WO2016201307A1 - Glutamine antagonists for use in treating cerebral edema and cerebral malaria - Google Patents

Glutamine antagonists for use in treating cerebral edema and cerebral malaria Download PDF

Info

Publication number
WO2016201307A1
WO2016201307A1 PCT/US2016/036996 US2016036996W WO2016201307A1 WO 2016201307 A1 WO2016201307 A1 WO 2016201307A1 US 2016036996 W US2016036996 W US 2016036996W WO 2016201307 A1 WO2016201307 A1 WO 2016201307A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
brain
don
mice
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/036996
Other languages
French (fr)
Other versions
WO2016201307A8 (en
Inventor
Susan K. PIERCE
Jonathan D. Powell
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
US Department of Health and Human Services
Original Assignee
Johns Hopkins University
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University, US Department of Health and Human Services filed Critical Johns Hopkins University
Publication of WO2016201307A1 publication Critical patent/WO2016201307A1/en
Publication of WO2016201307A8 publication Critical patent/WO2016201307A8/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42Oxazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure concerns the use of a glutamine antagonist to treat cerebral edema and reverse blood-brain barrier defects in a subject, such as a subject with cerebral malaria.
  • HCM cerebral malaria
  • administration of a glutamine antagonist to a subject suffering from cerebral malaria is capable of treating cerebral edema, restoring BBB integrity, inhibiting degranulation of CD8+ T cells in the brain, and promoting survival.
  • the cerebral edema is caused by cerebral malaria, a traumatic brain injury or a hemorrhagic stroke.
  • a subject with malaria who has been diagnosed with cerebral malaria e.g., a subject who is exhibiting at least one neurological sign or symptom of cerebral malaria
  • a method of inhibiting degranulation of CD8+ T cells in the brain of a subject with malaria by selecting a subject with cerebral malaria and administering to the subject a therapeutically effective amount of a glutamine antagonist.
  • the glutamine antagonist is 6- diazo-5-oxo-L-norleucine (DON).
  • compositions comprising DON and an antimalarial agent.
  • FIGS. 1A-1D DON treatment reduced the mortality associated with experimental cerebral malaria (ECM).
  • C57BL/6 mice were infected with Plasmodium berghei ANKA (PbA) on day 0 and injected intraperitoneally with saline (NoRx) or with DON (1.3 mg/kg) beginning on day 5 post infection (p.i.) at 7 am (DON Rx d5a), on day 5 p.i. at 11 pm (DON Rx d5p), or on day 6 p.i. at 7 am (DON Rx d6a). DON treatment was continued every day or every other day as shown (FIG. 6). (FIG.
  • FIG. 1A Kaplan-Meier survival plots.
  • FIG. IB Clinical scores (Waisberg et al, PLoS One 7, e29493, 2012) from 0 (no symptoms) to 10 (moribund) of mice in FIG. 1A.
  • FIG. 1C Peripheral blood parasitemia for mice in FIG. 1A. Data for DON Rx d5a were combined from three independent experiments, data for DON Rx d5p were combined from four independent experiments and data for DON Rx d6a were combined from two independent experiments. Shown are the mean and standard error of the mean (SEM) for FIG. IB and FIG. 1C. (FIG.
  • mice infected with PbA were treated with DON on d5p p.i. or left untreated.
  • mice were transcardially perfused, the brains removed and the fold changes in PbA 18s RNA of treated and untreated mice as compared to the brains of untreated mice removed on day 5p p.i. were determined as detailed in Example 1.
  • Each dot represents a mouse with the mean and standard deviation (SD) given. Shown are the results combined from three independent experiments each having three-four mice per group. A Mann- Whitney test showed no significant difference.
  • FIGS. 2A-2C DON treatment restored BBB function and reduced brain swelling but did not acutely resolve brain hemorrhages in /3 ⁇ 4A-infected mice. All mice were infected with PbA and treated with saline or DON (1.3mg/kg) on day 5p p.i. and the brains removed and analyzed on the days and times indicated.
  • FIG. 2A Levels of Evans blue (EB) in the brains were quantified and expressed relative to the levels of EB in the brains of /3 ⁇ 4>A-infected, untreated mice on d6a p.i. Each symbol represents one mouse. The data are combined from three independent experiments. The mean and SD are given.
  • FIGS. 2A-2C DON treatment restored BBB function and reduced brain swelling but did not acutely resolve brain hemorrhages in /3 ⁇ 4A-infected mice. All mice were infected with PbA and treated with saline or DON (1.3mg/kg) on day 5p p.i.
  • FIGS. 3A-3J DON treatment reduced CD8 + T cell degranulation but not the accumulation of immune cell in the brains of PbA -infected mice. All mice were either uninfected or infected with PbA and treated with DON (1.3 mg/kg) or saline on day 5p p.i. (FIGS. 3A-3E). On day 6a p.i. mice were perfused with cold PBS, the brains and/or spleens removed and single cell suspensions prepared. Cells were analyzed by flow cytometry using the gating strategy show in FIG. 8. Shown are the number of cells per brain for: (FIG. 3A) macrophage/DCs; (FIG. 3B) neutrophils; (FIG.
  • FIG. 3C natural killer (NK) cells;
  • FIG. 3D CD 4 + T cells; and
  • FIG. 3E CD8 + T cells. Data were combined from three independent experiments.
  • FIG. 3F Representative flow cytometry plots of glideosome-associated protein 50 (GAP50) major histocompatibility complex (MHC) class I D b tetramer binding CD8 + T cells in unenriched spleen/lymph node cell populations (left and right panels), and in GAP50-tetramer-binding cells enriched using magnetic beads coated with APC-specific antibodies (middle panel).
  • GAP50 glideosome-associated protein 50
  • MHC major histocompatibility complex
  • FIG. 3G The number of GAP50-tetramer binding CD8 + T cells in spleen and brains. Data were combined from three independent experiments.
  • FIG. 3H Representative flow cytometry plots of CD8 + T cells in the spleens of mice that received fluorescently labeled CD107-specific antibodies intravenously one hour before being sacrificed to allow labeling of CD107-expressing cells in vivo.
  • FIGS.4A-4F DON significantly alters citrulline, urea and nitric oxide metabolism in the brain during ECM.
  • Principle components analysis was performed for each of three tissue types collected from mice at day 6a p.i. for the five experimental groups defined by infection, treatment and clinical outcome. Principal components were determined from all detectable metabolites for the (FIG.4A) brain (438 metabolites), (FIG. 4B) liver (544 metabolites) and (FIG. 4C) serum (563 metabolites). Each symbol represents one tissue sample from one mouse.
  • FIG. 4D Venn diagram showing the number of differentially abundant brain metabolites for the two main comparisons: (1) infected, untreated mice vs.
  • FIGS.5A-5C 81 metabolites that were reversed by DON treatment during PbA infection.
  • the table lists the 81 metabolites that were differentially abundant in both the PbA- infected, untreated vs. uninfected, untreated comparison and the /3 ⁇ 4>A-infected, DON treated, low clinical score vs PbA infected, untreated comparison. Only metabolites meeting differential abundance thresholds of absolute fold change >1.2 and a false discovery rate ⁇ 5% in both comparisons are shown.
  • FIG.6 DON treatment schedule. DON treatment (1.3 mg/kg) was initiated on day 5 p.i. at 7 am (d5a), day 5 p.i. at 11 pm (d5p) or day 6 p.i at 7 am (d6a) and continued every day or every other day as shown.
  • FIG.7 Late cessation of DON treatment leads to increased parasitemia.
  • C57BL/6 mice were infected with PbA on day 0 and given saline (No Rx) or DON (1.3 mg/kg) every other day beginning at 7 am on day 1 p.i. (DON Rx dla) and peripheral blood parasitemia was determined by flow cytometry on the days indicated.
  • FIG. 8 Gating strategy to identify immune cells in the brain and spleens. Single cell suspensions were gated, excluding very small cells/debris, and cell doublets were excluded by side- scatter-width. Using 'aqua' live/dead dye to label dead cells, only living cells were gated. The pan leukocyte marker CD45.2 was used to gate on leukocytes. Cells were gated on CD3+ cells that include CD4+ and CD8+ T cells, NKT and ⁇ T cells. CD3+ T cells were gated further on CD8+ and CD4+ cells.
  • the CD3- gate was used to further subset cells into neutrophils (Ly6G+, Ly6C+), macrophages/DC (Ly6G-, Ly6C+) and NK cells (NK1.1+).
  • neutrophils Ly6G+, Ly6C+
  • macrophages/DC Ly6G-, Ly6C+
  • NK1.1+ NK cells
  • FIGS. 9A-9B The effect of PbA infection and DON treatment on the glutaminolysis pathway in the brain, liver and serum.
  • DON blocks the first step of glutaminolysis by inhibiting glutaminase.
  • FIG. 9B PbA infection and DON treatment of PbA infected mice affect the glutaminolysis pathway differently in the brain relative to the liver and serum. Shown are absolute fold change and false discovery rates (FDR) by Welch's t test for the indicated 2- way comparison. Positive fold changes (red shading) represent significantly increased (FDR ⁇ 0.05) metabolite abundance in the first group compared to the second group. Negative fold changes (blue shading) represent significantly decreased (FDR ⁇ 0.05) metabolite abundance in the first group compared to the second group.
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • sequence Listing is submitted as an ASCII text file, created on June 6, 2016, 2.08 KB, which is incorporated by reference herein. In the accompanying sequence listing:
  • SEQ ID Nos: 1-8 are nucleic acid primer sequences.
  • SEQ ID NO: 9 is an amino acid sequence of a PbA GAP50 peptide.
  • DON 6-diazo-5-oxo-L-norleucine
  • Acivicin ((alpha S,5S)-alpha-amino-3-chloro-4,5-dihydro-5-isoxazoleacetic acid): A glutamate antagonist that is a fermentation product of Streptomyces.
  • Acivicin is a glutamine analog that irreversibly inhibits glutamine-dependent amidotransferases involved in nucleotide and amino acid biosynthesis.
  • Acivicin also inhibits gamma-glutamyl transpeptidase and is known to have anti-tumorigenic activity.
  • a therapeutic agent e.g. a glutamine antagonist
  • routes of administration include, but are not limited to, injection or infusion (such as subcutaneous, intramuscular, intradermal,
  • intraperitoneal intrathecal, intravenous, intracerebroventricular, intrastriatal, intracranial and into the spinal cord), oral, intraductal, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
  • Antimalarial agent Any agent that is capable of preventing or treating malaria.
  • antimalarial agents include, but are not limited to, quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, artemeiher/lumefantrine, pyrimethamine/sulfadoxine and artemisinin or an artemisinin derivative (such as artesimate).
  • Azaserine A glutamine antagonist.
  • Azaserine is serine derivative diazo compound with antineoplastic and antibiotic properties deriving from its action as a purinergic antagonist and structural similarity to glutamine.
  • Azaserine acts by competitively inhibiting glutamine amidotransferase, a key enzyme responsible for glutamine metabolism.
  • Blood-brain barrier A highly selective permeability barrier that separates the circulating blood from the brain extracellular fluid in the central nervous system.
  • the BBB is formed by brain endothelial cells, which are connected by tight junctions with an extremely high electrical resistivity.
  • the BBB allows the passage of water, some gases, and lipid-soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids that are cracial to neural function.
  • the BBB prevents the entry of lipophilic, potential neurotoxins by way of an active transport mechanism mediated by P-glycoprotein.
  • the BBB also protects the brain from bacterial infection.
  • Cerebral edema Swelling of the brain caused by excessive accumulation of fluid.
  • Cerebral malaria A severe, life-threatening form of malaria. Cerebral malaria is characterized by a number of neurological symptoms (including cerebral edema, disruption of the BBB, brain hemorrhage, seizures, delirium and unarousable coma), the presence of infected red blood cells (iRBCs) in the peripheral circulation and sequestration of iRBCs on the brain vascular endothelium.
  • neurological symptoms including cerebral edema, disruption of the BBB, brain hemorrhage, seizures, delirium and unarousable coma
  • iRBCs infected red blood cells
  • Coma A state of unconsciousness in which a person cannot be awakened, fails to respond normally to painful stimuli, light or sound, lacks a normal wake-sleep cycle, and does not initiate voluntary actions.
  • CD8 ⁇ T cells Refers to the process of releasing cytotoxic molecules, such as perforin and granzymes, from secretory vesicles of a CD8+ T cell.
  • Delirium An acute state of mental confusion characterized by anxiety, disorientation, restlessness, hallucinations, delusions and incoherence of thought and speech. Delirium can be caused by, for example, brain injury, high fever, poisoning, intoxication or shock.
  • Glutamine antagonist An inhibitor of biochemical reactions that utilize glutamine.
  • Glutamine antagonists include, but are not limited to, DON, acivicin and azaserine.
  • Hemorrhage Bleeding from a ruptured blood vessel in the body.
  • Hemorrhagic stroke At type of stroke (sudden death of brain cells due to a lack of oxygen) that results from an accumulation of blood in or around the brain, such as from a ruptured blood vessel. Hemorrhages in the brain can be caused by a variety of disorders that affect the blood vessels, such as long-term high blood pressure and cerebral aneurysms (a week or thin spot on a blood vessel wall).
  • Malaria Malaria is a parasitic infection of humans and non-human primates by the
  • rodents P. berghei, P. chabaudi, P. vinckei, and P. yoelii
  • parenteral Administered outside of the intestine, for example, not via the alimentary tract.
