also includes any fragment or derivative of any of the herein described antibodies that specifically binds the target antigen.
The term "epitope" or "antigenic determinant" are used interchangeably herein and refer to that portion of an antigen capable of being recognized and specifically bound by a particular antibody. When the antigen is a polypeptide, epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation. An antigenic determinant can compete with the intact antigen (i.e., the "immunogen" used to elicit the immune response) for binding to an antibody. By "substantially identical" is meant a protein or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and most preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;
aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e"3 and e"100 indicating a closely related sequence.
By "an effective amount" is meant the amount of a required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for therapeutic treatment of malaria varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.
The term "malaria" includes the art recognized condition known as "malaria" e.g., disorders which are caused by a protozoan of the genus Plasmodium. Malaria is generally characterized by symptoms such as headache, malaise, anemia, splenomegaly, and paroxyms with cold, hot, and wet stages and is transmitted by mosquitoes. In a further embodiment, the protozoan is selected from the group consisting of: P. falciparum, P. vivax, P. ovale, P.
malariae, and P. knowlesi.
Examples of malaria treatment or anti-malarials include, but are not limited to, quinine, chloroquine, amodiaquine, roguanil, chlorproguanil, proguanil, cycloquanil, pyrimethamine, sulfadoxine, pyrimethamine-sulfadoxine, pyrimethamine-dapsone, primaquine, amopyroquine, chlorproquanil, quinidine, tetracycline, dapsone, doxycycline, clindamycin, sulphonamides, arteflene, mefloquine, halofantrine, bulaquine, artemisinin, artemether, arteether, atovaquone, lumefantrine, dihydroartemisinin, piperaquine, artesunate, pyronaridine, azithromycin, tafenoquine, trimethoprim, sulfamethoxazole, artemisone, ferroquine, fosmidomycin, tinidazole, naphthoquine, methylene blue, (+)-erythromefioquine, tert-butyl isoquine, trioxaquine, an endoperoxide, a dihydrofolate reductase inhibitor, or a dihydroorotate dehydrogenase inhibitor. In particular embodiments, the present invention can be used to determine parasite clearance after drug treatment, specifically for stages that are responsible for transmission to mosquitoes. Other uses of the present invention in conjunction with treatment are described herein.
The term "solid support", as used herein, refers to any composition and/or material that is capable of immobilizing a compound including, but not limited to, immobilizing an antibody (i.e., for example, an antibody that binds to an HRP2) or an antigen (i.e., for example, an HRP2 protein). A solid support may include, but is not limited to, a membrane (e.g. a charged membrane), plastic, beads, strips, microtiter wells, microchannels, etc.
II. Detection of Malaria Parasite Biomarkers
A. Detection by Immunoassay
In specific embodiments, the malaria parasite biomarkers of the present invention can be detected and/or measured by immunoassay. Immunoassay requires biospecific capture reagents/binding agent, such as antibodies, to capture the biomarkers. Many antibodies are available commercially. Antibodies also can be produced by methods well known in the art, e.g., by immunizing animals with the biomarkers. Biomarkers can be isolated from samples based on their binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to generate antibodies by methods well-known in the art.
The present invention contemplates traditional immunoassays including, for example, sandwich immunoassays including ELISA or fluorescence-based immunoassays, immunoblots, Western Blots (WB), as well as other enzyme immunoassays. Nephelometry is an assay performed in liquid phase, in which antibodies are in solution. Binding of the antigen to the antibody results in changes in absorbance, which is measured. In a SELDI- based immunoassay, a biospecific capture reagent for the biomarker is attached to the surface of an MS probe, such as a pre-activated protein chip array. The biomarker is then specifically captured on the biochip through this reagent, and the captured biomarker is detected by mass spectrometry.
In certain embodiments, the expression levels of the biomarkers employed herein are quantified by immunoassay, such as enzyme-linked immunoassay (ELISA) technology. In specific embodiments, the levels of expression of the biomarkers are determined by contacting the biological sample with antibodies, or antigen binding fragments thereof, that selectively bind to the biomarker; and detecting binding of the antibodies, or antigen binding fragments thereof, to the biomarkers. In certain embodiments, the binding agents employed in the disclosed methods and compositions are labeled with a detectable moiety. In other embodiments, a binding agent and a detection agent are used, in which the detection agent is labeled with a detectable moiety.
For example, the level of a biomarker in a sample can be assayed by contacting the biological sample with an antibody, or antigen binding fragment thereof, that selectively binds to the target biomarker (referred to as a capture molecule or antibody or a binding agent), and detecting the binding of the antibody, or antigen-binding fragment thereof, to the biomarker. The detection can be performed using a second antibody to bind to the capture antibody complexed with its target biomarker. A target biomarker can be an entire protein, or a variant or modified form thereof. Kits for the detection of biomarkers as described herein can include pre-coated strip/plates, biotinylated secondary antibody, standards, controls, buffers, streptavidin-horse radish peroxidise (HRP), tetramethyl benzidine (TMB), stop reagents, and detailed instructions for carrying out the tests including performing standards.
The present disclosure also provides methods for detecting the malaria parasite Plasmodium in a subject, wherein the levels of expression of the malaria parasite biomarkers in a biological sample are determined simultaneously. For example, in one embodiment, methods are provided that comprise: (a) contacting a biological sample obtained from the subject with a plurality of binding agents that selectively bind to a plurality of biomarkers disclosed herein for a period of time sufficient to form binding agent-biomarker complexes; and (b) detecting binding of the binding agents to the plurality of biomarkers. The detection of the biomarkers indicates the presence of the malaria parasite in the subject. In further embodiments, detection thereby determines the levels of expression of the biomarkers in the biological sample; and the method can further comprise (c) comparing the levels of expression of the plurality of biomarkers in the biological sample with predetermined threshold values, wherein levels of expression of at least one of the plurality of polypeptide biomarkers above or below the predetermined threshold values indicates, for example, the presence of the malaria parasite in the subject. Examples of binding agents that can be effectively employed in such methods include, but are not limited to, antibodies or antigen- binding fragments thereof, aptamers, lectins and the like. In a further aspect, the present disclosure provides compositions that can be employed in the disclosed methods. As further described herein, in particular embodiments, the present invention comprises a lateral flow assay. In certain embodiments, a lateral flow device (e.g., a strip) is provided that comprises a binding agent deposited on the device. For example, a strip can be constructed to contain a binding agent (e.g., a biotinylated mAb against PSSP17). The strip can further be designed to contain streptavidin at the test line. The control line of the strip can comprise IgG. In alternative embodiments, the lateral flow device does not comprise a detection agent; the detection agent (and binding agent) can be added to the sample in a tube prior to being deposited on the lateral flow strip (or prior to placing the lateral flow strip into the sample tube).
In certain embodiments, such compositions comprise a solid substrate and a plurality of binding agents immobilized on the substrate, wherein each of the binding agents is immobilized at a different, indexable, location on the substrate and the binding agents selectively bind to a plurality of biomarkers disclosed herein. In a specific embodiment, the locations are pre-determined. In one embodiment, the binding agents selectively bind to a plurality of biomarkers described herein. Binding agents that can be employed in such compositions include, but are not limited to, antibodies, or antigen-binding fragments thereof, aptamers, lectins and the like.
In a related aspect, methods for assessing malaria in a subject are provided, such methods comprising: (a) contacting a biological sample obtained from the subject with a composition disclosed herein for a period of time sufficient to form binding agent- polypeptide biomarker complexes; and (b) detecting binding of the plurality of binding agents to the plurality of polypeptide biomarkers. In further embodiments, detection thereby determines the levels of expression of the biomarkers in the biological sample; and the method can further comprise (c) comparing the levels of expression of the plurality of polypeptide biomarkers in the biological sample with predetermined threshold values, wherein levels of expression of at least one of the plurality of polypeptide biomarkers above or below the predetermined threshold values indicates malaria status in the subject.
Although antibodies are useful because of their extensive characterization, any other suitable agent (e.g., a peptide, an aptamer, or a small organic molecule) that specifically binds a biomarker of the present invention is optionally used in place of the antibody in the above described immunoassays. For example, an aptamer that specifically binds a biomarker and/or one or more of its breakdown products might be used. Aptamers are nucleic acid-based molecules that bind specific ligands. Methods for making aptamers with a particular binding specificity are known as detailed in U. S. Patents No. 5,475,096; No. 5,670,637; No.
5,696,249; No. 5,270, 163; No. 5,707,796; No. 5,595,877; No. 5,660,985; No. 5,567,588; No. 5,683,867; No. 5,637,459; and No. 6,011 ,020.
In specific embodiments, the assay performed on the biological sample can comprise contacting the biological sample with one or more capture agents (e.g., antibodies, peptides, aptamer, etc., combinations thereof) to form a biomarker: capture agent complex. The complexes can then be detected and/or quantified. A subject can then be identified as having the malaria parasite based on a comparison of the detected/quantified/measured levels of biomarkers to one or more reference controls as described herein.
In one method, a first, or capture, binding agent, such as an antibody that specifically binds the biomarker of interest, is immobilized on a suitable solid phase substrate or carrier. The test biological sample is then contacted with the capture antibody and incubated for a desired period of time. After washing to remove unbound material, a second, detection, antibody that binds to a different, non-overlapping, epitope on the biomarker (or to the bound capture antibody) is then used to detect binding of the polypeptide biomarker to the capture antibody. The detection antibody is preferably conjugated, either directly or indirectly, to a detectable moiety. Examples of detectable moieties that can be employed in such methods include, but are not limited to, cheminescent and luminescent agents; fluorophores such as fluorescein, rhodamine and eosin; radioisotopes; colorimetric agents; and enzyme-substrate labels, such as biotin.
In another embodiment, the assay is a competitive binding assay, wherein labeled biomarker is used in place of the labeled detection antibody, and the labeled biomarker and any unlabeled biomarker present in the test sample compete for binding to the capture antibody. The amount of biomarker bound to the capture antibody can be determined based on the proportion of labeled biomarker detected.
Solid phase substrates, or carriers, that can be effectively employed in such assays are well known to those of skill in the art and include, for example, 96 well microtiter plates, glass, paper, and microporous membranes constructed, for example, of nitrocellulose, nylon, polyvinylidene difluoride, polyester, cellulose acetate, mixed cellulose esters and
polycarbonate. Suitable microporous membranes include, for example, those described in US Patent Application Publication no. US 2010/0093557 Al . Methods for the automation of immunoassays are well known in the art and include, for example, those described in U. S. Patent Nos. 5,885,530, 4,981,785, 6, 159,750 and 5,358,691. The presence of several different polypeptide biomarkers in a test sample can be detected simultaneously using a multiplex assay, such as a multiplex ELISA. Multiplex assays offer the advantages of high throughput, a small volume of sample being required, and the ability to detect different proteins across a board dynamic range of concentrations. For example, a kit can
In certain embodiments, such methods employ an array, wherein multiple binding agents (for example capture antibodies) specific for multiple biomarkers are immobilized on a substrate, such as a membrane, with each capture agent being positioned at a specific, predetermined, location on the substrate. Methods for performing assays employing such arrays include those described, for example, in US Patent Application Publication nos.
US2010/0093557A1 and US2010/0190656A1, the disclosures of which are hereby specifically incorporated by reference.
Multiplex arrays in several different formats based on the utilization of, for example, flow cytometry, chemiluminescence or electron-chemiluminesence technology, can be used. Flow cytometric multiplex arrays, also known as bead-based multiplex arrays, include the Cytometric Bead Array (CBA) system from BD Biosciences (Bedford, Mass.) and multi- analyte profiling (xMAP®) technology from Luminex Corp. (Austin, Tex.), both of which employ bead sets which are distinguishable by flow cytometry. Each bead set is coated with a specific capture antibody. Fluorescence or streptavidin-labeled detection antibodies bind to specific capture antibody-biomarker complexes formed on the bead set. Multiple biomarkers can be recognized and measured by differences in the bead sets, with chromogenic or fluorogenic emissions being detected using flow cytometric analysis.
In an alternative format, a multiplex ELISA from Quansys Biosciences (Logan, Utah) coats multiple specific capture antibodies at multiple spots (one antibody at one spot) in the same well on a 96-well microtiter plate. Chemiluminescence technology is then used to detect multiple biomarkers at the corresponding spots on the plate.
B. Detection by Electrochemicaluminescent Assay
In several embodiments, the biomarker biomarkers of the present invention may be detected by means of an electrochemicaluminescent assay developed by Meso Scale Discovery (Gaithersrburg, MD). Electrochemiluminescence detection uses labels that emit light when electrochemically stimulated. Background signals are minimal because the stimulation mechanism (electricity) is decoupled from the signal (light). Labels are stable, non-radioactive and offer a choice of convenient coupling chemistries. They emit light at -620 nm, eliminating problems with color quenching. See U.S. Patents No. 7,497,997; No. 7,491,540; No. 7,288,410; No. 7,036,946; No. 7,052,861; No. 6,977,722; No. 6,919,173; No. 6,673,533; No. 6,413,783; No. 6,362,011 ; No. 6,319,670; No. 6,207,369; No. 6,140,045; No. 6,090,545; and No. 5,866,434. See also U.S. Patent Applications Publication No.
2009/0170121; No. 2009/006339; No. 2009/0065357; No. 2006/0172340; No.
2006/0019319; No. 2005/0142033; No. 2005/0052646; No. 2004/0022677; No.
2003/0124572; No. 2003/0113713; No. 2003/0003460; No. 2002/0137234; No.
2002/0086335; and No. 2001/0021534.
C. Other Methods for Detecting Biomarkers
The biomarkers of the present invention can be detected by other suitable methods. Detection paradigms that can be employed to this end include optical methods,
electrochemical methods (voltametry and amperometry techniques), atomic force microscopy, and radio frequency methods, e.g., multipolar resonance spectroscopy.
Illustrative of optical methods, in addition to microscopy, both confocal and non-confocal, are detection of fluorescence, luminescence, chemiluminescence, absorbance, reflectance, transmittance, and birefringence or refractive index (e.g., surface plasmon resonance, ellipsometry, a resonant mirror method, a grating coupler waveguide method or
interferometry).
Furthermore, a sample may also be analyzed by means of a biochip. Biochips generally comprise solid substrates and have a generally planar surface, to which a capture reagent (also called an adsorbent or affinity reagent) is attached. Frequently, the surface of a biochip comprises a plurality of addressable locations, each of which has the capture reagent bound there. Protein biochips are biochips adapted for the capture of polypeptides. Many protein biochips are described in the art. These include, for example, protein biochips produced by Ciphergen Biosystems, Inc. (Fremont, CA.), Invitrogen Corp. (Carlsbad, CA), Affymetrix, Inc. (Fremong, CA), Zyomyx (Hayward, CA), R&D Systems, Inc. (Minneapolis, MN), Biacore (Uppsala, Sweden) and Procognia (Berkshire, UK). Examples of such protein biochips are described in the following patents or published patent applications: U.S. Patent No. 6,537,749; U.S. Patent No. 6,329,209; U.S. Patent No. 6,225,047; U.S. Patent No.
