WO2016191293A1 - Prediction of hybrid vigor using circadian-regulated stress-responsive gene expression - Google Patents

Prediction of hybrid vigor using circadian-regulated stress-responsive gene expression Download PDF

Info

Publication number
WO2016191293A1
WO2016191293A1 PCT/US2016/033580 US2016033580W WO2016191293A1 WO 2016191293 A1 WO2016191293 A1 WO 2016191293A1 US 2016033580 W US2016033580 W US 2016033580W WO 2016191293 A1 WO2016191293 A1 WO 2016191293A1
Authority
WO
WIPO (PCT)
Prior art keywords
stress
plants
gene
responsive
expression level
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/033580
Other languages
French (fr)
Inventor
Z. Jeffrey Chen
Marisa MILLER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Texas System
University of Texas at Austin
Original Assignee
University of Texas System
University of Texas at Austin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Texas System, University of Texas at Austin filed Critical University of Texas System
Publication of WO2016191293A1 publication Critical patent/WO2016191293A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12Processes for modifying agronomic input traits, e.g. crop yield

Definitions

  • Hybrid plants and animals grow larger and more vigorously than their parents, a common phenomenon known as hybrid vigor or heterosis. Since Charles Darwin systematically described the phenomenon, heterosis has been widely applied in agriculture to dramatically improve the production of crops and farm animals. Heterosis in food crops often refers to grain yield, while biomass heterosis is commonly measured in other crops including vegetable and energy crops.
  • the molecular basis for heterosis remains elusive, and traditional dominance and overdominance genetic models cannot adequately explain heterosis in yeast and many crop plants.
  • the conventional technology uses phenotypes and DNA sequence polymorphism as selection criteria to make high-yield hybrids. The predictability resulting from this conventional technology is relatively low.
  • the present invention provides methods of producing a hybrid plant with increased biomass comprising the steps of: (a) detecting an expression level of a stress- responsive gene in a plurality of plants; (b) selecting a first parent plant having a first expression level of the stress-responsive gene from the plurality of plants; (c) selecting a second parent plant of a different genotype having a second expression level of the stress- responsive gene from the plurality of plants, wherein the second expression level is different from the first expression level; and (d) crossing the first parent plant with the second parent plant to produce a progeny plant.
  • the stress-responsive gene is an abiotic stress gene, for example LSR3, ERD11/GSTF6, COR47/RD17, LTI45/ERD10, COR413-TM1, ALDH7B4, ATGRP3, PIP2B, RD28, CAX1/RCI4, COR15A, PIP1B, LTI30, PIP1A, PIP1;4, COR78/RD29A, COR6.6/KIN2, RD22, ERD1, GRP8, GRP2, GRP7/CCR2, MDH, HSP70 family, CAT2, LOS2, ATAVP1, LTP4, TCH2, TCH4, mtHsc70-l, COR15B, MT1A, LTP3, LOS1, Salt-stress responsive protein, FIB, KIN1, or homologs thereof.
  • abiotic stress gene for example LSR3, ERD11/GSTF6, COR47/RD17, LTI45/ERD10, COR413-TM1, ALDH7B4, ATGRP3, P
  • the stress-responsive gene is a biotic stress gene, for example PR1, PR5, NUDT6, HSPR02, CNGC11, EBP/ERF72, PCC1, HR3/MLA10, CAX3, PAD4, WRKY70, PR2/BGL2, ACD6, NIA2, NHL3, Protease inhibitor, WAK1, WAK2, EP1, RVE2, BG3, LURP1, DMR6, SAG21, SUR2, ANK, or homologs thereof.
  • a biotic stress gene for example PR1, PR5, NUDT6, HSPR02, CNGC11, EBP/ERF72, PCC1, HR3/MLA10, CAX3, PAD4, WRKY70, PR2/BGL2, ACD6, NIA2, NHL3, Protease inhibitor, WAK1, WAK2, EP1, RVE2, BG3, LURP1, DMR6, SAG21, SUR2, ANK, or homologs thereof.
  • the expression level of the stress-responsive gene is detected at one or more time points selected from the group consisting of zeitgeber time (ZT) 0, ZT6, ZT12, ZT15, ZT18, and ZT21.
  • the ratio of the first gene expression level to the second gene expression level may be greater than 1.00, for example greater than 1.5, or greater than 3.0.
  • the expression levels of stress-responsive genes are detected using quantitative reverse transcription polymerase chain reaction (qRT-PCR).
  • the invention provides methods for producing hybrid progeny plants wherein the progeny plant exhibits and improved agronomic trait compared with the parent plants, for example biomass, yield, disease tolerance, insect resistance, pathogen resistance, plant growth and development, starch content, oil content, fatty acid content, protein content, fruit ripening, and stress resistance.
  • Embodiments of the present invention include methods for use with monocot plants or dicot plants, for example plants is selected from the group consisting of: Arabidopsis thaliana, maize (corn; Zea mays), soybean (Glycine max), cotton (Gossypium hirsutum; Gossypium sp.), peanut (Arachis hypogaea), barley (Hordeum vulgar e); oats (Avena sativa); orchard grass (Dactylis glomerata); rice (Oryza sativa, including indica and japonica varieties); sorghum (Sorghum bicolor); sugar cane (Saccharum sp.); tall fescue (Festuca arundinacea); turfgrass species (e.g.
  • oilseed crops may include soybean, canola, oil seed rape, oil palm, sunflower, olive, corn, cottonseed, peanut, flaxseed, safflower, and coconut.
  • the invention provides a progeny plant produced by the methods of the invention, or a plant part, plant cell, or seed of such a progeny plant.
  • the invention provides methods of producing a hybrid plant with increased biomass comprising the steps of: (a) detecting an expression level of at least two stress-responsive genes in a plurality of plants; (b) selecting a first parent plant having a first expression level of each of the stress-responsive genes from the population of plants; (c) selecting a second parent plant of a different genotype having a second expression level of each of the stress-responsive gene from the population of plants, wherein the first expression level for each gene is different than the second expression level for that gene; and (d) crossing the first parent plant with the second parent plant to produce a progeny plant.
  • a method for producing a hybrid plant with high-yield biomass comprising the following steps of measuring gene expression for a stress-responsive gene in a population of plants under both a stress condition and a non-stress condition. Based on the gene expression of the stress responsive gene, a normal gene expression profile is then determined for the population of plants.
  • the normal gene expression profile comprises a first expression level based on the expression of the stress-responsive gene during the non-stress condition and a second expression level based on the expression of the stress-responsive gene during the stress condition.
  • a first plant is then selected based on display of a lower expression of the stress-responsive gene during the non-stress condition as compared to the first expression level and the same or higher expression of the stress-responsive gene during the stress condition as compared to the second expression level. This first plant is then crossed with a second plant to produce the hybrid plant.
  • the second plant can be selected in a similar fashion as the first plant based on expression of a second stress-responsive gene.
  • gene expression for a second stress-responsive gene is measured in a second population of plants under both a second stress condition and a second non-stress condition.
  • a second normal gene expression profile based on the second population of plants collectively is then developed, wherein the second normal gene expression profile comprises a third expression level based on the expression of the second stress-responsive gene during the second non- stress condition and a fourth expression level based on the expression of the second stress- responsive gene during the second stress condition.
  • the second plant is selected based on its lower expression of the second stress-responsive gene during the second non- stress condition as compared to the third expression level and the same or higher expression of the second stress-responsive gene during the second stress condition as compared to the fourth expression level.
  • the first plant may display a higher expression of the second stress-responsive gene during the second non-stress condition as compared to the second plant and the same or lower expression of the second stress-responsive gene during the second stress condition as compared to the second plant.
  • the second plant may display a higher expression of the first stress-responsive gene during the first non- stress condition as compared to the first plant and the same or lower expression of the first stress-responsive gene during the first stress condition as compared to the first plant.
  • the first stress condition is abiotic and the second stress condition is biotic.
  • the first stress condition is biotic and the second stress condition is abiotic.
  • a hybrid plant is also provided.
  • the hybrid plant is derived from a first parent and a second parent, wherein the first parent displays a first expression level of a abiotic stress-responsive gene and a second expression level of a biotic stress-responsive gene, wherein the second parent displays a third expression level of the abiotic stress- responsive gene and a fourth expression level of the biotic stress-responsive gene, wherein the first expression level is higher than the third expression level, and wherein the second expression level is lower than the fourth expression level.
  • Fold-change Log2-transformed values from low to high, (e-j) Percentage of down- regulated differentially expressed genes that are biotic or abiotic stress-responsive genes at ZTO (e, f), ZT6 (g, h), and ZT15 (i, j) in reciprocal Fl hybrids ColXC24 (e, g, i) and C24XCol (f, h, j).
  • Figure 3 provides data to support circadian clock regulation of the rhythmic expression of ACD6 and COR78.
  • Figure 4 provides data to demonstrate Stress-responsive gene expression levels as predictors for heterosis and effects of cold stress and salicylic acid (SA) on the growth rate in hybrids and their parents, (a, b).
  • C24 (dashed-box) has higher ACD6 and lower COR78 expression levels than Col, Ler, and Ws (grey-boxes), (c, d, e) Biomass increase relative to MPV (Y-axis) in various hybrids was plotted against absolute values of the log2-fold expression level changes (X-axis) in different stress genes at three time points (ZTO, 9, 18). Scatter plots for ACD6 at ZT18 (c), COR78 at ZT9 (d), and COR47 at ZT9 (e). Regression lines were statistically significant for ACD6 at ZT18 (c), COR78 at ZT9 (d) and COR47 at ZT9 (e).
  • Figure 5 provides data demonstrating the effects of knockdown or overexpression of abiotic and biotic genes on biomass.
  • (b) Rosettes of 3 week-old plants in Fl(C24xWs) and its parents C24 and Ws. Scale bars 1 cm for all images.
  • X-axis positions relative to the transcribed region.
  • Figure 7 provides a proposed model for altered stress-responsive gene expression in the promotion of growth vigor in Fl hybrids
  • Natural variation of circadian rhythms and stress responses is associated with the adaptation of each ecotype to local environments
  • Parent 1 and parent 2 that have adapted to different environments require high levels of gene expression in response to abiotic (parent 1) or biotic (parent 2) stress, which is partly mediated by circadian rhythms (clock symbols).
  • Parent 1 and parent 2 do not reach the full growth potential, probably because of the fitness cost in response to the stress in respective adaptive environments.
  • the expression of both biotic and abiotic stress-responsive genes is compromised, leading to increased levels of growth vigor.
  • FIG. 9 shows biotic and abiotic stress genes exhibiting altered expression in Fl hybrids, (a-h) Expression of PCC1 (a), HSPOR2 (b), PR1 (c), CPR5 (d), COR47 (e), COR15A (f), RD22 (g), and RD28 (h) in a 48-hour period starting from dawn.
  • R.E.L. relative expression levels to that of ACT7 in each sample. Values were averaged from three biological replicates (+ s.d.). Single and double asterisks indicate statistical significance levels at p ⁇ 0.05 and p ⁇ 0.01, respectively, using two-tailed student's t-test (compared to the mid-parent value, MPV). Arrows indicate down-regulation in hybrids compared to the MPV.
  • Figure 10 shows cis and trans effects on stress genes in Fl hybrids, (a) Number of genes with cis and trans effects in Fl hybrids, (b) Percentage of stress-responsive genes with cis or trans effects. Statistically significant enrichment of stress genes is indicated by asterisks, which are representative of a FDR adjusted p ⁇ 0.05 using the hypergeometric test (compared to the whole genome background), (c-h) Clustered heatmaps showing RPKM of trans -effected genes in parents and hybrid alleles, (i-p) RPKM values in Col, C24, and Col and C24 alleles in reciprocal hybrids for ACD6 (i), PR1Q), PR2/BGL2 (k), PAD4 (1), COR78 (m), COR15A (n), COR47 (o) and RD22 (p) at ZTO (i-1) or ZT6 (m-p).
  • Figure 13 shows responsive gene expression in higher and lower vigor Fl hybrids,
  • (e, f) Seedlings of 3-week-old plants (scale bars 1 cm for all images) in Fl(ColXWs) and its parents Col and Ws (e) and in (ColXL ⁇ ?r) and its parents Col and Ler (f).
  • Single and double asterisks indicate statistical significance levels at p ⁇ 0.05 and p ⁇ 0.01, respectively, using two-tailed student's t-test (compared to MPV). Upward and downward arrows indicate up- and down-regulation in the hybrids compared to the MPV.
  • Figure 14 shows an experimental scheme for stress treatments. All experiments were performed in a 16-hour light/8-hour dark regime. The white box represents light and the black box represents dark,
  • Figure 15 shows performance and stress-responsive gene expression in Fl(ColXC24) hybrids and their parents (Col and C24).
  • (a-d) Relative expression ratios (R.E.R.) of COR78 (a, b) and COR15A (c, d) between treated and untreated samples across 5 time points after the cold-treatment at ZTO (a, c) or ZT15 (b, d).
  • Relative expression ratios (R.E.R.) of COR78 (k), COR15A (1), ACD6 (m), and PR1 (n) between treated and control samples across 3 time points after 15 days of stress treatment. Dashed lines indicate no expression change between treated and untreated samples. Expression values are averaged from three biological replicates (+ s.d.). Asterisks indicate statistical significance levels at p ⁇ 0.05 using two-tailed student's t-test, compared to the mid-parent value (MPV). Values were averaged from three biological replicates (+ s.d.).
  • Hybrid plants exhibit enhanced agronomic traits due to the varied genetic contribution of their parents, a phenomenon known as heterosis or outbreeding enhancement. While useful hybrids have been identified through extensive breeding and evaluation of the resulting phenotypes, this process is costly and time-consuming. Efforts to develop methods of selecting parents for producing hybrid plants with beneficial traits have been hampered by an incomplete understanding of the factors contributing to heterosis. A need therefore remains for improved methods of producing hybrid plants with useful phenotypes. In the absence of improved methods for selecting parent plants for hybrid breeding programs, it may not be practical to attempt to produce certain new hybrid crop plants.
  • the present invention provides previously unknown methods for producing hybrid plants with significantly improved agronomic traits.
  • methods are provided for selecting parent plants for crossing based on expression levels of stress- responsive genes, which result in hybrid plants exhibiting enhanced traits due to heterosis.
  • the methods of the present invention can therefore be used to accurately predict advantageous traits in hybrid plants, including increased biomass or increased yield.
  • the present invention provides methods of producing hybrid plants with improved agronomic traits comprising selecting parent plants based on expression levels of stress- responsive or photosynthetic genes.
  • the invention provides methods comprising detecting expression levels of one or more stress-responsive genes in a plurality of plants, and selecting parent plants for a cross which express the stress-responsive genes at different levels. For example, a first parent plant may express high levels of a stress- responsive gene, while a second parent plant expresses low levels of the stress-responsive gene. In another example, a first parent plant may express low levels of a stress-responsive gene, while a second parent plant expresses high levels of the stress-responsive gene.
  • the plurality of plants from which the parent plants are selected according to the methods of the present invention may be from the same species of plant, and may comprise different genotypes.
  • parent plants for a hybrid cross may be selected by determining a difference in expression level of a particular gene between prospective parent plants.
  • Genes useful in selecting parent plants for crossing according to the invention include any stress-responsive gene.
  • parent plants may be selected by detecting a difference in expression levels of abiotic stress genes, biotic stress genes, or photosynthetic genes. Gene expression levels may be detected and compared between prospective parent plants at any timepoint, including zeitgeber time (ZT) 0, ZT6, ZT12, ZT15, ZT18, and ZT21.
  • parent plants having ratios of stress-responsive gene expression of 1.00, 1.50, or 2.00 are predictive of improved agronomic traits in progeny plants.
  • the present invention further provides methods of producing hybrid plants having beneficial traits by detecting and comparing expression levels of one or more stress- responsive genes to select parent plants for a cross. A difference in expression levels of one or more stress-responsive genes can be used to select parent plants for a cross resulting in hybrid plants with advantageous traits.
  • the methods of the present invention may comprise detecting expression levels of any stress-responsive gene, including biotic stress genes and abiotic stress genes.
  • biotic stress genes include PRl (AT2G14610), PR5 (AT1G75040), NUDT6 (AT2G04450), HSPR02 (AT2G40000), CNGC11 (AT2G46440), EBP/ERF72 (AT3G16770), PCC1 (AT3G22231), HR3/MLA10 (AT3G50470), CAX3 (AT3G51860), PAD4 (AT3G52430), WRKY70 (AT3G56400), PR2/BGL2 (AT3G57260), ACD6 (AT4G14400), NIA2 (AT1G37130), NHL3 (AT5G06320), Protease inhibitor (AT5G55450), WAK1 (AT1G21250), WAK2 (AT1G21270), EP1 (AT4G23170), RVE2 (AT5G37260),
  • PRl AT2G
  • Non-limiting examples of abiotic stress genes useful in the present invention include LSR3 (AT1G01470), ERD11/GSTF6 (AT1G02930), COR47/RD17 (AT1G20440), LTI45/ERD10 (AT1G20450), COR413-TM1 (AT1G29395), ALDH7B4 (AT1G54100), ATGRP3 (AT2G05520), PIP2B (AT2G37170), RD28 (AT2G37180), CAX1/RCI4 (AT2G38170), COR15A (AT2G42540), PIP1B (AT2G45960), LTI30 (AT3G50970), PIP1A (AT3G61430), PIP1;4 (AT4G00430), COR78/RD29A (AT5G52310), COR6.6/KIN2 (AT5G15970), RD22 (AT5G25610), ERD1 (AT5G51070), GRP8 (AT
  • Hybrid plants produced by the novel methods of the present invention therefore exhibit enhanced agronomic traits including modified biomass, modified yield, improved disease tolerance, improved insect resistance, improved pathogen resistance, modified plant growth and development, modified starch content, modified oil content, modified fatty acid content, modified protein content, modified fruit ripening, and improved stress resistance.
  • the methods provided by the invention may be used to produce hybrid plants exhibiting advantageous traits resulting from heterosis in monocotyledonous or dicotyledonous plants including, but not limited to, Arabidopsis thaliana, maize (corn; Zea mays), soybean (Glycine max), cotton (Gossypium hirsutum; Gossypium sp.), peanut (Arachis hypogaea), barley (Hordeum vulgare); oats (Avena sativa); orchard grass (Dactylis glomerata); rice (Oryza sativa, including indica and japonica varieties); sorghum (Sorghum bicolor); sugar cane (Saccharum sp.); tall fescue (Festuca arundinacea); turfgrass species (e.g.
  • oilseed crops may include soybean, canola, oil seed rape, oil palm, sunflower, olive, corn, cottonseed, peanut, flaxseed, safflower, and coconut, among others.
  • Expression levels of stress-responsive genes may be detected by various methods known to one of skill in the art. For example, expression levels of a gene in a tissue sample may be detected by isolating mRNA from the sample and quantitating mRNA transcripts by reverse transcription polymerase chain reaction (RT-PCR) using primers directed to the mRNA to be detected.
  • RT-PCR reverse transcription polymerase chain reaction
  • RNA-sequencing or microarray technologies can be used to identify genome-wide gene expression changes, including all stress-responsive genes, at different times of day. The data can be analyzed to find optimal times of day to detect expression level differences in stress-responsive genes among parental strains.
  • Detection of stress-response gene expression according to methods of the present invention may be carried out at any time of day.
  • stress-responsive gene expression levels may be detected in ACD6 at ZT18, in COR78 at ZT9, and in COR47 at ZT9.
  • the optimal time of day in which the stress-responsive gene expression differences between the parents are predictive of hybrid performance which corresponds to the peak of gene expression for a given gene in the diurnal cycle. Therefore, to find optimal times of day for hybrid performance prediction, gene expression of stress-responsive genes should be assayed for at least 24 hours to identify the peak times of gene expression in the desired parental types.
  • the present invention provides methods for identifying parent plants which can be crossed to produce a hybrid plant having a particular agronomic trait.
  • Hybrid plants resulting from a cross according to the invention may exhibit an improved trait compared with either of the parent plants, or compared with the mid-parent value (MPV) for a trait of interest.
  • the improved trait is increase biomass or increased yield.
  • One application of the present methods is therefore in breeding programs aimed at increasing the presence or degree of favorable traits in plants. This can be accomplished through a single round of breeding, or by repeated crossing of progeny plants with other suitable parent plants identified using the methods of the invention. Multiple rounds of crossing, including backcrossing, using the selection methods provided herein are contemplated by the invention.
  • Plant materials include the following Arabidopsis thaliana ecotypes, which were used to generate Fl hybrids; C24, Columbia (Col), Cvi-0 (CS22614), Est-1 (CS22629), Ler, Nd-1 (CS22619), Oy-0 (CS22658), Sorbo (CS22653), Wei-0 (CS22622), and Ws. Crossing was carried out as previously described (Miller, et al. G3 (Bethesda) 2:505-513, 2012).
  • acd6- 1 hyperactive mutant (Max Planck Institute for Developmental Biology, Tubingen, Germany), and ccal-11 (CS9378), lhy21 (CS9379), and ccal-l llhy21 (CS9380) T-DNA insertion mutants in the Ws background (Arabidopsis Biological Resource Center) were also used. All plants were grown under a 16/8-h light/dark cycle with temperatures of 22 °C (light) and 20°C (dark) on soil, and rosette leaves from ⁇ 3 week old plants before flowering were collected for RNA analysis, unless otherwise noted. For qRT-PCR validation, plants were grown in three biological replicates, and leaves were harvested every three hours for two diurnal cycles (48 hours). For plant transformation, 4-5 week old plants were used for Agrobacterium tumefaciens- mediated transformation through floral dipping.
  • Biomass was measured after drying rosettes before bolting at 80°C for 24 hours as previously described (Miller, et al. G3 (Bethesda) 2:505-513, 2012).
  • Trypan blue staining solution was prepared by adding 20 mg of Trypan blue to 40 ml of lactophenol solution for a final concentration of 0.5 mg rnl -1 . Leaves were incubated for 3 h in a sufficient amount of solution to immerse the tissue. The tissue was then cleared in a sufficient amount of chloral hydrate solution to cover the tissue (25 g of chloral hydrate per 10 ml water) for 30 min.
  • mRNA-seq reads from 12 libraries (Col, C24, ColxC24 and C24xCol at three time points) were mapped to the TAIR9 genome and cDNA sequence using BFAST (Blat-like Fast Accurate Search Tool, publically available on the internet).
  • Transcript levels were quantified by counting reads per kilobase per million mapped reads (RPKM).
  • RPKM kilobase per million mapped reads
  • SNP data for C24 was obtained from the Arabidopsis 1001 Genomes database (available on the internet). Reads mapped to regions containing SNPs were extracted and then assigned to reads from Col or C24 according to the SNP database. The total RPKM value in hybrids was split to Col and C24 alleles based on the ratio between the number of reads mapped to either Col and C24. To calculate cis and trans effects, a previously published strategy was employed (Shi, et al. Nat. Commun. 3, 950, 2012).
  • Integrative Genomics Viewer was used to display publically available mRNA- seq, sRNA-seq, and methylation data (Shen, et al. Plant Cell 24, 875-892, 2012) (GSE34658). Genes were identified as having a higher methylation level than the MPV if average methylation differences were 0.1 or greater for CG and CHG contexts and 0.05 or greater for CHH contexts, similar to the criteria used by Shen, et al.
  • genes present in QTL intervals were tested for significant overlap with DEGs using the GeneSect Tool, which implements a non-parametric randomization test which can determine whether the overlap between two gene lists is higher or lower than expected by chance, from the Virtual Plant website, as well as the hypergeometric test in R.
  • PCC1-F 19 ACAAATCTCACATCCTCACTCC PCC1 (At3g22231) qPCR
  • Plasmid constructs [0055] For luciferase reporter constructs, genomic DNA from Col, C24, and Ws was used to amplify ACD6 and COR78 promoter regions. SNPs between Col and C24 promoter and coding regions were identified using Polymorph (Ossowski, et al , publically available on the internet). The amplified fragments were cloned into pGEM-T vector (Promega) for sequence verification. The Promoter :LUC plasmid constructs were generated by inserting luciferase gene between the restriction enzyme sites Ncol and BamHI in the pFAMIR plasmid (Yadegari, University of Arizona).
  • the transcribed region of COR78 from Col or C24 was cloned into the pF35SE vector (A vector for 35S- driven gene expression, Yadegari, University of Arizona) between RsrII and Aatll restriction sites.
  • Artificial miRNAs were designed using the WMD3 web app (Ossowski and Fitz, publically available on the internet) against a conserved region in Col and C24 and then amplified using the pRS300 vector as a template. The amplified fragments were cloned into pGEM-T vector (Promega) for sequence verification.
  • the artificial miRNAs were then cloned into the pF35SE vector between RsrII and Aatll restriction sites for amiACD6 and between Xmal and Aatll restriction sites for amiCOR78. All constructs were individually cloned into Agrobacterium strain GV3101 for plant transformation and seeds were screened on 1 % (w/v) agar with Murashige and Skoog (MS) media containing 7.5 mg/L phosphinothricin. The primer sequences are listed in Table 1.
  • Plants containing either ACD6:LUC or COR78:LUC constructs were analyzed using a Packard TopCount luminometer as previously described. Seeds were sterilized with bleach and 75% ethanol and plated on 1 % (w/v) agar with MS media containing 7.5 mg/L phosphinothricin. Seeds were stratified 2 days in the dark at 4°C and then transferred into 16- h light and 8-h dark cycles for 7 days, and then transferred to MS containing no selection for 3 days. Seedlings were transferred to white microtiter plates (Nunc, Denmark) containing agar MS medium plus 30g sucrose/L and 30 iL of 0.5 mM luciferin (Gold Biotechnology).
  • Microtiter plates were covered with clear plastic MicroAmp sealing film (Applied Biosystems, Foster City, CA) in which holes were placed above each well for seedling gas exchange.
  • Applied Biosystems Foster City, CA
  • luciferin One day after addition of luciferin, plates were moved to the TopCount and interleaved with two clear plates to allow light diffusion to the seedlings. All luciferase data were analyzed using the Biological Rhythm Analysis Software System (BRASS, publically available on the internet). All period estimates were performed on rhythms from 24-120 hours using fast Fourier Transform-nonlinear least squares (FFT-NLLS) analysis.
  • FFT-NLLS fast Fourier Transform-nonlinear least squares
  • Fig. 14 The scheme for stress experiments is shown in Fig. 14.
  • 6 two week old seedlings (3 seedlings were used per replicate) were removed from agar media and were placed into 5 ml culture tubes containing room- temperature liquid MS media with 3% sucrose 24 hours before cold- treatment.
  • Cold- treatment was performed by placing the tubes in ice or leaving at 22°C for the control. After 60 minutes, tubes containing seedlings were placed back into 22°C and then whole seedlings (excluding roots) were snap frozen in liquid nitrogen at the ZT times listed in Fig. 14.
  • Example 1 Diurnal repression of stress-responsive genes in hybrids
  • Biotic stress-responsive genes such as ACCELERATED CELL DEATH6 (ACD6, At4gl4400), PATHOGEN AND ORCADIAN CONTROLLED 1 (PCC1, At3g22231), and HOMOLOG of SUGAR BEET HSl PRO-2 (HSPR02, At2g40000) were primarily repressed to below MPV levels between ZTO and ZT6 (Fig. 2a and Fig. 9a,b), and PATHOGENESIS-RELATED GENES 1 (PR1, At2gl4610) and PR5 (Atlg75040) were repressed at all times (Fig. 9c,d).
  • cold stress-responsive genes including COLD -REGULATED78 (COR78, At5g52310), COR47 (Atlg20440), COR15A (At2g42540), RESPONSIVE-TO-DESICCATION22 (RD22, At5g25610), and RD28 (At2g37180), were repressed in the middle and later parts of the day (Fig. 2b and Fig. 9e-h).
  • COLD -REGULATED78 COR78, At5g52310
  • COR47 Alg20440
  • COR15A At2g42540
  • RESPONSIVE-TO-DESICCATION22 RESPONSIVE-TO-DESICCATION22
  • RD28 At2g37180
  • irans-regulated genes of either parental origin could be repressed to the low-parent level or lower (Fig.10c -h), including several known biotic (Fig. lOi-1) and abiotic (Fig. lOm-p) stress- responsive genes.
  • Fig. lOi-1 several known biotic
  • Fig. lOm-p abiotic stress- responsive genes.
  • the genome-wide data suggest a role for trans-acting factors in the diurnal repression of stress-responsive genes in these hybrids.
  • the circadian clock regulators, CCA1 and LATE ELONGATED HYPOCOTYL (LHY, Atlg01060) were repressed in the middle of the day and upregulated around dawn (Fig. l la,b), and their feedback regulator TOC1 (At5g61380) showed the opposite expression changes (Fig.
  • ACD6(C24):LUC in C24 was expressed at higher levels than ACD6(Col):LUC in Col (Fig. 2c).
  • COR78(Col):LUC in Col was expressed at higher levels than COR78(C24):LUC in C24 (Fig. 2e).
  • the expression differences between the ecotypes were amplified when they were expressed in reciprocal combinations.
  • ACD6(Col):LUC expression amplitudes in C24 were 10- 15 -fold higher than ACD6(C24):LUC levels in Col (Fig. 2d).
  • COR78(C24):LUC amplitudes in Col were 7-8 fold higher than COR78(Col):LUC in C24 (Fig. 2f).
  • genetic backgrounds could act as transacting factors to mediate rhythmic expression peaks of these stress-responsive genes, probably through altered binding of regulatory factors such as the clock proteins or other upstream regulators to the promoters between the ecotypes (Table 3).
  • SNP data was obtained from the Arabidopsis 1001 genomes database (hitp:// " i001 genomes. org/).
  • Example 3 Stress-responsive expression as a predictor for heterosis
  • Fig. 4a,b, Table 4, and Fig. 12a-d The diurnal regulation of stress-responsive genes could provide a basis for natural variation among diverse ecotypes tested (Fig. 4a,b, Table 4, and Fig. 12a-d), which is consistent with their wide-geographical distributions.
  • abiotic genes were poorly expressed (Fig. 4a,b and Fig. 12c,d), but biotic genes were highly expressed at ZT18, which correlated with higher SA levels and more necrotic lesions on mature leaves in C24 than in Col 15 (Fig. lc). This is because these ecotypes are adapted to warmer environments with relatively more pathogens 40.
  • the table shows the overlap between all DEGs in hybrids (982 total) and QTL regions for dry weight at day 15 (DW15) from Meyer et al 2010. QTL regions were identified in the RILs and verified in the ILs (See Supplementary Table 5 in Meyer et al 2010).
  • hybrids Under long-term stress (cold or SA) conditions (see Methods and Fig. 14), hybrids maintained higher relative growth rates (RGR) than their parents (Fig. 4f-i). After removal from stress conditions the RGR of hybrids accelerated more than that of the parents, consistent with increased protection from freezing damage during cold stress. As a result, hybrids accumulated more biomass than parents (Fig. 15i,j). Hybrids also showed higher than MPV induction of cold-responsive genes at certain times after two weeks growing in the cold, although this trend was less obvious after the long-term treatment with SA (Fig. 15k-n).
  • Hybrid necrosis as previously reported, was likely caused by the induction of stress-responsive genes. Indeed, expression of several stress-responsive genes including PR1, PR2, and PRS is elevated in these necrotic hybrids. However, the higher- vigor hybrids have a better-timed stress-response strategy whereby stress-responsive genes are generally repressed under non-stress conditions and selectively induced at certain times under the stress, thus balancing the tradeoff between a rapid requirement for stress responses and long- term maintenance of growth vigor.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Methods for producing hybrid plants exhibiting heterosis are provided, including methods for selecting parent plants for a cross to produce hybrid progeny plant having advantageous properties such as increased biomass and increased yield. Plants, plant parts, plant cells, and seeds resulting from the methods are further provided.

