WO2016182513A1 - Profiling of hepatocellular carcinoma and applications thereof - Google Patents

Profiling of hepatocellular carcinoma and applications thereof Download PDF

Info

Publication number
WO2016182513A1
WO2016182513A1 PCT/SG2016/050221 SG2016050221W WO2016182513A1 WO 2016182513 A1 WO2016182513 A1 WO 2016182513A1 SG 2016050221 W SG2016050221 W SG 2016050221W WO 2016182513 A1 WO2016182513 A1 WO 2016182513A1
Authority
WO
WIPO (PCT)
Prior art keywords
edil3
inhibitor
tgf
gene expression
use according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SG2016/050221
Other languages
French (fr)
Inventor
Kam Man Hui
Hongping XIA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Singapore Health Services Pte Ltd
Original Assignee
Singapore Health Services Pte Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Singapore Health Services Pte Ltd filed Critical Singapore Health Services Pte Ltd
Publication of WO2016182513A1 publication Critical patent/WO2016182513A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4709Non-condensed quinolines and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57525Immunoassay; Biospecific binding assay; Materials therefor for cancer of the liver or pancreas
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to the field of profiling (in particular molecular profiling) and/or therapy of tumour.
  • HCC Hepatocellular carcinoma
  • the present invention provides a method for profiling a liver sample from a hepatocellular carcinoma subject comprising:
  • the present invention provides a method for monitoring a HCC subject comprising determining EDIL3 gene expression levels and/or EDIL3 protein activity of (a) at least one liver sample isolated from the subject at a first time point before the subject has been administered at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF- ⁇ inhibitor; and (b) at least one liver sample separately isolated from the subject at various subsequent time points after the subject has been administered the at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF- ⁇ inhibitor; wherein
  • the present invention further provides a method for treating HCC in a subject comprising administering at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- ⁇ inhibitor to the subject.
  • the present invention includes a method for treating HCC comprising:
  • the present invention further includes an EDIL3 inhibitor; an ERK inhibitor and/or a TGF- ⁇ inhibitor for use in treating HCC in a subject.
  • the present also includes the use of an EDIL3 inhibitor; an ERK inhibitor and/or a TGF- ⁇ inhibitor in the preparation of a medicament for treating HCC in a subject.
  • EDIL3 is significantly upregulated in HCC and associated with recurrence and patient survival.
  • A The venn diagram of significantly different expressed genes among HCC tissues (T) vs matched normal tissues (MN), HCC with recurrence (R) vs non-recurrence (NR) and liver cancer cells with epithelial phenotype vs cells with mesenchymal phenotype.
  • B Validation of EDIL3 expression in a cohort of patient samples (T-R: Tumor Recurrence, T- NR: Tumor Non-Recurrence, MN: Matched Normal and NN: histologically normal liver tissues) by RT-qPCR.
  • C and D The expression of EDIL3 was significantly correlated with the expression of the mesenchymal marker vimentin (VIM) and epithelial marker E-cadherin (CDH1) in a group of HCC samples.
  • E Representative imaging of IHC staining for validation of the expression of EDIL3 in another panel of HCC tumour tissues (100 ⁇ ). Up panel: H&E staining for the tumorous and non-tumorous parts. Down panel: IHC staining for the EDIL3 expression.
  • F Imaging analysis and quantification of EDIL3 IHC staining. The IHC quantification was evaluated according to the percentage of cells with positive nuclei.
  • A Expression of EDIL3 was studied in a panel of liver cancer cell lines by qRT-PCR.
  • B and C Expression of EDIL3 was studied in a panel of liver cancer cell lines by western blotting and immunofluorescence analysis showed the location of EDIL3 in HLE cells (C).
  • C and E Representative images of stably transfected HuH7 (C) and HLE (E) cell invasion.
  • D and F The invading cells were quantified by plotting them as the average number of cells per field of view from three different experiments as described.
  • FIG. 4 EDIL3 promotes tumour angiogenesis of HCC in vitro.
  • a and E Representative images of endothelial cell migration after incubation with conditioned media (CM) from stably transfected HuH7 and HLE cells using the endothelial recruitment assay.
  • B and F Representative tube formation by ECs after incubation with conditioned media (CM) from stably transfected HuH7 and HLE cells using the tube formation assay.
  • C and G Quantification of the numbers of migrating endothelial cells in different groups.
  • D and H Quantification of the numbers of branchs in different groups, showing their tube forming ability.
  • miR-137 is identified as an upstream regulator of EDIL3 and is downregulated in HCC samples.
  • A The target sequences predicted by RNAhybrid 2.2 or TargetScan and mutations generated in the 3'-UTR of the EDIL3 mRNA are shown.
  • B The overexpression of miR-137 was examined by qRT-PCR.
  • C Effects of co-transfection of P-miR-137 with wild-type (wt) or mutant (mut) pGL3-EDIL3 constructs into HLE cells on luciferase reporter assays. Data were normalized by the ratio of Firefly and Renilla luciferase activities measured at 48 h post-transfection. The bar graph shows the meaniSD in three independent transfection experiments. *P ⁇ 0.05.
  • E The inhibitory effects of miR-137 on HCC cell invasion and induction of tube formation.
  • F Decreased expression of miR-137 in HCC associated with recurrence was observed in the HCC tissue samples.
  • G The expression of EDIL3 was significantly correlated with the expression of miR-137 in a group of HCC samples based on the RT-qPCR analysis.
  • FIG. 6 Overexpression of EDIL3 regulates TGF-beta and ERK signalling through binding to ⁇ ⁇ ⁇ 3 integrin.
  • A A co-immunoprecipitation experiment detecting the interaction between EDIL3 and ⁇ ⁇ ⁇ 3 integrin.
  • B The colocalization of EDIL3 and ⁇ ⁇ ⁇ 3 integrin in HCC cells. Bar represents 50 ⁇ .
  • C The production of TGF- ⁇ was examined by ELISA and was shown significantly increased in both HuH7 and PLC/PRF/5 cells stable transfected with EDIL3.
  • EDIL3 was significantly correlated with the expression of Transforming growth factor beta-1 -induced transcript 1TGFB1 I1 (D) and TGFB2 (E) in the panel of liver cancer cells.
  • F and G The expression of PEAK1 was shown to be consistent with the silencing or overexpression of EDIL3 by qRT- PCR.
  • H The expression of EDIL3 was significantly correlated with the expression of PEAK1 in our establish HCC dataset.
  • I The correlation expression of PEAK1 was validated in the HCC patients' samples by IHC staining (compared to the IHC staining results of EDIL3 in Figure.1 E).
  • J Overexpression of EDIL3 significantly enhanced the expression of PEAK1 and induced increasing phosphorylation of SRC, ERK and Smad2 by western blotting analysis.
  • FIG. 7 Blocking the TGF-beta and ERK signalling effectively inhibits EDIL3 mediated angiogenesis and invasion.
  • A Western blotting analysis of the expression of p-ERK and p-Smad2 in DMSO- and VX-11e or LY2109761- treated HuH7-p-lenti-EDIL3 cells. GAPDH was used as a loading control.
  • B Dose effect analysis of HuH7-p-lenti-EDIL3 cells exposed to VX-11e in the presence of DMSO or 2.5Mg/ml of LY2109761 as evaluated by MTS assays.
  • FIG. 8 Overexpression of EDIL3 promotes tumour metastasis and angiogenesis in vivo.
  • A Representative bioluminescent signal images of orthotopic mouse xenograft model with injection of HuH7-p-lenti-EDIL3 cells and HuH7-p-lenti-control cells.
  • B Quantitative analysis of bioluminescent imaging signals from all mice during each week is shown.
  • C Representative images of the bioluminescence signal detected in the lung of mice injected with HuH7-p-lenti-EDIL3 and HuH7-p-lenti-control cells.
  • Double-IHC staining were performed using antibodies against the endothelial marker CD34 (brown staining) and EDIL3 (red staining).
  • EDIL3 is expressed in some intratumoral endothelial cells (A).
  • EDIL3 produced by tumoral cells promotes adjacent endothelial cell growth (B).
  • C The represent immunohistochemistry staining images showed the correlation between EDIL3 and vimentin/E-Cadherin expression.
  • Figure 10. A and B) The expression of EDIL3 was shown significantly correlation with the expression of epithelial marker CDH1 and mesenchymal marker VIM expression in the microarray data of liver cancer cell lines.
  • C and D The expression of EDIL3 in HuH7 cells with p-lenti-EDIL3 or p-lenti-control stable transfection (C) or HLE cells with EDIL3-shRNA or shRNA-control stable transfection (D).
  • E and F Overexpression of EDIL3 significantly promoted the anchorage-independent growth.
  • G and H Overexpression of EDIL3 increased cell viability (G) and decreased the anoikis rate of HCC cells (H).
  • FIG. 11 The differently expressed genes in EDIL3 high and low liver cancer cells are mainly TGF-beta regulated genes.
  • A The Ingenuity Pathway Analysis (IPA) showed that the differently expressed genes in EDIL3 high and low liver cancer cells are mainly TGF-beta regulated genes.
  • B The hierarchical clustering analysis showed that the TGF-beta regulated genes differently expressed in EDIL3 high and low liver cancer cells can separate the EMT phenotype of liver cancer cells.
  • IPA Ingenuity Pathway Analysis
  • FIG. 12 The significantly dysregulated genes between HLE-shEDIL3 and HLE-shControl cells was analyzed by Ingenuity Pathway Analysis (IPA) (A) and pathway construction (B).
  • IPA Ingenuity Pathway Analysis
  • B pathway construction
  • FIG. 13 Effects of ERK and TGF-beta inhibitors.
  • a and B Dose effect analysis of HuH7-p-lenti-EDIL3 cells exposed to different dose of VX-11e (A) and LY2109761 (B) as evaluated by MTS assays.
  • C and D The ERK inhibitor significantly inhibits proliferation of EDIL3 overexpression HCC cells.
  • E and F The ERK inhibitor induces apoptosis of EDIL3 overexpression cells (E), while TGF-beta inhibitor is unable to blunt the apoptosis of EDIL3 overexpression cells (F). Definitions
  • the term “comprising” or “including” is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof.
  • the term “comprising” or “including” also includes “consisting of.
  • the variations of the word “comprising”, such as “comprise” and “comprises”, and “including”, such as “include” and “includes”, have correspondingly varied meanings.
  • a subject with HCC is one diagnosed with HCC based on the typical diagnostic criteria or symptoms for HCC.
  • a healthy individual not suffering from HCC is assessed as HCC negative based on the typical diagnostic criteria or symptoms for HCC.
  • a recurrence of HCC is defined as recurrence following the absence of HCC symptoms after therapy for HCC, for example after a curative resection.
  • An early recurrence of HCC was defined as recurrence within 2 years following the absence of HCC symptoms after therapy for HCC, for example after a curative resection.
  • HCC hepatocellular carcinoma
  • DEL1 Developmental Endothelial Locus-1
  • EDIL3 and Del-1 may be used interchangeably;
  • ERK Extracellular signal-regulated kinase; TGF- ⁇ (TGF-beta, TGFB), Transforming growth factor beta;
  • TGFB1 I1 transforming growth factor 1 induced transcript 1 ;
  • IHC immunohistochemistry;
  • CTCs circulating tumor cells; CFI, cancer-free interval;
  • DMEM Dulbecco's Modified Eagle's medium; HBV, hepatitis virus B; HCV, hepatitis virus C; RIPA radioimmunoprecipitation;
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction;
  • the present invention provides a method for profiling a liver sample from a hepatocellular carcinoma subject comprising:
  • EDIL3 EGF-like repeat and discoidin l-like domain protein 3
  • the present invention provides a method for monitoring a HCC subject comprising determining EDIL3 gene expression levels and/or EDIL3 protein activity of (a) at least one liver sample isolated from the subject at a first time point before the subject has been administered at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF- ⁇ inhibitor; and (b) at least one liver sample separately isolated from the subject at various subsequent time points after the subject has been administered the at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF- ⁇ inhibitor; wherein
  • EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point is the same as the first time point and/or a preceding subsequent time point is indicative that the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- ⁇ inhibitor does not appear to have an effect on the subject. It will be further appreciated that the person skilled in the art would be able to set a criteria for the amount of difference between the compared time points to define if a subject is responding positive or negatively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- ⁇ inhibitor; as appropriate.
  • the liver sample from the HCC subject may be diseased liver tissue from the subject. It will be appreciated that the disease liver tissue comprises transformed cells. It will be further appreciated that the liver sample may be isolated from a liver neoplasm. It will be appreciated that any suitable control may be used. Typically, the control comprises at least one normal tissue sample. A normal liver tissue sample may be from a healthy individual not suffering from HCC. A normal liver tissue sample may also be from non-diseased liver tissue from a subject with HCC. Non-diseased liver tissue refers to liver tissue with non-transformed cells. Typically, non-diseased liver tissue and/or cells can be easily distinguished from the HCC tissue, for example morphologically. It will be appreciated that non- diseased liver tissue and/or cells also do not show any manifestation of any other liver conditions, including but not limited to liver cirrhosis, hepatic steatosis and hepatitis, for example.
  • control HCC subjects may be diagnosed as early stage, intermediate state or advanced stage HCC. It would also be informative to compare with a subject with recurring HCC, for example early recurring HCC. It will be appreciated that if a subject has a higher EDIL3 gene expression level and/or EDIL3 protein activity than a control, the subject is likely to have a recurrence of HCC.
  • the higher the EDIL3 gene expression level and/or EDIL3 protein activity in a subject the higher and/or the earlier recurrence of HCC in the subject.
  • the first subject is likely to have a higher and/or earlier HCC recurrence than the second subject.
  • the same correlation for HCC recurrence applies if the first subject has a higher EDIL3 gene expression level and/or EDIL3 protein activity compared to a control than a second subject compared to the same control. It will be appreciated that the person skilled in the art would be able to determine a correlation between difference in EDIL3 gene expression levels and/or EDIL3 protein activity to HCC recurrence.
  • the method for profiling a liver sample from a HCC subject or the method for monitoring a HCC subject as described herein may be an in vitro method.
  • the present invention further provides a method for treating HCC in a subject comprising administering at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- ⁇ inhibitor to the subject.
  • the present invention includes a method for treating HCC comprising:
  • EDIL3 gene expression level(s) may be determined at the transcription and/or translation level(s).
  • any suitable method may be employed for determining EDIL3 gene expression level(s) at the transcription level, including but not limited to Northern blot analysis, microarray analysis and/or reverse-transcription PCR.
  • the reverse-transcription PCR may be quantitative reverse-transcription PCR (RT- qPCR).
  • Any suitable method may also be used to determine EDIL3 gene expression level(s) at the translation level, including but not limited to Western blot, immunohistochemistry (IHC) and/or enzyme-linked immunosorbent assay (ELISA).
  • the present invention further includes an EDIL3 inhibitor, an ERK inhibitor and/or a TGF- ⁇ inhibitor for use in treating HCC in a subject.
  • the present also includes the use of an EDIL3 inhibitor, an ERK inhibitor and/or a TGF- ⁇ inhibitor in the preparation of a medicament for treating HCC in a subject. It will be appreciated that the EDIL3 inhibitor(s), ERK inhibitor(s) and TGF- ⁇ inhibitor(s) may be used separately or together.
  • EDIL3 inhibitor(s), ERK inhibitor(s) or TGF- ⁇ inhibitor(s) is to be used for the subject.
  • one or more EDIL3 inhibitors may be used for the subject.
  • a suitable number of different EDO inhibitors may be used together for sequential or simultaneous administration.
  • a suitable number of different EDIL3 inhibitors may be mixed together (for example, in a single composition) for administration to the subject. It will be appreciated that the same applies with one or more ERK inhibitor(s), or one or more TGF- ⁇ inhibitor(s).