  • parenteral formulations are those that will be administered through any possible mode except ingestion. This term especially refers to injections, whether administered intravenously, intrathecally, intramuscularly, intraperitoneally, or subcutaneously, and various surface applications including intranasal, intradermal, and topical application, for instance.
  • compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • Seizure Uncontrolled electrical activity in the brain, which may produce a physical convulsion, minor physical signs, thought disturbances, or a combination of symptoms. Seizures can be caused by, for example, head injuries, brain tumors, lead poisoning, maldevelopment of the brain, genetic and infectious illnesses, and fevers.
  • Subject Living multi-cellular organisms, including vertebrate organisms, a category that includes both human and non-human mammals.
  • Therapeutically effective amount A quantity of compound or composition, for instance, a glutamine antagonist (e.g. DON), sufficient to achieve a desired effect in a subject being treated. For instance, this can be the amount necessary to treat cerebral edema and/or restore BBB integrity.
  • a glutamine antagonist e.g. DON
  • Traumatic brain injury A form of acquired brain injury that occurs when a sudden trauma causes damage to the brain. TBI can result when the head suddenly and violently hits an object, or when an object pierces the skull and enters brain tissue. Symptoms of a TBI can be mild, moderate, or severe, depending on the extent of the damage to the brain. A person with a mild TBI may remain conscious or may experience a loss of consciousness for a few seconds or minutes. Other symptoms of mild TBI include headache, confusion, lightheadedness, dizziness, blurred vision or tired eyes, ringing in the ears, bad taste in the mouth, fatigue or lethargy, a change in sleep patterns, behavioral or mood changes, and trouble with memory, concentration, attention, or thinking.
  • a person with a moderate or severe TBI may show these same symptoms, but may also have a headache that gets worse or does not go away, repeated vomiting or nausea, convulsions or seizures, an inability to awaken from sleep, dilation of one or both pupils of the eyes, slurred speech, weakness or numbness in the extremities, loss of coordination, and increased confusion, restlessness, or agitation.
  • ECM Experimental cerebral malaria
  • ECM displays key features of HCM, including BBB breakdown, focal hemorrhaging and brain swelling (Nacer et al, PLoS Pathog 8, el002982, 2012; Promeneur et al. , Proc Natl Acad Sci U SA 110, 1035-1040, 2013; Penet et al., J N euro sci 25, 7352-7358, 2005).
  • ECM's pathology also includes sequestration of infected red blood cells (iRBCs) in the brain vasculature (Baptista et al.
  • CD8 + T cells are the major mediators of death in ECM (Howland et al, Semin Immunopathol, 2015) and that antigen-specific CD8 + T cells engage parasite antigens cross-presented on MHC class I molecules on brain endothelium resulting in endothelial cell dysfunction by a perforin-dependent mechanism (Nitcheu et al, J Immunol 170, 2221-2228, 2003).
  • a critical role for metabolic reprogramming in regulating immune responses is becoming increasingly appreciated.
  • T cells Upon activation, T cells undergo metabolic reprogramming to meet the increased energetic and biosynthetic demands of growth and effector T cell functions (Maclver et al., Annu Rev Immunol 31, 259-283, 2013; O'Sullivan and Pearce, Trends Immunol 36, 71-80, 2015; Pollizzi and Powell, Nat Rev Immunol 14, 435-446, 2014).
  • Reprogramming involves a shift to aerobic glycolysis and increased glutaminolysis.
  • Activated T cells import large quantities of glutamine (Gin) and increase their expression of glutaminase (Carr et al, J Immunol 185, 1037- 1044, 2010; Wang et al, Immunity 35, 871-882, 2011; Nakaya et al, Immunity 40, 692-705, 2014).
  • the studies disclosed herein focus on targeting Gin metabolism for an adjunctive therapy for CM using the Gin analog, 6-diazo-5-oxo-L-norleucine (DON).
  • DON broadly inhibits glutamine metabolism in part by blocking glutamine transport and inhibiting all three isoforms of glutaminase as well as other glutamine-utilizing enzymes such as the amidotransferases and glutamine synthetase (Thangavelu et al, Sci Rep 4, 3827, 2014). Consequently, DON has been shown to be a potent inhibitor of T cell proliferation (Wang et al. , Immunity 35, 871-882, 2011 ).
  • DON is an active site inhibitor of glutaminase, an enzyme responsible for the first step in the glutaminolysis pathway that converts Gin to glutamate plus ammonia (Thangavelu et al, Sci Rep 4, 3827, 2014).
  • a selective increase in extracellular Glu or ammonia are both neurotoxic and might not be detected by the metabolic analysis of brain tissue.
  • DON has been shown to reduce excessive Glu release by activated microglia that contribute to neurodegeneration in a number of neurological diseases including ischemic brain injury (Takeuchi et al. , Exp Neurol 214, 144-146, 2008) and in Japanese encephalitis virus induced encephalitis (Chen et al, Glia 60, 487- 501, 2012).
  • the ability of DON to reverse disease is concomitant with a decrease in the number and effector function of parasite- specific CD8 + T cells in the brains of treated mice.
  • the striking ability of DON treatment to reverse pathology so late in the disease suggests a fundamental and potentially direct role for Gin metabolism in promoting neuropathology.
  • the methods include selecting a subject with cerebral edema and administering to the subject a therapeutically effective amount of a glutamine antagonist.
  • the cerebral edema is caused by cerebral malaria, a traumatic brain injury or a hemorrhagic stroke.
  • the methods include selecting a subject with malaria who is exhibiting at least one neurological sign or symptom of cerebral malaria (or who has been diagnosed with malaria) and administering to the subject a therapeutically effective amount of a glutamine antagonist.
  • the at least one neurological sign of cerebral malaria is selected from cerebral edema, loss of blood-brain barrier integrity, brain hemorrhage, infected red blood cells in the brain vasculature, coma, seizure and delirium.
  • the methods further include
  • antimalarial agent Any antimalarial agent effective for the treatment of malaria can be selected.
  • the antimalarial agent is quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, artemether/lumefantrine,
  • pyrimethamine/sulfadoxine artemisinin or an artemisinin derivative (such as artesunate), or any combination of two or more thereof.
  • the methods include selecting a subject with cerebral malaria and administering to the subject a therapeutically effective amount of a glutamine antagonist.
  • the glutamine antagonist can be administered using any suitable route of administration.
  • the glutamine antagonist is administered intraperitoneally, intravenously, rectally or orally.
  • Suitable doses and dosing schedules for administration of the glutamate antagonist can be determined by a physician, based on several factors including age, weight, general condition of the subject, the particular condition being treated, the particular glutamate antagonist being used and its mode of administration.
  • the glutamine antagonist is administered once a day. In other examples, the glutamine antagonist is administered once every other day.
  • the glutamine antagonist is 6-diazo-5-oxo-L- norleucine, acivicin or azaserine. In specific non-limiting embodiments, the glutamine antagonist is 6-diazo-5-oxo-L-norleucine.
  • the subject is administered 6-diazo-5-oxo-L-norleucine at a dose of about 0.1 to about 15 mg/kg, about 0.13 mg/kg to about 15 mg/kg, about 0.25 mg/kg to about 15 mg/kg, about 0.5 mg/kg to about 15 mg/kg, about 0.1 to about 10 mg/kg, about 1 to about 10 mg/kg, about 0.1 to about 0.5 mg/kg, about 1 to about 5 mg/kg, about 0.1 to about 2.5 mg/kg, or about 1 to about 2.5 mg/kg.
  • the subject is administered 6-diazo-5-oxo-L-norleucine at a dose of about 0.1 mg/kg, about 0.2 mg/kg, about 0.3 mg/kg, about 0.4 mg/kg, about 0.5 mg/kg, about 0.6 mg/kg, about 0.7 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, about 1.0 mg/kg mg/kg, about 1.1 mg/kg mg/kg, about 1.2 mg/kg mg/kg, about 1.3 mg/g mg/kg, about 1.4 mg/kg or about 1.5 mg/kg.
  • the 6-diazo-5-oxo-L-norleucine is administered to the subject at a dose of about 1.3 mg/kg once per day. In other examples, the 6-diazo-5-oxo-L-norleucine is administered to the subject at a dose of about 1.3 mg/kg once every other day.
  • compositions comprising 6-diazo-5-oxo-L-norleucine and an antimalarial agent.
  • the antimalarial agent is quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, arteinether/lumefantriiie, pyrimethamine/sulfadoxine, artemisinin or an artemisinin derivative (such as artesunate), or any combination of two or more thereof.
  • the composition further comprises a pharmaceutically acceptable carrier.
  • Glutamine antagonists can be administered, such as for the treatment of cerebral edema, as a composition comprising one or more pharmaceutically acceptable carriers. Such carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions for use in the methods of the present disclosure. In some embodiments herein, the compositions further include an antimalarial agent.
  • Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives can also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
  • compositions comprising a glutamine antagonist can be administered orally in liquid, capsule, pill or tablet form, and can include, for example, lactose, microcrystalline cellulose, colloidal silicon dioxide, croscarmellose sodium, magnesium stearate, stearic acid, and other excipients, colorants, pharmacologically compatible carriers, or any combination thereof.
  • Oral formulations of a glutamine antagonist can be taken with a suitable buffer, such as
  • the glutamine antagonist can be coated with an enteric coating.
  • the pharmaceutical composition can be presented in unit-dose or multi-dose sealed containers, for example, ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use.
  • sterile liquid carrier for example, water for injections, immediately prior to use.
  • Extemporanenous injection solutions and suspensions can be prepared from sterile powders, granules and tablets.
  • Administration can be accomplished by single or multiple doses.
  • the dose required will vary from subject to subject depending on the species, age, weight, general condition of the subject, the particular condition being treated, the particular glutamate antagonist being used and its mode of administration.
  • An appropriate dose can be determined by one of ordinary skill in the art using only routine experimentation.
  • the dose of glutamine antagonist is about 0.1 to about 15 mg/kg, about 0.13 mg/kg to about 15 mg/kg, about 0.25 mg/kg to about 15 mg/kg, about 0.5 mg/kg to about 15 mg/kg, about 0.1 to about 10 mg/kg, about 1 to about 10 mg/kg, about 0.1 to about 0.5 mg/kg, about 1 to about 5 mg/kg, about 0.1 to about 2.5 mg/kg, or about 1 to about 2.5 mg/kg.
  • the subject is administered 6-diazo-5-oxo-L- norleucine at a dose of about 0.1 mg/kg, about 0.2 mg/kg, about 0.3 mg/kg, about 0.4 mg/kg, about 0.5 mg/kg, about 0.6 mg/kg, about 0.7 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, about 1.0 mg/kg mg/kg, about 1.1 mg/kg mg/kg, about 1.2 mg/kg mg/kg, about 1.3 mg/g mg/kg, about 1.4 mg/kg or about 1.5 mg/kg.
  • 6-diazo-5-oxo-L-norleucine is administered to a subject at a dose of about 1.3 mg/kg once per day. In other examples, 6-diazo-5-oxo-L-norleucine is administered to a subject at a dose of about 1.3 mg/kg once every other day.
  • the glutamate antagonist can also be administered in combination with other therapeutic agents, such as antimalarial agents if the subject is infected with P. falciparum.
  • Antimalarial agents include, but are not limited to, quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, artemether/lumefantrine, pyrimethamine/suifadoxine, artemisinin and artemisinin derivatives (such as artesunate).
  • mice C57BL/6 female mice (7-10 weeks old) were obtained from The Jackson Laboratories. Mice were infected with PbA by injecting intraperitoneally lxlO 6 /3 ⁇ 4>A-infected RBC obtained from infected C57BL/6 mice. Peripheral blood parasitemia was determined by flow cytometry as described below. Infected mice were monitored for the progression of ECM using a ten point clinical scoring system that rates mice from a score of 0 (no signs) to 10 (moribund) as previously described (Waisberg et al, PLoS One 7, e29493, 2012). 6-Diazo-5-oxo-L-norleucine (DON) Treatment
  • mice weighing approximately 25 grams were injected
  • Parasitemia was determined by flow cytometry using a modification of a previously described method (Malleret et al, Sci Rep 1, 118, 2011). Briefly, blood was obtained from mouse tail veins, fixed with 0.025% aqueous glutaradehyde solution, washed with 2 mL PBS, resuspended and stained with the following: the DNA dye Hoechst 33342 (Sigma) (8 ⁇ ), the DNA and RNA dye dihydroethidium (diHEt) (10 ⁇ g/mL), the pan C57BL/6 lymphocyte marker APC-conjugated antibody specific for CD45.2 (BioLegend, San Diego, CA), and the RBC marker APC-Cy7- conjugated antibody specific for Terll9 (BD Pharmingen, San Jose, CA).
  • the DNA dye Hoechst 33342 Sigma
  • diHEt DNA and RNA dye dihydroethidium
  • CD45.2 pan C57BL/6 lymphocyte marker
  • iRBCs Infected RBCs (iRBCs) were CD45.2 , Terll9 + , Hoechst + and diHEt + . Parasitemia were calculated as the number of iRBCs/total number of RBCs.
  • mice were anesthetized and transcardially perfused with cold PBS and brains were removed and immediately frozen in liquid nitrogen. Brains were thawed and 1 ml Qiagen RNEASYTM lysis buffer was added immediately. Brains were homogenized and RNA was extracted from the homogenate using a Qiagen RNEASYTM Mini kit according to manufacturer's instructions.
  • Genomic DNA was digested on a column using RNAse-free DNAse set (Qiagen, Valencia, CA) and the elimination of genomic DNA was confirmed using no reverse transcriptase controls.
