WO2016179254A1 - Methods of diagnosing and treating breast cancer - Google Patents

Methods of diagnosing and treating breast cancer Download PDF

Info

Publication number
WO2016179254A1
WO2016179254A1 PCT/US2016/030730 US2016030730W WO2016179254A1 WO 2016179254 A1 WO2016179254 A1 WO 2016179254A1 US 2016030730 W US2016030730 W US 2016030730W WO 2016179254 A1 WO2016179254 A1 WO 2016179254A1
Authority
WO
WIPO (PCT)
Prior art keywords
loop
level
subject
biological sample
brcal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/030730
Other languages
French (fr)
Inventor
Rong Li
Xiaowen Zhang
Huai-chin CHIANG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Texas System
University of Texas at Austin
Original Assignee
University of Texas System
University of Texas at Austin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Texas System, University of Texas at Austin filed Critical University of Texas System
Priority to US15/571,819 priority Critical patent/US20180346989A1/en
Publication of WO2016179254A1 publication Critical patent/WO2016179254A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57515Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • BRCA1 and BRCA2 Women carrying germ-line mutations of BRCA1 and BRCA2 have significantly increased risk of developing breast and ovarian cancers. Both BRCA1 and BRCA2 play roles in reducing R-loops, a DNA-RNA hybrid structure and by-product of transcription. It is well known that individuals with one mutated germ-line BRCA allele are at an increased risk for developing breast cancer. However, there is no available method to pre-screen individuals in the general population who may harbor deleterious BRCA mutations and/or have elevated risk of developing breast cancer. The use of the association of BRCAl/2 mutation carriers and elevated R-loop signals could be a useful tool for diagnosing individuals with a risk of developing breast cancer.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRC A mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the subject is a BRCA mutation carrier.
  • the BRCA mutation carrier is a BRCA1 or BRCA2 mutation carrier.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the non-BRCA mutation carrier is a subject having two wild type copies of the BRCA gene.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay includes an ELISPOT assay, ELISA, fluorescent immunoassays, two-antibody sandwich assays, a flow- through or strip test
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRC A mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, the hybridization assay is carried out with an R- loop antibody.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the sample comprises one or more of tissue, blood, bone marrow, plasma, serum, urine, and feces. In some instances, the sample comprises breast tissue. In some instances,
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, further comprising administering to said subject a therapeutically effective amount of a given therapeutic.
  • Disclosed are methods for treating breast cancer in a subject comprising administering to said subject a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps of a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
  • Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCA1 mutation carrier.
  • Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCA1 mutation carrier, wherein the treatment is increasing expression and/or activity of RNase H, which degrades the RNA component in the R-loop structure, or decreasing COBRAl expression and/or activity.
  • Disclosed are methods of reducing tumor incidence in BRCA1 -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity.
  • Disclosed are methods of reducing tumor incidence in BRCA1 -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity, wherein the treatment comprises siRNA that targets Cobral mRNA.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCA1 activity.
  • RNA can target BRCA1 mRNA.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes.
  • puberty-related genes are Gata3, Prlr, Ramp2, Vwf, Prom2, Acotl, or a combination thereof.
  • Other puberty-related genes include, but are not limited to, those genes listed in Figure 19.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the estrogen-responsive genes are 2410081M15RIK, 6430706D22RIK, ACOT1, ACTB, ARL4A, BCL6B, CTSH, CXCL9, EMCN, GBP 6, GGTA1 , HOXA7, PABPC1, PDLIM1, PDLIM2, PROM2, PTPN14, SLC02B1 , STARD10, TMEM2, WIPI1, or a combination thereof.
  • the estrogen-responsive genes are 2410081M15RIK, 6430706D22RIK, ACOT1, ACTB, ARL4A, BCL6B, CTSH, CXCL9, EMCN, GBP 6, GGTA1 , HOXA7, PABPC1, PDLIM1, PDLIM2, PROM2, PT
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the progesterone-responsive genes are 5730593F 17RIK, CCDC80, CDH13, CLDN5, CRYZ, EDNl , IRXl , NOXOl, PKP2, PRKCDBP, PSEN2, SLC7A3, SPNB3, or a combination thereof.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that increases transcription.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that decreases transcription.
  • FIGS 1A, IB, and 1C show that DKO rescues ductal developmental defect in CKO.
  • (a) Whole mounts of mammary glands from 8-wk virgin mice. The boundary of the ductal area is highlighted. Scale bars: 1 mm. Images are representatives of at least 6 animals.
  • (c) Flow cytometry analysis of various mammary gland compartments from 16-wk virgin mice.
  • Stromal cells CD49f-EpCAM-, luminal epithelial cells: CD49fmedEpCAMhigh, myoepithelial cells: CD49fhighEpCAMmed.
  • the numbers of animals used are: WT (4), BKO (3), CKO (3), and DKO (4). * P ⁇ 0.05, ** P ⁇ 0.01 by Student's t-test. Statistical analysis was conducted between CKO and WT, and between DKO and CKO. Error bars represent standard error of the mean (s.e.m).
  • Figures 2A, 2B, 2C, and 2D show that DKO rescues alveolar and lactogenic defects associated with CKO and BKO.
  • (a-b) Whole mounts of mammary glands one day postpartum. Scale bar: 1 mm in (a), and 500 ⁇ in (b).
  • H&E Hematoxylin and eosin
  • Scale bar 100 ⁇ .
  • (d) Immunohistochemistry for total milk proteins in mammary glands of mice one day postpartum. Scale bar: 50 ⁇ . Images in this figure are representatives of at least 4 animals in each genotype.
  • FIGS 3A, 3B, and 3C show aberrant pubertal gene expression in CKO is partially rescued in DKO.
  • FIG. 4A, 4B, and 4C show that Cobral deletion reduces mammary tumor incidence and abundance of luminal progenitor cells in BKO.
  • FIGS 5A, 5B, 5C, 5D, and 5E show that Cobral deletion does not rescue DSB repair deficiency in DKO.
  • FIGS. 6A, 6B, 6C, and 6D show that COBRAl contributes to R loop accumulation in BKO.
  • RNAPII ChlP-seq Average reads per million for RNAPII ChlP-seq, NELF-A ChlP-seq, NELF-B/COBRA1 ChlP-seq, and DRIP- seq surrounding the TSS regions in mammary epithelial cells. Reads from two biological repeats were merged for RNAPII ChlP-seq and DRIP-seq.
  • Figures 7A, 7B, and 7C show elevated R-loop signal in normal breast tissue from BRCAl mutation carriers, (a) Low and high magnification images of R-loop staining in samples from non-carriers and BRCAl mutation carriers, with and without pre-treatment of RNase H. Scale bar: 20 ⁇ (left) and 5 ⁇ (right), (b) Low and high magnification images of R-loop staining in BRCAl mutation carriers, showing different staining signals in the luminal epithelial compartment and basal/stromal compartments.
  • Figure 8 shows a model that illustrates the functional antagonism between BRCAl and COBRAl during normal mammary gland development and tumorigenesis.
  • Figures 9A and 9B show the depletion of COBRAl and BRCAl in mammary epithelial cells of virgin KO mice, (a) IHC of COBRAl in 8-week virgin mice.
  • Figure 10 shows homozygous Cobral deletion results in ductal growth defects.
  • Figures 11 A, 1 IB, 11C, and 1 ID show the sorting of luminal and myoepithelial cells
  • Figure 12 shows lack of signs of morphogenic rescue in 6-week DKO.
  • Figures 13 A and 13B show the developmental defect in CKO cannot be rescued by Ink4-Arf deletion
  • (a) Whole mounts of 8-wk virgin mice. Representative images from at least 3 mice in each genotype group. Scale bar: 1 mm.
  • Figures 14A and 14B who the developmental defect in CKO cannot be rescued by Trp53 deletion (a) Whole mounts of 8-wk virgin mice. Representative images from at least 3 mice in each genotype group. Scale bar: 1 mm. (b) mRNA analysis for Cobral and Trp53, using sorted luminal mammary epithelial cells. Error bars represent standard deviation.
  • Figure 15 shows immunofluorescence staining with luminal epithelial and myoepithelial markers K8 and K14, respectively. Scale bar: 50 ⁇ .
  • Figure 16 shows examples of genes with TSS-enriched signals for RNAPII, NELF, and R-loops in mammary epithelium.
  • Figures 17 A, 17B, and 17C show elevated R-loop signals in BRCA1 mutation carriers,
  • (a) Four examples of non-carriers and BRCA1 mutation carriers stained for R-loop and DAPI from the Lombardi Cancer Center. Each image is from a specific donor. Scale bar: 20 ⁇ .
  • Figure 18 shows a relapse-free survival curve for TNBC patients with low or high COBRA1 expression.
  • Figure 19 shows a table of 6wks CKO affected and pubertal related gene list.
  • Figures 20 A, B, and C show R-loops in BRCA1 mutant luminal cells preferentially accumulate at luminal super-enhancers. Average normalized reads for R loops at (A) TSS, (B) super-enhancers, and (C).
  • administering is meant a method of giving a dosage of a composition, such as a therapeutic, to a subject in need thereof.
  • the compositions described herein can be administered by any acceptable route known in the art and including, e.g., parenteral, dermal, transdermal, ocular, inhalation, buccal, sublingual, perilingual, nasal, rectal, topical, and oral administration.
  • Parenteral administration includes intra-arterial, intravenous, intraperitoneal, subcutaneous, and intramuscular administration.
  • the preferred method of administration can vary depending on various factors (e.g., the components of the composition being administered, the condition being treated and its severity, and the age, weight, and health of the patient).
  • the term "therapeutically effective amount” means an amount of a therapeutic, prophylactic, and/or diagnostic agent that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, alleviate, ameliorate, relieve, alleviate symptoms of, prevent, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of the disease, disorder, and/or condition.
  • treating refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular disease, disorder, and/or condition.
  • breast cancer can refer to reducing the symptoms of breast cancer, reducing the spread of breast cancer and/or eliminating breast cancer.
  • Treatment may be administered to a subj ect who does not exhibit signs of a disease, disorder, and/or condition and/or to a subj ect who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.
  • treatment comprises delivery of an inventive vaccine nanocarrier to a subject.
  • Ranges may be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range- 1 from the one particular value and/or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
  • the subject can be a BRCA mutation carrier.
  • the BRCA mutation can be in BRCAl or BRCA2. Therefore, the subject can be a BRCAl or BRCA2 mutation carrier.
  • a non-BRCA mutation carrier can be a subject having two wild type copies of the BRCA gene.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay includes an ELISPOT assay, ELISA, fluorescent immunoassays, two-antibody sandwich assays, a flow- through or strip test format,
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay is carried out with an R-loop antibody.
  • Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the sample comprises one or more of tissue, blood, bone marrow, plasma, serum, urine, and feces.
  • the sample can comprise breast tissue or epithelial cells.
  • a therapeutic can be any known breast cancer therapeutics such as, but not limited to, chemotherapy, radiation, targeted therapies, such as
  • Disclosed are methods for treating breast cancer in a subject comprising administering to said subject a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps of (a) obtaining a biological sample from the subject; (b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRC A mutation carrier; (c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRC A mutation carrier; and (d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
  • the subject can be a BRCA mutation carrier.
  • the BRCA mutation can be in BRCAl or BRCA2. Therefore, the subject can be a BRCAl or BRCA2 mutation carrier.
  • a non-BRCA mutation carrier can be a subject having two wild type copies of the BRCA gene.
  • Disclosed are methods for treating breast cancer in a subject comprising administering to said subject a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps of (a) obtaining a biological sample from the subject; (b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; (c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and (d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay includes an ELISPOT assay, ELISA,
  • the hybridization assay can be carried out with an R-loop antibody.
  • the sample can comprise one or more of tissue, blood, bone marrow, plasma, serum, urine, and feces.
  • the sample can comprise breast tissue or epithelial cells.
  • epithelial cells can be luminal epithelial cells.
  • a therapeutic can be any known breast cancer therapeutics such as, but not limited to, chemotherapy, radiation, targeted therapies, such as Her-2 specific therapies, or hormone therapy.
  • Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCAl mutation carrier.
  • Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCAl mutation carrier, wherein the treatment can be increasing expression and/or activity of RNase H, which degrades the RNA component in the R-loop structure; decreasing COBRAl expression and/or activity; or a combination thereof.
  • Disclosed are methods of reducing tumor incidence in BRCAl -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity.
  • NELF-B is an integral subunit of the four-subunit complex and depletion of any one subunit can abolish the NELF activity. Therefore, targeting the other NELF subunits, NELF-A, -C/D, and -E, can also be used for COBRAl inactivation/elimination.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCAl activity.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCAl activity, wherein the treatment comprises siRNA.
  • BRCAl can form a stable dimeric complex with BARDl and the protein stability of these two proteins can be mutually dependent. Therefore, depletion of BARDl can also be used to reduce or eliminate BRCA1 activity.
  • Also disclosed are methods of increasing mammary gland development in Cobra-deficient subjects comprising administering a treatment that alters transcription of puberty-related genes, estrogen-responsive genes or progesterone-responsive genes.
  • Altering transcription can be the increase or decrease in transcription.
  • puberty-related genes are Gata3, Prlr, Ramp2, Vwf, Prom2, or Acotl.
  • Other puberty-related genes include, but are not limited to, those genes listed in Figure 19.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the estrogen-responsive genes are 2410081M15RIK, 6430706D22RIK, ACOT1, ACTB, ARL4A, BCL6B, CTSH, CXCL9, EMCN, GBP 6, GGTA1 , HOXA7, PABPC1, PDLIM1, PDLIM2, PROM2, PTPN14, SLC02B1 , STARD10, TMEM2, WIPI1, or a combination thereof.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the progesterone-responsive genes are 5730593F 17RIK, CCDC80, CDH13, CLDN5, CRYZ, EDNl , IRXl , NOXOl, PKP2, PRKCDBP, PSEN2, SLC7A3, SPNB3, or a combination thereof.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that increases transcription.
  • Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that decreases transcription.
  • retinoblastoma retinoblastoma. It was recently shown that the idiosyncratic signaling circuitry in cone progenitor cells renders these cells particularly sensitive to tumorigenesis initiated by RBI loss.
  • the product of tumor suppressor gene ATM plays a critical role in DNA damage response (DDR) to double-strand breaks (DSB).
  • DDR DNA damage response
  • DSB double-strand breaks
  • BRCAl is best known for its role in promoting the homologous recombination (HR)-based pathway of DSB repair.
  • BRCAl forms multi-protein complexes in response to DSBs and acts as a scaffolding protein to recruit various DNA repair proteins to the break sites, thus facilitating DNA repair per se and/or activating cell cycle checkpoints.
  • Cancer-predisposing mutations of BRCAl abolish its DSB repair activity, thus underscoring the clinical relevance of BRCAl function in DSB repair.
  • BRCAl has also been implicated in other cellular processes including transcriptional regulation and
  • RNAPII RNA polymerase II
  • ERa estrogen receptor a
  • GAT A3 GAT A3
  • TSS transcription start sites
  • recent cell line-based studies also implicate BRCAl in elimination of R loops, by-products of transcription.
  • R loops consist of a DNA-RNA hybrid between nascent RNA and the template DNA strand, and an unpaired single-stranded DNA from the non-template strand.
  • R loops have become an increasingly appreciated source of genetic instability and important regulators of transcription, DNA methylation, and chromatin architecture. Given the divergent roles of R loops in genome integrity and gene expression, prevention of R-loop accumulation by BRCAl could suppress cancer development via multiple mechanisms. Notwithstanding these in vitro findings, compelling in vivo evidence for the importance of these transcription-related activities of BRCAl to BRCAl -mediated tumor suppression is lacking.
  • NELF-B A BRCAl-binding protein, cofactor of BRCAl or COBRA1, which is identical to the B subunit of the four-subunit NELF complex (NELF-B) was previously identified.
  • NELF is a metazoan-specific transcription elongation factor that pauses RNAPII at a TSS- proximal region.
  • COBRAl/NELF-B interacts with ERa and regulates RNAPII movement at ERa target genes. While NELF-mediated RNAPII pausing has been proposed to ensure synchronous transcriptional activation of developmentally regulated genes, the exact physiological roles of mammalian NELF have just begun to be deciphered. Mouse COBRAl/NELF-B is critical for early embryogenesis and energy homeostasis in adult myocardium.