  • Any two or all three of the different inhibitor(s) may be used together. Any two or all three of EDIL3 inhibitor(s), ERK inhibitor(s) and TGF- ⁇ inhibitor(s) may be used in combination. Any two or all three of EDIL3 inhibitor(s), ERK inhibitor(s) and/or TGF- ⁇ inhibitors) may be used together for sequential or simultaneous administration. Any two or all three of EDIL3 inhibitor(s), ERK inhibitors) and/or TGF- ⁇ inhibitor(s) may be mixed together (for example, in a single composition) for administration to the subject.
  • the EDIL3 inhibitor may inhibit EDIL3 expression.
  • the EDIL3 inhibitor comprises at least one RNA interfering agent targeting EDIL3 gene expression.
  • the RNA interfering agent may comprise a small interfering RNA (siRNA) or a microRNA (miRNA).
  • siRNA small interfering RNA
  • miRNA microRNA
  • the miRNA includes but is not limited to miR-137.
  • the sequence of miR-137 is:
  • the EDIL3 inhibitor may inhibit EDIL3 protein activity.
  • the EDIL3 inhibitor may be at least one antibody and/or a functional fragment thereof.
  • the at least one antibody may be a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
  • Monoclonal, chimeric and polyclonal antibodies may be produced by standard methods.
  • a further example of an EDIL3 inhibitor includes a peptide.
  • the ERK inhibitor may inhibit ERK1 and/or ERK2 gene expression.
  • the ERK inhibitor comprises at least one RNA interfering agent targeting ERK1 and/or ERK2 gene expression.
  • the RNA interfering agent may comprise a small interfering RNA (siRNA) or a microRNA (miRNA).
  • the ERK inhibitor may inhibit ERK1 and/or ERK2 protein activity.
  • the ERK inhibitor may be at least one antibody and/or a functional fragment thereof.
  • the at least one antibody may be a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
  • Monoclonal, chimeric and polyclonal antibodies may be produced by standard methods.
  • a further example of an ERK inhibitor includes a peptide.
  • the ERK inhibitor includes but is not limited to 4-[2-(2-chloro-4-fluoroanilino)-5-methylpyrimidin-4-yl]-N-[(1S)-1-(3- chlorophenyl)-2-hydroxyethyl]-1 H-pyrrole-2-carboxamide (Vx-11 e).
  • the TGF- ⁇ inhibitor may inhibit TGF- ⁇ , TGF-fi2 and/or 7GF- ?3 gene expression.
  • the TGF- ⁇ inhibitor comprises at least one RNA interfering agent targeting TGF-J31, TGF- 2 and/or TGF-fi3 gene expression.
  • the RNA interfering agent may comprise a small interfering RNA (siRNA) or a microRNA (miRNA).
  • the TGF- ⁇ inhibitor may inhibit TGF- ⁇ , TGF ⁇ 2 and/or TGF ⁇ 3 protein activity.
  • the TGF- ⁇ inhibitor may be at least one antibody and/or a functional fragment thereof.
  • the at least one antibody may be a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
  • Monoclonal, chimeric and polyclonal antibodies may be produced by standard methods.
  • a further example of a TGF- ⁇ inhibitor includes a peptide.
  • the TGF- ⁇ inhibitor includes but is not limited to 4-[2-[4-(2-pyridin-2-yl-5,6-dihydro-4H- pyrrolo[1 ,2-b]pyrazol-3-yl)quinolin-7-yl]oxyethyl]morpholine (LY2109761 ).
  • a subject is profiled for EDIL3 expression levels before administration of treatment of EDIL3 inhibitors), ERK inhibitor(s) and/or TGF- ⁇ inhibitors); and to assess response to the treatment.
  • the treatment is for a subject with higher EDIL3 gene expression level and/or higher EDIL3 protein activity compared to at least one normal liver tissue subject.
  • the subject may be profiled according to an applicable method described herein.
  • EDIL3 in a fluid sample including but not limited to blood, serum, saliva, urine and tears
  • a fluid sample including but not limited to blood, serum, saliva, urine and tears
  • CIRB SingHealth Centralised Institutional Review Board
  • STR SingHealth Tissue Repository
  • Written informed consent was obtained from all participating patients and all clinical and histopathological data provided to the researchers were rendered anonymous.
  • All human liver cancer cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% FBS, 100units/mL of penicillin and 100 g/mL of streptomycin (Invitrogen, Carlsbad, CA).
  • DMEM Dulbecco's modified Eagle's medium
  • RNA from the tissue samples or cell lines was extracted using TRIzol reagent (Invitrogen). The quality and quantity of isolated total RNA were assessed using the Agilent 2100 Bioanalyzer and NanoDrop ND-1000 Spectrophotometer (Agilent, Santa Clara, CA, USA). mRNA microarray analysis was performed as described (Wang et a/., 2011 ; Xia et a/., 2013) using the Affymetrix Human Genome U133 plus 2.0 Arrays (Affymetrix, USA). Briefly, total RNA was processed for hybridization with GeneChip 3' IVT Express (Affymetrix, Santa Clara, USA), according to the manufacturers instruction.
  • GeneChip 3' IVT Express Affymetrix, Santa Clara, USA
  • cDNA was synthesized from immunoprecipitated RNA using reverse transcriptase followed by second strand synthesis to generate double-stranded cDNA.
  • An in vitro transcription reaction was used to generate biotinylated cRNA.
  • cRNA was hybridized onto GeneChip Affymetrix Human Genome U133 Plus 2.0 arrays. Post-hybridization washes were performed on an Affymetrix GeneChip Fluidics Station 450. Arrays were scanned on an Affymetrix GeneChip Scanner 3000 and normalized using GCRMA in Partek software (Partek Incorporated. St. Louis, MO). Array quality control was performed using Affymetrix® Expression ConsoleTM.
  • RNA preparation, microarray analysis and qRT-PCR were transformed to log 2 base and imported to Partek Genomics Suite software (Partek Inc., St. Louis, MO) to conduct statistical analyses.
  • the microarray data have been deposited in the European Bioinformatics Institutes of the European Molecular Biology Laboratory database (http://www.ebi.ac.uk/array express/) and are accessible through ArrayExpress public database with accession numbers E-MEXP-84 and E-TABM-292 (Wang et a/., 201 1 ).
  • RNA from the tissue samples or cell lines was extracted using TRIzol reagent (Invitrogen). The quality and quantity of the isolated total RNA was assessed using the Agilent 2100 Bioanalyzer and NanoDrop ND-1000 Spectrophotometer (Agilent, Santa Clara, CA, USA). The microarray analysis was performed as described (Wang et al., 201 1 ; Xia et al., 2013). The qRT- PCR was performed as described (Xia et al., 2013). For mRNA detection, the total RNA was reverse transcribed using the Superscript® VILOTM cDNA Synthesis Kit (Invitrogen, CA).
  • the qPCR was performed using SsoFastTM EvaGreen® Supermix (Bio-Rad).
  • SsoFastTM EvaGreen® Supermix Bio-Rad
  • the total RNA samples were polyadenylated and reverse transcribed for a two-step quantitative RT- PCR reaction using the NCodeTM VILOTM miRNA cDNA Synthesis Kit and EXPRESS SYBR® GreenERTM miRNA qRT-PCR Kits (Invitrogen, CA) according to the manufacturer's instructions.
  • the HPRT1 or U6 gene was used as an endogenous control, and fold changes were calculated via relative quantification (2 " ⁇ ) (Livak and Schmittgen, 2001 ).
  • Enzyme-linked immunosorbent assay The plasma EDIL3 concentration in 40 HCC, 20 hepatitis and 20 normal human control subjects was measured by enzyme-linked immunosorbent assay (ELISA) using a kit from USCN Life Science (Wuhan, China). The detection range was 0.313-20 ng/mL.
  • the standard curve concentrations used for the ELISA were 20ng/mL, 10ng/mL, 5ng/mL, 2.5ng/mL, 1.25ng/mL, 0.625ng/mL and 0.313 ng/mL. The assay was performed in duplicate and the concentrations were calculated from a standard curve according to the manufacturer's instructions.
  • the membrane was incubated for 2 h in PBS containing 0.1% Tween 20 and 5% skim milk to block nonspecific binding, followed by incubation for overnight at 4 °C temperature with a primary antibody, rabbit anti-EDIL3 (HPA020415, Sigma) (1 :20), rabbit anti-CD34 (ab81289) (1 :100), rabbit anti-PEAK1 (ab121869) (1 :100), Phospho-Src (Tyr416) (D49G4) rabbit and PhosphoPlus® p44/42 MAPK(ERK1/2) (Cell Signaling Technology, INC) (1 :100) or goat GAPDH (GenScript, NJ).
  • a primary antibody rabbit anti-EDIL3 (HPA020415, Sigma) (1 :20), rabbit anti-CD34 (ab81289) (1 :100), rabbit anti-PEAK1 (ab121869) (1 :100), Phospho-Src (Tyr416) (D49G4) rabbit and PhosphoPlus® p44
  • HEK 293T cells were co-transfected with the indicated combinations of plasmids expressing Flag-EDIL3 and ⁇ 3 integrin. Cell lysates were incubated with anti-Flag antibody (Sigma) and protein G Sepharose 4 fast flow beads, followed by western blotting using indicated antibodies.
  • Anti-Flag antibody was used to immunoprecipitate (IP) Flag-EDIL3 from whole-cell extracts, followed by western blotting analyses using anti- ⁇ 3 integrin (top) and anti- EDIL3 (bottom) antibodies to detect ⁇ 3 integrin and EDIL3, respectively.
  • the cells were seeded in the BD FalconTM 8-well CultureSlide and incubated with primary antibodies, E-Cadherin (24E10) Rabbit mAb #3195, Vimentin (R28) Antibody #3932 (Cell Signaling Technology, Danvers, MA) or goat anti- EDO (sc-161035, Santa Cruz), and then incubated with Alexa Fluor® 594 goat anti-rabbit or mouse anti-goat IgG (Invitrogen).
  • the Culture slides were counterstained with Hoechst 33342 and imaged with a confocal laser-scanning microscope (Carl Zeiss). Data were processed with Adobe Photoshop 7.0 software for analysis.
  • Immunohistochemistry The paraffin-embedded tissue samples from consenting patients were cut in 5- pm sections and placed on polylysine coated slides; then the samples were deparaffinized in xylene and rehydrated using a series of graded alcohols. Antigen retrieval was performed by heat mediation in citrate buffer (pH 6) (Dako). Samples were blocked with 10% goat serum before incubating with primary antibody.
  • the samples were incubated overnight using a primary antibody, rabbit anti-EDIL3 (HPA020415, Sigma) (1 :20), rabbit anti-CD34 (ab81289) (1 :100), rabbit anti-PEAK1 (ab121869) (1 :100), Phospho-Src (Tyr416) (D49G4) rabbit and PhosphoPlus® p44/42 MAPK(ERK1/2) (Cell Signaling Technology, INC) (1 :100) or an isotype-matched IgG as a negative control in a humidified container at 4 °C. Immunohistochemical staining was performed with the Dako Envision Plus System (Dako, Carpinteria, CA) according to the manufacturer's instructions. The intensity of staining was evaluated.
  • Dako Envision Plus System Dako Envision Plus System (Dako, Carpinteria, CA) according to the manufacturer's instructions. The intensity of staining was evaluated.
  • the HCC cells were seeded onto 6-well plates at approximately 80% confluence.
  • the cells were transfected either with the p- lenti-EDIL3 or shEDIL3 or their control vectors using the Lipofectamine® LTX Reagent with PLUSTM Reagent (Life Technologies), or Gen JetTM Plus DNA in- vitro tranfection reagent (SignaGen, MD), according to the manufacturer's instructions.
  • the cells were subcultured to 10% confluence in a medium containing 1 pg/mL of puromycin (Sigma-Aldrich, St. Louis, MO). When all cells in the non-transfected control culture were killed, antibiotic-resistant clones were picked and passaged through the medium containing puromycin.
  • the expression of EDIL3 was confirmed by qRT-PCR or western blotting as described. Wound healing assay
  • HCC cells were culture and transfection conditions for HCC cells were optimized to ensure a homogeneous and viable cell monolayer prior to wounding.
  • HCC cells 5.0x10 4
  • Cells were then transfected with 50 nM siEDIL3 and siControl using Lipofectamine RNAiMAX transfection reagent (Invitrogen), respectively.
  • an artificial homogenous wound was created onto the monolayer with a sterile plastic 100 ⁇ _ micropipette tip. After wounding, the debris was removed by washing the cells with serum-free medium. Migration of cells into the wound was observed at different time points.
  • HUVECs 5x10 4
  • tumor cells were placed in the lower compartments in 800 ⁇ of serum free medium.
  • the co- cultured tumor cells were HLE or HuH7 non-transfected or transfected with shEDIL3 or p-EDIL3 or their controls for 24 h and refreshed with serum free medium before the recruitment experiments.
  • the endothelial tube formation assay was conducted using the Angiogenesis Starter Kit (Life technologies, Carlsbad, CA, USA) according to the protocol. Briefly, HUVEC cells were seeded at 2.5 ⁇ 10 3 viable cells per cm 2 in a culture dishes or flask using LVES-supplemented Medium 200. One day before performing the tube formation assay, place the vial containing the Geltrex® LDEV-Free Reduced Growth Factor Basement Membrane Matrix at 4 °C to thaw overnight. 0.1 mL of undiluted Geltrex® solution was added to each well of a 24-well plate (i.e., 50 iL of Geltrex® solution per cm 2 growth surface).
  • the coated plate was incubated at 37 °C for 30 minutes to allow the matrix to solidify.
  • the HUVEC cells were collected and dilute the cells in supplemented Medium 200.
  • the cells were seeded at a density of approximately 25,000 cells per cm 2 .
  • the cells were treated with conditional medium of HCC cells with higher or low EDII3 and incubated overnight at 37°C in a humidified atmosphere of 5% C02.
  • the cells were imaged at 4x magnification.
  • Luciferase reporter assay The potential targeting microRNAs EDIL3 were selected by bioinformatics analysis. The 3 -UTR sequence of EDIL3 predicted to interact with the microRNAs or a mutated sequence within the predicted target sites were synthesized and inserted into the Xbal and Fsel sites of pGL3 control vector (Promega, Madison, Wl).
  • HLE cells were plated onto 24- well plates and transfected with the above constructs and microRNA expression vectors using GenJetTM Plus DNA in vitro transfection reagent (SignaGen, MD). A Renilla luciferase vector pRL-SV50 (Promega, Madison, Wl) was also co- transfected to normalize the differences in transfection efficiency. After transfection for 48 h, cells were harvested and assayed with Dual-Luciferase Reporter Assay System (Promega, Madison, Wl) according to the manufacturer's instructions. This experiment was performed in duplicate in three independent experiments.
  • the cell viability was assessed by using MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetra zolium] assays (CellTiter 96 AQueous One Solution Cell Proliferation Assay; Promega).
  • the CellTiter 96 aqueous one solution assay is a colorimetric method for determining the number of viable cells in proliferation or cytotoxicity assays.
  • HuH7-p-lenti-EDIL3 cells were treated with VX-11e, a potent, selective, and orally bioavailable inhibitor of ERK (ChemieTek, Indianapolis, IN, USA), and LY2109761 , a selective TGF- ⁇ receptor type l/ll dual inhibitor (MedChemexpress, Shanghai, China) or combination.
  • VX-11e a potent, selective, and orally bioavailable inhibitor of ERK
  • LY2109761 a selective TGF- ⁇ receptor type l/ll dual inhibitor
  • a selective TGF- ⁇ receptor type l/ll dual inhibitor MedChemexpress, Shanghai, China
  • MTS assay the CellTiter 96 aqueous one solution cell proliferation assay kit (Promega, Madison, Wl, USA) was used, following the manufacturer's instructions. Briefly, 20 pL of the MTS reagent was added into each well and the cells were incubated at 37 °C for around 2 h. The absorbance was detected at 490nm using a
  • the established stable HCC cell lines (HuH7-p-lenti-control or HuH7-p-lenti-EDIL3) were mixed with tissue culture medium containing 0.6% low-melting- point agarose (Sigma Saint Louise, MO), resulting in a final agar concentration of 0.3%. Then, 500 ⁇ _ of the cell suspension (800 cells) was immediately plated in 24-well plates coated with 500 pL 0.6% agar in tissue culture medium and cultured at 37°C with 5% CO 2 . The plates were kept in the incubator and the number of colonies formed was counted under an inverted light microscope (x40) after 2-3 weeks. The assay was analyzed in duplicate in three independent experiments. Anoikis assay
  • the established stable HCC cell lines (HuH7-p-lenti-control or HuH7-p-lenti-EDIL3) were seeding in the 96 well plates. Anoikis was induced by culturing cells in poly-HEMA coated plates. Briefly, poly-HEMA were prepared as a 10 mg/ml solution in ethanol, which covered completely the well of the plates, then dried and repeated once. The established stable HCC cell lines in serum-free medium were seeded into the coated plates for different time points. To avoid survival effects caused by the clumping of cells, 0.5% methyl cellulose (Sigma- Aldrich) was added into the medium. At the designated time points, the cells were collected and subjected to cell viability assays by MTS (Promega) and apoptosis assays by Caspase3/7 Glo kit (Promega) according to the protocols from the respective manufacturers.
  • MTS Promega
  • Caspase3/7 Glo kit Promega
  • mice Stable transfected HCC cells were resuspended in PBS and implanted into the liver (1.5 * 106 cells per flank) of male BALB/c nude mice. Tumour growth was measured by bioluminescence imaging using the Xenogen MS Lumina system once a week (Xenogen Corporation, Hopkinton, MA). Briefly, following anaesthesia with 2% isoflurane, mice injected with D-Luciferin IP (150mg/kg; Caliper Life Sciences, Inc., Hopkinton, MA) received 10 s to 1 min scans to assess the bioluminescent signal. Mice were euthanized at the end of the experiment and the liver and lung were harvested, imaged and processed for histopathological examination. The statistical significance of the bioluminescent signal was evaluated using the Student's t-test. The liver tumours and lung were fixed in 10% neutral buffered formalin before processing into paraffin blocks and tissue section. Survival and statistical analysis
