WO2016205239A1 - Non-hormonal mammalian sperm decoy contraception based on the n-terminus of the zp2 protein - Google Patents

Non-hormonal mammalian sperm decoy contraception based on the n-terminus of the zp2 protein Download PDF

Info

Publication number
WO2016205239A1
WO2016205239A1 PCT/US2016/037428 US2016037428W WO2016205239A1 WO 2016205239 A1 WO2016205239 A1 WO 2016205239A1 US 2016037428 W US2016037428 W US 2016037428W WO 2016205239 A1 WO2016205239 A1 WO 2016205239A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
mammalian
sperm
solid support
bound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/037428
Other languages
French (fr)
Other versions
WO2016205239A8 (en
Inventor
Jurrien Dean
Matteo Alessandro AVELLA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Publication of WO2016205239A1 publication Critical patent/WO2016205239A1/en
Publication of WO2016205239A8 publication Critical patent/WO2016205239A8/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/689Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to pregnancy or the gonads
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/36Gynecology or obstetrics
    • G01N2800/367Infertility, e.g. sperm disorder, ovulatory dysfunction

Definitions

  • compositions comprising an N-terminal region of the zona pellucida 2 (ZP2) protein and its use, such as for reversible contraception in mammals and for selection of sperm exhibiting an enhanced ability to bind and penetrate the zona pellucida.
  • ZP2 zona pellucida 2
  • the present disclosure describes the identification of a region within the N-terminus of the ZP2 protein that is required for sperm to bind the zona pellucida of an ovulated egg. It is further disclosed herein that N-terminal ZP2 peptides bound to a solid support can decoy sperm to prevent fertilization in vitro. Also disclosed is the finding that mammalian ZP2 peptides bound to a solid support can be used to select sperm capable of binding and penetrating the zonae pellucidae of ovulated eggs.
  • mammalian ZP2 peptides bound to the solid support are provided herein.
  • the mammalian ZP2 peptide is no more than 100 amino acids in length and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, or the corresponding residues from a mammalian homolog of ZP2, such as a mouse, rat, dog, cat, cow, pig, horse or elephant homolog of ZP2.
  • the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, or the corresponding residues from a mammalian homolog of ZP2, and the solid support comprises a contraceptive device.
  • the contraceptive device can be, for example, an intrauterine device, a sponge, a diaphragm, a cervical cap or a vaginal ring.
  • the method includes administering to the subject by intravaginal or intrauterine administration a therapeutically effective amount of a mammalian ZP2 peptide bound to a solid support.
  • the solid support comprises a contraceptive device, such as an intrauterine device, a sponge, a diaphragm, a cervical cap or a vaginal ring.
  • the method includes providing a sperm sample from a mammal; contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide; and isolating the sperm bound to the mammalian ZP2 peptide.
  • the present disclosure also provides a method of diagnosing infertility in a male subject of a mammalian species.
  • the method includes obtaining a sperm sample from the subject; contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide; quantifying the number of sperm bound to the mammalian ZP2 peptide; and diagnosing infertility in the subject if the number of sperm is below a threshold level required for fertility in the mammalian species.
  • FIGS. 1A-1B Phylogeny and domain structure of zona pellucida proteins. (FIG. 1 A)
  • FIG. IB Schematic representation of the four zona pellucida proteins with 8 or 10 conserved cysteine residues. The resultant disulfide bonds differ in the zona domains of the ZP1/2/4 and ZP3 clades and are indicated as A and B, respectively.
  • the post- fertilization cleavage site is marked on ZP2, and both ZP1 and ZP4 contain trefoil domains.
  • FIGS. 2A-2B Truncated ZP2 does not support sperm binding.
  • FIG. 2 A Representation of secreted ectodomains of normal mouse zp2 35-633 md truncated ZP2 lacking ZP2 51 149 . Cysteine residues are shown in yellow. Monoclonal antibodies that bind N and C terminal to the post- fertilization cleavage site (arrowhead) and zona domains are indicated.
  • FIG. 2B Immunoblot of eggs (15) from moQuad (3 ⁇ 4 " Zi> ⁇ (1) and moQuad-Z J p2 r 'TM c (2) mice stained with domain-specific monoclonal antibodies. Molecular masses are indicated on the left.
  • FIGS. 3A-3D Human sperm binding to the zona pellucida requires human ZP2.
  • FIG. 3A Litter sizes after transcervical insemination of control (Cd9 +/ ⁇ ) mice compared with natural mating (top).
  • PVS perivitelline space
  • FIG. 3B As in FIG. 3A, but with huZP2 Rescue (top) and huZP3 Rescue (bottom) eggs after transcervical insemination with human sperm.
  • FIG. 3A Litter sizes after transcervical insemination of control (Cd9 +/ ⁇ ) mice compared with natural mating (top).
  • PVS perivitelline space
  • FIG. 3B As in FIG. 3A, but with huZP2 Rescue (top) and huZP3 Rescue (bottom) eggs after transcervical insemination with human sperm.
  • FIG. 3B As in FIG. 3A, but with huZP2 Rescue (top) and hu
  • FIG. 3C In vivo oviduct transfer of human sperm (2.3 x 10 3 sperm in 0.5 ⁇ ) to hormonally stimulated, anesthetized huZP2 Rescue and huZP3 Rescue female mice.
  • FIG. 3D As in FIG. 3B, but after in vivo oviductal transfer.
  • FIGS. 4A-4C Taxon-specific sperm recognition of the N terminus of chimeric ZP2.
  • FIG. 4A Ectodomains of huZP2, chimeric hu/moZP2, and chimeric mo/huZP2 proteins. Red and green, human and mouse protein, respectively. Yellow, conserved cysteine residues. Post-fertilization cleavage site (arrowhead) and zona domains are indicated.
  • FIG. 4B Schematic of human (red) and mouse (green) recombinant peptides in which mouse ZP2 52 ⁇ 83 , ZP2 85 ⁇ 101 , or ZP2 103 ⁇ 133 replace the corresponding human sequence.
  • FIG. 4C Box plots reflect the median (vertical line) number of human sperm binding to peptide beads (left) and data points within the 10th and 90th percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots.
  • FIG. 5 Model of gamete recognition on the surface of the zona pellucida.
  • the mouse zona pellucida (aquamarine) is composed of ZP1, ZP2 and ZP3, and surrounds ovulated eggs and early embryos.
  • Sperm capacitated by passage through the female reproductive tract, bind on the surface of the zona pellucida to an N-terminal domain of ZP2 in unfertilized eggs.
  • gametes fuse at fertilization and activate the egg. This triggers egg cortical granule migration and fusion with the plasma membrane, which releases ovastacin, a zinc metalloendoprotease that cleaves ZP2 at 166 LA jDE 169 .
  • the immediate post-fertilization block to polyspermy prevents additional sperm from fusing with eggs or penetrating through the zona pellucida matrix.
  • the most definitive block is secondary to the proteolytic destruction of the sperm binding domain at the N terminus of ZP2. If sperm do not bind, they will not penetrate nor fuse with the egg's plasma membrane.
  • FIGS. 6A-6B Transgenes encoding truncated isoforms and human/mouse chimeric ZP2.
  • FIG. 6A Exon maps of endogenous mouse Zp2 (moZp2) and transgenes of truncated mouse Zp2 (moZp2 Tmnc ), chimeric hu/moZp2, human ZP2 (huZP2), and chimeric mo/huZP2 assembled from BAC clones by DNA recombineering. Exons are indicated by the numbers below each map; red and green exons encode human mouse proteins, respectively.
  • FIG. 6B Tissue-specific expression of transgenes was determined by reverse transcription followed by RT-PCR of total RNA isolated from tissues from transgenic, normal (Nor), and rescue (Res, transgenic line crossed into the Zp2 Nu11 background) mouse lines.
  • H heart; B, brain; K, kidney; Lu, lung; S, spleen; Li, liver; U, uterus; T, testis; O, ovary.
  • RT-PCR products from primers (Table 4): mouse Zp2, 703 bp; hu/moZp2, 439 bp; mo/huZP2, 411 bp; and moZp2Trunc, 332 bp. Detection of Gapdh (510 bp) was used to ensure the integrity of isolated RNA.
  • FIGS. 7A-7B Transcervical insemination and sperm binding in transgenic mice.
  • FIG. 7A Schematic representation of transcervical insemination.
  • Transgenic female mice were stimulated to ovulate with gonadotropins, inseminated with human sperm (3 x 10 7 in 100 ⁇ ), and mated with vasectomized males to mimic physiological copulations. Eggs were collected 2 hours later and fixed, then z projections from confocal microscopy were used to determine the number of sperm that had accumulated in the perivitelline space.
  • FIG. 7B Coomassie blue-stained SDS-PAGE of recombinant ZP2 peptides expressed in HIGH FIVETM cells after purification of IMAC beads. Molecular mass is shown on the left.
  • FIGS. 8A-8D Mouse and human sperm bind to the N-terminus of ZP2. (FIG. 8A)
  • FIG. 8B Schematic of the transgene used to establish the Acr mCherry transgenic mice.
  • FIG. 8B Schematic of moZP2 35"149 (blue) and huZP2 39"154 (grey) peptides at the N-terminus of ZP2 (tan) that mediate sperm- egg binding in mice and human, respectively. Inverted triangle, mouse ZP2 167 LA l DE 170 post- fertilization cleavage site; zona domain, ZP2 365 63U .
  • FIG. 8C Model of moZP2 35"149 or huZP2 39"154 peptide-beads interacting with uncapacitated and capacitated sperm.
  • FIG. 8C Model of moZP2 35"149 or huZP2 39"154 peptide-beads interacting with uncapacitated and capacitated sperm.
  • FIGS. 9A-9D The N-terminus of moZP2 acts to decoy sperm in vitro and prevents mouse fertilization.
  • FIG. 9A Schematic of in vitro fertilization in which mouse eggs in cumulus were incubated overnight with 1 x 10 5 progressive-motile mouse sperm in HTF (500 ⁇ ) in the presence of moZP2 35"154 peptide-beads (100 ⁇ ).
  • FIG. 9B In vitro fertilization (%) after co-incubation of eggs in cumulus with media (no beads), beads alone or ZP2 peptide-beads.
  • FIG. 9A Schematic of in vitro fertilization in which mouse eggs in cumulus were incubated overnight with 1 x 10 5 progressive-motile mouse sperm in HTF (500 ⁇ ) in the presence of moZP2 35"154 peptide-beads (100 ⁇ ).
  • FIG. 9B In vitro fertilization (%) after co-incubation of eggs in cumulus with
  • FIG. 9C Progressive-motility of unbound capacitated and uncapacitated mouse sperm in media with ZP2 peptide-beads during 8 hours after insemination.
  • FIG. 9D Percentage of acrosome-intact sperm that remain bound to ZP2 peptide- beads during 8 hours after insemination.
  • FIGS. lOA-lOC N-terminus of human ZP2 prevents zona matrix penetration of human sperm.
  • FIG. 10A Same as FIG. 9A except 1 x 10 5 progressive-motile human sperm were added to aZP2 Rescue eggs in cumulus in the presence of huZP2 39"154 peptide-beads or beads alone.
  • FIG. 10B Same as FIG. 9C except with human sperm.
  • FIG. IOC HuZP2 Rescue eggs in cumulus were inseminated with capacitated human sperm in the presence of media (no beads), beads alone and huZP2 peptide- beads.
  • Eggs were fixed and stained with WGA-633 and Hoechst to detect zonae pellucidae and nuclei, respectively.
  • the numbers of eggs (avg. ⁇ s.e.m.) with 0, 1, 2, 3 or >3 sperm in the perivitelline space was determined for each experimental group.
  • the total number of eggs analyzed in three independent experiments is indicated above each graph.
  • FIGS. 11A-11D Selection of human sperm competent for binding and zona pellucida penetration.
  • FIG. 11A Human sperm from two donors (A and B) were unselected (1) or selected on the basis of binding to beads alone (2) or to huZP2 peptide-beads (3) and tested for their ability to bind to the surface of the zona pellucida (stained with WGA-633) surrounding uZP2 Rescue eggs (see FIG. 16C). Box plots reflect the median (horizontal line) number of human sperm binding and data points within the 10 th and 90* percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots. (FIG.
  • FIG. 11C Same as (FIG. 11 A), but assayed for sperm penetration into the perivitelline space.
  • FIG. 1 ID Same as (FIG. 1 IB), but for sperm present in the perivitelline space.
  • FIG. 12 Schematic of female mouse reproductive tract with transcervical delivery of beads into the bilateral uterine horns. Precocious interaction with moZP2 peptide-beads in the uterus prevents normal sperm migration through the uterotubal junction (UTJ) into the oviduct which results in female infertility.
  • UJ uterotubal junction
  • FIGS. 13A-13B Mouse ZP2 35"149 peptide-beads provide long-term reversible
  • FIG. 13 A Female mice were mated after transcervical administration of media (control), beads alone or moZP2 peptide-beads and fertilization was determined by the presence of 2- cell embryos in the oviduct 40 hours later.
  • FIG. 13B The number and time of live births from two litters of female mice (5) continuously mated after transcervical administration of media (control), beads alone or moZP2 peptide-beads. Days (avg. ⁇ s.e.m.) after mating.
  • FIGS. 14A-14C Effect of capacitation on sperm binding to ZP2 peptide-beads.
  • FIG. 14A To detect Acr" 1016 " 7 transcripts in transgenic mice, total RNA was extracted from brain (Br), lung (Lu), heart (H), liver (Li), kidney (K), uterus (U), ovary (Ov) and testis (T), and analyzed by RT-PCR using transgene specific primers (see Table 6). GAPDH was used to as a load control and to ensure integrity of RNA.
  • FIG. 14B Sperm viability, progressive-motility, in vitro fertilization and litter size of:
  • FIG. 14C Quantification of binding of uncapacitated AcrTM 3 TM and capacitated Acr 1 " 0116 " 7 sperm alone or mixed 1 : 1 to cumulus-free mouse eggs in which box plots reflect the median (vertical line) number of sperm binding to mouse eggs and data points within the 10 th and 90 th percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots.
  • FIGS. 15A-15B Uncapacitated and capacitated sperm bind and rotate moZP2 peptide- beads.
  • FIG. 15A Uncapacitated Acr ⁇ 1 ⁇ mouse sperm binding to moZP2 peptide-beads. Number of sperm bound per bead was quantified from z projections. Box plots reflect the median (horizontal line) number of mouse sperm binding to moZP2 peptide-beads and data points within the 10 th and 90 th percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots.
  • FIG. 15B Same as (FIG. 15A), but with capacitated Acr 1 " 016 " 7 sperm.
  • FIGS. 16A-16C Selection of human sperm with huZP2 peptide-beads. (FIG. 16A) Same as
  • FIG. 15A but with human sperm.
  • FIG. 16C Same as FIG. 15B, but with human sperm.
  • FIG. 16C Human sperm that bind to huZP2 peptide-beads were transferred from Dish A to Dish B (1). The beads were removed leaving unbound sperm behind (2). Eggs in cumulus were added (3) and assayed for binding to and penetration of the zona pellucida. The three steps take 35 min.
  • FIG. 17 Fertility of mutant female mice. Shown is a table indicating the number of ovulated eggs and the number of 2-cell (2C) embryos per animal in each transgenic mouse line.
  • FIGS. 18A-18C Alignment of mammalian ZP2 proteins. Shown are ZP2 amino acid sequences for human (SEQ ID NO: 47), mouse (SEQ ID NO: 48), dog (SEQ ID NO: 49), cat (SEQ ID NO: 50), rat (SEQ ID NO: 51), cow (SEQ ID NO: 52), pig (SEQ ID NO: 53), horse (SEQ ID NO: 54) and elephant (SEQ ID NO: 55) ZP2.
  • the region corresponding to residues 55-88 of human ZP2 is shown in bold and the region corresponding to residues 39-154 of human ZP2 is underlined.
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • sequence Listing is submitted as an ASCII text file, created on June 8, 2016, 64.2 KB, which is incorporated by reference herein. In the accompanying sequence listing:
  • SEQ ID Nos: 1-44 are nucleic acid primer sequences.
  • SEQ ID NO: 45 is the amino acid sequence of the proacrosin signal peptide.
  • SEQ ID NO: 46 is the amino acid sequence of an N-terminal peptide.
  • SEQ ID NO: 47 is the amino acid sequence of human ZP2, deposited under GENKBANKTM Accession No. NP_003451.1.
  • SEQ ID NO: 48 is the amino acid sequence of mouse ZP2, deposited under GENKBANKTM Accession No. NP_035905.1.
  • SEQ ID NO: 49 is the amino acid sequence of dog ZP2, deposited under GENKBANKTM
  • SEQ ID NO: 50 is the amino acid sequence of cat ZP2, deposited under GENKBANKTM Accession No. NP_001009875.1.
  • SEQ ID NO: 51 is the amino acid sequence of rat ZP2, deposited under GENKBANKTM Accession No. NP_112412.1.
  • SEQ ID NO: 52 is the amino acid sequence of cow ZP2, deposited under GENKBANKTM Accession No. NP_776398.1.
  • SEQ ID NO: 53 is the amino acid sequence of pig ZP2, deposited under GENKBANKTM Accession No. NP_999013.1.
  • SEQ ID NO: 54 is the amino acid sequence of horse ZP2, deposited under GENKBANKTM
  • SEQ ID NO: 55 is the amino acid sequence of elephant ZP2, deposited under GENKBANK T Accession No. XP_003418938.2.
  • Administration The introduction of a composition into a subject by a chosen route.
  • Exemplary routes of administration include, but are not limited to, intravaginal, intrauterine, injection
  • the route of administration is intravaginal or intrauterine.
  • Antibody A polypeptide ligand that recognizes and binds an epitope of an antigen, or a fragment thereof.
  • Immunoglobulin molecules are composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region.
  • VH region and the VL region are responsible for binding the antigen recognized by the antibody.
  • Antibodies include intact immunoglobulins and the variants and portions of antibodies well known in the art, such as single-domain antibodies ⁇ e.g. VH domain antibodies), Fab fragments, Fab' fragments, F(ab)'2 fragments, single chain Fv proteins (“scFv”), and disulfide stabilized Fv proteins ("dsFv”)-
  • a scFv protein is a fusion protein in which a light chain variable region of an
  • antibody also includes genetically engineered forms such as chimeric antibodies (for example, humanized murine antibodies) and heteroconjugate antibodies (such as bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3 rd Ed., W. H. Freeman & Co., New York, 1997.
  • Antigen A compound, composition, or substance that can stimulate the production of antibodies or a T-cell response in an animal. An antigen reacts with the products of specific humoral or cellular immunity.
  • Antigen-specific antibody is an antibody that was elicited (produced and/or activated) in response to a particular antigen.
  • An “antigen-specific” antibody is capable of binding to the antigen, typically with high affinity.
  • Avidin The extraordinary affinity of avidin for biotin allows biotin-containing molecules in a complex mixture to be discretely bound with avidin.
  • Avidin is a glycoprotein found in the egg white and tissues of birds, reptiles and amphibia. It contains four identical subunits having a combined mass of 67,000-68,000 daltons. Each subunit consists of 128 amino acids and binds one molecule of biotin. Extensive chemical modification has little effect on the activity of avidin, making it especially useful for protein purification.
  • streptavidin Another biotin-binding protein is streptavidin, which is isolated from Streptomyces avidinii and has a mass of 60,000 daltons. In contrast to avidin, streptavidin has no carbohydrate and has a mildly acidic pi of 5.5. Another version of avidin is NEUTRAVIDINTM Biotin Binding Protein (available from Pierce Biotechnology) with a mass of approximately 60,000 daltons.
  • the bond formation between biotin and avidin is very rapid, and once formed, is unaffected by extremes of pH, temperature, organic solvents and other denaturing agents.
  • avidin is meant to refer to avidin, streptavidin and other forms of avidin (such as derivatives or analogs thereof) that have similar biotin binding characteristics.
  • Analogs or derivatives of avidin/streptavidin include, but are not limited to, nitro-streptavidin, non-glycosylated avidin, N-acyl avidins (such as N-acetyl, N-phthalyl and N- succinyl avidin), and the commercial products EXTRA VIDINTM (Sigma-Aldrich), Neutralite Avidin (SouthernBiotech), CaptAvidin (Invitrogen) and NEUTRAVIDINTM.
  • Biotin A molecule (also known as vitamin H or vitamin B7) that binds with high affinity to avidin and streptavidin, and analogs or derivatives thereof. Biotin is often used to label nucleic acids and proteins for subsequent detection by avidin or streptavidin linked to a detectable label, such as a fluorescent or enzymatic reporter molecule. Unless indicated otherwise, the term "biotin” includes derivatives or analogs that participate in a binding reaction with avidin.
  • Biotin analogs and derivatives include, but are not limited to, N-hydroxysuccinimide-iminobiotin (NHS-iminobiotin), amino or sulfhydryl derivatives of 2-iminobiotin, amidobiotin, desthiobiotin, biotin sulfone, caproylamidobiotin and biocytin, biotinyl-s-aminocaproic acid-N-hydroxysuccinimide ester, sulfo-succinimide-iminobiotin, biotinbromoacetylhydrazide, p-diazobenzoyl biocytin, 3-(N-maleimidopropionyl) biocytin, 6-(6- biotinamidohexanamido)hexanoate and 2-biotinamidoethanethiol.
  • NHS-iminobiotin N-hydroxysuccinimide-iminobio
  • Biotin derivatives are also commercially available, such as DSB-XTM Biotin (Invitrogen). Additional biotin analogs and derivatives are known in the art (see, for example, U.S. Patent No. 5,168,049; U.S. Patent Application Publication Nos. 2004/0024197, 2001/0016343, and 2005/0048012; and PCT Publication No. WO 1995/007466).
  • Cervical cap A contraceptive device that fits over the cervix and blocks sperm from entering the uterus. Cervical caps are generally small, thimble-shaped cups made of silicone.
  • Conjugated refers to two molecules that are bonded together, for example by covalent bonds.
  • Constant amino acid substitutions are those substitutions that do not substantially affect or decrease an activity or antigenicity of a protein, such as a ZP2 peptide.
  • a ZP2 peptide can include at most about 1, at most about 2, at most about 5, and most about 10, or at most about 15 conservative substitutions and specifically bind an antibody that binds the original ZP2 peptide and/or retain the capacity to mediate binding of sperm to the zona pellucida.
  • conservative variant also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid.
  • Contacting Placement in direct physical association; includes both in solid and liquid form.
  • Contraceptive device A device designed to prevent conception. Contraceptive devices include, but are not limited to, cervical caps, condoms, diaphragms, intrauterine devices and contraceptive sponges.
  • Diaphragm A contraceptive device that comprises a flexible dome-shaped cup, generally made of rubber or plastic, that fits over the cervix.
  • Fertility refers to the ability of an animal to produce offspring. As used herein "inhibiting fertility” refers to reducing the rate of, or preventing, reproduction.
  • Fertilization The fusion of egg and sperm, which produces a zygote, or fertilized egg, initiating prenatal development.
  • Fusion protein A protein generated by expression of a nucleic acid sequence engineered from nucleic acid sequences encoding at least a portion of two different (heterologous) proteins. To create a fusion protein, the nucleic acid sequences must be in the same reading frame and contain no internal stop codons.
  • the fusion protein comprises a ZP2 peptide and a protein tag, such as a His tag.
  • Heterologous Originating from separate genetic sources or species.
  • a peptide that is heterologous to ZP2 originates from a nucleic acid that does not encode ZP2.
  • the heterologous amino acid sequence includes a protein tag, such as a His tag.
  • Hapten A small molecule that reacts with a specific antibody, but cannot induce the formation of antibodies unless bound to a carrier protein or other large antigenic molecule.
  • Histidine tag An amino acid motif that includes at least six histidine (His) residues. His tags are often used to aid in protein purification or detection.
  • Infertility The inability of a person or animal to reproduce by natural means.
  • the primary cause of male infertility is low semen quality, which could include low sperm count, immotile sperm and/or inability of sperm to bind and penetrate the zona pellucida.
  • Intrauterine device A type of contraceptive device that provides long-acting reversible contraception. IUDs are typically T-shaped and are inserted into the uterus to prevent pregnancy.
  • IUDs There are two types of IUDs - one that contains copper and another that contains the hormone levonorgestrel.
  • Isolated An "isolated” or “purified” biological component (such as a nucleic acid, peptide, protein, protein complex, or particle) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, that is, other chromosomal and extra-chromosomal DNA and RNA, and proteins.
  • Nucleic acids, peptides and proteins that have been “isolated” or “purified” thus include nucleic acids and proteins purified by standard purification methods.
  • the term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins.
  • isolated or purified does not require absolute purity; rather, it is intended as a relative term.
  • Mammal A warm-blooded vertebrate animal of the class Mammalia, characterized by hair on the skin, and in females, milk-producing mammary gland for nourishing the young. Mammals include, but are not limited to, humans, non-human primates, dogs, cats, cows, pigs, mice, rats, horses and elephants.
  • ZP2 peptides include synthetic embodiments of the peptides described herein.
  • analogs non-peptide organic molecules
  • derivatives chemically functionalized peptide molecules obtained starting with the disclosed peptide sequences
  • variants homologs or paralogs
  • Each polypeptide is comprised of a sequence of amino acids, which may be either L- and/or D- amino acids, naturally occurring and otherwise.
  • Peptides may be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified peptides, and optionally having other desirable properties.
  • carboxylic acid groups of the protein may be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified to form a Ci-Cie ester, or converted to an amide of formula NR1R2 wherein Ri and R2 are each independently H or Ci-Cie alkyl, or combined to form a heterocyclic ring, such as a 5- or 6- membered ring.
  • Amino groups of the peptide may be in the form of a pharmaceutically-acceptable acid addition salt, such as the HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric and other organic salts, or may be modified to Ci-Cie alkyl or dialkyl amino or further converted to an amide.
  • a pharmaceutically-acceptable acid addition salt such as the HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric and other organic salts
  • Hydroxyl groups of the peptide side chains may be converted to Ci-Cie alkoxy or to a Ci-Cie ester using well-recognized techniques.
  • Phenyl and phenolic rings of the peptide side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine or iodine, or with Ci- Cie alkyl, Ci-Cie alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids.
  • Methylene groups of the peptide side chains can be extended to homologous C2-C4 alkylenes.
  • Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups.
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
  • solid compositions for example, powder, pill, tablet, or capsule forms
  • conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
  • compositions to be administered can contain minor amounts of nontoxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • nontoxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • a recombinant nucleic acid or protein is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acids, e.g. , by genetic engineering techniques.
  • Sequence identity The similarity between amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or variants of a ZP2 peptide will possess a relatively high degree of sequence identity when aligned using standard methods.
  • BLAST Basic Local Alignment Search Tool
  • NCBI National Center for Biotechnology Information
  • Homologs and variants of a ZP2 polypeptide are typically characterized by possession of at least about 75%, for example at least about 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity counted over the full length alignment with the amino acid sequence of ZP2, a ZP2 peptide, or a ZP2 paralog using the NCBI Blast 2.0, gapped blastp set to default parameters.
  • the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1).
  • the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologs and variants will typically possess at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence.
  • Solid support Any material having a rigid or semi-rigid surface. In the context of the present disclosure, the solid support is capable of binding directly or indirectly to a peptide. In some
  • the solid support is a bead, resin, microtiter plate, membrane, glass, metal, or contraceptive device.
  • Specific binding partner A member of a pair of molecules that interact by means of specific, non-covalent interactions that depend on the three-dimensional structures of the molecules involved.
  • Exemplary pairs of specific binding partners include antigen/antibody, hapten/antibody, ligand/receptor, nucleic acid strand/complementary nucleic acid strand, substrate/enzyme, inhibitor/enzyme,
  • biotin/avidin including biotin/streptavidin
  • virus/cellular receptor including biotin/streptavidin
  • Sponge in the context of the present disclosure, includes any sponge appropriate for insertion into the vagina for the purpose of contraception. In some cases, the sponge is a
  • contraceptive sponge comprising spermicide. Contraceptive sponges are placed over the cervix to serve as a barrier to sperm. Spermicide in the contraceptive sponge prevents sperm motility.
  • a "subject” is any mammal, including humans and non-human mammals.
  • Synthetic Produced by artificial means in a laboratory, for example a synthetic nucleic acid or peptide can be chemically synthesized in a laboratory.
  • the ZP2 peptides disclosed herein include synthetic ZP2 peptides.
  • Therapeutically effective amount A quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. For example, this may be the amount of a ZP2 peptide useful for inhibiting or preventing fertilization. Ideally, in the context of the present disclosure, a therapeutically effective amount of a ZP2 peptide is an amount sufficient to prevent fertilization in a subject without causing a substantial cytotoxic effect in the subject.
  • Vaginal ring A type of contraceptive device comprised of a small, flexible ring. Vaginal rings are polymeric drug delivery devices that provide controlled release of hormones (such as estrogen and/or progesterone) to prevent ovulation and thicken the cervical mucus.
  • ZP Zona pellucida
  • the ZP of mice is made up of three proteins - ZP1, ZP2 and ZP3 (Zp4 is a pseudogene).
  • Zp4 is a pseudogene.
  • the ZP is important for oocyte development and protection, fertilization, spermatozoa binding, preventing polyspermy, blastocyst development and preventing premature implantation. Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
  • Improved reproductive choice requires more robust options for contraception as well as enhanced assisted reproductive technologies (ART) for treatment of infertility.
  • the current world population (7.2 billion) is expected to increase to 9.6-12.3 billion by 2100 (Gerland et ai, Science 346, 234-237, 2014), giving immedicacy to the discovery of innovative and effective contraceptive strategies.
  • improved gamete selection would materially benefit successful outcomes for ART in the treatment of infertility that affects roughly 1 in 8 couples (Boivin et ai, Hum. Reprod. 22, 1506-1512, 2007).
  • a compelling target for non-hormonal modulation of fertility is the zona pellucida, an extracellular matrix surrounding ovulated eggs and the pre-implantation embryo.
  • the zona pellucida is composed of 3 (mouse) or 4 (human) homologous glycoproteins designated ZP1-4 (Bleil and Wassarman, Dev. Biol. 76, 185-202, 1980; Lefievre et at , Hum. Reprod. 19, 1580-1586, 2004).
  • sperm bound to the ZP2 peptide-beads did not progress into the oviduct to encounter ovulated eggs which provided long term, reversible contraception in vivo.
  • the present disclosure describes the identification of a region within the N-terminus of the ZP2 protein that is required for sperm to bind the zona pellucida of an ovulated egg. It is further disclosed herein that N-terminal ZP2 peptides can decoy sperm to prevent fertilization in vivo. Also disclosed is the finding that mammalian ZP2 peptides bound to a solid support can be used to select sperm capable of binding and penetrating the zonae pellucidae of ovulated eggs.
  • compositions and methods disclosed herein can be used, for example, for contraception and/or assessing fertility of any mammalian species, including humans, domestic animals (such as cats and dogs), livestock (such as cattle, horses, pigs, goats and sheep), wildlife (such as wolves, coyotes, deer, mice and rats) or animals in captivity (such as elephants, bears, lions, tigers and giraffes).
  • domestic animals such as cats and dogs
  • livestock such as cattle, horses, pigs, goats and sheep
  • wildlife such as wolves, coyotes, deer, mice and rats
  • animals in captivity such as elephants, bears, lions, tigers and giraffes.
  • the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, or comprises the corresponding residues from a mammalian homolog of ZP2.
  • the mammalian ZP2 peptide comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47, or comprises the corresponding residues from a mammalian homolog of ZP2.
  • Table 1 Several exemplary mammalian ZP2 homologs, and the amino acid residues corresponding to residues 55-88 and 139-154 of human ZP2, are listed in Table 1.
  • the mammalian ZP2 peptide comprises or consists of residues 55-88 of human ZP2 set forth as SEQ ID NO: 47. In other non-limiting examples, the mammalian ZP2 peptide comprises or consists of residues 51-84 of mouse ZP2 set forth herein as SEQ ID NO: 48. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 55-88 of dog ZP2 set forth herein as SEQ ID NO: 49. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 55-88 of cat ZP2 set forth herein as SEQ ID NO: 50.
  • the mammalian ZP2 polypeptide comprises or consists of residues 40-73 of rat ZP2 set forth herein as SEQ ID NO: 51. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 51- 84 of cow ZP2 set forth herein as SEQ ID NO: 52. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 52-85 of pig ZP2 set forth herein as SEQ ID NO: 53. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 61-94 of horse ZP2 set forth herein as SEQ ID NO: 54. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 55-88 of elephant ZP2 set forth herein as SEQ ID NO: 55.
  • the mammalian ZP2 peptide is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length.
  • a mammalian ZP2 peptide can include residues 55-88 (or residues 39-154) of human ZP2 of SEQ ID NO: 47, or the corresponding residues from a mammalian homolog of ZP2, along with additional amino acid sequence of human ZP2, or additional sequence from the corresponding mammalian ZP2 homolog.
  • the mammalian ZP2 peptide is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length, and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47;
  • the mammalian ZP2 peptide comprises no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid substitution(s) relative to a wild-type mammalian ZP2 protein sequence set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length, and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, residues 51-84 of mouse ZP2 set forth herein as SEQ ID NO: 47,
  • amino acid sequence of the mammalian ZP2 peptide is at least
  • peptide fragment of mammalian ZP2 set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide fragment is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length, and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, residues 51-84 of mouse ZP2 set forth herein as SEQ ID NO: 48, residues
  • the mammalian ZP2 peptide is no more 200, no more than 150, or no more than 125 amino acids in length, and comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47; residues 35-149 of mouse ZP2 set forth herein as SEQ ID NO: 48; residues 39-154 of dog ZP2 set forth herein as SEQ ID NO: 49; residues 39-154 of cat ZP2 set forth herein as SEQ ID NO: 50; residues 24-138 of rat ZP2 set forth herein as SEQ ID NO: 51 ; residues 36-150 of cow ZP2 set forth herein as SEQ ID NO: 52; residues 36-151 of pig ZP2 set forth herein as SEQ ID NO: 53; residues 45- 160 of horse ZP2 set forth herein as SEQ ID NO: 54; or residues 39-156 of elephant ZP2 set forth herein as SEQ ID NO: 55.
  • the mammalian ZP2 peptide comprises no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid substitution(s) relative to a wild-type mammalian ZP2 protein sequence set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide is no more 200, no more than 150, or no more than 125 amino acids in length, and comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47; residues 35-149 of mouse ZP2 set forth herein as SEQ ID NO: 48; residues 39-154 of dog ZP2 set forth herein as SEQ ID NO: 49; residues 39-154 of cat ZP2 set forth herein as SEQ ID NO: 50; residues 24-138 of