  • cDNA was generated using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA). SYBRTM Green PCR master mix (Bio-Rad) was used to determine the relative expression of parasite 18s ribosomal RNA and three mouse housekeeping genes, hprt, gapdh, and actb.
  • the primer sequences were: Pb 18s - AAGCATTAAATAAAGCGAATACATCCTTAC (SEQ ID NO: 1) and
  • mice hprt - TGCTCGAGATGTGATGAAGG (SEQ ID NO: 3 and
  • mice actb TCCGGCATGTGCAAAGC (SEQ ID NO: 7) and TCCTTCTGACCCATTCCC (SEQ ID NO: 8).
  • the geometrical mean of the cycle threshold (Ct) values of mouse housekeeping genes was first determined to create a normalized base line for the brain to allow a comparison of the delta Ct values of 18s gene amplification.
  • the fold changes in gene expression was then calculated by comparing the delta Ct values of /3 ⁇ 4>A-infected mice on day 5 p.i. to that on day 6 p.i. for mice treated with DON on day 5p p.i. or mice left untreated.
  • EB Evans blue
  • mice 20 mg/kg
  • mice were anesthetized, perfused with saline and their brains removed and immediately frozen at -80°C for later processing (Kim et al. , Nature 457, 191-195, 2009).
  • EB was extracted using N, N-dimethylformamide and quantified using a Varioskan Flash fluorometer (620 nm excitation; 695 nm emission).
  • Brains were removed from animals and weighed. Brains were then desiccated at 80°C for 12 hours and weighed again. Percent water content was calculated using the decrease in weight.
  • H&E hematoxylin and eosin
  • mice were anesthetized with
  • ketamine/xylazine at the specified times and transcardially perfused with cold PBS and the brains and spleens were removed. Brains were dissected, minced and digested with 1 mg/mL collagenase for 30 minutes at 37°C. After passing the tissue through 70 ⁇ nylon mesh, homogenates were placed on a 90-60-40% discontinuous PERCOLLTM gradient, centrifuged for 18 minutes at 1000 x g and the cells at the 40-60% interface containing leukocytes were collected for analysis. Spleens were mashed using a 70 ⁇ nylon mesh, then red blood cells were lysed. The cells were washed and re-suspended in FACS buffer consisting of PBS and 1% FBS. The following fluorescent dye- conjugated antibodies specific for the following cell surface markers were used for staining:
  • BRILLIAN VIOLETTM(BV) 421-NK1.1 BioLegend
  • BV605-CD4 BioLegend
  • BV785-CD8 BioLegend
  • PE-Ly6G BD Pharmingen
  • PE-Cy7-CD3 eBioscience, San Diego, CA
  • APC- Ly6C BD Pharmingen
  • APC-Cy7-CD45.2 BD Pharmingen
  • LIVE/DEADTM Fixable AquaDead Cell Stain Life Technologies, Grand Island, NY. Gating of subsets is depicted in FIG. 6.
  • Cell acquisition data was obtained on a BDTM LSRII flow cytometer. Data was analyzed with FLOWJOTM software (Tree Star Technologies, Ashland, OR).
  • GAP50-tetramer binding CD8 + T cells were enriched by magnetic bead separation as described (Haluszczak et al, J Exp Med 206, 435-448, 2009). Briefly, a single cell suspension was prepared from spleen and peripheral lymph nodes (axillary, brachial, inguinal, and cervical) and incubated with 0.5 mg GAP-50 tetramer (obtained from the NIH Tetramer Core Facility, Emory University, Atlanta, GA) conjugated to APC for 30 minutes on ice.
  • Cells were stained for 30 minutes at 4°C with the following fluorescent dye-conjugated antibodies specific for the following cell surface markers: BV785-CD8 (Biolegend); BV421-CD44 (Biolegend); BV605-CD4 (Biolegend); BV711-CDllb (Biolegend); PE-CD107a (Biolegend); PE-CD107b (Biolegend); PerCP-Cy5.5-Thyl.2; Db:GAP50-Bio; APC-streptavidin (Life Technologies); AquaDead Cell Stain ( Life Technologies); ALEXA FLUORTM 700-Ly6C (Biolegend); and APC-Cy7-CD45.2 (BD Pharmingen).
  • Cell acquisition data was obtained on a BDTM LSRII flow cytometer and analyzed with FLOWJOTM software (Tree Star Technologies).
  • mice were given PE-conjugated antibodies specific for CD107a (12 ⁇ g) and for CD107b (12 ⁇ g) (Biolegend) by intravenous injection 1 hour prior to sacrificing the mice and removal of their brains and spleens, as previously described (Yuzefpolskiy et al. , Cell Mol Immunol, 2014).
  • mice from all experimental groups were euthanized to collect brain, liver, and serum. Tissue samples were snap frozen in liquid nitrogen and stored at -80°C until sample preparation. Automated tissue processing and metabolomic profiling by ultrahigh performance liquid chromatography-tandem mass spectroscopy and gas chromatography-mass spectroscopy were performed at Metabolon using multiple quality control standards as described (Shin et al. , Nat Genet 46, 543-550, 2014). After extraction of raw data, peaks were identified by comparison to known purified standards and recurrent unknown entities present in Metabolon' s reference library.
  • Peak quantification was performed using area-under-the-curve with data normalization to correct for day-to-day variation for studies spanning multiple days.
  • Statistical analyses of metabolomics data were performed in ArrayStudio 5.0 and R 3.1.1 (online at R-project.org). Two-way comparisons between experimental groups were analyzed by Welch's t test for each of the three tissue types using log-transformed data in R. To correct for multiple testing, false discovery rates (FDR) were estimated using the q-value method (Storey and Tibshirani, Proc Natl Acad Sci USA 100, 9440-9445, 2003), and only metabolites with an FDR ⁇ 5% were considered significant.
  • Canonical pathways analysis was applied to metabolites meeting a fold-change threshold of > 11.21 and a FDR of ⁇ 5% for each two-way comparison and for each tissue using Ingenuity Pathway Analysis (IPA, Qiagen).
  • IPA Ingenuity Pathway Analysis
  • Example 2 Targeting Glutamine Metabolism Rescues Mice from Late-Stage Cerebral Malaria
  • This example describes the finding that in an animal model of cerebral malaria, DON treatment at late stages of disease restores BBB integrity, reduces brain swelling and promotes survival. DON treatment also reduces the number of CD8 + effector T cells that degranulate in the brains of infected mice.
  • mice were evaluated for the development of neurological signs associated with ECM and given clinical scores between 0 (no signs) to 10 (moribund) using previously described criteria (Waisberg et al., PLoS One 7, e29493, 2012). Nearly all of the untreated mice that were infected with PbA developed neurological signs by day 5p p.i. that in most cases were severe (clinical score >6) by day 6a p.i. (FIG. IB). Treatment with DON beginning on day 5a p.i. prevented the development of neurological symptoms in all /3 ⁇ 4>A-infected mice (FIG. IB).
  • DON was able to reverse disease even when the mice were already displaying signs of neurologic damage.
  • the effect of DON treatment on the water content of the brain as a measure of cerebral edema was determined by weighing the brains before and after desiccation. As compared to uninfected mice, the brains of /3 ⁇ 4>A-infected mice had a significantly greater water content measured on both day 5p and day 6a p.i. (FIG. 2B). Treating mice with DON on day 5p p.i.
  • mice were stained with hematoxylin and eosin (H&E).
  • H&E hematoxylin and eosin
  • the brains of /3 ⁇ 4>A-infected, untreated mice developed petechial hemorrhages throughout the brain by day 5p p.i. that increased in number by day 6a p.i. (FIG. 2C).
  • Treatment of mice with DON beginning on day 5p p.i. had no significant effect on the number of hemorrhages that developed. However, by day 15 p.i. the hemorrhages were no longer evident (FIG. 2C).
  • DON treated mice survived local hemorrhaging in the brain when the overall integrity of the BBB was restored and brain swelling was reduced.
  • DON treatment reduces the number of CD8 + effector T cells that degranulate in the brains of infected mice
  • CD8 + T cells have been shown to play a major role in promoting death in ECM (Howland et al, Semin Immunopathol, 2015). Glutamine metabolism is critical for the differentiation, proliferation and function of effector T cells.
  • DON was administered to PbA- infected mice on day 5p p.i. and on day 6a p.i. mice were terminally anesthetized and transcardially perfused with cold PBS.
  • the brains were collected and single cell suspension were prepared and analyzed by flow cytometry. First, immune cell infiltration of both the treated and untreated mice was examined.
  • CD8 + T cells results in the expression of CD107 on their plasma membranes.
  • fluorescently-labeled CD107-specific monoclonal antibodies were administered intravenously to mice one hour before tissues were removed for analysis to allow in vivo labeling of CD107 + cells. Shown are representative flow cytometry plots showing the percent of CD44 + , CD8 + T cells that express CD 107 in the spleens of uninfected mice, Pb A- infected mice and Pb A- infected mice treated with DON (FIG. 3H).
  • DON treatment of /3 ⁇ 4>A-infected mice resulted in significant decreases in the percent of CD8 + T cells that were CD107 "1" in both the spleens and brains (FIG. 31).
  • the percent of GAP50-tetramer-binding CD8 + T cells that were CD107 "1” also decreased significantly in the brains of /3 ⁇ 4>A-infected mice (FIG. 3J).
  • the late-stage treatment of DON does not block the expansion of the /3 ⁇ 4>A-specific CD8 + T cells, it does seem to block their effector function as measured by degranulation.
  • DON treatment reverses /3 ⁇ 4A-induced metabolic changes in the brain
  • HCM is a deadly complication of P. falciparum malaria despite treatment with effective anti-malarial drugs. That is, even in the setting of effectively suppressing the replication of P. falciparum, once signs of neurologic disease have commenced, there is no effective adjunctive treatment for HCM and overall mortality remains high. As such, the identification of a treatment which can arrest and reverse disease in the late stages is urgently needed.
  • the Gin analog, DON is an effective therapy for ECM even when treatment is first initiated after infected animals show neurological signs of disease. This clinical response was accompanied by the ability of DON to inhibit pathology as measured by decreases in BBB dysfunction, brain swelling and degranulation of parasite-specific CD8 + T cells that accumulated in the brain.
  • DON is able to reverse metabolic changes associated with the disease state.
  • DON has been shown to have anti-parasitic activity, albeit weak both in vitro and in vivo (Plaimas et al., Infect Genet Evol 20, 389-395, 2013; Queen et al., Antimicrob Agents Chemother 34, 1393-1398, 1990).
  • the findings disclosed herein indicate that the anti-parasitic activity of DON is not playing a major role in its ability to arrest and reverse ECM. Indeed, DON had little effect on the parasite load in the brains of /3 ⁇ 4>A-infected mice during the critical period of time when the BBB was restored and brain swelling decreased in DON-treated mice. Under continual treatment with DON, /3 ⁇ 4>A-infected mice were able to control parasitemia, keeping it well under 2%. However, when DON treatment was stopped the parasitemias rose rapidly and mice died of severe anemia.
  • CD8 + effector T cells that release perforin have been shown to play a critical role in promoting the pathogenesis which constitutes ECM (Howland et al. , Semin
  • rapamycin protected infected mice from death due to ECM when administered within the first 4 days of infection (Gordon et al., mBio 6, e00725-00715, 2015). This protection was associated with a marked decrease in CD8 + T cells in the brain and it was hypothesized that rapamycin prevents the development of ECM in part by inhibiting the generation of CD8 + effector cells.
  • T cell activation results in a dramatic shift from oxidative metabolism to aerobic glycolysis and glutaminolysis necessary for T cell expansion and effector function (Maclver et ⁇ ., ⁇ Rev Immunol 31, 259-283, 2013; O'Sullivan and Pearce, Trends Immunol 36, 71-80, 2015; Pollizzi and Powell, Nat Rev Immunol 14, 435-446, 2014).
  • Both T cell cytokine production and proliferation are blocked by restricting the availability of extracellular Gin (Carr et al, J Immunol 185, 1037- 1044, 2010) or by treating T cells with DON (Wang et al, Immunity 35, 871-882, 2011).
  • DON treatment of /3 ⁇ 4>A-infected mice did not prevent or decrease the accumulation of CD8 + T cells in the brain. Rather, the number of CD8 + T cells that degranulated, was decreased following DON treatment.
  • DON is not mediating its protective effect by preventing proliferation and generation of CD8 + effector cells, but rather by blocking CD8 + T cell effector function. This may account in part for the remarkably fast kinetics by which DON mediates its protective effect.
  • rapamycin treatment was not effective when administered later in the disease. It is the ability of DON to promote survival at such a late stage of the disease that distinguishes the present findings from all other attempts to treat and reverse ECM.
  • the studies disclosed herein demonstrate for the first time the ability of pharmacologic intervention to reverse disease and promote survival in the late stages of ECM. Once neurologic symptoms are manifested, there is a high mortality rate in HCM. Therefore, the findings disclosed herein have relevant and immediate clinical implications. Furthermore, these studies reveal a selective metabolic signature for ECM and the subsequent reversal of diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Emergency Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Cerebral malaria is the most deadly complication associated with P. falciparum infection, having a fatality rate of 15-25% in African children despite the use of effective antimalarial chemotherapy. The use of a glutamine antagonist, such as 6-diazo-5-oxo-L-norleucine, for treating cerebral edema and restoring blood-brain barrier integrity, such as in patients suffering from cerebral malaria, is described. In an animal model of cerebral malaria, animals administered 6- diazo-5-oxo-L-norleucine at later stages of disease when blood-brain barrier dysfunction, brain swelling and hemorrhaging are evident, were effectively rescued from disease.