  • the experimental data are presented as the mean ⁇ standard deviation (SD). All statistical analyses were performed using ANOVA or a two-tailed Student's t test (GraphPad Prism 5 or Partek Genomics Suite software). The survival curves were calculated using the Kaplan-Meier method. Differences were considered statistically significant when the P-values were less than 0.05.
  • EDIL3 is significantly up-regulated in in HCC samples of patients with early recurrent disease and poor survival
  • T Tumor
  • MN Matched Normal
  • R Recurrence
  • NR Non-Recurrence
  • E epithelial
  • M mesenchymal
  • EDIL3 was shown to be significantly positive correlated with vimentin (VIM), a mesenchymal marker and negative correlated with E-cadherin (CDH1 ), an epithelial marker (Fig. 1 C and 1 D).
  • VIM vimentin
  • CDH1 E-cadherin
  • Fig. 1 C and 1 D E-cadherin
  • the expression of EDIL3 was further studied in an independent cohort of 20 pairs of HCC tumour tissues (10 T-R and 10 T- NR) by IHC staining and EDIL3 protein expression was significantly increased in HCC tumour tissues (Fig. 1 E and 1 F).
  • Table 2 The patients' clinicopathological features in HCC and survival univariate and multivariate analyses
  • EDIL3 is known to be produced by endothelial cells
  • the double-staining immunohistochemistry was also used for the endothelial marker CD34 (brown staining) and EDIL3 (red staining). It was observed that EDIL3 is also expressed in some intratumoral endothelial cells (Fig. 9A). Interestingly, the results also indicated that EDIL3 produced by tumoral cells promote adjacent endothelial cell growth (Fig. 9B). The correlation between EDIL3 and Vimentin/E-Cadherin expression was also indicated by immunohistochemistry analysis (Fig. 9C).
  • EDIL3 When the median EDIL3 expression was calculated for all the fifty HCC samples studied by qRT-PCR and used as the cut-off for Fisher's exact test and Kaplan-Meier analysis, it was demonstrated that high EDIL3 expression was significantly associated with a shorter overall survival (Fig. 1 G). Consistent with EDIL3 being a secreted glycoprotein, EDIL3 protein expression was also shown to be significantly higher in the plasma of HCC patients compared to normal individuals by ELISA analysis. It is also showed that the EDIL3 level is significantly higher in the HCC patients with early recurrence than the HCC patients without early recurrence, suggesting EDIL3 can be a potential non-invasive diagnostic biomarker for HCC with early recurrence (Fig. 1 H).
  • EDIL3 is a novel regulator of EMTin HCC
  • epithelial liver cancer cells such as HepG2, Hp3B, HuH7 and PLC/PRF/5 had high E-cadherin (CDH1 ) and low vimentin (VIM) expression (Xia et al., 2013).
  • liver cancer cells with a mesenchymal phenotype such as HLE, SK-HEP-1 , SNU-449 and Mahlavu had low E-cadherin and high vimentin expression (Xia et al., 2013).
  • EDIL3 expression was significantly higher in liver cancer cells with a mesenchymal phenotype than in the cells with an epithelial phenotype (Figs. 2A and 2B). Similar observations could be made using independent published microarray data for liver cancer cell lines (Barretina et al., 2012). EDIL3 expression was significantly correlated with expression of the mesenchymal marker VIM and inversely correlated with the epithelial marker CDH1 (Figs. 10A and 10B).
  • epithelial HuH7 cells were stably transfected with either pLenti-EDIL3 or pLenti-control vector.
  • the stable cells were tentatively designated as HuH7- EDIL3 or HuH7-control, respectively.
  • the expression of EDIL3 in these cells was confirmed by qRT-PCR (Fig. 10C).
  • the up-regulation of EDIL3 was associated with dramatic morphological changes observed in the HuH7-EDIL3 cells: from an epithelial cobblestone phenotype to an elongated fibroblastic phenotype, which is indicative of EMT (Fig. 2C).
  • EMT has been indicated as a key step in initiating cancer cell migration (Xia et a/., 2013).
  • the migration potential of the HuH7-EDIL3 and HLE-shEDIL3 cells was studied using the wound healing assay. It was observed that stable overexpression of EDIL3 in the epithelial HuH7 cells significantly promoted cell migration (Fig. 3A) while stable knockdown of EDIL3 in the mesenchymal HLE cells significantly inhibited cell migration (Fig. 3B). Consistent with results of the wound healing assay, overexpression of EDIL3 in the HuH7-EDII_3 cells promoted invasion (Fig.
  • Angiogenesis is a key early step in the cancer invasion-metastasis cascade.
  • EDIL3 being a glycoprotein secreted by endothelial cells, is likely to be involved in tumour angiogenesis.
  • the role of EDIL3 in HCC angiogenesis by in vitro endothelial recruitment and capillary tube formation assays using stably transfected HuH7 and HLE cells with different EDIL3 expression was studied. In the presence of HLE cells with high EDIL3 expression, HUVECs migrated more efficiently through the transwell pores compared to those grown in the absence of tumour cells conditioned medium (NC) or in the presence of HLE-shEDIL3 cells with low EDIL3 expression.
  • NC tumour cells conditioned medium
  • HLE cells The knockdown of EDIL3 expression could significantly suppress the effects of HLE cells on HUVEC migration (Fig. 4A and 4C).
  • cell-conditioned medium of EDIL3-high HLE cells compared to the absence of tumour cells conditioned medium (NC) promoted the HUVECs to develop more capillary-like structures. Tube formation was reduced dramatically in HUVECs that were grown in conditioned medium from HLE- shEDIL3 cells (Fig. 4B and 4D).
  • the overexpression of EDIL3 in HuH7 cells enhanced HUVEC migration (Fig. 4E and 4G) and capillary tube formation (Fig. 4F and 4H).
  • miR-137 is a critical upstream regulator of EDIL3
  • miRecords that has incorporated ten miRNA target prediction algorithms; Xiao et ai, 2009 was employed to predict miRNAs that could be the potential regulators of EDIL3 (Table 3).
  • EDIL3 could potentially be regulated by miR-137.
  • a sequence containing the predicted 3 -UTR target site of the EDIL3 mRNA and its mutated sequence was then cloned into the pGL3 luciferase reporter gene to generate pGL3-EDIL3-3'UTR-wt and pGL3- EDIL3-3'UTR-mut vector respectively (Fig. 5A).
  • These vectors were co- transfected into the HLE cells together with either the p-miR-137 vector or the p- miR-control vector.
  • a Renilla luciferase vector (pRL-TK) was used to normalize the differences in transfection efficiency.
  • RNA over-expression of miR-137 was validated by RT-qPCR (Fig. 5B). Luciferase activity in HLE cells co-transfected with either the p-miR-137 or the pGL3-EDIL3-3'UTR-wt vector was significantly decreased compared to the control (Fig. 5C). Over-expression of miR-137 decreased EDIL3 protein expression in HLE cells (Fig. 5D) and significantly inhibited HLE cell invasion and induced endothelial cell capillary tube formation (Fig. 5E).
  • MiR-137 expression was significantly down-regulated in tumor tissues of HCC patients when compared to adjacent histologically normal liver tissues and miR-137 expression was significantly down-regulated in tumor samples of HCC patients with early recurrent disease compared to samples of patients with non-recurrent disease (Fig. 5F).
  • the decreased expression of miR-137 also significantly correlated with increased expression of EDIL3 in HCC samples (Fig. 5G). Therefore, overexpression of EDIL3 was correlated with downregulation of miR-137 in HCC and miR-137 is a critical upstream regulator of EDIL3.
  • EDIL3 regulates TGF-beta and ERK signalling through binding to ⁇ ⁇ ⁇ 3 integrin
  • EDIL3 was initially reported to be a new ligand for the ⁇ ⁇ ⁇ 3 integrin receptor regulating embryonic vascular morphogenesis and remodelling (Hidai et a/., 1998; Rezaee et a/., 2002).
  • Co-immunoprecipitation experiments demonstrated that EDIL3 could be specifically co-precipitated with the ⁇ ⁇ ⁇ 3 integrin (Fig. 6A), demonstrating that EDIL3 and ⁇ ⁇ ⁇ 3 integrin physically interacted with each other.
  • immunofluorescence analysis demonstrated that EDIL3 and ⁇ ⁇ ⁇ 3 integrin co-localized in HLE cells (Fig. 6B).
  • TGF-beta regulated genes are differently expressed in EDIL3 high and low liver cancer cells.
  • EDIL3 expression was found to be significantly correlated with PEAK1 expression in HCC patient tumor samples (Fig. 6H) and was further validated by IHC staining with another 20 cases of HCC tissue samples (Fig. 6I).
  • IPA Ingenuity pathway analysis
  • the MTS results showed that the cell viability was inhibited with the increasing dose of VX-11e but not LY2109761 and EDIL3 overexpression HuH7-p-lenti-EDIL3 cell is more sensitive to VX-1 1 e treatment (Fig. 13A and 13B).
  • the ERK inhibitor also significantly inhibits proliferation (Fig. 13C and 13D) and induces apoptosis (Fig. 13E) of EDIL3 overexpression cells, while TGF-beta inhibitor is unable to blunt the apoptosis of EDIL3 overexpressing cells (Fig. 13F).
  • the colony formation assay showed that VX- 1 1 e treatment significantly decreased colony formation ability of HuH7-p-lenti- EDIL3 stable cells and LY2109761 can sensitize this effect (Fig. 7C and 7D). Blocking the TGF-beta and ERK signalling was also shown significant inhibition effect on EDIL3 overexpression HuH7-p-lenti-EDIL3 cell invasion ability (Fig. 7E and 7F) and the HuH7-p-lenti-EDIL3 cells conditional medium enhanced HUVEC capillary tube formation (Fig.
  • HuH7-pLenti-EDIL3 and HuH7-pLenti- control cells with luciferase were orthotopically implanted into nude mice.
  • lung tissues harvested from mice at the end of the experiments inoculated with the HuH7- pLenti-EDIL3 cells gave prominent bioluminescent signals, indicating the presence of lung metastasis.
  • no lung bioluminescent signal was detected in mice inoculated with HuH7-pLent-control cells (Fig. 8C).
  • the epithelial-mesenchymal transition is a key step in cancer recurrence and metastasis by which epithelial cells lose their cell polarity and cell-cell adhesion, and gain migratory and invasive properties to become mesenchymal cells (Lamouile et al., 2014; Kalluri and Weinberg, 2009; Craene and Berx, 2013).
  • the EMT process enables cancerous cells to depart from the primary tumour, invading surrounding stromal tissue and be disseminated to distant organs.
  • EMT has also been shown to confer efficient tumourigenicity to murine breast cancer cells by up-regulating their expression of the proangiogenic factor VEGF-A and increasing tumour angiogenesis (Fantozzi er a/., 2014).
  • EMT markers including vimentin, twist, ZEB1 , ZEB2, snail, slug and E-cadherin
  • CTCs circulating tumour cells
  • Tissue microarray studies also demonstrated that overexpression of vimentin was significantly associated with HCC metastasis (Hu et al., 2004). These observations demonstrated that EMT regulatory molecules may play critical roles in HCC progression. High EDIL3 expression was shown to associate with early HCC recurrence and a mesenchymal cell phenotype. In vitro studies demonstrated that EDIL3 is a novel regulator of EMT, migration, invasion and tumor angiogenesis in HCC cells. In vivo studies further validated that over-expression of EDIL3 in HCC cells promotes tumour growth, metastasis and angiogenesis. MiR-137 is involved in the upstream regulation of EDIL3, while EDIL3 over-expression regulates the TGF- ⁇ and ERK signalling pathways downstream through binding to ⁇ 3 integrin in HCC cells.
  • EDIL3 was cloned and characterized in 1998 (Hidai et a/., 1998).
  • the EDIL3 protein contains three EGF-like repeats homologous to those in Notch and related proteins, including an EGF-like repeat that contains an RGD motif and two discoidin l-like domains.
  • EDIL3 has been shown to be a matrix protein, to promote adhesion of endothelial cells through interaction with the ⁇ 3 integrin receptor, and to inhibit the formation of vascular-like structures.
  • EDIL3 is an endogenous leukocyte-endothelial adhesion inhibitor and limits the recruitment of inflammatory cells (Choi et a/., 2008) indicating that EDIL3 plays an important role in mediating angiogenesis and may be important in vessel wall remodelling and development (Hidai et a/., 1998).
  • Many human tumours have been reported to be dependent on angiogenesis for growth and development.
  • Human osteosarcoma cells and murine Lewis lung carcinoma cells engineered to express EDIL3 resulted in two- to four-fold increases in tumour volume (Aoka et a/., 2002).
  • EDIL3 Down- regulated of EDIL3 expression has also been shown to inhibit the growth of colon cancer cells (Zou et a/., 2008). Over-expression of EDIL3 accelerates tumour growth by enhancing vascular formation, thus suggesting that EDIL3 is a potential target for anti-angiogenic agents.
  • Tumour angiogenesis is a complex process that is regulated by many factors including vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF) and basic fibroblast growth factor (FGF) (Cameliet and Jain, 201 1 ). Inhibition of angiogenesis has been extensively studied as a potential therapeutic strategy for HCC.
  • the anti-angiogenic multi-kinase inhibitor sorafenib is the first and only FDA approved target therapy for advanced HCC, but the median survival rate remains unsatisfactory (Llovet et al., 2008). In this study, it was demonstrated that over-expression of EDIL3 increases the ability of HCC cells to promote migration and capillary tube formation by endothelial cells.
  • HCC is usually regarded as a highly vascular tumour
  • EDIL3 can provide an attractive potential target for the development of novel anti- angiogenic interventions in HCC.
  • TGF- ⁇ plays an important pro-tumorigenic role in HCC mainly by promoting angiogenesis and inducing EMT, invasion and metastasis (Neuzillet et al., 2014). Inhibition of TGF- ⁇ receptor I kinase has been shown to block HCC growth and angiogenesis (Mazzocca et al., 2009).
  • the ERK signalling has been shown to play important roles in the development of HCC and blocking ERK pathway has been demonstrated as a promising treatment for HCC (Liu et al., 2006). In this study, it was shown that blocking the TGF-beta and ERK signalling effectively inhibits EDIL3 mediated angiogenesis and invasion. Therefore, the combination inhibition of TGF- ⁇ and ERK signaling pathways may provide a promising targeted therapy for HCC cells with high EDIL3 expression.
  • a panel of early HCC recurrence-associated miRNAs have been identified by comparing the miRNA expression in samples of recurrent and non-recurrent human HCC tissue samples using microarrays (Xia et al., 2013).
  • EDIL3 expression was regulated by miR-137. Its expression was shown to be significantly down-regulated in HCC tissues compared to adjacent histologically normal liver samples and in HCC samples of patients with early recurrence compared to samples of non-recurrent disease. Therefore, restoring miR-137 expression in human HCC such as the introduction of synthetic miRNA mimics could offer appealing miRNA-based therapeutic strategies.
  • HCC hepatocellular carcinoma
  • EMT Epithelial-mesenchymal transition
  • EDIL3 was identified as a novel regulator of EMT.
  • the expression of EDIL3 was evaluated by quantitative PCR, western blotting or immunohistochemistry.
  • the effects of EDIL3 on the angiogenesis and metastasis of HCC cells were examined by wound healing, Matrigel invasion and tube formation assay in vivo and orthotopic xenograft mouse model of HCC in vivo.
  • the signalling pathways of EDIL3 mediated were investigated through microarray and western blotting analysis.
  • EDIL3 was identified as a novel regulator of EMT, which contributes to angiogenesis, metastasis and recurrence of HCC. EDIL3 induces EMT and promotes HCC migration, invasion and angiogenesis in vitro. Mechanistically, overexpression of EDIL3, which was regulated by downregulation of miR-137 in HCC, triggered the activation of ERK and TGF- ⁇ signaling through interactions with ⁇ ⁇ ⁇ 3 integrin. Blocking ERK and TGF- ⁇ signaling overcomes EDIL3 induced angiogenesis and invasion. Using the orthotopic xenograft mouse model of HCC, we demonstrated that EDIL3 enhanced the tumorigenic, metastatic and angiogenesis potential of HCC in vivo. Conclusions: EDIL3 mediated activation of TGF- ⁇ and ERK signalling could provide therapeutic implications for HCC.
  • Lamouille et al. (2014) Nature Reviews Molecular Cell Biology 15:178-196. Li et al., (2013) Cell death & disease 4:e831.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a method for profiling hepatocellular carcinoma comprising classifying EGF-like repeat and discoidin l-like domain protein 3 (EDIL3) gene expression level and/or EDIL3 protein activity in HCC compared to a control. The present invention also includes treating HCC with EDIL3 inhibitor(s), ERK inhibitor(s), and/or TGF-β inhibitor(s); particularly in subjects with high EDIL3 gene expression and/or EDIL3 protein activity.