  • mammary epithelium-specific KO mice were generated by breeding the MMTV-Cre strain with Cobralf/f animals that resulted in deletion of the first 4 Cobral exons.
  • Mammary epithelium of the resulting female MMTV-Cre, Cobralf/f (CKO) animals was effectively depleted of COBRAl mRNA and protein (Fig. 9).
  • WT wild-type
  • MMTV-Cre Cobralf/+
  • P 2.34x10-9 for 6- wk
  • expression of Gata3 and Prlr two known pubertal genes, was disrupted by Cobral ablation but partially restored in DKO (Fig. 3b).
  • the microarray result was confirmed for several pubertal genes by gene-specific RT-PCR (Fig. 3c).
  • Fig. 3a the transcriptional rescue in DKO occurred as early as 4 weeks (Fig. 3a)
  • restoration of ductal growth in DKO was not apparent until 8 weeks (Fig. la,b and Fig.
  • Table 3 Overlap between CKO-affected genes and published gene list. Number in parentheses is p-value of the overlap calculated by Fisher's exact test .
  • COBRA1 contributes to BRCAl-associated mammary tumorigenesis
  • the luminal progenitor cell population in DKO remained substantially lower than that in BKO (Fig. 4b), yet the mature luminal cell population in DKO was more abundant compared to BKO and CKO (Fig. 4b).
  • DKO mammary ducts tended to have thickened epithelial layers (Fig. 4c), which were contributed predominantly by cells with known luminal markers keratin 8 and 18 (K8 and K18) (Fig. 15).
  • Fig. 4c thickened epithelial layers
  • K8 and K18 luminal markers keratin 8 and 18
  • HR efficiency was examined in vivo following ionizing radiation (IR).
  • IR ionizing radiation
  • Proliferating cells were tracked in irradiated mice by pulse-labeling them with bromodeoxyuridine (BrdU).
  • BrdU bromodeoxyuridine
  • DSB damage was monitored 3 hours after irradiation by immunofluorescence staining for ⁇ 2 ⁇ .
  • IR-induced ⁇ 2 ⁇ nuclear foci were present in both BrdU+ and BrdU- cells of WT and KO animals (Fig. 5c).
  • COBRA1 promotes R-loop accumulation in BRCAl-deficient mammary epithelium
  • the R-loop signal in BKO mammary epithelium was obliterated by pre-treatment of the fixed tissue samples with RNase H, a nuclease that specifically degrades RNA in the R-loop structure (Fig. 6a,b).
  • RNase H a nuclease that specifically degrades RNA in the R-loop structure
  • the R-loop intensity in DKO mammary epithelial cells was significantly lower than that in BKO (Fig. 6a, b).
  • a COBRAl -dependent event likely its well- characterized role in RNAPII pausing, can contribute to R-loop accumulation.
  • stromal cells stromal cells
  • basal epithelial cells luminal progenitor cells
  • MoatLum mature luminal epithelial cells
  • the R-loop- specific antibody was used in DNA-RNA immunoprecipitation-sequencing (DRIP-seq)3. An average of 50 million mapped reads were obtained per DRIP-seq reaction. Consistent with the immunostaining data, R-loop accumulation in BRCA1 mutant carriers (Bl) was only observed in the luminal progenitor (yellow) and mature luminal cells (red), not stromal (blue) or basal epithelial (green) cells (Fig. 20A-B).
  • BRCA1 mutation-associated R-loop accumulation occurs most notably at transcription start sites (TSS, Fig. 20A) and luminal super-enhancers (Fig. 20B), which are known to drive gene expression for cell fate determination ⁇ .
  • genomic regions distal to both enhancers and genie regions did not exhibit any appreciable difference between carriers and non-carriers (Fig. 20C).
  • Gene ontology indicates that BRCA1 mutation-associated R-loop accumulates preferentially at gene loci encoding luminal differentiation-related transcription factors (e.g., ERa, GAT A3, ELF5, and ZNF217) and known luminal markers (e.g., ALDH1A37), thus further supporting a role of BRCA1 in luminal lineage-specific transcriptional regulation.
  • BRCA1 -associated tumorigenesis has been linked with various actions of ovarian hormones.
  • Antagonism between BRCA1 and COBRAl strikes a critical balance between promotion of ovarian hormone-driven mammary gland development and prevention of breast cancer (Fig. 8).
  • transcription in response to surging ovarian hormones leads to production of developmentally important gene products that are obligatory to ductal morphogenesis.
  • activation of the transcription program also yields a less desirable by-product in the form of R loops, the accumulation of which can cause aberrant gene expression, epigenetic changes, and genome instability.
  • R-loops are analogous to spontaneous mutations resulting from DNA replication in dividing adult stem cells, which was indicated to be the underlying cause for many cancer types.
  • COBRAl ensures proper ductal transcription and development by counteracting the BRCA1 effect on these events.
  • BRCA1 attenuates COBRAl -dependent R-loop accumulation in mammary epithelium.
  • COBRAl are able to reestablish a quasi-balanced state, in which a partially restored transcription program is potent enough to drive normal tissue development yet sufficiently tamed to avoid accumulation of R loops.
  • DKO mice have reduced tumorigenesis compared to BKO, yet exhibit an expanded luminal epithelial compartment.
  • precocious differentiation in the luminal compartment could result in exhaustion of the progenitor cell pool that would otherwise accumulate, with a high propensity to develop BRCA1 -associated tumors.
  • the multilayer phenotype in DKO mammary glands could reflect a "self-cleansing" mechanism for eliminating the cell of origin for BRCA1 -associated tumors.
  • mice Cobra/Nelf-bf/f mice have been described previously61.
  • MMTV- Cre,Cobraf/f mice were generated by breeding MMTV-Cre line A animals with Cobraf/f mice.
  • Trp53f/f (Trp53tmlBrn), Ink4-ArfKO, and Brcalf/f mice were obtained from Mouse Model of Human Cancer Consortium (MMHCC), National Cancer Institute.
  • Ella-Cre was purchased from the Jackson Laboratory, and used to generate the whole-body hemizygous deletion strain Brcal+/-, Cobra+/- per previously described procedures. The strains were in a mixed genetic background.
  • the stained glands were dehydrated in ascending grades of alcohol (70%, 70%, 90%, 95%, 100%, 100%) for 15 min each, and cleared with Citrisolv reagent (Fisher, Cat#. 22-143975). Samples were and examined under a Nikon SMZ1000 dissection microscope. Duct length was measured from calibrated images using Eclipse software. Average length of three longest ducts from nipple region was taken as the ductal length of each animal.
  • Immunohistochemistry (IHC) and immunofluorescence staining Primary antibodies used were anti-NELF-B/COBRA161, anti-milk protein (Nordic Immunology, RAM/MSP), anti-R-loop (S9.6; Karafast, ENH001), anti-BrdU (GE Healthcare, RPN20), anti-DH2AX (Cell Signaling, 9718) , anti-K8 (Developmental Studies Hybridoma Bank, TROMA-1), anti-K14 (Covance, PRB-155P), anti-Rad51 (Santa Cruz, sc-8349), and anti- ERa (Santa Cruz, sc-542).
  • Blocking was performed with 10% normal goat serum in PBS for 1 hr at room temperature followed by primary antibody incubation overnight at 40C.
  • the ABC peroxidase detection system (Vector Labs, PK-6105) was used with 3, 3'-diaminobenzidine (DAB) as substrate (Vector Labs, SK-4105) according to manufacturer's instruction.
  • mice were intraperitoneally injected with cell proliferation labeling reagent (GE Healthcare, RPN201) at 16.7ml/kg.
  • BrdU/Rad51 and BrdU/yH2AX double staining mice were first injected with BrdU and then X-rayed at 20 Gy using a Faxitron cabinet X- ray system (Model 43855F). Mammary glands were harvested 3 hr after labeling.
  • R-loop intensity was determined using MetaMorph Microscopy Automation and Image Analysis Software 7.8. At least four images, each of which contained a minimum of one complete epithelial duct, were acquired for each sample. For each image, the DAPI signal was used to create a mask of the nucleus in either the luminal epithelial compartment or the basal/stromal compartments. The R-loop intensity was determined by calculating the average intensity in the mask. The final R-loop intensity for each sample is the average of all images.
  • MEC Primary mammary epithelial cell isolation and flow cytometry: Thoracic and inguinal mammary glands from virgin mice were isolated in sterile condition and lymph nodes from inguinal gland were removed. Single cells were prepared using published protocol97 with minor modifications. All reagents were purchased from StemCell Technologies (Vancouver, Canada), unless otherwise indicated. Briefly, the isolated glands were minced using scissors and digested for 15-18 hr at 370C in DMEM F-12 (Cat# 36254) containing 2% FBS, Insulin (5 mg/ml), Penicillin-Streptomycin and a final concentration of 1 mg/mL Collagenase and 100 U/ml Hyaluronidase (Cat# 07919).
  • epithelial organoids were collected by centrifugation at 600 g for 4 min. Red blood cells (RBCs) in the resulting pellets were lysed with 0.8% NH4C1. The epithelial organoids were then digested by pipetting with 2 ml of 0.05% pre-warmed Trypsin (Life Technologies, 25300) for 2 min, followed by washing in ice-cold Hanks Balanced Salt Solution (Cat# 37150) with 2% FBS (HF). The cells were resuspended in 5 mg/ml Dispase (Cat# 07913) with 0.1 mg/ml DNAse I (Sigma- Aldrich, D4513). After trituration for 1-2 min.
  • the cells were resuspended in ice-cold HF, and single cells were prepared by filtering the cell suspension through a 40- ⁇ cell strainer (Fisher, Cat# 22363547). Cells were counted and resuspended in HF at a concentration of 1x106 cells/100 ⁇ . Cell were incubated for 10 min on ice with 10% rat serum (Jackson Laboratories, 012-000-120) and Fc receptor antibody (BD Biosciences, 553141).
  • stromal, luminal, and myoepithelial populations were verified by real-time PCR analysis of Vimentin (stromal), Keratin-18 (luminal), Keratin 5 (myoepithelial), and Keratin-14 (myoepithelial) mRNA.
  • RNA samples from different mice of each genotype were labeled using the Illumina® TotalPrepTM RNA amplification kit (Ambion, Cat. #AMIL1791) and subsequently hybridized to Illumina mouse whole genome gene expression BeadChips (MouseRef-8 version 2.0, Illumina). BeadChips were scanned on an iScan Reader (Illumina) using iScan software (version 3.3.29, Illumina). For further analysis, the scanned data were uploaded into GenomeStudio® software (version 1.9.0, Illumina) via the gene expression module (Direct Hyb).
  • CKO-affected genes were identified that are affected by Cobral KO (CKO-affected) and those that are eventually rescued by double KO (DKO-rescued).
  • CKO-affected genes are defined as the genes that show >2.0 fold enrichment (either up or down) in CKO mice compared to corresponding WT control mice, with P ⁇ 0.05.
  • DKO-rescued genes are defined as those CKO-affected genes that had either (1) ⁇ 1.5 fold enrichment (either up or down, P ⁇ 0.05) in DKO versus WT control mice, or (2) fold of changes in DKO versus WT (P ⁇ 0.05) no more than 50% of those in CKO versus WT, or (3) any fold of changes in DKO versus WT with P value larger than 0.05.
  • Table 3 shows the total number of CKO-affected and DKO- rescued genes for the indicated time points.
  • C(n,k) is the bionomial coefficient.
  • HR-based DSB repair assay The homology directed repair (HDR) assay was performed using established methods.
  • the recombination substrate, pDR-GFP contains two inactive GFP genes, one of which is due to the presence of an I-Scel endonuclease recognition sequence. This DNA is integrated into a single site in HeLa cells.
  • siRNAs specific for a control sequence, COBRAl, and BRCAl were transfected, using Oligofectamine (Invitrogen), into wells containing HeLa-DR-GFP cells.
  • the cells were re-transfected with the same siRNAs plus a plasmid for the expression of the I-Scel endonuclease using the Lipofectamine 2000 transfection reagent (Invitrogen).
  • the fraction of GFP+ cells was determined using a FACS-Calibur analytical flow cytometry instrument. Results were normalized to the percent of GFP+ cells in the sample in which the control siRNA was transfected and plotted ⁇ s.e.m. Assays were performed in triplicate and the significance of the results was analyzed using the two-tailed student's t-test.
  • Chromatin Immunoprecipitation (ChIP) assay Primary mammary epithelial cells were isolated as described above, with the following modification for the tissue digestion step. Briefly, thoracic and inguinal mammary glands were isolated from 6-8 week virgin mice. Lymph nodes were removed from the inguinal glands. Tissues were quickly minced with scissors and digested in DMEM F-12 containing 2% FBS, Penicillin-Streptomycin and a final concentration of 300 U/ml Collagenase and 100 U/ml Hyaluronidase (StemCell Technologies, Cat# 07912) for 45 min with gentle shaking. Samples were vortexed vigorously for 15 sec every 15 min during the digestion.
  • RNAPII ChIP RNAPII ChIP
  • Dynabeads were washed 3 times in RIPA buffer and once in TE buffer (10 mM Tris-HCl, pH 8.0, 10 mM EDTA), then reverse-crosslinked and eluted.
  • TE buffer 10 mM Tris-HCl, pH 8.0, 10 mM EDTA
  • Dynabeads were washed twice in TE Sarcosyl buffer (50 mM Tris-HCl pH 8.0, 2 mM EDTA, 0.2% sarcosyl), twice in TSE1 buffer [150 mM sodium chloride, 20 mM Tris-HCl pH 8.0, 2 mM EDTA, 0.1% (wt/vol) SDS, 1% Triton-X-100], twice in TSE2 buffer [500 mM sodium chloride, 20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 0.1% (wt/vol) SDS, 0.1% Triton-X-100], twice in TSE3 buffer (250 m
  • DRIP assay was performed following the established protocol47. Briefly, primary mammary epithelial cells were isolated as described above in the ChIP assay. Cells were washed twice in PBS, and resuspended in TE (Sigma, T9285) containing a final concentration of 0.5% SDS and proteinase K (Roche, 031 15828001). Samples were incubated overnight at 370C. Genomic DNA was extracted using phenol/chloroform (Sigma, P2069) in phase lock tubes (5 PRIME, 2302840) and ethanol precipitated.
  • DNA was digested using established restriction enzyme cocktail (Hindlll, EcoRI, BsrGI, Xbal and Sspl) overnight at 370C. Digested DNA was cleaned up by phenol-chloroform extraction and ethanol precipitation. For DRIP, digested DNA was incubated with S9.6 antibody overnight at 40C in binding buffer (10 mM sodium phosphate, 140 mM sodium chloride, 0.05% Triton X-100 in TE). RNase H-treated sample was used as a negative control for DRIP. Dynabeads were added the next day for 2 hr. Bound
  • Dynabeads were then washed with binding buffer three times at room temperature. DNA was eluted, phenol-chloroform extracted, and ethanol precipitated. DRIP DNA was sonicated using Covaris (Model S220) before library preparation.
  • ChlP-seq and DRIP-seq libraries were built following the instruction of MicroPlex library preparation kit (Diagenode, C05010011).
  • RNAPII ChlP-seq 1 ng of ChIP DNA was used for a total of 15 cycles of PCR
  • amplification For NELF-A/B ChlP-seq, 0.2 ng ChIP DNA were used for a total of 18 cycles of PCR amplification. For DRIP-seq, a total of 15 cycles of PCR amplification was performed.
  • libraries were purified using Agencourt AMPure XP system (Beckman Coulter, A63880) following the product manual. Quantity of the libraries was measured with Qubit dsDNA HS Assay Kit (Life Technologies, Q32851), and quality of the libraries was verified using Bioanalyzer 2100. Libraries were pooled based on index sequences. 14pM library pool was loaded to Illumina HiSeq2000 and sequenced by 50bp single-read sequencing module.
  • the estimated FDR of identified peaks for all samples are all less than 8% except for NELF-B ChlP-seq.
  • TSS-bound peaks were identified by 1 bp overlap to TSS upstream/downstream 1 kb region of mouse reference genes.
  • Venn diagrams of the overlap genes were generated by BioVennlOl, a web application for comparison and visualization of biological lists. The p-value of the significance of the overlap in the Venn diagrams was calculated by hypergeometric distribution.
  • Primer sequences For RT-PCR: 18sRNA-F: 5'- GAATTCCCAGTAAGTGCGGG-3 ' (SEQ ID NO: l), 18sRNA-R: 5'- GGGCAGGGACTTAATCAACG-3 ' (SEQ ID NO:2). Cobral-F: 5'- ACAACTTCTTCAGCCCTTCCC-3' (SEQ ID NO:3), Cobral-R: 5'- TCTGCACCACCTCTCCTTGG-3'(SEQ ID NO:4).
  • Brcal-F 5'- AGC AAAC AGCCTGGC ATAGC-3 ' (SEQ ID NO:5), Brcal-R: 5'- ACTTGCAGCCCATCTGCTCT-3'(SEQ ID NO:6).
  • pl6Ink4a-F 5'- GAACTCTTTCGGTCGTACCCC-3 ' (SEQ ID NO:7), pl6Ink4a-R: 5'- CGTGAACGTTGCCCATCAT-3 '(SEQ ID NO:8).
  • pl9Arf-F 5'- CTTGAGAAGAGGGCCGCAC-3 '(SEQ ID NO:9), pl9Arf-R: 5'- AACGTTGCCCATCATCATCA-3'(SEQ ID NO: 10).
  • p53-F 5'- GAGAC AGC AGGGCTC ACTCC-3 ' (SEQ ID NO: 11), p53-R: 5'- TGGCCCTTCTTGGTCTTC AG-3 ' (SEQ ID NO: 12).
  • Ctse-F 5'- ATTGGCAGATTGCCCTGGAT-3 ' (SEQ ID NO: 13), Ctse-R: 5'- GCCTTCGGAGCAGAACATC A-3 ' (SEQ ID NO: 14).
  • Prom2-F 5'- TGACCTGGATAAGC ACCTGG-3 ' (SEQ ID NO: 15), Prom2-R: 5'- AAGCTCTGAAGCTCCTGCTG-3 ' (SEQ ID NO: 16).
  • Acotl-F 5'- ATGGC AGC AGCTCC AGACTT-3 ' (SEQ ID NO: 17), Acotl-R: 5'- CCCAACCTCCAAACCATCAT-3' (SEQ ID NO: 18).
  • Ramp2-F 5'- GCCTCATCCCGTTCCTTGTT-3 ' (SEQ ID NO: 19), Ramp2-R: 5'- CCTGGGCATCGCTGTCTTTA-3 ' (SEQ ID NO:20).
  • Vwf-F 5'- CGACCTGGAGTGTATGAGCC-3 ' (SEQ ID NO:21), Vwf-R: 5'- AC AC ACTTGTTTTCGTGCCG-3 ' (SEQ ID NO:22).
  • Gata3-F 5'- GATGTAAGTCGAGGCCC AAG-3 ' (SEQ ID NO:23), Gata3-R: 5'- GCAGGCATTGCAAAGGTAGT-3 '(SEQ ID NO:24).
  • K18-F 5'- ACTCCGC AAGGTGGTAGATGA-3 ' (SEQ ID NO:25), K18-R: 5'- TCCACTTCCACAGTCAATCCA-3'(SEQ ID NO: 26), K14-F: 5'- AGCGGCAAGAGTGAGATTTCT-3 ' (SEQ ID NO:27), K14-R: 5'- CCTCCAGGTTATTCTCCAGGG -3' (SEQ ID NO:28) , K5-F: 5'- GAGATCGCCACCTACAGGAA-3 ' (SEQ ID NO:29), K5-R: 5'- TCCTCCGTAGCCAGAAGAGA-3 ' (SEQ ID NO:30), Vimentin-F: 5'-
  • Yamaguchi Y. et al. NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell 97, 41 -51 (1999).
  • RNA polymerase II directs rapid signaling responses at the promoters of estrogen target genes. Mol Cell Biol 29, 1 123-1 133 (2009).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer comprising measuring the level of R-loop in a biological sample. Also disclosed are methods of treating breast cancer in a subject comprising administering to said subject a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps that include measuring the level of R-loop in a biological sample. The measured level of R-loop in a biological sample can be compared to a control sample from a non-BRCA mutation carrier. Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCA1 mutation carrier.