  • the amino acid sequence of the mammalian ZP2 peptide is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to a peptide fragment of mammalian ZP2 set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide fragment is no more 200, no more than 150, or no more than 125 amino acids in length, and comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47; residues 35-149 of mouse ZP2 set forth herein as SEQ ID NO: 48; residues 39-154 of dog ZP2 set forth herein as SEQ ID NO: 49; residues 39-154 of cat ZP
  • the mammalian ZP2 peptide is bound to or encapsulated within a solid support.
  • the solid support comprises a synthetic polymer and the ZP2 peptide is encapsulated within the synthetic polymer.
  • the solid support comprises a contraceptive device, such as a vaginal ring comprising a synthetic polymer and the ZP2 peptide is encapsulated within the synthetic polymer.
  • the mammalian ZP2 peptide comprises at least one modified or non- naturally occurring amino acid.
  • the mammalian ZP2 peptide is fused to a heterologous amino acid sequence.
  • the heterologous amino acid sequence includes a protein tag, such as an affinity tag, an epitope tag, a fluorescent protein, an enzyme or a carrier protein.
  • the protein tag is a histidine tag, chitin binding protein, maltose binding protein, glutathione-S- transferase, V5, c-myc, HA, FLAG, GFP or another well-known fluorescent protein.
  • the solid support can be any suitable material or substrate suitable for attachment of a peptide, such as attachment by chemical conjugation or via specific binding partners.
  • the solid support comprises a bead, resin, microtiter plate, membrane, glass, metal or contraceptive device.
  • the contraceptive device is an intrauterine device, sponge, diaphragm, cervical cap or vaginal ring.
  • the bead is an agarose bead, a paramagnetic bead or a resin bead.
  • exemplary solid supports known in the art include, but are not limited to, tubes, microscope slides, wafers, silica membranes, silica chips, treated glass, polymers of various kinds (such as polyamide, polystyrene and polyacrylmorpholide), polysaccharides (such as SEPHAROSE , SEPHADEXTM and dextran), a resin, plastic film, glass beads, plastic beads, latex beads, latex-coated substrates and metal surfaces.
  • polymers of various kinds such as polyamide, polystyrene and polyacrylmorpholide
  • polysaccharides such as SEPHAROSE , SEPHADEXTM and dextran
  • a resin plastic film, glass beads, plastic beads, latex beads, latex-coated substrates and metal surfaces.
  • the solid support is a polymer, such as a synthetic polymer, that can act as a binding surface for the ZP2 peptide or can encapsulate the ZP2 peptide.
  • exemplary polymers include, but are not limited to, silicone elastomers, non-silicone resins and non-silicone polymers.
  • Conjugation of a ZP2 peptide to a solid support can be via covalent or non-covalent conjugation.
  • a wide range of covalent and non-covalent forms of conjugation are known to those of skill in the art, and fall within the scope of the present disclosure.
  • the mammalian ZP2 peptide is bound to the solid support by chemical conjugation.
  • the ZP2 peptide can be modified with a chemical group that can be linked to a compatible moiety on the solid support, or the chemical group may react directly with the primary amines of a peptide.
  • amine groups can react with NHS-activated agarose, aldehyde-activated agarose resin, azlactone groups and carbonyl diimidazole activated resin.
  • the solid support comprises a metal-chelate and the mammalian ZP2 peptide comprises a histidine tag and the mammalian ZP2 peptide is bound to the solid support by binding of the metal-chelate to the histidine tag.
  • the solid support comprises a first specific binding partner and the mammalian ZP2 peptide comprises a second specific binding partner and the mammalian ZP2 peptide is bound to the solid support by non-covalent binding of the first and second specific binding partners.
  • the first and second specific binding partners include a metal-chelate and a histidine tag; biotin and avidin; an antigen and an antibody that specifically binds the antigen; a hapten and an antibody that specifically binds the hapten; or a first nucleic acid strand and a complementary nucleic acid strand.
  • the metal-chelate comprises nickel, cobalt or copper.
  • the method includes administering to the subject by intravaginal or intrauterine administration a therapeutically effective amount of a mammalian ZP2 peptide bound to a solid support as disclosed herein.
  • the solid support comprises a bead, resin, microtiter plate, membrane, glass, metal, contraceptive device or any other material suitable for intravaginal or intrauterine administration.
  • the contraceptive device is an intrauterine device, sponge, diaphragm, cervical cap or vaginal ring.
  • the method includes providing a sperm sample from a mammal; contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support as disclosed herein under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide; and isolating the sperm bound to the mammalian ZP2 peptide.
  • the solid support comprises a bead, a resin, a microtiter plate or a membrane.
  • the bead is an agarose bead, a paramagnetic bead or a resin bead.
  • the method includes obtaining a sperm sample from the subject;
  • the threshold level required for fertility in the mammalian species is an empirically determined reference value.
  • the present disclosure contemplates the use of any of the solid-support bound ZP2 peptides disclosed herein in the described methods.
  • the mammalian ZP2 peptide is bound to the solid support by chemical conjugation.
  • the ZP2 peptide can be modified with a chemical group that can be linked to a compatible moiety on the solid support, or the chemical group may react directly with the primary amines of a peptide.
  • amine groups can react with NHS -activated agarose, aldehyde-activated agarose resin, azlactone groups and carbonyl diimidazole activated resin.
  • the solid support comprises a metal-chelate and the mammalian ZP2 peptide comprises a histidine tag and the mammalian ZP2 peptide is bound to the solid support by binding of the metal-chelate to the histidine tag.
  • the solid support comprises a first specific binding partner and the mammalian ZP2 peptide comprises a second specific binding partner and the mammalian ZP2 peptide is bound to the solid support by non-covalent binding of the first and second specific binding partners.
  • the first and second specific binding partners include a metal-chelate and a histidine tag; biotin and avidin; an antigen and an antibody that specifically binds the antigen; a hapten and an antibody that specifically binds the hapten; or a first nucleic acid strand and a complementary nucleic acid strand.
  • the metal-chelate comprises nickel, cobalt or copper.
  • a number of mammalian ZP2 protein sequences are publically available.
  • Several exemplary mammalian ZP2 protein sequences are disclosed herein, including human, mouse, dog, cat, rat, cow, pig, horse and elephant (listed below and set forth herein as SEQ ID NOs: 47-55).
  • An alignment of the exemplary mammalian ZP2 proteins is shown in FIGS. 18A-18C.
  • Also indicated in FIGS. 18A-18C is the N-terminal region of ZP2 corresponding to residues 55-88 of human ZP2, which was shown herein to be required for sperm binding, as well as the region corresponding to residues 39-154 of human ZP2.
  • the residues corresponding to human ZP2 residues 55-88 and residues 39-154 for each exemplary mammalian homolog are provide below in Table 1.
  • the mammalian N- terminal ZP2 peptides include the conserved cysteine residues corresponding to positions 55 and 88 of human ZP2 (see also FIG. 18A).
  • the ZP2 peptides include only one or neither of the conserved cysteine residues.
  • the ZP2 peptides comprise or consist of the following residues:
  • Rat. (Rattiis norvegicus - SEQ ID NO: 51
  • bacterial artificial chromosome (BAC) DNA (Life Technologies) that include either mouse Zpl (RP23-65I3) or human ZP2 (RP11-1023A8) were transformed into SW102 bacterial cells containing the ⁇ prophage recombineering system (Liu et al , Genome Res. 13:476-484, 2003).
  • human genomic DNA encoding huZP2 41 ⁇ 168 (bp 26 in exon 2 to bp 21 in exon 6) replaced mouse genomic DNA encoding moZP2 37 ⁇ 165 (bp 59 in exon 2 to bp 6 in exon 5).
  • PCR fragment (1,331 bp) containing the galK operon flanked by 50 bp homologous to oZp2 gene 5' and 3' of the sequence encoding moZP2 22 ⁇ 161 protein was amplified (huZ ⁇ -GalK primers; Table 2) using NEB Phusion (New England Biolabs, Inc.). After digestion with Dpnl and overnight gel purification (0.7% agarose, 15 V, 16 hours), the PCR fragment was electroporated into the BAC containing SW102 cells, and recombinants were selected by growth on minimal media with galactose.
  • the galK cassette was replaced by recombineering with a second PCR fragment (5,783 bp) encoding huZP2 41 ⁇ 168 protein with 100-bp arms homologous to moZP2 on either side ( oZp2- uZP2 primers; Table 2).
  • Mutant clones were selected on minimal media with 2-deoxy-galactose and confirmed by DNA sequencing of PCR products using gene specific primers (Table 2) to isolate 5' and 3' junction fragments.
  • DNA encoding huZP2 22 ⁇ 161 protein was replaced with sequence encoding moZP2 18 ⁇ 156 using huZK-GalK and uZP2- oZp2 primers (Table 2), and DNA encoding moZP2 51 ⁇ 149 protein was removed using moZ/?2-GalK and bridging oZp2 primers (Table 2) to establish the o/huZP2 and moZp2 Tmnc transgenes, respectively.
  • mouse genomic DNA encoding moZP2 18 ⁇ 156 (bp 1 in exon 2 to bp 150 in exon 5) replaced human genomic DNA encoding huZP2 22 ⁇ 161 (bp 1 in exon 2 to bp 152 in exon 5), and for the
  • F forward primer
  • R reverse primer 2 Fonts: oZp2 (normal); GalK (bold, underline); uZP2 (italic, underline)
  • transgenes were injected into the male pronucleus of fertilized FVB/N eggs by the Taconic Transgenic Mouse Facility. At least two founders were established for each transgene and crossed into mouse Zpl-3 null and human ZP1-4 transgenic mouse lines.
  • Hu/moZ;>2 mice were genotyped by PCR ([95°C for 30 s, 58°C for 30 s, 72°C for 1 min] x 30 cycles, 72°C for 7 min, and 4°C for >30 min) using primers in intron 5 of human ZP2 and intron 6 of mouse Zp2; o/huZP2 mice were genotyped using primers in intron 4 of mouse Zp2 and intron 5 of human ZP2; and moZp2 Tmnc mice were genotyped by PCR using primers in intron 2 and intron 5 of mouse Zp2 (Table 3).
  • Each transgenic line was crossed into the Zp2 Nul1 background (Rankin et at , Development 128: 1119-1126, 2001) to establish lmoZp2, o/huZP2, and moZp2 Tmnc rescue lines.
  • the normal Zp2 allele was detected by three distinct primer sets for hu/moZp2 (Set 1), mo/huZP2 (Set 2), and moZp2 Tmnc (Set 3) rescue lines (FIG. 6A; Table 3).
  • Millipore supplemented with 0.4% BSA (Sigma-Aldrich) for 40 minutes (37°C, 90% N 2 , 5% 0 2 , and 5% CO 2 ), and added to eggs in cumulus and embryos in 100 ⁇ of HTF, 0.4% BSA at a final concentration of 10 5 ml -1 progressive motile sperm as determined by a HTM-IVOS (Version 12.3) motility analyzer (Hamilton Thorne; Gahlay et al, Science 329:216-219, 2010). Zp3 EGFP mouse eggs (green zona) and two-cell embryos served as positive and negative wash controls, respectively.
  • BSA Sigma-Aldrich
  • mice Female mice (8-12 weeks old) were hormonally stimulated at 12:00 midnight with 5 IU of pregnant mare serum gonadotropin (PMSG), and hCG was injected intraperitoneally 48 hours later. Epididymal mouse sperm from three males was released into 1.5 ml of HTF, 0.4% BSA and equilibrated for 1-5 hours (37°C, 90% N 2 , 5% 0 2 , and 5% C0 2 ). Five hundred ⁇ was used to inseminate each of two female mice.
  • PMSG pregnant mare serum gonadotropin
  • HuZP2 Rescue and uZP3 Rescue females were stimulated with gonadotropins and anesthetized. Human sperm were injected into the oviduct, proximal to the swollen ampulla. Two hours later, the mice were euthanized to collect eggs that were fixed and imaged by confocal microscopy (Sato and Kimura, Theriogenology. 55: 1881-1890, 2001 ; Tokuhiro et al., Proc. Natl. Acad. Sci U. S. A. 109:3850- 3855, 2012). Immunoblot
  • cDNA encoding human (39-154 aa) and mouse (35-149 aa) ZP2 were cloned into pFastBac- HBM TOPO (Invitrogen) downstream of a polyhedron promoter and a 23-amino acid honeybee melittin signal peptide. Each clone was tagged with 6-histidine at the C terminus to facilitate purification.
  • chimeric mouse -human ZP2 clones were generated by DNA synthesis and used to make additional baculovirus expression constructs in which sequences encoding mouse ZP2 52 ⁇ 83 , ZP2 85 ⁇ 101 and ZP2 103 ⁇ 133 replaced endogenous human sequence.
  • Recombinant peptides were expressed in HI FIVETM cells, purified on IMAC SEPHAROSETM High Performance beads (GE Healthcare), and assayed on SDS-PAGE (FIG. 7B) as described previously (Baibakov et al., 2012).
  • Results reflect the mean ⁇ SEM from at least three independently obtained samples, each containing 20- 25 beads. Cloning, expression, and attachment to IMAC beads were performed in the Protein
  • Example 2 A single domain of the ZP2 zona pellucida protein mediates gamete recognition in mice and humans
  • ZP zona pellucida
  • the zona pellucida is composed of 3 (mouse) or 4 (human) homologous proteins (Bleil and Wassarman, Dev Biol 76: 185-202, 1980; Lefievre et al., Hum Reprod 19: 1580-1586, 2004).
  • ZP2 has been defined in both species as the zona ligand for a yet-to-be defined sperm surface receptor (Baibakov et al., J Cell Biol 197:897-905, 2012).
  • mice that form a zona pellucida lacking ZP2 are sterile
  • zona domains 260 aa motifs with conserved cysteine residues present near the C terminus of each secreted zona protein (Bork and Sander, FEBS Lett. 300:237-240, 1992).
  • the human zona pellucida is composed of four (ZP1-4) and the mouse of three (ZP1-3) glycoproteins (Bleil and Wassarman, Dev. Biol. 76: 185-202, 1980; Bauskin et ah , Mol. Hum. Reprod. 5:534-540, 1999).
  • Mouse ZP1 the least abundant protein, is not required for formation of the zona pellucida or fertility (Rankin et ah , Development 126:3847-3855, 1999).
  • ZP2 a thin zona matrix is formed around growing oocytes that does not persist in ovulated eggs (Rankin et ah, Development 128:1119-1126, 2001), and no zona matrix is formed in the absence of ZP3 (Liu et ah , Proc. Natl. Acad. Sci. U. S. A. 93:5431-5436, 1996; Rankin et ah , Development
  • ZP1/ZP2/ZP4 fall into one clade and ZP3 into another (FIG. 1 A).
  • the zona domains of ZP2 and ZP3 have 10 and 8 conserved cysteine residues, respectively, the linkage of which differs in the two clades (FIG. IB; Boja et ah , J. Biol. Chem. 278:34189-34202, 2003).
  • mice lacking mouse ZP2 in the presence of ZP4 were established and designated moQuad-Z/?2 V "" (moZPl, moZP3, and huZP4; Table 5).
  • moQuad ⁇ " 2 ⁇ (ZP1 ,2,3,4) and moQuad-Z/ ⁇ ZP ⁇ ) transgenic lines form zonae pellucidae during oocyte growth that is similar to normal oocytes (Table 5).
  • the zona pellucida persists after eggs are ovulated into the oviduct, and the composition of the moQuad- Zp2 Nul1 zona matrix was confirmed with monoclonal antibodies that documented the absence of mouse ZP2.
  • mice Ovulated eggs in cumulus (hyaluron interspersed with follicular cells) from moQuad (3 ⁇ 4 " Zi> ⁇ and moQua.d-Zp2 Nul1 mice were inseminated with mouse sperm using Zp3 EGFP mouse eggs (green zona) and normal mouse two-cell embryos, respectively, as positive and negative controls.
  • mouse ZP2 is required for in vitro sperm binding and in vivo mouse fertility. Table 5.
  • Truncated ZP2 does not support mouse sperm binding
  • the secreted ZP2 ectodomain (35-633 aa) lacks the signal peptide (1-34 aa) that directs ZP2 into the endosomal pathway, and the C terminus (634-713) that includes a transmembrane domain.
  • the ectodomain is cleaved near the N terminus ( 166 LA jDE 169 ) by ovastacin, an egg cortical granule metalloendoprotease, after which sperm no longer bind to the zona pellucida (Gahlay et al, Science 329:216-219, 2010; Burkart et al, J. Cell Biol. 197:37-44, 2012).
  • the zona pellucida surrounding ovulated eggs from moQuad and moQuad-Z/?2 r,' TM c mice were analyzed by confocal microscopy using ZP2 domain-specific monoclonal antibodies.
  • the zonae from both genotypes reacted with antibodies to ZP1, ZP2 C term , ZP3, and huZP4.
  • the monoclonal antibody to the N terminus of ZP2 did not react with the zona pellucidae surrounding moQuad- Zp2 T nc eggs, although it recognized normal ZP2 in the moQuad.
  • the monoclonal antibody to the zP2 N"term detected a 120-kD band in the zona pellucida isolated from moQuad, but not moQuad-Z;>2 r TM c eggs (FIG. 2B, left).
  • a monoclonal antibody to the ZP2 C term detected a 120-kD band in the zona pellucida isolated from moQuad eggs and a 92-kD band in eggs from moQ ad-Zp2 nc mice (FIG. 2B, right).
  • huQuad 3 ⁇ 4 " zw ⁇ mice containing all four human proteins and none of the endogenous mouse proteins (Baibakov et al., J. Cell Biol. 197:897-905, 2012) were used to establish uQuad-ZP2 NuU (huZPl,3,4) mouse lines (Table 5). Both lines formed a zona surrounding growing oocytes within the ovary, and using monoclonal antibodies specific to the human proteins, the absence of huZP2 in huQuad-ZP2 V "" ovulated eggs was confirmed.
  • mice Zp2 was expressed in huQuad- ZP2 NuU eggs.
  • mice were fertile, albeit with smaller litters (2.0 ⁇ 0.54 vs. 10.4 ⁇ 0.81 for natural mating).
  • Cd9 Nul1 eggs to which sperm will not fuse (Le Naour et al. , 2000) accumulated 1-6 mouse sperm in their perivitelline spaces (between the inner aspects of the zona matrix and the plasma membrane) in 9 of 113 eggs (FIG. 3 A).
  • huZP2 Rescue (huZP2 replaces moZP2) and huZP3 Rescue (huZP3 replaces moZP3) mice (Table 5) were inseminated with human sperm (3 x 10 7 ) and eggs recovered from the oviduct were examined by confocal microscopy to detect sperm in the perivitelline space where they accumulated, unable to fuse with mouse eggs.
  • human sperm were detected in the perivitelline space of four eggs (one egg per female), which is consistent with the small litters observed in control (Cd9 +/ ⁇ ) female mice.
  • sialyl-Lewis x antigen has been reported to mediate human sperm binding to human zonae pellucidae (Pang et al. , Science 333: 1761-1764, 2011). Although the sialyl-Lewis x antigen was detected in the zona pellucida surrounding control human oocytes, it was not present in the zona matrix formed by normal, uZP2 Rescue , or huQuad' 7 TM 2 " ⁇ eggs and cannot account for the observed binding of human sperm under these experimental conditions. The ZP2 domain required for sperm binding regulates taxon-specific gamete recognition
  • each transgenic line was crossed into the mouse Zp2 Nul1 line to eliminate endogenous ZP2 protein and designated almoZp2 Rescue and mo/huZP2 3 ⁇ 4SCMe mice, respectively (FIG. 4A).
  • the mice appeared normal and a robust zona pellucida was observed in ovarian sections from hu/moZP2 Rescue and mo/huZP2 Rescue female mice.
  • Mouse ZP1 and ZP3 were present in the zona pellucida surrounding ovulated eggs from each of the three transgenic mouse lines.
  • the zona pellucida from huZP2 rescue mice (Table 5) reacted with monoclonal antibodies to huZP2 N Term and not with either mouse-specific monoclonal antibody.
  • the zona pellucida of the chimeric u/ oZP2 eggs reacted with huZP2 N term and moZP2 C term , but not moZP2 N term monoclonal antibodies, and the zona pellucida surrounding the chimeric o/huZP2 rescue eggs reacted with antibodies to the N terminus, but not the C terminus, of mouse ZP2.
  • a recombinant baculovirus encoding N-terminal chimeric human and mouse ZP2 peptides was constructed in which mouse replaced human sequence between cysteine residues to systematically express moZP2 52 ⁇ 83 , moZP2 85 ⁇ 101 , and moZP2 103 ⁇ 133 in place of the corresponding human sequence (FIG. 4B and FIG. 7B).
  • Peptide beads were incubated with human sperm and washed to remove loosely adherent sperm, and binding was quantified from z projections of confocal images.
  • ZP2 was first proposed as a primary sperm-binding ligand in Xenopus laevis (Tian et al. , Proc. Natl. Acad. Sci. U. S. A. 96:829-834, 1999) and more recently in humans (Baibakov et al. , J. Cell Biol. 197:897-905, 2012). However, like all other candidates, it had not been defined as essential by genetic ablation. It is now disclosed herein that transgenic mice expressing human ZP4 form a zona pellucida in the absence of ZP2.
  • EGFP was released from Acr3-EGFP (Nakanishi et al, FEBS Lett. 449, 277-283, 1999) in pUC19 by digestion with PstI (New England Biolabs, Ipswich, Massachusetts) and treated with Klenow (Promega, Madison, Wisconsin) to generate blunt ends in the plasmid. Using pmCherry (Takara
  • mCherry+SV40 polyA cDNA was synthetized by PCR using oligonucleotides flanking the EcoRV restriction sites:
  • the PCR product was subcloned into pCR2.1, isolated after digestion with EcoRV and blunt- end ligated into pUC19-Acr3 to establish a transgene with an acrosin promoter (2.4 kb), the proacrosin signal peptide (MVEMLPTVAVLVLAVSVVA; SEQ ID NO: 45) including an N-terminal peptide (KDNTT; SEQ ID NO: 46) in frame with the mCherry cassette, analogous to Acr3-EGFP.
  • MVEMLPTVAVLVLAVSVVA the proacrosin signal peptide
  • KDNTT N-terminal peptide
  • the transgene was isolated with BamHI and Hindlll (New England Biolabs), gel purified and injected into the male pronucleus of fertilized FVB/N eggs. Mice were genotyped by PCR [95°C for 30 s, 58°C for 30 s, 72°C for 1 min] x 30 cycles, 72°C for 7 min, and 4°C for >30 min using mouse tail DNA, and primers that recognized a 507 bp region across the 5' UTR of Acrosin and mCherry (Table 6). Three founder males passed the transgene through their germline and accumulated mCherry in their acrosomes.
  • Tg(Acr/mCherrylDean) was used in the experiments reported and designated Acr jnCherr .
  • This line was crossed with the Prml EGW (Haueter et al, Genesis. 48, 151-160, 2010) and the Figla EGFF (Lin et al. , PLoS One 9, e84477, 2014) lines to obtain a mouse line with sperm that accumulates mCherry in the acrosome and EGFP in the sperm nucleus and in the plasma membrane
  • mice sperm Normal or transgenic mouse sperm were released from cauda epididymides in human tubal fluid (HTF; EMD Millipore, Billerica, Massachusetts) supplemented with 0.4% BSA (Sigma-Aldrich, St. Louis, Missouri) and analyzed by CASA IVOS (see Example 1). Mouse sperm were capacitated for 1 hour (37°C, 90% N 2 , 5% 0 2 , 5% C0 2 ). Control (ICR) or Zp3 EGFP (Zhao et ⁇ . , ⁇ . Cell. Biol.
  • mice Female mice were stimulated with 5 IU of eCG and hCG (Sigma-Aldrich) and eggs in cumulus were collected 12 hours post hCG injection and incubated in 500 ⁇ of HTF, 0.4% BSA at a final concentration of 1 x 10 5 ml "1 progressive-motile sperm (Gahlay et al. , Science 329, 216-219, 2010; and Example 1). Fertilization was scored 24 hours later by the presence of 2-cell embryos. To assess in vivo fertility, males (>5) from each mouse line were singly co-caged with control fertile female mice and litters were recorded until females gave birth to at least two litters.
  • EPPENDORFTM tube 2.0 ml containing 0.5 ml of 40% of Pure-Sperm (Nidacon) layered over 0.5 ml of 80% PureSperm. After centrifugation (swinging bucket, 20 minutes x 300 g, 20°C) and removal of the supernatant, sperm were resuspended in the residual buffer and transferred into 1.0 ml HTF. After a second centrifugation (5 minutes x 300 g), sperm were resuspended in 0.2 ml of HTF/BSA.
  • HTF/BSA HTF/BSA (Gahlay et al. , Science 329, 216-219, 2010) and incubated with either uncapacitated Act ⁇ G ⁇ P , capacitated AcrTM 0116 " 7 or both (1 :1 ratio) progressive-motile sperm (1 x 10 5 ml "1 ) suspended in 500 ⁇ HTF/BSA. After incubation (5 minutes), eggs were washed in HTF/BSA by careful transfer to a second and a third dish. Fixed sperm and eggs were mounted in PBS with Hoechst (10 g/ml) to identify nuclei. Bound sperm were quantified from z projections obtained by confocal microscopy.
  • IMAC SEPHAROSETM beads (100 ⁇ , GE HealthCare Life Sciences, Piscataway, New Jersey) were incubated overnight (37°C, 90% N 2 , 5% 0 2 , and 5% C0 2 ) with recombinant mouse ZP2 35"149 peptides in 100 ⁇ HTF/BSA and washed in the same media to remove free peptide.
  • the presence of the N-terminus peptide on the agarose beads (Approximately 35 ⁇ diameter) was determined with a monoclonal antibody to the N-terminus of ZP2 (Baibakov et al. , J. Cell Biol. 197, 897-905, 2012).
  • sperm were imaged live for 8 hours (37°C, 90% N 2 , 5% O2, 5% CO2) while interacting with moZP2 peptide-beads in HTF/BSA (500 ⁇ ) under mineral oil.
  • a 60 ⁇ z series (5 ⁇ each) was acquired at 15 second intervals to prevent sperm bleaching/damage.
  • Recombinant huZP2 peptides were attached to IMAC beads as described for mouse ZP2 peptide. Beads alone or huZP2 peptide-beads were incubated with uncapacitated or capacitated (2 hours) human sperm in HTF/BSA (500 ⁇ ). Samples (20-50 beads) were collected over time and analyzed as described for mouse sperm binding.
  • mice Eggs in cumulus from control (ICR) mice were incubated with capacitated, progressive-motile sperm (1 x 10 5 ml "1 ) in the presence of beads alone or moZP2 peptide-beads in HTF/BSA (500 ⁇ ). Sixteen hours later, eggs were collected and fertilization was scored by the presence of 2-cell embryos. Experiments were performed in triplicate. Alternatively, eggs in cumulus from uZP2 Rescue female mice were incubated (HTF/BSA, 500 ⁇ ) with capacitated, progressive-motile human sperm (1 x 10 5 ml "1 ) in the presence of beads alone or huZP2 peptide-beads.
  • Gonadotropin stimulated female mice were anesthetized with Avertin (0.2 mg/lOg body weight). Beads alone, or moZP2 peptide-beads (3 x 10 5 ), each diluted in 700 ⁇ HTF/BSA, were administered transcend cally into both uterine horns using a syringe (1 ml) attached to a blunt plastic needle. Females were mated overnight with ICR males proven to be fertile. Those with a copulatory plug 24 hours after mating were euthanized to determine the number of 1- and 2-cell embryos within the oviduct.
  • mice administered beads alone or moZP2- peptide-beads (5 each experimental group) were co-caged with a media (HTF) treated female and mated with a male proven to be fertile. Litters were recorded until the control female gave birth to at least three litters or after 5 month of mating.
  • mice were perfused via cardiac puncture with PBS (60 ml) containing heparin (10 U/ml) while still under anesthesia and then sacrificed. After isolation, the female reproductive tract was fixed overnight in 3% PFA and stained with IE-3 (1 :50), a monoclonal antibody specific to the N-terminus of moZP2 (East and Dean, J. Cell Biol. 98, 795-800, 1984; Sun et al , Biol. Reprod. 60, 900-907, 1999).
  • the female reproductive tract was fixed in 4% PF A/PBS (24 hours, room temperature), washed 3 times in PBS over 12 hours and cleared with ScaleA2 solution (Hama et al. , Nat. Neurosci. 14, 1481-1488, 2011) for 3 weeks (5 ml/50 mg tissue) at room temperature protected from light.
  • ScaleA2 solution Haama et al. , Nat. Neurosci. 14, 1481-1488, 2011
  • Zp3 EGFP female mice with green zonae pellucidae (Zhao et ⁇ . , ⁇ Cell. Biol. 22, 3111-3120, 2002) in a Cd9 NuU background (Le Naour et al , Science 287, 319-321, 2000) were mated overnight with Acr 1 " 0116 " 7 ; Prml EGFP ;
  • Figla EGFP male mice Twenty-four hours after mating, females with copulatory plugs were anesthetized, perfused and sacrificed as described. Their reproductive tract was fixed and clarified prior to imaging by confocal microscopy.
  • Example 4 ZP2 peptide-beads that select human sperm in vitro, decoy mouse sperm in vivo and provide reversible contraception
  • the N-terminus of ZP2 is a sperm binding ligand in the zona pellucida surrounding ovulated eggs.
  • This example describes the finding that mouse and human sperm bind, respectively, to recombinant mouse ZP2 35"149 and human ZP2 39"154 peptides attached to agarose beads.
  • Mouse ZP2 peptide-beads dramatically inhibit fertilization of ovulated mouse eggs inseminated in vitro.
  • human ZP2 peptide-beads prevent sperm binding and penetration of transgenic zP2 Rescue zonae pellucidae in which human ZP2 replaces mouse ZP2.
  • Human sperm selected by the peptide-beads are better able to penetrate the zonae of human zP2 Rescue eggs and thus could be used in selecting superior sperm for human assisted reproductive technologies.
  • FIG. 8A A transgene (FIG. 8A) in which cDNA encoding mCherry replaced EGFP in ⁇ ⁇ (Le Naour et at , Science 287, 319-321, 2000; Nakanishi et at , FEBS Lett. 449, 277-283, 1999) was used to establish mouse lines. Under the control of the acrosin promoter, these mice expressed fluorescent mCherry that accumulated in the acrosomes overlying the anteriorly located sperm nucleus and was detected before, but not after, induction of acrosome exocytosis. The Acr mCherry transgenic mice were fertile in vitro and in vivo with normal litter sizes. Their sperm had normal morphology and motility as determined by computer-assisted sperm analysis (CASA-IVOS) (FIG. 14B).
  • CASA-IVOS computer-assisted sperm analysis
  • sperm were released from the epididymides into human tubal fluid (HTF) media supplemented with bovine serum albumin (BSA) and used immediately or after 1 hour incubation at 37°C, respectively. Both fluorescently- tagged sperm bound within 5 minutes to the zona pellucida surrounding cumulus-free eggs either alone or as a 1: 1 mixture (FIG. 14C). Mouse sperm also bound to moZP2 35"149 peptide-beads and prior 1 hour incubation to capacitate sperm did not affect the number of sperm that initially bound (FIG.
  • Human ZP2 39"154 peptide-beads select sperm competent for binding and penetration of the zona pellucida
  • the number of sperm that bound to the surface of the zona pellucida (FIGS. 11 A and 1 IB) or penetrated through the zona matrix (FIGS. 11C and 1 ID) was substantially increased after selection with huZP2 peptide-beads compared to unselected sperm incubated with media or beads alone.
  • the two donors differed in the number of sperm bound to the zona pellucida (Donor A 2.0 ⁇ 0.5; Donor B 8.6 ⁇ 2.2), but had comparable number of sperm in the perivitelline space (Donor A 2.0 ⁇ 0.5;
  • moZP2 35"149 peptide-beads or beads alone were transcervically administered (FIG. 12) into the bilateral uterine horns using a 1 ml syringe attached to a plastic blunted needle.
  • FOG. 12 transcervically administered into the bilateral uterine horns using a 1 ml syringe attached to a plastic blunted needle.
  • the presence of moZP2 35"149 peptide on the moZP2 peptide-beads was confirmed in vitro with a monoclonal antibody to zP2 N"term .
  • the reproductive tract was fixed, cleared for 3 weeks with ScaleA2 (Hama et al., Nat. Neurosci.
  • Prml EGFP Figla EGFP mice in which protamine EGEP was present in the nucleus, myristoylated EGFP was embedded in the plasma membrane and mCherry was present in the acrosome. These mice were fertile with normal litter sizes and sperm had normal morphology and motility as determined by computer- assisted sperm analysis (CASA-IVOS) (FIG. 14B).
  • mice Female mice were treated with HTF media, beads alone or moZP2 peptide-beads prior to mating with Acr mCherry ; Prml EGFP ; Figla EGFP male mice. After fixation and clarification of the female reproductive tract, acrosome-reacted sperm bound to moZP2 peptide-beads were present in the uterus, but no sperm were observed in the oviduct. In contrast, sperm were present in the oviduct of female mice treated with media or beads alone and
  • MoZP2 35"149 peptide-beads provide long-term reversible contraception in female mice
  • Gonadotropin-stimulated normal female mice were mated with fertile males after treatment with media, beads alone or moZP2 35"149 peptide-beads (approximately 1.5 x 10 6 beads in 500 ⁇ ). Embryos from females with copulatory plugs were isolated 48 hours after mating. Females (5) treated with media or beads alone were fertile and 21.0 ⁇ 2.1 and 17.7 ⁇ 1.2 two-cell embryos, respectively, were recovered from their oviducts 40 hours after mating. Embryos were rarely (1.3 ⁇ 0.3) observed in females (5) treated with moZP2 peptide-beads (FIG. 13 A).
  • mice (5) treated with media, beads alone or moZP2 peptide-beads were co-caged and continuously mated with a male proven to be fertile (1 :3).
  • Female mice treated with beads alone or media became pregnant and delivered pups 25.4 ⁇ 0.6 (avg. ⁇ s.e.m.) and 28.2 ⁇ 3.1 days after mating, respectively.
  • the size of the first moZP2 peptide-bead treated litters were smaller (3.2 ⁇ 1.2 vs 7.2 ⁇ 1.5) than the beads alone control, but matched them (8.0 ⁇ 0.7 vs 8.4 ⁇ 1.5) by the second litter (FIG. 13B). All of the moZP2 peptide-bead treated mice eventually resumed fertility and produced at least two litters within the 5 month study (FIG. 13B).
  • the reproductive tracts of female mice were isolated 14 days after treatment. Compared to female mice treated with beads alone, no histopathology or evidence of inflammation was observed in female mice treated with moZP2 peptide-beads. Thus, these date indicate that moZP2 peptide-bead treatment results in long-term, reversible contraception with no obvious adverse effects.
  • Effective contraception is critical for family planning and includes barrier methods, hormone intervention, intrauterine devices and sterilization (Cates and Maggwa, Contraception 90, S14-S21, 2014).
  • Newer methods for male contraception reversibly prevent sperm maturation (Matzuk et al., Cell 150, 673-684, 2012; Amory et al , J. Androl. 32, 111-119, 2011), disrupt the Sertoli cell-barrier to promote sperm loss (Li et al., Fertil. Steril. 92, 1141-1146, 2009; Su et al. , Nat. Commun. 3, 1185, 2012) or affect sperm motility (Li et al , Fertil. Steril.
  • the present disclosure provides evidence that decoying sperm in the lower female reproductive tract with ZP2 N-terminal peptide-beads prevents interactions with ovulated eggs.
  • This strategy provides highly effective, non-hormonal, long-term, but reversible contraception in female mice.
  • the N-terminus of human ZP2 has a comparable effect on human sperm in vitro and ZP2 is conserved among eutherian mammals (Spargo and Hope, Biol. Reprod. 68, 358-362, 2003).
  • sperm Normally sperm undergo capacitation during passage through the female reproductive tract, or after incubation with serum proteins, to gain the ability to fertilize ovulated eggs (Chang, Nature 168, 697-698, 1951; Austin, Aust. J. Sci. Res., (B) 4, 581-596, 1951).
  • mouse nor human sperm need be capacitated to bind to the peptide-beads which provide immediate capture of sperm following initial contact with the ZP2 N-terminal peptide both in vitro and in vivo. After 4 (mouse) to 8 (human) hours, bound sperm lose their motility as well as the integrity of the plasma and outer acrosome membranes in vitro and remain adherent to the beads.
  • sperm do not ascend through the utero-tubal junction and are not observed in the oviduct. Whether all sperm interact with the peptide-beads or just a sufficient number to fall below a threshold needed to progress into the upper female reproductive tract remains to be determined.
  • inert beads approximately 35 ⁇ diameter themselves are no obstacle to sperm passage through the uterus as female mice treated with beads alone had normal in vitro and in vivo fertility.
  • the peptide-beads provided effective, long-term contraception that was ultimately reversible.
  • the ZP2 peptide-beads could be combined with spermicidal gels or attached to removable spermicidal sponges.
  • the ZP2 peptides could be attached to vaginal rings impregnated with steroid hormones (estrogen and progestin) to improve contraceptive efficacy by decreasing available sperm and suppressing ovulation.
  • sperm binding to the N-terminus of ZP2 in vitro also provides a physiological criterion to identify sperm for assisted reproductive technologies.
  • Intracytoplasmic sperm injection in which a single human spermatozoon is injected directly into a retrieved egg ( Palermo et ai, Lancet 340, 17- 18, 1992), relies on anthropomorphic selection of one sperm out of many and successful outcome may not be apparent until birth or later in life (Bonduelle et ai, Hum. Reprod. 14 Suppl 1, 243-264, 1999).
  • huZP2 peptide-beads human sperm were selected that have a superior ability to bind and penetrate the aZP2 Rescue zona pellucida, where they accumulate in the perivitelline space unable to fuse with the mouse egg's plasma membrane.
  • the advantage of sperm selection with huZP2 peptide-beads is multi-fold.
  • Recombinant human peptide provides an inexhaustible supply of reagents and commercial production of the peptide-beads is technologically simple. The selection procedure takes about 30 minutes and can be supplemented by secondary criteria based on sperm morphology and/or motility.
  • huZP2 peptide-beads could be used to concentrate sperm in patients with oligozoopermia ( ⁇ 20 million sperm ml "1 ), select better performing sperm from patients with asthenozoospermia ( ⁇ 50% normal motility or ⁇ 25% any motility) and discriminate between normal and abnormal sperm in patients with teratozoospermia ( ⁇ 30% normal morphology).
  • oligozoopermia ⁇ 20 million sperm ml "1
  • select better performing sperm from patients with asthenozoospermia ⁇ 50% normal motility or ⁇ 25% any motility
  • discriminate between normal and abnormal sperm in patients with teratozoospermia ⁇ 30% normal morphology

