WO2016176493A1 - Treatment of medical conditions - Google Patents

Abstract

Methods and compositions are provided for the treatment of medical conditions associated with cyclophilin D or USP16 activity. Aspects of the methods include screens to identify therapeutics for the treatment of autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder associated with increased cyclophilin D activity or that would be responsive to a change in a cyclophilin D activity.

Description

TREATMENT OF MEDICAL CONDITIONS

CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62/155, 128, filed April 30, 2015, which application is incorporated herein by reference in its entirety.

GOVERNMENT RIGHTS

[0002] This invention was made with Government support under contract CA100225 awarded by the National Institutes of Health, and contract W81XWH-13-1-0281 awarded by the Department of Defense. The Government has certain rights in the invention.

BACKGROUND OF THE INVENTION

[0003] Down's syndrome (DS) is one of the most common genetic abnormalities in humans and most often results from full or partial trisomy of chromosome 21. It is a complex clinical syndrome associated with higher risk of multiple pathological conditions, including heart problems, motor skills and cognitive deficits, a reduced incidence of solid tumors, and both early onset and higher incidence of aging-related phenomena such as Alzheimer's disease (Antonarakis, S. E., et al. Chromosome 21 and Down's syndrome: from genomics to pathophysiology. Nat. Rev. Genet. 5, 725-738 (2004); Yang, Q., et al. Mortality associated with Down's syndrome in the USA from 1983 to 1997: a population-based study. Lancet 359, 1019- 1025 (2002); Satge, D. et al. A tumor profile in Down's syndrome. Am. J. Med. Genet. 78, 207- 216 (1998); Roth, G. et al. Premature aging in persons with Down's syndrome: MR findings. AJNR Am J Neuroradiol 17, 1283-1289 (1996); Carmeliet, G., et al. Cellular ageing of Alzheimer's disease and Down's syndrome cells in culture. Mutat. Res. 256, 221-231 (1991); Zigman, W. B. et al. Alzheimer's disease in Down's syndrome: neurobiology and risk. Ment Retard Dev Disabil Res Rev 13, 237-246 (2007)).

[0004] Down's syndrome is but one of many medical conditions that are associated with increased risk of type 1 and type 2 diabetes, increased risk of osteoporosis, and increased risk of autoimmune diseases. The present disclosure addresses these issues.

SUMMARY OF THE INVENTION

[0005] Methods, compositions and screening assays are provided that relate to the inhibition of H2A deubiquitinating enzyme activity, or interactions with cellular regulators in cells for the treatment of medical conditions associated with Down's Syndrome, including those associated with a reduced rate of stem cell self-renewal or that will be responsive to an increased rate of stem cell self-renewal. In some embodiments the individual is a human. In some embodiments, the individual human has full or partial trisomy of chromosome 21. In others the In some embodiments the H2A deubiquitinating enzyme is USP16. Aspects of the methods include inhibiting H2A deubiquitinating enzyme activity in cells, e.g. by administering an effective amount of an H2A enzyme antagonist, including inhibitors of its deubiquitinating activity. Also provided are screens to identify therapeutics for the treatment of medical conditions by inhibition of H2A deubiquitinating enzyme activity.

[0006] In some embodiments of the invention, inhibition of USP16 is associated with amelioration of various diseases, including without limitation diabetes type I and type II, osteoporosis, celiac disease, and hypothyroidism. These conditions can be complications of Down's Syndrome, but can arise in people without Down's syndrome.

[0007] In some specific embodiments, screening methods are provided for inhibitors of USP16.

High throughput assays can be initially performed on large numbers of drug candidates to determine molecules capable of binding to, or modulating the activity of USP16, including by not exclusively it's deubiquitination activity. In some embodiments, the screening assays are drawn, optionally in combination with an initial screen to select candidate agents, to treating Ts65Dn mice to reduce abnormally high baseline glucose levels. In other embodiments, the assays are drawn to determining the effect of the candidate agent on mesenchymal stem cells, hematopoietic stem cells, pancreatic islet cells, etc., which cells are involved in glucose metabolism.

[0008] In some specific embodiments, screening methods, assays and methods of treatment are directed to inhibiting USP16 for the treatment of osteoporosis. Screening methods include determining the effect of a USP16 inhibitor on bone density in an animal model, e.g. in the Ts65Dn mouse, or in cells derived therefrom including mesenchymal cells. The candidate inhibitor may be previously identified in, for example, a high throughput screening assay. Cells of interest for bone density effects include mesenchymal stem cells (MSC), and bone progenitor cells, including osteoblast and osteoclast cells derived therefrom. In some embodiments, the effect of a USP16 inhibitor on the ability of MSC to produce osteoblasts is determined in the absence and presence of a candidate USP16 inhibitor, e.g. determining the effect on proliferation defects in the MSC.

[0009] In other embodiments, methods, compositions and screening methods are provided for the treatment of medical conditions associated with proliferation defects in Down's Syndrome by treatment with inhibitors of cyclophilin D activity. In some embodiments, pancreatic islet cells are protected from senescence by contacting the cells with an effective dose of an inhibitor of cyclophilin D. Screening methods may include determining the effect of a candidate agent, e.g. an agent identified as inhibiting cyclophilin D, on the proliferation defects of progenitor cells, e.g. rescue from premature senescence. Useful progenitor cells for this purpose include, without limitation, MSC, central fat cells, pancreatic islet cells, bone progenitors, hematopoietic stem cells, etc. A decrease in reactive oxygen species may also be monitored as an indicia of the effectiveness of the agent. Agents active in such assays are useful in the treatment of the relevant condition, e.g. diabetes, osteoporosis, etc.

[0010] Screens may include assaying for or inhibiting (or activating) cyclophilin D activity and/or assaying for or inhibiting (or activating) superoxide in cells, e.g., by administering an effective amount of a cyclophilin D antagonist (or agonist) or superoxide antagonist (or agonist) and may further include assaying for or activating (or inhibiting) proliferation of mesenchymal cells. These and other objects, advantages, and features of the invention will become apparent to those persons skilled in the art upon reading the details of the compositions and methods as more fully described below.

BRIEF DESCRIPTION OF THE DRAWINGS

[0011] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity. Included in the drawings are the following figures.

[0012] Figure 1. Usp 16 affects glucose metabolism in Down Syndrome mice models. A,B Blood glucose levels were measured after normal diet (A) or after 6 hours fasting (B). Glucose levels are higher in Ts65Dn mice, especially after fasting. C,D Glucose tolerance tests were performed on mice fasted for 6 hours by i.p. glucose injection (2g/Kg). Glucose levels were analyzed after 30 minutes (C) and after 90 minutes (D). Glucose levels were higher in Ts65Dn compared to WT mice, but not in Ts65Dn/Usp16 mice. After 90 minutes glucose levels were normalized in WT and Ts65Dn/Usp16 mice, but not in Ts65Dn mice.

[0013] Figure 2. Usp16 affects bone mineral density in Down's Syndrome mice models.

Experiments were performed in 6 to 8 months old male mice. Four to eight mice were analyzed per group. Bone mineral density at lumbar level was determined through dual energy X-ray absorptiometry (DXA) analyses. The graphs indicate p-values (* < 0.05 **0.01 ***0.001 ns=non- significant). [0014] Figure 3. Cyclosporine A protects Ts65dn mesenchymal progenitors from premature senescence. Cyclosporine A protects Ts65dn mesenchymal progenitors from premature senescence. Fluorescence activated cell sorting (FACS) analyses of hematopoietic progenitor cells (KLS= Lineage- Ckit+ Sca+ cells, enriched for stem cells) isolated from bone marrow of wild type and Ts65Dn tibiae. Mitosox staining indicates the level of superoxide production from the mitochondria. The levels of superoxide are significantly higher in Ts65Dn cells.

[0015] Figure 4. Proliferation of mouse fibroblasts isolated from the indicated mouse strain is shown. Treatment of Ts65Dn mouse mesenchymal progenitor cells with Cyclosporine A partially rescues the proliferation defect of the cells.

DETAILED DESCRIPTION OF THE INVENTION

[0016] Before the present methods and compositions are described, it is to be understood that this invention is not limited to particular method or composition described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0017] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0018] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. It is understood that the present disclosure supersedes any disclosure of an incorporated publication to the extent there is a contradiction. [0019] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

[0020] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and reference to "the peptide" includes reference to one or more peptides and equivalents thereof, e.g. polypeptides, known to those skilled in the art, and so forth.

[0021] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

[0022] Methods and compositions are provided for the treatment of a medical condition that is associated with a reduced rate of stem cell self-renewal or that will be responsive to, i.e. be treated by, an increased rate of stem cell self-renewal. Stem cells may be subject to premature senescence, which is treated by contacting the cells with an effective dose of an inhibitor of USP16; or with an inhibitor of cyclophilin D.

[0023] By a medical condition that is associated with a reduced rate of stem cell self-renewal or that will be responsive to an increased rate of stem cell self-renewal (i.e. the "subject medical condition"), it is meant a disease, disorder, or other medical condition in which the tissue manifesting the disease, disorder or other condition is deficient in somatic cells (e.g. the tissue- specific stem cells that gave rise to the tissue had a defect in proliferation or differentiation), or for which additional somatic cells may treat the condition (e.g. in a tissue that has suffered damage, e.g. in tissues having tissue-specific stem cells have become quiescent, e.g. in adult tissue). Examples of conditions that are associated with a reduced rate of stem cell self- renewal or that will be responsive to an increased rate of stem cell self-renewal include neurodevelopmental disorders, e.g. Down's Syndrome, fragile-X syndrome, autism; brain injury, e.g. chemotherapy or radiation-induced brain injury, traumatic brain injury; neurodegenerative diseases, e.g. Alzheimer's Disease, Parkinson's disease, ALS; aging-associated disorders, e.g. rheumatoid arthritis; muscle atrophy, e.g. muscle atrophy associated with diseases or disorders such as cancer, AIDS, congestive heart failure, COPD (chronic obstructive pulmonary disease), and renal failure; bone marrow deficiency; diseases requiring the regeneration of pancreatic cells, e.g. β islet cells, e.g. diabetes; diseases requiring liver regeneration, e.g. cirrhosis; conditions requiring skin regeneration, e.g. severe burns; bone conditions, diseases, or disorders, e.g., osteogenesis imperfect, osteopenia, osteoporosis, Paget's disease and the like.

[0024] Methods and compositions are provided for the treatment of a medical condition that is associated with an altered (e.g., increased or decreased) rate of cell death or that will be responsive to an altered (e.g., increased or decreased) rate of cell death. By a medical condition that is associated with an altered (e.g., increased or decreased) rate of cell death or that will be responsive to an altered (e.g., increased or decreased) rate of cell death (i.e. the "subject medical condition"), it is meant a disease, disorder, or other medical condition in which the tissue manifesting the disease, disorder or other condition has an alteration (e.g., increased or decreased) rate of cell death. Examples of conditions that are associated with altered (e.g., increased or decreased) rate of cell death include neurodevelopmental disorders, e.g. Down's Syndrome, fragile-X syndrome, autism; brain injury, e.g. chemotherapy or radiation-induced brain injury, traumatic brain injury; autoimmune and immunological dysfunction related conditions, disorders, and diseases (e.g., celiac disease, Crohn's disease; osteoporosis; thyroid disease such as hypothyroidism); neurodegenerative diseases, e.g. Alzheimer's Disease, Parkinson's disease, ALS; aging-associated disorders, e.g. rheumatoid arthritis; muscle atrophy, e.g. muscle atrophy associated with diseases or disorders such as cancer, AIDS, congestive heart failure, COPD (chronic obstructive pulmonary disease), and renal failure; bone marrow deficiency; diseases requiring the regeneration of pancreatic cells, e.g. β islet cells, e.g. type I (insulin dependent) and type 2 (insulin resistant) diabetes; diseases requiring liver regeneration, e.g. cirrhosis; conditions requiring skin regeneration, e.g. severe burns; and the like.

[0025] By "treatment", "treating" and the like it is generally meant obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. "Treatment" as used herein covers any treatment of a disease in a mammal, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or (c) relieving the disease, i.e., causing regression of the disease. The therapeutic agent may be administered before, during or after the onset of disease or injury. The treatment of ongoing disease, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, is of particular interest. Such treatment is desirably performed prior to complete loss of function in the affected tissues. The subject therapy will desirably be administered during the symptomatic stage of the disease, and in some cases after the symptomatic stage of the disease. The terms "individual," "subject," "host," and "patient," are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.

[0026] In describing aspects of the invention, the subject compositions will be described first, followed by methods for their use.

COMPOSITIONS

[0027] In some aspects of the invention, compositions are provided that comprise an antagonist of a histone deubiquitinating enzyme. By a deubiquitinating enzyme or "deubiquitinase" it is meant an enzyme that removes a covalently attached ubuiquitin from a protein. By a histone deubiquitinating enzyme, it is meant an enzyme that removes a covalently attached ubiquitin from histones, e.g. the H2A histone, the H2B histone. By an Ή2Α deubiquitinating enzyme" or Ή2Α deubiquitinase", it is meant an enzyme that removes a covalently attached ubiquitin from the histone H2A. Non-limiting examples of H2A deubiquitinating enzymes include 2A- DUB/MYSM1 , USP3, USP7, Ubp-M/USP16, USP21 , USP22, BAP1 , and BRCC36 (BRCA-1 containing complex ) . By a Ή2Α deubiquitinating enzyme antagonist", it is meant any agent that reduces, suppresses, inhibits, antagonizes, etc. the activity of one or more H2A deubiquitinating enzymes in the cell.

[0028] In some embodiments, the subject composition comprises an antagonist or inhibitor of an H2A deubiquitinating enzyme, particularly USP16. Screening methods identify such agonists of USP16, or identify therapeutic activity of candidate USP16 inhibitors. By "USP16" it is meant Ubiquitin Specific Peptidase 16, the sequence for which may be found at GenBank Accession Nos. NM_006447.2 (variant 1), NM_001001992.1 (variant 2), and NM_001032410.1 (variant 3).

[0029] As demonstrated in the working examples herein, USP16 regulates stem cell proliferation and senescence in a number of tissues, including the hematopoietic stem cell compartment, mesenchymal cells and progeny derived therefrom, pancreatic islet cells, etc., including but not limited to cells and conditions associated with Down's Syndrome. As such, inhibiting USP16, will promote the proliferation of stem and progenitor cells. [0030] In other embodiments, it is shown that inhibitors of cyclophilin D regulate stem cell proliferation and senescence in a number of tissues, including the hematopoietic stem cell compartment, mesenchymal cells and progeny derived therefrom, pancreatic islet cells, etc., including but not limited to cells and conditions associated with Down's Syndrome. As such, inhibiting cyclophilin D, will promote the proliferation of stem and progenitor cells.

