WO2016176222A1

WO2016176222A1 - Cgas in systemic lupus erythematosus (sle)

Info

Publication number: WO2016176222A1
Application number: PCT/US2016/029396
Authority: WO
Inventors: Keith Elkon; Jie An; Mark MINIE; Tomikazu Sasaki; Joshua J. WOODWARD
Original assignee: University of Washington
Current assignee: University of Washington
Priority date: 2015-04-30
Filing date: 2016-04-26
Publication date: 2016-11-03
Anticipated expiration: 2017-10-30
Also published as: US20180086713A1; US10329258B2

Abstract

The present invention provides therapeutic strategies for treatment of severe debilitating diseases associated with IFN-I due to cGAS activation. In one aspect, the invention provides compounds of Formula (I): [Formula should be inserted here] and pharmaceutical uses thereof. In another aspect, the invention provides methods for treating an autoimmune disease or a monogenic disorder by administering an effective amount of a compound of Formula (I).

Description

CGAS IN SYSTEMIC LUPUS ERYTHEMATOSUS (SLE)

[0001] This application claims priority from U.S. Provisional Application No. 62/155,389 filed April 30, 2015, the disclosure of which is herein incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

[0002] The innate immune system senses the presence of microbes or damage via germline- encoded receptors, which detect pathogen associated molecular patte ns (PAMPs) or damage- associated molecular patterns (DAMPs). Nucleic acids constitute a major molecular pattern that is recognized during infection by viruses or intracellular bacteria and that results in the stimulation of type I interferons (IFN-I) and other cytokines. However, chronic or inappropriate activation of nucleic acid-sensing pathways are also implicated in inflammatory and autoimmune diseases.

[0003] Evidence for the involvement of type 1 IFNs (IFN-I) in the pathogenesis of systemic autoimmune disorders such as systemic lupus erythematosus (SLE) (Elkon, K B. and A. Wiedeman, Type I IFN system in the development and manifestations of SLE. Curr Opto Rheumatol, 2012. 24(5): p. 499-505) as well as in rare monogenic disorders including Aicardi-Goutierre's Syndrome (AGS) and spondyloenchondrodysplasia (SPENCD), is demonstrated by the increased expression of IFN-I stimulated genes (ISGs) in peripheral blood cells. SLE is a heterogeneous and flaring disease which can cause diseases of the skin, heart, lung, kidney, joints, nervous system etc., which make it very difficult to treat. AGS is a rare inherited Orphan' disease that affects children. It is characterized predominantly by abnormalities in the skin and brain resulting in severe brain defects and even death in some of these children (-35% of patients die by age 15). This disease is also associated with the expression of IFN-I and some of these patients develop features similar to SLE. In a reciprocal fashion, 1-2% of SLE patients have mutations in TREX1. The association of TREX1 mutations with SLE remains the strongest single association of a gene identified so far (highest odds ratio). There is currently no effective treatment for the severe, debilitating disorder of AGS.

[0004] How, where and when IFN-I is initially stimulated, and which of the approximately 20 IFN-I subtypes are expressed in each disease, has been difficult to determine. In vitro studies (Santer, D.M., et al.. Potent induction of IFN-aipha and chemokines by

autoantibodies in the cerebrospinal fluid of patients with neuropsychiatric lupus, J Immunol, 2009. 182(2): p. 1 192-201 ), have revealed that IFN-aipha (IFNa) is induced by SLE immune complexes (IC) containing (ribo)nucleoprotein antigens (Lovgren, T., et al., Induction of interferon-alpha by immune complexes or liposomes containing systemic lupus

erythematosus autoantigen- and Sjogren 's syndrome autoantigen-associated UNA. Arthritis Rheum, 2006. 54(6): p. 1917-27), However, the in vitro studies do not address how IFN-I may be induced prior to the formation of IC. Cytosolic DNA induces type I interferons and oilier cytokines which are important for antimicrobial defense but can also trigger autoimmunity. Experiments demonstrating that the serum from a significant proportion of SLE family members without autoantibodies induce ISGs in responder cells (Niewold, T.B., et al., High serum IFN-alpha activity is a heritable risk factor for systemic lupus

erythematosus. Genes Immun, 2007. 8(6): p. 492,-502) as well as incomplete neutralization of ISGs in clinical trials using biologies targeting IFN-a, suggest that other IFN-I may well be involved in SLE (Petri, M., et al., Sifalimumab, a human anti-interferon-alpha monoclonal antibody, in systemic lupus erythematosus: a phase I randomized, controlled, dose-escalation study. Arthritis Rheum, 2013. 65(4): p. 1011-21). Moreover, in a mouse model of AGS caused by deficient expression of the 3-5' DNA exonuclease, TREX1, accumulation of intracellular DNA is responsible for cell intrinsic production of IFNb.

[0005] While many DNA sensors have been described, the recent discovery of cyclic GAMP synthase, (cGAS) (Wu, J., et ak, Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science, 2013. 339(6121): p. 826-30) (Sun, L., et al., Cyclic GMP-AMP synthase is a cytosolic DNA sensor thai activates the type I interferon pathway. Science, 2013. 339(6121): p. 786-91), is of particular interest as it has been shown to play a pivotal role in virus-induced as well as DNA damage- induced IFN-I production. Following binding of double stranded (ds)-DNA to a positively charged pocket of cGAS, the enzyme undergoes a conformational change revealing a catalytic cleft which results in the synthesis of the cyclic dinucleotide, cyclic GMP-AMP (cGAMP) (Diner, E.J,, et al., The Innate Immune DNA Sensor cG AS Produces a Noncanonical Cyclic Dinucleotide that Activates Human STING. Cell Rep, 2013. 3(5): p. 1355-61). cGAMP binds to the adapter protein, STING, which triggers activation of TBK, phosphorylation of IRF3 with resulting transcription of IFN-b (Sun, 2013) (Wu, 2013). In cells that are deficient in TREX1, it has recently been shown that DNA triggers IFN-b selectively through the cGAS pathway (Gao, D., et ai. Activation of cyclic GMP-AMP synthase by self-DNA causes autoimmune diseases. Proc Natl Acad Sci U S A 112, E5699-5705 (2015), 26371324); Gray, E.E., Treutmg, P.M., Woodward, J.J., and Stetson, D.B. 2015. Cutting Edge: cGAS Is Required for Lethal Autoimmune Disease in the Trexl -Deficient Mouse Model of Aicardi-Goutieres Syndrome. J Immunol 195: 1939-1943).

[0006] There remains a need in the art for treatment of severe debilitating diseases associated with IFN-I due to cGAS activation. Understanding the mechanism how cGAS/cGAMP contribute to IFN-I stimulation in SLE patients allows for directed therapeutic approaches which we are pursuing in SLE and possibly other autoimmune diseases associated with eytosolie DNA as a Danger Associated Molecular Pattern (DAMP).

SUMMARY OF THE INVENTION

[0007] Systemic Lupus Erythematosus (SLE) is strongly associated with increased expression of type I interferon (IFN-I) (Elkon, 2012), Both genetic as well as experimental studies indicate that IFN-1 plays a central role in this disease (Lovgren, 2006) (Niewold, 2007). IFN- 1 can be stimulated by several pathways including cGAS (Cyclic di-GMP-AMP Synthase), a recently discovered eytosolie DNA sensor (Wu, 2013; Sun, 2013). cGAS is activated by ds-DNA, catalyzes the production of novel second messenger, cGAMP that potently activates type 1 IF through STING and IRF3 pathway. The discovery of cGAS means that any microbe with DNA that stimulates gene expression by the transcription factors NF-KB and IRP3 should also signal via a cyclic dinucleotide made by the host cell via cGAS. The pathway is also likely to be important for the sensing of self DNA, which can lead to autoimmunity. Since cGAS has catalytic activity, it is possible that a small-molecule inhibitor could have therapeutic potential for autoimmune diseases.

[0008] In view of the key role that cGAS plays in DNA stimulated IFN-b production and the suspected role of this pathway in diseases associated with high expression of ISGs , in silico screening of chemical and drag libraries was performed in order to identify candidate drugs predicted to block cGAS activity. Several candidates were identified by computational analysis, including hydroxychloroquine (HCQ) and quinacrine (QC), belonging to the antimalarial class of drugs, that were predicted to interact with cGAS and ds-DNA. Studies validated that several antimalarial drags were effective inhibitors of IFN-b production and that they functioned by inhibiting dsDNA stimulated cGAS production of cGAMP.

[0009] In an effort to identify drugs to block cGAS activity, we performed in silico screening of chemical and drug libraries and identified several commonly used antimalarial drags for the treatment of SLE, predicted to interact strongly with cGAS by computational analysis (Figure 1 ). We have verified experimentally that these antimalarial drugs block DNA binding to cGAS (Figure 1). Antimalarial drugs including HCQ could inhibit the cGAS activity and cGAMP production in vitro (Figure 2). More importantly, they could inhibit the type I IFN production when ceils were transfected with dsDNA. Our results provide a novel mechanism of action of antimalarial drugs that are used in the treatment of Lupus and RA and other autoimmune disorders.

[0010] It has been reported that the antimalarial drugs hydroxychloroquine and quinacrine induce remissions of SLE and rheumatoid arthritis. However, despite the use of

hydroxychloroquine and quinacrine as therapeutic drugs for autoimmune disease, their mechanism of action still remains unclear and controversial. Cuirent therapy for SLE such as corticosteroids, cyclophosphamide and hydroxychloroquine were introduced several decades ago and, although used, were not approved by FDA for SLE. Benlysta (HGS/GSK) anti-BLys monoclonal antibody (niAb) is the first and only approved SLE therapy in 50 years. Although clinical outcome following Benlysta treatment was better than placebo, the difference was small. So there is still a large unmet medical need for therapeutic target identification and new drag development for effective SLE treatment. The present invention provides therapeutic strategies for treatment of severe debilitating diseases associated with IFN-I due to cGAS activation.

BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 is an eiectrophoretic mobility shift assay (EMSA) showing that HCQ blocks dsDNA/cGAS binding.

[0012] Figure 2 is (A) A representative TLC analysis of Quinacrine inhibi tion of cGAS turnover; (B) Quantification of cGAS inhibition by HCQ derivatives; (C) summary of the 95% confidence intervals for the IC₅₀ of each associated inhibitor; and (D) binding affinity correlated with -log (IC50).

[0013] Figure 3 shows (A) the inhibition of the IFNb induction with antimalarial drugs; and (B and C) the different capability of antimalarial drugs to inhibit IFNb production as shown by inhibition curves and IC50.

[0014] Figure 4 shows the binding of 32P-c-di-AMP (2 nM) by STING (170 μΜ) monitored in the presence of unlabeled c-di-AMP (200 μ.Μ) and HCQ with different concentrations.

[0015] Figure 5 is (A) QPCR analysis of cGAS expression from healthy controls (CNT, n=20) and SLE (n=51); (B) cGAS expression correlated with IFN score in SLE patients; and (C) Western blot assay for the phosphorylated IRF3 expression. [0016] Figure 6 shows (A) the abundance of cGAMP THPl cells were transfected with HT- DNA quantized by mass spectrometry using SRM: and (B) the PBMC for cGAMP expression by LC/MS/MS in SLE and RA patients,

[0017] Figure 7 shows cGAS activity of compounds X5, X6 and X7 by in vitro biochemical assay.

[0018] Figure 8 shows the effect of compound X6 on spleen mass in TREX1 KO mouse.

[0019] Figure 9 shows the effect of compound X6 on the expression of ISG15 and CXCL10 in TREXl KO mouse heart.

[0020] Figure 10 shows the effect of compound X6 on the expression of 1SG15 and 1SG20 in TRE l KO mouse spleen.

[0021 ] Figure 11 shows the effect of compound X6 on the expression of IFNb in TREX l KO mouse heart.

[0022] Figure 12 shows the effect of compound X6 on Trexl-/- KO mouse cGAMP expression compared to SPLENDA™ treatment.

[0023] Figure 3 shows the Trexl -/- Heart Pathology total score for compound X6.

[0024] Figure 14 shows the effect of compound X6 on Trexl-/- heart endocardial inflammation.

[0025] Figure 15 shows the effect of compound X6 on Trexl-/- heart endocardial fibrosis.

[0026] Figure 16 shows the effect of compound X6 on Trexl-/- Heart endocardial inflammation/fibrosis .

DETAILED DESCRIPTION OF THE INVENTION

[0027] The present invention provides therapeutic strategies for treatment of severe debilitating diseases associated with IFN-I due to cGAS activation.

[0028] Before the present invention is described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

[0030] It must be noted that as used herein and in the appended claims, the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a compound" includes a plurality of such compounds, and reference to "the method" includes reference to one or more methods, method steps, and equivalents thereof known to those skilled in the art, and so forth.

[0031] In die broadest sense, as used herein, the term "autoimmune disease," refers to a disease wherein a patient's immune system is producing an unwanted immune response to one or more of their own proteins. Representative examples of autoimmune diseases include systemic lupus erythematosus (SLE), lupus nephritis (LN), rheumatoid arthritis, juvenile rheumatoid arthritis, Wegener's disease, inflammatory bowel disease, idiopathic tlirombocvtopenic purpura (ITP), thrombotic tlirombocvtopenic purpura (TTP), autoimmune thrombocytopenia, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathies, myasthenia gravis, vasculitis, diabetes mellitus, Reynaud's syndrome, Sjorgen's syndrome, scleroderma, polymyositis and glomerulonephritis. Preferably, the autoimmune disease is SLE.

[0032] In the broadest sense, as used herein, the term "monogenic disorder," refers to a disease that is the result of a single defective gene on the autosomes. Representative monogenic disorders include rare monogenic disorders, Aicardi-Goutierre's Syndrome (AGS) and spondyioenchondrodysplasia (SPENCD). Preferably, the monogenic disorder is AGS.

[0033] A "biological sample" encompasses a variety of sample types obtained from an individual and can be used in a diagnostic or monitoring assay. The definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived there from and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as polynucleotides. The term "biological sample" encompasses a clinical sample, and also includes cells in culture, cell supernatants, cell lysates, serum, plasma, biological fluid, and tissue samples.

[0034] As used herein, the terms "treatment", "treating", and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. "Treatment", as used herein, co vers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from, occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.

[0035] The terms "individual," "subject," and "patient," used interchangeably herein, refer to a mammal, including, but not limited to, murines, simians, humans, mammalian farm animals, mammalian sport animals, and mammalian pets. Preferably, the subject herein is human.

[0036] The present invention relates to compounds of Formula (I) or a prodrug or metabolite thereof,

(I)

wherein

R is -OH, -NH₂, -N(H)C(0)R₇ or -NO,;

R₂ is -H or ·0(1 ! :.

R.3 and R4 are independently -H or -CI h:

R5 and Re are independently -H, -CFI3, -CH₂CH₂SH,

R₇ is -OCH3, -OCH2CH3, -OCH2CH2CH3, -OC! l,( ! !■⁽ H i l b. -CFI3, -CH₂CH₃, -CH₂

CH₂CH₃, -CH₂CH₂CH₂CH₃, -CH₂CH₂CH₂CH₂CH₃, -CH₂CH₂CH₂CH₂CH₂CH₃, -Cf 3,

n is 2 or 3.

In some embodiments,

is [00381 In some embodiments, R, is -NH₂ or -N(H)C(0)R₇ R₃ is -( ! i : .

, is -H;

R, is -CM.

- is -OCH₃, -OCH₂CH3, -OCH₂CH2CH3, ~0€H i i lhd!:. -CH₃, -< ll.Clk -CH₂ CH2CH3. -CH2CH2CH2CH3, -CH2CH2CH2C -

CH₂CH₂CH₂CH₂CH₂CH₃, -CF₃, -CH₂CF₃ or

n is 2.

In some embodiments,

R is -NH₂ or -N(H)C(0)R₇; : is -CH₃;

R i is -H;

R₇ is -OCH₂CH₃, -CH₂CH₂CH₂CH2CH3, -CF3 or - ; and

n is 2; and

[0040] In some embodiments,

R, is -CH₃;

R.₁ is -H;

n is 2. [004Γ| In some embodiments, R; is -NH₂:

and n is 2.

[00421 In some embodiments,

R; is -NH₂:

R« is -CH₃;

-\ ?"_f -¾·.. ¾

8

R₆ is ^'— ; and n is 2.

In some embodiments. R; is N(H)C(0)R- [0044] In some embodiments,

R; is -N(H)C(0)R₇; R, is -CI S : . R, is -CI I .:

n is 2.

[0045] In some embodiments,

R-_; is -N(H)C(0)CH₂CH₂CH₂CH₂CH3. R₃ is -CI I :.

R₄ is -H;

n is 2.

[0046] In some embodiments,

R. is -N(H)C(0)CF₃;

R. is -0( SI::

R₃ is -( !!:.

R₄ is -H;

n is 2.

[0047] In some embodiments,

R is -N(H)C(())R₇;

R₂ is -GCH₃;

R₃ is -( !!:.

R₄ is -H;

R-. is -

n is 2.

[0048] Hie present invention also relates to compounds of Formula (III) or a prodrug or metabolite thereof,

(111) wherein R, is -CI -OR -NH₂, or -N0₂: e is

[0 In some aspects, Ri is -Ci; R6 is , and n is 3.

[0050] In other aspects, Ri is -Ci; e is , and n is 4.

[0051] in other aspects, i is -CI; R₆ is , and n is 3.

[0052] In some aspects, R] is -CI; R₆ is

, and n is 4.

[0053] In some aspects, R_t is -CI Re is " , and n is 3.

[0054] In other aspects,

, and n is 4.

^••CH_¾ «4 }>

[0055] In some aspects, i is OH; R₆ is , and n is 3.

[0056] In some aspects. Ri is OH; Re is , and n is 4.

[0057] In some aspects, Rj is OH; Re is , and n is 3.

[0058] In other aspects, Ri is OH; Re is

, and n is 4.

/^""^'\

j

[0059] in other aspects, Ri is OH; R₆ is , and n is 3.

[0060] In other aspects, Ri is OH; Re is .. 1 , and n is 4.

[0061 ] In some aspects, R] is NH₂; Re is , and n is 3. .../

[0062] in some aspects, Ri is H₂; R₂ is , and n is 4. [0063] In other aspects, Ri is NH₂; ¾ is

, and n is Λ .

I I ^■■? ;.>

^'\.../

[0064] In other aspects, j is NH₂; Re is and n is 4.

51 In some aspects, Ri is NH₂; R is and n is 3.

[0066] In some aspects, Ri is NH₂; Re is and n is 4.

[0067] In some aspects, Ri is Q₂; e is , and n is 3. [0068] In some aspects. Ri is N0₂; R₆ is , and n is 4.

In some aspects, Ri is N0₂; Re is

, and n is 3.

[0070] In other aspects, Ri is N0₂; Re is ^^™^ , and n is 4.

[0071] In other aspects, Ri is N0₂; Re is n is J .

[0072] In other aspects, Ri is N0₂; R₆ is

, and n is 4.