Description

METHODS OF DIAGNOSING AND TREATING BREAST CANCER
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional Application No. 62/156,686, filed May 4, 2015 and is hereby incorporated herein by reference in its entirety.
REFERENCE TO SEQUENCE LISTING
[0002] The Sequence Listing submitted May 4, 2016 as a text file named
"21105_0027Pl_Sequence_Listing.txt," created on May 3, 2016, and having a size of 7,123 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).
BACKGROUND
[0003] Women carrying germ-line mutations of BRCA1 and BRCA2 have significantly increased risk of developing breast and ovarian cancers. Both BRCA1 and BRCA2 play roles in reducing R-loops, a DNA-RNA hybrid structure and by-product of transcription. It is well known that individuals with one mutated germ-line BRCA allele are at an increased risk for developing breast cancer. However, there is no available method to pre-screen individuals in the general population who may harbor deleterious BRCA mutations and/or have elevated risk of developing breast cancer. The use of the association of BRCAl/2 mutation carriers and elevated R-loop signals could be a useful tool for diagnosing individuals with a risk of developing breast cancer.
BRIEF SUMMARY
[0004] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
[0005] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRC A mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the subject is a BRCA mutation carrier. In some instances, the BRCA mutation carrier is a BRCA1 or BRCA2 mutation carrier.
[0006] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the non-BRCA mutation carrier is a subject having two wild type copies of the BRCA gene.
[0007] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay includes an ELISPOT assay, ELISA, fluorescent immunoassays, two-antibody sandwich assays, a flow- through or strip test format, PCR, Real time PCR , Reverse Transcription-PCR (RT-PCR), immunohistochemistry, or DNA/RNA immunoprecipitation.
[0008] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRC A mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, the hybridization assay is carried out with an R- loop antibody.
[0009] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the sample comprises one or more of tissue, blood, bone marrow, plasma, serum, urine, and feces. In some instances, the sample comprises breast tissue. In some instances, the sample comprises epithelial cells. The epithelial cells can be luminal epithelial cells.
[0010] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, further comprising administering to said subject a therapeutically effective amount of a given therapeutic.
[0011] Disclosed are methods for treating breast cancer in a subject, comprising administering to said subject a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps of a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample; c) conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; d) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and e) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
[0012] Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCA1 mutation carrier.
[0013] Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCA1 mutation carrier, wherein the treatment is increasing expression and/or activity of RNase H, which degrades the RNA component in the R-loop structure, or decreasing COBRAl expression and/or activity.
[0014] Disclosed are methods of reducing tumor incidence in BRCA1 -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity.
[0015] Disclosed are methods of reducing tumor incidence in BRCA1 -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity, wherein the treatment comprises siRNA that targets Cobral mRNA.
[0016] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCA1 activity.
[0017] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCA1 activity, wherein the treatment comprises siRNA. The siRNA can target BRCA1 mRNA.
[0018] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes.
[0019] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the puberty -related genes are Gata3, Prlr, Ramp2, Vwf, Prom2, Acotl, or a combination thereof. Other puberty-related genes include, but are not limited to, those genes listed in Figure 19.
[0020] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the estrogen-responsive genes are 2410081M15RIK, 6430706D22RIK, ACOT1, ACTB, ARL4A, BCL6B, CTSH, CXCL9, EMCN, GBP 6, GGTA1 , HOXA7, PABPC1, PDLIM1, PDLIM2, PROM2, PTPN14, SLC02B1 , STARD10, TMEM2, WIPI1, or a combination thereof.
[0021] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the progesterone-responsive genes are 5730593F 17RIK, CCDC80, CDH13, CLDN5, CRYZ, EDNl , IRXl , NOXOl, PKP2, PRKCDBP, PSEN2, SLC7A3, SPNB3, or a combination thereof.
[0022] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that increases transcription.
[0023] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that decreases transcription.
[0024] Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or may be learned by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the disclosed method and compositions and together with the description, serve to explain the principles of the disclosed method and compositions.
[0026] Figures 1A, IB, and 1C show that DKO rescues ductal developmental defect in CKO. (a) Whole mounts of mammary glands from 8-wk virgin mice. The boundary of the ductal area is highlighted. Scale bars: 1 mm. Images are representatives of at least 6 animals, (b) Measurement of the average ductal length at 4 developmental time points. The numbers of animals used for each of the four time points (6, 8, 12, 24 weeks) are: WT (4, 7, 7, 12 mice), BKO (3, 3, 4, 4 mice), CKO (3, 6, 5, 8 mice), and DKO (4, 7, 4, 4 mice), (c) Flow cytometry analysis of various mammary gland compartments from 16-wk virgin mice. Stromal cells: CD49f-EpCAM-, luminal epithelial cells: CD49fmedEpCAMhigh, myoepithelial cells: CD49fhighEpCAMmed. The numbers of animals used are: WT (4), BKO (3), CKO (3), and DKO (4). * P < 0.05, ** P < 0.01 by Student's t-test. Statistical analysis was conducted between CKO and WT, and between DKO and CKO. Error bars represent standard error of the mean (s.e.m).
[0027] Figures 2A, 2B, 2C, and 2D show that DKO rescues alveolar and lactogenic defects associated with CKO and BKO. (a-b) Whole mounts of mammary glands one day postpartum. Scale bar: 1 mm in (a), and 500 μιτι in (b). (c) Hematoxylin and eosin (H&E) stain of the lobular-alveolar structure in mammary glands of mice one day postpartum. Scale bar: 100 μιτι. (d) Immunohistochemistry for total milk proteins in mammary glands of mice one day postpartum. Scale bar: 50 μιτι. Images in this figure are representatives of at least 4 animals in each genotype.
[0028] Figures 3A, 3B, and 3C show aberrant pubertal gene expression in CKO is partially rescued in DKO. (a) Heatmap illustrates the gene expression changes in mammary epithelial cells of CKO and DKO as compared to their corresponding WT littermates (n = 3) at three time points (4, 6, 8 weeks). The gene expression levels in WT are set as 1. (b) Expression patterns for two representative pubertal genes that are affected by CKO and partially rescued by DKO. The lowest expression level in each graph is set at 1. (c) Confirmation of the microarray data by gene-specific RT-PCR for a number of pubertal genes. The result is average of values from 3 animals in each genotype. Error bars represent s.e.m. * P < 0.05. Statistical analysis was conducted between WT and CKO, and between CKO and DKO. [0029] Figures 4A, 4B, and 4C show that Cobral deletion reduces mammary tumor incidence and abundance of luminal progenitor cells in BKO. (a) Curve for tumor incidence. * P < 0.05. The number of animals used in each group is indicated. Log-rank test was used to estimate the statistical significance, (b) Enumeration of mature luminal (CD49fmedEpCAMhighCD49b-) and progenitor cells (CD49fmedEpCAMhighCD49b+). The numbers of animals used are: WT (4), BKO (3), CKO (3), and DKO (4). ** P < 0.01. (c) H&E stain of mammary ducts from WT and KO animals. Scale bar: 50 μιη.
[0030] Figures 5A, 5B, 5C, 5D, and 5E show that Cobral deletion does not rescue DSB repair deficiency in DKO. (a) Diagram of the GFP reporter assay for measuring HR efficiency. I-Scel : restriction enzyme. iGFP: internal GFP fragment as the template for HR. (b) Top: Immunoblot of COBRAl and BRCAl for assessing siRNA knockdown efficiency with control (Con) oligos or ones targeting human BRCAl (-B) and COBRAl (-C) in HeLa cells. Bottom: Percentage of GFP+ cells as a result of HR-mediated DSB repair. Results are average of three independent experiments. * P < 0.05 by Student's t-test. (c) Mice of 8-wk old were pulse-labeled with BrdU, irradiated (20 Gy), and mammary glands were harvested 3 hr later for immunostaining for γΗ2ΑΧ and BrdU. Scale bar: 5 μιτι. (d) The same samples as shown in (c) were stained for Rad51 and BrdU. Scale bar: 5 μιη. (e) Percentage of Rad51+/BrdU+ mammary epithelial cells. * P < 0.05. Error bars represent s.e.m. The numbers of animals used are indicated below the graph.
[0031] Figures 6A, 6B, 6C, and 6D show that COBRAl contributes to R loop accumulation in BKO. (a) Immunofluorescence staining for R-loop structure in mammary ducts of 8-wk virgin mice. Scale bars: 20 μιτι (left) and 5 μιτι (right), (b) Quantitation of relative R-loop intensity in 8-week old animals. The numbers of animals used in each group are: WT (9), BKO (9), CKO (5), and DKO (8). * P < 0.05. (c) Average reads per million for RNAPII ChlP-seq, NELF-A ChlP-seq, NELF-B/COBRA1 ChlP-seq, and DRIP- seq surrounding the TSS regions in mammary epithelial cells. Reads from two biological repeats were merged for RNAPII ChlP-seq and DRIP-seq. (d) Venn diagram indicating the overlapping genes with TSS-enriched signals for RNAPII, NELF-A/B, and R loops.
[0032] Figures 7A, 7B, and 7C show elevated R-loop signal in normal breast tissue from BRCAl mutation carriers, (a) Low and high magnification images of R-loop staining in samples from non-carriers and BRCAl mutation carriers, with and without pre-treatment of RNase H. Scale bar: 20 μιτι (left) and 5 μιτι (right), (b) Low and high magnification images of R-loop staining in BRCAl mutation carriers, showing different staining signals in the luminal epithelial compartment and basal/stromal compartments. Scale bar: 20 μιτι (top) and 5 μηι (bottom), (c) Quantitation of the R-loop intensity in luminal epithelial and basal/stromal compartments in the non-carrier group (n = 12), BRCAl mutation carrier group (n = 12), and BRCAl mutation carrier pre-treated with RNase H group (n = 5). * P < 0.05. ** P < 0.01.
[0033] Figure 8 shows a model that illustrates the functional antagonism between BRCAl and COBRAl during normal mammary gland development and tumorigenesis.
[0034] Figures 9A and 9B show the depletion of COBRAl and BRCAl in mammary epithelial cells of virgin KO mice, (a) IHC of COBRAl in 8-week virgin mice.
Representative result from at least 5 sets of animals. Scale bar: 50 Dm. (b) RT-PCR analysis of COBRAl and BRCAl mRNA levels from sorted luminal mammary epithelial cells. Representative result from more than 6 sets of WT and mutant animals. Also shown are relative expression levels of COBRAl and BRCAl in myoepithelial and luminal epithelial cells of WT mammary glands. 18S rRNA was used for normalization. Note that COBRAl is expressed to similar levels in both epithelial compartments, whereas BRCAl is predominantly expressed in the luminal compartment. The relatively high residual levels of COBRAl mRNA in sorted luminal epithelial samples of CKO mice could be due to minor contamination with myoepithelial cells.
[0035] Figure 10 shows homozygous Cobral deletion results in ductal growth defects. Whole mounts of 8-wk virgin mice. Representative images from at least 4 animals in each genotype. Scale bar: 1 mm.
[0036] Figures 11 A, 1 IB, 11C, and 1 ID show the sorting of luminal and myoepithelial cells, (a) Representative flow cytometry results indicating the typical gating for debris exclusion, doublet discrimination, selection of lineage-negative/live cells, and separation of luminal, myoepithelial cells and stromal cells, (b) Cell surface markers and fluorochromes used in the flow cytometry, (c) Validation of cell sorting efficiency by RT-PCR of known luminal (K18) and myoepithelial cell (K5 and K14) markers. 18S rRNA was used as the normalization control, (d) Enumeration of ERa+ luminal cells by IHC in WT and KO mammary glands. The numbers of animals used are: WT (10), BKO (8), CKO (10), and DKO (10).
[0037] Figure 12 shows lack of signs of morphogenic rescue in 6-week DKO. Whole mounts of mammary gland tissue from 6-week animals. The images are representatives of at least 3 animals in each genotype. Scale bar: 1 mm.
[0038] Figures 13 A and 13B show the developmental defect in CKO cannot be rescued by Ink4-Arf deletion, (a) Whole mounts of 8-wk virgin mice. Representative images from at least 3 mice in each genotype group. Scale bar: 1 mm. (b) mRNA analysis for COBRA1, pl6INK4a, and pl 9ARF by RT-PCR, using sorted luminal mammary epithelial cells. Error bars represent standard deviation.
[0039] Figures 14A and 14B who the developmental defect in CKO cannot be rescued by Trp53 deletion, (a) Whole mounts of 8-wk virgin mice. Representative images from at least 3 mice in each genotype group. Scale bar: 1 mm. (b) mRNA analysis for Cobral and Trp53, using sorted luminal mammary epithelial cells. Error bars represent standard deviation.
[0040] Figure 15 shows immunofluorescence staining with luminal epithelial and myoepithelial markers K8 and K14, respectively. Scale bar: 50 μηι.
[0041] Figure 16 shows examples of genes with TSS-enriched signals for RNAPII, NELF, and R-loops in mammary epithelium.
[0042] Figures 17 A, 17B, and 17C show elevated R-loop signals in BRCA1 mutation carriers, (a) Four examples of non-carriers and BRCA1 mutation carriers stained for R-loop and DAPI from the Lombardi Cancer Center. Each image is from a specific donor. Scale bar: 20 μιτι. (b) Higher magnification images of R-loop staining in non-carriers and BRCA1 mutation carriers from the same individuals as shown in A. Scale bar: 5 μιη. (c)
Quantitation of the R-loop intensity in the non-carrier group (n = 12) and BRCA1 mutation carrier group (n = 13). ** P < 0.01.
[0043] Figure 18 shows a relapse-free survival curve for TNBC patients with low or high COBRA1 expression.
[0044] Figure 19 shows a table of 6wks CKO affected and pubertal related gene list.
[0045] Figures 20 A, B, and C show R-loops in BRCA1 mutant luminal cells preferentially accumulate at luminal super-enhancers. Average normalized reads for R loops at (A) TSS, (B) super-enhancers, and (C).
DETAILED DESCRIPTION
[0046] The disclosed method and compositions may be understood more readily by reference to the following detailed description of particular embodiments and the Example included therein and to the Figures and their previous and following description.
[0047] It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. [0048] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed method and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective
combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. If a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited, each is individually and collectively contemplated. Thus, is this example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods, and that each such combination is specifically contemplated and should be considered disclosed.
A. Definitions
[0049] It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
[0050] It must be noted that as used herein and in the appended claims, the singular forms "a ", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a therapeutic" includes a plurality of such therapeutics, reference to "the subject" is a reference to one or more subjects and equivalents thereof known to those skilled in the art, and so forth.
[0051] "Optional" or "optionally" means that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present and instances where it does not occur or is not present.
[0052] As used herein, by "administering" is meant a method of giving a dosage of a composition, such as a therapeutic, to a subject in need thereof. The compositions described herein can be administered by any acceptable route known in the art and including, e.g., parenteral, dermal, transdermal, ocular, inhalation, buccal, sublingual, perilingual, nasal, rectal, topical, and oral administration. Parenteral administration includes intra-arterial, intravenous, intraperitoneal, subcutaneous, and intramuscular administration. The preferred method of administration can vary depending on various factors (e.g., the components of the composition being administered, the condition being treated and its severity, and the age, weight, and health of the patient).
[0053] As used herein, the term "therapeutically effective amount" means an amount of a therapeutic, prophylactic, and/or diagnostic agent that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, alleviate, ameliorate, relieve, alleviate symptoms of, prevent, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of the disease, disorder, and/or condition.
[0054] As used herein, the term "treating" refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. For example, "treating" breast cancer can refer to reducing the symptoms of breast cancer, reducing the spread of breast cancer and/or eliminating breast cancer. Treatment may be administered to a subj ect who does not exhibit signs of a disease, disorder, and/or condition and/or to a subj ect who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some embodiments, treatment comprises delivery of an inventive vaccine nanocarrier to a subject.
[0055] Ranges may be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range-1 from the one particular value and/or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise. Finally, it should be understood that all of the individual values and sub-ranges of values contained within an explicitly disclosed range are also specifically contemplated and should be considered disclosed unless the context specifically indicates otherwise. The foregoing applies regardless of whether in particular cases some or all of these embodiments are explicitly disclosed.
[0056] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed method and compositions belong. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present method and compositions, the particularly useful methods, devices, and materials are as described. Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. No admission is made that any reference constitutes prior art. The discussion of references states what their authors assert, and applicants reserve the right to challenge the accuracy and pertinence of the cited documents. It will be clearly understood that, although a number of publications are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0057] Throughout the description and claims of this specification, the word
"comprise" and variations of the word, such as "comprising" and "comprises," means "including but not limited to," and is not intended to exclude, for example, other additives, components, integers or steps. In particular, in methods stated as comprising one or more steps or operations it is specifically contemplated that each step comprises what is listed (unless that step includes a limiting term such as "consisting of), meaning that each step is not intended to exclude, for example, other additives, components, integers or steps that are not listed in the step.
[0058] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims. B. Methods of Diagnosing Risk of Developing Breast Cancer
[0059] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
[0060] The subject can be a BRCA mutation carrier. The BRCA mutation can be in BRCAl or BRCA2. Therefore, the subject can be a BRCAl or BRCA2 mutation carrier. A non-BRCA mutation carrier can be a subject having two wild type copies of the BRCA gene.
[0061] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay includes an ELISPOT assay, ELISA, fluorescent immunoassays, two-antibody sandwich assays, a flow- through or strip test format, PCR, Real time PCR , Reverse Transcription-PCR (RT-PCR), immunohistochemistry, or DNA/RNA immunoprecipitation.
[0062] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay is carried out with an R-loop antibody.
[0063] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the sample comprises one or more of tissue, blood, bone marrow, plasma, serum, urine, and feces. In some instances, the sample can comprise breast tissue or epithelial cells. For example, epithelial cells can be luminal epithelial cells.
[0064] Disclosed are methods of diagnosing whether a subject is at risk of developing breast cancer, comprising a) obtaining a biological sample from the subject; b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R- loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, further comprising administering to said subject a therapeutically effective amount of a given therapeutic. A therapeutic can be any known breast cancer therapeutics such as, but not limited to, chemotherapy, radiation, targeted therapies, such as Her-2 specific therapies, or hormone therapy.
C. Methods for Treating Breast Cancer
[0065] Disclosed are methods for treating breast cancer in a subject, comprising administering to said subject a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps of (a) obtaining a biological sample from the subject; (b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRC A mutation carrier; (c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRC A mutation carrier; and (d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
[0066] The subject can be a BRCA mutation carrier. The BRCA mutation can be in BRCAl or BRCA2. Therefore, the subject can be a BRCAl or BRCA2 mutation carrier. A non-BRCA mutation carrier can be a subject having two wild type copies of the BRCA gene.
[0067] Disclosed are methods for treating breast cancer in a subject, comprising administering to said subject a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps of (a) obtaining a biological sample from the subject; (b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier; (c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and (d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier, wherein the hybridization assay includes an ELISPOT assay, ELISA, fluorescent immunoassays, two-antibody sandwich assays, a flow-through or strip test format, PCR, Real time PCR , Reverse Transcription-PCR (RT-PCR),
immunohistochemistry, or DNA/RNA immunoprecipitation. In some instances, the hybridization assay can be carried out with an R-loop antibody.
[0068] The sample can comprise one or more of tissue, blood, bone marrow, plasma, serum, urine, and feces. In some instances, the sample can comprise breast tissue or epithelial cells. For example, epithelial cells can be luminal epithelial cells. [0069] A therapeutic can be any known breast cancer therapeutics such as, but not limited to, chemotherapy, radiation, targeted therapies, such as Her-2 specific therapies, or hormone therapy.
D. Methods of Treating Subjects with Increased R-loops
[0070] Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCAl mutation carrier.
[0071] Disclosed are methods of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R-loop, wherein the subject is a BRCAl mutation carrier, wherein the treatment can be increasing expression and/or activity of RNase H, which degrades the RNA component in the R-loop structure; decreasing COBRAl expression and/or activity; or a combination thereof.