Description

GLUTAMINE ANTAGONISTS FOR USE IN TREATING CEREBRAL EDEMA AND
CEREBRAL MALARIA
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 62/175,000, filed
June 12, 2015, which is herein incorporated by reference in its entirety.
FIELD
This disclosure concerns the use of a glutamine antagonist to treat cerebral edema and reverse blood-brain barrier defects in a subject, such as a subject with cerebral malaria.
BACKGROUND
There are nearly 600 million clinical cases of Plasmodium falciparum malaria annually (Snow et al, Nature 434, 214-217, 2005). For most individuals living in endemic areas, malaria is uncomplicated and resolves with time. However, in about 1% of cases, almost exclusively among young children, malaria becomes severe and life threatening resulting in 700,000 deaths each year in Africa alone. One of the most deadly complications of P. falciparum infection in humans is cerebral malaria (HCM) characterized by the onset of severe neurological signs such as altered consciousness, seizures, and coma (Molyneux et al, Q J Med 71, 441-459, 1989). Autopsy and MRI analyses of brains of children with HCM indicate a diffuse symmetrical encephalopathy
(Severe falciparum malaria, World Health Organization, Communicable Diseases Cluster, Trans R Soc Trop Med Hyg 94, Suppl l:Sl-90, 2000), microhemorrhaging, breakdown of the blood-brain barrier (BBB) (Taylor et al. , Nat Med 10, 143-145, 2004) and a fatal increase in intracranial pressure resulting from edema (Newton et al., Lancet 337, 573-576, 1991; Newton et al., Arch Dis Child 70, 281-287, 1994; Walker et al. , Trans R Soc Trop Med Hyg 86, 491-493, 1992; Waller et al, Trans R Soc Trop Med Hyg 85, 362-364, 1991; Potchen et al., Am J Neuroradiol 33, 1740- 1746, 2012; Seydel et al, N Engl J Med 372, 1126-1137, 2015). At present, despite effective antimalarial drug treatment, mortality for children presenting with HCM remains at 15-25%. HCM takes a second toll on African children leaving survivors at risk of debilitating neurological defects (Shikani et al, Am J Pathol 181, 1484-1492, 2012). Thus, there is an urgent need for the development of effective adjunctive therapies that can be used in conjunction with anti-malarials to treat children with HCM. SUMMARY
It is disclosed herein that administration of a glutamine antagonist to a subject suffering from cerebral malaria is capable of treating cerebral edema, restoring BBB integrity, inhibiting degranulation of CD8+ T cells in the brain, and promoting survival.
Provided herein is a method of treating cerebral edema in a subject by selecting a subject with cerebral edema and administering to the subject a therapeutically effective amount of a glutamine antagonist. In some embodiments, the cerebral edema is caused by cerebral malaria, a traumatic brain injury or a hemorrhagic stroke.
Also provided is a method for treating cerebral malaria in a subject by selecting a subject with malaria who has been diagnosed with cerebral malaria (e.g., a subject who is exhibiting at least one neurological sign or symptom of cerebral malaria) and administering to the subject a therapeutically effective amount of a glutamine antagonist.
Further provided is a method of inhibiting degranulation of CD8+ T cells in the brain of a subject with malaria by selecting a subject with cerebral malaria and administering to the subject a therapeutically effective amount of a glutamine antagonist.
In particular embodiments of the methods disclosed herein, the glutamine antagonist is 6- diazo-5-oxo-L-norleucine (DON).
Also provided herein are compositions comprising DON and an antimalarial agent. The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A-1D: DON treatment reduced the mortality associated with experimental cerebral malaria (ECM). C57BL/6 mice were infected with Plasmodium berghei ANKA (PbA) on day 0 and injected intraperitoneally with saline (NoRx) or with DON (1.3 mg/kg) beginning on day 5 post infection (p.i.) at 7 am (DON Rx d5a), on day 5 p.i. at 11 pm (DON Rx d5p), or on day 6 p.i. at 7 am (DON Rx d6a). DON treatment was continued every day or every other day as shown (FIG. 6). (FIG. 1A) Kaplan-Meier survival plots. (FIG. IB) Clinical scores (Waisberg et al, PLoS One 7, e29493, 2012) from 0 (no symptoms) to 10 (moribund) of mice in FIG. 1A. (FIG. 1C) Peripheral blood parasitemia for mice in FIG. 1A. Data for DON Rx d5a were combined from three independent experiments, data for DON Rx d5p were combined from four independent experiments and data for DON Rx d6a were combined from two independent experiments. Shown are the mean and standard error of the mean (SEM) for FIG. IB and FIG. 1C. (FIG. 1C) Mice infected with PbA were treated with DON on d5p p.i. or left untreated. On day 6a p.i. mice were transcardially perfused, the brains removed and the fold changes in PbA 18s RNA of treated and untreated mice as compared to the brains of untreated mice removed on day 5p p.i. were determined as detailed in Example 1. Each dot represents a mouse with the mean and standard deviation (SD) given. Shown are the results combined from three independent experiments each having three-four mice per group. A Mann- Whitney test showed no significant difference.
FIGS. 2A-2C: DON treatment restored BBB function and reduced brain swelling but did not acutely resolve brain hemorrhages in /¾A-infected mice. All mice were infected with PbA and treated with saline or DON (1.3mg/kg) on day 5p p.i. and the brains removed and analyzed on the days and times indicated. (FIG. 2A) Levels of Evans blue (EB) in the brains were quantified and expressed relative to the levels of EB in the brains of /¾>A-infected, untreated mice on d6a p.i. Each symbol represents one mouse. The data are combined from three independent experiments. The mean and SD are given. (FIG. 2B) Brain water content expressed as the weight of each brain after desiccation divided by the weight before desiccation xlOO is given. Each symbol represents one mouse. Data are combined from two independent experiments. The mean and SD are given. (FIG. 2C) For quantification of brain hemorrhages, mice were perfused with cold phosphate buffered saline (PBS), their brains removed, fixed, sectioned and stained with H&E. Hemorrhages were counted in 10 high power (40x) fields of brain sections and the number of hemorrhages is given. Each symbol represents one mouse. Data are combined from three independent experiments. Mann- Whitney tests were used for comparison of groups (* = p-value <0.05, ** = P-value <0.005), and *** = P-value <0.0005).
FIGS. 3A-3J: DON treatment reduced CD8+ T cell degranulation but not the accumulation of immune cell in the brains of PbA -infected mice. All mice were either uninfected or infected with PbA and treated with DON (1.3 mg/kg) or saline on day 5p p.i. (FIGS. 3A-3E). On day 6a p.i. mice were perfused with cold PBS, the brains and/or spleens removed and single cell suspensions prepared. Cells were analyzed by flow cytometry using the gating strategy show in FIG. 8. Shown are the number of cells per brain for: (FIG. 3A) macrophage/DCs; (FIG. 3B) neutrophils; (FIG. 3C) natural killer (NK) cells; (FIG. 3D) CD 4+T cells; and (FIG. 3E) CD8+ T cells. Data were combined from three independent experiments. (FIG. 3F) Representative flow cytometry plots of glideosome-associated protein 50 (GAP50) major histocompatibility complex (MHC) class I Db tetramer binding CD8+ T cells in unenriched spleen/lymph node cell populations (left and right panels), and in GAP50-tetramer-binding cells enriched using magnetic beads coated with APC-specific antibodies (middle panel). (FIG. 3G) The number of GAP50-tetramer binding CD8+ T cells in spleen and brains. Data were combined from three independent experiments. (FIG. 3H) Representative flow cytometry plots of CD8+ T cells in the spleens of mice that received fluorescently labeled CD107-specific antibodies intravenously one hour before being sacrificed to allow labeling of CD107-expressing cells in vivo. The percent of total CD8+ T cells that expressed CD 107 (FIG. 31) and the percent of GAP50-tetramer binding CD8+ T cells that express CD 107 (FIG. 3J) are shown. Data were combined from three independent experiments. Mann- Whitney tests were used for statistical analysis. ns= not significant, * = p-value <0.05, ** = P-value <0.005), and *** = P-value <0.0005.
FIGS.4A-4F: DON significantly alters citrulline, urea and nitric oxide metabolism in the brain during ECM. Principle components analysis was performed for each of three tissue types collected from mice at day 6a p.i. for the five experimental groups defined by infection, treatment and clinical outcome. Principal components were determined from all detectable metabolites for the (FIG.4A) brain (438 metabolites), (FIG. 4B) liver (544 metabolites) and (FIG. 4C) serum (563 metabolites). Each symbol represents one tissue sample from one mouse. (FIG. 4D) Venn diagram showing the number of differentially abundant brain metabolites for the two main comparisons: (1) infected, untreated mice vs. uninfected, untreated mice and (2) infected, DON-treated mice with low clinical scores vs. infected, untreated mice. Differential abundance thresholds were an absolute fold-change in abundance of > 1.2 and a false discovery rate of <5% (Welch's t test). Pathways analysis of differentially abundant metabolites for each 2- way comparison demonstrated several significantly overrepresented pathways that are shared between the two comparisons (FIGS. 4E and 4F). Shown are the ratio of overlap of metabolites in the dataset with metabolites in the pathway and the -log (p-value) of the overlap by Fisher's exact test. Metabolites discussed in the present disclosure are shown in bold.
FIGS.5A-5C: 81 metabolites that were reversed by DON treatment during PbA infection. The table lists the 81 metabolites that were differentially abundant in both the PbA- infected, untreated vs. uninfected, untreated comparison and the /¾>A-infected, DON treated, low clinical score vs PbA infected, untreated comparison. Only metabolites meeting differential abundance thresholds of absolute fold change >1.2 and a false discovery rate <5% in both comparisons are shown.
FIG.6: DON treatment schedule. DON treatment (1.3 mg/kg) was initiated on day 5 p.i. at 7 am (d5a), day 5 p.i. at 11 pm (d5p) or day 6 p.i at 7 am (d6a) and continued every day or every other day as shown.
FIG.7: Late cessation of DON treatment leads to increased parasitemia. C57BL/6 mice were infected with PbA on day 0 and given saline (No Rx) or DON (1.3 mg/kg) every other day beginning at 7 am on day 1 p.i. (DON Rx dla) and peripheral blood parasitemia was determined by flow cytometry on the days indicated.
FIG. 8: Gating strategy to identify immune cells in the brain and spleens. Single cell suspensions were gated, excluding very small cells/debris, and cell doublets were excluded by side- scatter-width. Using 'aqua' live/dead dye to label dead cells, only living cells were gated. The pan leukocyte marker CD45.2 was used to gate on leukocytes. Cells were gated on CD3+ cells that include CD4+ and CD8+ T cells, NKT and γδ T cells. CD3+ T cells were gated further on CD8+ and CD4+ cells. The CD3- gate was used to further subset cells into neutrophils (Ly6G+, Ly6C+), macrophages/DC (Ly6G-, Ly6C+) and NK cells (NK1.1+). Leukocytes were counted per spleen and brain preparation on a hemocytometer and the numbers of each cell type was calculated.
FIGS. 9A-9B: The effect of PbA infection and DON treatment on the glutaminolysis pathway in the brain, liver and serum. (FIG. 9A) DON blocks the first step of glutaminolysis by inhibiting glutaminase. (FIG. 9B) PbA infection and DON treatment of PbA infected mice affect the glutaminolysis pathway differently in the brain relative to the liver and serum. Shown are absolute fold change and false discovery rates (FDR) by Welch's t test for the indicated 2- way comparison. Positive fold changes (red shading) represent significantly increased (FDR < 0.05) metabolite abundance in the first group compared to the second group. Negative fold changes (blue shading) represent significantly decreased (FDR < 0.05) metabolite abundance in the first group compared to the second group.
SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on June 6, 2016, 2.08 KB, which is incorporated by reference herein. In the accompanying sequence listing:
SEQ ID NOs: 1-8 are nucleic acid primer sequences.
SEQ ID NO: 9 is an amino acid sequence of a PbA GAP50 peptide.
DETAILED DESCRIPTION
I. Abbreviations
APC antigen presenting cell
BBB blood brain barrier CM cerebral malaria
Ct cycle threshold
d5a post-infection day 5, 7am
d5p post-infection day 5, 11pm
d6a post-infection day 6, 7am
DON 6-diazo-5-oxo-L-norleucine
EB Evan's blue
ECM experimental cerebral malaria
FACS fluorescence activated cell sorting
FBS fetal bovine serum
FDR false discovery rate
GAP50 glideosome-associated protein 50
H&E hematoxylin and eosin
HCM human cerebral malaria
iRBC infected red blood cell
MHC major histocompatibility complex
NK natural killer
PbA Plasmodium berghei ANKA
PBS phosphate buffered saline
PE phycoerythrin
p.i. post-infection
RBC red blood cell
II. Terms and Methods
Unless otherwise noted, technical terms are used according to conventional usage.
Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632- 02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
6-diazo-5-oxo-L-norleucine (DON): A glutamine antagonist originally isolated from Streptomyces in a sample of Peruvian soil. DON is a non-standard amino acid (an analog of glutamine). DON is an active site inhibitor of glutaminase, an enzyme responsible for the first step in the glutaminolysis pathway that converts Gin to glutamate plus ammonia (Thangavelu et al. , Sci Rep 4, 3827, 2014). DON has previously been evaluated as a cancer chemotherapeutic agent.
Acivicin ((alpha S,5S)-alpha-amino-3-chloro-4,5-dihydro-5-isoxazoleacetic acid): A glutamate antagonist that is a fermentation product of Streptomyces. Acivicin is a glutamine analog that irreversibly inhibits glutamine-dependent amidotransferases involved in nucleotide and amino acid biosynthesis. Acivicin also inhibits gamma-glutamyl transpeptidase and is known to have anti-tumorigenic activity.
Administration: To provide or give a subject an agent, such as a therapeutic agent (e.g. a glutamine antagonist), by any effective route. Exemplary routes of administration include, but are not limited to, injection or infusion (such as subcutaneous, intramuscular, intradermal,
intraperitoneal, intrathecal, intravenous, intracerebroventricular, intrastriatal, intracranial and into the spinal cord), oral, intraductal, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
Antimalarial agent: Any agent that is capable of preventing or treating malaria. Examples of antimalarial agents include, but are not limited to, quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, artemeiher/lumefantrine, pyrimethamine/sulfadoxine and artemisinin or an artemisinin derivative (such as artesimate).
Azaserine: A glutamine antagonist. Azaserine is serine derivative diazo compound with antineoplastic and antibiotic properties deriving from its action as a purinergic antagonist and structural similarity to glutamine. Azaserine acts by competitively inhibiting glutamine amidotransferase, a key enzyme responsible for glutamine metabolism.
Blood-brain barrier (BBB): A highly selective permeability barrier that separates the circulating blood from the brain extracellular fluid in the central nervous system. The BBB is formed by brain endothelial cells, which are connected by tight junctions with an extremely high electrical resistivity. The BBB allows the passage of water, some gases, and lipid-soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids that are cracial to neural function. However, the BBB prevents the entry of lipophilic, potential neurotoxins by way of an active transport mechanism mediated by P-glycoprotein. The BBB also protects the brain from bacterial infection.
Cerebral edema: Swelling of the brain caused by excessive accumulation of fluid.
Cerebral malaria: A severe, life-threatening form of malaria. Cerebral malaria is characterized by a number of neurological symptoms (including cerebral edema, disruption of the BBB, brain hemorrhage, seizures, delirium and unarousable coma), the presence of infected red blood cells (iRBCs) in the peripheral circulation and sequestration of iRBCs on the brain vascular endothelium.