Description

PREDICTION OF HYBRID VIGOR USING ORCADIAN-REGULATED
STRESS-RESPONSIVE GENE EXPRESSION
REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of United States Provisional Application 62/165,637, filed May 22, 2015, which is incorporated herein by reference in its entirety.
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under Grant Number ISO1238048 awarded by the National Science Foundation. The government has certain rights in the invention.
INCORPORATION OF SEQUENCE LISTING
[0003] A sequence listing contained in the file named "UTTA003WO_ST25.txt" which is 9.73 bytes (measured in MS-Windows®) and created on May 20, 2016, comprises 54 nucleotide sequences, is filed electronically herewith and incorporated by reference in its entirety.
BACKGROUND
[0004] Hybrid plants and animals, such as corn and domestic dogs, grow larger and more vigorously than their parents, a common phenomenon known as hybrid vigor or heterosis. Since Charles Darwin systematically described the phenomenon, heterosis has been widely applied in agriculture to dramatically improve the production of crops and farm animals. Heterosis in food crops often refers to grain yield, while biomass heterosis is commonly measured in other crops including vegetable and energy crops. However, the molecular basis for heterosis remains elusive, and traditional dominance and overdominance genetic models cannot adequately explain heterosis in yeast and many crop plants. To this end, the conventional technology uses phenotypes and DNA sequence polymorphism as selection criteria to make high-yield hybrids. The predictability resulting from this conventional technology is relatively low.
SUMMARY
[0005] In one aspect, the present invention provides methods of producing a hybrid plant with increased biomass comprising the steps of: (a) detecting an expression level of a stress- responsive gene in a plurality of plants; (b) selecting a first parent plant having a first expression level of the stress-responsive gene from the plurality of plants; (c) selecting a second parent plant of a different genotype having a second expression level of the stress- responsive gene from the plurality of plants, wherein the second expression level is different from the first expression level; and (d) crossing the first parent plant with the second parent plant to produce a progeny plant. In certain embodiments, the stress-responsive gene is an abiotic stress gene, for example LSR3, ERD11/GSTF6, COR47/RD17, LTI45/ERD10, COR413-TM1, ALDH7B4, ATGRP3, PIP2B, RD28, CAX1/RCI4, COR15A, PIP1B, LTI30, PIP1A, PIP1;4, COR78/RD29A, COR6.6/KIN2, RD22, ERD1, GRP8, GRP2, GRP7/CCR2, MDH, HSP70 family, CAT2, LOS2, ATAVP1, LTP4, TCH2, TCH4, mtHsc70-l, COR15B, MT1A, LTP3, LOS1, Salt-stress responsive protein, FIB, KIN1, or homologs thereof. In other embodiments, the stress-responsive gene is a biotic stress gene, for example PR1, PR5, NUDT6, HSPR02, CNGC11, EBP/ERF72, PCC1, HR3/MLA10, CAX3, PAD4, WRKY70, PR2/BGL2, ACD6, NIA2, NHL3, Protease inhibitor, WAK1, WAK2, EP1, RVE2, BG3, LURP1, DMR6, SAG21, SUR2, ANK, or homologs thereof.
[0006] In some embodiments of the invention, the expression level of the stress-responsive gene is detected at one or more time points selected from the group consisting of zeitgeber time (ZT) 0, ZT6, ZT12, ZT15, ZT18, and ZT21. The ratio of the first gene expression level to the second gene expression level may be greater than 1.00, for example greater than 1.5, or greater than 3.0. In further embodiments, the expression levels of stress-responsive genes are detected using quantitative reverse transcription polymerase chain reaction (qRT-PCR).
[0007] In further embodiments, the invention provides methods for producing hybrid progeny plants wherein the progeny plant exhibits and improved agronomic trait compared with the parent plants, for example biomass, yield, disease tolerance, insect resistance, pathogen resistance, plant growth and development, starch content, oil content, fatty acid content, protein content, fruit ripening, and stress resistance.
[0008] Embodiments of the present invention include methods for use with monocot plants or dicot plants, for example plants is selected from the group consisting of: Arabidopsis thaliana, maize (corn; Zea mays), soybean (Glycine max), cotton (Gossypium hirsutum; Gossypium sp.), peanut (Arachis hypogaea), barley (Hordeum vulgar e); oats (Avena sativa); orchard grass (Dactylis glomerata); rice (Oryza sativa, including indica and japonica varieties); sorghum (Sorghum bicolor); sugar cane (Saccharum sp.); tall fescue (Festuca arundinacea); turfgrass species (e.g. species: Agrostis stolonifera, Poa pratensis, Stenotaphrum secundatum); wheat (Triticum aestivum); alfalfa (Medicago sativa); members of the genus Brassica, including broccoli, cabbage, carrot, cauliflower, Chinese cabbage; cucumber, dry bean and other leguminous plants, eggplant, tobacco (Nicotiana sp.), fennel, garden beans, gourd, leek, lettuce, melon, okra, onion, pea, pepper, pumpkin, radish, spinach, squash, sweet corn, tomato, potato, watermelon, Miscanthus, ornamental plants, and other fruit, vegetable, tuber, oilseed, and root crops, wherein oilseed crops may include soybean, canola, oil seed rape, oil palm, sunflower, olive, corn, cottonseed, peanut, flaxseed, safflower, and coconut.
[0009] In another aspect, the invention provides a progeny plant produced by the methods of the invention, or a plant part, plant cell, or seed of such a progeny plant.
[0010] In further embodiments, the invention provides methods of producing a hybrid plant with increased biomass comprising the steps of: (a) detecting an expression level of at least two stress-responsive genes in a plurality of plants; (b) selecting a first parent plant having a first expression level of each of the stress-responsive genes from the population of plants; (c) selecting a second parent plant of a different genotype having a second expression level of each of the stress-responsive gene from the population of plants, wherein the first expression level for each gene is different than the second expression level for that gene; and (d) crossing the first parent plant with the second parent plant to produce a progeny plant.
[0011] The present disclosure provides methods of selecting parents for producing hybrids with high-yield biomass based on rhythmic stress-responsive gene expression. In one embodiment, a method for producing a hybrid plant with high-yield biomass comprising the following steps of measuring gene expression for a stress-responsive gene in a population of plants under both a stress condition and a non-stress condition. Based on the gene expression of the stress responsive gene, a normal gene expression profile is then determined for the population of plants. The normal gene expression profile comprises a first expression level based on the expression of the stress-responsive gene during the non-stress condition and a second expression level based on the expression of the stress-responsive gene during the stress condition. A first plant is then selected based on display of a lower expression of the stress-responsive gene during the non-stress condition as compared to the first expression level and the same or higher expression of the stress-responsive gene during the stress condition as compared to the second expression level. This first plant is then crossed with a second plant to produce the hybrid plant.
[0012] In another embodiment, the second plant can be selected in a similar fashion as the first plant based on expression of a second stress-responsive gene. In this embodiment, gene expression for a second stress-responsive gene is measured in a second population of plants under both a second stress condition and a second non-stress condition. A second normal gene expression profile based on the second population of plants collectively is then developed, wherein the second normal gene expression profile comprises a third expression level based on the expression of the second stress-responsive gene during the second non- stress condition and a fourth expression level based on the expression of the second stress- responsive gene during the second stress condition. Finally, the second plant is selected based on its lower expression of the second stress-responsive gene during the second non- stress condition as compared to the third expression level and the same or higher expression of the second stress-responsive gene during the second stress condition as compared to the fourth expression level. In this embodiment, the first plant may display a higher expression of the second stress-responsive gene during the second non-stress condition as compared to the second plant and the same or lower expression of the second stress-responsive gene during the second stress condition as compared to the second plant. Similarly, the second plant may display a higher expression of the first stress-responsive gene during the first non- stress condition as compared to the first plant and the same or lower expression of the first stress-responsive gene during the first stress condition as compared to the first plant.
[0013] In the above embodiments, the first stress condition is abiotic and the second stress condition is biotic. Alternatively, the first stress condition is biotic and the second stress condition is abiotic.
[0014] A hybrid plant is also provided. In one embodiment, the hybrid plant is derived from a first parent and a second parent, wherein the first parent displays a first expression level of a abiotic stress-responsive gene and a second expression level of a biotic stress-responsive gene, wherein the second parent displays a third expression level of the abiotic stress- responsive gene and a fourth expression level of the biotic stress-responsive gene, wherein the first expression level is higher than the third expression level, and wherein the second expression level is lower than the fourth expression level. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 provides a comparison of expression of many abiotic and biotic stress- responsive genes in reciprocal Fl hybrids relative to the parents (by convention, the female is listed first in a genetic cross), (a, c) Rosettes of 3-week-old plants (scale bars = 1 cm) (a) and the tenth leaf stained with Trypan blue (scale bars = 0.5 mm) (c). (b, d) Clustered heatmaps of RNA-seq data (Table 7) showing subsets of genes in biotic (b) and abiotic (d) stress (ZTO = dawn). Fold-change: Log2-transformed values from low to high, (e-j) Percentage of down- regulated differentially expressed genes that are biotic or abiotic stress-responsive genes at ZTO (e, f), ZT6 (g, h), and ZT15 (i, j) in reciprocal Fl hybrids ColXC24 (e, g, i) and C24XCol (f, h, j).
[0016] Figure 2 relates to the diurnal regulation of gene expression of ACD6 and COR78 in two ecotypes, Col and C24, and in hybrids (arrows), (a, b) Relative expression levels (R.E.L.) of ACD6 (a) and COR78 (b) every 3 hours in a 48-hour period (ZT 0 = dawn) (mean+s.d., values were averaged from three biological replicates). Single and double asterisks indicate statistical significance levels at p<0.05 and p<0.01 using two-tailed student' s t-test (compared to MPV), respectively, (c, d) Bioluminescent activities (counts per second in 1,000) of transgenic (T2) seedlings that expressed ACD6(Col):LUC in Col (dark gray) or ACD6(C24):LUC in C24 (light gray) (c) and ACD6(C24):LUC in Col (dark gray) or ACD6(Col):LUC in C24 (light gray) (d). (e, f) Bioluminescent activities of transgenic seedlings that expressed COR78(Col):LUC in Col (light gray) or COR78(C24):LUC in C24 (dark gray) (e) and COR78(Col):LUC in C24 (light gray) or COR78(C24):LUC in Col (dark gray) (f). Diurnal cycles of light (open) and dark (filled) and one of three replicate experiments (mean+s.e.m., n=16 individuals per transgenic line, 3 independent transgenic lines were examined) are shown.
[0017] Figure 3 provides data to support circadian clock regulation of the rhythmic expression of ACD6 and COR78. (a, b) Bioluminescent activities of pACD6(Ws):LUC in T3 transgenic seedlings that were treated with salicylic acid (SA) and the control (a) and of pCOR78(Ws):LUC in T3 transgenic seedlings that were treated with cold and the control (b). (c, d) Altered bioluminescent activities of pACD6(Ws):LUC in T3 transgenic seedlings in ccal-11, lhy21, ccal-11 lhy21, and Ws backgrounds, which were sprayed with water (control, c) or SA (d). (e, f) Altered bioluminescent activities of pCOR78(Ws):LUC in T3 transgenic seedlings in ccal-11, lhy21, ccal-11 lhy21, and Ws backgrounds, which were subjected to control (e) or cold (f) treatments. One of three replicate experiments (χΙΟ,ΟΟΟ counts per second+ s.e.m., n=16 individuals per transgenic line, 3 independent transgenic lines were examined) is shown.
[0018] Figure 4 provides data to demonstrate Stress-responsive gene expression levels as predictors for heterosis and effects of cold stress and salicylic acid (SA) on the growth rate in hybrids and their parents, (a, b). Relative expression levels (R.E.L.) of ACD6 (a) and COR78 (b) in 10 ecotypes at ZTO, ZT9, and ZT18. Values are averages from three biological replicates (+ s.d.). C24 (dashed-box) has higher ACD6 and lower COR78 expression levels than Col, Ler, and Ws (grey-boxes), (c, d, e) Biomass increase relative to MPV (Y-axis) in various hybrids was plotted against absolute values of the log2-fold expression level changes (X-axis) in different stress genes at three time points (ZTO, 9, 18). Scatter plots for ACD6 at ZT18 (c), COR78 at ZT9 (d), and COR47 at ZT9 (e). Regression lines were statistically significant for ACD6 at ZT18 (c), COR78 at ZT9 (d) and COR47 at ZT9 (e). Data used to perform regression analyses are shown in Table 4, and detailed results of the analysis were included in Table 8. (f, g) Rosette diameters of seedlings (n=15 plants averaged per replicate) that were grown at 22oC (f) or 4oC (g) for 17 days and transferred to grow in soil for another 8 days at 22oC. (h, i) Rosette diameters of seedlings (n=15 plants averaged per replicate) that were mock treated (h) or treated with salicylic acid twice (indicated by arrows) (SA) (i) and were transferred to soil for another 8 days. Values were averaged from three biological replicates (mean+ s.d.). Single and double asterisks indicate statistically significant levels of p<0.05 and p<0.01 using two-tailed student's t-test (compared to MPV), respectively.
[0019] Figure 5 provides data demonstrating the effects of knockdown or overexpression of abiotic and biotic genes on biomass. (a) Rosettes of 3-week-old plants in Fl(C24xLer) and its parents C24 and Ler. (b) Rosettes of 3 week-old plants in Fl(C24xWs) and its parents C24 and Ws. Scale bars = 1 cm for all images, (c-f) Biomass of rosettes from 3-week-old seedlings in high-vigor crosses C24XLer (c) and C24XWs (d) and low-vigor crosses ColXLer (e) and ColXWs (f). Values were averaged from three biological replicates (+ s.d.). (g) Biomass of Col and acd6-l hyperactive mutant, (h, i) Dry weight (mg) of transgenic amiRACD6 lines in Col (h) and in C24 (i). (j, k) Dry weight (mg) of transgenic amiRCOR78 lines in Col (j) and in C24 (k). (1, m) Dry weight (mg) of transgenic 35S:COR78 lines in Col (1) and in C24 (m). (n-p) Relative expression levels of COR78 expression in overexpression lines (n) and in amiRNA lines (o) and of ACD6 in amiRNA lines (p). Values were averaged from three biological replicates (+ s.d.). Single and double asterisks indicate statistical significance levels at p<0.05 and p<0.01 using two-tailed student's t-test, respectively, compared to the transgenic control (vector).
[0020] Figure 6 provides an analysis of DNA methylation in stress-related genes, (a, b) Sequence densities and distributions of CG, CHG, and CHH (H = A, T, or C) methylation, small RNA, and mRNA in the vicinity of PR1 (a) and ACD6 (b) genomic regions. Gray boxes are genes, and black boxes are transposons. Changes in CHG and CHH methylation between Fl reciprocal hybrids and their parents (Ler and C24) are boxed. Genomic coordinates are shown above each diagram, (c-e) Percentage (%, Y-axis) of CG (c), CHG (d), and CHH (e) methylation (H = A, T, or C) levels in all genes, (f-h) Percentage (%, Y-axis) of CG (f), CHG (g), and CHH (h) methylation levels in all biotic stress responsive genes, (i-k) Percentage (%, Y-axis) of CG (i), CHG (j), and CHH (k) methylation levels in all abiotic stress responsive genes. X-axis: positions relative to the transcribed region.
[0021] Figure 7 provides a proposed model for altered stress-responsive gene expression in the promotion of growth vigor in Fl hybrids, (a) An example of an Fl (ColXC24) hybrid showing growth vigor compared to the parents, Col and C24 (scale bars=l cm). Natural variation of circadian rhythms and stress responses is associated with the adaptation of each ecotype to local environments, (b) Parent 1 and parent 2 that have adapted to different environments require high levels of gene expression in response to abiotic (parent 1) or biotic (parent 2) stress, which is partly mediated by circadian rhythms (clock symbols). Parent 1 and parent 2 do not reach the full growth potential, probably because of the fitness cost in response to the stress in respective adaptive environments. In Fl hybrids, the expression of both biotic and abiotic stress-responsive genes is compromised, leading to increased levels of growth vigor.
[0022] Figure 8 shows an analysis of differentially expressed genes (DEGs) in hybrids, (a-f) Only significantly enriched GO terms are displayed. Enriched GO categories are defined by having a FDR adjusted p<0.05 using the hypergeometric test (compared to that of all genes in the genome), (g) Heatmap of RNA-seq data (Table 7) showing a subset of genes in the photosynthetic pathway (ZT0 = dawn). Fold-change: Log2-transformed values from low to high, (h-k) Relative expression levels (R.E.L.) of LHCB1.4 (h), PORB (i), CAB2 (j), and LHCB4.2 (k) at 4 time points in reciprocal Fl hybrids between Col and C24, compared to the mid-parent value (MPV). Values were averaged from three biological replicates (+ s.d.). Single and double asterisks indicate statistical significance levels at p<0.05 and p<0.01, respectively, using two-tailed student's t-test (compared to MPV). Arrows indicate up- regulation in the hybrids compared to the MPV.
[0023] Figure 9 shows biotic and abiotic stress genes exhibiting altered expression in Fl hybrids, (a-h) Expression of PCC1 (a), HSPOR2 (b), PR1 (c), CPR5 (d), COR47 (e), COR15A (f), RD22 (g), and RD28 (h) in a 48-hour period starting from dawn. R.E.L.: relative expression levels to that of ACT7 in each sample. Values were averaged from three biological replicates (+ s.d.). Single and double asterisks indicate statistical significance levels at p<0.05 and p<0.01, respectively, using two-tailed student's t-test (compared to the mid-parent value, MPV). Arrows indicate down-regulation in hybrids compared to the MPV.
[0024] Figure 10 shows cis and trans effects on stress genes in Fl hybrids, (a) Number of genes with cis and trans effects in Fl hybrids, (b) Percentage of stress-responsive genes with cis or trans effects. Statistically significant enrichment of stress genes is indicated by asterisks, which are representative of a FDR adjusted p<0.05 using the hypergeometric test (compared to the whole genome background), (c-h) Clustered heatmaps showing RPKM of trans -effected genes in parents and hybrid alleles, (i-p) RPKM values in Col, C24, and Col and C24 alleles in reciprocal hybrids for ACD6 (i), PR1Q), PR2/BGL2 (k), PAD4 (1), COR78 (m), COR15A (n), COR47 (o) and RD22 (p) at ZTO (i-1) or ZT6 (m-p).
[0025] Figure 11 shows perturbation of circadian-regulated genes in Fl hybrids, (a-c) Relative expression levels (R.E.L.) of CCA1 (a), LHY (b), and TOC1 (c) in a 24-h period starting from dawn (ZT = 0) in reciprocal Fl hybrids between C24 and Col. Values were averaged from three biological replicates (+ s.d.). Single and double asterisks indicate statistical significance levels at p<0.05 and p<0.01, respectively, using two-tailed student's t- test (compared to the mid-parent value, MPV). Upward and downward arrows indicate up- and down-regulation in the hybrids compared to the MPV. (d-i) Phase distributions of differentially expressed genes (DEGs) in hybrids in ColxC24 (d, f, h) and C24xCol (e, g, i) at ZTO, ZT6, and ZT15. Dark gray and light gray lines indicate down- and up-regulated genes, respectively. P- values calculated using chi-square test of independence. [0026] Figure 12 shows natural variation of stress responsive gene expression at specific times of day is associated with biomass heterosis, (a) Seedlings of 3-week-old plants in the following ecotypes: Cvi, Est, Ler, Oy, Col, Sorbo, Ws, C24, Nd, and Wei (scale bars = 1 cm for all images), (b) Biomass (dry weight, mg) of the ecotypes in three replications (mean + s.d.). (c-d) Relative expression levels (R.E.L) PR1 (c) and COR47 (d) in ecotypes at ZTO, ZT9, and ZT18. Values are averages from three biological replicates (+ s.d.). (e-p) Biomass increase relative to MPV (Y-axis) in various hybrids was plotted against absolute values of the log2-fold expression level changes (X-axis) in different stress genes at three time points (ZTO, 9, 18). Scatter plots for ACD6 (e-g), COR78 (h-j), PR1 (k-m), and COR47 (n-p) were shown at ZTO (e, h, k, n), ZT9 (f, i, 1, o), and ZT18 (g, j, m, p). Regression lines were statistically significant for ACD6 at ZT18 (g), COR78 at ZT9 (i) and COR47 at ZT9 (o). Data used to perform regression analyses were shown in Table 4, and detailed results of the analysis were included in Table 8.
[0027] Figure 13 shows responsive gene expression in higher and lower vigor Fl hybrids, (a- d) Relative expression levels (R.E.L.) of COR78 and ACD6 in Fl(ColXWs) and its parents (a, c) and in Fl(ColXL<?r) and its parents (b, d) at 5 time points, compared to the mid-parent value (MPV). Values were averaged from three biological replicates (+ s.d.). (e, f) Seedlings of 3-week-old plants (scale bars = 1 cm for all images) in Fl(ColXWs) and its parents Col and Ws (e) and in (ColXL<?r) and its parents Col and Ler (f). (g-j) Relative expression levels (R.E.L to that of ACT7) of COR78 and ACD6 in C24 and Ler and their Fl (g, i) and in C24 and Ws and their Fl (h, j) at 5 time points, compared to the mid-parent value (MPV). Values were averaged from three biological replicates (+ s.d.). (k) Seedlings of 3-week-old plants in Fl(EstXCol) and its parents Est and Col. (1, m) R.E.L. of COR78 (1) and ACD6 (m) in Fl(EstlXCol) and its parents at 5 time points, compared to the mid-parent value (MPV). Single and double asterisks indicate statistical significance levels at p<0.05 and p<0.01, respectively, using two-tailed student's t-test (compared to MPV). Upward and downward arrows indicate up- and down-regulation in the hybrids compared to the MPV.
[0028] Figure 14 shows an experimental scheme for stress treatments. All experiments were performed in a 16-hour light/8-hour dark regime. The white box represents light and the black box represents dark, (a, b) Experimental design for measurement of gene expression induction at ZTO (a) and ZT15 (b), which was treated by either cold shock or salicylic acid (SA). (c, d) Experimental design for longer-term stress applications under the treatment of cold (4 °C) for two weeks (c) or SA spray (d).
[0029] Figure 15 shows performance and stress-responsive gene expression in Fl(ColXC24) hybrids and their parents (Col and C24). (a-d) Relative expression ratios (R.E.R.) of COR78 (a, b) and COR15A (c, d) between treated and untreated samples across 5 time points after the cold-treatment at ZTO (a, c) or ZT15 (b, d). (e-h) R.E.R. of ACD6 (e, f) and PR1 (g, h) between treated and untreated samples across 5 time points after the SA-treatment at ZTO (e, g) or ZT15 (f, h). Expression values were averaged from three biological replicates (+ s.d.). Asterisks indicate statistical significance levels at p<0.05 using two-tailed student's t-test, compared to the mid-parent value (MPV). Dashed lines indicate no expression change between treated and untreated samples. After seedlings were cold- or SA-treated for 1 hour at ZTO or ZT15, rosette leaves were harvested at designated time points for gene expression studies (see Methods for details), (i) Dry weight (n = 5 plants averaged per replicate) of the hybrids relative to the MPV in the control and cold-treated conditions 8 days post transfer, (j) Dry weight (n = 5 plants averaged per replicate) of the hybrids relative to the MPV in the control and SA-treated conditions after 15 days. Relative expression ratios (R.E.R.) of COR78 (k), COR15A (1), ACD6 (m), and PR1 (n) between treated and control samples across 3 time points after 15 days of stress treatment. Dashed lines indicate no expression change between treated and untreated samples. Expression values are averaged from three biological replicates (+ s.d.). Asterisks indicate statistical significance levels at p<0.05 using two-tailed student's t-test, compared to the mid-parent value (MPV). Values were averaged from three biological replicates (+ s.d.).
DETAILED DESCRIPTION
[0030] Hybrid plants exhibit enhanced agronomic traits due to the varied genetic contribution of their parents, a phenomenon known as heterosis or outbreeding enhancement. While useful hybrids have been identified through extensive breeding and evaluation of the resulting phenotypes, this process is costly and time-consuming. Efforts to develop methods of selecting parents for producing hybrid plants with beneficial traits have been hampered by an incomplete understanding of the factors contributing to heterosis. A need therefore remains for improved methods of producing hybrid plants with useful phenotypes. In the absence of improved methods for selecting parent plants for hybrid breeding programs, it may not be practical to attempt to produce certain new hybrid crop plants.
[0031] The present invention provides previously unknown methods for producing hybrid plants with significantly improved agronomic traits. In certain embodiments, methods are provided for selecting parent plants for crossing based on expression levels of stress- responsive genes, which result in hybrid plants exhibiting enhanced traits due to heterosis. The methods of the present invention can therefore be used to accurately predict advantageous traits in hybrid plants, including increased biomass or increased yield.
I. Methods for Producing Hybrid Plants
[0032] The present invention provides methods of producing hybrid plants with improved agronomic traits comprising selecting parent plants based on expression levels of stress- responsive or photosynthetic genes. In certain embodiments, the invention provides methods comprising detecting expression levels of one or more stress-responsive genes in a plurality of plants, and selecting parent plants for a cross which express the stress-responsive genes at different levels. For example, a first parent plant may express high levels of a stress- responsive gene, while a second parent plant expresses low levels of the stress-responsive gene. In another example, a first parent plant may express low levels of a stress-responsive gene, while a second parent plant expresses high levels of the stress-responsive gene. The plurality of plants from which the parent plants are selected according to the methods of the present invention may be from the same species of plant, and may comprise different genotypes.
[0033] According to the methods provided herein, parent plants for a hybrid cross may be selected by determining a difference in expression level of a particular gene between prospective parent plants. Genes useful in selecting parent plants for crossing according to the invention include any stress-responsive gene. For example, parent plants may be selected by detecting a difference in expression levels of abiotic stress genes, biotic stress genes, or photosynthetic genes. Gene expression levels may be detected and compared between prospective parent plants at any timepoint, including zeitgeber time (ZT) 0, ZT6, ZT12, ZT15, ZT18, and ZT21. In certain embodiments of the invention, parent plants having ratios of stress-responsive gene expression of 1.00, 1.50, or 2.00 are predictive of improved agronomic traits in progeny plants. [0034] The present invention further provides methods of producing hybrid plants having beneficial traits by detecting and comparing expression levels of one or more stress- responsive genes to select parent plants for a cross. A difference in expression levels of one or more stress-responsive genes can be used to select parent plants for a cross resulting in hybrid plants with advantageous traits.
II. Genes Useful in Selecting Parent Plants
[0035] The methods of the present invention may comprise detecting expression levels of any stress-responsive gene, including biotic stress genes and abiotic stress genes. Non-limiting examples of biotic stress genes include PRl (AT2G14610), PR5 (AT1G75040), NUDT6 (AT2G04450), HSPR02 (AT2G40000), CNGC11 (AT2G46440), EBP/ERF72 (AT3G16770), PCC1 (AT3G22231), HR3/MLA10 (AT3G50470), CAX3 (AT3G51860), PAD4 (AT3G52430), WRKY70 (AT3G56400), PR2/BGL2 (AT3G57260), ACD6 (AT4G14400), NIA2 (AT1G37130), NHL3 (AT5G06320), Protease inhibitor (AT5G55450), WAK1 (AT1G21250), WAK2 (AT1G21270), EP1 (AT4G23170), RVE2 (AT5G37260), BG3 (AT3G57240), LURP1 (AT2G14560), DMR6 (AT5G24530), SAG21 (AT4G02380), SUR2 (AT4G31500), ANK (AT5G54610), and homologs thereof.
[0036] Non-limiting examples of abiotic stress genes useful in the present invention include LSR3 (AT1G01470), ERD11/GSTF6 (AT1G02930), COR47/RD17 (AT1G20440), LTI45/ERD10 (AT1G20450), COR413-TM1 (AT1G29395), ALDH7B4 (AT1G54100), ATGRP3 (AT2G05520), PIP2B (AT2G37170), RD28 (AT2G37180), CAX1/RCI4 (AT2G38170), COR15A (AT2G42540), PIP1B (AT2G45960), LTI30 (AT3G50970), PIP1A (AT3G61430), PIP1;4 (AT4G00430), COR78/RD29A (AT5G52310), COR6.6/KIN2 (AT5G15970), RD22 (AT5G25610), ERD1 (AT5G51070), GRP8 (AT4G39260), GRP2 (AT4G38680), GRP7/CCR2 (AT2G21660), MDH (AT3G47520), HSP70 family (AT3G09440), CAT2 (AT4G35090), LOS2 (AT2G36530), ATAVP1 (AT1G15690), LTP4 (AT5G59310), TCH2 (AT5G37770), TCH4 (AT5G57560), mtHsc70-l (AT4G37910), COR15B (AT2G42530), MT1A (AT1G07600), LTP3 (AT5G59320), LOS1 (AT1G56070), Salt-stress responsive protein (AT1G13930), FIB (AT4G04020), KIN1 (AT5G15960), and homologs thereof.
[0037] Hybrid plants produced by the novel methods of the present invention therefore exhibit enhanced agronomic traits including modified biomass, modified yield, improved disease tolerance, improved insect resistance, improved pathogen resistance, modified plant growth and development, modified starch content, modified oil content, modified fatty acid content, modified protein content, modified fruit ripening, and improved stress resistance.
[0038] The methods provided by the invention may be used to produce hybrid plants exhibiting advantageous traits resulting from heterosis in monocotyledonous or dicotyledonous plants including, but not limited to, Arabidopsis thaliana, maize (corn; Zea mays), soybean (Glycine max), cotton (Gossypium hirsutum; Gossypium sp.), peanut (Arachis hypogaea), barley (Hordeum vulgare); oats (Avena sativa); orchard grass (Dactylis glomerata); rice (Oryza sativa, including indica and japonica varieties); sorghum (Sorghum bicolor); sugar cane (Saccharum sp.); tall fescue (Festuca arundinacea); turfgrass species (e.g. species: Agrostis stolonifera, Poa pratensis, Stenotaphrum secundatum); wheat (Triticum aestivum); alfalfa (Medicago sativa); members of the genus Brassica, including broccoli, cabbage, carrot, cauliflower, Chinese cabbage; cucumber, dry bean and other leguminous plants, eggplant, tobacco (Nicotiana sp.), fennel, garden beans, gourd, leek, lettuce, melon, okra, onion, pea, pepper, pumpkin, radish, spinach, squash, sweet corn, tomato, potato, watermelon, Miscanthus, ornamental plants, and other fruit, vegetable, tuber, oilseed, and root crops, wherein oilseed crops may include soybean, canola, oil seed rape, oil palm, sunflower, olive, corn, cottonseed, peanut, flaxseed, safflower, and coconut, among others.
III. Detection of Stress-Responsive or Photosynthetic Gene Expression
[0039] Expression levels of stress-responsive genes provided by the invention may be detected by various methods known to one of skill in the art. For example, expression levels of a gene in a tissue sample may be detected by isolating mRNA from the sample and quantitating mRNA transcripts by reverse transcription polymerase chain reaction (RT-PCR) using primers directed to the mRNA to be detected. Alternatively, RNA-sequencing or microarray technologies can be used to identify genome-wide gene expression changes, including all stress-responsive genes, at different times of day. The data can be analyzed to find optimal times of day to detect expression level differences in stress-responsive genes among parental strains.
[0040] Detection of stress-response gene expression according to methods of the present invention may be carried out at any time of day. In certain embodiments, stress-responsive gene expression levels may be detected in ACD6 at ZT18, in COR78 at ZT9, and in COR47 at ZT9. In general, the optimal time of day in which the stress-responsive gene expression differences between the parents are predictive of hybrid performance, which corresponds to the peak of gene expression for a given gene in the diurnal cycle. Therefore, to find optimal times of day for hybrid performance prediction, gene expression of stress-responsive genes should be assayed for at least 24 hours to identify the peak times of gene expression in the desired parental types.
IV. Selection and Breeding Methods
[0041] The present invention provides methods for identifying parent plants which can be crossed to produce a hybrid plant having a particular agronomic trait. Hybrid plants resulting from a cross according to the invention may exhibit an improved trait compared with either of the parent plants, or compared with the mid-parent value (MPV) for a trait of interest. In certain embodiments, the improved trait is increase biomass or increased yield.
[0042] One application of the present methods is therefore in breeding programs aimed at increasing the presence or degree of favorable traits in plants. This can be accomplished through a single round of breeding, or by repeated crossing of progeny plants with other suitable parent plants identified using the methods of the invention. Multiple rounds of crossing, including backcrossing, using the selection methods provided herein are contemplated by the invention.
EXAMPLES
[0043] The following Examples are illustrative of the invention described herein and should not be read to limit the scope of the invention to the particular aspects described herein. The methods described below were used in the applicable Examples unless described otherwise.
Plant materials and growth conditions
[0044] Plant materials include the following Arabidopsis thaliana ecotypes, which were used to generate Fl hybrids; C24, Columbia (Col), Cvi-0 (CS22614), Est-1 (CS22629), Ler, Nd-1 (CS22619), Oy-0 (CS22658), Sorbo (CS22653), Wei-0 (CS22622), and Ws. Crossing was carried out as previously described (Miller, et al. G3 (Bethesda) 2:505-513, 2012). An acd6- 1 hyperactive mutant (Max Planck Institute for Developmental Biology, Tubingen, Germany), and ccal-11 (CS9378), lhy21 (CS9379), and ccal-l llhy21 (CS9380) T-DNA insertion mutants in the Ws background (Arabidopsis Biological Resource Center) were also used. All plants were grown under a 16/8-h light/dark cycle with temperatures of 22 °C (light) and 20°C (dark) on soil, and rosette leaves from ~3 week old plants before flowering were collected for RNA analysis, unless otherwise noted. For qRT-PCR validation, plants were grown in three biological replicates, and leaves were harvested every three hours for two diurnal cycles (48 hours). For plant transformation, 4-5 week old plants were used for Agrobacterium tumefaciens- mediated transformation through floral dipping.
Biomass measurement
[0045] Biomass was measured after drying rosettes before bolting at 80°C for 24 hours as previously described (Miller, et al. G3 (Bethesda) 2:505-513, 2012).
Trypan blue staining
[0046] Trypan blue staining solution was prepared by adding 20 mg of Trypan blue to 40 ml of lactophenol solution for a final concentration of 0.5 mg rnl-1. Leaves were incubated for 3 h in a sufficient amount of solution to immerse the tissue. The tissue was then cleared in a sufficient amount of chloral hydrate solution to cover the tissue (25 g of chloral hydrate per 10 ml water) for 30 min.
mRNA-seq library preparation