[0073] Other aspects of the present invention relate to compounds of Formula (II) or a prodrug or metabolite thereof,

wherein Ri is H. CI, OH, H₂ or N0₂; R₂ is H or OCl¾; R₃ and j are independently H or

CH₃ -CH₂CH₂SH,

[ erred aspect, Ri is NH₂; R₂ is-OCH₃; R₃ is CH₃; ¾ is H; R₅ is CHj. , is

[0075] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, 2 is H, R₃ and R4 are H, R₅ and Re are H, and n is 2 or 3.

[0076] In some aspects, i is H, CI, OH, NH₂ or N0₂, R2 is H, R₃ and R, are H, R₅ and Re are CH₃, and n is 2 or 3.

[0077] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R _> are H, R₅ and ₆ are -CH₂CH₂SH, and n is 2 or 3.

[0078] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ and R₄ are H, R₅ and R, ··< ¾·· >,----•\

are , and n is 2 or 3.

[00 ects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ and R₆

[0080] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R, are H, R₅ and Re

In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, Rj and R,

[0082] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R are H, Rj is H, « is CH₃, and n is 2.

[0083] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R _> are H, R₅ s H, Re is -CH₂CH₂SH, and n is 2 or 3.

is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is H, Re is , OH, NH₂ or N0₂, R · is H, R₃ and R are H, R₅ is H, Ri. is

[00861 n some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is H, Re is

R is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R, are H, R-. is H, R, is

[0088] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is CH , Re is H, and n is 2 or 3.

[0089] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3 ,

[0090] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R, are H, R-. is CH₃,

/^SBa\

Re is , and n is 2 or 3.

NH₂ or N0₂, R₂ is H, R₃ and R > are H, R₅ s CH₃,

[0092] In some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ and R₄ are H, R₅ is CH₃,

[0093] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R_A are H, R₅ is CH₃,

[0094] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is CH₂CH₂SH, Re is H, and n is 2 or 3.

[0095] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is ( ! !,( ! I,SH. R, is CH₃, and n is 2 or 3.

[0096] In some as is H, CI, OH, NH₂ or N0₂, R - is H, R₃ and R, are H, R-. is

CH₂CH₂SH, Re is , and n is 2 or 3. [00971 n some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ and R₄ are H, R₅ is

CH₂CH₂ SH, Re is ^™ , and n is 2 or 3.

[0098] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

CH₂CH₂SH, ¾ is

, and n is 2 or 3.

[0099] In some aspects, Ri is H, CI, OH, H₂ or NQ₂, R₂ is H, R₃ and R₄ are H, R₅ is

CH₂CH₂ SH, Re is

, and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is H₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

me aspects, R . is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R > are H, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

N0₂, R₂ is H, R₃ and R₄ are H, R₅ is

[0104] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, Κ · is H, R₃ and R₄ are H, R₅ is

>0 . e is -^·ϋ?Η 1 , and n is 2 or .

[0105] In some NH₂ or NQ₂, R₂ is H, R₃ and R₄ are ss

r N0₂, R₂ is H, R₃ and * are H, R₅ is

[01071 n some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ and R₄ are H, R₅ is "* , Re is CH₃, and n is 2 or 3.

[0108] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R4 are H, R₅ is

^•• H_F- X

, R« is -CH CH₂SH, and n is 2 or 3.

[0 N0₂, R₂ is H, R₃ and R4 are H, R₅ is

[0110] In some aspects, R is H, CI, OH, NH₂ or N0₂, R - is I I. R₃ and R, are H, R-. is

[0111 ] In some as or NO , R₂ is H, R₃ and R₄ are H, R₅ is

[0112] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and R, are I

, R is H, and n is 2 or 3.

[01 13 In some aspects, Rj is H, CI, OH, H₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

_; g₆ j_s Qj_f_{3; anc}; _n j_s 2 ₀₅- [0114] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R5 is

, ¾ is -CH₂CH₂SH, and n is 2 or 3.

[01 15] In some aspects, Ri is H, CI, OH, H₂ or N0₂, R₂ is H, R and R₄ are H, R₅ is

[0116] In some aspects, R is H, CI, OH, NH₂ or N0₂, R · is H, R₃ and R4 are H, R₅ is

[01171 n some aspe or NO , R₂ is H, R₃ and R₄ are H, R₅ is

[0118] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and R, are H, R-. is

OH, H₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, 3 and R4 are H, R5 is

, !¾, is -CH₂CH₂SH, and n is 2 or 3.

[0 21] In some aspects, Ri is H, CI, OH, H₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is

2, K · is H, R. = and R4 are H, R5 is

2, R₂ is H, R₃ and R₄ are H, R₅ s

[0124] In some aspects, R. _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is CH₃, Re is H, and n is 2 or 3.

[0125] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and R, are H, R-. is - CH₂CH₂SH, Re is H, and n is 2 or 3.

[0126] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R5 is

, Re is H, and n is 2 or 3. [0 OH, NH₂ or NO , R₂ is H, R₃ and R₄ are H, R₅ is

[0128J In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R4 are H, R₅ is

H, CI, OH, H₂ or NQ₂, R₂ is H, R₃ and R4 are H, R₅ is

[0130] In some aspects, Rj is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R4 are H, R₅ is H, R is CH₃, and n is 2 or 3.

[0131] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R5 is - CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

OH, H₂ or NQ₂, R₂ is H, R₃ and R4 are H, R₅ is

or N0₂, R₂ is H, R₃ and R4 are H, Rj is

[0134] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

[0135] In some aspects, Ri is H, CI, OH, H₂ or NQ₂, R₂ is H, R₃ and R4 are H, R₅ is

[0136] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is H, Re is -CH₂CH₂SH, and n is 2 or 3.

[0137] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3. [01381 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is

, ¾ is -CH₂CH₂SH, and n is 2 or 3.

[0 aspects, Ri is H, CI, OH, NH₂ or NO₂, R₂ is H, R3 and R4 are H, R5 is

, e is -CH₂CH₂SH, and n is 2 or 3.

[0140] In some aspects, i is H, R₂ is H, R₃ and R4 are H, R₅ is

, Re is -

CH₂CH₂SH, and 11 is 2.

[0141] In some aspects, Rj is H, CI, OH, H₂ or N0₂, R₂ is H, R3 and R4 are H, R₅ is nd n is 2 or 3 ,

, CI, OH, NH₂ or NO₂, R₂ is H, R3 and R4 are H, R5 is H, e is

[0143] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is CH₃,

-CH: " _\ ¾

Re is , and n is 2 or 3.

[0144] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is -

J ^

CH₂CH₂SH, ₆ is , and n is 2 or 3.

[0145] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

^N¾™* , Re is ^™" , and n is 2 or 3.

[0146] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is

[01481 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is H, Re is "* , and n is 2 or 3.

[0149] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is CH₃,

Re is ^, , and n is 2 or 3.

[0150] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R5 is -

CH₂CH₂SH, Re is ^~<; H ^^™' * , and n is 2 or 3.

[0151] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and R, are H, R-. is

[0152] In some aspects, R . is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R _> are H, R₅ is

or N0₂, R₂ is H, R₃ and R4 are H, R₅ is

[0154] In some aspects, R_x is H, CI, OH, H₂ or NQ₂, R₂ is H, R₃ and R4 are H, R₅ is H, e is

[0155] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂. is H, R₃ and R4 are H, R₅ is CH₃, e is I , and n is 2 or 3 ,

[0156] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is I I. R and R , are H, R₅ is

CH₂CH₂SH, Re is

, and n is 2 or 3.

[0157] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R5 is _J> . ¾^f

, Re is ^^'"^"" , and n is 2 or 3. [01581 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R and R₄ are H, R₅ is

or N0₂, R₂ is H, R₃ and , are H, R₅ is

some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are H, R₅ is H, Re is

is H, CI, OH, NH₂ or N0₂, R₂ is H, 3 and R4 are H, R5 is CH

[0162] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is

H

CH₂CH₂SH, Re is ' _; and n is 2 or 3.

[0163] In some aspects, R is H, CI, OH, NH₂ or NO₂, K · is H, R₃ and R4 are H, R₅ is

[0164] In some aspects, R . is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R > are H, R₅ is

[0165] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are H, R₅ is

[0166] In some aspects, i is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R4 are CH₃, R₅ and Re are H, and n is 2 or 3.

[0167] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ and R₆ are C¾, and n is 2 or 3. [01681 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ and R₆ are -CH₂CH₂SH, and n is 2 or 3.

H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ and R.₆

[0170] In some aspects, i is H, CI, OH, ₂ or NQ₂, R₂ is H, R₃ and R4 are CH₃, R₅ and R

.. < ··>;

a_re . and n is 2 or 3.

[0171] In some aspects, R . is H, CI, OH, or NO ·. R · is H, R₃ and R » are CH₃, .5 and Re

; is H, Ci, OH, NH₂ or N0₂, R is H, R₃ and R._t are CH₃, R₅ and

[0173] In some aspects, R . is H, CI, OH, or NO₂, ₂ is H, R₃ and R₄ are CH₃, R₅ is H,

[0174] In some aspects, Rj is H, CI, OH, ¾ or NO , R₂ is H, R₃ and R₄ are CH₃, R-. is I I Re is -CH₂CH₂SH, and n is 2 or 3.

Ci, OH, NH₂ or N0₂, ₂ is H, R₃ and R₄ are CH₃, R₅ is H,

, Ri is H, CI, OH, or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is H,

, and n is 2 or 3.

[0177] In some aspects, R . is H, CI, OH, or NO₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is H,

[017 aspects, R. _; is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is H,

Re is

and n is 2 or : [01791 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R, and R₄ are CH₃, R₅ is CH₃, Re is H, and n is 2 or 3.

[0180] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3 ,

[0181] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is I I. R and R , are CH₃, R-. is CH₃,

Re is ^•••---•Li , and n is 2 or 3.

NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is CH₃,

[0183] In some as ects, R . is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is CH

[0184] In some aspects, R is H, CI, OH, NH₂ or N0₂, R - is I I. R₃ and R, are CH,, R₅ is CH,

[0185] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R, and R₄ are CH₃, R₅ is CH₂CH₂SH, Re is H, and n is 2 or 3.

[0186] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is ( ! !,( ! I . SH. e is CH₃, and n is 2 or 3.

[0187] In some as is H, CI, OH, NH₂ or N0₂, R - is I I. R₃ and R, are CH,, R₅ is

CH₂CH₂SH, Re is , and n is 2 or 3.

[0188] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R, and R₄ are CH₃, R₅ is CH₂CH₂SH, R₆ is ^^'" , and n is 2 or 3.

[0189] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

( ! !,( ! I . SH. e is

and n is 2 or 3 , [01901 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

CH₂CH₂SH, ₆ is

, and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is I I. R₃ and R, are CH₃, R₅ is H₂ or NQ₂, R₂ is H, R₃ and EU are CH₃, R₅ is

[ me aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is

, Re is -CH2CH2SH, and n is 2 or 3 ,

[0194] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ and R_A are CH₃, R₅ is

^■¾ i? * $

, e is , and n is 2 or 3.

[0195] In some aspects, i is H, CI, OH, H₂ or NQ₂, R₂ is H, R₃ and R4 are CH₃, R₅ is

[0196] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

r N0₂, R₂ is H, R₃ and R, are CH₃, R₅ is

[0198] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

, e is CH₃, and n is 2 or 3.

[0 aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3. [0 N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

[0201] In some aspects, Ri is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R5 is

[0202] In some aspects, i is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

[0203] In some aspects, Rj is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is

[0204] In some aspects, R ; is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and R4 are CH₃, R-. is

[0205] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

, Re i s -CH₂CH₂SH, and n 1 s 2 or 3 ,

[0206] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and , are CH₃, R₅ is

[0207] In some aspects, Ri is H, CI, OH, NH₂ or NO., R₂ is H, R and R₄ are CH₃, Rs is

[0208] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

, and n is 2 or . H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and R, are CH₃, R₅ is

, R₆ is ( i I :. and n is 2 or 3.

[0211] In some aspects, Rj is H, CI, OH, H₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R5 is

_; Rg is -CH₂CH₂SH, and n is 2 or 3 ,

NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R5 is

0₂, R₂ is H, R and R₄ are CH₃, R₅ is

[0214] In some aspects, R is H, CI, OH, NH₂ or N0₂, K · is H, R₃ and R are CH . R₅ is

[0215] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is CH₃, Re is H, and n is 2 or 3.

[0216] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH , R₅ is - CH₂CH₂SH, Re is H, and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

[0218] In some aspects, i is H, CI, OH, H₂ or NQ₂, R₂ is H, R₃ and R4 are O k R₅ is

^^**"* , Re is H, and n is 2 or 3. [02191 n some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is

[0221] In some aspects, Rj is H, CI, OH, H₂ or N0₂, R₂ is H, R₃ and R4 are CH3, R5 is H, Re is CH , and n is 2 or 3.

[0222] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, Κ · is H, R₃ and 4 are CH₃, R₅ is - ( ! !,( ! I,SH. R,. is CH₃, and n is 2 or 3.

NH₂ or N0₂, R₂ is I I. R₃ and R, are i l l - . R₅ is

or NQ₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

[0225] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R3 and R are CH3, R5 is

, R₆ is ( i I :. and n is 2 or 3.

[0227] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is H, Re is -CH₂CH₂SH, and n is 2 or 3.

[0228J In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3,

me aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R, are CH₃, R₅ is

, e is -CH₂CH₂SH, and n is 2 or 3. [0 aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

, e is -CH₂CH₂SH, and n is 2 or 3.

[0231] In some aspects, Ri is H, Ci, OH, NH₂ or N0₂, R₂ is H, R> and R4 are CH₃, R_> is

is -CH CH SH. and n is 2 or 3.

some aspects, i is H, CI, OH, H₂ or NQ₂, R₂ is H, R₃ and R4 are CH₃, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

Ci, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is H_: H, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is CH₃3,

[0235] In some aspects, R₄ is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is ( 1 1 1 1 - SH, R₆ is ^' , and n is 2 or 3.

[0236] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH , R₅ is

\, ,« ^

^■™»>' , R_g is , and n is 2 or 3.

[0237] In some aspects, R _; is H, Ci, OH, NH₂ or N0₂, Κ · is H, R₃ and R₄ are CH₃, R₅ is

[0238] In some aspects, R₄ is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

[0239] In some aspects, Ri is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ and * are CH₃, R₅ is H, Re is ^{^}*^*"^*^ , and n is 2 or 3 , [02401 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is CH₃, Re is ^^™" , and n is 2 or 3.

[0241J In some aspe H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R5 is - CH₂CH₂SH, ₆ is

, and n is 2 or 3,

N0₂, R₂ is H, R and R4 are CH₃, R5 is

[0243] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R, are CH₃, R₅ is

[0244] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH , R₅ is

[0245] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R, are CH₃, R₅ is H, s

Re is · , and n is 2 or 3.

[Θ246] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is CH

[0247] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is -

CH₂CH₂SH, Re is ^ , and n is 2 or 3.

[Θ248] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

[0249] In some aspects, R is H, CI, OH, NH₂ or N0₂, K · is H, R₃ and R4 are CH . R₅ is

[02501 In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ and R, are CH₃, R₅ is H,

, CI, OH, H₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R₅ is CH₃,

, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R4 are CH₃, R5 is

[0254] In some aspects, Ri is H, CI, OH, H₂ or N0₂, R₂ is H, R and R₄ are CH₃, R₅ is

2, R is H, R₃ and R4 are CH₃, R_> is

[0256] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ and R₄ are CH₃, R₅ is

[0257] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, \< _> is CH₃, R₅ and e are H, and n is 2 or 3.

[0258] In some aspects, R is H, CI, OH, NH₂ or N0₂, R - is I I. R₃ is H, R₄ is CH₃, R, and Re are CH₃, and n is 2 or 3.

[0259] In some aspects, Ri is H, C!, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R s CH₃, R₅ and ¾ are -CH₂CFLSH, and n is 2 or 3. H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ and Re

[026 ects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R is H, R4 is CH₃, R₅ and Re are

, and n is 2 or 3 ,

In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ and Re

is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ and ¾

[0264] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is H, R₆ is CH₃, and n is 2 or 3.

[0265] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is H, R₆ is -CH₂CH₂SH, and n is 2 or 3.

H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is H, R₆ H, NH₂ or N0₂, R is H, R₃ is H, R₄ is CH , R₅ is H, Re

[0268] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is H, Re

- OH ..

is and n is 2 or 3.

[0269] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R, is H,

[0270] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is CH₃ Re is H, and n is 2 or 3. [02711 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3.

[0272 ects, Ri is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, Rj is CH₃,

is and n is 2 or 3.

NH₂ or NQ₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is CH₃,

[0274] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is CH₃,

[0275] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is CH₃,

[0276] In some aspects, R_x is H, C!, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is CH₂CH₂SH, Re is H, and n is 2 or 3.

[0277] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ is CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0278] In some as is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

CH₂CH₂SH, is , and n is 2 or 3.

[0279] In some aspects, i is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is

(^'! ! ·( ! LSI L Re is , and n is 2 or 3.

[0280] In some aspects, R_x is H, C!, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

CH₂CH₂SH, Re is ^¾-" ^J , and n is 2 or 3.

[0281] In some aspects, R _; is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

CH₂CH₂SH, Re is

and n is 2 or : CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ is H₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

[0284] In some aspects, i is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, * is CH₃, R₅ is ...,· *. ../"%

, Re is -CI 1 ( 1 1 SI i. and n is 2 or 3.

NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

[0286] In some aspects, Rj is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is

[0287] In some NH₂ or NQ₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is

r N0₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is r N0₂, R₂ is H, R₃ is H, \< > is CH₃, R₅ is

[0 aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0 R _; is H, CI, OH, NH₂ or N0₂, R . is H, R₃ is H, R4 is CH₃, R - is

[02921 n some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ is

[0293] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is H, R₄ is CH₃, R₅ is

[0294] In some aspects, Rj is H, CI, OH, NH₂ or NO., R₂ is H, R₃ is H, R, is CH₃, R₅ is

[0295] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

^' % '?

, Re is CH₃, and n is 2 or 3.

[0296] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, ¾ is CH₃, R₅ is

\ it

w _? ¾ i_s -CH₂CH₂SH, and n is 2 or 3.

[0297] In some aspects, R. is H, CI, OH, NH₂ or N0₂, K · is H, R₃ is H, R₄ is CH , R₅ is

[0298] In some aspects, Rj is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

[0299] In some aspects, R. _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

[0300] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R , is CH₃, R₅ is

some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

, _6 is CH₃, and n is 2 or 3,

some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is H, R₄ is CH₃, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

NH₂ or N0₂, R₂ is H, R is H, R, is CH₃, R₅ is

2, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

2, R₂ is H, R₃ is H, R, is CH₃, R₅ is

[0306] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R is H, R₃ is H, R₄ is CH , R₅ is CH₃ Re is H, and n is 2 or 3.

[0307] In some aspects, ¾ is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is - CH₂CH₂SH, e is H, and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is H, R₃ is H, R_¾ is CH₃, R₅ is 2 or N0₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is

[0310] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

[0312] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is H, R₄ is CH₃, R₅ is is CH , and n is 2 or 3.