5,242,828; PCT International Publication No. WO 00/56934; and PCT International
Publication No. WO 03/048768.
In a particular embodiment, the present invention comprises a microarray chip. More specifically, the chip comprises a small wafer that carries a collection of binding agents bound to its surface in an orderly pattern, each binding agent occupying a specific position on the chip. The set of binding agents specifically bind to each of the one or more one or more of the biomarkers described herein. In particular embodiments, a few micro-liters of blood serum or plasma are dropped on the chip array. Biomarker proteins present in the tested specimen bind to the binding agents specifically recognized by them. Subtype and amount of bound mark is detected and quantified using, for example, a fluorescently-labeled secondary, subtype-specific antibody. In particular embodiments, an optical reader is used for bound biomarker detection and quantification. Thus, a system can comprise a chip array and an optical reader. In other embodiments, a chip is provided.
III. Kits for the Detection of Biomarkers
In another aspect, the present invention provides kits for qualifying malaria status, which kits are used to detect the biomarkers described herein. In a specific embodiment, the kit is provided as a lateral flow immunoassay kit comprising antibodies to the biomarkers of the present invention including, but not limited to, PSSP17.
The kit may comprise a solid support, such as a chip, microtiter plate (e.g., a 96-well plate), bead, or resin having biomarker capture reagents attached thereon. The kit may further comprise a means for detecting the biomarkers, such as antibodies, and a secondary antibody-signal complex such as horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody and tetramethyl benzidine (TMB) as a substrate for HRP.
The kit may be provided as an immuno-chromatography strip comprising a membrane on which the antibodies are immobilized, and a means for detecting, e.g., gold particle bound antibodies, where the membrane, includes NC membrane and PVDF membrane. The kit may comprise a plastic plate on which a sample application pad, gold particle bound antibodies temporally immobilized on a glass fiber filter, a nitrocellulose membrane on which antibody bands and a secondary antibody band are immobilized and an absorbent pad are positioned in a serial manner, so as to keep continuous capillary flow of the sample.
In certain embodiments, a patient can be diagnosed by adding a biological sample
(e.g., saliva) from the patient to the kit and detecting the relevant biomarkers conjugated with antibodies, specifically, by a method which comprises the steps of: (i) collecting saliva from the patient; (ii) adding the saliva from patient to a diagnostic kit; and, (iii) detecting the biomarkers conjugated with antibodies. In this method, the antibodies are brought into contact with the patient's saliva. If the biomarkers are present in the sample, the antibodies will bind to the sample, or a portion thereof. In other kit and diagnostic embodiments, saliva not be collected from the patient (i.e., it is already collected). Saliva samples can be collected from subject of varying ages. Moreover, in other embodiments, the sample may comprise a blood, serum, sweat, tissue, urine or a clinical sample. The kit can also comprise a washing solution or instructions for making a washing solution, in which the combination of the capture reagents and the washing solution allows capture of the biomarkers on the solid support for subsequent detection by, e.g., antibodies or mass spectrometry. In a further embodiment, a kit can comprise instructions for suitable operational parameters in the form of a label or separate insert. For example, the instructions may inform a consumer about how to collect the sample, how to wash the probe or the particular biomarkers to be detected, etc. In yet another embodiment, the kit can comprise one or more containers with biomarker samples, to be used as standard(s) for calibration or normalization. Detection of the markers described herein may be accomplished using a lateral flow assay.
In certain embodiments, the malaria parasite biomarker proteins of the present invention can be detected and/or measured by immunoassay. Immunoassay requires biospecific capture reagents, such as antibodies to capture the biomarkers. Many antibodies are available commercially. Antibodies also can be produced by methods well known in the art, e.g., by immunizing animals with the malaria parasite biomarker proteins. Proteins can be isolated from samples based on their binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to generate antibodies by methods well-known in the art.
The present invention contemplates traditional immunoassays including, for example, sandwich immunoassays including ELISA or luminescence/fluorescence-based
immunoassays, immunoblots, Western Blots (WB), as well as other enzyme immunoassays. Nephelometry is an assay performed in liquid phase, in which antibodies are in solution. Binding of the antigen to the antibody results in changes in absorbance, which is measured. In a SELDI-based immunoassay, a biospecific capture reagent for the biomarker is attached to the surface of an MS probe, such as a pre-activated protein chip array. The biomarker is then specifically captured on the biochip through this reagent, and the captured biomarker is detected by mass spectrometry.
Although antibodies are useful because of their extensive characterization, any other suitable agent (e.g., a peptide, an aptamer, or a small organic molecule) that specifically binds a biomarker of the present invention is optionally used in place of the antibody in the above described immunoassays. For example, an aptamer that specifically binds a malaria parasite biomarker proteins and/or one or more of its breakdown products might be used. Aptamers are nucleic acid-based molecules that bind specific ligands. Methods for making aptamers with a particular binding specificity are known as detailed in U.S. Patents No. 5,475,096; No. 5,670,637; No. 5,696,249; No. 5,270, 163; No. 5,707,796; No. 5,595,877; No. 5,660,985; No. 5,567,588; No. 5,683,867; No. 5,637,459; and No. 6,011 ,020.
In specific embodiments, the assay performed on the biological sample (e.g., saliva) can comprise contacting the biological sample with one or more capture agents (e.g., antibodies, peptides, aptamer, etc., combinations thereof) to form a biomarker: capture agent complex. The complexes can then be detected and/or quantified. In certain embodiments, a subject can then be identified as being asymptomatic or symptomatic for malaria based on the presence of the malaria parasite biomarker proteins in the sample or a comparison of the detected/quantified/measured levels of malaria parasite biomarker proteins to one or more reference controls as described herein.
In particular embodiments, the malaria parasite biomarker proteins of the present invention can be captured and concentrated using nano particles. In a specific embodiment, the proteins can be captured and concentrated using Nanotrap® technology (Ceres
Nanosciences, Inc. (Manassas, VA)). Briefly, the Nanotrap platform reduces pre-analytical variability by enabling biomarker enrichment, removal of high-abundance analytes, and by preventing degradation to highly labile analytes in an innovative, one-step collection workflow. Multiple analytes sequestered from a single sample can be concentrated and eluted into small volumes to effectively amplify, up to 100-fold or greater depending on the starting sample volume (Shafagati, 2014; Shafagati, 2013; Longo, et al, 2009), resulting in substantial improvements to downstream analytical sensitivity.
In another aspect, the present invention provides kits for rapidly diagnosing malaria in asymptomatic and/or symptomatic individuals. In particular embodiments, the kit is provided as a 61 par point of care use malaria RDT. The kit can comprise antibodies (or fragments that specifically bind) to the proteins described herein. In a specific embodiment, the antibodies specifically bind to a protein biomarker, which biomarkers include one or more of PF3D7 01 11300 (replication factor c protein, putative), PF3D7_0216700.1 (conserved Plasmodium protein, unknown function), PF3D7_0310500 (DEAD box helicase, putative), PF3D7_0318200 (DNA-directed RNA polymerase II, putative), PF3D7_0401900 (acyl-CoA synthetase (ACS6)), PF3D7_0419900 (phosphatidylinositol 4-kinase, putative),
PF3D7_0422300 (alpha tubulin 2), PF3D7_0507800 (conserved Plasmodium protein, unknown function), PF3D7 0508100 (SET domain protein, putative (SET9)),
PF3D7_0509400 (RNA polymerase I (RNAPI)), PF3D7_0510100 (conserved Plasmodium protein, unknown function), PF3D7 0511500 (RNA pseudouridylate synthase, putative), PF3D7 0512600 (Rab GTPase lb (Rablb)), PF3D7 0528700 (peptidyl-prolyl cis-trans isomerase (CYP23)), PF3D7_0529800 (conserved Plasmodium protein, unknown function), PF3D7 0610400 (histone H3 (H3)), PF3D7 0632500 (erythrocyte membrane protein 1, PfEMPl (VAR)), PF3D7_0704100 (conserved Plasmodium membrane protein, unknown function), PF3D7_0705500 (inositol-phosphate phosphatase, putative), PF3D7_0717900 (thioredoxin-like protein), PF3D7_0720700 (phosphoinositide-binding protein, putative), PF3D7_0818900 (heat shock protein 70 (HSP70)), PF3D7_0831700 (heat shock protein 70 (HSP70-x)), PF3D7 0903200 (Rab GTPase 7 (Rab7)), PF3D7 0904100 (adapter-related protein, putative), PF3D7_0906100 (developmental protein, putative), PF3D7_0907200 (GTPase activator, putative), PF3D7 0917900 (heat shock protein 70 (HSP70-2)),
PF3D7_0927200 (zinc finger protein, putative), PF3D7_1015900 (enolase (ENO)),
PF3D7_1029000 (conserved Plasmodium protein, unknown function, pseudogene),
PF3D7 1034400 (flavoprotein subunit of succinate dehydrogenase (SDHA)),
PF3D7 1 102400 (flavoprotein, putative), PF3D7 1 105600 (translocon component PTEX88 (PTEX88)), PF3D7 1134700 (DNA-directed RNA polymerase 1, subunit 2, putative), PF3D7_1142100 (conserved Plasmodium protein, unknown function), PF3D7_1200200 (rifin (RIF)), PF3D7_1202300 (dynein heavy chain, putative), PF3D7_1207000 (conserved Plasmodium protein, unknown function), PF3D7_1211800 (polyubiquitin (PfpUB)), PF3D7_1215100 (conserved Plasmodium protein, unknown function), PF3D7_1216000 (serine—tRNA ligase, putative), PF3D7_1216900 (DNA-binding chaperone, putative), PF3D7 1218800 (secreted ookinete protein, putative (PSSP17)), PF3D7 1231 100 (Rab GTPase 2 (RAB2)), PF3D7 1235700 (ATP synthase subunit beta, mitochondrial),
PF3D7 1239900 (vesicle fusion and protein sorting subunit 16, putative (VPS 16)),
PF3D7 1313500 (conserved Plasmodium membrane protein, unknown function),
PF3D7_1318300 (conserved Plasmodium protein, unknown function), PF3D7_1319200 (conserved Plasmodium protein, unknown function), PF3D7_1325900 (conserved
Plasmodium protein, unknown function), PF3D7_1327300 (conserved Plasmodium protein, unknown function), PF3D7 1337200 (1-deoxy-D-xylulose 5-phosphate synthase),
PF3D7_1337500 (conserved Plasmodium protein, unknown function), PF3D7_1342600 (myosin A (MyoA)), PF3D7_1353000 (tryptophan-rich antigen, pseudogene),
PF3D7 141 1400 (plastid replication-repair enzyme (PREX)), PF3D7 1421300 (conserved Plasmodium protein, unknown function), PF3D7_1434200 (calmodulin (CAM)),
PF3D7_1443800 (zinc finger protein, putative), and PF3D7_1452200
(aminomethyltransferase, putative). In other embodiments, the methods, compositions and kits of the present invention can comprise monoclonal antibodies, cGMP conjugated monoclonal antibodies, cGMP recombinant proteins, cGMP saliva collection vessels and stabilization buffers.
Without further elaboration, it is believed that one skilled in the art, using the preceding description, can utilize the present invention to the fullest extent. The following examples are illustrative only, and not limiting of the remainder of the disclosure in any way whatsoever.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and/or methods described and claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for herein. Unless indicated otherwise, parts are parts by weight, temperature is in degrees Celsius or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component
concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.
EXAMPLE 1 : Sex-Partitioning of the Plasmodium falciparum .Stage V Gametocvte Proteome Provides Insight into Falciparum-Specific Cell Biology
Sexual stages represent only a small fraction of Plasmodium falciparum parasites that are present during human malaria infection, yet they alone are responsible for disease transmission. As such, the Malaria Eradication Research Agenda (malERA) has prioritized the need for studies specifically addressing these transmission stages, with the hope of developing new transmission-blocking vaccines and drugs, as well as diagnostics that are specific for these sexual stages. In fact, one of the critical gaps in malaria transmission biology and surveillance centers on the lack of knowledge about the infectivity of symptomatic and asymptomatic gametocytemic individuals for mosquitoes. Many infected individuals harboring the Plasmodium falciparum sexual stage, or gametocyte, are asymptomatic carriers and they represent the primary reservoir for malaria transmission. Missing the opportunity to treat these carriers will increase the risk for epidemic malaria in regions that have approached the elimination phase. Thus, proper surveillance of gametocyte carriers is critical for evaluating ongoing malaria control and elimination programs.
Surveillance is difficult, however, because gametocytes comprise only 0.1 -2% of the total body parasite load during active infection, and are only observed in the bloodstream in their mature (Stage V) form, with the first four developing stages sequestered in tissues.
Microscopy-based analysis for sex ratio determination and infectivity studies remains limited due to cost, training and suitability for population- wide studies. Although light microscopy remains the gold standard for malaria diagnosis, the relatively low prevalence of circulating gametocytes makes it difficult to, accurately detect much less quantify these stages.
Moreover, due to variations in skill level of microscopists and inconsistency in method, exclusive use of light microscopy estimates of gametocyte carriage carries a high risk of error. Importantly, the presence of stage V gametocytes in the bloodstream alone, as determined by thick smear microscopy does not imply infectivity to mosquitoes. Ratios of male and female gametocytes in the blood circulation are generally skewed towards the female, but they can vary significantly based on co-infection, parasite and gametocyte density and host environmental factors and it is therefore hypothesized that this variation in sex ratios will influence mosquito infectivity. For example, mature gametocyte sex ratios can change during the course of infection in response to host cues or especially following antimalarial treatment resulting in an increase in the number of males. However, it remains unknown whether the transmission potential to mosquitoes of the individuals in these studies fluctuated due to the changes in sex ratio.
There are currently no molecular tools to distinguish male and female mature P. falciparum gametocytes (of which at least one of each is required for fertilization and ookinete development in the mosquito), and there is no correlate available to predict gametocyte infectiousness to mosquitoes. Although the proteome of Plasmodium
gametocytes has been described, these previous analyses fell just short of providing the partitioned male and female proteomes for P. falciparum. Moreover, the availability of the genomes of human, primate and rodent malaria parasites and the acquisition of sequence information for recently derived field isolates of P. falciparum have created the opportunity to understand gene diversity and conservation in sexual stage development across Plasmodia. Identifying markers that differ between male and female P. falciparum stage V gametocytes is critical in informing transgenic approaches aimed at separating the two. It has been argued that the inherent evolutionary differences between rodent and human malaria parasites, especially for the sexual stages, limit the utility of the P. berghei gametocyte proteome in providing a priori knowledge of these markers. Several iterations and improvements to the P. berghei genome have been made available since 2005, while MS search engines have commensurately improved further compounding the issue. However, we would also argue that the current evidence suggests a high degree of conservation in gametocyte gene complement across Plasmodium, and therefore presumably in sex-specific genes-despite key differences such as gametocyte sequestration and morphology. Here, we report on our effort to partially address these scientific gaps and to test our gametocyte gene conservation hypothesis through the use of leading-edge comparative protein bioinformatics analyses of the mature stage V gametocyte proteomes of two distinct P. falciparum strains with our updated P. berghei male and female gametocyte proteomes.
Materials and Methods
Parasite culture and gametocyte isolation:
P. falciparum NF54 gametocyte culture. P. falciparum gametocytes were cultured in RPMI-1640 containing HEPES and glutamine and supplemented with 10% human serum and hypoxanthine as described earlier (34). P. falciparum NF54 strain was diluted to 0.5% mixed stage asexual parasites and 4% hematocrit in complete culture medium in six well plates. Plates were transferred to 37°C incubator and microaerophilic environment was created using desiccators as candle jar. Media was exchanged every day without the addition of new blood from day 1 to day 17 (culture maturation). To remove asexual stage parasites 50 mM N- acetylglucosamine was added to the culture media from day 8 (early stage gametocytes) until day 10. Blood smears were made every alternate day to monitor the progress of the culture and to determine gametocyte percent on day 18. Stage V gametocytes (stage V) were harvested from culture at day 17 post-gametocytogenesis initiation and isolated by passage through a LS-25 Midi MACS column (CS Miltenyi).
P. falciparum Dd2 gametocyte culture. The production of stage V gametocytes was performed using a modified version of a previously described protocol (35). Ten (10) mL cultures at 4% hematocrit and -5% ring parasitemia were sorbitol synchronized. After 24 hours, trophozoite cultures were transferred to a T75 flask to which complete media and red blood cells were added to create a 30mL culture with 2% hematocrit in each flask. After another 24hrs, adding 50% old media and 50% new complete media stressed the newly reinvaded rings. Cultures were allowed to develop to late schizonts and then split into three T75 flasks evenly. Twenty (20) mLs of fresh media was then added to each flask. During sexual stage development, fresh media was added daily. At 48 hours after sexual stage invasion, lmL of 1M N-Acetyl-D-Glucosamine was added to all flasks in order to clear asexual parasites. Drug treatment was given during media changes for three consecutive days. On day nine of sexual development, the cultures were MACS column separated to purify late stage gametocytes. Purified cultures were washed in PBS and snap frozen.
Protein extraction. The GiRBC elution from MACS column was washed with cold PBS three times prior to protein extraction. Freezing and thaw method was applied to extracted the soluble proteins by adding 120 5 mM phosphate buffer containing 0.5 mM PMSF, 1 mM EDTA and 1 mM protease inhibitors cocktail (Sigma, St. Louis, MO) to l lO6 GiRBC pellets. Totally four cycles of freezing and thaw cycles were used. The supernatant was collected as soluble protein fraction after centrifugation at 20,000g for 30 min at 4°C. To get the membrane part proteins, the pellets was washed by cold PBS for 3 times prior to be dissolved in 95 μΐ. SDT-lysis buffer including 4% (w/v) SDS, 100 mM Tris/HCl, 0.1 M DTT, pH 7.6, then boiled at 95 °C for 5 min. The supernatant was collected as membrane part protein fraction after centrifugation at 20,000 g for 5 min at 4°C.
Multi-Lane Combined In-gel Digestion (MLCID). We used a Multi-Lane Combined In-gel Digestion (MLCID) strategy to reduce the impact of non-specific absorption during the process of in-gel tryptic digestion and to avoid losing the SDS-PAGE separation power. For NF54 parasites, we used 3 lanes for the soluble protein fraction and 4 lanes for the membrane fraction, respectively, and each lane was loaded with 20 of sample under reducing conditions. After resolving on a 4-20% precast gradient gel (BioRad, Hercules, CA), the proteins were stained with Coomassie. GiRBC soluble and membrane fractions were cut into 14 slices by combining 3 lanes (soluble) and 16 slices by combining 4 lanes (membrane). Both the soluble and membrane fractions from Dd2 were cut into 14 slices by combing 3 lanes. Gel slices were cut into l x l mm pieces prior to de-staining, reduction and alkylation, tryptic digestion and peptide extraction. The extracted peptides were lyophilized and then were re-suspended in 2% ACN, 97.9% water and 0.1 % formic acid buffer for LC-MS/MS analysis.
LC-MS/MS. Biological in-gel digestion replicates were analyzed independently as follows. One third of the MLCID sample of all the fractions, were injected onto an Agilent LC-MS system comprised of a 1200 LC system coupled to a 6520 Q-TOF via an HPLC Chip Cube interface. The only exception to this process was made for the first low molecular weight fraction, which consisted primarily of hemoglobin, and thus only 1/50th of this fraction was injected. The sample was trapped and analyzed using an Agilent Polaris-HR- Chip-3C18 chip (360 nL, 180 A C18 trap with a 75 μιη i.d., 150 mm length, 180 A C18 analytical column). Peptides were loaded onto the enrichment column automatically by autosampler using 97% solvent A (0.1% formic acid in water) and 3% solvent B (0.1% formic acid in 90% acetonitrile) at a flow rate of 2 μί/ηιίη. Elution of peptides from the analytical column was performed using a gradient starting at 97% A at 300 nL/min. The mobile phase was 3-10% B for 4 min, 10-35% B for 56 min, 35-99% for 2 min, and maintained at 99% B for 6 min, followed by re-equilibration of the column with 3% B for 10 min. Data dependent (autoMS2) mode was used for MS acquisition by Agilent 6520 Q-TOF in 2 GHz. Precursor MS spectra were acquired from m/z 315 to 1700 and the top 4 peaks were selected for MS/MS analysis. Product scans were acquired from m/z 50 to 1700 at a scan rate of 1.5/second. A medium isolation width (~4 amu) was used, and a collision energy of slope 3.9 V/100 Da with a 2.9 V offset was applied for fragmentation. A dynamic exclusion list was applied, with precursors excluded of 0.50 min after two MS/MS spectrum was acquired.
Mass spectrometry data search and analysis. Each sample was further fractionated into 14 membrane and 14 soluble fractions. Raw data from Dd2 sample runs (2 biological replicates, 217,165 MS/MS total spectra) and NF54 GiRBC sample runs (3 biological replicates, 497,006 MS/MS total spectra) was converted to mzXML format using Trapper (Institute for Systems Biology, Seattle, Washington). A merged search was performed on the mzXML data for each fraction using the PepArML metasearch engine (36), which automatically conducts target and decoy searches using the following: Mascot (37), OMSSA (38) and Tandem (39) with native, K-score (40) and S-score pluggable scoring modules (41), and Inspect (42) with MS-GF spectral probability scoring (43). The results were then combined using an unsupervised machine-learning strategy, and the peptide identification false discovery rates were estimated using identifications from the reversed decoy searches (44).
The data was searched by a combined database of SwissProt Human and Plasmodium falciparum sequences from GeneDB (2013.02), which consists of 28,960 entries with the following parameters; fixed modification: carbamidomethyl cysteine and variable modification: oxidized methionine; mass tolerance: 30 ppm and 20 ppm respectively for precursor and fragment ions; one missed cleavage. The results from the metasearch were combined and the results were parsed into the MASPECTRAS 2 data analysis system (18) with data filters of 1% spectra FDR and 5% peptide FDR, and protein identifications were then clustered to remove redundancy. Proteins were clustered together if there was a peptide identification shared between them, since this indicates substantial sequence similarity, and the protein with the greatest number of peptides identified was considered the unique protein identification from that group. Throughout this paper we report only the unique
identifications. Proteins identified by single peptides were manually validated. The data analysis pipeline meets all MIAPE standards (45) and the proteomics data have been deposited in the ProteomeExchange via the PRotein IDEntifications database (PRIDE) partner repository with the dataset identifier PXD000813 (46). The protein lists have also been uploaded to PlasmoDB (plasmodb.org).
For the reanalysis of the Khan, et al. dataset (11), the individual MS raw files from Male (113,213 total MS/MS spectra) and Female dataset (243,468 total MS/MS spectra) were searched against a combined database of SwissProt Human, Mouse and P. berghei. Using these results we determined the male/female partitioned proteomes for P. falciparum gametocytes through a subtractive bioinformatics proteomics approach. Briefly, in our approach, we take protein identification lists and use set comparisons to generate protein lists that are specific for biological states, with those protein lists clustered to remove redundancy. Therefore, we took the NF54 and Dd2 gametocyte-infected red blood cell lysate proteome and subtracted out all host proteins, generating the NF54 and Dd2 gametocyte proteomes. Putative male-specific, female-specific, and sex-unspecific proteomes were generated by taking protein identifications unique to NF54 and Dd2, respectively. These putative proteomes were then BLAST searched against the two previous datasets of Khan et al. and Silvestrini et al. (8, 11). In house developed Python scripts were used for BLAST automation, with an e-value cutoff of 0.01 and >40% identity for BLAST 2.2.20 homology search. In order to focus on the parasite proteome, all identified human proteins were excluded from this analysis.
Identified proteins were annotated by GeneDB (02, 2013); specifically, the Gene Ontology database was searched by BLAST homology for annotations. The surface expressed (SE) proteins were predicted by searching for canonical signal peptides with the SignalP 4.1 Server (47). Transmembrane domain information was obtained on all identified proteins by the transmembrane protein prediction tool TMHMM Server v. 2.0 (48).
Analysis of diversity and divergence for male and female P. falciparum gametocyte proteins. The πΝ SNP diversity statistic, representing mean pairwise non-synonymous SNP diversity per site, was calculated for previously generated data within each genie region for a given population using the VCFtools—site-pi utility (49). For each pair of populations, the Fst divergence statistic was calculated for each gene with the VCFtools implementation of Fst and weighted Fst estimators as described in Weir and Cockerham (50). Expression of recombinant proteins and generation of polyclonal antibodies for proteomic validation. The selection of predicted immunogenic domains for each protein were based on physiochemical properties of each gene (PF3D7_0906100; PF3D7_1218800; PF3D7_0309100; PF3D7_0422000) using the Bcepred server (51) and Immune epitope Database (IEDP) (52). Each codon-optimized gene or gene fragment (GenScript) was used as a template for PCR along with the following primer sets (all 5' to 3'): PF3D7 0906100, F- CACCATGGGTAACAAAATTAGC (SEQ ID NO: l), R- TTTCAGGTTTTTGATACGTTCC (SEQ ID NO:2); PF3D7 1218800, F- CACCAAAATCGTGCTGTCCA (SEQ ID NO:3), R- ACCGAAGTAAATAAAACTCGGTTC (SEQ ID NO:4); PF3D7 0309100, F-
CACCGACCTGAGCGGCCT (SEQ ID NO:5), R- CAGTTCTTCGTTTTTGATGAACACG (SEQ ID NO:6). Each 20 μΐ PCR reaction consisted of 0.25 μΐ of DNA (200 ng/ μΐ), 4.0 μΐ of 5x iProof DNA polymerase buffer, 0.4 μΐ of dNTPs (lOmM each), 0.4 μΐ each of forward and reverse primers (10 μΜ), 0.1 μΐ of iProof DNA polymerase (2 U/μΙ), and 14.85 μΐ of sterile deionized water. Reaction conditions were 98°C for 2 minutes, followed by 40 cycles of 98°C for 15 seconds, 62°C for 25 seconds, and 72°C for 25 seconds. All forward primers were appended with the nucleotides CACC on the 5' end to facilitate directional insertion of each amplicon into the E. coli expression vector pBAD202/D-TOPO. Ligation and transformation steps were carried out according to the manufacturer's protocols, and clones were grown on selective LB agar plates with kanamycin (50 μg/ml) overnight at 37 °C. For each gene, colonies were picked and screened by PCR and then sequenced to confirm proper orientation and reading frame. Prior to induction, positive clones were grown in LB media+kanamycin (50 μg/ml) overnight at 37 °C in a shaking incubator (200 RPM). Each overnight culture was then used to seed 50 mL of fresh LB+kanamycin (50 μg/mL), grown to an O.D.600a0.4, and then induced with arabinose (0.01%) for 6-8 hours at 37 °C. Cells were harvested by centrifugation at 10,000 x g for 10 minutes, and the presence of recombinant protein from each expression was confirmed by western blot using mouse anti-His monoclonal Ab (Sigma). The cell pellets were then processed for recombinant protein using BugBuster Reagent (Novagen) following the manufacturer's protocol for both soluble and insoluble fractions. Recombinant protein was then purified by immobilized metal affinity chromatography (ProBond, Invitrogen) following the manufacturer's "hybrid" protocol for inclusion bodies and the "native" protocol for soluble protein. Following elution from the column, eluates positive for protein by Western blot were pooled and dialyzed overnight (3,500-10,000 Da MWCO) against imadozole-free elution buffer and then concentrated using diafiltration (3,000 Da MWCO).
To generate polyclonal antibodies, Swiss Webster mice were immunized with purified recombinant protein emulsified with incomplete Freund's adjuvant (Sigma) following a prime and 3 boosts at two week intervals. The mice were exsanguinated at the end of the immunization regimen to collect serum.
Immunofluorescence microscopy assays. P. falciparum NF54 gametocyte and trophozoite samples were fixed with 4% paraformaldehyde/0.0075% glutaraldehyde and prepared for fluorescence microscopy by washing three times with PBS. The cells were permeabilized with 0.2% Triton-X 100/PBS for 10 minutes and then washed as before. After washing, samples were blocked with 3% BSA in PBS overnight at 4°C. The samples were then incubated with mouse anti -gametocyte protein serum (1 :50) for 1 hr at RT. Cells were washed with PBS as before and detected with Alexa Fluor(R) 488 Goat Anti-Mouse IgG (H+L), highly cross-adsorbed (Molecular Probes®, 1 : 1000) in 0.02% Evans blue for 1 hr at RT. Following incubation, the cells were washed three times with PBS, resuspended in PBS, spotted on slides and allowed to air dry. Samples were mounted using Slow Fade Gold antifade reagent with DAPI (Molecular Probes) or Aqua Poly/mount (Polysciences Inc.). Samples were imaged using a Nikon Upright E800 microscope equipped with SPOT camera and software and a Nikon 90i light microscope (Nikon Corp., Tokyo, Japan) connected to a Hamamatsu ORCA high sensitivity monochrome CCD camera.
Results
The Plasmodium falciparum stage V gametocyte proteome: NF54 vs. Dd2. We selected two P. falciparum strains for proteomic analysis of stage V gametocytes: a transmission-competent reference isolate, NF54 (West Africa) (14) and a Southeast Asian clone Dd2 (15). Importantly, Dd2 has a defect in male gametocyte development resulting in arrested and morphologically altered male stages. The genetic basis of this defect is at least in part, a mutation in the male development 1 (MDV-1) gene (16). Assuming that the stage V proteome of Dd2 will be enriched for female proteins, we can then characterize the male- and female-specific P. falciparum proteomes by comparative analysis of Dd2 and NF54.
We produced three biological replicates of P. falciparum (NF54 isolate) stage V gametocytes in the presence of GlcNAc to reduce the number of asexuals that could remain present at 17 days post-initiation of gametocytogenesis. Microscopic analysis of thin-blood smears from the day 17 culture suggested a predominantly stage V culture (-6-7% gametocytemia), with few stage IV gametocytes and a sex ratio of approximately 1 :4 for male vs. female (FIG. 1 A, Table 1). In parallel, we cultured the P. falciparum Dd2 mutant clone and induced gametocytogenesis in the presence of GlcNAc to produce two biological replicates of preferentially female-enriched stage V gametocyte samples. We determined by microscopy the number of pre-stage V gametocytes in two replicate cultures with low and high gametocytemias to be 14.5% and 27.3% , respectively (Table 2). The proportion of morphologically altered tear-drop forms were 0.6% and 1.2% and rectangular forms were 0.4% and 1.6% for each of the two replicates. Although far fewer in number we considered these latter forms to be likely male gametocyte stages 1-4 and thus, a potential source of contaminating male proteins.
Table 1. Microscopic verification of the Stage V gametocyte male-to-female ratio for the
Plasmodium falciparum NF54 used in this study.
Several thin-smear slides taken from a N-acetylglucosamine (GlcNAc) treated culture of NF54 was examined by oil-immersion microscopy (1000X) at day 17 post-initiation of gametocytogenesis by 1/40 dilution of Giemsa in Sorensen's buffer.
Read l Read 2 Read 3 Pooled
Total # RBCs counted 1204 1212 1130 3546
Number of Males (pink) 16 15 17 48
Number of Females (blue) 88 58 40 186
Total # Gametocytes (Stage V) 104 73 57 234
Gametocytemia (Stage V) 0.09 0.06 0.05 0.07
Male:Female Ratio 0.18 0.26 0.43 0.26
Table 2. Microscopic verification of purified Pre- and Mature Stage V gametocytes for the
Plasmodium falciparum Dd2 line used in this study.
Gametocytemia (%) Pre -Stage V (%) Tear drop (%) Rectangular (%)
LOW 503/758 (66.3) 73/503 (14.5) 3/503 (0.60) 2/503 (0.40)
HIGH 506/536 (94.4) 138/506 (27.3) 6/506 (1.19) 8/506 (1.58)
The Dd2 clone has a defect in male gametocyte development. However, the presence of Pre-Stage V gametocytes would complicate the partitioning of Dd2 proteins since male- specific markers in P. falciparum, e.g., alpha-tubulin II are expressed in pre-stage V females. In addition to determining the number of Pre-Stage V's we also ascertained the number of "tear drop" and "rectangular" forms, which have been hypothesized to be malformed male gametocytes. The contamination level with Pre-Stage V as well as these malformed parasites helped explain our Dd2 gametocyte proteome.