Coma: A state of unconsciousness in which a person cannot be awakened, fails to respond normally to painful stimuli, light or sound, lacks a normal wake-sleep cycle, and does not initiate voluntary actions.
Degranuiation of CD8÷ T cells: Refers to the process of releasing cytotoxic molecules, such as perforin and granzymes, from secretory vesicles of a CD8+ T cell.
Delirium: An acute state of mental confusion characterized by anxiety, disorientation, restlessness, hallucinations, delusions and incoherence of thought and speech. Delirium can be caused by, for example, brain injury, high fever, poisoning, intoxication or shock.
Glutamine antagonist: An inhibitor of biochemical reactions that utilize glutamine.
Glutamine antagonists include, but are not limited to, DON, acivicin and azaserine.
Hemorrhage: Bleeding from a ruptured blood vessel in the body.
Hemorrhagic stroke: At type of stroke (sudden death of brain cells due to a lack of oxygen) that results from an accumulation of blood in or around the brain, such as from a ruptured blood vessel. Hemorrhages in the brain can be caused by a variety of disorders that affect the blood vessels, such as long-term high blood pressure and cerebral aneurysms (a week or thin spot on a blood vessel wall).
Malaria: Malaria is a parasitic infection of humans and non-human primates by the
Plasmodium species P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi. Humans become infected following the bite of an infected anopheline mosquito, the host of the malarial parasite. Malaria occasionally occurs in humans following a blood transfusion or subsequent to needle-sharing. Clinical manifestations of malarial infection may include blackwater fever, cerebral malaria, respiratory failure, hepatic necrosis, and/or occlusion of myocardial capillaries. Additional Plasmodium species infect other hosts, such as rodents (P. berghei, P. chabaudi, P. vinckei, and P. yoelii), other mammals, birds and reptiles.
Parenteral: Administered outside of the intestine, for example, not via the alimentary tract. Generally, parenteral formulations are those that will be administered through any possible mode except ingestion. This term especially refers to injections, whether administered intravenously, intrathecally, intramuscularly, intraperitoneally, or subcutaneously, and various surface applications including intranasal, intradermal, and topical application, for instance.
Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers of use are conventional. Remington's Pharmaceutical Sciences, by E.W. Martin, Mack Publishing Co., Easton, PA, 15th Edition, 1975, describes compositions and formulations suitable for pharmaceutical delivery of the compositions disclosed herein.
In general, the nature of the carrier will depend on the particular mode of administration being employed. In addition to biologically neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Seizure: Uncontrolled electrical activity in the brain, which may produce a physical convulsion, minor physical signs, thought disturbances, or a combination of symptoms. Seizures can be caused by, for example, head injuries, brain tumors, lead poisoning, maldevelopment of the brain, genetic and infectious illnesses, and fevers.
Subject: Living multi-cellular organisms, including vertebrate organisms, a category that includes both human and non-human mammals.
Therapeutically effective amount: A quantity of compound or composition, for instance, a glutamine antagonist (e.g. DON), sufficient to achieve a desired effect in a subject being treated. For instance, this can be the amount necessary to treat cerebral edema and/or restore BBB integrity.
Traumatic brain injury: A form of acquired brain injury that occurs when a sudden trauma causes damage to the brain. TBI can result when the head suddenly and violently hits an object, or when an object pierces the skull and enters brain tissue. Symptoms of a TBI can be mild, moderate, or severe, depending on the extent of the damage to the brain. A person with a mild TBI may remain conscious or may experience a loss of consciousness for a few seconds or minutes. Other symptoms of mild TBI include headache, confusion, lightheadedness, dizziness, blurred vision or tired eyes, ringing in the ears, bad taste in the mouth, fatigue or lethargy, a change in sleep patterns, behavioral or mood changes, and trouble with memory, concentration, attention, or thinking. A person with a moderate or severe TBI may show these same symptoms, but may also have a headache that gets worse or does not go away, repeated vomiting or nausea, convulsions or seizures, an inability to awaken from sleep, dilation of one or both pupils of the eyes, slurred speech, weakness or numbness in the extremities, loss of coordination, and increased confusion, restlessness, or agitation.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. "Comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. III. Introduction
Experimental cerebral malaria (ECM) in mice is a widely used model of HCM and provides a valuable tool for elucidating the mechanisms involved in CM pathogenesis and identifying cellular and molecular targets for adjunctive therapy (Grau and Craig, Future Microbiol 7, 291-302, 2012). In ECM, 6 to 7 days after infection with Plasmodium berghei ANKA (PbA), mice of susceptible strains, such as C57BL/6 develop ataxia, paralysis, seizures, coma and ultimately die (Engwerda et al. , Curr Top Microbiol Immunol 297, 103-143, 2005). ECM displays key features of HCM, including BBB breakdown, focal hemorrhaging and brain swelling (Nacer et al, PLoS Pathog 8, el002982, 2012; Promeneur et al. , Proc Natl Acad Sci U SA 110, 1035-1040, 2013; Penet et al., J N euro sci 25, 7352-7358, 2005). ECM's pathology also includes sequestration of infected red blood cells (iRBCs) in the brain vasculature (Baptista et al. , Infect Immun 78, 4033- 4039, 2010; McQuillan et al, Int J Parasitol 41, 155-163, 2011), a hallmark of HCM (Newton et al, Lancet 337, 573-576, 1991). Histological analysis of the brains of children who died of HCM showed that leukocytes, primarily monocytes with phagocytized hemozoin and platelets but also intravasculature leukocytes, including CD8+ T cells, sequestered in the brain vessels (Clark et al. , Malar J 2, 6, 2003; Grau et al, J Infect Dis 187, 461-466, 2003; Dorovini-Zis et al, Am J Pathol 178, 2146-2158, 2011). In ECM, the sequestration of various immune cells including monocytes, NK cells, neutrophils and T cells in the brain vasculature have been implicated in the development of neurological damage (Hansen et al, J Immunol 178, 5779-5788, 2007; Belnoue et al, J Immunol 169, 6369-6375, 2002). Current evidence indicates that CD8+ T cells are the major mediators of death in ECM (Howland et al, Semin Immunopathol, 2015) and that antigen-specific CD8+ T cells engage parasite antigens cross-presented on MHC class I molecules on brain endothelium resulting in endothelial cell dysfunction by a perforin-dependent mechanism (Nitcheu et al, J Immunol 170, 2221-2228, 2003). A critical role for metabolic reprogramming in regulating immune responses is becoming increasingly appreciated. Upon activation, T cells undergo metabolic reprogramming to meet the increased energetic and biosynthetic demands of growth and effector T cell functions (Maclver et al., Annu Rev Immunol 31, 259-283, 2013; O'Sullivan and Pearce, Trends Immunol 36, 71-80, 2015; Pollizzi and Powell, Nat Rev Immunol 14, 435-446, 2014). Reprogramming involves a shift to aerobic glycolysis and increased glutaminolysis. Activated T cells import large quantities of glutamine (Gin) and increase their expression of glutaminase (Carr et al, J Immunol 185, 1037- 1044, 2010; Wang et al, Immunity 35, 871-882, 2011; Nakaya et al, Immunity 40, 692-705, 2014). The studies disclosed herein focus on targeting Gin metabolism for an adjunctive therapy for CM using the Gin analog, 6-diazo-5-oxo-L-norleucine (DON). DON broadly inhibits glutamine metabolism in part by blocking glutamine transport and inhibiting all three isoforms of glutaminase as well as other glutamine-utilizing enzymes such as the amidotransferases and glutamine synthetase (Thangavelu et al, Sci Rep 4, 3827, 2014). Consequently, DON has been shown to be a potent inhibitor of T cell proliferation (Wang et al. , Immunity 35, 871-882, 2011 ).
DON is an active site inhibitor of glutaminase, an enzyme responsible for the first step in the glutaminolysis pathway that converts Gin to glutamate plus ammonia (Thangavelu et al, Sci Rep 4, 3827, 2014). A selective increase in extracellular Glu or ammonia are both neurotoxic and might not be detected by the metabolic analysis of brain tissue. Likewise, the accumulation of Gin in the cytosol of astrocytes, as a result of efforts of the astrocytes to detoxify ammonia, results in astrocyte swelling (Albrecht and Norenberg, Hepatology 44, 788-794, 2006) and DON has been shown to prevent ammonia-induced astrocyte swelling in vitro (Norenberg et al, J Bioenerg Biomembr 36, 303-307, 2004). Furthermore, a recent study by Miranda et al. (Braz J Med Biol Res 43, 1173-1177, 2010), demonstrated that increased levels of Glu in the cerebral spinal fluid of PbA- infected mice is associated with the neurological signs of ECM. Indeed, DON has been shown to reduce excessive Glu release by activated microglia that contribute to neurodegeneration in a number of neurological diseases including ischemic brain injury (Takeuchi et al. , Exp Neurol 214, 144-146, 2008) and in Japanese encephalitis virus induced encephalitis (Chen et al, Glia 60, 487- 501, 2012).
The studies disclosed herein show that DON treatment rescues /¾>A-infected mice from ECM at late stages in the disease, at a time when the animals show clinical signs of neurological damage and physical loss of BBB integrity, brain swelling, and hemorrhaging. The ability of DON to reverse disease is concomitant with a decrease in the number and effector function of parasite- specific CD8+ T cells in the brains of treated mice. The striking ability of DON treatment to reverse pathology so late in the disease suggests a fundamental and potentially direct role for Gin metabolism in promoting neuropathology.
IV. Overview of Several Embodiments
Provided herein are methods of treating cerebral edema in a subject. In some embodiments, the methods include selecting a subject with cerebral edema and administering to the subject a therapeutically effective amount of a glutamine antagonist. In particular embodiments, the cerebral edema is caused by cerebral malaria, a traumatic brain injury or a hemorrhagic stroke.
Also provided herein are methods for treating cerebral malaria in a subject. In some embodiments, the methods include selecting a subject with malaria who is exhibiting at least one neurological sign or symptom of cerebral malaria (or who has been diagnosed with malaria) and administering to the subject a therapeutically effective amount of a glutamine antagonist. In particular embodiments, the at least one neurological sign of cerebral malaria is selected from cerebral edema, loss of blood-brain barrier integrity, brain hemorrhage, infected red blood cells in the brain vasculature, coma, seizure and delirium.
In some embodiments for treating cerebral malaria, the methods further include
administering to the subject an antimalarial agent. Any antimalarial agent effective for the treatment of malaria can be selected. In some examples, the antimalarial agent is quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, artemether/lumefantrine,
pyrimethamine/sulfadoxine, artemisinin or an artemisinin derivative (such as artesunate), or any combination of two or more thereof.
Further provided are methods of inhibiting degranulation of CD8+ T cells in the brain of a subject with malaria. In some embodiments, the methods include selecting a subject with cerebral malaria and administering to the subject a therapeutically effective amount of a glutamine antagonist.
The glutamine antagonist can be administered using any suitable route of administration. In some embodiments of the methods disclosed herein, the glutamine antagonist is administered intraperitoneally, intravenously, rectally or orally.
Suitable doses and dosing schedules for administration of the glutamate antagonist can be determined by a physician, based on several factors including age, weight, general condition of the subject, the particular condition being treated, the particular glutamate antagonist being used and its mode of administration. In particular examples of the methods disclosed herein, the glutamine antagonist is administered once a day. In other examples, the glutamine antagonist is administered once every other day.
In some embodiments of the methods, the glutamine antagonist is 6-diazo-5-oxo-L- norleucine, acivicin or azaserine. In specific non-limiting embodiments, the glutamine antagonist is 6-diazo-5-oxo-L-norleucine.
In some instances in which the glutamine antagonist is 6-diazo-5-oxo-L-norleucine, the subject is administered 6-diazo-5-oxo-L-norleucine at a dose of about 0.1 to about 15 mg/kg, about 0.13 mg/kg to about 15 mg/kg, about 0.25 mg/kg to about 15 mg/kg, about 0.5 mg/kg to about 15 mg/kg, about 0.1 to about 10 mg/kg, about 1 to about 10 mg/kg, about 0.1 to about 0.5 mg/kg, about 1 to about 5 mg/kg, about 0.1 to about 2.5 mg/kg, or about 1 to about 2.5 mg/kg. In specific examples, the subject is administered 6-diazo-5-oxo-L-norleucine at a dose of about 0.1 mg/kg, about 0.2 mg/kg, about 0.3 mg/kg, about 0.4 mg/kg, about 0.5 mg/kg, about 0.6 mg/kg, about 0.7 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, about 1.0 mg/kg mg/kg, about 1.1 mg/kg mg/kg, about 1.2 mg/kg mg/kg, about 1.3 mg/g mg/kg, about 1.4 mg/kg or about 1.5 mg/kg.
In some examples, the 6-diazo-5-oxo-L-norleucine is administered to the subject at a dose of about 1.3 mg/kg once per day. In other examples, the 6-diazo-5-oxo-L-norleucine is administered to the subject at a dose of about 1.3 mg/kg once every other day.
Also provided herein are compositions comprising 6-diazo-5-oxo-L-norleucine and an antimalarial agent. In some embodiments, the antimalarial agent is quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, arteinether/lumefantriiie, pyrimethamine/sulfadoxine, artemisinin or an artemisinin derivative (such as artesunate), or any combination of two or more thereof. In some examples, the composition further comprises a pharmaceutically acceptable carrier.
V. Administration of Pharmaceutical Compositions
Glutamine antagonists can be administered, such as for the treatment of cerebral edema, as a composition comprising one or more pharmaceutically acceptable carriers. Such carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions for use in the methods of the present disclosure. In some embodiments herein, the compositions further include an antimalarial agent.
Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives can also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
Pharmaceutical compositions comprising a glutamine antagonist can be administered orally in liquid, capsule, pill or tablet form, and can include, for example, lactose, microcrystalline cellulose, colloidal silicon dioxide, croscarmellose sodium, magnesium stearate, stearic acid, and other excipients, colorants, pharmacologically compatible carriers, or any combination thereof. Oral formulations of a glutamine antagonist can be taken with a suitable buffer, such as
bicarbonate. Alternatively, the glutamine antagonist can be coated with an enteric coating.
The pharmaceutical composition can be presented in unit-dose or multi-dose sealed containers, for example, ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporanenous injection solutions and suspensions can be prepared from sterile powders, granules and tablets.