[0313] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0314] In some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

--< !■;

, ¾ is CH₃, and n is 2 or 3.

[0315] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

^^™"^''^' , R₆ is CH₃, and n is 2 or 3.

[0316] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is H, R₄ is CH₃, R₅ is

[0317] In some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

, _e is CH₃, and n is 2 or 3,

[0318] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ is H, R is CH₃, R₅ is is -CH₂CH₂SH, and n is 2 or 3.

[0319] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is R6 is -CH₂CH₂SH, and n is 2 or 3.

me aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

, Re is -CH₂CHjSH, and n is 2 or 3.

[0 aspects, . is H, Ci, OH, NH₂ or N0₂, K · is H, R₃ is H, R is CH , R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3 [03221 I» some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

, ₆ is -CH₂CH₂SH, and n is 2 or 3,

some aspects, Ri is H, CI, OH, NH₂ or N0₂, R_ is H, R₃ is H, R₄ is CH₃, R₅ is

, R_f, is -CH₂CH₂SH, and n is 2 or 3.

H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ is

[0325] In some aspects, ¾ is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

^:··-^'·*^"

is , and n is 2 or 3

; is H, C, OH, NH₂ or N0₂, R₂ is II. R₃ is H, R₄ is CH₃, R- is

is H, R₃ is H, ¾ is CH₃, R₅ is

[0328 In some aspects, R. is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R4 is C^'lk R₅ is

[0329] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is II. R₃ is H, R₄ is CH₃, R₅ is

, R₆ is -^·°^ί ' , and n is 2 or .

[0330] In some aspects, R_: is H, CI, OH, NH₂ or NO, R₂ is H, R₃ is H, R, is C^'lk R₅ is H, 6 is \ and n is 2 or 3.

[0331] In some aspects, R_; is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R_s is CH₃, R₅ is CH₃, Rs is ^^4*^ , and n is 2 or 3 , [03321 I» some aspe is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is CH₂CH₂ SH, Re is

, and n is 2 or 3.

[0333] In some aspects, ¾ is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R4 is CH₃, Rj is

[0334] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

[0335] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R, s CH₃, R₅ is

[0336] In some aspects, i is H, Ci, OH, NH₂ or N0₂, R is H, R₃ is H, R₄ is CH , R₅ is H, Re

[0337] In some aspects, Rj is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is CH₃,

[0338] In some aspects, ¾ is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is -

CH₂CH₂SH, Re is

, and n is 2 or 3.

[0339] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is H, R4 is CH₃, R₅ is

[0340] In some aspects, R, is H, Ci, OH, NH, or NO .. R₂ is H, R₃ is H, 4 is CH₃, R, is

[03411 I» some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is H, R, is CH₃, R₅ is

R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is H, R₄ is CH

, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R, is CH₃, R₅ is CH₃,

, CL OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

[0345] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R_¾ is CH₃, R₅ is

2, R is H, R₃ is H, R4 is CH₃, Rj is

7] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is H, R₄ is CH₃, R₅ is

[0348] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ and R₆ are H, and n is 2 or 3.

[0349] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R* is H, R₅ and R₆ are CH₃, and n is 2 or 3.

[0350] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R_₅ and Re are -CH₂CFLSH, and n is 2 or 3. H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ and R. , OH, NH₂ or N0₂, R₂ is H, 3 is CH₃, R4 is H, Rj and Re

[0353] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ and R₆

is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ and ^

[0355] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is H, Re is CH₃, and n is 2 or 3.

[0356] In some aspects, R . is H, CI, OH, or NQ₂, R₂ is H, R₃ is CH₃, R₄ is H, R₅ is is -CH1CH7SH, and n is 2 or 3.

H, CI, OH, ¾ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is H, H, NH₂ or N0₂, R is H, R₃ is CH₃, R₄ is H, R₅ is H, ₆

[0359] In some aspects, R is H, CI, OH, : JH₂ or N0₂, R₂ is H, R₃ is CH₃, is H, R₅ is H,

R j is H, CI, OH, ¾ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is H,

] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, Rj is CH₃ Re is H, and n is 2 or 3. [03621 n some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is i l k Re is -CH₂CH₂SH, and n is 2 or 3.

[0 CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, 4 is H, R₅ is CH₃,

[0 H, NH₂ or NQ₂, R . is H, R₃ is CH₃, R4 is H, R, is CH₃,

Re i

s , and n is 2 or 3.

[0365] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is CH₃, R₄ is H, R5 is CH₃,

[0366] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is CH₃,

[0367] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R₅ is CH₂CH₂SH, Re is H, and n is 2 or 3.

[0368] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0369] In some as _; is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

CH₂CH₂SH, is , and n is 2 or 3.

[0370] In some aspects, i is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

(^'! ! ·( ! LSI L Re is , and n is 2 or 3.

[0371] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R_₅ is

CH₂CH₂SH, Re is ^¾-" ^J , and n is 2 or 3.

[0372] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R - is H, R . is CH₃, R4 is H, R₅ is

CH₂CH₂SH, Re is

and n is 2 or : CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is H₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

[0375] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is ...,· *. ../"%

, Re is -CI 1 ( 1 1 SI i. and n is 2 or 3.

NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is

[0377] In some aspects, Rj is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

[0378] In some NH₂ or NQ₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

r N0₂, R₂ is H, R₃ is CH , R4 is I I. R₅ is r N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

[0 aspects, R_x is H, Ci, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0 aspects, R _; is H, CI, OH, NH₂ or NQ₂, R . is H, R₃ is CH₃, R4 is H, R , is

, Re is [0383] In some aspects, R, is H, CI, OH, NH₂ or N0₂, R, is R R? is CH₃, t is H, R₅ is

or N0₂, R₂ is H, R₃ is CH₃, R* is H, R₅ is

[0385] In some aspects, R, is H, CI, OH, H₂ or N0₂, R₂ is R R₃ is CH₃, R is H, R_s is

[0386] In some aspects, Ri is H, CI. OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

, R_f, is CH₃, and 11 is 2 or 3.

[0387] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is R R₃ is CH₃, R₄ is H, R₅ is

_? ¾ i_s -CH2CH2SH, and n is 2 or 3.

In some aspects, Ri is H. CI. OH, NH₂ or N0₂, R₂ is R R₃ is CH₃, R₄ is H, R₅ is

[0389] In some aspects, Rj is H, CI, OH, NH₂ or NQ₂, R₂ is R R₃ is CH₃, R₄ is H, R₅ is

or N0₂, R₂ is R ¾ is CH₃, R4 is H, R₅ is

[0391] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is R R₃ is CH₃, + is H, R₅ is

some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is

, _6 is CH₃, and n is 2 or 3,

some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is ( Ί k R i is H, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

NH₂ or N0₂, R₂ is H, R₃ is CH₃, R is H, R₅ is

2, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

2, R₂ is H, R₃ is CH₃, R₄ is H, R₅ is

[0397] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R₅ is CH₃ e is H, and n is 2 or 3.

[0398] In some aspects, ¾ is H, CI, OH, NH₂ or NQ₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is - CH₂CH₂SH, Re is H, and n is 2 or 3.

[0399] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R₅ is

¹ ^

, Re is H, and n is 2 or 3.

[ NH₂ or N0₂, R₂ is H, R₃ is CH₃, ¾ is H, R₅ is

[0401] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R* is H, R₅ is

H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is

[0403] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is CH , i is H, R₅ is is CH , and n is 2 or 3.

[0404] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R₅ is CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0405] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is

--< !■;

, ¾ is CH₃, and n is 2 or 3.

[0406] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

^^™"''^' , R₆ is CH₃, and n is 2 or 3.

[0407] In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is ( Ί k R i is H, R₅ is

[0408] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is

, _e is CH₃, and n is 2 or 3,

[0409] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is is -CH₂CH₂SH, and n is 2 or 3.

[0410] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R_₅ is R6 is -CH₂CH₂SH, and n is 2 or 3.

me aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0 aspects, R is H, Ci, OH, NH₂ or N0₂, Κ · is H, R . is CH₃, R is H, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3. [04131 I» some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is II. R₅ is

, ₆ is -CH2CH2SH, and n is 2 or 3,

some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

, R§ is -CH₂CH₂SH, and n is 2 or 3.

H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is H, R₆

is H, R₃ is CH₃, R4 is H, R₅ is CH₃,

is II. R₃ is CH₃, R; is H, R- is

is H, R₃ is CH₃, R₄ is H, R₅ is

[0419 In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH , R4 is II. R₅ is

104201 In some aspects, R is H, CI, OH, NH₂ or N0₂, R₂ is II. R₃ is ( I k R₄ is H, R₅ is

, R₆ is -^·°^ί ' , and n is 2 or 3.

[0421] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is II. R₅ is H, 6 is \ and n is 2 or 3.

OH, NH₂ or N0₂, R- is H, R₃ is CH₃, R4 is II. Rj is CH₃,

3| in some aspects, R , is H, CI, OH, NH₂ or NO , R, is H, R₃ is CH₃, > is H, R₅ is

CH _? CH₂ SH, Re is , and n is 2 or 3.

10424] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R - is H, R₃ is CH₃. R* is 1 1. Rj is

[0425] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

[0426] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃. R₄ is H, R₅ is

[0427] In some aspects, i is H, CL OH, NH₂ or N0₂. R₂ is H, R₃ is CH₃, R₄ is H, R₅ is H, Re

[0428] In some aspects. Ri is H, CL OH. NH₂ or N0₂, R₂ is H, R₃ is CH₃. R₄ is H, R₅ is CH₃,

[0429] In some aspects, R, is H. CI. OH, NH₂ or N0₂. R₂ is H, R₃ is CH₃, R is H, R₅ is -

CH2CH2SH, Rs is ^' , and n is 2 or 3.

[0430] In some aspects. R_t is H, CI, OH. NH₂ or NQ₂, R₂ is H, R is CH₃, R4 is H, R₅ is

[0431 [ In some aspects, R, is H, CL OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃. ¾ is H, R, is

[04321 I» some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is H, R₃ is CH₃, R, is I I. R₅ is

R is H, CI, OH, NH₂ or N0₂, R₂ is I I. R₃ is CH , i is H, R₅ is H, R<.

, CI, OH, NH₂ or N0₂, R₂ is H, R is CH₃, R₄ is H, R₅ is CH₃,

, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R4 is H, R₅ is

[0436] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R₅ is

2, R₂ is H, R₃ is CH₃, 4 is H, Rj is

[0438] In some aspects, R j is H, CI, OH, NH₂ or N0₂, R₂ is H, R₃ is CH₃, R₄ is H, R_₅ is

[0439] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ and e are H, and n is 2 or 3.

[0440] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ and Re are CH₃, and n is 2 or 3.

[0441] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R¾. are H, R₅ and Re are -CH₂CH₂SH, and n is 2 or 3. [04421 , Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and ÷ are H, R₅ and Re are and n is 2 or 3.

[0443] , Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ and Re are

, and n is 2 or 3.

[0444] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ and

[0445] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R¾. are H, R₅ and

[0446] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is H, Re is CH₃, and n is 2 or 3.

[0447] In some aspects, R . is H, CI, OH, NH₂ or NQ₂, R₂ is ~OCH₃, R₃ and R | are H, R₅ is H, Re is -CH₂CH₂SH, and n is 2 or 3.

[0448] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and ÷ are H, R₅ is

H, Re is , and n is 2 or 3.

NH₂ or N0₂, R₂ is -GCH₃, R₃ and R4 are H, R₅ is

[0450] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is

[0451 ] I pects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

I, Re is

, and n is 2 or 3.

[0452] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is CH₃, Re is H, and n is 2 or 3. [04531 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and ÷ are H, R₅ is CH₃, Rs is -CH₂CH₂SH, and n is 2 or 3.

[0454] In some aspects, Rj is H, Ci, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is

CH₃, e is and n is 2 or 3 ,

[0455] In is H, CI, OH, H₂ or NQ₂, R₂ is -0CH₃, R₃ and R4 are H, R₅ is CH₃, Re is

, and n is 2 or 3.

[0456] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH3, R₃ and R4 are H, R₅ is

[0457] in some aspects, j is H, Ci, OH, NH₂ or N0₂, ₂ is -OCH₃, R₃ and R₄ are H, R₅ is

CM .. Ri. is

, and n is 2 or 3.

[0458] In some aspects, R . is H, CI, OH, NH₂ or NQ₂, R _: is ~OCH₃, R₃ and 4 are H, R₅ is CH₂CH₂SH, Re is H, and n is 2 or 3.

[0459] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0460] In some as is H, Ci, OH, NH₂ or N0₂, ₂ is -OCH₃, R₃ and R₄ are H, R₅ is

CH₂CH₂SH, is , and n is 2 or 3.

[0461] In some aspects, Ri is H, CI, OH, H₂ or NQ₂, R₂ is -OCH₃, R₃ and ¾ are H, R₅ is

(^'! ! ·(^'! LSI L Re is , and n is 2 or 3.

[0462] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R _: is -OCH₃, R₃ and R4 are H, R₅ is

( I I . i l l . SS I. Re is ^¾-"^J , and n is 2 or 3.

[0463] In some aspects, j is H, Ci, OH, NH₂ or N0₂, ₂ is -OCH₃, R₃ and R₄ are H, R₅ is

CH₂CH₂SH, Re is

and n is 2 or : CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and ÷ are H, R₅ is H₂ or N0₂, R₂ is -OCH₃, -3 and R₄ are H, R₅ is

[0466] In some aspects, Ri is H, CI, OH, H₂ or NQ₂, R₂ is -OCH₃, R₃ and ¾ are H, R₅ is ...,· *. ../"%

, Re is -CI 1 ( 1 1 SI i. and n is 2 or 3.

NO , R₂ is -OCH₃, R₃ and _t are H, R₅ is

[0468] In some aspects, Rj is H, Ci, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

[0469] In some aspects, Ri is H, CI, OH, H₂ or NQ₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

r N0₂, R₂ is -OCH₃, R₃ and 4 are H, R₅ is r N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is

[0 aspects, i is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0473] NQ₂, R₂ is -OCH₃, R₃ and R4 are H, R, is

[04741 In some aspects, Rj is H, CI, OH, NH, or N()₂, R₂ is -OCH₃, R₃ arid R₄ are H, R₅ is

[0475] In some aspects, Ri is H, CI, OI L NH₂ or N0₂, R₂ is OCl . R₃ and R are H, R₅ is

[0476] In some aspects, Rj is H, C!, OH, NH₂ or N0₂„ R₂ is -OCH₃, R₃ and ¾ are H, R₅ is

[0477] In some aspects, i is H, CI, OH. NH₂ or N0₂, R₂ is -OCR. R₃ and R₄ are H, R₅ is

[0478] In some aspects. Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCR, R₃ and ¾ are H, R₅ is

, e is -CH₂CH₂SH. and n is 2 or 3.

[0479] In some aspects, Ri is H, CI, OH, NR or N0₂, R₂ is -OCR, R₃ and R₄ are H, R₅ is

[0480] In some aspects. Ri is H, C!, OH. NH₂ or NQ₂, R₂ is -OCR, R₃ and ¾ are H, R₅ is

[0481] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCR, R₃ and R₄ are H, R₅ is

[0482] In some aspects. Ri is H, CI, OH. NR or 0₂, R₂ is OCH . R₃ and R» are H, R, is

. Re is H, and n is 2 or 3. some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ and ¾ are H, R₅ is

some aspects, R_t is H, CI. OH, NH₂ or N0₂, Rj is -OC¾. R₃ and R₄ are H, R₅ is

, R₆ is -CH₂CH₂SH. and n is 2 or 3.

NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

2, R₂ is -OCH3, R₃ and R₄ are H, R₅ is

2, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

88] In some aspects, Ri is H. CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are H, R₅ is CHi, Re is H, and n is 2 or 3.

[0489] In some aspects. Ri is H, CI. OH. NH₂ or N0₂, R₂ is OCH₃. R₃ and ¾ are H. R₅ is CH₂CH₂SH, Re is H. and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is 2 or N0₂, R₂ is -OCH3, R₃ and 4 are H, R₅ is

[0492] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are H, R₅ is

[04931 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ and ¾ are H, R₅ is

In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH3. R₃ and R₄ are H, R₅ is H. ¾ is CH₃, and n is 2 or 3.

[0495] In some aspects. R_x is H, CI, OH. NH₂ or NQ₂. R₂ is -OCH₃, R₃ and 4 are H. R₅ is CH₂CH₂SH, R₆ is CH₃, and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

or N0₂, R₂ is -OCH3, R₃ and R₄ are H, R₅ is

[0498] In some aspects. R, is H, CI. OH, NH₂ or N0₂, R? is -OCH3, R₃ and R₄ are H. R₅ is

In some aspects, Rj is H. CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

[0500] In some aspects. R, is H, CI. OH, NH₂ or N0_2; R? is -OCH3, R₃ and R₄ are H. R, is H, Re is -CH₂CH₂SH, and n is 2 or 3.

[0501] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3.

me aspects, Rj is H. CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

, Re is -CH₂CH2SH, and n is 2 or 3.

aspects. Ri is H, CI. OH, NH₂ or N0₂. R₂ is -OCH3, R3 and R are H. R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3. [05041 n some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

^D , is -CH₂CH₂SH, and n is 2 or 3 ,

some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

[Θ506] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R¾. are H, R₅ is

H, Re is , and n is 2 or 3.

[0507] In some aspects, j is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is

CH « is , and n is 2 or ^'.

; is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are I I. is

is -OCH₃, R₃ and R4 are H, R₅

[0510 In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are H, R₅

[0511] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -()(¾, R₃ and R₄ are H, R₅ is

, R₆ is "^CH ^·· , and n is 2 or 3.

[0512] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is -OCH₃, R₃ and R, are H, R₅ is

H, R₆ is

, and n is 2 or 3.

or N0₂, R₂ is -OCH3, R₃ and 4 are H, R₅ is

[05141 In some asp is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ and R4 are H, R₅ is CH_?CH₂SH, R₅ is

, and n is 2 or 3.

[0515] In some aspects, ¾ is H, Ci, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ and R4 are H, R₅ is

- :';.— ···;...(·*.. J¾

, R is ^N" , and n is 2 or 3.

[05163 In some aspects, Ri is H, CI. OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are H, R₅ is

or NQ₂, R₂ is -OCH3, R₃ and R4 are H, R₅ is

[0518] In some aspects, Ri is H, CI. OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are H, R₅ is

^•~CH.-. ···£ |l

' ¾. §

H. R is ^^*** , and n is 2 or 3.

[0519] In some aspects, Rj is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH3, R₃ and R4 are H, R_s is

[0520] In some aspects, Rj is H, CI. OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are H, R₅ is

CH₂CH₂SH, R5 is ^¾-~~^f , and n is 2 or 3.

0521] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -0CH₃, R₃ and ¾ are H, R₅ is

[0522] In some aspects, Rj is H, Ci, OH, NH or N0₂, R₂ is 0CH₃, R₃ and R4 are H, R_s is

[05231 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and ÷ are H, R₅ is

[0524] ects, R is H, CI, OH, NH₂ or N0₂, R₂ is ()(¾, R₃ and R, are I I. R₅ is

Re i

and n is 2 or .