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Toxicology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Reproductive Health (AREA)
  • Pregnancy & Childbirth (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Gynecology & Obstetrics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Mammalian ZP2 N-terminal peptides bound to a solid support are described. The mammalian ZP2 peptides can be used to decoy sperm in the female reproductive tract to achieve long-term, reversible contraception. The mammalian ZP2 peptides bound to a solid support are also capable of selecting sperm that are better able to bind and penetrate the zona pellucida of an ovulated egg.

Description

NON-HORMONAL MAMMALIAN SPERM DECOY CONTRACEPTION BASED ON THE
N-TERMINUS OF THE ZP2 PROTEIN
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 62/175,821, filed June
15, 2015, which is herein incorporated by reference in its entirety.
FIELD
This disclosure concerns compositions comprising an N-terminal region of the zona pellucida 2 (ZP2) protein and its use, such as for reversible contraception in mammals and for selection of sperm exhibiting an enhanced ability to bind and penetrate the zona pellucida.
BACKGROUND
Human overpopulation threatens to outstrip available world resources, particularly in sub- Sahara Africa. The United Nations has estimated that the current population of 7.2 billion, if left unchecked, will increase to 9.6-12.3 billion by 2100 (Gerland et al, Science 346:234-237, 2014). A challenge lies in current projections that earth can support no more than 9-10 billion people
(Sakschewski et al., Ecol Model 288: 103-111, 2014). The current gold standard for female
contraception, oral birth control pills, were first introduced in 1960 and are currently used by more than 100 million women world-wide; however, these pills are not universally accepted because of potential medical complications, costs associated with distribution and poor acceptance in some cultures (Marnach et al., Mayo Clin Proc 88:295-299, 2013; Christin-Maitre, Best Pract Res Clin Endocrinol Metab 27:3-12, 2013; Cornet, Curr Opin Obstet Gynecol 25 Suppl 1:S1-10, 2013). Thus, other contraceptive strategies have been sought to provide better reproductive choices to populations throughout the world (Trussel, Contraception 83:397-404, 2011 ; Bahamondes and Bahamondes, Int J Women's Health 6:221-234, 2014).
Monospermic fertilization is required for successful development in mice and humans;
however, the molecular basis of sperm-egg interaction remains incompletely understood despite decades of investigation. Ovulated eggs are surrounded by an extracellular glycoprotein layer (called the zona pellucida) to which sperm bind and penetrate prior to gamete fusion. Following fertilization, the zona matrix is modified so that sperm do not bind to the early embryo. Humans have four genetic loci encoding four zona pellucida proteins - ZP1, ZP2, ZP3 and ZP4 (Spargo and Hope, 2003), but mouse Zp4 is a pseudogene (Lefievre et al., Hum. Reprod. 19: 1580-1586, 2004) and the mouse zona pellucida contains only three glycoproteins (Bleil and Wassarman, Proc. Natl. Acad. Sci. U. S. A.
85:6778-6782, 1980). Given the simple structure of the zona pellucida, it has been surprisingly difficult to genetically define a zona protein that is essential for fertilization and the post-fertilization block to polyspermy.
SUMMARY
The present disclosure describes the identification of a region within the N-terminus of the ZP2 protein that is required for sperm to bind the zona pellucida of an ovulated egg. It is further disclosed herein that N-terminal ZP2 peptides bound to a solid support can decoy sperm to prevent fertilization in vitro. Also disclosed is the finding that mammalian ZP2 peptides bound to a solid support can be used to select sperm capable of binding and penetrating the zonae pellucidae of ovulated eggs.
Provided herein are mammalian ZP2 peptides bound to the solid support. In some
embodiments, the mammalian ZP2 peptide is no more than 100 amino acids in length and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, or the corresponding residues from a mammalian homolog of ZP2, such as a mouse, rat, dog, cat, cow, pig, horse or elephant homolog of ZP2. In other embodiments, the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, or the corresponding residues from a mammalian homolog of ZP2, and the solid support comprises a contraceptive device. The contraceptive device can be, for example, an intrauterine device, a sponge, a diaphragm, a cervical cap or a vaginal ring.
Also provided is a method of inhibiting fertilization in a female mammalian subject. In some embodiments, the method includes administering to the subject by intravaginal or intrauterine administration a therapeutically effective amount of a mammalian ZP2 peptide bound to a solid support. In non-limiting examples, the solid support comprises a contraceptive device, such as an intrauterine device, a sponge, a diaphragm, a cervical cap or a vaginal ring.
Further provided is a method of selecting for sperm capable of binding and penetrating the zona pellucida of an ovulated egg. In some embodiments, the method includes providing a sperm sample from a mammal; contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide; and isolating the sperm bound to the mammalian ZP2 peptide.
The present disclosure also provides a method of diagnosing infertility in a male subject of a mammalian species. In some embodiments, the method includes obtaining a sperm sample from the subject; contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide; quantifying the number of sperm bound to the mammalian ZP2 peptide; and diagnosing infertility in the subject if the number of sperm is below a threshold level required for fertility in the mammalian species. The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A-1B: Phylogeny and domain structure of zona pellucida proteins. (FIG. 1 A)
Phylogeny of mouse and human zona proteins indicate two clades - one composed of ZP1, ZP2, and ZP4 and the other of ZP3. There is no mouse ZP4 protein because of multiple stop and missense codons in the cognate gene. Mya, million years ago. (FIG. IB) Schematic representation of the four zona pellucida proteins with 8 or 10 conserved cysteine residues. The resultant disulfide bonds differ in the zona domains of the ZP1/2/4 and ZP3 clades and are indicated as A and B, respectively. The post- fertilization cleavage site is marked on ZP2, and both ZP1 and ZP4 contain trefoil domains.
FIGS. 2A-2B: Truncated ZP2 does not support sperm binding. (FIG. 2 A) Representation of secreted ectodomains of normal mouse zp235-633 md truncated ZP2 lacking ZP251 149. Cysteine residues are shown in yellow. Monoclonal antibodies that bind N and C terminal to the post- fertilization cleavage site (arrowhead) and zona domains are indicated. (FIG. 2B) Immunoblot of eggs (15) from moQuad"Zi>^ (1) and moQuad-ZJp2r'™c (2) mice stained with domain-specific monoclonal antibodies. Molecular masses are indicated on the left.
FIGS. 3A-3D: Human sperm binding to the zona pellucida requires human ZP2. (FIG. 3A) Litter sizes after transcervical insemination of control (Cd9+/~) mice compared with natural mating (top). Sperm in the perivitelline space (PVS) of Cd9~'~ eggs after transcervical insemination with mouse sperm (bottom). (FIG. 3B) As in FIG. 3A, but with huZP2Rescue (top) and huZP3Rescue (bottom) eggs after transcervical insemination with human sperm. (FIG. 3C) In vivo oviduct transfer of human sperm (2.3 x 103 sperm in 0.5 μΐ) to hormonally stimulated, anesthetized huZP2Rescue and huZP3Rescue female mice. (FIG. 3D) As in FIG. 3B, but after in vivo oviductal transfer.
FIGS. 4A-4C: Taxon-specific sperm recognition of the N terminus of chimeric ZP2. (FIG. 4A) Ectodomains of huZP2, chimeric hu/moZP2, and chimeric mo/huZP2 proteins. Red and green, human and mouse protein, respectively. Yellow, conserved cysteine residues. Post-fertilization cleavage site (arrowhead) and zona domains are indicated. (FIG. 4B) Schematic of human (red) and mouse (green) recombinant peptides in which mouse ZP252~83, ZP285~101, or ZP2103~133 replace the corresponding human sequence. The green bar under the huZP2 protein was deleted in the mouse ZP2Tmnc. Cysteine residues, yellow bars. Predicted N-glycosylation sites, blue bars with asterisks. Arrowhead, di-acidic residues and potential ovastacin cleavage sites. (FIG. 4C) Box plots reflect the median (vertical line) number of human sperm binding to peptide beads (left) and data points within the 10th and 90th percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots. FIG. 5: Model of gamete recognition on the surface of the zona pellucida. The mouse zona pellucida (aquamarine) is composed of ZP1, ZP2 and ZP3, and surrounds ovulated eggs and early embryos. Sperm, capacitated by passage through the female reproductive tract, bind on the surface of the zona pellucida to an N-terminal domain of ZP2 in unfertilized eggs. After sperm acrosome exocytosis and penetration of the zona matrix, gametes fuse at fertilization and activate the egg. This triggers egg cortical granule migration and fusion with the plasma membrane, which releases ovastacin, a zinc metalloendoprotease that cleaves ZP2 at166LA jDE169. The immediate post-fertilization block to polyspermy prevents additional sperm from fusing with eggs or penetrating through the zona pellucida matrix. The most definitive block is secondary to the proteolytic destruction of the sperm binding domain at the N terminus of ZP2. If sperm do not bind, they will not penetrate nor fuse with the egg's plasma membrane.
FIGS. 6A-6B: Transgenes encoding truncated isoforms and human/mouse chimeric ZP2.
(FIG. 6A) Exon maps of endogenous mouse Zp2 (moZp2) and transgenes of truncated mouse Zp2 (moZp2Tmnc), chimeric hu/moZp2, human ZP2 (huZP2), and chimeric mo/huZP2 assembled from BAC clones by DNA recombineering. Exons are indicated by the numbers below each map; red and green exons encode human mouse proteins, respectively. The post-fertilization cleavage site (arrow) of ZP2 is encoded by exon 6 (LADD = residues 166-169 of mouse ZP2 of SEQ ID NO: 48 and residues 171- 174 of human ZP2 of SEQ ID NO: 47). PCR products for genotyping are indicated below each construct. (FIG. 6B) Tissue-specific expression of transgenes was determined by reverse transcription followed by RT-PCR of total RNA isolated from tissues from transgenic, normal (Nor), and rescue (Res, transgenic line crossed into the Zp2Nu11 background) mouse lines. H, heart; B, brain; K, kidney; Lu, lung; S, spleen; Li, liver; U, uterus; T, testis; O, ovary. RT-PCR products from primers (Table 4): mouse Zp2, 703 bp; hu/moZp2, 439 bp; mo/huZP2, 411 bp; and moZp2Trunc, 332 bp. Detection of Gapdh (510 bp) was used to ensure the integrity of isolated RNA.
FIGS. 7A-7B: Transcervical insemination and sperm binding in transgenic mice. (FIG.
7A) Schematic representation of transcervical insemination. Transgenic female mice were stimulated to ovulate with gonadotropins, inseminated with human sperm (3 x 107 in 100 μΐ), and mated with vasectomized males to mimic physiological copulations. Eggs were collected 2 hours later and fixed, then z projections from confocal microscopy were used to determine the number of sperm that had accumulated in the perivitelline space. (FIG. 7B) Coomassie blue-stained SDS-PAGE of recombinant ZP2 peptides expressed in HIGH FIVE™ cells after purification of IMAC beads. Molecular mass is shown on the left.
FIGS. 8A-8D: Mouse and human sperm bind to the N-terminus of ZP2. (FIG. 8A)
Schematic of the transgene used to establish the AcrmCherry transgenic mice. (FIG. 8B) Schematic of moZP235"149 (blue) and huZP239"154 (grey) peptides at the N-terminus of ZP2 (tan) that mediate sperm- egg binding in mice and human, respectively. Inverted triangle, mouse ZP2 167LA l DE170 post- fertilization cleavage site; zona domain, ZP2365 63U. (FIG. 8C) Model of moZP235"149 or huZP239"154 peptide-beads interacting with uncapacitated and capacitated sperm. (FIG. 8D) Capacitated and uncapacitated mouse (left) and human (right) sperm bind in similar numbers to moZP235"149 and huZP239"154, respectively. Box plots reflect the median (horizontal line) number of mouse or human sperm binding to peptide-beads and data points within the lO"1 and 90* percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots.
FIGS. 9A-9D: The N-terminus of moZP2 acts to decoy sperm in vitro and prevents mouse fertilization. (FIG. 9A) Schematic of in vitro fertilization in which mouse eggs in cumulus were incubated overnight with 1 x 105 progressive-motile mouse sperm in HTF (500 μΐ) in the presence of moZP235"154 peptide-beads (100 μΐ). (FIG. 9B) In vitro fertilization (%) after co-incubation of eggs in cumulus with media (no beads), beads alone or ZP2 peptide-beads. (FIG. 9C) Progressive-motility of unbound capacitated and uncapacitated mouse sperm in media with ZP2 peptide-beads during 8 hours after insemination. (FIG. 9D) Percentage of acrosome-intact sperm that remain bound to ZP2 peptide- beads during 8 hours after insemination.
FIGS. lOA-lOC: N-terminus of human ZP2 prevents zona matrix penetration of human sperm. (FIG. 10A) Same as FIG. 9A except 1 x 105 progressive-motile human sperm were added to aZP2Rescue eggs in cumulus in the presence of huZP239"154 peptide-beads or beads alone. (FIG. 10B) Same as FIG. 9C except with human sperm. (FIG. IOC) HuZP2Rescue eggs in cumulus were inseminated with capacitated human sperm in the presence of media (no beads), beads alone and huZP2 peptide- beads. Eggs were fixed and stained with WGA-633 and Hoechst to detect zonae pellucidae and nuclei, respectively. The numbers of eggs (avg. ± s.e.m.) with 0, 1, 2, 3 or >3 sperm in the perivitelline space was determined for each experimental group. The total number of eggs analyzed in three independent experiments is indicated above each graph.
FIGS. 11A-11D: Selection of human sperm competent for binding and zona pellucida penetration. (FIG. 11A) Human sperm from two donors (A and B) were unselected (1) or selected on the basis of binding to beads alone (2) or to huZP2 peptide-beads (3) and tested for their ability to bind to the surface of the zona pellucida (stained with WGA-633) surrounding uZP2Rescue eggs (see FIG. 16C). Box plots reflect the median (horizontal line) number of human sperm binding and data points within the 10th and 90* percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots. (FIG. 1 IB) The number of uZP2Rescue eggs with 0, 1 , 2, 3 or >3 sperm bound to the zona surface using sperm from human donor A (upper) and B (lower). (FIG. 11C) Same as (FIG. 11 A), but assayed for sperm penetration into the perivitelline space. (FIG. 1 ID) Same as (FIG. 1 IB), but for sperm present in the perivitelline space.
FIG. 12: Schematic of female mouse reproductive tract with transcervical delivery of beads into the bilateral uterine horns. Precocious interaction with moZP2 peptide-beads in the uterus prevents normal sperm migration through the uterotubal junction (UTJ) into the oviduct which results in female infertility.
FIGS. 13A-13B: Mouse ZP235"149 peptide-beads provide long-term reversible
contraception. (FIG. 13 A) Female mice were mated after transcervical administration of media (control), beads alone or moZP2 peptide-beads and fertilization was determined by the presence of 2- cell embryos in the oviduct 40 hours later. (FIG. 13B) The number and time of live births from two litters of female mice (5) continuously mated after transcervical administration of media (control), beads alone or moZP2 peptide-beads. Days (avg. ± s.e.m.) after mating.
FIGS. 14A-14C: Effect of capacitation on sperm binding to ZP2 peptide-beads. (FIG. 14A) To detect Acr"1016"7 transcripts in transgenic mice, total RNA was extracted from brain (Br), lung (Lu), heart (H), liver (Li), kidney (K), uterus (U), ovary (Ov) and testis (T), and analyzed by RT-PCR using transgene specific primers (see Table 6). GAPDH was used to as a load control and to ensure integrity of RNA. (FIG. 14B) Sperm viability, progressive-motility, in vitro fertilization and litter size of:
control (grey); Acr1"016^ (red); and Acr1"0116^; PrmlEGFP; FiglaEGFP (green) male mice. (FIG. 14C) Quantification of binding of uncapacitated Acr™3™ and capacitated Acr1"0116"7 sperm alone or mixed 1 : 1 to cumulus-free mouse eggs in which box plots reflect the median (vertical line) number of sperm binding to mouse eggs and data points within the 10th and 90th percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots.
FIGS. 15A-15B: Uncapacitated and capacitated sperm bind and rotate moZP2 peptide- beads. (FIG. 15A) Uncapacitated Acr^1^ mouse sperm binding to moZP2 peptide-beads. Number of sperm bound per bead was quantified from z projections. Box plots reflect the median (horizontal line) number of mouse sperm binding to moZP2 peptide-beads and data points within the 10th and 90th percentiles (error bars). Boxes include the middle two quartiles and outliers are indicated by dots. (FIG. 15B) Same as (FIG. 15A), but with capacitated Acr1"016"7 sperm.
FIGS. 16A-16C: Selection of human sperm with huZP2 peptide-beads. (FIG. 16A) Same as
FIG. 15A, but with human sperm. (FIG. 16C) Same as FIG. 15B, but with human sperm. (FIG. 16C) Human sperm that bind to huZP2 peptide-beads were transferred from Dish A to Dish B (1). The beads were removed leaving unbound sperm behind (2). Eggs in cumulus were added (3) and assayed for binding to and penetration of the zona pellucida. The three steps take 35 min.
FIG. 17: Fertility of mutant female mice. Shown is a table indicating the number of ovulated eggs and the number of 2-cell (2C) embryos per animal in each transgenic mouse line.
FIGS. 18A-18C: Alignment of mammalian ZP2 proteins. Shown are ZP2 amino acid sequences for human (SEQ ID NO: 47), mouse (SEQ ID NO: 48), dog (SEQ ID NO: 49), cat (SEQ ID NO: 50), rat (SEQ ID NO: 51), cow (SEQ ID NO: 52), pig (SEQ ID NO: 53), horse (SEQ ID NO: 54) and elephant (SEQ ID NO: 55) ZP2. The region corresponding to residues 55-88 of human ZP2 is shown in bold and the region corresponding to residues 39-154 of human ZP2 is underlined. SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on June 8, 2016, 64.2 KB, which is incorporated by reference herein. In the accompanying sequence listing:
SEQ ID NOs: 1-44 are nucleic acid primer sequences.
SEQ ID NO: 45 is the amino acid sequence of the proacrosin signal peptide.
SEQ ID NO: 46 is the amino acid sequence of an N-terminal peptide.
SEQ ID NO: 47 is the amino acid sequence of human ZP2, deposited under GENKBANK™ Accession No. NP_003451.1.
SEQ ID NO: 48 is the amino acid sequence of mouse ZP2, deposited under GENKBANK™ Accession No. NP_035905.1.
SEQ ID NO: 49 is the amino acid sequence of dog ZP2, deposited under GENKBANK™
Accession No. NP_001003304.1.
SEQ ID NO: 50 is the amino acid sequence of cat ZP2, deposited under GENKBANK™ Accession No. NP_001009875.1.
SEQ ID NO: 51 is the amino acid sequence of rat ZP2, deposited under GENKBANK™ Accession No. NP_112412.1.
SEQ ID NO: 52 is the amino acid sequence of cow ZP2, deposited under GENKBANK™ Accession No. NP_776398.1.
SEQ ID NO: 53 is the amino acid sequence of pig ZP2, deposited under GENKBANK™ Accession No. NP_999013.1.
SEQ ID NO: 54 is the amino acid sequence of horse ZP2, deposited under GENKBANK™
Accession No. XP_001494819.2.
SEQ ID NO: 55 is the amino acid sequence of elephant ZP2, deposited under GENKBANKT Accession No. XP_003418938.2.
DETAILED DESCRIPTION
Abbreviations
ART assisted reproductive technologies
BAC bacterial artificial chromosome
BSA bovine serum albumin
CASA computer-assisted sperm analysis
DIC differential interference contrast EGFP enhanced green fluorescent protein
hCG human chorionic gonadotropin
HTF human tubal fluid
PFA paraformaldehyde
PVS perivitelline space
ZP zona pellucida
II. Terms and Methods
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of
Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by
VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
Administration: The introduction of a composition into a subject by a chosen route.
Exemplary routes of administration include, but are not limited to, intravaginal, intrauterine, injection
(such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, intraductal, sublingual, rectal, transdermal, intranasal and inhalation routes. In particular embodiments disclosed herein, the route of administration is intravaginal or intrauterine.
Antibody: A polypeptide ligand that recognizes and binds an epitope of an antigen, or a fragment thereof. Immunoglobulin molecules are composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region.
Together, the VH region and the VL region are responsible for binding the antigen recognized by the antibody.
Antibodies include intact immunoglobulins and the variants and portions of antibodies well known in the art, such as single-domain antibodies {e.g. VH domain antibodies), Fab fragments, Fab' fragments, F(ab)'2 fragments, single chain Fv proteins ("scFv"), and disulfide stabilized Fv proteins ("dsFv")- A scFv protein is a fusion protein in which a light chain variable region of an
immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains. The term "antibody" also includes genetically engineered forms such as chimeric antibodies (for example, humanized murine antibodies) and heteroconjugate antibodies (such as bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3rd Ed., W. H. Freeman & Co., New York, 1997. Antigen: A compound, composition, or substance that can stimulate the production of antibodies or a T-cell response in an animal. An antigen reacts with the products of specific humoral or cellular immunity.
Antigen-specific: As used herein, an "antigen-specific" antibody is an antibody that was elicited (produced and/or activated) in response to a particular antigen. An "antigen-specific" antibody is capable of binding to the antigen, typically with high affinity.
Avidin: The extraordinary affinity of avidin for biotin allows biotin-containing molecules in a complex mixture to be discretely bound with avidin. Avidin is a glycoprotein found in the egg white and tissues of birds, reptiles and amphibia. It contains four identical subunits having a combined mass of 67,000-68,000 daltons. Each subunit consists of 128 amino acids and binds one molecule of biotin. Extensive chemical modification has little effect on the activity of avidin, making it especially useful for protein purification.
Another biotin-binding protein is streptavidin, which is isolated from Streptomyces avidinii and has a mass of 60,000 daltons. In contrast to avidin, streptavidin has no carbohydrate and has a mildly acidic pi of 5.5. Another version of avidin is NEUTRAVIDIN™ Biotin Binding Protein (available from Pierce Biotechnology) with a mass of approximately 60,000 daltons.
The avidin-biotin complex is the strongest known non-covalent interaction (Ka = 1015 M"1) between a protein and ligand. The bond formation between biotin and avidin is very rapid, and once formed, is unaffected by extremes of pH, temperature, organic solvents and other denaturing agents.
In the context of the present disclosure, the term "avidin" is meant to refer to avidin, streptavidin and other forms of avidin (such as derivatives or analogs thereof) that have similar biotin binding characteristics. Analogs or derivatives of avidin/streptavidin include, but are not limited to, nitro-streptavidin, non-glycosylated avidin, N-acyl avidins (such as N-acetyl, N-phthalyl and N- succinyl avidin), and the commercial products EXTRA VIDIN™ (Sigma-Aldrich), Neutralite Avidin (SouthernBiotech), CaptAvidin (Invitrogen) and NEUTRAVIDIN™. Additional avidin/streptavidin analogs and derivatives are known in the art (see, for example, U.S. Patent No. 5,973,124 and U.S. Patent Application Publication Nos. US 2004/0191832; US 2007/0105162; and US 2008/0255004).
Biotin: A molecule (also known as vitamin H or vitamin B7) that binds with high affinity to avidin and streptavidin, and analogs or derivatives thereof. Biotin is often used to label nucleic acids and proteins for subsequent detection by avidin or streptavidin linked to a detectable label, such as a fluorescent or enzymatic reporter molecule. Unless indicated otherwise, the term "biotin" includes derivatives or analogs that participate in a binding reaction with avidin. Biotin analogs and derivatives include, but are not limited to, N-hydroxysuccinimide-iminobiotin (NHS-iminobiotin), amino or sulfhydryl derivatives of 2-iminobiotin, amidobiotin, desthiobiotin, biotin sulfone, caproylamidobiotin and biocytin, biotinyl-s-aminocaproic acid-N-hydroxysuccinimide ester, sulfo-succinimide-iminobiotin, biotinbromoacetylhydrazide, p-diazobenzoyl biocytin, 3-(N-maleimidopropionyl) biocytin, 6-(6- biotinamidohexanamido)hexanoate and 2-biotinamidoethanethiol. Biotin derivatives are also commercially available, such as DSB-X™ Biotin (Invitrogen). Additional biotin analogs and derivatives are known in the art (see, for example, U.S. Patent No. 5,168,049; U.S. Patent Application Publication Nos. 2004/0024197, 2001/0016343, and 2005/0048012; and PCT Publication No. WO 1995/007466).
Cervical cap: A contraceptive device that fits over the cervix and blocks sperm from entering the uterus. Cervical caps are generally small, thimble-shaped cups made of silicone.
Conjugated: Refers to two molecules that are bonded together, for example by covalent bonds.
Conservative variants: "Conservative" amino acid substitutions are those substitutions that do not substantially affect or decrease an activity or antigenicity of a protein, such as a ZP2 peptide. For example, a ZP2 peptide can include at most about 1, at most about 2, at most about 5, and most about 10, or at most about 15 conservative substitutions and specifically bind an antibody that binds the original ZP2 peptide and/or retain the capacity to mediate binding of sperm to the zona pellucida.
Specific, non-limiting examples of a conservative substitution include the following examples:
Original Residue Conservative Substitutions
Ala Ser
Arg Lys
Asn Gin, His
Asp Glu
Cys Ser
Gin Asn
Glu Asp
His Asn; Gin
He Leu, Val
Leu He; Val
Lys Arg; Gin; Glu
Met Leu; He
Phe Met; Leu; Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp; Phe
Val He; Leu
The term conservative variant also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid. Contacting: Placement in direct physical association; includes both in solid and liquid form.