[0047] Total RNA was isolated from mature leaves (3 week-old A. thaliana plants) before bolting using plant RNA purification reagent (Invitrogen). The integrity of extracted RNA was analyzed by resolving 1 μg RNA in a 1%-formaldehyde denaturing agarose gel. An aliquot of 10 μg total RNA was used to prepare mRNA-seq libraries using Illumina mRNA- seq sample preparation kit (Illumina). Libraries with a range of 200+25 bp were excised and amplified for subsequent cluster generation and massively parallel sequencing using the Illumina Genome Analyzer Gil with read lengths of 85 bp.
mRNA-seq read mapping and expression quantification
[0048] mRNA-seq reads from 12 libraries (Col, C24, ColxC24 and C24xCol at three time points) were mapped to the TAIR9 genome and cDNA sequence using BFAST (Blat-like Fast Accurate Search Tool, publically available on the internet). Transcript levels were quantified by counting reads per kilobase per million mapped reads (RPKM). First, all unique reads without alternative splice isoforms were used to calculate a preliminary RPKM. Second, unique reads with isoform exons were weighted using the preliminary RPKM. Final RPKMs were calculated by combining the unique and weighted multiple mapped reads. Primary isoforms were used for further analysis. These isoforms could indicate a role for splicing variants of circadian clock genes in a temperature-dependent mechanism.
Bioinformatics analyses
[0049] Differentially-expressed genes were identified using the R-package DEGseq with a log2 fold change > 10.51 and a FDR corrected p-value (q-value) < 0.05 (Table 6). Heat maps were generated using Gene-E (Broad Institute, publically available on the internet), and clustering was performed using the default settings (one minus pearson correlation). RPKM values used to generate heat maps are located in Table 7, along with locations of EE and CBS motifs and circadian correlations of the genes displayed in the heat maps. GO analysis was performed and figures were generated using the agriGO website. The hypergeometric test was used to identify enriched (FDR adjusted p-value < 0.05) GO categories relative to the genome background. Genes were identified as biotic or abiotic stress-responsive by GO term analysis, followed by manual removal of uncharacterized genes to ensure that the classifications were accurate.
[0050] SNP data for C24 was obtained from the Arabidopsis 1001 Genomes database (available on the internet). Reads mapped to regions containing SNPs were extracted and then assigned to reads from Col or C24 according to the SNP database. The total RPKM value in hybrids was split to Col and C24 alleles based on the ratio between the number of reads mapped to either Col and C24. To calculate cis and trans effects, a previously published strategy was employed (Shi, et al. Nat. Commun. 3, 950, 2012). Log2-transformed ratios were used to estimate allelic expression divergence, such that gene-expression divergence (A) between ecotypes was calculated by log2(Col/C24) and the allelic ratio in the hybrids by log2(FlCol/FlC24). Genes which showed different expression between parents (log2 fold change > 111), but the same allelic expression within the hybrid (log2 fold change < 10.51), were considered to be caused by only trans effects. A gene was considered having only cis effects if the ratio of parental expression was equal to the allelic expression in hybrid or allotetraploid (A=B, log2 fold change < 10.51). [0051] Circadian-regulated genes were identified by comparing a given dataset (i.e. DEG or MPV gene lists in parents and hybrids, respectively) with the intersection of two different microarray experiments (Covington + Edwards intersection).
[0052] Integrative Genomics Viewer (IGV) was used to display publically available mRNA- seq, sRNA-seq, and methylation data (Shen, et al. Plant Cell 24, 875-892, 2012) (GSE34658). Genes were identified as having a higher methylation level than the MPV if average methylation differences were 0.1 or greater for CG and CHG contexts and 0.05 or greater for CHH contexts, similar to the criteria used by Shen, et al.
[0053] For QTL analysis, genes present in QTL intervals were tested for significant overlap with DEGs using the GeneSect Tool, which implements a non-parametric randomization test which can determine whether the overlap between two gene lists is higher or lower than expected by chance, from the Virtual Plant website, as well as the hypergeometric test in R.
RNA Extraction and qRT-PCR
[0054] Tissue collected for gene expression analysis was collected from plants before bolting (3 week old plants unless noted otherwise) at indicated Zeitgeber time (ZT0 = dawn). Total RNA was extracted using Concert Plant RNA Reagent (Invitrogen) and digested with RQ1 RNase-Free DNase (Promega) according to the manufacturer's instructions. cDNA was synthesized using ΙμΜ oligo dT (12-18) primer (GeneLink) from 1 μg DNase-treated RNA using the Omniscript RT Kit (Qiagen) according to the manufacturer's instructions. For qRT- PCR, FastStart Universal SYBR Green Master (Rox) (Roche Applied Science) was used for PCR in the presence of gene-specific primers and 2 μΐ^ of diluted cDNA template. Expression levels of target genes were normalized against transcript levels of ACT7 (At5g09810) and relative expression levels of transcripts were calculated. The primer sequences are listed in Table 1.
"able 1. Oligonucleotide primers used for expression ana yses and cloning.
Name SEQ ID NO. Sequence (5' - 3') Description
ACT7-F 1 GTCTGTGACAATGGAACTGGAA ACT7 (At5g09810) qPCR
ACT7-R 2 CTTTCTGACCCATACCAACCAT ACT7 (At5g09810) qPCR
ACD6-F 3 ATCACTGCAATTGCCCATGT ACD6 (At4g 14400) qPCR
ACD6-R 4 ACACGCCACACAACCAAAA ACD6 (At4gl4400) qPCR
COR78-F 5 CTTGATGGTCAACGGAAGGT COR78 (At5g52310) qPCR
COR78-R 6 CAATCTCCGGTACTCCTCCA COR78 (At5g52310) qPCR
PR1-F 7 CGTTCACATAATTCCCACGA PR1 (At2gl4610) qPCR
PR1-R 8 AAGAGGCAACTGCAGACTCA PR1 (At2gl4610) qPCR
COR47-F 9 CGGTACCAGTGTCGGAGAGT COR47 (Atlg20440) qPCR
COR47-R 10 ACAGCTGGTGAATCCTCTGC COR47 (Atlg20440) qPCR
PR5-F 11 TCGAGGATTTTCAAGAACGC PR5 (Atlg75040) qPCR
PR5-R 12 AAGCTTCGGTTTTTAAGGGC PR5 (Atlg75040) qPCR
COR15A-F 13 GAAAAAAACAGTGAAACCGCAGAT COR15A (At2g42540) qPCR
COR15A-R 14 CCACATACGCCGCAGCTT COR15A (At2g42540) qPCR
HSPR02-F 15 GAGGAAGACAGAGTGCGATAAG HSPR02 (At2g40000) qPCR
HSPR02-R 16 CACTAACTGCCTATACCCAAAGA HSPR02 (At2g40000) qPCR
RD22-F 17 GATTCGTCTTCCTCTGATCTG RD22 (At5g25610) qPCR
RD22-R 18 TGGGTGTTAACGTTTACTCCG RD22 (At5g25610) qPCR
PCC1-F 19 ACAAATCTCACATCCTCACTCC PCC1 (At3g22231) qPCR
PCC1-R 20 GCCCTGATGAAGTCTCTGAAG PCC1 (At3g22231) qPCR
RD28-F 21 TTCGACGCAGAGGAGCTTACCA RD28 (At2g37180) qPCR
RD28-R 22 TACGAACTCGGCGATGACTGCT RD28 (At2g37180) qPCR
LHCB1.4-F 23 GCCTTCGCTACCAACTTCGTC LHCB1.4 (At2g34430) qPCR
LHCB1.4-R 24 AACCGGATACACACAACTCGATC LHCB1.4 (At2g34430) qPCR
PORB-F 25 GTGGACGGCAAGAAAACGTT PORB (At4g27440) qPCR
PORB-R 26 GGCTCCAGTGACCACCACAT PORB (At4g27440) qPCR
CAB2-F 27 ATTCGCAAGGAACCGTGAGCTAGA CAB2 (Atlg29920) qPCR
CAB2-R 28 TGAACCAGCCTTGAACCAAACTGC CAB2 (Atlg29920) qPCR
LHCB4.2-F 29 GCCGCCACTTCAACCGCCGCTGCTG LHCB4.2 (At3g08940) qPCR
LHCB4.2-R 30 CCCGTAGTCCCCGACAAGTGAACCG LHCB4.2 (At3g08940) qPCR
CCA1-F 31 CCTCGTCAGACACAGACTTCCA CCA1 (At2g46830) qPCR
CCA1-R 32 CCGCAGTAGAATCAGCTCCAATA CCA1 (At2g46830) qPCR
LHY-F 33 GGGACAAAGACTGCTGTTCAGAT LHY (Atlg01060) qPCR
LHY-R 34 TTTGTGAAGAACTTTTGTGCATGA LHY (Atlg01060) qPCR
TOC1-F 35 GTTGATGGATCGGGTTTCTC TOC1 (At5g61380) qPCR
TOC1-R 36 TCATGACCCCATGCATACAG TOC1 (At5g61380) qPCR
Xhol pCOR78-F 37 ccatCTCGAGAGATTTGGGGTTTTGCTTTTG COR78 promoter cloning
Ncol pCOR78-R 38 ccatCCATGGGAGTAAAACAGAGGAGGGT COR78 promoter cloning
Xhol pACD6-F 39 ccatCTCGAGAAGAGTTTGTAGCCTATTCAAAG ACD6 promoter cloning
Ncol pACD6-R 40 ccatCCATGGGGTTATCGAGAGGAGTGGTGGTC ACD6 promoter cloning
RsrII COR78-F 41 ccatCGGACCGATCAAACAGAGGAACCACC COR78 transcribed region cloning
Aatll COR78-R 42 ccatGACGTCTTAAAGCTCCTTCTGCACCGG COR78 transcribed region cloning amiCor78-l 43 gaTATAGGTAACTTCGTTGTCACctctcttttgtattcca For amiRNA against COR78 amiCor78-2 44 agGTGACAACGAAGTTACCTATAtcaaagagaatcaatga For amiRNA against COR78 amiCor78-3 45 agGTAACAACGAAGTAACCTATTtcacaggtcgtgatatg For amiRNA against COR78 amiCor78^ 46 gaAATAGGTTACTTCGTTGTTACctacatatatattccta For amiRNA against COR78
Aatll COR78 A 47 ccatGACGTCCTGCAAGGCGATTAAGTTGGGTAAC For final amiRNA sequence
Xmal COR78 B 48 ccatCCCGGGGCGGATAACAATTTCACACAGGAAACAG For final amiRNA sequence amiACD6-l 49 gaTTAATGGTGACTAAAGGCCGTctctcttttgtattcca For amiRNA against ACD6 amiACD6-2 50 agACGGCCTTTAGTCACCATTAAtcaaagagaatcaatga For amiRNA against ACD6 amiACD6-3 51 agACAGCCTTTAGTCTCCATTATtcacaggtcgtgatatg For amiRNA against ACD6 amiACD6-4 52 gaATAATGGAGACTAAAGGCTGTctacatatatattccta For amiRNA against ACD6
RsrII ACD6 A 53 ccatCGGACCGCTGCAAGGCGATTAAGTTGGGTAAC For final amiRNA sequence
Aatll ACD6 B 54 ccatGACGTCGCGGATAACAATTTCACACAGGAAACAG For final amiRNA sequence
Note: Restriction enzyme sites are underlined and capitalized letters correspond to the miRNA and miRNA : sequences.
Plasmid constructs [0055] For luciferase reporter constructs, genomic DNA from Col, C24, and Ws was used to amplify ACD6 and COR78 promoter regions. SNPs between Col and C24 promoter and coding regions were identified using Polymorph (Ossowski, et al , publically available on the internet). The amplified fragments were cloned into pGEM-T vector (Promega) for sequence verification. The Promoter :LUC plasmid constructs were generated by inserting luciferase gene between the restriction enzyme sites Ncol and BamHI in the pFAMIR plasmid (Yadegari, University of Arizona). For 35S-driven overexpression constructs, the transcribed region of COR78 from Col or C24 was cloned into the pF35SE vector (A vector for 35S- driven gene expression, Yadegari, University of Arizona) between RsrII and Aatll restriction sites. Artificial miRNAs were designed using the WMD3 web app (Ossowski and Fitz, publically available on the internet) against a conserved region in Col and C24 and then amplified using the pRS300 vector as a template. The amplified fragments were cloned into pGEM-T vector (Promega) for sequence verification. The artificial miRNAs were then cloned into the pF35SE vector between RsrII and Aatll restriction sites for amiACD6 and between Xmal and Aatll restriction sites for amiCOR78. All constructs were individually cloned into Agrobacterium strain GV3101 for plant transformation and seeds were screened on 1 % (w/v) agar with Murashige and Skoog (MS) media containing 7.5 mg/L phosphinothricin. The primer sequences are listed in Table 1.
Luciferase assays
[0056] Plants containing either ACD6:LUC or COR78:LUC constructs were analyzed using a Packard TopCount luminometer as previously described. Seeds were sterilized with bleach and 75% ethanol and plated on 1 % (w/v) agar with MS media containing 7.5 mg/L phosphinothricin. Seeds were stratified 2 days in the dark at 4°C and then transferred into 16- h light and 8-h dark cycles for 7 days, and then transferred to MS containing no selection for 3 days. Seedlings were transferred to white microtiter plates (Nunc, Denmark) containing agar MS medium plus 30g sucrose/L and 30 iL of 0.5 mM luciferin (Gold Biotechnology). Microtiter plates were covered with clear plastic MicroAmp sealing film (Applied Biosystems, Foster City, CA) in which holes were placed above each well for seedling gas exchange. One day after addition of luciferin, plates were moved to the TopCount and interleaved with two clear plates to allow light diffusion to the seedlings. All luciferase data were analyzed using the Biological Rhythm Analysis Software System (BRASS, publically available on the internet). All period estimates were performed on rhythms from 24-120 hours using fast Fourier Transform-nonlinear least squares (FFT-NLLS) analysis.
Regression analysis
[0057] Regression analysis was performed using JMP 10 (JMP®, Version 10. SAS Institute Inc., Cary, NC, 1989-2007) with the default parameters and all graphs were generated using JMP. Data used for the regression analysis is in Table 4, and detailed results can be found in Table 8.
Cold- and SA-treatment experiments
[0058] The scheme for stress experiments is shown in Fig. 14. For cold-induction of gene expression (cold-shock), 6 two week old seedlings (3 seedlings were used per replicate) were removed from agar media and were placed into 5 ml culture tubes containing room- temperature liquid MS media with 3% sucrose 24 hours before cold- treatment. Cold- treatment was performed by placing the tubes in ice or leaving at 22°C for the control. After 60 minutes, tubes containing seedlings were placed back into 22°C and then whole seedlings (excluding roots) were snap frozen in liquid nitrogen at the ZT times listed in Fig. 14.
[0059] For SA-induction of gene expression, two-week old seedlings growing on agar media were sprayed with 1 mM SA (Sigma-Aldrich). After 60 minutes, whole seedlings (excluding roots) were snap frozen in liquid nitrogen for the first time point, and then at the subsequent ZT times listed in Fig. 14.
[0060] For longer-term cold stress application, two-week old seedlings growing on agar media were placed into a 4°C growth chamber of the same light intensity as control seedlings which were left at 22°C. Every 2-3 days, seedlings were photographed and rosette diameter was quantified using ImageJ. Every 2-3 days, seedlings were photographed and rosette diameter was quantified using ImageJ. After two weeks, seedlings were snap frozen in liquid nitrogen at ZT0, ZT9, and ZT15. A batch of seedlings was transferred to soil, placed at 22°C to allow for recovery, and rosette diameter was measured every 2-3 days. After one week biomass was measured.
[0061] For longer-term SA-treatment, two-week old seedlings growing on agar media were sprayed with lmM SA or water (control). Rosette diameter was measured every 2-3 days as described above. After one week seedlings were transferred to soil, sprayed with 1 mM SA again, and rosette diameter was measured every 2-3 days. After one more week, seedlings were snap frozen in liquid nitrogen at ZTO, ZT9, and ZT15 and biomass was measured.
[0062] To calculate relative expression ratios (R.E.R), expression levels of target genes were first normalized against transcript levels of ACT7 and then the induced value was divided by the control value (indicated by a dashed line in the figures). Data of absolute values are available but not shown owing to space limitations.
[0063] Relative growth rate (RGR) was calculated according to RGR = (lnD2 - lnDl)/t2 - tl, where Dl and D2 are rosette diameters at time points tl and t2, respectively.
Example 1 : Diurnal repression of stress-responsive genes in hybrids
[0064] To assess the role of diurnal stress-responsive gene expression in heterosis, we deep- sequenced mRNAs from 3-week old seedling leaves of highly heterotic Fl hybrids between A. thaliana Col and C24 ecotypes at zeitgeber time (ZT) 0 (dawn), ZT6 (midday), and ZT15 (dusk) (Fig. la). All experiments were performed in diurnal conditions where heterosis naturally occurs.
[0065] The percentage of differentially expressed genes (DEGs) between Fl hybrids and the mid-parent value (MPV) was highest (-5%) at ZT6 (noon), followed by -3% at ZTO (dawn), and -1.3% at ZT15 (dusk) (Table 6). Gene Ontology (GO) analysis (Fig. 8a-f) revealed that both photosynthetic and stress-responsive genes were enriched in the DEGs relative to all expressed genes (DEGseq q-value (FDR-adjusted p-value) < 0.05, see Methods). Thirty of 267-328 (10%) genes that were upregulated in reciprocal hybrids at ZT6 belonged to the photosynthetic processes using GO term analysis (Fig. 8g-k), consistent with previous observations of increased photosynthetic capacity in hybrids. Note that gene expression patterns were slightly and consistently different between the reciprocal Fl crosses (also below), which is known to be due to parent-of-origin effects on circadian rhythms and biomass heterosis. Among down-regulated genes, 3-13% were in the GO classifications of biotic and abiotic stress-responsive genes (Fig. le-j and Table 7). The repression of these genes, including 26 known biotic and 38 known abiotic stress-responsive genes (classified using GO term analysis, see Methods), occurred at different times of the day (Fig. lb,d). At ZT6, 2-3-fold more abiotic than biotic stress-responsive genes were repressed (Fig. lg,h). This trend was reversed at ZTO and ZT15, and biotic stress-responsive genes comprised a larger proportion of the repressed genes (Fig. le,f,i,j). The timing of repression in the hybrids was confirmed by quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR) analysis in two diurnal cycles (48 hours) in 3 biological replicates. Biotic stress-responsive genes such as ACCELERATED CELL DEATH6 (ACD6, At4gl4400), PATHOGEN AND ORCADIAN CONTROLLED 1 (PCC1, At3g22231), and HOMOLOG of SUGAR BEET HSl PRO-2 (HSPR02, At2g40000) were primarily repressed to below MPV levels between ZTO and ZT6 (Fig. 2a and Fig. 9a,b), and PATHOGENESIS-RELATED GENES 1 (PR1, At2gl4610) and PR5 (Atlg75040) were repressed at all times (Fig. 9c,d). However, cold stress-responsive genes, including COLD -REGULATED78 (COR78, At5g52310), COR47 (Atlg20440), COR15A (At2g42540), RESPONSIVE-TO-DESICCATION22 (RD22, At5g25610), and RD28 (At2g37180), were repressed in the middle and later parts of the day (Fig. 2b and Fig. 9e-h). A slight shift of the expression peaks between ecotypes may reflect their adaptation to fluctuating local environments. Moreover, expression rhythms of many stress-responsive genes are modulated by other signaling factors in addition to the circadian clock.
[0066] This genome-wide repression of stress-responsive genes could be caused by cis- and trans-acting factors in the hybrids, which was tested using all expressed genes. Consistent with the findings in the interspecific hybrids of Arabidopsis 32 or yeast 33, >43% more genes exhibited cis effects than trans effects in the Fl hybrids at ZTO, ZT6, and ZT15 (Fig. 10a). However, amongst stress-responsive genes, significantly more genes displayed irans-effects than ds-effects at all time points (FDR adjusted p<0.05, hypergeometric test, Fig. 10b). The irans-regulated genes of either parental origin could be repressed to the low-parent level or lower (Fig.10c -h), including several known biotic (Fig. lOi-1) and abiotic (Fig. lOm-p) stress- responsive genes. The genome-wide data suggest a role for trans-acting factors in the diurnal repression of stress-responsive genes in these hybrids.
[0067] These trans-acting factors are predicted to involve circadian-clock regulators, as the clock is known to regulate stress-responsive gene expression. Indeed, DEGs in the hybrids included circadian-regulated genes (Table 2), which were significantly enriched with the evening element (p=0.018) and CIRCADIAN CLOCK ASSOCIATED1 (CCA1, At2g46830)-binding site (p<10) (Table 7). The circadian clock regulators, CCA1 and LATE ELONGATED HYPOCOTYL (LHY, Atlg01060), were repressed in the middle of the day and upregulated around dawn (Fig. l la,b), and their feedback regulator TOC1 (At5g61380) showed the opposite expression changes (Fig. 11c), consistent with previous results. As a result of the clock regulation, the phases of up- and down-regulated DEGs in the hybrids at ZTO and ZT6 were clustered in the middle of the day and towards dawn, respectively (Fig. l ld-i). Hence, the expression of many circadian clock-associated genes and stress-responsive genes is coordinately changed, which promotes growth vigor in the hybrids.
Table 2. Percentage of DEGs in hybrids, which are circadian-regulated
Genotype_Time % circadian regulated p-value
MPV ZTO 16.17% N/A
Col x C24_ZT0 33.62% 7.21E-13
C24 x Col_ZT0 27.54% 8.88E-06
MPV_ZT6 16.08% N/A
Col x C24_ZT6 45.97% < 2.2e-16
C24 x Col_ZT6 36.53% < 2.2e-16
MPV_ZT15 16.64% N/A
Col x C24_ZT15 30.65% 2.83E-05
C24 x Col_ZT15 30.00% 0.0003352
Note: p-values were calculated using chi-square test of independence.
Example 2: Circadian rhythms and stress responses in Arabidopsis
[0068] Expression level changes in certain stress-responsive genes among different ecotypes may result from plants experiencing different stresses during the day and night, leading to natural variation. To determine natural variation of stress-responsive gene expression between ecotypes, we used two well-characterized biotic (ACD6) and abiotic (COR78) stress-responsive genes as examples in stable transgenic plants expressing a promoter:luciferase (LUC) reporter. ACD6:LUC and COR78:LUC displayed rhythmic activities in both Col and C24 ecotypes (Fig. 2c ,e) and showed natural variation in trans gene activity between Col and C24, consistent with the expression of endogenous genes (Fig. 2a,b). ACD6(C24):LUC in C24 was expressed at higher levels than ACD6(Col):LUC in Col (Fig. 2c). Likewise, COR78(Col):LUC in Col was expressed at higher levels than COR78(C24):LUC in C24 (Fig. 2e). Notably, the expression differences between the ecotypes were amplified when they were expressed in reciprocal combinations. For instance, ACD6(Col):LUC expression amplitudes in C24 were 10- 15 -fold higher than ACD6(C24):LUC levels in Col (Fig. 2d). COR78(C24):LUC amplitudes in Col were 7-8 fold higher than COR78(Col):LUC in C24 (Fig. 2f). Thus, genetic backgrounds could act as transacting factors to mediate rhythmic expression peaks of these stress-responsive genes, probably through altered binding of regulatory factors such as the clock proteins or other upstream regulators to the promoters between the ecotypes (Table 3).
Table 3. SNPs between Col and C24 ecotypes in ACD6 and COR78
ACD6 promoter
Position (bp) Col C24
8292298 T C
8292361 G A
8293280 A G
8293767 C A
8293798 C T
8293903 A C
8294012 C T
ACD6 coding region
Position (bp) Col C24
8296397 A G
8296493 A G
8296559 A G
8296617 T C
8296646 G A
8296650 T G
8296709 G A
8296909 A G
8296951 A G
8297194 C G
8297414 A T
8297500 G T
8297531 A G
8297960 T C
8298037 T C
8298049 T G
8298255 T G
COR78 promoter
N/A No SNPs
COR78 coding region
Position (bp) Col C24
21258687 G T
Note: SNP data was obtained from the Arabidopsis 1001 genomes database (hitp://" i001 genomes. org/).
[0069] Tests were conducted to determine whether stress conditions affect rhythmic expression and if the clock regulates expression of stress-responsive genes in the clock mutants as in the wild-type. Since the clock mutants, namely, ccal-1, lhy21, and ccal-1 llhy21, are in the Ws ecotype background, Ws was used as the wild-type for comparison to the clock mutants. Salicylic acid (SA), a plant hormone that triggers biotic stress responses, induced elevated arrhythmic expression of ACD6(Ws):LUC in the transgenic plants (Fig. 3a). Likewise, cold-shock transiently induced COR78(Ws):LUC expression, but the induction was rhythmic and remained for -36 hours (Fig. 3b). In the absence of stress, the period of ACD6(Ws):LUC activity (24.26+0.30 s.e.m., 20 n=16 individuals per transgenic line) was nearly normal in the ccal-11 or lhy21 mutant, but was shortened by ~1 hour in the ccal- llhy21 double mutant (23.17+0.41, p<0.05) (Fig. 3c). However, both the expression amplitudes and periods of COR78(Ws):LUC were severely altered in the single (ccal-11, 23.73+0.51 ; lhy21 24.14+0.30, p < 0.05) or double (22.61+0.66, p < 0.05) mutant (Fig. 3e). Under stress conditions, SA-mediated induction of ACD6(Ws):LUC was hindered in the double mutant, but not in the single mutants (Fig. 3d). Induction of COR78(Ws):LUC after cold-shock was compromised in all mutants tested (Fig. 3f). These data indicate that the clock regulators, CCAl and LHY together, or CCAl alone, mediate expression amplitudes and periods of these biotic and abiotic stress-responsive genes in stress and non-stress conditions, as previously suggested.
Example 3: Stress-responsive expression as a predictor for heterosis
[0070] The diurnal regulation of stress-responsive genes could provide a basis for natural variation among diverse ecotypes tested (Fig. 4a,b, Table 4, and Fig. 12a-d), which is consistent with their wide-geographical distributions. For example, in C24 (Coimbra, Portugal) and Cvi (Cape Verde Islands), abiotic genes were poorly expressed (Fig. 4a,b and Fig. 12c,d), but biotic genes were highly expressed at ZT18, which correlated with higher SA levels and more necrotic lesions on mature leaves in C24 than in Col 15 (Fig. lc). This is because these ecotypes are adapted to warmer environments with relatively more pathogens 40. However, in Col (Columbia, USA), Ler (Germany), and Ws (Russia), where the plants are presumably adapted to colder climates, COR78 and COR47 was highly expressed at ZT9 (Fig. 4b and Fig. 12d), but ACD6 and PR1 were poorly expressed (Fig. 4a and Fig. 12c). Interestingly, no ecotype tested showed low expression levels of both biotic and abiotic stress-responsive genes, indicating that the basal level of stress responses reflects a genetic basis for a given ecotype's adaptation to its local environment. Thus, the overall repression of stress-responsive genes of both parental origins is unique in the hybrids, which could affect heterosis. This also suggests that natural variation in stress responsive-gene expression between parents could be used to predict the level of heterosis. Table 4. Biomass and gene expression values used for regression analysis
Figure imgf000027_0001
are relative to ACT7 and are an average of three biological replicates. The rows containing the parental gene expression ratio shows the absolute value of the log2 fold change in expression level between parents. [0071] To test the relationship between natural variation of stress responses and heterosis in hybrids, a regression analysis was performed between the mean increase in biomass relative to the mid-parent value as the dependent variable and the expression level difference for a given stress-responsive gene between the parents at different time points as the independent predicting variable (Fig. 4c-e, Table 4, and Fig. 12e-p). It was determined that expression differences of the stress-responsive genes between parental ecotypes at certain times of day, including ACD6 at ZT18, COR78 at ZT9, and COR47 at ZT9 (Fig. 4c-e), were significantly correlated with biomass heterosis (p<0.05, Table 8). This indicates that the timing of measurement of expression in the parents is relevant to predicting the level of heterosis based on expression differences of stress-responsive genes. Using data from an independent study, quantitative trait loci (QTL) for biomass heterosis were compared with the DEGs in the hybrids (Table 5). The DEGs overlapped significantly with two QTL regions using both hypergeometric and non-parametric randomization tests (p=0.01). Moreover, many stress- responsive genes including COR15A and PR2, both of which were down-regulated in the hybrids, coincided within the QTL regions, suggesting a potential role of these candidate genes underlying the QTL of biomass heterosis.
Table 5. Genes in common between biomass quantitative trait loci (QTLs) and differentially expressed genes (DEGs)
Figure imgf000029_0001
Note: The table shows the overlap between all DEGs in hybrids (982 total) and QTL regions for dry weight at day 15 (DW15) from Meyer et al 2010. QTL regions were identified in the RILs and verified in the ILs (See Supplementary Table 5 in Meyer et al 2010).
[0072] According to the hypothesis that genetic distance plays a role in heterosis, higher levels of heterosis could be obtained from the parents with larger expression differences in stress-responsive genes. For example, the hybrids between Col and C24 with larger COR78 and ACD6 expression differences (Fig. 2) displayed higher heterosis (Fig. la). Using this concept, two additional high-vigor Fl hybrids (C24XLer and C24XWs) were predicted (Fig. 5a-d), which correlated with larger ACD6 and COR78 expression differences between the parents (C24 vs. Ler and C24 vs. Ws) (Fig. 4a,b). In contrast, if the parents had similar levels of ACD6 and COR78 expression (for example, Col vs. Ws and Col vs. Ler) (Fig. 13a-d), their Fl hybrids displayed relatively low levels of heterosis (ColXWs and ColXLer) (Fig. 5e,f and Fig. 12e,f). Moreover, in the high-vigor hybrids, both COR78 and ACD6 were repressed at most time points (Fig. 12g-j), whereas in low-vigor hybrids, COR78 and ACD6 were generally repressed but also upregulated at several time points (Fig. 12a-d). Another Fl hybrid (EstXCol) displayed high biomass heterosis (Fig. 12k), which correlated with repression of both ACD6 and COR78 (Fig. 121,m). Example 4: Hybrids have a timed stress-response strategy
[0073] It is paradoxical that in the absence of stress, stress-responsive genes were repressed in the hybrids, and yet hybrids are generally more tolerant than parents to stresses. To address this paradox, growth vigor and stress responses were tested in the hybrids and their parents during short- and long-term stress treatments. After short-term cold shock treatment at ZTO or ZT15 (see Methods and Fig. 14), both COR78 and COR15A transcripts were transiently induced in ColXC24 hybrids and their parents (Fig. 15a-d). Cold-treatment caused a greater increase in gene expression at ZT15 than at ZTO (Fig. 15, a vs. b and c vs. d) due to gating of induction by the circadian clock and diurnal regulation of stress responses. Interestingly, higher than MPV induction of stress-responsive genes in the hybrids occurred only at some specific time points (e.g., COR15A at ZT3 and ZT9 and COR78 at ZT9). Similarly, after SA- treatment, both ACD6 and PR1 were also expressed at higher levels at ZT15 than at ZTO (Fig. 15e-h). In the hybrids, induction of PR1 and ACD6 was delayed for a few hours after SA treatment, but ultimately reached a level higher than the MPV at several time points.
[0074] Under long-term stress (cold or SA) conditions (see Methods and Fig. 14), hybrids maintained higher relative growth rates (RGR) than their parents (Fig. 4f-i). After removal from stress conditions the RGR of hybrids accelerated more than that of the parents, consistent with increased protection from freezing damage during cold stress. As a result, hybrids accumulated more biomass than parents (Fig. 15i,j). Hybrids also showed higher than MPV induction of cold-responsive genes at certain times after two weeks growing in the cold, although this trend was less obvious after the long-term treatment with SA (Fig. 15k-n). These data collectively suggest that stress-responsive genes, which are normally repressed in the hybrids, can be rapidly induced at certain time points under the stress, which we propose may preserve energy and metabolism to promote growth in the presence of stress. This is reminiscent of the trade-off between growth and fitness in diploids.
Example 5: Effects of stress-responsive genes on biomass
[0075] It is well established that constitutive defense responses decrease biomass, growth rate, and seed production, and R-genes reduce fitness in the absence of pathogens. To determine if the repression of stress-responsive genes in the hybrids could promote growth vigor, the effects of repressing and overexpressing ACD6 and COR78 on biomass in Col and C24 ecotypes was investigated (Fig. 5g-m). The dominant negative mutant acd6-l accumulated less biomass than the wild-type due to the production of higher amounts of SA and spontaneous cell death (Fig. 5g). Conversely, knockdown of ACD6 (amiACD6) using artificial microRNAs (amiRNA) showed a modest but non-significant increase in biomass relative to Col (Fig. 5h), whereas amiACD6 in C24 showed significant increases in biomass (Fig. 5i). This is probably because the basal expression level of ACD6 is low in Col, and SA levels are naturally elevated in C24. Overexpressing COR78 in either Col or C24 caused biomass reductions at statistically significant levels (Fig. 51,m), and repressing COR78 increased biomass in Col but not in C24 (Fig. 5j,k). This is likely because the basal expression level of COR78 is low in C24, and expression levels of cold stress-responsive genes are high in Col. Thus, repressing COR78 has a smaller effect in C24 than in Col. Biomass increase or reduction in individual transgenic lines was anti-correlated with expression levels of ACD6 and COR78, respectively (Fig. 5n-p). Thus, reducing or increasing expression of a single stress-responsive gene in diploids can alter biomass, and simultaneous suppression of many of these genes in hybrids could lead to biomass heterosis.
Example 6: Epigenetic reprogramming of hybrids
[0076] The available data indicate that natural variation and circadian regulation of stress- responsive gene expression is correlated with heterosis. Different ecotypes experience diurnal and seasonal changes in their corresponding environments, leading to differences in circadian regulation of stress-responsive gene expression. The hypothesis was tested that, over time, "long-term" adaptation to the local environment results in genetic and epigenetic variation between parents, which is reprogrammed in hybrids to change the expression of circadian regulators and stress-responsive genes, and possibly metabolites, leading to heterosis. Consistent with the role of epigenetic variation in heterosis, the overall levels of CG, CHG and CHH (H = A, T, or C) methylation in many genes, including biotic and abiotic stress- responsive genes (Fig. 6a,b), were generally increased in hybrids compared to parents (Fig. 6c-k). These results are reminiscent of dynamic changes in transposon methylation that can regulate the expression of neighboring genes in response to biotic stress and of changes in CHH methylation that mediate circadian gene expression and heterosis in reciprocal Fl hybrids. In DNA methylation mutants, the circadian-clock genes, CCA1 and LHY, and stress-responsive genes, including ACD6 and PRl, are upregulated, indicating repression of these genes by DNA methylation. Consequently, increased methylation levels in hybrids selectively repress stress-responsive genes. [0077] On the basis of these findings, a general role is proposed for the repression of stress- responsive genes by both epigenetic mechanisms and circadian clock regulators in hybrids to promote biomass heterosis under non-stress conditions. Under stress conditions, hybrids induce expression of repressed stress-responsive genes at certain times of the day to combat the effects of stress and recover faster than their parents after stress conditions are removed. This role for the timing of stress responses in biomass heterosis is reminiscent of the connection between altered clock gene expression and growth vigor in Arabidopsis allopolyploids and diploids. In particular, repressing CCA1 expression peaks in TOCl: :ccal(RNAi) transgenic plants during the day increases starch content and biomass, while overexpressing T0C1 ::CCA1 in the transgenic plants decreases starch content and biomass. These findings provide a direct link between circadian regulators and biomass heterosis through promoting the clock output pathways of photosynthesis and starch metabolism. These data suggests that this clock-heterosis link involves another clock output pathway, namely, stress-responses. In addition to regulation by the circadian clock, stress responsive genes are epigenetically regulated in the hybrids.
[0078] Balancing stress-response to promote heterosis can explain heterosis as well as hybrid necrosis (Fig. 7). Hybrid necrosis, as previously reported, was likely caused by the induction of stress-responsive genes. Indeed, expression of several stress-responsive genes including PR1, PR2, and PRS is elevated in these necrotic hybrids. However, the higher- vigor hybrids have a better-timed stress-response strategy whereby stress-responsive genes are generally repressed under non-stress conditions and selectively induced at certain times under the stress, thus balancing the tradeoff between a rapid requirement for stress responses and long- term maintenance of growth vigor. This stress-response strategy is inherited from adaptively divergent ecotypes, with more competitive species having lower levels of constitutive expression of stress-responsive genes but higher levels of inducible resistance. Hybrids may simply have exploited this adaptive response. Hybrid plants recovered faster than their parents after encountering stresses, suggesting that hybrids have a higher potential to promote growth by regulating stress responses under both stress and non-stress conditions. Using stress responsive genes in several time points, the biomass heterosis based was accurately predicted by their expression levels between different pairs of parental lines. This link between natural variation, circadian regulation of stress-responsive genes and heterosis provides a method of selecting parents to improve hybrid production of plants and animals. Table 6. List of differentially expressed genes (DEGs) in hybrids between C24 and Col at ZTO, ZT6, and ZT15
Figure imgf000033_0001
171.3832
AT5G55450.1 46.4321 1.884031342 8.864736 7.67E-19 4.28862E-16 4.28862E-16
1
AT5G08760.1 156.9006 39.3351 1.995961713 8.805219 1.31E-18 7.15752E-16 7.15752E-16
193.6132
AT1G72930.1 59.82 1.694477872 8.772977 1.74E-18 9.34944E-16 9.34944E-16
5
ATCGOl 180.1 953.6365 624.501 0.610735573 8.738779 2.36E-18 1.2418E-15 1.2418E-15