Description

PROFILING OF HEPATOCELLULAR CARCINOMA AND APPLICATIONS THEREOF
Field of the invention
The present invention relates to the field of profiling (in particular molecular profiling) and/or therapy of tumour.
Background of the invention
Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer and one of the leading causes of cancer-related deaths worldwide. Population-based studies have shown that the incidence rate continues to approximate the death rate of HCC, indicating that most patients who develop HCC die of the disease (Maluccio and Covey, 2012). Some of the recognized risk factors associated with HCC include chronic infection with hepatitis B virus (HBV) or hepatitis C virus (HCV), excessive alcohol intake, exposure to aflatoxin and, more recently added, chronic lifestyle diseases such as diabetes and obesity (Sherman and Llovet, 2011 ). Despite recent advances in our understanding of the genetic landscape of HCC, the molecular mechanisms underlying hepatocarcinogenesis remain unclear and the prognoses for patients with advanced HCC remain dismal (Villaneuva and Llovet, 2014). Early recurrence, metastasis and angiogenesis are the major obstacles to improving the clinical outcome of these patients. It is therefore desirable to investigate targets that correlate with angiogenesis, recurrence and metastasis in HCC for developing novel therapeutic strategies to clinically manage HCC.
Summary of the invention According to a first aspect, the present invention provides a method for profiling a liver sample from a hepatocellular carcinoma subject comprising:
(i) determining EGF-like repeat and discoidin l-like domain protein 3 (EDIL3) gene expression level and/or EDIL3 protein activity in the sample;
(ii) comparing EDIL3 gene expression level and/or EDIL3 protein activity with EDIL3 gene expression level and/or EDIL3 protein activity, respectively, from at least one control; and
(iii) classifying the sample as either having higher, lower or equal EDIL3 gene expression levels and/or EDIL3 protein activity compared to the control.
According to another aspect, the present invention provides a method for monitoring a HCC subject comprising determining EDIL3 gene expression levels and/or EDIL3 protein activity of (a) at least one liver sample isolated from the subject at a first time point before the subject has been administered at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF-β inhibitor; and (b) at least one liver sample separately isolated from the subject at various subsequent time points after the subject has been administered the at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF-β inhibitor; wherein
(i) lower EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point compared to the first time point and/or a preceding subsequent time point, is indicative that the HCC subject is responding positively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF-β inhibitor;
(ii) higher EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point compared to the first time point and/or a preceding subsequent time point, is indicative that the HCC subject is responding negatively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- β inhibitor.
The present invention further provides a method for treating HCC in a subject comprising administering at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF-β inhibitor to the subject.
The present invention includes a method for treating HCC comprising:
(i) determining EDIL3 gene expression level and/or EDIL3 protein activity in a liver sample from a HCC subject;
(ii) comparing EDIL3 gene expression level and/or EDIL3 protein activity with EDIL3 gene expression level and/or EDIL3 protein activity, respectively from at least one control; and (iii) administering at least one EDIL3 inhibitor; at least one ERK inhibitor and/or at least one TGF-β inhibitor to a subject classified as having a higher EDIL3 gene expression level and/or EDIL3 protein activity compared to the control. The present invention further includes an EDIL3 inhibitor; an ERK inhibitor and/or a TGF-β inhibitor for use in treating HCC in a subject.
The present also includes the use of an EDIL3 inhibitor; an ERK inhibitor and/or a TGF-β inhibitor in the preparation of a medicament for treating HCC in a subject. Brief description of the figures
Figure 1. EDIL3 is significantly upregulated in HCC and associated with recurrence and patient survival. (A) The venn diagram of significantly different expressed genes among HCC tissues (T) vs matched normal tissues (MN), HCC with recurrence (R) vs non-recurrence (NR) and liver cancer cells with epithelial phenotype vs cells with mesenchymal phenotype. (B) Validation of EDIL3 expression in a cohort of patient samples (T-R: Tumor Recurrence, T- NR: Tumor Non-Recurrence, MN: Matched Normal and NN: histologically normal liver tissues) by RT-qPCR. (C and D) The expression of EDIL3 was significantly correlated with the expression of the mesenchymal marker vimentin (VIM) and epithelial marker E-cadherin (CDH1) in a group of HCC samples. (E) Representative imaging of IHC staining for validation of the expression of EDIL3 in another panel of HCC tumour tissues (100 χ). Up panel: H&E staining for the tumorous and non-tumorous parts. Down panel: IHC staining for the EDIL3 expression. (F) Imaging analysis and quantification of EDIL3 IHC staining. The IHC quantification was evaluated according to the percentage of cells with positive nuclei. (G) The expression of EDIL3 was associated with the disease- free survival of patients with HCC. The median expression value of EDIL3 was chosen as the cut-off point for survival analysis using the Kaplan-Meier method (*P=0.028). (H) The expression of EDIL3 in the plasma of HCC patients (n=40, 16R, 24NR) compared with normal individuals (n=20). Figure 2. EDIL3 is a novel regulator of EMT in HCC. (A) Expression of EDIL3 was studied in a panel of liver cancer cell lines by qRT-PCR. (B and C) Expression of EDIL3 was studied in a panel of liver cancer cell lines by western blotting and immunofluorescence analysis showed the location of EDIL3 in HLE cells (C). (D and E) The represent images of morphological change of HuH7- EDIL3 cells from an epithelial cobblestone phenotype to an elongated fibroblastic phenotype, indicative of EMT (D), or HLE-shEDIL3 cells from an elongated fibroblastic phenotype to an epithelial cobblestone phenotype, indicative of MET (E). (F) The expression of EDIL3 and the EMT markers E- cadherin and vimentin in HuH7 cells stably transfected with pLenti-hEDIL3. (G) The expression of EDIL3 and the EMT markers E-cadherin and vimentin in HLE cells stably transfected with shEDIL3. (H and I) The expression of the epithelial marker E-cadherin and the mesenchymal marker vimentin was further analysed in HuH7 and HLE transfected cells by confocal microscopy. The red signal represents staining for vimentin (upper panel) or E-cadherin (lower panel). Nuclear DNA was detected by staining with Hoechst 33342. Scale bar represents 50 μιη. Figure 3. The effects of EDIL3 on HCC cell migration and invasion in vitro. (A and B) Representative images of cell migration ability in stably transfected HuH7 and HLE cells evaluated by wound healing assay. Twenty four hours after wounding, cells with extended membrane protrusions moved into the wounded areas. The distance of migrated cells travelled in each treatment group is shown. (C and E) Representative images of stably transfected HuH7 (C) and HLE (E) cell invasion. (D and F) The invading cells were quantified by plotting them as the average number of cells per field of view from three different experiments as described.
Figure 4. EDIL3 promotes tumour angiogenesis of HCC in vitro. (A and E) Representative images of endothelial cell migration after incubation with conditioned media (CM) from stably transfected HuH7 and HLE cells using the endothelial recruitment assay. (B and F) Representative tube formation by ECs after incubation with conditioned media (CM) from stably transfected HuH7 and HLE cells using the tube formation assay. (C and G) Quantification of the numbers of migrating endothelial cells in different groups. (D and H) Quantification of the numbers of branchs in different groups, showing their tube forming ability. Figure 5. miR-137 is identified as an upstream regulator of EDIL3 and is downregulated in HCC samples. (A) The target sequences predicted by RNAhybrid 2.2 or TargetScan and mutations generated in the 3'-UTR of the EDIL3 mRNA are shown. (B) The overexpression of miR-137 was examined by qRT-PCR. (C) Effects of co-transfection of P-miR-137 with wild-type (wt) or mutant (mut) pGL3-EDIL3 constructs into HLE cells on luciferase reporter assays. Data were normalized by the ratio of Firefly and Renilla luciferase activities measured at 48 h post-transfection. The bar graph shows the meaniSD in three independent transfection experiments. *P<0.05. (D) Western blotting analysis of EDIL3 expression in P-miR-control- and P-miR-137- transfected HLE cells. (E) The inhibitory effects of miR-137 on HCC cell invasion and induction of tube formation. (F) Decreased expression of miR-137 in HCC associated with recurrence was observed in the HCC tissue samples. (G) The expression of EDIL3 was significantly correlated with the expression of miR-137 in a group of HCC samples based on the RT-qPCR analysis.
Figure 6. Overexpression of EDIL3 regulates TGF-beta and ERK signalling through binding to ανβ3 integrin. (A) A co-immunoprecipitation experiment detecting the interaction between EDIL3 and ανβ3 integrin. (B) The colocalization of EDIL3 and ανβ3 integrin in HCC cells. Bar represents 50μιη. (C) The production of TGF-βΙ was examined by ELISA and was shown significantly increased in both HuH7 and PLC/PRF/5 cells stable transfected with EDIL3. (D and E) The expression of EDIL3 was significantly correlated with the expression of Transforming growth factor beta-1 -induced transcript 1TGFB1 I1 (D) and TGFB2 (E) in the panel of liver cancer cells. (F and G) The expression of PEAK1 was shown to be consistent with the silencing or overexpression of EDIL3 by qRT- PCR. (H) The expression of EDIL3 was significantly correlated with the expression of PEAK1 in our establish HCC dataset. (I) The correlation expression of PEAK1 was validated in the HCC patients' samples by IHC staining (compared to the IHC staining results of EDIL3 in Figure.1 E). (J) Overexpression of EDIL3 significantly enhanced the expression of PEAK1 and induced increasing phosphorylation of SRC, ERK and Smad2 by western blotting analysis.
Figure 7. Blocking the TGF-beta and ERK signalling effectively inhibits EDIL3 mediated angiogenesis and invasion. (A) Western blotting analysis of the expression of p-ERK and p-Smad2 in DMSO- and VX-11e or LY2109761- treated HuH7-p-lenti-EDIL3 cells. GAPDH was used as a loading control. (B) Dose effect analysis of HuH7-p-lenti-EDIL3 cells exposed to VX-11e in the presence of DMSO or 2.5Mg/ml of LY2109761 as evaluated by MTS assays. (C and D) The colony formation assay showed that VX-11e treatment significantly decreased colony formation ability of HuH7-p-lenti-EDIL3 stable cells but not LY2109761 , while LY2109761 can sensitize the inhibition effect of VX-11 on colony formation. (E and F) The inhibition effect of VX-11e, LY2109761 or combination on EDIL3 overexpression HuH7-p-lenti-EDIL3 cell invasion ability. (G and H) The inhibition effect of VX-11 e, LY2109761 or combination on the EDIL3 overexpression HuH7-p-lenti-EDIL3 cells conditional medium enhanced HUVEC capillary tube formation.
Figure 8. Overexpression of EDIL3 promotes tumour metastasis and angiogenesis in vivo. (A) Representative bioluminescent signal images of orthotopic mouse xenograft model with injection of HuH7-p-lenti-EDIL3 cells and HuH7-p-lenti-control cells. (B) Quantitative analysis of bioluminescent imaging signals from all mice during each week is shown. (C) Representative images of the bioluminescence signal detected in the lung of mice injected with HuH7-p-lenti-EDIL3 and HuH7-p-lenti-control cells. (D) The expression of EDIL3, CD34, p-Smad2, p-SRC, PEAK and p-ERK1/2 in mice tumour tissues from HuH7-p-lenti-EDIL3 and HuH7-p-lenti-control group by IHC staining. (E) A schematic diagram has been put forward to summarize the possible regulatory roles of the downregulation of miR-137 and overexpression of EDIL3, which contribute to the EMT,metastasis, recurrence and angiogenesis in HCC. Figure 9. IHC studies of EDIL3, CD34, E-cadherin and Vimentin. (A and B) Double-IHC staining were performed using antibodies against the endothelial marker CD34 (brown staining) and EDIL3 (red staining). EDIL3 is expressed in some intratumoral endothelial cells (A). EDIL3 produced by tumoral cells promotes adjacent endothelial cell growth (B). (C) The represent immunohistochemistry staining images showed the correlation between EDIL3 and vimentin/E-Cadherin expression. Figure 10. (A and B) The expression of EDIL3 was shown significantly correlation with the expression of epithelial marker CDH1 and mesenchymal marker VIM expression in the microarray data of liver cancer cell lines. (C and D) The expression of EDIL3 in HuH7 cells with p-lenti-EDIL3 or p-lenti-control stable transfection (C) or HLE cells with EDIL3-shRNA or shRNA-control stable transfection (D). (E and F) Overexpression of EDIL3 significantly promoted the anchorage-independent growth. (G and H) Overexpression of EDIL3 increased cell viability (G) and decreased the anoikis rate of HCC cells (H).
Figure 11. The differently expressed genes in EDIL3 high and low liver cancer cells are mainly TGF-beta regulated genes. (A) The Ingenuity Pathway Analysis (IPA) showed that the differently expressed genes in EDIL3 high and low liver cancer cells are mainly TGF-beta regulated genes. (B) The hierarchical clustering analysis showed that the TGF-beta regulated genes differently expressed in EDIL3 high and low liver cancer cells can separate the EMT phenotype of liver cancer cells.
Figure 12. The significantly dysregulated genes between HLE-shEDIL3 and HLE-shControl cells was analyzed by Ingenuity Pathway Analysis (IPA) (A) and pathway construction (B).
Figure 13. Effects of ERK and TGF-beta inhibitors. (A and B) Dose effect analysis of HuH7-p-lenti-EDIL3 cells exposed to different dose of VX-11e (A) and LY2109761 (B) as evaluated by MTS assays. (C and D) The ERK inhibitor significantly inhibits proliferation of EDIL3 overexpression HCC cells. (E and F) The ERK inhibitor induces apoptosis of EDIL3 overexpression cells (E), while TGF-beta inhibitor is unable to blunt the apoptosis of EDIL3 overexpression cells (F). Definitions
As used herein, the term "comprising" or "including" is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. However, in context with the present disclosure, the term "comprising" or "including" also includes "consisting of. The variations of the word "comprising", such as "comprise" and "comprises", and "including", such as "include" and "includes", have correspondingly varied meanings.
A subject with HCC is one diagnosed with HCC based on the typical diagnostic criteria or symptoms for HCC.
A healthy individual not suffering from HCC is assessed as HCC negative based on the typical diagnostic criteria or symptoms for HCC.
A recurrence of HCC is defined as recurrence following the absence of HCC symptoms after therapy for HCC, for example after a curative resection. An early recurrence of HCC was defined as recurrence within 2 years following the absence of HCC symptoms after therapy for HCC, for example after a curative resection.
Abbreviations: HCC, hepatocellular carcinoma; EDIL3, EGF-like repeat and discoidin l-like domain-containing protein 3; DEL1 , Developmental Endothelial Locus-1 ; EDIL3 and Del-1 may be used interchangeably; ERK, Extracellular signal-regulated kinase; TGF-β (TGF-beta, TGFB), Transforming growth factor beta; TGFB1 I1 , transforming growth factor 1 induced transcript 1 ; IHC, immunohistochemistry; CTCs, circulating tumor cells; CFI, cancer-free interval; DMEM, Dulbecco's Modified Eagle's medium; HBV, hepatitis virus B; HCV, hepatitis virus C; RIPA radioimmunoprecipitation; RT-PCR, Reverse Transcription-Polymerase Chain Reaction; ELISA, enzyme-linked immunosorbent assay; SCID, severe combined immunodeficiency; TUNEL, Terminal deoxynucleotidyl transferase dUTP nick end labelling; MVD, microvessel density; BrdU, 5-Bromo-2'-deoxyuridine; IPA, Ingenuity Pathway Analysis.
Detailed description of the invention
Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference. According to a first aspect, the present invention provides a method for profiling a liver sample from a hepatocellular carcinoma subject comprising:
(i) determining EGF-like repeat and discoidin l-like domain protein 3 (EDIL3) gene expression level and/or EDIL3 protein activity in the sample; (ii) comparing EDIL3 gene expression level and/or EDIL3 protein activity with EDIL3 gene expression level and/or EDIL3 protein activity, respectively, from at least one control; and
(iii) classifying the sample as either having higher, lower or equal EDIL3 gene expression levels and/or EDIL3 protein activity compared to the control. According to another aspect, the present invention provides a method for monitoring a HCC subject comprising determining EDIL3 gene expression levels and/or EDIL3 protein activity of (a) at least one liver sample isolated from the subject at a first time point before the subject has been administered at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF-β inhibitor; and (b) at least one liver sample separately isolated from the subject at various subsequent time points after the subject has been administered the at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF-β inhibitor; wherein
(i) lower EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point compared to the first time point and/or a preceding subsequent time point, is indicative that the HCC subject is responding positively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF-β inhibitor;
(ii) higher EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point compared to the first time point and/or a preceding subsequent time point, is indicative that the HCC subject is responding negatively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- β inhibitor.
It will be appreciated that EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point is the same as the first time point and/or a preceding subsequent time point is indicative that the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- β inhibitor does not appear to have an effect on the subject. It will be further appreciated that the person skilled in the art would be able to set a criteria for the amount of difference between the compared time points to define if a subject is responding positive or negatively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF- β inhibitor; as appropriate.