We demonstrated highly consistent acquisition of the mixed-sex stage V gametocyte proteome (FIG. 2A), with greater than 95% reproducibility in protein identifications across biological replicates (FIG. 2A-B). We identified 1,703 mature NF54 stage V proteins, including all the known and well-studied gametocyte surface markers such as P230, P48/45, P47 and the LCCL domain-containing (CCp) protein family of molecules (Table 1). Of these, 449 (26%) proteins were consistently and exclusively identified in the membrane fraction of each sample. In parallel, a total of 1,337 proteins were reproducibly identified from the two Dd2 biological replicates (Table 2). Of these, 726 (54%) proteins were consistently and exclusively identified in the membrane fraction of each sample. For both NF54 and Dd2 it remains unclear if these proteins localize to the parasite plasmalemma or RBC membrane. We observed that NF54 and Dd2 have 1105 proteins in common, 598 NF54-specific proteins and 232 Dd2-specific proteins, which may include proteins emanating from the malformed, arrested male gametocytes (Table 2). We compared our NF54 gametocyte stage V proteome (1703 proteins), which will be referred to in the text as DTgv, with the recently described P. falciparum 3D7/NF54 gametocyte stage V proteomes, gametocyte stage I-II and trophozoite protein lists (8), the datasets of which we refer to in our study here on as FSgv (2,031 proteins), FSg1"11 (1,427 proteins) and FS Asx (1,345 proteins), respectively. For these three datasets, we converted the previous and now deprecated accession numbers for each protein to the new protein identifiers as described in the P.
falciparum 3D7 databases in GeneDB (Version 3) and PlasmoDB (Version 9.3. 11 Mar 11, 2013). The NF54 stage V proteome was comparable to the previously described 3D7/NF54 gametocyte stage V proteome (8), with 1,274 proteins found to be in common between the two NF54 datasets. We also noted the addition of 429 newly identified NF54 proteins to the gametocyte proteome (FIG. 2D). Together, these two datasets represent the most complete P. falciparum NF54 stage V gametocyte proteome to date. The Dd2 stage V proteome was also comparable to the FSgv proteome, with 1106 proteins in common (FIG. 2E). Similar to the results with our NF54 stage V comparison, we noted that -230 Dd2-specific proteins had partitioned from FSgv. The acquisition of the NF54 and Dd2 stage V gametocyte proteomes (summary MS statistics are provided in Table 3) represents the first step in our Systematic Subtractive Protein Bioinformatics analysis (SSB) approach, which is outlined in FIG. 1C. Table 3. Mass spectrometry data summary statistics for P. falciparum NF54 and Dd2 stage V gametocvtes.
Strain Total # Spectra # Unique Spectra Unique Proteins Identified
P. falciparum NF54
Membrane Fraction 97,128 96,167 1455
Soluble Fraction 87,308 86,390 1031
Total NF54 184,436 182,557 1703*
P. falciparum Dd2
Membrane Fraction 80,127 36,064 1065
Soluble Fraction 77,364 49,184 893
Total Dd2 157,491 85,248 1337*
Combined Total 341,927 267,805 1935**
*783 proteins are shared between membrane and soluble NF54 proteins and *621 proteins are shared between Dd2 membrane and soluble proteins. **1105 proteins are shared between Dd2 and NF54 proteins.
Re-analysis of the rodent malaria sex-specific proteomes. To define and characterize the subset of conserved male and female Plasmodium gametocyte markers, we sought to compare the Dd2 and NF54 data with the available male and female proteomes from the rodent malaria parasite, P. berghei ANKA 2.34 (11) (see FIG. 1C for the strategy). However, given the number of iterations of the P. berghei genome since 2005, as well as further refinement of MS search engines capabilities, we first performed a PepArML-Search
MASPECTRAS2 Analysis (PSMA) of the original peptide spectral data from that study, to allow for appropriate and updated comparisons of protein identities (17, 18).
Our re-analysis resulted in updated P. berghei male (1,128 clustered proteins) and female (1,180 clustered proteins) gametocyte proteomes (Table 4). From these two datasets we identified 762 clustered proteins (FIG. 2F) that were common between male and female gametocytes, as compared to the 51 shared proteins originally reported between berghei males and females (11). The re-analyzed (PSMA) sex-specific protein lists increased from 278 to 366 male proteins (FIG. 2G) and 171 to 418 female proteins (FIG. 2H). We found that only 136 proteins were conserved between the original and current Male-specific protein lists (Table 2F) and 70 proteins between the original and current Female-specific protein lists (Table 2G). Taken altogether, the combined datasets represent the most complete ANKA sex-specific gametocyte proteomes to date. Apart from the increased resolution of the data set through the use of the PSMA approach, we also noted that seven proteins originally described to be male specific (1 1), actually partitioned to the female specific protein list and that two proteins originally reported to be female specific were now found to be in the male specific list (Table 5). We also observed that several proteins were putatively shared between males and females in the current PSMA analyses with differential enrichments in one sex over the other (FIG. 10).
Table 4. Comparative mass spectrometry data summary statistics.
Summary of the re-analyses of the Plasmodium berghei ANKA 2.34 Male and Female Gametocyte Proteomes using an updated P. berghei genome database (version 2013- 01) and the PepArML Search-MASPECTRAS2 Analysis (PSMA) platform.
Figure imgf000041_0001
Currentb 30,786 9,389 1, 128
/' rgh i 1 T:\ I . \ I .I :
Previous - - 541
Current 41 ,719 9,465 1 ,180
Speci fic
Previous - 698 278
Current 5,076 2,158 366 Ι Ί Λ ΙΛ Ι .ΐ : speci fic
Previous - 216 171
Current 3,405 1 ,359 418
Shared Male Femal e
Previous - 758 69
Current 64,024 10,407 762 aSearch engine used in previous analyses: Mascot (11).
bSearch engine used in current analyses: Mascot, OMSSA, X! Tandem, Kscore, Sscore, Inspect and MyriMatch. Table 5. A PSMA reanalysis of the existing Plasmodium berghei male and female gametocvte proteome using the current iteration of the genome revealed significant changes in the assignment of male and female proteins.
Previous" Current13
Acc. Number Protein Description M F M F cytoplasmic dynein intermediate chain,
PBANKA 050450 • • putative
PBANKA 080230 ubiquitin transferase, putative • • conserved Plasmodium protein, unknown
PBANKA 090620 • • function
U6 snRNA-associated Sm-like protein LSm4,
PBANKA 093990 • • putative (LSM4)
conserved Plasmodium protein, unknown
PBANKA 103870 • •
function
conserved Plasmodium protein, unknown
PBANKA 113640 • • function
conserved Plasmodium protein, unknown
PBANKA 120490 • • function
PBANKA 123400 vacuolar ATP synthetase, putative • •
PBANKA J41440 exportin-T, putative • • α See reference (11).
PPepArML-Search MASPECTRAS2 Analysis (PSMA).
Importantly, two proteins that were highlighted [cf. original Table 1 in (11)] as male- specific based on separation of gametocytes expressing GFP under the control of a sex- specific promoter, the Dynein heavy chain (PBANKA 092540) and Dynein heavy chain (PBANKA_041610) retained the same partitioning. The 6-cysteine protein, P230p
(PBANKA_030600), was previously described to be male-specific and we find this to hold true following PSMA re-analysis as well. There were two proteins, the transmission- blocking vaccine candidate, P48/45 (PBANKA_135960) and the male development gene 1 (PBANKA_143220), which were not previously reported in the original proteomic study of P. berghei gametocytes, but following PSMA, we noted that these two previously described male-specific proteins (19, 20) were indeed present in the original raw dataset and in our reanalysis did not exhibit sex-specific partitioning. Further interrogation of the data suggests that P48/45 appear to be enriched (3.25-fold based on spectral counts) in P. berghei males as opposed to females (FIG. 10). Interestingly, despite its moniker, male development gene 1 (MDV1) appeared to be less enriched in males as opposed to females based on our PSMA reanalysis, which follows the report by Lai, et al, (2009), wherein it was shown that MDV1 is in both males and females but is particularly important for female gametocyte development (21). Although it was recently shown that the egress of male gametes is partly dependent on MDV1 (22). We also noted that a dynein heavy chain protein (PBANKA_050730) that did not partition to either sex appears to have a 74.5-fold enrichment in males. Conversely, we also determined that another dynein heavy chain protein (PBANKA_021400) appears to be enriched 67-fold in females. A kinesin (PBANKA_145880), which has not been fully described to date, was enriched 36-fold in the male fraction. The CCpl/LCCLl domain containing protein (PBANKA_130070), which was hypothesized to be female specific (23) was also found in both male and female fractions, but was 63-fold enriched in the male fraction. The osmiophilic body protein (PBANKA_146300), a putative female-specific protein was found in both male and female fractions and is 27-fold enriched in the female fraction. These sex-specific enrichments are significant and strongly support the notion that while MS sensitivity enables their detection in the fraction, these fractions are likely unable to isolate completely male- or female-specific proteins. However, evidence from the literature is borne of both P. berghei and P. falciparum studies, and it remains to be seen whether falciparum-specific expression and sex-partitioning mirrors that of P. berghei.
We anticipated differential partitioning following PSMA, since we had also observed that a direct comparison of the Pb PSMA lists with the published Pb sex-specific lists resulted in only 136 shared male-proteins (FIG. 2E) and only 70 shared female-proteins (FIG. 2H). Moreover, we observed that there are 100 proteins from the original male-specific dataset (278) that are also found in the PSMA conserved male and female proteins (762 proteins). We could therefore account for only 178 male proteins of the original 278 male-specific proteins. In addition to the 70 shared female-specific proteins, we found that 85 proteins from the original female-specific dataset were also in the PSMA conserved male and female protein list (762 proteins). We could therefore account for only 86 female-specific proteins of the original 171 female-specific proteins. Altogether, re-analysis of the available P.
berghei mature gametocyte proteome data by PSMA has significantly improved the quality of this data set. We used this new annotation for comparison with the P. falciparum NF54/Dd2 stage V proteome data. Systematic Subtractive Protein Bioinformatics analysis (SSB) to partition male and female stage V gametocyte proteomes. To define the male and female proteomes ofP. falciparum stage V gametocytes we employed a SSB work-flow using the re-analyzedP. berghei mature gametocyte proteome data as a reference (FIG. 1C, FIG. 8). This approach is based on the assumption that sexual development is fundamentally evolutionarily conserved across the genus, although not all proteins will sex-partition similarly between the different lineages. Thus, the re-analyzedP. berghei male/female gametocyte PSMA datasets along with the proteome of a mutantP. falciparum clone, Dd2, which is defective in male gametocyte development, permit the sex-specific partitioning of our mixed-sex NF54 stage V gametocyte proteome. Integral in this process is using the known or strongly supported P. falciparum male/female gametocyte proteins as positive control markers (e.g., P47). This will allow us to track their partitioning throughout the SSB workflow (FIG. 4B-G).
Step 1. We curated the Dd2 proteome by first identifying Dd2 proteins that are conserved in the maleP. berghei PSMA (ANKA-M) dataset and generating a new list of male-subtracted proteins, i.e., female-enriched proteins (Dd2-FE; 1258 proteins). The male proteins that are shared with Dd2 are set aside (Dd2-M; 79 proteins) (FIG. 4B).
Step 2. This set was then combined with the mixed-sex protein list from NF54 to identify proteins that are conserved between Dd2-FE and NF54 and are likely to be enriched in female specific proteins (Dd2-FE/NF54; 1045 proteins; FIG. 4C). The proteins that are excluded from the overlap are then used to generate a list of likely male-enriched proteins (NF54-ME; 658 proteins) and Dd2-FE specific proteins (Dd2-FE-SP; 213 proteins) (FIG. 4C).
Step 3. The NF54-ME protein list is then used to search theP. berghei male-specific gametocyte protein list (ANKA-M; 366 proteins) to identify orthologs by BLAST (FIG. 4D). P. falciparum NF54 proteins with syntenic matches in the male P. berghei list are likely to be genus conserved and male-specific (NF54-M; 155 proteins). The NF54-ME proteins that do not have matches are likely to be NF54-specific proteins (NF54-SP; 503 proteins).
Step 4. The Dd2-FE/NF54 (1045) protein list was used to search the P. berghei Female-specific gametocyte protein list (ANKA-F; 418 proteins) to identify orthologs by BLAST. This analysis identified 181 proteins conserved between the two datasets, and 864 proteins that are Dd2-FE/NF54-specific and 237 proteins that are specific to P. berghei females (FIG. 4E).
Step 5. The NF54-ME list (male-enriched, 658 proteins) was used to determine if there are proteins that are conserved with the ANKA-F (female, 418 proteins) list. We surprisingly found 60 proteins that are conserved between ANKA-F and the putative male- enriched NF54-ME protein subset. Following the comparison, we noted that 598 proteins are likely to be highly enriched with male-specific P. falciparum proteins.
Although we did not anticipate missing proteins that do not partition to each of the subsequent protein lists, we nonetheless performed a set of additional data filtering steps as follows:
Determine if there are any overlapping proteins between NF54 F (181 proteins) and ANKA-M (366 proteins). This filtering step was performed to check that we had erroneously assigned a female protein that was actually found in the ANKA-M list. As expected no overlapping proteins were observed (data not shown).
Determine the overlap of between Dd2-M or "Ml" protein list (79 proteins) and the NF54-M or "M2" protein list (155 proteins) to assess Dd2 vs. NF54 specific protein subsets. We observed 60 conserved proteins between these two lists, and these conserved proteins represent the putative P. falciparum-specific male gametocyte proteins. Proteins that are conserved between these two divergent P. falciparum lines were categorized as conserved P. falciparum male proteins (conserved Pf-M; 60 proteins). Interestingly, 19 proteins were found to be specific to only Dd2 (Dd2-M-SP) and 95 proteins were NF54-specific (NF54-M- SP).
Determine if there are proteins that are conserved between NF54-M or "M2" list (male-specific, 155 proteins) and the ANKA-F (female, 418 proteins) list. The NF54-M list was predicted to be highly enriched in male-specific proteins and we observed, as we had expected in this quality check of the data, no overlap with P. berghei female proteins.
Determine if there are proteins that are conserved between NF54-SP (503 proteins) with the ANKA-F (418 proteins) list. We identified 60 proteins, and these were set aside and categorized as NF54-SP-female proteins (NF54-SP-F) for subsequent inclusion in the berghei-driven female-specific list. The remaining 443 proteins, which were not shared with Dd2 or present in the P. berghei dataset, were considered NF54-specific proteins, non-sex partitioning (or potentially P. falciparum male-specific) (FIG. 4F).
Determine if there are proteins that are conserved between Dd2-FE-SP (213 proteins) and the ANKA-F (418 proteins) list. We identified 17 female proteins that appear to be completely Dd2-specific (Dd2-SP) in our analysis (FIG. 4G). Since we expected that all of the Dd2-FE-SP were gametocyte female-specific proteins, we hypothesized that the remaining 196 proteins from this list are Dd2-specific, non-(sex) partitioning. Determine if there are proteins that are conserved between Dd2-FE/NF54 (1,045 proteins) and ANKA-M (366 proteins) list? As expected, we did not identify any
contaminating males in this protein list since, in theory, the Dd2-FE is female enriched and thus any matching proteins from the mixed NF54 gametocyte stage V proteome, should be female-specific (data not shown).
The systematic steps described above allowed us to assemble a list of putative cross- strain (NF54-Dd2) P. falciparum male (Pf-M) and female (Pf-F) stage V gametocyte protein lists. Our initial Pf-M list, which was a grouping of NF54-M and Dd2-M proteins, identified 174 proteins; while our Pf-F list, which was a grouping of NF54-F, Dd2-SPF, and NF54-SPF proteins, identified 258 proteins. Of note there were marked differences in the composition of the Pf-M and Pf-F protein lists from either NF54 or Dd2, with the latter contributing only 11% of the proteins for Pf-F and 33% of the proteins for Pf-M.
Partitioning of male- and female-specific gametocyte proteins in P. falciparum.
Pf-MALES. Of those described to be male specific in P. berghei (11), we noted that the Mitogen-activated protein kinase 2 (MAP2; PF3D7_1113900), the Dynein light chain type 2 (PF3D7_1114000) were also only found in the male proteome in P. falciparum). The ortholog of the second P. berghei dynein heavy chain (PF3D7_0905300), which was originally described to be male-specific as well, was found to be non-sex partitioning. The 6- cysteine protein, P230p (PF3D7_0208900), which was previously described to be male- specific in P. berghei and confirmed in our PSMA analysis was also found to be male- specific in P. falciparum. The same was noted for the NIMA-related kinase 1 (NEK1 ;