AT3G63160.1 834.9635 1251.65 -8.675992 4.10E-18 2.11966E-15 2.11966E-15
0.584046159
AT5G17920.1 643.7895 1012.39 -0.65310421 -8.671221 4.28E-18 2.16947E-15 2.16947E-15
AT5G13930.1 272.441 521.067 -8.609819 7.32E-18 3.64588E-15 3.64588E-15
0.935525057
AT2G38540.1 721.902 1107.59 -8.604886 7.64E-18 3.73818E-15 3.73818E-15
0.617549027
AT1G75040.1 134.8691 30.3642 2.151116584 8.555388 1.17E-17 5.64758E-15 5.64758E-15
114.5984
AT5G44568.1 20.9744 2.4498864 8.51371 1.68E-17 7.82405E-15 7.82405E-15
75
151.0934
AT5G49360.1 39.4663 1.936747943 8.474792 2.36E-17 1.07557E-14 1.07557E-14
5
68.99072
AT1G65960.1 0 7.385301513 8.396417 4.60E-17 2.03449E-14 2.03449E-14
5
AT1G64770.2 63.37355 0 6.599604979 8.244165 1.66E-16 7.23429E-14 7.23429E-14
AT3G16240.1 897.3015 596.715 0.58855078 8.214911 2.12E-16 9.09099E-14 9.09099E-14
AT1G21250.1 100.4144 17.3973 2.529030848 8.111644 4.99E-16 2.04252E-13 2.04252E-13
AT1G44575.1 796.1525 1171.49 -8.023658 1.03E-15 4.01815E-13 4.01815E-13
0.557227934
141.5520
AT5G54610.1 38.9761 1.860670998 7.990298 1.35E-15 5.19549E-13 5.19549E-13
5
AT2G 18660.1 70.84787 6.21963 3.509823817 7.951095 1.85E-15 6.93975E-13 6.93975E-13
AT5G54270.1 788.598 1147.09 -7.711238 1.25E-14 4.55267E-12 4.55267E-12
0.540616632
104.5118
AT1G15690.2 251.059 -7.696117 1.40E-14 5.05743E-12 5.05743E-12
65 1.264359706
AT5G24530.1 87.90475 14.8102 2.569350001 7.655411 1.93E-14 6.76979E-12 6.76979E-12
AT1G72930.2 148.6832 46.4299 1.679115565 7.63969 2.18E-14 7.55302E-12 7.55302E-12
52.04808
AT2G24790.2 0 6.232964678 7.521122 5.43E-14 1.86026E-11 1.86026E-11
5
AT5G59890.2 0 52.3849 -7.483181 7.25E-14 2.45425E-11 2.45425E-11
6.072965409
AT1G56120.1 57.44258 3.82696 3.907849822 7.433484 1.06E-13 3.53478E-11 3.53478E-11
AT3G29240.2 287.539 140.079 1.037516958 7.418725 1.18E-13 3.90421E-11 3.9042 IE- 11
AT1G09310.1 563.933 853.757 -7.330523 2.29E-13 7.47895E-11 7.47895E-11
0.598301734
AT3G29240.1 281.814 138.41 1.025795104 7.278667 3.37E-13 1.07425E-10 1.07425E-10
AT1G04040.1 258.055 456.789 -7.204214 5.84E-13 1.83882E-10 1.83882E-10
0.823849325
AT5G45775.1 48.698 0 6.821822772 7.18689 6.63E-13 2.06406E-10 2.06406E-10
AT3G17390.1 252.017 445.662 -7.104898 1.20E-12 3.66627E-10 3.66627E-10
0.822428898
AT3G16370.1 343.0555 559.223 -6.917854 4.59E-12 1.35111E-09 1.35111E-09
0.704981701
AT3G26060.1 496.6235 752.205 -6.887753 5.67E-12 1.65235E-09 1.65235E-09
0.598973365
AT4G 14400.1 87.08665 19.8483 2.133436131 6.839911 7.92E-12 2.28576E-09 2.28576E-09
AT3G23810.1 159.5375 310.494 -6.800591 1.04E-11 2.9741E-09 2.9741E-09
0.960669814
48.83483
AT1G57720.2 3.78518 3.68947681 6.7236 1.77E-11 4.95738E-09 4.95738E-09
5
AT1G22930.2 40.75225 0 5.779820388 6.677983 2.42E-11 6.63847E-09 6.63847E-09
AT3G11945.2 0 41.6028 -5.64437038 -6.673383 2.50E-11 6.78216E-09 6.78216E-09 44.51555
AT1G13470.1 2.72981 4.027437065 6.604207 4.00E-11 1.06326E-08 1.06326E-08
4
582.4196
AT1G31580.1 843.076 -6.526891 6.71E-11 1.75245E-08 1.75245E-08
45 0.533603672
ATCG00020.1 80.63565 18.8952 2.093398024 6.504905 7.77E-11 2.00979E-08 2.00979E-08
AT5G37260.1 513.717 334.83 0.617545021 6.472945 9.61E-11 2.43863E-08 2.43863E-08
AT4G 14400.3 78.4433 18.0911 2.116370098 6.459482 1.05E-10 2.64129E-08 2.64129E-08
AT2G05070.1 380.147 590.189 -6.443349 1.17E-10 2.91134E-08 2.91134E-08
0.634619626
AT1G66970.1 396.5445 243.271 0.704918425 6.356111 2.07E-10 5.10846E-08 5.10846E-08
AT4G 14400.2 74.82275 17.3254 2.11058833 6.297965 3.02E-10 7.24925E-08 7.24925E-08
80.03337
AT1G72910.1 20.1556 1.989421018 6.275407 3.49E-10 8.30957E-08 8.30957E-08
5
AT1G04430.2 35.78905 0 5.613820815 6.256759 3.93E-10 9.28539E-08 9.28539E-08
AT5G20630.1 350.177 545.662 -6.24406 4.26E-10 9.98584E-08 9.98584E-08
0.639923249
AT3G60420.1 61.95607 11.4365 2.437600033 6.242145 4.32E-10 1.00233E-07 1.00233E-07
AT1G19960.1 80.94655 20.9954 1.946896319 6.223958 4.85E-10 1.11631E-07 1.11631E-07
AT1G12090.1 81.92595 184.516 -1.17135352 -6.199355 5.67E-10 1.29468E-07 1.29468E-07
34.66080
AT5G40890.2 0 5.167025653 6.126398 8.99E-10 1.98651E-07 1.98651E-07
5
39.91199
AT2G05540.1 2.93739 3.764215662 6.120709 9.32E-10 2.04228E-07 2.04228E-07
5
AT3G47370.3 0 34.5368 -6.0692 1.29E-09 2.79574E-07 2.79574E-07
6.193382566
AT4G13510.1 86.51895 25.2621 1.776041584 6.055394 1.40E-09 3.0224E-07 3.0224E-07
AT5G03350.1 60.1157 11.6823 2.36341748 6.041106 1.53E-09 3.27682E-07 3.27682E-07
AT5G42100.2 34.4656 1.48951 4.532247416 5.98665 2.14E-09 4.55031E-07 4.55031E-07
AT1G67870.1 567.521 394.117 0.526049797 5.936905 2.90E-09 6.12254E-07 6.12254E-07
AT2G40100.1 199.685 341.719 -5.897282 3.70E-09 7.7301E-07 7.7301E-07
0.775084502
AT1G29070.1 494.5855 710.446 -5.870197 4.35E-09 8.96835E-07 8.96835E-07
0.522505052
AT2G44120.2 8.63801 52.7006 -5.837352 5.30E-09 1.08461E-06 1.08461E-06
2.609048495
30.95762
AT3G17510.2 0 5.877117413 5.818922 5.92E-09 1.1847E-06 1.1847E-06
35
22.99125
AT3G09820.2 80.6454 -5.724347 1.04E-08 2.047E-06 2.047E-06
5 1.810507026
162.4307
AT1G55330.1 287.074 -5.696754 1.22E-08 2.39012E-06 2.39012E-06
5 0.821597896
AT3G48640.1 38.6603 4.06748 3.248645676 5.692066 1.26E-08 2.43929E-06 2.43929E-06
AT2G38230.1 390.9695 254.156 0.621341776 5.675915 1.38E-08 2.64352E-06 2.64352E-06
AT2G46440.1 54.05935 10.8745 2.313595097 5.658143 1.53E-08 2.91193E-06 2.91193E-06
21.57527
AT1G02205.2 76.6937 -5.623856 1.87E-08 3.52915E-06 3.52915E-06
5 1.829729124
AT4G38550.1 160.5464 77.4153 1.052299688 5.605496 2.08E-08 3.8976E-06 3.8976E-06
AT1G01060.2 250.9395 144.859 0.79269026 5.573683 2.49E-08 4.64935E-06 4.64935E-06
AT2G31880.1 69.6876 19.4327 1.842415606 5.569738 2.55E-08 4.72372E-06 4.72372E-06
AT3G51860.1 98.75402 36.5954 1.432177163 5.559832 2.70E-08 4.96627E-06 4.96627E-06
AT3G27690.1 205.449 339.993 -5.546477 2.91E-08 5.28975E-06 5.28975E-06
0.726724735
AT5G24210.1 156.7978 75.5965 1.052513971 5.54055 3.02E-08 5.43596E-06 5.41274E-06
AT1G49750.1 237.609 135.322 0.812193078 5.533304 3.14E-08 5.5919E-06 5.5919E-06
100.8057
AT5G17230.2 195.917 -5.39198 6.97E-08 1.2163E-05 1.2163E-05
5 0.958664655 AT5G10140.2 0 26.7327 -5.336438 9.48E-08 1.64401E-05 1.64401E-05
6.244617498
26.51290
AT2G03680.2 0 6.578973158 5.334817 9.56E-08 1.64833E-05 1.64833E-05
3
106.9263
AT2G39570.1 44.0233 1.280278223 5.322925 1.02E-07 1.73799E-05 1.73799E-05
5
AT1G24147.1 68.21087 21.088 1.693579388 5.205106 1.94E-07 3.22003E-05 3.22003E-05
AT3G62290.1 424.7795 293.481 0.533447037 5.197502 2.02E-07 3.33432E-05 3.33432E-05
AT1G44575.2 363.722 526.853 -5.167806 2.37E-07 3.88661E-05 3.88661E-05
0.534564293
AT3G02470.1 274.837 170.98 0.684748661 5.164208 2.41E-07 3.93852E-05 3.93852E-05
AT1G56280.1 259.6525 160.063 0.697942262 5.100365 3.39E-07 5.49681E-05 5.49681E-05
AT3G61430.2 274.454 172.013 0.674046764 5.092859 3.53E-07 5.65213E-05 5.65213E-05
AT1G64500.1 320.509 210.531 0.606332188 5.033693 4.81E-07 7.53377E-05 7.53377E-05
AT5G54710.1 113.5198 51.3931 1.14329737 5.029547 4.92E-07 7.65477E-05 7.65477E-05
230.6922
AT3G14210.1 358.291 -5.023831 5.07E-07 7.84171E-05 7.84171E-05
5 0.635162266
23.01831
AT3G02560.2 0 5.941842243 5.015986 5.28E-07 8.12271E-05 8.12271E-05
55
AT3G57260.1 69.732 23.4044 1.57504108 5.002758 5.65E-07 8.65196E-05 8.65196E-05
AT2G24200.2 52.2909 13.6058 1.942338114 4.994795 5.89E-07 8.96662E-05 8.96662E-05
AT5G10760.1 59.45502 17.6958 1.748391642 4.966618 6.81E-07 0.000103148 0.000103148
124.5248
AT5G03240.2 59.8018 1.058172859 4.958404 7.11E-07 0.000107014 0.000107014
5
41.26470
AT3G50470.1 8.2487 2.322669654 4.954745 7.24E-07 0.000108452 0.000108452
5
ATCG00960.1 45.9658 10.5839 2.118689514 4.947975 7.50E-07 0.000111682 0.000111682
AT2G36830.1 289.9395 429.607 -4.941137 7.77E-07 0.000115045 0.000115045
0.567265608
AT2G30520.2 37.51625 6.76536 2.471277018 4.894965 9.83E-07 0.000144083 0.000144083
AT4G38810.1 0 22.3198 -4.817873 1.45E-06 0.000208172 0.000208172
4.864075199
AT3G19030.1 332.064 224.782 0.562934812 4.810701 1.50E-06 0.000214659 0.000214659
AT3G45140.1 231.9285 353.562 -4.790882 1.66E-06 0.000233347 0.000233347
0.608283113
114.0330
AT2G29400.1 54.4958 1.065235068 4.769835 1.84E-06 0.00025778 0.00025778
5
AT4G19200.1 285.5205 187.329 0.608020076 4.762116 1.92E-06 0.000266482 0.000266482
105.4080
AT1G64770.1 189.357 -4.744741 2.09E-06 0.000287489 0.000287489
5 0.845123705
21.61947
AT2G30766.1 65.6063 -1.60150287 -4.724797 2.30E-06 0.000315607 0.000315607
5
AT5G17310.1 0 20.7333 -4.712765 2.44E-06 0.000333168 0.000333168
5.770089403
AT5G11740.1 184.7765 291.719 -4.691011 2.72E-06 0.000366982 0.000366982
0.658798068
AT5G21020.2 203.471 122.787 0.728665363 4.680228 2.87E-06 0.000384926 0.000384926
AT4G13930.1 203.2735 314.319 -4.661021 3.15E-06 0.000418553 0.000418553
0.628807334
AT2G44290.1 88.3886 38.4574 1.200599079 4.608604 4.05E-06 0.00053665 0.00053665
AT5G15230.2 0 20.287 -4.58388 4.56E-06 0.000598442 0.000598442
4.805591229
AT3G02470.4 213.7805 324.954 -4.562984 5.04E-06 0.000654967 0.000654967
0.604105243
AT1G78370.1 267.146 390.688 -4.56103 5.09E-06 0.000657974 0.000657974
0.548388528
AT4G23170.1 35.79804 7.43065 2.268320278 4.550972 5.34E-06 0.000686988 0.000686988
AT2G28000.1 284.429 410.728 -4.525805 6.02E-06 0.000766851 0.000766093
0.530114734 AT3G08030.2 18.8735 0 5.219092044 4.525033 6.04E-06 0.000766093 0.000766093
AT3G18490.1 240.167 154.837 0.633287672 4.520372 6.17E-06 0.000779548 0.000779548
AT1G21310.1 45.48745 12.6007 1.851964679 4.515327 6.32E-06 0.000794677 0.000794677
AT1G02205.1 13.39814 48.3486 -4.502136 6.73E-06 0.000841784 0.000841784
1.851441383
AT3G18410.2 23.48501 66.0838 -1.49255644 -4.497167 6.89E-06 0.000857774 0.000857774
19.06896
AT1G48450.2 0 4.649081679 4.475494 7.62E-06 0.000941018 0.000937454
85
36.26389
AT4G35450.4 86.3329 -4.475345 7.63E-06 0.000937454 0.000937454
5 1.251376562
AT5G59670.1 47.34948 13.9064 1.767599589 4.465194 8.00E-06 0.000978632 0.000978632
243.9390
AT5G63160.1 159.033 0.617194563 4.45775 8.28E-06 0.001008726 0.001008726
5
AT3G16520.2 0 18.6479 -4.434901 9.21E-06 0.00111691 0.00111691
5.111278493
AT1G67860.1 98.82745 47.325 1.06230931 4.430812 9.39E-06 0.001133286 0.001133286
AT5G10140.3 0 18.4917 -4.411873 1.02E-05 0.001226316 0.001226316
6.600416813
AT1G08450.1 106.3937 53.8889 0.981352682 4.316964 1.58E-05 0.001876571 0.001876571
AT5G21940.1 111.3664 57.5503 0.952418673 4.312011 1.62E-05 0.001910843 0.001910843
AT3G16770.1 90.2963 42.6029 1.083715234 4.30219 1.69E-05 0.001980488 0.001980488
186.9533
AT2G47730.1 115.842 0.690519907 4.289131 1.79E-05 0.002091652 0.002091652
5
AT2G32870.1 52.3485 18.072 1.534392023 4.254682 2.09E-05 0.002420559 0.002420559
AT2G07180.1 65.92335 26.8164 1.297673983 4.222174 2.42E-05 0.002774203 0.002774203
103.6963
AT3G02770.1 53.0562 0.966771858 4.211115 2.54E-05 0.002901447 0.002901447
5
AT1G04430.1 38.18775 85.6231 -1.16489015 -4.203648 2.63E-05 0.002986447 0.002986447
75.19192
AT5G66052.1 33.1597 1.181146724 4.19762 2.70E-05 0.00305435 0.00305435
2
AT5G59890.1 141.467 81.7258 0.791602055 4.179953 2.92E-05 0.003288012 0.003288012
15.92978
AT5G28050.2 0 5.770030105 4.175208 2.98E-05 0.003343551 0.003343551
95
115.2520
AT4G37800.1 190.328 -4.13368 3.57E-05 0.003913145 0.003913145
5 0.723695406
AT2G41410.1 81.27165 38.0377 1.09532217 4.115747 3.86E-05 0.004196663 0.004196663
AT5G19120.1 58.0915 22.5763 1.363518019 4.112684 3.91E-05 0.004235938 0.004235938
45.04706
AT2G04450.1 14.5981 1.625652503 4.111409 3.93E-05 0.004242628 0.004242628
5
AT3G47370.1 100.4849 51.7838 0.95640598 4.109687 3.96E-05 0.004257624 0.004257624
AT4G25100.4 55.5167 21.0502 1.399087874 4.097735 4.17E-05 0.004465975 0.004465975
52.02938
AT5G36700.3 104.305 -4.091979 4.28E-05 0.004560498 0.004560498
5 1.003409758
119.6499
AT1G01060.3 66.2419 0.853003835 4.087401 4.36E-05 0.004633368 0.004633368
5
AT2G44120.1 100.9012 52.3321 0.947175274 4.086216 4.38E-05 0.004639102 0.004639102
AT1G21270.1 50.61175 18.1258 1.481427688 4.079207 4.52E-05 0.004762814 0.004762814
AT3G47480.1 27.38465 5.36984 2.350416434 4.064303 4.82E-05 0.005058133 0.005058133
17.79924
AT2G45660.1 1.37645 3.692791937 4.060438 4.90E-05 0.005122967 0.005122967
5
AT5G42080.2 0 16.9984 -4.050554 5.11E-05 0.00532394 0.00532394
4.133182121
AT5G01015.1 37.3 82.16 -4.042615 5.29E-05 0.005486669 0.005486669
1.139260551
AT5G16110.1 97.16485 50.1273 0.954837976 4.035896 5.44E-05 0.005624777 0.005624777
56.48328
AT3G57520.1 22.1192 1.352524789 4.031051 5.55E-05 0.005720415 0.005720415
5 AT2G41100.1 70.8626 31.7054 1.160295822 4.019367 5.84E-05 0.005989128 0.005989128
AT3G25770.1 64.73805 120.424 -3.982575 6.82E-05 0.006944747 0.006944747
0.895437129
14.41986
AT4G25030.2 0 5.75904041 3.972438 7.11E-05 0.007220256 0.007200565
7
AT5G17230.3 146.5025 88.3957 0.728877187 3.972208 7.12E-05 0.007200565 0.007200565
AT5G15850.1 162.436 101.107 0.683988523 3.966248 7.30E-05 0.007355778 0.007355778
AT5G41700.1 114.1155 63.4843 0.846023007 3.965003 7.34E-05 0.007367178 0.007367178
AT2G40000.1 38.24575 11.4828 1.735824964 3.963898 7.37E-05 0.007374398 0.007374398
1.049671
AT3G47810.2 16.6027 -3.958396 7.55E-05 0.00751887 0.00751887
5 3.983408073
53.48717
AT3G57520.3 20.7402 1.366763201 3.953289 7.71E-05 0.007653414 0.007653414
5
AT4G34881.1 103.5325 55.9049 0.889037073 3.93251 8.41E-05 0.00831621 0.00831621
52.86118
AT3G57520.2 20.5203 1.365156944 3.926662 8.61E-05 0.008490297 0.008490297
5
18.13819
AT3G56710.1 1.88024 3.270041927 3.909729 9.24E-05 0.009075384 0.009075384
2
31.90283
AT4G14365.1 8.40803 1.923844911 3.877204 0.0001057 0.010304287 0.010301075
5
AT1G14150.2 40.15836 84.1875 -3.876415 0.000106 0.010301075 0.010301075
1.067905687
AT3G52430.1 45.89365 16.5724 1.469512004 3.861773 0.0001126 0.010899933 0.010899933
AT1G23390.1 119.5275 68.8856 0.795068246 3.856019 0.0001152 0.01112025 0.011088453
AT3G11670.2 0 13.6863 -5.30164053 -3.813825 0.0001368 0.013110567 0.013092323
AT1G65960.2 220.68 314.282 -3.813306 0.0001371 0.013092323 0.013092323
0.510103761
157.5342
AT5G53370.1 99.4493 0.663632402 3.808108 0.00014 0.013278055 0.013278055
5
17.58763
AT1G23850.1 1.94192 3.179005455 3.80328 0.0001428 0.013492917 0.013492917
05
AT5G15410.2 20.09229 52.686 -3.802371 0.0001433 0.013496024 0.013496024
1.390777649
AT5G06320.1 79.2979 39.6311 1.000649649 3.785265 0.0001535 0.014360398 0.014360398
AT5G03240.1 141.4455 87.145 0.698756483 3.767899 0.0001646 0.015292503 0.015292503
AT2G28840.1 44.37275 16.2228 1.451651122 3.763667 0.0001674 0.015501168 0.015501168
AT3G04210.1 74.01495 36.3798 1.024679093 3.726641 0.000194 0.017904078 0.017904078
AT1G61250.1 66.235 30.9537 1.0974819 3.721258 0.0001982 0.018228769 0.018228769
46.92701
AT5G20250.3 18.3344 1.35586564 3.680989 0.0002323 0.021221923 0.021220136
5
18.46846
AT2G40750.1 2.62729 2.813416603 3.679316 0.0002339 0.021220136 0.021220136
5
AT2G25520.1 93.58005 51.169 0.870930961 3.676628 0.0002363 0.021374058 0.021374058
109.0306
AT1G09070.1 63.0193 0.790868119 3.666732 0.0002457 0.022072403 0.022049666
5
20.64979
AT1G21520.1 3.61574 2.513764614 3.666159 0.0002462 0.022049666 0.022049666
5
25.02145
AT2G17040.1 5.72093 2.128844088 3.661394 0.0002508 0.02239076 0.02239076
5
21.89316
AT2G39210.1 4.24149 2.367837468 3.649563 0.0002627 0.023371476 0.023371476
5
AT1G73805.1 25.07119 5.8294 2.104611171 3.639155 0.0002735 0.024257752 0.024257752
AT5G20250.2 42.08793 15.5894 1.432841153 3.630791 0.0002826 0.024896558 0.024896558
AT4G05070.1 135.6605 84.443 0.683950976 3.624432 0.0002896 0.02535408 0.02535408
13.99789
AT3G25882.1 1.05854 3.725062509 3.611788 0.0003041 0.026370423 0.026370423
8
AT2G29670.1 42.95285 16.2893 1.398829252 3.603852 0.0003135 0.027103568 0.027103568
AT2G46430.2 14.68468 1.37024 3.421811317 3.584123 0.0003382 0.02905344 0.02905344 14.52849
AT5G25260.1 1.31569 3.464993356 3.58269 0.0003401 0.029122053 0.029110692
1
AT4G28780.1 30.1687 65.8212 -3.581977 0.000341 0.029110692 0.029110692
1.125499798
11.65867
AT1G32550.2 0 5.556828692 3.570095 0.0003569 0.030274958 0.030274958
05
AT5G17300.1 169.682 112.894 0.587864718 3.567533 0.0003604 0.030478011 0.030478011
AT2G41250.1 166.3665 110.247 0.59362556 3.561839 0.0003683 0.031051045 0.031051045
AT2G21187.2 14.09215 1.21001 3.541800861 3.558328 0.0003732 0.031372456 0.031372456
AT2G37600.2 18.74904 3.11703 2.588572782 3.549742 0.0003856 0.032216004 0.032216004
AT5G05360.2 13.0779 0 3.914093394 3.54862 0.0003873 0.03225517 0.03225517
AT5G05580.1 69.853 120.35 -0.78484216 -3.53931 0.0004012 0.033212696 0.033212696
AT1G55910.1 48.88935 20.728 1.237939304 3.508612 0.0004505 0.037179904 0.037179904
AT1G11260.1 81.46365 43.8517 0.893523683 3.502554 0.0004608 0.037808007 0.037808007
AT5G22620.2 3.196995 19.1645 -3.500783 0.0004639 0.037946547 0.037946547
2.583647966
AT4G02220.1 25.41155 6.55252 1.955362619 3.496985 0.0004705 0.038376276 0.038376276
AT1G68440.1 198.8245 138.371 0.52295393 3.495715 0.0004728 0.038444918 0.038444918
AT3G28540.2 19.66845 3.70323 2.409027208 3.493543 0.0004767 0.038530455 0.038530455
AT5G44570.1 13.66375 1.21859 3.487068772 3.483023 0.0004958 0.039958805 0.039958805
AT4G32870.1 53.45735 23.9963 1.155576349 3.480012 0.0005014 0.040174403 0.040174403
AT3G48115.1 14.44465 1.55023 3.219981065 3.466037 0.0005282 0.042198214 0.042111803
ATCG00490.1 37.93395 14.0194 1.436064998 3.45262 0.0005552 0.044096658 0.044096658
AT1G43670.1 81.3995 133.953 -3.445467 0.0005701 0.044890056 0.044890056
0.718635054
1.280390
AT4G11100.2 13.9348 -3.43839 0.0005852 0.045947797 0.045947797
5 3.444036513
AT1G02930.1 63.4848 31.324 1.019142759 3.436556 0.0005892 0.045996528 0.045996528
AT1G22890.1 55.3102 25.6411 1.109087404 3.428607 0.0006067 0.047230263 0.047230263
AT1G65845.1 24.21185 6.1926 1.967096152 3.426629 0.0006111 0.047440767 0.047440767
AT1G35710.1 35.2188 12.5388 1.489946469 3.41691 0.0006334 0.048890267 0.048890267
C24xCol at ZTO
MPV C24xCol log2(Fold_c
Gene Name z-score p-value q-value q-value
RPKM RPKM hange)
AT2G01020.1 1320.29 5833.45 -54.38968 0 0 0
2.143494519
AT1G29930.1 8620.885 12539.5 -25.1443 1.63E-139 1.4998E-135 1.4998E-135
0.540571938
AT3G41768.1 1553.44 3346.65 -24.99893 6.28E-138 4.33E-134 4.33E-134
1.107251159
513.3905
AT2G14610.1 24.828 4.37001684 22.97246 8.79E-117 4.8478E-113 4.8478E-113
7
ATCG01210.1 602.974 1641.09 -21.71599 1.45E-104 6.6592E-101 6.6592E-101
1.444486661
ATCG00920.1 705.1415 1647.43 -1.22423247 -19.05896 5.54E-81 2.18119E-77 2.18119E-77
ATCG00950.1 906.044 1948.43 -19.02615 1.04E-80 3.57139E-77 3.57139E-77
1.104659083
AT2G25510.1 4023.435 2667.04 0.593188263 17.81468 5.44E-71 1.66599E-67 1.66599E-67
AT5G42530.1 3922.185 2604.56 0.590617913 17.52474 9.28E-69 2.55849E-65 2.55849E-65
AT3G12120.2 2.257155 217.043 -15.09695 1.70E-51 3.34099E-48 3.34099E-48
6.587331591
AT1G75750.1 559.408 1182.7 -1.08011138 -14.53863 6.90E^8 1.2679E-44 1.2679E-44
AT1G29920.1 2344.825 3458.31 -13.62408 2.88E^2 4.96472E-39 4.96472E-39
0.560586942 160.3250
AT5G17920.2 4.22705 5.245204599 13.21932 6.79E-M) 1.10109E-36 1.10109E-36
2
AT4G05050.3 1.039953 157.229 -12.61917 1.66E-36 2.53668E-33 2.53668E-33
7.240205201
ATCGOl 180.1 953.6365 1601.37 -12.19442 3.33E-34 4.58997E-31 4.58997E-31
0.747795324
AT3G22231.1 1308.492 796.735 0.715733246 11.853 2.08E-32 2.60267E-29 2.60267E-29
381.0823
AT1G67865.1 135.319 1.49373837 11.33458 8.85E-30 1.06071E-26 1.06071E-26
5
ATCGOl 160.1 249.744 67.3325 1.891075081 10.78273 4.15E-27 4.58218E-24 4.58218E-24
353.1850
AT2G14560.1 128.82 1.455067557 10.70823 9.31E-27 9.87835E-24 9.87835E-24
2
104.5118
AT1G15690.2 0 7.29687573 10.3829 2.97E-25 3.02978E-22 3.02978E-22
65
239.2091
AT1G14880.1 67.768 1.819596475 10.28901 7.90E-25 7.77978E-22 7.77978E-22
5
AT2G41090.1 675.719 365.51 0.886512544 10.13346 3.93E-24 3.73287E-21 3.61828E-21
AT3G16240.1 897.3015 535.676 0.744232163 10.13319 3.94E-24 3.61828E-21 3.61828E-21
AT1G65490.1 324.7945 127.963 1.343800482 9.689885 3.33E-22 2.86911E-19 2.8691 IE- 19
373.3330
AT5G35630.2 703.086 -9.684476 3.51E-22 2.93343E-19 2.93343E-19
6 0.913237897
AT2G05100.1 674.7335 1081.46 -9.173056 4.60E-20 3.52242E-17 3.52242E-17
0.680590608
AT2G28190.1 92.55565 265.555 -9.084052 1.05E-19 7.7971E-17 7.7971E-17
1.520617727
AT2G10940.1 578.3505 917.874 -8.282628 1.20E-16 8.30723E-14 8.30723E-14
0.666352043
AT5G59890.2 0 63.9149 -8.22571 1.94E-16 1.30521E-13 1.30521E-13
6.359966691
AT3G22235.2 74.05175 212.24 -8.114739 4.87E-16 3.19675E-13 3.19675E-13
1.519090846
AT1G75040.1 134.8691 35.2148 1.937306055 8.048485 8.38E-16 5.37631E-13 5.37631E-13
AT3G51600.1 415.613 693.382 -7.927293 2.24E-15 1.40386E-12 1.40386E-12
0.738409604
AT3G16640.1 889.9105 607.65 0.550419663 7.859076 3.87E-15 2.37166E-12 2.37166E-12
AT1G04040.1 258.055 475.994 -7.734057 1.04E-14 6.11269E-12 6.11269E-12
0.883264804
171.3832
AT5G55450.1 59.4632 1.52715677 7.721292 1.15E-14 6.61646E-12 6.61646E-12
1
ATCG00020.1 80.63565 212.923 -7.632563 2.30E-14 1.29526E-11 1.29526E-11
1.400842081
AT4G05050.1 485.539 287.27 0.757179844 7.558548 4.08E-14 2.24821E-11 2.22577E-11
52.04808
AT2G24790.2 0 5.891228072 7.557277 4.12E-14 2.22577E-11 2.22577E-11
5
AT2G10940.2 407.4455 668.332 -7.541889 4.63E-14 2.45672E-11 2.45672E-11
0.713957856
AT2G05070.1 380.147 630.717 -7.484321 7.19E-14 3.7423 lE-11 3.7423 IE- 11
0.730435414
193.6132
AT1G72930.1 77.8413 1.314569978 7.360252 1.84E-13 9.2045 lE-11 9.2045 lE-11
5
179.0094
AT3G56400.1 69.1124 1.373019266 7.308027 2.71E-13 1.33509E-10 1.33509E-10
5
48.83483
AT1G57720.2 1.91114 4.675405251 7.184789 6.73E-13 3.1464E-10 3.1464E-10
5
68.99072
AT1G65960.1 182.561 -7.07953 1.45E-12 6.4341 lE-10 6.4341 lE-10
5 1.403904273
AT1G56120.1 57.44258 5.79389 3.309516349 7.0137 2.32E-12 1.01603E-09 1.01603E-09
AT2G 18660.1 70.84787 11.3959 2.636209613 6.993992 2.67E-12 1.15131E-09 1.15131E-09
AT4G26850.1 674.307 462.123 0.54512868 6.785379 1.16E-11 4.62777E-09 4.62777E-09
AT5G20630.1 350.177 199.967 0.808322393 6.769836 1.29E-11 5.07959E-09 5.07959E-09
ATCGOl 170.1 130.006 44.9598 1.531870685 6.739541 1.59E-11 6.08606E-09 6.08606E-09
AT1G22930.2 40.75225 0 5.788341314 6.689329 2.24E-11 8.35558E-09 8.35558E-09 AT3G62030.2 699.811 487.304 0.522143277 6.667851 2.60E-11 9.54516E-09 9.54516E-09
AT4G02520.1 507.579 327.674 0.631371178 6.653073 2.87E-11 1.0416E-08 1.0416E-08
AT3G12120.1 359.5715 211.917 0.76277935 6.543498 6.01E-11 2.12487E-08 2.12487E-08
AT1G72930.2 148.6832 60.4789 1.297737839 6.388334 1.68E-10 5.78134E-08 5.78134E-08
ATCG00970.1 158.7295 67.9677 1.223649071 6.315829 2.69E-10 9.14929E-08 9.14929E-08
AT3G11945.2 0 37.0903 -6.281999 3.34E-10 1.12417E-07 1.12417E-07
5.478731688
36.26389
AT4G35450.4 1.15537 4.972107044 6.251073 4.08E-10 1.33838E-07 1.33838E-07
5
557.0393
AT1G54040.1 805.464 -6.236803 4.47E-10 1.44905E-07 1.4357E-07
55 0.532040851
AT4G01150.2 586.0575 840.747 -6.236421 4.48E-10 1.4357E-07 1.4357E-07
0.520629507
AT2G44120.1 100.9012 32.6914 1.625960266 6.190838 5.98E-10 1.87553E-07 1.87553E-07
AT5G27850.1 309.2735 180.082 0.780229237 6.181549 6.35E-10 1.96696E-07 1.96696E-07
AT3G47370.1 100.4849 33.1822 1.598497276 6.105233 1.03E-09 3.14556E-07 3.14556E-07
AT3G09500.1 268.0005 149.878 0.838447061 6.100461 1.06E-09 3.20532E-07 3.20532E-07
AT4G27090.1 434.7615 288.601 0.59114789 5.829111 5.57E-09 1.65247E-06 1.65247E-06
AT5G37260.1 513.717 354.893 0.533589698 5.81702 5.99E-09 1.7576E-06 1.7576E-06
208.1798
AT5G19240.1 109.736 0.923793541 5.811936 6.18E-09 1.77409E-06 1.77409E-06
5
AT3G11120.1 146.7835 66.028 1.152539951 5.802952 6.52E-09 1.83365E-06 1.83365E-06
AT3G50480.1 25.33585 85.7781 -5.752485 8.79E-09 2.40132E-06 2.39033E-06
1.759429129
AT2G27710.1 188.265 96.0242 0.971294872 5.751595 8.84E-09 2.39033E-06 2.39033E-06
AT2G27720.1 186.423 94.9241 0.973733544 5.734753 9.77E-09 2.58962E-06 2.58962E-06
114.5984
AT5G44568.1 45.8336 1.322110334 5.686485 1.30E-08 3.40615E-06 3.40615E-06
75
AT3G62030.1 383.1195 570.84 -5.669191 1.43E-08 3.73287E-06 3.73287E-06
0.575291973
80.03337
AT1G72910.1 24.8386 1.688017889 5.657717 1.53E-08 3.95384E-06 3.95384E-06
5
AT2G37190.1 144.8805 66.512 1.123176872 5.652015 1.59E-08 4.04945E-06 4.04945E-06
151.0934
AT5G49360.1 71.468 1.080071799 5.599836 2.15E-08 5.37927E-06 5.37927E-06
5
AT3G16370.1 343.0555 518.303 -5.585095 2.34E-08 5.80332E-06 5.80332E-06
0.595353748
AT3G51860.1 98.75402 36.9613 1.417823977 5.556559 2.75E-08 6.7752E-06 6.7752E-06
AT3G45030.1 149.773 71.6305 1.064131651 5.511212 3.56E-08 8.69765E-06 8.69765E-06
AT2G38170.3 374.4115 554.421 -5.502178 3.75E-08 9.07514E-06 9.07514E-06
0.566357156
AT5G24530.1 87.90475 30.903 1.508194226 5.480769 4.23E-08 1.01558E-05 1.01558E-05
AT5G42100.2 34.4656 3.40547 3.339231303 5.452807 4.96E-08 1.17879E-05 1.17879E-05
AT3G29240.2 287.539 177.27 0.697809243 5.438993 5.36E-08 1.26303E-05 1.26303E-05
AT3G29240.1 281.814 174.586 0.69080541 5.339966 9.30E-08 2.11888E-05 2.11888E-05
AT3G22890.1 416.275 599.592 -5.32439 1.01E-07 2.28979E-05 2.28979E-05
0.526444216
AT2G38230.1 390.9695 264.62 0.563133961 5.30823 1.11E-07 2.48199E-05 2.48199E-05
AT3G52590.1 375.8795 252.778 0.572399328 5.27614 1.32E-07 2.93435E-05 2.93435E-05
AT1G08830.1 43.88145 109.936 -1.32498079 -5.246866 1.55E-07 3.41336E-05 3.412E-05
AT3G47370.3 0 25.7724 -5.245471 1.56E-07 3.412E-05 3.412E-05
5.771075041
AT5G39740.1 227.42 133.893 0.764278597 5.211975 1.87E-07 4.05738E-05 4.05738E-05
AT5G08760.1 156.9006 80.6245 0.960560656 5.204588 1.94E-07 4.18916E-05 4.18916E-05 AT2G44290.1 88.3886 33.5614 1.39705741 5.200673 1.99E-07 4.2452E-05 4.2452E-05
AT3G62870.1 286.016 180.784 0.661828855 5.192526 2.07E-07 4.40119E-05 4.40119E-05
AT2G36830.1 289.9395 439.645 -5.187487 2.13E-07 4.48739E-05 4.48739E-05
0.600587169
44.51555
AT1G13470.1 8.94291 2.315493248 5.158538 2.49E-07 5.2E-05 5.19405E-05
4
30.95762
AT3G17510.2 87.502 -5.157339 2.50E-07 5.19405E-05 5.19405E-05
35 1.499021267
AT1G08360.1 272.419 170.973 0.672058815 5.13226 2.86E-07 5.8921E-05 5.8921E-05
AT3G60420.1 61.95607 18.5354 1.740962385 5.083495 3.71E-07 7.45945E-05 7.45945E-05
AT3G17390.1 252.017 388.419 -5.059797 4.20E-07 8.38767E-05 8.38767E-05
0.624092719
AT3G01290.1 191.8198 109.023 0.815119121 5.044311 4.55E-07 9.03082E-05 9.03082E-05
22.99125
AT3G09820.2 72.0057 -5.02269 5.10E-07 0.000100373 0.00010036
5 1.647025896
23.01831
AT3G02560.2 0 5.446015819 5.021349 5.13E-07 0.00010036 0.00010036
55
AT4G38810.1 0 23.7423 -4.9532108 -4.973256 6.58E-07 0.000126974 0.000126974
AT2G04780.2 1.06124 24.5109 -4.969085 6.73E-07 0.000127947 0.000127605
4.529600594
AT3G04920.1 149.0955 77.9528 0.935563965 4.96827 6.76E-07 0.000127605 0.000127605
AT5G02960.1 380.5195 265.575 0.518851043 4.890066 1.01E-06 0.000189117 0.000189117
AT4G34670.1 215.8025 130.786 0.722503462 4.848545 1.24E-06 0.000230202 0.000230202
AT3G62250.1 386.0615 271.558 0.507570323 4.835689 1.33E-06 0.000240745 0.000240745
AT3G12965.1 59.713 18.9069 1.659132215 4.829394 1.37E-06 0.000246858 0.000246858
AT3G05590.1 287.902 189.506 0.603334284 4.824459 1.40E-06 0.000251406 0.000251406
AT5G56670.1 232.5995 144.727 0.684513902 4.814745 1.47E-06 0.000262246 0.000262246
141.5520
AT5G54610.1 74.3701 0.928538026 4.811952 1.49E-06 0.000264234 0.000264234
5
AT2G30520.2 37.51625 7.38593 2.344664133 4.770109 1.84E-06 0.000321393 0.000320815
AT5G02450.1 204.3965 123.101 0.731528011 4.76699 1.87E-06 0.000322328 0.000322328
34.66080
AT5G40890.2 88.0257 -4.750545 2.03E-06 0.000347511 0.000347511
5 1.344619633
AT1G27400.1 145.5735 78.323 0.894239823 4.735198 2.19E-06 0.000372556 0.000372556
AT3G54920.1 103.9923 188.33 -4.733029 2.21E-06 0.000374252 0.000374252
0.856786123
AT3G55500.1 57.0985 18.0501 1.661446016 4.727013 2.28E-06 0.000383157 0.000383157
AT4G12600.1 69.45335 25.6882 1.43493848 4.700556 2.59E-06 0.000431054 0.000431054
AT4G23400.1 256.9365 384.372 -4.697305 2.64E-06 0.000435345 0.000435345
0.581091393
AT2G36170.1 122.473 61.8842 0.984820713 4.689864 2.73E-06 0.000448794 0.000448794
AT1G18540.1 194.0175 117.032 0.729283727 4.632662 3.61E-06 0.000589103 0.000589103
AT5G28060.1 242.2155 155.76 0.636966401 4.629099 3.67E-06 0.000595805 0.000595805
AT3G13750.1 211.134 325.144 -4.620852 3.82E-06 0.000616362 0.000616362
0.622919879
AT5G15410.2 20.09229 61.6865 -4.588542 4.46E-06 0.000699428 0.000699428
1.618312789
AT5G16130.1 211.551 132.191 0.678381549 4.557695 5.17E-06 0.000805839 0.000805839
AT5G47560.1 266.595 391.966 -4.543641 5.53E-06 0.000856667 0.000856667
0.556078794
AT4G09320.1 278.3445 187.156 0.572630276 4.5416 5.58E-06 0.000860172 0.000860172
18.87408
AT4G21105.2 0 6.29454374 4.53221 5.84E-06 0.000894321 0.000894321
2
ATCG00490.1 37.93395 89.9628 -4.515378 6.32E-06 0.000957749 0.000957749
1.245838959 AT1G69530.2 120.4594 205.725 -4.499481 6.81E-06 0.001021018 0.001021018
0.772170145
AT3G08030.2 18.8735 0 4.809976145 4.488129 7.19E-06 0.001065369 0.001065369
AT2G25080.1 307.8295 213.45 0.528233332 4.464598 8.02E-06 0.001183082 0.001183082
39.91199
AT2G05540.1 10.0143 1.994760813 4.46076 8.17E-06 0.001198065 0.001198065
5
AT3G49010.3 81.03775 35.6894 1.183098471 4.398715 1.09E-05 0.001572347 0.001572347
AT3G04840.1 282.714 193.69 0.545593856 4.395871 1.10E-05 0.001584779 0.001584779
AT5G19510.1 271.0745 184.105 0.558160597 4.387116 1.15E-05 0.001632896 0.001632896
AT3G48640.1 38.6603 9.73569 1.989497697 4.382897 1.17E-05 0.00165632 0.00165632
AT3G15356.1 64.3508 126.717 -4.364498 1.27E-05 0.001792846 0.001792846
0.977580096
AT3G22235.1 44.22475 97.2191 -4.349407 1.37E-05 0.001911018 0.001911018
1.136385791
AT1G77940.1 205.669 131.147 0.64913955 4.333006 1.47E-05 0.002048743 0.002048743
AT4G 18730.1 200.069 126.868 0.657169421 4.317338 1.58E-05 0.002177669 0.002177669
AT5G58420.1 176.348 107.89 0.708864062 4.314739 1.60E-05 0.002192487 0.002192487
AT1G48920.1 65.83735 26.4087 1.317892983 4.299856 1.71E-05 0.002333412 0.002333412
AT2G14560.2 30.43515 6.06344 2.327530054 4.278229 1.88E-05 0.002559356 0.002559356
AT2G37600.2 18.74904 1.20669 3.957689729 4.27416 1.92E-05 0.002593766 0.002593766
AT5G25610.1 177.222 273.151 -4.243191 2.20E-05 0.002950199 0.002950199
0.624140996
AT1G56110.1 43.8299 13.3493 1.715151294 4.232604 2.31E-05 0.003077667 0.003077667
AT3G61430.2 274.454 190.091 0.529874138 4.226514 2.37E-05 0.00314692 0.00314692
AT4G25100.4 55.5167 20.4359 1.441816033 4.217103 2.47E-05 0.003265422 0.003265422
AT1G56045.1 163.396 99.164 0.720484294 4.209152 2.56E-05 0.003366351 0.003366351
AT3G23450.1 38.83625 87.0084 -4.197453 2.70E-05 0.003511554 0.003511554
1.163750787
AT5G42080.2 0 18.1007 -4.19583 2.72E-05 0.003520197 0.003520197
4.223828655
15.92978
AT5G28050.2 0 5.634943973 4.181894 2.89E-05 0.003708295 0.003708295
95
19.06896
AT1G48450.2 1.55976 3.611830842 4.180818 2.90E-05 0.003708643 0.003708643
85
AT1G69530.1 94.2991 164.305 -4.158935 3.20E-05 0.004063582 0.004063582
0.801060477
AT1G48630.1 72.4728 31.9923 1.179714919 4.15069 3.31E-05 0.004193453 0.00417733
AT5G52650.1 170.0575 105.595 0.687481111 4.131466 3.60E-05 0.004518647 0.004518647
AT5G03850.1 194.262 125.166 0.634160997 4.130368 3.62E-05 0.004519753 0.004519753
AT1G24147.1 68.21087 29.3735 1.215486483 4.119213 3.80E-05 0.004701638 0.004701638
AT3G16520.2 0 16.274 -4.112524 3.91E-05 0.004818411 0.004818411
4.914834216
AT2G27530.1 223.618 149.677 0.579183774 4.10944 3.97E-05 0.004861499 0.004861499
AT1G70600.1 278.658 196.082 0.507038468 4.104508 4.05E-05 0.00494441 0.00494441
AT1G52300.1 272.9655 191.31 0.512806334 4.10104 4.11E-05 0.004996997 0.004996997
AT3G60770.1 232.785 158.299 0.556345956 4.054362 5.03E-05 0.00608084 0.006064841
AT2G47880.1 20.3154 2.37149 3.098708081 4.053955 5.04E-05 0.006064841 0.006064841
17.72281
AT3G02360.2 1.46184 3.599750167 4.025633 5.68E-05 0.006813485 0.006813485
15
AT5G09510.1 64.91725 27.9302 1.216775982 4.021755 5.78E-05 0.006896688 0.006896688
AT1G64650.2 0 15.5573 -4.017782 5.87E-05 0.006983714 0.006983714
4.890524371
AT1G49750.1 237.609 163.466 0.539598888 3.992822 6.53E-05 0.00772822 0.00772822 AT3G44010.1 190.605 124.586 0.613444006 3.979949 6.89E-05 0.008124024 0.008100246
AT5G59850.1 114.701 64.2739 0.83557305 3.979632 6.90E-05 0.008100246 0.008100246
AT1G21250.1 100.4144 53.5949 0.905798547 3.973319 7.09E-05 0.008282833 0.008282833
AT4G15440.1 102.2531 55.143 0.890894919 3.956599 7.60E-05 0.00884672 0.0088253
AT5G10760.1 59.45502 24.8078 1.261004827 3.953795 7.69E-05 0.008876198 0.008876198
AT2G20450.1 72.14735 33.6266 1.10134349 3.928384 8.55E-05 0.009827157 0.009827157
AT3G57260.1 69.732 31.9689 1.125151756 3.92635 8.62E-05 0.009869465 0.009833395
AT4G31500.1 96.3199 51.0496 0.915934237 3.926235 8.63E-05 0.009833395 0.009833395
AT5G48490.1 45.379 16.1631 1.489320891 3.902581 9.52E-05 0.010801477 0.010757439
AT5G10360.1 220.6445 150.827 0.548829073 3.902576 9.52E-05 0.010757439 0.010757439
AT3G44750.1 23.40085 4.1588 2.492321723 3.899471 9.64E-05 0.010851857 0.010851857
AT5G56710.1 124.4825 72.8395 0.773150015 3.892375 9.93E-05 0.011128866 0.011128866
AT3G11945.1 90.1307 47.2517 0.931652361 3.849896 0.0001182 0.013035841 0.013035841
AT2G44120.2 8.63801 33.2949 -3.847175 0.0001195 0.01312889 0.01312889
1.946530315
105.9526
AT1G69530.3 173.5 -3.829481 0.0001284 0.013998094 0.013998094
5 0.711515991
AT1G78450.1 35.23955 76.7712 -3.827718 0.0001293 0.014043241 0.014043241
1.123369697
AT2G21187.2 14.09215 0 4.473193702 3.825792 0.0001304 0.014097969 0.014097969
AT5G59670.1 47.34948 17.8888 1.404291969 3.820745 0.000133 0.014333472 0.014333472
AT2G32870.1 52.3485 21.158 1.306944938 3.810461 0.0001387 0.01488493 0.01488493
AT1G69530.4 105.7521 172.769 -3.804492 0.0001421 0.01518936 0.01518936
0.708158065
AT3G18410.2 23.48501 58.2358 -3.784366 0.0001541 0.016409089 0.016409089
1.310166103
AT5G64140.1 102.1007 56.925 0.842858466 3.781109 0.0001561 0.016561341 0.016561341
13.05923
AT1G47740.2 0 5.385887761 3.77991 0.0001569 0.016577509 0.016577509
5
AT3G53020.1 181.1825 120.02 0.594168781 3.778556 0.0001577 0.016604256 0.016604256
AT1G04480.1 234.1695 164.93 0.505699338 3.754208 0.0001739 0.018165594 0.018165594
AT1G36050.1 13.0713 0 4.893381694 3.744774 0.0001806 0.018720188 0.018720188
AT2G01250.1 162.074 104.962 0.626785556 3.736171 0.0001868 0.019299472 0.019299472
AT5G21940.1 111.3664 64.559 0.78662389 3.733817 0.0001886 0.019408172 0.019408172
17.79924
AT2G45660.1 2.27088 2.97049267 3.721399 0.0001981 0.020237093 0.020222273
5
AT5G62190.1 88.55875 47.3931 0.901957827 3.718706 0.0002002 0.020303584 0.020303584
AT5G19120.1 58.0915 25.6563 1.179013954 3.71441 0.0002037 0.020575987 0.020575987
AT3G48930.1 207.13 142.955 0.534975443 3.701151 0.0002146 0.021602538 0.021602538
AT3G14310.1 100.6882 164.133 -3.692507 0.0002221 0.022188544 0.022188544
0.704970712
AT3G16530.1 57.4174 106.35 -3.677332 0.0002357 0.023465705 0.023465705
0.889260125
124.5248
AT5G03240.2 75.7706 0.716723596 3.658693 0.0002535 0.025058861 0.025058861
5
46.51102
AT5G10140.1 90.8146 -3.654291 0.0002579 0.02540157 0.025334657
46 0.965351532
AT4G31700.1 135.561 84.6313 0.679678952 3.654053 0.0002581 0.025334657 0.025334657
AT3G20470.1 83.5314 140.814 -3.638762 0.000274 0.026791934 0.026791934
0.753400253
AT5G60920.1 124.1495 192.674 -3.618052 0.0002968 0.028926624 0.028926624
0.634083452
AT1G67860.1 98.82745 56.3478 0.810552532 3.60409 0.0003132 0.030419272 0.030419272 AT3G61110.1 187.7985 128.354 0.549057283 3.601594 0.0003163 0.03060512 0.03060512
AT4G10450.1 40.65705 15.0543 1.433329913 3.593464 0.0003263 0.031466109 0.031466109
AT5G24210.1 156.7978 102.897 0.607704397 3.581602 0.0003415 0.032701626 0.032701626
AT2G47610.1 162.9155 108.022 0.592798706 3.576102 0.0003488 0.03328144 0.03328144
AT1G14150.2 40.15836 80.6448 -3.569357 0.0003579 0.034032354 0.034032354
1.005881158
AT1G34030.1 136.7185 87.2324 0.648272486 3.528769 0.0004175 0.039297406 0.039292763
103.6963
AT3G02770.1 60.9533 0.766588878 3.527899 0.0004189 0.039292763 0.039292763
5
AT4G25100.1 57.6868 104.39 -3.519513 0.0004323 0.04028205 0.04028205
0.855670375
AT1G76160.1 144.3505 215.75 -3.511233 0.000446 0.041140921 0.041140921
0.579784455
115.2520
AT4G37800.1 179.33 -3.51022 0.0004477 0.041160375 0.041160375
5 0.637824444
AT1G15405.1 33.79175 70.5434 -3.497764 0.0004692 0.042988067 0.042988067
1.061840045
AT3G06680.2 45.4426 18.7566 1.276647046 3.488671 0.0004854 0.044329887 0.044329887
ColxC24 at ZT6
MPV ColxC24 log2(Fold_c
Gene Name z-score p-value q-value q-value
RPKM RPKM hange)
AT2G34430.1 3462.985 6992.6 -33.22218 5.15E-242 1.4153E-237 1.4153E-237
1.013812842
AT1G67090.1 14717.8 19905.4 -24.95106 2.08E-137 2.8571E-133 2.8571E-133
0.435597828
AT1G66100.1 679.961 1761.73 -1.37346893 -21.46937 3.01E-102 2.75799E-98 2.75799E-98
458.2150
AT2G42540.2 30.3444 3.916522645 21.11586 5.69E-99 3.90669E-95 3.90669E-95
5
AT2G34420.1 8960.135 12360 -20.93067 2.81E-97 1.54714E-93 1.54714E-93
0.464086369
441.3380
AT2G42540.1 29.7895 3.889008321 20.67792 5.47E-95 2.50758E-91 2.50758E-91
5
346.5066
AT5G59320.1 3.5468 6.610221249 19.33086 2.95E-83 1.01489E-79 1.01489E-79
5
AT4G 18440.1 566.515 1400.57 -1.30582803 -18.37603 2.04E-75 6.2405E-72 6.2405E-72
AT4G04020.1 537.8893 103.833 2.373044259 18.26353 1.62E-74 4.43853E-71 4.43853E-71
324.0262
AT5G35630.2 0 8.560251691 17.23648 1.41E-66 3.53255E-63 3.53255E-63
65
1315.334
AT5G11740.1 675.18 0.96208566 15.24272 1.84E-52 3.61272E-49 3.61272E-49
5
AT5G25610.1 618.1075 206.122 1.584359274 15.1416 8.61E-52 1.57734E-48 1.57734E-48
AT5G01530.1 4531.32 6244.14 -14.78162 1.92E^9 3.3058E-46 3.3058E-46
0.462571507
AT3G27690.1 1939.925 3065.26 -14.77739 2.05E^9 3.31323E-46 3.31323E-46
0.660008574