Contraceptive device: A device designed to prevent conception. Contraceptive devices include, but are not limited to, cervical caps, condoms, diaphragms, intrauterine devices and contraceptive sponges.
Diaphragm: A contraceptive device that comprises a flexible dome-shaped cup, generally made of rubber or plastic, that fits over the cervix.
Fertility: Refers to the ability of an animal to produce offspring. As used herein "inhibiting fertility" refers to reducing the rate of, or preventing, reproduction.
Fertilization: The fusion of egg and sperm, which produces a zygote, or fertilized egg, initiating prenatal development.
Fusion protein: A protein generated by expression of a nucleic acid sequence engineered from nucleic acid sequences encoding at least a portion of two different (heterologous) proteins. To create a fusion protein, the nucleic acid sequences must be in the same reading frame and contain no internal stop codons. In some embodiments herein, the fusion protein comprises a ZP2 peptide and a protein tag, such as a His tag.
Heterologous: Originating from separate genetic sources or species. For example, a peptide that is heterologous to ZP2 originates from a nucleic acid that does not encode ZP2. In some embodiments, the heterologous amino acid sequence includes a protein tag, such as a His tag.
Hapten: A small molecule that reacts with a specific antibody, but cannot induce the formation of antibodies unless bound to a carrier protein or other large antigenic molecule.
Histidine tag: An amino acid motif that includes at least six histidine (His) residues. His tags are often used to aid in protein purification or detection.
Infertility: The inability of a person or animal to reproduce by natural means. The primary cause of male infertility is low semen quality, which could include low sperm count, immotile sperm and/or inability of sperm to bind and penetrate the zona pellucida.
Intrauterine device (IUD): A type of contraceptive device that provides long-acting reversible contraception. IUDs are typically T-shaped and are inserted into the uterus to prevent pregnancy.
There are two types of IUDs - one that contains copper and another that contains the hormone levonorgestrel.
Isolated: An "isolated" or "purified" biological component (such as a nucleic acid, peptide, protein, protein complex, or particle) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, that is, other chromosomal and extra-chromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins that have been "isolated" or "purified" thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins. The term "isolated" or "purified" does not require absolute purity; rather, it is intended as a relative term.
Mammal: A warm-blooded vertebrate animal of the class Mammalia, characterized by hair on the skin, and in females, milk-producing mammary gland for nourishing the young. Mammals include, but are not limited to, humans, non-human primates, dogs, cats, cows, pigs, mice, rats, horses and elephants.
Peptide modifications: ZP2 peptides include synthetic embodiments of the peptides described herein. In addition, analogs (non-peptide organic molecules), derivatives (chemically functionalized peptide molecules obtained starting with the disclosed peptide sequences) and variants (homologs or paralogs) of these proteins can be utilized in the compositions and methods described herein. Each polypeptide is comprised of a sequence of amino acids, which may be either L- and/or D- amino acids, naturally occurring and otherwise.
Peptides may be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified peptides, and optionally having other desirable properties. For example, carboxylic acid groups of the protein, whether carboxyl-terminal or side chain, may be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified to form a Ci-Cie ester, or converted to an amide of formula NR1R2 wherein Ri and R2 are each independently H or Ci-Cie alkyl, or combined to form a heterocyclic ring, such as a 5- or 6- membered ring. Amino groups of the peptide, whether amino-terminal or side chain, may be in the form of a pharmaceutically-acceptable acid addition salt, such as the HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric and other organic salts, or may be modified to Ci-Cie alkyl or dialkyl amino or further converted to an amide.
Hydroxyl groups of the peptide side chains may be converted to Ci-Cie alkoxy or to a Ci-Cie ester using well-recognized techniques. Phenyl and phenolic rings of the peptide side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine or iodine, or with Ci- Cie alkyl, Ci-Cie alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids.
Methylene groups of the peptide side chains can be extended to homologous C2-C4 alkylenes. Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups.
Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this disclosure are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or proteins, and additional pharmaceutical agents.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically- neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of nontoxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Recombinant: A recombinant nucleic acid or protein is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acids, e.g. , by genetic engineering techniques.
Sequence identity: The similarity between amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or variants of a ZP2 peptide will possess a relatively high degree of sequence identity when aligned using standard methods.
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981 ;
Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988; Higgins and Sharp, Gene 13:231, 1988; Higgins and Sharp, CABIOS 5: 151, 1989; Corpet et al. , Nucleic Acids Research 16:10881, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988. In addition, Altschul et al., Nature Genet. 6: 119, 1994, presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403,
1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
Homologs and variants of a ZP2 polypeptide are typically characterized by possession of at least about 75%, for example at least about 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity counted over the full length alignment with the amino acid sequence of ZP2, a ZP2 peptide, or a ZP2 paralog using the NCBI Blast 2.0, gapped blastp set to default parameters. For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologs and variants will typically possess at least 80% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available at the NCBI website on the internet. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided.
Solid support: Any material having a rigid or semi-rigid surface. In the context of the present disclosure, the solid support is capable of binding directly or indirectly to a peptide. In some
embodiments herein, the solid support is a bead, resin, microtiter plate, membrane, glass, metal, or contraceptive device.
Specific binding partner: A member of a pair of molecules that interact by means of specific, non-covalent interactions that depend on the three-dimensional structures of the molecules involved. Exemplary pairs of specific binding partners include antigen/antibody, hapten/antibody, ligand/receptor, nucleic acid strand/complementary nucleic acid strand, substrate/enzyme, inhibitor/enzyme,
carbohydrate/lectin, biotin/avidin (including biotin/streptavidin), and virus/cellular receptor.
Sponge: In the context of the present disclosure, a "sponge" includes any sponge appropriate for insertion into the vagina for the purpose of contraception. In some cases, the sponge is a
contraceptive sponge comprising spermicide. Contraceptive sponges are placed over the cervix to serve as a barrier to sperm. Spermicide in the contraceptive sponge prevents sperm motility.
Subject: In the context of the present disclosure, a "subject" is any mammal, including humans and non-human mammals.
Synthetic: Produced by artificial means in a laboratory, for example a synthetic nucleic acid or peptide can be chemically synthesized in a laboratory. The ZP2 peptides disclosed herein include synthetic ZP2 peptides.
Therapeutically effective amount: A quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. For example, this may be the amount of a ZP2 peptide useful for inhibiting or preventing fertilization. Ideally, in the context of the present disclosure, a therapeutically effective amount of a ZP2 peptide is an amount sufficient to prevent fertilization in a subject without causing a substantial cytotoxic effect in the subject. Vaginal ring: A type of contraceptive device comprised of a small, flexible ring. Vaginal rings are polymeric drug delivery devices that provide controlled release of hormones (such as estrogen and/or progesterone) to prevent ovulation and thicken the cervical mucus.
Zona pellucida (ZP): A specialized extracellular matrix surrounding mammalian oocytes. In humans, the ZP includes four types of ZP glycoproteins - ZP1, ZP2, ZP3 and ZP4. The ZP of mice is made up of three proteins - ZP1, ZP2 and ZP3 (Zp4 is a pseudogene). The ZP is important for oocyte development and protection, fertilization, spermatozoa binding, preventing polyspermy, blastocyst development and preventing premature implantation. Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. "Comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
III. Introduction
Improved reproductive choice requires more robust options for contraception as well as enhanced assisted reproductive technologies (ART) for treatment of infertility. The current world population (7.2 billion) is expected to increase to 9.6-12.3 billion by 2100 (Gerland et ai, Science 346, 234-237, 2014), giving immedicacy to the discovery of innovative and effective contraceptive strategies. Conversely, improved gamete selection would materially benefit successful outcomes for ART in the treatment of infertility that affects roughly 1 in 8 couples (Boivin et ai, Hum. Reprod. 22, 1506-1512, 2007). A compelling target for non-hormonal modulation of fertility is the zona pellucida, an extracellular matrix surrounding ovulated eggs and the pre-implantation embryo. The zona pellucida is composed of 3 (mouse) or 4 (human) homologous glycoproteins designated ZP1-4 (Bleil and Wassarman, Dev. Biol. 76, 185-202, 1980; Lefievre et at , Hum. Reprod. 19, 1580-1586, 2004).
Successful mammalian fertilization requires sperm binding to ZP2. Fastidious human sperm do not bind to the mouse zona pellucida (Bedford, Anat. Rec. 188, 477-488, 1977), but will bind and penetrate a mouse zona pellucida in which human ZP2 replaces the endogenous mouse protein
( uZP2Re cue mice). The penetrating human sperm do not bind or fuse with mouse eggs, but accumulate in the perivitelline space between the zona matrix and plasma membrane (Baibakov et al., J. Cell Biol. 197 ', 897-905, 2012). Following fertilization, egg cortical granules release ovastacin (Quesada et al. , J. Biol. Chem. 279, 26627-26634, 2004), a zinc metalloendoprotease that cleaves the N-terminus of ZP2 to prevent gamete recognition and polyspermy (Burkart et al., J. Cell Biol. 197 ', 37-44, 2012.; Gahlay et al., Science 329, 216-219, 2010). Recent progress in understanding the molecular basis of gamete recognition has documented that the N-terminus of ZP2 is necessary and sufficient for mouse and human sperm binding. As disclosed herein, recombinant mouse and human ZP2 N-terminus peptides (moZP235 149 or huZP239"154) produced in baculovirus and attached to agarose beads can support in vitro binding of their cognate sperm.
The studies disclosed herein investigate the ability of the N-terminus of ZP2 to: 1) select human sperm better able to bind and penetrate the zona pellucida; and 2) decoy sperm in the female reproductive tract for reversible contraception. Existing selection criteria of sperm for ART are based on Kruger's strict morphology (Check et al. , Arch. Androl. 28, 15-17, 1992); sperm motility, the ability of sperm to bind hyaluronic acid, penetrate through the cumulus oophorus or bind the hemi-zona assay, depend on appearance or sperm surface characteristics. None are ideal (Herbemont and Sifer, Minerva Ginecol. 67, 185-193, 2015). It is disclosed herein that human sperm isolated by ZP2-peptide beads preferentially bind and penetrate zonae pellucidae surrounding ovulated uZP2Re cue eggs. In addition, the present disclosure documents the ability of N-terminal ZP2 peptides attached to a solid support {i.e. agarose beads) to decoy mouse sperm and prevent fertilization in vitro. After intrauterine
administration, sperm bound to the ZP2 peptide-beads did not progress into the oviduct to encounter ovulated eggs which provided long term, reversible contraception in vivo.
IV. Overview of Several Embodiments
The present disclosure describes the identification of a region within the N-terminus of the ZP2 protein that is required for sperm to bind the zona pellucida of an ovulated egg. It is further disclosed herein that N-terminal ZP2 peptides can decoy sperm to prevent fertilization in vivo. Also disclosed is the finding that mammalian ZP2 peptides bound to a solid support can be used to select sperm capable of binding and penetrating the zonae pellucidae of ovulated eggs. The compositions and methods disclosed herein can be used, for example, for contraception and/or assessing fertility of any mammalian species, including humans, domestic animals (such as cats and dogs), livestock (such as cattle, horses, pigs, goats and sheep), wildlife (such as wolves, coyotes, deer, mice and rats) or animals in captivity (such as elephants, bears, lions, tigers and giraffes).
Provided here are isolated mammalian ZP2 peptides bound to a solid support. In some embodiments, the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, or comprises the corresponding residues from a mammalian homolog of ZP2. In some embodiments, the mammalian ZP2 peptide comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47, or comprises the corresponding residues from a mammalian homolog of ZP2. Several exemplary mammalian ZP2 homologs, and the amino acid residues corresponding to residues 55-88 and 139-154 of human ZP2, are listed in Table 1.
In non-limiting examples, the mammalian ZP2 peptide comprises or consists of residues 55-88 of human ZP2 set forth as SEQ ID NO: 47. In other non-limiting examples, the mammalian ZP2 peptide comprises or consists of residues 51-84 of mouse ZP2 set forth herein as SEQ ID NO: 48. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 55-88 of dog ZP2 set forth herein as SEQ ID NO: 49. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 55-88 of cat ZP2 set forth herein as SEQ ID NO: 50. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 40-73 of rat ZP2 set forth herein as SEQ ID NO: 51. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 51- 84 of cow ZP2 set forth herein as SEQ ID NO: 52. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 52-85 of pig ZP2 set forth herein as SEQ ID NO: 53. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 61-94 of horse ZP2 set forth herein as SEQ ID NO: 54. In other examples, the mammalian ZP2 polypeptide comprises or consists of residues 55-88 of elephant ZP2 set forth herein as SEQ ID NO: 55.
In some embodiments, the mammalian ZP2 peptide is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length. For example, a mammalian ZP2 peptide can include residues 55-88 (or residues 39-154) of human ZP2 of SEQ ID NO: 47, or the corresponding residues from a mammalian homolog of ZP2, along with additional amino acid sequence of human ZP2, or additional sequence from the corresponding mammalian ZP2 homolog.
In some embodiments, the mammalian ZP2 peptide is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length, and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47;
residues 51-84 of mouse ZP2 set forth herein as SEQ ID NO: 48; residues 55-88 of dog ZP2 set forth herein as SEQ ID NO: 49; residues 55-88 of cat ZP2 set forth herein as SEQ ID NO: 50; residues 40-73 of rat ZP2 set forth herein as SEQ ID NO: 51; residues 51-84 of cow ZP2 set forth herein as SEQ ID NO: 52; residues 52-85 of pig ZP2 set forth herein as SEQ ID NO: 53; residues 61-94 of horse ZP2 set forth herein as SEQ ID NO: 54; or residues 55-88 of elephant ZP2 set forth herein as SEQ ID NO: 55.
In other embodiments, the mammalian ZP2 peptide comprises no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid substitution(s) relative to a wild-type mammalian ZP2 protein sequence set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length, and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, residues 51-84 of mouse ZP2 set forth herein as SEQ ID NO: 48, residues 55-88 of dog ZP2 set forth herein as SEQ ID NO: 49, residues 55-88 of cat ZP2 set forth herein as SEQ ID NO: 50, residues 40-73 of rat ZP2 set forth herein as SEQ ID NO: 51, residues 51-84 of cow ZP2 set forth herein as SEQ ID NO: 52, residues 52-85 of pig ZP2 set forth herein as SEQ ID NO: 53, residues 61-94 of horse ZP2 set forth herein as SEQ ID NO: 54, or residues 55-88 of elephant ZP2 set forth herein as SEQ ID NO: 55.
In yet other embodiments, the amino acid sequence of the mammalian ZP2 peptide is at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to a peptide fragment of mammalian ZP2 set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide fragment is no more 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40, no more than 39, no more than 38, no more than 37, no more than 36, no more than 35 or no more than 34 amino acids in length, and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47, residues 51-84 of mouse ZP2 set forth herein as SEQ ID NO: 48, residues 55-88 of dog ZP2 set forth herein as SEQ ID NO: 49, residues 55-88 of cat ZP2 set forth herein as SEQ ID NO: 50, residues 40-73 of rat ZP2 set forth herein as SEQ ID NO : 51 , residues 51 -84 of cow ZP2 set forth herein as SEQ ID NO: 52, residues 52-85 of pig ZP2 set forth herein as SEQ ID NO: 53, residues 61-94 of horse ZP2 set forth herein as SEQ ID NO: 54, or residues 55-88 of elephant ZP2 set forth herein as SEQ ID NO: 55.
In some embodiments, the mammalian ZP2 peptide is no more 200, no more than 150, or no more than 125 amino acids in length, and comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47; residues 35-149 of mouse ZP2 set forth herein as SEQ ID NO: 48; residues 39-154 of dog ZP2 set forth herein as SEQ ID NO: 49; residues 39-154 of cat ZP2 set forth herein as SEQ ID NO: 50; residues 24-138 of rat ZP2 set forth herein as SEQ ID NO: 51 ; residues 36-150 of cow ZP2 set forth herein as SEQ ID NO: 52; residues 36-151 of pig ZP2 set forth herein as SEQ ID NO: 53; residues 45- 160 of horse ZP2 set forth herein as SEQ ID NO: 54; or residues 39-156 of elephant ZP2 set forth herein as SEQ ID NO: 55.
In other embodiments, the mammalian ZP2 peptide comprises no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid substitution(s) relative to a wild-type mammalian ZP2 protein sequence set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide is no more 200, no more than 150, or no more than 125 amino acids in length, and comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47; residues 35-149 of mouse ZP2 set forth herein as SEQ ID NO: 48; residues 39-154 of dog ZP2 set forth herein as SEQ ID NO: 49; residues 39-154 of cat ZP2 set forth herein as SEQ ID NO: 50; residues 24-138 of rat ZP2 set forth herein as SEQ ID NO: 51 ; residues 36-150 of cow ZP2 set forth herein as SEQ ID NO: 52;
residues 36-151 of pig ZP2 set forth herein as SEQ ID NO: 53; residues 45-160 of horse ZP2 set forth herein as SEQ ID NO: 54; or residues 39-156 of elephant ZP2 set forth herein as SEQ ID NO: 55.
In yet other embodiments, the amino acid sequence of the mammalian ZP2 peptide is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to a peptide fragment of mammalian ZP2 set forth herein as SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 53, SEQ ID NO: 54 or SEQ ID NO: 55, wherein the peptide fragment is no more 200, no more than 150, or no more than 125 amino acids in length, and comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47; residues 35-149 of mouse ZP2 set forth herein as SEQ ID NO: 48; residues 39-154 of dog ZP2 set forth herein as SEQ ID NO: 49; residues 39-154 of cat ZP2 set forth herein as SEQ ID NO: 50; residues 24-138 of rat ZP2 set forth herein as SEQ ID NO: 51 ; residues 36-150 of cow ZP2 set forth herein as SEQ ID NO: 52; residues 36-151 of pig ZP2 set forth herein as SEQ ID NO: 53; residues 45- 160 of horse ZP2 set forth herein as SEQ ID NO: 54; or residues 39-156 of elephant ZP2 set forth herein as SEQ ID NO: 55.
In some embodiments, the mammalian ZP2 peptide is bound to or encapsulated within a solid support. In some examples, the solid support comprises a synthetic polymer and the ZP2 peptide is encapsulated within the synthetic polymer. In some examples, the solid support comprises a contraceptive device, such as a vaginal ring comprising a synthetic polymer and the ZP2 peptide is encapsulated within the synthetic polymer.
In some examples, the mammalian ZP2 peptide comprises at least one modified or non- naturally occurring amino acid.
In some embodiments, the mammalian ZP2 peptide is fused to a heterologous amino acid sequence. In some examples, the heterologous amino acid sequence includes a protein tag, such as an affinity tag, an epitope tag, a fluorescent protein, an enzyme or a carrier protein. In particular examples, the protein tag is a histidine tag, chitin binding protein, maltose binding protein, glutathione-S- transferase, V5, c-myc, HA, FLAG, GFP or another well-known fluorescent protein.
The solid support can be any suitable material or substrate suitable for attachment of a peptide, such as attachment by chemical conjugation or via specific binding partners. In some embodiments, the solid support comprises a bead, resin, microtiter plate, membrane, glass, metal or contraceptive device. In some examples, the contraceptive device is an intrauterine device, sponge, diaphragm, cervical cap or vaginal ring. In some examples, the bead is an agarose bead, a paramagnetic bead or a resin bead.
Other exemplary solid supports known in the art include, but are not limited to, tubes, microscope slides, wafers, silica membranes, silica chips, treated glass, polymers of various kinds (such as polyamide, polystyrene and polyacrylmorpholide), polysaccharides (such as SEPHAROSE , SEPHADEX™ and dextran), a resin, plastic film, glass beads, plastic beads, latex beads, latex-coated substrates and metal surfaces.
In other examples, the solid support is a polymer, such as a synthetic polymer, that can act as a binding surface for the ZP2 peptide or can encapsulate the ZP2 peptide. Exemplary polymers include, but are not limited to, silicone elastomers, non-silicone resins and non-silicone polymers.
Conjugation of a ZP2 peptide to a solid support can be via covalent or non-covalent conjugation. A wide range of covalent and non-covalent forms of conjugation are known to those of skill in the art, and fall within the scope of the present disclosure. In some embodiments, the mammalian ZP2 peptide is bound to the solid support by chemical conjugation. For instance, the ZP2 peptide can be modified with a chemical group that can be linked to a compatible moiety on the solid support, or the chemical group may react directly with the primary amines of a peptide. For example, amine groups can react with NHS-activated agarose, aldehyde-activated agarose resin, azlactone groups and carbonyl diimidazole activated resin.
In some embodiments, the solid support comprises a metal-chelate and the mammalian ZP2 peptide comprises a histidine tag and the mammalian ZP2 peptide is bound to the solid support by binding of the metal-chelate to the histidine tag.
In some embodiments, the solid support comprises a first specific binding partner and the mammalian ZP2 peptide comprises a second specific binding partner and the mammalian ZP2 peptide is bound to the solid support by non-covalent binding of the first and second specific binding partners. In some examples, the first and second specific binding partners include a metal-chelate and a histidine tag; biotin and avidin; an antigen and an antibody that specifically binds the antigen; a hapten and an antibody that specifically binds the hapten; or a first nucleic acid strand and a complementary nucleic acid strand. In some examples, the metal-chelate comprises nickel, cobalt or copper.
Also provided herein are methods of inhibiting fertilization in a female mammalian subject. In some embodiments, the method includes administering to the subject by intravaginal or intrauterine administration a therapeutically effective amount of a mammalian ZP2 peptide bound to a solid support as disclosed herein. In some embodiments, the solid support comprises a bead, resin, microtiter plate, membrane, glass, metal, contraceptive device or any other material suitable for intravaginal or intrauterine administration. In some examples, the contraceptive device is an intrauterine device, sponge, diaphragm, cervical cap or vaginal ring.
Further provided herein are methods of selecting for sperm capable of binding and penetrating the zona pellucida of an ovulated egg. In some embodiments, the method includes providing a sperm sample from a mammal; contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support as disclosed herein under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide; and isolating the sperm bound to the mammalian ZP2 peptide. In some embodiments, the solid support comprises a bead, a resin, a microtiter plate or a membrane. In some examples, the bead is an agarose bead, a paramagnetic bead or a resin bead.
Also provided herein are methods for diagnosing infertility in a male subject of a mammalian species. In some embodiments, the method includes obtaining a sperm sample from the subject;
contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support as disclosed herein under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide;
quantifying the number of sperm bound to the mammalian ZP2 peptide; and diagnosing infertility in the subject if the number of sperm is below a threshold level required for fertility in the mammalian species. In some examples, the threshold level required for fertility in the mammalian species is an empirically determined reference value.
The present disclosure contemplates the use of any of the solid-support bound ZP2 peptides disclosed herein in the described methods.