The liver sample from the HCC subject may be diseased liver tissue from the subject. It will be appreciated that the disease liver tissue comprises transformed cells. It will be further appreciated that the liver sample may be isolated from a liver neoplasm. It will be appreciated that any suitable control may be used. Typically, the control comprises at least one normal tissue sample. A normal liver tissue sample may be from a healthy individual not suffering from HCC. A normal liver tissue sample may also be from non-diseased liver tissue from a subject with HCC. Non-diseased liver tissue refers to liver tissue with non-transformed cells. Typically, non-diseased liver tissue and/or cells can be easily distinguished from the HCC tissue, for example morphologically. It will be appreciated that non- diseased liver tissue and/or cells also do not show any manifestation of any other liver conditions, including but not limited to liver cirrhosis, hepatic steatosis and hepatitis, for example.
For the first aspect of the invention, it may also be informative to classify a liver sample from a HCC subject by comparing with a control also comprising at least one liver sample from at least one HCC subject rather than a normal liver tissue sample. For example, control HCC subjects may be diagnosed as early stage, intermediate state or advanced stage HCC. It would also be informative to compare with a subject with recurring HCC, for example early recurring HCC. It will be appreciated that if a subject has a higher EDIL3 gene expression level and/or EDIL3 protein activity than a control, the subject is likely to have a recurrence of HCC. It will be further appreciated that the higher the EDIL3 gene expression level and/or EDIL3 protein activity in a subject, the higher and/or the earlier recurrence of HCC in the subject. For example, if a first subject has a higher EDIL3 gene expression level and/or EDIL3 protein activity compared to a second subject, the first subject is likely to have a higher and/or earlier HCC recurrence than the second subject. It will also be appreciated that the same correlation for HCC recurrence applies if the first subject has a higher EDIL3 gene expression level and/or EDIL3 protein activity compared to a control than a second subject compared to the same control. It will be appreciated that the person skilled in the art would be able to determine a correlation between difference in EDIL3 gene expression levels and/or EDIL3 protein activity to HCC recurrence.
The method for profiling a liver sample from a HCC subject or the method for monitoring a HCC subject as described herein may be an in vitro method.
The present invention further provides a method for treating HCC in a subject comprising administering at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF-β inhibitor to the subject.
The present invention includes a method for treating HCC comprising:
(i) determining EDIL3 gene expression level and/or EDIL3 protein activity in a liver sample from a HCC subject;
(ii) comparing EDIL3 gene expression level and/or EDIL3 protein activity with EDIL3 gene expression level and/or EDIL3 protein activity, respectively from at least one control; and
(iii) administering at least one EDIL3 inhibitor; at least one ERK inhibitor and/or at least one TGF-β inhibitor to a subject classified as having a higher EDIL3 gene expression level and/or EDIL3 protein activity compared to the control.
It will be appreciated that for an applicable aspect of the invention, EDIL3 gene expression level(s) may be determined at the transcription and/or translation level(s).
Any suitable method may be employed for determining EDIL3 gene expression level(s) at the transcription level, including but not limited to Northern blot analysis, microarray analysis and/or reverse-transcription PCR. In particular, the reverse-transcription PCR may be quantitative reverse-transcription PCR (RT- qPCR).
Any suitable method may also be used to determine EDIL3 gene expression level(s) at the translation level, including but not limited to Western blot, immunohistochemistry (IHC) and/or enzyme-linked immunosorbent assay (ELISA). The present invention further includes an EDIL3 inhibitor, an ERK inhibitor and/or a TGF-β inhibitor for use in treating HCC in a subject.
The present also includes the use of an EDIL3 inhibitor, an ERK inhibitor and/or a TGF-β inhibitor in the preparation of a medicament for treating HCC in a subject. It will be appreciated that the EDIL3 inhibitor(s), ERK inhibitor(s) and TGF-β inhibitor(s) may be used separately or together.
If used separately, only EDIL3 inhibitor(s), ERK inhibitor(s) or TGF-β inhibitor(s) is to be used for the subject. For example, It will be appreciated that one or more EDIL3 inhibitors) may be used for the subject. If more than one EDIL3 inhibitor is used for the subject, a suitable number of different EDO inhibitors may be used together for sequential or simultaneous administration. A suitable number of different EDIL3 inhibitors may be mixed together (for example, in a single composition) for administration to the subject. It will be appreciated that the same applies with one or more ERK inhibitor(s), or one or more TGF-β inhibitor(s).
Any two or all three of the different inhibitor(s) may be used together. Any two or all three of EDIL3 inhibitor(s), ERK inhibitor(s) and TGF-β inhibitor(s) may be used in combination. Any two or all three of EDIL3 inhibitor(s), ERK inhibitor(s) and/or TGF-β inhibitors) may be used together for sequential or simultaneous administration. Any two or all three of EDIL3 inhibitor(s), ERK inhibitors) and/or TGF-β inhibitor(s) may be mixed together (for example, in a single composition) for administration to the subject.
Any suitable EDIL3 inhibitor is applicable for relevant aspects of the invention as described herein. The EDIL3 inhibitor may inhibit EDIL3 expression. For example, the EDIL3 inhibitor comprises at least one RNA interfering agent targeting EDIL3 gene expression. The RNA interfering agent may comprise a small interfering RNA (siRNA) or a microRNA (miRNA). For example, the miRNA includes but is not limited to miR-137. The sequence of miR-137 is:
GGTCCTCTGACTCTCTTCGGTGACGGGTATTCTTGGGTGGATAATACGGAT TACGTTGTTATTGCTTAAGAATACGCGTAGTCGAGGAGAGTACCAGCGGC
(SEQ ID NO: 1 ).
Alternatively, the EDIL3 inhibitor may inhibit EDIL3 protein activity. The EDIL3 inhibitor may be at least one antibody and/or a functional fragment thereof. The at least one antibody may be a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies. Monoclonal, chimeric and polyclonal antibodies may be produced by standard methods. A further example of an EDIL3 inhibitor includes a peptide.
Any suitable ERK inhibitor is applicable for relevant aspects of the invention as described herein. The ERK inhibitor may inhibit ERK1 and/or ERK2 gene expression. For example, the ERK inhibitor comprises at least one RNA interfering agent targeting ERK1 and/or ERK2 gene expression. The RNA interfering agent may comprise a small interfering RNA (siRNA) or a microRNA (miRNA).
Alternatively, the ERK inhibitor may inhibit ERK1 and/or ERK2 protein activity. The ERK inhibitor may be at least one antibody and/or a functional fragment thereof. The at least one antibody may be a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies. Monoclonal, chimeric and polyclonal antibodies may be produced by standard methods. A further example of an ERK inhibitor includes a peptide. For example, the ERK inhibitor includes but is not limited to 4-[2-(2-chloro-4-fluoroanilino)-5-methylpyrimidin-4-yl]-N-[(1S)-1-(3- chlorophenyl)-2-hydroxyethyl]-1 H-pyrrole-2-carboxamide (Vx-11 e).
Any suitable TGF-β inhibitor is applicable for relevant aspects of the invention as described herein. The TGF-β inhibitor may inhibit TGF-βΙ, TGF-fi2 and/or 7GF- ?3 gene expression. For example, the TGF-β inhibitor comprises at least one RNA interfering agent targeting TGF-J31, TGF- 2 and/or TGF-fi3 gene expression. The RNA interfering agent may comprise a small interfering RNA (siRNA) or a microRNA (miRNA).
Alternatively, the TGF-β inhibitor may inhibit TGF-βΙ, TGF^2 and/or TGF^3 protein activity. The TGF-β inhibitor may be at least one antibody and/or a functional fragment thereof. The at least one antibody may be a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies. Monoclonal, chimeric and polyclonal antibodies may be produced by standard methods. A further example of a TGF-β inhibitor includes a peptide. For example, the TGF-β inhibitor includes but is not limited to 4-[2-[4-(2-pyridin-2-yl-5,6-dihydro-4H- pyrrolo[1 ,2-b]pyrazol-3-yl)quinolin-7-yl]oxyethyl]morpholine (LY2109761 ). It will be appreciated that the present invention is suitable for personalised treatment, for example a subject is profiled for EDIL3 expression levels before administration of treatment of EDIL3 inhibitors), ERK inhibitor(s) and/or TGF-β inhibitors); and to assess response to the treatment. In particular, the treatment is for a subject with higher EDIL3 gene expression level and/or higher EDIL3 protein activity compared to at least one normal liver tissue subject. The subject may be profiled according to an applicable method described herein.
It will be appreciated that EDIL3 in a fluid sample (including but not limited to blood, serum, saliva, urine and tears) from a subject may also be applied to profile HCC.
Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.
Examples Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2012). MATERIALS AND METHODS
Human liver cancer tissue samples and cell lines
The collection of tumour and adjacent normal liver tissues from HCC patients was approved by the SingHealth Centralised Institutional Review Board (CIRB) and all tissues studied were provided by the SingHealth Tissue Repository (STR). Written informed consent was obtained from all participating patients and all clinical and histopathological data provided to the researchers were rendered anonymous. All human liver cancer cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% FBS, 100units/mL of penicillin and 100 g/mL of streptomycin (Invitrogen, Carlsbad, CA).
RNA extraction and microarray analysis
Total RNA from the tissue samples or cell lines was extracted using TRIzol reagent (Invitrogen). The quality and quantity of isolated total RNA were assessed using the Agilent 2100 Bioanalyzer and NanoDrop ND-1000 Spectrophotometer (Agilent, Santa Clara, CA, USA). mRNA microarray analysis was performed as described (Wang et a/., 2011 ; Xia et a/., 2013) using the Affymetrix Human Genome U133 plus 2.0 Arrays (Affymetrix, USA). Briefly, total RNA was processed for hybridization with GeneChip 3' IVT Express (Affymetrix, Santa Clara, USA), according to the manufacturers instruction. cDNA was synthesized from immunoprecipitated RNA using reverse transcriptase followed by second strand synthesis to generate double-stranded cDNA. An in vitro transcription reaction was used to generate biotinylated cRNA. After purification and fragmentation, cRNA was hybridized onto GeneChip Affymetrix Human Genome U133 Plus 2.0 arrays. Post-hybridization washes were performed on an Affymetrix GeneChip Fluidics Station 450. Arrays were scanned on an Affymetrix GeneChip Scanner 3000 and normalized using GCRMA in Partek software (Partek Incorporated. St. Louis, MO). Array quality control was performed using Affymetrix® Expression Console™. Signal intensities were transformed to log2 base and imported to Partek Genomics Suite software (Partek Inc., St. Louis, MO) to conduct statistical analyses. The microarray data have been deposited in the European Bioinformatics Institutes of the European Molecular Biology Laboratory database (http://www.ebi.ac.uk/array express/) and are accessible through ArrayExpress public database with accession numbers E-MEXP-84 and E-TABM-292 (Wang et a/., 201 1 ). RNA preparation, microarray analysis and qRT-PCR
Total RNA from the tissue samples or cell lines was extracted using TRIzol reagent (Invitrogen). The quality and quantity of the isolated total RNA was assessed using the Agilent 2100 Bioanalyzer and NanoDrop ND-1000 Spectrophotometer (Agilent, Santa Clara, CA, USA). The microarray analysis was performed as described (Wang et al., 201 1 ; Xia et al., 2013). The qRT- PCR was performed as described (Xia et al., 2013). For mRNA detection, the total RNA was reverse transcribed using the Superscript® VILO™ cDNA Synthesis Kit (Invitrogen, CA). The qPCR was performed using SsoFast™ EvaGreen® Supermix (Bio-Rad). For miRNA detection, the total RNA samples were polyadenylated and reverse transcribed for a two-step quantitative RT- PCR reaction using the NCode™ VILO™ miRNA cDNA Synthesis Kit and EXPRESS SYBR® GreenER™ miRNA qRT-PCR Kits (Invitrogen, CA) according to the manufacturer's instructions. The HPRT1 or U6 gene was used as an endogenous control, and fold changes were calculated via relative quantification (2"Δα) (Livak and Schmittgen, 2001 ).
Enzyme-linked immunosorbent assay (ELISA) The plasma EDIL3 concentration in 40 HCC, 20 hepatitis and 20 normal human control subjects was measured by enzyme-linked immunosorbent assay (ELISA) using a kit from USCN Life Science (Wuhan, China). The detection range was 0.313-20 ng/mL. The standard curve concentrations used for the ELISA were 20ng/mL, 10ng/mL, 5ng/mL, 2.5ng/mL, 1.25ng/mL, 0.625ng/mL and 0.313 ng/mL. The assay was performed in duplicate and the concentrations were calculated from a standard curve according to the manufacturer's instructions.
Western blotting and co-immunoprecipitation assays
These methods were performed as previously described (Xia et al., 2013). The protein concentrations were determined using the Bradford protein assay (Bio- Rad, Hercules, CA, USA). Heat-denatured protein samples (20 Mg per lane) were resolved by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to the nitrocellulose membrane using the iBIot® Dry blotting transfer system (Invitrogen, California, USA). The membrane was incubated for 2 h in PBS containing 0.1% Tween 20 and 5% skim milk to block nonspecific binding, followed by incubation for overnight at 4 °C temperature with a primary antibody, rabbit anti-EDIL3 (HPA020415, Sigma) (1 :20), rabbit anti-CD34 (ab81289) (1 :100), rabbit anti-PEAK1 (ab121869) (1 :100), Phospho-Src (Tyr416) (D49G4) rabbit and PhosphoPlus® p44/42 MAPK(ERK1/2) (Cell Signaling Technology, INC) (1 :100) or goat GAPDH (GenScript, NJ). The membrane was washed three times for 10 min in PBS with 0.1 % Tween 20 and then incubated for 1-2 h with the secondary antibody. The membrane was washed thoroughly in PBS containing 0.1% Tween20, and detected with Pierce ECL western blotting substrate (Pierce, Rockford, IL) according to the manufacturer's instructions. For co-immunoprecipitation assays, HEK 293T cells were co-transfected with the indicated combinations of plasmids expressing Flag-EDIL3 and ανβ3 integrin. Cell lysates were incubated with anti-Flag antibody (Sigma) and protein G Sepharose 4 fast flow beads, followed by western blotting using indicated antibodies. Anti-Flag antibody was used to immunoprecipitate (IP) Flag-EDIL3 from whole-cell extracts, followed by western blotting analyses using anti- ανβ3 integrin (top) and anti- EDIL3 (bottom) antibodies to detect ανβ3 integrin and EDIL3, respectively.
Immunofluorescence analysis The cells were seeded in the BD Falcon™ 8-well CultureSlide and incubated with primary antibodies, E-Cadherin (24E10) Rabbit mAb #3195, Vimentin (R28) Antibody #3932 (Cell Signaling Technology, Danvers, MA) or goat anti- EDO (sc-161035, Santa Cruz), and then incubated with Alexa Fluor® 594 goat anti-rabbit or mouse anti-goat IgG (Invitrogen). The Culture slides were counterstained with Hoechst 33342 and imaged with a confocal laser-scanning microscope (Carl Zeiss). Data were processed with Adobe Photoshop 7.0 software for analysis.
Immunohistochemistry (IHC) The paraffin-embedded tissue samples from consenting patients were cut in 5- pm sections and placed on polylysine coated slides; then the samples were deparaffinized in xylene and rehydrated using a series of graded alcohols. Antigen retrieval was performed by heat mediation in citrate buffer (pH 6) (Dako). Samples were blocked with 10% goat serum before incubating with primary antibody. The samples were incubated overnight using a primary antibody, rabbit anti-EDIL3 (HPA020415, Sigma) (1 :20), rabbit anti-CD34 (ab81289) (1 :100), rabbit anti-PEAK1 (ab121869) (1 :100), Phospho-Src (Tyr416) (D49G4) rabbit and PhosphoPlus® p44/42 MAPK(ERK1/2) (Cell Signaling Technology, INC) (1 :100) or an isotype-matched IgG as a negative control in a humidified container at 4 °C. Immunohistochemical staining was performed with the Dako Envision Plus System (Dako, Carpinteria, CA) according to the manufacturer's instructions. The intensity of staining was evaluated.
Establishment of stable HCC cell lines
One day before transfection, the HCC cells were seeded onto 6-well plates at approximately 80% confluence. The cells were transfected either with the p- lenti-EDIL3 or shEDIL3 or their control vectors using the Lipofectamine® LTX Reagent with PLUS™ Reagent (Life Technologies), or Gen Jet™ Plus DNA in- vitro tranfection reagent (SignaGen, MD), according to the manufacturer's instructions. After 48 h, the cells were subcultured to 10% confluence in a medium containing 1 pg/mL of puromycin (Sigma-Aldrich, St. Louis, MO). When all cells in the non-transfected control culture were killed, antibiotic-resistant clones were picked and passaged through the medium containing puromycin. The expression of EDIL3 was confirmed by qRT-PCR or western blotting as described. Wound healing assay
Culture and transfection conditions for HCC cells were optimized to ensure a homogeneous and viable cell monolayer prior to wounding. One day before transfection, equal numbers of HCC cells (5.0x104) were seeded into 24-well tissue culture plates without antibiotics. Cells were then transfected with 50 nM siEDIL3 and siControl using Lipofectamine RNAiMAX transfection reagent (Invitrogen), respectively. When the cell confluence reached about 90% at 48 h post-transfection, an artificial homogenous wound was created onto the monolayer with a sterile plastic 100 μΙ_ micropipette tip. After wounding, the debris was removed by washing the cells with serum-free medium. Migration of cells into the wound was observed at different time points. Cells that migrated into the wounded area or cells with extended protrusion from the border of the wound were visualized and photographed under an inverted microscope (40* objective) (Leica, Solms, Germany). A total of three areas were selected randomly from each well and the cells in three wells of each group were quantified in each experiment. In vitro Matrigel invasion assay
Cell invasiveness was assessed using BioCoat Matrigel invasion chambers (BD Biosciences, Bedford, MA). For this, 800 μΙ_ of the cell culture medium with 10% FBS was added to the lower chamber as a chemo-attractant. Then, the transfected cells were resuspended in 500 μΙ_ serum-free medium and seeded onto the rehydrated insert at 24 h after transfection. After another 24 h of incubation at 37 °C, any non-invading cells on the upper surface of the Matrigel membrane were gently removed using a cotton-tipped swab. The invaded cells were then fixed with 100% methanol and stained with 1 % toluidine blue. The stained invasive cells on the lower surface of the membrane were photographed under an inverted light microscope (*40) and quantified by manual counting in three randomly selected areas. This experiment was performed in duplicate in three independent experiments. HUVEC cells recruitment and endothelial tube formation Assay (In Vitro Angiogenesis)