AT1G55670.1 3702.25 5138.19 -13.71138 8.68E^3 1.25536E-39 1.25536E-39
0.472857921
AT2G38170.3 255.224 37.0744 2.783268749 13.69964 1.02E^2 1.40202E-39 1.40202E-39
AT3G22231.1 178.0048 547.966 -13.61818 3.12E-12 4.08639E-39 4.08639E-39
1.622170235
AT3G61470.1 4325.365 5780.87 -12.79598 1.73E-37 2.0629E-34 2.0629E-34
0.418464748
AT1G15820.1 4339.485 5773.43 -12.57418 2.93E-36 3.35281E-33 3.35281E-33
0.411904843
AT1G20440.1 160.9686 11.6055 3.793898706 12.38847 3.02E-35 3.1893E-32 3.1893E-32
AT3G23810.1 566.5985 240.548 1.236001978 12.1176 8.52E-34 8.67345E-31 8.67345E-31
AT2G23672.1 5.192375 142.125 -12.06963 1.53E-33 1.49996E-30 1.49996E-30
4.774621959
134.4629
AT5G59310.1 0 7.109524035 11.87158 1.66E-32 1.57594E-29 1.57594E-29
03 AT1G37130.1 504.3845 206.333 1.289549364 11.7986 3.97E-32 3.63515E-29 3.63515E-29
AT5G03350.1 23.60015 186.792 -11.71978 1.01E-31 8.94791E-29 8.94791E-29
2.984564734
175.7573
AT5G24780.1 477.698 -11.61772 3.35E-31 2.87647E-28 2.87647E-28
5 1.442513814
AT3G17390.1 666.1755 332.394 1.003007956 11.2034 3.92E-29 3.26768E-26 3.26768E-26
109.3148
AT5G52310.1 2.94445 5.214347545 10.93057 8.23E-28 6.6545E-25 6.6545E-25
6
391.8129
AT5G24770.1 777.359 -10.8053 3.25E-27 2.55095E-24 2.55095E-24
5 0.988415936
105.2391
AT2G38530.1 3.0328 5.116877192 10.70561 9.58E-27 7.31304E-24 7.31304E-24
4
AT2G23670.1 414.1405 173.237 1.257373201 10.49241 9.36E-26 6.95279E-23 6.95279E-23
AT2G30570.1 2429.63 3320.6 -10.4757 1.12E-25 8.07832E-23 8.07832E-23
0.450707319
AT1G07600.1 412.678 173.04 1.253910959 10.4524 1.43E-25 1.00666E-22 1.00666E-22
AT5G24780.2 132.5342 363.795 -10.21656 1.67E-24 1.09375E-21 1.09375E-21
1.456761024
AT3G62030.1 624.871 1059.55 -9.952409 2.46E-23 1.50322E-20 1.50322E-20
0.761821378
AT1G67740.1 1726.13 2436.67 -9.93445 2.95E-23 1.76117E-20 1.76117E-20
0.497369757
AT2G38170.1 178.079 41.0644 2.116557273 9.822587 9.00E-23 5.26251E-20 5.26251E-20
AT4G05180.1 1944.87 2681.19 -9.682862 3.57E-22 2.04155E-19 2.04155E-19
0.463199733
AT3G09390.1 205.567 57.7938 1.830622048 9.626382 6.19E-22 3.46989E-19 3.46989E-19
AT1G07610.1 121.0873 16.9464 2.836996826 9.525739 1.64E-21 9.00672E-19 9.00672E-19
AT3G22235.1 12.89104 116.145 -9.516719 1.79E-21 9.63094E-19 9.63094E-19
3.171486483
AT5G13930.1 427.8275 204.013 1.068368134 9.426963 4.22E-21 2.18881E-18 2.18881E-18
AT2G01020.1 203.1045 451.654 -9.407713 5.07E-21 2.55673E-18 2.53349E-18
1.152995781
AT3G41979.1 203.1045 451.654 -9.407713 5.07E-21 2.55673E-18 2.53349E-18
1.152995781
503.8607
AT3G14210.1 867.557 -9.249251 2.26E-20 1.08994E-17 1.08994E-17
5 0.783933471
342.2011
AT5G15970.1 156.451 1.129133728 8.795495 1.42E-18 6.63357E-16 6.63357E-16
5
AT1G14250.1 148.4455 350.021 -8.786624 1.54E-18 7.05903E-16 6.96765E-16
1.237508121
AT4G17470.1 47.4905 179.262 -8.786231 1.55E-18 6.96765E-16 6.96765E-16
1.916358847
AT3G16140.1 1447.015 2013.51 -0.47663276 -8.641076 5.57E-18 2.46824E-15 2.46824E-15
264.4387
AT5G24770.2 508.632 -0.94368863 -8.387459 4.97E-17 2.13306E-14 2.13306E-14
5
AT2G36830.1 703.7615 442.005 0.671023903 8.353332 6.64E-17 2.80576E-14 2.77599E-14
AT5G02160.1 264.548 507.659 -8.352789 6.67E-17 2.77599E-14 2.77599E-14
0.940330238
AT4G08870.1 693.13 434.565 0.673553978 8.315383 9.15E-17 3.75123E-14 3.75123E-14
AT5G06870.1 72.55255 214.68 -8.295107 1.08E-16 4.38434E-14 4.38434E-14
1.565089567
AT2G46820.1 1529.07 2085.93 -0.44803629 -8.246223 1.63E-16 6.51101E-14 6.51101E-14
AT3G08580.2 650.6945 405.147 0.683534902 8.153619 3.53E-16 1.38658E-13 1.38658E-13
AT3G50820.1 1681.18 2255.8 -8.094834 5.73E-16 2.21947E-13 2.21947E-13
0.424164965
AT4G17090.1 186.248 66.0338 1.495948358 7.982347 1.44E-15 5.40497E-13 5.40497E-13
AT2G01021.1 174.4355 366.853 -7.969921 1.59E-15 5.89638E-13 5.89638E-13
1.072508405
62.71857
AT2G14610.1 3.48079 4.171406053 7.954437 1.80E-15 6.59352E-13 6.59352E-13
3
137.0262
AT1G01470.1 38.2337 1.841535569 7.889879 3.02E-15 1.09375E-12 1.09375E-12
5 AT1G19670.1 164.022 348.704 -7.867538 3.62E-15 1.29085E-12 1.29085E-12
1.088113579
AT4G35090.1 598.303 371.403 0.687890828 7.858764 3.88E-15 1.3668E-12 1.3668E-12
AT2G43550.1 257.5345 481.592 -7.845147 4.32E-15 1.50432E-12 1.50432E-12
0.903045714
AT3G22235.2 28.66485 124.359 -7.828232 4.95E-15 1.69963E-12 1.69963E-12
2.117156286
AT1G77760.1 88.24675 14.3045 2.625074076 7.816977 5.41E-15 1.8357E-12 1.8357E-12
134.0233
AT2G42530.1 37.4585 1.83911934 7.796238 6.38E-15 2.13748E-12 2.13748E-12
5
AT1G07590.1 234.388 99.5185 1.235862064 7.792126 6.59E-15 2.18162E-12 2.18162E-12
AT3G14420.4 37.59345 141.037 -7.768253 7.96E-15 2.60336E-12 2.60336E-12
1.907520468
AT1G79850.1 648.4465 987.261 -7.713707 1.22E-14 3.95127E-12 3.95127E-12
0.606443987
AT1G13930.1 804.3055 547.062 0.556039239 7.658241 1.88E-14 6.02334E-12 6.02334E-12
AT3G13520.1 355.206 188.352 0.915224599 7.613058 2.68E-14 8.45548E-12 8.45548E-12
AT1G78370.1 913.699 1306.39 -7.545667 4.50E-14 1.40521E-11 1.4052 IE- 11
0.515794771
1242.907
AT1G54040.2 1701.42 -7.532904 4.96E-14 1.53227E-11 1.53227E-11
3 0.453020618
AT3G09820.2 0 62.9915 -7.417464 1.19E-13 3.64532E-11 3.64532E-11
8.778646427
AT4G34950.1 260.2055 123.433 1.075923304 7.391307 1.45E-13 4.39071E-11 4.39071E-11
AT5G23820.1 87.83275 218.543 -7.297504 2.93E-13 8.66256E-11 8.66256E-11
1.315086289
AT1G20620.2 53.6408 160.841 -7.24653 4.28E-13 1.25004E-10 1.25004E-10
1.584232552
AT4G27440.2 228.739 423.272 -7.242854 4.39E-13 1.27089E-10 1.27089E-10
0.887882689
AT1G75040.1 97.9543 23.1209 2.082911268 7.213694 5.45E-13 1.55881E-10 1.55881E-10
AT3G11630.1 963.286 1345.9 -7.15292 8.50E-13 2.33454E-10 2.33454E-10
0.482535119
122.0934
AT5G49480.1 36.8416 1.728578183 7.141309 9.24E-13 2.51536E-10 2.51536E-10
5
AT4G27440.1 248.0635 445.29 -0.84403574 -7.093706 1.31E-12 3.45012E-10 3.45012E-10
AT1G09750.1 174.089 342.429 -0.97597984 -7.09046 1.34E-12 3.49837E-10 3.49837E-10
211.3350
AT2G46820.2 94.281 1.164493093 7.075383 1.49E-12 3.86385E-10 3.86385E-10
5
45.69840
AT1G57720.2 1.64845 4.792961778 6.994116 2.67E-12 6.85576E-10 6.85576E-10
5
AT2G15620.1 333.763 184.809 0.852789014 6.977554 3.00E-12 7.64285E-10 7.64285E-10
AT3G14420.6 292.068 155.532 0.909092861 6.866642 6.57E-12 1.64214E-09 1.64214E-09
109.4150
AT2G46600.1 32.6081 1.746508908 6.807293 9.95E-12 2.4622E-09 2.4622E-09
5
AT5G57560.1 50.4339 4.27188 3.561450765 6.78277 1.18E-11 2.8671E-09 2.8671E-09
AT1G20450.1 64.6089 10.0933 2.678334973 6.759049 1.39E-11 3.34834E-09 3.34834E-09
ATCG01210.1 348.6355 567.636 -6.751578 1.46E-11 3.49476E-09 3.49476E-09
0.703246609
AT4G35090.2 422.0065 258.767 0.705611575 6.737302 1.61E-11 3.82256E-09 3.82256E-09
AT1G10370.1 223.5145 108.442 1.0434448 6.690312 2.23E-11 5.23069E-09 5.23069E-09
AT4G17340.1 182.009 79.9321 1.187162893 6.662373 2.69E-11 6.27502E-09 6.27502E-09
AT4G16980.1 814.2085 1141.36 -6.65324 2.87E-11 6.62108E-09 6.62108E-09
0.487283721
AT5G42530.1 936.878 1287.67 -6.63978 3.14E-11 7.19435E-09 7.19435E-09
0.458829814
AT2G38140.1 350.1345 562.886 -6.555454 5.55E-11 1.24955E-08 1.24055E-08
0.684933544
AT1G62180.1 291.283 160.608 0.858877748 6.555315 5.55E-11 1.24055E-08 1.24055E-08 AT3G22600.1 38.85114 0 5.55738228 6.540333 6.14E-11 1.36035E-08 1.36035E-08
38.67408
AT3G02560.2 0 5.653373321 6.527623 6.68E-11 1.46906E-08 1.46906E-08
45
AT3G56290.1 164.4246 69.9576 1.232873459 6.514408 7.30E-11 1.59165E-08 1.59161E-08
AT3G55500.1 60.69725 9.68021 2.648520904 6.513225 7.36E-11 1.59161E-08 1.59161E-08
AT1G02820.1 67.21645 12.655 2.409106842 6.510667 7.48E-11 1.6063E-08 1.6063E-08
AT2G24200.2 89.89505 24.342 1.884793969 6.487731 8.71E-11 1.85633E-08 1.85633E-08
AT2G45470.1 309.285 507.531 -6.481844 9.06E-11 1.91539E-08 1.91539E-08
0.714559079
AT1G48920.1 227.9215 115.252 0.983745235 6.45365 1.09E-10 2.29053E-08 2.29053E-08
AT1G03600.1 533.516 789.738 -6.439919 1.20E-10 2.48863E-08 2.48863E-08
0.565842573
AT1G20070.1 55.13055 7.67472 2.844665972 6.435973 1.23E-10 2.53496E-08 2.53496E-08
1167.055
AT4G21280.1 1547.88 -6.421444 1.35E-10 2.76835E-08 2.76835E-08
5 0.407420459
AT1G03820.1 45.00694 4.19056 3.424932525 6.312853 2.74E-10 5.49494E-08 5.49494E-08
AT1G15690.1 364.2845 223.12 0.707245771 6.271195 3.58E-10 7.13484E-08 7.13484E-08
AT5G40890.2 34.8311 0 6.019060306 6.187222 6.12E-10 1.21062E-07 1.21062E-07
AT3G08030.1 92.44265 28.3651 1.704441667 6.155276 7.49E-10 1.47116E-07 1.47116E-07
AT1G20450.2 53.9998 8.58684 2.652754849 6.148499 7.82E-10 1.5245E-07 1.5245E-07
AT5G04140.1 338.0065 204.99 0.721497458 6.139152 8.30E-10 1.60557E-07 1.60557E-07
58.48607
AT5G55450.1 10.8282 2.433299733 6.107217 1.01E-09 1.94833E-07 1.94833E-07
5
AT2G36530.1 466.2445 311.729 0.580794332 6.041838 1.52E-09 2.90781E-07 2.90781E-07
AT2G20260.1 646.1025 910.553 -6.038504 1.56E-09 2.94804E-07 2.94804E-07
0.494979936
AT1G13440.1 637.5915 457.379 0.479242269 6.034334 1.60E-09 3.00446E-07 3.00446E-07
AT5G47330.1 35.02124 1.70094 4.36382601 6.011057 1.84E-09 3.44575E-07 3.44575E-07
AT3G08940.2 908.204 1218.59 -5.945919 2.75E-09 5.10461E-07 5.10461E-07
0.424124511
AT3G51860.1 32.48985 1.10451 4.878510697 5.913184 3.36E-09 6.14761E-07 6.14761E-07
AT3G22121.1 155.86 286.782 -5.911594 3.39E-09 6.16618E-07 6.16618E-07
0.879703754
AT1G27950.1 270.783 156.966 0.786685074 5.891805 3.82E-09 6.90639E-07 6.90639E-07
AT5G01410.1 289.716 171.773 0.754136076 5.890507 3.85E-09 6.91536E-07 6.91536E-07
AT2G41410.1 70.83545 18.3246 1.950689839 5.887499 3.92E-09 6.99667E-07 6.99667E-07
88.25640
AT4G16590.1 28.1462 1.648760849 5.87991 4.10E-09 7.27785E-07 7.27785E-07
65
AT1G23310.1 547.1075 384.62 0.508390549 5.867442 4.43E-09 7.79631E-07 7.79631E-07
AT1G19960.1 18.65192 74.784 -5.850583 4.90E-09 8.57428E-07 8.55536E-07
2.003405492
AT3G11945.2 31.05615 0 5.723547275 5.849895 4.92E-09 8.55536E-07 8.55536E-07
AT4G30270.1 93.204 31.5099 1.564586696 5.82753 5.63E-09 9.72269E-07 9.72269E-07
AT5G15960.1 38.48454 3.71908 3.371261316 5.801074 6.59E-09 1.13173E-06 1.13173E-06
30.74252
AT4G35450.4 0 5.249077763 5.79978 6.64E-09 1.13341E-06 1.13341E-06
3
AT2G37170.1 176.47 87.9734 1.00428367 5.770776 7.89E-09 1.33855E-06 1.33855E-06
AT5G44130.1 167.5135 82.2992 1.025327056 5.713713 1.11E-08 1.84101E-06 1.84101E-06
AT2G38230.1 219.5125 121.296 0.85577112 5.674136 1.39E-08 2.30758E-06 2.30758E-06
AT5G06290.1 248.677 403.604 -5.657232 1.54E-08 2.53144E-06 2.53144E-06
0.698667393
AT3G09820.1 214.831 118.334 0.860337537 5.637118 1.73E-08 2.82858E-06 2.82858E-06 AT2G44120.1 124.886 53.7443 1.216428098 5.62054 1.90E-08 3.09545E-06 3.09545E-06
AT3G54210.1 696.1735 952.059 -5.614421 1.97E-08 3.18815E-06 3.18815E-06
0.451604083
AT1G23310.2 385.4955 255.963 0.590778739 5.570834 2.54E-08 4.0743E-06 4.0743E-06
AT3G51600.1 406.4395 274.186 0.567885709 5.537902 3.06E-08 4.89091E-06 4.89091E-06
ATCG00950.1 561.683 787.314 -5.523682 3.32E-08 5.27329E-06 5.27329E-06
0.487182994
AT3G02470.4 223.374 126.727 0.817737338 5.51985 3.39E-08 5.35862E-06 5.35862E-06
159.0129
AT5G15650.1 78.9837 1.009517406 5.500066 3.80E-08 5.96179E-06 5.96179E-06
5
34.41927
AT2G36590.1 3.433 3.325674947 5.455964 4.87E-08 7.60533E-06 7.60533E-06
5
AT1G56070.1 654.826 491.372 0.414295955 5.426212 5.76E-08 8.93718E-06 8.93603E-06
AT2G33450.1 447.3685 644.968 -5.425228 5.79E-08 8.93603E-06 8.93603E-06
0.527763906
AT1G70600.1 539.2125 390.436 0.465767859 5.420499 5.94E-08 9.12446E-06 9.12446E-06
AT1G23130.1 536.9025 389.053 0.464693418 5.398615 6.72E-08 1.01964E-05 1.01964E-05
AT4G21960.1 466.8715 667.543 -5.39265 6.94E-08 1.04829E-05 1.04434E-05
0.515835249
AT5G01600.1 227.489 368.688 -5.391624 6.98E-08 1.04854E-05 1.04434E-05
0.696603674
ATCG00920.1 210.067 346.045 -5.391366 6.99E-08 1.04434E-05 1.04434E-05
0.720110117
AT2G37180.1 96.4126 37.3495 1.368132772 5.386281 7.19E-08 1.0685E-05 1.0685E-05
26.51602
AT2G05540.1 0 5.222932109 5.38413 7.28E-08 1.07554E-05 1.07554E-05
4
AT5G58250.1 228.457 369.187 -5.364301 8.13E-08 1.18787E-05 1.18787E-05
0.692429105
AT5G36700.2 60.8255 16.4314 1.888220867 5.342868 9.15E-08 1.32324E-05 1.32324E-05
AT3G02480.1 25.8883 0 5.694228326 5.340986 9.24E-08 1.33006E-05 1.32463E-05
145.3564
AT3G20470.1 71.1875 1.029899249 5.340781 9.25E-08 1.32463E-05 1.32463E-05
5
AT1G55330.1 447.538 314.794 0.507602142 5.299718 1.16E-07 1.65145E-05 1.65145E-05
AT4G37990.1 25.3133 0 5.661823693 5.281119 1.28E-07 1.81881E-05 1.81881E-05
AT4G22240.1 243.3315 146.883 0.728255663 5.248123 1.54E-07 2.15441E-05 2.15441E-05
AT4G18100.1 465.2135 331.925 0.487035668 5.222824 1.76E-07 2.45815E-05 2.45815E-05
26.36685
AT2G43620.1 0 7.476711596 5.185855 2.15E-07 2.96941E-05 2.96941E-05
5
AT1G78040.2 336.089 224.307 0.583368681 5.14798 2.63E-07 3.59997E-05 3.59997E-05
77.32357
AT1G15690.2 159.663 -5.14489 2.68E-07 3.6416E-05 3.6416E-05
45 1.046049787
26.73460
AT4G 14690.1 1.66485 4.005244257 5.13467 2.83E-07 3.82621E-05 3.82621E-05
5
AT1G51402.1 44.57105 109.876 -5.131281 2.88E-07 3.87668E-05 3.87668E-05
1.301697442
AT5G42650.1 434.275 617.961 -5.117311 3.10E-07 4.15463E-05 4.15463E-05
0.508906888
AT2G06850.1 130.2085 63.0986 1.04514373 5.112615 3.18E-07 4.23859E-05 4.23859E-05
AT1G73325.1 59.1657 131.923 -5.098207 3.43E-07 4.5521E-05 4.5521E-05
1.156863159
ATCGOl 180.1 739.6015 980.298 -5.096085 3.47E-07 4.58125E-05 4.58125E-05
0.406472229
110.2576
AT5G04140.2 205.117 -5.081002 3.75E-07 4.93672E-05 4.93672E-05
75 0.895567982
AT4G00430.1 221.075 132.169 0.742152054 5.079338 3.79E-07 4.95643E-05 4.95643E-05
AT3G08940.1 716.4695 952.318 -5.076527 3.84E-07 5.00645E-05 5.00645E-05
0.410538111
AT3G51240.1 49.32555 11.9124 2.049871034 5.068548 4.01E-07 5.19626E-05 5.19626E-05
AT1G28400.1 69.54185 23.7105 1.552355361 5.006171 5.55E-07 7.13009E-05 7.13009E-05 AT1G02930.1 25.4132 1.66288 3.933822082 4.97925 6.38E-07 8.1588E-05 8.1588E-05
AT5G09440.1 24.29697 1.30663 4.216853837 4.964953 6.87E-07 8.74275E-05 8.74275E-05
AT3G08030.2 0 23.2043 -4.931059 8.18E-07 0.000102627 0.000102527
5.134820866
AT1G78570.1 102.9068 46.0761 1.159247804 4.920211 8.65E-07 0.0001075 0.0001075
AT2G05520.2 126.8635 63.0189 1.009420573 4.912267 9.00E-07 0.000111446 0.000111446
AT2G37660.1 277.9155 419.075 -4.91071 9.07E-07 0.000111831 0.000111831
0.592562161
AT3G14395.1 50.615 13.5515 1.901112447 4.895288 9.82E-07 0.000120428 0.000120428
AT3G27830.1 513.994 705.21 -4.884054 1.04E-06 0.000126933 0.000126933
0.456301414
AT1G29070.1 536.027 731.077 -4.874983 1.09E-06 0.000132319 0.000132319
0.447717693
AT3G25520.1 515.7785 385.653 0.419448303 4.864482 1.15E-06 0.000138927 0.000138927
AT2G16630.1 48.0092 12.4335 1.949078427 4.844358 1.27E-06 0.0001531 0.0001531
173.2718
AT4G23600.2 98.6053 0.813300193 4.84032 1.30E-06 0.000155562 0.000155562
5
164.9534
AT1G75750.1 92.4279 0.835658642 4.826211 1.39E-06 0.000166266 0.000166266
5
AT5G28050.2 22.4831 0 7.337228301 4.814964 1.47E-06 0.000175148 0.000175148
AT1G64720.1 380.8885 542.51 -4.807789 1.53E-06 0.000179994 0.000179994
0.510281001
23.95319
AT3G03341.1 1.69904 3.81742647 4.788494 1.68E-06 0.000197344 0.000197344
65
AT1G65490.1 89.1382 38.1739 1.223457243 4.768935 1.85E-06 0.000216577 0.000215758
AT2G05520.3 118.6263 58.7657 1.013377655 4.764567 1.89E-06 0.000219453 0.000219453
AT3G23080.2 22.4045 1.21997 4.198870954 4.7624 1.91E-06 0.000220892 0.000220892
AT1G13440.2 401.5785 289.256 0.473335146 4.739875 2.14E-06 0.000244868 0.000244868
199.2271
AT4G23600.1 120.442 0.726075696 4.737148 2.17E-06 0.000247154 0.000247154
5
AT5G08280.1 267.697 401.27 -4.736139 2.18E-06 0.000247361 0.000247361
0.583972329
AT3G18080.1 97.6601 180.675 -4.729983 2.25E-06 0.000253932 0.000253932
0.887555734
AT4G02520.1 78.51135 31.5522 1.315160631 4.72219 2.33E-06 0.00026278 0.00026278
AT2G24200.1 88.28225 167.429 -4.7186 2.37E-06 0.000266367 0.000266367
0.923354131
AT2G42600.1 154.593 86.1563 0.843446796 4.706881 2.52E-06 0.000279857 0.000279857
AT3G05590.1 419.8245 305.998 0.456264138 4.702316 2.57E-06 0.000285034 0.000285034
AT3G04840.1 447.584 330.345 0.438184956 4.696787 2.64E-06 0.00029168 0.00029168
AT4G01080.1 137.5963 233.91 -4.695728 2.66E-06 0.000292023 0.000292023
0.765511864
AT2G42600.2 160.3205 90.7009 0.821770142 4.694648 2.67E-06 0.000292401 0.000292401
AT5G49030.2 0 21.2129 -4.690047 2.73E-06 0.000297867 0.000297867
6.799703959
AT2G42220.1 398.643 559.451 -4.67278 2.97E-06 0.000322765 0.000321863
0.488914441
AT4G27520.1 477.796 357.505 0.418431357 4.672545 2.97E-06 0.000321863 0.000321863
21.93812
AT1G70410.1 1.33091 4.042955142 4.66398 3.10E-06 0.000334246 0.000334246
25
AT1G20620.1 119.0748 208.498 -4.663085 3.12E-06 0.000334393 0.000334393
0.808165419
AT4G37910.1 98.44825 45.6804 1.107790278 4.648985 3.34E-06 0.00035669 0.00035669
AT5G13510.1 423.24 588.134 -4.646971 3.37E-06 0.000358791 0.000358791
0.474668913
20.07786
AT2G03680.2 0 6.73495905 4.638918 3.50E-06 0.000371618 0.000371618
9
117.2258
AT2G05520.4 59.2447 0.984532738 4.631015 3.64E-06 0.000384605 0.000384605
5 117.2599
AT2G05520.6 59.3782 0.981705082 4.621297 3.81E-06 0.000401526 0.000401163
5
34.59604
AT3G57260.1 6.7224 2.363558825 4.620691 3.82E-06 0.000401163 0.000401163
5
AT1G20620.5 112.8033 198.852 -4.60457 4.13E-06 0.000430243 0.000430243
0.817885799
100.7092
AT5G09510.1 47.9177 1.071565632 4.583684 4.57E-06 0.000473767 0.000473767
5
19.33259
AT4G28140.1 0 6.455159995 4.58112 4.62E-06 0.000477811 0.000477811
4
114.2347
AT2G05520.5 57.9495 0.979133464 4.551952 5.32E-06 0.000547052 0.000547052
5
AT5G10760.1 34.946 7.18588 2.281890582 4.550837 5.34E-06 0.000547907 0.000547907
AT1G48300.1 55.4394 18.3987 1.591307811 4.547651 5.42E-06 0.000554197 0.000554197
AT1G66580.1 204.8385 127.991 0.678444532 4.546114 5.46E-06 0.000556191 0.000556191
129.7008
AT1G06430.1 69.7416 0.895096567 4.519763 6.19E-06 0.000627794 0.000627794
5
AT3G62870.1 430.363 319.92 0.427842863 4.5161 6.30E-06 0.000636396 0.000636396
AT4G16720.1 474.944 359.375 0.402267366 4.510565 6.47E-06 0.000650837 0.000650837
185.9050
AT4G23600.3 113.424 0.71284002 4.508321 6.53E-06 0.000655359 0.000655359
5
AT3G45970.1 31.7402 5.89237 2.429391289 4.494996 6.96E-06 0.000692714 0.000692714
AT5G58420.1 259.923 174.514 0.574741522 4.472116 7.74E-06 0.000765606 0.000765606
AT5G61820.1 63.1373 23.7803 1.408725651 4.452035 8.51E-06 0.000834836 0.000834836
AT3G09440.1 183.1945 112.324 0.705709973 4.439 9.04E-06 0.000880734 0.000880734
19.37297
AT4G30290.1 0 7.568540481 4.428378 9.49E-06 0.000921969 0.000921969
2
AT5G19240.1 59.28965 21.6634 1.452520593 4.410138 1.03E-05 0.000999621 0.000999621
AT1G56045.1 269.169 183.709 0.551089959 4.396776 1.10E-05 0.001059421 0.001059421
AT1G67870.1 369.085 269.725 0.452463859 4.378713 1.19E-05 0.001143118 0.001143118
39.74885
AT5G36700.3 91.3503 -4.37641 1.21E-05 0.001151244 0.001151244
5 1.200496164
17.59498
AT4G39320.1 0 5.011798359 4.367156 1.26E-05 0.001196942 0.001196942
5
AT1G21500.1 460.866 622.934 -4.362522 1.29E-05 0.001218372 0.001218372
0.434731979
AT2G45960.1 389.639 288.692 0.432606958 4.336259 1.45E-05 0.001363965 0.001363965
113.5348
AT1G04680.1 60.0109 0.919838735 4.320787 1.55E-05 0.001458219 0.001454106
5
221.8808
AT3G08580.1 332.816 -4.32024 1.56E-05 0.001456866 0.001454106
86 0.584939401
195.4151
AT1G52400.1 124.024 0.655922995 4.319909 1.56E-05 0.001454106 0.001454106
5
110.9747
AT1G19450.1 58.3038 0.928569638 4.303715 1.68E-05 0.001554089 0.001554089
5
AT3G53260.1 95.67 47.1698 1.020203114 4.301113 1.70E-05 0.001567177 0.001567177
AT1G04480.1 265.1155 182.525 0.53852694 4.281704 1.85E-05 0.001704627 0.001704627
AT2G36630.1 46.5118 14.7938 1.652604096 4.275287 1.91E-05 0.00174863 0.00174863
AT1G64510.1 386.603 531.557 -4.269728 1.96E-05 0.001786824 0.001786824
0.459371571
AT2G43100.1 268.03 388.305 -4.265824 1.99E-05 0.001812342 0.001812342
0.534795797
AT2G27530.1 310.8025 222.322 0.48334739 4.242049 2.21E-05 0.001989124 0.001989124
19.88279
AT2G23130.2 1.74141 3.513192758 4.237135 2.26E-05 0.002026522 0.002026522
5
AT5G09810.1 301.848 215.173 0.488325183 4.215827 2.49E-05 0.002220466 0.002213536
AT3G03150.1 139.3555 225.769 -4.215801 2.49E-05 0.002213536 0.002213536
0.696077462
AT4G19710.1 16.6726 0 4.65839719 4.204096 2.62E-05 0.00232372 0.00232372 AT1G18540.1 310.8365 223.222 0.477676701 4.201334 2.65E-05 0.002344694 0.002344694
AT4G08950.1 27.71085 5.18266 2.418686308 4.18963 2.79E-05 0.002461043 0.002461043
17.88963
AT2G02990.1 0 7.929592137 4.186811 2.83E-05 0.002483837 0.002483837
53
AT3G22840.1 29.33637 5.98508 2.293247931 4.181673 2.89E-05 0.002532552 0.002532552
AT3G61430.1 195.7595 126.546 0.629420416 4.180629 2.91E-05 0.002536138 0.002536138
AT1G64200.1 58.5824 116.181 -4.173988 2.99E-05 0.002594771 0.002594771
0.987834949
AT5G08640.1 34.404 8.62201 1.99648017 4.163756 3.13E-05 0.002705365 0.002705365
AT1G67865.1 238.648 162.579 0.553743326 4.156296 3.23E-05 0.002786423 0.002786423
AT1G78040.1 164.6155 101.804 0.693305937 4.147727 3.36E-05 0.002883719 0.002872322
AT5G59850.1 206.154 135.643 0.603907856 4.14749 3.36E-05 0.002877712 0.002872322
AT3G22120.1 206.7305 309.514 -4.147207 3.37E-05 0.002872322 0.002872322
0.582253415
AT4G13930.1 276.018 194.789 0.502850144 4.129655 3.63E-05 0.003072027 0.003072027
AT2G26080.1 244.7025 168.207 0.540791096 4.12772 3.66E-05 0.003088477 0.003088477
AT1G75690.1 429.7455 577.771 -0.42701526 -4.122477 3.75E-05 0.003140371 0.003140371
AT2G23120.1 94.4464 48.183 0.970971584 4.111925 3.92E-05 0.003277454 0.003277454
AT3G48460.1 79.9663 37.8417 1.079415235 4.107401 4.00E-05 0.003332161 0.003332161
AT3G23080.1 23.5216 62.2661 -1.40446072 -4.106152 4.02E-05 0.003340108 0.003340108
AT1G26770.2 52.84815 19.8332 1.413935501 4.083991 4.43E-05 0.003664308 0.003664308
AT5G39740.1 361.4705 270.102 0.42037359 4.079369 4.52E-05 0.003726694 0.003726694
AT1G01550.1 59.3871 24.116 1.30015895 4.072412 4.65E-05 0.00382832 0.00382832
AT5G60790.1 88.68805 44.4266 0.997315991 4.068755 4.73E-05 0.003865747 0.003865747
AT1G56110.1 71.9269 32.6163 1.140938295 4.064023 4.82E-05 0.003933297 0.003933297
AT5G50915.1 46.7127 16.1821 1.529415993 4.060338 4.90E-05 0.003984065 0.003984065
AT4G26850.1 248.3955 172.655 0.524746923 4.057153 4.97E-05 0.004026862 0.004026862
AT2G45960.3 312.0555 227.472 0.456113668 4.052782 5.06E-05 0.004090799 0.004090799
AT2G45660.1 21.37576 2.84639 2.908770463 4.051007 5.10E-05 0.004109877 0.004109877
AT1G29660.1 329.3605 242.616 0.440992848 4.049968 5.12E-05 0.004116092 0.004116092
14.86674
AT3G22620.1 0 5.587465388 4.046361 5.20E-05 0.004167813 0.004167813
55
19.01078
AT5G22500.1 1.96224 3.276244617 4.029802 5.58E-05 0.004459573 0.004459573
4
AT2G45560.2 0 16.4005 -4.024495 5.71E-05 0.004534986 0.004510541
4.384561539
AT4G09010.1 321.969 446.542 -4.024143 5.72E-05 0.004528668 0.004510541
0.471874087
AT2G21970.1 77.8651 37.1049 1.069367122 4.024029 5.72E-05 0.004517856 0.004510541
AT2G38750.1 65.0826 122.903 -0.91717634 -4.018387 5.86E-05 0.004600932 0.004600932
14.96870
AT1G54575.1 0 4.819717975 4.006379 6.17E-05 0.004827325 0.004827325
5
AT5G28060.1 318.717 234.408 0.443254165 4.000738 6.31E-05 0.004929815 0.004929815
AT1G54100.2 19.33045 2.22785 3.117151218 3.977359 6.97E-05 0.005409646 0.005409646
AT5G02450.1 255.9535 180.71 0.502205391 3.972496 7.11E-05 0.005505764 0.005505764
AT4G15440.1 60.80035 116.117 -0.93342767 -3.967902 7.25E-05 0.00559718 0.00559718
AT1G64770.1 162.779 103.012 0.660102182 3.963107 7.40E-05 0.005694842 0.005694842
AT3G51920.1 126.989 74.6499 0.766491301 3.951004 7.78E-05 0.005957332 0.005957332
AT3G05220.2 0 15.5797 -3.944393 8.00E-05 0.006090159 0.006090159
4.486207627 AT5G22620.2 18.9079 2.18907 3.110599146 3.92997 8.50E-05 0.006431659 0.006431659
154.7682
AT1G52400.2 97.0833 0.672814486 3.924834 8.68E-05 0.006552365 0.006552365
5
AT5G13650.1 175.642 114.192 0.621176285 3.917524 8.95E-05 0.006717307 0.006717307
AT4G25700.1 64.34235 28.6802 1.165713544 3.906901 9.35E-05 0.007000353 0.007000353
29.09972
AT5G54710.1 6.99806 2.05597858 3.900238 9.61E-05 0.007156852 0.007156852
5
AT4G34670.1 253.273 179.847 0.493923193 3.897996 9.70E-05 0.007203877 0.007203877
AT3G53020.1 265.962 191.009 0.477579515 3.885518 0.0001021 0.007563726 0.007563726
AT2G32240.1 36.5203 11.1272 1.714608012 3.884315 0.0001026 0.007580824 0.007580824
AT4G01310.1 381.159 512.331 -3.878677 0.000105 0.007737848 0.007737848
0.426683247
19.47636
AT2G44120.2 52.9524 -3.868399 0.0001096 0.008028299 0.008028299
5 1.442971631
AT1G76160.1 133.5865 81.0125 0.721557785 3.859374 0.0001137 0.008308461 0.008308461
AT5G58770.1 28.1426 6.77607 2.054234937 3.833542 0.0001263 0.009207334 0.009207334
AT5G13650.2 186.3285 124.418 0.582653139 3.828971 0.0001287 0.009355199 0.009355199
AT4G20830.2 33.78515 9.86844 1.775495313 3.824345 0.0001311 0.009507427 0.009507427
AT5G10360.1 310.636 231.288 0.425534619 3.819607 0.0001337 0.009666418 0.009666418
AT1G68520.1 87.17055 45.762 0.929690707 3.817901 0.0001346 0.009707912 0.009707912
AT5G24490.1 97.3623 163.033 -0.74372886 -3.815122 0.0001361 0.00979214 0.00979214
102.1920
AT1G04430.1 57.1517 0.838414649 3.808586 0.0001398 0.010028307 0.010008044
5
35.66851
AT5G65390.1 11.0193 1.694618573 3.808442 0.0001398 0.010008044 0.010008044
5
25.43309
AT3G01290.1 5.5356 2.199895434 3.79943 0.000145 0.010352058 0.01034748
5
AT3G21670.1 97.6897 53.9061 0.857757921 3.792046 0.0001494 0.010609746 0.010609746
AT5G15350.1 177.596 117.931 0.590656085 3.780168 0.0001567 0.011071722 0.011065706
AT1G69420.2 14.7296 0 3.894474273 3.779026 0.0001574 0.011065706 0.011065706
AT5G13710.2 3.81119 22.6792 -3.770367 0.000163 0.011427593 0.011427593
2.573056313
AT4G09000.1 138.2455 86.0323 0.684282208 3.760731 0.0001694 0.01184671 0.01184671
AT2G20450.1 132.7545 81.6483 0.701266012 3.759396 0.0001703 0.011879908 0.011879908
AT5G05270.1 33.90255 10.2961 1.71929582 3.749404 0.0001773 0.012269894 0.012269894
AT2G23090.1 314.92 236.711 0.411858633 3.744207 0.000181 0.012495173 0.012495173
AT4G12600.1 101.0628 57.102 0.823638874 3.734066 0.0001884 0.012912178 0.012912178
AT3G04920.1 200.002 137.637 0.539146075 3.72231 0.0001974 0.013461488 0.013461488
AT1G78680.1 76.57135 133.718 -3.717764 0.000201 0.013638325 0.013601946
0.804317084
23.57028
AT2G30790.1 57.9478 -3.717226 0.0002014 0.013633717 0.013601946
5 1.297784687
AT4G25700.2 0 14.093 -3.717194 0.0002014 0.013601946 0.013601946
4.323401946
AT5G06320.1 57.51165 25.494 1.17369648 3.7128 0.000205 0.013806441 0.013802516
AT3G02230.1 96.5691 53.9015 0.84123621 3.712252 0.0002054 0.013802516 0.013802516
AT4G13940.4 127.384 78.0935 0.705909702 3.702331 0.0002136 0.014283971 0.014283971
104.1147
AT5G67370.1 59.8091 0.799737557 3.701688 0.0002142 0.014285465 0.014285465
5
AT1G09590.1 248.8525 179.988 0.467390157 3.692406 0.0002221 0.014745624 0.014745624
AT5G13490.1 30.75745 8.79014 1.806977851 3.691681 0.0002228 0.014752143 0.014752143
AT3G44860.1 52.76995 100.632 -3.686303 0.0002275 0.014994962 0.014994962
0.931300619 AT1G01550.2 3.815575 22.074 -3.685626 0.0002281 0.014998893 0.014998893
2.532375692
AT5G47560.1 65.289 31.4222 1.055055751 3.646683 0.0002656 0.017381555 0.017381555
AT4G 14040.1 250.1965 349.582 -3.643955 0.0002685 0.017483656 0.017483656
0.482569295
112.8117
AT1G09780.1 67.2892 0.745470466 3.641317 0.0002712 0.017622061 0.017622061
5
AT3G44750.1 52.5095 22.627 1.214533141 3.640163 0.0002725 0.017659525 0.017659525
AT5G08610.1 54.60045 24.2421 1.171398162 3.612252 0.0003035 0.019581802 0.019581802
12.14895
AT2G37770.2 0 4.838740053 3.611525 0.0003044 0.019590797 0.019590797
25
AT1G29395.1 38.73728 13.9761 1.47076082 3.596588 0.0003224 0.020701855 0.020701855
AT3G12965.1 75.92265 39.5693 0.940148805 3.594564 0.0003249 0.020814823 0.020814823
AT3G48930.1 293.242 220.976 0.408202062 3.586692 0.0003349 0.021403209 0.021403209
AT5G56030.1 129.9964 81.7603 0.668999276 3.580396 0.0003431 0.021874742 0.021874742
AT1G03870.1 100.0647 58.0459 0.785667049 3.577617 0.0003467 0.022057384 0.022057384
AT5G61960.2 13.8915 1.16435 3.576605691 3.565297 0.0003634 0.023066583 0.023066583
AT1G23490.1 267.5665 198.841 0.428282234 3.563631 0.0003658 0.023160003 0.023114921
AT1G32080.1 274.819 376.858 -3.563539 0.0003659 0.023114921 0.023114921
0.455539268
AT2G37190.1 206.018 145.56 0.501156436 3.557777 0.000374 0.023573553 0.023573553
AT2G28190.1 76.8872 40.6387 0.91988919 3.555801 0.0003768 0.023697171 0.023697171
113.6606
AT4G13940.2 68.9889 0.720296708 3.554853 0.0003782 0.023728461 0.023728461
5
AT1G43710.1 67.8649 34.1304 0.991608277 3.543276 0.0003952 0.024626281 0.024626281
AT1G26770.1 38.86326 14.358 1.436552122 3.542353 0.0003966 0.02465671 0.02465671
AT3G56360.1 52.46815 23.3549 1.167716654 3.532595 0.0004115 0.025527071 0.025527071
12.90172
AT2G47485.1 0 3.836012242 3.519845 0.0004318 0.026725832 0.026725832
6
AT2G41090.1 216.6435 305.831 -3.516221 0.0004377 0.027032407 0.026989544
0.497411698
AT4G21620.1 69.4058 35.4847 0.967859119 3.516047 0.000438 0.026989544 0.026989544
AT2G43290.1 33.3801 11.163 1.58026348 3.511705 0.0004452 0.027372866 0.027372866
AT2G20570.1 147.0465 96.6855 0.604900997 3.507429 0.0004525 0.027754539 0.027754539
AT3G19030.1 43.476 17.5363 1.309874827 3.503563 0.0004591 0.028097865 0.028097865
AT5G03240.3 19.96325 49.9114 -3.502132 0.0004616 0.028123916 0.028123916
1.322022762
AT2G27420.1 23.75605 5.7992 2.034369175 3.500909 0.0004637 0.028190767 0.028190767
AT3G07050.1 43.253 17.4534 1.309292093 3.493421 0.0004769 0.028929296 0.028929296
AT1G61570.1 64.44595 32.1158 1.004806463 3.488613 0.0004855 0.029389781 0.029389781
AT2G39030.1 47.57119 20.3481 1.225194026 3.487512 0.0004875 0.029446156 0.029446156
121.0834
AT1G54270.1 75.7629 0.676438228 3.486697 0.000489 0.029471303 0.029471303
5
AT2G34620.1 78.36245 132.249 -3.485199 0.0004918 0.029507306 0.029507306
0.755022404
11.35781
AT5G44420.1 0 4.697724965 3.475127 0.0005106 0.030504632 0.030504632
96
AT5G14200.1 132.0217 200.827 -3.470602 0.0005193 0.030888921 0.030888921
0.605178164
AT3G13920.3 150.2965 100.002 0.58778256 3.463605 0.000533 0.031635067 0.031635067
12.37697
AT3G50970.1 0 3.885002168 3.461468 0.0005372 0.031818619 0.031818619
6
AT5G08760.1 42.9918 17.4898 1.297547723 3.459807 0.0005406 0.03187816 0.031858932
AT1G64500.1 62.9123 31.2495 1.009509 3.459392 0.0005414 0.031858932 0.031858932 AT3G50685.1 227.1525 317.031 -3.458168 0.0005439 0.031867489 0.031867489
0.480962734
AT5G37770.1 31.36805 10.2605 1.612194811 3.451731 0.000557 0.032568092 0.032568092
AT3G01820.1 38.8337 14.8564 1.386224606 3.45112 0.0005583 0.032572568 0.032572568
AT5G64840.1 181.511 126.477 0.521181929 3.448696 0.0005633 0.032796734 0.032796734
25.20068
AT3G18410.2 57.4904 -3.446038 0.0005689 0.033050965 0.033050965
5 1.189858119
AT2G43570.1 12.61471 0 3.700068534 3.438789 0.0005843 0.033877117 0.033877117
AT3G20390.1 259.4635 355.003 -3.432903 0.0005972 0.034548334 0.034538772
0.452299614
AT5G52470.1 82.98185 46.4496 0.837129648 3.427769 0.0006086 0.035060602 0.035013801
AT2G45960.2 210.535 151.72 0.472648815 3.427563 0.000609 0.035013801 0.035013801
AT1G69870.1 29.4477 9.28845 1.664645184 3.418698 0.0006292 0.036099114 0.036099114
AT5G16130.1 270.425 204.381 0.403967446 3.414987 0.0006379 0.036518284 0.036518284
AT5G38120.1 6.892615 26.4538 -3.404284 0.0006634 0.037822197 0.037822197
1.940351637
AT4G37540.1 41.8206 17.1081 1.289534215 3.39678 0.0006818 0.038794186 0.038794186
AT1G09240.1 19.73373 4.14063 2.252741478 3.394118 0.0006885 0.039092243 0.039092243
AT4G25630.1 46.8327 20.5187 1.190576885 3.386681 0.0007074 0.040084644 0.040084644
AT5G24120.1 33.2371 11.7192 1.503920421 3.384597 0.0007128 0.040307074 0.040307074
AT1G04040.1 267.1705 202.3 0.4012644 3.375756 0.0007361 0.04153929 0.04153929
AT2G39390.1 114.5075 71.8784 0.671811895 3.371804 0.0007468 0.042053534 0.042053534
AT1G29250.1 59.2979 29.3775 1.013269384 3.368264 0.0007564 0.042510191 0.042477404
AT1G70780.1 75.82905 41.596 0.866305848 3.367351 0.0007589 0.042520705 0.042477404
AT1G70782.1 75.82905 41.596 0.866305848 3.367351 0.0007589 0.042520705 0.042477404
11.79340
AT1G43160.1 0 8.128882501 3.366021 0.0007626 0.042596051 0.042530922
55
AT3G13120.1 276.9475 373.91 -0.43307854 -3.365883 0.000763 0.042530922 0.042530922
AT2G15020.1 34.35115 12.5067 1.457657226 3.365308 0.0007646 0.042533379 0.042533379
AT1G72430.1 83.0429 47.1253 0.817355023 3.364135 0.0007678 0.042628363 0.042628363
AT3G03920.1 68.9142 36.4634 0.918352195 3.361944 0.000774 0.042881392 0.042881392
AT5G28840.1 127.2875 82.4102 0.627195932 3.361269 0.0007759 0.042899783 0.042899783
AT5G62190.1 64.5973 33.3699 0.952926502 3.350971 0.0008053 0.044348959 0.044272139
AT3G48000.1 164.4945 113.739 0.532312322 3.340521 0.0008362 0.045868282 0.045868282
AT2G16660.1 179.909 126.875 0.503859537 3.339389 0.0008396 0.045963774 0.045963774
AT4G 14746.1 15.39521 2.31579 2.732905209 3.333651 0.0008571 0.046829176 0.046829176
AT5G05600.1 38.43492 15.3466 1.3244986 3.321168 0.0008964 0.048877742 0.048869207
AT5G10380.1 24.9028 7.12153 1.806048834 3.320664 0.000898 0.048869207 0.048869207
AT3G16080.1 193.064 138.572 0.4784434 3.315274 0.0009155 0.04972293 0.04972293
10.53352
AT4G21105.2 0 4.470537721 3.314468 0.0009182 0.049768117 0.049768117
75
C24xCol at ZT6
MPV C24xCol log2(Fold_c
Gene Name z-score p-value q-value q-value
RPKM RPKM hange)
AT2G25510.1 611.3505 3869.93 -51.38346 0 0 0
2.662235821
AT5G42530.1 936.878 3577.68 -40.76095 0 0 0
1.933091256
315.6361
AT1G31580.1 1651.36 -31.56433 1.14E-218 1.0576E-214 1.0576E-214
28 2.387320413 AT5G38430.1 9310.055 5752.33 0.694643248 28.89545 1.36E-183 7.5793E-180 7.5793E-180
AT3G22231.1 178.0048 660.3000 -28.35438 7.39E-177 3.428E-173 3.428E-173
2.704509818
AT5G38420.1 7993.535 4929.52 0.697386476 26.85234 7.92E-159 3.1482E-155 3.1482E-155
AT3G15353.1 1288.045 2949.59 -26.07815 6.45E-150 2.2439E-146 2.2439E-146
1.195331433
AT2G34420.1 8960.135 12674.1 -25.90238 6.26E-148 1.9355E-144 1.9355E-144
0.500290929
AT1G72610.1 3176.92 1474.8 1.10710944 25.08491 7.27E-139 2.022E-135 2.022E-135
AT5G38410.1 7088.105 4653.98 0.606934965 22.30605 3.23E-110 8.1642E-107 8.1642E-107
AT5G17920.1 1161.278 375.489 1.628870833 20.417 1.18E-92 2.73849E-89 2.73849E-89
1315.334
AT5G11740.1 473.186 1.47495044 20.19821 1.02E-90 2.17287E-87 2.17287E-87
5
AT5G17920.2 13.88325 382.905 -20.06434 1.51E-89 3.00695E-86 3.00695E-86
4.785569259
AT4G25100.4 357.812 5.34104 6.065937273 19.63069 8.46E-86 1.56858E-82 1.56858E-82
AT2G10940.1 1218.745 466.415 1.385710208 18.54352 9.20E-77 1.59999E-73 1.59999E-73
AT1G66100.1 679.961 1526.48 -18.39503 1.44E-75 2.35683E-72 2.35683E-72
1.166684781
458.2150
AT2G42540.2 63.9289 2.906206901 -18.37543 2.07E-75 3.19483E-72 3.19483E-72
5
AT2G41090.1 216.6435 773.524 -18.29638 8.84E-75 1.29509E-71 1.29509E-71
1.836123103
441.3380
AT2G42540.1 61.8759 2.834434625 17.80726 6.21E-71 8.63563E-68 8.63563E-68
5
AT1G76960.1 9.92065 254.398 -16.28972 1.17E-59 1.41258E-56 1.41258E-56
4.680508869
19.60383
AT1G14880.1 281.693 -16.28168 1.33E-59 1.54379E-56 1.54379E-56
5 3.844915899
AT3G22235.1 12.89104 258.424 -16.13781 1.38E-58 1.53999E-55 1.53999E-55
4.325299496
AT5G38410.2 4347.715 2955.89 0.55666479 16.12193 1.79E-58 1.91485E-55 1.91485E-55
AT3G22235.2 28.66485 292.907 -15.77219 4.83E-56 4.80427E-53 4.80427E-53
3.353088037
AT2G36830.1 703.7615 233.299 1.592906469 15.63618 4.13E-55 3.82821E-52 3.82821E-52
AT5G38410.3 4226.515 2893.7 0.54655321 15.629 4.62E-55 4.14666E-52 4.14666E-52
AT2G10940.2 874.739 337.023 1.376005567 15.62358 5.03E-55 4.37375E-52 4.37375E-52
AT1G64370.1 211.228 634.748 -14.97024 1.15E-50 9.68816E-48 9.68816E-48
1.587382856
AT1G19960.1 18.65192 241.06 -14.85232 6.72E-50 5.50009E-47 5.50009E-47
3.691996227
AT1G75040.1 97.9543 16.7790 2.082162123 14.5494 5.89E^8 4.68366E-45 4.68366E-45
AT3G23810.1 566.5985 180.975 1.646536366 14.36992 7.99E-17 6.17718E-44 6.17718E-44
AT4G21960.1 466.8715 991.922 -14.01437 1.27E^4 9.32259E-42 9.32259E-42
1.087201156
AT5G03350.1 23.60015 219.943 -13.43274 3.89E^1 2.77366E-38 2.77366E-38
3.220261752
AT3G17390.1 666.1755 265.899 1.325023945 13.24164 5.04E-W 3.50858E-37 3.50858E-37
AT5G42980.1 762.189 1355.23 -13.11378 2.75E-39 1.86338E-36 1.86338E-36
0.830317024
346.5066
AT5G59320.1 88.2156 1.973777331 12.73814 3.63E-37 2.40446E-34 2.40446E-34
5
AT5G10760.1 34.946 229.594 -12.63815 1.30E-36 8.41719E-34 8.41719E-34
2.715885704
AT1G23130.1 536.9025 1004.57 -12.12274 8.00E-34 4.94913E-31 4.94913E-31
0.903846069
134.4629
AT5G59310.1 5.20005 4.692538897 11.80582 3.64E-32 2.20313E-29 2.20313E-29
03
113.8939
AT4G19170.1 363.427 -11.76324 6.04E-32 3.57416E-29 3.57416E-29
5 1.673974492
AT3G44860.1 52.76995 244.965 -11.61978 3.27E-31 1.89548E-28 1.89548E-28
2.214787114 AT4G16190.1 127.3365 378.674 -11.4825 1.62E-30 9.17288E-28 9.17288E-28
1.572310353
AT4G02520.1 78.51135 291.53 -11.46206 2.05E-30 1.1386E-27 1.1386E-27
1.892671215
AT3G14420.4 37.59345 206.054 -11.32547 9.81E-30 5.35471E-27 5.35471E-27
2.454469245
AT3G16240.1 757.2185 380.334 0.993442744 11.18741 4.70E-29 2.51465E-26 2.51465E-26
AT3G26520.1 1303.235 789.03 0.723945195 11.17399 5.47E-29 2.87018E-26 2.87018E-26
AT2G45180.1 1598.02 1027.31 0.637413871 11.04301 2.37E-28 1.22099E-25 1.22099E-25
AT4G16980.1 814.2085 434.427 0.906284512 10.73555 6.93E-27 3.44345E-24 3.44345E-24
AT5G19140.1 93.59195 293.191 -10.4464 1.52E-25 7.42975E-23 7.42975E-23
1.647384467
AT3G08580.2 650.6945 326.505 0.994875274 10.38273 2.97E-25 1.42551E-22 1.40316E-22
AT3G13520.1 355.206 129.617 1.454401003 10.38261 2.98E-25 1.40316E-22 1.40316E-22
105.2391
AT2G38530.1 4.6991 4.485143084 10.3472 4.31E-25 1.99832E-22 1.99832E-22
4
AT1G67870.1 369.085 697.978 -10.24655 1.23E-24 5.50392E-22 5.41663E-22