[0525] In some aspects, Rj is H, CI, OH, H₂ or N0₂, R₂ is -OCH₃, R₃ and R¾. are H, R5 is

H

CH₃, i, is , and n is 2, or 3,

[0526] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is

[0527] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are H, R₅ is

2, R is -OCH3, R₃ and R4 are H, R₅ is

[0529] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R | are H, R₅ is

[0530] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ and Re are H, and n is 2 or 3 ,

[0531] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ and Re are CH₃, and n is 2 or 3.

[0532] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R4 are CH₃, R₅ and Re are -CH₂CH₂SH, and n is 2 or 3. OH, NH₂ or N0₂, R₂ is <)⁽ I k R₃ and R¾. are

[0534] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃ and Re are ^^™' , and n is 2 or 3,

[0535] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃,

r N0₂, R₂ is -OCH₃, R and R¾. are CH₃, R₅

[0537] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is H, Re is CH₃, and n is 2 or 3.

[0538] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is ~OCH₃, R₃ and R₄ are CH₃, R₅ is H, R is -CH₂CH₂SH, and n is 2 or 3.

[0539] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

H, Re is , and n is 2 or 3.

[0540] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ and R₄ are CH₃, R₅ is

H, R is ^"""^ ·, and n is 2 or 3.

[0541] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

[0542] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

I, Re is

, and n is 2 or 3.

[0543] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is CH₃, Re is H, and n is 2 or 3. [05441 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and ÷ are CH₃, R₅ is CH₃, R is -CH₂CH₂SH, and n is 2 or 3.

[0545] In some aspects, j is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

CH₃, e is , and n is 2 or 3 ,

[0 is H, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is CH₃, e is

[0547] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

[0548] In some aspects, j is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

[0549] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is -CH₂CH₂SH, Re is H, and n is 2 or 3.

[0550] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -0CH₃, R₃ and R₄ are CH₃, R₅ is -CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0551] In some asp is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

-CH₂CH₂SH, Re is , and n is 2 or 3 ,

[0552] In some aspects, Ri is H, CI, OH, H₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is -CH₂CH₂SH, Re is , and n is 2 or 3.

[0553] In some aspects, R . is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

-CH₂CH₂SH, Re is

, and n is 2 or 3.

[0554] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

-CH₂CH₂SH, Re is

, and n is 2 or CI, OH, NH₂ or N0₂, R₂ is <)( I k R₃ and R_¾. are CH₃, R₅ is H₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

[0557] In some aspects, i is H, CI, OH, H₂ or NQ₂, R₂ is -OCH₃, R₃ and ¾ are CH₃, R₅ is ...,· *. ../"%

, Re is -CI 1 (1 1 SI i. and n is 2 or 3.

N0₂, R₂ is -OCH₃, R₃ and ¾. are CH₃, R₅ is

[0S59J In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and 4 are CH₃, R₅ is

[0560] In some aspects, i is H, CI, OH, H₂ or NQ₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

r N0₂, R₂ is -OCH3, R and 4 are CH₃, R₅ is r N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

[0 aspects, R_x is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0564] NQ₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

[05651 n some aspects, ¾ is H, CI, OH, NH₂ or N0₂, R₂ is 0( 1 1 .. R₃ and ¾. are CH₃, R₅ is

[0 or N0₂, R₂ is OCH₃, R₃ and R₄ are

[0567] In some aspects. R, is H, CI, OH, NH₂ or N0₂, R₂ is -OCH?, R₃ and R are CH₃, R

[0568] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

[0569] In some aspects. Rj is H, CI, OH, NH₂ or N0₂, R₂ is ΟΠ L R₃ and R4 are CH₃, R₅ is

^^*** , Re is -CH₂CH₂SH, and n is 2 or 3.

[0570] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are CH₃, R₅ is

[0571] In some aspects, R . is H, CI, OH, NH₂ or NQ₂, R is -OCH₃, R and 4 are CH₃, R₅ is f ··€«, ··

>^»- Rg _s ^•> and n is 2 or 3.

[0S72| In some aspects, j is H, CI. OH. NH₂ or N0₂. R₂ is -OCH₃, R₃ and R₄ are CH₃. R₅ is

[0573] In some aspects. i is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ and ¾ are CH₃, R₅ is

H, CI, OH, NH₂ or N0₂, R₂ is 0( 1 1.. R₃ and ¾. are CH₃, R₅ is

[0575] In some aspects, R_x is H, CI, OH. NH. or N0₂, R₂ is OCH₃. R₃ and R₄ are CH₃, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

[0576] In some aspects, Ri is H, CI, OH, NH₂ or NO., R₂ is -OCH₃, R₃ and R+ are CH₃, R₅ is

[0577] In some aspects, i is H, CL OH, NH, or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and Rj are CH₃, R₅ is

, and n is 2 or 3.

[0579] In some aspects, i is H, Ci, OH, NH, or N0₂, R₂ is -OCH₃, R₃ and R are CH₃, R₅ is CH₃, Re is H, and n is 2 or 3.

[0580] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ and ¾ are CH₃, R₅ is -CH₂CH₂SH, R6 is H, and n is 2 or 3.

OH, NH₂ or NO,, R₂ is -OCH₃, R₃ and Rj are CH₃, R₅ is , or N0₂, R₂ is -OCH₃, R₃ and R, are CH₃, R₅ is

[0583] In some aspects, R_x is H, CL OH, NH, or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

H, CI, OH, NH₂ or N0₂, R, is OCH₃, R₃ and R4 are CH₃, R, is

[0585] In some aspects, i is H, CI. OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are CH₃, R₅ is H. R_fi is CH₃, and n is 2 or 3.

[05861 In some aspects. Rj is H, CI, OH. NH₂ or NQ₂. R₂ is -OCH₃, R₃ and R are CH₃, R₅ is -CH₂CH₂SH, R6 is C I S , and n is 2 or 3.

[0587[ In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R, is

- !}"¾

, ¾ is CH₃, and n is 2 or 3.

[0 NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are CH₃, R.₅ is

[0589] In some aspects. R, is H, CI. OH, NH₂ or N0₂, R_? is -OCH₃, R₃ and R₄ are CH₃. R₅ is

[0590] In some aspects, Rj is H. CI, OH, NH₂ or N0₂, R₂ is -0CH₃, R₃ and R4 are CH₃, R₅ is

[0591 ] In some aspects. R, is H, CI, OH, NH₂ or N0₂. R_? is -OCT¾, R₃ and R₄ are CH . R.s is H, Re is -CH₂CH₂SH, and n is 2 or 3.

[0592] In some aspects, R_x is H, C!, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is CH₃, R6 is -CH₂CH₂SH, and n is 2 or 3.

me aspects, Rj is I I. CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

, ¾ is -CH₂CH?SH. and 11 is 2 or 3.

[0 aspects. Ri is H, CI. OH, NH₂ or N0₂. R₂ is -OCH3, R₃ and R₄ are CH₃. R₅ is

, Re is -CH2CH2SH, and n is 2 or 3. [05951 n some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

, Rg is -CH₂CH₂SH, and n is 2 or 3 ,

some aspects, i is H, CI, OH, NH₂ or NO₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

[0597] In some aspects, Ri is H, CI, OH, NH₂ or NO_., R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

H, Re is , and n is 2 or 3.

[0598] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ and R₄ are CH₃, R₅ is

CH « is , and n is 2 or ^'.

[0599] In some asp is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

~CH₂CH₂SH, Re is , and n is 2 or 3.

[0 N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

[0601] In some as ects, R . is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

[0602] In some aspects, R_x is H, C , OH, NH₂ or N0₂, R₂ is -()(¾, R₃ and R₄ are CH₃, R₅ is

, R₆ is ^"CH ^·· , and n is 2 or .

[0603] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

H, R₆ is

, and n is 2 or 3.

or N0₂, 2 is -OCH3, R₃ and 4 are CH₃, Rj is

[06051 In some aspe H. CI, OH, NH, or N0₂, R₂ is OCH₃, R₃ and R4 are CH₃, R₅ is

-CH₃CH₂SH, Re is

, and n is 2 or 3.

106061 In some aspects, ¾ is H, Ci, OH, NH₂ or N0₂, R₂ is 0CH₃, R₃ and R4 are CH₃, R₅ is _ -\ ..... /^**%

, R_u is ^N" , and n is 2 or 3.

10607| In some aspects, i is H, CL OH, NH or N0₂, R₂ is -OCH3, R₃ and R are CH₃, R₅ is

>8] in some aspects. Ri is H, CI, OH. NH₂ or N0₂, R₂ is -OCH₃, R₃ and R, are CH₃, R₅ is

In some aspects, Ri is H, Ci. OH, NH or N0₂, R₂ is -OCH3, R₃ and R₄ are CH₃. R₅ is

[0610] In some aspects, R_x is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH3, R₃ and R₄ are CH₃. R₅ is

[0611] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH3, R₃ and R₄ are CH₃, R₅ is

-CH₂CH₂SH, s is

, and n is 2 or 3.

0612] In some aspects, R_t is H, CI, OH, NH₂ or N0₂, R₂ is -0CH₃, R₃ and R, are CH₃, 1 , is

[0613] In some aspects, Rj is H, Ci, OH, NH₂ or N0₂, R₂ is 0CH₃, R₃ and R4 are CH₃, R₅ is

or N0₂, R₂ is -OCH₃, R₃ and ÷ are CH₃, R_s is

[0615] in some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

[0616] In some aspects, Ri is H, C!, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ and ¾ are CH₃, R₅ is

H

CH i. R_A is N and n is 2 or 3.

[0617] In some aspects, Ri is H, CI, OH, NH, or N0₂, R₂ is -OCH₃, R₃ and R₄ are CH₃, R₅ is

H

-CH₂CH₂SH. ¾ is . and n is 2 or 3.

In some aspects. Rj is H, CI, OH. NH₂ or N0₂, R₂ is -OCH₃, R₃ and R4 are CH₃, R₅ is

[0619] In some as or N0₂, R₂ is -OCH3, R₃ and R₄ are CH₃, Rs is

[ ₂, R₂ is -OCH_?. R₃ and ₄ are CH₃, R₅ is

[0621] In some aspects, Rj is H, Ci, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is H, R₄ is CH₃, R₅ and Re are H, and n is 2 or 3.

[0622] in some aspects, R_t is H, CI. OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R* is CH₃, R₅ and ¾ are CH , and n is 2 or 3.

[0623] In some aspects, Ri is H, C!, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ and e are -CH₂CH₂SH, and n is 2 or 3. OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, ¾ is CH₃, R₅

[0625] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ and Re are ^^™' , and n is 2 or 3,

In some aspects, i is H, CI, OH, NH₂ or N0₂, R_ is -OCH3, R₃ is H, R4 is CH₃, R₅

r NO., R₂ is -OCH3, R₃ is H, R₄ is CH₃, R₅

[0628] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, Rs is H, R* is CH₃, R₅ is H, Re is CH₃, and n is 2 or 3.

[0629] In some aspects, Ri is H, C!, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is H, R is -CH₂CH₂SH, and n is 2 or 3.

[0630] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

H, Re is , and n is 2 or 3.

[0631] In some aspects, i is H, CI, OH, NH₂ or NO₂, R₂ is -OCH3, R₃ is H, R₄ is CH₃, R₅ is

H, is ^"""^ ·, and n is 2 or 3.

[0632] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is I I. R4 is CH₃, R₅ is

..S"S» <* ¾

Re is , and n is 2 or 3.

[0633] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

I, Re is

, and n is 2 or 3.

[0634] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is CH₃, Re is H, and n is 2 or 3. [06351 In some aspects, ¾ is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3.

[0636] In some aspects, j is H, CI, OH, NH₂ or N0₂, ₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

CH₃, e is and n is 2 or 3 ,

[0637] In is H, CI, OH, NH₂ or NQ₂, R . is -OCH₃, R₃ is H, R, is CH₃, R, is CH₃, Re is

, and n is 2 or 3.

[0638] In some aspects, Ri is H, CI, OH, NH₂ or NO₂, R₂ is -OCH3, R₃ is H, R₄ is CH₃, R₅ is

[0639] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is H, R4 is CH₃, R₅ is

[0640] In some aspects, Ri is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is -CH₂CH₂SH, Re is H, and n is 2 or 3.

[0641 ] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is -CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0642] In some asp is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is H, R4 is CH₃, R₅ is

-CH₂CH₂SH, Re is , and n is 2 or 3 ,

[0643] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, \i is CH₃, R, is -CH₂CH₂SH, Re is , and n is 2 or 3.

[0644] In some aspects, Ri is H, C!, OH, NH₂ or N0₂, R₂ is ~OCH₃, R₃ is H, R₄ is CH₃, R₅ is

-CH₂CH₂SH, Re is

and n is 2 or 3.

[0645] In some aspects, R _; is H, Ci, , NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

-CH₂CH₂SH, Re is

, and n is 2 or CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is H₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

[0648] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R . is -OCH₃, R₃ is H, R, is CH₃, R, is ...,· *. ../"%

, Re is -CI 1 ( 1 1 SI i. and n is 2 or 3.

N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is

[06S0J In some aspects, R, is H, Ci, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

In some H₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

r N0₂, R₂ is -OCH₃, R₃ is I I. R4 is CH₃, R₅ is r N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

[0 aspects, i is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0655] NQ₂, R . is -OCH₃, R₃ is H, R4 is CH₃, R, is

[06561 In some aspects, ¾ is H, Cl, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ is H, ¾ is CH₃, R₅ is

^' or N0₂, R₂ is OCH₃. R₃ is H, R4 is CH₃, R₅ is

[0658] In some aspects, Ri is H, Cl, OH, H₂ or N0₂, R₂ is -OCH3, R₃ is H, R₄ is CH₃, R₅ is

[0659] In some aspects, Ri is H, Cl. OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

[0660] In some aspects, Rj is H, Cl, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

_? ¾ i_s -CH2CH2SH, and n is 2 or 3.

In some aspects, i is H. CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

[0662] In some aspects. Rj is H, Cl, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

I " « : -i. 8

>^»- ^ i_s , and n is 2 or 3_.

[0663] In some aspects, Rj is H. Cl, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, 4 is CH₃, R₅ is

[0664] In some aspects. Ri is H, Cl, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ is H, R4 is CH₃, R₅ is

^'N3 , R₆ is H, and n is 2 or 3. CI, OH, NH₂ or N0₂, R₂ is --OCH₃, R₃ is H, R_t is CH₃, R₅ is

some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ is I I. R i is CH₃, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

H₂ or N0₂, R₂ is -OCH₃, R₃ is H, R is CH₃, R₅ is

2, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

2, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

[0670] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R is -GCH₃, R₃ is H, R₄ is CH₃, R₅ is CH₃, Re is H, and n is 2 or 3.

[0671] In some aspects, R _; is H, CI, OH, NH₂ or N0₂, R . is -OCH₃, R₃ is H, R, is CH₃, R, is -CH₂CH₂SH, Re is H, and n is 2 or 3.

[Θ672] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

¹ ^

, Re is H, and n is 2 or 3.

[ NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

[0674] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

... . ,·-^:~^; -·

" , Re is H, and n is 2 or 3. H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is

[0676] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ is I I. R i is CH₃, R₅ is H, s is CH₃, and n is 2 or 3.

[0677] In some aspects, Ri is H, C!, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is -CH₂CH₂SH, R6 is CH₃, and n is 2 or 3.

[0678] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is

--< !■;

, ¾ is CH₃, and n is 2 or 3.

[0679] In some aspects, i is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅

^^™"''^' , <5 is CH₃, and n is 2 or 3.

[068Θ] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is I I. R i is CH₃, R₅

[0681] In some aspects, R_: is H, CI, OH, NH₂ or NO , R₂ is -OCH₃, R₃ is I I. R, is CH₃, R₅

, _e is CH₃, and n is 2 or 3,

[0682] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, 4 is CH₃, R₅ is H, Re is -CH₂CH₂SH, and n is 2 or 3.

[0683] In some aspects, Ri is H, C!, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is CH₃, e is -CH₂CH₂SH, and n is 2 or 3.

me aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0 aspects, is H, CI, OH, NH₂ or N0₂, R is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

, e is -CH₂CH₂SH, and n is 2 or 3 [06861 n some aspects, ¾ is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, ¾ is CH₃, R₅ is

, ₆ is -CH₂CH₂SH, and n is 2 or 3 ,

some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is I I. R4 is CH₃, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

[0688] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ is H, R₄ is CH₃, R₅

H, Re is , and n is 2 or 3.

[0689] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is H, R4 is CH₃, R₅

CH « is , and n is 2 or ^'.

[0690] In some asp _; is H, CI, OH, NH₂ or NO -, R₂ is -OCH , R₃ is I I. R , is CH₃, R₅ is

-CH₂CH₂SH, Re is , and n is 2 or 3.

[0 N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅

[0692] In some as ects, R . is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅

[0693] In some aspects, i is H, C , OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is I I. R4 is CH₃, R₅ is

, R₆ is ^"CH ^·· , and n is 2 or .

[0694] In some aspects, R] is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

H, R₆ is

, and n is 2 or 3.

or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

In some aspects, Rj is H. CI, OH, NR or N()₂, R, is OCR, R₃ is H, R₄ is CR, R₅ is

-CRCRSH, Re is , and n is 2 or 3.

[06971 in some aspects, Ri is H, CI, OH, NH₂ or NG₂, 2 is -OCH3, 3 is H, R4 is CR, R₅ is

[0698] In some aspects, R_x is H, CI, OH, NH, or N0₂, R₂ is -OCH3, R₃ is H, R4 is CR, R₅ is

or N0₂, R₂ is -OCR, R₃ is H. R is CH₃. R₅ is

In some aspects, i is H, CI. OH, NH or N0₂, R₂ is -OCH3, R? is H, R is CR. R₅ is

-CH... ·^»£ |l

¾. §

H, Re is , and n is 2 or 3.

[07011 In some aspects, R_x is H. CI, OH, NH₂ or NQ₂, R₂ is -OCR, R₃ is H. R₄ is CR. R₅ is

CR, R is ^•·°^ Λ I , and n is 2 or 3.

[07021 In some aspects, Rj is CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, 4 is CR, R₅ is -CH₂CH₂SH. Re is

, and n is 2 or 3.

[0703] In some aspects, R_x is H. CI, OH, NR or NQ₂, R₂ is OCR, R₃ is H, R4 is CH₃, R₅ is

[0704] In some aspects, R, is H. Ci, OH, NR or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CR, R₅ is

[07051 n some aspects, ¾ is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R_t is CH₃, R₅ is

[0706] ects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ is H, R is CH₃, R₅ is

Re i

and n is 2 or .

[0707] In some aspects, Rj is H, CI, OH, H₂ or N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

H

CH₃, i, is , and n is 2, or 3,

[0708] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R4 is CH₃, R₅ is

-CH2CH2SH, ¾ is

_ and n is 2 or 3.