Administration can be accomplished by single or multiple doses. The dose required will vary from subject to subject depending on the species, age, weight, general condition of the subject, the particular condition being treated, the particular glutamate antagonist being used and its mode of administration. An appropriate dose can be determined by one of ordinary skill in the art using only routine experimentation. In some embodiments, the dose of glutamine antagonist (such as DON) is about 0.1 to about 15 mg/kg, about 0.13 mg/kg to about 15 mg/kg, about 0.25 mg/kg to about 15 mg/kg, about 0.5 mg/kg to about 15 mg/kg, about 0.1 to about 10 mg/kg, about 1 to about 10 mg/kg, about 0.1 to about 0.5 mg/kg, about 1 to about 5 mg/kg, about 0.1 to about 2.5 mg/kg, or about 1 to about 2.5 mg/kg. In specific examples, the subject is administered 6-diazo-5-oxo-L- norleucine at a dose of about 0.1 mg/kg, about 0.2 mg/kg, about 0.3 mg/kg, about 0.4 mg/kg, about 0.5 mg/kg, about 0.6 mg/kg, about 0.7 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, about 1.0 mg/kg mg/kg, about 1.1 mg/kg mg/kg, about 1.2 mg/kg mg/kg, about 1.3 mg/g mg/kg, about 1.4 mg/kg or about 1.5 mg/kg.
In some examples disclosed herein, 6-diazo-5-oxo-L-norleucine is administered to a subject at a dose of about 1.3 mg/kg once per day. In other examples, 6-diazo-5-oxo-L-norleucine is administered to a subject at a dose of about 1.3 mg/kg once every other day. The glutamate antagonist can also be administered in combination with other therapeutic agents, such as antimalarial agents if the subject is infected with P. falciparum. Antimalarial agents include, but are not limited to, quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, artemether/lumefantrine, pyrimethamine/suifadoxine, artemisinin and artemisinin derivatives (such as artesunate).
The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.
EXAMPLES
Example 1: Materials and Methods
This example describes the materials and experimental procedures for the studies described in Example 2.
Animal and Malaria Infections
C57BL/6 female mice (7-10 weeks old) were obtained from The Jackson Laboratories. Mice were infected with PbA by injecting intraperitoneally lxlO6 /¾>A-infected RBC obtained from infected C57BL/6 mice. Peripheral blood parasitemia was determined by flow cytometry as described below. Infected mice were monitored for the progression of ECM using a ten point clinical scoring system that rates mice from a score of 0 (no signs) to 10 (moribund) as previously described (Waisberg et al, PLoS One 7, e29493, 2012). 6-Diazo-5-oxo-L-norleucine (DON) Treatment
For each DON treatment, mice weighing approximately 25 grams were injected
intraperitoneally with 1.3 mg/kg DON (Sigma, Cat#D2141, St. Louis, MO) in 200 PBS.
Quantification of Peripheral Blood Parasitemia by Flow Cytometry
Parasitemia was determined by flow cytometry using a modification of a previously described method (Malleret et al, Sci Rep 1, 118, 2011). Briefly, blood was obtained from mouse tail veins, fixed with 0.025% aqueous glutaradehyde solution, washed with 2 mL PBS, resuspended and stained with the following: the DNA dye Hoechst 33342 (Sigma) (8 μΜ), the DNA and RNA dye dihydroethidium (diHEt) (10 μg/mL), the pan C57BL/6 lymphocyte marker APC-conjugated antibody specific for CD45.2 (BioLegend, San Diego, CA), and the RBC marker APC-Cy7- conjugated antibody specific for Terll9 (BD Pharmingen, San Jose, CA). Cells were analyzed on a BD™ LSRII flow cytometer equipped with UV (325nm), Violet (407nm), Blue (488nm) and Red (633nm) lasers. Data were analyzed using FLOWJO™ software (Tree Star Technologies, Ashland, OR). Infected RBCs (iRBCs) were CD45.2 , Terll9+, Hoechst+ and diHEt+. Parasitemia were calculated as the number of iRBCs/total number of RBCs.
Quantification of Parasite Loads in Brains
Mice were anesthetized and transcardially perfused with cold PBS and brains were removed and immediately frozen in liquid nitrogen. Brains were thawed and 1 ml Qiagen RNEASY™ lysis buffer was added immediately. Brains were homogenized and RNA was extracted from the homogenate using a Qiagen RNEASY™ Mini kit according to manufacturer's instructions.
Genomic DNA was digested on a column using RNAse-free DNAse set (Qiagen, Valencia, CA) and the elimination of genomic DNA was confirmed using no reverse transcriptase controls.
cDNA was generated using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA). SYBR™ Green PCR master mix (Bio-Rad) was used to determine the relative expression of parasite 18s ribosomal RNA and three mouse housekeeping genes, hprt, gapdh, and actb. The primer sequences were: Pb 18s - AAGCATTAAATAAAGCGAATACATCCTTAC (SEQ ID NO: 1) and
GGAGATTGGTTTTGACGTTTATGTG (SEQ ID NO: 2);
mouse hprt - TGCTCGAGATGTGATGAAGG (SEQ ID NO: 3 and
TCCCCTGTTGACTGGTCATT (SEQ ID NO: 4);
mouse gaphd - GTGGAGTCATACTGGAACATGTAG (SEQ ID NO: 5 and
AATGGTGAAGGTCGGTGTG (SEQ ID NO: 6); and
mouse actb - TCCGGCATGTGCAAAGC (SEQ ID NO: 7) and TCCTTCTGACCCATTCCC (SEQ ID NO: 8).
The geometrical mean of the cycle threshold (Ct) values of mouse housekeeping genes was first determined to create a normalized base line for the brain to allow a comparison of the delta Ct values of 18s gene amplification. The fold changes in gene expression was then calculated by comparing the delta Ct values of /¾>A-infected mice on day 5 p.i. to that on day 6 p.i. for mice treated with DON on day 5p p.i. or mice left untreated. Assessment of BBB Integrity
Evans blue (EB; 20 mg/kg) was injected intraorbitally on the specified day and three hours later the mice were anesthetized, perfused with saline and their brains removed and immediately frozen at -80°C for later processing (Kim et al. , Nature 457, 191-195, 2009). EB was extracted using N, N-dimethylformamide and quantified using a Varioskan Flash fluorometer (620 nm excitation; 695 nm emission).
Assessment of Brain Swelling
Brains were removed from animals and weighed. Brains were then desiccated at 80°C for 12 hours and weighed again. Percent water content was calculated using the decrease in weight.
Quantification of Brain Hemorrhages
Brain samples were fixed in 10% buffered formalin, embedded in paraffin and sectioned. Sections were stained with hematoxylin and eosin (H&E) for ultrastructural examination and detection of hemorrhages. For quantification of hemorrhages, hemorrhages were counted in 10 microscopic 40x power fields.
Flow Cytometry
For quantification of brain infiltrating leukocytes, mice were anesthetized with
ketamine/xylazine at the specified times and transcardially perfused with cold PBS and the brains and spleens were removed. Brains were dissected, minced and digested with 1 mg/mL collagenase for 30 minutes at 37°C. After passing the tissue through 70 μιη nylon mesh, homogenates were placed on a 90-60-40% discontinuous PERCOLL™ gradient, centrifuged for 18 minutes at 1000 x g and the cells at the 40-60% interface containing leukocytes were collected for analysis. Spleens were mashed using a 70 μιη nylon mesh, then red blood cells were lysed. The cells were washed and re-suspended in FACS buffer consisting of PBS and 1% FBS. The following fluorescent dye- conjugated antibodies specific for the following cell surface markers were used for staining:
BRILLIAN VIOLET™(BV) 421-NK1.1 (BioLegend), BV605-CD4 (BioLegend), BV785-CD8 (BioLegend), PE-Ly6G (BD Pharmingen), PE-Cy7-CD3 (eBioscience, San Diego, CA), APC- Ly6C (BD Pharmingen), APC-Cy7-CD45.2 (BD Pharmingen), and LIVE/DEAD™ Fixable AquaDead Cell Stain ( Life Technologies, Grand Island, NY). Gating of subsets is depicted in FIG. 6. Cell acquisition data was obtained on a BD™ LSRII flow cytometer. Data was analyzed with FLOWJO™ software (Tree Star Technologies, Ashland, OR). To quantify GAP50-tetramer binding CD8+ T cells (Howland et al, EMBO Mol Med 5, 984-999, 2013) in tissues from uninfected mice, GAP50-tetramer-binding CD8+ T cells were enriched by magnetic bead separation as described (Haluszczak et al, J Exp Med 206, 435-448, 2009). Briefly, a single cell suspension was prepared from spleen and peripheral lymph nodes (axillary, brachial, inguinal, and cervical) and incubated with 0.5 mg GAP-50 tetramer (obtained from the NIH Tetramer Core Facility, Emory University, Atlanta, GA) conjugated to APC for 30 minutes on ice. Cells were washed and incubated for 40 minutes at 4°C with anti-APC beads (Miltenyi Biotec, San Diego, CA). The cells were washed and applied to magnetic columns (Miltenyi). Both the bound GAP50-tetramer+, and unbound cells were incubated for 30 minutes at 4°C with antibodies specific for CD8, CD3, CD44, MHC class II and F4/80 obtained from
Biolegend, ebioscience, and Tonbo. Cells were washed, analyzed on a BD LSRFORTRESSA™ flow cytometer (BD Biosciences), and the acquired data analyzed using FLOWJO™ software. To quantify GAP50-tetramer binding CD8+ T cells in the tissues of /¾>A-infected mice, brain and spleen were collected and single cell suspensions prepared as described above. Cells were stained for 30 minutes at 4°C with the following fluorescent dye-conjugated antibodies specific for the following cell surface markers: BV785-CD8 (Biolegend); BV421-CD44 (Biolegend); BV605-CD4 (Biolegend); BV711-CDllb (Biolegend); PE-CD107a (Biolegend); PE-CD107b (Biolegend); PerCP-Cy5.5-Thyl.2; Db:GAP50-Bio; APC-streptavidin (Life Technologies); AquaDead Cell Stain ( Life Technologies); ALEXA FLUOR™ 700-Ly6C (Biolegend); and APC-Cy7-CD45.2 (BD Pharmingen). Cell acquisition data was obtained on a BD™ LSRII flow cytometer and analyzed with FLOWJO™ software (Tree Star Technologies).
For the detection of in vivo degranulation, mice were given PE-conjugated antibodies specific for CD107a (12^g) and for CD107b (12^g) (Biolegend) by intravenous injection 1 hour prior to sacrificing the mice and removal of their brains and spleens, as previously described (Yuzefpolskiy et al. , Cell Mol Immunol, 2014).
Metabolic/Metabolomic Profiling
On day 6a p.i., mice from all experimental groups were euthanized to collect brain, liver, and serum. Tissue samples were snap frozen in liquid nitrogen and stored at -80°C until sample preparation. Automated tissue processing and metabolomic profiling by ultrahigh performance liquid chromatography-tandem mass spectroscopy and gas chromatography-mass spectroscopy were performed at Metabolon using multiple quality control standards as described (Shin et al. , Nat Genet 46, 543-550, 2014). After extraction of raw data, peaks were identified by comparison to known purified standards and recurrent unknown entities present in Metabolon' s reference library. Peak quantification was performed using area-under-the-curve with data normalization to correct for day-to-day variation for studies spanning multiple days. Statistical analyses of metabolomics data were performed in ArrayStudio 5.0 and R 3.1.1 (online at R-project.org). Two-way comparisons between experimental groups were analyzed by Welch's t test for each of the three tissue types using log-transformed data in R. To correct for multiple testing, false discovery rates (FDR) were estimated using the q-value method (Storey and Tibshirani, Proc Natl Acad Sci USA 100, 9440-9445, 2003), and only metabolites with an FDR <5% were considered significant.
Canonical pathways analysis was applied to metabolites meeting a fold-change threshold of > 11.21 and a FDR of < 5% for each two-way comparison and for each tissue using Ingenuity Pathway Analysis (IPA, Qiagen).
Example 2: Targeting Glutamine Metabolism Rescues Mice from Late-Stage Cerebral Malaria
This example describes the finding that in an animal model of cerebral malaria, DON treatment at late stages of disease restores BBB integrity, reduces brain swelling and promotes survival. DON treatment also reduces the number of CD8+ effector T cells that degranulate in the brains of infected mice.
DON treatment promotes survival even in late-stage ECM
To determine if blocking glutamine metabolism would inhibit death due to
immunopathology in a mouse model of ECM, C57BL/6 mice were infected with Plasmodium berghei ANKA (PbA) on day 0 and injected intraperitoneally with DON (1.3 mg/kg) or saline, beginning either at 7 am on the morning of day 5p.i. (day 5a p.i.), at 11 pm on day 5 p.i. (day 5p p.i.) or at 7 am on day 6 p.i. (day 6a p.i.). DON treatments were repeated either every day or every other day (FIG. 6). The majority of untreated, /¾>A-infected mice died during day 6 p.i. and all died by day 7 p.i. (FIG. 1A). In contrast, all of the mice treated with DON beginning on day 5a p.i. and 80% of the mice treated on day 5p p.i. survived as followed out to day 12 p.i. Remarkably, nearly 50% of mice treated as late as day 6a p.i. survived.
Mice were evaluated for the development of neurological signs associated with ECM and given clinical scores between 0 (no signs) to 10 (moribund) using previously described criteria (Waisberg et al., PLoS One 7, e29493, 2012). Nearly all of the untreated mice that were infected with PbA developed neurological signs by day 5p p.i. that in most cases were severe (clinical score >6) by day 6a p.i. (FIG. IB). Treatment with DON beginning on day 5a p.i. prevented the development of neurological symptoms in all /¾>A-infected mice (FIG. IB). Treatment of mice with DON beginning on day 5p p.i., a point at which most mice had clinical scores of two, not only prevented the worsening of clinical signs but promoted the rapid resolution of symptoms (FIG. IB). Remarkably, treatment of mice on day 6a p.i., when many mice had already developed clinical scores of five, blocked the progression of the disease and rapidly resolved the symptoms in half the mice (FIG. IB). Thus, DON was able to reverse disease even when the mice were already displaying signs of neurologic damage.
In both DON-treated and untreated /¾>A-infected mice, parasitemias increased similarly with time, reaching peak levels of approximately 8-12% between d5 and d6 p.i. (FIG. 1C). Nearly all untreated mice died by day 7 p.i., with peripheral parasitemia of 10-12%. In the DON-treated mice that survived beyond day 6 p.i., the peripheral parasitemias decreased beginning on day 7 p.i., reaching low levels by day 8 p.i. However, during the critical period on day 6 p.i. during which untreated mice die and DON treated mice survive, the parasite loads were indistinguishable in the brains of the mice treated on day 5p p.i. and untreated mice (FIG. ID), suggesting that inhibition of parasite growth by DON is not the primary mechanism promoting survival. Consistent with the ability of DON to inhibit parasite replication, once neurologic symptoms were resolved, continued DON treatment suppressed parasitemia to under 5% as followed out to day 17 p.i. and upon stopping DON treatment, parasitemia increased to a mean of 40% by day 21 p.i. (FIG. 7).
DON treatment restores BBB integrity and reduces brain swelling but does not have an immediate effect on brain hemorrhaging
Compromise of the BBB, brain swelling and hemorrhaging are major components of the neuropathology observed in ECM. Thus, the effect of DON treatment on the integrity of the BBB was assessed by measuring the leakage of the dye Evans blue (EB) into the brains (Yen et al. , PLoS One 8, e68595, 2013; Nag, Methods Mol Med 89, 133-144, 2003). Mice were injected
retroorbitally with EB, sacrificed three hours later and their brains removed and EB quantified. By both visual inspection and by EB quantification, the brains of /¾>A-infected, untreated mice showed significant leakage of EB into their brains on day 5p p.i. that increased further on day 6a p.i. (FIG. 2A). Remarkably, in the brains of /¾>A-infected DON-treated mice, EB leakage was significantly less on day 6a p.i. as compared to untreated mice and decreased significantly further by day 7a p.i. (FIG. 2A). The effect of DON treatment on the water content of the brain as a measure of cerebral edema was determined by weighing the brains before and after desiccation. As compared to uninfected mice, the brains of /¾>A-infected mice had a significantly greater water content measured on both day 5p and day 6a p.i. (FIG. 2B). Treating mice with DON on day 5p p.i.
significantly reduced the water content of the brains measured on day 6a p.i. Thus, not only could DON arrest the disease process, but it also promoted resolution even when treatment was first initiated at a time when significant BBB dysfunction and brain swelling were already manifest.