E. Methods of Reducing Tumors
[0072] Disclosed are methods of reducing tumor incidence in BRCAl -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity.
[0073] Disclosed are methods of reducing tumor incidence in BRCAl -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity, wherein the treatment comprises siRNA that targets Cobral mRNA. COBRAl (aka NELF-B) is an integral subunit of the four-subunit complex and depletion of any one subunit can abolish the NELF activity. Therefore, targeting the other NELF subunits, NELF-A, -C/D, and -E, can also be used for COBRAl inactivation/elimination.
F. Methods of Increasing Mammary Gland Development
[0074] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCAl activity.
[0075] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCAl activity, wherein the treatment comprises siRNA.
[0076] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that reduces or eliminates BRCAl activity, wherein the treatment comprises siRNA, wherein the siRNA targets BRCAl mRNA. BRCAl can form a stable dimeric complex with BARDl and the protein stability of these two proteins can be mutually dependent. Therefore, depletion of BARDl can also be used to reduce or eliminate BRCA1 activity.
[0077] Also disclosed are methods of increasing mammary gland development in Cobra-deficient subjects comprising administering a treatment that alters transcription of puberty-related genes, estrogen-responsive genes or progesterone-responsive genes.
Altering transcription can be the increase or decrease in transcription.
[0078] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the puberty-related genes are Gata3, Prlr, Ramp2, Vwf, Prom2, or Acotl. Other puberty-related genes include, but are not limited to, those genes listed in Figure 19.
[0079] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the estrogen-responsive genes are 2410081M15RIK, 6430706D22RIK, ACOT1, ACTB, ARL4A, BCL6B, CTSH, CXCL9, EMCN, GBP 6, GGTA1 , HOXA7, PABPC1, PDLIM1, PDLIM2, PROM2, PTPN14, SLC02B1 , STARD10, TMEM2, WIPI1, or a combination thereof.
[0080] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of one or more puberty -related genes, estrogen-responsive genes or progesterone-responsive genes, wherein the progesterone-responsive genes are 5730593F 17RIK, CCDC80, CDH13, CLDN5, CRYZ, EDNl , IRXl , NOXOl, PKP2, PRKCDBP, PSEN2, SLC7A3, SPNB3, or a combination thereof.
[0081] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that increases transcription.
[0082] Disclosed are methods of increasing mammary gland development in Cobra- deficient subjects comprising administering a treatment that alters transcription of puberty- related genes, estrogen-responsive genes or progesterone-responsive genes, wherein a treatment that alters transcription comprises a treatment that decreases transcription. Examples
G. BRCAl Balances the Action of a Transcription Elongation Factor In Mammary Gland Development and Tumorigenesis
1. INTRODUCTION
[0083] Germ-line mutations in BRCAl predispose women to breast and ovarian cancers. The preponderant association of BRCAl tumors with female reproductive organs has been well established. Furthermore, the origin of BRCAl breast tumors has been traced to progenitors of the luminal epithelial compartment, which constitutes the inner layer of breast epithelium. As BRCAl protein is expressed in a variety of tissue and cell types outside breast and ovaries, context-dependent BRCAl activity must underlie its sex and tissue-specific tumor suppressor function. However, the exact mechanism by which BRCAl suppresses tumors in breast and ovaries remains poorly understood, even two decades after the cloning of the BRCAl gene. The enduring conundrum of tissue specificity for tumor suppressor function is not limited to BRCAl. For example, until recently, it was unclear why germ-line mutations of the RBI gene specifically predispose children to
retinoblastoma. It was recently shown that the idiosyncratic signaling circuitry in cone progenitor cells renders these cells particularly sensitive to tumorigenesis initiated by RBI loss. In another salient example, the product of tumor suppressor gene ATM plays a critical role in DNA damage response (DDR) to double-strand breaks (DSB). However, recent mouse genetic studies identified a DDR-independent function of ATM in modulating mitochondrial homeostasis, which could explain some of the clinical phenotypes associated with ataxia telangiectasia.
[0084] Mechanistically, BRCAl is best known for its role in promoting the homologous recombination (HR)-based pathway of DSB repair. BRCAl forms multi-protein complexes in response to DSBs and acts as a scaffolding protein to recruit various DNA repair proteins to the break sites, thus facilitating DNA repair per se and/or activating cell cycle checkpoints. Cancer-predisposing mutations of BRCAl abolish its DSB repair activity, thus underscoring the clinical relevance of BRCAl function in DSB repair. However, as such BRCAl activity can be readily demonstrated in vitro using established cell lines that are not limited to breast and ovarian origins, it is unclear as to why the loss of a universal function of BRCAl in DSB repair leads to highly sex/tissue-specific tumor development in vivo.
[0085] In addition to its well-documented role in DSB repair, BRCAl has also been implicated in other cellular processes including transcriptional regulation and
heterochromatin-mediated gene silencing. BRCAl binds to RNA polymerase II (RNAPII) and various site-specific transcription factors including estrogen receptor a (ERa) and GAT A3, which are involved in mammary gland development and breast cancer. Consistent with a role for BRCAl in transcription-related events, genome-wide analysis indicates that chromatin binding of BRCAl is enriched at transcription start sites (TSS) across the human genome. Notably, recent cell line-based studies also implicate BRCAl in elimination of R loops, by-products of transcription. R loops consist of a DNA-RNA hybrid between nascent RNA and the template DNA strand, and an unpaired single-stranded DNA from the non-template strand. R loops have become an increasingly appreciated source of genetic instability and important regulators of transcription, DNA methylation, and chromatin architecture. Given the divergent roles of R loops in genome integrity and gene expression, prevention of R-loop accumulation by BRCAl could suppress cancer development via multiple mechanisms. Notwithstanding these in vitro findings, compelling in vivo evidence for the importance of these transcription-related activities of BRCAl to BRCAl -mediated tumor suppression is lacking.
[0086] A BRCAl-binding protein, cofactor of BRCAl or COBRA1, which is identical to the B subunit of the four-subunit NELF complex (NELF-B) was previously identified. NELF is a metazoan-specific transcription elongation factor that pauses RNAPII at a TSS- proximal region. Although NELF was first identified as an transcription elongation repressor in vitro, subsequent in vivo studies indicate that NELF-mediated RNAPII pausing can lead to decreased or increased transcription. In ERa+ breast cancer cells,
COBRAl/NELF-B interacts with ERa and regulates RNAPII movement at ERa target genes. While NELF-mediated RNAPII pausing has been proposed to ensure synchronous transcriptional activation of developmentally regulated genes, the exact physiological roles of mammalian NELF have just begun to be deciphered. Mouse COBRAl/NELF-B is critical for early embryogenesis and energy homeostasis in adult myocardium.
[0087] Using mammary epithelium-specific knockout (KO) mouse models for Brcal and Cobral, the functional relationship between these two genes in mammary gland morphogenesis and tumorigenesis was investigated. A tissue-selective and DSB repair- independent functional interaction between Brcal and Cobral was identified. This previously unappreciated balancing act between BRCAl and a key transcription elongation factor promotes normal tissue development while suppressing tumorigenesis in the same mammary epithelial compartment. 2. RESULTS
i. Genetic complementation between Brcal and Cobral in mammary gland development and function
[0088] To investigate the role of COBRAl in mammary gland development, mammary epithelium-specific KO mice were generated by breeding the MMTV-Cre strain with Cobralf/f animals that resulted in deletion of the first 4 Cobral exons. Mammary epithelium of the resulting female MMTV-Cre, Cobralf/f (CKO) animals was effectively depleted of COBRAl mRNA and protein (Fig. 9). Compared with age-matched wild-type (WT, Cobralf/f) and hemizygous mice (MMTV-Cre, Cobralf/+), CKO with homozygous deletion of Cobral displayed severely retarded mammary ductal growth (Fig. la,b and Fig. 10). The developmental defect of CKO was most profound during and shortly after puberty (6 and 8 weeks), and remained significant in older virgin mice (12 and 24 weeks, Fig. lb). In further support, flow cytometry using established cell surface markers for mammary epithelial cells65 showed that luminal (CD49fmedEpCAMhigh) and myoepithelial (CD49fhighEpCAMmed) cell populations of CKO mammary glands were equally reduced compared to WT controls (Fig. lc and Fig. l la-c). Furthermore, the CKO luminal compartment did not exhibit any significant change in the relative abundance of ER+ over ER- cells (Fig. l id), consistent with an overall developmental arrest of multiple mammary epithelial lineages.
[0089] Given the physical interaction between BRCAl and COBRAl, the phenotypes of CKO were compared withMWT -Cre-mediated Brcal KO that was conditionally deleted of Brcal exon 11 (MMTV-Cre, Br calf/f BKO), and Brcal /Cobral double KO mice (MMTV-Cre,Brcalf/f Cobralf/f DKO). BKO animals exhibited normal ductal growth at puberty (Fig. la-b). Ductal development of DKO mice was stunted at 6 weeks (Fig. lb and Fig. 12), but remarkably, it approached that of WT and BKO at later stages (Fig. la,b). Furthermore, the abundance of luminal and myoepithelial cells in DKO mammary glands was largely restored to WT levels (Fig. lc). COBRAl and BRCAl expression in DKO mice were depleted to a similar extent versus the corresponding single-gene KO animals (Fig. 9). Therefore the marked phenotypic difference between CKO and DKO reflects a bona fide genetic complementation between Brcal and Cobral. CKO mammary glands manifest a 5rca7-dependent developmental blockade.
[0090] Despite the partial ductal growth in older virgin CKO (Fig. lb), all pups of CKO dams died shortly after birth from obvious lack of nursing. In support, mammary glands of CKO at postpartum were largely devoid of alveolar structure (Fig. 2a-c) and milk proteins (Fig. 2d). Similar, albeit less severe, alveologenic and lactogenic defects were observed in BKO mammary glands (Fig. 2). In stark contrast, DKO dams with simultaneous deletion of Brcal and Cobral underwent efficient alveologenesis and lactogenesis, as evidenced by the normal alveolar structure (Fig. 2a-c), abundant milk proteins (Fig. 2d), and restored nursing ability. Collectively, these genetic data unequivocally demonstrate a functional interaction between Brcal and Cobral in mammary gland development and function.
ii. The Brcal and Cobral genetic interaction is specific for mammary glands
[0091] To determine how specific the genetic complementation is between Brcal and Cobral, whether genetic ablation of other growth-arresting tumor suppressor genes could rescue the developmental defects associated with CKO was investigated. Tumor suppressor genes Ink4-Arf play a critical role in oncogene-induced senescence, and co-deletion of the Ink4a/Arf locus restored developmental defect associated with the loss of Bmil, a transcriptional regulator of stem cell renewal. In addition, deletion of tumor suppressor gene Trp53 partially rescued early embryonic lethality associated with Brcal deficiency. CKO was combined with whole-body deletion of Ink4-Arf or mammary gland-specific deletion of Trp53. In contrast to Brcal deletion, neither Ink4-Arf nor Trp53 deficiency rescued the ductal growth defect of CKO (Figs. 13 and 14), indicating a specific genetic interaction between Brcal and Cobral.
[0092] Whether the genetic complementation between Brcal and Cobral was tissue- dependent was investigated. Homozygous deletion of Brcal or Cobral causes early embryonic lethality. Mice that carried hemizygous germ-line deletions of Brcal and Cobral {Brcal + /-Cobra 1+/-) were bred and progenies were examined for rescue of embryonic lethality. Upon genotyping a large number of embryos and viable pups, we did not find any with homozygous deletion of both genes (Brcal -/-,Cobral -/-, Table 1). Taken together, these findings indicate a tissue and gene-selective genetic interaction between Cobral and Brcal in mammary epithelium.
Table 1. Lethality of Brcal - and Cobral -deleted embryos cannot be mutually rescued by double KO Brcal,Co FE MA F +
bral MALE LE M
+/+, +/+ 11 20 31
+/+, +/- 25 18 43
+/+, -/- 0 0 0
+/-, +/+ 35 23 58
+/-, +/- 69 55 124
+/-, -/- 0 0 0
-/-, +/- 0 0 0
-/-, -/- 0 0 0
TOTAL 140 116 256 i. BRCA1 inhibits pubertal transcription in COBRAl-deficient mammary epithelium
[0093] To gain molecular insight into the Brcal/Cobral genetic complementation during ductal development at puberty, gene expression profiling of sorted mammary epithelial cells from WT, BKO, CKO, and DKO at 4, 6, and 8 weeks was performed.
Consistent with their normal ductal growth (Fig. la,b) and previously reported gene expression profiling of the same animal model, BKO mice exhibited very few
transcriptionally affected genes compared to their WT controls (Table 2) and therefore were not included in the subsequent bioinformatics analysis. In contrast, the gene expression profiles of CKO were significantly different from their WT littermates, with the most significant transcriptional aberration observed at the early (4 week) and mid-pubertal (6 week) stages (Fig. 3 and Table 2). Furthermore, these CKO-affected genes were enriched with previously identified pubertal genes (P=7.65xl0-13 for 6-wk), and estrogen
(P=7.73x10-6) and progesterone-responsive genes (P=5.00x10-5) in mammary epithelium (Table 3). Strikingly, approximately 80% of the CKO-affected genes at 4 and 6 weeks were either partially or completely rescued in DKO mammary glands (Fig. 3 and Table 3).
Likewise, the DKO-rescued genes were enriched with puberty -related (P=2.34x10-9 for 6- wk) and estrogen (P=2.09x10-5) and progesterone-responsive genes (P=7.64x10-4, Table 3). For example, expression of Gata3 and Prlr, two known pubertal genes, was disrupted by Cobral ablation but partially restored in DKO (Fig. 3b). The microarray result was confirmed for several pubertal genes by gene-specific RT-PCR (Fig. 3c). Of note, while the transcriptional rescue in DKO occurred as early as 4 weeks (Fig. 3a), restoration of ductal growth in DKO was not apparent until 8 weeks (Fig. la,b and Fig. 12), likely due to incomplete transcriptional rescue of CKO-affected genes. The fact that transcriptional rescue precedes developmental rescue indicates that the former is likely a cause, rather than consequence, of the restored ductal morphogenesis. Collectively, the data define an inhibitory activity of BRCA1 in pubertal transcription and ductal development that manifests in the absence of COBRAl.
Table 2: 8wks DKO affected gene list (DKOAVT >2 or DKOAVT≤-2, p<0.05)
Fold
Group I Group II Change
SYMBOL ACCESSION
(Dff).AVG_Signal (DKO).AVG_Signal (II/I)
(DKO/Dff) Mucl NM_013605.1 824.4185 206.1236 -4.00
Bglap-rsl NM_ 031368.3 492.883 126.5445 -3.89
Dmkn NM_ 172899.3 1873.177 579.8171 -3.23
Mucl NM_ 013605.1 912.9594 284.6109 -3.21
Clic6 NM_ 172469.3 709.8447 222.9155 -3.18
Dmkn NM_ 172899.2 1955.163 626.6171 -3.12
Mucl NM_ 013605.1 523.3958 172.2742 -3.04
Mucl NM_ 013605.1 403.5068 135.7065 -2.97
C3 NM_ 009778.1 1956.615 661.4249 -2.96
Scara5 NM_ 028903.1 557.677 191.1359 -2.92
Trf NM_ 133977.2 7689.115 2657.633 -2.89
AI428936 NM_ 153577.2 613.7659 228.6717 -2.68
Cdl4 NM_ 009841.3 5180.815 1935.141 -2.68
Slcl3a2 NM_ 022411.3 259.2089 100.97 -2.57
Gdpd3 NM_ 024228.2 1361.444 536.8906 -2.54
Ltf NM_ 008522.3 21105.27 8340.986 -2.53
Ceacaml NM_ 001039187.1 803.8411 318.2288 -2.53
Elf5 NM_ 010125.2 718.727 285.1689 -2.52
Ogfrll NM_ _001081079.1 732.4705 297.2078 -2.46
Cyp24al NM_ 009996.2 278.1577 115.2921 -2.41
Cyp2d22 NM_ 019823.3 813.0899 338.1125 -2.40
AU040829 NM_ 175003.3 432.2578 188.2646 -2.30
Btnlal NM_ 013483.2 351.197 161.8884 -2.17
A730008L03Rik NM_ 021393.1 311.523 144.6753 -2.15
Ltf NM_ 008522.2 349.789 166.111 -2.11
Ckmtl NM_ 009897.2 523.3627 249.3914 -2.10
Pabpcl NM_ 008774.2 2434.311 1162.352 -2.09
Bglapl NM_ 001037939.1 220.6627 105.7095 -2.09
Gjb2 NM_ 008125.2 627.1307 304.1209 -2.06
Elf5 NM 010125.2 288.463 140.1559 -2.06 Xbpl NM_013842.2 7508.566 3669.257 -2.05
A730008L03Rik NM_021393.1 298.9673 146.1672 -2.05
Atf5 NM_030693.1 940.6545 462.3745 -2.03
Tmc4 NM_181820.2 987.8871 488.3747 -2.02
Igf p5 NM_010518.2 8533.547 4231.91 -2.02
Slc5a8 NM_145423.2 2351.473 1170.86 -2.01
Scdl NM_009127.3 1553.969 776.8299 -2.00
Ceacaml NM_001039185.1 355.335 177.758 -2.00
Krt79 NM_146063.1 103.8764 207.4121 +2.00
Lgmn NM_011175.2 534.8884 1069.188 +2.00
Histlh3d NM_178204.1 220.1151 441.7187 +2.01
Psmb9 NM_013585.2 118.0195 239.2073 +2.03
Histlh4f NM_175655.1 180.4794 368.4062 +2.04
Histlh2bn NM_178201.1 385.2098 796.5076 +2.07
Hdc NM_008230.4 133.3217 279.6878 +2.10
Cenpa NM_007681.2 631.3411 1326.15 +2.10
Histlh3e NM_178205.1 223.9645 473.4436 +2.11
Fbln2 NM_001081437.1 199.1063 421.028 +2.11
Ccl5 NM_013653.2 316.7475 670.5001 +2.12
Histlh2bj NM_178198.1 1375.097 2918.971 +2.12
Histlhlc NM_015786.1 3375.41 7220.594 +2.14
Rbp7 NM_022020.2 102.1815 221.7561 +2.17
Itih2 NM_010582.2 139.8296 307.2296 +2.20
Histlh2bf NM_178195.1 1180.516 2613.672 +2.21
Cxcl9 NM_008599.3 114.0531 252.5468 +2.21
Histlh4m NM_175657.1 132.5918 296.3 +2.23
Cited 1 NM_007709.3 187.3248 420.7397 +2.25
Ly6cl NM_010741.2 283.9633 649.633 +2.29
Lgals7 NM_008496.4 273.0249 626.1846 +2.29
Histlh2bc NM_023422.3 953.8706 2222.036 +2.33
Cdknla NM_007669.2 194.9874 458.4763 +2.35
Histlh2bh NM_178197.1 697.3153 1647.799 +2.36
Vim NM_011701.3 219.9753 528.9696 +2.40
EG630499 NM_001081015.1 127.463 309.3895 +2.43
Histlh2bk NM_175665.1 466.8949 1146.251 +2.46
Cdknla NM_007669.3 605.1024 1485.854 +2.46
Histlh4k NM_178211.1 139.4921 348.1631 +2.50
Cavl NM_007616.3 465.0926 1161.802 +2.50
Cdknla NM_007669.2 264.1147 670.9604 +2.54
Actg2 NM_009610.1 804.6465 2051.867 +2.55
Aqpl NM_007472.1 142.4449 372.2909 +2.61
Selp NM_011347.1 322.0848 842.3918 +2.62
Ccl21c NM_023052.1 158.7866 425.8169 +2.68
Cst3 NM_009976.3 934.4656 2530.607 +2.71
2210407C18Rik NM_144544.1 228.2843 618.973 +2.71
Dnaicl NM 175138.3 149.6938 415.3302 +2.77 Histlh4i NM_ 175656.2 173.086 520.6535 +3.01
Plvap NM_ 032398.1 180.8246 551.1104 +3.05
CxcllO NM_ 021274.1 251.0965 768.627 +3.06
Serpinfl NM_ 011340.3 262.5768 822.2831 +3.13
H2-T23 NM_ 010398.1 693.5092 2233.837 +3.22
Mmrn2 NM_ 153127.3 150.8225 492.4206 +3.26
Aqpl NM_ 007472.2 226.3429 758.06 +3.35
Ckb NM_ 021273.3 720.8067 2427.159 +3.37
Hist2h2aal NM_ 013549 158.6823 585.7575 +3.69
Histlh4j NM_ 178210.1 171.9211 651.2156 +3.79
Ccl21a NM_ 011124.4 245.4477 945.769 +3.85
Upk3a NM_ 023478.1 171.1022 685.8395 +4.01
Vwf NM_ 011708.3 253.2617 1033.758 +4.08
Histlh4h NM 153173.2 151.452 662.3843 +4.37
Table 3 : Overlap between CKO-affected genes and published gene list. Number in parentheses is p-value of the overlap calculated by Fisher's exact test .
Figure imgf000026_0001
ii. COBRA1 contributes to BRCAl-associated mammary tumorigenesis
[0094] Given the roles of Brcal in mediating the developmental arrest and
transcriptional changes in Cobral -deficient mammary glands, the reciprocal question of whether Cobral could influence mammary tumor development in Brcal -deficient mice was investigated. CKO mice did not display elevated mammary tumor occurrence versus WT control (Fig. 4a). Consistent with published findings, BKO mice had increased spontaneous mammary tumors (Fig. 4a). Hemizygous deletion of Cobral in the BKO background (BKO,C-hemi) did not affect 7?rca7-associated tumorigenesis (Fig. 4a). In stark contrast, DKO mice exhibited significantly lower incidence of tumorigenesis than BKO and BKO,C- hemi mice (Fig. 4a), indicating that Cobral deletion mitigated 7?rca7-associated tumorigenesis. Thus, COBRA1 can exacerbate mammary tumor development in the absence of functional BRCAL
[0095] Consistent with the notion that luminal progenitor cells are the cell of origin for 7?7?C47-associated breast tumors, it was found that BKO had more luminal epithelial cells with CD49b expression, an established marker for the luminal progenitor population, compared to WT animals (Fig. 4b and Fig. 11). In contrast, CKO mammary glands contained markedly reduced pools of both mature (CD49b-) and progenitor (CD49b+) cells in the luminal epithelial compartment (Fig. 4b), again indicating inhibition of mammary epithelial cells of all lineages and differentiation stages upon Cobral ablation. Intriguingly, the flow cytometry profiles of DKO were distinct from those of BKO and CKO. In particular, the luminal progenitor cell population in DKO remained substantially lower than that in BKO (Fig. 4b), yet the mature luminal cell population in DKO was more abundant compared to BKO and CKO (Fig. 4b). Notably, DKO mammary ducts tended to have thickened epithelial layers (Fig. 4c), which were contributed predominantly by cells with known luminal markers keratin 8 and 18 (K8 and K18) (Fig. 15). Thus, excessive differentiation into mature cells of the same lineage could result in reduced pools of luminal progenitor cells in DKO mammary glands, which offers an explanation at the cellular level for the lower incidence of tumor development in DKO mice.
iii. The effect of COBRA1 on BRCAl-associated tumorigenesis is independent of DSB repair
[0096] The genetic interaction between Brcal and Cobral is reminiscent of the previously reported antagonism between Brcal and 53BP1, whereby loss of 53BP1 eliminates BRCAl-associated mammary tumorigenesis and rescues HR-mediated DSB repair in BRCAl -deficient cells. Whether reduced tumorigenesis in DKO mice could be due to restored HR-mediated DSB repair was investigated. A green fluorescence protein (GFP)- based reporter assay was used in vitro, in which repair of site-specific DSB through the HR- dependent pathway gives rise to a functional GFP gene (Fig. 5a). As expected, BRCAl knockdown significantly compromised HR efficiency, as indicated by reduced GFP+ cell numbers (Fig. 5b). Depletion of COBRAl alone did not affect HR efficiency, nor did it rescue the HR defect in BRCAl -depleted cells (Fig. 5b), suggesting that COBRAl did not affect BRCAl -mediated DSB repair in vitro.