In some embodiments of the methods disclosed herein, the mammalian ZP2 peptide is bound to the solid support by chemical conjugation. For instance, the ZP2 peptide can be modified with a chemical group that can be linked to a compatible moiety on the solid support, or the chemical group may react directly with the primary amines of a peptide. For example, amine groups can react with NHS -activated agarose, aldehyde-activated agarose resin, azlactone groups and carbonyl diimidazole activated resin.
In some embodiments of the methods, the solid support comprises a metal-chelate and the mammalian ZP2 peptide comprises a histidine tag and the mammalian ZP2 peptide is bound to the solid support by binding of the metal-chelate to the histidine tag.
In some embodiments of the methods, the solid support comprises a first specific binding partner and the mammalian ZP2 peptide comprises a second specific binding partner and the mammalian ZP2 peptide is bound to the solid support by non-covalent binding of the first and second specific binding partners. In some examples, the first and second specific binding partners include a metal-chelate and a histidine tag; biotin and avidin; an antigen and an antibody that specifically binds the antigen; a hapten and an antibody that specifically binds the hapten; or a first nucleic acid strand and a complementary nucleic acid strand. In some examples, the metal-chelate comprises nickel, cobalt or copper.
V. Mammalian ZP2 Protein Sequences
A number of mammalian ZP2 protein sequences are publically available. Several exemplary mammalian ZP2 protein sequences are disclosed herein, including human, mouse, dog, cat, rat, cow, pig, horse and elephant (listed below and set forth herein as SEQ ID NOs: 47-55). An alignment of the exemplary mammalian ZP2 proteins is shown in FIGS. 18A-18C. Also indicated in FIGS. 18A-18C is the N-terminal region of ZP2 corresponding to residues 55-88 of human ZP2, which was shown herein to be required for sperm binding, as well as the region corresponding to residues 39-154 of human ZP2. The residues corresponding to human ZP2 residues 55-88 and residues 39-154 for each exemplary mammalian homolog are provide below in Table 1.
Table 1. N-terminal residues of mammalian ZP2 that mediate sperm binding
Figure imgf000023_0001
In some embodiments of the compositions and methods disclosed herein, the mammalian N- terminal ZP2 peptides include the conserved cysteine residues corresponding to positions 55 and 88 of human ZP2 (see also FIG. 18A). In alternative embodiments, the ZP2 peptides include only one or neither of the conserved cysteine residues. Thus, in these embodiments, the ZP2 peptides comprise or consist of the following residues:
Human - residues 56-88, 55-87 or 56-87 of SEQ ID NO: 47
Mouse - residues 52-84, 51-83 or 52-83 of SEQ ID NO: 48
Dog - residues 56-88, 55-87 or 56-87 of SEQ ID NO: 49
Cat - residues 56-88, 55-87 or 56-87 of SEQ ID NO: 50
Rat - residues 41-73, 40-72 or 41-72 of SEQ ID NO: 51
Cow - residues 52-84, 51-83 or 52-83 of SEQ ID NO: 52
Pig - residues 53-85, 52-84 or 53-84 of SEQ ID NO: 53
Horse - residues 62-94, 61-93 or 62-93 of SEQ ID NO: 54
Elephant - residues 56-88, 55-87 or 56-87 of SEQ ID NO: 55 Human (Homo sapiens) ZP2 - SEQ ID NO: 47
1 macrqrggsw spsgwfnagw styrsislff alvtsgnsid vsqlvnpafp gtvtcderei
61 tvefpsspgt kkwhasvvdp lgldmpncty ildpekltlr atydnctrrv hgghqmtirv
121 mnnsaalrhg avmyqffcpa mqveetqgls asticqkdfm sfslprvfsg laddskgtkv
181 qmgws ievgd garaktltlp eamkegfsll idnhrmtfhv pfnatgvthy vqgnshlymv
241 s lkltfispg qkvifssqai capdpvtcna thmtltipef pgklksvsfe nqnidvsqlh
301 dngidleatn gmklhfsktl Iktklsekcl Ihqfylaslk Itfllrpetv smviypeclc
361 espvsivtge Ictqdgfmdv evysyqtqpa Idlgtlrvgn sscqpvfeaq sqglvrfhip
421 lngcgtrykf eddkvvyene ihalwtdfpp skisrdsefr mtvkcsysrn dmllninves
481 ltppvasvkl gpftlilqsy pdnsyqqpyg eneyplvrfl rqpiymevrv lnrddpnikl
541 vlddcwatst mdpdsfpqwn vvvdgcaydl dnyqttfhpv gssvthpdhy qrfdmkafaf
601 vseahvlssl vyfhcsalic nrlspdsplc svtcpvssrh rratgateae kmtvslpgpi
661 lllsddssfr gvgs sdlkas gssgeksrse tgeevgsrga mdtkghktag dvgskavaav
721 aafagvvatl gfiyylyekr tvsnh
Mouse (Mus musculus) ZP2 - SEQ ID NO: 48
1 marwqrkasv sspcgrsiyr flsllftlvt svnsvslpqs enpafpgtli cdkdevrief
61 ssrfdmekwn psvvdtlgse ilnctyaldl erfvlkfpye tctikvvggy qvnirvgdtt
121 tdvrykddmy hffcpaiqae theiseivvc rrdlisfsfp qlfsrladen qnvsemgwiv
181 kigngtrahi lplkdaivqg fnllidsqkv tlhvpanatg ivhyvqessy lytvqlellf
241 sttgqkivfs shaicapdls vacnathmtl tipefpgkle svdfgqwsip edqwhangid
301 keatnglrln frksllktkp sekcpfyqfy lsslkltfyf qgnmlstvid pechcespvs
361 idelcaqdgf mdfevyshqt kpalnldtll vgnsscqpif kvqsvglarf hiplngcgtr
421 qkfegdkviy eneihalwen ppsnivfrns efrmtvrcyy irdsmllnah vkghpspeaf
481 vkpgplvlvl qtypdqsyqr pyrkdeyplv rylrqpiyme vkvlsrndpn iklvlddcwa
541 tssedpasap qwqivmdgce yeldnyrttf hpagssaahs ghyqrfdvkt fafvseargl
601 ssliyfhcsa licnqvslds plcsvtcpas lrskreanke dtmtvslpgp illlsdvsss
661 kgvdpsssei tkdiiakdia sktlgavaal vgsavilgfi cylykkrtir fnh
Dog (Canis familiaris) - SEQ ID NO: 49
1 mackqkgdsg spssrfsadw styrsislff ilvtsvnsvg vmqlvnpifp gtvichenkm
61 tvefprdlgt kkwhasvvdp fsfellncts ildpekltlk apyetcsrrv lgqhqmairl
121 tdnnaasrhk afmyqiscpv mqteetheha gstictkdsm sftfniipgm adentnpsgg
181 kwmmevddak aqnltlreal mqgynflfds hrlsvqvsfn atgvthymqg nshlytvplk
241 lihtspgqki ilttrvlcms dpvtcnathm tltipefpgk lqsvrfentn frvsqlhnhg
301 idkeelnglr lhfsksllkm nssekcllyq fylaslkltf aferdtvstv vypecvcepp
361 vtivtgdlct qdgfmdvkvy shqtkpalnl dtlrvgdssc qptfkapsqg Itlfhiplng
421 cgtrlkfkgd tviyeneiha lwtdlppsti srdsefrmtv kchysrddll intnvqslpp
481 pvasvrpgpl alilqtypdk sylrpygdke ypvvrylrqp iylevkvlnr adpniklvld
541 dcwatptmdp aslpqwnivm dgceynldny rttfhpvgss vtypthyqrf dvktfafise 601 aqvlsslvyf hctalicnrl spdsplcsvt cpvssrhrra tgsteeekmi vslpgpilll 661 adssslrdgv dskghraagy vafkt vava alaglvaalg liiylrkkrt mvlnh
Cat (Felis catus) - SEQ ID NO: 50
1 masrqkgdsg spsswfnadw styrslfllf ilvtsvnsig vlqlvnpvfp gtvtcyetrm 61 avefpsdfgt kkwhts vdp fsfellncty ildpenltlk apyetctrrt lgqhrmiirl 121 kdhnaasrhn slmyqincpv mqaeetheha gstictkdsm sftfnvipgl adentdiknp 181 mgwsievgdg tkaktltlqd vlrqgynilf dnhkitfqvs fnatgvthym qgnshlymvp 241 lkliheslgq kiilttrvlc msdavtcnat hvtltipefp gklksvssen rnfavsqlhn 301 ngidkeessg ltlhfsktll kmefsekclp yqfylaslkl tfafnqetis tvlypecvce 361 spvsivtgdl ctqdgfmdik vyshqtkpal nletlrggds scqptfqaas qglilfhipl 421 ngcgtrhkfk egkviyenei havwadlpps tisrdsefrm tvqchyskgd llintrvqsl 481 pppeasvrpg plalilqtyp dksylqpyge keypvvrylr qpiylevrvl nrsdpniklv 541 lddcwatptm dpasvpqwni imdgceynld nhrttfhpvg ssvtypthyr rfdvktfafv 601 seaqvlsslv yfhcsvlics rlsadsplcs vtcpvssrhr ratgtteeek mivslpgpil 661 llsdssslrd vvdskgygaa gyvafktvva vaalaglvat lgfitylrkn rtminh
Rat. (Rattiis norvegicus - SEQ ID NO: 51
1 marwqrvywl rslffalvts vnslslpqse npafpgtlic dkdevrvefs srfdmekwnp 61 slvdtfgnei snctyaldle kfilkfpyet ctikviggyq vnirvqdtna dvsykddvhh 121 ffcpaiqaei hevseivvcm edlisfsfpq lfsrladenq nvsemgwiik igngtrvhtl 181 plkdaivqgf nllidsqkit lhvpanatgv ahyvqessyl ytvqlkllfs spgqkitfss 241 qaicapdlsv acnvthmslt ipefpgklks vgfgqrnipe dqwhangidk eatnglrlhf 301 rksllktkps ekcpfyqfyf ssleltfnfq gdmlstvidp echcespvsi delctrdgfm 361 dfevyshqtk palnlesllv gnsscqpifk vqslglarfh iplngcgtrq kfegdkviye 421 neihalwenp psniifrnse frmtvrchyi rdsmllrahi kshsspvasv kpgplalvlq 481 typdisyqrp yrkneyplvr ylrqpiymev tvlnrndpni klvlddcwat tfedpasvpq 541 wqiimdgcey eldnyrttfh aanssaahsg hyqrfdvktf afvsesrgls sliyfhcsal 601 icnqasplcs vtcpaplrnk reaskegtmt vslpgpiill sddssskgvm npdsyeitkd 661 iasktlgava alvgsaviig ficylhkkri vrfns
Cow (Bos taurus) - SEQ ID NO: 52
1 macrqrgdsg rpsswfradw rsfflsftll tsvnsidvnq ldpafpgtvt cyenrmvvef 61 krtlgnkiqh asvvdslglk mlnctyvldp ekltlkapye sctkrvlgqh qmtitfmndn 121 tahrqktvly hvscpvmqag rhdqhsgsti cskdfmsftf hffpgladdt agpkpqmgwt 181 vtvgdgeraq nltlqealtq gynllienqk msiqvlfhat gvthysqgns hlymvplklt 241 hvspgqtiil ssrlicasdp vtcnathmtl tipefpgklk svsfenknia vnqlhnsgiv 301 meianglrlh fsktllktkf sekclpyqfy lsslkltfyt qletvsmviy pecvcestvs 361 ivsgelctqd gfmdvevyrh qtkpalnldt lrvgdsscqp tikapfqglv kfhiplngcg 421 trhkfengkv iyeneihalw adlppstisr dsefrmtvrc yysssnmlin tnveslpppv 481 asvkpgplal tlqtypdnsy Iqpygdkdyp vvrylrqpiy levrvlnrtd pniklvlddc 541 watstmdpas lpqwniivdg ceynldnhrt tfhpvgssva ypnhyqrfav ktfafvsedp 601 afshlvyfhc salicdqlss nfplcsascl vssrsrratg ateeekmivs lpgpilllsd 661 gssfrdavds kghgtsgyaa fktmva val ag vatlsli sylrkkritv lnh
1 macrhrgdsg rplswlsasw rslllffplv tsvnsigvnq lvntafpgiv tchenrm ve
61 fprilgtkiq yts vdplgl emmnctyvld penltlkapy eactkrvrgh hqmtirlidd
121 naalrqealm yhiscpvmga egpdqhsgst icmkdfmsft fnffpgmade nvkredskqr
181 mgwslvvgdg erartltfqe amtqgynfli enqkmniqvs fhatgvtrys qgnshlymvp
241 lklkhvshgq slilasqlic vadpvtcnat hvtlaipefp gklksvnlgs gniavsqlhk
301 hgiemettng lrlhfnqtll ktnvsekcqp hqlylsslrl tfhsqleavs mviypeclce
361 stvslvseel ctqdgfmdvk vhshqtkpal nldtlrvgds scqptfkapa qglvqfripl
421 ngcgtrhkfk ndkviyenei halwadppsa vsrdsefrmt vrcsysssnm lintnveslp
481 speasvkpgp ltltlqtypd naylqpygdk eypvvkylrq piylevriln rtdpniklvl
541 ddcwatsted paslpqwnvv mdgceynldn hrttfhpvgs svtypnhhqr fdvktfafvs
601 gaqgvsqlvy fhcsvficnq lsptfslcsv tchgpsrsrr atgtteeekm ivslpgpill
661 lsdgsslrda vnskgsrtng yvafktmvam vasagivatl glisylhkkr immlnh
Horse (Equus caballus) - SEQ ID NO: 54
1 mplamahrqr gdcgspsswr dsstdwsvyr slslffalvt lvnsggavkl vnpdfsgtvt 61 cykdrmivel pshlgpkkwh asvvdpsgle mlncthdldp ekltlkapye tctrrvlgrh 121 qmtirlvdns aalkreevvy qiscpvmqae ethehsgsti clkdfmsftf qifpgmades 181 sdpdsqmgwi ievgdgtraq tltlweamtq gynllidnkk iiiqvlfnat gvthytqgns 241 hlymvplklt yvspgqkvil ssqvicmsgp vtcnathmtl dipefpgklk svsfenrkia 301 asqlhnneid meatnglrlh fsktllkakf sekclpyqfy lpslkltfyv qletvsmvvy 361 peclcessvs ivtgelctqd gfmdievysh qtnpalnldt lmvgdsscqp tfkapsqglv 421 rfhiplngcg trhkfendtf iyeneihalw adlppstisr dsefrmtvkc hysrddmlin 481 tnieslpppv asvkpgqlal ilqtypdnsy lqpygdkeyp vmrylrqpiy levrilnrtd 541 pniklvlddc watptmdpas lpqwnivvdg ceynldnyrt tfhpvessvt ypnhyqrfdv 601 ktfaflseaq elsslvyfhc ralicnilsp dsplcsatcp lssrsrrdag tteqertlvs 661 lpgpilllsd dssfrgvvdt kghetagyia fktivavval ggvvatlgfi sylhkkrtmm 721 lnh
Elephant {Loxodonta africana) - SEQ ID NO: 55
1 macrwrtdsr chpswfhgvs raymslslff almtsvnsag apllanlafp gtvscnedgm 61 ivefpkdlgt kkwhasvvds lgleipncty vldpeklilr asydnctrrv hgayqttirl 121 mdnnaaktne atmyqiscpa meaedhlsks lvgstdcmkd smsvqtpllg wilkigdgpt 181 rsltlaeaik qgytvlmdsg kiilqvsfna tgvthyeqdn shlymvpltl iyespgqtit 241 lstrmicvtd svtcnathmt ltipgfpgkl kavstenrni nvsqlhdngi ereatnglrl 301 hfstsflktk isakclsqqf ylpslkltfh fhletvsmvv ypeclcespv svvtdelctq 361 dgfmefevys hqtkpaldld tlrvgdsscq pifkaqsqgl vrfhiplngc gtryefkedr 421 viyeneiyal wadlpskisr dsefrmtvkc yysssdvlin tnveslpppv asvkpgplal
481 ilqtypdnsy qhphgdheyp lvrylrqpiy levrilnrtd pniklviddc watatmdpas
541 lpqwni vdg ceynldnyqt tfhqarsfvt hpdhyqrfev ktftfvsgtp alsslvyfhc
601 salicnrlsp dsplcsvtcp gsprrrratg ateegkttvs lpgpilllsd spsfrdlgds
661 kghettedvt skttvavaas agvlatlglv tylrkkrtmr np
The following examples are provided to illustrate certain particular features and/or
embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.
EXAMPLES
Example 1: Materials and Methods
This example describes the materials and experimental procedures used for the studies described in Example 2.
Transgenic mouse lines
Targeted mutagenesis with a PGK-neomycin cassette was used to genetically
ablate Zpl (replaced exon 1-3), Zp2 (replaced exon 1-2), Zp3 (disrupted exon 1), and Cd9 (replaced promoter and exon 1) in embryonic stem (ES) cells. Correctly targeted ES cells were identified for injection into blastocysts to establish mouse lines with null alleles (Rankin et al. , Development
122:2903-2910, 1996; Rankin et al , Development 126:3847-3855, 1999; Rankin et al , Development 128: 1119-1126, 2001 ; Le Naour et al , Science 287:319-321 , 2000). Mouse lines expressing human zona proteins were established after pronuclear injection of genomic DNA encoding human ZP1 (11.9 kb including 2.2 promoter, 8.1 coding region, and 1.5 of 3' flank), ZP2 (16.8 kb including 2.3 kb promoter, 14 kb coding region, and 0.5 kb of 3' flank), ZP3 (16 kb including 6.0 kb promoter, exons 1-4 followed by cDNA encoding exons 5-8 and a BGH polyadenylation signal), and ZP4 (11.6 kb including 2.4 kb promoter, 8.2 coding region, and 1.0 kb of 3' flank; Rankin et al , Development 125:2415-2424, 1998; Rankin et al , Dev. Cell 5:33-43, 2003; Yauger et al , Reproduction 141 :313-319, 2011 ; Baibakov et al , J. Cell Biol. 197:897-905, 2012). In addition, three new mouse lines were established using chimeric almoZp2, chimeric molhaZP2, and oZp2T nc transgenes constructed by GalK DNA recombineering (Warming et al. , Nucleic Acids Res. 33:e36, 2005).
To establish the new lines, bacterial artificial chromosome (BAC) DNA (Life Technologies) that include either mouse Zpl (RP23-65I3) or human ZP2 (RP11-1023A8) were transformed into SW102 bacterial cells containing the λ prophage recombineering system (Liu et al , Genome Res. 13:476-484, 2003). For hu/moZ;>2, human genomic DNA encoding huZP241~168 (bp 26 in exon 2 to bp 21 in exon 6) replaced mouse genomic DNA encoding moZP237~165 (bp 59 in exon 2 to bp 6 in exon 5). To construct this transgene, a PCR fragment (1,331 bp) containing the galK operon flanked by 50 bp homologous to oZp2 gene 5' and 3' of the sequence encoding moZP222~161 protein was amplified (huZ ^-GalK primers; Table 2) using NEB Phusion (New England Biolabs, Inc.). After digestion with Dpnl and overnight gel purification (0.7% agarose, 15 V, 16 hours), the PCR fragment was electroporated into the BAC containing SW102 cells, and recombinants were selected by growth on minimal media with galactose. Using a clone from this first step, the galK cassette was replaced by recombineering with a second PCR fragment (5,783 bp) encoding huZP241~168 protein with 100-bp arms homologous to moZP2 on either side ( oZp2- uZP2 primers; Table 2). Mutant clones were selected on minimal media with 2-deoxy-galactose and confirmed by DNA sequencing of PCR products using gene specific primers (Table 2) to isolate 5' and 3' junction fragments.
In a similar recombineering strategy, DNA encoding huZP222~161 protein was replaced with sequence encoding moZP218~156 using huZK-GalK and uZP2- oZp2 primers (Table 2), and DNA encoding moZP251~149 protein was removed using moZ/?2-GalK and bridging oZp2 primers (Table 2) to establish the o/huZP2 and moZp2Tmnc transgenes, respectively. For the o/huZP2 transgene, mouse genomic DNA encoding moZP218~156 (bp 1 in exon 2 to bp 150 in exon 5) replaced human genomic DNA encoding huZP222~161 (bp 1 in exon 2 to bp 152 in exon 5), and for the
oZp2Trnuc transgene, DNA encoding moZP251~149 (bp 59 in exon 2 to bp 27 in exon 6) was deleted (FIG. 6A).
Table 2. Primers to produce and evaluate transgenes
Figure imgf000028_0001
SEQ ID
Primer Set F/R1 DNA Sequence (5' to 3')2
NO:
CAGGTGGGGGGAGGGACACAGAGAG 4
AGAGGTGGGGGGAGGGACAGAGGAA
R GAAGACAGAACAAATTGTATTCTTAC
CTGGTTTTCATCAGCAAGCCTAGAG A
GACCCGTGGCAAGGAAAACTGG
TTGTTTGTTAAAGTCCATTCTTCCTTGAC 5
F TATCTCCCTGTCTCTTTCCAGCCTGTTG
ACAATTAATCATCGGCA
huZP2-GalK
1TCCCCCTGCAGTAGCCATATACCCCGA 6
R GCAGTCAGCCCGTTTCACTCACTCAGC
ACTGTCCTGCTCCTT
CAGGCTGGAGGTGAGTAATTCTGGAAGT 7
GGAGGGAGGGGGTATGGTAGCTTTGTTT
F GTTAAAGTCCATTCTTCCTTGACTATCTC
CCTGTCTCTTTCCAGCATCT AC AGGTTT
CTTTCCCTCTTA
huZP2-moZp2
TAAA TCA TGGTCTGA TTTCTAAGCCCCG 8 CCCTGGTTAGATCATCATCATATTCCCCC
R TGCAGTAGCCATATACCCCGAGCAGTCA
GCCCGTTTCACTCAC AG ΑΎΑΎΎ AG ATC
TCTCCTGCAGACA
mo/huZP2 F GGTAGTGTCTTCTGCTATGGC 9
5' junction R CTTGACTACCTGGGGATGGA 10 mo/huZP2 F TTTCCCACTGAGGAATCGAC 11
3' junction R ATCTAGGGTAGGGCCTGGAA 12 hu/moZp2 F GGTGGTA CCTTCCAA CA TGG 13
5' junction R GAGCAGCTCCAGTTTTGCTT 14 hu/moZp2 F AATCGCTTGAACCCAGGAG 15
3' junction R CTCCTGGGTTCAAGCGATT 16
F TTTGCACGCTTTCCTGTAGC 17
Zp2Trunc
R GGGACAGGATATGGGATGTG 18
F, forward primer; R, reverse primer 2Fonts: oZp2 (normal); GalK (bold, underline); uZP2 (italic, underline)
Notl fragments containing the hu/moZjp2 (17.9 kb including 2.3 kb and 0.9 kb of the 5' and 3' flanking regions, respectively), mo/huZZ^ (16.8 kb including 1.5 kb and 1.7 kb of the 5' and 3' flanking regions, respectively), and truncated moZp2Tmnc (13.9 kb including 2.3 kb and 0.9 kb of the 5' and 3' flanking regions, respectively) transgenes were retrieved from the BAC with pl253 (Gahlay et ai, Science 329:216-219, 2010), and the fidelity of coding regions was confirmed by DNA sequencing. After gel purification, the transgenes were injected into the male pronucleus of fertilized FVB/N eggs by the Taconic Transgenic Mouse Facility. At least two founders were established for each transgene and crossed into mouse Zpl-3 null and human ZP1-4 transgenic mouse lines.
Genotyping
Hu/moZ;>2 mice were genotyped by PCR ([95°C for 30 s, 58°C for 30 s, 72°C for 1 min] x 30 cycles, 72°C for 7 min, and 4°C for >30 min) using primers in intron 5 of human ZP2 and intron 6 of mouse Zp2; o/huZP2 mice were genotyped using primers in intron 4 of mouse Zp2 and intron 5 of human ZP2; and moZp2Tmnc mice were genotyped by PCR using primers in intron 2 and intron 5 of mouse Zp2 (Table 3). Each transgenic line was crossed into the Zp2Nul1 background (Rankin et at , Development 128: 1119-1126, 2001) to establish lmoZp2, o/huZP2, and moZp2Tmnc rescue lines. To avoid ambiguity of PCR product sizes, the normal Zp2 allele was detected by three distinct primer sets for hu/moZp2 (Set 1), mo/huZP2 (Set 2), and moZp2Tmnc (Set 3) rescue lines (FIG. 6A; Table 3).
Table 3. Primers used for genotyping transgenic mice
Primer Set F/R1 DNA Sequence (5' to 3') SEQ ID PCR
NO: Product
(bp)
F TCCTCAGTCCGAGAATCCTG 19
Zp2 (Set 1) 693
R CTTGACTACCTGGGGATGGA 20
F TCCTCAGTCCGAGAATCCTG 21
Zp2 (Set 2) 3,478
R GCTAGACACAGTGTACTCAACATGG 22
F TCCTCAGTCCGAGAATCCTG 23
Zp2 (Set 3) 1,104
R CCAAGGGTTGGACTCTGTGT 24
F GCCTGAAGAACGAGATCAGC 25
Zp2Nu" 860
R CTTGACTACCTGGGGATGGA 26
F AATCGCTTGAACCCAGGAG 27 hu/moZp2 411
R GGACAGAGGAAGAAGACAGAACAA 28 mo/huZP2 F TTTCCCACTGAGGAATCGAC 29 544 Primer Set vnv DNA Sequence (5' to 3') SEQ ID PCR
NO: Product
(bp)
R ATCTAGGGTAGGGCCTGGAA 30
F TTTGCACGCTTTCCTGTAGC 31 moZp2Trunc 429
R GGGACAGGATATGGGATGTG 32
!F, forward primer; R, reverse primer
Expression of transgenes
Expression of normal Zp2, as well as u/ oZp2, mo/huZP2 and oZp2Trunc transgenes, was detected by RT-PCR using as gene-specific primer sets (Table 4) and total RNA isolated from 8-12-wk- old mouse tissue. Gapdh transcripts served as a control for RNA integrity (Baibakov et al. , J. Cell Biol. 197:897-905, 2012).
Table 4. Primers used for RT-PCR of RNA
Figure imgf000031_0001
*F, forward primer; R, reverse primer
Microscopy
Samples were mounted in PBS, and images of eggs, embryos, and beads were obtained with a confocal microscope (LSM 510; Carl Zeiss) using a 63x/1.2 NA water immersion objective lens at room temperature (Baibakov et al. , Development 134:933-943, 2007;Yauger et al. , Reproduction 141 :313-319, 2011). LSM 510 images were exported as full-resolution TIF files and processed in Photoshop CS5.5 (Adobe) to adjust brightness and contrast. Alternatively, confocal optical sections were projected to a single plane with maximum intensity and combined with DIC images of eggs or peptide beads using LSM image software. Ovarian histology and immunohistochemistry
Mouse ovaries were fixed in glutaraldehyde and embedded in glycol methacrylate before staining with periodic Schiff s acid and hematoxylin (Yauger et al , Reproduction 141:313-319, 2011). Ovulated eggs were fixed in 2% paraformaldehyde before staining with rat or mouse monoclonal antibodies (1 :50) specific to: moZPl (Rankin et al., Development 126:3847-3855, 1999), N terminus of moZP2 (East and Dean, J. Cell Biol. 98:795-800, 1984), C terminus of moZP2 (Rankin et al, Dev. Cell 5:33-43, 2003), moZP3 (East et al, Dev. Biol. 109:268-273, 1985), huZPl (Ganguly et al. , Hum.
Reprod. 25: 1643-1656, 2010), huZP2 (Rankin et al, Dev. Cell 5:33-43, 2003), huZP3 (Rankin et al , Development 125:2415-2424, 1998), and huZP4 (Bukovsky et al, J. Reprod. Immunol. 78: 102-114,
2008). Primary antibody binding was detected with goat anti-mouse ALEXA FLUOR™ 568 (1: 100) or goat anti-rat Cy3 (1: 100) antibodies (Life Technologies). Monoclonal antibody CSLEX1 (BD) that binds to the sialyl-Lewisx antigen was diluted 1:50 and detected with goat anti-mouse IgM-FITC (1 :20; Life Technologies). Images were obtained at room temperature on a microscope (Carl Zeiss; Axioplan 2) equipped with a 40x/0.75 NA lens using a camera (AxioCam lCcl) and AxioVision software (all from Carl Zeiss).
Assessment of sperm binding and fertility
To assay mouse sperm binding to the zona pellucida surrounding normal and transgenic mouse eggs, sperm were released from cauda epididymides, capacitated in human tubal fluid (HTF; EMD
Millipore) supplemented with 0.4% BSA (Sigma-Aldrich) for 40 minutes (37°C, 90% N2, 5% 02, and 5% CO2), and added to eggs in cumulus and embryos in 100 μΐ of HTF, 0.4% BSA at a final concentration of 105 ml-1 progressive motile sperm as determined by a HTM-IVOS (Version 12.3) motility analyzer (Hamilton Thorne; Gahlay et al, Science 329:216-219, 2010). Zp3EGFP mouse eggs (green zona) and two-cell embryos served as positive and negative wash controls, respectively.
Samples were fixed in 2% paraformaldehyde and stained with Hoechst to identify nuclei. Bound sperm were quantified from z projections obtained by confocal microscopy (Baibakov et al , Development 134:933-943, 2007), and results reflect the mean ± SEM from at least three independently obtained samples each containing 10-50 mouse eggs/embryos.
To assay human sperm binding, individual aliquots (0.5 ml) of liquefied human semen
(Genetics & IVF Institute Fairfax Cryobank) were added to an EPPENDORF™ tube (2.0 ml) containing 0.5 ml of 40% of PureSperm (Nidacon) layered over 0.5 ml of 80% PureSperm. After centrifugation (swinging bucket, 20 minutes x 300 g, 20°C) and removal of the supernatant, sperm were resuspended in the residual buffer and transferred into 1.0 ml HTF. After a second centrifugation (5 minutes x 300 g), sperm were resuspended in 0.2 ml of HTF/BSA, and 2-4 aliquots were mixed before evaluation by HTM-IVOS. Sperm were then diluted in HTF, 0.5% BSA to 107 ml"1 progressive motile sperm. Transgenic eggs in cumulus, normal eggs, Zp3 eggs (Zhao et al. , Mol. Cell. Biol. 22:3111- 3120, 2002), and noninseminated, immature human oocytes were incubated in droplets (100 μΐ) of sperm (107) in HTF, 0.5% BSA under mineral oil for 4 hours (37°C, 90% N2, 5% 02, and 5% C02) in a BT37GP incubator (Planer). Eggs/embryos/oocytes were washed by serial transfer through 500 μΐ of HTF/BSA and fixed for imaging (Baibakov et al. , J. Cell Biol. 197:897-905, 2012). For each experiment using human sperm, initial evaluations were conducted using 10 aZP2Rescue eggs as positive controls to test batches of HTF media and quality of human sperm preparations, which varied.
To assess fertility, females (>5) from each mouse line were singly co-caged with a fertile female (control, NIH Swiss) and mated (2: 1) with a male (NIH Swiss) proven to be fertile. Litters were recorded until the NIH Swiss fertile female gave birth to at least three litters or after 5 months of mating.
In vivo transcervical insemination
Female mice (8-12 weeks old) were hormonally stimulated at 12:00 midnight with 5 IU of pregnant mare serum gonadotropin (PMSG), and hCG was injected intraperitoneally 48 hours later. Epididymal mouse sperm from three males was released into 1.5 ml of HTF, 0.4% BSA and equilibrated for 1-5 hours (37°C, 90% N2, 5% 02, and 5% C02). Five hundred μΐ was used to inseminate each of two female mice. Alternately, commercially obtained human semen (proven to bind and penetrate human ZP2Rescue eggs in vitro) was prepared as described in the section above and diluted in 500 μΐ HTF 0.5% BSA that had been equilibrated (>24 hours) at 37°C, 90% N2, 5% 02, and 5% C02. After capacitation (1.5 hours), the contents of two vials of human semen were used to inseminate a single female mouse. At 11:00 p.m. (11 hours after hCG injection), females were restrained and inseminated with mouse or human sperm using an NSET device (ParaTechs) connected to a 1-ml syringe, which reached a single uterine horn without anesthesia and surgery (Snell et al., Anat. Rec. 90:243-253, 1944). Females were mated overnight with sterile, vasectomized males, and approximately 10 hours later, eggs were collected from the oviducts of females with copulatory plugs.
In vivo oviduct transfer of sperm
HuZP2Rescue and uZP3Rescue females were stimulated with gonadotropins and anesthetized. Human sperm were injected into the oviduct, proximal to the swollen ampulla. Two hours later, the mice were euthanized to collect eggs that were fixed and imaged by confocal microscopy (Sato and Kimura, Theriogenology. 55: 1881-1890, 2001 ; Tokuhiro et al., Proc. Natl. Acad. Sci U. S. A. 109:3850- 3855, 2012). Immunoblot
Ovulated eggs with intact zonae pellucidae from moQuad"Zi>^ and moQuad- moZp2Trunc transgenic mice were resolved by SDS-PAGE and probed with monoclonal antibodies to the N and C termini of mouse ZP2 (Burkart et al. , J. Cell Biol. 197:37-44, 2012).
Peptide bead binding assay
cDNA encoding human (39-154 aa) and mouse (35-149 aa) ZP2 were cloned into pFastBac- HBM TOPO (Invitrogen) downstream of a polyhedron promoter and a 23-amino acid honeybee melittin signal peptide. Each clone was tagged with 6-histidine at the C terminus to facilitate purification. Using the human cDNA as a backbone, chimeric mouse -human ZP2 clones were generated by DNA synthesis and used to make additional baculovirus expression constructs in which sequences encoding mouse ZP252~83, ZP285~101 and ZP2103~133 replaced endogenous human sequence. Recombinant peptides were expressed in HI FIVE™ cells, purified on IMAC SEPHAROSE™ High Performance beads (GE Healthcare), and assayed on SDS-PAGE (FIG. 7B) as described previously (Baibakov et al., 2012).
Results reflect the mean ± SEM from at least three independently obtained samples, each containing 20- 25 beads. Cloning, expression, and attachment to IMAC beads were performed in the Protein
Expression Laboratory of the Advanced Technology Program, SAIC-Frederick, Inc. Example 2: A single domain of the ZP2 zona pellucida protein mediates gamete recognition in mice and humans