[0031] Any agent that inhibits USP16 or cyclophilin D in stem and progenitor cells, e.g. as known in the art, as described herein, or as identified using the screening methods described herein, may be employed in the subject compositions. The subject agent may act by, for example, reduce the relative amount of the deubiquitinating enzyme in the cell, block the active site of deubiquitination on the histone, promote the localization of the deubiquitinating enzyme to the cell cytoplasm, promote the ubiquitination of the H2A histone, etc. For example, the subject agent may reduce the activity of USP16 or cyclophilin D by, for example, reducing the relative amount of protein in the cell, e.g. the subject agent may be a nucleic acid inhibitor that is specific for USP16 or cyclophilin D, i.e., it is a specific nucleic acid inhibitor, for example, an antisense RNA, antagomir RNA, shRNA, siRNA, CRISPRi, etc. By "specific", "specific binding," "specifically bind," and the like, it is meant the ability of a binding agent, e.g. nucleic acid, polypeptide, antibody, etc., to preferentially bind directly to a target molecule relative to other molecules or moieties in the cell. In certain embodiments, the affinity between the binding agent and the target to which it specifically binds when they are specifically bound to each other in a binding complex is characterized by a KD (dissociation constant) of less than 10^"6 M, less than 10-7 M, less than 10-8 M, less than 10^"9 M, less than 10^"10 M, less than 10^"11 M, less than 10^"12 M, less than 10^"13 M, less than 10^"14 M, or less than 10^"15 M.

[0032] Agents suitable for use as inhibits USP16 or cyclophilin D in the subject compositions include small molecule compounds, e.g. a naturally occurring or synthetic small molecule compound. Naturally occurring or synthetic small molecule compounds of interest include numerous chemical classes, such as organic molecules, e.g., small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents comprise functional groups for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents may include cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Exemplary of pharmaceutical agents suitable for this invention are those described in, "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw-Hill, New York, N.Y., (1996), Ninth edition. Also included are toxins, and biological and chemical warfare agents, for example see Somani, S. M. (Ed.), "Chemical Warfare Agents," Academic Press, New York, 1992). Small molecule compounds can be provided directly to the medium in which the cells are being cultured, for example as a solution in DMSO or other solvent.

[0033] Agents suitable for use as inhibits USP16 or cyclophilin D in the subject compositions also include nucleic acids, for example, nucleic acids that encode siRNA, shRNA or antisense molecules, or nucleic acids that encode polypeptides. Many vectors useful for transferring nucleic acids into target cells are available. The vectors may be maintained episomally, e.g. as plasmids, minicircle DNAs, virus-derived vectors such cytomegalovirus, adenovirus, etc., or they may be integrated into the target cell genome, through homologous recombination or random integration, e.g. retrovirus derived vectors such as MMLV, HIV-1 , ALV, etc.

[0034] Vectors may be provided directly to the subject cells. In other words, the cells are contacted with vectors comprising the nucleic acid of interest such that the vectors are taken up by the cells. Methods for contacting cells with nucleic acid vectors, such as electroporation, calcium chloride transfection, and lipofection, are well known in the art.

[0035] Alternatively, the nucleic acid of interest may be provided to the subject cells via a virus.

In other words, the cells are contacted with viral particles comprising the nucleic acid of interest. Retroviruses, for example, lentiviruses, are particularly suitable to the method of the invention. Commonly used retroviral vectors are "defective", i.e. unable to produce viral proteins required for productive infection. Rather, replication of the vector requires growth in a packaging cell line. To generate viral particles comprising nucleic acids of interest, the retroviral nucleic acids comprising the nucleic acid are packaged into viral capsids by a packaging cell line. Different packaging cell lines provide a different envelope protein to be incorporated into the capsid, this envelope protein determining the specificity of the viral particle for the cells. Envelope proteins are of at least three types, ecotropic, amphotropic and xenotropic. Retroviruses packaged with ecotropic envelope protein, e.g. MMLV, are capable of infecting most murine and rat cell types, and are generated by using ecotropic packaging cell lines such as BOSC23 (Pear et al. (1993) P.N.A.S. 90:8392-8396). Retroviruses bearing amphotropic envelope protein, e.g. 4070A (Danos et al, supra.), are capable of infecting most mammalian cell types, including human, dog and mouse, and are generated by using amphotropic packaging cell lines such as PA12 (Miller et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol. 6:2895-2902); GRIP (Danos et al. (1988) PNAS 85:6460-6464). Retroviruses packaged with xenotropic envelope protein, e.g. AKR env, are capable of infecting most mammalian cell types, except murine cells. The appropriate packaging cell line may be used to ensure that the subject CD33+ differentiated somatic cells are targeted by the packaged viral particles. Methods of introducing the retroviral vectors comprising the subject nucleic acid into packaging cell lines and of collecting the viral particles that are generated by the packaging lines are well known in the art.

[0036] Vectors used for providing nucleic acid of interest to the subject cells will typically comprise suitable promoters for driving the expression, that is, transcriptional activation, of the nucleic acid of interest. In other words, the nucleic acid of interest will be operably linked to a promoter. This may include ubiquitously acting promoters, for example, the CMV-b-actin promoter, or inducible promoters, such as promoters that are active in particular cell populations or that respond to the presence of drugs such as tetracycline. By transcriptional activation, it is intended that transcription will be increased above basal levels in the target cell by at least about 10 fold, by at least about 100 fold, more usually by at least about 1000 fold. In addition, vectors used for providing the subject nucleic acids to the cells may include genes that must later be removed, e.g. using a recombinase system such as Cre/Lox, or the cells that express them destroyed, e.g. by including genes that allow selective toxicity such as herpesvirus TK, bcl-xs, etc

[0037] Agents suitable for use as inhibits USP16 or cyclophilin D in the subject compositions also include polypeptides. Such polypeptides may optionally be fused to a polypeptide domain that increases solubility of the product. The domain may be linked to the polypeptide through a defined protease cleavage site, e.g. a TEV sequence, which is cleaved by TEV protease. The linker may also include one or more flexible sequences, e.g. from 1 to 10 glycine residues. In some embodiments, the cleavage of the fusion protein is performed in a buffer that maintains solubility of the product, e.g. in the presence of from 0.5 to 2 M urea, in the presence of polypeptides and/or polynucleotides that increase solubility, and the like. Domains of interest include endosomolytic domains, e.g. influenza HA domain; and other polypeptides that aid in production, e.g. IF2 domain, GST domain, GRPE domain, and the like.

[0038] If the polypeptide agent is to inhibits USP16 or cyclophilin D activity intracellular^, the polypeptide may comprise the polypeptide sequences of interest fused to a polypeptide permeant domain. A number of permeant domains are known in the art and may be used in the non-integrating polypeptides of the present invention, including peptides, peptidomimetics, and non-peptide carriers. For example, a permeant peptide may be derived from the third alpha helix of Drosophila melanogaster transcription factor Antennapaedia, referred to as penetratin. As another example, the permeant peptide comprises the HIV-1 tat basic region amino acid sequence, which may include, for example, amino acids 49-57 of naturally-occurring tat protein. Other permeant domains include poly-arginine motifs, for example, the region of amino acids 34-56 of HIV-1 rev protein, nona-arginine, octa-arginine, and the like. (See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003 Apr; 4(2): 87-96; and Wender et al. (2000) Proc. Natl. Acad. Sci. U.S.A 2000 Nov. 21 ; 97(24): 13003-8; published U.S. Patent applications 20030220334; 20030083256; 20030032593; and 20030022831 , herein specifically incorporated by reference for the teachings of translocation peptides and peptoids). The nona-arginine (R9) sequence is one of the more efficient PTDs that have been characterized (Wender et al. 2000; Uemura et al. 2002).

[0039] If the polypeptide agent is to inhibits USP16 or cyclophilin D activity extracellularly, the polypeptide may be formulated for improved stability. For example, the peptides may be PEGylated, where the polyethyleneoxy group provides for enhanced lifetime in the blood stream. The polypeptide may be fused to another polypeptide to provide for added functionality, e.g. to increase the in vivo stability. Generally such fusion partners are a stable plasma protein, which may, for example, extend the in vivo plasma half-life of the polypeptide when present as a fusion, in particular wherein such a stable plasma protein is an immunoglobulin constant domain. In most cases where the stable plasma protein is normally found in a multimeric form, e.g., immunoglobulins or lipoproteins, in which the same or different polypeptide chains are normally disulfide and/or noncovalently bound to form an assembled multichain polypeptide, the fusions herein containing the polypeptide also will be produced and employed as a multimer having substantially the same structure as the stable plasma protein precursor. These multimers will be homogeneous with respect to the polypeptide agent they comprise, or they may contain more than one polypeptide agent.

[0040] Stable plasma proteins are proteins which typically exhibit in their native environment an extended half-life in the circulation, i.e. greater than about 20 hours. Examples of suitable stable plasma proteins are immunoglobulins, albumin, lipoproteins, apolipoproteins and transferrin. The polypeptide agent typically is fused to the plasma protein, e.g. IgG at the N- terminus of the plasma protein or fragment thereof which is capable of conferring an extended half-life upon the polypeptide. Increases of greater than about 100% on the plasma half-life of the polypeptide are satisfactory. Ordinarily, the polypeptide is fused C-terminally to the N- terminus of the constant region of immunoglobulins in place of the variable region(s) thereof, however N-terminal fusions may also find use. Typically, such fusions retain at least functionally active hinge, CH2 and CH3 domains of the constant region of an immunoglobulin heavy chain, which heavy chains may include lgG1 , lgG2a, lgG2b, lgG3, lgG4, IgA, IgM, IgE, and IgD, usually one or a combination of proteins in the IgG class. Fusions are also made to the C- terminus of the Fc portion of a constant domain, or immediately N-terminal to the CH1 of the heavy chain or the corresponding region of the light chain. This ordinarily is accomplished by constructing the appropriate DNA sequence and expressing it in recombinant cell culture. Alternatively, the polypeptides may be synthesized according to known methods.

[0041] The site at which the fusion is made may be selected in order to optimize the biological activity, secretion or binding characteristics of the polypeptide. The optimal site will be determined by routine experimentation.

[0042] In some embodiments the hybrid immunoglobulins are assembled as monomers, or hetero- or homo-multimers, and particularly as dimers or tetramers. Generally, these assembled immunoglobulins will have known unit structures. A basic four chain structural unit is the form in which IgG, IgD, and IgE exist. A four chain unit is repeated in the higher molecular weight immunoglobulins; IgM generally exists as a pentamer of basic four-chain units held together by disulfide bonds. IgA immunoglobulin, and occasionally IgG immunoglobulin, may also exist in a multimeric form in serum. In the case of multimers, each four chain unit may be the same or different.

[0043] The polypeptide agent for use in the subject methods may be produced from eukaryotic produced by prokaryotic cells, it may be further processed by unfolding, e.g. heat denaturation, DTT reduction, etc. and may be further refolded, using methods known in the art.

[0044] Modifications of interest that do not alter primary sequence include chemical derivatization of polypeptides, e.g., acylation, acetylation, carboxylation, amidation, etc. Also included are modifications of glycosylation, e.g. those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g. by exposing the polypeptide to enzymes which affect glycosylation, such as mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences that have phosphorylated amino acid residues, e.g. phosphotyrosine, phosphoserine, or phosphothreonine.

[0045] Also included in the subject invention are polypeptides that have been modified using ordinary molecular biological techniques and synthetic chemistry so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g. D-amino acids or non-naturally occurring synthetic amino acids. D-amino acids may be substituted for some or all of the amino acid residues. [0046] The subject polypeptides may be prepared by in vitro synthesis, using conventional methods as known in the art. Various commercial synthetic apparatuses are available, for example, automated synthesizers by Applied Biosystems, Inc., Beckman, etc. By using synthesizers, naturally occurring amino acids may be substituted with unnatural amino acids. The particular sequence and the manner of preparation will be determined by convenience, economics, purity required, and the like.

[0047] If desired, various groups may be introduced into the peptide during synthesis or during expression, which allow for linking to other molecules or to a surface. Thus cysteines can be used to make thioethers, histidines for linking to a metal ion complex, carboxyl groups for forming amides or esters, amino groups for forming amides, and the like.

[0048] The polypeptides may also be isolated and purified in accordance with conventional methods of recombinant synthesis. A lysate may be prepared of the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique. For the most part, the compositions which are used will comprise at least 20% by weight of the desired product, more usually at least about 75% by weight, preferably at least about 95% by weight, and for therapeutic purposes, usually at least about 99.5% by weight, in relation to contaminants related to the method of preparation of the product and its purification. Usually, the percentages will be based upon total protein.

[0049] Another example of polypeptide agents suitable for use as inhibits USP16 or cyclophilin D in the subject compositions are antibodies. The term "antibody" or "antibody moiety" is intended to include any polypeptide chain-containing molecular structure with a specific shape that fits to and recognizes an epitope, where one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope. The specific or selective fit of a given structure and its specific epitope is sometimes referred to as a "lock and key" fit. The archetypal antibody molecule is the immunoglobulin, and all types of immunoglobulins, IgG, IgM, IgA, IgE, IgD, etc., from all sources, e.g. human, rodent, rabbit, cow, sheep, pig, dog, other mammal, chicken, other avians, etc., are considered to be "antibodies." The term "antibody" herein is used in the broadest sense and specifically covers intact antibodies, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies) formed from at least two intact antibodies, and antibody fragments, so long as they exhibit the desired biological activity. Antibodies are typically provided in the media in which the cells are cultured.

[0050] Agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

[0051] Agents that are inhibits USP16 or cyclophilin D may be readily validated as such by any of a number of convenient methods in the art. For example, the amount of H2AK1 19 ubiquitin mark at the Ink4a/Arf locus in cells can be measured, wherein an increase in ubiquitin mark following treatment with agent indicates that the agent is a USP16 antagonist. As another example, the amount of Ink4a RNA or protein in cells can be assessed, where a decrease in the amount of Cdkn2a including Ink4a RNA/protein following treatment with agent indicates that the agent is a USP16 antagonist. As a third example, the proliferation rate of cells, e.g. Down's syndrome fibroblasts, e.g. fibroblasts and mesenchymal stem cells from the Ts65Dn mouse, may be determined, where an increase in proliferation following treatment with the agent indicates that the agent is a H2A deubiquitinating enzyme antagonist.

[0052] For inclusion in a medicament, the subject agent may be obtained from a suitable commercial source. As a general proposition, the total pharmaceutically effective amount of the subject agent administered parenterally per dose will be in a range that can be measured by a dose response curve.

[0053] Preparations of subject agent to be used for therapeutic administration must be sterile.

Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 μηι membranes). Therapeutic compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle. The subject agent -based therapies may be stored in unit or multi- dose containers, for example, sealed ampules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10-mL vials are filled with 5 ml of sterile-filtered 1 % (w/v) aqueous solution of compound, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized compound using bacteriostatic Water-for-lnjection.

[0054] Pharmaceutical compositions can include, depending on the formulation desired, pharmaceutically-acceptable, non-toxic carriers of diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, buffered water, physiological saline, PBS, Ringer's solution, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation can include other carriers, adjuvants, or non-toxic, nontherapeutic, nonimmunogenic stabilizers, excipients and the like. The compositions can also include additional substances to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, wetting agents and detergents.

[0055] The composition can also include any of a variety of stabilizing agents, such as an antioxidant for example. When the pharmaceutical composition includes a polypeptide, the polypeptide can be complexed with various well-known compounds that enhance the in vivo stability of the polypeptide, or otherwise enhance its pharmacological properties (e.g., increase the half-life of the polypeptide, reduce its toxicity, enhance solubility or uptake). Examples of such modifications or complexing agents include sulfate, gluconate, citrate and phosphate. The nucleic acids or polypeptides of a composition can also be complexed with molecules that enhance their in vivo attributes. Such molecules include, for example, carbohydrates, polyamines, amino acids, other peptides, ions (e.g., sodium, potassium, calcium, magnesium, manganese), and lipids.

[0056] The subject agent can be incorporated into a variety of formulations. More particularly, the subject agent of the present invention can be formulated into pharmaceutical compositions by combination with appropriate pharmaceutically acceptable carriers or diluents.

[0057] Pharmaceutical preparations are compositions that include one or more targeted subject agents present in a pharmaceutically acceptable vehicle. "Pharmaceutically acceptable vehicles" may be vehicles approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, such as humans. The term "vehicle" refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is formulated for administration to a mammal. Such pharmaceutical vehicles can be lipids, e.g. liposomes, e.g. liposome dendrimers; liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, saline; gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents may be used. Pharmaceutical compositions may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres, and aerosols. As such, administration of the subject agent can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intracheal, etc., administration. The active agent may be systemic after administration or may be localized by the use of regional administration, intramural administration, or use of an implant that acts to retain the active dose at the site of implantation. The active agent may be formulated for immediate activity or it may be formulated for sustained release.

[0058] For some conditions, particularly central nervous system conditions, it may be necessary to formulate agents to cross the blood-brain barrier (BBB). One strategy for drug delivery through the blood-brain barrier (BBB) entails disruption of the BBB, either by osmotic means such as mannitol or leukotrienes, or biochemically by the use of vasoactive substances such as bradykinin. The potential for using BBB opening to target specific agents to brain tumors is also an option. A BBB disrupting agent can be co-administered with the therapeutic compositions of the invention when the compositions are administered by intravascular injection. Other strategies to go through the BBB may entail the use of endogenous transport systems, including Caveolin-1 mediated transcytosis, carrier-mediated transporters such as glucose and amino acid carriers, receptor-mediated transcytosis for insulin or transferrin, and active efflux transporters such as p-glycoprotein. Active transport moieties may also be conjugated to the therapeutic compounds for use in the invention to facilitate transport across the endothelial wall of the blood vessel. Alternatively, drug delivery of therapeutics agents behind the BBB may be by local delivery, for example by intrathecal delivery, e.g. through an Ommaya reservoir (see e.g. US Patent Nos. 5,222,982 and 5385582, incorporated herein by reference); by bolus injection, e.g. by a syringe, e.g. intravitreally or intracranially; by continuous infusion, e.g. by cannulation, e.g. with convection (see e.g. US Application No. 20070254842, incorporated here by reference); or by implanting a device upon which the agent has been reversably affixed (see e.g. US Application Nos. 20080081064 and 20090196903, incorporated herein by reference).

[0059] Further guidance regarding formulations that are suitable for various types of administration can be found in Remington's Pharmaceutical Sciences, Mace Publishing Company, Philadelphia, Pa., 17th ed. (1985). For a brief review of methods for drug delivery, see, Langer, Science 249: 1527-1533 (1990).

[0060] The pharmaceutical compositions can be administered for prophylactic and/or therapeutic treatments. Toxicity and therapeutic efficacy of the active ingredient can be determined according to standard pharmaceutical procedures in cell cultures and/or experimental animals, including, for example, determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Therapies that exhibit large therapeutic indices are preferred.

[0061] The data obtained from cell culture and/or animal studies can be used in formulating a range of dosages for humans. The dosage of the active ingredient typically lines within a range of circulating concentrations that include the ED50 with low toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.

[0062] The components used to formulate the pharmaceutical compositions are preferably of high purity and are substantially free of potentially harmful contaminants (e.g., at least National Food (NF) grade, generally at least analytical grade, and more typically at least pharmaceutical grade). Moreover, compositions intended for in vivo use are usually sterile. To the extent that a given compound must be synthesized prior to use, the resulting product is typically substantially free of any potentially toxic agents, particularly any endotoxins, which may be present during the synthesis or purification process. Compositions for parental administration are also sterile, substantially isotonic and made under GMP conditions.

[0063] The effective amount of a therapeutic composition to be given to a particular patient will depend on a variety of factors, several of which will differ from patient to patient. A competent clinician will be able to determine an effective amount of a therapeutic agent to administer to a patient to halt or reverse the progression the disease condition as required. Utilizing LD50 animal data, and other information available for the agent, a clinician can determine the maximum safe dose for an individual, depending on the route of administration. For instance, an intravenously administered dose may be more than an intrathecally administered dose, given the greater body of fluid into which the therapeutic composition is being administered. Similarly, compositions which are rapidly cleared from the body may be administered at higher doses, or in repeated doses, in order to maintain a therapeutic concentration. Utilizing ordinary skill, the competent clinician will be able to optimize the dosage of a particular therapeutic in the course of routine clinical trials.

[0064] The calculation of the effective amount or effective dose of agent to be administered is within the skill of one of ordinary skill in the art, and will be routine to those persons skilled in the art. Needless to say, the final amount to be administered will be dependent upon the route of administration and upon the nature of the disorder or condition that is to be treated. METHODS

[0065] In practicing the subject methods, the agent that inhibits USP16 or cyclophilin D is contacted with a stem or progenitor cell. The term "stem cell" is used herein to refer to a mammalian cell that has the ability both to self renew and to generate a differentiated cell type (see Morrison et al. (1997) Cell 88:287-298). In the context of cell ontogeny, the adjective "differentiated", or "differentiating" is a relative term. A "differentiated cell" is a cell that has progressed further Down's the developmental pathway than the cell it is being compared with. Thus, pluripotent stem cells (described below) can differentiate into further restricted stem cells (e.g., Epiblast stem cells (described below), mesodermal stem cells, mesenchymal stem cells, and the like), which in turn can differentiate into cells that are further restricted (e.g., cardiomyocyte progenitors, neural progenitors, and the like), which can differentiate into end- stage cells (i.e., terminally differentiated cells, e.g., neurons, skeletal muscle cells, cardiomyocytes, adipocytes, osteoblasts, and the like), which play a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further. Different types of stem cells may be characterized by both the presence of specific markers (e.g., proteins, RNAs, etc.) and the absence of specific markers. Stem cells may also be identified by functional assays both in vitro and in vivo, particularly assays relating to the ability of stem cells to give rise to particular types of differentiated progeny.

[0066] When a stem cell divides symmetrically, both resulting daughter cells are equivalent. For example, a stem cell may undergo a self-renewing symmetric division in which both resulting daughter cells are stem cells with an equal amount of differentiation potential as the mother cell. However, a symmetric division is not necessarily a self-renewing division because both resulting daughter cells may instead be differentiated relative to the mother cell. When a stem cell divides asymmetrically, the resulting daughter cells are different than one another. For example, if a stem cell undergoes a self-renewing asymmetric division, then one of the resulting daughter cells is a stem cell with the same amount of differentiation potential as the mother cell while the other daughter cell is differentiated relative to the mother cell (e.g., a more lineage restricted progenitor cell, a terminally differentiated cell, etc.). A stem cell may directly differentiate (i.e., without dividing), or may instead produce a differentiated cell type through an asymmetric or symmetric cell division.

[0067] Stem cells of interest in the present disclosure also include tissue-specific stem cells, e.g. mesenchymal stem cells and progeny derived therefrom, including without limitation central fat cells, osteoblasts and other bone progenitor cells, etc., pancreatic islet cells, hematopoietic stem cells, etc. The term "tissue-specific stem cell" is used herein to mean a cell capable of self-renewal but having a restricted potential, i.e. it cannot give rise to all cell types in the body without some manipulation by the hand of man. Tissue specific stem cells can give rise to the cells of the tissue from which they are derived. Tissue specific stem cells can in turn can differentiate into proliferating cells that are further restricted (e.g., bone progenitors, pancreatic islet progenitors, and the like), which can differentiate into end-stage cells (i.e., terminally differentiated cells, e.g., adipocytes, osteoblasts, pancreatic islet cells, and the like.

[0068] Cells of interest in the present disclosure also include progenitor cells. The term "progenitor cell" is used herein to refer to a type of stem cell that typically does not have extensive self-renewal capacity (i.e., the number of self-renewing divisions is limited), and often can only generate a limited number of differentiated cell types (e.g., a specific subset of cells found in the tissue from which they derive). Thus, a progenitor cell is differentiated relative to the tissue-specific stem cell that gave rise to it, but can also give rise to cells that are further differentiated (e.g., terminally differentiated cells). For the purposes of the present invention, progenitor cells are those cells that are committed to a lineage of interest (e.g., a bone progenitor, a fat progenitor, etc.), but have not yet differentiated into a mature cell.

[0069] The stem or progenitor cells contacted in the subject methods may be from any mammalian species, e.g. murine, rodent, canine, feline, equine, bovine, ovine, primate, human, etc. For in vitro studies, cells may be from established cell lines or they may be primary cells, where "primary cells", "primary cell lines", and "primary cultures" are used interchangeably herein to refer to cells and cells cultures that have been derived from a subject and allowed to grow in vitro for a limited number of passages, i.e. splittings, of the culture. For example, primary cultures are cultures that may have been passaged 0 times, 1 time, 2 times, 4 times, 5 times, 10 times, or 15 times, but not enough times go through the crisis stage. Typically, the primary cell lines of the present invention are maintained for fewer than 10 passages in vitro.

[0070] If the cells are primary cells, they may be harvest from an individual by any convenient method, e.g. for screening purposes. For example, cells, e.g. blood cells, e.g. hematopoietic stem cells or hematopoietic progenitor cells, may be harvested by apheresis, leukocytapheresis, density gradient separation, bone marrow biopsy, fetal liver biopsy, cord blood, etc. As another example, cells from solid tissues, e.g. bone stem cell or progenitor cells, may be harvested by biopsy, e.g. from the stem cell niche. An appropriate solution may be used for dispersion or suspension of the harvested cells. Such solution will generally be a balanced salt solution, e.g. normal saline, PBS, Hank's balanced salt solution, Iscoves, etc., conveniently supplemented with fetal calf serum and/or other factors, e.g. B27, in conjunction with an acceptable buffer at low concentration, generally from 5-25 mM. Convenient buffers include HEPES, phosphate buffers, lactate buffers, etc. The cells may be used immediately, or they may be stored, frozen, for long periods of time, being thawed and capable of being reused. In such cases, the cells will usually be frozen in 10% DMSO, 50% serum, 40% buffered medium, or some other such solution as is commonly used in the art to preserve cells at such freezing temperatures, and thawed in a manner as commonly known in the art for thawing frozen cultured cells.

SCREENING METHODS

USP16

[0071] In some aspects of the invention, methods are provided for screening a candidate agent for the ability to treat an individual having a condition associated with a reduced rate of stem cell self-renewal or that will be responsive to an increased rate of stem cell self-renewal, e.g., for use in the treatment methods described herein. To this end, it has been shown herein that USP16 activity, including its deubiquitinase activity, reduces stem cell proliferation and function. Accordingly, screening for candidate agents that reduce USP16 deubiquitinase activity should identify agents that will be useful in promoting stem cell proliferation, and more particularly, neural stem cell proliferation and neurogenesis, which will, in turn, treat the symptoms of conditions associated with a reduced rate of stem cell self-renewal or that will be responsive to an increased rate of stem cell self-renewal.

[0072] In some aspects of the invention, methods are provided for screening a candidate agent for the ability to treat an individual having a condition associated with an altered bone tissue (e.g., increased or decreased bone mineral density) for use in the treatment methods described herein. To this end, it has been shown herein that USP16 deubiquitinase activity reduces bone cell density. Accordingly, screening for candidate agents that reduce USP16 deubiquitinase activity should identify agents that will be useful in altering bone tissue (e.g., increasing or decreasing bone mineral density), which will, in turn, treat the symptoms of conditions associated with an altered (e.g., increased or decreased) bone mineral density.

[0073] In some examples, in screening assays for biologically active agents, cells expressing USP16, cyclophilin D, and/or reactive oxygen (e.g., superoxide) are contacted with a candidate agent of interest and the effect of the candidate agent on the cell is assessed by monitoring one or more output parameters. Parameters are quantifiable components of cells, particularly components that can be accurately measured, desirably in a high throughput system. A parameter can be any cell component or cell product including cell surface determinant, receptor, protein or conformational or posttranslational modification thereof, lipid, carbohydrate, organic or inorganic molecule, nucleic acid, e.g. mRNA, DNA, etc. or a portion derived from such a cell component or combinations thereof. While most parameters will provide a quantitative readout, in some instances a semi-quantitative or qualitative result will be acceptable. Readouts may include a single determined value, or may include mean, median value, or the variance, etc. Characteristically a range of parameter readout values will be obtained for each parameter from a multiplicity of the same assays. Variability is expected and a range of values for each of the set of test parameters will be obtained using standard statistical methods with a common statistical method used to provide single values. Thus, for example, one such method may comprise contacting a cell that expresses USP16, cyclophilin D, and/or a reactive oxygen (e.g., superoxide) with a candidate agent; and comparing the parameter to the parameter in a cell that expresses USP16, cyclophilin D, and/or a reactive oxygen (e.g., superoxide) but was not contacted with the candidate agent, wherein a difference in the parameter in the cell contacted with the candidate agent indicates that the candidate agent will treat the symptoms of with the condition associated with a reduced rate of stem cell self-renewal or that will be responsive to an increased rate of stem cell self-renewal.