PF3D7_1228300), which was also male-specific in P. falciparum. The ortholog of the P. cynomolgi and P. vivax sperm-specific protein Don Juan (PF3D7_1413200) was found to be male specific. This protein was not found in the FS Asx and FSg1"11 databases, but Florens, et al., (2002) apparently detected the protein in highly synchronized trophozoites(9). One of the top male-partitioning proteins in P. berghei (PBANKA_050730) (11) was detected in our total NF54 gametocyte stage V proteome but the ortholog (PF3D7_1023100) did not partition to either sex. PBANKA_050730 was already found to be shared in berghei males and females so it would naturally not partition in P. falciparum, since the male- and female- specific berghei lists were used to guide the assembly of the male and female lists in P.
falciparum.
Pf-FEMALES. Our dataset supports the argument that both the NIMA related kinase- 4 (NEK4, PF3D7_0719200) and LCCL/CCp3 (PF3D7_1407000) proteins are conserved between P. berghei and P. falciparum female gametocytes. We also noted that NIMA related kinase 2 (NEK2, PF3D7_0525900) partitioned to females. A functional NEK2 has been shown to be essential for human/murine parasite development in the mosquito and its expression appears to be female gametocyte specific (24). The ortholog of the P. berghei female-specific Dynein heavy chain (PF3D7 0729900) did not partition to either sex.
Interestingly, P28, which is expressed as a transcript in gametocytes and only translated during gametogenesis, was identified in the female proteome. Although there are clearly differences in the conditions of gametocyte cultures as opposed to in vivo development, which may lead to the misexpression of P28 protein, it is also possible that female gametocyte activation may have occurred during cell harvest. Our data however, clearly supports the current hypothesis that P28 is female-specific. Approximately 46% of the 299 proteins (138) are conserved proteins with unknown function and represent a rich set of potential female markers for subsequent study.
We then took the Pf-M (174 proteins) and Pf-F (258 proteins) proteomes that were generated above to identify proteins that are conserved in the asexual trophozoite and the earlier gametocyte stages I-II, as described above, to further refine our P. falciparum male/female Stage V proteomes (Pf-M' and Pf-F', respectively). We also sought to identify any potential overlapping proteins that may have partitioned "artificially" according to the P. berghei PSMA lists but in fact are non-sex partitioning in P. falciparum and found none (data not shown).
Comparison of predicted functions of male- and female-specific gametocyte proteins in P. berghei and P. falciparum. To identify potential functional differences in male vs female gametocytes based on the proteomics data, we measured enrichment of molecular function based on Gene Ontology (GO) terms in the male and female protein data sets from both P. berghei (FIG. 3 A) and P. falciparum (FIG. 3H). Indeed we identified enrichment of GO terms relating to cell motility and movement as well as microtubule cytoskeleton in the male gametocyte proteins, reflecting the exflagellation process during male gamete maturation (FIG. 4A). Conversely the analysis identified GO term enrichment in female proteins for RNA binding and processing as well as for protein translation, relating to the translational repression mechanism that allows or just-in-time protein expression in the female gamete. The relevance of other enriched functions such as particular enzymatic activities in male (kinase, phosphatase) and female gametocyte proteins (transferase, isomerase, and oxidoreductase) remains to be determined.
Signatures of natural selection in male and female gametocyte proteins. All the major transmission blocking vaccine candidates (i.e., Pfs25, P47 and P230) are not exposed to the human immune system during infection (unless the infected RBCs are cleared) but become functional upon mosquito infection when they present on the gamete and/or ookinete surface and interact with host factors. For example, P47 has an important role in immune evasion that contributes to the differential susceptibility of A. gambiae M and S strains to P.
falciparum infection (25). The immunomodulatory role of P47 is reflected in unusual population structure with fixed differences between African and non- African parasite populations (26, 27). To systematically test for signatures of natural selection in the genes encoding the sets of male and female P. falciparum gametocyte proteins, we determined the rate of single nucleotide polymorphisms (SNPs) within a parasite population in Senegal (West Africa), and between this West African parasite population and a population from Papua New Guinea (26) (FIG. 4B). As a measure of balancing selection within the
Senegalese population, we calculated SNP π (N) for each gene based on a sequence comparison of a total of 25 sequenced parasite isolates (28). SNP π (N) quantifies the number of pairwise non-synonymous differences amongst the set of strains analyzed. As a measure for positive selection between populations, we also calculated Fst for each gene by comparing the genetic diversity within the African parasite population with the diversity in the PNG parasite population. As predicted, P47 showed one of the highest Fst levels amongst all the male and female proteins (FIG. 4B). Interestingly, the female gametocyte marker and major vaccine candidate Pfs25 has an even higher value, reflecting strong positive selection potentially due to selection of gamete recognition and compatibility. In addition, several hypothetical proteins are encoded by genes with high Fst such as the male-specific gene PF3D7 1430800 and the female-specific gene PF3D7 J 358400. Except for one gene encoding a conserved hypothetical male protein PF3D7_0313600, the sex-specific gene set shows significantly lower diversity within the African population than known markers of balancing selection such as MSP1 or SERA5. This would suggest that none of the male and female-specific proteins described here interact with the human immune system, either because these proteins are not present on the infected RBC surface or because of their low abundance during human infection.
Identification of P. falciparum-specific gametocyte sex proteomes. Once we had assembled the male- and female-specific protein lists based on conservation with P. berghei, we sought to determine if we can derive through the SSB approach the P. falciparum-specific sex partitioned protein lists. We first performed a principal components analysis using male and female-specific P. falciparum stage V proteomes (Pf-M and Pf-F, respectively), replicate Dd2 and NF54 stage V gametocyte proteomes, as well as FSgv and FSg1"11 protein lists (FIG. 5A). As expected the PCA clearly demonstrated enrichment for stage V proteins in NF54. To derive the putative male-specific stage V protein list, we compared the NF54-specific male list (443 proteins) with the FS Asx protein list and identified 354 proteins that likely represent the non-conserved falciparum-specific male proteome (FIG. 5B). To derive the putative female-specific stage V protein list, we first removed 573 proteins that are shared between Dd2FE/NF54-SP (864 proteins) and the ANKA Male-Female Common (762 proteins) protein lists. This step effectively filtered out proteins that would still be present in the Dd2- FE/NF54-SP list and that are conserved between falciparum and berghei. From this P.
falciparum female-specific protein list (291 proteins, FIG. 5C), we filtered out proteins that are also found in the FS Asx (1345 proteins) set to identify 177 stage V-specific female proteins (FIG. 9B). We were cognizant that the FS Asx dataset may not have captured all the late trophozoite or schizont/merozoite proteins that may be present in our samples, since GlcNAc treatment never completely removes all persisting asexual stages from a gametocyte culture. These "missed" asexual proteins are highlighted in the respective male and female lists (Tables S6A and S6C). Considering the presence of obvious merozoite/schizont contaminants, we conservatively assembled a list of 339 male andl74 female stage V specific proteins.
We further determined the degree of NF54 stage V specificity of proteins to stage V gametocytes by comparing DTgv with the FS Asx protein lists and noted that 860 proteins were conserved (FIG. 5D). These 860 proteins comprise 50% of the total DTgv proteome, and may represent proteins that are simply conserved between trophozoites and stage V gametocytes, or potential contaminating proteins that are present in the culture, despite the treatment with GlcNAc. Of the remaining 843 proteins from DTgv, 216 proteins were found to be conserved in the FSg1"11 dataset, indicating that these proteins are expressed early in gametocytogenesis and remain present on stage V gametocytes, given the apparent absence of stage I-II in the culture, as determined by microscopy (see above). The remaining 627 proteins that did not match with either the FS Asx or FSgI_II datasets, represents a potential pool of stage III-IV gametocyte markers in addition to those that are present in stage V. Of these 627 proteins, 422 proteins (67%) were identified in the membrane fraction and supported by GO predictions for cellular component and biological process. Of the 627, 188 proteins (30%) have predicted transmembrane domains and 52% (325/627 proteins) of which are conserved hypothetical proteins. Several previously described proteins appear in this putative list of Stage III-V markers, including four LCCL domain-containing proteins CCp2 (PF3D7_1455800), CCp3 (PF3D7_1407000), CCp5 (PF3D7_0109100) and FNPA (PF3D7 1451600), which all have hypothesized adhesive functions (23). CCp3 and CCp5 were found to be female-specific proteins in our analyses. The NIMA related kinases, NEK2 (PF3D7_0525900) and NEK4 (PF3D7_0719200) are also found in this list and categorized as female-specific proteins as well. There are 95 male-specific proteins present in this list, including the two dynein heavy chain proteins (PF3D7 1122900 and PF3D7 0905300). This short list of proteins represents a pool of well-studied targets that may be used to specifically select stage III gametocytes from culture.
Identification of the stage-specific male/female protein markers as an indicator for stage transition and to investigate the stage-specific Dd2 defect. Since Dd2 is defective in the production of mature, stage V male gametocytes (15), we hypothesized that the Dd2 proteome is more enriched in the stage I-II gametocytes, representing the small subset of rectangular and tear-drop forms that we had described from the Dd2 culture (Table 2).
Following PCA analysis, we observed that Dd2 clustered with gametocyte stages I-II proteins, which likely reflects the arrested male gametocytes in this strain. Moreover, the male specific and female specific stage V proteomes appear to be distinct from all other clusters. The PCA also shows biological reproducibility of our proteome, as NF54 and Dd2 replicates cluster clearly.
To identify the putative arrest of male gametocytes in Dd2 candidate male protein markers, we also sought to further narrow the Dd2 stage V gametocyte dataset into stage specific proteins, and thus compared the Dd2 gametocyte stage V proteome (1,337 proteins), referred to as Dd2gv, with the FS Asx and FSg1"11 datasets. We noted that 804 proteins were conserved between FS Asx and Dd2gv datasets (FIG. 5F). Of these, 603 Dd2 trophozoite- conserved proteins are also found in the NF54 trophozoite-conserved subset. These 603 proteins comprise 56% of the total Dd2gv proteome, and may similarly represent proteins that are conserved between trophozoite and stage V gametocytes, or contaminating proteins that remain present in the GlcNAc-treated culture. Of the remaining 533 proteins from Dd2gv, 189 proteins were found in the FSg1"11 dataset as well (FIG. 5C, indicating that these proteins are expressed early in gametocytogenesis and remain present on female stage V gametocytes. For Dd2, we found 344 proteins that are stage V-specific. Of these stage V proteins, 227 proteins (66%, 227/344) were identified in the membrane fraction, 62%
(142/227 proteins) are conserved hypothetical proteins with diverse predicted GO functions and 89% (127/142) of these proteins have predicted transmembrane domains.
Since Dd2 is defective in producing morphologically distinct stage V males, we examined whether the 189 Dd2 proteins shared with FSg1"11 are enriched in male gametocytes (FIG. 5H). We found that only 12 proteins were common between the Pf-M protein list (174 proteins) and the Dd2gWI set. These 12 proteins are also shared between the Pf-M and NF54- SP protein list, which is potentially male-specific, and the Dd2gWI set (data not shown). Of these 12 proteins, 2 proteins PF3D7_0508200 and PF3D7_1215100 had corresponding transcript markers for immature gametocytes (29), and were also thus absent from the stage V-specific Pf-M protein list (109 proteins). As expected, 46 proteins were found in Dd2gI_ 11 list that are orthologs of proteins that were shared between males and females in P. berghei. Twelve of these proteins have ~2-fold (or greater) enrichment in males in P. berghei.
Although we cannot be certain that the same fold-enrichment exists for falciparum, based on these analyses, only 24/189 (13%) of the Dd2gWI proteins are male; suggesting no male- specific enrichment. This is not unexpected given that the 162 remaining Pf-M proteins may be expressed only at stage III or IV during gametocytogenesis.
We also examined whether the 344 Dd2 proteins that are specific for Stage III-V are enriched in female proteins (FIG. 51). To test this hypothesis we looked for proteins in the Dd2gv stage-V specific protein list that are also found in the Pf-F (291 P. falciparum female- specific proteins) list that we had generated previously, which we then refined to only stage V-specific female proteins, Pf-F' (81 proteins). We observed that 28 proteins were not found in the Dd2gv stage-V specific protein list, and 53 proteins were conserved, suggesting that only 15% (53/344) of the Dd2gm"v specific protein list were in the combined Dd2/NF54 female protein list. It is possible that the number of mature stage V females in Dd2with the full protein complement is low; falling below the identification criteria threshold used in this study. There are 113 proteins that are shared between Dd2/NF54-SP Females and Dd2, which gives a total of 164 female-specific proteins in the Dd2gm"v list. The lack of enrichment in female proteins in this list may suggest that a significant proportion of the 178 Dd2gm"v proteins (Tables S7J) are male-female shared proteins or stage III males. In fact, only 26/178 (15%) of these proteins have orthologs in the ANKA male-female shared protein list. Moreover, expanding the Pf-Female protein list to include those that are not stage V- specific (to capture putative stage III-IV proteins) does not result in additional 'female hits' in the Dd2gm"v list (FIG. 9A). Moreover, of the 291 proteins that remain partitioned to Dd2gm" v, only 10% (30/291) have orthologs in the male-female shared protein list. Assuming that the developmental defect in Dd2 extends beyond the presence of mature males and also results in slower maturation of females, the 178 Dd2/NF54-SP female proteins may represent the remaining complement of mature stage V proteins. A comparison of the Dd2gv stage-V specific protein list with the Pf-M (P. falciparum male-specific) protein list identified 40 conserved proteins (FIG. 9B), which may include stage III male candidate markers. We found that two conserved proteins of unknown function, PF3D7_1413200 and PF3D7_1235800, had corresponding stage specific transcript markers for immature gams, i.e., stages II-IV (29) and another conserved protein,
PF3D7_1404200 had a corresponding mature (stage V) gametocyte transcript marker. The remaining 69 proteins may represent a pool of candidate stage IV -V male gametocyte markers. Indeed, we found that of the 10 proteins with corresponding stage-specific transcript markers, 5 were mature stage V gametocyte proteins, and 3 corresponded to young (stage I) or immature (II-IV) gametocytes. Two of the 10 proteins were predicted to be ring-stage specific, which are likely contaminants in the sample and the last protein did not have a predicted profile that was captured by the defined stages used in the Joice, et al. (2013) study (29).
Validation of the sex-specificity for a subset of female protein markers. We successfully generated mouse antibodies to three proteins (PF3D7_1218800;
PF3D7_0906100; PF3D7_0309100). PF3D7_1218800, PF3D7_0906100 and
PF3D7_0309100 were selected based on their predicted female-specificity using the ANKA male and female proteomes. We tested the stage specificity of these antibodies by staining NF54 male and female gametocytes (FIG. 5) and noted that antibodies for all three proteins stained fully "falciform" stage V gametocytes from day 17 cultures. Interestingly,
PF3D7_0309100 appears to differentiate falciform from stage IV -V transitioning
gametocytes, i.e., elongated gametocytes with no relaxing of the ends to those gametocytes with more pronounced curvature but not completely falciform (30). The antibodies were further validated by western blot analysis to assess stage specificity (FIG. 6A). We found that the anti-PF3D7_0906100 antibodies recognized a -28 kDa protein band (predicted