A compelling target for non-hormonal female contraception is the zona pellucida, an extracellular matrix surrounding ovulated eggs and the pre-implantation embryo. The zona pellucida (ZP) is composed of 3 (mouse) or 4 (human) homologous proteins (Bleil and Wassarman, Dev Biol 76: 185-202, 1980; Lefievre et al., Hum Reprod 19: 1580-1586, 2004). Recently, ZP2 has been defined in both species as the zona ligand for a yet-to-be defined sperm surface receptor (Baibakov et al., J Cell Biol 197:897-905, 2012). Early studies had targeted the zona pellucida by passive administration of anti-zona antibodies that results in effective, long-term, but reversible contraception (Shivers et al. , Science 178: 1211-1213, 1972). As the molecular biology of the zona pellucida became known, monoclonal antibodies to specific zona proteins also were shown to be remarkable effective in preventing fertility (East et al., Dev Biol 109:268-273, 1985; Greenhouse et al. , Hum Reprod 14:593- 600, 1999; East et al., Dev Biol 104:49-56, 1984). These specific immunological reagents were also useful in defining epitopes for development of contraceptive vaccines (Millar et al., Science 246:935- 938, 1989; Sun et al., Biol Reprod 60:900-907, 1999; Jackson et al. , Biol Reprod 58: 152-159, 1998). However, active immunization results in autoimmune oophoritis not only in mice (Rhim et al. , J Clin Invest 89:28-35, 1992), but also in primate models (Paterson et al. , Am J Reprod Immunol 40: 198-209, 1998). Thus, these immunological approaches for reversible contraception in humans have been largely abandoned, although they continue to be effective in permanent sterilization of domestic and wild life populations in need of control (Massei and Cowan, Wildl Res 41: 1-21, 2014; McLaughlin and Aitken, Mol Cell Endocrinol 335:78-88, 2011).
Female mice that form a zona pellucida lacking ZP2 are sterile
Formation of the extracellular zona matrix is mediated by zona domains (260 aa motifs with conserved cysteine residues) present near the C terminus of each secreted zona protein (Bork and Sander, FEBS Lett. 300:237-240, 1992). The human zona pellucida is composed of four (ZP1-4) and the mouse of three (ZP1-3) glycoproteins (Bleil and Wassarman, Dev. Biol. 76: 185-202, 1980; Bauskin et ah , Mol. Hum. Reprod. 5:534-540, 1999). Mouse ZP1, the least abundant protein, is not required for formation of the zona pellucida or fertility (Rankin et ah , Development 126:3847-3855, 1999). In the absence of ZP2, a thin zona matrix is formed around growing oocytes that does not persist in ovulated eggs (Rankin et ah, Development 128:1119-1126, 2001), and no zona matrix is formed in the absence of ZP3 (Liu et ah , Proc. Natl. Acad. Sci. U. S. A. 93:5431-5436, 1996; Rankin et ah , Development
122:2903-2910, 1996). Based on the phylogeny (Larkin et ah, Bioinformatics. 23:2947-2948, 2007) of human and mouse zona proteins, ZP1/ZP2/ZP4 fall into one clade and ZP3 into another (FIG. 1 A). The zona domains of ZP2 and ZP3 have 10 and 8 conserved cysteine residues, respectively, the linkage of which differs in the two clades (FIG. IB; Boja et ah , J. Biol. Chem. 278:34189-34202, 2003). It was reasoned that if members of the first clade could substitute for one another, the presence of ZP4 along with ZP1 might permit formation of a matrix in the absence of mouse ZP2 and provide a loss-of- function assay for sperm-egg recognition. Because mouse Zp4 is a pseudogene (Lefievre et ah , Hum. Reprod. 19: 1580-1586, 2004), human ZP4 was expressed in transgenic mice (Yauger et ah ,
Reproduction 141:313-319, 2011) to establish a mouse line designated moQuad (moZPl, moZP2, moZP3, and huZP4). After the appropriate crosses, mice lacking mouse ZP2 in the presence of ZP4 were established and designated moQuad-Z/?2 V"" (moZPl, moZP3, and huZP4; Table 5).
In the presence of huZP4, moQuad^"2^ (ZP1 ,2,3,4) and moQuad-Z/^^ZP ^) transgenic lines form zonae pellucidae during oocyte growth that is similar to normal oocytes (Table 5). The zona pellucida persists after eggs are ovulated into the oviduct, and the composition of the moQuad- Zp2Nul1 zona matrix was confirmed with monoclonal antibodies that documented the absence of mouse ZP2. Ovulated eggs in cumulus (hyaluron interspersed with follicular cells) from moQuad"Zi>^ and moQua.d-Zp2Nul1 mice were inseminated with mouse sperm using Zp3EGFP mouse eggs (green zona) and normal mouse two-cell embryos, respectively, as positive and negative controls. Mouse sperm bound to moQuad^"2^ (41.4 ± 2.5, n = 30), but not to moQuad-Zp2Nu" , eggs (1.6 ± 0.3, n = 43), and the latter, but not the former, mouse line was sterile (FIG. 17). Thus, mouse ZP2 is required for in vitro sperm binding and in vivo mouse fertility. Table 5. Transgenic mouse lines
Figure imgf000036_0001
+ indicates human protein from transgene or endogenous mouse protein
X indicates absence of mouse protein due to genetic ablation
- indicates absence of human protein in transgenic mouse
Truncated ZP2 does not support mouse sperm binding
The secreted ZP2 ectodomain (35-633 aa) lacks the signal peptide (1-34 aa) that directs ZP2 into the endosomal pathway, and the C terminus (634-713) that includes a transmembrane domain. After fertilization, the ectodomain is cleaved near the N terminus (166LA jDE169) by ovastacin, an egg cortical granule metalloendoprotease, after which sperm no longer bind to the zona pellucida (Gahlay et al, Science 329:216-219, 2010; Burkart et al, J. Cell Biol. 197:37-44, 2012). To investigate the importance of the N terminus in mouse gamete recognition, DNA recombineering was used to construct a transgene lacking ZP25 U9(moZp2Tmnc; FIG. 2A and FIG. 6A). After crossing into the Zp2Nu" background, female mice reconstituted a zona pellucida that was thinner than normal. Therefore, these lines were crossed with uZP4 transgenic mice to establish moQuad-Z/?2r,'c mice that developed a more robust zona matrix during oocyte growth.
The zona pellucida surrounding ovulated eggs from moQuad and moQuad-Z/?2r,'c mice were analyzed by confocal microscopy using ZP2 domain-specific monoclonal antibodies. The zonae from both genotypes reacted with antibodies to ZP1, ZP2C term, ZP3, and huZP4. However, the monoclonal antibody to the N terminus of ZP2 did not react with the zona pellucidae surrounding moQuad- Zp2T nc eggs, although it recognized normal ZP2 in the moQuad. On immunoblots, the monoclonal antibody to the zP2N"term detected a 120-kD band in the zona pellucida isolated from moQuad, but not moQuad-Z;>2rc eggs (FIG. 2B, left). A monoclonal antibody to the ZP2C term detected a 120-kD band in the zona pellucida isolated from moQuad eggs and a 92-kD band in eggs from moQ ad-Zp2 nc mice (FIG. 2B, right). These observations are consistent with deletion of 99 amino acids (ZP251~149) in the N terminus of ZP2 of the zona pellucida surrounding moQuad-Z/?2r,'ceggs.
Mouse sperm did not bind to either Zp2Trunc (0.6 ± 0.2, n = 22) or moQuad-Zf>2rc (2.3 ± 1.3, n = 30) eggs and when mated with normal males, moQuad-ZJp27c females were sterile (FIG. 17). Based on these observations in transgenic mice, we conclude that the N terminus of mouse ZP2 is necessary for gamete recognition in vitro and in vivo.
Human sperm recognize human but not mouse ZP2
To extend these observations to human biology, huQuad"zw^ mice containing all four human proteins and none of the endogenous mouse proteins (Baibakov et al., J. Cell Biol. 197:897-905, 2012) were used to establish uQuad-ZP2NuU (huZPl,3,4) mouse lines (Table 5). Both lines formed a zona surrounding growing oocytes within the ovary, and using monoclonal antibodies specific to the human proteins, the absence of huZP2 in huQuad-ZP2 V"" ovulated eggs was confirmed. After insemination with human semen, sperm bound robustly to huQuad"zw^1 eggs (59.8 ± 5.3, n = 37), but rarely to huQuad-ZP2Nu" eggs (1.5 ± 0.3, n = 36). To ascertain if mouse ZP2 exerted a non-taxon-specific effect on the zona structure important for gamete recognition, mouse Zp2 was expressed in huQuad- ZP2NuU eggs. However, human sperm did not bind to the zona pellucida surrounding huQuad- ZP2N"";Zp2Mo eggs (0.7 ± 0.2, n = 30).
To determine if these observations pertain in vivo, an artificial insemination assay was established using mouse sperm as a positive control for fertility and for accumulation of sperm in the perivitelline space. After transcervical insemination (FIG. 7A), control (Cd9+/~) mice were fertile, albeit with smaller litters (2.0 ± 0.54 vs. 10.4 ± 0.81 for natural mating). Cd9Nul1 eggs to which sperm will not fuse (Le Naour et al. , 2000) accumulated 1-6 mouse sperm in their perivitelline spaces (between the inner aspects of the zona matrix and the plasma membrane) in 9 of 113 eggs (FIG. 3 A). Subsequently, huZP2Rescue (huZP2 replaces moZP2) and huZP3Rescue (huZP3 replaces moZP3) mice (Table 5) were inseminated with human sperm (3 x 107) and eggs recovered from the oviduct were examined by confocal microscopy to detect sperm in the perivitelline space where they accumulated, unable to fuse with mouse eggs. Of 29 eggs recovered from four uZP2Rescue mice, human sperm were detected in the perivitelline space of four eggs (one egg per female), which is consistent with the small litters observed in control (Cd9+/~) female mice. No sperm were observed in the perivitelline space of 28 uZP3Rescue eggs (FIG. 3B). To facilitate access to ovulated eggs, human sperm also were transferred directly to the oviduct (FIG. 3C). After 2 hours of incubation in vivo, 1-5 human sperm were observed in the perivitelline space of 22-77 eggs (29%) from uZP2Rescue mice (FIG. 3D). No sperm were observed in the perivitelline space of 85 control uZP3Rescue eggs, which is consistent with their inability to support human sperm binding in vitro (Baibakov et al, 2012). Thus, human sperm bind and penetrate the zona pellucida of uZP2Re cue, but not uZP3Re cue, eggs in vitro and in vivo.
Mouse sperm, lacking taxon-specific gamete recognition (Bedford, Anat. Rec. 188:477-488, 1977), also bound to huQuad"zw^ expressing human ZP2 (35.3 ± 1.9, n = 52) and the huQuad- ZP2Nu"; Zp2Mo (36.3 ± 2.2, n = 36) expressing mouse ZP2, but not the huQuad-Z/^"" eggs missing both mouse and human ZP2 (2.4 ± 0.3, n = 44). After mating, huQuad^"2"^ and huQuad- ZP2NuU; Zp2Mo female mice containing human or mouse ZP2 in their zonae pellucidae were fertile, but uQuad-ZP2Nul1 female mice lacking mouse and human ZP2 were sterile (FIG. 17). Collectively, these results indicate that ZP2 is necessary for human and mouse sperm binding and penetration through the zona pellucida, and for mouse fertility.
Earlier models of gamete recognition had focused on the role of specific glycans as ligands for sperm binding (Florman and Wassarman, Cell 41 :313-324, 1985; Bleil and Wassarman, Proc. Natl. Acad. Sci. U. S. A. 85:6778-6782, 1988; Miller et al., Nature 357:589-593, 1992; Chen et al. , Proc. Natl. Acad. Sci. U. S. A. 95:6193-6197, 1998). However, continued fertility after mutation of attachment sites (Liu et al., Mol. Biol. Cell 6:577-585, 1995; Gahlay et al., Science 329:216-219, 2010) and genetic ablation of specific galactosyltransferases (Thall et al. , J. Biol. Chem. 270:21437-21440, 1995; Lowe and Marth, Annu. Rev. Biochem. 72:643-691,2003; Shi et al, Mol. Cell. Biol. 24:9920- 9929, 2004; Williams et al, J. Cell Sci. 120: 1341-1349, 2007) have not supported the candidacy of any of the proposed glycans. More recently, the sialyl-Lewisx antigen has been reported to mediate human sperm binding to human zonae pellucidae (Pang et al. , Science 333: 1761-1764, 2011). Although the sialyl-Lewisx antigen was detected in the zona pellucida surrounding control human oocytes, it was not present in the zona matrix formed by normal, uZP2Rescue, or huQuad'72"^ eggs and cannot account for the observed binding of human sperm under these experimental conditions. The ZP2 domain required for sperm binding regulates taxon-specific gamete recognition
The ectodomains of human (602 aa) and mouse (599 aa) ZP2 share 62% amino acid identity, but the N termini of the two ZP2 proteins are only 48% identical. Thus, it was questioned whether the taxon specificity is mediated by the gamete recognition domain found to be essential for normal mouse sperm binding and fertility in Zp2Tmnc mice. Using DNA recombineering, genomic regions encoding the N termini of oZp2 and uZP2 were replaced with the corresponding human exons encoding huZP222~164 and mouse exons encoding moZP218~156, respectively (FIG. 6A). After establishment by pronuclear injection, each transgenic line was crossed into the mouse Zp2Nul1 line to eliminate endogenous ZP2 protein and designated almoZp2Rescue and mo/huZP2¾SCMe mice, respectively (FIG. 4A). The mice appeared normal and a robust zona pellucida was observed in ovarian sections from hu/moZP2Rescue and mo/huZP2 Rescue female mice. Mouse ZP1 and ZP3 were present in the zona pellucida surrounding ovulated eggs from each of the three transgenic mouse lines. The zona pellucida from huZP2 rescue mice (Table 5) reacted with monoclonal antibodies to huZP2N Term and not with either mouse-specific monoclonal antibody. The zona pellucida of the chimeric u/ oZP2 eggs reacted with huZP2N term and moZP2C term, but not moZP2N term monoclonal antibodies, and the zona pellucida surrounding the chimeric o/huZP2 rescue eggs reacted with antibodies to the N terminus, but not the C terminus, of mouse ZP2. Sperm binding was assessed in vitro using noninseminated human oocytes as a positive control and normal mouse eggs with a green zona (Zp3EGFP) as a negative control. Human sperm bound to the zona pellucida surrounding uZP2 (30.7 ± 1.3, n = 52) and u/ oZp2 (22.5 ± 1.7, n = 69), but not to the zona surrounding o/huZP2 rescue eggs (2.9 ± 0.5, n = 49). These observations indicate that a domain near the N terminus of ZP2 mediates the taxon specificity of human sperm binding to the zona pellucida.
Using ZP239~154 as a backbone, a recombinant baculovirus encoding N-terminal chimeric human and mouse ZP2 peptides was constructed in which mouse replaced human sequence between cysteine residues to systematically express moZP252~83, moZP285~101, and moZP2103~133 in place of the corresponding human sequence (FIG. 4B and FIG. 7B). Peptide beads were incubated with human sperm and washed to remove loosely adherent sperm, and binding was quantified from z projections of confocal images. HuZP239 154 (15.0 ± 0.9, n = 43) and moZP235 149 (1.2 ± 0.2, n = 43) peptide beads were used as positive and negative controls, respectively. Replacement of human sequence with moZP252~83 (3.2 ± 0.2, n = 16) dramatically decreased human sperm binding, whereas chimeric peptides with moZP285 101 (10.5 ± 1.0, n = 14) or moZP2103 133 (11.7 ± 0.8, n = 14) had a more minimal effect. These observations were quantified with box plots (FIG. 4C), which indicate that the region between the first two cysteine residues (huZP255~88; moZP252~83) near the N terminus of ZP2 plays a significant role in human gamete recognition. Model for sperm binding and penetration of the zona matrix
ZP2 was first proposed as a primary sperm-binding ligand in Xenopus laevis (Tian et al. , Proc. Natl. Acad. Sci. U. S. A. 96:829-834, 1999) and more recently in humans (Baibakov et al. , J. Cell Biol. 197:897-905, 2012). However, like all other candidates, it had not been defined as essential by genetic ablation. It is now disclosed herein that transgenic mice expressing human ZP4 form a zona pellucida in the absence of ZP2. Using this model system, a domain within ZP2 was identified that accounts for the taxon specificity of human sperm binding to the zona pellucida and, by genetic ablation, it was documented that this domain is essential for female mouse fertility. Collectively, these results are consistent with a model (FIG. 5) in which mouse and human sperm bind to ZP251~149 and hyperactive sperm penetrate the zona matrix to fuse and fertilize ovulated eggs. This triggers egg cortical granule exocytosis in which ovastacin, a metalloendoprotease (Quesada et al. , J. Biol. Chem. 279:26627-26634, 2004) encoded by Astl, is released and cleaves upstream of a di-acidic motif (166LA jDE169) in ZP2 (Burkart et al. , J. Cell Biol. 197:37-44, 2012). Although a single cleavage site is reported in human ZP2 (Bauskin et al., Mol. Hum. Reprod. 5:534-540, 1999), multiple degradation products are observed in mouse ZP2 (Burkart et al. , J. Cell Biol. 197:37-44, 2012). In each case, the post-fertilization cleavage of ZP2 provides a definitive block to polyspermy. Sperm that do not bind to the zona pellucida cannot penetrate the zona matrix or fuse with the egg plasma membrane. The destruction of the N terminus of ZP2 provides an effective block to polyspermy and ensures the monospermic fertilization required for the successful onset of development.
Example 3: Methods
This example describes the experimental procedures for the studies described in Example 4.
Establishment of mouse lines with fluorescent sperm
EGFP was released from Acr3-EGFP (Nakanishi et al, FEBS Lett. 449, 277-283, 1999) in pUC19 by digestion with PstI (New England Biolabs, Ipswich, Massachusetts) and treated with Klenow (Promega, Madison, Wisconsin) to generate blunt ends in the plasmid. Using pmCherry (Takara
Clontech, Mountain View, California) as a template, mCherry+SV40 polyA cDNA was synthetized by PCR using oligonucleotides flanking the EcoRV restriction sites:
Fwd 5'-GATATC ACC ATGGTGAGC AAGGGC-3 ' (SEQ ID NO: 43)
Rev 5' -GAT ATCCACCATGGTGAGC AAGGGC-3' (SEQ ID NO: 44)
The PCR product was subcloned into pCR2.1, isolated after digestion with EcoRV and blunt- end ligated into pUC19-Acr3 to establish a transgene with an acrosin promoter (2.4 kb), the proacrosin signal peptide (MVEMLPTVAVLVLAVSVVA; SEQ ID NO: 45) including an N-terminal peptide (KDNTT; SEQ ID NO: 46) in frame with the mCherry cassette, analogous to Acr3-EGFP.
The transgene was isolated with BamHI and Hindlll (New England Biolabs), gel purified and injected into the male pronucleus of fertilized FVB/N eggs. Mice were genotyped by PCR [95°C for 30 s, 58°C for 30 s, 72°C for 1 min] x 30 cycles, 72°C for 7 min, and 4°C for >30 min using mouse tail DNA, and primers that recognized a 507 bp region across the 5' UTR of Acrosin and mCherry (Table 6). Three founder males passed the transgene through their germline and accumulated mCherry in their acrosomes. One line (Tg(Acr/mCherrylDean) was used in the experiments reported and designated AcrjnCherr . This line was crossed with the PrmlEGW (Haueter et al, Genesis. 48, 151-160, 2010) and the FiglaEGFF (Lin et al. , PLoS One 9, e84477, 2014) lines to obtain a mouse line with sperm that accumulates mCherry in the acrosome and EGFP in the sperm nucleus and in the plasma membrane
(Ac^nCherry. PrmJ∞FP. piglaE∞P Table 6. Primers
Figure imgf000041_0001
Preparation of mouse and human gametes
Normal or transgenic mouse sperm were released from cauda epididymides in human tubal fluid (HTF; EMD Millipore, Billerica, Massachusetts) supplemented with 0.4% BSA (Sigma-Aldrich, St. Louis, Missouri) and analyzed by CASA IVOS (see Example 1). Mouse sperm were capacitated for 1 hour (37°C, 90% N2, 5% 02, 5% C02). Control (ICR) or Zp3EGFP (Zhao et αΙ. , ΜοΙ. Cell. Biol. 22, 3111-3120, 2002) female mice were stimulated with 5 IU of eCG and hCG (Sigma-Aldrich) and eggs in cumulus were collected 12 hours post hCG injection and incubated in 500 μΐ of HTF, 0.4% BSA at a final concentration of 1 x 105 ml"1 progressive-motile sperm (Gahlay et al. , Science 329, 216-219, 2010; and Example 1). Fertilization was scored 24 hours later by the presence of 2-cell embryos. To assess in vivo fertility, males (>5) from each mouse line were singly co-caged with control fertile female mice and litters were recorded until females gave birth to at least two litters.
Human semen (Genetics & IVF Institute Cryobank, Fairfax, Virginia) was added to an
EPPENDORF™ tube (2.0 ml) containing 0.5 ml of 40% of Pure-Sperm (Nidacon) layered over 0.5 ml of 80% PureSperm. After centrifugation (swinging bucket, 20 minutes x 300 g, 20°C) and removal of the supernatant, sperm were resuspended in the residual buffer and transferred into 1.0 ml HTF. After a second centrifugation (5 minutes x 300 g), sperm were resuspended in 0.2 ml of HTF/BSA. Sperm were then diluted in in 500 μΐ HTF, 0.5% BSA to 1 x 105 ml"1 progressive motile sperm (Baibakov et al., J. Cell Biol. 197, 897 -905, 2012; Y auger et al. , Reproduction 141, 313-319, 2011). Human sperm were capacitated in HTF/BSA for 4 hours (see Example 1).
Light microscopy
Fixed gamete samples (1 hour, 2% paraformaldehyde) were mounted in PBS, and images of eggs, embryos, and beads were obtained with a LSM 780 confocal microscope (Carl Zeiss AG, Jena, Germany) using a 63x/1.2 NA water immersion objective lens at room temperature. Images were exported as full resolution TIF files and processed in Photoshop CS6 (Adobe Systems, San Jose, California) to adjust brightness and contrast. Alternatively, confocal optical sections were projected on a single plane with maximum intensity and combined with DIC images of eggs or peptide-beads using LSM image software.
Electron microscopy
Mouse sperm bound to beads were fixed in 2% glutaraldehyde in 0.1M cacodylate buffer (pH
7.4) and incubated at 4°C for 2 hours. After extensive washing in the cacodylate buffer, beads were embedded in 2% agarose. The samples were then dehydrated through a graded series of ethanol and processed for embedding in LR-White resin. Ultrathin sections were obtained with an ultramicrotome (Microm International GmbH, Walldorf, Germany) and mounted on formvar coated nickel grids.
Ultrathin sections were counterstained with uranyl acetate followed by lead citrate and imaged in a Jeol JEL-1011 Transmission Electron Microscope (Jeol, Tokyo, Japan).
Sperm-egg binding assays
After treatment with hyaluronidase to remove cumulus cells, eggs were washed 3X in
HTF/BSA (Gahlay et al. , Science 329, 216-219, 2010) and incubated with either uncapacitated Act^G¥P, capacitated Acr™0116"7 or both (1 :1 ratio) progressive-motile sperm (1 x 105 ml"1) suspended in 500 μΐ HTF/BSA. After incubation (5 minutes), eggs were washed in HTF/BSA by careful transfer to a second and a third dish. Fixed sperm and eggs were mounted in PBS with Hoechst (10 g/ml) to identify nuclei. Bound sperm were quantified from z projections obtained by confocal microscopy.
Mouse and human sperm binding to ZP2 peptide-bead
IMAC SEPHAROSE™ beads (100 μΐ, GE HealthCare Life Sciences, Piscataway, New Jersey) were incubated overnight (37°C, 90% N2, 5% 02, and 5% C02) with recombinant mouse ZP235"149 peptides in 100 μΐ HTF/BSA and washed in the same media to remove free peptide. The presence of the N-terminus peptide on the agarose beads (Approximately 35 μπι diameter) was determined with a monoclonal antibody to the N-terminus of ZP2 (Baibakov et al. , J. Cell Biol. 197, 897-905, 2012). Beads alone or moZP2 peptide-beads were incubated with uncapacitated Aci^G¥P (Nakanishi et al. , FEBS Lett. 449, 277-283, 1999) or capacitated (1 hour) Acr1"0116"7 mouse sperm in HTF/BSA (500 μΐ). Samples (20-50 beads) were collected at 5 minutes, 30 minutes, 60 minutes, 90 minutes, 3 hours, 4 hours and 8 hours, fixed, washed and mounted in PBS with Hoechst. Bound sperm were quantified from z projections and acrosome status was determined by confocal microscopy. Concomitantly, the concentration and progressive-motility of unbound sperm were evaluated at each time point.
Alternatively, sperm were imaged live for 8 hours (37°C, 90% N2, 5% O2, 5% CO2) while interacting with moZP2 peptide-beads in HTF/BSA (500 μΐ) under mineral oil. A 60 μπι z series (5 μπι each) was acquired at 15 second intervals to prevent sperm bleaching/damage. Recombinant huZP2 peptides were attached to IMAC beads as described for mouse ZP2 peptide. Beads alone or huZP2 peptide-beads were incubated with uncapacitated or capacitated (2 hours) human sperm in HTF/BSA (500 μΐ). Samples (20-50 beads) were collected over time and analyzed as described for mouse sperm binding.
Competitive sperm binding assay
Eggs in cumulus from control (ICR) mice were incubated with capacitated, progressive-motile sperm (1 x 105 ml"1) in the presence of beads alone or moZP2 peptide-beads in HTF/BSA (500 μΐ). Sixteen hours later, eggs were collected and fertilization was scored by the presence of 2-cell embryos. Experiments were performed in triplicate. Alternatively, eggs in cumulus from uZP2Rescue female mice were incubated (HTF/BSA, 500 μΐ) with capacitated, progressive-motile human sperm (1 x 105 ml"1) in the presence of beads alone or huZP2 peptide-beads. Sixteen hours later, eggs were fixed, stained with WGA-633 to visualize the zona pellucida and mounted in PBS with Hoechst to quantify by confocal microscopy the number of supernumerary human sperm in the perivitelline space. Experiments were performed in triplicate.
Human sperm selection by peptide-bead binding
Beads alone or coated with the huZP239"154 peptide were incubated (30 minutes) with uncapacitated, progressive-motile human sperm (1 x 105 ml"1) in HTF (500 μΐ). Sperm, loosely attached to beads in each sample, were carefully transferred to a second dish containing HTF (50 μΐ), released from beads by gentle pipetting, and quantified by IVOS. In each sample, beads were removed and freshly ovulated eggs in cumulus from uZP2Rescue female mice were added. As a control, a comparable number of sperm from the parental dish (prior to selection) were incubated with uZP2Rescue eggs in cumulus. Sixteen hours later, eggs were fixed, stained with WGA-633, mounted in PBS with Hoechst (10 μg/ml) and the number of sperm bound to the zona pellucida and present in the perivitelline space was quantified by z projections using confocal microscopy. Experiments were performed using sperm from two different proven-to-be-fertile donors.
In vivo bead delivery
Gonadotropin stimulated female mice were anesthetized with Avertin (0.2 mg/lOg body weight). Beads alone, or moZP2 peptide-beads (3 x 105), each diluted in 700 μΐ HTF/BSA, were administered transcend cally into both uterine horns using a syringe (1 ml) attached to a blunt plastic needle. Females were mated overnight with ICR males proven to be fertile. Those with a copulatory plug 24 hours after mating were euthanized to determine the number of 1- and 2-cell embryos within the oviduct. Alternatively, female mice administered beads alone or moZP2- peptide-beads (5 each experimental group) were co-caged with a media (HTF) treated female and mated with a male proven to be fertile. Litters were recorded until the control female gave birth to at least three litters or after 5 month of mating.