0.919228458
AT1G19670.1 164.022 402.608 -10.24655 1.23E-24 5.41663E-22 5.41663E-22
1.295486505
AT5G42650.1 434.275 783.331 -0.85101315 -10.17682 2.52E-24 1.09407E-21 1.09407E-21
ATCG01210.1 348.6355 131.691 1.404562728 10.01774 1.27E-23 5.45288E-21 5.45288E-21
AT3G26740.1 99.45095 284.496 -9.69365 3.21E-22 1.35268E-19 1.35268E-19
1.516351311
AT1G15930.2 282.746 101.639 1.476052528 9.366527 7.50E-21 3.113E-18 3.113E-18
AT5G13930.1 427.8275 195.266 1.131588452 9.360389 7.94E-21 3.25076E-18 3.25076E-18
AT4G00430.1 221.075 66.0414 1.74309328 9.34636 9.07E-21 3.65824E-18 3.65824E-18
AT1G24147.1 19.4416 125.673 -2.69245587 -9.307352 1.31E-20 5.20959E-18 5.20959E-18
AT1G45145.1 32.44625 154.024 -9.29514 1.47E-20 5.76142E-18 5.76142E-18
2.247031517
AT2G16600.2 238.351 478.887 -9.146274 5.89E-20 2.24624E-17 2.24624E-17
1.006597594
AT1G04040.1 267.1705 96.8646 1.463719298 9.047644 1.46E-19 5.49303E-17 5.49303E-17
104.0749
AT1G66970.1 270.343 -8.796531 1.41E-18 5.23518E-16 5.23518E-16
5 1.377168136
AT5G37600.1 46.7268 169.984 -8.660092 4.71E-18 1.7034E-15 1.7034E-15
1.863076812
AT3G09820.1 214.831 71.0585 1.596123049 8.650346 5.13E-18 1.83159E-15 1.83159E-15
ATCGOl 180.1 739.6015 443.431 0.738038519 8.560397 1.12E-17 3.96169E-15 3.96169E-15
102.5731
AT3G25760.1 260.361 -8.473838 2.37E-17 8.15641E-15 8.15641E-15
5 1.343860226
10.15764
AT1G15930.1 87.772 -8.355275 6.53E-17 2.18848E-14 2.18848E-14
5 3.111194822
AT1G64360.1 9.670385 86.4521 -8.351314 6.75E-17 2.23618E-14 2.23618E-14
3.160255776
AT2G43570.1 12.61471 93.833 -8.347189 6.99E-17 2.28842E-14 2.28842E-14
2.894988351
AT3G60245.1 766.863 471.311 0.70228951 8.341281 7.35E-17 2.37775E-14 2.37775E-14
62.71857
AT2G14610.1 3.0800 3.999400127 7.954437 1.51E-16 1.05186E-13 1.05186E-13
3
AT5G10380.1 24.9028 119.302 -2.26023836 -8.209622 2.22E-16 7.01588E-14 7.01588E-14
AT4G23670.1 600.8025 914.259 -8.198415 2.44E-16 7.61524E-14 7.61524E-14
0.605712108
AT4G32940.1 20.4915 109.229 -8.167735 3.14E-16 9.71503E-14 9.71503E-14
2.414258439
AT5G19140.2 59.93795 183.233 -8.131782 4.23E-16 1.29349E-13 1.29349E-13
1.612137707
109.4150
AT2G46600.1 261.635 -8.073213 6.85E-16 2.07091E-13 2.0709 IE- 13
5 1.257744355 AT3G28270.2 285.9618 509.557 -8.06356 7.41E-16 2.19355E-13 2.19355E-13
0.833421099
88.25640
AT4G16590.1 11.8691 2.894490463 8.047552 8.45E-16 2.47399E-13 2.47399E-13
65
AT4G26530.1 114.9041 268.26 -7.999542 1.25E-15 3.58233E-13 3.58233E-13
1.223201675
109.3148
AT5G52310.1 21.5452 2.343051135 7.971586 1.57E-15 4.44775E-13 4.44775E-13
6
AT1G72930.1 92.90955 231.688 -7.877205 3.35E-15 9.40949E-13 9.40949E-13
1.318284522
AT4G26530.2 109.9663 257.106 -7.841935 4.44E-15 1.23447E-12 1.23447E-12
1.225301812
AT1G27950.1 270.783 118.057 1.197653582 7.794587 6.46E-15 1.76278E-12 1.76278E-12
AT1G55330.1 447.538 249.397 0.843566074 7.483005 7.26E-14 1.92502E-11 1.92502E-11
AT5G44020.1 296.737 140.968 1.073817122 7.468575 8.11E-14 2.12804E-11 2.12804E-11
AT3G25520.1 515.7785 302.737 0.768686627 7.408762 1.27E-13 3.31518E-11 3.31518E-11
AT3G09390.1 205.567 381.015 -7.369934 1.71E-13 4.3982E-11 4.3982E-11
0.890239111
AT1G70890.1 39.63525 132.839 -7.320318 2.47E-13 6.31509E-11 6.31509E-11
1.744822786
110.2576
AT5G04140.2 244.968 -7.290384 3.09E-13 7.81812E-11 7.81812E-11
75 1.151714218
AT3G62410.1 540.7345 801.816 -0.5683508 -7.257147 3.95E-13 9.91024E-11 9.91024E-11
AT2G06850.1 130.2085 38.1651 1.770497754 7.251446 4.12E-13 1.02442E-10 1.02364E-10
AT2G05520.2 126.8635 268.291 -7.250345 4.16E-13 1.02364E-10 1.02364E-10
1.080521609
AT1G67430.1 550.251 334.503 0.718070712 7.205929 5.76E-13 1.4071E-10 1.4071E-10
AT4G30530.1 312.5785 515.58 -7.174667 7.25E-13 1.73867E-10 1.72458E-10
0.721977752
AT4G39090.1 85.48125 205.208 -7.174606 7.25E-13 1.72458E-10 1.72458E-10
1.263407065
AT1G29660.1 329.3605 169.712 0.956578965 7.146397 8.91E-13 2.10067E-10 2.10067E-10
AT1G59870.1 55.5652 156.899 -7.133028 9.82E-13 2.29579E-10 2.29579E-10
1.497582634
AT1G49750.1 93.0316 214.596 -7.07502 1.49E-12 3.46485E-10 3.46485E-10
1.205830441
AT3G25770.1 473.1745 710.846 -7.032668 2.03E-12 4.65945E-10 4.65945E-10
0.587164717
AT1G35710.1 6.546205 59.6782 -6.966254 3.25E-12 7.42359E-10 7.42359E-10
3.188473335
AT5G15200.1 652.0425 421.935 0.627945236 6.956112 3.50E-12 7.91298E-10 7.91298E-10
AT1G20440.1 160.9686 59.3688 1.439002433 6.932923 4.12E-12 9.17632E-10 9.17632E-10
AT5G44130.1 167.5135 63.4465 1.400664882 6.928828 4.24E-12 9.3709E-10 9.3709E-10
AT4G26850.1 248.3955 424.214 -6.894517 5.40E-12 1.18417E-09 1.18417E-09
0.772153196
AT1G72930.2 71.21175 175.961 -6.811872 9.63E-12 2.07796E-09 2.07796E-09
1.305068493
AT4G35100.1 375.694 210.823 0.833525807 6.785275 1.16E-11 2.47997E-09 2.47997E-09
AT5G20290.1 711.159 475.889 0.579547044 6.753689 1.44E-11 3.06143E-09 3.06143E-09
AT1G75380.2 21.78725 90.6164 -6.745885 1.52E-11 3.18202E-09 3.18202E-09
2.056288067
AT3G49910.1 427.8035 251.332 0.767353917 6.736858 1.62E-11 3.36077E-09 3.36077E-09
44.84697
AT1G64770.2 0 7.390903552 6.73223 1.67E-11 3.44376E-09 3.44376E-09
15
AT1G20620.2 53.6408 146.453 -6.725662 1.75E-11 3.57626E-09 3.56885E-09
1.449035087
AT1G75380.3 21.26615 89.2931 -6.724897 1.76E-11 3.56885E-09 3.56885E-09
2.069989824
324.0262
AT5G35630.2 515.312 -6.716873 1.86E-11 3.74358E-09 3.74358E-09
65 0.669335429
AT4G00430.2 14.59439 74.9079 -6.674323 2.48E-11 4.97197E-09 4.97197E-09
2.359703965 AT1G10960.1 582.582 374.521 0.637414512 6.664507 2.66E-11 5.27792E-09 5.24315E-09
AT2G05520.3 118.6263 243.064 -6.664432 2.66E-11 5.24315E-09 5.24315E-09
1.034912335
AT4G25050.1 800.4635 552.684 0.534380772 6.650707 2.92E-11 5.71566E-09 5.71566E-09
AT3G62550.1 26.63585 98.2075 -6.628234 3.40E-11 6.6104E-09 6.6104E-09
1.882463885
AT3G56240.1 205.623 360.653 -6.625735 3.46E-11 6.67655E-09 6.67655E-09
0.810609778
AT3G18740.1 342.354 189.926 0.850051451 6.587948 4.46E-11 8.49894E-09 8.49894E-09
AT3G47370.3 0 40.0957 -6.582222 4.63E-11 8.77279E-09 8.76076E-09
5.367582087
AT3G47370.1 136.2025 48.1329 1.500657931 6.581418 4.66E-11 8.76076E-09 8.76076E-09
AT1G70700.1 114.4384 234.857 -6.562752 5.28E-11 9.86455E-09 9.86455E-09
1.037211362
AT1G70600.1 539.2125 342.844 0.653301667 6.555382 5.55E-11 1.02952E-08 1.02952E-08
AT2G43530.1 77.90625 181.223 -1.21795509 -6.5527 5.65E-11 1.04125E-08 1.04125E-08
AT5G64770.1 54.4497 144.355 -6.530836 6.54E-11 1.19727E-08 1.19727E-08
1.406625074
AT3G49010.3 151.2035 58.1052 1.379752349 6.5075 7.64E-11 1.38964E-08 1.38964E-08
AT5G23010.1 365.5995 559.938 -6.501496 7.95E-11 1.43688E-08 1.43688E-08
0.615002994
AT1G47128.1 180.017 323.387 -0.84512853 -6.499394 8.06E-11 1.4477E-08 1.4477E-08
AT3G45860.1 4.81574 49.5845 -6.497857 8.15E-11 1.45318E-08 1.45318E-08
3.364059799
AT2G21970.1 77.8651 179.753 -6.479923 9.18E-11 1.62642E-08 1.62642E-08
1.206967102
AT1G64720.1 380.8885 576.461 -6.434425 1.24E-10 2.1827E-08 2.1827E-08
0.597854277
AT5G57560.1 50.4339 5.29832 3.250786906 6.425242 1.32E-10 2.28964E-08 2.28964E-08
AT3G09820.2 0 43.7015 -6.405567 1.50E-10 2.58914E-08 2.58914E-08
8.251172061
AT4G38740.1 416.8195 618.579 -6.385419 1.71E-10 2.91784E-08 2.91784E-08
0.569535084
AT3G48930.1 293.242 158.085 0.891391267 6.350816 2.14E-10 3.61177E-08 3.61177E-08
AT5G60360.1 73.40985 170.558 -6.349839 2.16E-10 3.61289E-08 3.61289E-08
1.216216867
AT2G 18020.1 642.202 431.994 0.572015883 6.341342 2.28E-10 3.79508E-08 3.79508E-08
AT1G75380.1 18.7841 78.9449 -6.325823 2.52E-10 4.17186E-08 4.17186E-08
2.071334074
AT5G08760.1 42.9918 122.045 -6.314707 2.71E-10 4.45651E-08 4.45472E-08
1.505279771
AT2G32060.2 116.0795 38.8043 1.580824775 6.313856 2.72E-10 4.45472E-08 4.45472E-08
AT5G58420.1 259.923 134.729 0.94802388 6.300407 2.97E-10 4.83057E-08 4.83057E-08
AT2G41840.1 393.4945 234.956 0.743952861 6.2872 3.23E-10 5.22922E-08 5.22922E-08
AT3G28540.2 4.25398 45.6963 -3.4251922 -6.284034 3.30E-10 5.30604E-08 5.30604E-08
AT1G26770.2 52.84815 6.86553 2.944409968 6.280483 3.38E-10 5.39746E-08 5.39746E-08
AT3G28540.1 3.848515 44.483 -6.274903 3.50E-10 5.56264E-08 5.56264E-08
3.530880313
AT1G73600.2 83.0039 183.364 -6.27137 3.58E-10 5.65804E-08 5.65804E-08
1.143459392
AT5G41700.2 52.538 136.808 -6.2695 3.62E-10 5.69404E-08 5.69404E-08
1.380719409
AT4G17390.1 340.614 195.191 0.803251201 6.256316 3.94E-10 6.16178E-08 6.16178E-08
AT2G 14890.1 140.3554 54.2973 1.370132206 6.236095 4.49E-10 6.97379E-08 6.97379E-08
AT4G05320.3 217.646 365.354 -6.221302 4.93E-10 7.62167E-08 7.62167E-08
0.747311497
AT4G18100.1 465.2135 292.884 0.667563581 6.208057 5.36E-10 8.20128E-08 8.20128E-08
117.2258
AT2G05520.4 230.943 -6.203926 5.51E-10 8.37362E-08 8.37362E-08
5 0.978246078 AT5G15350.1 177.596 78.8818 1.17083471 6.19863 5.70E-10 8.61319E-08 8.61319E-08
159.0129
AT5G15650.1 66.8221 1.250747036 6.18234 6.32E-10 9.44827E-08 9.44827E-08
5
AT5G49730.1 76.3389 171.75 -6.180081 6.41E-10 9.53323E-08 9.53323E-08
1.169819796
AT4G16720.1 474.944 301.601 0.655116205 6.16751 6.94E-10 1.02133E-07 1.02133E-07
AT5G43850.1 81.42705 178.769 -6.153738 7.57E-10 1.10828E-07 1.10828E-07
1.134516542
AT3G49120.1 99.9597 205.511 -1.03979714 -6.151408 7.68E-10 1.1188E-07 1.1188E-07
114.2347
AT2G05520.5 225.511 -6.145703 7.96E-10 1.15372E-07 1.15372E-07
5 0.981196224
AT3G05590.1 419.8245 258.949 0.697118374 6.130261 8.77E-10 1.26489E-07 1.26489E-07
AT3G62870.1 430.363 267.373 0.686700263 6.123911 9.13E-10 1.30958E-07 1.30958E-07
58.48607
AT5G55450.1 15.1610 2.433299733 6.107217 1.01E-09 1.94833E-07 1.94833E-07
5
AT4G04830.1 34.88045 105.139 -1.59180736 -6.103821 1.04E-09 1.47775E-07 1.47775E-07
AT1G78040.2 336.089 195.052 0.784984533 6.091036 1.12E-09 1.59259E-07 1.59259E-07
AT3G04840.1 447.584 281.936 0.666790759 6.082918 1.18E-09 1.66688E-07 1.66688E-07
AT5G40890.2 34.8311 0 6.551316678 6.08175 1.19E-09 1.67059E-07 1.67059E-07
AT1G13470.1 4.126738 43.148 -6.077901 1.22E-09 1.70258E-07 1.70258E-07
3.386219937
117.2599
AT2G05520.6 228.076 -6.069426 1.28E-09 1.78593E-07 1.78593E-07
5 0.959804296
AT3G02560.1 138.1556 54.844 1.33288834 6.056772 1.39E-09 1.91304E-07 1.91304E-07
AT1G03870.1 100.0647 31.8169 1.65306794 6.055175 1.40E-09 1.92259E-07 1.92259E-07
AT2G36620.1 254.738 135.796 0.907573202 6.010705 1.85E-09 2.50721E-07 2.50721E-07
113.5348
AT1G04680.1 40.2007 1.497842679 6.000396 1.97E-09 2.65874E-07 2.65874E-07
5
ATCG00950.1 561.683 376.251 0.578060722 5.987595 2.13E-09 2.8627E-07 2.8627E-07
AT1G73325.1 59.1657 142.265 -5.982214 2.20E-09 2.94469E-07 2.94469E-07
1.265747821
AT2G14560.2 2.119945 36.3541 -5.966404 2.43E-09 3.22902E-07 3.22902E-07
4.100019339
AT3G51600.1 406.4395 253.408 0.681578547 5.911507 3.39E-09 4.49164E-07 4.49164E-07
AT5G27850.1 360.274 217.794 0.72613033 5.888251 3.90E-09 5.14702E-07 5.14702E-07
AT4G13340.1 114.953 42.3373 1.441042946 5.864949 4.49E-09 5.89667E-07 5.85469E-07
AT1G18540.1 310.8365 180.264 0.786044613 5.864592 4.50E-09 5.88164E-07 5.85469E-07
100.3834
AT5G38980.1 200.259 -5.864577 4.50E-09 5.85469E-07 5.85469E-07
5 0.996345646
AT5G49740.1 70.5982 157.367 -5.86198 4.57E-09 5.91935E-07 5.91935E-07
1.156429733
AT2G39800.1 53.57355 131.5 -5.855327 4.76E-09 6.13275E-07 6.13275E-07
1.295469996
AT1G77940.1 217.966 111.911 0.961751261 5.839812 5.23E-09 6.70105E-07 6.70105E-07
AT3G56340.1 384.657 238.333 0.690593839 5.818779 5.93E-09 7.56622E-07 7.56622E-07
AT1G10370.1 223.5145 116.404 0.941227791 5.806992 6.36E-09 8.04459E-07 8.04459E-07
AT5G15960.1 38.48454 3.34243 3.525309751 -5.805065 6.43E-09 8.10086E-07 8.10086E-07
AT1G15690.1 364.2845 222.731 0.709763243 5.802354 6.54E-09 8.19589E-07 8.19589E-07
AT5G50915.1 46.7127 6.54033 2.8363795 5.794872 6.84E-09 8.53136E-07 8.53136E-07
45.69840
AT1G57720.2 6.19391 2.883221487 5.779446 7.49E-09 9.30982E-07 9.30982E-07
5
AT3G11945.2 31.05615 0 5.275827476 5.766811 8.08E-09 9.99047E-07 9.99047E-07
AT1G76160.1 133.5865 55.0893 1.277930183 5.76326 8.25E-09 1.01579E-06 1.01579E-06
AT1G56280.1 88.9902 181.272 -5.716802 1.09E-08 1.33054E-06 1.33054E-06
1.026437724 AT3G54400.1 91.5691 29.8424 1.617497278 5.702174 1.18E-08 1.44359E-06 1.44359E-06
AT1G70820.1 89.6604 181.739 -5.691833 1.26E-08 1.52712E-06 1.52712E-06
1.019325205
AT4G31700.1 245.3485 134.246 0.869953349 5.689029 1.28E-08 1.54566E-06 1.54566E-06
AT5G39740.1 361.4705 223.044 0.696549573 5.683996 1.32E-08 1.58498E-06 1.57847E-06
AT2G16660.1 179.909 87.2213 1.044514961 5.683961 1.32E-08 1.57847E-06 1.57847E-06
AT5G02960.1 451.5985 294.811 0.615250339 5.682344 1.33E-08 1.58664E-06 1.58664E-06
AT4G05320.6 188.296 312.924 -5.661231 1.50E-08 1.77951E-06 1.77813E-06
0.732809959
AT1G80920.1 31.00335 92.1328 -5.660636 1.51E-08 1.77813E-06 1.77813E-06
1.571290747
AT5G60360.3 64.1305 144.197 -5.659349 1.52E-08 1.78395E-06 1.77969E-06
1.168958589
AT2G34480.1 619.133 433.058 0.515689098 5.659036 1.52E-08 1.77969E-06 1.77969E-06
AT5G60360.2 62.8228 141.295 -5.603589 2.10E-08 2.43421E-06 2.43421E-06
1.169350264
AT1G52000.1 78.9107 164.629 -5.59602 2.19E-08 2.53228E-06 2.53228E-06
1.060925651
AT3G60770.1 317.7625 190.968 0.734617969 5.587015 2.31E-08 2.65609E-06 2.65609E-06
AT1G21600.2 29.50665 0 6.679879862 5.581877 2.38E-08 2.72452E-06 2.72452E-06
AT4G00100.1 323.0825 195.316 0.726092471 5.575697 2.47E-08 2.81148E-06 2.81148E-06
AT4G19200.1 139.7155 247.456 -5.56871 2.57E-08 2.91461E-06 2.91461E-06
0.824679941
AT2G37600.1 102.1552 37.3379 1.45204995 5.560681 2.69E-08 3.03953E-06 3.03953E-06
AT2G36160.1 247.725 138.246 0.841501732 5.555057 2.78E-08 3.12632E-06 3.12632E-06
AT1G23290.1 321.947 195.055 0.722942226 5.544481 2.95E-08 3.2946E-06 3.2946E-06
AT4G13930.1 276.018 160.026 0.786456029 5.52882 3.22E-08 3.58821E-06 3.58821E-06
AT2G16630.1 48.0092 8.29843 2.532400575 5.526857 3.26E-08 3.61413E-06 3.61413E-06
AT5G18380.2 467.176 311.442 0.585002647 5.520335 3.38E-08 3.73599E-06 3.73599E-06
AT3G18490.1 171.271 287.485 -5.517773 3.43E-08 3.77586E-06 3.77586E-06
0.747205791
AT5G01410.1 289.716 435.497 -5.510979 3.57E-08 3.90911E-06 3.90911E-06
0.588023419
AT2G37600.2 2.42516 32.7231 -3.75415759 -5.504283 3.71E-08 4.04471E-06 4.04471E-06
143.1423
AT1G04800.1 64.3029 1.154494862 5.502232 3.75E-08 4.07607E-06 4.07607E-06
5
AT5G02160.1 264.548 403.852 -5.483857 4.16E-08 4.50561E-06 4.50561E-06
0.610297173
AT4G27520.1 477.796 321.122 0.573273269 5.480314 4.25E-08 4.57895E-06 4.57895E-06
AT1G26770.1 38.86326 4.70618 3.045778518 5.474686 4.38E-08 4.69052E-06 4.69052E-06
AT4G01080.1 137.5963 242.321 -5.464126 4.65E-08 4.95939E-06 4.95939E-06
0.816477761
AT3G02020.1 97.5078 187.977 -5.449071 5.06E-08 5.37741E-06 5.37741E-06
0.946966616
AT2G43550.1 257.5345 393.853 -5.43578 5.46E-08 5.77208E-06 5.77208E-06
0.612891552
AT5G47930.1 223.9765 122.846 0.866496487 5.416986 6.06E-08 6.38838E-06 6.38838E-06
AT3G56050.2 4.982875 38.6699 -5.413712 6.17E-08 6.48179E-06 6.48179E-06
2.956160745
AT5G65730.1 262.541 151.868 0.789724828 5.41171 6.24E-08 6.53005E-06 6.53005E-06
AT5G10360.1 310.636 188.908 0.717541236 5.410079 6.30E-08 6.56513E-06 6.56513E-06
AT3G14395.1 50.615 10.0508 2.33225466 5.409257 6.33E-08 6.57073E-06 6.57073E-06
AT2G24200.1 88.28225 174.265 -5.401869 6.60E-08 6.82181E-06 6.82181E-06
0.981087538
AT1G57660.1 341.2315 213.079 0.679362417 5.400654 6.64E-08 6.84272E-06 6.84272E-06 AT4G37450.1 59.97305 14.7015 2.028350983 5.394852 6.86E-08 7.04149E-06 7.04149E-06
13.27769
AT5G09220.1 56.5144 -5.382159 7.36E-08 7.50131E-06 7.50131E-06
5 2.089613799
AT1G73602.1 60.7741 134.404 -5.375043 7.66E-08 7.7752E-06 7.7752E-06
1.145047546
AT2G39800.2 47.2306 113.953 -5.369929 7.88E-08 7.96983E-06 7.96983E-06
1.270645138
AT1G73600.1 60.6468 134.105 -5.36836 7.95E-08 8.01035E-06 8.01035E-06
1.144859599
AT5G63160.1 37.3404 98.0129 -1.39223426 -5.339875 9.30E-08 9.27606E-06 9.27606E-06
AT1G31812.1 300.536 443.38 -5.333703 9.62E-08 9.56283E-06 9.56283E-06
0.561005879
AT2G31880.1 14.16455 57.5917 -2.02357614 -5.322769 1.02E-07 1.01199E-05 1.01199E-05
10.69296
AT2G 18660.1 50.5745 -5.318567 1.05E-07 1.03197E-05 1.03197E-05
05 2.241748813
AT5G20630.1 71.6367 21.4164 1.74198289 5.317716 1.05E-07 1.03314E-05 1.03314E-05
AT5G47330.1 35.02124 3.8129 3.199269567 5.316355 1.06E-07 1.03723E-05 1.03723E-05
AT1G20620.1 119.0748 214.39 -5.308784 1.10E-07 1.07745E-05 1.07745E-05
0.848369489
AT5G28060.1 318.717 197.607 0.689641919 5.289927 1.22E-07 1.19049E-05 1.19049E-05
AT1G03820.1 45.00694 8.06393 2.480592459 5.288678 1.23E-07 1.19447E-05 1.19447E-05
AT3G02480.1 25.8883 0 6.093851992 5.278925 1.30E-07 1.25545E-05 1.25545E-05
AT1G04480.1 265.1155 156.921 0.756582586 5.237496 1.63E-07 1.56715E-05 1.56715E-05
AT1G18080.1 426.722 285.446 0.580078646 5.235222 1.65E-07 1.5811E-05 1.5811E-05
AT4G37990.1 25.3133 0 5.661823693 5.226369 1.73E-07 1.65297E-05 1.65297E-05
AT3G11510.1 346.654 221.064 0.649032305 5.224727 1.74E-07 1.662E-05 1.662E-05
AT5G23740.1 241.908 139.546 0.79371771 5.217596 1.81E-07 1.72136E-05 1.72136E-05
AT3G55500.1 60.69725 16.1713 1.908195493 5.21188 1.87E-07 1.76922E-05 1.76922E-05
AT4G 11600.1 59.63525 129.987 -5.208967 1.90E-07 1.79113E-05 1.79113E-05
1.124130091
AT3G22230.1 294.74 180.5 0.707444029 5.20386 1.95E-07 1.83486E-05 1.83486E-05
AT5G40370.1 168.8965 276.823 -5.198999 2.00E-07 1.87715E-05 1.87715E-05
0.712824383
AT1G29070.1 536.027 376.851 0.508311451 5.195396 2.04E-07 1.90746E-05 1.90746E-05
AT4G36040.1 53.96315 121.009 -5.170692 2.33E-07 2.17044E-05 2.17044E-05
1.165067881
AT1G48630.1 127.47 57.715 1.143139524 5.150937 2.59E-07 2.40397E-05 2.40397E-05
77.32357
AT1G15690.2 154.29 -5.148906 2.62E-07 2.42207E-05 2.42207E-05
45 0.996664323
AT1G70700.2 82.6952 161.649 -5.141054 2.73E-07 2.51716E-05 2.51716E-05
0.966989086
AT1G32640.1 54.92195 121.917 -5.138388 2.77E-07 2.54471E-05 2.54471E-05
1.150444554
AT2G25210.1 167.7465 86.1502 0.961356614 5.121202 3.04E-07 2.77878E-05 2.77878E-05
AT5G36910.1 261.1826 156.14 0.742218613 5.111394 3.20E-07 2.91743E-05 2.91743E-05
AT2G27710.1 225.888 129.394 0.80383691 5.097858 3.44E-07 3.12365E-05 3.12365E-05
AT5G62350.1 225.7375 345.362 -5.094229 3.50E-07 3.17371E-05 3.17371E-05
0.613463251
AT4G13510.1 16.1091 58.594 -5.083922 3.70E-07 3.34008E-05 3.34008E-05
1.862877047
AT2G01020.1 203.1045 112.591 0.851130695 5.079503 3.78E-07 3.40215E-05 3.39629E-05
AT3G41979.1 203.1045 112.591 0.851130695 5.079503 3.78E-07 3.40215E-05 3.39629E-05
AT5G56710.1 180.366 95.8504 0.912071051 5.078911 3.80E-07 3.39629E-05 3.39629E-05
AT2G47610.1 239.894 140.379 0.773069943 5.077347 3.83E-07 3.4134E-05 3.4134E-05
AT1G28400.1 69.54185 21.9971 1.660568109 5.064267 4.10E-07 3.63297E-05 3.63297E-05 AT3G61110.1 219.651 125.507 0.807445237 5.046621 4.50E-07 3.97228E-05 3.97228E-05
AT2G37180.1 96.4126 38.4059 1.327893744 5.044897 4.54E-07 3.99559E-05 3.99559E-05
26.36685
AT2G43620.1 1.60163 4.041112691 5.038608 4.69E-07 4.11607E-05 4.11607E-05
5
AT5G61170.1 267.4925 162.597 0.718197802 5.024322 5.05E-07 4.42062E-05 4.42062E-05
AT2G27530.1 310.8025 197.068 0.657304579 5.003802 5.62E-07 4.90301E-05 4.90301E-05
AT2G37190.1 206.018 116.002 0.828620713 4.998621 5.77E-07 5.02084E-05 5.02084E-05
34.41927
AT2G36590.1 4.74212 2.859612633 4.994948 5.89E-07 5.1014E-05 5.1014E-05
5
AT5G03850.1 274.107 168.361 0.703181188 4.991444 5.99E-07 5.17868E-05 5.17868E-05
AT2G19680.2 24.6494 1.17276 4.393572822 4.983665 6.24E-07 5.3747E-05 5.3747E-05
AT3G09440.1 183.1945 99.3672 0.882534572 4.976688 6.47E-07 5.55482E-05 5.55482E-05
AT5G20700.1 321.366 457.395 -4.969166 6.72E-07 5.7569E-05 5.7569E-05
0.509223293
AT5G35480.1 82.00435 157.24 -4.94976 7.43E-07 6.34213E-05 6.34213E-05
0.939195923
AT1G52870.2 49.98965 111.593 -4.943414 7.68E-07 6.53219E-05 6.53219E-05
1.158545201
AT3G52590.1 419.8655 286.886 0.549449681 4.940893 7.78E-07 6.57699E-05 6.57699E-05
AT5G26340.1 5.49148 35.3731 -4.932854 8.10E-07 6.83288E-05 6.83288E-05
2.687385733
AT2G40750.1 3.83774 31.0582 -3.01664534 -4.899091 9.63E-07 8.04511E-05 8.04511E-05
AT1G27400.1 181.1985 99.1051 0.870539806 4.891737 1.00E-06 8.32669E-05 8.32669E-05
AT3G51730.1 70.7813 140.324 -4.872558 1.10E-06 9.15006E-05 9.15006E-05
0.987321614
AT3G16080.1 193.064 108.381 0.832967311 4.860871 1.17E-06 9.67832E-05 9.67832E-05
AT2G36530.1 466.2445 327.528 0.509468461 4.855503 1.20E-06 9.91474E-05 9.91474E-05
AT3G50480.1 9.601025 43.5373 -2.1809916 -4.852257 1.22E-06 0.000100486 0.000100486
AT2G21140.1 37.23775 6.52483 2.512753685 4.846088 1.26E-06 0.000103354 0.000103354
AT5G16130.1 270.425 168.205 0.685007939 4.843342 1.28E-06 0.000104179 0.000104179
AT4G12730.1 196.582 111.348 0.820055582 4.838973 1.31E-06 0.000106184 0.000106184
AT5G42300.1 155.1895 250.812 -4.826642 1.39E-06 0.000112642 0.000112642
0.692575426
AT5G63800.1 41.3443 96.8591 -4.821824 1.42E-06 0.000115063 0.000115063
1.228199154
AT4G39730.1 215.876 325.826 -4.808626 1.52E-06 0.000122568 0.000122568
0.593898871
AT1G08450.1 27.68435 75.2494 -4.804975 1.55E-06 0.000124465 0.000124465
1.442609429
AT2G26440.1 7.865295 39.4411 -4.802188 1.57E-06 0.000125847 0.000125847
2.326127006
AT4G34670.1 253.273 155.599 0.702860499 4.79601 1.62E-06 0.000129416 0.000129416
AT1G01620.2 132.2735 65.2952 1.018475213 4.772631 1.82E-06 0.000144973 0.000144973
AT2G28190.1 76.8872 28.5546 1.429020267 4.766176 1.88E-06 0.000149266 0.000149266
AT4G08950.1 27.71085 2.94495 3.23413592 4.751912 2.02E-06 0.000159284 0.000159284
AT5G36700.2 60.8255 19.1552 1.666940185 4.749275 2.04E-06 0.000160918 0.000160918
AT1G52300.1 373.3325 253.102 0.560742199 4.7469 2.07E-06 0.000162358 0.000162358
AT3G14420.6 292.068 187.44 0.639875441 4.734595 2.19E-06 0.000172039 0.000172039
AT1G73480.1 29.46285 77.121 -4.726393 2.29E-06 0.00017813 0.00017813
1.388226767
1.509807
AT3G49580.1 23.3208 -4.725132 2.30E-06 0.000178738 0.000178738
5 3.949180757
AT1G52870.1 44.2545 99.8168 -4.722812 2.33E-06 0.000180286 0.000180286
1.173458491
AT1G70410.1 21.93812 0 4.473385485 4.721415 2.34E-06 0.000181025 0.000181025 25
AT3G11120.1 200.42 116.073 0.78799406 4.719126 2.37E-06 0.000182566 0.000182566
AT5G54940.1 64.36515 128.67 -4.712243 2.45E-06 0.000188322 0.000188322
0.999324053
AT2G17040.1 5.346735 33.0479 -2.62782852 -4.711003 2.47E-06 0.00018895 0.00018895
AT3G02230.1 96.5691 41.6563 1.21302693 4.702118 2.57E-06 0.000196821 0.000196821
AT3G23390.1 220.109 131.443 0.743780823 4.700933 2.59E-06 0.000197424 0.000197424
AT1G20620.5 112.8033 193.66 -4.69683 2.64E-06 0.000200879 0.000200879
0.779716726
AT1G35720.1 87.4434 159.684 -4.674216 2.95E-06 0.000223113 0.000223113
0.868798362
AT1G65800.1 11.9294 46.3172 -4.670619 3.00E-06 0.000226441 0.000226441
1.957026558
AT3G18080.1 97.6601 173.235 -4.669744 3.02E-06 0.000226793 0.000226793
0.826889278
AT2G15620.1 333.763 222.69 0.583787256 4.656843 3.21E-06 0.000240174 0.000240174
AT5G54940.2 83.38085 153.883 -4.65595 3.22E-06 0.00024057 0.00024057
0.884045876
102.1920
AT1G04430.1 45.902 1.154654047 4.649484 3.33E-06 0.000246913 0.000246913
5
AT3G56020.1 147.575 77.7368 0.924778716 4.648385 3.35E-06 0.000247572 0.000247572
AT5G05270.1 33.90255 5.86501 2.531188317 4.643156 3.43E-06 0.000252579 0.000252579
AT4G36130.1 165.621 91.0596 0.863002585 4.641883 3.45E-06 0.000253471 0.000253471
AT3G47480.1 7.940425 38.0335 -4.634931 3.57E-06 0.00026145 0.00026145
2.259982575
20.07786
AT2G03680.2 0 5.211350506 4.631522 3.63E-06 0.000265095 0.000265095
9
34.59604
AT3G57260.1 3.7950 2.363558825 4.620691 3.82E-06 0.000401163 0.000401163
5
19.88279
AT2G23130.2 0 5.180853404 4.606231 4.10E-06 0.00029867 0.00029867
5
AT3G26280.1 8.263135 38.3708 -4.599146 4.24E-06 0.000308202 0.000308202
2.215247701
AT5G03240.2 76.3518 143.056 -4.581459 4.62E-06 0.000333714 0.000333714
0.905845934
AT3G14067.1 64.18025 126.092 -4.568636 4.91E-06 0.000353873 0.000353873
0.974275431
AT3G59540.1 266.0445 170.021 0.645954628 4.557391 5.18E-06 0.000371427 0.000371427
AT5G19240.1 59.28965 118.637 -4.529883 5.90E-06 0.000422142 0.000422142
1.000701836
116.2725
AT3G18130.1 56.8121 1.033240404 4.52844 5.94E-06 0.000423943 0.000423943
5
AT2G32060.1 7.911885 36.9795 -4.52668 5.99E-06 0.000426395 0.000426395
2.224632357
AT1G09690.1 409.8555 288.564 0.506224031 4.525364 6.03E-06 0.000427963 0.000427963
AT4G26230.1 167.6455 94.1817 0.831895089 4.524495 6.05E-06 0.000428631 0.000428631
AT5G19590.1 63.8111 124.859 -4.523744 6.08E-06 0.000429065 0.000429065
0.968420507
AT5G45950.1 88.21415 37.8044 1.222455933 4.521877 6.13E-06 0.000431771 0.000431771
AT3G05220.2 0 19.2534 -4.499957 6.80E-06 0.000477573 0.000477573
4.791653411
AT4G34920.1 51.17365 106.596 -4.495132 6.95E-06 0.0004873 0.0004873
1.058680259
AT5G19510.1 306.2095 203.634 0.58854058 4.493571 7.00E-06 0.000489656 0.000489656
AT3G16460.1 3.602485 26.9743 -4.482677 7.37E-06 0.000514047 0.000513208
2.904521193
AT2G32680.1 3.882205 27.6563 -4.482491 7.38E-06 0.000513208 0.000513208
2.832659952
AT1G09590.1 248.8525 157.873 0.656526423 4.472535 7.73E-06 0.000535028 0.000535028
AT5G19250.1 108.457 183.601 -4.47129 7.77E-06 0.000536817 0.000536817
0.759450747 AT1G49500.1 71.62675 134.327 -4.444913 8.79E-06 0.000604095 0.000604095
0.907178931
AT4G31700.2 162.8475 91.7583 0.827611004 4.439366 9.02E-06 0.000618348 0.000618348
AT5G02450.1 255.9535 164.212 0.640322177 4.434938 9.21E-06 0.0006281 0.0006281
AT3G04720.1 5.205575 30.3464 -4.434169 9.24E-06 0.000628806 0.000628806
2.543395944
AT1G33120.1 322.121 218.076 0.562771712 4.423858 9.70E-06 0.000657984 0.000657984
AT5G56670.1 269.8235 175.667 0.619172805 4.417299 9.99E-06 0.000676614 0.000676123
AT2G15960.1 41.6755 91.6976 -4.416931 1.00E-05 0.000676123 0.000676123
1.137684467
AT5G57040.1 166.058 254.982 -4.409911 1.03E-05 0.000696723 0.000696723
0.618708178
AT1G02920.1 4.983335 29.5522 -4.39923 1.09E-05 0.000730141 0.000730141
2.568082069
AT2G16600.1 75.03555 138.133 -4.396027 1.10E-05 0.000739208 0.000739208
0.880411845
AT5G14200.1 132.0217 211.89 -4.380381 1.18E-05 0.000792423 0.000792423
0.682540422
AT1G70580.3 8.34782 36.5202 -4.37807 1.20E-05 0.000798949 0.000797549
2.129223268
AT4G32340.1 37.9247 85.5793 -1.17412411 -4.374971 1.21E-05 0.000804596 0.00080286
AT3G53870.1 368.6355 257.67 0.516670434 4.373824 1.22E-05 0.000805006 0.000805006
AT4G12420.1 121.1695 62.0311 0.965962985 4.369996 1.24E-05 0.000817312 0.000817312
AT5G07090.1 191.897 115.084 0.737644886 4.35729 1.32E-05 0.000862135 0.000860448
AT1G22930.1 9.68981 38.9233 -4.351342 1.35E-05 0.000881712 0.000881712
2.006093748
19.33259
AT4G28140.1 1.08286 4.15811659 4.350527 1.36E-05 0.000882928 0.000882928
4
AT2G39460.1 135.815 72.9033 0.897586801 4.347418 1.38E-05 0.000893447 0.000893447
AT1G19660.1 17.8959 53.6328 -4.342999 1.41E-05 0.000909495 0.000909495
1.583486474
AT5G59850.1 206.154 126.737 0.701884683 4.321504 1.55E-05 0.001000471 0.001000471
AT1G74670.1 146.062 80.9283 0.851864695 4.310643 1.63E-05 0.001046041 0.001046041
AT3G45030.1 171.8965 100.449 0.775076969 4.307594 1.65E-05 0.001058118 0.001058072
19.37297
AT4G30290.1 1.20805 4.003293221 4.306587 1.66E-05 0.001058072 0.001058072
2
AT5G24120.1 33.2371 77.5837 -4.301039 1.70E-05 0.001082432 0.001082432
1.222959071
AT1G70810.1 26.8441 67.6598 -4.29452 1.75E-05 0.001112184 0.001112184
1.333693876
AT5G47240.1 19.6022 55.9484 -4.291632 1.77E-05 0.001124186 0.00112216
1.513081294
AT4G05320.5 138.2835 217.9 -4.29137 1.78E-05 0.001122957 0.00112216
0.656037172
AT3G55750.1 174.0625 102.343 0.766192993 4.291023 1.78E-05 0.00112216 0.00112216
35.66851
AT5G65390.1 8.17107 2.126054236 4.288471 1.80E-05 0.00113256 0.00113256
5
17.88963
AT2G02990.1 0 7.194432604 4.282171 1.85E-05 0.00115987 0.00115987
53
AT2G45470.1 309.285 210.51 0.555048098 4.280122 1.87E-05 0.00116535 0.00116535
AT5G44568.1 27.47175 68.4234 -4.276185 1.90E-05 0.001183484 0.001183484
1.316540979
AT5G02870.1 206.932 128.137 0.691469642 4.272328 1.93E-05 0.00120146 0.00120146
AT3G09500.1 324.7455 223.491 0.539092799 4.269597 1.96E-05 0.001213555 0.001213555
AT4G05070.1 30.8337 73.4221 -4.260488 2.04E-05 0.00126128 0.00126128
1.251706357
AT1G22780.1 171.975 101.211 0.764832759 4.258558 2.06E-05 0.001269398 0.001269398
AT2G01250.1 236.565 151.875 0.639352233 4.257789 2.06E-05 0.001270952 0.001270952
AT2G24850.1 15.05075 47.754 - -4.248892 2.15E-05 0.001319572 0.001319572 1.665786202
4.637550
AT1G56120.1 27.5249 -4.246765 2.17E-05 0.001329219 0.001329219
5 2.569302425
AT3G45970.1 31.7402 6.45287 2.298298353 4.245837 2.18E-05 0.001331802 0.001331802
AT5G23020.1 50.26739 101.623 -4.243162 2.20E-05 0.00134483 0.00134483
1.015532271
127.0074
AT4G05320.1 202.301 -4.220273 2.44E-05 0.001485662 0.001485662
5 0.671590326
AT3G02470.4 223.374 142.075 0.652808555 4.215753 2.49E-05 0.001512432 0.001512432
26.51602
AT2G05540.1 4.22082 2.651269253 4.213167 2.52E-05 0.001526526 0.001525341
4
AT1G20693.1 32.93125 76.0091 -4.212851 2.52E-05 0.001525341 0.001525341
1.206714877
100.7092
AT5G09510.1 49.396 1.027730074 4.195804 2.72E-05 0.001637611 0.001637611
5
AT4G38550.1 31.44855 73.4867 -4.19002 2.79E-05 0.00167629 0.00167629
1.224489667
17.59498
AT4G39320.1 0 4.276634861 4.18217 2.89E-05 0.001727779 0.001727779
5
AT4G04330.1 18.38745 52.7439 -4.181412 2.90E-05 0.001729832 0.001729832
1.520282833
19.01078
AT5G22500.1 1.41182 3.751189961 4.175397 2.97E-05 0.001772381 0.001772381
4
AT5G19190.1 86.40955 39.7393 1.120624308 4.172982 3.01E-05 0.001787451 0.001787451
AT3G49010.1 22.44765 59.1488 -1.39778448 -4.160602 3.17E-05 0.001883144 0.00188269
AT2G23130.1 82.84035 37.4389 1.145795602 4.16017 3.18E-05 0.00188269 0.00188269
AT1G69620.1 259.096 171.972 0.591313054 4.151115 3.31E-05 0.001954596 0.00195404
AT1G13360.1 50.3716 100.439 -4.150695 3.31E-05 0.00195404 0.00195404
0.995637107
AT5G47700.1 158.847 92.8125 0.775246818 4.141634 3.45E-05 0.002028584 0.00202649
AT1G20620.4 157.0028 237.858 -4.141386 3.45E-05 0.00202649 0.00202649
0.599310261
AT1G04820.1 157.274 91.6391 0.779244994 4.139691 3.48E-05 0.00203722 0.00203722
AT1G56045.1 269.169 180.44 0.576993074 4.137366 3.51E-05 0.002053644 0.002053644
AT3G09200.2 211.6115 134.171 0.657345155 4.128873 3.65E-05 0.00212652 0.00212652
AT2G47130.1 2.116742 20.4663 -4.126664 3.68E-05 0.002142546 0.002142546
3.273332967
AT3G10020.2 8.846985 35.2453 -4.12466 3.71E-05 0.002152277 0.002152277
1.994173103
AT3G06700.1 219.815 140.855 0.642079061 4.120045 3.79E-05 0.002191285 0.002191285
AT2G04780.1 63.43555 25.0704 1.339306555 4.119342 3.80E-05 0.002193418 0.002193418
AT2G37710.1 20.81545 55.9775 -4.111163 3.94E-05 0.002258536 0.002257239
1.427192309
AT4G33865.1 289.5415 197.804 0.549698544 4.104491 4.05E-05 0.002315163 0.002315163
AT3G53460.1 277.0895 187.699 0.561931079 4.097288 4.18E-05 0.002383481 0.002380101
11.26915
AT4G27740.1 39.5408 -4.097142 4.18E-05 0.002380101 0.002380101
5 1.810962719
AT5G01750.2 180.5685 265.477 -4.094373 4.23E-05 0.002403813 0.002403813
0.556040638
39.74885
AT5G36700.3 84.485 -4.090277 4.31E-05 0.002441675 0.002441675
5 1.087781916
AT2G44290.1 31.4387 71.9526 -4.066296 4.78E-05 0.002695934 0.002695934
1.194505257
AT3G22600.1 38.85114 10.8788 1.836437505 4.062442 4.86E-05 0.0027353 0.0027353
AT5G64310.1 28.34837 5.60128 2.339437331 4.055639 5.00E-05 0.002810466 0.002810466
AT1G41880.1 216.1145 139.019 0.636513799 4.053238 5.05E-05 0.002833753 0.002833753
AT5G02870.2 180.921 111.211 0.702060382 4.049256 5.14E-05 0.002876595 0.002876595
AT3G51450.1 26.1406 63.6222 -4.043047 5.28E-05 0.002936146 0.002936146
1.283238004 AT3G56090.1 114.0505 60.6298 0.911573803 4.036714 5.42E-05 0.003010493 0.003010493
AT3G15840.2 72.9656 129.284 -4.027281 5.64E-05 0.003127572 0.003127572
0.825255377
AT1G78040.1 164.6155 99.1714 0.731104157 4.003977 6.23E-05 0.00343192 0.00343192
AT1G19660.2 14.32745 44.0369 -4.000083 6.33E-05 0.003481996 0.003481996
1.619931052
AT3G16670.1 82.72135 38.8801 1.089227801 3.989334 6.63E-05 0.003636406 0.003636406
AT3G15840.1 73.22795 128.849 -3.978998 6.92E-05 0.003783239 0.003783239
0.815215027
AT4G23260.1 10.79297 37.5543 -3.974701 7.05E-05 0.003837112 0.00383111
1.798886188
AT1G14345.1 165.107 99.9701 0.723832717 3.974608 7.05E-05 0.00383111 0.00383111
AT4G14320.1 293.7255 204.063 0.525453898 3.9655 7.32E-05 0.003972635 0.003972635
AT2G17360.1 215.522 140.058 0.621810753 3.963007 7.40E-05 0.00400656 0.00400656
AT4G31985.1 246.511 165.211 0.577342278 3.961551 7.45E-05 0.004023251 0.004023251
AT2G29550.1 64.8752 27.1722 1.255535703 3.960691 7.47E-05 0.00402995 0.00402995
AT1G43170.1 159.6775 95.9774 0.734394402 3.959153 7.52E-05 0.004048135 0.004048135
AT3G28940.1 60.286 111.25 -3.958214 7.55E-05 0.004056227 0.004056227
0.883910422
AT1G24145.1 3.00834 21.4763 -3.952189 7.74E-05 0.004151744 0.004144992
2.835705929
AT3G17020.1 54.64205 103.466 -3.95066 7.79E-05 0.004162313 0.004152025
0.921073246
AT1G16720.1 107.7315 172.786 -3.950505 7.80E-05 0.004157042 0.004152025
0.681546181
AT1G66330.1 13.3654 41.8977 -3.950336 7.80E-05 0.004152025 0.004152025
1.648368033
12.58668
AT4G37150.1 40.4872 -3.944946 7.98E-05 0.004238423 0.004238423
5 1.685567508
AT3G62820.1 70.5978 31.076 1.18382241 3.942799 8.05E-05 0.004268415 0.004268415
AT1G55490.2 294.1845 205.001 0.521090289 3.938081 8.21E-05 0.004344931 0.004344931
AT4G39200.1 203.697 131.076 0.63602118 3.932296 8.41E-05 0.004433993 0.004433993
AT4G34950.1 260.2055 177.043 0.555551654 3.929042 8.53E-05 0.004485929 0.004481208
AT2G24200.2 89.89505 44.4291 1.01673676 3.928841 8.54E-05 0.004481208 0.004481208
AT5G45380.1 4.34361 24.3753 -3.925682 8.65E-05 0.00451487 0.00451487
2.488453496
AT4G15530.3 5.433125 26.7065 -3.922377 8.77E-05 0.004568696 0.004558671
2.297336772
AT2G29670.1 44.8778 89.5463 -3.922353 8.77E-05 0.004560614 0.004558671
0.996631868
AT1G78680.1 76.57135 132.282 -3.920018 8.85E-05 0.004587876 0.004587876
0.788740165
AT3G28900.1 118.236 65.0822 0.861334443 3.915429 9.02E-05 0.004667342 0.004667342
AT1G71030.1 59.28655 109.213 -3.912355 9.14E-05 0.004709659 0.004709659
0.881367844
AT3G11940.2 194.898 124.425 0.647442899 3.90867 9.28E-05 0.004773219 0.004773219
AT1G29670.1 168.6545 103.702 0.701627094 3.907406 9.33E-05 0.004789412 0.004789412
AT5G56710.2 99.81805 51.7525 0.947672164 3.902881 9.51E-05 0.004861926 0.004861926
AT4G20110.1 1.37375 16.8839 -3.902234 9.53E-05 0.004866007 0.004866007
3.619456803
AT1G07890.8 93.20835 47.06 0.985957883 3.899216 9.65E-05 0.00491802 0.00491802
14.86674
AT3G22620.1 0 7.244620388 3.896877 9.74E-05 0.004956666 0.0049486
55
AT1G24020.1 45.96455 15.8094 1.539739001 3.896829 9.75E-05 0.0049486 0.0049486
AT3G19010.1 16.1142 46.0219 -3.894035 9.86E-05 0.004996857 0.004996857
1.513987979
AT1G65790.1 4.724616 24.9451 -3.890243 0.0001001 0.005066365 0.00505291
2.400487471 AT4G15440.1 60.80035 110.917 -3.890008 0.0001002 0.00505291 0.00505291
0.867328967
AT1G14320.1 291.3175 203.634 0.516613907 3.887635 0.0001012 0.005093317 0.005093317
AT1G06460.1 108.4214 172.413 -3.884025 0.0001027 0.005160254 0.005151361
0.669219017
AT3G07110.1 117.3875 64.8146 0.856888058 3.884006 0.0001027 0.005151361 0.005151361
AT3G15536.1 0 14.7836 -3.882304 0.0001035 0.005178222 0.00516918
4.432086848
AT2G41410.1 70.83545 124.144 -3.882292 0.0001035 0.00516918 0.00516918
0.809471085
AT2G21580.1 131.8296 75.6834 0.800625531 3.880737 0.0001041 0.005193016 0.005193016
AT3G06680.2 64.5535 27.5728 1.227249539 3.880219 0.0001044 0.005194778 0.005194778
AT5G60900.1 4.537915 24.3877 -3.870171 0.0001088 0.005403958 0.005397258
2.426052213
AT3G08030.1 92.44265 46.8061 0.981862056 3.869641 0.000109 0.005406068 0.005397258
AT1G27970.1 72.0882 32.7808 1.136912063 3.856413 0.0001151 0.005686737 0.005686737
AT5G44580.1 67.87095 119.802 -3.854986 0.0001157 0.005699743 0.005699743
0.819785881
AT2G15020.1 34.35115 73.6516 -3.854426 0.000116 0.005702722 0.005702722
1.100358468
AT1G11910.1 192.7875 274.367 -3.847398 0.0001194 0.005858421 0.005853555
0.509095456
AT2G27720.1 151.4485 91.1964 0.731778509 3.84362 0.0001212 0.005928475 0.005928475
AT2G47110.1 230.8265 154.599 0.578277874 3.839104 0.0001235 0.006027974 0.006013843
AT4G24350.1 21.9515 54.8501 -3.838912 0.0001236 0.006022128 0.006013843
1.321174725
AT3G15840.4 62.51505 112.441 -3.83882 0.0001236 0.006013843 0.006013843
0.846892736
AT3G16780.1 95.5603 49.365 0.952922856 3.836584 0.0001248 0.006058252 0.006058252
AT1G08450.2 17.5863 47.8418 -3.833629 0.0001263 0.006120842 0.006120842
1.443819686
AT3G55280.3 85.22735 42.0601 1.018864195 3.832132 0.000127 0.006147516 0.006147516
27.81259
AT1G72910.1 63.7041 -3.828991 0.0001287 0.006215677 0.006215677
5 1.195647869
AT3G54600.1 135.5905 204.984 -3.827202 0.0001296 0.00625017 0.00625017
0.596255204
AT5G13490.1 30.75745 7.70148 1.997728278 3.825102 0.0001307 0.006292779 0.006292779
AT1G17880.1 201.8825 131.42 0.61933101 3.821667 0.0001326 0.006370067 0.006370067
AT2G34510.1 68.3158 30.5636 1.160404798 3.816732 0.0001352 0.006487584 0.006487584
AT5G23900.1 156.6775 95.7283 0.710780619 3.809771 0.0001391 0.006661507 0.006661507
AT4G22010.1 44.50175 15.5337 1.518460561 3.795006 0.0001476 0.007058562 0.007058562
AT3G53460.2 244.442 166.607 0.553043173 3.792329 0.0001492 0.007122864 0.007122864
AT5G09440.1 24.29697 4.6934 2.372071085 3.785757 0.0001532 0.00730126 0.00730126
AT2G05220.1 136.243 80.2575 0.763473986 3.784439 0.0001541 0.007327534 0.007327534
AT3G58610.2 182.814 116.923 0.644817806 3.771702 0.0001621 0.007685654 0.007685654
AT2G30520.2 26.7304 5.91234 2.176680285 3.768011 0.0001646 0.007773681 0.007773681
AT5G24210.1 36.603 75.7976 -3.765861 0.000166 0.007827607 0.007827607
1.050190271
AT1G72370.1 264.0975 183.591 0.524575308 3.754313 0.0001738 0.008169706 0.008169706
AT5G19770.1 175.744 111.564 0.655603869 3.753695 0.0001742 0.008176101 0.008176101