[0074] One example of a parameter that may be quantified when screening candidate agents to identify those that may be used as therapeutics for the treatment of neurodevelopmental disorder or a neurodegenerative disease, a bone condition, disease or disorder, or an immune or autoimmune disease would be USP16 deubiquitinase activity. USP16 deubiquitinase activity may be measured by any convenient method, e.g. as described herein or as known in the art. For example, USP16 deubiquitinase activity may be measured by assessing H2A ubiquitination, wherein an increase in the amount of H2A ubiquitination as compared to the amount of H2A ubiquitination in a cell not contacted with candidate agent indicates that the candidate agent will treat an individual having a neurodevelopmental disorder or a neurodegenerative disease. As another example, USP16 activity, including but not limited to its dubiquitinase activity, may be measured by measuring the amount of Ink4a/Arf RNA or protein in the cell, wherein a decrease in the amount of Ink4a/Arf RNA or protein in the cell as compared to the amount of Ink4a/Arf RNA or protein in a cell not contacted with candidate agent indicates that the candidate agent will treat an individual having a neurodevelopmental disorder or a neurodegenerative disease. In some instances, one parameter is measured. As another example, human Down's syndrome or APP mutant cells, or murine TS65DN or APP mutant cells, including both neural and mesencymal stem/progenitor cells, may be screened for increased proliferation. In some instances, multiple parameters are measured.

[0075] Cells useful for screening include any cell that expresses USP16. In some instances, the cell overexpresses USP16, e.g. the cell expresses more USP16 than would be observed in wild type cell. For example, the cell may be trisomic for USP16, e.g. the cell may be acutely cultured from a subject having a trisomy at chromosome 21 or a USP16-comprising fragment thereof, i.e. a trisomy 21 primary cell. The cell may be a cell line derived from a trisomy 21 primary cell. The cell may be engineered to overexpress USP16, e.g. by transformation or infection with a vector comprising a nucleic acid that encodes the USP16 protein, by the introduction of USP16 polypeptide directly into the cell, etc. In some instances, the USP16 is expressed extrachromosomally (e.g. from a minicircle, a cosmid, etc.). In other instances, the USP16 is expressed from the genome of the cell. For example, the cell may be, e.g., a neural stem cell, a hematopoietic stem cell, a mammary stem cell, a mesenchymal stem cell, a fibroblast, etc., that either ectopically expresses additional copies of USP16 or that is from an individual (e.g. mouse, rat, human, etc.) having Down's syndrome.

[0076] Candidate agents of interest for screening include known and unknown compounds that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, etc. An important aspect of the invention is to evaluate candidate drugs, including toxicity testing; and the like.

[0077] Candidate agents include organic molecules comprising functional groups necessary for structural interactions, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, frequently at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules, including peptides, polynucleotides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Included are pharmacologically active drugs, genetically active molecules, etc. Compounds of interest include chemotherapeutic agents, hormones or hormone antagonists, etc. Exemplary of pharmaceutical agents suitable for this invention are those described in, "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw- Hill, New York, N.Y., (1996), Ninth edition. Also included are toxins, and biological and chemical warfare agents, for example see Somani, S. M. (Ed.), "Chemical Warfare Agents," Academic Press, New York, 1992).

[0078] Candidate agents of interest for screening also include nucleic acids, for example, nucleic acids that encode siRNA, shRNA, antisense molecules, CRISPRi, or miRNA, or nucleic acids that encode polypeptides. Many vectors useful for transferring nucleic acids into target cells are available. The vectors may be maintained episomally, e.g. as plasmids, minicircle DNAs, virus-derived vectors such cytomegalovirus, adenovirus, etc., or they may be integrated into the target cell genome, through homologous recombination or random integration, e.g. retrovirus derived vectors such as MMLV, HIV-1 , ALV, etc. Vectors may be provided directly to the subject cells. In other words, the cells are contacted with vectors comprising the nucleic acid of interest such that the vectors are taken up by the cells.

[0079] Methods for contacting cells with nucleic acid vectors, such as electroporation, calcium chloride transfection, and lipofection, are well known in the art. Alternatively, the nucleic acid of interest may be provided to the subject cells via a virus. In other words, the cells are contacted with viral particles comprising the nucleic acid of interest. Retroviruses, for example, lentiviruses, are particularly suitable to the method of the invention. Commonly used retroviral vectors are "defective", i.e. unable to produce viral proteins required for productive infection. Rather, replication of the vector requires growth in a packaging cell line. To generate viral particles comprising nucleic acids of interest, the nucleic acids comprising the nucleic acid are packaged into viral capsids by a packaging cell line. Different packaging cell lines provide a different envelope protein to be incorporated into the capsid, this envelope protein determining the specificity of the viral particle for the cells. Methods of introducing viral vectors comprising the nucleic acid of interest into packaging cell lines, of collecting the viral particles that are generated by the packaging lines, and of infecting cells using the packaged viral particles are well known in the art.

[0080] Vectors used for providing nucleic acid of interest to the subject cells will typically comprise suitable promoters for driving the expression, that is, transcriptional activation, of the nucleic acid of interest. This may include ubiquitously acting promoters, for example, the CMV- b-actin promoter, or inducible promoters, such as promoters that are active in particular cell populations or that respond to the presence of drugs such as tetracycline. By transcriptional activation, it is intended that transcription will be increased above basal levels in the target cell by at least about 10 fold, by at least about 100 fold, more usually by at least about 1000 fold. In addition, vectors used for providing reprogramming factors to the subject cells may include genes that must later be removed, e.g. using a recombinase system such as Cre/Lox, or the cells that express them destroyed, e.g. by including genes that allow selective toxicity such as herpesvirus TK, bcl-xs, etc

[0081] Candidate agents of interest for screening also include polypeptides. Such polypeptides may optionally be fused to a polypeptide domain that increases solubility of the product. The domain may be linked to the polypeptide through a defined protease cleavage site, e.g. a TEV sequence, which is cleaved by TEV protease. The linker may also include one or more flexible sequences, e.g. from 1 to 10 glycine residues. In some embodiments, the cleavage of the fusion protein is performed in a buffer that maintains solubility of the product, e.g. in the presence of from 0.5 to 2 M urea, in the presence of polypeptides and/or polynucleotides that increase solubility, and the like. Domains of interest include endosomolytic domains, e.g. influenza HA domain; and other polypeptides that aid in production, e.g. IF2 domain, GST domain, GRPE domain, and the like.

[0082] The polypeptide may comprise the polypeptide sequences of interest fused to a polypeptide permeant domain to promote entry into the cell. A number of permeant domains are known in the art and may be used in the non-integrating polypeptides of the present invention, including peptides, peptidomimetics, and non-peptide carriers. For example, a permeant peptide may be derived from the third alpha helix of Drosophila melanogaster transcription factor Antennapaedia, referred to as penetratin. As another example, the permeant peptide comprises the HIV-1 tat basic region amino acid sequence, which may include, for example, amino acids 49-57 of naturally-occurring tat protein. Other permeant domains include poly-arginine motifs, for example, the region of amino acids 34-56 of HIV-1 rev protein, nona-arginine, octa-arginine, and the like. (See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003 Apr; 4(2): 87-96; and Wender et al. (2000) Proc. Natl. Acad. Sci. U.S.A 2000 Nov. 21 ; 97(24): 13003-8; published U.S. Patent applications 20030220334; 20030083256; 20030032593; and 20030022831 , herein specifically incorporated by reference for the teachings of translocation peptides and peptoids). The nona-arginine (R9) sequence is one of the more efficient PTDs that have been characterized (Wender et al. 2000; Uemura et al. 2002).

[0083] Candidate agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

[0084] Candidate agents are screened for biological activity by adding the agent to at least one and usually a plurality of cell samples, usually in conjunction with cells not contacted with the agent. The change in parameters in response to the agent is measured, and the result evaluated by comparison to reference cultures, e.g. in the presence and absence of the agent, obtained with other agents, etc.

[0085] The agents are conveniently added in solution, or readily soluble form, to the medium of cells in culture. The agents may be added in a flow-through system, as a stream, intermittent or continuous, or alternatively, adding a bolus of the compound, singly or incrementally, to an otherwise static solution. In a flow-through system, two fluids are used, where one is a physiologically neutral solution, and the other is the same solution with the test compound added. The first fluid is passed over the cells, followed by the second. In a single solution method, a bolus of the test compound is added to the volume of medium surrounding the cells. The overall concentrations of the components of the culture medium should not change significantly with the addition of the bolus, or between the two solutions in a flow through method.

[0086] A plurality of assays may be run in parallel with different agent concentrations to obtain a differential response to the various concentrations. As known in the art, determining the effective concentration of an agent typically uses a range of concentrations resulting from 1 :10, or other log scale, dilutions. The concentrations may be further refined with a second series of dilutions, if necessary. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection of the agent or at or below the concentration of agent that does not give a detectable change in the phenotype. In some instances, a positive control may be employed, e.g. a USP16-specific shRNA, a USP16-specific siRNA, and the like.

[0087] Various methods can be utilized for quantifying the selected parameters. For example, H2A ubiquitination may be measured by, e.g, chromatin immunoprecipitation (ChIP) of the Ink4a/Arf locus. Ink4a/Arf expression, i.e. RNA or protein levels, may be detected by qRT-PCR, western blots, protein arrays, and the like. Cell proliferation rates and senescence may be measured by flow cytometry, BrdU incorporation, quit fractions, etc. Such methods will be well known to one of ordinary skill in the art.

Cyclophilin D

[0088] One aspect of the invention provides methods for screening a candidate agent for the ability to treat an individual having a cyclophilin D related condition, disease, or disorder or a condition responsive to an alteration in cyclophilin D activity, such as, for example by contacting a cell expressing cyclophilin D with a candidate agent, and assaying a cyclophilin D target activity. In some of these, an alteration in the cyclophilin D target activity in the cell as compared to a cell not in contact with candidate agent indicates that the candidate agent will treat the condition. In some embodiments, a characteristic of cyclophilin D is assayed directly, such as a cyclophilin D conformation, a cellular location of cyclophilin D protein, or a level of cyclophilin D binding to a target. In some embodiments a cyclophilin D enzyme activity is assayed. For example, a cyclophilin D peptidyl prolyl isomerase activity may be assayed using a peptidyl prolyl substrate. A peptidyl prolyl substrate may be a naturally occurring substrate, may be introduced into a cell (e.g., by introducing a vector, RNA, protein, etc.) or may be present in an in vitro assay. In some embodiments, a cyclophilin D target activity that is downstream of cyclophilin D activity may be assayed. A cyclophilin D target activity may be indirectly controlled by the activity of cyclophilin D. For example (and as explained in more detail below), cyclophilin D can act to increase the permeability of the mitochondrial membrane by opening a mitochondrial pore and therefore allowing the passage of small molecules across the mitochondrial membrane. Thus, the activity of molecules affected by the mitochondrial membrane opening mediated by the activity of cyclophilin D may be assayed. A cytophilin D activity may be assayed in vivo on living cells or in vitro on dead cells or on cell extracts. In some particular examples, mitochondrial membrane potential is assayed such as using a reporter sensitive to changes in mitochondrial membrane potential, such as using a cationic cyanine dye such as DilC1 (5) (1 , 1 ',3,3,3',3'-hexamethylindodicarbocyanine iodide) that accumulates primarily in mitochondria with active membrane potentials but whose intensity decreases when the mitochondrial membrane potential is disrupted. In some other examples, mitochondrial pore opening is assayed by using a reporter such as (fluorescently) labeled calcein that emits a signal when located in the mitochondria but whose signal is quenched when it moves out of the mitochondria and into the cytosol. In some embodiments, an activity level of cyclophilin D may be calculated or inferred.

[0089] In some embodiments, a cyclophilin D related condition, disease, or disorder comprises an immune or autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder.

[0090] In some embodiments, a cyclophilin D related condition, disease, or disorder comprises a mesenchymal cell related condition, disease, or disorder. In some embodiments, a mesenchymal cell related condition, disease, or disorder comprises a bone cell related condition, disease, or disorder, a connective or cartilage cell related condition, disease, or disorder or a fat cell related condition, disease, or disorder. In some embodiments, a cyclophilin D related condition, disease, or disorder comprises a bone condition, a bone disease, or a bone disorder, including but not limited to osteopenia, osteoporosis, osteogenesis inperfecta, and Paget's disease of bone. In some embodiments, a method for screening a candidate agent may include screening for a candidate that is not immunosuppressive or has limited immunosuppressive activity. In some examples, a method for screening a candidate agent may include performing a control reaction with an immunosuppressive agent (such as e.g., cyclosporine A, FK506, etc.) and determining that the candidate agent is less immunosuppressive than the immunosuppressive agent, such as when its activity is less than 10%, less than 5%, less than 4%, less than 3%, less than 2 %, or less than 1 % or any of the activity level of cyclosporine A. Immunosuppressive activity can also or instead be measured, for example, in a mixed lymphocyte reaction (MLR) (T. Meo, "Immunological Methods", L. Lefkovits and B. Peris, Eds., Academic Press;; 227-239 (1979).

[0091] As described in more detail below, analysis of cells from Ts65 Dn mice shows increased levels of reactive oxygen and treatment of Ts65Dn mouse mesenchymal progenitors (e.g., fibroblasts) with a cyclophilin D antagonist protects the mesenchymal progenitors from premature senescence. In some aspects of the invention, methods are provided for screening a candidate agent for the ability to treat an individual having a condition associated with an altered (e.g., increased or decreased) rate of cell death or that will be responsive to an altered (e.g., increased or decreased) rate of cell death e.g., for use in the treatment methods described herein. To this end, it has been shown herein that inhibition of cyclophilin D activity increases proliferation of mesenchymal progenitors (e.g., fibroblasts) and improves mesenchymal function. Accordingly, screening for candidate agents that modulate (e.g., inhibit or activate) cyclophilin D activity should identify agents that will be useful in promoting mesenchymal cell proliferation, which will, in turn, treat the symptoms or conditions associated with an altered (e.g., increased or decreased) rate of cell death. To this end, it has also been shown herein that inhibition of reactive oxygen (e.g., superoxide) activity increases proliferation of mesenchymal progenitors and improves mesenchymal function. Accordingly, screening for candidate agents that modulate (e.g., inhibit or activate) superoxide activity should identify agents that will be useful in promoting mesenchymal cell proliferation, which will, in turn, treat the symptoms or conditions associated with an altered (e.g., increased or decreased) rate of cell death.

[0092] By osteopenia (also referred to as low bone density) is meant bone density that is lower than normal, but not low enough to be considered osteoporosis. Osteopenia may be identified clinical symptoms and/or a Bone Mineral Density (BMD) test as known in the art. A Bone Mineral Density test generally assesses the quantity of minerals (e.g., calcium and phosphate) in a bone in the body. A Bone Mineral Density test may be performed using a dual x-ray absorptiometry (DXA) of one or more bones (e.g., forearm, hand, heel, hip, spine, wrist) in the body and a T-score provided based on the test results. A T-score is based on the number of standard deviations a value is in comparison to Bone Mineral Density test results to the average bone density of young normal reference (young healthy adults). A T-score between -1.0 and - 2.5 is considered indicative of osteopenia.