[0097] Next, HR efficiency was examined in vivo following ionizing radiation (IR). HR repair predominantly occurs in proliferating cells during late S and G2 phases of the cell cycle, when sister chromatids are available as the homologous templates for HR-mediated repair. Proliferating cells were tracked in irradiated mice by pulse-labeling them with bromodeoxyuridine (BrdU). DSB damage was monitored 3 hours after irradiation by immunofluorescence staining for γΗ2ΑΧ. As expected, IR-induced γΗ2ΑΧ nuclear foci were present in both BrdU+ and BrdU- cells of WT and KO animals (Fig. 5c). To assess efficiency of HR-dependent DSB repair, BrdU+ mammary epithelial cells with IR-induced nuclear foci of Rad51, an HR marker, recruitment of which to DSB sites is facilitated by BRCA1 were enumerated. Consistent with the well-established role of BRCA1 in HR, irradiated BKO animals exhibited substantially lower Rad51+/BrdU+ ratios versus WT (Fig. 5d,e). CKO mammary glands had similar Rad51+/BrdU+ ratios versus WT control, indicating that COBRA1 per se is not involved in IR-induced DSB repair. Notably, HR repair in DKO mice remained as deficient as that in BKO (Fig. 5d,e). Taken together, both in vitro and in vivo data clearly indicate that the reduced mammary tumorigenesis in DKO versus BKO is not due to restored HR-mediated DSB repair.
iv. COBRA1 promotes R-loop accumulation in BRCAl-deficient mammary epithelium
[0098] Given the well-documented function of COBRAl in transcriptional elongation and the recently reported link between BRCA1 and R-loop accumulation, it was investigated whether the functional antagonism between Cobral and Brcal in mammary tumorigenesis was associated with R-loop dynamics. Luminal epithelial cells from BKO exhibited more pronounced pan-nuclear staining with an R-loop-specific antibody versus age-matched WT mice (Fig. 6a, b), consistent with the in vitro findings of elevated R-loop accumulation upon BRCA1 knockdown. As a critical control, the R-loop signal in BKO mammary epithelium was obliterated by pre-treatment of the fixed tissue samples with RNase H, a nuclease that specifically degrades RNA in the R-loop structure (Fig. 6a,b). Remarkably, the R-loop intensity in DKO mammary epithelial cells was significantly lower than that in BKO (Fig. 6a, b). Thus, a COBRAl -dependent event, likely its well- characterized role in RNAPII pausing, can contribute to R-loop accumulation.
[0099] To validate the association between COBRAl, RNAPII pausing, and R-loops in mammary epithelium, primary epithelial cells were isolated from mouse mammary tissue and chromatin immunoprecipitation-sequencing (ChlP-seq) and DNA-RNA
immunoprecipitation-sequencing (DRIP-seq) was performed. ChlP-seq of RNAPII and the NELF complex (NELF-A and NELF-B/COBRAl) indicated that both signals were enriched at TSS (Fig. 6c, Fig. 16), consistent with the known RNAPII-pausing function of NELF. As detected by DRIP-seq, average R-loop signals in the same mammary epithelial cells exhibited a TSS-enriched partem (Fig. 6c). Notably, there was a marked overlap between the genes with TSS-enrichment of NELF, RNAPII, and R loops (P=0, Fig. 8d and Fig. 16). Taken together, the genomic data indicate that COBRAl -mediated RNAPII pausing contributes to R-loop dynamics in mammary epithelium. [00100] Following R-loop-specific immunostaining of formalin fixed paraffin-embedded (FFPE) cancer-free breast tissue of BRCA1 mutation-carrying women, next-generation sequencing was used to identify the specific genomic locations of BRCA1 mutation- associated R-loop accumulation. Specifically, fresh breast tissue samples from BRCA1 mutation carriers and non-carriers were subjected to fluorescence-activated cell sorting (FACS) using established cell surface markers (EpCAM and CD49f)l,2. Each clinical sample was sorted to four populations: stromal cells, basal epithelial cells, luminal progenitor cells (LumPro), and mature luminal epithelial cells (MatLum). The R-loop- specific antibody was used in DNA-RNA immunoprecipitation-sequencing (DRIP-seq)3. An average of 50 million mapped reads were obtained per DRIP-seq reaction. Consistent with the immunostaining data, R-loop accumulation in BRCA1 mutant carriers (Bl) was only observed in the luminal progenitor (yellow) and mature luminal cells (red), not stromal (blue) or basal epithelial (green) cells (Fig. 20A-B). Furthermore, BRCA1 mutation- associated R-loop accumulation occurs most notably at transcription start sites (TSS, Fig. 20A) and luminal super-enhancers (Fig. 20B), which are known to drive gene expression for cell fate determination^. In contrast, genomic regions distal to both enhancers and genie regions did not exhibit any appreciable difference between carriers and non-carriers (Fig. 20C). Gene ontology indicates that BRCA1 mutation-associated R-loop accumulates preferentially at gene loci encoding luminal differentiation-related transcription factors (e.g., ERa, GAT A3, ELF5, and ZNF217) and known luminal markers (e.g., ALDH1A37), thus further supporting a role of BRCA1 in luminal lineage-specific transcriptional regulation.
v. Normal luminal epithelial cells from cancer-free BRCA1 mutation carriers exhibit R-loop accumulation due to BRCA1 haploinsufficiency
[00101] To extend the findings from these animal models, R-loop signals were examined in normal breast tissue of cancer-free BRCA1 mutation-carrying women. Breast epithelial cells from the non-carrier group displayed relatively low pan-nuclear staining, with one or two distinct nuclear foci per cell (Fig. 7a). In contrast, breast epithelial cells from the BRCA1 mutation carriers had pronounced pan-nuclear R-loop staining that was sensitive to RNase H (Fig. 7a). Furthermore, R-loop accumulation occurred preferentially in the luminal epithelial cells of the BRCA1 mutation carrier group (Fig. 7b,c). In comparison, non-luminal cells (basal epithelial and stromal) from the same carriers did not exhibit elevated R-loop signals compared to their counterparts in the control group (Fig. 7b,c). This finding was confirmed using a separate cohort of BRCA1 mutation carriers (Fig. 17). Thus, R-loop accumulation represents an early sign of BRCA1 haploinsufficiency in BRCA1 mutation carriers, prior to breast cancer development.
2. DISCUSSION
[00102] The universality of the extensively characterized DSB repair activity of BRCA1 stands in stark contrast to its sex and tissue-specific tumor suppressor function. By using mammary gland-specific KO mouse models and focusing on a critical stage of hormone- driven mammary gland development, a DSB repair-independent functional interplay between BRCA1 and a key regulator of transcriptional elongation during normal tissue development and tumorigenesis was identified. These findings underscore the importance of studying physiologically relevant tissue context to elucidate early molecular events that drive initiation of tissue-specific BRCA1 -associated tumors.
[00103] BRCA1 -associated tumorigenesis has been linked with various actions of ovarian hormones. Antagonism between BRCA1 and COBRAl strikes a critical balance between promotion of ovarian hormone-driven mammary gland development and prevention of breast cancer (Fig. 8). In this model, transcription in response to surging ovarian hormones leads to production of developmentally important gene products that are obligatory to ductal morphogenesis. On the flip side of the same coin, activation of the transcription program also yields a less desirable by-product in the form of R loops, the accumulation of which can cause aberrant gene expression, epigenetic changes, and genome instability. In this regard, R-loops are analogous to spontaneous mutations resulting from DNA replication in dividing adult stem cells, which was indicated to be the underlying cause for many cancer types. These two outcomes of the same transcriptional event are controlled by COBRAl and BRCA1 in an antagonistic manner. COBRAl ensures proper ductal transcription and development by counteracting the BRCA1 effect on these events. Reciprocally, BRCA1 attenuates COBRAl -dependent R-loop accumulation in mammary epithelium. Thus, this model explains why loss of COBRAl manifests the BRCA1- mediated inhibition of ductal morphogenesis as observed in CKO, and conversely, why BKO mice without functional BRCA1 suffer from accumulated R loops as a result of unopposed COBRAl actions. DKO animals with simultaneous loss of BRCA1 and
COBRAl are able to reestablish a quasi-balanced state, in which a partially restored transcription program is potent enough to drive normal tissue development yet sufficiently tamed to avoid accumulation of R loops.
[00104] It is counterintuitive that DKO mice have reduced tumorigenesis compared to BKO, yet exhibit an expanded luminal epithelial compartment. One explanation is that precocious differentiation in the luminal compartment could result in exhaustion of the progenitor cell pool that would otherwise accumulate, with a high propensity to develop BRCA1 -associated tumors. In other words, the multilayer phenotype in DKO mammary glands could reflect a "self-cleansing" mechanism for eliminating the cell of origin for BRCA1 -associated tumors.
[00105] The DSB repair-independent interaction between BRCA1 and COBRAl in tissue development and tumorigenesis represents a conceptual departure from the prevailing DNA repair-centric paradigm for BRCA1 biology. However, it is important to note that this work does not refute the DNA repair function of BRCA1 as an integral component of its tumor suppressor activity. In fact, the residual tumor incidence in DKO compared to WT can be due to persistent DNA repair deficiency in the absence of BRCA1. The functional antagonism between BRCA1 and COBRAl is distinct from the previously reported interplay between BRCA1 and 53BP182,83, which is attributed to the competition between HR and non-homologous end-joining pathways of DSB repair. In contrast,
BRCAl/COBRAl antagonism is clearly DSB-independent. Furthermore, while 53BP1 deletion rescued developmental defects in Brcal -deficient embryos, the genetic
complementation between Brcal and Cobral is apparently more tissue-restricted. The universal function of BRCA1 in DNA repair and its tissue-dependent crosstalk with COBRAl in transcription are both required for maximal suppression of tumorigenesis in the unique hormonal milieu of breast epithelium.
[00106] Based on evidence from various in vitro studies, collision between R loops and DNA replication forks can be the primary source of R-loop-associated DSB. However, unlike monotypic cancer cell lines cultured in vitro, normal human and mouse ER+ luminal epithelial cells in vivo are predominantly non-proliferative. Rather, in response to ovarian hormones, a paracrine action of these ER+ cells stimulates proliferation of their neighboring ER- epithelial cells. This important idiosyncrasy of normal breast epithelium in vivo likely adds another level of complexity to the functional consequences of R-loop accumulation, which could differ between proliferating and non-proliferating breast epithelial cells. R- loop accumulation was observed across the entire BRCA1 -deficient luminal epithelial compartment, and it did not correlate with the DSB marker γΗ2ΑΧ. Therefore, in addition to DSBs resulting from R-loop collision with replication forks in proliferating epithelial cells, other known effects of R-loop accumulation including DSB-independent genetic instability, epigenetic alterations, and gene expression changes can also contribute to tumorigenesis in breast epithelium. [00107] Considering that all non-cancerous somatic cells of a BRCA1 mutation carrier have one WT and one mutant BRCA1 allele, it is intriguing that elevated R-loop signals were predominantly observed in luminal epithelial cells in a BRCAl-haploinsufficient manner. Cell type-specific R-loop accumulation can represent an early hallmark in BRCA1- associated tumorigenesis, which can be used as a risk-assessing tool for BRCA1 mutation carriers, especially those BRCA1 mutations with equivocal disease association. It is also worth noting that, when compared with dissected normal breast epithelium from cancer-free individuals, tumor samples from triple negative breast cancer patients have significantly elevated COBRA1 mRNA (2.55 fold, P=4.83xl0"6). In addition, high COBRA1 expression is associated with poor outcome for patients with basal-like breast cancer (Fig. 18). As most BRCA1 -associated breast tumors fall into the triple-negative and basal -like types, the previously unappreciated role of COBRA1 in R-loop accumulation and luminal progenitor cell expansion offers a potential DSB repair-independent target for reducing BRCA1- associated cancer risk.
3. METHODS
[00108] Mice: Cobra/Nelf-bf/f mice have been described previously61. MMTV- Cre,Cobraf/f mice were generated by breeding MMTV-Cre line A animals with Cobraf/f mice. Trp53f/f (Trp53tmlBrn), Ink4-ArfKO, and Brcalf/f mice were obtained from Mouse Model of Human Cancer Consortium (MMHCC), National Cancer Institute. Ella-Cre was purchased from the Jackson Laboratory, and used to generate the whole-body hemizygous deletion strain Brcal+/-, Cobra+/- per previously described procedures. The strains were in a mixed genetic background.
[00109] Breast tissue cohorts: Cancer-free breast tissue was procured from women either undergoing cosmetic reduction mammoplasty, diagnostic biopsies, or mastectomy. All donors signed a written consent form authorizing the use of the specimens for breast cancer- related laboratory investigations.
[00110] Whole mount analysis of the mammary glands: Inguinal mammary glands from mice of different age groups as indicated were used for whole mount staining. The inguinal fat pads were gently isolated and spread onto a glass slide. The glands were fixed in Carnoy's fixative (ethanol: chloroform: glacial acetic acid, 60:30: 10) overnight at room temperature. The glands were rehydrated in descending grades of alcohol (70%, 50%, 30%) for 15 min each, then washed with distilled water prior to overnight staining in Carmine alum (1 g carmine, 2.5 g aluminum potassium sulfate boiled for 20 min in distilled water, filtered and brought to a final volume of 500 ml). The stained glands were dehydrated in ascending grades of alcohol (70%, 70%, 90%, 95%, 100%, 100%) for 15 min each, and cleared with Citrisolv reagent (Fisher, Cat#. 22-143975). Samples were and examined under a Nikon SMZ1000 dissection microscope. Duct length was measured from calibrated images using Eclipse software. Average length of three longest ducts from nipple region was taken as the ductal length of each animal.
[00111] Immunohistochemistry (IHC) and immunofluorescence staining: Primary antibodies used were anti-NELF-B/COBRA161, anti-milk protein (Nordic Immunology, RAM/MSP), anti-R-loop (S9.6; Karafast, ENH001), anti-BrdU (GE Healthcare, RPN20), anti-DH2AX (Cell Signaling, 9718) , anti-K8 (Developmental Studies Hybridoma Bank, TROMA-1), anti-K14 (Covance, PRB-155P), anti-Rad51 (Santa Cruz, sc-8349), and anti- ERa (Santa Cruz, sc-542).
[00112] Mammary glands were fixed in 10% Neutral buffered formalin for 18 hr at 40C and paraffin embedded. Sections of 2 or 3 μΜ in thickness were used for hematoxylin- eosin (H&E) staining and IHC. Samples were baked at 700C for 15 min, then de- paraffinized by three 5-min extractions in 100% xylene, followed by 3-min each of descending grade of alcohol (100%, 95%, 70%, 50%). Samples were washed briefly with PBS before transferring to boiling antigen-unmasking solution (Vector Labs, H-3300) for 20 min. For IHC, sections were pre-treated with 3% hydrogen peroxide for 10 min before blocking. Blocking was performed with 10% normal goat serum in PBS for 1 hr at room temperature followed by primary antibody incubation overnight at 40C. For detection with primary antibody using the immune enzymatic method, the ABC peroxidase detection system (Vector Labs, PK-6105) was used with 3, 3'-diaminobenzidine (DAB) as substrate (Vector Labs, SK-4105) according to manufacturer's instruction.
[00113] For immunofluorescence staining, sections were incubated with Alexa-488 and Alexa-546-conjugated secondary antibodies (Life Technologies), mounted with Vectashield mounting medium with DAPI (Vector Labs, H-1200), and examined with an Olympus FVIOOO confocal microscope or Nikon Eclipse Ni fluorescent microscope. For BrdU pulse- labeling, mice were intraperitoneally injected with cell proliferation labeling reagent (GE Healthcare, RPN201) at 16.7ml/kg. For BrdU/Rad51 and BrdU/yH2AX double staining, mice were first injected with BrdU and then X-rayed at 20 Gy using a Faxitron cabinet X- ray system (Model 43855F). Mammary glands were harvested 3 hr after labeling.
[00114] R-loop immunofluorescence staining and intensity quantification: After de- paraffin and re-hydration, samples were treated in boiling antigen-unmasking solution (Vector Labs, H-3300) for 1 hr. After antigen unmasking, samples were cooled down to room temperature and then treated with 0.2x SSC buffer (Ambion, AM9763) for 20 min with gentle shaking. Samples were then incubated overnight in primary antibody S9.6 (S9.6; Karafast, ENH001) at 1 : 100 dilution in PBS containing 1% normal goat serum and 0.5% Tween-20 at 37°C. The next day, samples were washed with PBS containing 0.5% Tween-20 for 5 min three times. Samples were incubated with Alexa-488-conjugated secondary antibody (Life Technologies) at 1 : 1000 dilution in PBS containing 1% normal goat serum and 0.5% Tween-20 at 37°C for 2 hr. Samples were washed twice with PBS containing 0.5% Tween-20 for 3 min followed by 3 min PBS wash twice. Samples were then mounted with Vectashield mounting medium with 4',6-diamidino-2-phenylindole (DAPI, Vector Labs, H-1200), and examined under a Nikon Eclipse Ni fluorescent microscope. For samples pre-treated with RNase H, an overnight treatment of RNase H (NEB, M0297S) is carried out after 0.2x SSC treatment. Samples were then washed in PBS for 5 min three times before incubation with the primary antibody.
[00115] R-loop intensity was determined using MetaMorph Microscopy Automation and Image Analysis Software 7.8. At least four images, each of which contained a minimum of one complete epithelial duct, were acquired for each sample. For each image, the DAPI signal was used to create a mask of the nucleus in either the luminal epithelial compartment or the basal/stromal compartments. The R-loop intensity was determined by calculating the average intensity in the mask. The final R-loop intensity for each sample is the average of all images.
[00116] Statistics: All data are expressed as means ± s.e.m. Differences between two groups were compared using a two-tailed unpaired Student's t test. P < 0.05 was considered statistically significant. For mouse tumor studies, log-rank test in the GraphPad Prism software was used.
[00117] Primary mammary epithelial cell (MEC) isolation and flow cytometry: Thoracic and inguinal mammary glands from virgin mice were isolated in sterile condition and lymph nodes from inguinal gland were removed. Single cells were prepared using published protocol97 with minor modifications. All reagents were purchased from StemCell Technologies (Vancouver, Canada), unless otherwise indicated. Briefly, the isolated glands were minced using scissors and digested for 15-18 hr at 370C in DMEM F-12 (Cat# 36254) containing 2% FBS, Insulin (5 mg/ml), Penicillin-Streptomycin and a final concentration of 1 mg/mL Collagenase and 100 U/ml Hyaluronidase (Cat# 07919). After vortexing, epithelial organoids were collected by centrifugation at 600 g for 4 min. Red blood cells (RBCs) in the resulting pellets were lysed with 0.8% NH4C1. The epithelial organoids were then digested by pipetting with 2 ml of 0.05% pre-warmed Trypsin (Life Technologies, 25300) for 2 min, followed by washing in ice-cold Hanks Balanced Salt Solution (Cat# 37150) with 2% FBS (HF). The cells were resuspended in 5 mg/ml Dispase (Cat# 07913) with 0.1 mg/ml DNAse I (Sigma- Aldrich, D4513). After trituration for 1-2 min. the cells were resuspended in ice-cold HF, and single cells were prepared by filtering the cell suspension through a 40-μιτι cell strainer (Fisher, Cat# 22363547). Cells were counted and resuspended in HF at a concentration of 1x106 cells/100 μί. Cell were incubated for 10 min on ice with 10% rat serum (Jackson Laboratories, 012-000-120) and Fc receptor antibody (BD Biosciences, 553141). After blocking, cells were incubated for 20 min with antibodies for the following cell-surface markers: Ep-CAM-PE (BioLegend, 118206), CD49f-FITC (BD Biosciences, 555735), CD31-Biotin (BD Bioscience, 553371), CD45 biotin
(BioLegend, 103103), TER-119 Biotin (BioLegend, 103511), and CD49b-Alexa Fluor 647 (BioLegend, 104317) followed by Streptavidin-Pacific Blue (Invitrogen, S I 1222). 7-AAD (BD Biosciences, 559925) was added 10 min before analysis. CD49b+ cells were gated using a fluorescent-minus-one (FMO) control, in which all antibodies except CD49b-Alexa 647 were used. Sorting was performed with a Moflo Astrios cell sorter (Beckmen Coulter). Data were analyzed using FACSDiva software. Purity of the stromal, luminal, and myoepithelial populations were verified by real-time PCR analysis of Vimentin (stromal), Keratin-18 (luminal), Keratin 5 (myoepithelial), and Keratin-14 (myoepithelial) mRNA.
[00118] Gene expression profiling: Triplicates of RNA samples from different mice of each genotype were labeled using the Illumina® TotalPrepTM RNA amplification kit (Ambion, Cat. #AMIL1791) and subsequently hybridized to Illumina mouse whole genome gene expression BeadChips (MouseRef-8 version 2.0, Illumina). BeadChips were scanned on an iScan Reader (Illumina) using iScan software (version 3.3.29, Illumina). For further analysis, the scanned data were uploaded into GenomeStudio® software (version 1.9.0, Illumina) via the gene expression module (Direct Hyb).
[00119] Bioinformatics analysis of microarray data: For each of the time points, genes were identified that are affected by Cobral KO (CKO-affected) and those that are eventually rescued by double KO (DKO-rescued). CKO-affected genes are defined as the genes that show >2.0 fold enrichment (either up or down) in CKO mice compared to corresponding WT control mice, with P <0.05. DKO-rescued genes are defined as those CKO-affected genes that had either (1) <1.5 fold enrichment (either up or down, P < 0.05) in DKO versus WT control mice, or (2) fold of changes in DKO versus WT (P < 0.05) no more than 50% of those in CKO versus WT, or (3) any fold of changes in DKO versus WT with P value larger than 0.05. Table 3 shows the total number of CKO-affected and DKO- rescued genes for the indicated time points.
[00120] Pubertal, estrogen and progesterone signature genes were extracted from previously published studies to identify the overlap with CKO-affected or DKO-rescued genes. Table 3 shows the overlap among CKO-affected/DKO-rescued genes with pubertal, estrogen and progesterone genes. The statistical significance (p-value) of the overlap was calculated using the Fisher's exact test:
Figure imgf000036_0001
where N is the total number of genes in the experiment; m,n is the selected affected/rescued and previously published signature genes respectively and o is the overlap among those genes. C(n,k) is the bionomial coefficient.
[00121] In vitro HR-based DSB repair assay: The homology directed repair (HDR) assay was performed using established methods. The recombination substrate, pDR-GFP, contains two inactive GFP genes, one of which is due to the presence of an I-Scel endonuclease recognition sequence. This DNA is integrated into a single site in HeLa cells. On day 1, siRNAs specific for a control sequence, COBRAl, and BRCAl were transfected, using Oligofectamine (Invitrogen), into wells containing HeLa-DR-GFP cells. On day 3, the cells were re-transfected with the same siRNAs plus a plasmid for the expression of the I-Scel endonuclease using the Lipofectamine 2000 transfection reagent (Invitrogen). On day 6, cells were released from the monolayer using trypsin and the fraction of GFP+ cells was determined using a FACS-Calibur analytical flow cytometry instrument. Results were normalized to the percent of GFP+ cells in the sample in which the control siRNA was transfected and plotted ± s.e.m. Assays were performed in triplicate and the significance of the results was analyzed using the two-tailed student's t-test.