To quantify brain hemorrhages, brain sections were stained with hematoxylin and eosin (H&E). The brains of /¾>A-infected, untreated mice developed petechial hemorrhages throughout the brain by day 5p p.i. that increased in number by day 6a p.i. (FIG. 2C). Treatment of mice with DON beginning on day 5p p.i. had no significant effect on the number of hemorrhages that developed. However, by day 15 p.i. the hemorrhages were no longer evident (FIG. 2C). Thus, DON treated mice survived local hemorrhaging in the brain when the overall integrity of the BBB was restored and brain swelling was reduced.
DON treatment reduces the number of CD8+ effector T cells that degranulate in the brains of infected mice
CD8+ T cells have been shown to play a major role in promoting death in ECM (Howland et al, Semin Immunopathol, 2015). Glutamine metabolism is critical for the differentiation, proliferation and function of effector T cells. Thus, studies were conducted to determine the effect of DON treatment on T cells in the brains of infected mice. DON was administered to PbA- infected mice on day 5p p.i. and on day 6a p.i. mice were terminally anesthetized and transcardially perfused with cold PBS. The brains were collected and single cell suspension were prepared and analyzed by flow cytometry. First, immune cell infiltration of both the treated and untreated mice was examined. As compared to uninfected mice, the brains of infected mice showed large increases in all immune cell types analyzed including CD8+ and CD4+ T cells, neutrophils, macrophages and NK cells. Interestingly, in spite of its ability to reverse disease, DON treatment had no effect on the absolute numbers of immune cell subsets in the brains of infected mice (FIGS. 3A-3E).
Next, the effect of DON on the expansion and function of parasite- specific CD8+ T cells was examined. The accumulation of /¾>A-specific CD8+ T cells in the brains and spleens was quantified using a peptide-MHC class I tetramer composed of the PbA glideosome-associated protein 50 (GAP50) peptide, SQLLNAKYL (SEQ ID NO: 9), bound to MHC class I Db (referred to as a GAP50-tetramer) that identifies approximately 5% of splenic CD8+ T cells in Pb A- infected mice (Howland et al. , EMBO Mol Med 5, 984-999, 2013). It was verified that in the spleens of uninfected mice the frequency of GAP50-tetramer-binding CD8+ T cells was less than 0.1% (FIG. 3F, left panel). Enrichment for GAP50-tetramer-binding cells in the spleen and lymph nodes of uninfected mice by GAP50-tetramer-bound magnetic bead purification showed approximately 2,700 GAP50-tetramer-binding CD8+ T cells, the majority of which were resting, CD44" cells (FIG. 3F, middle panel). In contrast, in /¾>A-infected mice the frequency of GAP50-tetramer- binding T cells in the spleen was approximately 3% and these were CD44+ effector T cells (FIG. 3F, right panel). DON treatment of /¾>A-infected mice resulted in a small decrease in the number of GAP50-tetramer-binding CD8+ T cells in the spleens but had little effect on the number of GAP50-tetramer binding T cells in the brains (FIG. 3G). These observations suggest that the ability of DON to reverse neuropathology at this late stage in the disease process is not dependent on its ability to inhibit the expansion of /¾>-specific CD8+ T cells.
Having observed that DON was not inhibiting expansion of parasite-specific CD8+ T cells, a study was conducted to determine the effect of DON on CD8+ T cell effector function. The development of ECM has been shown to be dependent on degranulation and perforin release of CD8+ T cells that accumulate in the brains of /¾>A-infected mice (Howland et al, Semin
Immunopathol, 2015). Degranulation of CD8+ T cells results in the expression of CD107 on their plasma membranes. To assess the ability of DON to inhibit CD8+ T cell degranulation in the brains of infected mice, fluorescently-labeled CD107-specific monoclonal antibodies were administered intravenously to mice one hour before tissues were removed for analysis to allow in vivo labeling of CD107+ cells. Shown are representative flow cytometry plots showing the percent of CD44+, CD8+ T cells that express CD 107 in the spleens of uninfected mice, Pb A- infected mice and Pb A- infected mice treated with DON (FIG. 3H). DON treatment of /¾>A-infected mice resulted in significant decreases in the percent of CD8+ T cells that were CD107"1" in both the spleens and brains (FIG. 31). The percent of GAP50-tetramer-binding CD8+ T cells that were CD107"1" also decreased significantly in the brains of /¾>A-infected mice (FIG. 3J). Thus, while the late-stage treatment of DON does not block the expansion of the /¾>A-specific CD8+ T cells, it does seem to block their effector function as measured by degranulation. DON treatment reverses /¾A-induced metabolic changes in the brain
The ability of DON to rapidly reverse ECM at such a late stage of disease led to studies to determine whether in addition to inhibiting immune-mediated pathology, DON might also be affecting pathology induced by altered brain metabolism. To investigate this possibility, metabolites in the brain, liver and serum were profiled from five groups of mice that differed in their infection, treatment and/or clinical status (Table 1). Principal component analysis of all detected metabolites revealed distinct clustering of samples according to infection status in all tissues (FIGS. 4A-4C). Notably, it was observed that infected, DON-treated mice with low clinical scores (<6) clustered with uninfected mice for metabolites in the brain (FIG. 4A). In contrast, when the effect of DON on systemic metabolism was examined, as determined by serum metabolites or the effect of DON on liver metabolism, this correlation did not hold (FIGS. 4B-4C) suggesting that DON treatment in ECM results in specific effects on brain metabolites.
Table 1: Infection and treatment groups for metabolomics studies
Figure imgf000024_0001
Since DON blocks the initial step in cellular glutaminolysis by inhibiting glutaminase
(Thangavelu et al., Sci Rep 4, 3827, 2014) (FIG.9), the metabolites of glutaminolysis were examined. It was observed that PbA infection alone affects these metabolites differently in the brain compared to the liver and serum (FIG. 9B). Notably, PbA infection increased Gin in the brain but decreased Gin in the serum. In /¾>A-infected mice with low clinical scores, treatment with DON significantly increased Gin in both the liver and the serum, as expected, but modestly decreased Gin in the brains relative to infected, untreated mice. DON treatment of infected mice that have the good clinical outcomes have Gin levels that are closer to the uninfected mice, which are lower than the infected, untreated mice. The same is true of Glu, except that the levels are higher than the infected, untreated mice.
Of the 225 brain metabolites that changed significantly in infected versus uninfected mice, 81 overlapped with the 89 significantly affected metabolites identified by comparing infected, DON-treated mice with low clinical scores to infected, untreated mice (FIG. 4D). Pathways significantly affected by PbA infection involved citrulline metabolism, the urea cycle or nitric oxide (NO) biosynthesis (aspartate, citrulline, ornithine, and urea) and were similar to pathways affected by DON treatment of /¾>A-infected mice (FIGS. 4E-4F). Strikingly, all 81 overlapping metabolites were metabolites that were reversed by DON treatment (FIGS. 5A-5C). Unsupervised hierarchal clustering analysis on these 81 brain metabolites accurately grouped the samples by infection, treatment, and clinical status, with 9 out of 10 /¾>A-infected, DON treated mice with low clinical scores (<6) clustering together and demonstrating remarkable metabolic similarities to uninfected mice. DON appears to reverse brain metabolism associated with disease acting through its immunomodulatory effects as well as potentially directly on brain metabolism. While these data do not identify the specific metabolites promoting disease, they do identify a set of metabolites which are specifically associated with ECM and are selectively reversed by treatment with DON.
Summary of Results
HCM is a deadly complication of P. falciparum malaria despite treatment with effective anti-malarial drugs. That is, even in the setting of effectively suppressing the replication of P. falciparum, once signs of neurologic disease have commenced, there is no effective adjunctive treatment for HCM and overall mortality remains high. As such, the identification of a treatment which can arrest and reverse disease in the late stages is urgently needed. It is disclosed herein that the Gin analog, DON, is an effective therapy for ECM even when treatment is first initiated after infected animals show neurological signs of disease. This clinical response was accompanied by the ability of DON to inhibit pathology as measured by decreases in BBB dysfunction, brain swelling and degranulation of parasite-specific CD8+ T cells that accumulated in the brain.
Furthermore, DON is able to reverse metabolic changes associated with the disease state.
Previously, DON has been shown to have anti-parasitic activity, albeit weak both in vitro and in vivo (Plaimas et al., Infect Genet Evol 20, 389-395, 2013; Queen et al., Antimicrob Agents Chemother 34, 1393-1398, 1990). The findings disclosed herein indicate that the anti-parasitic activity of DON is not playing a major role in its ability to arrest and reverse ECM. Indeed, DON had little effect on the parasite load in the brains of /¾>A-infected mice during the critical period of time when the BBB was restored and brain swelling decreased in DON-treated mice. Under continual treatment with DON, /¾>A-infected mice were able to control parasitemia, keeping it well under 2%. However, when DON treatment was stopped the parasitemias rose rapidly and mice died of severe anemia.
On the other hand, CD8+ effector T cells that release perforin have been shown to play a critical role in promoting the pathogenesis which constitutes ECM (Howland et al. , Semin
Immunopathol, 2015). Recently, it was observed that the mTOR inhibitor rapamycin protected infected mice from death due to ECM when administered within the first 4 days of infection (Gordon et al., mBio 6, e00725-00715, 2015). This protection was associated with a marked decrease in CD8+ T cells in the brain and it was hypothesized that rapamycin prevents the development of ECM in part by inhibiting the generation of CD8+ effector cells. CD8+ T cell activation results in a dramatic shift from oxidative metabolism to aerobic glycolysis and glutaminolysis necessary for T cell expansion and effector function (Maclver et αΙ., Αηηιι Rev Immunol 31, 259-283, 2013; O'Sullivan and Pearce, Trends Immunol 36, 71-80, 2015; Pollizzi and Powell, Nat Rev Immunol 14, 435-446, 2014). Both T cell cytokine production and proliferation are blocked by restricting the availability of extracellular Gin (Carr et al, J Immunol 185, 1037- 1044, 2010) or by treating T cells with DON (Wang et al, Immunity 35, 871-882, 2011).
Interestingly, unlike the previous studies employing rapamycin, DON treatment of /¾>A-infected mice did not prevent or decrease the accumulation of CD8+ T cells in the brain. Rather, the number of CD8+ T cells that degranulated, was decreased following DON treatment. These observations indicate that DON is not mediating its protective effect by preventing proliferation and generation of CD8+ effector cells, but rather by blocking CD8+ T cell effector function. This may account in part for the remarkably fast kinetics by which DON mediates its protective effect. Along these lines, unlike DON, rapamycin treatment was not effective when administered later in the disease. It is the ability of DON to promote survival at such a late stage of the disease that distinguishes the present findings from all other attempts to treat and reverse ECM.
While the studies disclosed herein were motivated by the ability of DON to inhibit immune function, the effect of DON treatment on infected brain metabolism was also investigated by interrogating the brain for known metabolites. Over 81 metabolic changes in the brains of the infected mice compared to uninfected mice were observed and these changes were reversed by DON. Such findings do not unequivocally reveal the mechanism by which DON is mediating its affects. The complexity of the fluctuations in Gin and Glu levels in the brain during infection and upon treatment most likely reflect the fact that DON not only inhibits glutaminase activity but also Gin transport and other glutamine-utilizing enzymes (Thangavelu et al, Sci Rep 4, 3827, 2014). However, these findings provide a metabolic profile, a biomarker for diseased brains in ECM.
In summary, the studies disclosed herein demonstrate for the first time the ability of pharmacologic intervention to reverse disease and promote survival in the late stages of ECM. Once neurologic symptoms are manifested, there is a high mortality rate in HCM. Therefore, the findings disclosed herein have relevant and immediate clinical implications. Furthermore, these studies reveal a selective metabolic signature for ECM and the subsequent reversal of diseases.
In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. A method of treating cerebral edema in a subject, comprising:
selecting a subject with cerebral edema; and
administering to the subject a therapeutically effective amount of a glutamine antagonist, thereby treating cerebral edema in the subject.
2. The method of claim 1 , wherein the cerebral edema is caused by cerebral malaria, a traumatic brain injury or a hemorrhagic stroke.
3. A method of treating cerebral malaria in a subject, comprising:
selecting a subject with malaria who is exhibiting at least one neurological sign or symptom of cerebral malaria; and
administering to the subject a therapeutically effective amount of a glutamine antagonist, thereby treating cerebral malaria in the subject.
4. The method of claim 3, wherein the at least one neurological sign of cerebral malaria is selected from cerebral edema, loss of blood-brain barrier integrity, brain hemorrhage, infected red blood cells in the brain vasculature, coma, seizure and delirium.
5. The method of claim 3 or claim 4, comprising selecting a subject who has been diagnosed with cerebral malaria.
6. The method of any one of claims 3-5, further comprising administering to the subject an antimalarial agent.
7. The method of claim 6, wherein the antimalarial agent is selected from quinine, chloroquine, quinine sulfate, hydroxycholorquine, mefloquine, quinidine gluconate, doxycycline, tetracycline, clindamycin, mefloquine, atovaquone, artemether/lumefantrine,
pyrimethamine/sulfadoxine, artemisinin and artesunate.
8. A method of inhibiting degranulation of CD8+ T cells in the brain of a subject with malaria, comprising:
selecting a subject with cerebral malaria; and administering to the subject a therapeutically effective amount of a glutamine antagonist, thereby inhibiting degranulation of CD8+ T cells in the brain of the subject.
9. The method of any one of claims 1-8, wherein the glutamine antagonist is administered intraperitoneally or intravenously.
10. The method of any one of claims 1-9, wherein the glutamine antagonist is administered once a day.
11. The method of any one of claims 1-9, wherein the glutamine antagonist is administered once every other day.
12. The method of any one of claims 1-11, wherein the glutamine antagonist is 6-diazo- 5-oxo-L-norleucine, acivicin or azaserine.
13. The method of claim 12, wherein the glutamine antagonist is 6-diazo-5-oxo-L- norleucine.
14. The method of claim 13, wherein the 6-diazo-5-oxo-L-norleucine is administered to the subject at a dose of about 0.1 to about 5 mg/kg.
15. The method of claim 13, wherein the 6-diazo-5-oxo-L-norleucine is administered to the subject at a dose of about 1.3 mg/kg once per day.
16. The method of claim 13, wherein the 6-diazo-5-oxo-L-norleucine is administered to the subject at a dose of about 1.3 mg/kg once every other day.
17. A composition comprising 6-diazo-5-oxo-L-norleucine and an antimalarial agent for use in treating cerebral malaria.
PCT/US2016/036996 2015-06-12 2016-06-10 Glutamine antagonists for use in treating cerebral edema and cerebral malaria Ceased WO2016201307A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562175000P 2015-06-12 2015-06-12
US62/175,000 2015-06-12