[0093] By osteoporosis is meant a disease of the bones that thins and weakens the bones to the point that they become fragile and break easily. Osteoporosis can be identified by clinical symptoms and/ore a T-score of -2.5 or lower on a Bone Mineral Density test, such as the Bone Mineral Density test described above.

[0094] By osteogenesis imperfecta is meant a genetic disorder characterized by fragile bones (e.g., bones that are deformed and fracture easily). In some cases, osteogenesis inperfecta is often characterized by too little type I collagen or poor quality of type I collagen, or a mutation Osteogenesis imperfecta may be diagnosed based on clinical symptoms and diagnosis may be based in part on results from a biochemical test (e.g., for collagen quality) or a molecular test (e.g., a DNA test such as for a mutation (such as a point mutation, deletion or duplication), in a type I collagen gene (COL1A1 or COL1A2) or for interferon induced transmembrane protein 5), in the interferon induced transmembrane protein 5 (IFITM5) gene, and/or in one or more of the CRTAP, LEPRE1, PPIB, FKBP10, SERPINH1, SERPINF1, PLOD2, OSX, ALPL, TMEM38B, BMP1, WNT1 or CREB3L1 genes.

[0095] By Paget's disease is meant a disorder that involves abnormal bone destruction and regrowth, generally in only a subset of bones (e.g., pelvis, low back (spine), hips, thighs, skull, arms) and resulting in deformity, weakness, and/or bending of the affected bones. In general, Paget's disease results in deformed, softer and/or larger bones due to an unusually rapid rate of bone growth. Paget's disease can be diagnosed based on clinical symptoms and may be based in part on the results of an X-ray, a blood test and/or a urine test (e.g., for serum alkaline phosphatase indicative of rapid new bone turnover).

[0096] In some embodiments, a cyclophilin D related condition, disease, or disorder comprises an immune or autoimmune disease including but not limited to Celiac disease, Crohn's disease and hypothyroidism.

[0097] By autoimmune disease is meant a misguided immune response by a subject against tissues or other substances normally present in the subject's body, resulting in the presence of autoantibodies that attack and destroy the tissues or other substances. By Celiac disease is meant a genetic autoimmune disease that results in an immune reaction in response to ingesting gluten, a protein found in wheat, barley, and rye. Celiac disease damages the villi of the small intestine and interferes with absorption of nutrients from food and can lead to malnutrition. Celiac disease can deprive the bones, brain, and other organs of nourishment and may lead to other disorders including infertility, reduced bone density, and neurological disorders. Celiac disease may be diagnosed by clinical symptoms and a blood panel test. A positive result of a blood panel test indicative of Celiac disease may include positive results from tests for tissue transglutaminase antibody (tTG), IgA class or tissue transglutaminase antibody (tTG), IgG class, quantitative immunoglobulin A (IgA) test, deamidated gliadin peptide (DGP) antibodies, IgA or IgG. A positive result of biopsy of the small intestine showing damage to the intestinal villi may also or instead be used for diagnosing Celiac disease. Other tests recommended by the American College of Gastroenterology may also or instead be used for diagnosis. Diagnosis may also include a positive result for genetic testing of the HLA-DQ8 gene.

[0098] By Crohn's disease or inflammatory bowel disease (IBD, or inflammatory bowel syndrome) is meant a disease where parts of the gastrointestinal tract become inflamed and often thickened. Crohn's disease most commonly affects the small intestine and the beginning of the large intestine. Crohn's disease may be diagnosed by clinical symptoms and tests. Symptoms indicative of Crohn's disease include tenderness or a mass in the abdomen, skin rash, swollen joints, or mouth ulcers. Tests that can be used to diagnosis Crohn's disease include a barium enema or upper gastrointestinal series, colonoscopy or sigmoidoscopy, CT or CAT scans (computerized axial tomography), capsule endoscopy, MRI (magnetic resonance imaging) of the abdomen, or enterscopy.

[0099] By hypothyroidism is meant a condition of the subject in which the thyroid gland does not make enough hormone and in particular a condition caused by an autoimmune response. Hypothyroidism is diagnosed based on clinical symptoms and results of blood tests for the thyroid hormones TSH (thyroid stimulating hormone or thyrotropin) and free thyroxine (T4). Levels of TSH above 4.0 milli-international units per liter (mlU/L) are indicative of hypothyroidism. A positive result of greater than 9.0 lU/ml for a blood test to detect specific antithyroid antibodies against thyroperoxidase (TPO) can be used to diagnosis hypothyroidism. A positive result for a blood test to detect specific antithyroid antibodies against thyroglobulin can also be used. Values above a control value may be used (in conjunction with other tests and clinical symptoms) to indicate hypothyroidism.

[00100] In some embodiments, a mesenchymal cell related condition, disease, or disorder comprises a connective or cartilage cell related condition, disease, or disorder. In some embodiments, a mesenchymal cell related condition, disease, or disorder comprises an adipocyte or fat cell related condition, disease, or disorder (e.g., from an adipocyte or fat cell descended from a mesenchymal cell precursor). In some examples, an adipocyte or fat cell related condition comprises metabolic syndrome, type 1 diabetes, or type 2 diabetes.

[00101] Metabolic syndrome is a condition of the body characterized by increased blood pressure, high fasting blood-sugar levels, excess abdominal fat, and abnormal cholesterol markers. Metabolic syndrome may also include having insulin resistant Metabolic syndrome may be diagnosed by clinical examination and testing such as having positive indicators, such as at least three out of five of blood pressure of 130 over 85 mm Hg or higher; fasting blood sugar of 100 mg/dL or higher; waist of at least 35 inches (for women) or 40 inches (for men); HDL cholesterol level below 50 mg/dL (for women) or below 40 mg/dL (for men), or triglycerides of 150 mg/dL or higher. It may also or instead be characterized by the presence of (elevated) levels of biomarkers associated with insulin resistance and chronic inflammation, an increase in the normal level of macrophages in fat tissue from a subject.

[00102] By a "cyclophilin D antagonist", it is meant any agent that reduces, suppresses, inhibits, antagonizes, etc. the activity of one or more cyclophilin D proteins in the cell.

[00103] By a "cyclophilin D agonist", it is meant any agent that increases, activates, agonizes, etc. the activity of one or more cyclophilin D proteins in the cell. While in general a cyclophilin D antagonist may be most effective for screening for or treating a condition, disorder, or disease as described herein, in some examples a cyclophilin D agonist may also be useful. For example, a cyclophilin D agonist may be used in a screen for a cyclophilin D antagonist in order to improve screen sensitivity or ease of use or for another reason.

[00104] As described herein and demonstrated in the working examples, cyclophilin D regulates cell proliferation and function in a number of tissues, including the hematopoietic stem cell compartment and mesenchymal cells. Mesenchymal cells are precursor cells to osteoblasts (e.g., bone cells), chondrocytes (e.g., connective or cartilage cells) and adipocytes (e.g., fat cells). As such, inhibiting cyclophilin D activity in mesenchymal (or hematopoietic cells) by providing an antagonist to cyclophilin D may promote the proliferation of mesenchymal cells which may increase the production of osteoblasts (e.g., bone cells) such as in individuals with a bone condition, a bone disorder, or a bone disease and improve skeletal system function; may promote the proliferation of chondrocytes and/or may increase the production of connective tissue or cartilage; and/or may promote the proliferation of hematopoietic stem cells. As indicated elsewhere herein, cyclophilin D is inhibited by the drug cyclosporine A. Cyclosporine A also acts to inhibit the immune system through a cyclophilin A dependent pathway.

[00105] By cyclophilin D is meant peptidylprolyl isomerase D. Sequence for human cyclophilin D may be found at GenBank Accession No. NM_005038.2. In some embodiments, human cyclophilin D is used for the performing the methods described herein. In some embodiments, cyclophilin D homologs from other species (e.g., mouse, rat, etc.) may be used. Cyclophilin D has peptidyl-prolyl cis-trans isomerase activity and thus some embodiments include the step of assaying for peptidyl-prolyl cis-trans isomerase activity. In some embodiments, from cyclophilin D peptidyl-prolyl cis-trans isomerase activity is assayed. Some embodiments include the step of inhibiting peptidyl-prolyl cis-trans isomerase.

[00106] By cyclophilin A is meant peptidylprolyl isomerase A, (PPIA). Cyclophilin A has peptidyl- prolyl cis-trans isomerase activity. Sequence for human cyclophilin A may be found at GenBank Accession No. NIV 321130.4. In some embodiments, cyclophilin A activity is assayed. For example, cyclophilin A peptidyl-prolyl cis-trans isomerase activity may be assayed or a cell activity controlled by cyclophilin A may be assayed. Cyclophilin A and cell activities controlled by cyclophilin A may be indicative of immune system activity and may be used in assays to determine immune system function (e.g., immunosuppression). For example, cyclophilin A activity or a cell activity controlled by cyclophilin A (e.g., NF-AT translocation) may be assayed. NF-AT translocation activity may be assayed, for example using a reporter assay such as using a transduced lentivirus particle assay system that expresses a reporter (e.g., a firefly luciferase gene) under the control of a minimal CMV promoter with tandem repeats of the NFAT transcriptional response element (TRE) (e.g., using a Qiagen Lenti NFAT Reporter (luc) system).

[00107] Mitochondria use oxidative phosphorylation to produce ATP to provide power for cellular functions. Maintaining the integrity of the mitochondrial membrane and presence of a proton gradient across the membrane is an important part of ATP production and important for maintaining cell integrity. Loss of mitochondrial membrane integrity can lead to cell death. Cyclophilin D is located in the mitochondrial matrix and plays a role in maintaining and altering mitochondrial membrane integrity. A mitochondrial permeability transition pore (MPTP; also referred to as the mitochondrial permeability transition or MPT; or the permeability transition or PT) is a non-specific voltage-sensitive channel in the mitochondrial membrane of a cell that, when open for an extended period of time such as in response to a cell death stimulus, leads to cell death. When open, the pore allows molecules less than about 1.5kDa, including protons, to pass through the membrane. Molecules may pass from outside the mitochondria to inside the mitochondria. For example, the level of Ca2+ or NADH may increase inside the mitochondria. Equilibration of the proton gradient and related events causes mitochondrial depolarization, massive swelling of mitochondria, rupture of the outer membrane, and induction of cell death. The mitochondrial permeability transition pore is thought to be formed from two dimers of F-ATP synthase. Closure of the pore promotes cell survival. Cytophilin D binds to and opens the mitochondrial permeability transition pore, leading to cell death. Cyclosporine A inhibits the action of cyclophilin D and prevents the opening of the mitochondrial permeability transition pore by cytophilin D.

[00108] Another aspect of the invention provides methods for screening a candidate agent for the ability to treat an individual having a cyclophilin D related condition, disease, or disorder or a condition, disease or disorder responsive to an alteration in cyclophilin D activity, such as, for example by contacting a cell expressing contacting a Down syndrome model cell expressing cyclophilin D with a candidate agent and assaying a cyclophilin D target activity as described elsewhere herein. In some of these, an alteration in the cyclophilin D target activity in the cell as compared to a cell not in contact with candidate agent indicates that the candidate agent will treat the condition.

[00109] In some examples, in screening assays for biologically active agents, cells expressing cyclophilin D (and/or USP 16 and/or superoxide) are contacted with a candidate agent of interest and the effect of the candidate agent on the cell is assessed by monitoring one or more output parameters. In some examples, in screening for biologically active agents, a Down syndrome model cell may be used. A Down syndrome model cell may be a cell from a Down syndrome patient, a Down syndrome mouse (e.g., Ts65dn, Tsl Cje, etc.), another Down syndrome animal, a cell selected or engineered to have attributes of a cell from a Down syndrome patient or animal (e.g., partial or complete human trisomy 21 , partial or complete mouse trisomy 16 and the like). In some embodiments, the Down syndrome model cell is a cell from a patient (or animal) having Down syndrome and the cell is being screened to, for example, treat the patient (or animal) from whom the cell was obtained. Parameters are quantifiable components of cells, particularly components that can be accurately measured, desirably in a high throughput system. A parameter can be any cell component or cell product including cell surface determinant, receptor, protein or conformational or posttranslational modification thereof, lipid, carbohydrate, organic or inorganic molecule, nucleic acid, e.g. mRNA, DNA, etc. or a portion derived from such a cell component or combinations thereof. While most parameters will provide a quantitative readout, in some instances a semiquantitative or qualitative result will be acceptable. Readouts may include a single determined value, or may include mean, median value, or the variance, etc. Characteristically a range of parameter readout values will be obtained for each parameter from a multiplicity of the same assays. Variability is expected and a range of values for each of the set of test parameters can be obtained using standard statistical methods with a common statistical method used to provide single values. Thus, for example, one such method may comprise contacting a cell that expresses cyclophilin D (and/or USP 16 and/or superoxide) to the parameter in a cell that expresses cyclophilin D (and/or USP 16 and/or superoxide) but was not contacted with the candidate agent, wherein a difference in the parameter in the cell contacted with the candidate agent indicates that the candidate agent will treat the symptoms or condition associated with autoimmune disease, metabolic disorder or metabolic disease, or a bone condition, bone disorder, or bone disease.

[00110] One example of a parameter that may be quantified when screening candidate agents to identify those that may be used as therapeutics for the treatment of an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder would be cyclophilin D activity. Cyclophilin D activity may be measured by any convenient method, e.g. as described herein or as known in the art. For example, cyclophilin D activity may be measured by assessing a level of a reactive oxygen species, such as a level of superoxide, wherein a decrease in the amount of a reactive oxygen species such as a level of superoxide as compared to the amount of a reactive oxygen species such as superoxide in a cell not contacted with candidate agent indicates that the candidate agent will treat an individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder.

[0011 1] As another example, cyclophilin D activity may be measured by measuring the number of cells, wherein a decrease in the number of cells in a sample as compared to the number of cells in a sample not contacted with candidate agent indicates that the candidate agent will treat an individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder. In some instances, one parameter is measured. In some instances, multiple parameters are measured.

[00112] One example of a parameter that may be quantified when screening a candidate agent to identify one that may be used as a therapeutic for the treatment of an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder or a mesenchymal cell related condition, disease or disorder would be cyclophilin D mediated reactive oxygen activity. Cyclophilin D mediated reactive oxygen activity may be measured by any convenient method, e.g. as described herein or as known or developed in the art. For example, cyclophilin D mediated reactive oxygen activity may be measured by assessing oxidation, wherein a decrease in the amount of oxidation as compared to the amount of oxidation in a cell not contacted with candidate agent indicates that the candidate agent will treat an individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder. As an example, cyclophilin D mediated superoxide activity may be measured by measuring the amount of superoxide activity in the cell, wherein a decrease in the amount of superoxide activity in the cell as compared to the amount of superoxide activity in a cell not contacted with the same candidate agent indicates that the candidate agent will treat an individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder. In some instances, one parameter is measured. In some instances, multiple parameters are measured.