[0709] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is H, R₄ is CH₃, R₅ is

2, R₂ is -GCH₃, R₃ is H, R is CH₃, R₅ is

[0711] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is ~OCH₃, R₃ is H, R₄ is CH₃, R₅ is

[0712] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ and Re are H, and n is 2 or 3 ,

[0713] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅ and Re are CH , and n is 2 or 3.

[0714] In some aspects, R₄ is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R is CH₃, R₄ is H, R₅ and R are -CH₂CH₂SH, and n is 2 or 3. [07151 I" s , R _: is H, CI, OH, NH₂ or NO , R₂ is 0( 1 1.. R₃ is CH₃, R₄ is H, R₅

and R are , and n is 2 or 3.

[0716] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ and Re are ^^™' , and n is 2 or 3 ,

[0717] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅

r NO_., R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅

[0719] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is H, Re is CH₃, and n is 2 or 3.

[0720] In some aspects, R . is H, C!, OH, NH₂ or NO -. R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R, is H, R is -CH₂CH₂SH, and n is 2 or 3.

[0721 ] I cts, R _: is H, CI, OH, NH₂ or NO , R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

H, Re is , and n is 2 or 3.

[0722] In some aspects, i is H, Ci, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is CH₃, R is H, R₅ is

H, is ^"""^ ·, and n is 2 or 3.

[0723] In some aspects, R_x is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅ is

[0724] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

I, Re is

, and n is 2 or 3.

[0725] In some aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is CH₃, Re is H, and n is 2 or 3. [07261 In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is CH₃, Re is -CH₂CH₂SH, and n is 2 or 3.

[0727] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

CH₃, e is and n is 2 or 3 ,

[0728] In is H, CI, OH, NH₂ or NQ₂, R . is -OCH₃, R₃ is CH₃, R4 is H, R, is CH₃, Re is

, and 11 is 2 or 3.

[0729] In some aspects, Ri is H, C!, OH, NH₂ or NQ₂, R₂ is -OCH3, R3 is CH₃, R₄ is H, R₅ is

[0730] In some aspects, ¾ is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0731] In some aspects, R . is H, C!, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is -CH₂CH₂SH, e is H, and n is 2 or 3.

[0732] In some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is -CH₂CH₂SH, Re is CH₃, and n is 2 or 3.

[0733] In some asp is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

-CH₂CH₂SH, Re is , and n is 2 or 3 ,

[0734] In some aspects, R _; is H, CI, OH, NH₂ or NQ₂, R . is -OCH₃, R₃ is CH₃, R is H, R, is -CH₂CH₂SH, Re is , and n is 2 or 3.

[0735] In some aspects, R . is H, C!, OH, NH₂ or NO -. R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

-CH₂CH₂SH, Re is

, and n is 2 or 3.

In some aspects, j is H, CI, OH, NH₂ or N0₂, ₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

-CH₂CH₂SH, Re is

, and n is 2 or CI, OH, NH₂ or NO , R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is H₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0739] In some aspects, R _; is H, CI, OH, NH₂ or NQ₂, R . is -OCH₃, R₃ is CH₃, R., is H, R, is ...,· *. ../"%

, Re is -CI 1 ( 1 1 SI i. and n is 2 or 3.

NO , R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0741] In some aspects, R, is H, Ci, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0742] In some aspects, R _; is H, CI, OH, NH₂ or NQ₂, R . is -OCH₃, R₃ is CH₃, R₄ is H, R, is

r N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is r N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0 aspects, Ri is H, CL OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3.

[0746] NQ₂, R . is -OCH₃, R₃ is CH₃, R, is H, R, is

[07471 In some aspects, Rj is H, CI, OH, NH, or N()₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0748] In some aspects, R, is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃. R, is H, R₅ is

[0749] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0750] In some aspects, i is H, CI, OH. NH₂ or N0₂, R₂ is -OCH₃. R₃ is CH₃, R₄ is H, R₅ is

[0751] In some aspects. Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

, Rs is -CH₂CH₂SH. and n is 2 or 3.

[0752] In some aspects, Ri is H, CI, OH, NH. or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0753] In some aspects. Ri is H, C!, OH. NH₂ or NQ₂, R₂ is -OCH₃, R₃ is CH₃. R₄ is H, R₅ is

[0 or N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0755] In some aspects. Ri is H, CI, OH. NH₂ or N0₂, R₂ is -OCH . R₃ is CH₃, R* is H, R₅ is

some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0757] In some aspects, R_t is H, CI. OH, NH₂ or N0₂, Rj is -OCH₃. R₃ is CH₃, R, is H, R₅ is

, R₆ is -CH₂CH₂SH. and n is 2 or 3.

[0758] In some aspects, R, is H, CI, OH, H₂ or NO., R₂ is -OCH3, R₃ is CH₃, R₄ is H, R₅ is

[0759] In some aspects, Ri is H, CI. OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R, is II, R₅ is

[0760] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0761] In some aspects, Ri is H. CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ is CH₃, R₄ is H, R₅ is CH₃, Re is H, and n is 2 or 3.

[0762] In some aspects. Ri is H, CI. OH. NH₂ or N0₂, R₂ is OCH₃. R₃ is CH₃, R4 is H, R, is -CH₂CH₂SH, e is H. and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is 2 or N0₂, R₂ is -OCH₃, R₃ is CH₃, R4 is H, R₅ is

[0765] In some aspects, Ri is H, CI, OH, NH₂ or N0₂. R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅ is

[0767] In some aspects, R_t is H, CI, OH, NH₂ or N0₂, R₂ is -OC¾. R₃ is CH₃, R, is H, R₅ is H. ¾ is CH₃, and n is 2 or 3.

[0768] In some aspects. R_x is H, CI, OH. NH₂ or NQ₂. R₂ is -OCH₃, R₃ is CH₃, R₄ is H. R₅ is -CH₂CH₂SH, R6 is CH₃, and n is 2 or 3.

OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

or N0₂, R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅ is

[0771] In some aspects. R, is H, CI. OH, NH₂ or N0₂, R_? is -OCH₃, R₃ is CH₃, R, is II. R₅ is

[0772] In some aspects, Rj is H. CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0773] In some aspects. R, is H, CI. OH, NH₂ or N0₂, R? is -OCH₃, R₃ is CH , R, is H. R₅ is H, e is -CH₂CH₂SH, and n is 2 or 3.

[0774] In some aspects, Rj is H, C!, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is CH₃, R,, is -CH₂CH₂SH, and n is 2 or 3.

[0775] In some aspects, Rj is I I. CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

¹ #

, ¾ is -CH₂CH?SH. and n is 2 or 3.

[0 aspects. Ri is H. CI. OH, NH₂ or N0₂. R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅ is

, Re is -CH₂CH₂SH, and n is 2 or 3. [07771 n some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

, ₆ is -CH2CH2SH, and n is 2 or 3 ,

some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R, is H, R₅ is

, R₆ is -CH₂CH₂SH, and n is 2 or 3.

[0779] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

H, Re is , and n is 2 or 3.

[0780] In some aspects, ¾ is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

CH « is , and n is 2 or ^'.

[0781] In some asp is H, CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ is CH₃, R4 is H, R₅ is

-CH₂CH₂SH, Re is , and n is 2 or 3.

[0 N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0783] In some as ects, R . is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0784] In some aspects, i is H, C , OH, NH₂ or N0₂, R₂ is -()(¾, R₃ is CH₃, R, is H, R₅ is

, R₆ is ^"CH ^·· , and n is 2 or .

[0785] In some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

H, R₆ is , and n is 2 or 3.

[0786] In is H, Ci, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ is CH₃, R₄ is H, R₅ is

CH₃. A is

, and n is 2 or 3. [07871 n some aspects, R _: is H, CI, OH, NH₂ or NO , R₂ is 0( 1 1.. R₃ is CH₃, R₄ is H, R₅ is

-C S hCl i -SS L ¾ is , and n is 2 or 3.

me N0₂, R₂ is -OCH₃, R₃ is CH₃, R4 is H, R₅ is

[0789] In some aspects, i is H. or N0₂, 2 is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0790] In some aspects. Ri is H, C!, OH. NH₂ or N0₂, R₂ is -OCH3, R₃ is CH₃. R is H, R₅ is

[0791] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0792] In some aspects. Rj is H, Ci, OH. NH₂ or NQ₂, R₂ is -OCH₃. R is CH₃, R₄ is H, R₃ is

[0793] In some aspects, Rj is H, CI, OH, NH₂ or N0₂, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

-CH₂CH₂SH, Re is ^ . and n is 2 or 3.

[0794] In some aspects. R_t is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R, is

[0795] In some aspects, R, is H, Ci, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

or N0₂, R₂ is ~-OCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0797] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is OCH₃, R₃ is CH₃, R, is H, R₅ is

Θ798] In some aspects, Ri is H, CI, OH, NH₂ or NO_., R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

H

CH₃, i, is , and n is 2 or 3 ,

[0799] In some aspects, i is H, CI, OH, NH₂ or N0₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R₅ is

H

-CH₂CH₂SH, ¾ is N _ and n is 2 or 3.

[0800] In some aspects, Ri is H, CI, OH, NH₂ or N0₂, R₂ is -OCH3, R₃ is CH₃, R₄ is H, R₅ is

2, R₂ is -GCH₃, R₃ is CH₃, R₄ is H, R₅ is

[0802] In some aspects, R . is H, CI, OH, NH₂ or NQ₂, R₂ is -OCH₃, R₃ is CH₃, R₄ is H, R, is

[0803] The invention also provides pharmaceutical compositions of the compounds disclosed herein. In some embodiments, the pharmaceutical composition may include a compound of formulae (I) or (II) and a pharmaceutically acceptable carrier, diluent or excipient.

[0804] The invention further relates to the treatment of autoimmune diseases by the administration of a compound of a compound of Formula (I) or a compound of Formula (II). Compounds of Formula (I) and Fonnuia (II) can be useful for the treatment of autoimmune diseases including systemic lupus erythematosus (SLE), lupus nephritis (LN), rheumatoid arthritis, juvenile rheumatoid arthritis, Wegener's disease, inflammatory bowel disease, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathies, myasthenia gravis, vasculitis, diabetes mellitus, Reynaud's syndrome, Sjorgen's syndrome, scleroderma, polymyositis and glomerulonephritis. Preferably, the autoimmune disease is SLE.

[0805] The invention further relates to the treatment of monogenic disorders by the administration of a compound of Formula (I) or a compound of Formula (II). Compounds Formula (I) and Formula (II) can be useful for the treatment of monogenic disorders including Aicardi-Goutierre's Syndrome (AGS) or spondyloenchondrodysplasia (SPENC Preferably, the monogenic disorder is AGS,

[0806] In one embodiment, the method of treatment includes the administration of a pharmaceutical described herein.

[0807] The invention also relates to a method for the treatment of an autoimmune disease a monogenic disorder, the method comprising administering an effective amount of a compound of Formula (III) or a prodrug or metabolite thereof,

(III)

wherein

-H, halogen, -OH, ~OCH₃, -M l. -NMe₂, - (H)C(0)R₇ or -N0₂, wherein R- is -OCH₃, -OCH₂CH₃, -CX I LC! i d k -ΟΠ Ι .ί I Ϊ C 1 1 C I I _:

-(. i I _' s I :. -C I i _' C H■( 1 1 -( H■( 1 1 _'( Π _'( ! ί : . ~( Π ·( R■( H _'( i i_.>C \ ί ·.

-α ΐ -α Ή,Π Ι .ί H , -CF₃, -CH₂CF₃ or

ring X is absent or

, wherein R₂ is -H, halogen, -NMe₂, -OCH₃ or

wherein R is-Hor-CH₃;

R, is -H or -CH₃;

R₅ and R-6 are independently -H, -CH₃, -CH₂CH₃, -CH₂CH₂SH, -CH₂CH₂OH,

R_Y is -NO₂, -( (())()( H-C!h or -N(H)S0₂Me; and

n is 2 or 3;

to a patient in need thereof.

[0808 J In some embodiments of the method, the compound is of formula (Ilia):

(Ilia)

wherein

R is -H, halogen, -OH, ·{)( !!:. -NH₂, -N(H)C(0)R₇ or -N0₂,

wherein R- is -OCH3, -OCH₂CH₃, -OCH₂CH₂CH₃, -OCH₂CH₂CH₂CH₃, -CH₃, -CH₂CH₃, -CH₂ CH₂CH₃, -CH₂CH₂CH₂CH₃, H₂CH₂CH₃,

CH₂CH₂CH₂CH₂CH₂CH₃, -CF₃, -CH₂CF₃ or

, wheein

R₃is-Hor -( H ·

R₄is-Hor-CH₃;

Rj and Re are independently -H, -CH₃, -CH₂CH₃ or -CH₂CH₂OH; and

n is 2 or 3.

09] In some embodiments of the method, the compound is of formula (Illb):

(IUb)

wherein Ri is -H, halogen, -OH, -OCH₃, -NH₂, -N(H)C(0)R₇ or -N0₂,

wherein R₇ is -OCH₃, -OCH₂CH₃, -OCH₂CH₂CH₃, -OCH₂CH₂CH₂CH₃, ·( ! ! :.

~CH₂CFi₃, -CH₂ C i l . 1 1■. -CH₂CH₂CH₂CH₃, H₂CH₂CH₃,

-CH₂CH₂CH₂CH₂CH₂CH₃, -CF₃, -CH₂CF

-H, halogen, -OCH₃ or -OCH₂CH₃;

X is -NH₂,

. wherein

R₃ is -H or -CH₃;

R₄ is -H or -CH₃;

Rj and Re are independently ··! !. -CH₃, -CH₂CH₃, -CH₂CH₂SH, -CH₂CH₂OH,

R_Y is -NO2, -C(0)OCH₂CH₃ or -N(H)S0₂Me; and

n is 2 or 3.

In some embodiments of the method, X is -NH₂.

[0811] In some embodim ents of the method, X is

[0812] In some embodiments of the method, X is

[0813] In some embodiments of the method, X is

[0814] In some embodiments of the method, the compound of Fonnula (ITIc) or a prodrug or metabolite thereof.

(IIIc)

wherein

is -H, halogen, -OH, -QCH₃, -NH₂, -N(H)C(0)R₇ or -N0₂;

R₃ and R4 are independently -H or -CH₃;

and Rc are independently ~H, -CH3, -CH2CH3, -CH₂CH₂SH, -CH₂CH₂OH,

R- is -OCH3, -OCH₂CH₃, -OCH₂CH₂CH₃, -OCH₂CH₂CH₂CH₃, -CH₃, -CH₂CH₃, -CH₂ CI 1■( ί ! :. -CH₂CH₂CH₂CH₃, -CI l,C! \ ^'l ! ·( I Ι ·(Ί k -

CH₂CH₂CH₂CH₂CH₂CH3, -CF₃, -CH₂CF₃ or

, and

n is 2 or 3.

[0815] In some embodim ents of the method,

Ri is -H, -CI, -OH, -NH₂, -N(H)C(0)R₇ or -NO -:

R3 and 4 are independently -H or -CH₃;

R₅ and _<

R₇ is -OCH3, -OCH₂CH₃, -OCH₂CH₂CH₃, -OCH₂CH₂CH₂CH₃, -CH₃, -CH₂CH₃, -( H · CH₂CH₃, -CH₂CH₂CH₂CH₃, -CH₂CH₂CH₂C -

( 1 1,( 1 i ·(^'! ! .( ! S I :. -CF₃, -CH₂CF₃ or

and

n is 2 or 3.

[0816] In some embodiments of the method, R; is -NH₂ or -M(H)C(0)R₇;

R: i s -CH₃;

R, is -H;

Rs is -CH_3;

R₇is -OCH₃. -OCH2CH3, "ίΚΉ,ΠΙ,ί H:. -OCH2CH2CH2CH3

CH,C¾, -CH₂CH₂CH₂CH₃, -CH₂CH₂CH₂C -

CH₂CH₂CH₂CH₂CH₂CH₃, -CF_3> -CH₂CF₃ or

n is 2.

[0817J in some embodiments of the method,

R; is NH₂ or N(H)C(0)R₇;

R₇ is -OCH₂( !!:. CH₂CH₂CH₂CH₂CH3. -CF₃ or _ _; and n is 2.

[0818 j In some embodiments of the method.

R is -NH₂;

R₂ is -OCH₃;

R is -CH₃;

n is 2.

[08 ί 9 J In some embodiments of the method. R-, is -NH₂;

R₂ is -OCH_?;

R₃ is ~CH₃;

R , is -H;

n is 2.

[0820] In some embodiments of the method,

R; is -NH_?:

R₂ is -OCH₃;

R₃ i s -CH₃;

R , is -H;

Rs is -Cl :

n is 2.

[0821] In some embodiments of the method, Ri is -N(H)C(0)R₇.

[0822] In some embodiments of the method, Rj is -N(H)C(0)R₇;

R . is -OCH₃;

R₃ is -CH₃;

R₄ is -H;

n is 2.

[0823] In some embodiments of the me thod .

Ri is -Ν(Ι-!)€(0)α¾(Ή₂€Η₂(:Η^,α-Ι₃;

R₂ is -()( S i c

R₃ is -( ! ! : .

R₄ is -H;

R, is -CH₃; R₆ is ^N¾~~^¾ ; and

n is 2.

[0824] In some embodiments of the method,

R is ~ (H)C(0)CF₃;

n is 2.

[0825J In some embodiments of the method,

R is ~ (H)C(0)R₇;

R₇ is ... _; and

n is 2. Θ826] In some embodiments of the method, the treatment is of an autoimmune disease. The autoimmune disease may be selected from the group consisting of systemic lupus erythematosus (SLE), lupus nephritis (LN), rheumatoid arthritis, juvenile rheumatoid arthritis, Wegener's disease, inflammatory bowel disease, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathies, myasthenia gravis, vasculitis, diabetes mellitus, Raynaud's syndrome, Sjorgen's syndrome, scleroderma, polymyositis and glomerulonephritis.

[0827] In some embodiments of the method, the autoimmune disease is SLE.

[0828] In some embodiments of the metliod, the autoimmune disease involves inhibition of cGAS activity.

[0829] In some embodiments of the method, the treatment of a monogenic disorder. [0830] In some embodiments of the method, the monogenic disorder is Aicardi-Goutierre's

Syndrome (AGS) or spondyloenchondrodysplasia (SPENCD).

[0831] In some embodiments of the method, the monogenic disorder is AGS,

EXAMPLES

Example 1

Anti-malarial drugs are predicted to block cGAS-DNA interaction by computational analysis

[0832] The structural domains of cGAS present two highly attractive drag targets, the catalytic site and a regulatory site, both with established key residues in relatively compressed regions and both with known substrates/ligands. The pronounced confonnational change in the dsDNA bound enzyme compared to apo enzyme lends further enthusiasm to the hypothesis that cGAS activity could be inhibited by appropriately -designed small molecules.