To localize beads after transcervical administration, female mice were perfused via cardiac puncture with PBS (60 ml) containing heparin (10 U/ml) while still under anesthesia and then sacrificed. After isolation, the female reproductive tract was fixed overnight in 3% PFA and stained with IE-3 (1 :50), a monoclonal antibody specific to the N-terminus of moZP2 (East and Dean, J. Cell Biol. 98, 795-800, 1984; Sun et al , Biol. Reprod. 60, 900-907, 1999). Alternatively, the female reproductive tract was fixed in 4% PF A/PBS (24 hours, room temperature), washed 3 times in PBS over 12 hours and cleared with ScaleA2 solution (Hama et al. , Nat. Neurosci. 14, 1481-1488, 2011) for 3 weeks (5 ml/50 mg tissue) at room temperature protected from light. For confocal imaging, the tissues were mounted in ScaleA2 solution.
To document interactions of sperm with moZP2 peptide-beads in vivo, Zp3EGFP female mice with green zonae pellucidae (Zhao et αΙ. , Μοί Cell. Biol. 22, 3111-3120, 2002) in a Cd9NuU background (Le Naour et al , Science 287, 319-321, 2000) were mated overnight with Acr1"0116"7; PrmlEGFP;
FiglaEGFP male mice. Twenty-four hours after mating, females with copulatory plugs were anesthetized, perfused and sacrificed as described. Their reproductive tract was fixed and clarified prior to imaging by confocal microscopy.
Example 4: ZP2 peptide-beads that select human sperm in vitro, decoy mouse sperm in vivo and provide reversible contraception
The N-terminus of ZP2 is a sperm binding ligand in the zona pellucida surrounding ovulated eggs. This example describes the finding that mouse and human sperm bind, respectively, to recombinant mouse ZP235"149 and human ZP239"154 peptides attached to agarose beads. Mouse ZP2 peptide-beads dramatically inhibit fertilization of ovulated mouse eggs inseminated in vitro. Similarly, human ZP2 peptide-beads prevent sperm binding and penetration of transgenic zP2Rescue zonae pellucidae in which human ZP2 replaces mouse ZP2. Human sperm selected by the peptide-beads are better able to penetrate the zonae of human zP2Rescue eggs and thus could be used in selecting superior sperm for human assisted reproductive technologies. When mouse ZP2 peptide-beads are
transcervically deposited into the uterus, there is no change in mating behavior, copulatory plugs are present, but decoyed sperm do not progress into the oviduct and female mice are infertile. On average, contraception lasts >10 estrus cycles, but is reversible with no detectable pathology in the reproductive tract. Establishment oiAcrmChe"y mice with sperm that bind to ZP2 peptide-beads
A transgene (FIG. 8A) in which cDNA encoding mCherry replaced EGFP in Α^ορρ (Le Naour et at , Science 287, 319-321, 2000; Nakanishi et at , FEBS Lett. 449, 277-283, 1999) was used to establish mouse lines. Under the control of the acrosin promoter, these mice expressed fluorescent mCherry that accumulated in the acrosomes overlying the anteriorly located sperm nucleus and was detected before, but not after, induction of acrosome exocytosis. The AcrmCherry transgenic mice were fertile in vitro and in vivo with normal litter sizes. Their sperm had normal morphology and motility as determined by computer-assisted sperm analysis (CASA-IVOS) (FIG. 14B).
AcfmCherry md ACT£GFP (Nakanishi ET fl/ ? FEBS LETT 449 ? 277-283, 1999) sperm were released from the epididymides into human tubal fluid (HTF) media supplemented with bovine serum albumin (BSA) and used immediately or after 1 hour incubation at 37°C, respectively. Both fluorescently- tagged sperm bound within 5 minutes to the zona pellucida surrounding cumulus-free eggs either alone or as a 1: 1 mixture (FIG. 14C). Mouse sperm also bound to moZP235"149 peptide-beads and prior 1 hour incubation to capacitate sperm did not affect the number of sperm that initially bound (FIG. 8D). These data indicate that mouse and human sperm incubated for 5 minutes in HTF/BSA can bind to the N- terminus of ZP2. This is consistent with reports that sperm bind in vitro to the zona pellucida surrounding eggs prior to capacitation (Hartmann et at , Proc. Natl. Acad. Sci. U. S. A. 69, 2767-2769, 1972) which is required for acrosome exocytosis and fertilization (Chang, Nature 168, 697-698, 1951 ; Austin, Aust. J. Sci. Res., (B) 4, 581-596, 1951).
Inhibition of in vitro fertilization in the presence of moZP235"149 peptide-beads
To determine if moZP235"149 could decoy sperm, eggs in cumulus mass were inseminated in vitro with 1 x 105 sperm in 500 μΐ in the presence of moZP235"149 peptide-beads (3000 beads/μΐ), agarose beads alone (3000 beads/μΐ), or media (FIG. 9A). In the media or beads alone controls, 84.5 ± 1.7% and 75.8 ± 1.6% of eggs were fertilized, respectively. However, in the presence of moZP235"149 peptide-beads, only 6.8 ± 3.8% of the eggs were fertilized after a 24-hour incubation (FIG. 9B).
To study the effect of sperm pep tide-bead interactions in vitro, 10 μΐ of moZP235"149 peptide- beads (300 beads/μΐ) were added to 1 x 105 progressive-motile uncapacitated or capacitated AcrmCherry sperm in 500 μΐ. The uncapacitated sperm should become capacitated within an hour under the assay conditions. At 30 minutes to 8 hours after insemination, the number, motility and acrosome status of bound sperm as well as the motility of the free sperm in the media were determined. Comparable numbers of initially uncapacitated and capacitated mouse sperm bound to the peptide-beads (FIGS. 15A-15B). Unbound sperm in the media maintained progressive-motility for 2 hours after
insemination, but completely lost their motility by 4 hours (FIG. 9C) at which time the beads to which they were bound no longer rotated. Both initially uncapacitated and capacitated bound sperm underwent acrosome exocytosis between 60 minutes and 4 hours post insemination (FIG. 9D), but acrosome-reacted, non- motile sperm remained bound to the peptide-bead as determined by light (FIGS. 15A and 15B) and electron microscopy. It was concluded that sperm decoyed to the moZP2 peptide- beads lose motility, undergo acrosome exocytosis over time and remain attached to the beads unable to fertilize eggs.
Human ZP239"154 peptide-beads inhibit human sperm zona matrix penetration
To extend these observations to human biology, it was documented that initially uncapacitated and capacitated human sperm bound to huZP239"154 peptide-beads (FIGS. 8B-8D; FIGS. 16A and 16B). Sperm binding and zona penetration were assayed using aZP2Rescue eggs from transgenic mice in which human ZP2 replaced endogenous mouse ZP2. Normally human sperm bind, penetrate the zona matrix of aZP2Rescue eggs and accumulate in the perivitelline space unable to fuse with mouse eggs (Baibakov et al, J. Cell Biol. 197, 897-905, 2012). UuZP2Rescue eggs in cumulus and 1 x 105 progressive motile human sperm were incubated overnight in media (500 μΐ), beads alone (3000 beads/μΐ) or huZP239"154 peptide-beads (3000 beads/μΐ) (FIG. 10A). Progressive motility of unbound sperm was maintained for at least 2 hours (FIG. 10B). In the presence of media or beads alone, 1-5 human sperm were observed in the perivitelline space of these eggs (FIG. IOC). However, in the presence of huZP239"154 peptide-beads, no sperm were present in the perivitelline space of 27 uZP2Rescue eggs and a single human sperm was observed in a 28th egg. These data indicate that moZP235"149 and huZP239"154 peptide-beads are effective in decoying mouse and human sperm, respectively, from binding and penetrating the zona pellucida surrounding ovulated eggs in cumulus.
Human ZP239"154 peptide-beads select sperm competent for binding and penetration of the zona pellucida
From the peptide-bead binding experiments, it was observed that 30 minutes after insemination, human sperm binding to the beads was loose and easily disrupted by gentle pipetting. To determine if bound sperm selectively improved fertility, 1 x 105 progressive motile human sperm were incubated in 500 μΐ of media with beads alone (300 beads/μΐ) or huZP2 peptide-beads (300 beads/μΐ) for 30 minutes and transferred to a second dish where sperm and beads separate. Beads were then removed and aZP2Rescue eggs (5-10) in cumulus (3-4) were added (FIG. 16C). Using sperm from two fertile anonymous human donors, the number of sperm that bound to the surface of the zona pellucida (FIGS. 11 A and 1 IB) or penetrated through the zona matrix (FIGS. 11C and 1 ID) was substantially increased after selection with huZP2 peptide-beads compared to unselected sperm incubated with media or beads alone. The two donors differed in the number of sperm bound to the zona pellucida (Donor A 2.0 ± 0.5; Donor B 8.6 ± 2.2), but had comparable number of sperm in the perivitelline space (Donor A 2.0 ± 0.5;
Donor B 2.2 ± 0.7). From these observations, it was concluded that human sperm selection with huZP2 peptide-beads is a rapid (35 minutes) and effective procedure to identify subpopulations of sperm competent for zona pellucida binding and penetration. These results indicate utility in the clinic to improve the outcome of assisted reproductive technologies for humans. MoZP235"149 peptide-beads act to decoy sperm in vivo
To determine if the same sperm decoy effect observed in vitro could be achieved in vivo, moZP235"149 peptide-beads or beads alone (1.5 x 106) were transcervically administered (FIG. 12) into the bilateral uterine horns using a 1 ml syringe attached to a plastic blunted needle. To assay the effectiveness of this procedure, the presence of moZP235"149 peptide on the moZP2 peptide-beads was confirmed in vitro with a monoclonal antibody to zP2N"term. After intrauterine administration, the reproductive tract was fixed, cleared for 3 weeks with ScaleA2 (Hama et al., Nat. Neurosci. 14, 1481- 1488, 2011) and ZP2 peptide-beads were detected throughout the uterus by confocal microscopy. No immunoreactivity with the anti-ZP2 antibody was observed following administration of beads alone which were identified by staining with wheat germ agglutinin.
After intra-uterine ejaculation, it was hypothesized that precocious interaction between sperm and the moZP2 peptide-beads would impede sperm progression and cause infertility. To follow sperm migration and acrosome status, AcrmCherry mice were crossed with Prml EGFP (Haueter et al. , Genesis. 48, 151-160, 2010) and FiglaEGFP (Lin et al, PLoS One 9, e84477, 2014) mice to establish AcrjnCherr ;
PrmlEGFP; FiglaEGFP mice in which protamineEGEP was present in the nucleus, myristoylated EGFP was embedded in the plasma membrane and mCherry was present in the acrosome. These mice were fertile with normal litter sizes and sperm had normal morphology and motility as determined by computer- assisted sperm analysis (CASA-IVOS) (FIG. 14B).
Eggs in cumulus oophorus from Zp3EGFP female mice with a green zona pellucida (Zhao et al. , Mol. Cell. Biol. 22, 3111-3120, 2002) were inseminated in vitro with AcrmCherr ; PrmlEGW; FiglaEGFP sperm. After 5 minutes, sperm and eggs were fixed and clarified prior to imaging by confocal microscopy where both acrosome-intact and acrosome-reacted sperm could be observed at single-cell resolution. Therefore, these procedures were used to determine if sperm competent for binding and zona matrix penetration reach the oviductal ampulla after encountering the moZP2 peptide beads in the uterus. To avoid possible inconsistencies from in vivo fertilization (time of insemination, dissolution of the cumulus oophorus, etc.), Zp3EGFP mice were crossed into the Cd9 (Le Naour et al., Science 287,
319-321, 2000) null background to prevent gamete fusion. Female mice were treated with HTF media, beads alone or moZP2 peptide-beads prior to mating with AcrmCherry; PrmlEGFP; FiglaEGFP male mice. After fixation and clarification of the female reproductive tract, acrosome-reacted sperm bound to moZP2 peptide-beads were present in the uterus, but no sperm were observed in the oviduct. In contrast, sperm were present in the oviduct of female mice treated with media or beads alone and
Zp3EGFP; Cd9Nul1 eggs accumulated sperm in their perivitelline space. After overnight mating, the non- fertilizing sperm in the ampulla of the oviduct were acrosome-reacted (green heads), whereas those in the uterus and lower oviduct were mostly acrosome-intact (yellow heads), consistent with previous observations (Jin et al, Proc. Natl. Acad. Sci. U. S. A. 108, 4892-4896, 2011 ; Cummins et al., Gamete Res. 5, 239-256, 1982).
MoZP235"149 peptide-beads provide long-term reversible contraception in female mice
Gonadotropin-stimulated normal female mice were mated with fertile males after treatment with media, beads alone or moZP235"149 peptide-beads (approximately 1.5 x 106 beads in 500 μΐ). Embryos from females with copulatory plugs were isolated 48 hours after mating. Females (5) treated with media or beads alone were fertile and 21.0 ± 2.1 and 17.7 ± 1.2 two-cell embryos, respectively, were recovered from their oviducts 40 hours after mating. Embryos were rarely (1.3 ± 0.3) observed in females (5) treated with moZP2 peptide-beads (FIG. 13 A).
To investigate an effect on natural mating, female mice (5) treated with media, beads alone or moZP2 peptide-beads were co-caged and continuously mated with a male proven to be fertile (1 :3). Female mice treated with beads alone or media became pregnant and delivered pups 25.4 ± 0.6 (avg. ± s.e.m.) and 28.2 ± 3.1 days after mating, respectively. Female mice treated with moZP2 peptide-bead initially were infertile and did not give birth to pups until 72.8 ± 4.6 (avg. ± s.e.m.) days after mating. The size of the first moZP2 peptide-bead treated litters were smaller (3.2 ± 1.2 vs 7.2 ± 1.5) than the beads alone control, but matched them (8.0 ± 0.7 vs 8.4 ± 1.5) by the second litter (FIG. 13B). All of the moZP2 peptide-bead treated mice eventually resumed fertility and produced at least two litters within the 5 month study (FIG. 13B). To investigate potential pathology as causative of the observed infertility, the reproductive tracts of female mice were isolated 14 days after treatment. Compared to female mice treated with beads alone, no histopathology or evidence of inflammation was observed in female mice treated with moZP2 peptide-beads. Thus, these date indicate that moZP2 peptide-bead treatment results in long-term, reversible contraception with no obvious adverse effects.
Use for Contraception and Fertility
Effective contraception is critical for family planning and includes barrier methods, hormone intervention, intrauterine devices and sterilization (Cates and Maggwa, Contraception 90, S14-S21, 2014). Newer methods for male contraception reversibly prevent sperm maturation (Matzuk et al., Cell 150, 673-684, 2012; Amory et al , J. Androl. 32, 111-119, 2011), disrupt the Sertoli cell-barrier to promote sperm loss (Li et al., Fertil. Steril. 92, 1141-1146, 2009; Su et al. , Nat. Commun. 3, 1185, 2012) or affect sperm motility (Li et al , Fertil. Steril. 92, 1141-1146, 2009). As an alternative approach, the present disclosure provides evidence that decoying sperm in the lower female reproductive tract with ZP2 N-terminal peptide-beads prevents interactions with ovulated eggs. This strategy provides highly effective, non-hormonal, long-term, but reversible contraception in female mice. The N-terminus of human ZP2 has a comparable effect on human sperm in vitro and ZP2 is conserved among eutherian mammals (Spargo and Hope, Biol. Reprod. 68, 358-362, 2003).
Normally sperm undergo capacitation during passage through the female reproductive tract, or after incubation with serum proteins, to gain the ability to fertilize ovulated eggs (Chang, Nature 168, 697-698, 1951; Austin, Aust. J. Sci. Res., (B) 4, 581-596, 1951). However, neither mouse nor human sperm need be capacitated to bind to the peptide-beads which provide immediate capture of sperm following initial contact with the ZP2 N-terminal peptide both in vitro and in vivo. After 4 (mouse) to 8 (human) hours, bound sperm lose their motility as well as the integrity of the plasma and outer acrosome membranes in vitro and remain adherent to the beads. Once bound to the peptide-beads, sperm do not ascend through the utero-tubal junction and are not observed in the oviduct. Whether all sperm interact with the peptide-beads or just a sufficient number to fall below a threshold needed to progress into the upper female reproductive tract remains to be determined. The data indicate that inert beads (approximately 35 μπι diameter) themselves are no obstacle to sperm passage through the uterus as female mice treated with beads alone had normal in vitro and in vivo fertility. In these experiments, the peptide-beads provided effective, long-term contraception that was ultimately reversible. For human contraception, the ZP2 peptide-beads could be combined with spermicidal gels or attached to removable spermicidal sponges. Alternatively, the ZP2 peptides could be attached to vaginal rings impregnated with steroid hormones (estrogen and progestin) to improve contraceptive efficacy by decreasing available sperm and suppressing ovulation.
Sperm binding to the N-terminus of ZP2 in vitro also provides a physiological criterion to identify sperm for assisted reproductive technologies. Intracytoplasmic sperm injection, in which a single human spermatozoon is injected directly into a retrieved egg ( Palermo et ai, Lancet 340, 17- 18, 1992), relies on anthropomorphic selection of one sperm out of many and successful outcome may not be apparent until birth or later in life (Bonduelle et ai, Hum. Reprod. 14 Suppl 1, 243-264, 1999). Using huZP2 peptide-beads, human sperm were selected that have a superior ability to bind and penetrate the aZP2Rescue zona pellucida, where they accumulate in the perivitelline space unable to fuse with the mouse egg's plasma membrane. The advantage of sperm selection with huZP2 peptide-beads is multi-fold. Recombinant human peptide provides an inexhaustible supply of reagents and commercial production of the peptide-beads is technologically simple. The selection procedure takes about 30 minutes and can be supplemented by secondary criteria based on sperm morphology and/or motility. huZP2 peptide-beads could be used to concentrate sperm in patients with oligozoopermia (< 20 million sperm ml"1), select better performing sperm from patients with asthenozoospermia (< 50% normal motility or < 25% any motility) and discriminate between normal and abnormal sperm in patients with teratozoospermia (< 30% normal morphology). In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. An isolated mammalian zona pellucida 2 (ZP2) peptide bound to a solid support, wherein the mammalian ZP2 peptide is no more than 100 amino acids in length and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47 or the corresponding residues from a mammalian homolog of ZP2.
2. The solid support-bound mammalian ZP2 peptide of claim 1, wherein mammalian ZP2 peptide is no more than 75, no more than 60, no more than 50, no more than 40 or no more than 35 amino acids in length.
3. The solid support-bound mammalian ZP2 peptide of claim 1 or claim 2, wherein the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47.
4. The solid support-bound mammalian ZP2 peptide of claim 1 or claim 2, wherein the mammalian ZP2 peptide consists of residues 55-88 of human ZP2 set forth as SEQ ID NO: 47.
5. The solid support-bound mammalian ZP2 peptide of any one of claims 1-4, wherein the solid support comprises a bead, resin, microtiter plate, membrane, glass, metal, intrauterine device, sponge, diaphragm, cervical cap or vaginal ring.
6. The solid support-bound mammalian ZP2 peptide of claim 5, wherein the bead is an agarose bead, a paramagnetic bead or a resin bead.
7. An isolated mammalian zona pellucida 2 (ZP2) peptide bound to a solid support, wherein:
the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47 or the corresponding residues from a mammalian homolog of ZP2; and
the solid support comprises a contraceptive device.
8. The solid support-bound mammalian ZP2 peptide of claim 7, wherein the mammalian ZP2 peptide is no more than 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40 or no more than 35 amino acids in length.
9. The solid support-bound mammalian ZP2 peptide of claim 7 or claim 8, wherein the mammalian ZP2 peptide comprises or consists of residues 55-88 of human ZP2 set forth as SEQ ID NO: 47.
10. The solid support-bound mammalian ZP2 peptide of claim 7 or claim 8, wherein the mammalian ZP2 peptide comprises or consists of residues 39-154 of human ZP2 set forth as SEQ ID NO: 47.
11. The solid support-bound mammalian ZP2 peptide of any one of claims 7-10, wherein the contraceptive device comprises an intrauterine device, a sponge, a diaphragm, a cervical cap or a vaginal ring.
12. The solid support-bound mammalian ZP2 peptide of any one of claims 1-11, wherein the mammalian ZP2 peptide is bound to the solid support by chemical conjugation.
13. The solid support-bound mammalian ZP2 peptide of any one of claims 1-11, wherein the solid support comprises a first specific binding partner and the mammalian ZP2 peptide comprises a second specific binding partner and the mammalian ZP2 peptide is bound to the solid support by non-covalent binding of the first and second specific binding partners.
14. The solid support-bound mammalian ZP2 peptide of claim 13, wherein the first and second specific binding partners comprise:
(i) a metal-chelate and a histidine tag;
(ii) bio tin and avidin;
(iii) an antigen and an antibody that specifically binds the antigen; or
(iv) a hapten and an antibody that specifically binds the hapten.
15. The solid support-bound mammalian ZP2 peptide of any one of claims 1-11, wherein the solid support comprises a metal-chelate and the mammalian ZP2 peptide comprises a histidine tag and the mammalian ZP2 peptide is bound to the solid support by binding of the metal- chelate to the histidine tag.
16. The solid support-bound mammalian ZP2 peptide of claim 15, wherein the metal comprises nickel, cobalt or copper.
17. A method of inhibiting fertilization in a female mammalian subject, comprising administering to the subject by intravaginal or intrauterine administration a therapeutically effective amount of a mammalian ZP2 peptide bound to a solid support.
18. The method of claim 17, wherein the solid support comprises a contraceptive device.
19. The method of claim 18, wherein the contraceptive device comprises an intrauterine device, a sponge, a diaphragm, a cervical cap or a vaginal ring.
20. A method of selecting for sperm capable of binding and penetrating the zona pellucida of an ovulated egg, comprising:
providing a sperm sample from a mammal;
contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide; and
isolating the sperm bound to the mammalian ZP2 peptide.
21. The method of claim 20, wherein the solid support comprises a bead, a resin, a microtiter plate or a membrane.
22. The method of claim 21, wherein the bead is an agarose bead, a paramagnetic bead or a resin bead.
23. A method of diagnosing infertility in a male subject of a mammalian species, comprising:
obtaining a sperm sample from the subject;
contacting the sperm sample with a mammalian ZP2 peptide bound to a solid support under conditions sufficient to allow binding of the sperm to the mammalian ZP2 peptide;
quantifying the number of sperm bound to the mammalian ZP2 peptide; and
diagnosing infertility in the subject if the number of sperm is below a threshold level required for fertility in the mammalian species.
24. The method of claim 23, wherein the solid support comprises a bead, a resin, a microtiter plate or a membrane.
25. The method of claim 24, wherein the bead is an agarose bead, a paramagnetic bead or a resin bead.
26. The method of any one of claims 23-25, wherein the threshold level required for fertility in the mammalian species is an empirically determined reference value.
27. The method of any one of claims 17-26, wherein the mammalian ZP2 peptide is no more than 200, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 50, no more than 40 or no more than 35 amino acids in length.
28. The method of any one of claims 17-27, wherein the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47 or the corresponding residues from a mammalian homolog of ZP2.
29. The method of any one of claims 17-28, wherein the subject is a human subject and the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47.
30. The method of any one of claims 17-28, wherein the subject is a human subject and the mammalian ZP2 peptide consists of residues 55-88 of human ZP2 set forth as SEQ ID NO: 47.
31. The method of any one of claims 17-28, wherein the subject is a human subject and the mammalian ZP2 peptide comprises residues 39-154 of human ZP2 set forth as SEQ ID NO: 47.
32. The method of any one of claims 17-28, wherein the subject is a human subject and the mammalian ZP2 peptide consists of residues 39-154 of human ZP2 set forth as SEQ ID NO: 47.
33. The method of any one of claims 17-32, wherein the mammalian ZP2 peptide is bound to the solid support by chemical conjugation.
34. The method of any one of claims 17-32, wherein the solid support comprises a first specific binding partner and the mammalian ZP2 peptide comprises a second specific binding partner and the mammalian ZP2 peptide is bound to the solid support by non-covalent binding of the first and second specific binding partners.
35. The method of any one of claims 17-32, wherein the solid support comprises a metal-chelate and the mammalian ZP2 peptide comprises a histidine tag and the mammalian ZP2 peptide is bound to the solid support by binding of the metal-chelate to the histidine tag.
36. The method of claim 35, wherein the metal comprises nickel, cobalt or copper.
37. An isolated mammalian ZP2 peptide bound to or encapsulated within a solid support, wherein the mammalian ZP2 peptide is no more than 100 amino acids in length and comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47 or the corresponding residues from a mammalian homolog of ZP2.
38. The solid support-bound mammalian ZP2 peptide, wherein the solid support comprises a synthetic polymer and the ZP2 peptide is encapsulated within the synthetic polymer.
39. An isolated mammalian ZP2 peptide bound to or encapsulated within a solid support, wherein:
the mammalian ZP2 peptide comprises residues 55-88 of human ZP2 set forth as SEQ ID NO: 47 or the corresponding residues from a mammalian homolog of ZP2; and
the solid support comprises a contraceptive device.
40. The solid support-bound mammalian ZP2 peptide of claim 39, wherein the contraceptive device comprises a vaginal ring comprising a synthetic polymer and the ZP2 peptide is encapsulated within the synthetic polymer.
PCT/US2016/037428 2015-06-15 2016-06-14 Non-hormonal mammalian sperm decoy contraception based on the n-terminus of the zp2 protein Ceased WO2016205239A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562175821P 2015-06-15 2015-06-15
US62/175,821 2015-06-15