[00122] Chromatin Immunoprecipitation (ChIP) assay: Primary mammary epithelial cells were isolated as described above, with the following modification for the tissue digestion step. Briefly, thoracic and inguinal mammary glands were isolated from 6-8 week virgin mice. Lymph nodes were removed from the inguinal glands. Tissues were quickly minced with scissors and digested in DMEM F-12 containing 2% FBS, Penicillin-Streptomycin and a final concentration of 300 U/ml Collagenase and 100 U/ml Hyaluronidase (StemCell Technologies, Cat# 07912) for 45 min with gentle shaking. Samples were vortexed vigorously for 15 sec every 15 min during the digestion. After tissue digestion mammary organoids were collected and RBCs were lysed. Organoids were further digested by Trypsin and Dispase, and single mammary epithelial cells were obtained after passing through cell strainer, as described above. Cells were crosslinked in crosslinking solution (1% formaldehyde, 10% FBS in PBS) for 10 min at room temperature, and the reaction was terminated with 125 mM Glycine for 5 min at room temperature. The crosslinking reagents were removed by spinning at 1600 g for 5 min at 40C, and cells were washed with cold PBS containing 2% FBS twice at 1600 g for 5 min. From this step on until ChIP elution, all buffers were prepared with freshly added cocktail of phosphatase and protease inhibitors (10 mM sodium fluoride, 10 mM sodium pyrophosphate tetrabasic, 2 mM sodium orthovanadate, 1 μg/ml leupeptin, 1 μg/ml aprotinin, 1 μg/ml pepstatin and 1 mM PMSF). Cells were lysed on ice for 10 min using lysis buffer (5 mM HEPES, pH 7.9, 85 mM KC1, 0.5% Triton-X-100). Supernatant was removed after spinning at 1600 g for 5 min at 40C, and cells were resuspended for 10 min at 40C in nuclei lysis buffer [50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 0.5% (wt/vol) SDS]. Nuclei were isolated by spinning at 14,000 g for 10 min at 40C and resuspended in RIPA buffer [10 mM Tris-HCl, pH 7.5, 140 mM NaCl, 1 mM EDTA, 0.5mM EGTA, 1% Triton-X-100, 0.1% (wt/vol) SDS, 0.1% sodium deoxycholate]. Chromosomal DNA was sonicated using a probe sonicator 30 s on and 30 s off (4 cycles) at 25% power on ice. Cells were centrifuged at 14,000 g for 10 min and the supernatant was saved. Protein-A Dynabeads were washed and prebound with antibodies (anti-RNAPII, Abeam, ab5408, anti-NELF-A/B) for 2 hr at 40C. Sonicated DNA and antibody-bound Dynabeads were incubated at 40C overnight. For RNAPII ChIP,
Dynabeads were washed 3 times in RIPA buffer and once in TE buffer (10 mM Tris-HCl, pH 8.0, 10 mM EDTA), then reverse-crosslinked and eluted. For NELF-A/B ChIP, Dynabeads were washed twice in TE Sarcosyl buffer (50 mM Tris-HCl pH 8.0, 2 mM EDTA, 0.2% sarcosyl), twice in TSE1 buffer [150 mM sodium chloride, 20 mM Tris-HCl pH 8.0, 2 mM EDTA, 0.1% (wt/vol) SDS, 1% Triton-X-100], twice in TSE2 buffer [500 mM sodium chloride, 20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 0.1% (wt/vol) SDS, 0.1% Triton-X-100], twice in TSE3 buffer (250 mM lithium chloride, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1% sodium deoxycholate, 1% NP-40), and twice in TE buffer. Samples were subsequently reverse-crosslinked and eluted.
[00123] DNA-RNA ImmunoPrecipitation (DRIP): DRIP assay was performed following the established protocol47. Briefly, primary mammary epithelial cells were isolated as described above in the ChIP assay. Cells were washed twice in PBS, and resuspended in TE (Sigma, T9285) containing a final concentration of 0.5% SDS and proteinase K (Roche, 031 15828001). Samples were incubated overnight at 370C. Genomic DNA was extracted using phenol/chloroform (Sigma, P2069) in phase lock tubes (5 PRIME, 2302840) and ethanol precipitated. DNA was digested using established restriction enzyme cocktail (Hindlll, EcoRI, BsrGI, Xbal and Sspl) overnight at 370C. Digested DNA was cleaned up by phenol-chloroform extraction and ethanol precipitation. For DRIP, digested DNA was incubated with S9.6 antibody overnight at 40C in binding buffer (10 mM sodium phosphate, 140 mM sodium chloride, 0.05% Triton X-100 in TE). RNase H-treated sample was used as a negative control for DRIP. Dynabeads were added the next day for 2 hr. Bound
Dynabeads were then washed with binding buffer three times at room temperature. DNA was eluted, phenol-chloroform extracted, and ethanol precipitated. DRIP DNA was sonicated using Covaris (Model S220) before library preparation.
[00124] Library preparation and sequencing: ChlP-seq and DRIP-seq libraries were built following the instruction of MicroPlex library preparation kit (Diagenode, C05010011). For RNAPII ChlP-seq, 1 ng of ChIP DNA was used for a total of 15 cycles of PCR
amplification. For NELF-A/B ChlP-seq, 0.2 ng ChIP DNA were used for a total of 18 cycles of PCR amplification. For DRIP-seq, a total of 15 cycles of PCR amplification was performed. After amplification, libraries were purified using Agencourt AMPure XP system (Beckman Coulter, A63880) following the product manual. Quantity of the libraries was measured with Qubit dsDNA HS Assay Kit (Life Technologies, Q32851), and quality of the libraries was verified using Bioanalyzer 2100. Libraries were pooled based on index sequences. 14pM library pool was loaded to Illumina HiSeq2000 and sequenced by 50bp single-read sequencing module. After sequencing run, demultiplexing with CASAVA was employed to generate the FASTQ file for each sample. Two biological replicates were used for RNAPII ChlP-seq and DRIP-seq and between 38-64 million total reads were obtained for each biological sample.
[00125] Bioinformatics analysis of ChlP-seq and DRIP-seq: Reads in FASTQ file were aligned to mouse genome by BWA99, a software package for mapping low-divergent sequences against reference genome, and only unique mapped reads were selected for analysis. BELT100, a peak-calling program, was used to identify the peaks (binding sites) for uniquely mapped reads. In brief, BELT employs a bin-based enrichment threshold to define peaks and applies a statistical method to control false discovery rate (FDR). With different parameters, BELT identifies different number of peaks, and generally higher number of peaks is more likely to be associated with higher FDR. In this study, using the same parameters, the estimated FDR of identified peaks for all samples are all less than 8% except for NELF-B ChlP-seq. TSS-bound peaks were identified by 1 bp overlap to TSS upstream/downstream 1 kb region of mouse reference genes. Venn diagrams of the overlap genes were generated by BioVennlOl, a web application for comparison and visualization of biological lists. The p-value of the significance of the overlap in the Venn diagrams was calculated by hypergeometric distribution.
[00126] Primer sequences: For RT-PCR: 18sRNA-F: 5'- GAATTCCCAGTAAGTGCGGG-3 ' (SEQ ID NO: l), 18sRNA-R: 5'- GGGCAGGGACTTAATCAACG-3 ' (SEQ ID NO:2). Cobral-F: 5'- ACAACTTCTTCAGCCCTTCCC-3' (SEQ ID NO:3), Cobral-R: 5'- TCTGCACCACCTCTCCTTGG-3'(SEQ ID NO:4). Brcal-F: 5'- AGC AAAC AGCCTGGC ATAGC-3 ' (SEQ ID NO:5), Brcal-R: 5'- ACTTGCAGCCCATCTGCTCT-3'(SEQ ID NO:6). pl6Ink4a-F: 5'- GAACTCTTTCGGTCGTACCCC-3 ' (SEQ ID NO:7), pl6Ink4a-R: 5'- CGTGAACGTTGCCCATCAT-3 '(SEQ ID NO:8). pl9Arf-F: 5'- CTTGAGAAGAGGGCCGCAC-3 '(SEQ ID NO:9), pl9Arf-R: 5'- AACGTTGCCCATCATCATCA-3'(SEQ ID NO: 10). p53-F: 5'- GAGAC AGC AGGGCTC ACTCC-3 ' (SEQ ID NO: 11), p53-R: 5'- TGGCCCTTCTTGGTCTTC AG-3 ' (SEQ ID NO: 12). Ctse-F: 5'- ATTGGCAGATTGCCCTGGAT-3 ' (SEQ ID NO: 13), Ctse-R: 5'- GCCTTCGGAGCAGAACATC A-3 ' (SEQ ID NO: 14). Prom2-F: 5'- TGACCTGGATAAGC ACCTGG-3 ' (SEQ ID NO: 15), Prom2-R: 5'- AAGCTCTGAAGCTCCTGCTG-3 ' (SEQ ID NO: 16). Acotl-F: 5'- ATGGC AGC AGCTCC AGACTT-3 ' (SEQ ID NO: 17), Acotl-R: 5'- CCCAACCTCCAAACCATCAT-3' (SEQ ID NO: 18). Ramp2-F: 5'- GCCTCATCCCGTTCCTTGTT-3 ' (SEQ ID NO: 19), Ramp2-R: 5'- CCTGGGCATCGCTGTCTTTA-3 ' (SEQ ID NO:20). Vwf-F: 5'- CGACCTGGAGTGTATGAGCC-3 ' (SEQ ID NO:21), Vwf-R: 5'- AC AC ACTTGTTTTCGTGCCG-3 ' (SEQ ID NO:22). Gata3-F: 5'- GATGTAAGTCGAGGCCC AAG-3 ' (SEQ ID NO:23), Gata3-R: 5'- GCAGGCATTGCAAAGGTAGT-3 '(SEQ ID NO:24). K18-F: 5'- ACTCCGC AAGGTGGTAGATGA-3 ' (SEQ ID NO:25), K18-R: 5'- TCCACTTCCACAGTCAATCCA-3'(SEQ ID NO: 26), K14-F: 5'- AGCGGCAAGAGTGAGATTTCT-3 ' (SEQ ID NO:27), K14-R: 5'- CCTCCAGGTTATTCTCCAGGG -3' (SEQ ID NO:28) , K5-F: 5'- GAGATCGCCACCTACAGGAA-3 ' (SEQ ID NO:29), K5-R: 5'- TCCTCCGTAGCCAGAAGAGA-3 ' (SEQ ID NO:30), Vimentin-F: 5'- CGGCTGCGAGAGAAATTGC-3 ' (SEQ ID N0:31), Vimentin-R: 5'- CCACTTTCCGTTCAAGGTCAAG-3' (SEQ ID NO:32), β-Actin-F: 5'- CGGTTCCGATGCCCTGAGGCTCTT-3' (SEQ ID NO:33), β-Actin-R: 5'- CGTCACACTTCATGATGGAATTGA-3 SEQ ID N0.34).
1 Levy-Lahad, E. & Friedman, E. Cancer risks among BRCA1 and BRCA2 mutation carriers. Br J Cancer 96, 11-15 (2007).
2 Lim, E. et al. Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers. Nat Med 15, 907-913 (2009).
3 Molyneux, G. et al. BRCA1 basal-like breast cancers originate from luminal epithelial progenitors and not from basal stem cells. Cell Stem Cell 7, 403-417 (2010).
4 Proia, T. A. et al. Genetic predisposition directs breast cancer phenotype by dictating progenitor cell fate. Cell Stem Cell 8, 149-163 (2011).
5 Visvader, J. E. Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis. Genes Dev 23, 2563-2577 (2009).
6 Rios, A. C, Fu, N. Y., Lindeman, G. J. & Visvader, J. E. In situ identification of bipotent stem cells in the mammary gland. Nature 506, 322-327 (2014).
7 Marquis, S. T. et al. The developmental pattern of Brcal expression implies a role in differentiation of the breast and other tissues. Nat Genet. 11, 17-26 (1995).
8 King, M. C. "The race" to clone BRCAl. Science 343, 1462-1465 (2014).
9 Silver, D. P. & Livingston, D. M. Mechanisms of BRCAl tumor suppression.
Cancer Discov 2, 679-684 (2012).
10 Venkitaraman, A. R. Cancer Suppression by the Chromosome Custodians, BRCAl and BRCA2. Science 343, 1470-1475 (2014).
11 Lee, E. Y. & Abbondante, S. Tissue-specific tumor suppression by BRCAl. Proc Natl Acad Sci U S A 111, 4353-4354 (2014).
12 Couch, F. J., Nathanson, K. L. & Offit, K. Two decades after BRCA: setting paradigms in personalized cancer care and prevention. Science 343, 1466-1470 (2014).
13 Xu, X. L. et al. Rb suppresses human cone-precursor-derived retinoblastoma tumours. Nature 514, 385-388 (2014).
14 Bremner, R. & Sage, J. Cancer: The origin of human retinoblastoma. Nature 514, 312-313 (2014).
15 Derheimer, F. A. & Kastan, M. B. Multiple roles of ATM in monitoring and maintaining DNA integrity. FEBS Lett 584, 3675-3681 (2010).
16 Valentin-Vega, Y. A. et al. Mitochondrial dysfunction in ataxia-telangiectasia. Blood 119, 1490-1500 (2012).
17 Huen, M. S., Sy, S. M. & Chen, J. BRCAl and its toolbox for the maintenance of genome integrity. Nat Rev Mol Cell Biol 11, 138-148 (2010). 18 Moynahan, M. E. & Jasin, M. Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis. Nat Rev Mol Cell Biol 11, 196-207 (2010).
19 Zhang, J. & Powell, S. N. The role of the BRCAl tumor suppressor in DNA double- strand break repair. Mol Cancer Res 3, 531-539 (2005).
20 Xu, X. et al. Genetic interactions between tumor suppressors BRCAl and p53 in apoptosis, cell cycle and tumorigenesis. Nat Genet 28, 266-271 (2001).
21 Parameswaran, B. et al. Damage-Induced BRCAl Phosphorylation by Chk2 Contributes to the Timing of End Resection. Cell Cycle 4, 437-448 (2015).
22 Zhu, Q. et al. BRCAl tumour suppression occurs via heterochromatin-mediated silencing. Nature 477, 179-184 (2011).
23 Rosen, E. M., Fan, S. & Ma, Y. BRCAl regulation of transcription. Cancer Lett 236, 175-185 (2006).
24 Scully, R. et al. BRCAl is a component of the RNA polymerase II holoenzyme. Proc Natl Acad Sci U S A 94, 5605-5610 (1997).
25 Fan, S. et al. BRCAl inhibition of estrogen receptor signaling in transfected cells. Science 284, 1354-1356 (1999).
26 Tkocz, D. et al. BRCAl and GAT A3 corepress FOXC1 to inhibit the pathogenesis of basal-like breast cancers. Oncogene 31, 3667-3678 (2012).
27 Gorski, J. J. et al. Profiling of the BRCAl transcriptome through microarray and ChlP-chip analysis. Nucleic Acids Res 39, 9536-9548 (2011).
28 Consortium, E. P. et al. An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012).
29 Gardini, A., Baillat, D., Cesaroni, M. & Shiekhattar, R. Genome-wide analysis reveals a role for BRCAl and PALB2 in transcriptional co-activation. EMBO J 33, 890-90 (2014).
30 Bhatia, V. et al. BRCA2 prevents R-loop accumulation and associates with TREX-2 mRNA export factor PCID2. Nature 511, 362-365 (2014).
31 Hill, S. J. et al. Systematic screening reveals a role for BRCAl in the response to transcription-associated DNA damage. Genes Dev 28, 1957-1975 (2014).
32 Hatchi, E. et al. BRCAl Recruitment to Transcriptional Pause Sites Is Required for R-Loop-Driven DNA Damage Repair. Mol Cell 57, 636-647 (2015).
33 Svejstrup, J. Q. The interface between transcription and mechanisms maintaining genome integrity. Trends Biochem Sci 35, 333-338 (2010). 34 Gan, W. et al. R-loop-mediated genomic instability is caused by impairment of replication fork progression. Genes Dev 25, 2041-2056 (2011).
35 Kim, N. & Jinks-Robertson, S. Transcription as a source of genome instability. Nat Rev Genet 13, 204-214 (2012).
36 Saponaro, M. et al. RECQL5 controls transcript elongation and suppresses genome instability associated with transcription stress. Cell 157, 1037-1049 (2014).
37 Aguilera, A. & Garcia-Muse, T. R loops: from transcription byproducts to threats to genome stability. Mol Cell 46, 115-124 (2012).
38 Skourti-Stathaki, K. & Proudfoot, N. J. A double-edged sword: R loops as threats to genome integrity and powerful regulators of gene expression. Genes Dev 28, 1384-1396 (2014).
39 Hamperl, S. & Cimprich, K. A. The contribution of co-transcriptional RNA:DNA hybrid structures to DNA damage and genome instability. DNA Repair (Amst) 19, 84-94 (2014).
40 Groh, M. & Gromak, N. Out of balance: R-loops in human disease. PLoS Genet 10, el004630 (2014).
41 Aguilera, A. The connection between transcription and genomic instability. EMBO J 21, 195-201 (2002).
42 Huertas, P. & Aguilera, A. Cotranscriptionally formed DNA:RNA hybrids mediate transcription elongation impairment and transcription-associated recombination. Mol Cell 12, 711-721 (2003).
43 Skourti-Stathaki, K., Proudfoot, N. J. & Gromak, N. Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination. Mol Cell 42, 794-805 (2011).
44 Skourti-Stathaki, K., Kamieniarz-Gdula, K. & Proudfoot, N. J. R-loops induce repressive chromatin marks over mammalian gene terminators. Nature 516, 436-439 (2014).
45 Powell, W. T. et al. R-loop formation at Snordl 16 mediates topotecan inhibition of Ube3a-antisense and allele-specific chromatin decondensation. Proc Natl Acad Sci U S A 110, 13938-13943 (2013).
46 Sun, Q., Csorba, T., Skourti-Stathaki, K., Proudfoot, N. J. & Dean, C. R-loop stabilization represses antisense transcription at the Arabidopsis FLC locus. Science 340, 619-621 (2013). 47 Ginno, P. A., Lott, P. L., Christensen, H. C, Korf, I. & Chedin, F. R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters. Mol Cell 45, 814-825 (2012).
48 Nakama, M., Kawakami, K., Kajitani, T., Urano, T. & Murakami, Y. DNA-RNA hybrid formation mediates RNAi-directed heterochromatin formation. Genes Cells 17, 218- 233 (2012).
49 Ye, Q. et al. BRCA1 -induced large-scale chromatin unfolding and allele-specific effects of cancer-predisposing mutations. J Cell Biol 155, 91 1-921 (2001).
50 Yamaguchi, Y. et al. NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell 97, 41 -51 (1999).
51 Narita, T. et al. Human transcription elongation factor NELF: identification of novel subunits and reconstitution of the functionally active complex. Mol Cell Biol 23, 1863-1873 (2003).
52 Levine, M. Paused RNA Polymerase II as a Developmental Checkpoint. Cell 145, 502-51 1 (201 1).
53 Kwak, H. & Lis, J. T. Control of Transcriptional Elongation. Annu Rev Genet 47, 483-508 (2013).
54 Adelman, K. & Lis, J. T. Promoter-proximal pausing of RNA polymerase II:
emerging roles in metazoans. Nat Rev Genet 13, 720-731 (2012).
55 Gilchrist, D. A. et al. Pausing of RNA polymerase II disrupts DNA-specified nucleosome organization to enable precise gene regulation. Cell 143, 540-551 (2010).
56 Sun, J. & Li, R. Human negative elongation factor activates transcription and regulates alternative transcription initiation. J Biol Chem 285, 6443-6452 (2010).
57 Aiyar, S. E. et al. Attenuation of estrogen receptor alpha-mediated transcription through estrogen-stimulated recruitment of a negative elongation factor. Genes Dev 18, 2134-2146 (2004).
58 Kininis, M., Isaacs, G. D., Core, L. J., Hah, N. & Kraus, W. L. Postrecruitment regulation of RNA polymerase II directs rapid signaling responses at the promoters of estrogen target genes. Mol Cell Biol 29, 1 123-1 133 (2009).
59 Danko, C. G. et al. Signaling pathways differentially affect RNA polymerase II initiation, pausing, and elongation rate in cells. Mol Cell 50, 212-222 (2013).
60 Jennings, B. H. Pausing for thought: disrupting the early transcription elongation checkpoint leads to developmental defects and tumourigenesis. Bioessays 35, 553-560 (2013). 61 Amleh, A. et al. Mouse Cofactor of BRCA1 (Cobral) is Required for Early Embryogenesis. PloS One 4, e5034 (2009).
62 Williams, L. H. et al. Pausing of RNA Polymerase II Regulates Mammalian Developmental Potential through Control of Signaling Networks. Mol Cell (2015).
63 Pan, H. et al. RNA Polymerase II Pausing Factor NELF Controls Energy
Homeostasis in Cardiomyocytes. Cell Rep 7, 79-85 (2014).
64 Wagner, K. U. et al. Cre-mediated gene deletion in the mammary gland. Nucleic Acids Res 27, 4323-4330 (1997).
65 Shackleton, M. et al. Generation of a functional mammary gland from a single stem cell. Nature 439, 84-88 (2006).
66 Xu, X. et al. Conditional mutation of Brcal in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nat Genet 22, 37-43 (1999).
67 Smart, C. E. et al. Analysis of Brcal -deficient mouse mammary glands reveals reciprocal regulation of Brcal and c-kit. Oncogene 30, 1597-1607 (2011).
68 Kim, W. Y. & Sharpless, N. E. The regulation of INK4/ARF in cancer and aging. Cell 127, 265-275 (2006).
69 Collado, M., Blasco, M. A. & Serrano, M. Cellular senescence in cancer and aging. Cell 130, 223-233 (2007).
70 Jacobs, J. J., Kieboom, K., Marino, S., DePinho, R. A. & van Lohuizen, M. The oncogene and Poly comb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature 397, 164-168 (1999).
71 Pietersen, A. M. et al. Bmil regulates stem cells and proliferation and differentiation of committed cells in mammary epithelium. Curr Biol 18, 1094-1099 (2008).
72 Bruggeman, S. W. et al. Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmil -deficient mice. Genes Dev 19, 1438-1443 (2005).
73 Molofsky, A. V., He, S., Bydon, M., Morrison, S. J. & Pardal, R. Bmi-1 promotes neural stem cell self-renewal and neural development but not mouse growth and survival by repressing the pl6Ink4a and pl9Arf senescence pathways. Genes Dev 19, 1432-1437 (2005).
74 Biehs, B. et al. BMI1 represses Ink4a/Arf and Hox genes to regulate stem cells in the rodent incisor. Nat Cell Biol 15, 846-852 (2013).
75 Hakem, R. et al. The Tumor Suppressor Gene Brcal Is Required for Embryonic Cellular Proliferation in the Mouse. Cell 85, 1009-1023 (1996). 76 Hakem, R., de la Pompa, J. L., Elia, A., Potter, J. & Mak, T. W. Partial rescue of Brcal (5-6) early embryonic lethality by p53 or p21 null mutation. Nat Genet 16, 298-302 (1997).
77 Ludwig, T., Chapman, D. L., Papaioannou, V. E. & Efstratiadis, A. Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brcal, Brca2, Brcal/Brca2, Brcal/p53, and Brca2/p53 nullizygous embryos. Genes Dev 1 1, 1226-1241 (1997).
78 McBryan, I, Howlin, I, Kenny, P. A., Shioda, T. & Martin, F. ERalpha-CITED 1 co-regulated genes expressed during pubertal mammary gland development: implications for breast cancer prognosis. Oncogene 26, 6406-6419 (2007).
79 Lu, S. et al. Transcriptional responses to estrogen and progesterone in mammary gland identify networks regulating p53 activity. Endocrinology 149, 4809-4820 (2008).
80 Deng, C. X. & Xu, X. Generation and analysis of Brcal conditional knockout mice. Methods Mol Biol 280, 185-200 (2004).
81 Shehata, M. et al. Phenotypic and functional characterization of the luminal cell hierarchy of the mammary gland. Breast Cancer Res 14, R134 (2012).
82 Cao, L. et al. A selective requirement for 53BP1 in the biological response to genomic instability induced by Brcal deficiency. Mol Cell 35, 534-541 (2009).
83 Bunting, S. F. et al. 53BP1 inhibits homologous recombination in Brcal -deficient cells by blocking resection of DNA breaks. Cell 141 , 243-254 (2010).
84 Pierce, A. I, Hu, P., Han, M., Ellis, N. & Jasin, M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev 15, 3237-3242 (2001).
85 Ira, G. et al. DNA end resection, homologous recombination and DNA damage checkpoint activation require CDK1. Nature 431 , 1011 -1017 (2004).
86 Jazayeri, A. et al. ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks. Nat Cell Biol 8, 37-45 (2006).
87 Scully, R. et al. Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88, 265-275 (1997).
88 Phillips, D. D. et al. The sub-nanomolar binding of DNA-RNA hybrids by the single-chain Fv fragment of antibody S9.6. J Mol Recognit 26, 376-381 (2013).
89 Hu, Y.-F. et al. Modulation of aromatase expression by BRCA1 : a possible link to tissue-specific tumor suppression. Oncogene 24, 8343-8348 (2005). 90 Poole, A. J. et al. Prevention of Brcal -mediated mammary tumorigenesis in mice by a progesterone antagonist. Science 314, 1467-1470 (2006).
91 Gorrini, C. et al. Estrogen controls the survival of BRCA1 -deficient cells via a PI3K-NRF2-regulated pathway. Proc Natl Acad Sci U S A 111, 4472-4477 (2014).
92 Tomasetti, C. & Vogelstein, B. Cancer etiology. Variation in cancer risk among tissues can be explained by the number of stem cell divisions. Science 347, 78-81 (2015).
93 Rosen, J. M. & Roarty, K. Paracrine signaling in mammary gland development: what can we learn about intratumoral heterogeneity? Breast Cancer Res 16, 202 (2014).
94 Visvader, J. E. & Stingl, J. Mammary stem cells and the differentiation hierarchy: current status and perspectives. Genes Dev 28, 1143-1158 (2014).
95 Radovich, M. et al. Characterizing the heterogeneity of triple-negative breast cancers using microdissected normal ductal epithelium and RNA-sequencing. Breast Cancer Res Treat 143, 57-68 (2014).
96 Gyorffy, B. et al. An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1,809 patients. Breast Cancer Res Treat 123, 725-731 (2010).
97 Stingl, J. et al. Purification and unique properties of mammary epithelial stem cells. Nature. 439, 993-997 (2006).
98 Ransburgh, D. J., Chiba, N., Ishioka, C, Toland, A. E. & Parvin, J. D. Identification of breast tumor mutations in BRCA1 that abolish its function in homologous DNA recombination. Cancer Res 70, 988-995 (2010).
99 Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760 (2009).
100 Lan, X., Bonneville, R., Apostolos, J., Wu, W. & Jin, V. X. W-ChlPeaks: a comprehensive web application tool for processing ChlP-chip and ChlP-seq data.
Bioinformatics 27, 428-430 (2011).
101 Hulsen, T., de Vlieg, J. & Alkema, W. BioVenn - a web application for the comparison and visualization of biological lists using area-proportional Venn diagrams. BMC Genomics 9, 488 (2008).