[00113] Cells useful for screening include any cell that expresses cyclophilin D. In some instances, the cell overexpresses cyclophilin D or has an increased level of cyclophilin D activity. For example, the cell may express more cyclophilin D than would be observed in wild type cell. For example, the cell may be trisomic for cyclophilin D or Usp16 or another gene that increases cyclophilin D production above normal cyclophilin D levels, e.g. the cell may be acutely cultured from a subject having a trisomy at chromosome 21 or a USP16-comprising fragment thereof, i.e. a trisomy 21 primary cell. The cell may be a cell line derived from a trisomy 21 primary cell. The cell may be engineered to overexpress cyclophilin D or USP16, e.g. by transformation or infection with a vector comprising a nucleic acid that encodes the cyclophilin or USP16 protein, by the introduction of cyclophilin D or USP16 polypeptide directly into the cell, etc. In some instances, the cyclophilin D or USP16 is expressed extrachromosomally (e.g. from a minicircle, a cosmid, etc.). In other instances, the cyclophilin D or USP16 is expressed from the genome of the cell. For example, the cell may be, e.g., a neural stem cell, a hematopoietic stem cell, a mammary stem cell, a mesenchymal stem cell, a fibroblast, a reporter cell, etc., that either ectopically expresses additional copies of cyclophilin D or USP16 or that is from an individual (e.g. mouse, rat, human, etc.) having Down's syndrome.

[00114] Candidate agents of interest for screening include known and unknown compounds that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, etc. One aspect of the invention that may be important is to evaluate candidate drugs, including toxicity testing; and the like. Candidate agents include organic molecules comprising functional groups necessary for structural interactions, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, frequently at least two of the functional chemical groups. A candidate agent may in particular comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules, including peptides, polynucleotides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Also contemplated are pharmacologically active drugs, genetically active molecules, etc. Compounds of interest include chemotherapeutic agents, hormones or hormone antagonists, etc. Exemplary of pharmaceutical agents suitable for this invention include those described in, "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw- Hill, New York, N.Y., (1996), Ninth edition. Also contemplated are toxins, and biological and chemical warfare agents, for example see Somani, S. M. (Ed.), "Chemical Warfare Agents," Academic Press, New York, 1992).

15] In some particular examples, compounds of interest for treating or screening a condition such as an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder as described herein include non-immunosuppresive compounds or compounds with limited immunosuppressive (e.g., minimally immunosuppressive) character, such as Debio 025 (also known as UNIL025 or alisporivir (Novartis),) or analogs of cyclosporine A or sangliferhrin A (e.g., , SCY-635 (Scynexis); NIM81 1) (Sweeney et al., J. Med. Chem., "From chemical tools to clinical medicines: nonimmunosuppressive cyclophilin inhibitors derived from the cyclosporine and sanglifehrin scaffolds", 2014 Sep. 11 ;57(17):7145-59), In some examples, a non-immunosuppresive (or minimally or limitedly immunosuppressive) compound does not inhibit NF-AT translocation from the cytosol to the nucleus and therefore does not inhibit an immune response. In some examples, a non-immunosuppresive (or minimally or limitedly immunosuppressive) compound is unable to bind to calcineurin. In some examples, a compound as described herein does not inhibit calcineurin, and does not inhibit NF-AT translocation to the nucleus and therefore may not inhibit an immune response (Coelmont et al., "Debio 025, a Cyclophilin Binding Molecule, is highly efficient in clearing Hepatitis C Virus (HCV) Replicon-containing cells when used alone or in combination with specifically targeted antiviral therapy for HCV (STAT-C) inhibitors", Antimicrob Agents Chemother. 2009 Mar; 53(3): 967-976). In some examples, a cell response to a compound (e.g., a candidate agent) may include a normal or near normal immune response. Additional examples include naturally occurring sangliferhrin, cyclosporins A through Z [Traber et al.; 1 , Helv. Chim. Acta, 60, 1247-1255 (1977); Traber et al.; 2, Helv. Chim. Acta, 65, 1655- 1667 (1982); Kobel et al.; Europ. J. Applied Microbiology and Biotechnology, 14, 273-240 (1982); and von Wartburg et al.; Progress in Allergy, 38, 28-45 (1986)], as well as various non- natural cyclosporin derivatives and artificial or synthetic cyclosporin derivatives and artificial or synthetic cyclosporins including dihydrocyclosporins [in which the -MeBmt-residue is saturated by hydrogenation]; derivatized cyclosporins (e.g., in which the 3-O-atom of the -MeBmt-residue is acylated or a further substituent is introduced at the a-carbon atom of the sarcosyl residue at the 3-position); and cyclosporins in which variant amino acids are incorporated at specific positions within the peptide sequence (see e.g. Traber et al., 1 ; Traber et al., 2; and Kobel et al., loc cit. U.S. Pat. Nos. 4, 108,985, 4,220,641 , 4,288,431 , 4,554,351 , 4,396,542 and 4,798,823; European Patent Publication Nos. 34.567A, 56.782A, 300.784A and 300,785; International Patent Publication No. WO 86/02080 and UK Patent Publication Nos. 2,206, 119 and 2,207,678; Wenger 1 , Transpl. Proa, 15 Suppl. 1 :2230 (1983); Wenger 2, Angew. Chem. Int. Ed. 24 77 (1985) and Wenger 3, Progress in the Chemistry of Organic Natural Products, 50, 123 (1986)). A cyclosporine derivative may also be or may also include a synthetic modification of the - MeBmt-residue residing at position 1 of the cyclosporin undecapeptide (e.g., as described in Park et al., Tetrahedron Lett. 1989, 30, 4215-4218; U.S. Pat. Nos. 5,239,037, 5,293,057; U.S. Publication Nos. US20020142946, US20030087813, US20030104992, PCT Publication Nos. WO99/18120 and WO03/033526; and U.S. Pat. Nos.4,384,996, 4,771 , 122, 5,284,826, and 5,525,590.

[00116] Candidate agents of interest that may be useful for screening also include nucleic acids, for example, nucleic acids that encode siRNA, shRNA, antisense molecules, CRISPRi, or miRNA, or nucleic acids that encode polypeptides. Many vectors useful for transferring nucleic acids into target cells are available and may be utilized in the treatments, methods, and screens described herein. The vectors may be maintained episomally, e.g. as plasmids, minicircle DNAs, virus-derived vectors such cytomegalovirus, adenovirus, adeno-associated virus, etc., or they may be integrated into the target cell genome, such as through homologous recombination or random integration, e.g. retrovirus derived vectors such as MMLV, HIV-1 , ALV, etc. Vectors may be provided directly to the subject cells. In other words, cells for use as described herein may contacted with vectors comprising the nucleic acid of interest such that the vectors are taken up by the cells.

[00117] Methods for contacting cells with nucleic acid vectors, such as electroporation, calcium chloride transfection, and lipofection, are well known in the art and may be used. Alternatively, the nucleic acid of interest may be provided to the subject cells via a virus. In other words, the cells are contacted with viral particles comprising the nucleic acid of interest. Retroviruses, for example, lentiviruses, are particularly suitable for some examples. Commonly used retroviral vectors such as those that are "defective", i.e. unable to produce viral proteins required for productive infection may be used. Rather, replication of the vector requires growth in a packaging cell line. To generate viral particles comprising nucleic acids of interest, the nucleic acids comprising the nucleic acid are packaged into viral capsids by a packaging cell line. Different packaging cell lines provide a different envelope protein to be incorporated into the capsid, this envelope protein determining the specificity of the viral particle for the cells. Methods of introducing viral vectors comprising the nucleic acid of interest into packaging cell lines, of collecting the viral particles that are generated by the packaging lines, and of infecting cells using the packaged viral particles are well known in the art.

[00118] Vectors used for providing nucleic acid of interest to the subject cells will typically comprise suitable promoters for driving the expression, that is, transcriptional activation, of the nucleic acid of interest. This may include ubiquitously acting promoters, for example, the CMV- b-actin promoter, or inducible promoters, such as promoters that are active in particular cell populations or that respond to the presence of drugs such as tetracycline. By transcriptional activation, it is intended that transcription will be increased above basal levels in the target cell by at least about 10 fold, by at least about 100 fold, more usually by at least about 1000 fold. In addition, vectors used for providing reprogramming factors to the subject cells may include genes that must later be removed, e.g. using a recombinase system such as Cre/Lox, or the cells that express them destroyed, e.g. by including genes that allow selective toxicity such as herpesvirus TK, bcl-xs, etc.

[00119] Candidate agents of interest for screening also include polypeptides. Such polypeptides may optionally be fused to a polypeptide domain that increases solubility of the product.The domain may be linked to the polypeptide through a defined protease cleavage site, e.g. a TEV sequence, which is cleaved by TEV protease. The linker may also include one or more flexible sequences, e.g. from 1 to 10 glycine residues. In some embodiments, the cleavage of the fusion protein is performed in a buffer that maintains solubility of the product, e.g. in the presence of from 0.5 to 2 M urea, in the presence of polypeptides and/or polynucleotides that increase solubility, and the like. Domains of interest include endosomolytic domains, e.g. influenza HA domain; and other polypeptides that aid in production, e.g. IF2 domain, GST domain, GRPE domain, and the like.

[00120] The polypeptide may comprise the polypeptide sequences of interest fused to a polypeptide permeant domain to promote entry into the cell. A number of permeant domains are known in the art and may be used in the non-integrating polypeptides, including peptides, peptidomimetics, and non-peptide carriers. For example, a permeant peptide may be derived from the third alpha helix of Drosophila melanogaster transcription factor Antennapaedia, referred to as penetratin. As another example, the permeant peptide comprises the HIV-1 tat basic region amino acid sequence, which may include, for example, amino acids 49-57 of naturally-occurring tat protein. Other permeant domains include poly-arginine motifs, for example, the region of amino acids 34-56 of HIV-1 rev protein, nona-arginine, octa-arginine, and the like. (See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003 Apr; 4(2): 87-96; and Wender et al. (2000) Proc. Natl. Acad. Sci. U.S.A 2000 Nov. 21 ; 97(24): 13003-8; published U.S. patent applications 20030220334; 20030083256; 20030032593; and 20030022831 , herein specifically incorporated by reference for the teachings of translocation peptides and peptoids). The nona-arginine (R9) sequence is one of the more efficient PTDs that have been characterized (Wender et al. 2000; Uemura et al. 2002).

[00121] Candidate agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

[00122] Candidate agents are screened for biological activity by adding the agent to at least one and usually a plurality of cell samples, usually in conjunction with cells not contacted with the agent. The change in parameters in response to the agent is measured, and the result evaluated by comparison to reference cultures, e.g. in the presence and absence of the agent, obtained with other agents, etc.

[00123] The agents are conveniently added in solution, or readily soluble form, to the medium of cells in culture. The agents may be added in a flow-through system, as a stream, intermittent or continuous, or alternatively, adding a bolus of the compound, singly or incrementally, to an otherwise static solution. In a flow-through system, two fluids are used, where one is a physiologically neutral solution, and the other is the same solution with the test compound added. The first fluid is passed over the cells, followed by the second. In a single solution method, a bolus of the test compound is added to the volume of medium surrounding the cells. The overall concentrations of the components of the culture medium should not change significantly with the addition of the bolus, or between the two solutions in a flow through method.

[00124] A plurality of assays may be run in parallel with different agent concentrations to obtain a differential response to the various concentrations. As known in the art, determining the effective concentration of an agent typically uses a range of concentrations resulting from 1 :10, or other log scale, dilutions. The concentrations may be further refined with a second series of dilutions, if necessary. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection of the agent or at or below the concentration of agent that does not give a detectable change in the phenotype. In some instances, a positive control may be employed, e.g. a cyclophilin D or USP16-specific shRNA, a cyclophilin D USP16-specific siRNA, and the like.

[00125] In some embodiments, a screening method as described herein further comprises assaying a level of an immune system marker of a target cell wherein the level of the immune system marker contacted with the candidate agent as compared to the level of the immune system marker of a target cell not contacted with candidate agent indicates that the candidate agent will treat the individual without substantially immunosuppressing the individual. Without immunosuppressing the individual means without substantially inhibiting the normal immune response. In some examples, an immune system marker may be cyclophilin A or a cyclophilin A target. An immune system marker may be a biomarker that indicates the immune status of an individual. An immune system marker may be, for example, calcineurin, NF-AT, II-2, IL-3, IL4, GMCSF, etc. As indicated elsewhere herein for quantifying the selected parameters, any aspect of the biomarker may be determined (RNA level, protein level, protein or enzyme activity, etc.) using any of the methods described herein.

[00126] Various methods can be utilized for quantifying the selected parameters. For example, a cyclophilin D target activity may be determined directly or indirectly. For example, cyclophilin D target activity levels may be determined by measuring cyclophilin D levels, such as by cyclophilin D antibody binding, blot, etc. or indirectly by measuring Ink4a/Arf expression, i.e. RNA or protein levels, may be detected by qRT-PCR, western blots, protein arrays, and the like. Cell proliferation rates and senescence may be measured by flow cytometry, BrdU incorporation, quit fractions, etc. Such methods will be well known to one of ordinary skill in the art.

Utility

[00127] The subject methods and compositions find a number of uses in medical treatment and in research. For example, the subject methods and compositions may be used in vivo in the treatment of an individual having a medical condition that is associated with a reduced rate of stem cell self-renewal or that will be responsive to an increased rate of stem cell self-renewal. As a second example, the subject methods and compositions may be used in in vitro screens to identify new therapies for medical conditions that are associated with a reduced rate of stem cell self-renewal or that will be responsive to an increased rate of stem cell self-renewal. In some examples, the subject methods and compositions may be used in vivo in the treatment of an individual having a medical condition that is associated with an altered (e.g., increased or decreased) rate of cell death or that will be responsive to an altered (e.g., increased or decreased) rate of cell death. The subject methods may include inhibiting (or activating) cyclophilin D activity and/or inhibiting (or activating) superoxide in cells, e.g., by administering an effective amount of a cyclophilin D antagonist (or agonist) or superoxide antagonist (or agonist). The subject compositions may include a cyclophilin D antagonist (or agonist) or a superoxide antagonist (or agonist). Screens may include assaying for and/or activating (or inhibiting) proliferation of mesenchymal cells. In some examples, the subject methods and compositions may be used in in vitro screens to identify new therapies for medical conditions that are associated with an altered (e.g., increased or decreased) rate of cell death or that will be responsive to an altered (e.g., increased or decreased) rate of cell death, such as an altered cyclophilin D or superoxide activity.