Publications (2)

Publication Number Publication Date
WO2016205239A1 true WO2016205239A1 (en) 2016-12-22
WO2016205239A8 WO2016205239A8 (en) 2017-01-26

Family

ID=56292915

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/037428 Ceased WO2016205239A1 (en) 2015-06-15 2016-06-14 Non-hormonal mammalian sperm decoy contraception based on the n-terminus of the zp2 protein

Country Status (1)

Country Link
WO (1) WO2016205239A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023066923A1 (en) * 2021-10-19 2023-04-27 Rahman Nafis Male contraception

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5168049A (en) 1984-10-02 1992-12-01 Biogen, Inc. Production of streptavidin-like polypeptides
WO1995007466A2 (en) 1993-09-08 1995-03-16 Baxter International Inc. Biotin-analog conjugated antibodies for positive cell selection and release
US5973124A (en) 1995-06-14 1999-10-26 Yeda Research And Development Co. Ltd. Modified avidin and streptavidin molecules and use thereof
US20010016343A1 (en) 1999-05-27 2001-08-23 Strongin Robert M. Derivatized biotin compounds and methods
US20020004479A1 (en) * 1996-05-23 2002-01-10 Ursula-Friederike Habenicht Zona pellucida proteins for contraception
WO2003011118A2 (en) * 2001-08-02 2003-02-13 Trinity Biomedical Technology Corporation Human zona pellucida proteins and methods of their use in diagnosing male infertility
US20040024197A1 (en) 2000-09-22 2004-02-05 Phillppe Duchaussoy Polysaccharides with antithrombotic activity comprising at least a covalent bond with biotin or a biotin derivative
US20040191832A1 (en) 1998-11-10 2004-09-30 Yeda Research And Development Co., Ltd. Avidin derivatives and uses thereof
US20050048012A1 (en) 2003-08-26 2005-03-03 Roland Jermann Use of biotin or a biotin derivative for skin lightening purposes and for the treatment of senile lentigines
US20070105162A1 (en) 2005-10-28 2007-05-10 Massachusetts Institute Of Technology Monovalent avidin and streptavidin compositions
US20080255004A1 (en) 2006-11-15 2008-10-16 Invitrogen Dynal As Methods of reversibly binding a biotin compound to a support

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5168049A (en) 1984-10-02 1992-12-01 Biogen, Inc. Production of streptavidin-like polypeptides
WO1995007466A2 (en) 1993-09-08 1995-03-16 Baxter International Inc. Biotin-analog conjugated antibodies for positive cell selection and release
US5973124A (en) 1995-06-14 1999-10-26 Yeda Research And Development Co. Ltd. Modified avidin and streptavidin molecules and use thereof
US20020004479A1 (en) * 1996-05-23 2002-01-10 Ursula-Friederike Habenicht Zona pellucida proteins for contraception
US20040191832A1 (en) 1998-11-10 2004-09-30 Yeda Research And Development Co., Ltd. Avidin derivatives and uses thereof
US20010016343A1 (en) 1999-05-27 2001-08-23 Strongin Robert M. Derivatized biotin compounds and methods
US20040024197A1 (en) 2000-09-22 2004-02-05 Phillppe Duchaussoy Polysaccharides with antithrombotic activity comprising at least a covalent bond with biotin or a biotin derivative
WO2003011118A2 (en) * 2001-08-02 2003-02-13 Trinity Biomedical Technology Corporation Human zona pellucida proteins and methods of their use in diagnosing male infertility
US20050048012A1 (en) 2003-08-26 2005-03-03 Roland Jermann Use of biotin or a biotin derivative for skin lightening purposes and for the treatment of senile lentigines
US20070105162A1 (en) 2005-10-28 2007-05-10 Massachusetts Institute Of Technology Monovalent avidin and streptavidin compositions
US20080255004A1 (en) 2006-11-15 2008-10-16 Invitrogen Dynal As Methods of reversibly binding a biotin compound to a support

Non-Patent Citations (101)

* Cited by examiner, † Cited by third party
Title
"Molecular Biology and Biotechnology: a Comprehensive Desk Reference", 1995, VCH PUBLISHERS, INC.
"The Encyclopedia of Molecular Biology", 1994, BLACKWELL SCIENCE LTD.
ADOLFO AVELLA ET AL: "ZP2 peptide beads select human sperm in vitro, decoy mouse sperm in vivo, and provide reversible contraception", SCIENCE TRANSLATIONAL MEDICINE, vol. 8, no. 336, 27 April 2016 (2016-04-27), Washington, DC, pages 336ra60, XP055290363, ISSN: 1946-6234, DOI: 10.1126/scitranslmed.aad9946 *
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403
ALTSCHUL ET AL., NATURE GENET, vol. 6, 1994, pages 119
AMORY ET AL., J. ANDROL., vol. 32, 2011, pages 111 - 119
AUSTIN, AUST. J. SCI. RES., (B), vol. 4, 1951, pages 581 - 596
BAHAMONDES; BAHAMONDES, INT J WOMEN'S HEALTH, vol. 6, 2014, pages 221 - 234
BAIBAKOV ET AL., DEVELOPMENT, vol. 134, 2007, pages 933 - 943
BAIBAKOV ET AL., J CELL BIOL, vol. 197, 2012, pages 897 - 905
BAIBAKOV ET AL., J. CELL BIOL., vol. 197, 2012, pages 897 - 905
BAUSKIN ET AL., MOL. HUM. REPROD, vol. 5, 1999, pages 534 - 540
BAUSKIN ET AL., MOL. HUM. REPROD., vol. 5, 1999, pages 534 - 540
BEDFORD, ANAT. REC., vol. 188, 1977, pages 477 - 488
BENJAMIN LEWIN: "Genes V", 1994, OXFORD UNIVERSITY PRESS
BLEIL; WASSARMAN, DEV BIOL, vol. 76, 1980, pages 185 - 202
BLEIL; WASSARMAN, DEV. BIOL., vol. 76, 1980, pages 185 - 202
BLEIL; WASSARMAN, PROC. NATL. ACAD. SCI. U. S. A., vol. 85, 1980, pages 6778 - 6782
BLEIL; WASSARMAN, PROC. NATL. ACAD. SCI. U. S. A., vol. 85, 1988, pages 6778 - 6782
BOIVIN ET AL., HUM. REPROD., vol. 22, 2007, pages 1506 - 1512
BOJA ET AL., J. BIOL. CHEM., vol. 278, 2003, pages 34189 - 34202
BONDUELLE ET AL., HUM. REPROD., vol. 14, no. 1, 1999, pages 243 - 264
BORIS BAIBAKOV ET AL: "Human sperm bind to the N-terminal domain of ZP2 in humanized zonae pellucidae in transgenic mice", THE JOURNAL OF CELL BIOLOGY, 25 June 2012 (2012-06-25), United States, pages 897 - 905, XP055289804, Retrieved from the Internet <URL:http://jcb.rupress.org/content/197/7/897.full.pdf> DOI: 10.1083/jcb.201203062 *
BORK; SANDER, FEBS LETT., vol. 300, 1992, pages 237 - 240
BUKOVSKY ET AL., J. REPROD. IMMUNOL, vol. 78, 2008, pages 102 - 114
BURKART ET AL., J. CELL BIOL., vol. 197, 2012, pages 37 - 44
CHANG, NATURE, vol. 168, 1951, pages 697 - 698
CHECK ET AL., ARCH. ANDROL., vol. 28, 1992, pages 15 - 17
CHEN ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 95, 1998, pages 6193 - 6197
CHRISTIN-MAITRE, BEST PRACT RES CLIN ENDOCRINOL METAB, vol. 27, 2013, pages 3 - 12
CORNET, CURR OPIN OBSTET GYNECOL, vol. 25, no. 1, 2013, pages S1 - 10
CORPET ET AL., NUCLEIC ACIDS RESEARCH, vol. 16, 1988, pages 10881
CUMMINS ET AL., GAMETE RES., vol. 5, 1982, pages 239 - 256
E. W. MARTIN: "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING CO.
EAST ET AL., DEV BIOL, vol. 104, 1984, pages 49 - 56
EAST ET AL., DEV BIOL, vol. 109, 1985, pages 268 - 273
EAST ET AL., DEV. BIOL., vol. 109, 1985, pages 268 - 273
EAST; DEAN, J. CELL BIOL., vol. 98, 1984, pages 795 - 800
FLORMAN; WASSARMAN, CELL, vol. 41, 1985, pages 313 - 324
GAHLAY ET AL., SCIENCE, vol. 329, 2010, pages 216 - 219
GANGULY ET AL., HUM. REPROD., vol. 25, 2010, pages 1643 - 1656
GERLAND ET AL., SCIENCE, vol. 346, 2014, pages 234 - 237
GREENHOUSE ET AL., HUM REPROD, vol. 14, 1999, pages 593 - 600
HAMA ET AL., NAT. NEUROSCI., vol. 14, 2011, pages 1481 - 1488
HARTMANN ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 69, 1972, pages 2767 - 2769
HAUETER ET AL., GENESIS, vol. 48, 2010, pages 151 - 160
HERBEMONT; SIFER, MINERVA GINECOL., vol. 67, 2015, pages 185 - 193
HIGGINS; SHARP, CABIOS, vol. 5, 1989, pages 151
HIGGINS; SHARP, GENE, vol. 73, 1988, pages 237
JACKSON ET AL., BIOL REPROD, vol. 58, 1998, pages 152 - 159
JIN ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 108, 2011, pages 4892 - 4896
LARKIN ET AL., BIOINFORMATICS, vol. 23, 2007, pages 2947 - 2948
LE NAOUR ET AL., SCIENCE, vol. 287, 2000, pages 319 - 321
LEA I A ET AL: "Analysis of recombinant mouse zona pellucida protein 2 (ZP2) constructs for immunocontraception", VACCINE, ELSEVIER LTD, GB, vol. 20, no. 11-12, 22 February 2002 (2002-02-22), pages 1515 - 1523, XP004340371, ISSN: 0264-410X, DOI: 10.1016/S0264-410X(01)00514-X *
LEFIEVRE ET AL., HUM REPROD, vol. 19, 2004, pages 1580 - 1586
LEFIEVRE ET AL., HUM. REPROD., vol. 19, 2004, pages 1580 - 1586
LI ET AL., FERTIL. STERIL., vol. 92, 2009, pages 1141 - 1146
LIN ET AL., PLOS ONE, vol. 9, 2014, pages E84477
LIU ET AL., GENOME RES., vol. 13, 2003, pages 476 - 484
LIU ET AL., MOL. BIOL. CELL, vol. 6, 1995, pages 577 - 585
LIU ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 93, 1996, pages 5431 - 5436
LOWE; MARTH, ANNU. REV. BIOCHEM., vol. 72, 2003, pages 643 - 691
M. A. AVELLA ET AL: "The molecular basis of gamete recognition in mice and humans", MOLECULAR HUMAN REPRODUCTION., vol. 19, no. 5, 17 January 2013 (2013-01-17), GB - BE, pages 279 - 289, XP055289802, ISSN: 1360-9947, DOI: 10.1093/molehr/gat004 *
MARNACH ET AL., MAYO CLIN PROC, vol. 88, 2013, pages 295 - 299
MASSEI; COWAN, WILDL RES, vol. 41, 2014, pages 1 - 21
MATTEO A. AVELLA ET AL: "A single domain of the ZP2 zona pellucida protein mediates gamete recognition in mice and humans", THE JOURNAL OF CELL BIOLOGY : JCB, vol. 205, no. 6, 16 June 2014 (2014-06-16), US, pages 801 - 809, XP055289777, ISSN: 0021-9525 *
MATZUK ET AL., CELL, vol. 150, 2012, pages 673 - 684
MCLAUGHLIN; AITKEN, MOL CELL ENDOCRINOL, vol. 335, 2011, pages 78 - 88
MILLAR ET AL., SCIENCE, vol. 246, 1989, pages 935 - 938
MILLER ET AL., NATURE, vol. 357, 1992, pages 589 - 593
NAKANISHI ET AL., FEBS LETT., vol. 449, 1999, pages 277 - 283
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
PALERMO ET AL., LANCET, vol. 340, 1992, pages 17 - 18
PANG ET AL., SCIENCE, vol. 333, 2011, pages 1761 - 1764
PATERSON ET AL., AM J REPROD IMMUNOL, vol. 40, 1998, pages 198 - 209
PEARSON; LIPMAN, PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 2444
QUESADA ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 26627 - 26634
RANKIN ET AL., DEV. CELL, vol. 5, 2003, pages 33 - 43
RANKIN ET AL., DEVELOPMENT, vol. 122, 1996, pages 2903 - 2910
RANKIN ET AL., DEVELOPMENT, vol. 125, 1998, pages 2415 - 2424
RANKIN ET AL., DEVELOPMENT, vol. 126, 1999, pages 3847 - 3855
RANKIN ET AL., DEVELOPMENT, vol. 128, 2001, pages 1119 - 1126
RHIM ET AL., J CLIN INVEST, vol. 89, 1992, pages 28 - 35
SAKSCHEWSKI ET AL., ECOL MODEL, vol. 288, 2014, pages 103 - 111
SATO; KIMURA, THERIOGENOLOGY, vol. 55, 2001, pages 1881 - 1890
SHI ET AL., MOL. CELL. BIOL., vol. 24, 2004, pages 9920 - 9929
SHIVERS ET AL., SCIENCE, vol. 178, 1972, pages 1211 - 1213
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
SNELL ET AL., ANAT. REC., vol. 90, 1944, pages 243 - 253
SPARGO; HOPE, BIOL. REPROD., vol. 68, 2003, pages 358 - 362
SU ET AL., NAT. COMMUN., vol. 3, 2012, pages 1185
SUN ET AL., BIOL REPROD, vol. 60, 1999, pages 900 - 907
SUN ET AL., BIOL. REPROD., vol. 60, 1999, pages 900 - 907
THALL ET AL., J. BIOL. CHEM., vol. 270, 1995, pages 21437 - 21440
TIAN ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 96, 1999, pages 829 - 834
TOKUHIRO ET AL., PROC. NATL. ACAD. SCI U. S. A., vol. 109, 2012, pages 3850 - 3855
TRUSSEL, CONTRACEPTION, vol. 83, 2011, pages 397 - 404
WARMING ET AL., NUCLEIC ACIDS RES., vol. 33, 2005, pages E36
WILLIAMS ET AL., J. CELL SCI., vol. 120, 2007, pages 1341 - 1349
YAUGER ET AL., REPRODUCTION, vol. 141, 2011, pages 313 - 319
ZHAO ET AL., MOL. CELL. BIOL., vol. 22, 2002, pages 3111 - 3120

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023066923A1 (en) * 2021-10-19 2023-04-27 Rahman Nafis Male contraception

Also Published As

Publication number Publication date
WO2016205239A8 (en) 2017-01-26

Similar Documents

Publication Publication Date Title
Rankin et al. Fertility and taxon-specific sperm binding persist after replacement of mouse sperm receptors with human homologs
Krutskikh et al. Epididymal protein Rnase10 is required for post-testicular sperm maturation and male fertility
Sachdev et al. Oocyte specific oolemmal SAS1B involved in sperm binding through intra-acrosomal SLLP1 during fertilization
EP2559701A1 (en) Transgenic animal with enhanced immune response and method for the preparation thereof
CN109922823A (en) The diagnostic and therapeutic method of pre-eclampsia
US20060015954A1 (en) GPR54 knock-out mammals and screening methods using them
CN103361336A (en) Animal model with male reproductive disorders, as well as preparation method and application thereof
Dun et al. Sperm–zona pellucida interaction: molecular mechanisms and the potential for contraceptive intervention
JP5374389B2 (en) Method for introducing foreign gene into early embryo of primate and method for producing transgenic primate animal containing the method
ES2784643T3 (en) Pig model for diabetes
AU771957B2 (en) MSH5 ablated mice and uses therefor
JP2004508009A (en) Sperm factor oscilogenin
ES2313116T3 (en) PEPTIDE THAT INCREASES THE PHUSOGENIC CAPACITY OF A GAMET.
US7384913B2 (en) PT32 sperm protein, sperm c-Yes, oocyte cytoplasmic c-Yes, and uses thereof
Godin Pagé The role of Nodal in the modulation of the maternal immune system in early pregnancy
Williams et al. 9 Meiosis, Fertilization, and Preimplantation Embryo Development
CN101732714A (en) Manchette binding protein and effects thereof during spermiogenesis
Skinner–Biol Week 14
Scenna Inhibition of Direct Prostaglandin F 2α Effects on Pre-attachment Embryos Improves Reproductive Efficiency in Cattle
Chung Disruption of the HMGA2 Gene in Swine Reduces Growth
AU2006233166A1 (en) Sperm factor oscillogenin
Solimena et al. PTBP1 Is Required for Embryonic Development before Gastrulation
Dietzel et al. The biological role of fetuin-B: inhibition of zona pellucida hardening and preservation of female fertility in mice
Baldassarre et al. CHAPTER V. IMMUNOHISTOCHEMISTRY STUDIES AND PRODUCTION ENHANCEMENT TREATMENTS IN TRANSGENIC GOATS EXPRESSING RECOMBINANT HUMAN BUTYRYLCHOLINESTERASE
Alfieri Gamete fusion: A perspective on egg glycosylphosphatidylinositol-anchored proteins

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16733792

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16733792

Country of ref document: EP

Kind code of ref document: A1