[0833] In an effort to identify drags to block cGAS activity, we performed in silico screening of chemical and drug libraries using the publicly available software, such as VINA™ and DOCK™. Using Computational Analysis with the Autodock VINA™ platform, we identified hydroxychloroquine (HCQ), 9-amino-6-chloro-2-methoxyacridine and quinacrine to interact at the Zn thumb and spine regions of cGAS involving simultaneous enzyme and DNA binding. The two main binding events, at the zinc thumb and at the spine, appear to occur within 3-10 Angstroms of the ammo acids shown by mutation to be needed for dsDNA binding. The binding affinity was calculated by AutoDock VINA™ software. See Table 2.

Anti-malarial drugs inhibit DNA binding to cGAS and dsDNA/cGAS complex formation

[Θ834] To determine whether these anti-malarial drags could inhibit DNA binding to cGAS in vitro, we performed DNA binding studies by the electrophoretic mobility shift assay (EMSA). As previously shown, addition of increasing concentrations of cGAS to a constant concentration of ds DNA (ISD), results in the protein retarding migration of ISD on the gel ('gel shift') and less free DNA (Figure 1, left panel). To test whether HCQ as a model antimalarial could attenuate the gel shift, we used constant concentrations of both ISD and cGAS (Figure 1, right panel) in the presence of increasing concentrations of HCQ. As shown, increasing the concentration of HC Q reduced the gel shift caused by the formation of dsDNA/cGAS complexes and led to increasing free DNA at the bottom of the gel. This result indicates that HCQ blocked dsDNA/cGAS binding. Inhibition of formation of dsDNA/cGAS higher order complexes by antimalarial drugs are especially interesting and important since cGAS is activated by dsDNA induced oligomerization and dsDNA/cGAS complex formation is required for cGAS activation.

Antimalarial drugs differentially inhibit cGAS activity and cGAMP production

[0835] HCQ belongs to a family of antimalarial drugs that share the structure of

aminoquinolines. To rapidly screen these antimalarial drugs for their ability to interfere with cGAS activation by ds-DNA, we performed dose titration experiments with drug and quantified cGAMP production using thin layer chromatography (TLC) (Figure 2A).

Reactions were performed in triplicate and normalized to no-inhibitor controls and fit by nonlinear regression using Prism GRAPHPAD™ to deto ;rmine the IC50 of each compound. Each compound yielded dose-response curves similar to HCQ but with different inhibitory activities (Figure 2B). From these curves, we estimated the concentration of the test compound required for half maximal blockade of cGAS activity (IC₅₀, 50% inhibition coefficient). As shown in Figure 2C, Quinacrine and ACM A were relatively potent inhibitors of cGAMP production; Primaquine and Quinine had very low inhibitory activity and both HCQ and Chloroquine had intermediate inhibitory activities. Strikingly, the computational predicted binding affinities of these anti-malaria drugs inversely correlated with the IC50 of anti-malarial drugs, validating the prediction of our computational analysis (Figure 2D).

[0836] To test whether HCQ specifically inhibit cGAS activity but not STING activity, we incubated isotope labelled c-di-AMP with STING and then added un-labelled c-di-AMP or different concentration of HCQ. Our results demonstrated that HCQ could specifically block dsDNA binding to cGAS but not c-di-AMP to STING (Figure 4).

Antimalarial drugs could inhibit IFNb expression

[0837] Systemic Lupus Erythematosus (SLE) is strongly associated with increased expression of type I interferon (IFN-I) (Elkon, 2012). Both genetic as well as experimental studies indicate that IFN-I plays a central role in this disease (Lovgren, 2006) (Niewold, 2007). To determine the physiological relevance of our computational analysis and in vitro observance, we examined whether antimalarial drugs could inhibit IFNb production within the cell. As previously demonstrated by Sun and Wu et al (Sun, 2013) (Wu, 2013), cGAS is the cytosolic DNA sensor required for the IFNb production in THP1 cells transfected with herring testis DNA. Using this approach, we transfected THP1 cells with DNA in the presence or absence of antimalarial compounds and quantified IFNb expression by QPCR. As shown in Figure 3, Quinacrine, AMCA, HCQ and Chloroquine all inhibited IFNb production by THPl cells with an IC₅₀ dose range of 3-25 μΜ. In contrast primaquine and Quinine were less effective by about one log order IFNb (Figure 3A and 3B). Of note, the rank order of antimalarials in vitro and in vivo was virtually identical validating the DNA/cGAS interaction as the target (compare Figure 2B and Figure 3B).

[0838] To rule out whether antimalarial dmgs inhibited IFNb production by interfering with transfection efficiency, we performed two experiments. First, we compared DNA transfection efficiency in the presence or absence of antimalarial In the second experiment, we preincubated THPl cells with antimalarial, washed the drug away and then evaluated the ability of transfected drag to stimulate IFNb.

[0839] PolylC was transfected by Lipofectamine to THPl cells with different concentration of HCQ. The IL-lb cytokine production was measured by ELISA and the results indicated HCQ did not interfere with the Lipofectamine transfection efficiency (Supplemental Figure 3).

[0840] The results demonstrated that some of antimalarial drags could strongly block the interaction of DNA and cGAS and thus inhibit the IFNb production, which is a novel mechanism of antimalarial drugs' inhibition of type I IFN production.

Materials and Methods

Computational analysis

[0841] cGAS inhibitors were screened based on the crystal structure of the cGAS and docking of compounds predicted in silico. In silico, structure-based drug screening were provided by AutoDock VINA™ and DOCK™. cGAS expression and purification

[0842] Protein was expressed in Rosetta BL21 pLysS cells. 4.5 L of bacterial culture was induced at OD₆oo=0,5 with 500 μΜ IPTG and at 18 ^°C for 20 hrs. Cells were lysed into 50 mM Tns-HCl, pH = 8, 300 mM NaCl, 20 mM Imidazole, 5 mM BME and 0.2 mM PMSF by sonication. Cleared lysate was incubated with Ni-NTA, washed with 50 mL of Lysis buffer and eluted with 20 mM Tris-C3, pH = 7.4, 300 mM NaCl, 500 mM Imidazole. Protein was subsequently diluted to 200 mM NaCl and bound to a Heparin SEPHAROSE™ column (GE Healthcare). The column was washed with 2 column volumes of 250 mM NaCl, 20 mM Tris, 1 mM DTT, pH 7.4 and developed with a gradient from 250-1000 mM NaCl. The major peak of cGAS was finally purified using an S200 SUPERDEX™ (GE Healthcare) size exclusion column with 20 mM Tris pH 7.5, 250 mM NaCl and 1 mM DTT running buffer. Protem was -95 % pure by Coomassie stained SDS-PAGE gel. cGAS activity assays

[0843] Initial characterization of enzyme activity was monitored in the presence of 250 μΜ ATP, 250 μΜ GTP, 0-500 g/mL herring testes DNA, 1.4 μΜ cGAS, 3.3 nM ³²Ρ-γ-ΑΤΡ in a buffer composed of 40 mM Tns, 250 mM NaCl, 10 mM MgC12, pH 7.5. Reactions were incubated for 1 hr at room temperature and subsequently spotted on PEI-cellulose TLC plates and developed using a solvent composition 1 : 1.5 [v/v] saturated NH4S04 and 1.5 M

KH2P04 [pH 3.6] . For inhibition assays, compounds were characterized in the presence of the above reaction contents at fixed 100 μ-g/mL htDNA. TLC plates were exposed to a phosphor-storage screen and imaged using a TYPHOON^l imaging system. (See Figures 7- 16).

[0844] cGAS activity was monitored in the presence of 250 μΜ ATP, 250 μΜ GTP, 0-500 pg/ml herring testes DMA, 1.4 μΜ cGAS, and 3.3 nM [³²P]-ATP in Tris buffer (pH 7.5). After incubation for 1 h at room temperature, samples were spotted on PEI-cellulose Thin Layer Chromatograph (TLC) plates, and developed using a solvent composed of 1 : 1.5 [v/v] saturated NH4SO4 and 1.5 M KH2PO4 [pH 3.6] . For inhibition assays, compounds were characterized in the presence of the above reaction contents at fixed 100 ug/ml HT DNA. TLC plates were exposed to a phosphor-storage screen and imaged using a TYPHOOON^m imaging system. (Figure 7).

[0845] Thin Layer Chromatograph (TLC) assay was used for the quantification of cGAS inhibition by compounds X5/X6/X7. Reactions were normalized to no-inhibitor controls and fit by non-linear regression using Prism. GRAPHPAD ' to determine the TC50 of each compound. (Figure 7).

[0846] Trexl-A mouse were treated with 25mg kg/day compound X6 dissolved in water with SPLENDA™ or water with SPLENDA™ only as control for 8 weeks from birth. At 8 weeks age, mice were sacrificed and spleens were harvested. Mouse body mass and spleen mass were measured by balance. Statistical analysis was performed with a two-tailed, unpaired Student's t test. (Figure 8).

[0847] Total RNA was isolated from heart or spleen tissues using the RNeasy mini kit with a DNASE^lM treatment step (Qiagen, Valencia, C ). cDNA was generated using 300 ng RNA with the high-capacity cDNA RT-KFT¹*¹ using random primers (Applied Biosystems, Foster City, CA). Reactions in duplicate were run on an ABI ONESTEP PLUS™ using the different gene specific primers. A two-stage cycle of 95°C for 15 s and 60°C for 1 min was repeated for 40 cycles followed by a dissociation stage. Threshold cycle values were set as a constant threshold at 0.2, and fold changes in gene expression were then calculated using the 2^'&& T method. (Figures 9, 10 and 1 1 ).

[0848] Heart were harvested when the mouse were sacrificed after 8 weeks treatment. RNA was isolated from heat tissues with R EAST ΜΓΝ1Κ1Τ™ and cDNA was synthesized with the high-capacity cD A RT-KiT^f using random primers. 1SG15 and CXCLiO mR A expression was normalized to the 18S mRNA. Horizontal bars represent the mean values. Statistical analysis was performed with a two-tailed, unpaired Student^'s t test. (Figure 9).

[0849] Spleen were harvested when the mouse were sacrificed after 8 weeks treatment. Spleen TSG.15 and TSG20 mRNA expression was analyzed by qPCR and the results expressed relative to the 18S mRNA. Horizontal bars represeni the mean values. Mean data was compared using a t test. (Figure 10).

[0850] Heart were harvested when the mouse were sacrificed after 8 weeks treatment. Heart IFNb mRNA expression was analyzed by qPCR and the results expressed relative to the 1 8S mRNA. Horizontal bars represent the mean values. Mean daia was compared using a t tesi. (Figure 1 .1).

[0851 ] Heart tissues were lysed with 80% MeOH spiked with 5nM heavy isotope-labeled cGAMP (cGAMP*), containing ^ljC, ¹⁵N-perlabeled AMP, as internal standard. Tissues extracts were sonicated on ice for 1 min with 20% duty cycle and 1 output settings. Tissue debris was pelleted at 14,000rpm for 10 minutes. Methanol extraction solution was transferred to a new tube and evaporated using a speed vac. cGAMP was further purified by- Solid phase extraction column (OASIS WAX^1M column from Waters) and re-suspended in 50ui OPTIMA LC/MS™ water (Thermal Scientific, Odessa, TX) for Mass Spec analysis. For targeted detection of cGAMP, a Multiple Reaction Monitoring (MRM) assay was developed on Waters XEVO TQS¹ Mass Spectrometer coupled with Ultra-Performance Liquid Chromatogram (UPLC). In the assay , two transitions of each target ion were monitored: cGAMP, +675.1/152, 1 (parent ion/daughter ion) and +675.1/136.0; cGAMP*, +690,0/152.1 and +690.0/146.0, (Figure 12).

[0852] cGAMP was isolated from mouse heart tissues by a methanol extraction procedure. The abundance of cGAMP was quantitated by mass spectrometry using multiple reaction monitoring (M M). Heavy isotope-labeled cGAMP was spiked into each, sample as an internal standard and the mass spectrum of the internal standard was used to determine the peak of the endogenous cGAMP. cGAMP signal peak area was normalized to Heavy isotope labelled cOAMP internal standards peak area. Mean data was compared using a t test.

(Figure 12).

Method for Pathology (Figure 13, 14, IS, 16)

[0853] Trexl-/- mouse were treated with 25mg/kg/day compound X6 dissolved in water with SPLENDA ^m or water with SPLENDA^rM only as control for 8 weeks from birth. At 8 weeks age, mice were sacrificed and heart tissues were harvested. Tissues were fixed in Formalin, paraffin embedded, cut into 5 um sections, and stained with hematoxylin and eosin. All tissues were coded to remove genotype identification and were evaluated for evidence of inflammation and fibrosis. Numerical scores were assigned based on degree of se verity (0 =normal to 5 = most severe). The sum of individual scores from Endocardial inflammation, Fibrosis and Myocardial inflammation was used to obtain a total tissue histological score. Scoring criteria for each tissue:

Endocardial Inflammation score:

0 = normal; 1 = few inflammatory cells; 2 = multifocal clusters 5; 3 = multifocal clusters < 10; 4 = coalescing foci > 10; 5 = coalescing to diffuse foci

Myocardial Inflammation:

0 = normal; 1 = few (1 -3 cells); 2 = multifocal foci (3 - 5) with degenerative changes; 3 = multifocal foci (3 - 5) with necrotic changes; 4 = > 10 coalescing foci

Endocardial Fibrosis:

0 = normal; 1 = few inflammatory cells; 2 = multifocal clusters < 5; 3 = multifocal clusters < 10; 4 = coalescing foci > 10; 5 = coalescing to diffuse foci

[0854] Blinded analysis of heart tissues from Trexl-/- mouse treated with compound X6 or SPLENDA™. Data are represented as total histological scores from, individual animals as a sum of the scores from Endocardial Inflammation, Endocardial Fibrosis and Myocardial changes. Horizontal bars represent the mean values. Statistical analysis was performed with a two-tailed, unpaired Student's t test. (Figure 13).

[0855] Blinded analysis of heart tissues from Trexl-/- mouse treated with compound X6 or SPLENDA ^{1J l} . Data are represented as histological scores from individual animals for Endocardial Inflammation. Horizontal bars represent the mean values. Statistical analysis was performed with a two-tailed, impaired Student's t test. (Figure 14).

Θ856] Blinded analysis of heart tissues from Trexl-/'- mouse treated with compound X6 or SPLENDA™ . Data are represented as histological scores from individual animals for Endocardial Inflammation. Horizontal bars represent the mean values. Statistical analysis was performed with a two-tailed, unpaired Students t test. (Figure 15).

[0857] Blinded analysis of heart tissues from Trexl-/- mouse treated with compound X6 or SPLENDA ^llV1. Data are represented as combined histological scores from individual animals as a sum of the scores from Endocardial Inflammation and Fibrosis. Horizontal bars represent the mean values. Statistical analysis was performed with a two-tailed, unpaired Student's t test. (Figure 16).

Electrophoretic mobility shift assays (EMSA)

[0858] Electrophoretic mobility shift assay (EMSAs) were performed to measure the DNA- binding ability with or without HCQ in vitro. For the DNA binding studies, 0.2μΜ of the 100 bp annealed double stranded interferon stimulatory DNA (1SD) (Forward: 5^"- ACATCTAGTACATGTCTAGTCAGTATCTAGTGATTATCTAGACATACATCTAGTA CATGTCTAGTCAGTATCTAGTGATTATCTAGAC ATGGACTCATCC-3', Backward 5 '- GGATGAGTCCATGTCTAGATAATCACTAGATACTGACTAGACATGTACTAGATGT ATGTCTAGATAATCACTAGATACTGACTAGACATGTACTAGATGT-3') were mixed 1.5 μΜ cGAS protein and different concentration of HCQ (0.075~5mM) and incubated in RT for 2hours. The mixtures were resolved on 1% agarose gel using lX TBE electrophoresis buffer of at constant voltage of 100 V. The gel was analyzed by using a fluorescence-based EMSA kit (Molecular Probes) according to the manufacturer's protocol. Gels stained with fluorescent dyes were visualized by a Gel Doc XR^1M (Bio-Rad).

THP1 cell stimulation and IFNb expression inhibition

[0859] THP1 cells (0.2X10⁶) were transfected with 0.5ug herring testis DNA using

Lipofectamine 2000 (Invitrogen) according to the manufacture's instruction. Before transfection, THP1 cells were incubated with different concentration of Hydroxychloroquine or other antimalarial drugs (100, 50, 25, 12.5 μΜ) for 5 minutes. Cells were stimulated for 16 hours and then harvested for RNA extraction.

RNA preparation and quantitative real-time PCJR

[086Θ] Total RNA was isolated from TH 1 cells using the RNeasy mini kit (Qiagen, Valencia, CA). cDNA was synthesized using 100 ng RNA with the high-capacity cDNA RT- KIT™ using random primers (Applied Biosystems, Foster City, CA). Reactions in duplicate were ran on an ABI STEPONE PLUS^1M using the primers from Qiagen (primer catalog number); a two-stage cycle of 95°C for 15 s and 60°C for 1 rain was repeated for 40 cycles followed by a dissociation stage. Threshold cycle values were set as a constant threshold at 0.2, and fold changes in gene expression were then calculated using the 2^"ΔΔ-^€Ι method.

Example 2

The second messenger, cGAMP, and the enzyme, cGAS, are expressed in Systemic Lupus Erythematosus

[0861] To determine whether the cGAS pathway could contribute to IFN production in SLE, cGAS expression was quantified by QPCR from RNA obtained from 51 SLE and 20 Normal Control peripheral blood mononuclear cells (PBMC). These studies revealed that SLE patients had a significant increase in the expression of cGAS (P=0.0045). cGAS expression positively correlated with ISG expression and IFN score in SLE patients consistent with it being an IFN signature gene.

[0862] To determine whether downstream pathways of cGAS were activated in SLE cells, IRF3 activation was quantified by phosphorylation in PBMC. 1RF3 was activated in a higher proportion of SLE patients compared to controls. These findings suggest that the cGAS pathway appears active in SLE patients and likely contributes to IFN stimulation regardless of whether upregulation of cGAS is an initiator of IFN -I stimulation or is a consequence of IFN -I stimulation. To quantify c-GAMP in patient samples we have obtained cyclic GMP- AMP dinucleotide that is comprised of the unusual 2'-5' and 3'-5' phosphodiester linkage and have been able to distinguish the cyclic dinucleotide from other species by High Performance Liquid Chromatography-tandem Mass Spectrometry (HPLC-MS/MS). cGAMP is expressed in approximately one third of SLE patients with higher anti-DN A antibody titer. Experiments were conducted to determine whether cGAS and cGAMP can be used as a biomarker of SLE activity that correlates with disease activity, duration or severity.

AutoDock VTNA^IM was used to identify several drugs including Hydroxychloroquine that interacts at the Zn thumb and spine regions of cGAS involving simultaneous protein and DNA binding. EMSA analysis shows that HCQ inhibits the DNA binding to cGAS, which suggests a possible mechanism of HCQ action through the interruption of dsDNA stimulated cGAS enzyme activation besides the HCQ inhibition of lysosome acidification.