[00128] By "treatment", "treating" and the like it is generally meant obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. "Treatment" as used herein covers any treatment of a disease in a mammal, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or (c) relieving the disease, i.e., causing regression of the disease. The therapeutic agent may be administered before, during or after the onset of disease or injury. The treatment of ongoing disease, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, is of particular interest. Such treatment is desirably performed prior to complete loss of function in the affected tissues. The subject therapy will desirably be administered during the symptomatic stage of the disease, and in some cases after the symptomatic stage of the disease. The terms "individual," "subject," "host," and "patient," are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.

[00129] The following examples are offered by way of illustration and not by way of limitation. EXAMPLES

[00130] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

[00131] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, cloning vectors, and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as BioRad, Stratagene, Invitrogen, Sigma-Aldrich, and ClonTech.

EXAMPLES

MATERIALS AND METHODS

[00132] Mice. Ts65Dn, TslCje and euploid littermates mice were purchased from Jackson Laboratories and maintained in the mixed background B6EiC3SnF1/J. Mice were genotyped by real-time or by PCR as previously published (Reinholdt, L. G. et al. Molecular characterization of the translocation breakpoints in the Down's syndrome mouse model Ts65Dn. Mamm. Genome 22, 685-691 (2011) and Jackson website). Control littermates were used as wild-type mice. These mice are heterozygous for B6 and C3H alleles at all loci in their genome. Usp16^het mice (FVB/N-Usp16Tg(Tyr)2414FOve/Mmjax ) were acquired from MMRRC. Weaning age NOD/SCI D female mice were purchased by Jackson Laboratories. Mice were housed in Stanford University, in SCORE facility or in SIM1 animal facility, in accordance with the guidelines of Institutional Animal Care Use Committee. [00133] Bone marrow and peripheral blood analyses. Isolation and analyses of bone marrow cells were performed as previously described (Akala, O. O. et al. Long-term haematopoietic reconstitution by Trp53-/-p16lnk4a-/-p19Arf-/- multipotent progenitors. Nature 453, 228-232 (2008)). In brief, bone marrow cells were isolated by crushing long bones and hips with mortal and pestle in Calcium and Magnesium free HBSS with 2% heat-inactivated bovine serum. The cells were drawn by passing through a 25G needle several times, treated with ACK for 1 minute and filtered with a 40 mm nylon mesh. Before sorting, progenitor cells were enriched through magnetic isolation with Lineage cell depletion kit (Miltenyi Biotec) using an autoMACS pro Separator. Antibodies used for analyses and sort of bone marrow cells were lineage markers (CD3, CD5, CD8, Gr-1 , B220 and Ter119), Sca-1 , c-kit, CD150, CD48, CD135 (Flt3) and CD34.

[00134] For peripheral blood analysis, red blood cells were lysed with hypotonic buffer, and nucleated cells were stained with antibodies against CD45.1 , CD45.2, Ter119, Gr-1 , Mac-1 , CD3 and B220.

[00135] All antibodies were directly conjugated or biotinylated and purchased from e-Bioscience, BD Biosciences, or Biolegend. Cells were gated based upon forward and side-scatter profiles, and live/dead discrimination was obtained with 7-Amino-Actinomycin D (7-AAD) or DAPI. Analyses and sorting was performed using a FACS Aria II (BD Biosciences).

[00136] Bone marrow transplants. Recipient C57BI CD45.1 mice (8 to 12 weeks old) were lethally irradiated (1 , 140 rad), with two doses of radiations delivered 3 hours apart. Bone marrow single cell suspensions were obtained from long bones and hips of Ts65Dn, TslCje and wild type mice (8 to 12 weeks old) and treated for 1 minute with ACK for red cells lysis. Only donor animals with a matching haplotype for the major histocompatibility antigens were used (H2K b/b). Recipient mice were competitively reconstituted by retro-orbital venous sinus injection of three different doses (5x10⁵ cells, 1.5x10⁵ cells, 0.5x10⁵ cells) of whole bone marrow cells from donor mice mixed with a radioprotective dose of -3x10⁵ bone marrow cells from non irradiated C57BI/Ka-CD45.1 mice. Five mice were used for each group. Mice were analyzed monthly for reconstitution of peripheral blood.

[00137] For secondary transplants, 5x10⁶ bone marrow cells were collected at least four months after primary transplants from engrafted recipients, and injected in lethally irradiated C57BI CD45.1 mice. Reconstitution was measured in peripheral blood at the indicated time points.

[00138] For transplantation of lentivirus-infected Ts65Dn marrow cells, KLS cells were isolated and sorted from 8 to 12 weeks old Ts65Dn H2K b/b mice. Sorted KLS were incubated overnight with the indicated lentivirus (MOI=200). The morning after, KLS were washed, mixed with a radioprotective dose of 3x10⁵ bone marrow cells from unirradiated C57BI/Ka-CD45.1 mice, and injected in lethally irradiated mice. In parallel, 48 hours after infection we verified by FACS the level of GFP expression in infected cells, to make sure that the level of lentiviral integration would be similar between multiple samples.

[00139] For all the transplantation experiments, mice that were consider as repopulated by donor cells were mice that had more than 1 % donor-derived (CD45.2+) cells in both lymphoid (CD3+ and B220+) and myeloid (Gr-1+ and Mac-1 +) subpopulations. Frequency of long-term reconstituting cells from limiting dilution experiments was calculated using ELDA software (Hu, Y. et al. ELDA: extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J. Immunol. Methods 347, 70-78 (2009)).

[00140] In vitro colony formation of hematopoietic stem cells. For Methocult cultures, single wild- type HSCs were double-sorted into U-bottom 96-well plates containing 100 μΙ of Methocult GF M3434 media (StemCell Technologies) as previously described (Akala, O. O. et al. Long-term haematopoietic reconstitution by Trp53-/-p16lnk4a-/-p19Arf-/- multipotent progenitors. Nature 453, 228-232 (2008)). Positive colonies were scored on day 7 of culture.

[00141] For all experiments, antibodies were directly conjugated or biotinylated and purchased from e-Bioscience, BD Biosciences, or Biolegend. Cells were gated based upon forward and side-scatter profiles, and live/dead discrimination was obtained with 7-Amino-Actinomycin D (7- AAD) or DAPI. Analyses and sorting was performed using a FACS Aria II (BD Biosciences).

[00142] Western Blot and Chromatin Immunoprecipitation. For Western blot analyses, chromatin extracts were prepared with subcellular protein fractionation kit (Thermo Scientific). H2AK1 19 antibody (rabbit) was purchased from Cell Signaling; H2A antibody was purchased from Chromatin Immunoprecipitation was performed essentially as previously described (Negishi, M. et al. A novel zinc finger protein Zfp277 mediates transcriptional repression of the Ink4a/arf locus through polycomb repressive complex 1. PLoS ONE 5, e12373 (2010)) using the polyclonal antibody for H2AK1 19 (Cell Signaling).

[00143] Lentivirus preparation. The lentiviral vector that we used for downregulation was vector pSicoR-GFP (Ventura, A. et al. C re- 1 ox- regulated conditional RNA interference from transgenes. Proc. Natl. Acad. Sci. U.S.A. 101 , 10380-10385 (2004)). We cloned the following hairpins: shC (TTCTCCGAACGTGTCACGT) shUSP16 #1 (CGAGTGCTGTATTCCTTATAT), shUSP16 #2 (TTCTCTGGAAATACACCTATG), shp16 (CATCAAGACATCGTGCGATAT), shp19 (GCCATCTAAACGGTTCAGTTT), human shUSP16 (). A lentivirus construct expressing Cherry and Bmi1 (pEIZ-HIV-mCherry-Bmi1) was kindly by Dr. Y. Shimono (Shimono, Y. et al. Downregulation of miRNA-200c links breast cancer stem cells with normal stem cells. Cell 138, 592-603 (2009)). USP16 overexpression vector was obtained by subcloning USP16 clone (ATCC) in pCDH-MSCV-GFP vector (SBI).

[00144] Viruses were produced in 293T cells with a second-generation lentivirus system.

Supernatants were collected at 48hrs and 72hrs, and concentrated through ultracentrifugation (Tiscornia, G. et al. Production and purification of lentiviral vectors. Nat Protoc 1 , 241-245 (2006)). Viral titers were calculated by FACS analyses of 293T cells infected with serial dilution of concentrated virus.

[00145] Mouse Embryonic Fibroblasts (MEFs) and Terminal Tip-Tail Fibroblasts (TTFs). Mouse embryonic fibroblasts (MEFs) were generated from E14.5 embryos obtained from Ts65Dn mothers. Genotype was verified by real time PCR. Cells were passaged 1 :4 when almost confluent. To culture mouse primary tip-tail fibroblasts (TTFs), the skin was peeled from tail tips of wild type (n=4), Ts65Dn (n=3), Ts65Dn/Usp16^het (n=3) and Usp16^het (n=1) 8-weeks old mice, finely minced with a blade and shortly digested in trypsin. Resulting pieces were incubated in DM EM containing 20% FBS for three weeks. Derived fibroblasts were then passaged to new plates and considered P2. Human fibroblasts (WT: CRL-2088, CRL-2076; DS: CCL-54, CRL- 7090, CRL-7031) were purchased by ATCC.

[00146] Fibroblasts proliferation, SA-BGal and p16 staining. 5x10³ fibroblasts were seeded in a 24-well plate and viable cells were counted by trypan blue exclusion at the indicated time points.

[00147] For SA-BGal staining of senescent cells, the Senescence Detection Kit (Abeam, ab65351) was used according to manufacturer's protocol.

[00148] For p16 staining, fibroblasts were permeabilized with 0.2% Triton-PBS, blocked in 3% BSA-PBS and stained with a mouse anti-human p16 (JC8, Santa Cruz Biotechnology, CA) or rabbit anti-mouse p16. Specific secondary antibodies (Alexa Fluor 488 anti-mouse and Alexa Fluor 647 anti-rabbit) were used 1 :1000.

[00149] SA-BGal and p16 staining were detected by microscope at 10x and the positive cells were evaluated in three different fields per well. Three technical replicates were performed.

[00150] In experiments with infected cells, cells were sorted based on GFP or Cherry expression and expression of the construct was verified by real-time PCR.

[00151] RNA expression analyses. For real-time analyses, cells were collected in trizol (Invitrogen), and RNA was extracted following the manufacturer's protocol. cDNA was obtained using Superscript III First Strand Synthesis (Invitrogen).

[00152] Real time reactions were assembled using Taqman probes (Applied Biosystem) in accordance with the manufacturers' directions. Expression data were normalized by the expression of housekeeping genes ActB and GAPDH. Probes used in this study: USP16 (Mm_00470393, Mm_00470406), p16lnk (Mm_01257348, Mm_00494449), p19Arf (Mm_00486943), ActB (Mm_00607939), GAPDH (Mm_99999915), Hoxal (Mm00439359_m1), Hoxa3 (Mm01326402_m1), Hoxa5 (Mm01326402_m1).

[00153] Immunofluorescence of histones in MEFs and HSCs. Cells were cultured for 48 hours (for MEFs) or directly cytospinned on glass slides after purification (for HSC). Cells were fixed in PFA 2% for 10 minutes and washed in PBS triton 0.1 %. Cells were blocked in PBS with Donkey serum 10% for 1 hour at room temperature prior to incubation with primary antibody at 4C overnight. Incubation with secondary antibody and DAPI was set for 45 minutes at RT. Alternatively antibody staining was performed with Zenon Kit (Invitrogen) following manufacturer's directions. Samples were then mounted and imaged.

[00154] Imaging was performed using a Zeiss Observer Z1 fluorescent microscope (Zeiss) equipped with a Hamamatsu Orca-ER camera or a Zeiss confocal system LSM710 (Zeiss). Data acquisition and foci measurements were performed using Improvision Volocity software (Perkin Elmer).

[00155] The primary antibody used in this study was anti Ubiquityl-histone H2A D27C4 (Cell Signaling). Secondary antibodies were Alexa 488 and 594.

[00156] Glucose metabolism analyses. Blood glucose levels were measured from blood samples taken from 6-8 month old wild type, Ts65Dn, Ts65Dn/Usp16het (also referred to as Ts65Dn/Usp16 mice), and Usp16het mice. Mice were fed normal diet or fasted for 6 hours prior to blood glucose testing. Glucose tolerance tests were performed on mice fasted for 6 hours and then injected intraperitoneally (i.p.) with 2g/kg body weight glucose. Glucose levels were analyzed after 30 minutes and after 90 minutes. Blood glucose levels were determined using the OneTouch glucose meter (LifeScan, Inc).

[00157] Bone mineral density analyses. Bone mineral density analyses were performed on 6-8 month old male mice (4-8 mice per group). Bone mineral density at the lumbar level was determined through dual energy X-ray absorptiometry (DXA) analyses. Graphs indicate p- values (*<0.05, **0.01 , ***0.001 , ns=non-significant.

[00158] Superoxide analyses. Cells were isolated from tibiae from bone marrow of mice (e.g., wild type, Ts65Dn). Analyses were performed on the cells for superoxide using fluorescence activated cell sorting (FACS) of hematopoietic progenitor cells enriched for stem cells (KLS=lineage - Ckit+Sca+ cells,) and stained with the MitoSOX™ Red Mitochondrial superoxide indicator (LifeTechnologies). Oxidation of the MitoSOX™ Red reagent produces red fluorescence. MitoSOX™ Red is readily oxidized by superoxide, but not by other reactive oxygen species. The X axis shows the fluorescence intensity of MitoSox Red and the y axis shows cell number normalized as a percentage of the maximum (% of Max).

[00159] Cyclosporine treatment of fibroblasts. Mouse Terminal Tip-Tail Fibroblast (TTFs) isolated from wild type or Ts65Dn mice and cultured essentially as described above, except some samples treated with 100 ng/ml Cyclosporine A prior to incubation. Other samples were left untreated. The number of cells were counted over time (e.g., 3, 5, 8, 10, and 15 days).

RESULTS

[00160] Potential role for USP16 in human Down's Syndrome. Fibroblasts isolated from four human Down's syndrome patients were tested to see if USP16 might limit their proliferation. Consistent with previous reports (Carmeliet, G. et al. Cellular ageing of Alzheimer's disease and Down's syndrome cells in culture. Mutat. Res. 256, 221-231 (1991); Contestabile, A. et al. Widespread impairment of cell proliferation in the neonate Ts65Dn mouse, a model for Down's syndrome. Cell Prolif. 42, 171-181 (2009); Kimura, M. et al. Proliferation dynamics in cultured skin fibroblasts from Down's syndrome subjects. Free Radic. Biol. Med. 39, 374-380 (2005)), DS fibroblasts proliferation was impaired compared to wild type controls (Figure 6a). This was associated with increased senescence as measured by expression of SA^Gal and p16^lnk4a (Figure 6b-c and Figure 14). To determine whether USP16 overexpression might contribute to the proliferation defect, we did gain of function experiments in normal fibroblasts and loss of function experiments in Down's syndrome fibroblasts. Transduction of normal foreskin fibroblasts with USP16 slowed the proliferation of normal wild type fibroblasts (Figure 6d and Figure 14b). Conversely, shRNA mediated downregulation of USP16 or overexpression of BMI 1 resulted in increased proliferation capacity of DS fibroblasts (Figure 14b-c). Interestingly, overexpression of USP16 in two different cultures of human neural progenitor cells (from one paediatric and one adult patient) reduced their in vitro expansion potential and the formation of neurospheres (Figure 6f). These experiments suggest that a third copy of USP16 might have a role in the pathology associated in patients with Down's syndrome.