Publications (2)

Publication Number Publication Date
WO2016201307A1 true WO2016201307A1 (en) 2016-12-15
WO2016201307A8 WO2016201307A8 (en) 2017-01-26

Family

ID=56204007

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/036996 Ceased WO2016201307A1 (en) 2015-06-12 2016-06-10 Glutamine antagonists for use in treating cerebral edema and cerebral malaria

Country Status (1)

Country Link
WO (1) WO2016201307A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992007562A1 (en) * 1990-10-29 1992-05-14 The Children's Medical Center Corporation Controlling glutamine/glutamate related neuronal injury
WO2001080809A2 (en) * 2000-04-27 2001-11-01 Anders Hofer Medicament for the treatment of diseases caused by parasitic protozoa
WO2003063857A1 (en) * 2002-01-31 2003-08-07 Mso Pharma Llc A novel dosage form of l-methionine s-sulfoximine
WO2013158628A1 (en) * 2012-04-16 2013-10-24 New York University Modulation of angiotensin ii peceptors for the prevention and treatment of cerebral malaria

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992007562A1 (en) * 1990-10-29 1992-05-14 The Children's Medical Center Corporation Controlling glutamine/glutamate related neuronal injury
WO2001080809A2 (en) * 2000-04-27 2001-11-01 Anders Hofer Medicament for the treatment of diseases caused by parasitic protozoa
WO2003063857A1 (en) * 2002-01-31 2003-08-07 Mso Pharma Llc A novel dosage form of l-methionine s-sulfoximine
WO2013158628A1 (en) * 2012-04-16 2013-10-24 New York University Modulation of angiotensin ii peceptors for the prevention and treatment of cerebral malaria

Non-Patent Citations (63)

* Cited by examiner, † Cited by third party
Title
"Communicable Diseases Cluster", TRANS R SOC TROP MED HYG, vol. 94, no. 1, 2000, pages 1 - 90
"Molecular Biology and Biotechnology: a Comprehensive Desk Reference", 1995, VCH PUBLISHERS, INC.
"The Encyclopedia of Molecular Biology", 1994, BLACKWELL SCIENCE LTD.
A.S. MIRANDA ET AL: "Increased levels of glutamate in the central nervous system are associated with behavioral symptoms in experimental malaria", BRAZILIAN JOURNAL OF MEDICAL AND BIOLOGICAL RESEARCH, vol. 43, no. 12, 1 December 2010 (2010-12-01), pages 1173 - 1177, XP055296312, DOI: 10.1590/S0100-879X2010007500130 *
ALBRECHT; NORENBERG, HEPATOLOGY, vol. 44, 2006, pages 788 - 794
BAPTISTA ET AL., INFECT IMMUN, vol. 78, 2010, pages 4033 - 4039
BELNOUE ET AL., J IMMUNOL, vol. 169, 2002, pages 6369 - 6375
BENJAMIN LEWIN: "Genes V", 1994, OXFORD UNIVERSITY PRESS
CARR ET AL., J IMMUNOL, vol. 185, 2010, pages 1037 - 1044
CARR, J IMMUNOL, vol. 185, 2010, pages 1037 - 1044
CHEN ET AL., GLIA, vol. 60, 2012, pages 487 - 501
CLARK ET AL., MALAR J, vol. 2, 2003, pages 6
DOROVINI-ZIS, AM J PATHOL, vol. 178, 2011, pages 2146 - 2158
E.W. MARTIN: "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING CO.
EMILE B. GORDON ET AL: "Targeting glutamine metabolism rescues mice from late-stage cerebral malaria", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 112, no. 42, 5 October 2015 (2015-10-05), US, pages 13075 - 13080, XP055296141, ISSN: 0027-8424, DOI: 10.1073/pnas.1516544112 *
ENGWERDA, CURR TOP MICROBIOL IMMUNOL, vol. 297, 2005, pages 103 - 143
GORDON ET AL., MBIO, vol. 6, 2015, pages E00725 - 00715
GRAU ET AL., J INFECT DIS, vol. 187, 2003, pages 461 - 466
GRAU; CRAIG, FUTURE MICROBIOL, vol. 7, 2012, pages 291 - 302
HALUSZCZAK ET AL., J EXP MED, vol. 206, 2009, pages 435 - 448
HANSEN ET AL., J IMMUNOL, vol. 178, 2007, pages 5779 - 5788
HOWLAND ET AL., EMBO MOL MED, vol. 5, 2013, pages 984 - 999
HOWLAND ET AL., SEMIN IMMUNOPATHOL, 2015
JAYAKUMAR A R ET AL: "Glutamine in the mechanism of ammonia-induced astrocyte swelling", NEUROCHEMISTRY INTERNATIONAL, PERGAMON PRESS, OXFORD, GB, vol. 48, no. 6-7, 1 May 2006 (2006-05-01), pages 623 - 628, XP027957818, ISSN: 0197-0186, [retrieved on 20060501] *
KIM, NATURE, vol. 457, 2009, pages 191 - 195
KITIPORN PLAIMAS ET AL: "Computational and experimental analysis identified 6-diazo-5-oxonorleucine as a potential agent for treating infection by Plasmodium falciparum", INFECTION, GENETICS AND EVOLUTION, vol. 20, 1 December 2013 (2013-12-01), NL, pages 389 - 395, XP055296294, ISSN: 1567-1348, DOI: 10.1016/j.meegid.2013.09.019 *
MACIVER ET AL., ANNU REV IMMUNOL, vol. 31, 2013, pages 259 - 283
MACLVER ET AL., ANNU REV IMMUNOL, vol. 31, 2013, pages 259 - 283
MALLERET ET AL., SCI REP, vol. 1, 2011, pages 118
MCQUILLAN ET AL., INT J PARASITOL, vol. 41, 2011, pages 155 - 163
MIRANDA ET AL., BRAZ J MED BIOL RES, vol. 43, 2010, pages 1173 - 1177
MOLYNEUX ET AL., Q J MED, vol. 71, 1989, pages 441 - 459
NACER ET AL., PLOS PATHOG, vol. 8, 2012, pages E1002982
NAG, METHODS MOL MED, vol. 89, 2003, pages 133 - 144
NAKAYA, IMMUNITY, vol. 40, 2014, pages 692 - 705
NEWTON ET AL., ARCH DIS CHILD, vol. 70, 1994, pages 281 - 287
NEWTON ET AL., LANCET, vol. 337, 1991, pages 573 - 576
NITCHEU ET AL., J IMMUNOL, vol. 170, 2003, pages 2221 - 2228
NORENBERG ET AL., J BIOENERG BIOMEMBR, vol. 36, 2004, pages 303 - 307
O'SULLIVAN; PEARCE, TRENDS IMMUNOL, vol. 36, 2015, pages 71 - 80
PENET ET AL., J NEUROSCI, vol. 25, 2005, pages 7352 - 7358
PLAIMAS ET AL., INFECT GENET E, vol. 20, 2013, pages 389 - 395
POLLIZZI; POWELL, NAT REV IMMUNOL, vol. 14, 2014, pages 435 - 446
POTCHEN ET AL., AM JNEURORADIOL, vol. 33, 2012, pages 1740 - 1746
PROMENEUR ET AL., PROC NATL ACAD SCI USA, vol. 110, 2013, pages 1035 - 1040
QUEEN ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 34, 1990, pages 1393 - 1398
SARAH CRUNKHORN: "Infectious disease: Glutamine analogue reverses cerebral malaria", NATURE REVIEWS. DRUG DISCOVERY, vol. 14, no. 12, 20 November 2015 (2015-11-20), GB, pages 820 - 820, XP055296142, ISSN: 1474-1776, DOI: 10.1038/nrd4786 *
SEYDEL ET AL., N ENGL J MED, vol. 372, 2015, pages 1126 - 1137
SHIKANI ET AL., AM J PATHOL, vol. 181, 2012, pages 1484 - 1492
SHIN ET AL., NAT GENET, vol. 46, 2014, pages 543 - 550
SNOW ET AL., NATURE, vol. 434, 2005, pages 214 - 217
STOREY; TIBSHIRANI, PROC NATL ACAD SCI USA, vol. 100, 2003, pages 9440 - 9445
TAKEUCHI, EXP NEUROL, vol. 214, 2008, pages 144 - 146
TAYLOR ET AL., NAT MED, vol. 10, 2004, pages 143 - 145
THANGAVELU ET AL., SCI REP, vol. 4, 2014, pages 3827
WAISBERG ET AL., PLOS ONE, vol. 7, 2012, pages E29493
WALKER ET AL., TRANS R SOC TROP MED HYG, vol. 86, 1992, pages 491 - 493
WALLER ET AL., TRANS R SOC TROP MED HYG, vol. 85, 1991, pages 362 - 364
WANG ET AL., IMMUNITY, vol. 35, 2011, pages 871 - 882
WANG, IMMUNITY, vol. 35, 2011, pages 871 - 882
WARHURST D C ET AL: "The effect of cytotoxic agents on autophagic vacuole formation in chloroquine-treated malaria parasites (Plasmodium berghei)", LIFE SCIENCES, PERGAMON PRESS, OXFORD, GB, vol. 10, no. 13, 8 July 1971 (1971-07-08), pages 761 - 771, XP023722468, ISSN: 0024-3205, [retrieved on 19710708], DOI: 10.1016/0024-3205(71)90208-6 *
YEN, PLOS ONE, vol. 8, 2013, pages E68595
YUZEFPOLSKIY ET AL., CELL MOL IMMUNOL, 2014

Also Published As

Publication number Publication date
WO2016201307A8 (en) 2017-01-26

Similar Documents

Publication Publication Date Title
Qari et al. Reduction of painful vaso-occlusive crisis of sickle cell anaemia by tinzaparin in a double-blind randomized trial
Grau et al. Cerebral malaria pathogenesis: revisiting parasite and host contributions
Waknine-Grinberg et al. Glucocorticosteroids in nano-sterically stabilized liposomes are efficacious for elimination of the acute symptoms of experimental cerebral malaria
Kordes et al. Caspase-1 activation of interleukin-1β (IL-1β) and IL-18 is dispensable for induction of experimental cerebral malaria
Pamplona et al. Cerebral malaria and the hemolysis/methemoglobin/heme hypothesis: shedding new light on an old disease
McQuillan et al. Coincident parasite and CD8 T cell sequestration is required for development of experimental cerebral malaria
Crowley et al. Synthetic oleanane triterpenoids enhance blood brain barrier integrity and improve survival in experimental cerebral malaria
Palomares-Alonso et al. Effect of dexamethasone on albendazole cysticidal activity in experimental cysticercosis by Taenia crassiceps in BALB/c mice: In vitro and in vivo evaluation
Thomas et al. MiR-451a and let-7i-5p loaded extracellular vesicles attenuate heme-induced inflammation in hiPSC-derived endothelial cells
Xu et al. Anti-nociceptive roles of the glia-specific metabolic inhibitor fluorocitrate in paclitaxel-evoked neuropathic pain
Orjuela-Sánchez et al. Transdermal glyceryl trinitrate as an effective adjunctive treatment with artemether for late-stage experimental cerebral malaria
Lv et al. Mannose inhibits Plasmodium parasite growth and cerebral malaria development via regulation of host immune responses
Cui et al. Reuterin promotes pyroptosis in hepatocellular cancer cells through mtDNA-mediated STING activation and caspase 8 expression
Nyariki et al. Coenzyme Q10 exhibits anti-inflammatory and immune-modulatory thereby decelerating the occurrence of experimental cerebral malaria
Garcia et al. Suppression of Plasmodium MIF-CD74 signaling protects against severe malaria
Spiteri et al. Clodronate is not protective in lethal viral encephalitis despite substantially reducing inflammatory monocyte infiltration in the CNS
Kim et al. NAD+ modulation of intestinal macrophages renders anti-inflammatory functionality and ameliorates gut inflammation
Bensalel et al. Exploring adjunctive therapies for cerebral malaria
Angstwurm et al. Tumour necrosis factor alpha induces only minor inflammatory changes in the central nervous system, but augments experimental meningitis
Wang et al. Intracerebroventricular administration of lupus serum induces microglia activation and leukocyte adhesion in the cerebromicrovasculature of mice
Wenisch et al. Effect of pentoxifylline on cytokine patterns in the therapy of complicated Plasmodium falciparum malaria.
Zheng et al. L-Arginine supplementation in mice enhances NO production in spleen cells and inhibits Plasmodium yoelii transmission in mosquitoes
Min-Oo et al. Cysteamine, the natural metabolite of pantetheinase, shows specific activity against Plasmodium
Wishart et al. Metabolic Programming Drives Protective and Inflammatory Monocyte Fates in Viral Encephalitis
Moradin et al. Cysteamine broadly improves the anti-plasmodial activity of artemisinins against murine blood stage and cerebral malaria

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16732127

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16732127

Country of ref document: EP

Kind code of ref document: A1