For in vitro endothelial recruitment assays, 24-well Boyden chambers with 8-μιη pore size polycarbonate membranes (BD Biosciences, Bedford, MA) were used. HUVECs (5x104) were resuspended in 500 μΙ of serum free medium and seeded in the upper compartments of the chambers, and tumor cells were placed in the lower compartments in 800 μΙ of serum free medium. The co- cultured tumor cells were HLE or HuH7 non-transfected or transfected with shEDIL3 or p-EDIL3 or their controls for 24 h and refreshed with serum free medium before the recruitment experiments.
The endothelial tube formation assay was conducted using the Angiogenesis Starter Kit (Life technologies, Carlsbad, CA, USA) according to the protocol. Briefly, HUVEC cells were seeded at 2.5 χ 103 viable cells per cm2 in a culture dishes or flask using LVES-supplemented Medium 200. One day before performing the tube formation assay, place the vial containing the Geltrex® LDEV-Free Reduced Growth Factor Basement Membrane Matrix at 4 °C to thaw overnight. 0.1 mL of undiluted Geltrex® solution was added to each well of a 24-well plate (i.e., 50 iL of Geltrex® solution per cm2 growth surface). The coated plate was incubated at 37 °C for 30 minutes to allow the matrix to solidify. The HUVEC cells were collected and dilute the cells in supplemented Medium 200. The cells were seeded at a density of approximately 25,000 cells per cm2. Then the cells were treated with conditional medium of HCC cells with higher or low EDII3 and incubated overnight at 37°C in a humidified atmosphere of 5% C02. At 16 hours post-seeding, the cells were imaged at 4x magnification.
Luciferase reporter assay The potential targeting microRNAs EDIL3 were selected by bioinformatics analysis. The 3 -UTR sequence of EDIL3 predicted to interact with the microRNAs or a mutated sequence within the predicted target sites were synthesized and inserted into the Xbal and Fsel sites of pGL3 control vector (Promega, Madison, Wl). For reporter assay, HLE cells were plated onto 24- well plates and transfected with the above constructs and microRNA expression vectors using GenJet™ Plus DNA in vitro transfection reagent (SignaGen, MD). A Renilla luciferase vector pRL-SV50 (Promega, Madison, Wl) was also co- transfected to normalize the differences in transfection efficiency. After transfection for 48 h, cells were harvested and assayed with Dual-Luciferase Reporter Assay System (Promega, Madison, Wl) according to the manufacturer's instructions. This experiment was performed in duplicate in three independent experiments.
Cell viability assay
The cell viability was assessed by using MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetra zolium] assays (CellTiter 96 AQueous One Solution Cell Proliferation Assay; Promega). The CellTiter 96 aqueous one solution assay is a colorimetric method for determining the number of viable cells in proliferation or cytotoxicity assays. HuH7-p-lenti-EDIL3 cells were treated with VX-11e, a potent, selective, and orally bioavailable inhibitor of ERK (ChemieTek, Indianapolis, IN, USA), and LY2109761 , a selective TGF-β receptor type l/ll dual inhibitor (MedChemexpress, Shanghai, China) or combination. For the MTS assay, the CellTiter 96 aqueous one solution cell proliferation assay kit (Promega, Madison, Wl, USA) was used, following the manufacturer's instructions. Briefly, 20 pL of the MTS reagent was added into each well and the cells were incubated at 37 °C for around 2 h. The absorbance was detected at 490nm using a Wallac Victor 1420 Multilabel plate reader (PerkinElmer, San Diego, CA). Each experiment was repeated three times.
Soft agar colony assay
The established stable HCC cell lines (HuH7-p-lenti-control or HuH7-p-lenti- EDIL3) were mixed with tissue culture medium containing 0.6% low-melting- point agarose (Sigma Saint Louise, MO), resulting in a final agar concentration of 0.3%. Then, 500 μΙ_ of the cell suspension (800 cells) was immediately plated in 24-well plates coated with 500 pL 0.6% agar in tissue culture medium and cultured at 37°C with 5% CO2. The plates were kept in the incubator and the number of colonies formed was counted under an inverted light microscope (x40) after 2-3 weeks. The assay was analyzed in duplicate in three independent experiments. Anoikis assay
The established stable HCC cell lines (HuH7-p-lenti-control or HuH7-p-lenti- EDIL3) were seeding in the 96 well plates. Anoikis was induced by culturing cells in poly-HEMA coated plates. Briefly, poly-HEMA were prepared as a 10 mg/ml solution in ethanol, which covered completely the well of the plates, then dried and repeated once. The established stable HCC cell lines in serum-free medium were seeded into the coated plates for different time points. To avoid survival effects caused by the clumping of cells, 0.5% methyl cellulose (Sigma- Aldrich) was added into the medium. At the designated time points, the cells were collected and subjected to cell viability assays by MTS (Promega) and apoptosis assays by Caspase3/7 Glo kit (Promega) according to the protocols from the respective manufacturers.
Tumourigenicity in xenograft models in vivo
Stable transfected HCC cells were resuspended in PBS and implanted into the liver (1.5 * 106 cells per flank) of male BALB/c nude mice. Tumour growth was measured by bioluminescence imaging using the Xenogen MS Lumina system once a week (Xenogen Corporation, Hopkinton, MA). Briefly, following anaesthesia with 2% isoflurane, mice injected with D-Luciferin IP (150mg/kg; Caliper Life Sciences, Inc., Hopkinton, MA) received 10 s to 1 min scans to assess the bioluminescent signal. Mice were euthanized at the end of the experiment and the liver and lung were harvested, imaged and processed for histopathological examination. The statistical significance of the bioluminescent signal was evaluated using the Student's t-test. The liver tumours and lung were fixed in 10% neutral buffered formalin before processing into paraffin blocks and tissue section. Survival and statistical analysis
The experimental data are presented as the mean ± standard deviation (SD). All statistical analyses were performed using ANOVA or a two-tailed Student's t test (GraphPad Prism 5 or Partek Genomics Suite software). The survival curves were calculated using the Kaplan-Meier method. Differences were considered statistically significant when the P-values were less than 0.05.
RESULTS
EDIL3 is significantly up-regulated in in HCC samples of patients with early recurrent disease and poor survival
A global gene expression profile database of histologically normal liver tissues and tumour tissues of HCC patients with early recurrent disease using Affymetrix Human Genome U133 plus 2.0 arrays was established (Wang et ai, 2007). To facilitate the identification of novel early recurrence-related genes associated with EMT in HCC, we have analysed the expression profiles of samples of HCC patients with early recurrence ("early recurrence" has been defined as recurrent disease detected within a 2-year time duration after curative hepatic resection) in conjunction with the expression profiles of liver cancer cell lines with demonstrated epithelial or mesenchymal phenotype based on the expression of E-cadherin and Vimentin (Barretina et a/.,2012; Wang et al., 2007). A group of 23 genes which expression was modulated were shortlisted (Fig. 1A, Table 1 ).
Table 1 : The recurrence related factors associated with liver cancer EMT
Probeset Gene Tissues Tissues
ID Symbol Cells E/M p-value T7MN p-value R/NR p-value
205892_ _s_ at FABP1 321.112 5.83E-08 -4.76877 0.002446 -2.81406 0.005315
217073. X at APOA1 278.204 1.60E-08 -3.00381 0.004862 -2.42093 0.001791
206130_ _s_ at ASGR2 215.74 8.93E-08 -2.90318 2.62E-05 -1.75254 0.001827
204450. X at APOA1 150.763 1.28E-07 -2.98779 0.003278 -2.31261 0.001857
205305_ at FGL1 71.5661 7.49E-07 -4.53651 0.000178 -2.02758 0.013621
201131. _s_ at CDH1 61.6689 1.85E-05 -4.09243 8.20E-05 -1.94428 0.008775
214261. _s_ at ADH6 28.6754 1.99E-05 -3.32345 0.001606 -2.14764 0.005222
204836. at GLDC 23.1278 0.000207 -4.59857 1.93E-06 -1.76591 0.010998
219404. at EPS8L3 22.4279 1.73E-05 2.51384 0.012027 3.25371 1.46E-05
206410. at NR0B2 20.4081 6.60E-05 -4.77111 0.000119 -1.90357 0.025067
231693_ at FABP1 18.9185 2.48E-05 -6.43664 9.65E-07 -2.85702 9.74E-05
206010. _at HABP2 17.4994 0.000967 -3.90248 0.00173 -1.99084 0.026645
204105. _s_ at NRCAM 15.1314 0.004357 2.96786 0.023288 2.48833 0.008711
209301. at CA2 14.4219 0.006567 -4.3172 4.82E-08 -1.63586 0.00761
205075. at SERPINF2 13.8877 1.20E-05 -2.94873 0.000234 -1.97981 0.001201
226226. at TMEM45B 12.9808 0.000981 3.24193 0.011645 -3.35571 0.000386
207096_ at SAA4 12.3417 0.001999 -7.66929 5.79E-05 -2.74626 0.004956
221188_ _s_ at CIDEB 10.9909 2.91E-05 -2.88526 0.000129 -1.76436 0.003985
209035. at MDK 10.1909 0.001619 6.89864 5.57E-07 2.13439 0.004778
202949. _s_ at FHL2 -14.5221 0.000223 -3.20431 0.003639 -2.04242 0.013086
205896_ at SLC22A4 -20.947 7.39E-07 3.79246 2.82E-06 1.55641 0.025691
204595_ _s_ at STC1 -49.1167 4.06E-07 4.79205 1.51E-05 1.7038 0.035686
225275_ at EDIL3 -290.686 4.07E-07 2.78802 0.014523 1.53263 0.030912
Note: T: Tumor, MN: Matched Normal, R: Recurrence, NR: Non-Recurrence, E: epithelial, M: mesenchymal. Among these, the expression of EDIL3 was up-regulated in samples of early HCC recurrence compared to histologically normal tissues. By qRT-PCR analysis, it was further demonstrated that EDIL3 expression was more markedly increased in samples of HCC patients with early recurrent disease compared to samples of HCC patients with non-recurrent disease (Fig. 1 B). The patients' clinicopathological features in HCC and survival univariate and multivariate analyses are shown in the Table 2. Moreover, the expression of EDIL3 was shown to be significantly positive correlated with vimentin (VIM), a mesenchymal marker and negative correlated with E-cadherin (CDH1 ), an epithelial marker (Fig. 1 C and 1 D). The expression of EDIL3 was further studied in an independent cohort of 20 pairs of HCC tumour tissues (10 T-R and 10 T- NR) by IHC staining and EDIL3 protein expression was significantly increased in HCC tumour tissues (Fig. 1 E and 1 F).
Table 2: The patients' clinicopathological features in HCC and survival univariate and multivariate analyses
Figure imgf000036_0001
Figure imgf000037_0001
Since EDIL3 is known to be produced by endothelial cells, the double-staining immunohistochemistry was also used for the endothelial marker CD34 (brown staining) and EDIL3 (red staining). It was observed that EDIL3 is also expressed in some intratumoral endothelial cells (Fig. 9A). Interestingly, the results also indicated that EDIL3 produced by tumoral cells promote adjacent endothelial cell growth (Fig. 9B). The correlation between EDIL3 and Vimentin/E-Cadherin expression was also indicated by immunohistochemistry analysis (Fig. 9C). When the median EDIL3 expression was calculated for all the fifty HCC samples studied by qRT-PCR and used as the cut-off for Fisher's exact test and Kaplan-Meier analysis, it was demonstrated that high EDIL3 expression was significantly associated with a shorter overall survival (Fig. 1 G). Consistent with EDIL3 being a secreted glycoprotein, EDIL3 protein expression was also shown to be significantly higher in the plasma of HCC patients compared to normal individuals by ELISA analysis. It is also showed that the EDIL3 level is significantly higher in the HCC patients with early recurrence than the HCC patients without early recurrence, suggesting EDIL3 can be a potential non-invasive diagnostic biomarker for HCC with early recurrence (Fig. 1 H).
EDIL3 is a novel regulator of EMTin HCC Previously, it was established that epithelial liver cancer cells such as HepG2, Hp3B, HuH7 and PLC/PRF/5 had high E-cadherin (CDH1 ) and low vimentin (VIM) expression (Xia et al., 2013). In comparison, liver cancer cells with a mesenchymal phenotype such as HLE, SK-HEP-1 , SNU-449 and Mahlavu had low E-cadherin and high vimentin expression (Xia et al., 2013). When the expression of EDIL3 was studied with the same panel of liver cancer cell lines by qRT-PCR and western blotting, it was observed that EDIL3 expression was significantly higher in liver cancer cells with a mesenchymal phenotype than in the cells with an epithelial phenotype (Figs. 2A and 2B). Similar observations could be made using independent published microarray data for liver cancer cell lines (Barretina et al., 2012). EDIL3 expression was significantly correlated with expression of the mesenchymal marker VIM and inversely correlated with the epithelial marker CDH1 (Figs. 10A and 10B).
Next, epithelial HuH7 cells were stably transfected with either pLenti-EDIL3 or pLenti-control vector. The stable cells were tentatively designated as HuH7- EDIL3 or HuH7-control, respectively. The expression of EDIL3 in these cells was confirmed by qRT-PCR (Fig. 10C). Compared to pLenti-control-transfected cells, the up-regulation of EDIL3 was associated with dramatic morphological changes observed in the HuH7-EDIL3 cells: from an epithelial cobblestone phenotype to an elongated fibroblastic phenotype, which is indicative of EMT (Fig. 2C). The induction of EMT in the HuH7-EDIL3 cells was also associated with reduced E-cadherin and elevated vimentin expression (Figs. 2E and 2G). Similarly, HLE cells with a mesenchymal phenotype and high EDIL3 expression were used as the recipient cells for the transfection of EDIL3 shRNA. Following the silencing of EDIL3 (Fig. 10D), striking morphological changes consistent with those of the mesenchymal-to-epithelial transition (MET) were observed (Fig. 2D). The up-regulation of E-cadherin and reduced vimentin expression were also observed (Fig. 2F and 2H).
Effect of EDIL3 expression on HCC cell migration and invasion in vitro
EMT has been indicated as a key step in initiating cancer cell migration (Xia et a/., 2013). The migration potential of the HuH7-EDIL3 and HLE-shEDIL3 cells was studied using the wound healing assay. It was observed that stable overexpression of EDIL3 in the epithelial HuH7 cells significantly promoted cell migration (Fig. 3A) while stable knockdown of EDIL3 in the mesenchymal HLE cells significantly inhibited cell migration (Fig. 3B). Consistent with results of the wound healing assay, overexpression of EDIL3 in the HuH7-EDII_3 cells promoted invasion (Fig. 3C and 3D) and the repression of EDIL3 expression in the HLE-shEDIL3 cells reduced the number of cells invading the extracellular matrix gel (Fig. 3E and 3F). Meanwhile, the effects of EDIL3 modulation on proliferation and apoptosis of HCC cells using soft agar colony formation assay and anoikis assay were investigated. Anoikis is a form of apoptosis that is induced by anchorage-dependent cells detaching from the surrounding extracellular matrix (ECM) (Paoli et a/., 2013). The results showed that overexpression of EDIL3 significantly promoted the anchorage-independent growth (Fig. 10E and 10F) and decreased the anoikis rate of HCC cells (Fig. 10G and 10H), suggesting that EDIL3 affects cell proliferation and apoptosis. Taken together, these data indicated that EDIL3 played an important role in regulating HCC cell migration and invasion. EDIL3 enhances recruitment of endothelial cells and promotes capillary tube formation in vitro
Angiogenesis is a key early step in the cancer invasion-metastasis cascade. EDIL3, being a glycoprotein secreted by endothelial cells, is likely to be involved in tumour angiogenesis. The role of EDIL3 in HCC angiogenesis by in vitro endothelial recruitment and capillary tube formation assays using stably transfected HuH7 and HLE cells with different EDIL3 expression was studied. In the presence of HLE cells with high EDIL3 expression, HUVECs migrated more efficiently through the transwell pores compared to those grown in the absence of tumour cells conditioned medium (NC) or in the presence of HLE-shEDIL3 cells with low EDIL3 expression. The knockdown of EDIL3 expression could significantly suppress the effects of HLE cells on HUVEC migration (Fig. 4A and 4C). Furthermore, cell-conditioned medium of EDIL3-high HLE cells compared to the absence of tumour cells conditioned medium (NC) promoted the HUVECs to develop more capillary-like structures. Tube formation was reduced dramatically in HUVECs that were grown in conditioned medium from HLE- shEDIL3 cells (Fig. 4B and 4D). In contrast, the overexpression of EDIL3 in HuH7 cells enhanced HUVEC migration (Fig. 4E and 4G) and capillary tube formation (Fig. 4F and 4H). These data suggested that high EDIL3 expression in HCC cells can promote endothelial cells migration and tumour angiogenesis in vitro. miR-137 is a critical upstream regulator of EDIL3 To identify the potential upstream miRNA regulator of EDIL3, miRecords (that has incorporated ten miRNA target prediction algorithms; Xiao et ai, 2009) was employed to predict miRNAs that could be the potential regulators of EDIL3 (Table 3).
Table 3: Predicted targeting miRNAs of EDIL3 miRNA ID A B c E E F G H I J K hsa-miR-137 0 0 0 1 0 0 1 1 0 1 1 hsa-miR-548d-3p 0 0 1 1 0 0 0 1 0 1 1 hsa-miR-496 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-548b-5p 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-220c 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-135b 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-338-5p 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-548c-5p 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-374a 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-380 0 0 1 1 0 0 0 1 0 0 1 hsa-miR-217 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-509-3-5p 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-425 0 0 0 1 0 0 0 1 0 1 1 hsa-miR-509-5p 0 0 1 1 0 0 0 1 0 1 0 hsa-miR-548a-3p 0 0 0 1 0 0 0 1 0 1 1 hsa-miR-557 0 0 0 1 0 0 0 1 0 1 1 hsa-miR-508-3p 0 0 0 1 0 0 0 1 0 1 1 hsa-miR-203 0 0 1 0 0 0 0 1 0 1 1 hsa-miR-607 0 0 1 0 0 0 0 1 0 1 1
Note: A: Diana, B: Microinspector, C: Miranda, D: Mirtarget2, E: Mitarget, F: Nbmirtar, G: Pictar, H: Pita, I: Rna22, J: Rnahybrid, K: targetscan. 1 means "predicted" and 0 means "not predicted". # "1 ": interaction predicted; "0": interaction not predicted.
Using the luciferase reporter assay, it was validated that EDIL3 could potentially be regulated by miR-137. A sequence containing the predicted 3 -UTR target site of the EDIL3 mRNA and its mutated sequence was then cloned into the pGL3 luciferase reporter gene to generate pGL3-EDIL3-3'UTR-wt and pGL3- EDIL3-3'UTR-mut vector respectively (Fig. 5A). These vectors were co- transfected into the HLE cells together with either the p-miR-137 vector or the p- miR-control vector. A Renilla luciferase vector (pRL-TK) was used to normalize the differences in transfection efficiency. The over-expression of miR-137 was validated by RT-qPCR (Fig. 5B). Luciferase activity in HLE cells co-transfected with either the p-miR-137 or the pGL3-EDIL3-3'UTR-wt vector was significantly decreased compared to the control (Fig. 5C). Over-expression of miR-137 decreased EDIL3 protein expression in HLE cells (Fig. 5D) and significantly inhibited HLE cell invasion and induced endothelial cell capillary tube formation (Fig. 5E). MiR-137 expression was significantly down-regulated in tumor tissues of HCC patients when compared to adjacent histologically normal liver tissues and miR-137 expression was significantly down-regulated in tumor samples of HCC patients with early recurrent disease compared to samples of patients with non-recurrent disease (Fig. 5F). The decreased expression of miR-137 also significantly correlated with increased expression of EDIL3 in HCC samples (Fig. 5G). Therefore, overexpression of EDIL3 was correlated with downregulation of miR-137 in HCC and miR-137 is a critical upstream regulator of EDIL3. EDIL3 regulates TGF-beta and ERK signalling through binding to ανβ3 integrin