Claims

CLAIMS We claim:
1. A method of diagnosing whether a subject is at risk of developing breast cancer, comprising
(a) obtaining a biological sample from the subject;
(b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier;
(c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and
(d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
2. The method of claim 1 , wherein the subject is a BRCA mutation carrier.
3. The method of claim 2, wherein the BRCA mutation carrier is a BRCA1 or BRCA2 mutation carrier.
4. The method of claim 1 , wherein the non-BRCA mutation carrier is a subject having two wild type copies of the BRCA gene.
5. The method of claim 1, wherein the hybridization assay includes an ELISPOT assay, ELISA, fluorescent immunoassays, two-antibody sandwich assays, a flow-through or strip test format, PCR, Real time PCR, Reverse Transcription-PCR (RT-PCR), immunohistochemistry, or DNA/RNA immunoprecipitation.
6. The method of claim 1, the hybridization assay is carried out with an R-loop
antibody.
7. The method of claim 1, wherein the sample comprises one or more of tissue, blood, bone marrow, plasma, serum, urine, and feces.
8. The method of claim 7, wherein the sample comprises breast tissue.
9. The method of claim 7, wherein the sample comprises epithelial cells.
10. The method of claim 9, wherein epithelial cells are luminal epithelial cells.
11. The method of claim 1, further comprising administering to said subject a
therapeutically effective amount of a given therapeutic.
12. A method for treating breast cancer in a subject, comprising administering to said subj ect a therapeutically effective amount of a given therapeutic when the subject is diagnosed with increased risk of developing breast cancer by the steps of (a) obtaining a biological sample from the subject;
(b) measuring the level of R-loop in the biological sample by conducting at least one hybridization assay of the biological sample so as to obtain physical data to determine whether the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier;
(c) comparing the level of R-loop in the biological sample with the level of R-loop in a control sample from a non-BRCA mutation carrier; and
(d) identifying the subject is at risk of developing breast cancer if the physical data indicate that the level of R-loop in the biological sample is higher than the level of R-loop in a control sample from a non-BRCA mutation carrier.
A method of treating a subject having an increase in breast epithelium R-loop comprising administering a treatment to the subject that reduces or eliminates R- loop, wherein the subject is a BRCA1 mutation carrier.
The method of claim 13, wherein the treatment is increasing expression and/or activity of RNase H or decreasing COBRAl expression and/or activity.
A method of reducing tumor incidence in BRCA1 -deficient subjects comprising administering a treatment that reduces or eliminates Cobral activity.
The method of claim 15, wherein the treatment comprises siRNA that targets Cobral mRNA.
A method of increasing mammary gland development in Cobra-deficient subjects comprising administering a treatment that reduces or eliminates BRCA1 activity. The method of claim 17, wherein the treatment comprises siRNA.
The method of claim 17, wherein the siRNA targets BRCA1 mRNA.
A method of increasing mammary gland development in Cobra-deficient subjects comprising administering a treatment that alters transcription of one or more puberty-related genes, estrogen-responsive genes or progesterone-responsive genes. The method of claim 20, wherein the puberty-related genes are Gata3, Prlr, Ramp2, Vwf, Prom2, or Acotl.
The method of claim 20, wherein the estrogen-responsive genes are
2410081M15RIK, 6430706D22RIK, ACOT1, ACTB, ARL4A, BCL6B, CTSH, CXCL9, EMCN, GBP6, GGTA1, HOXA7, PABPC 1, PDLIM1 , PDLIM2, PROM2, PTPN14, SLC02B1 , STARD10, TMEM2, WIPI1, or a combination thereof.
The method of claim 20, wherein the progesterone-responsive genes are
5730593F17RIK, CCDC80, CDH13, CLDN5, CRYZ, EDN1, IRX1, NOXOl, PKP2, PRKCDBP, PSEN2, SLC7A3, SPNB3, or a combination thereof.
The method of claim 20, wherein a treatment that alters transcription comprises a treatment that increases transcription. The method of claim 20, wherein a treatment that alters transcription comprises a treatment that decreases transcription.
PCT/US2016/030730 2015-05-04 2016-05-04 Methods of diagnosing and treating breast cancer Ceased WO2016179254A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/571,819 US20180346989A1 (en) 2015-05-04 2016-05-04 Methods of diagnosing and treating breast cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562156686P 2015-05-04 2015-05-04
US62/156,686 2015-05-04

Publications (1)

Publication Number Publication Date
WO2016179254A1 true WO2016179254A1 (en) 2016-11-10

Family

ID=56098332

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/030730 Ceased WO2016179254A1 (en) 2015-05-04 2016-05-04 Methods of diagnosing and treating breast cancer

Country Status (2)

Country Link
US (1) US20180346989A1 (en)
WO (1) WO2016179254A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019139967A1 (en) * 2018-01-09 2019-07-18 Board Of Regents Of The University Of Texas System Methods of detection and treatment of hyper transcription diseases
CN114032236A (en) * 2021-09-24 2022-02-11 南通市肿瘤医院 shRNA of TMEM2 and application thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TWI796420B (en) * 2018-01-22 2023-03-21 國立陽明交通大學 Method to enhance the transcription regulation of supt4h on genes containing repetitive nucleotide sequences
WO2021016203A1 (en) * 2019-07-19 2021-01-28 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Pdlim2 as a biomarker for cancer and as an anti-cancer treatment target
CN120114588B (en) * 2025-05-14 2025-08-26 天津医科大学 A drug combination for promoting anti-tumor immunity and its application in preparing drugs for treating tumors

Non-Patent Citations (104)