AT1G26880.1 125.022 72.1306 0.793498657 3.749827 0.000177 0.008289243 0.008289243
1.043211
AT1G18150.2 14.9293 -3.746214 0.0001795 0.008395345 0.008395345
5 3.839042939
AT5G20720.1 275.706 193.572 0.510260381 3.738834 0.0001849 0.008631165 0.008631165
AT4G 18730.1 203.8 134.336 0.601308075 3.738151 0.0001854 0.00864012 0.00864012 AT3G53020.1 265.962 185.687 0.518347316 3.726104 0.0001945 0.009033228 0.009033228
AT2G43970.1 120.6245 184.502 -3.721265 0.0001982 0.009192776 0.009192776
0.613113493
2.040674
AT5G55460.1 17.4505 -3.717178 0.0002015 0.009311694 0.009311694
5 3.096150387
AT5G07090.2 160.0175 99.6567 0.683190984 3.716654 0.0002019 0.009315525 0.009315525
AT1G23390.1 71.23 122.022 -3.715322 0.0002029 0.009349266 0.009349266
0.776584387
AT4G15000.1 160.8545 100.342 0.680830698 3.714848 0.0002033 0.009351313 0.009351313
AT4G15000.2 170.427 107.957 0.658697122 3.712144 0.0002055 0.009436202 0.009436202
AT2G40590.1 134.0685 79.5196 0.753587904 3.711311 0.0002062 0.009451727 0.009451727
AT3G28220.1 258.9823 180.226 0.523046347 3.707738 0.0002091 0.0095703 0.0095703
23.95319
AT3G03341.1 4.83662 2.308147094 3.697959 0.0002173 0.009913929 0.009913929
65
AT4G24350.2 17.767 46.727 -3.692556 0.000222 0.010110415 0.010110415
1.395056316
AT2G31610.1 206.279 137.147 0.588873892 3.68989 0.0002244 0.010200286 0.010200286
15.17815
AT3G14620.1 42.4533 -1.48388027 -3.685225 0.0002285 0.010371991 0.010371991
5
AT5G42050.1 40.45025 80.1281 -3.678349 0.0002347 0.010620932 0.010620932
0.986159649
AT1G01620.1 130.1535 76.9638 0.757962171 3.675394 0.0002375 0.010727196 0.010727196
AT5G02290.1 5.313335 24.5548 -3.672054 0.0002406 0.010850812 0.010850812
2.208315491
AT1G70090.1 27.23075 6.54858 2.055982708 3.667316 0.0002451 0.011035888 0.011035888
AT4G10500.1 1.936441 16.8354 -3.663961 0.0002483 0.01116345 0.011160861
3.120018548
AT5G54585.1 7.822255 29.3742 -3.658799 0.0002534 0.011354052 0.011354052
1.908893088
AT4G34630.1 26.82615 60.2975 -3.658279 0.0002539 0.01135879 0.01135879
1.168458169
AT5G60670.1 113.3605 64.4409 0.814869478 3.654286 0.0002579 0.011518496 0.011511906
AT5G62300.1 127.003 74.8122 0.763517114 3.654022 0.0002582 0.011511906 0.011511906
114.1013
AT1G50010.1 65.0921 0.809761497 3.646213 0.0002661 0.011848252 0.011838167
5
AT2G38310.1 41.60895 14.6564 1.5053631 3.646021 0.0002663 0.011838167 0.011838167
AT4G10480.1 157.401 98.7428 0.672697246 3.635417 0.0002775 0.01229667 0.01229667
2.573757
AT3G61280.1 18.2311 -3.634037 0.000279 0.012343022 0.012343022
5 2.824453577
AT1G51402.1 44.57105 85.2262 -0.93519006 -3.631096 0.0002822 0.012464724 0.012464724
AT1G43170.3 147.9435 91.4055 0.69469343 3.627348 0.0002863 0.012626944 0.012618962
AT1G43170.2 148.202 91.6117 0.693961151 3.627103 0.0002866 0.012618962 0.012618962
AT5G47560.1 65.289 112.868 -3.624777 0.0002892 0.012712952 0.012711581
0.789724666
AT2G37040.1 83.36525 42.6804 0.965872438 3.624397 0.0002896 0.012711581 0.012711581
AT4G29110.1 4.750885 22.9965 -3.618608 0.0002962 0.012938068 0.012938068
2.275146114
AT4G35750.1 20.58515 50.392 -3.616212 0.0002989 0.013037879 0.013037879
1.291590755
AT5G40890.1 39.2044 77.5505 -3.612556 0.0003032 0.013181836 0.013181836
0.984120503
AT2G36170.1 146.575 90.5977 0.694092727 3.607745 0.0003089 0.013407626 0.013407626
AT4G25630.1 46.8327 18.0976 1.371717827 3.605322 0.0003118 0.013512294 0.013512294
AT1G21310.1 5.43912 24.3046 -2.15978423 -3.603494 0.000314 0.013586549 0.013586549
AT1G44350.1 30.4341 64.9462 -3.601501 0.0003164 0.013669927 0.013669927
1.093556413
AT3G11010.1 2.50068 17.8366 -3.600943 0.0003171 0.013678049 0.013678049
2.834448276 175.7573
AT5G24780.1 113.916 0.625614629 3.59854 0.00032 0.013783649 0.013783649
5
AT4G01390.1 0 12.6783 -3.592347 0.0003277 0.014093696 0.014093696
4.416609511
AT5G02790.1 138.1735 203.342 -3.591167 0.0003292 0.014135824 0.014135824
0.557427282
AT3G04920.1 200.002 133.683 0.581198412 3.590031 0.0003306 0.014175707 0.014175707
AT2G38750.1 65.0826 112.013 -3.586032 0.0003357 0.014372585 0.014372585
0.783322386
AT1G74050.1 189.3245 125.116 0.597594824 3.582664 0.0003401 0.014536879 0.014536879
AT3G26180.2 12.13213 36.374 -3.577533 0.0003469 0.014779741 0.014779741
1.584074724
AT5G03240.1 69.64555 117.803 -0.7582732 -3.576702 0.000348 0.014804112 0.014804112
AT3G02080.1 232.522 160.7 0.532997294 3.574943 0.0003503 0.01488122 0.01488122
AT3G26450.1 117.8318 178.217 -0.59690602 -3.571977 0.0003543 0.015005052 0.015005052
AT2G26560.1 17.45965 45.0435 -3.57085 0.0003558 0.01504682 0.01504682
1.367294294
AT5G21020.2 43.5136 82.9645 -3.56936 0.0003579 0.015109735 0.015089939
0.931027768
AT3G04290.1 21.31906 4.04385 2.398342439 3.569306 0.0003579 0.015089939 0.015089939
AT3G09630.1 141.656 87.2829 0.698620768 3.567305 0.0003607 0.015159624 0.015159624
11.79340
AT1G43160.1 0 5.978682576 3.566008 0.0003625 0.015211864 0.015211864
55
14.96870
AT1G54575.1 40.912 -3.55744 0.0003745 0.015692885 0.015692885
5 1.450574652
AT1G23205.1 43.1845 16.1266 1.421071281 3.556829 0.0003754 0.015705774 0.015705774
AT4G16520.1 41.2548 79.6748 -3.55544 0.0003773 0.015765267 0.015765267
0.949561506
AT1G66580.1 204.8385 138.274 0.566956991 3.551604 0.0003829 0.015972891 0.015972891
AT4G26690.1 75.55445 37.7975 0.999225915 3.550041 0.0003852 0.01602004 0.01602004
AT2G29170.1 12.38437 36.5425 -3.548103 0.000388 0.016114282 0.016114282
1.561054857
AT3G14600.1 135.832 83.1466 0.708094221 3.535333 0.0004073 0.016838131 0.016815064
AT5G35530.1 142.7585 88.5753 0.688600296 3.535303 0.0004073 0.016815064 0.016815064
AT1G09070.1 60.24825 104.886 -3.532294 0.000412 0.016982367 0.016982367
0.799830881
AT1G08360.1 234.445 163.1 0.523492729 3.530467 0.0004148 0.017049553 0.017049553
AT5G24155.1 41.8267 80.1262 -0.93784988 -3.529066 0.000417 0.017114821 0.017114821
AT3G51240.1 49.32555 20.1973 1.288172693 3.523938 0.0004252 0.017398156 0.017387727
AT4G 14020.1 19.12295 47.1917 -3.523707 0.0004256 0.017387727 0.017387727
1.303228045
AT2G29630.1 121.496 181.724 -0.58084015 -3.521019 0.0004299 0.017539186 0.017539186
AT1G07770.1 191.237 127.746 0.582083561 3.515355 0.0004392 0.01786524 0.01786524
AT1G72370.2 215.5775 147.76 0.544950839 3.513348 0.0004425 0.017974446 0.017974446
AT5G63780.1 36.0298 71.8538 -3.511348 0.0004458 0.018083804 0.018083804
0.995873812
AT2G23840.1 25.43675 56.5974 -3.509064 0.0004497 0.018213264 0.018213264
1.153821427
AT2G04570.1 36.25685 12.2237 1.568572547 3.508528 0.0004506 0.018223486 0.018223486
101.8616
AT2G43970.2 157.316 -3.504732 0.0004571 0.01843174 0.01843174
5 0.627054417
AT5G51550.1 62.29865 29.0113 1.102585956 3.496688 0.0004711 0.018969031 0.018969031
AT5G53350.1 39.0402 75.8594 -3.495811 0.0004726 0.019003961 0.019003961
0.958367517
148.8668
AT2G25450.1 214.164 -3.492073 0.0004793 0.019244097 0.019244097
2 0.524693754
AT2G20450.1 132.7545 81.3493 0.706558928 3.488308 0.0004861 0.019489069 0.019489069 AT3G07110.2 94.4911 52.2733 0.854104211 3.4749 0.000511 0.020430773 0.020430773
AT2G37270.1 125.5275 75.9206 0.725440159 3.472378 0.0005159 0.020594096 0.020594096
AT4G15800.1 86.8944 46.7384 0.894654857 3.467612 0.0005251 0.020902786 0.020902786
AT3G52400.1 3.903295 20.0947 -3.460568 0.000539 0.02142676 0.02142676
2.364050632
AT4G01610.1 13.42655 37.4812 -3.457873 0.0005445 0.021580571 0.021573386
1.481078496
AT3G44010.1 191.9815 129.284 0.570423554 3.457579 0.0005451 0.021573386 0.021573386
AT4G12600.1 101.0628 57.3862 0.816476306 3.456277 0.0005477 0.021647067 0.021647067
AT5G43150.1 17.43441 43.8824 -3.454588 0.0005511 0.021752205 0.021752205
1.331704889
25.43309
AT3G01290.1 55.9695 -3.451333 0.0005578 0.021985081 0.021985081
5 1.137933823
AT5G19780.1 120.443 72.2518 0.737245113 3.450253 0.0005601 0.022041989 0.022027671
AT2G44120.1 124.886 75.6991 0.722263704 3.450047 0.0005605 0.022027671 0.022027671
127.1249
AT5G16010.1 77.452 0.714872808 3.449214 0.0005622 0.022064586 0.022064586
5
AT4G15210.1 52.92815 23.0609 1.19858641 3.447939 0.0005649 0.022137829 0.022137829
AT2G37970.1 33.0581 66.9049 -3.447192 0.0005664 0.022167831 0.022167831
1.017108067
AT1G72430.1 83.0429 44.1414 0.911724439 3.444974 0.0005711 0.022319164 0.022319164
AT3G11940.1 146.9755 93.1789 0.657500482 3.441624 0.0005782 0.022502541 0.022502541
AT2G03310.1 20.23 48.0341 -3.437147 0.0005879 0.022845928 0.022845928
1.247562637
AT3G07310.1 34.43935 68.7102 -3.435347 0.0005918 0.022966093 0.022959549
0.996466368
AT5G08640.1 34.404 11.5135 1.579249844 3.434731 0.0005931 0.022986345 0.022959549
AT3G61280.2 2.303189 16.2955 -3.43467 0.0005933 0.022959549 0.022959549
2.822768911
AT1G20330.1 122.084 73.7616 0.726932282 3.430653 0.0006021 0.023205388 0.023205388
AT5G43780.1 11.92649 34.7217 -3.42735 0.0006095 0.023457041 0.023457041
1.541668069
AT2G39030.1 47.57119 19.7472 1.26844001 3.41901 0.0006285 0.024121202 0.024121202
AT5G52650.1 205.7485 141.411 0.540987565 3.40929 0.0006513 0.024894302 0.024894302
AT2G39420.1 16.0851 41.2915 -3.405293 0.0006609 0.025192307 0.025192307
1.360119923
AT5G45350.1 46.3692 84.6594 -3.40234 0.0006681 0.025396589 0.025396589
0.868503428
AT5G27770.1 156.159 101.077 0.627560969 3.401497 0.0006702 0.0254403 0.0254403
AT3G15840.3 60.9621 103.882 -3.399224 0.0006758 0.025617694 0.025617694
0.768961189
AT1G43170.4 131.4465 81.5314 0.689048035 3.394298 0.000688 0.026047529 0.026047529
AT5G66040.1 68.09825 112.847 -3.382833 0.0007174 0.027122686 0.027122686
0.728678436
AT3G27820.1 97.56445 149.737 -3.375847 0.0007359 0.027745431 0.027745431
0.618003288
AT1G73230.1 166.4565 109.78 0.600529963 3.374315 0.00074 0.027862487 0.027862487
AT3G56800.1 116.46 172.815 -3.373603 0.0007419 0.027896916 0.027896916
0.569393922
AT3G48460.1 79.9663 42.6109 0.908169613 3.369323 0.0007535 0.028295515 0.028295515
AT1G56600.1 1.397526 13.5927 -3.366808 0.0007604 0.028516317 0.028516317
3.281885027
AT2G20340.1 23.1057 51.6196 -3.364646 0.0007664 0.028702055 0.028702055
1.159670165
AT1G20510.1 29.70575 61.168 -3.36164 0.0007748 0.028938347 0.028938347
1.042034892
AT1G04270.1 192.161 131.063 0.552055104 3.3568 0.0007885 0.029370886 0.029370886
AT3G05560.1 101.2684 58.7248 0.786142263 3.34746 0.0008156 0.030338135 0.030338135 AT3G11660.1 39.91865 75.1171 -3.338789 0.0008414 0.031217626 0.031217626
0.912078436
AT1G62510.1 35.51086 12.6655 1.487356268 3.338141 0.0008434 0.031248779 0.031242794
AT2G43150.1 54.35145 94.2755 -3.330066 0.0008683 0.032083904 0.032083904
0.794564373
AT3G26170.1 2.576655 16.2861 -2.66006988 -3.328902 0.0008719 0.032175513 0.032175513
AT5G64140.1 136.9705 86.7759 0.658498878 3.326939 0.0008781 0.032360099 0.03235192
AT5G56030.1 129.9964 81.2623 0.677813568 3.326273 0.0008802 0.03235192 0.03235192
AT3G13470.1 134.619 85.0349 0.662755067 3.317401 0.0009086 0.033309025 0.033309025
AT1G01100.3 130.5215 81.8099 0.67394013 3.315923 0.0009134 0.033441647 0.033441647
AT2G02100.1 63.984 31.6562 1.015223101 3.310465 0.0009314 0.034055811 0.034055811
AT3G09630.2 117.901 71.9835 0.711837799 3.309179 0.0009357 0.03416781 0.03416781
AT2G04080.1 19.606 45.7695 -3.303753 0.000954 0.034790286 0.034790286
1.223091303
12.57268
AT1G53903.1 34.7245 -3.302642 0.0009578 0.034882678 0.034882678
5 1.465661139
AT5G35970.1 139.274 198.837 -3.301443 0.0009619 0.034986348 0.034986348
0.513660284
AT5G01820.1 34.16445 66.6662 -3.294306 0.0009867 0.035840158 0.035840158
0.964459594
AT3G56710.1 4.43891 20.0737 -3.291057 0.0009981 0.036162187 0.036162187
2.177029197
12.45429
AT1G53885.1 34.3974 -3.287042 0.0010125 0.036634156 0.036595918
5 1.465656163
AT1G80180.1 23.4099 51.2345 -1.12999684 -3.283762 0.0010243 0.036966996 0.036966996
AT5G42820.2 0 10.9771 -3.282412 0.0010292 0.037048292 0.037048292
4.117051616
AT3G16530.1 7.604745 26.0176 -3.277516 0.0010472 0.037648114 0.037648114
1.774516109
AT4G34260.1 56.6728 26.8279 1.078922353 3.276341 0.0010516 0.037756421 0.037756421
AT2G 14750.1 118.724 173.646 -3.271452 0.00107 0.038365819 0.038365819
0.548537574
AT1G03400.1 19.945 45.9537 -3.270205 0.0010747 0.038436265 0.038436265
1.204153903
AT5G40670.1 29.15275 59.3368 -3.267641 0.0010845 0.038736322 0.038736322
1.025295145
19.47636
AT2G44120.2 4.15719 2.228043852 3.263361 0.001101 0.039225518 0.039225518
5
AT5G45350.2 38.6945 72.5102 -3.262278 0.0011052 0.0393253 0.0393253
0.906055435
AT1G01120.1 90.9571 51.8437 0.811017573 3.259839 0.0011148 0.039614304 0.039614304
AT4G15530.5 5.15112 21.2777 -3.258715 0.0011192 0.039720882 0.039709945
2.046384158
195.4151
AT1G52400.1 135.365 0.529687556 3.258432 0.0011203 0.039709945 0.039709945
5
AT4G14716.1 35.89045 68.5827 -0.93424469 -3.254552 0.0011357 0.040205107 0.040205107
AT3G44450.1 115.5999 169.527 -3.252518 0.0011439 0.040442575 0.040442575
0.552374915
11.15382
AT3G62650.1 31.9422 -1.51792514 -3.250299 0.0011528 0.040707778 0.040707778
5
AT3G51870.1 49.7047 22.2805 1.157600668 3.249221 0.0011572 0.040758893 0.040758893
10.03854
AT1G35140.1 0 4.891265253 3.24873 0.0011592 0.040777724 0.040760522
5
AT2G09990.1 107.949 64.9621 0.732679703 3.24849 0.0011602 0.040760522 0.040760522
AT4G09760.3 6.276375 23.3532 -3.247203 0.0011655 0.040893773 0.040893773
1.895616793
AT3G51430.1 5.86931 22.5797 -3.246511 0.0011683 0.040941633 0.040941633
1.943763504
AT2G01250.2 137.569 88.3278 0.639215924 3.246127 0.0011699 0.040945376 0.040945376
121.0834
AT1G54270.1 75.32 0.684896782 3.240195 0.0011945 0.041701854 0.041701854
5 AT5G64000.1 1.725425 13.6717 -3.234694 0.0012177 0.042407287 0.042407287
2.986168975
AT5G62210.1 15.54975 2.47134 2.653525974 3.227869 0.0012472 0.043377827 0.043348688
AT5G19860.1 28.31295 57.7088 -3.227704 0.0012479 0.043348688 0.043348688
1.027329257
AT3G52930.1 211.094 148.989 0.502679754 3.226243 0.0012543 0.043516159 0.043516159
AT2G36630.1 46.5118 20.3304 1.193958173 3.222202 0.0012721 0.044079693 0.044079693
AT2G39700.1 36.61115 13.9912 1.387763386 3.216242 0.0012988 0.044838068 0.044838068
AT5G67070.1 67.59125 35.0348 0.948047835 3.212666 0.0013151 0.045343821 0.045343821
AT1G56300.1 8.7324 27.5081 -3.210543 0.0013248 0.045567137 0.045567137
1.655406374
AT1G50290.1 10.86475 31.0838 -3.204137 0.0013547 0.046478454 0.046478454
1.516507906
AT4G29190.1 6.61898 23.6136 -3.194614 0.0014002 0.047921359 0.047921359
1.834937187
AT1G14150.2 30.24258 60.0252 -3.191125 0.0014172 0.048384815 0.048371258
0.988987084
118.6646
AT3G47520.1 74.0249 0.680807681 3.190535 0.0014201 0.048424258 0.048371258
5
AT2G26250.1 117.454 73.0736 0.684673657 3.190329 0.0014211 0.048399455 0.048371258
164.9534
AT1G75750.1 111.308 0.567501665 3.189874 0.0014234 0.048416525 0.048371258
5
AT5G59670.1 4.169245 18.8557 -3.189752 0.0014239 0.048377742 0.048371258
2.177142652
AT5G65207.1 7.281995 24.783 -3.189405 0.0014257 0.04837673 0.048371258
1.766945182
AT2G17230.1 35.16915 13.2435 1.409026018 3.189086 0.0014272 0.048371258 0.048371258
AT4G10120.1 20.8183 46.439 -3.186572 0.0014397 0.048734229 0.048734229
1.157484642
AT3G03470.1 8.907795 27.6019 -3.18314 0.0014569 0.04925572 0.04925572
1.631627317
AT2G39390.1 114.5075 70.8649 0.692298965 3.181367 0.0014658 0.049497978 0.049497978
ColxC24 at ZT15
MPV ColxC24 log2(Fold_c
Gene Name z-score p-value q-value q-value
RPKM RPKM hange)
AT2G01021.1 3461.741 740.071 2.225762199 43.95194 0 0 0
AT3G41768.1 2347.425 5409.73 -34.91497 4.41E-267 6.0643E-263 6.0643E-263
1.204477526
AT2G01020.1 1836.3 3497.17 -22.62845 2.27E-113 1.789E-109 1.5654E-109
0.929386154
AT3G41979.1 1836.3 3497.17 -22.62845 2.27E-113 1.789E-109 1.5654E-109
0.929386154
579.6276
AT2G14610.1 54.6289 3.407390069 22.36927 7.84E-111 4.3171E-107 4.3171E-107
22
ATCG00950.1 1088.383 2347.85 -21.48863 1.99E-102 7.8217E-99 7.8217E-99
1.109153912
AT3G21055.1 4251.64 2561.14 0.731233327 21.01078 5.23E-98 1.79836E-94 1.79836E-94
ATCG00920.1 815.312 1901.34 -20.90662 4.66E-97 1.42569E-93 1.42569E-93
1.221592385
AT2G21660.1 827.607 229.977 1.847456263 19.05715 5.73E-81 1.57767E-77 1.57767E-77
ATCG01210.1 1461.44 2681.08 -18.81474 5.72E-79 1.43111E-75 1.43111E-75
0.875423668
AT4G03520.2 1.001273 302.059 -8.23685118 -16.80823 2.12E-63 4.873E-60 4.873E-60
AT5G04140.2 242.664 6.41035 5.242413157 16.17897 7.10E-59 1.3955E-55 1.3955E-55
AT4G39260.2 441.755 100.806 2.131664953 15.27612 1.10E-52 1.78624E-49 1.78624E-49
ATCGOl 180.1 1541.505 2511.18 -15.02716 4.87E-51 7.06184E-48 7.06184E-48
0.704025875
AT1G52400.1 59.40885 348.168 -14.91604 2.59E-50 3.56742E-47 3.56742E-47
2.551033844 AT1G52400.2 47.99325 278 -13.27849 3.09E-M) 3.86048E-37 3.86048E-37
2.534181465
179.4729
AT1G15690.2 0 8.617609432 12.73053 4.00E-37 4.78857E-34 4.78857E-34
9
AT4G25100.2 371.2835 790.044 -12.27507 1.23E-34 1.41409E-31 1.41409E-31
1.089411801
AT4G10340.1 1469.24 2189.77 -11.68032 1.61E-31 1.76939E-28 1.76939E-28
0.575709267
AT4G25100.4 140.914 8.91135 3.983027137 11.6611 2.01E-31 2.13247E-28 2.13247E-28
AT1G75750.1 359.5155 116.444 1.626417668 11.49928 1.33E-30 1.35613E-27 1.35613E-27
277.5745
AT5G24770.1 73.8251 1.910691909 11.28535 1.55E-29 1.524E-26 1.524E-26
35
266.8912
AT1G75040.1 73.4331 1.861749597 10.87643 1.49E-27 1.32574E-24 1.32574E-24
5
AT1G29920.1 164.5345 423.093 -10.74136 6.51E-27 5.59826E-24 5.59826E-24
1.362584693
AT3G12120.2 4.96863 112.235 -10.67994 1.26E-26 1.05392E-23 1.05392E-23
4.497530722
372.5500
AT5G55450.1 140.887 1.40289576 10.5099 7.78E-26 6.29662E-23 6.29662E-23
5
AT5G04140.1 238.819 522.786 -10.29052 7.78E-25 5.94562E-22 5.94562E-22
1.130302888
ATCG00020.1 73.8648 253.993 -10.1438 3.53E-24 2.62681E-21 2.62681E-21
1.781829815
AT1G67870.1 629.7125 330.548 0.92983352 9.879421 5.11E-23 3.70363E-20 3.70363E-20
AT2G44120.2 83.07385 2.25871 5.200823459 9.459184 3.10E-21 2.13578E-18 2.13578E-18
AT3G28220.1 28.57905 148.045 -9.327008 1.09E-20 7.31156E-18 7.31156E-18
2.373005901
AT1G78370.1 854.062 1292.31 -9.28234 1.66E-20 1.08664E-17 1.08664E-17
0.597539476
186.4137
AT5G24770.2 49.8654 1.902396975 9.221482 2.93E-20 1.87581E-17 1.87581E-17
145
AT5G45775.1 75.92565 0 7.00967632 8.902619 5.45E-19 3.41237E-16 3.41237E-16
AT3G29240.1 79.69635 5.42383 3.877129786 8.695311 3.46E-18 2.11579E-15 2.11579E-15
20.71277
AT1G52040.1 110.992 -8.173564 2.99E-16 1.75359E-13 1.75359E-13
225 2.421863129
AT2G21660.2 701.7705 437.244 0.682560716 8.033215 9.50E-16 5.33411E-13 5.33411E-13
AT1G19670.1 126.0645 286.49 -7.911162 2.55E-15 1.34987E-12 1.34987E-12
1.184322715
ATCG00490.1 47.7807 157.021 -7.768115 7.97E-15 4.06087E-12 4.06087E-12
1.716457623
AT2G03680.2 0 57.9074 -7.753177 8.96E-15 4.48548E-12 4.48548E-12
6.973220575
144.9084
AT1G51402.1 43.6022 1.73266889 7.631221 2.33E-14 1.12301E-11 1.12301E-11
5
AT3G57260.1 121.8981 31.1592 1.967945541 7.624789 2.44E-14 1.16009E-11 1.16009E-11
AT3G27830.1 941.4945 649.667 0.535252242 7.526437 5.21E-14 2.39227E-11 2.36508E-11
AT1G52000.1 26.67185 113.168 -7.525771 5.24E-14 2.36508E-11 2.36508E-11
2.085076271
AT1G21600.2 52.3702 0 6.707250432 7.456062 8.91E-14 3.89514E-11 3.89514E-11
51.58478
AT3G18410.2 0 6.542466115 7.427602 1.11E-13 4.75632E-11 4.75632E-11
5
176.4607
AT5G23820.1 66.774 1.401988951 7.229206 4.86E-13 2.02627E-10 2.02627E-10
5
481.2081
AT5G24780.1 291.397 0.723674992 6.994223 2.67E-12 1.04891E-09 1.04891E-09
3
AT2G24850.1 21.3537 92.0221 -2.10749431 -6.833139 8.31E-12 3.17618E-09 3.17618E-09
AT1G48450.2 0 43.55 -6.782036 1.18E-11 4.4682E-09 4.4682E-09
6.641633403
AT5G64040.1 493.4495 735.338 -6.761753 1.36E-11 5.07136E-09 5.07136E-09
0.575505095
AT5G54270.1 415.562 638.195 -6.734946 1.64E-11 6.0189E-09 6.0189E-09
0.618933569 AT1G57720.2 45.49585 2.63292 4.110999361 6.688051 2.26E-11 7.98147E-09 7.90264E-09
42.09787
AT4G33510.2 0 6.690615795 6.68764 2.27E-11 7.90264E-09 7.90264E-09
15
AT2G 18660.1 91.00222 23.0413 1.981679624 6.617859 3.64E-11 1.2385E-08 1.2385E-08
AT5G36700.2 78.6425 17.9609 2.130449541 6.442481 1.18E-10 3.94562E-08 3.94562E-08
35.75408
AT1G64770.2 0 5.853867161 6.235626 4.50E-10 1.49235E-07 1.4799E-07
2
AT5G10760.1 124.5697 45.5232 1.452279315 6.235062 4.52E-10 1.4799E-07 1.4799E-07
73.26946
AT4G05050.3 170.032 -6.218984 5.00E-10 1.62048E-07 1.62048E-07
85 1.214522231
AT4G21105.2 35.6223 0 6.822769709 6.13106 8.73E-10 2.79417E-07 2.79417E-07
AT4G38680.1 162.705 73.0272 1.155752765 5.984206 2.17E-09 6.88011E-07 6.88011E-07
AT3G02360.2 32.61275 0 5.464165053 5.948284 2.71E-09 8.47605E-07 8.47605E-07
AT1G35720.1 152.038 275.793 -5.93116 3.01E-09 9.30356E-07 9.30356E-07
0.859153887
AT4G39260.4 131.9026 53.2971 1.307344062 5.928667 3.05E-09 9.34097E-07 9.34097E-07
AT5G59890.2 32.99025 0 6.706697438 5.917873 3.26E-09 9.86532E-07 9.86532E-07
148.5108
AT4G08870.1 64.333 1.20693745 5.914743 3.32E-09 9.94543E-07 9.94543E-07
485
AT5G13710.2 3.22441 38.2966 -5.810886 6.21E-09 1.83937E-06 1.83937E-06
3.570109208
AT2G20630.2 30.10265 0 6.53991854 5.674303 1.39E-08 4.035E-06 4.035E-06
AT2G41840.1 536.4915 372.104 0.527849415 5.61097 2.01E-08 5.70961E-06 5.70961E-06
86.86759
AT4G17470.1 28.6921 1.598164532 5.581894 2.38E-08 6.68268E-06 6.68268E-06
5
AT2G38170.3 124.6885 52.7325 1.241564111 5.539995 3.02E-08 8.32638E-06 8.32638E-06
AT3G22121.1 290.8145 177.171 0.714956726 5.380644 7.42E-08 1.98354E-05 1.98354E-05
AT5G10140.2 0 27.2907 -5.374929 7.66E-08 2.00849E-05 2.00849E-05
5.048308192
AT5G64040.2 344.6735 503.351 -5.330256 9.81E-08 2.54688E-05 2.54688E-05
0.546334398
AT3G01910.2 2.40797 31.1999 -5.3132 1.08E-07 2.77114E-05 2.77114E-05
3.695652082
322.5456
AT5G24780.2 205.103 0.653154811 5.241832 1.59E-07 3.97865E-05 3.97865E-05
6
AT1G20620.4 152.5625 260.288 -5.23898 1.61E-07 4.00422E-05 4.00422E-05
0.770708411
174.5131
AT2G30766.1 91.3746 0.933470661 5.216624 1.82E-07 4.47838E-05 4.47838E-05
5
AT2G38210.1 62.0906 17.464 1.829990838 5.185346 2.16E-07 5.2524E-05 5.2524E-05
AT1G14150.1 219.2235 127.218 0.785099647 5.059368 4.21E-07 0.000100689 0.000100689
AT4G13510.1 200.952 113.858 0.819615273 5.023092 5.08E-07 0.000120659 0.000120659
AT5G03240.2 64.52 20.0866 1.683513055 4.990942 6.01E-07 0.000140167 0.000140167
28.29400
AT5G44570.2 2.67128 3.404893395 4.940297 7.80E-07 0.000180437 0.000180437
7
AT3G12120.1 188.835 106.828 0.821836357 4.880372 1.06E-06 0.000240886 0.000240886
AT1G32550.2 0 22.1078 -4.8707 1.11E-06 0.00025091 0.00025091
6.166385615
AT5G42800.1 22.2941 0 6.688338482 4.866998 1.13E-06 0.000253576 0.000253576
AT3G57240.1 66.74325 22.6734 1.557621192 4.803309 1.56E-06 0.000338267 0.000338267
AT5G17220.1 29.34973 3.56225 3.042486557 4.789752 1.67E-06 0.000359115 0.000359115
AT4G35090.1 226.3215 342.333 -4.77159 1.83E-06 0.000390025 0.000390025
0.597026727
AT2G27450.2 0 20.9109 -4.746875 2.07E-06 0.000437433 0.000437433
5.747751624
151.0342
AT2G46390.1 80.7414 0.903495239 4.723862 2.31E-06 0.000486256 0.000486256
5 AT2G03680.1 164.3215 90.8615 0.854780229 4.705126 2.54E-06 0.000529081 0.000529081
AT4G00810.2 136.1445 70.4949 0.949547908 4.672714 2.97E-06 0.000597247 0.000597247
AT3G05730.1 140.0293 230.546 -4.637016 3.53E-06 0.000700009 0.000700009
0.719325904
AT1G14250.1 70.0527 136.677 -4.609376 4.04E-06 0.000794113 0.000794113
0.964257925
AT5G02870.2 259.953 167.121 0.637357775 4.606789 4.09E-06 0.000798352 0.000798352
110.0902
AT1G58380.1 53.2725 1.047223813 4.550276 5.36E-06 0.001038576 0.001038576
5
46.57989
AT3G61440.2 101.752 -4.529241 5.92E-06 0.001139501 0.001139501
55 1.127277844
AT1G67865.1 185.8609 109.934 0.757585652 4.519462 6.20E-06 0.001185131 0.001185131
AT1G01100.4 219.142 136.453 0.683461899 4.493179 7.02E-06 0.001332074 0.001326561
AT5G28050.2 19.81015 0 7.383785204 4.489005 7.16E-06 0.001339958 0.001339958
24.42635
AT5G44570.1 2.61547 3.223296202 4.485342 7.28E-06 0.001353977 0.001353977
05
ATCG00960.1 16.9773 53.9485 -1.66797581 -4.460843 8.16E-06 0.001508222 0.001508222
AT1G11850.2 48.99665 14.8955 1.717806561 4.410865 1.03E-05 0.001876916 0.001876916
AT4G25100.3 169.1335 261.687 -4.380322 1.19E-05 0.002118219 0.002118219
0.629679816
ATCGOl 170.1 15.46675 50.2841 -4.367452 1.26E-05 0.002218116 0.002218116
1.700932209
17.81928
AT3G08030.2 0 4.996221369 4.360917 1.30E-05 0.002270866 0.002270866
35
AT5G02870.1 286.834 193.918 0.56476932 4.353997 1.34E-05 0.002328946 0.002320244
17.72738
AT4G25700.2 0 4.460762996 4.262471 2.02E-05 0.003435422 0.003435422
6
AT3G29240.2 79.5884 143.836 -4.2599 2.05E-05 0.003453845 0.003453845
0.853794727
33.75093
AT4G35450.4 78.587 -4.241283 2.22E-05 0.003730333 0.003730333
5 1.219363209
AT1G52410.2 7.791805 34.2854 -4.208733 2.57E-05 0.004258509 0.004258509
2.137564876
AT3G51370.2 0 17.2424 -4.156014 3.24E-05 0.005152924 0.005152924
4.362322625
AT5G54060.1 15.7555 0 6.322329217 4.121326 3.77E-05 0.005925353 0.005925353
AT3G51860.1 21.68511 2.64867 3.033364748 4.111302 3.93E-05 0.006153442 0.006131293
AT4G00810.1 112.4418 59.8053 0.910833206 4.103223 4.07E-05 0.006300804 0.006300804
15.87751
AT5G63890.1 0 6.838229056 4.091504 4.29E-05 0.006554249 0.006554249
8
AT1G71880.1 80.0928 37.3041 1.102338354 4.043931 5.26E-05 0.007993839 0.007993839
29.80730
AT3G02560.2 69.3476 -3.98106 6.86E-05 0.010099395 0.010099395
95 1.218179795
AT4G38550.1 190.9064 122.887 0.635533165 3.937909 8.22E-05 0.011908308 0.011883592
14.35398
AT4G22880.1 0 6.268462434 3.936887 8.25E-05 0.011896496 0.011883592
75
AT3G02360.1 35.13195 76.5535 -3.918314 8.92E-05 0.012652575 0.012599111
1.123684683
AT3G01290.1 105.2984 56.8883 0.88827964 3.88903 0.0001006 0.014063293 0.014052751
13.98048
AT4G22880.2 0 6.217696855 3.887983 0.0001011 0.014052751 0.014052751
2
AT5G03240.3 95.47145 158.007 -3.874554 0.0001068 0.014629036 0.014629036
0.726847198
AT3G16570.1 142.124 85.2785 0.736896231 3.859801 0.0001135 0.015387947 0.015387947
AT4G35090.2 158.616 236.357 -3.832175 0.000127 0.017055405 0.017055405
0.575429286
AT2G44290.1 90.8008 47.1084 0.946720676 3.806641 0.0001409 0.018642535 0.018642535
AT4G01080.1 87.086 145.92 -3.804639 0.000142 0.018704056 0.018704056
0.744664921 AT5G45775.2 89.9534 149.384 -3.790127 0.0001506 0.019736916 0.019736916
0.731775917
123.8201
AT2G47840.1 72.2454 0.777268476 3.769992 0.0001633 0.021297916 0.021297916
5
AT3G07390.1 130.1808 77.7734 0.74316797 3.72087 0.0001985 0.025069472 0.025069472
AT1G21500.1 221.5205 151.709 0.54613354 3.714884 0.0002033 0.025553215 0.025553215
AT2G02100.1 80.13995 135.131 -3.701001 0.0002148 0.026870225 0.026870225
0.753765162
AT1G52410.1 6.19633 26.7843 -3.691373 0.000223 0.027532731 0.027532731
2.111901707
AT2G44120.1 81.46215 136.601 -3.685972 0.0002278 0.027997857 0.027997857
0.745766249
21.42631
AT2G37600.2 3.85465 2.474711974 3.676655 0.0002363 0.028783058 0.028783058
5
AT5G36790.2 169.03 245.09 -3.653566 0.0002586 0.031224236 0.031224236
0.536032298
AT5G59890.1 53.3122 98.6382 -3.648388 0.0002639 0.031721057 0.031721057
0.887680755
20.27753
AT4G 14090.1 3.52182 2.525489204 3.617748 0.0002972 0.035413012 0.035413012
5
AT1G14880.1 176.1683 116.273 0.599438222 3.594901 0.0003245 0.03833878 0.03833878
AT2G41430.2 42.9403 83.4118 -3.58072 0.0003426 0.040308149 0.040308149
0.957919221
AT1G21880.1 11.74495 0 5.964335555 3.572144 0.0003541 0.041474426 0.041377303
AT2G34430.1 61.06315 107.97 -3.571646 0.0003547 0.041377303 0.041377303
0.822256589
17.41794
AT2G23130.2 2.45794 2.825052818 3.558923 0.0003724 0.043069117 0.043069117
5
AT3G23450.1 96.7361 54.0827 0.838887198 3.553693 0.0003799 0.04375096 0.04375096
AT5G47700.2 120.455 72.6856 0.7287528 3.519769 0.0004319 0.049334227 0.049334227
C24xCol at ZT15
MPV C24xCol log2(Fold_c
Gene Name z-score p-value q-value q-value
RPKM RPKM hange)
AT2G01021.1 3461.741 607.577 2.510358627 46.93695 0 0 0
579.6276
AT2G14610.1 35.2795 4.038224328 23.68328 5.36E-124 7.3615E-120 7.3615E-120
22
481.2081
AT5G24780.1 12.4192 5.276016869 22.74701 1.54E-114 1.4061E-110 1.4061E-110
3
322.5456
AT5G24780.2 9.00857 5.162061481 18.58423 4.31E-77 1.97312E-73 1.97312E-73
6
AT2G21660.1 827.607 247.085 1.743938417 18.2042 4.78E-74 1.87492E-70 1.87492E-70
277.5745
AT5G24770.1 5.10647 5.76440508 17.34266 2.24E-67 7.69234E-64 7.69234E-64
35
AT4G03520.2 1.001273 285.747 -16.43798 1.02E-60 3.12034E-57 3.12034E-57
8.156759159
ATCG00950.1 1088.383 1946.32 -0.8385626 -15.65182 3.23E-55 8.8652E-52 8.8652E-52
186.4137
AT5G24770.2 3.30768 5.816544525 14.21173 7.75E^6 1.93436E-42 1.93436E-42
145
AT1G75750.1 359.5155 76.2046 2.23810398 14.12814 2.55E^5 5.83034E-42 5.83034E-42
AT4G39260.2 441.755 119.526 1.885921988 14.03009 1.02E^4 2.15481E-41 2.15481E-41
ATCG01210.1 1461.44 2288.02 -13.52237 1.15E^1 2.26327E-38 2.26327E-38
0.646709063
AT3G41768.1 2347.425 3369.09 -13.51355 1.30E^1 2.38144E-38 2.38144E-38
0.521279904
AT4G25100.4 140.914 6.20682 4.504816834 12.01334 3.02E-33 3.95408E-30 3.95408E-30
144.9084
AT1G51402.1 9.8557 3.878039572 11.69162 1.41E-31 1.7559E-28 1.7559E-28
5
AT4G 18440.1 404.0195 147.769 1.451081284 11.13576 8.40E-29 9.22919E-26 9.22919E-26
AT2G23672.1 17.0232 152.207 -11.04433 2.34E-28 2.46617E-25 2.46617E-25
3.160460546 AT1G29920.1 164.5345 406.653 -10.27441 9.19E-25 9.01279E-22 9.01279E-22
1.305408134
266.8912
AT1G75040.1 81.0298 1.719727523 10.23549 1.37E-24 1.3019E-21 1.3019E-21
5
AT1G65960.1 109.535 0 8.251457359 10.13331 3.93E-24 3.59818E-21 3.59818E-21
116.0679
AT4G15210.1 10.7609 3.431099004 10.00396 1.46E-23 1.29693E-20 1.29693E-20
5
AT3G62030.2 328.8595 620.297 -0.9154878 -9.515474 1.81E-21 1.55218E-18 1.55218E-18
148.5108
AT4G08870.1 28.6892 2.371988677 9.401832 5.36E-21 4.46176E-18 4.46176E-18
485
AT2G44120.2 83.07385 2.58449 5.006442891 9.397117 5.61E-21 4.52898E-18 4.52898E-18
372.5500
AT5G55450.1 159.547 1.223452775 9.381228 6.52E-21 5.11589E-18 5.11589E-18
5
AT2G23670.1 394.7805 175.692 1.168002229 9.309295 1.29E-20 9.81535E-18 9.81535E-18
86.86759
AT4G17470.1 5.15348 4.075199218 9.192622 3.83E-20 2.84521E-17 2.84521E-17
5
AT5G45775.1 75.92565 0 6.665457351 8.971287 2.93E-19 2.11774E-16 2.11774E-16
AT4G25100.2 371.2835 657.635 -0.82476588 -8.964454 3.12E-19 2.19547E-16 2.19547E-16
94.03327
AT4G15210.2 9.03151 3.380132244 8.949431 3.57E-19 2.4529E-16 2.4529E-16
5
176.4607
AT5G23820.1 47.8109 1.883935853 8.860369 7.97E-19 5.21394E-16 5.21394E-16
5
AT3G09820.2 0 88.0258 -8.835747 9.94E-19 6.34953E-16 6.34953E-16
8.740960313
73.26946
AT4G05050.3 0 7.726125357 8.49983 1.90E-17 1.18491E-14 1.18491E-14
85
65.87779
AT4G16590.1 2.00549 5.037765533 8.374935 5.53E-17 3.29833E-14 3.29833E-14
24
AT4G21960.1 799.3895 1160.58 -8.152787 3.56E-16 2.07772E-13 2.07772E-13
0.537875444
AT2G21660.2 701.7705 432.971 0.696728905 8.045428 8.59E-16 4.81621E-13 4.81621E-13
AT3G22235.2 810.328 1164.88 -7.969981 1.59E-15 8.71538E-13 8.71538E-13
0.523603446
AT5G36700.2 78.6425 10.5243 2.901584906 7.633889 2.28E-14 1.15824E-11 1.15824E-11
AT2G 18660.1 91.00222 17.0511 2.416036927 7.43912 1.01E-13 5.06036E-11 5.06036E-11
51.58478
AT3G18410.2 0 6.575845369 7.40949 1.27E-13 6.21683E-11 6.21683E-11
5
46.57989
AT3G61440.2 0 6.23926614 7.081849 1.42E-12 6.62012E- 10 6.62012E-10
55
AT1G57720.2 45.49585 0 5.71178973 7.020741 2.21E-12 9.46883E-10 9.46883E-10
AT3G57260.1 121.8981 36.448 1.741764082 6.978854 2.98E-12 1.25719E-09 1.25719E-09
179.4729
AT1G15690.2 334.67 -6.881843 5.91E-12 2.45813E-09 2.45813E-09
9 0.898972493
42.09787
AT4G33510.2 0 6.678861795 6.678103 2.42E-11 9.92025E-09 9.92025E-09
15
AT1G48450.2 0 39.4203 -6.49789944 -6.483079 8.99E-11 3.52532E-08 3.52532E-08
AT1G65960.2 137.2315 264.127 -6.37406 1.84E-10 7.02066E-08 7.02066E-08
0.944620112
1.032503
AT3G47370.3 37.8044 -5.19433558 -6.360863 2.01E-10 7.54648E-08 7.54648E-08
5
AT2G38170.3 124.6885 44.3047 1.492796754 6.31743 2.66E-10 9.86852E-08 9.86852E-08
AT1G14250.1 70.0527 14.6331 2.259205222 6.271747 3.57E-10 1.30712E-07 1.30712E-07
AT2G34430.1 61.06315 149.081 -6.154774 7.52E-10 2.64679E-07 2.64679E-07
1.287722482
35.75408
AT1G64770.2 0 6.87708154 6.123021 9.18E-10 3.19142E-07 3.19142E-07
2
AT4G39260.4 131.9026 51.4437 1.358406688 6.052883 1.42E-09 4.88344E-07 4.88344E-07
33.75093
AT4G35450.4 0 5.762038408 6.047285 1.47E-09 4.99371E-07 4.99371E-07
5
AT5G59890.2 32.99025 0 7.013572396 5.85809 4.68E-09 1.49498E-06 1.49498E-06 AT5G10760.1 124.5697 50.3447 1.307041381 5.71076 1.12E-08 3.50954E-06 3.50954E-06
183.9688
AT1G45201.1 90.7849 1.018937244 5.690093 1.27E-08 3.91739E-06 3.91739E-06
5
29.80730
AT3G02560.2 0 5.205813557 5.654176 1.57E-08 4.72524E-06 4.69436E-06
95
AT5G13710.2 3.22441 36.5534 -5.653425 1.57E-08 4.69436E-06 4.69436E-06
3.502898498
AT5G10140.2 0 29.5086 -5.616044 1.95E-08 5.76871E-06 5.76871E-06
5.161034268
28.29400
AT5G44570.2 1.04258 4.762266511 5.442241 5.26E-08 1.50494E-05 1.50494E-05
7
AT3G01290.1 105.2984 40.7935 1.368072317 5.437373 5.41E-08 1.53068E-05 1.53068E-05
AT4G39800.1 225.2965 355.253 -5.39912 6.70E-08 1.87642E-05 1.87642E-05
0.657021931
AT4G35090.1 226.3215 355.086 -5.344967 9.04E-08 2.45863E-05 2.45863E-05
0.649794837
AT1G02930.1 49.2991 10.0629 2.292515178 5.308071 1.11E-07 2.98257E-05 2.98257E-05
AT1G14150.2 58.98955 130.729 -5.263124 1.42E-07 3.73938E-05 3.73938E-05
1.148047905
AT5G17220.1 29.34973 2.11703 3.793233613 5.222849 1.76E-07 4.60765E-05 4.60765E-05
AT1G35720.1 152.038 253.141 -0.73550924 -5.034674 4.79E-07 0.000120584 0.000120584
AT4G38680.1 162.705 84.9059 0.938321873 4.998005 5.79E-07 0.000143298 0.000143298
AT2G38210.1 62.0906 18.9262 1.713990097 4.925026 8.43E-07 0.000206798 0.000206798
AT2G24200.2 22.4597 68.3165 -4.916452 8.81E-07 0.000214148 0.000214148
1.604895407
280.9648
AT4G02520.1 177.338 0.663887944 4.87827 1.07E-06 0.000257778 0.000257778
5
24.42635
AT5G44570.1 1.46219 4.062235634 4.869996 1.12E-06 0.000266473 0.000266473
05
AT3G57240.1 66.74325 22.7349 1.553713281 4.759734 1.94E-06 0.000443573 0.000443573
20.51970
AT2G38530.1 0 5.215145096 4.692111 2.70E-06 0.000613629 0.000613629
6
AT4G13510.1 200.952 120.855 0.733573775 4.502328 6.72E-06 0.001441881 0.001441881
AT5G28050.2 19.81015 0 7.364767124 4.485284 7.28E-06 0.001549981 0.001549981
AT5G02870.2 259.953 169.359 0.618166149 4.404957 1.06E-05 0.002217782 0.002217782
17.72738
AT4G25700.2 0 5.315375935 4.368436 1.25E-05 0.00260319 0.00260319
6
AT3G49260.2 0 17.4991 -4.334143 1.46E-05 0.003021083 0.003021083
5.278782217
AT5G63530.2 5.379785 30.0142 -4.329184 1.50E-05 0.003066864 0.003066864
2.480024792
14.77304
AT1G29395.1 48.1886 -4.312881 1.61E-05 0.00322976 0.00322976
5 1.705724665
ATCG00020.1 73.8648 135.819 -4.299784 1.71E-05 0.003401818 0.003401818
0.878726393
178.5347
AT1G19570.1 107.192 0.73600767 4.255974 2.08E-05 0.004111749 0.004111749
5
AT5G42080.2 16.58675 0 6.003075889 4.235929 2.28E-05 0.004464218 0.004464218
AT5G42800.1 22.2941 0 9.52397146 4.232278 2.31E-05 0.004505159 0.004505159
AT3G51370.2 0 17.6987 -4.230426 2.33E-05 0.004510415 0.004510415
4.400005421
AT5G02870.1 286.834 195.468 0.553283601 4.190086 2.79E-05 0.005280625 0.005280625
AT4G35090.2 158.616 241.98 -4.165641 3.10E-05 0.005839336 0.005839336
0.609349505
110.0902
AT1G58380.1 57.2074 0.944413022 4.133389 3.57E-05 0.006677079 0.006677079
5
103.2391
AT3G47370.1 53.0319 0.961057826 4.061347 4.88E-05 0.008931575 0.008931575
5
141.3817
AT1G19570.2 81.9168 0.78736464 4.014861 5.95E-05 0.0107453 0.010688668
5
AT1G01100.4 219.142 143.304 0.612787133 4.013024 5.99E-05 0.010688668 0.010688668 174.5131
AT2G30766.1 107.857 0.69421594 3.998407 6.38E-05 0.011224807 0.011224807
5
AT1G48860.2 14.66555 0 5.821620651 3.986099 6.72E-05 0.011747639 0.011747639
AT1G14150.1 219.2235 144.649 0.599846109 3.938133 8.21E-05 0.014271377 0.014271377
AT2G41430.2 42.9403 87.4553 -3.929085 8.53E-05 0.014725906 0.014725906
1.026213547
AT1G71880.1 80.0928 38.3209 1.063541112 3.888089 0.000101 0.017339773 0.017339773
AT3G09820.1 243.1455 165.176 0.557815812 3.88615 0.0001018 0.017370218 0.017370218
AT3G27690.1 25.05365 60.1201 -3.849258 0.0001185 0.019958518 0.019958518
1.262826608
AT1G11850.2 48.99665 18.5258 1.403147269 3.780852 0.0001563 0.025698428 0.025698428
AT5G17310.1 13.114 0 5.554890206 3.76686 0.0001653 0.026860085 0.026860085
14.35398
AT4G22880.1 0 7.777263739 3.753615 0.0001743 0.028154003 0.028154003
75
AT5G45775.2 89.9534 147.158 -3.721923 0.0001977 0.031381295 0.031381295
0.710116256
AT1G10830.2 0 14.5844 -3.716528 0.000202 0.031874446 0.031874446
3.915779711
13.98048
AT4G22880.2 0 7.727703228 3.712604 0.0002051 0.032187827 0.032187827
2
AT2G37600.1 92.2382 48.6732 0.922236732 3.709009 0.0002081 0.032462785 0.032462785
20.27753
AT4G 14090.1 3.20293 2.662418111 3.707569 0.0002093 0.032463376 0.032463376
5
AT3G18140.2 2.04307 17.237 -3.670891 0.0002417 0.037286582 0.037167676
3.076698164
AT1G48450.1 96.50765 52.3755 0.881751195 3.653276 0.0002589 0.039279407 0.039279407
AT5G54060.1 15.7555 0 9.157965058 3.645229 0.0002672 0.040306398 0.040306398
AT2G45560.2 1.283521 14.9864 -3.636978 0.0002759 0.041391823 0.041391823
3.545475058
AT2G38310.1 54.4937 23.1272 1.23649884 3.61747 0.0002975 0.044156643 0.044156643
ATCGOl 170.1 15.46675 42.3211 -3.594794 0.0003246 0.047671263 0.047671263
1.452207048
AT2G41410.1 76.9253 38.7775 0.98823837 3.587706 0.0003336 0.048725047 0.048725047
AT5G36790.2 169.03 241.713 -3.580788 0.0003426 0.049768973 0.049734862
0.516015744
AT2G43745.1 0 11.8812 -3.579588 0.0003441 0.049734862 0.049734862
6.102440347
Table 7. Biotic, abiotic, and photosynthesis gene expression level, location of (evening element) EE and (CCAl-bininding sequence) CBS motifs, and circadian correlations in hybrids and parents.
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
Figure imgf000084_0001
Figure imgf000085_0001
Table 8. Results of regression analysis performed using JMP10
Figure imgf000086_0001
Figure imgf000087_0001
Figure imgf000088_0001