[00161] Down syndrome mice (Ts65Dn) have a defect in glucose metabolism; USP 16 modulates glucose metabolism. Down's syndrome patients are known to have an increased risk of both insulin dependent (type 1) and insulin resistant (type 2) diabetes mellitus (Fonseca et al., "Insulin resistance in adolescents with Down syndrome: a cross-sectional study; BMC Endocrine Disorders; 2005, 5:6; diapedia, The Living Textbook of Diabetes: Down's syndrome; http://www.diapedia.org/other-types-of-diabetes-mellitus/down-s-syndrome To determine whether a mouse model of Down's syndrome might have a defect in glucose metabolism, we first tested random and fasting glucose levels in the blood of Ts65Dn mice. Blood glucose levels were measured after normal diet (Figure 16a) or after 6 hours of fasting (Figure 16b). All experiments were performed in 6 to 8 months old mice housed on a regular diet. Three to ten mice were analyzed per group. Blood glucose levels were using the OneTouch glucose meter (LifeScan). All the graphs indicate p-values (* < 0.05 **0.01 ***0.001 ns=non-significant). We found that Down syndrome mice (Ts65Dn) mice have a defect in glucose metabolism compared with wild type (wt) mice. We found that glucose levels were higher in Ts65Dn mice compared to their wild type counterparts especially after fasting (Figures 16 A, B). Elimination of the extra allele of USP16 (Ts65Dn/USP16het mice, also referred to asTs65Dn/USP16) rescues the abnormally high baseline glucose levels (Figures 16 A,B). Mice with a single copy of USP16 (Usp16het) show normal glucose levels.

[00162] To further characterize glucose metabolism in the mice, we performed a glucose tolerance test. Mice fasted for 6 hours were injected by intraperitoneal (i.p.) injection of 2g/Kg glucose. Glucose levels were analyzed after 30 minutes (Figure 16C) and after 90 minutes (Figure 16D). Blood glucose levels were higher in Tn65Dn mice with three copies of Usp16 compared with wildtype, but not in Ts65Dn/Usp16 mice. After 90 minutes, glucose levels were normalized in wild type, Ts65Dn/Usp16, and Usp16het mice, but not in Ts65Dn mice. Elimination of the extra allele of Usp16 (Ts65Dn/Usp16) prevents the abnormally high glucose level (e.g., corrects the delay in normalization of glucose levels) in the Ts65Dn mice otherwise observed in Ts65Dn mice (Figures 16C.D). This rescue is secondary to the effects of USP16 on mesenchymal cells which are responsible for type 2 diabetes, and pancreatic islet cells, which produce insulin and are responsible for type 1 diabetes. These results show that inhibitors of USP16 may be useful for the treatment of both type 1 and type 2 diabetes mellitus.

[00163] Usp16 affects bone mineral density in Down's Syndrome mice models. Mesenchymal cells are important not only for glucose metabolism, but also for the generation of bone, muscle and cartilage tissue. It has been reported that bone density in Down's syndrome patients is reduced compared to healthy counterparts, even in young adults (Angelopoulou et al, Bone mineral density and muscle strength in young men with mental retardation (with and without Down Syndrome); Calcif Tissue Int. 2000 Mar; 66(3): 176-80; Angelopoulou et al. Bone mineral density in adults with Down's syndrome; Eur Radiol. 1999; 9(4):648-51). Figure 17 shows results from determining bone mineral density in wild type, Usp16het, Ts65Dn, and Ts65Dn/Usp16het mice. We show that bone density at the lumbar level is increased in 6-8 months old Ts65Dn animals upon restoration of normal copy number of Usp16 (compare Ts65Dn mouse bone mineral density results withTs65Dn/Usp16 het mouse results; Figure 17). These results show that inhibitors of Usp16 may be useful for the treatment of osteoporosis.

[00164] Effect of Cyclosporine A on mesenchymal cells. Cyclosporine (e.g., cyclosporine A;

CsA)) is a cyclic 1 1-amino acid peptide originally obtained from fungi. Cytosporine is widely used to suppress the immune system in organ transplant patients to prevent rejection of transplanted organs and to prevent and treat graft-versus host disease in bone marrow transplant patients. Calcineurin is a protein phosphatase that normally induces translocation of nuclear factor of activated T cells (NF-AT) from the cytosol into the nucleus to activate the transcription of genes encoding pro-inflammatory cytokines and the immune system. Calcineurin is a target of cyclosporine. The cytosolic protein cyclophilin a is the major intracellular receptor for cytosporine. Cytophilin a, cyclosporine, and calcineurin form a highly specific ternary complex that inhibits calcineurin activity, blocking translocation of NF-AT into the nucleus and preventing transcription of cytokines. Formation of this complex leads to reduced immune function and less transplant rejection. It is known that administration of cyclosporine A plays a protective role in preventing progression of diabetes and it has been thought that this role is due to immune system supression through binding of cyclosporine A to cyclophilin A (Huai et al., "Crystal structure of calcineurin-cyclophilin-cyclosporin shows common but distinct recognition of immunophilin-drug complexes", PNAS, 2002, 99: 12037-12042; Jenner et al., Diabetologia, "Cyclosporin A treatment of young children with newly diagnosed type 1 (insulin- dependent) diabetes mellitus"; 1992 Sep; 35(9):884-8;

[00165] Mesenchymal cells are precursors to fat and bone cells. Cyclophilin d protein is located in the mitochondria of cells and modulates reactive oxygen species (ROS) levels in cells by regulating the mitochondrial transition pore. Opening the mitochondrial transition pore allows reactants, including reactive oxygen species to move out of the mitochondria into the cytoplasm, leading to cell death. The drug cyclosporine A inhibits the activity of cyclophilin D. Figure 18 shows relative results (as a percentage of maximum) from FACS analysis of hematopoietic progenitor cells from wildtype and Ts65Dn mice using MitoSOX™ Red Mitochondrial Superoxide Indicator (Life Technologies) as an indicator of superoxide levels. We find that mitochondrial dysfunction contributes to the oxidative stress observed in Ts65Dn stem cells and that administration of the drug Cyclosporine A rescues a proliferation defect in Down's syndrome mesenchymal cells (Figure 18). (Mesenchymal cells are precursors to fat and bone cells). Metabolic problems with fat cells play a central role in type 2 diabetes. It has long been known that cyclosporine A play a protective role from diabetes progression. [00166] Our results show that inhibition of other cell types and other cyclophilins (other than cyclophilin a) also modulate disease. In particular, inhibition of cyclophilin D, which regulates the mitochondrial transition pore and decreases mitochondrial production of reactive oxygen species, will protect fat cells from becoming insulin resistant through development of the "metabolic syndrome". Our results also show that cyclosporine A will protect pancreatic islet cells from senescence via regulation of reactive oxygen species regulated by cyclophilin D.

[00167] Cyclosporine A protects Down's syndrome (Ts65Dn) mice mesenchymal progenitors from premature senescence. Proliferation of mouse fibroblasts isolated from the indicated mouse strains is shown. Note that Cyclosporine A partially rescues the proliferation defect of the Ts65Dn mouse mesenchymal progenitor cells. Compare the cell numbers from treatment of Ts65Dn fibroblast cells with 100 ng/ml Cyclosporine A with untreated Ts65Dn cells and wild type cells.

[00168] Our results also show that Cyclosporine A will protect bone producing progenitor cells from senescence via regulation of reactive oxygen species regulated by cyclophilin D.

[00169] The preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims.

Claims

CLAIMS That which is claimed is:

1. A method for screening a candidate agent for the ability to treat an individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder comprising:

contacting a cell expressing cyclophilin D with a candidate agent; and

assaying a cyclophilin D target activity,

wherein an alteration in the cyclophilin D target activity in the cell as compared to a cell not in contact with candidate agent indicates that the candidate agent will treat the individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder.

2. The method of claim 1 wherein the cyclophilin D target activity is assayed by detecting a decrease in reactive oxygen activity wherein a decrease in the amount of reactive oxygen activity as compared to the amount of reactive oxygen in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

3. The method of claim 1 wherein the cyclophilin D target activity is assayed by detecting a decrease in superoxide activity wherein a decrease in the amount of superoxide as compared to the amount of superoxide in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

4. The method of claim 1 wherein the individual has a bone disease and the bone disease is osteoporosis.

5. The method of claim 1 further comprising assaying a level of an immune system marker of a target cell wherein the level of the immune system marker contacted with the candidate agent as compared to the level of the immune system marker of a target cell not contacted with candidate agent indicates that the candidate agent will treat the individual without immunosuppressing the individual.

6. The method of claim 5 wherein the immune system marker comprises cyclophilin

A.

7. The method of claim 1 wherein the cell comprises a mesenchymal, hematopoietic, or fibroblast cell.

8. The method of claim 1 wherein the cell comprises a Down syndrome model cell.

9. The method of claim 1 wherein the cell comprises a trisomy of Usp16.

10. The method of claim 1 wherein the cyclophilin D target activity is assayed by detecting an increase in the amount of cell proliferation wherein an increase in the amount of cell proliferation as compared to the amount of cell proliferation in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

11. A method for screening a candidate agent for the ability to treat an individual having a condition associated with an increased cyclophilin D activity or that will be responsive to a decreased cyclophilin D activity comprising:

contacting a Down syndrome model cell expressing cyclophilin D with a candidate agent; and

assaying a cyclophilin D target activity,

wherein an alteration in the cyclophilin D target activity in the cell as compared to a cell not in contact with candidate agent indicates that the candidate agent will treat the individual for the condition associated with an increased cyclophilin D activity or that will be responsive to a decreased cyclophilin D activity.

12. The method of claim 11 wherein the cyclophilin D target activity is assayed by detecting a decrease in reactive oxygen activity wherein a decrease in the amount of reactive oxygen activity as compared to the amount of reactive oxygen in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

13. The method of claim 12 wherein the cyclophilin D target activity is assayed by detecting a decrease in superoxide activity wherein a decrease in the amount of superoxide as compared to the amount of superoxide in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

14. The method of claim 11 wherein the individual has a bone disease and the bone disease is osteoporosis.

15. The method of claim 1 1 further comprising assaying a level of an immune system marker of a target cell wherein the level of the immune system marker of the target cell contacted with the candidate agent as compared to the level of the immune system marker of a target cell not contacted with candidate agent indicates that the candidate agent will treat the individual without immunosuppressing the individual.

16. The method of claim 15 wherein the target cells are the Down syndrome model cell.

17. The method of claim 15 wherein the immune system marker comprises cyclophilin A.

18. The method of claim 1 1 wherein the cell comprises a mesenchymal, hematopoietic, or fibroblast cell.

19. The method of claim 11 wherein the cell comprises a trisomy of Usp16.

20. The method of claim 11 wherein the cyclophilin D target activity is assayed by detecting an increase in an amount of cell proliferation wherein an increase in the amount of cell proliferation as compared to the amount of cell proliferation in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

21. A method for screening a candidate agent for the ability to treat an individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder comprising:

contacting a cell expressing USP16 with a candidate agent; and

assaying a USP16 target activity,

wherein an alteration in the USP16 target activity in the cell as compared to a cell not in contact with candidate agent indicates that the candidate agent will treat the individual having an autoimmune disease, a bone condition, bone disease or bone disorder, or a metabolic disease or a metabolic disorder.

22. The method of claim 21 wherein the USP16 target activity is assayed by detecting a decrease in reactive oxygen activity wherein a decrease in the amount of reactive oxygen activity as compared to the amount of reactive oxygen in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

23. The method of claim 21 wherein the USP16 target activity is assayed by detecting a decrease in superoxide activity wherein a decrease in the amount of superoxide as compared to the amount of superoxide in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

24. The method of claim 21 wherein the individual has a bone disease and the bone disease is osteoporosis.

25. The method of claim 21 further comprising assaying a level of an immune system marker of a target cell wherein the level of the immune system marker contacted with the candidate agent as compared to the level of the immune system marker of a target cell not contacted with candidate agent indicates that the candidate agent will treat the individual without immunosuppressing the individual.

26. The method of claim 21 wherein the cell comprises a mesenchymal, hematopoietic, or fibroblast cell.

27. The method of claim 21 wherein the cell comprises a Down syndrome model cell.

28. The method of claim 21 wherein the cell comprises a trisomy of Usp16.

29. The method of claim 1 wherein the USP16 target activity is assayed by detecting an increase in the amount of cell proliferation wherein an increase in the amount of cell proliferation as compared to the amount of cell proliferation in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

30. A method for screening a candidate agent for the ability to treat an individual having a condition associated with an increased USP16 activity or that will be responsive to a decreased USP16 activity comprising:

contacting a Down syndrome model cell expressing USP16 with a candidate agent; and assaying a USP16 target activity,

wherein an alteration in the USP16 target activity in the cell as compared to a cell not in contact with candidate agent indicates that the candidate agent will treat the individual for the condition associated with an increased USP16 activity or that will be responsive to a decreased USP16 activity.

31. The method of claim 30 wherein the USP16 target activity is assayed by detecting a decrease in reactive oxygen activity wherein a decrease in the amount of reactive oxygen activity as compared to the amount of reactive oxygen in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

32. The method of claim 31 wherein the USP16 target activity is assayed by detecting a decrease in superoxide activity wherein a decrease in the amount of superoxide as compared to the amount of superoxide in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

33. The method of claim 30 wherein the individual has a bone disease and the bone disease is osteoporosis.

34. The method of claim 33 wherein the target cells are the Down syndrome model cell.

35. The method of claim 30 wherein the cell comprises a mesenchymal, hematopoietic, or fibroblast cell.

36. The method of claim 35 wherein the cell comprises a trisomy of Usp16.

37. The method of claim 30 wherein the USP16 target activity is assayed by detecting an increase in an amount of cell proliferation wherein an increase in the amount of cell proliferation as compared to the amount of cell proliferation in a cell not contacted with candidate agent indicates that the candidate agent will treat the individual.

The method of Claim 1 , wherein the cell expresses an APP mutation.

39. The method of Claim 21 , wherein the cell expresses an APP mutation.