* Cited by examiner, † Cited by third party
Title
"The Sequence Listing", 3 May 2016, article "21105_0027P1_Sequence_Listing.txt"
ADELMAN, K.; LIS, J. T.: "Promoter-proximal pausing of RNA polymerase II: emerging roles in metazoans", NAT REV GENET, vol. 13, 2012, pages 720 - 731
AGUILERA, A.: "The connection between transcription and genomic instability", EMBO J, vol. 21, 2002, pages 195 - 201
AGUILERA, A.; GARCIA-MUSE, T.: "R loops: from transcription byproducts to threats to genome stability", MOL CELL, vol. 46, 2012, pages 115 - 124, XP028420433, DOI: doi:10.1016/j.molcel.2012.04.009
AIYAR, S. E. ET AL.: "Attenuation of estrogen receptor alpha-mediated transcription through estrogen-stimulated recruitment of a negative elongation factor", GENES DEV, vol. 18, 2004, pages 2134 - 2146
AMLEH, A. ET AL.: "Mouse Cofactor of BRCA1 (Cobral) is Required for Early Embryogenesis", PLOS ONE, vol. 4, 2009, pages E5034
BHATIA, V. ET AL.: "BRCA2 prevents R-loop accumulation and associates with TREX-2 mRNA export factor PCID2", NATURE, vol. 511, 2014, pages 362 - 365, XP055287838, DOI: doi:10.1038/nature13374
BIEHS, B. ET AL.: "BMI1 represses Ink4a/Arf and Hox genes to regulate stem cells in the rodent incisor", NAT CELL BIOL, vol. 15, 2013, pages 846 - 852
BREMNER, R.; SAGE, J.: "Cancer: The origin of human retinoblastoma", NATURE, vol. 514, 2014, pages 312 - 313
BRUGGEMAN, S. W. ET AL.: "Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmil-deficient mice", GENES DEV, vol. 19, 2005, pages 1438 - 1443
BUNTING, S. F. ET AL.: "53BP1 inhibits homologous recombination in Brcal-deficient cells by blocking resection of DNA breaks", CELL, vol. 141, 2010, pages 243 - 254
CAO, L. ET AL.: "A selective requirement for 53BP1 in the biological response to genomic instability induced by Brcal deficiency", MOL CELL, vol. 35, 2009, pages 534 - 541
COLLADO, M.; BLASCO, M. A.; SERRANO, M: "Cellular senescence in cancer and aging", CELL, vol. 130, 2007, pages 223 - 233, XP055008896, DOI: doi:10.1016/j.cell.2007.07.003
CONSORTIUM, E. P. ET AL.: "An integrated encyclopedia of DNA elements in the human genome", NATURE, vol. 489, 2012, pages 57 - 74, XP055045368, DOI: doi:10.1038/nature11247
COUCH, F. J.; NATHANSON, K. L.; OFFIT, K.: "Two decades after BRCA: setting paradigms in personalized cancer care and prevention", SCIENCE, vol. 343, 2014, pages 1466 - 1470
DANKO, C. G. ET AL.: "Signaling pathways differentially affect RNA polymerase II initiation, pausing, and elongation rate in cells", MOL CELL, vol. 50, 2013, pages 212 - 222, XP028589791, DOI: doi:10.1016/j.molcel.2013.02.015
DENG, C. X.; XU, X.: "Generation and analysis of Brcal conditional knockout mice", METHODS MOL BIOL, vol. 280, 2004, pages 185 - 200
DERHEIMER, F. A.; KASTAN, M. B.: "Multiple roles of ATM in monitoring and maintaining DNA integrity", FEBS LETT, vol. 584, 2010, pages 3675 - 3681
FAN, S. ET AL.: "BRCA1 inhibition of estrogen receptor signaling in transfected cells", SCIENCE, vol. 284, 1999, pages 1354 - 1356
GAN, W. ET AL.: "R-loop-mediated genomic instability is caused by impairment of replication fork progression", GENES DEV, vol. 25, 2011, pages 2041 - 2056
GARDINI, A.; BAILLAT, D.; CESARONI, M.; SHIEKHATTAR, R.: "Genome-wide analysis reveals a role for BRCA1 and PALB2 in transcriptional co-activation", EMBO J, vol. 33, 2014, pages 890 - 90
GILCHRIST, D. A. ET AL.: "Pausing of RNA polymerase II disrupts DNA-specified nucleosome organization to enable precise gene regulation", CELL, vol. 143, 2010, pages 540 - 551, XP028931101, DOI: doi:10.1016/j.cell.2010.10.004
GINNO, P. A.; LOTT, P. L.; CHRISTENSEN, H. C.; KORF, I.; CHEDIN, F.: "R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters", MOL CELL, vol. 45, 2012, pages 814 - 825
GORRINI, C. ET AL.: "Estrogen controls the survival of BRCA1-deficient cells via a PI3K-NRF2-regulated pathway", PROC NATL ACAD SCI U S A, vol. 111, 2014, pages 4472 - 4477
GORSKI, J. J. ET AL.: "Profiling of the BRCA1 transcriptome through microarray and ChIP-chip analysis", NUCLEIC ACIDS RES, vol. 39, 2011, pages 9536 - 9548
GROH, M.; GROMAK, N.: "Out of balance: R-loops in human disease", PLOS GENET, vol. 10, 2014, pages EL004630
GYORFFY, B. ET AL.: "An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1,809 patients", BREAST CANCER RES TREAT, vol. 123, 2010, pages 725 - 731, XP002665257, DOI: doi:10.1007/S10549-009-0674-9
HAKEM, R. ET AL.: "The Tumor Suppressor Gene Brcal Is Required for Embryonic Cellular Proliferation in the Mouse", CELL, vol. 85, 1996, pages 1009 - 1023, XP002174576, DOI: doi:10.1016/S0092-8674(00)81302-1
HAKEM, R.; DE LA POMPA, J. L.; ELIA, A.; POTTER, J.; MAK, T. W.: "Partial rescue of Brcal (5-6) early embryonic lethality by p53 or p21 null mutation", NAT GENET, vol. 16, 1997, pages 298 - 302
HAMPERL, S.; CIMPRICH, K. A.: "The contribution of co-transcriptional RNA:DNA hybrid structures to DNA damage and genome instability", DNA REPAIR (AMST, vol. 19, 2014, pages 84 - 94
HATCHI, E. ET AL.: "BRCA1 Recruitment to Transcriptional Pause Sites Is Required for R-Loop-Driven DNA Damage Repair", MOL CELL, vol. 57, 2015, pages 636 - 647, XP029199503, DOI: doi:10.1016/j.molcel.2015.01.011
HILL, S. J. ET AL.: "Systematic screening reveals a role for BRCA1 in the response to transcription-associated DNA damage", GENES DEV, vol. 28, 2014, pages 1957 - 1975, XP055287817, DOI: doi:10.1101/gad.241620.114
HU, Y.-F. ET AL.: "Modulation of aromatase expression by BRCA1: a possible link to tissue-specific tumor suppression", ONCOGENE, vol. 24, 2005, pages 8343 - 8348
HUEN, M. S.; SY, S. M.; CHEN, J.: "BRCA1 and its toolbox for the maintenance of genome integrity", NAT REV MOL CELL BIOL, vol. 11, 2010, pages 138 - 148
HUERTAS, P.; AGUILERA, A: "Cotranscriptionally formed DNA:RNA hybrids mediate transcription elongation impairment and transcription-associated recombination", MOL CELL, vol. 12, 2003, pages 711 - 721
HULSEN, T.; DE VLIEG, J.; ALKEMA, W: "BioVenn - a web application for the comparison and visualization of biological lists using area-proportional Venn diagrams", BMC GENOMICS, vol. 9, 2008, pages 488, XP021042226, DOI: doi:10.1186/1471-2164-9-488
IRA, G. ET AL.: "DNA end resection, homologous recombination and DNA damage checkpoint activation require CDK1", NATURE, vol. 431, 2004, pages 1011 - 1017
JACOBS, J. J.; KIEBOOM, K.; MARINO, S.; DEPINHO, R. A.; VAN LOHUIZEN, M.: "The oncogene and Poly comb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus", NATURE, vol. 397, 1999, pages 164 - 168
JAZAYERI, A. ET AL.: "ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks", NAT CELL BIOL, vol. 8, 2006, pages 37 - 45
JENNINGS, B. H.: "Pausing for thought: disrupting the early transcription elongation checkpoint leads to developmental defects and tumourigenesis", BIOESSAYS, vol. 35, 2013, pages 553 - 560
KIM, N.; JINKS-ROBERTSON, S.: "Transcription as a source of genome instability", NAT REV GENET, vol. 13, 2012, pages 204 - 214
KIM, W. Y.; SHARPLESS, N. E.: "The regulation of INK4/ARF in cancer and aging", CELL, vol. 127, 2006, pages 265 - 275
KING, M. C.: "The race'' to clone BRCA1", SCIENCE, vol. 343, 2014, pages 1462 - 1465
KININIS, M.; ISAACS, G. D.; CORE, L. J.; HAH, N.; KRAUS, W. L.: "Postrecruitment regulation of RNA polymerase II directs rapid signaling responses at the promoters of estrogen target genes", MOL CELL BIOL, vol. 29, 2009, pages 1123 - 1133
KWAK, H.; LIS, J. T.: "Control of Transcriptional Elongation", ANNU REV GENET, vol. 47, 2013, pages 483 - 508
LAN, X.; BONNEVILLE, R.; APOSTOLOS, J.; WU, W.; JIN, V. X.: "W-ChIPeaks: a comprehensive web application tool for processing ChIP-chip and ChIP-seq data", BIOINFORMATICS, vol. 27, 2011, pages 428 - 430
LEE, E. Y.; ABBONDANTE, S.: "Tissue-specific tumor suppression by BRCA1", PROC NATL ACAD SCI U S A, vol. 111, 2014, pages 4353 - 4354
LEVINE, M.: "Paused RNA Polymerase II as a Developmental Checkpoint", CELL, vol. 145, 2011, pages 502 - 511, XP028374835, DOI: doi:10.1016/j.cell.2011.04.021
LEVY-LAHAD, E.; FRIEDMAN, E.: "Cancer risks among BRCA1 and BRCA2 mutation carriers", BR J CANCER, vol. 96, 2007, pages 11 - 15
LI, H.; DURBIN, R: "Fast and accurate short read alignment with Burrows-Wheeler transform", BIOINFORMATICS, vol. 25, 2009, pages 1754 - 1760, XP055287430, DOI: doi:10.1093/bioinformatics/btp324
LIM, E. ET AL.: "Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers", NAT MED, vol. 15, 2009, pages 907 - 913, XP002677998, DOI: doi:10.1038/NM.2000
LU, S. ET AL.: "Transcriptional responses to estrogen and progesterone in mammary gland identify networks regulating p53 activity", ENDOCRINOLOGY, vol. 149, 2008, pages 4809 - 4820
LUDWIG, T.; CHAPMAN, D. L.; PAPAIOANNOU, V. E.; EFSTRATIADIS, A.: "Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brcal, Brca2, Brcal/Brca2, Brcal/p53, and Brca2/p53 nullizygous embryos", GENES DEV, vol. 11, 1997, pages 1226 - 1241
MARQUIS, S. T. ET AL.: "The developmental pattern of Brcal expression implies a role in differentiation of the breast and other tissues", NAT GENET., vol. 11, 1995, pages 17 - 26
MCBRYAN, J.; HOWLIN, J.; KENNY, P. A.; SHIODA, T.; MARTIN, F.: "ERalpha-CITEDl co-regulated genes expressed during pubertal mammary gland development: implications for breast cancer prognosis", ONCOGENE, vol. 26, 2007, pages 6406 - 6419
MOLOFSKY, A. V.; HE, S.; BYDON, M.; MORRISON, S. J.; PARDAL, R.: "Bmi-1 promotes neural stem cell self-renewal and neural development but not mouse growth and survival by repressing the pl6Ink4a and pl9Arf senescence pathways", GENES DEV, vol. 19, 2005, pages 1432 - 1437, XP002511653, DOI: doi:10.1101/GAD.1299505
MOLYNEUX, G. ET AL.: "BRCA1 basal-like breast cancers originate from luminal epithelial progenitors and not from basal stem cells", CELL STEM CELL, vol. 7, 2010, pages 403 - 417
MOYNAHAN, M. E.; JASIN, M.: "Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis", NAT REV MOL CELL BIOL, vol. 11, 2010, pages 196 - 207
NAKAMA, M.; KAWAKAMI, K.; KAJITANI, T.; URANO, T.; MURAKAMI, Y.: "DNA-RNA hybrid formation mediates RNAi-directed heterochromatin formation", GENES CELLS, vol. 17, 2012, pages 218 - 233
NARITA, T. ET AL.: "Human transcription elongation factor NELF: identification of novel subunits and reconstitution of the functionally active complex", MOL CELL BIOL, vol. 23, 2003, pages 1863 - 1873
PAN, H. ET AL.: "RNA Polymerase II Pausing Factor NELF Controls Energy Homeostasis in Cardiomyocytes", CELL REP, vol. 7, 2014, pages 79 - 85
PARAMESWARAN, B. ET AL.: "Damage-Induced BRCA1 Phosphorylation by Chk2 Contributes to the Timing of End Resection", CELL CYCLE, vol. 4, 2015, pages 437 - 448
PHILLIPS, D. D. ET AL.: "The sub-nanomolar binding of DNA-RNA hybrids by the single-chain Fv fragment of antibody S9.6", J MOL RECOGNIT, vol. 26, 2013, pages 376 - 381
PIERCE, A. J.; HU, P.; HAN, M.; ELLIS, N.; JASIN, M. KU: "DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells", GENES DEV, vol. 15, 2001, pages 3237 - 3242
PIETERSEN, A. M. ET AL.: "Bmil regulates stem cells and proliferation and differentiation of committed cells in mammary epithelium", CURR BIOL, vol. 18, 2008, pages 1094 - 1099
POOLE, A. J. ET AL.: "Prevention of Brcal-mediated mammary tumorigenesis in mice by a progesterone antagonist", SCIENCE, vol. 314, 2006, pages 1467 - 1470, XP002492265, DOI: doi:10.1126/science.1130471
POWELL, W. T. ET AL.: "R-loop formation at Snordl 16 mediates topotecan inhibition of Ube3a-antisense and allele-specific chromatin decondensation", PROC NATL ACAD SCI U S A, vol. 110, 2013, pages 13938 - 13943
PROIA, T. A. ET AL.: "Genetic predisposition directs breast cancer phenotype by dictating progenitor cell fate", CELL STEM CELL, vol. 8, 2011, pages 149 - 163, XP028364665, DOI: doi:10.1016/j.stem.2010.12.007
RADOVICH, M. ET AL.: "Characterizing the heterogeneity of triple-negative breast cancers using microdissected normal ductal epithelium and RNA-sequencing", BREAST CANCER RES, vol. 143, 2014, pages 57 - 68, XP055172672, DOI: doi:10.1007/s10549-013-2780-y
RANSBURGH, D. J.; CHIBA, N.; ISHIOKA, C.; TOLAND, A. E.; PARVIN, J. D.: "Identification of breast tumor mutations in BRCA1 that abolish its function in homologous DNA recombination", CANCER RES, vol. 70, 2010, pages 988 - 995
RIOS, A. C.; FU, N. Y.; LINDEMAN, G. J.; VISVADER, J. E: "In situ identification of bipotent stem cells in the mammary gland", NATURE, vol. 506, 2014, pages 322 - 327, XP055240938, DOI: doi:10.1038/nature12948
ROSEN, E. M.; FAN, S.; MA, Y.: "BRCA1 regulation of transcription", CANCER LETT, vol. 236, 2006, pages 175 - 185, XP025021545, DOI: doi:10.1016/j.canlet.2005.04.037
ROSEN, J. M.; ROARTY, K.: "Paracrine signaling in mammary gland development: what can we learn about intratumoral heterogeneity?", BREAST CANCER RES, vol. 16, 2014, pages 202, XP021195395, DOI: doi:10.1186/bcr3610
SAPONARO, M. ET AL.: "RECQL5 controls transcript elongation and suppresses genome instability associated with transcription stress", CELL, vol. 157, 2014, pages 1037 - 1049, XP029028622, DOI: doi:10.1016/j.cell.2014.03.048
SARAH J. HILL ET AL: "Systematic screening reveals a role for BRCA1 in the response to transcription-associated DNA damage", GENES AND DEVELOPMENT (COLD SPRING HARBOUR LABORATORY PRESS), vol. 28, no. 17, 1 September 2014 (2014-09-01), Laurel Hollow, New York, USA, pages 1957 - 1975, XP055287817, ISSN: 0890-9369, DOI: 10.1101/gad.241620.114 *
SCULLY, R. ET AL.: "Association of BRCA1 with Rad51 in mitotic and meiotic cells", CELL, vol. 88, 1997, pages 265 - 275
SCULLY, R. ET AL.: "BRCA1 is a component of the RNA polymerase II holoenzyme", PROC NATL ACAD SCI U S A, vol. 94, 1997, pages 5605 - 5610
SHACKLETON, M. ET AL.: "Generation of a functional mammary gland from a single stem cell", NATURE, vol. 439, 2006, pages 84 - 88, XP002567665, DOI: doi:10.1038/nature04372
SHEHATA, M. ET AL.: "Phenotypic and functional characterization of the luminal cell hierarchy of the mammary gland", BREAST CANCER RES, vol. 14, 2012, pages R134, XP021130355, DOI: doi:10.1186/bcr3334
SILVER, D. P.; LIVINGSTON, D. M.: "Mechanisms of BRCA1 tumor suppression", CANCER DISCOV, vol. 2, 2012, pages 679 - 684
SKOURTI-STATHAKI, K.; KAMIENIARZ-GDULA, K.; PROUDFOOT, N. J.: "R-loops induce repressive chromatin marks over mammalian gene terminators", NATURE, vol. 516, 2014, pages 436 - 439
SKOURTI-STATHAKI, K.; PROUDFOOT, N. J.: "A double-edged sword: R loops as threats to genome integrity and powerful regulators of gene expression", GENES DEV, vol. 28, 2014, pages 1384 - 1396
SKOURTI-STATHAKI, K.; PROUDFOOT, N. J.; GROMAK, N.: "Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination", MOL CELL, vol. 42, 2011, pages 794 - 805, XP028100312, DOI: doi:10.1016/j.molcel.2011.04.026
SMART, C. E. ET AL.: "Analysis of Brcal-deficient mouse mammary glands reveals reciprocal regulation of Brcal and c-kit", ONCOGENE, vol. 30, 2011, pages 1597 - 1607
STINGL, J. ET AL.: "Purification and unique properties of mammary epithelial stem cells", NATURE, vol. 439, 2006, pages 993 - 997, XP002465395
SUN, J.; LI, R.: "Human negative elongation factor activates transcription and regulates alternative transcription initiation", J BIOL CHEM, vol. 285, 2010, pages 6443 - 6452
SUN, Q.; CSORBA, T.; SKOURTI-STATHAKI, K.; PROUDFOOT, N. J.; DEAN, C.: "R-loop stabilization represses antisense transcription at the Arabidopsis FLC locus", SCIENCE, vol. 340, 2013, pages 619 - 621
SVEJSTRUP, J. Q.: "The interface between transcription and mechanisms maintaining genome integrity", TRENDS BIOCHEM SCI, vol. 35, 2010, pages 333 - 338, XP027077329, DOI: doi:10.1016/j.tibs.2010.02.001
TKOCZ, D. ET AL.: "BRCA1 and GATA3 corepress FOXC1 to inhibit the pathogenesis of basal-like breast cancers", ONCOGENE, vol. 31, 2012, pages 3667 - 3678
TOMASETTI, C.; VOGELSTEIN, B.: "Cancer etiology. Variation in cancer risk among tissues can be explained by the number of stem cell divisions", SCIENCE, vol. 347, 2015, pages 78 - 81
V. BHATIA ET AL: "BRCA2 prevents R-loop accumulation and associates with TREX-2 mRNA export factor PCID2", NATURE (MACMILLAN PRESS), vol. 511, no. 7509, 1 June 2014 (2014-06-01), Basingstoke, United Kingdom, pages 362 - 365, XP055287838, ISSN: 0028-0836, DOI: 10.1038/nature13374 *
VALENTIN-VEGA, Y. A. ET AL.: "Mitochondrial dysfunction in ataxia-telangiectasia", BLOOD, vol. 119, 2012, pages 1490 - 1500
VENKITARAMAN, A. R.: "Cancer Suppression by the Chromosome Custodians, BRCA1 and BRCA2", SCIENCE, vol. 343, 2014, pages 1470 - 1475
VISVADER, J. E.; STINGL, J.: "Mammary stem cells and the differentiation hierarchy: current status and perspectives", GENES DEV, vol. 28, 2014, pages 1143 - 1158, XP055241024, DOI: doi:10.1101/gad.242511.114
VISVADER, J. E: "Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis", GENES DEV, vol. 23, 2009, pages 2563 - 2577
WAGNER, K. U. ET AL.: "Cre-mediated gene deletion in the mammary gland", NUCLEIC ACIDS RES, vol. 27, 1997, pages 4323 - 4330, XP002334273, DOI: doi:10.1093/nar/25.21.4323
WILLIAMS, L. H. ET AL.: "Pausing of RNA Polymerase II Regulates Mammalian Developmental Potential through Control of Signaling Networks", MOL CELL, 2015
XU, X. ET AL.: "Conditional mutation of Brcal in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation", NAT GENET, vol. 22, 1999, pages 37 - 43
XU, X. ET AL.: "Genetic interactions between tumor suppressors BRCA1 and p53 in apoptosis, cell cycle and tumorigenesis", NAT GENET, vol. 28, 2001, pages 266 - 271
XU, X. L. ET AL.: "Rb suppresses human cone-precursor-derived retinoblastoma tumours", NATURE, vol. 514, 2014, pages 385 - 388
YAMAGUCHI, Y. ET AL.: "NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation", CELL, vol. 97, 1999, pages 41 - 51, XP002924588, DOI: doi:10.1016/S0092-8674(00)80713-8
YE, Q. ET AL.: "BRCA1-induced large-scale chromatin unfolding and allele-specific effects of cancer-predisposing mutations", J CELL BIOL, vol. 155, 2001, pages 911 - 921
ZHANG, J.; POWELL, S. N.: "The role of the BRCA1 tumor suppressor in DNA double-strand break repair", MOL CANCER RES, vol. 3, 2005, pages 531 - 539
ZHU, Q. ET AL.: "BRCA1 tumour suppression occurs via heterochromatin-mediated silencing", NATURE, vol. 477, 2011, pages 179 - 184

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019139967A1 (en) * 2018-01-09 2019-07-18 Board Of Regents Of The University Of Texas System Methods of detection and treatment of hyper transcription diseases
CN114032236A (en) * 2021-09-24 2022-02-11 南通市肿瘤医院 shRNA of TMEM2 and application thereof

Also Published As

Publication number Publication date
US20180346989A1 (en) 2018-12-06

Similar Documents

Publication Publication Date Title
Maglic et al. YAP‐TEAD signaling promotes basal cell carcinoma development via ac‐JUN/AP1 axis
Wang et al. EZH2 Mediates epigenetic silencing of neuroblastoma suppressor genes CASZ1, CLU, RUNX3, and NGFR
Shan et al. miR128-1 inhibits the growth of glioblastoma multiforme and glioma stem-like cells via targeting BMI1 and E2F3
Renganathan et al. GAS5 long non-coding RNA in malignant pleural mesothelioma
Pan et al. MicroRNA-149 inhibits proliferation and invasion of glioma cells via blockade of AKT1 signaling
Liu et al. CCL5 promotes vascular endothelial growth factor expression and induces angiogenesis by down-regulating miR-199a in human chondrosarcoma cells
EP2999797B1 (en) Isoforms of gata6 and nkx2-1 as markers for diagnosis and therapy of cancer and as targets for anti-cancer therapy
Ke et al. Role of microRNA221 in regulating normal mammary epithelial hierarchy and breast cancer stem-like cells
Liang et al. Long non-coding RNA, HOTAIRM1, promotes glioma malignancy by forming a ceRNA network
US20180346989A1 (en) Methods of diagnosing and treating breast cancer
Cutting et al. The potential role of microRNAs in regulating gonadal sex differentiation in the chicken embryo
Du et al. The significance and therapeutic potential of GATA3 expression and mutation in breast cancer: a systematic review
WO2012073047A2 (en) Compositions and methods
Sun et al. Stem cell competition driven by the Axin2-p53 axis controls brain size during murine development
Chen et al. The long non-coding RNA MACC1-AS1 promotes nasopharyngeal carcinoma cell stemness via suppressing miR-145-mediated inhibition on SMAD2/MACC1-AS1 axis
Yu et al. Long noncoding RNA uc. 230/CUG-binding protein 1 axis sustains intestinal epithelial homeostasis and response to tissue injury
Tsang et al. A study of meiomitosis and novel pathways of genomic instability in cutaneous T-cell lymphomas (CTCL)
Nair et al. Genetic suppression reveals DNA repair-independent antagonism between BRCA1 and COBRA1 in mammary gland development
Shin et al. Overexpression of Id1 in transgenic mice promotes mammary basal stem cell activity and breast tumorigenesis
Peng et al. PiRNA-4447944 promotes castration-resistant growth and metastasis of prostate cancer by inhibiting NEFH expression through forming the piRNA-4447944-PIWIL2-NEFH complex
Zhang et al. [Retracted] Extracellular Vesicles Derived from Lung Cancer Cells Induce Transformation of Normal Fibroblasts into Lung Cancer‐Associated Fibroblasts and Promote Metastasis of Lung Cancer by Delivering lncRNA HOTAIR
Anoushirvani et al. Role of non-coding RNAs in neuroblastoma
Talbot et al. Sonic hedgehog medulloblastomas are dependent on Netrin-1 for survival
Magnani et al. Epigenetic Disordering Drives Stemness, Senescence Escape and Tumor Heterogeneity
CN115927333B (en) piR-36249 gene analogs and their use in preventing and treating cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16726997

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16726997

Country of ref document: EP

Kind code of ref document: A1