EDIL3 was initially reported to be a new ligand for the ανβ3 integrin receptor regulating embryonic vascular morphogenesis and remodelling (Hidai et a/., 1998; Rezaee et a/., 2002). Co-immunoprecipitation experiments demonstrated that EDIL3 could be specifically co-precipitated with the ανβ3 integrin (Fig. 6A), demonstrating that EDIL3 and ανβ3 integrin physically interacted with each other. Next, immunofluorescence analysis demonstrated that EDIL3 and ανβ3 integrin co-localized in HLE cells (Fig. 6B). Recent studies showed that ανβ3 integrin promotes latent TGF-3-activation by human cardiac fibroblast contraction (Sarrazy et al., 2014). We then examined whether the over- expression of EDIL3 could promote the increase production of TGF-βΙ in liver cancer cells and observed that the production of TGF-βΙ was significantly increased in both HuH7 and PLC/PRF/5 cells stably transfected with EDIL3 (Fig. 6C). Interestingly, using data reported in the Cancer Cell Line Encyclopedia (CCLE) dataset (http://www.broadinstitute.org/ccle) (Barretina et al., 2012), the group of liver cancer cells with EDIL3 high expression (array signal intensity > log26) and EDIL3 low expression (array signal intensity < log26) were compared and many TGF-3-regulated genes that were also differentially expressed (>10 fold) between £D/L3-high expressing and EDIL3- low expressing liver cancer cells by Ingenuity Pathway Analysis (I PA) were identified (Table 4 and Fig. 1 1 A).
Table 4: The TGF-beta regulated genes are differently expressed in EDIL3 high and low liver cancer cells.
Genes symbol Fold Change (EDIL3 high vs EDIL3 low)
WNT5B 17.431
WNT5A 10.346
VCAN 1
TNC 66.878
THBS1 10.786
TGFB1I1 37.985
SNAI2 10.645
SERPINE2 1 1.382
SERPINA1 -48.047
SCG5 1 1.881
S100A6 1 1.282 RUNX2 15.204
POSTN 25.67
PMEPA1 39.904
PLAU 18.617
NNMT 29.413
MYO10 19.656
MMP2 17.352
MGP 13.989
LOXL2 20.89
LOXL1 23.48
ITGA3 27.913
INHBA 21.931
IL13RA2 15.076
IGFBP7 10.655
HTRA1 23.08
HNF4A -27.392
GREM1 18.976
FZD2 17.277
FGF5 11.572
FGF2 12.419
ETS1 18.307
EPS8L3 -11.326
EPHB2 15.127
COL8A1 31.362
COL6A3 42.534
COL6A2 12.36
COL6A1 17.088
COL5A1 29.594
COL4A1 15.284
COL1A2 16.94
COL1A1 34.552
CNN1 12.936
CEACAMl -10.403
CDH1 -31.205
CDC42EP3 45.164
CA V2 13.612 CAV1 21.192
BDNF 18.492
AXL 22.164
ASGR2 -62.766
ALB -51.149
AFP -26.645
TGFB2 1 1.039
RHOU -10.128
PROM1 -13.188
MMP1 13.266
MITF 11.245
IL17RB -15.099
IL15 11.182
IGFBP5 10.7
IF U 6 96.043
GDF15 -10.234
FHL1 22.1 13
CEBPA -17.574
CD44 73.001
CCL20 -67.479
CBR3 1 1.112
ASS1 -10.019
APOB -201.289
C5 -21.267
DPYSL3 12.934
FXYD5 21.186
GFPT2 11.001
GPRC5A 10.989
ID4 -1 1.18
IFIT3 10.595
LSR -1 1.06
MTHFD2 -12.631
MYOF 10.935
NFIB 10.322
PAPPA 24.936
PLK2 14.753 PTX3 23.1 1 1
RBMS3 24.84
ROR1 16.498
Hierarchical clustering analysis further showed that these differentially expressed genes could also discriminate cells with the epithelial or mesenchymal phenotype (Fig. 1 1 B). Among these differentially expressed genes, expression of TGFB1I1 and TGFB2 showed significant correlation with the expression level of EDIL3 in the panel of liver cancer cells, Pearson r = 0.67, r = 0.68, respectively (Figs. 6D and 6E). These data suggested that over- expression of EDIL3 can regulate TGF-β signalling through binding to ανβ3 integrin in liver cancer cells.
To further explore the molecular mechanisms and downstream signal pathways of EDIL3 in HCC cells, microarray and bioinformatics analysis to identify the genes that are differentially expressed between HLE-shEDIL3 and HLE- shControl cells was also performed. Among the dysregulated genes, pseudopodium-enriched atypical kinase 1 (PEAK1) was significantly down- regulated in the HLE-shEDIL3 cells. Furthermore, knockdown of EDIL3 in HLE and Mahlavu cells significantly decreased the expression of PEAK1 , while overexpression of EDIL3 in HuH7 and PLC/PRF/5 cells increased the expression of PEAK1 (Figs. 6F and 6G). Moreover, EDIL3 expression was found to be significantly correlated with PEAK1 expression in HCC patient tumor samples (Fig. 6H) and was further validated by IHC staining with another 20 cases of HCC tissue samples (Fig. 6I). Next, the PEAKi-associated regulatory signalling pathways involved with the over-expression of EDIL3 in HCC cells were deciphered. Ingenuity pathway analysis (IPA) showed that EDIL3 could interact with PEAK1 through the SRC family kinases (Figs. 12A and 12B). Fig. 6J further demonstrated that the over-expression of EDIL3 not only significantly enhanced the expression of PEAK1 but also induced the phosphorylation of SRC, ERK and Smad2, suggesting the activation of ERK and TGF-β signaling. These data further suggest that over-expression of EDIL3 also activates ERK signalling which has been shown to be strongly associated with tumour angiogenesis and metastasis. Blocking the TGF-beta and ERK signalling effectively inhibits EDIL3 mediated angiogenesis and invasion
Since both TGF-beta and ERK signaling have been shown to be activated by overexpression of EDIL3, the effects of TGF-beta and ERK signaling inhibitors on the established EDIL3 overexpression HCC cells were investigated next. When HuH7-p-lenti-EDIL3 stable cells were treated with VX-1 1 e (I pg/ml; ChemieTek, Indianapolis, IN, USA), a potent, selective, and orally bioavailable inhibitor of ERK, or LY2109761 (1 g/ml; MedChemexpress, Shanghai, China), a selective TGF-β receptor type l/ll dual inhibitor, strong inhibition of p-ERK and p-Smad2 expression in the HuH7-p-lenti-EDIL3 stable cells was detected (Fig. 7A). The MTS results showed that the cell viability was inhibited with the increasing dose of VX-11e but not LY2109761 and EDIL3 overexpression HuH7-p-lenti-EDIL3 cell is more sensitive to VX-1 1 e treatment (Fig. 13A and 13B). The ERK inhibitor also significantly inhibits proliferation (Fig. 13C and 13D) and induces apoptosis (Fig. 13E) of EDIL3 overexpression cells, while TGF-beta inhibitor is unable to blunt the apoptosis of EDIL3 overexpressing cells (Fig. 13F). To determine if blocking the TGF-β pathway would sensitize the EDIL3 overexpressing HuH7-p-lenti-EDIL3 cell to VX-1 1 e, the effect of the presence or absence of LY2109761 (2.5 g/ml) on the sensitivity of HuH7-p- lenti-EDIL3 cells to VX-1 1 e was examined. Interestingly, the results showed that the presence of LY2109761 (2^g/ml) did not significantly inhibit cell growth but was sufficient to sensitize the EDIL3 overexpressing HuH7-p-lenti- EDIL3 cell to VX-1 1 e (Fig. 7B). The colony formation assay showed that VX- 1 1 e treatment significantly decreased colony formation ability of HuH7-p-lenti- EDIL3 stable cells and LY2109761 can sensitize this effect (Fig. 7C and 7D). Blocking the TGF-beta and ERK signalling was also shown significant inhibition effect on EDIL3 overexpression HuH7-p-lenti-EDIL3 cell invasion ability (Fig. 7E and 7F) and the HuH7-p-lenti-EDIL3 cells conditional medium enhanced HUVEC capillary tube formation (Fig. 7G and 7H), suggesting that blocking the TGF-beta and ERK signalling effectively inhibits EDIL3-mediated angiogenesis and invasion, which provide a promising therapeutic potential for the treatment of HCC with overexpression of EDIL3. Overexpression of EDIL3 promotes tumour metastasis and angiogenesis in vivo
To correlate our observations in vivo, HuH7-pLenti-EDIL3 and HuH7-pLenti- control cells with luciferase were orthotopically implanted into nude mice. The results indicated that stable overexpression of EDIL3 in the HuH7 cells significantly promoted tumour growth (Fig. 8A and 8B). In addition, lung tissues harvested from mice at the end of the experiments inoculated with the HuH7- pLenti-EDIL3 cells gave prominent bioluminescent signals, indicating the presence of lung metastasis. On the other hand, no lung bioluminescent signal was detected in mice inoculated with HuH7-pLent-control cells (Fig. 8C). IHC staining further demonstrated the significant overexpression of EDIL3 in tumour tissues induced by HuH7-pLenti-EDIL3 cells compared to HuH7-pLenti-control cells (Fig. 8D). Tumour tissues harvested from mice implanted with the HuH7- pLenti-EDIL3 cells also showed a significantly higher CD34 expression compared to tumour tissues implanted with the HuH7-p-lenti-control cells, thus indicating that overexpression of EDIL3 promoted tumour angiogenesis of HCC in vivo (Fig. 8D). Increased expression of PEAK1 and phosphorylation of Smad2, SRC and ERK were also observed in tumour tissues harvested from mice implanted with HuH7-p-lenti-EDIL3 cells (Fig. 8D), further suggesting that overexpression of EDIL3 activated the TGF-beta and ERK signalling. A schematic diagram has been put forward to summarize the possible regulatory circuitry that governs EDIL3 contributing to EMT, metastasis/invasion, early recurrence and angiogenesis in HCC (Fig. 8E). DISCUSSION
The epithelial-mesenchymal transition (EMT) is a key step in cancer recurrence and metastasis by which epithelial cells lose their cell polarity and cell-cell adhesion, and gain migratory and invasive properties to become mesenchymal cells (Lamouile et al., 2014; Kalluri and Weinberg, 2009; Craene and Berx, 2013). The EMT process enables cancerous cells to depart from the primary tumour, invading surrounding stromal tissue and be disseminated to distant organs. EMT has also been shown to confer efficient tumourigenicity to murine breast cancer cells by up-regulating their expression of the proangiogenic factor VEGF-A and increasing tumour angiogenesis (Fantozzi er a/., 2014).
The expression of EMT markers, including vimentin, twist, ZEB1 , ZEB2, snail, slug and E-cadherin, has been investigated in primary HCC tumours, adjacent non-tumoural liver tissues and circulating tumour cells (CTCs) in HCC patients (Yang et al., 2009; Li et al., 2013). It has been reported that a decreased expression of E-cadherin in HCC patients significantly reduced the cancer-free interval (CFI) and induced a more aggressive phenotype (Gianelli, 2009). Moreover, overexpression of Snail and Twist has been associated with the down-regulation of E-cadherin and reduced overall survival (Yang et al., 2009). Tissue microarray studies also demonstrated that overexpression of vimentin was significantly associated with HCC metastasis (Hu et al., 2004). These observations demonstrated that EMT regulatory molecules may play critical roles in HCC progression. High EDIL3 expression was shown to associate with early HCC recurrence and a mesenchymal cell phenotype. In vitro studies demonstrated that EDIL3 is a novel regulator of EMT, migration, invasion and tumor angiogenesis in HCC cells. In vivo studies further validated that over-expression of EDIL3 in HCC cells promotes tumour growth, metastasis and angiogenesis. MiR-137 is involved in the upstream regulation of EDIL3, while EDIL3 over-expression regulates the TGF-β and ERK signalling pathways downstream through binding to ανβ3 integrin in HCC cells.
EDIL3 was cloned and characterized in 1998 (Hidai et a/., 1998). The EDIL3 protein contains three EGF-like repeats homologous to those in Notch and related proteins, including an EGF-like repeat that contains an RGD motif and two discoidin l-like domains. EDIL3 has been shown to be a matrix protein, to promote adhesion of endothelial cells through interaction with the ανβ3 integrin receptor, and to inhibit the formation of vascular-like structures. Previous studies also showed that EDIL3 is an endogenous leukocyte-endothelial adhesion inhibitor and limits the recruitment of inflammatory cells (Choi et a/., 2008) indicating that EDIL3 plays an important role in mediating angiogenesis and may be important in vessel wall remodelling and development (Hidai et a/., 1998). Many human tumours have been reported to be dependent on angiogenesis for growth and development. Human osteosarcoma cells and murine Lewis lung carcinoma cells engineered to express EDIL3 resulted in two- to four-fold increases in tumour volume (Aoka et a/., 2002). Down- regulated of EDIL3 expression has also been shown to inhibit the growth of colon cancer cells (Zou et a/., 2008). Over-expression of EDIL3 accelerates tumour growth by enhancing vascular formation, thus suggesting that EDIL3 is a potential target for anti-angiogenic agents.
Tumour angiogenesis is a complex process that is regulated by many factors including vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF) and basic fibroblast growth factor (FGF) (Cameliet and Jain, 201 1 ). Inhibition of angiogenesis has been extensively studied as a potential therapeutic strategy for HCC. The anti-angiogenic multi-kinase inhibitor sorafenib is the first and only FDA approved target therapy for advanced HCC, but the median survival rate remains unsatisfactory (Llovet et al., 2008). In this study, it was demonstrated that over-expression of EDIL3 increases the ability of HCC cells to promote migration and capillary tube formation by endothelial cells. Since HCC is usually regarded as a highly vascular tumour, thus EDIL3 can provide an attractive potential target for the development of novel anti- angiogenic interventions in HCC. Although previous studies indicated that EDIL3 is over-expressed in HCC and high expression level of EDIL3 in HCC is associated with poor prognosis, the molecular roles of EDIL3 in HCC has not been well investigated (Luo et al., 2006; Sun et al., 2010; Feng et al., 2014).
In this study, it was found that EDIL3 overexpression triggers activate the TGF- β and ERK signaling pathway through interactions with ανβ3 integrin. These results provide important evidence for the development of novel treatment strategies targeting EDIL3 or downstream TGF-β and ERK signaling pathways for the management of HCC. TGF-β plays an important pro-tumorigenic role in HCC mainly by promoting angiogenesis and inducing EMT, invasion and metastasis (Neuzillet et al., 2014). Inhibition of TGF-β receptor I kinase has been shown to block HCC growth and angiogenesis (Mazzocca et al., 2009). The ERK signalling has been shown to play important roles in the development of HCC and blocking ERK pathway has been demonstrated as a promising treatment for HCC (Liu et al., 2006). In this study, it was shown that blocking the TGF-beta and ERK signalling effectively inhibits EDIL3 mediated angiogenesis and invasion. Therefore, the combination inhibition of TGF-β and ERK signaling pathways may provide a promising targeted therapy for HCC cells with high EDIL3 expression. Previously, a panel of early HCC recurrence-associated miRNAs,, have been identified by comparing the miRNA expression in samples of recurrent and non-recurrent human HCC tissue samples using microarrays (Xia et al., 2013). In this study, it was further demonstrated that EDIL3 expression was regulated by miR-137. Its expression was shown to be significantly down-regulated in HCC tissues compared to adjacent histologically normal liver samples and in HCC samples of patients with early recurrence compared to samples of non-recurrent disease. Therefore, restoring miR-137 expression in human HCC such as the introduction of synthetic miRNA mimics could offer appealing miRNA-based therapeutic strategies. SUMMARY OF EXAMPLE
Background & Aims: Patients with advanced hepatocellular carcinoma (HCC) continue to have a dismal prognosis. Early recurrence, metastases and angiogenesis are the major obstacles to improve the outcome of HCC. Epithelial-mesenchymal transition (EMT) is a key contributor to cancer metastasis and recurrence, which are the major obstacles to improve prognosis of HCC.
Methods: Combining gene expression profile of HCC samples with or without early recurrence and established cell lines with epithelial or mesenchymal phenotype, EDIL3 was identified as a novel regulator of EMT. The expression of EDIL3 was evaluated by quantitative PCR, western blotting or immunohistochemistry. The effects of EDIL3 on the angiogenesis and metastasis of HCC cells were examined by wound healing, Matrigel invasion and tube formation assay in vivo and orthotopic xenograft mouse model of HCC in vivo. The signalling pathways of EDIL3 mediated were investigated through microarray and western blotting analysis.
Results: EDIL3 was identified as a novel regulator of EMT, which contributes to angiogenesis, metastasis and recurrence of HCC. EDIL3 induces EMT and promotes HCC migration, invasion and angiogenesis in vitro. Mechanistically, overexpression of EDIL3, which was regulated by downregulation of miR-137 in HCC, triggered the activation of ERK and TGF-β signaling through interactions with ανβ3 integrin. Blocking ERK and TGF-β signaling overcomes EDIL3 induced angiogenesis and invasion. Using the orthotopic xenograft mouse model of HCC, we demonstrated that EDIL3 enhanced the tumorigenic, metastatic and angiogenesis potential of HCC in vivo. Conclusions: EDIL3 mediated activation of TGF-β and ERK signalling could provide therapeutic implications for HCC.
References
Any listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that such document is part of the state of the art or is common general knowledge. Aoka et a/., (2002) Microvascular Research 64:148-161.
Barretina er a/., (2012) Nature 483:603-607.
Carmeliet and Jain (201 1 ) Nature 473:298-307.
Choi et al., (2008) Science 322:1 101-4.
Craene and Berx (2013) Nature Reviews Cancer 13:97-1 10.
Fantozzi et al., (2014). Cancer Research 74(5): 1566-75.
Feng et al., (2014) Molecular Cancer 13:226.
Giannelli (2009) Hepatology 50:1344-1346.
Hidai et al., (1998) Genes & Development 12:21-33.
Hu et al., (2004) Oncogene 23:298-302.
Kalluri and Weinberg (2009) The Journal of Clinical Investigation 1 19:1420- 1428.
Lamouille et al., (2014) Nature Reviews Molecular Cell Biology 15:178-196. Li et al., (2013) Cell death & disease 4:e831.
Liu et al., (2006) Cancer Research 66:1 1851 -11858.
Livak and Schmittgen (2001 ) Methods 25:402-408.
Llovet et al., (2008) New England Journal of Medicine 359:378-390.
Luo et al., (2006) Hepatology 44:1012-1024.
Maluccio and Covey (2012) CA: A Cancer Journal for Clinicians 62:394-399. Mazzocca et al., (2009) Hepatology 50:1140-1151 .
Neuzillet et al., (2014) Oncotarget 5:78. Paoli et al., (2013) Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1833:3481-3498.
Rezaee et al., (2002) Circulatory Physiology 282:H1924-H1932.
Sarrazy et al., (2014) Cardiovascular Research 102:407-417.
Sherman and Llovet (2011 ) Journal of National Cancer Institute 103:1642-1643. Sun et al., (2010) World Journal of Gastroenterology 16:4611.
Villanueva and Llovet (2014). Nature Reviews Clinical Oncology 11(2):73-4. Wang et ai, (2007) Clinical Cancer Research 13:6275-6283.
Wang et al., (2011 ) Clinical Cancer Research 17:6040-6051.
Xia et ai, (2013) Hepatology 58:629-641.
Xiao et ai, (2009) Nucleic Acids Research 37:D105-110.
Yang et ai, (2009) Hepatology 50:1464-1474.
Zou et ai, (2008) Journal of Biomedical Science 16:33.