kDa) in both day 17 gametocyte and synchronized trophozoite lysates from NF54 and Dd2. However, the staining intensity appeared to be more pronounced for NF54 gametocytes and less so for Dd2 trophozoites. Anti-PF3D7_1218800 antibodies recognized a -37 kDa protein band (predicted Mr=39.6 kDa) and a lower MW band around 26 kDa in NF54 and Dd2 gametocytes only. However, the antibodies also recognized a similar lower Mr band, -26 kDa in the Dd2 trophozoite sample. The exact nature and identity of this protein band is not clear at present, but given the developmental defect in Dd2 during gametocytogenesis, we cannot rule out the possibility of dysregulated protein expression in the asexual stages of Dd2. Anti-PF3D7_0309100 antibodies appear to be highly specific to gametocytes in both NF54 and Dd2.
We further determined sex-specific staining by the antibodies using the morphological characteristics of male and female gametocytes (15) along with strong DAPI co-staining of DNA (FIG. 6B). Of the three antisera tested, two (PF3D7 1218800 and PF3D7 0906100) were found to be female specific. Antibodies to PF3D7_0309100, which is found in the "NF54-Dd2 Common Proteins", stained both males and females (FIG. 6B-C).
PF3D7 0906100 also referred to as a putative Developmental Protein was identified in our Dd2 stage V gametocyte protein list and in the Trophozoite protein list (8) and was therefore not included in any of the stage V specific male and female protein lists. Although the ortholog in P. berghei (PBANKA_041520) was included in the Female-specific protein list for P. berghei, a close examination of the spectral data revealed that it was identified by a single peptide only in a single replicate batch of purified females. It is likely that this protein exists in both males and females in P. berghei.
Discussion
One of the major caveats of the SSB approach is that the analysis is limited by the proteome size and accuracy of categorization. We recognized, a priori, that we are likely to miss out on a few potential male or female proteins, as we had noted in the comparison of our dataset with the previously published, FSgv mixed-sex proteome. However, it is also clear that given the differential efficiencies in proteome acquisition across MS approaches, the community must consider using the combined databases in their proteome mining studies for proteins of interest. For example, we were able to corroborate the identification of the non- (sex) partitioning, PIESP2 (PF3D7 0501200) in stage I-II and stage V gametocytes. It is a putative exported parasite-infected erythrocyte surface protein, with a predicted PEXEL motif, in stage V gametocytes. PIESP2 was notable in that transcript for this protein is virtually absent in stages I-II and stage V gametocytes (PlasmoDB) and it was also found to be potentially on the RBC membrane surface in asexuals and during liver stage development .
We had also observed the consistent partitioning of Dd2-specific proteins following our comparisons with the NF54 (DTgV) and the 3D7/NF54 (FSgV) stage V proteomes. Proteomic analyses of Dd2 has not been performed to date, but this observed partitioning is really unexpected as we would expect that the differences in gene content between the two falciparum strains should probably be minimal. While we have begun a partial analysis of the Dd2 developmental defect by identifying the enrichment of stage and male-specific proteins, the morphological differences observed even for the mature female Dd2 gametocytes suggest that the defect may also result in dysregulated expression of proteins that would not normally be present during 'normal' gametocytogenesis.
From a translational perspective, we have provided sex-specific information for several stage-specific gametocyte transcript markers that can be used to analyze blood samples taken during surveillance studies in malaria endemic countries. In the same vein, the antibodies that we have generated in this study may ultimately represent novel diagnostic markers for gametocyte carriage in the blood or other body fluid (e.g., urine or saliva) of infected but asymptomatic individuals. PF3D7 0906100 (conserved hypothetical protein), PF3D7_0309100 (a putive development gene) and PF3D7_1218800 (putative secreted ookinete protein, PSSP17) have not been well characterized to date. Previous attempts to knock out PSSP17 in P. berghei were unsuccessful and highlight the importance of this protein in parasite development in the asexual blood stages as well. The complete characterization of each of these proteins is the focus of current efforts in our laboratories, as they have potential as new transmission-blocking vaccine targets and/or sex-specific biomarkers of gametocyte carriage.
EXAMPLE 2: Development of a Rapid Diagnostic Test (RDT) for Asymptomatic Gametocyte Carriers.
Plasmodium falciparum sexual stage gametocyte parasites do not cause disease but are critical for transmission of the malaria parasite through the mosquito vector from one human to another. To date, no simple point of care diagnostic to identify gametocyte carriers and individuals with sub-microscopic asexual stage parasitemia exists. Current rapid diagnostic tests (RDTs) do not have enough sensitivity to identify such carriers. PCR is the only commonly used method for identifying, but it is costly and cannot be done in a rural health clinic in malaria endemic regions throughout the world. Current RDTs use blood as the biological sample source and in many countries in malaria endemic countries, cultural blood taboos exist, thereby limiting the usefulness of sampling blood from individuals who are not sick but are carriers. The present inventors have identified malaria parasite biomarkers for parasite carriage in the saliva of asymptomatic children in Cameroon and Zambia. Antibodies have been developed that can identify the sexual stage gametocyte in human saliva.
In particular embodiments, saliva is used as a biological source for parasite protein biomarkers (DNA has been the primary target). Antibodies (non-monoclonal) can already identify female-specific gametocyte proteins in saliva. No other group has been able to identify unequivocally more than 3-4 parasite proteins in saliva. The present inventors have identified 61 parasite proteins.
Because saliva is hypotonic, the present inventors hypothesized that infected red blood cells in the oral cavity vasculature carrying either asexual or gametocyte stages are carried by the gingival crevicular fluid (GCF) into saliva and lyse, releasing parasite-derived proteins into saliva, which can then be collected in a small volume. The GCF is a serum ultrafiltrate tissue fluid that seeps into the gingival sulcus from gingival connective tissue and the vasculature through thin sulcular epithelia. Periodontitis-related inflammation results in the further thinning of the sulcular epithelial membrane barrier. In turn, this results in an increase in GCF and an increase in serum transudate, including red cells and neutrophils. Gingivitis or periodontitis in general is widespread in developing countries. The present inventors hypothesized that due to potential gametocyte stage V sequestration in capillary beds, the extensive capillary loop structure and periodontitis that gametocyte and asexual stage parasitized red cells can transfer into the GCF, which mixes with saliva. The infected red cells then lyse in saliva releasing its parasite-derived proteins.
A low cost, non-invasive RDT with greater sensitivity is needed in malaria endemic countries, especially in those countries where current control methods are working. These countries are entering the pre-elimination phase and as they progress, the epidemiology of the disease changes from sick to carrier state. The current RDTs do not work in identifying these carriers. As described herein, the present inventors have generated the sex-specific
(male/female) proteomes of Plasmodium falciparum stage V gametocytes. Sixty-one P. falciparum proteins have been identified in the saliva of asymptomatic children.
In addition, the present inventors identified a female-specific, gametocyte protein across several samples. The present inventors also have developed antibodies against this protein and demonstrated its sex and stage specificity. To date, 392 saliva samples have been collected from asymptomatic children and comprehensively analyzed. The target female gametocyte protein has been identified in > 90% of the samples.
Furthermore, the present inventors have identified the target protein in about 12 microliters of saliva (unconcentrated) from several samples using the antibodies by western blot. They have also demonstrated the identification of the HRP2 protein from Plasmodium falciparum asexual stages in about 12 microliters of unconcentrated saliva samples by commercially available monoclonal antibodies on a western blot.
Paired-blood samples analyzed by current RDTs or by expert microscopy or
PCR/RTPCR have been collected and analyzed. The present inventors were able to identify asymptomatic carriers using the antibody to probe the human saliva at a level matching PCR/RTPCR. Blood samples that were analyzed using a current RDT were found to be negative, but positive by PCR and western blot.
We have identified 61 parasite-derived proteins in the saliva of asymptomatic children in Cameroon and detected and quantified a novel gametocyte-specific marker in a total 392 samples (12 unblinded and 380 blinded) from Cameroon and Zambia. We produced an antibody that is specific for this gametocyte protein in 12 μΐ of filtered, non-concentrated saliva from children who were determined to be negative by either a HRP2 rapid diagnostic test or expert microscopy from blood samples, but positive by PCR. We also demonstrated that anti-HRP2 antibodies recognize cognate antigen in the saliva of these asymptomatic individuals. Thus, the antibody-mediated detection is at the level of PCR-sensitivity.
Targeted Biomarker Discovery & Sensitivity Analyses using Laboratory Samples. Acquisition of the required baseline data and optimal analytical parameters prior to the analysis of the unblinded and blinded field samples.
We developed a robust, liquid chromatography tandem mass spectrometry (LC-
MS/MS) analytical approach using a quadrupole time-of-flight (QTOF) instrument at a sensitivity of -10-33 gametocytes^L (33 saliva digested peptides spiked with different amount of gametocytes protein digested peptides) and have surpassed the expected number of parasite-specific proteins that can be detected and identified in an artificial saliva sample containing serial dilutions of stage V gametocyte culture-derived parasite proteins.
We also developed a robust and simple workflow for the collection of unstimulated saliva in the field and the stabilization of host and pathogen-derived proteins in the saliva sample.
As described herein, we also produced mouse polyclonal antibodies against three gametocyte proteins. We noted that one protein, PSSP17/PF3D7_1218800 (FIG. 12A), a conserved, secreted protein from female gametocytes was among the 61 proteins detected across different saliva samples from asymptomatic children (FIG. 11). The fact that the male: female gametocyte ratio is generally skewed towards females provides additional support for selection of this protein as a gametocyte biomarker. We also selected a conserved hypothetical asexual protein (PF3D7_0507800) from this list of 61 that was also present within a majority of the saliva samples to confirm that other asexual antigens can serve as a biomarker. Targeted Biomarker Discovery & Sensitivity Analyses using Field-derived Samples. Acquisition of the potential spectrum of parasite-derived proteins from the saliva of asymptomatic children in Cameroon.
We collected 12 samples from 5-15 yr old children from Cameroon through a school - based sampling approach of children who were asymptomatic (of any febrile illness). Our LC-MS/MS analysis captured 61 of the most abundant parasite proteins from a pool of five different saliva samples from asymptomatic children; ~20-fold higher than what was previously reported from Gambian children with suspected malaria (Huang, et al, 2012). These proteins represent potential novel biomarkers of parasite carriage but do not likely exemplify the complete repertoire of malarial parasite proteins in saliva.
We then developed a more sensitive LC-Multiple Reaction Monitoring MS (MRM- MS) assay (Carr et al, 2014) using the stable isotope dilution method with an internal standard diagnostic peptide (with stable isotope-labeled Arg/Lys residues) derived from PF3D7_1218800 and PF3D7_0507800 using existing samples. This assay would permit the relative and absolute quantification of the biomarkers in saliva.
Field validation of targeted gametocyte stage V biomarkers. Analysis of blinded samples of saliva (which would include > 139 gametocyte positive samples and approximate the same number of gametocyte negatives +/- asexual parasitemia) from individuals recruited from malaria endemic countries.
We used the MRM-MS assay to determine the prevalence of two target candidate biomarkers PSSP17/PF3D7_1218800 and PF3D7_0507800 across a larger number of samples (N= 392) from two countries with differing malaria transmission characteristics. We collected paired saliva-blood or saliva-RDT samples from individuals residing in Yaounde, Cameroon (school-based sampling) and Nchelenge District, Zambia (household sampling), using the DNA genotek saliva collection device to collect 2 mL of saliva from asymptomatic children 5-15 years of age.
We collected a total of 392 saliva samples from Cameroon and Zambia (FIG. 12B). Of these, 12 samples were unblinded and were part of the initial collection in May 2013. The remaining 380 samples were completely blinded in terms of (i) identity and demographic information, (ii) presence/absence of gametocytes and asexuals in paired thick and thin blood smears, (iii) results of the paired HRP2 RDT, and (iv) the results following the nested PCR amplification of the Plasmodium cytochrome B gene from paired dried blood spots.
We analyzed a total of 380 blinded samples from Cameroon (N=338) and Zambia (Nchelenge District, N=42), and 12 unblinded samples from Cameroon. Of the total samples analyzed, 392 gave highly reproducible spectra and were thus considered valid
identifications. We observed that more than 90% of the saliva samples contained detectable levels of PSSP17/PF3D7 1218800 (gametocyte biomarker) and PF3D7_0507800 (asexual biomarker) and -88% of the samples contained both biomarkers (FIG. 12C). The Peak Area Ratio (PAR) of > 0.01 is the minimum threshold identified for an unequivocal identification and suggests potential abundance differences for each target biomarker in saliva.
We then directly tested the point of care bioassay potential of our targets by determining the capacity of anti-PF3D7_1218800 antibodies to detect antigen despite potential abundance differences across saliva samples (FIG. 12D). We have thus demonstrated that mouse antibodies that were generated against the stage V, female gametocyte-specific protein easily detected the target protein in a western blot using only 12 μΐ of saliva. Importantly, the saliva was only filtered through a 0.22 μιτι membrane to remove debris but remained otherwise unconcentrated. Using commercially available anti-P histidine rich protein-2 (HRP2) monoclonal antibodies, we were also able to demonstrate the abundance of HRP2 in saliva (FIG. 12E). To date, the identification of HRP2 by mass spectrometry has never been accomplished, owing to the intrinsic properties of this protein that affect detection of tryptic peptides by any mass spectrometry instrumentation using standard protocols. We now have proof-of-concept evidence that antibodies against known (HRP2) and novel (PSSP17) parasite proteins work directly on filtered and unconcentrated saliva.
Paired blood samples for each of the 338 blinded samples from Cameroon included thick and thin blood smears and 100 μΐ of finger-prick blood that was stored in RNAlater. The blood films were initially analyzed by microscopy at the time of collection and we subsequently determined if we can detect the presence of gametocytes in individuals that are microscopy negative by RTPCR amplification of the Pfs25 transcript (Bousema, et al, 2011; Mlambo, et al, 2008).
We have extracted RNA from 338 paired blood samples and have begun RT-PCR analyses. We were able to compare the various detection approaches, including MRM-MS, RDT, RTPCR/PCR and microscopy for a few samples to provide a general overview of the spectrum of observations thus far (FIG. 13). As we had shown previously for different saliva samples, our MRM results support our western blot data and easily identified asymptomatic carriers that would have otherwise been classified as negative by RDT or microscopy (gold standard). The RDT results for Case 21059 would likely have been interpreted to be a false positive, since the PCR analysis was negative. However, as clearly shown in FIG. 13, the saliva-derived western blot and MRM results suggest that the individual did in fact have parasitemia levels that should have been easily verified by PCR. Interestingly, although Pfs25 can be readily detected in the blood from individuals that are also microscopy positive for the presence of asexuals and/or gametocytes (data not shown), in some cases despite corroboration of negative microscopy data by RTPCR, we nonetheless identified the gametocyte protein in human saliva (Case D497 and CI 00). For Case 20990, this individual would have been classified as parasite negative because PCR, RDT and microscopy data were corroborative.
As described herein, we report the unequivocal presence of P. falciparum asexual and stage V gametocyte-specific "biomarker" proteins in the saliva of subclinical/asymptomatic children from two malaria endemic countries. Our analysis of 392 saliva samples demonstrates that a large proportion of asymptomatic and gametocytemic children are left undetected by the current molecular, RDT and gold standard approaches; further