Θ863] IFN-β can be produced by almost any cell following stimulation by (viral or bacterial) nucleic acids. Release of this cytokine serves to prime or amplify type I IFN by other cells, especially plasmacytoid dendritic ceils (pDCs) that are the main producers of IFN -a. Over the last decade, there have been major advances in the understanding of the role of intracellular sensors such as Toll Like Receptors (TLRs), RIG-I like receptors (RLRs) and Aim-like receptors ( ALRs) that respond to nucleic acid ligands by stimulating production of IFN-I and other inflammatory cytokines ( Takeuchi, O. and S. Akira, Pattern recognition receptors ana inflammation. Cell, 2010. 140(6): p. 805-20). Cyclic di-nucleotides were discovered in bacteria more than 25 years ago and are known to function as ubiquitous second messenger molecules that regulate motility, biofilm formation, and virulence. Recently, it was reported that cyclic di-AMP (c-di-AMP) produced by bacteria could stimulate the production of IFN-I by the cytosolic surveillance pathway (CSP) (Woodward, J.J., A.T. lavarone, and D.A. Portnoy, c-di-AMP secreted by intracellular Listeria monocytogenes activates a host type I interferon response. Science, 2010. 328(5986): p. 1703-5). Further dissection of the pathway- revealed that c-di-GMP bound to and activated the adaptor, STING ( Burdette, D.L., et ai., STING is a direct innate immune sensor of cyclic di-GMP. Nature, 20 ! 1 . 478(7370): p. 515- 8) which was previously identified as a DNA sensor in the CSP resulting in the stimulation of IFN-b. More recently, Chen et ai ( Wu, J ., et al., Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic UNA. Science, 2013. 339(6121): p. 826- 30) discovered that a cyclic GMP-AMP (cGAMP) was produced in metazoans and that it also stimulated IFN-I in mammalian cells. In brief, ds-DNA binds to a positively charged pocket of the enzyme, cyclic GAMP synthase (cGAS) ( Sun, L., et al., Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science, 2013.

339(6121): p. 786-91). This binding results in a conformational change and opening of a catalytic cleft resulting in the synthesis of the noncanonical cyclic dinucleotide, cyclic GMP- AMP (cGAMP) containing an unusual [G(2'-5')pA(3'-5')p] linkage ( Diner, E.J., et al, The Innate Immune DNA Sensor cGAS Produces a Noncanonical Cyclic Dinucleotide that Activates Human STING. Cell Rep, 2013. 3(5): p. 1355-61) cGAMP binds to the adaptor protein, STING, which triggers activation of TBK, IRF3 and IFN-b (Sun, 2 13). Our goal was to determine whether the second messenger, cGAMP, plays a role in the disease SLE that is characterized by an IFN signature.

Increased expression of cGAS and pIRF3 in a proportion of SLE patients

Θ864] QPCR analysis of cGAS expression from healthy controls (CNT, n=20) and SLE (n=51). Samples were normalized for expression of 18S ribosornal RNA. A highly statistically significant difference in expression was observed between SLE patients and controls. cGAS expression correlated well with IFN score in SLE patients (Figure 5B). Western blot assay for the phosphorylated IRF3 expression. PBMC were obtained from 10 SLE patients, 13 RA patients and healthy controls. Proteins were resolved by SDS-PAGE, blotted to nitrocellulose and probed with an antibody to phosphorylated IRF3. The blot was stripped and reprobed with antibody to b-actin to ensure equal loading. A representative blot is shown in Figure 5C. From in vitro studies, it has been shown that stimulation of TLR7 19 by IC endocytosed from blood or tissue contribute to the IFN signature observed in human SLE. There is precedent for cell intrinsic stimulation of IFN -I by DNA in the Aicardi- Goutierre's Syndrome (AGS) and a subset of SLE patients (Lee-Kirsch, M.A., et al, Mutations in the gene encoding the 3 '-5 'DNA exonuclease TREXl are associated with systemic lupus erythematosus, Nat Genet, 2.007. 39(9): p. 1065-7; Namjou, B., et al., Evaluation of the TREXl gene in a large multi-ancestral lupus cohort. Genes Immun, 2011. 12(4): p. 270-9). We therefore explored the idea that cGAS was implicated in the initiation or perpetuation of IFN stimulation in SLE. We first tested cGAS expression in SLE patients. QPCR obtained from 51 SLE patients and 20 normal controls, revealed that, indeed, cGAS expression was significantly increased in SLE patients compared to normal controls (Figure 5A). The IFN score and cGAS expression were highly correlated (Figure 5B). Since cGAS (c6ORF150) is an IFN response genes (ISG) (Schoggins, J.W., et al., A diverse range of gene products are effectors of the type 1 interferon antiviral response. Nature, 201 1 . 472(7344): p, 481-485), this finding could indicate that cGAS is elevated as a consequence of exposure to IFN -I and/or that cGAS may be induced by an unknown DNA stimulus which then primes for enhanced IFN-I responses in a positive feedback cycle.

[0865] cGAS synthesis of cGAMP leads to direct binding and activation of STING which, in turn, causes activation of IRF3 in a TBK dependent pathway. When IRF3 is activated, it becomes phosphorylated, dimerizes and translocates to the nucleus where it exerts its transcriptional function leading to upregulation of IFN-b (Akira, 2010). We therefore tested whether IRF3 was activated in PBMC from SLE patients. As shown in Figure 5C, when randomly selected SLE, rheumatoid arthritis (RA) and normal PBMC were tested for IRF3 activation, IRF3 phosphorylation was observed in 6 out of 10 SLE patients PBMC but only 2 out of 13 control samples (p=0.028, Fishers exact test). The finding that IRF3 was activated in PBMC from a proportion of SLE patients strongly indicates that this second messenger pathway is active.

GAS is functional and cGAMP is expressed in SLE patients

[0866] THP1 cells were transfected with HT-DNA. cGAMP were purified from THP1 cells, SLE patients PBMC and their controls as described in the methods section. The abundance of cGAMP was quantitated by mass spectrometry using SRM. Note that the peak in the SLE cells is derived from m/z of the daughter ions of m/z 673.1 corresponding to cGAMP. This result is pivotal because it proves that not only is the expression of cGAS increased, but also that the enzyme is functional in SLE patient cells and implies activation by DNA. B. cGAMP were purified from PBMC of SLE patients (n=13), RA patients (n=3) and healthy controls (n^;=6). The presence of cGAMP was measured by mass spectrometry using SRM.

[0867] Activation of 1RF3 could result from stimulation by cGAS or by other pathways such as TLR4, RIG-I or MDA5. To definitively determine whether the cGAS pathway was active in SLE patients, we sought to determine whether cGAMP was expressed in PBMC. We first optimized methods and detected cGAMP in DNA transfected (as well as HSV infected) THP1 ceils but not in un-transfected ΊΉΡ1 cells (Figure 6A). When we tested SLE and healthy control PBMCs, we detected the dinucleotide at exactly 3 minutes in the SLE patient, but not control sample. Note thai the peak is derived from m/z of 673.1 corresponding to cGAMP. This result is pivotal because it proves that cGAS in SLE patient ceils is functional. We then randomly selected 13 SLE, 6 normal controls and 3 rheumatoid arthritis patients and tested their PBMC for cGAMP expression by LC/MS/MS. Of these 22 samples, 4/13 (31%) SLE, but none of the 9 controls were positive (Figure 6B). Thus cGAMP is produced in the cells of approximately one third of SLE patients. DNA ICs have been shown to stimulate IL- b in monocytes.

Clinical features of SLE patients with cGAS expression

[Θ868] To determine what clinical, therapeutic or other properties might distinguish those that do and do not express cGAMP, the duration of disease is examined as we postulated that activation of the cGAS pathway may prime cells such as pDC for IFN-a responses. To determine whether dmg the apy could explain suppression of cGAMP in about two thirds of patients, hydroxychloroquine, corticosteroid and other therapies are compared. The severity of disease are explored by examining the SLEDAI in each patient.

Materials and Methods

RNA preparation and quantitative real-time PCR

[0869] Total RNA was isolated from peripheral mononuclear cells (PBMC) of normal and SLE patients' blood using the RNEASY MINI KIT™ with on column DNASE™ treatment (Qiagen, Valencia, CA). cDNA was generated using 25 ng RNA with the high-capacity cDNA RT-KIT™ using random primers (Applied Biosystems, Foster City, CA). Reactions in duplicate were run on an AB1 STEPONE PLUS™ using cGAS forward primer and backward primer: a two-stage cycle of 95°C for 15 s and 60°C for 1 min was repeated for 40 cycles followed by a dissociation stage. Threshold cycle values were set as a constant threshold at 0.2, and fold changes in gene expression were then calculated using the 2^"ΔΔ-^€Ι method.

Western blot

[0870] Cells were !ysed in RIPA buffer (25mM Tris-HCl pH 7.6, I SOmM aCl, l% NP-40, 1% sodium deoxycholate, 0.1% SDS) with IX protease inhibitors and phosphatase inhibitors cocktail (Thermal Scientific, Odessa, TX) , and 20 ^ig protein from each sample was used for Western blot. The dilution of anti-pIRF3 was 1 :500 (Cell Signalling, Danvers, MA, USA), the dilution of anti-actin was 1 :5000 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Signals were detected using the ECL™ detection system and film (GE Healthcare,

Piscataway, NJ, USA). The quantitation was earned out using FLUGRCHEM™ imaging system and software (Alpha Innotech, San Leandro, CA, USA) with normalizing on the intensity of β-actin.

DNA stimulation for cGAMP production

[0871] THP1 cells were seeded 35M cells in 35ML medium at the time of transfection in T175 cell culture flask. 90ug DNA was diluted in 1.75ml Serum free medium and 230ul LIPOFECTAMINE 2000™ reagent was diluted in 1.75ml serum free medium. Then diluted DNA was added to the tube of diluted LIPOFECTAMINE 2000™ reagent in 1 : 1 ratio. The DNA and LIPOFECTAMINE™ mixture was incubated for 5 mins at RT and then DNA- regent complex was added to the cells. The transfected cells were cultured in 37C incubator for 2 days and then harvested for the cGAMP purifications. cGAMP purification

[0872] The cells were lysed with NER ^m lysis buffer from NE-PER Nuclear and

Cytoplasmic Extraction kits (Thermal Scientific, Odessa, TX) according to the instruction for the cell volumes vs NER volumes. Spin down the nuclei (~T6,()00g for 5min), take the supernatant and mix this with phenol with 1 : 1 ratio. Mix, incubate on ice for 5min, centrifuge for Smin at 16,000g at 4°C. Take the upper phase and mix with 2x volumes chloroform. Mix, incubate for 5min, centrifuge for 5min at 16,000g at 4°C. Take the upper phase and transfer it to a molecular weight cut-off column (10,000 MW). Spin as indicated and collect the flow- through. The flow-through was dried by SPEED VAC™ and resuspended in 20ul OPTIMA LC/MS ^,M water (Thermal Scientific, Odessa, TX). This was loaded on the HPLC column for Mass Spec analysis. cGAMP measurement by UPLC-MS/MS

[0873] High resolution mass measurement and tandem MS/MS is performed on Waters XEVO TQS™ Mass Spectrometer coupled with Ultra-Performance Liquid Chromatogram (UPLC). Full scan mass spectra are acquired form m/z 200-800. MS/MS spectra are acquired and the top five rnosi abundant ions subjected to further fragmentation by collision induced dissociation (CID). For targeted quantification of cGAMP, a selective reaction monitoring (SRM) assay was developed on the XEVO TQS^IM mass spectrometer. In the assay, three transitions of each target ion are monitored. The parent ion is isolated at m/z 673.1 in a negative mode (M-H)-, fragmented while the resulting daughter ion is monitored at m/z 341.10, 150.05, and 133.93 in a negative mode (M-H)-,

Example 3

Targeted Therapy to Inhibit cGAS stimulated Type I IFS Production

[0874] In an effort to identify drugs to block cGAS activity, we performed in silico screening of chemical and drug libraries and identified a candidate, HCQ, predicted to interact strongly with cGAS. HCQ is FDA approved and has a favorable safety profile.

[0875] The compound of Formu

wherein ¾ is selected from CI, OH, NH₂, and NO_?.; R? is selected from

OH. -OH*

" , and ^^**"* ; and n is 3 or 4.

[0876] The compounds of Formula (I) potently inhibit cGAS resulting in reduced production of IFN-I in lupus as well as autoimmune diseases such as scleroderma, polymyositis and possibly type 1 diabetes that have been associated with increased IFN I.

Θ877] The design of the compound of Formula (I) started with the energy -minimized structures of X-cGAS and DNA-X-cGAS complexes. Preliminary in silico studies have already identified two potential binding sites that are likely responsibie for the blocking of the crucial DNA-cGAS interactions. The compound of Formula (I) has an increased affinity to cGAS while preventing DNA interaction with cGAS. Compounds of Formula (I) were be chemically synthesized and evaluated for binding to cGAS and for their ability to block the formation of DNA-cGAS complexes. They were also tested in cell-based assays (THP-1 production of IFN-b by QPCR) for production of IFN-I. The most promising drug candidates were tested in animal models of lupus and AGS. Compounds of Formula (I) non-toxic to ceils were tested in AGS mouse model and lupus mouse model compared with quinacrine (QC) or HCQ as controls. In some aspects the AGS mouse model is TREX1-/-. In some aspects the lupus mouse model is NZB/W.

Synthesis

[0878] N, N'-Dimetiiyl-N'-(6-nitro-2-memoxy-acridin-9-yl)-N-benzy'lpropane-l,3-diamine (Rl = N02, R2=benzyl, n=3). 6-Nitro-2-methoxy-9-chloroacridine (288 mg, 1 mmoi){Csuk, 2004 #323 i }is reacted with N,N'-dimethyl-N-benzylpropane l,3-diatnine (192 mg, 1 mmol) in phenol (10 mL) for 5 hrs at 1 10 °C. After cooled to room temperature, the reaction mixture is diluted with dichlorome thane. The mixture is washed twice with sodium hydroxide solution ( IN) and twice with ammonium chloride solution. The organic layer is separated, dried over anhydrous sodium sulfate, and concentrated. The residue is purified by silica gel chromatography using triethylamine (5%) and methanol (5 to 15%) in dichloromethane to give the desired compound.

[0879] N, N'-Dimemyl-A"-(6-nitro-2-memoxy-acridin-9-yl)-N-(4-pyridyl)propane-l,3- diamine(Rl = N02, R2=4-pyridyl, n=3). Essentially the same reaction as above is carried out by using 6-Nitro-2-methoxy-9-chloroacridine and N,N'-dimethyl-N-(4-pyridyl)propane l,3- diamine.

[0880] N, N'-Dimemyl-N'-(6-nitro-2-memoxy-acridin-9-yl)-N-(2-furanyl)propane- l,3- diamine(Rl = Ν02, R2=2-furanyl, n=3). Essentially the same reaction as above is carried out by using 6-Nitro-2-methoxy-9-chioroacridine and N,N'-dimethyl-N-(2-furanyl)propane l,3- diamine.

[0881] A hot (60°C) solution of SnC12-2H20 (3.5 mol/mol ofnitro group) in 12N HC1- AcOH (1 : 1 v/v) (2mL/g of SnC12-2H20) is added in one portion to finely powdered nitro acridine compound contained in an larger flask. The initial vigor of the reaction is moderated by cooling in tap water. It is essential that at some stage in the reaction a clear solution is obtained. When the vigorous reaction abated the mixture is boiled under reflux for 1.5 hr. After cooling to room temperature, HCL is added to precipitate the cmde product. The crude product is dissolved in hot 0.2 N HC1, filtered, and added 12N HQ to precipitate the pure material. The same general method is used to produce the following three compounds; N, N'- Dime1hyl-N'-(6-amino-2-methoxy (RI =^: ΝΗ2,

R2=benzyl, n=3), Ν, N'-Dimethyl-N'-(6-amino-2-metlioxy-acridin-9-yl)-N-(4- pyridyl)propane-l,3-diamine(Rl = ΝΗ2, R2=4-pyridyl, n=3), and Ν, N' -Dimethyl -N'-( 6- amino-2-methoxy-acridin-9-yl)-N-(2-furanyl)propane- l,3-diamine(Rl

n=3).

Example 4

Targeted Therapy to Inhibit cGAS stimulated Type I IFN Production

[0882] The compound of Formula (I),

wherein i is H, Ci, OH, NH₂ or N0₂; R2 is H or -OCH₃; R3 and R4 are H or CH₃; R5 and

[0883] The compounds of Formulae (I), (II) and (III) potently inhibit cG AS resulting in reduced production of IFN-I in lupus as well as autoimmune diseases such as scleroderma, polymyositis and possibly type 1 diabetes that have been associated with increased IFN I. Example 5

Synthesis of Compounds of Formulae (I) - (III)

9-Chloro-3-nitro-7-methoxyacridine

[0884] 9-Chloro-3-nitro-7-methoxyacridine was prepared in two steps according to the published procedure.

9-Chloro-3-amino-7-methoxyacridine

[Θ885] In a lOmL round bottom flask were placed 9-chloro-3-nitro-7-methoxyacridine (0.1 gram, 3.46 x 10^~4 mole), Fe powder (58 mg, 1.04 x 10^"3 mole), EtOH (0.5 mL), AcOH (2 mL) and H20 (10 μΐ.,). Yellow starting material appeared largely insoluble and suspended. Put a glass cap on the flask. Sonicated the mixture at 30 ~ 45 °C (started at 30°C and the bath temperature gradually increased during the sonication) for 50-min, 15min-break and another 50-min. The solution turned to a deep red color at the end of reaction. Filtered the reaction mixture through a small glass filter to remove excess iron. The insoluble residues were washed with EtOH-AcOH( 1 : 1 ) and then EtOH. The filtrate and washings were combined and concentrated under vacuum to approximately l~2mL. To the viscous red residues, 12NHC1 (2 mL) was added, and sonicated briefly. The oily residues turned into solid, and were collected by centrifugation. The products were dried under vacuum.. Yield: 0.138 gram (quantitative yield). ESI-MS: m/z = 259.1 ( ! M I I I ^' }-

N, N'-Dimethyl-N-benzyl-l,3-propanediamine (X5 arm)

[0886] The compound was prepared according to the published procedure. Benzyl chloride (2.0 mL, 0.017 mole) was added drop-wise into a refluxing solution of N, N'-dimethyl-l,3- propanediamine (3.2 mL, 0.026 mole) dissolved in 20mL THE. White precipitates appeared as the benzyl chloride was added gradually over 30-min. After the addition is complete, the reaction mixture was kept refluxing for another 1 hr. The reaction mixture was then cooled to room temperature, 1M NaOH solution was added and extracted with CH2C12. The organic layer was collected, dried over anhydrous Na2SQ4, and concentrated. The product was isolated by distillation under reduced pressure. The product boiled at 75 ~ 80°C (0.1 mmHg). Yield 1.29 g (40%).

S , N'-Dimethyl-N-(4'-pyridylmethyl)-l,3-propanediamine (X6 arm)

[0887] 4-chloromethylpyridine HQ (2.79 gram., 0.017 mole) is neutralized with 20 mL of 1M NaOH on an ice bath, and extracted with CH2C12 three times. Tlie CH2Q2 layers were combined and dried over anhydrous Na₂S0 . The solvent was evaporated, and the residues were re-dissolved in 5mL THF. The THF solution was used immediately for the synthesis.