Claims

1. A method of producing a hybrid plant with increased biomass comprising the steps of:
(a) detecting an expression level of a stress-responsive gene in a plurality of plants;
(b) selecting a first parent plant having a first expression level of the stress-responsive gene from the plurality of plants;
(c) selecting a second parent plant of a different genotype having a second expression level of the stress-responsive gene from the plurality of plants, wherein the second expression level is different from the first expression level; and
(d) crossing the first parent plant with the second parent plant to produce a progeny plant.
2. The method of claim 1 wherein the stress-responsive gene is an abiotic stress gene.
3. The method of claim 2, wherein the stress-responsive gene is selected from the group consisting of: LSR3, ERD11/GSTF6, COR47/RD17, LTI45/ERD10, COR413-TM1, ALDH7B4, ATGRP3, PIP2B, RD28, CAX1/RCI4, COR15A, PIP1B, LTI30, PIP1A, PIP1;4, COR78/RD29A, COR6.6/KIN2, RD22, ERDl, GRP8, GRP2, GRP7/CCR2, MDH, HSP70 family, CAT2, LOS2, ATAVPl, LTP4, TCH2, TCH4, mtHsc70-l, COR15B, MTIA, LTP3, LOS1, Salt-stress responsive protein, FIB, KIN1, and homologs thereof.
4. The method of claim 3, wherein the stress-responsive gene is selected from the group consisting of: COR47/RD17, COR78/RD29A, and homologs thereof.
5. The method of claim 1, wherein the stress-responsive gene is a biotic stress gene.
6. The method of claim 5, wherein the stress-responsive gene is selected from the group consisting of: PR1, PR5, NUDT6, HSPR02, CNGC11, EBP/ERF72, PCC1, HR3/MLA10, CAX3, PAD4, WRKY70, PR2/BGL2, ACD6, NIA2, NHL3, Protease inhibitor, WAKl, WAK2, EP1, RVE2, BG3, LURP1, DMR6, SAG21, SUR2, ANK, and homologs thereof.
7. The method of claim 6, wherein the stress-responsive gene is selected from the group consisting of: PR1, ACD6, and homologs thereof.
8. The method of claim 1 wherein the step of detecting an expression level of a stress- responsive gene is performed at one or more time points selected from the group consisting of zeitgeber time (ZT) 0, ZT6, ZT12, ZT15, ZT18, and ZT21.
9. The method of claim 1, wherein the ratio of the first gene expression level to the second gene expression level is greater than 1.00.
10. The method of claim 9, wherein the ratio of the first gene expression level to the second gene expression level is greater than 1.5.
11. The method of claim 10, wherein the ratio of the first gene expression level to the second gene expression level is greater than 3.0.
12. The method of claim 1, wherein the expression levels of stress-responsive genes are detected using quantitative reverse transcription polymerase chain reaction (qRT-PCR).
13. The method of claim 1, wherein the progeny plant exhibits and improved agronomic trait compared with the parent plants.
14. The method of claim 13, wherein the agronomic trait is selected from the group consisting of: biomass, yield, disease tolerance, insect resistance, pathogen resistance, plant growth and development, starch content, oil content, fatty acid content, protein content, fruit ripening, and stress resistance.
15. The method of claim 1, wherein the plants are monocot plants.
16. The method of claim 1, wherein the plants are dicot plants.
17. The method of claim 1, wherein the plant type of the plants is selected from the group consisting of: Arabidopsis thaliana, maize (corn; Zea mays), soybean (Glycine max), cotton (Gossypium hirsutum; Gossypium sp.), peanut (Arachis hypogaea), barley (Hordeum vulgare); oats (Avena sativa); orchard grass (Dactylis glomerata); rice (Oryza sativa, including indica and japonica varieties); sorghum (Sorghum bicolor); sugar cane (Saccharum sp.); tall fescue (Festuca arundinacea); turfgrass species (e.g. species: Agrostis stolonifera, Poa pratensis, Stenotaphrum secundatum); wheat (Triticum aestivum); alfalfa (Medicago sativa); members of the genus Brassica, including broccoli, cabbage, carrot, cauliflower, Chinese cabbage; cucumber, dry bean and other leguminous plants, eggplant, tobacco (Nicotiana sp.), fennel, garden beans, gourd, leek, lettuce, melon, okra, onion, pea, pepper, pumpkin, radish, spinach, squash, sweet corn, tomato, potato, watermelon, Miscanthus, ornamental plants, and other fruit, vegetable, tuber, oilseed, and root crops, wherein oilseed crops may include soybean, canola, oil seed rape, oil palm, sunflower, olive, corn, cottonseed, peanut, flaxseed, safflower, and coconut.
18. A progeny plant produced by the method of claim 1.
19. A plant part, plant cell, or seed of the plant of claim 18.
20. A method of producing a hybrid plant with increased biomass comprising the steps of:
(a) detecting an expression level of at least two stress-responsive genes in a plurality of plants;
(b) selecting a first parent plant having a first expression level of each of the stress- responsive genes from the population of plants;
(c) selecting a second parent plant of a different genotype having a second expression level of each of the stress-responsive gene from the population of plants, wherein the first expression level for each gene is different than the second expression level for that gene; and
(d) crossing the first parent plant with the second parent plant to produce a progeny plant.
PCT/US2016/033580 2015-05-22 2016-05-20 Prediction of hybrid vigor using circadian-regulated stress-responsive gene expression Ceased WO2016191293A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562165637P 2015-05-22 2015-05-22
US62/165,637 2015-05-22

Publications (1)

Publication Number Publication Date
WO2016191293A1 true WO2016191293A1 (en) 2016-12-01

Family

ID=57393688

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/033580 Ceased WO2016191293A1 (en) 2015-05-22 2016-05-20 Prediction of hybrid vigor using circadian-regulated stress-responsive gene expression

Country Status (1)

Country Link
WO (1) WO2016191293A1 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107821155A (en) * 2017-12-05 2018-03-23 河北省农林科学院旱作农业研究所 A kind of double early double breeding time in the evening coupling directional breeding methods of winter wheat summer corn
CN108070027A (en) * 2018-02-12 2018-05-25 中国农业科学院作物科学研究所 The breeding method and its relevant biological material of waterlogging and volume increase transgenic wheat
CN108642064A (en) * 2018-05-21 2018-10-12 安徽农业大学 Wheat seed suspend mode duration gene TaCNGC-2A and its functional label
CN108728562A (en) * 2017-04-17 2018-11-02 山东省农业科学院蔬菜花卉研究所 Chinese cabbage Bra000758 frameshift mutations detection label and its application in breeding for disease resistance
CN108795956A (en) * 2018-05-04 2018-11-13 华南农业大学 Application of the GmMDH12 genes in terms of promoting soybean nodulation nitrogen fixing capacity
CN108892714A (en) * 2018-08-06 2018-11-27 中国农业科学院油料作物研究所 The application of plant salt tolerance GAP-associated protein GAP GmLURP17 and its encoding gene
CN109042301A (en) * 2018-08-24 2018-12-21 新疆守信种业科技有限责任公司 A kind of new varieties HC-159 selection of no film cotton
CN109651494A (en) * 2019-01-10 2019-04-19 北京大宏利辉生物科技中心 Common nepenthes wcor413-like albumen and its application
CN109906939A (en) * 2019-03-21 2019-06-21 湖南师范大学 A kind of pepper in vitro regeneration method and used medium
CN109971766A (en) * 2019-03-28 2019-07-05 北京林业大学 A protein PwRBP1 related to plant stress tolerance and its encoding gene and application
CN110862439A (en) * 2019-12-05 2020-03-06 北京市农林科学院 Plant yield heterosis related protein TaMADS134 and coding gene and application thereof
CN111826390A (en) * 2019-03-29 2020-10-27 中国科学院微生物研究所 Application of protein WRKY78 in regulating plant biotic stress resistance
US11170872B2 (en) 2019-11-05 2021-11-09 Apeel Technology, Inc. Prediction of latent infection in plant products
CN116121260A (en) * 2022-11-11 2023-05-16 四川农业大学 Stress resistance related heat shock protein gene and application thereof
CN118910311A (en) * 2024-08-09 2024-11-08 湖北科技学院 Infinite gene of lncRNA under stress of metal ions of osmanthus fragrans and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140137290A1 (en) * 2008-10-13 2014-05-15 Z. Jeffrey Chen Molecular clock mechanism of hybrid vigor

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140137290A1 (en) * 2008-10-13 2014-05-15 Z. Jeffrey Chen Molecular clock mechanism of hybrid vigor

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MILLER: "Roles for polyploidy, circadian rhythms, and stress responses in hybrid vigor", May 2014 (2014-05-01), XP055332637, Retrieved from the Internet <URL:https://repositories.lib.utexas.edu/handle/2152130350> [retrieved on 20160712] *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108728562B (en) * 2017-04-17 2021-08-03 山东省农业科学院蔬菜花卉研究所 Chinese cabbage Bra000758 frameshift mutation detection marker and application thereof in disease-resistant breeding
CN108728562A (en) * 2017-04-17 2018-11-02 山东省农业科学院蔬菜花卉研究所 Chinese cabbage Bra000758 frameshift mutations detection label and its application in breeding for disease resistance
CN107821155A (en) * 2017-12-05 2018-03-23 河北省农林科学院旱作农业研究所 A kind of double early double breeding time in the evening coupling directional breeding methods of winter wheat summer corn
CN108070027A (en) * 2018-02-12 2018-05-25 中国农业科学院作物科学研究所 The breeding method and its relevant biological material of waterlogging and volume increase transgenic wheat
CN108795956A (en) * 2018-05-04 2018-11-13 华南农业大学 Application of the GmMDH12 genes in terms of promoting soybean nodulation nitrogen fixing capacity
CN108642064A (en) * 2018-05-21 2018-10-12 安徽农业大学 Wheat seed suspend mode duration gene TaCNGC-2A and its functional label
CN108642064B (en) * 2018-05-21 2021-11-26 安徽农业大学 Wheat seed dormancy duration gene TaCNGC-2A and functional marker thereof
CN108892714A (en) * 2018-08-06 2018-11-27 中国农业科学院油料作物研究所 The application of plant salt tolerance GAP-associated protein GAP GmLURP17 and its encoding gene
CN108892714B (en) * 2018-08-06 2021-08-10 中国农业科学院油料作物研究所 Plant salt tolerance associated protein GmLURP17 and application of coding gene thereof
CN109042301A (en) * 2018-08-24 2018-12-21 新疆守信种业科技有限责任公司 A kind of new varieties HC-159 selection of no film cotton
CN109651494A (en) * 2019-01-10 2019-04-19 北京大宏利辉生物科技中心 Common nepenthes wcor413-like albumen and its application
CN109651494B (en) * 2019-01-10 2022-06-03 济南瑞之源生物科技有限公司 Pitcher plant wcor413-like protein and application thereof
CN109906939A (en) * 2019-03-21 2019-06-21 湖南师范大学 A kind of pepper in vitro regeneration method and used medium
CN109906939B (en) * 2019-03-21 2021-11-26 湖南师范大学 Pepper in-vitro regeneration method and culture medium used by same
CN109971766B (en) * 2019-03-28 2021-05-25 北京林业大学 Plant stress tolerance associated protein PwRBP1, and coding gene and application thereof
CN109971766A (en) * 2019-03-28 2019-07-05 北京林业大学 A protein PwRBP1 related to plant stress tolerance and its encoding gene and application
CN111826390A (en) * 2019-03-29 2020-10-27 中国科学院微生物研究所 Application of protein WRKY78 in regulating plant biotic stress resistance
CN111826390B (en) * 2019-03-29 2022-05-31 中国科学院微生物研究所 Application of protein WRKY78 in regulation of plant biotic stress resistance
US11170872B2 (en) 2019-11-05 2021-11-09 Apeel Technology, Inc. Prediction of latent infection in plant products
US12380965B2 (en) 2019-11-05 2025-08-05 Apeel Technology, Inc. Prediction of infection in plant products
CN110862439A (en) * 2019-12-05 2020-03-06 北京市农林科学院 Plant yield heterosis related protein TaMADS134 and coding gene and application thereof
CN110862439B (en) * 2019-12-05 2021-07-20 北京市农林科学院 Plant yield heterosis-related protein TaMADS134 and its encoding gene and application
CN116121260A (en) * 2022-11-11 2023-05-16 四川农业大学 Stress resistance related heat shock protein gene and application thereof
CN118910311A (en) * 2024-08-09 2024-11-08 湖北科技学院 Infinite gene of lncRNA under stress of metal ions of osmanthus fragrans and application

Similar Documents

Publication Publication Date Title
WO2016191293A1 (en) Prediction of hybrid vigor using circadian-regulated stress-responsive gene expression
Zeng et al. Identification of cold stress responsive microRNAs in two winter turnip rape (Brassica rapa L.) by high throughput sequencing
Shuai et al. Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis
Miller et al. Natural variation in timing of stress-responsive gene expression predicts heterosis in intraspecific hybrids of Arabidopsis
Zhou et al. Integration of sRNA, degradome, transcriptome analysis and functional investigation reveals gma-miR398c negatively regulates drought tolerance via GmCSDs and GmCCS in transgenic Arabidopsis and soybean
Yang et al. High-throughput deep sequencing reveals the important role that microRNAs play in the salt response in sweet potato (Ipomoea batatas L.)
Fu et al. Identification of salt tolerance-related microRNAs and their targets in maize (Zea mays L.) using high-throughput sequencing and degradome analysis
Wang et al. Genome-wide analysis of SnRK gene family in Brachypodium distachyon and functional characterization of BdSnRK2. 9
Zhai et al. Genome‐wide identification and analysis of microRNA responding to long‐term waterlogging in crown roots of maize seedlings
Wang et al. Transcriptomic analyses of Pinus koraiensis under different cold stresses
Yue et al. Genome-wide sequence and expressional analysis of autophagy Gene family in bread wheat (Triticum aestivum L.)
Yang et al. Prediction and verification of microRNAs related to proline accumulation under drought stress in potato
Die et al. Elucidating cold acclimation pathway in blueberry by transcriptome profiling
Fang et al. Overexpression of Lsi1 in cold-sensitive rice mediates transcriptional regulatory networks and enhances resistance to chilling stress
Ahmad Genomics and transcriptomics to protect rice (Oryza sativa. L.) from abiotic stressors:-pathways to achieving zero hunger
Balyan et al. Delineating the tissue-mediated drought stress governed tuning of conserved miR408 and its targets in rice
Gao et al. Genome‑wide identification and expression analysis of the UBC gene family in wheat (Triticum aestivum L.)
Guo et al. Identification and characterization of miRNAome in tobacco (Nicotiana tabacum) by deep sequencing combined with microarray
Yang et al. mechanism of low phosphorus adaptation in Camellia oleifera
Ketehouli et al. Yonggang Zhou, Weican Liu, Xiaowei Li, Daqian Sun, Keheng Xu, Chen Feng, Idrice Carther Kue Foka
Doque On the biological relevance of alternative splicing in plants: dual function of an Arabidopsis membrane transporter
Andryka et al. NO-induced alleviation of dormancy of apple embryos is related to modification of phytohormonal signaling pathways
Siwinska et al. Gene-to-metabolite network for coumarins biosynthesis in natural accessions of Arabidopsis thaliana
Laubinger The microRNA pathway in plants
Kowalczyk et al. Elastin-like polypeptides-alternative way of recombinant protein purification

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16800553

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16800553

Country of ref document: EP

Kind code of ref document: A1