underscoring the need for novel diagnostic tools to support malaria elimination and eradication efforts.
EXAMPLE 3: Synthetic Gene Sequence for PSSP17 that is Codon-Optimized for E. coli Expression
P. falciparum gametocyte diagnostic biomarker, PSSP17 (PlasmoDB.org accession #: PF3D7 1218800), which is a 39.6 kDa protein (394 amino acids) that is translated from a 1050 bp mRNA transcript. The natural sequence is published on PlasmoDB.org and can be accessed using that number. However, for the purpose of producing a highly immunogenic recombinant protein, only a subset of the entire protein sequence was selected based on physico-chemical properties of the protein including hydrophobicity, helicity, linearity, presence of predicted B cell epitopes and CD4+ T helper epitopes, surface exposure, and so forth, which yielded a 117 amino acid (351-bp) fragment. A synthetic (cDNA) 351-bp gene sequence for PSSP17 (SEQ ID NO: 7; amino acid sequence shown in SEQ ID NO:8) that is codon-optimized for expression in E. coli was then produced and subcloned to an expression vector to make the recombinant protein with a HIS tag for subsequent purification. The protein was then used to generate mouse and rabbit antibody against PSSP17 that exhibited high specificity for the target biomarker. It is envisioned that a quality and process controlled Research Cell Bank (RCB) is developed to ensure that the synthetic sequence-derived recombinant subunit PSSP17 can be made in large quantities for use as a positive control. The RCB is used as the seed line for downstream process development of clinical diagnostic grade material. The recombinant subunit protein is used to generate both a capture and detection monoclonal antibody for the saliva-based RDT for every production lot. The epitopes recognized by the monoclonal antibodies are mapped against the recombinant subunit protein and the antibodies themselves are sequenced. Importantly, the recombinant subunit protein is also provided as a critical component of the RDT kit as a positive control. Positive controls do not exist for the currently available RDTs that are being used to diagnose symptomatic malaria. These control proteins have been identified by the Foundation of Innovative New Diagnostics, the WHO, and Roll Back Malaria Program as a critical tool to allow ministries of health and end users in malaria-endemic countries to conduct random quality checks of RDT lots, many of which have been in storage for protracted periods of time and under different temperatures. It is therefore envisioned that, in particular embodiments, a lyophilized, highly standardized positive control is provided with each lot of the RDTs to ensure that RDTs from a given production lot are performing as claimed.
EXAMPLE 4: Saliva-based Malaria Asymptomatic & Asexual Rapid Test (SMAART) We have developed a novel, point-of-care, non-invasive, rapid diagnostic test kit to identify subclinical carriers with very low levels of malarial parasites in their blood and biofluids. The test uses monoclonal antibodies, against a Plasmodium falciparum female gametocyte stage specific biomarker that we have observed to be present in saliva from 5 to 15 year old asymptomatic children in malaria endemic areas such as Cameroon and Zambia. SMAART (Saliva-based Malaria Asymptomatic and Asexual Rapid Test) is a simplified, lateral flow immunoassay platform. The current sensitivity of SMAART is Europium chelate, visible fluorescence detection of 2-12 parasites^L. Importantly, the current rapid diagnostic tests deployed in the field and that detect only asexual, malaria parasite antigens in the field have a sensitivity of about 200 parasites^L of blood.
FIG. 14. shows the Lateral Flow Immunoassay (LFIA) detection of the gametocyte specific proteins, PSSP17. (A) Schematic for the gRAD LFIA (BioPorto, Denmark). (B) Malaria gametocyte biomarker PSSP17 in 20 of solution (saliva) was captured by biotinylated anti-PSSP17 10E2.B7 and immobilized on the Test line, which is striped with streptavidin. Detection of PS SP 17 was achieved by adding the EuChelate nanoparticle- conjugated anti-PSSP17 27C9.B5 mAb to the 20 reaction solution, and diluting out with 120 sample dilution buffer (SDB-50, BioPorto) to a final concentration of 140 μL. As a negative control, 100 ng/mL of PfHRP2 (final concentration in the reaction) was used as the spiked-in antigen and EuChelate labeled mAbs were detected on the control (CTRL) line as it is striped with anti-mouse IgG. As a positive control we used mature P. falciparum gametocyte lysate (estimated to be -150 gametocytes^L). The lower limit of detection of recombinant PSSP17 was between 1-5 ng/mL, which is about 3-12 gametocytes^L. The readout in panel (B) is an image acquired by a camera phone. In another embodiment, a phone application can convert the image into an inverted grayscale file that can perform relative quantification (densitometry) on the visible testy bands.
FIG. 15. shows capture of PSSP17 in "spiked-in" samples of recombinant PSSP17 in malaria naive human saliva. Determine LOD using spiked-in samples. (A) Recombinant PfHRP2 was spiked-in to naive human saliva and tested by the SMAART-HRP2 Lateral Flow Immunoassay (LFIA). Recombinant PbMIF (an irrelevant parasite protein) was used as a spiked-in control. (B) Recombinant PSSP17 was spiked-in to 20 naive human saliva and tested by the SMAART-PSSP17 LFIA. Recombinant HRP2 was used as a spiked-in control. LOD for PSSP17 was ~5 ng/mL (approximately 3-12 gametocytes^L of blood), whereas the LOD for PfHRP2 was 25 ng/mL. The reaction time was -15-20 minutes, and analyte concentration dependent. Fluorescence images were captured by camera phone and inverted. C, control line. T, test line.
FIG. 16. Shows the capture of native PSSP17 from saliva samples collected from asymptomatic and symptomatic children in Cameroon. Determined LOD using field samples. (A) PSSP17 was effectively captured from preserved, frozen saliva from three saliva samples from symptomatic children/young adults (5-19 years old) presenting at a clinic in Yaounde, Cameroon. (B) PSSP17 was effectively captured from three preserved, frozen saliva samples from asymptomatic children from a primary school in Mfou, Cameroon. These tests used blinded samples. Control naive human saliva (+ HRP2) samples were analyzed in parallel.
Table 6. Head to head comparison of SMAART vs. SD Bioline RDT and the gold standard
Microscopy
Figure imgf000061_0001
Samples showcased in FIG. 16 were unblinded and found to have the following metrics. The apparent LOD for our studies is at the equivalence of ~2 gametocytes/1000 WBC or -16 parasites^L of blood (the known detection limit of microscopy) and undetectable by SD Bioline RDTs targeting the blood stage biomarker PfHRP2. All the individuals were SD Bioline RDT-positive for asexual parasites, but 4 samples were gam-negative by microscopy. Interestingly, given the repeated absence of false positives from our spiked-in/native saliva analyses (FIGS. 14-16), SMAART can potentially be faster (parallel analysis of samples) and more sensitive than the 30+mins/slide "gold standard" microscopy (i.e., <16 parasites^L blood). Also, SMS9 (weakly positive) included sputum in the saliva sample, suggesting that even suboptimal samples remain useful with SMAART. We have shown that gram-negative, RDT-positive samples by microscopy are routinely found to be gram-positive by PCR.
Kit Components
In certain embodiments, the kit comprises ten (10) 1.2 ml microdilution tubes (Light Labs) containing lyophilized, biotinylated mAb 10E2.B7 for capture and EuChelate nanoparticle-conjugated mAb 27C9.B5 (FIG. 17A-B). The kit can also comprise ten (10) microdilution tubes containing lyophilized anti-PfHRP2 capture and detection mAbs (Arista Biologicals) (FIG. 17A-B). The kit can further comprise twenty (20) Lateral flow strips (FIG. 17C). Twenty (20) medicine cups (30 mL, Sarstedt, FIG. ID) are provided for saliva collection by drool method and twenty (20) sterile, 1.5 ml fine tip transfer pipette for transferring -15 μΐ of saliva (FIG. 17E) from the medicine cup to the microdilution tubes. The above components can be further partnered with saliva collection devices from many manufacturers, e.g., Oasis Diagnostics Pure- Sal™ device (FIG. 17F), Thermo Fisher Scientific's Oral Eze® device, DNA Genotek's OraGene® device or any derivation of the same or similar platforms. Furthermore, in the absence of a saliva collection device, small medicine cups such as those that are included in the kit can be used to collect saliva as per the described collection method below. Moreover, disposable paper or plastic cups that are available can be used in lieu of a medicine cup or a specific saliva collection device.
In particular embodiments, the kit comprises lateral flow strips, e.g., BioPorto's gRAD lateral flow immunoassay strips (N = 20). In certain embodiments, the strips are striped with streptavidin at the test line and anti-mouse IgG in the control line. Twenty (20) strips are provided with a dropper of sample dilution buffer (SDB) enough for 20 reactions (FIG. 17C).
The kit can further comprise a strip holder insert (e.g., cardboard) for imaging 10 strips at a time (FIG. 18). The box containing the kit components can also serve as the viewing box for 10 strips from different individuals that are analyzed at the same time (FIGS. 19-21).
In further embodiments, a battery powered 395 nm (51W equivalent/2000 lumens) LED UV flashlight is provided (FIG. 19). For example, with the purchase of 10 kits a 395 nm 9 UV LED flashlight is provided. With the purchase of 5 kits, a battery powered 395 nm 4W UV flashlight (including 4AA batteries and a replacement bulb) is provided (FIG. 20). An amber filter sheet sticker (Epak Electronics, Ltd. (United Kingdom)) is provided with each box to allow for camera phone image acquisition (FIG. 21). A filter is not required for visualization by eye.
Method Of Detection
Lateral Flow Immunoassay
Antibody Conjugation. Antibody immobilization procedure was adapted from previously published methods (Xiaofei Yuan et al. 2012; Etvi Juntunen et al. 2012). To activate MP carboxyl groups, 30 MPs in 120 MES buffer was combined with \5 μΐ. EDC to achieve an EDC:COOH stoichiometric ratio of 1. The reaction was incubated for 20 min and then 125 borate buffer (200 mM) and 50 μΐ, of 27C9.B5 (94^g/mL) were added to achieve 1.354mg Ab/M2 of MP surface area. Reaction was incubated for 1 h. MPs were then centrifuged. Supernatant was discarded and pellet was resuspended via sonication in 300 μΐ borate buffer (20mM). PEG solution was added to a concentration of 0.1% (w/v) and the reactions was incubated for 30 min, centrifuged, and resuspended in borate buffer (20mM) as before. Incubation steps were carried out at room temperature (RT) with gentle shaking, and centrifugation steps at 10,000 x g for 25 min at 4°C.
Anti-PF3D7_1218800 mAb 27C9.B5 IgG was covalently coupled to carboxylate- modified polystyrene microparticles (MPs, 1% w/v) with 0.099nm diameter, 37 A2 parking area, and Europium (Ill)-chelate (Thermo Fisher Scientific). l-Ethyl-3-(3- Dimethylaminopropyl) Carbodiimide Hydrochloride (EDC, Thermo Fisher Scientific) was diluted to 10 mg/mL. Coupling reactions were performed using 200 mM and 20 mM sodium tetraborate decahydrate buffer (pH 9), as well as 25mM MES buffer (pH 6.1). A 3% solution of Methoxypoly ethylene glycol amine (PEG, Mn=5000 g/mol, Sigma Aldrich) was used for blocking MPs. Final MP-27C9.B5 conjugate (MPAb) concentration was 0.1% (w/v). Anti- PSSP17 mAb 10E2.B7 IgG (Bio-Ab) was biotinylated using EZ-Link NHS-PE04- Biotinylation Kit (Thermo Fisher) at a 20: 1 Biotin: Antibody molar ratio.
Biomarker capture and detection using the LFIA strip. Sample Dilution Buffer (SDB50), Matrix Reduction Buffer (MRB), and gRAD OneDetection strips were provided by BioPorto (Hellerup, Denmark). Assays are carried out by combining \0 μΐ. of MRB:SDB50 1 : 10,000 with either \0 μΐ. of human saliva samples or control naive human μΐ. saliva spiked with recombinant PSSP17 to concentrations of 100 ng/mL to 0.5 ng/mL. To this 20 μΐ^ reaction, 1.5 μΐ, of both MPAb (1.87E12 MP/mL) and Bio-Ab (580 μg/mL) are added with a fine tip transfer pipette and allowed to incubate for 5 min. Using the same tube, 3 drops of 120 SDB50 are added to the same microdilution tube as a chase buffer. The strip is then placed into the microdilution tube to draw up the strip. Once the buffer has been wicked up, the n tube/strip can be laid down on the table top, and then the strip removed from the tube and allowed to air dry for up to 5 minutes. LFIA strips are then activated by a LOFTEK® 51 UV LED handheld Flashlight 395 nM and imaged using an amber filter and an iPhone 5s 8 megapixel (MP) camera. All the UV LED hand held flashlights will work with the LFIA. However, any smart phone with a camera with >8 MP can be used for image acquisition. Android-based smart phones will allow for image analysis as described below. It is anticipated that working with cell phone manufacturers that a UV LED flash open can be utilized.
Data Storage. Cataloging And Quantification
Image acquisition by a camera phone (> 8 MP) would allow for analysis of the image in grayscale using image analysis algorithms akin to those that have been developed for MATLAB, ImageJ and "reader" software in R. The fluorescence image is first converted into grayscale and the intensity (pixel) of the Test line is compared to the Control line.
Alternatively, the intensity can be compared to a stored value for intensity based on readings using a standard curve with recombinant PSSP17 in known concentrations (FIG. 22).
Negative control saliva was spiked with the irrelevant P. falciparum HRP2 protein and analyzed with the PSSP17 lateral flow strips. Serial dilutions of recombinant PfPSSP17 were spiked into uninfected, naive human saliva to generate a standard that allows for the measurement of pixel intensity for the test and control lines and a comparison of the ratio of test/control line for each standard. An android-based app can be developed for image analysis. For all assays, only 10 of spiked-saliva were analyzed. Limit of detection for the assay is -50 pg of PSSP17. The 100 ng/mL strip takes about 4-5 mins to "develop". The 10 ng/mL strip takes about 20 mins to develop. As a positive control we used mature P. falciparum gametocyte lysate (estimated to be -150 gametocytes^L). The lower limit of detection of recombinant PSSP17 was between 1-5 ng/mL, which is about 3-12
gametocytes^L. This has been verified using a real field sample from a gametocytemic child in Cameroon, wherein the limit of detection of microscopy of 16 gametocytes/ of blood was matched by SMAART detection of PSSP17 in the saliva from the same child (C328).
Each strip can be dried and stored in the dark to further improve image acquisition and analysis up to 1 month following collection. Drying the strip for longer than 30 mins can greatly improve test control intensity for samples with lower abundance of the biomarker. Images acquired by camera phone can be uploaded to a local ministry of health cloud data repository or a cloud drive in another country, to facilitate real-time surveillance data reporting, cataloging and analysis.
EXAMPLE 5: Use of SMAART for detection of P. vivax gametocvte carriage
Plasmodium falciparum PSSP17 (Pfpsspl7) and its ortholog in P. vivax (Pvpsspl7) share 80% amino acid (aa) sequence identity (FIG. 23). Importantly, the region (bar) used to raise monoclonal antibodies for detection and capture of PSSP17 from human saliva has 87% (102/117 aa) sequence identity. Signal peptide is shown as an arrow for Pfpsspl7 (as determined by SignalP v. 4.1 algorithm). It is expected that the compositions and methods of the present invention can be used to detect P. ovale, P. malariae and P. knowlesi.
The SMAART Lateral Flow Immunoassay prototype can detect the presence of the P. vivax gametocyte PSSP17 in 10 μΐ of unprocessed, blinded saliva from adults presenting at a clinic in Manaus, Brazil. See FIG. 24. Image was captured by camera phone and inverted. Of the 9 saliva samples tested, four (4) were positive (red arrows) at the test line (T). Once unblinded, the samples were found to be from individuals who are were found to be positive by microscopy for asexual blood stages of P. vivax upon patient intake at the clinic (Day 1, left panel). However, given the difficulty in identifying P. vivax gametocytes,
gametocytemia was not determined for each blood smear. P. vivax gametocytes are present in the blood at the same time as asexual stages during the primary attack, which is quite different from P. falciparum. Although P. vivax gametocytes appear very early in infection and represent less than 2% of the total parasite biomass, they are also short-lived. Individuals presenting at a clinic with symptomatic malaria may or may have detectable gametocytes in their blood, since they would presumably be at different stages of the infection cycle. The same individuals were treated with Primaquine and re-screened at Day 7 (right panel) following treatment. The patients were all microscopy-negative following drug treatment. However, we determined that saliva from patient #2 appeared to remain faintly positive for P. vivax gametocytes. Whereas, saliva samples analyzed from patient #3, #5 and #8 suggest that parasite clearance was complete following drug treatment. This study demonstrates the utility of the SMAART test to determine parasite clearance after drug treatment, specifically for stages that are responsible for transmission to mosquitoes.