Claims

Claims
1 . A method for profiling a liver sample from a hepatocellular carcinoma subject comprising:
(i) determining EGF-like repeat and discoidin l-like domain protein 3 (EDIL3) gene expression level and/or EDIL3 protein activity in the sample;
(ii) comparing EDIL3 gene expression level and/or EDIL3 protein activity with EDIL3 gene expression level and/or EDIL3 protein activity, respectively from at least one control; and
(iii) classifying the sample as either having higher, lower or equal EDIL3 gene expression levels and/or EDIL3 protein activity compared to the control.
2. A method for treating HCC comprising:
(i) determining EDIL3 gene expression level and/or EDIL3 protein activity in a liver sample from a HCC subject;
(ii) comparing EDIL3 gene expression level and/or EDIL3 protein activity with EDIL3 gene expression level and/or EDIL3 protein activity, respectively from at least one control; and
(iii) administering at least one EDIL3 inhibitor; at least one ERK inhibitor and/or at least one TGF-β inhibitor to a subject classified as having a higher EDIL3 gene expression level and/or EDIL3 protein activity compared to the control.
3. The method according to claim 1 or 2, wherein the liver sample is taken from a liver neoplasm.
4. The method according to any one of the preceding claims, wherein the control comprises at least one normal liver tissue sample.
5. The method according to claim 4 as dependent on claim 1 or both claims 1 and 3, further comprising identifying a subject with higher EDIL3 gene expression level and/or EDIL3 protein activity than the control as likely to have a recurrence of HCC.
6. A method for monitoring a HCC subject comprising determining EDIL3 gene expression levels and/or EDIL3 protein activity of (a) at least one liver sample isolated from the subject at a first time point before the subject has been administered at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF-β inhibitor; and (b) at least one liver sample separately isolated from the subject at various subsequent time points after the subject has been administered the at least one EDIL3 inhibitor, at least one ERK inhibitor and/or at least one TGF-β inhibitor; wherein (i) lower EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point compared to the first time point and/or a preceding subsequent time point, is indicative that the HCC subject is responding positively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF-β inhibitor;
(ii) higher EDIL3 gene expression level and/or EDIL3 protein activity at a subsequent time point compared to the first time point and/or a preceding subsequent time point, is indicative that the HCC subject is responding negatively to the at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF-β inhibitor.
7. The method according to any one of the preceding claims wherein determining EDIL3 expression level(s) is at the transcription and/or translation level(s).
8. The method according to claim 7, wherein determining the EDIL3 gene expression level(s) at the transcription level comprises Northern blot analysis, microarray analysis and/or reverse-transcription PCR.
9. The method according to claim 7, wherein determining the EDIL3 gene expression level(s) at the translation level comprises Western blot, immunohistochemistry (IHC) and/or enzyme-linked immunosorbent assay (ELISA).
10. The method according to any one of claim 1 and its dependent claims 3 to 5 and 7 to 9; and claim 6 and its dependent claims 7 to 9, wherein the method comprises an in vitro method.
11. A method for treating HCC in a subject comprising administering at least one EDIL3 inhibitor, at least one ERK inhibitor, and/or at least one TGF-β inhibitor to the subject.
The method according to any one of claim 2 and its dependent claims 3 to 4 and 7 to 10; claim 6 and its dependent claims 7 to 10; and claim 11 , wherein said at least one EDIL3 inhibitor inhibits EDIL3 gene expression and/or inhibits EDIL3 protein activity.
The method according to claim 12, wherein said at least one EDIL3 inhibitor inhibiting EDIL3 gene expression comprises at least one RNA interfering agent targeting EDIL3 mRNA.
14. The method according to claim 13, wherein said at least one RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
15. The method according to claim 14, wherein said miRNA comprises SEQ ID NO: 1 (miR-137).
16. The method according to claim 12, wherein said at least one EDIL3 inhibitor inhibits EDIL3 protein activity.
17. The method according to claim 1 1 , 12 or 16 wherein said at least one EDIL3 inhibitor comprises at least one antibody and/or a functional fragment thereof.
18. The method according to claim 17, wherein at least one said antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
19. The method according to any one of claim 2 and its dependent claims 3 to 4 and 7 to 10; claim 6 and its dependent claims 7 to 10; and claim 1 1 , wherein said at least one ERK inhibitor inhibits ERK1 and/or ERK2 gene expression; and/or inhibits ERK1 and/or ERK2 protein activity.
20. The method according to claim 19, wherein said at least one ERK inhibitor inhibiting ERK1 and/or ERK2 gene expression comprises at least one RNA interfering agent targeting ERK1 and/or ERK2 mRNA.
21. The method according to claim 20, wherein said at least one RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
22. The method according to claim 19, wherein said at least one ERK inhibitor inhibits ERK1 and/or ERK2 protein activity.
23. The method according to claim 11 , 19 or 22, wherein said at least one ERK inhibitor comprises at least one antibody and/or a functional fragment thereof.
24. The method according to claim 23, wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
25. The method according to any one of claim 2 and its dependent claims 3 to 4 and 7 to 10; claim 6 and its dependent claims 7 to 10 and claim 11 , wherein said at least one TGF-β inhibitor inhibits TGF-βΙ, TGF-fi2 and/or TGF- 3 gene expression; and/or inhibits TGF-βΙ , TGF-p2 and/or TGF-p3 protein activity.
26. The method according to claim 25, wherein said at least one TGF-β inhibitor inhibiting TGF-βΙ, TGF-βΙ and/or TGF-P3 gene expression comprises at least one RNA interfering agent targeting TGF-βΙ, TGF-fi2 and/or TGF- 3 mRNA.
27. The method according to claim 26, wherein said at least one RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA). 28. The method according to claim 25, wherein said at least one TGF-β inhibitor inhibits TGF-βΙ , TGF- 2 and/or TGF- 3 protein activity.
29. The method according to claim 11 , 25 or 28, wherein said TGF-β inhibitor comprises at least one antibody and/or a functional fragment thereof.
30. The method according to claim 29, wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies. 31. An EDIL3 inhibitor, an ERK inhibitor and/or a TGF-β inhibitor for use in treating HCC in a subject. The EDIL3 inhibitor for the use according to claim 31 , wherein said EDIL3 inhibitor inhibits EDIL3 gene expression and/or inhibits EDIL3 protein activity.
The EDIL3 inhibitor for the use according to claim 32, wherein said EDIL3 inhibitor inhibiting EDIL3 gene expression comprises at least one RNA interfering agent targeting EDIL3 mRNA.
The EDIL3 inhibitor for the use according to claim 33, wherein said RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
The EDIL3 inhibitor for the use according to claim 34, wherein said miRNA comprises SEQ ID NO: 1 (miR-137).
The EDIL3 inhibitor for the use according to claim 32, wherein said EDIL3 inhibitor inhibits EDIL3 protein activity.
The EDIL3 inhibitor for the use according to claim 31 , 32 or 36, wherein said EDIL3 inhibitor comprises at least one antibody and/or a functional fragment thereof. The EDIL3 inhibitor for the use according to claim 37, wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
The ERK inhibitor for the use according to claim 31 , wherein said ERK inhibitor inhibits ERK1 and/or ERK2 gene expression; and/or inhibits ERK1 and/or ERK2 protein activity.
The ERK inhibitor for the use according to claim 39, wherein said ERK inhibitor inhibiting ERK1 and/or ERK2 gene expression comprises at least one RNA interfering agent targeting ERK1 and/or ERK2 mRNA.
The ERK inhibitor for the use according to claim 40, wherein said RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
42. The ERK inhibitor for the use according to claim 39, wherein said ERK inhibitor inhibits ERK1 and/or ERK2 protein activity.
The ERK inhibitor for the use according to claim 31 , 39 or 42, wherein said ERK inhibitor comprises at least one antibody and/or a functional fragment thereof.
44. The ERK inhibitor for the use according to claim 43, wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
45. The TGF-β inhibitor for the use according to claim 31 , wherein said TGF- β inhibitor inhibits TGF-βΙ, TGF-fi2 and/or TGF-ββ gene expression and/or inhibits TGF-βΙ, TGF- 2 and/or TGF- 3 protein activity.
46. The TGF-β inhibitor for the use according to claim 45, wherein said TGF- β inhibitor inhibiting TGF-βΙ, TGF-P2 and/or 7GF- 73 gene expression comprises at least one RNA interfering agent targeting TGF-βΙ, TGF-fi2 and/or TGF-fi3 mRNA.
47. The TGF-β inhibitor for the use according to claim 46, wherein said RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
48. The TGF-β inhibitor for the use according to claim 45, wherein said TGF- β inhibitor inhibits TGF-βΙ , TGF^2 and/or TGF^3 protein activity.
49. The TGF-β inhibitor for the use according to claim 31 , 45 or 48, wherein said TGF-β inhibitor comprises at least one antibody and/or a functional fragment thereof.
50. The TGF-β inhibitor for the use according to claim 49, wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
51. The EDIL3 inhibitor, ERK inhibitor, and/or TGF-β inhibitor for the use according to any one of claims 31 to 50, wherein an isolated liver sample from the subject has higher EDIL3 gene expression levels and/or higher EDIL3 protein activity compared to at least one normal liver tissue sample.
52. The EDIL3 inhibitor, ERK inhibitor and/or TGF-β inhibitor for the use according to claim 51 , wherein the subject is profiled according to the method of claim 1 and its dependent claims 3-5 and 7-10.
53. Use of an EDIL3 inhibitor, an ERK inhibitor and/or a TGF-β inhibitor in the preparation of a medicament for treating HCC in a subject.
54. Use according to claim 53, wherein said EDIL3 inhibitor inhibits EDIL3 gene expression and/or inhibits EDIL3 protein activity.
55. Use according to claim 54, wherein said EDIL3 inhibitor inhibiting EDIL3 gene expression comprises at least one RNA interfering agent targeting EDIL3 mRNA.
56. Use according to claim 55, wherein said RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
57. Use according to claim 56, wherein said miRNA comprises SEQ ID NO:
1 (miR-137).
58. Use according to claim 53, wherein said EDIL3 inhibitor inhibits EDO protein activity.
59. Use according to claim 53, 54 or 58, wherein said EDIL3 inhibitor comprises at least one antibody and/or a functional fragment thereof.
60. Use according to claim 59, wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies. Use according to claim 53, wherein said ERK inhibitor inhibits ERK1 and/or ERK2 gene expression; and/or inhibits ERK1 and/or ERK2 protein activity.
Use according to claim 61 , wherein said ERK inhibitor inhibiting ERK1 and/or ERK2 gene expression comprises at least one RNA interfering agent targeting ERK1 and/or ERK2 mRNA.
Use according to claim 62, wherein said RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
Use according to claim 61 , wherein said ERK inhibitor inhibits ERK1 and/or ERK2 protein activity.
Use according to claim 53, 61 or 64, wherein said ERK inhibitor comprises at least one antibody and/or a functional fragment thereof.
Use according to claim 65, wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
67. Use according to claim 53, wherein said TGF-β inhibitor inhibits TGF-βΙ, TGF-P2 and/or TGF- 3 gene expression and/or inhibits TGF-βΙ , TGF-p2 and/or TGF- 3 protein activity.
68. Use according to claim 67, wherein said TGF-β inhibitor inhibiting TGF- β1, TGF-βΙ and/or 7GF- 73 gene expression comprises at least one RNA interfering agent targeting TGF-βΙ, TGF-fi2 and/or TGF-β} mRNA.
69. Use according to claim 68, wherein said RNA interfering agent comprises at least one small interfering RNA (siRNA) and/or at least one microRNA (miRNA).
70. Use according to claim 53, wherein said TGF-β inhibitor inhibits TGF- β1, TGF^2 and/or TGF^3 protein activity.
71. Use according to claim 53, 67 or 70, wherein said TGF-β inhibitor comprises at least one antibody and/or a functional fragment thereof.
72. Use according to claim 71 , wherein said at least one antibody comprises a monoclonal antibody, a chimeric antibody and/or polyclonal antibodies.
73. Use according to any one of claims 53 to 72, wherein a liver sample from the subject has higher EDIL3 gene expression levels and/or higher EDIL3 protein activity compared to at least one normal liver tissue sample.
74. Use according to claim 73, wherein the subject is profiled according to the method of claim 1 and its dependent claims 3-5 and 7-10.
PCT/SG2016/050221 2015-05-13 2016-05-12 Profiling of hepatocellular carcinoma and applications thereof Ceased WO2016182513A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG10201503769V 2015-05-13
SG10201503769V 2015-05-13

Publications (1)

Publication Number Publication Date
WO2016182513A1 true WO2016182513A1 (en) 2016-11-17

Family

ID=57249281

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2016/050221 Ceased WO2016182513A1 (en) 2015-05-13 2016-05-12 Profiling of hepatocellular carcinoma and applications thereof

Country Status (1)

Country Link
WO (1) WO2016182513A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112662774A (en) * 2021-01-12 2021-04-16 南方医科大学南方医院 Liver cancer circulating tumor cell marker and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005084712A2 (en) * 2004-02-27 2005-09-15 Antisense Pharma Gmbh Use of an oligonucleotide or its active derivative for the preparation of a pharmaceutical composition for inhibiting the formation of metastases in cancer treatment
US7041801B1 (en) * 1995-06-07 2006-05-09 Vanderbilt University Antibodies binding to polypeptides encoded by developmentally-regulated endothelial cell locus-1
WO2012021383A2 (en) * 2010-08-10 2012-02-16 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF MITOGEN-ACTIVATED PROTEIN KINASE 1 (MAPK1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2014081954A1 (en) * 2012-11-21 2014-05-30 Janssen Biotech, Inc. BISPECIFIC EGFR/c-Met ANTIBODIES

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7041801B1 (en) * 1995-06-07 2006-05-09 Vanderbilt University Antibodies binding to polypeptides encoded by developmentally-regulated endothelial cell locus-1
WO2005084712A2 (en) * 2004-02-27 2005-09-15 Antisense Pharma Gmbh Use of an oligonucleotide or its active derivative for the preparation of a pharmaceutical composition for inhibiting the formation of metastases in cancer treatment
WO2012021383A2 (en) * 2010-08-10 2012-02-16 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF MITOGEN-ACTIVATED PROTEIN KINASE 1 (MAPK1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2014081954A1 (en) * 2012-11-21 2014-05-30 Janssen Biotech, Inc. BISPECIFIC EGFR/c-Met ANTIBODIES

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
FENG, M.-X. ET AL.: "Elevated autocrine EDIL3 protects hepatocellular carcinoma from anoikis through RGD-mediated integrin activation", MOLECULAR CANCER, vol. 13, no. 226, 2014, XP021201136 *
GIANNELLI, G. ET AL.: "Inhibiting TGF-β signaling in hepatocellular carcinoma", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1815, no. 2, 2011, pages 214 - 223, XP028177025 *
LIU, L.-L. ET AL.: "FoxD3-regulated microRNA-137 suppresses tumour growth and metastasis in human hepatocellular carcinoma by targeting AKT2", ONCOTARGET, vol. 5, no. 13, 2014, pages 5113 - 5124, XP055331285 *
LUO. J.-H. ET AL.: "Transcriptomic and Genomic Analysis of Human Hepatocellular Carcinomas and Hepatoblastomas", HEPATOLOGY, vol. 44, no. 4, 2006, pages 1012 - 1024, XP055085794 *
SUN, J.-C. ET AL.: "High expression level of EDIL3 in HCC predicts poor prognosis of HCC patients", WORLD JOURNAL OF GASTROENTEROLOGY, vol. 16, no. 36, 2010, pages 4611 - 4615, XP055331283 *
XIA, H. ET AL.: "EDIL3 is a novel regulator of epithelial-mesenchymal transition controlling early recurrence of hepatocellular carcinoma", JOURNAL OF HEPATOLOGY, vol. 63, no. 4, October 2015 (2015-10-01), pages 863 - 873, XP055331309 *
XIA, H. P. ET AL.: "Translational study for liver carcinogenesis and developing personalized targeted treatment", JOURNAL OF GASTROENTEROLOGY AND HEPATOLOGY, vol. 30, no. Suppl. 4, December 2015 (2015-12-01), pages 333, XP055331313 *
ZOU, X. ET AL.: "Downregulation of developmentally regulated endothelial cell locus- 1 inhibits the growth of colon cancer", JOURNAL OF BIOMEDICAL SCIENCE, vol. 16, no. 33, 2009, XP021047149 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112662774A (en) * 2021-01-12 2021-04-16 南方医科大学南方医院 Liver cancer circulating tumor cell marker and application thereof

Similar Documents

Publication Publication Date Title
Zhan et al. Circular RNA hsa_circRNA_103809 promoted hepatocellular carcinoma development by regulating miR‐377‐3p/FGFR1/ERK axis
Nan et al. Tumor-stroma TGF-β1-THBS2 feedback circuit drives pancreatic ductal adenocarcinoma progression via integrin αvβ3/CD36-mediated activation of the MAPK pathway
Fan et al. miR-210 transferred by lung cancer cell-derived exosomes may act as proangiogenic factor in cancer-associated fibroblasts by modulating JAK2/STAT3 pathway
Xia et al. EDIL3 is a novel regulator of epithelial-mesenchymal transition controlling early recurrence of hepatocellular carcinoma
Paterson et al. Down-regulation of the miRNA-200 family at the invasive front of colorectal cancers with degraded basement membrane indicates EMT is involved in cancer progression
Dai et al. Colorectal cancer cell–derived exosomes containing miR-10b regulate fibroblast cells via the PI3K/Akt pathway
Yoo et al. miR-181b-3p promotes epithelial–mesenchymal transition in breast cancer cells through Snail stabilization by directly targeting YWHAG
Ding et al. RETRACTED ARTICLE: Long non-coding RNA TPTEP1 inhibits hepatocellular carcinoma progression by suppressing STAT3 phosphorylation
Li et al. Interferon alpha-inducible protein 27 promotes epithelial–mesenchymal transition and induces ovarian tumorigenicity and stemness
Ji et al. GPR56 promotes proliferation of colorectal cancer cells and enhances metastasis via epithelial-mesenchymal transition through PI3K/AKT signaling activation
Wang et al. Amphiregulin enhances VEGF-A production in human chondrosarcoma cells and promotes angiogenesis by inhibiting miR-206 via FAK/c-Src/PKCδ pathway
Wan et al. MiR-25-3p promotes malignant phenotypes of retinoblastoma by regulating PTEN/Akt pathway
Leng et al. Overexpression of microRNA-29b inhibits epithelial-mesenchymal transition and angiogenesis of colorectal cancer through the ETV4/ERK/EGFR axis
Cao et al. hsa_circ_0003410 promotes hepatocellular carcinoma progression by increasing the ratio of M2/M1 macrophages through the miR‐139‐3p/CCL5 axis
You et al. Cervical cancer-derived exosomal miR-663b promotes angiogenesis by inhibiting vinculin expression in vascular endothelial cells
Niu et al. HBX suppresses PTEN to promote the malignant progression of hepatocellular carcinoma through mi-R155 activation
Gong et al. CircDCAF8 promotes the progression of hepatocellular carcinoma through miR-217/NAP1L1 Axis, and induces angiogenesis and regorafenib resistance via exosome-mediated transfer
Wu et al. Hypoxia derived exosomes promote the proliferation and metastasis of colorectal cancer through the regulation of HIF-1α/miR-4299/ZBTB4
Li et al. Regulation of tumorigenesis and metastasis of hepatocellular carcinoma tumor endothelial cells by microRNA-3178 and underlying mechanism
Wang et al. Targeting MEX3A attenuates metastasis of breast cancer via β-catenin signaling pathway inhibition
Shao et al. The emerging roles of circular RNAs in vessel co-option and vasculogenic mimicry: clinical insights for anti-angiogenic therapy in cancers
Gao et al. PURα mediates epithelial-mesenchymal transition to promote esophageal squamous cell carcinoma progression by regulating Snail2
Tao et al. Circular RNA circCPA4 promotes tumorigenesis by regulating miR‐214‐3p/TGIF2 in lung cancer
Wang et al. ADAR1 affects gastric cancer cell metastasis and reverses cisplatin resistance through AZIN1
Li et al. Long non‑coding RNA AFAP1‑AS1 facilitates the growth and invasiveness of oral squamous cell carcinoma by regulating the miR‑145/HOXA1 axis Retraction in/10.3892/or. 2022.8306

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16793098

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16793098

Country of ref document: EP

Kind code of ref document: A1