Claims

We claim
1. An antibody or fragment thereof that specifically binds SEQ ID NO: 8.
2. The antibody of claim 1, wherein the antibody comprises (a) a variable heavy chain comprising SEQ ID NO:20; and (b) a variable light chain comprising SEQ ID NO:40.
3. The antibody of claim 1, wherein the antibody comprises (a) a variable heavy chain comprising SEQ ID NO: 60; and (b) a variable light chain comprising SEQ ID NO: 80.
4. An antibody comprising (a) a variable heavy chain comprising the complementarity determining regions (CDRs) shown in SEQ ID NOS:23, 25 and 27; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:43, 45 and 47.
5. An antibody comprising (a) a variable heavy chain comprising the CDRs shown in SEQ ID NOS:63, 65 and 67; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:83, 85 and 87.
6. A kit comprising (a) at least one antibody that specifically binds PSSP17; and (b) a detection reagent for detecting the presence of PSSP17 in a saliva sample obtained from a subject suspected of having a malaria parasite.
7. The kit of claim 6, further comprising (c) at least one antibody that specifically binds histidine rich protein 2 (HRP2); and (d) a detection reagent for detecting the presence of HRP2 in a saliva sample obtained from a subject suspected of having a malaria parasite.
8. The kit of claim 6 or 7, further comprising a lateral flow immunoassay device.
9. The kit of any one of claims 6-8, further comprising a positive control for PSSP17, wherein the positive control is the amino acid sequence shown in SEQ ID NO: 8.
10. The kit of any one of claims 6-9, wherein the at least one antibody that specifically binds PSSP17 comprises an antibody that specifically binds SEQ ID NO:8.
11. The kit of any one of claims 6-9, wherein the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising SEQ ID NO:20; and (b) a variable light chain comprising SEQ ID NO:40.
12. The kit of any one of claims 6-9, wherein the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising SEQ ID NO:60; and (b) a variable light chain comprising SEQ ID NO: 80.
13. The kit of any one of claims 6-9, wherein the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising the complementarity determining regions (CDRs) shown in SEQ ID NOS:23, 25 and 27; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:43, 45 and 47.
14. The kit of any one of claims 6-9, wherein the at least one antibody that specifically binds PSSP17 comprises (a) a variable heavy chain comprising the CDRs shown in SEQ ID
NOS:63, 65 and 67; and (b) a variable light chain comprising the CDRs shown in SEQ ID NOS:83, 85 and 87.
15. A rapid diagnostic test kit for the malaria parasite Plasmodium comprising:
a. a plurality of capture reagents that bind to one or more of the proteins listed in
FIG. 11;
b. a detection agent for detecting the presence of one or more of the proteins listed in FIG. 11 that bind to the capture reagents;
c. a container for collecting a sample from an individual; and
d. instructions for collecting a sample from the individual, incubating the plurality of capture reagents, detecting the presence of the capture reagents bound to the proteins.
16. The kit of claim 15, wherein the one or more proteins listed in FIG. 11 comprises PF3D7_1218800 (PSSP17).
17. The kit of claim 16, wherein the one or more proteins listed in FIG. 11 further comprises PF3D7_0507800.
18. The kit of claim 15, wherein the kit further comprises a capture reagent that binds to histidine rich protein 2 (HRP2).
19. The kit of claim 15, wherein the capture reagent is an antibody.
20. The kit of claim 15, further comprising a positive control protein comprising SEQ ID NO:8.
21. A method for identifying the malaria parasite Plasmodium in a human subject comprising the steps of:
a. incubating a saliva sample obtained from the subject with an antibody that specifically binds PSSP17, wherein the presence of PSSP17 creates one or more antibody:PSSP17 complexes;
b. applying a detection agent that detects the antibody-PSSP17 complexes; and c. identifying the subject as having the malaria parasite Plasmodium where the antibody-PSSP17 complexes are detected.
22. A method for treating a human subject identified as having the malaria parasite Plasmodium comprising the steps of:
a. incubating a saliva sample obtained from the subject with an antibody that specifically binds PSSP17, wherein the presence of PSSP17 creates one or more antibody:PSSP17 complexes
b. applying a detection agent that detects the antibody:PSSP17 complexes; and c. administering a malaria treatment to the subject where the antibody:PSSP17 complexes are detected.
PCT/US2016/037968 2015-06-17 2016-06-17 Compositions and methods for detection of malaria parasite biomarkers Ceased WO2016205585A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/736,838 US12049494B2 (en) 2015-06-17 2016-06-17 Compositions and methods for detection of malaria biomarkers
ZA2018/00191A ZA201800191B (en) 2015-06-17 2018-01-10 Compositions and methods for detection of malaria parasite biomarkers

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562180705P 2015-06-17 2015-06-17
US62/180,705 2015-06-17

Publications (1)

Publication Number Publication Date
WO2016205585A1 true WO2016205585A1 (en) 2016-12-22

Family

ID=57546289

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/037968 Ceased WO2016205585A1 (en) 2015-06-17 2016-06-17 Compositions and methods for detection of malaria parasite biomarkers

Country Status (3)

Country Link
US (1) US12049494B2 (en)
WO (1) WO2016205585A1 (en)
ZA (1) ZA201800191B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108088996A (en) * 2017-12-08 2018-05-29 深圳市检验检疫科学研究院 Malaria quickly detects
CN113884453A (en) * 2021-09-30 2022-01-04 太原理工大学 Smartphone-based immunoturbidimetric detection device and its application in the rapid detection of myocardial infarction markers

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180348218A1 (en) * 2017-06-05 2018-12-06 Tokitae Llc Serology assay for recent malaria infection
US20230203466A1 (en) * 2020-04-03 2023-06-29 Medgenome Inc. Ace2 receptor polymorphisms and varying susceptibility to sars-cov-2, methods for diagnosis and treatment

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050004346A1 (en) * 2001-08-16 2005-01-06 Dziegiel Morten Steen Hanefeld Recombinant anti-plasmodium falciparum antibodies

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7205159B2 (en) 2001-08-20 2007-04-17 Proteome Systems Intellectual Property Pty Ltd. Diagnostic testing process and apparatus
US20040087874A1 (en) 2002-10-28 2004-05-06 David Schneider Saliva collection system
WO2010058059A1 (en) 2008-11-18 2010-05-27 University Of Jyväskylä A method for detecting specific nucleotide sequences
US8641642B2 (en) 2008-12-01 2014-02-04 Oasis Diagnostics Corporation Biological sample collection system
WO2010099607A1 (en) 2009-03-02 2010-09-10 Fio Corporation Diagnostic test panel for the diagnostic of malaria and severe bacterial infections
US8367350B2 (en) 2009-04-29 2013-02-05 Morehouse School Of Medicine Compositions and methods for diagnosis, prognosis and management of malaria
US20100279319A1 (en) 2009-04-29 2010-11-04 Stiles Jonathan K Detection of plasmodium falciparum histidine-rich protein II in saliva malaria patients
US8287719B2 (en) 2010-02-09 2012-10-16 Empire Technology Development Llc Methods for the detection and diagnosis of malaria using an electrochemical sensor
US8445192B2 (en) 2011-09-26 2013-05-21 Carnegie Mellon University Device and method for detection and identification of immunological proteins, pathogenic and microbial agents and cells
CN104169719B (en) 2011-12-29 2017-03-08 思迪赛特诊断有限公司 Methods and systems for detecting pathogens in biological samples
EP2696193A1 (en) 2012-08-06 2014-02-12 Andrew Wheeler Assay detection systems and methods

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050004346A1 (en) * 2001-08-16 2005-01-06 Dziegiel Morten Steen Hanefeld Recombinant anti-plasmodium falciparum antibodies

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 27 May 2010 (2010-05-27), XP013505912 *
FUNG ET AL.: "`Quantitative detection of Pf HRP2 in saliva of malaria patients in the Philippine s", MALARIA JOURNAL, vol. 11, 2012, pages 1 - 9 *
NGWA ET AL.: "Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito", BMC GENOMICS, vol. 14, 2013, pages 1 - 21, XP021147857 *
TAO ET AL.: "Sex-partitioning of the Plasmodium falciparum stage V gametocyte proteome provides insight into falciparum-specific cell biology", MOLECULAR & CELLULAR PROTEOMICS, vol. 13, no. 10, 2014, pages 2705 - 2724, XP055338549 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108088996A (en) * 2017-12-08 2018-05-29 深圳市检验检疫科学研究院 Malaria quickly detects
CN113884453A (en) * 2021-09-30 2022-01-04 太原理工大学 Smartphone-based immunoturbidimetric detection device and its application in the rapid detection of myocardial infarction markers
CN113884453B (en) * 2021-09-30 2024-05-14 太原理工大学 Detection device based on smart phone immune turbidimetry

Also Published As

Publication number Publication date
ZA201800191B (en) 2021-10-27
US20190256586A1 (en) 2019-08-22
US12049494B2 (en) 2024-07-30

Similar Documents

Publication Publication Date Title
Ndao Diagnosis of parasitic diseases: old and new approaches
Guirgis et al. Gold nanoparticle-based fluorescence immunoassay for malaria antigen detection
EP2530466B1 (en) Method and device for trichomonas detection
JP3887340B2 (en) Norovirus or Sapovirus specimen dilution and virus detection reagent
US12049494B2 (en) Compositions and methods for detection of malaria biomarkers
Nagaoka et al. PfMSA180 is a novel Plasmodium falciparum vaccine antigen that interacts with human erythrocyte integrin associated protein (CD47)
JP2025098086A (en) Tau protein detection method using blood sample as specimen
US9851352B2 (en) Compositions and methods for identifying Ehrlichia species
JP6639408B2 (en) Method for detecting arteriosclerosis and cancer using deoxyhypusine synthase gene as an index
WO2015001383A1 (en) Peptides and methods for the detection of leishmaniasis
US20210364515A1 (en) Optimizing diagnostics for galactofuranose containing antigens
Edaye et al. Characterization of native PfABCG protein in Plasmodium falciparum
JP5221825B1 (en) Method for detecting lung squamous cell carcinoma
US8741288B2 (en) Protein markers for detecting liver cancer and method for identifying the markers thereof
EP3919503A1 (en) Method for identifying helicobacter pylori strain and kit for identification
CN117607443B (en) Biomarker combinations for diagnosing breast cancer
FR2996918A1 (en) ANTIGENES GRA RECOMBINANTS AND THEIR APPLICATION FOR THE EARLY DIAGNOSIS OF TOXOPLASMOSIS
TW201323879A (en) Soluble CD14 as a biomarker for inspecting coronary artery disease
Bisht et al. Chapter-8 Current Trends in the Diagnosis of Haemoprotozoan Diseases
Blatch et al. Bassem SS Guirgis, Cláudia Sá e Cunha, Inês Gomes, Miguel Cavadas, Isabel Silva, Gonçalo Doria, Gregory
KR20030088294A (en) Petecting method and diagnostic kit for detecting of Plasmodium lactate dehydrogenase(pLDH) in human whole blood by rapid immunochromatographic assay and enzyme-linked immunosorbent assay(ELISA)
JP2016191581A (en) Detection method of trypanosome infection
HK1178974B (en) Method and device for trichomonas detection

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16812484

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16812484

Country of ref document: EP

Kind code of ref document: A1