[0888] A solution of N, N'-dimethyl~l,3~propanediamine (3.2 mL, 0.026 mole) in 15 mL THF was brought to reflux, and the THF solution of 4-chloromethylpyridine was added dropwise over 30-min. After the addition, the dropping funnel was washed with 5 mL TOF. After the addition is complete, the reaction mixture was kept refluxing for another 1 hr. White precipitates were formed. The reaction mixture was then cooled to room temperature, and the solvent was removed under vacuum. To the residue was added 1M NaOH, and the product was extracted CH2C12 three times. The organic layers were combined, and dried over anhydrous Na2C03. The CH2Q2 solution was concentrated, and the product was isolated by distillation under reduced pressure. The product boiled at 90 ~ 95°C (0.1 mmHg),

Yield 1.33 gram (41%). Ή-NMR (300 MHz, CDC1₃): 5(ppm) 8.54 (2H, d), 7.26 (2H, d), 3.48 (2H, s), 2.62 (2H, t), 2.41 (3H, s), 2.41 (2H, t), 2,20 (3H, s), 1.70 (21 1. quintet), 1.51 ( 1H, br. s).

N, N'-Dimethyl-N-furfuryl-l,3-propanediamine (X7 arm)

[Θ889] Furfury! chloride (2.0 mL, 0.017 mole) was added drop-wise into a refluxing solution of N, N'-dimethyl- l,3-propanediamine (3.2 mL, 0.026 mole) dissolved in 20mL THF. White precipitates were observed as furfuryl chloride was added gradually over 30-min. After the addition is complete, the reaction mixture was kept refluxing for another 1 hr. The reaction mixture was then cooled to room temperature, 1M NaOH solution was added, and extracted with CH2C12. The organic layers were combined, dried over anhydrous Na2S04 and concentrated. The product was isolated by distillation under reduced pressure. The product boiled at 60 - 65°C (0.1 rnrtiHg). Yield 1.16 g (37%). Ti-NMR (300 MHz, CDC1₃): δ(ρριη) 7.37 ( 11 1. m). 6.31 (1H, m), 6.17 (IH, m), 3.55 (2H, s), 2.61 (2H, t), 2.40 (3H, s), 2.40 (2H, t), 2.24 (3H, s), 1.70 (2H, quintet), 1.84 (IH, br. s).

9-(N-(4"-pyridyImethyl)-N-methyl-N'-methyl-l ',3'-propanediamine))-3-amino-7- methoxyacridine (X6)

[0890] The dark red powder of crude 9-Chloro-3-amino-7-methoxyacridine prepared from. 0.2 gram of the corresponding nitro compound was placed in 50 mL flask, and added 2mL of EtOH, X6 arm (0.25 gram) and triethyiamine (300 μΙΛ The mixture was sonicated briefly to make a suspension, and then heated to reflux on an oil bath. The reflux was continued with stirring for 5 hrs. The solvent was removed under vacuum. The residues were dissolved in lOmL CH2C32 with sonication. Some insoluble materials were visible. Apply the whole suspension to a silica gel column (12 g in CH2C32). The column was washed with 50 mL CH2C32, and then eluted with 9: 1 :0.1 (CH2C12, MeOH, NH40H) 100 mL. Collected the dark red fraction, and concentrated with under vacuum. The residues were dried under vacuum overnight. Yield 0.39 gram. The crude material was dissolved in DMF and purified by HPLC, CI 8 reverse phase and a standard acetonitrile-water-0.1% TFA linier gradient. The purified X6 was lyophilized to produce orange powder. ESI-MS: m/z = 16.3 ([M+H] J.

9-(N-benzyl-N-methyl-N'-methyl-l',3'-propanediamine)-3-amino-7-methoxyacridine (X5)

[0891] X5 was prepared by the same procedure as for X6 by using X5 arm. ESI-MS: m/z ----- 415.5 ilM+Hf)

9-(N urfury!-N-methyS- '-niethyl-l 3^,~propaned!amine)~3-amino-7-methoxyacr! (XT)

[0892] X7 was prepared by the same procedure as for X6 by using X7 arm. ESI-MS: m, 405.2 · H | }

ylmethyl)-N-methyl-N'-methyl-l',3' lamir

-methoxyacridine (C6X6) [0893] X6 (5 rng, 1.2 x 10-5 rnoie) was suspended in 1 mL CH2C12, and triethylamine (8.4 μL, 6 x 10-5 mole) was added. Slight color changes occurred from orange to yellow.

Sonicated the mixture for 1 min, and n-hexanoyl chloride (3.4 μΐ.,, 2.4 x 10-4 mole) was added by using a lOuL syringe. White fume appeared. The yellow color intensified with disappearance of suspended small particles of X6. The mixture was kept at room temperature. The color changed to yellow-green after 2hrs. HPLC showed a major peak that appears to be more hydrophobic than X6. The reaction was then quenched by adding 50uL of methanol. The product was purified by C18 reverse phase HPLC with a standard acetonitrile-water- 0.1% TFA gradient. Yield 6.4 mg m/z 524.4 ([M+H]^÷)

9-(N-(4"-pyridylmethyl)-N-methyl-N'-methyl-l',3'-propanediamine))-3- trifluoroacetylamide-7-metho

9-(N-(4''-pyridylmethyl)-N-methyl-N'-methyl-l%3^,-propanediamine))-3-benzamide-7- methoxyacridine (BzX6)

i l l

9-(N-(4^,'-pyridyImethyS)-N-methyl- '-methyl-l',3'-propanediamine))-3- ethoxycarbonyl-7-methoxyacridine (ETOX6)

[0894] TFAX6, BzX6 and ETOX6 were prepared by using the same procedure as thai for C6X6, starting from purified X6 and tnfluoroacetic anhydride, benzoyl chloride or chloroethylcarbonate as an acylating agent, respectively. The reaction product was purified by reverse phase HPLC, and the product was more hydrophobic than X6.

Table 1. IC₅₀ Data

Enzyme Toxicity¹

No. Structure

Assay (μΜ)^" (μΜ)

A

11 >650 -

C T)

o

12 >650 -

13

18 33.1 (X5)

14

23 27.4 (X6)

15

35 - (X7)

115

116 -9.3 -8.6 n -6.7 -7.5 -7.5

-8.5 -7.5 -8.0 -6.2 -7.5 -7.5

-9.5 -6.2 -7.2 -5.5 -7.4 -7.3

-9.0 -7.9 -7.3 -6.1 -7.7 -7.3

-9.2 -8.1 -7.4 -5.1 -7.4 -7.5

-7.8 -7.0 -7.0 -5.4 -7.3 -7.3

-7.5 -6.7 -6.8 -6.6 NA -7.5

Claims

c I AIMS

WHAT IS CLAIMED:

1. A compound of Formula (I) or a prodrug or metabolite thereof

wherein

Ri is -O! I. -NH₂, ~ (H)C(0)R₇ or - 0₂;

R3 and R4 are independently -H or -CH₃;

R~

R₇is -OCH3, -OCH₂CH3, -OCH₂CH₂CH₃, -OCH₂CH₂CH₂CH3, -CH:. -CH₂CH3, -CH₂

-CH2CH2CH2CH3,-CH2CH2CH2CH2CH3,-CH2CH2CH2CH₂CH2CH3,-

n is 2 or 3.

The compound of claim 1 , wherem

R_:i is -NI-I2 or -N(H)C(0)R₇;

R. is -OCR,;

R₃ is -CH:.

R₄ is -H;

R₇is -OCH3. -OCH2CH3, -0(ΊΙ.(Ή.⁽ Ik -OCH2CH2CH2CH3, -CH₃, -CH₂CH₃, -CH₂ -!, -CH9CH9CH₇CH₁, -CH₇CH9CH9CH₇CH₁, -CH9CH9CH9CH9CH7CH₃. -

n is 2.

The compound of claim.1, wherein

R₃ is -i lk

R₄ is -H;

R₅ is -CH₃.

d

n is 2: and

4. The compound of claim 1, wherem

R₃ is -( !!::

, is -H;

R · is -CH₃;

\ #

Re is ; and

n is 2.

5. The compound of claim 2, wherein

R: is -CH₃;

R. I is -f \.

Rs s ~CH₃;

1.19 Re is ^&™~* ; and

n is 2.

6. The compound of claim 2, wherem

R is -NH₂;

R. is ·()( SI::

R₃ is -( !!:.

R₄ is -H;

n is 2.

7. The compound of laim 2. wherein Ri is N{H)C(0)R7.

8. The compound ofclaim 2, wherem

R₂ is -OCH₃;

R₃ is ·( !!::

R, is -H;

n is 2.

9. The compound ofclaim 2, wherem

Ri is -N(H)C(0)CH :H₂C¾CH_?.CH,; R₃ is -( !!:.

R₄ is -H;

n is 2. The compound of claim 2, wherein

R, is -N(H)C(0)CF₃;

n is I.

11. The compound of claim 2, wherein

R₇ is ... ; and

n is 2.

A compound of Formula (II) or a prodrug or metabolite thereof,

wherein

is -CI, -OH, -NH₂, or^■

n is 3 or 4.

13. The compound of claim 1, wherein Ri is -Ci.

14. The compound of claim 1, wherein R_t is -OH.

15. The compound of claim. 1, wherein Ri is -NH>.

16. The compound of claim 1, wherein R] is -NO?.

17. The compound of claim 1, wherein Re is

18. The compound of claim 1, wherein Re is

The compound of claim 1, wherein Re is

The compound of claim 1, wherein n is 3. The compound of claim 1, wherein n is 4.

The compound of claim 1, wherein Rj is -CI; Re is

The compound of claim 1, wherein Ri is -CI; Re is

-CH;.-

The compound of claim 1, wherein R] is -Ci; Re is

The compound of claim 1 , wherein i is -CI; Re is

26. I he compound of claim 1, wherein Ri is -Ci; Re is , and n is 3.

27. Hie compound of claim 1, wherein Ri is -CI; e is

, and n is 4.

28. The compound of claim. 1, wherein Ri is -OH; Re is ^* — _{^ an( Q} -_g g_

29. The compound of claim 1, wherein R] is -OH; R is , and n is 4. 30, The compound of claim 1 , wherein Rj is -OH; Re is , and n is 3.

31 , The compound of claim. 1, wherein i is -OH; Re is

, and n is 4.

The compound of claim 1, wherein , and

The compound of claim 1, wherein , and n is 4

The compound of claim 1, wherein Ri is -NH₂; Re is , and n is 3.

)5. The compound of claim 1, wherein Rj is -NH₂; Re is , and n is 4.

The compound of claim. 1, wherein i is -NH₂; Re

, and n is 3.

:^::::\

37. The compound of claim 1, wherein Ri is - i₂; Re is ' , and n is 4.

38. The compound of claim 1, wherein Ri is -NH₂; , and n is 3 ,

39. The compound of claim 1, wherein Rj is -NH₂; , and n is 4.

40. The compound of claim 1, wherein Ri is -N0₂; , and n is 3.

41. The compound of claim. 1, wherein i is -NQ₂; , and n is 4.

42. The compound of claim 1, wherein R_t is -ΊΜ0₂; , and n is 3.

43. The compound of claim 1, wherein Ri is -N0₂; R

5 is , and n is 4, The compound of claim 1, wherein Rj is -N0₂; R₂ is and n is 3.

45 The compound of claim. 1, wherein Ri is -NQ₂; Rs is

, and n is 4.

46. A compound of Fonnula (I) or a prodrug or metabolite tliereof,

(I)

wherein

i is -H, -CI, -OH, -Ni l, or^■

R₂ is -H or -OCH₃:

R : and R _s are -H or ~CH₃;

R₅ and R₆

n is 2 or 3.

The compound of claim 35, wherein j is -NH₂; R₂ is -OCH₃; R₃ is -CH₃; ¾ is -H: R₅

48. A pharmaceutical composition comprising a compound of any one of claims 1-47 and a pharmaceuticailv acceptable carrier, diluent or excipient.

49, A method for the treatment of an autoimmune disease or a monogenic disorder, the method comprising administering an effective amount of a compound of any of claims 1 to 47, or a pharmaceutically acceptable composition of claim 48, to a patient in need thereof.

50. A method for the treatment of an autoimmune disease or a monogenic disorder, the method comprising administering an effective amount of a compound of Formula (III) or a prodrug or metabolite thereof,

(III)

wherein

Ri is -H, halogen, -GH, -OCH .. -Ni k -NMe₂, -N(H)C(0)R₇ or AO,.

wherein R is -OCH₃, -(⁾( ! !,( ! I :. ~OCH₂CH₂CH₃, -(⁾( ! I,( ! I ·( H C! h.

•-Π Ι,ί \ l. -CH₂ CH₂CH₃, -CH₂CH₂CH₂ai₃- -CH₂CH₂CH₂CH₂CH₃.

•(Ί 1 ,(1 ^'! I .Ci l .C! I . C! I :. -CF₃, -CH₂CF₃ or

ring X is absent or

wherein R₂ is -H, halogen, NMe₂, -OCH₃ or■

OCH₂CH₃;

herein

R₃ is -H or - 4 is -H or -CH₃;

K;. and R.-. are independently -H, -CH₃, -CH₂CH₃, -CH₂CH₂SH, -CH₂CH₂OH,

R_Y is -NO₂, -C(0)OCH₂CH₃ or -N(H)S0₂Me; and

11 is 2 or 3;

to a patient in need thereof.

51. The method of claim 50, wherein the compound is of fonnula (Ilia):

wherem

; is -H, halogen, -OH, -()<¾, -NH₂, -N(H)C(0)R₇ or -N()₂,

wherem R- is ·()(^'! h. ··()(^'! !_..(^'! ! :. -ΟΠ ! >( I ! ·(^'! . -QCH₂CH₂CH₂CH₃, -CH₃ -C ? s_.' i ί :. -CH₂ ( I I^■■(. \ I : -( I I^■■(. \ I _' s 1 ·( I i !. -GH₂CH₂CH₂CH₂CH₃,

-CH₂CH₂CH₂CH₂CH₂CH₃, -CF₃, -CH₂CF₃ or

, wherein

R₃ is -H or -CH₃;

R₄ is -H or -CH₃;

Rs and Re are independently -H, -CH₃, -CH₂CH₃ or -CH₂CH₂OH; and n is 2 or 3.

52. The method of claim 50, wherein the compound is of formula (Illb):

(Illb)

wherein

R is -H, halogen, -OH, -OCH₃, -NH₂, -\ί Π )(^"{())Η·· or -N0₂,

wherein R- is -OCH₃, -OCH₂CH₃, -OCH₂CH₂CH₃, -OCH₂CH₂CH₂CH₃, -CH₃, -CH₂CH₃, -CH₂ CH₂CH₃, -CH₂CH₂CH₂CH₃, - H₂CH₂CH₃,

-CH₂CH₂CH₂CH₂CH₂CH₃, -CF₃, -CH₂CF₃ or

R₂ is H, halogen, -OCH₃ or -OCH₂CH₃; H₂,

, wherein

R₃ is -H or -CH₃;

R₄ is -I I or -CH₃:

R₅ and R₆ are independently -H, -CH₃, -CH₂CH₃, -CI I .(1 ! .Si I. ~( I S S OI L

R_Y is -NO2, -C(0)OCH₂CH₃ or U2 Me; and

n is 2 or 3.

53. The method of claim 52, wherein X is - H₂

54. The method of claim 52, wherein X is

55. The method of claim 52, wherein X is

56. The method of claim 52, wherein X is

The method of claim 52, wherein compound of Formula (IIlc) or a prodrug or metabolite thereof,

(IIlc) wherein

Ri is -H, halogen, -GH, -GCH₃, -NH₂, -N(H)C(0)R₇ or -NO,:

R^■■ is ~H or -OCH₃;

R₃ and R4 are independently -H or -CH₃;

Rs and R, are independently -H, -CH₃, ··(^*! !■( II--. -CH₂CH₂SH, -CH₂C¾OH,

R₇is -OCH3. -OCH2CH3, ··()(^'! !.<<^*! IX Ik -OCH2CH2CH2CH3, -CH₃, -CH₂CH₃, -CH₂

-!, -CH₂C , -CH₂CH₂CH₂CH₂CH₃, -CH₂CH₂CH₂CH₂CH?CH₃. -

n is 2 or 3.

The method of claim 57, wherein

Ri is -H, -CI, -OH, -NH₂, -N(H)C(0)R₇ or -N0₂;

R3 and R are independently -H or -CH₃;

Rj and !¾,

R7IS -OCH₃, -OCH₂CH₃, -OCH₂CH,CH₃, -QCH₂CH₂CH₂CH₃, -Ok -CH₂CH₃, -CH₂

-CH₂C , -CH₂CH₂CH₂CH₂CH₃, -CH₂CH₂CH₂CH₂CH₂CH₃, -

n is 2 or 3.

The method of claim.57, wherein

R, is -H;

R-. is -CH..

R₇is -OCH₃, -OC! !,( !!:. ~OCH₂CH₂CH₃, -OC!l,( !!,( ILCIh. -CH₃, -CH₂CH₃, -CH₂ CaCH^-CaCH^CH^Hi^CHjCaCHoCHiCHi^CHjCaCHoCHiCHpCH^-

CF₃, -CH₂CF₃ or V../

11 is 2.

60. The method of claim 57, wherein

Ri is -NH₂ or -N(H)C(0)R₇;

R. is -OCH₃;

R is -(^'!!<:

¾ is -H;

d

n is 2; and

61. The method of claim 57, wherein

R. is -OCH₃;

R: is -CH₃;

R. I is -f \.

n is 2.

62. The method of claim 57, wherein

R₂ is -OCH₃;

R₃ is -CH₃; R-. is -CH₃;

Re is ^^™"* ; and

n is 2.

63. The method of claim 57, wherein

¾ is -NH₂;

R . is -OCH₃;

R is -CH₃;

R₄ is -H;

R₅ i s -CH₃;

n is 2.

64. Hie method of claim 57, wherem R_L is -N(H)C(0)R₇.

65. The method of claim. 57, wherein

R . is -OCH₃;

R₃ is -( ! ! :.

R₄ is -H;

n is 2.

66. The method of claim 57, wherein

R is -N(H)C(0)CH₂CH₂CH₂CH₂CH₃;

R . is -OCH₃;

R is -CH₃; 5 i s -CH₃;

^

Re is ^'¾~~^5ί' ; and

n is 2.

67. The method of claim 57, wherein

R₂ is ~QCH₃;

R : is -CH₃;

n is I.

68. The method of claim 57, wherein

R₂ is -OCR

R₃ is ·( ! ! : :

R i is H;

R₅

69. Tlie method of any of claims 49-68, for the treatment of an autoimmune disease.

70. The method of claim 69, wherein the autoimmune disease is selected from the group consisting of systemic lupus erythematosus (SLE), lupus nephritis (LN), rheumatoid arthritis (RA), juvenile rheumatoid arthritis, Wegener's disease, inflammatory bowel disease, idiopathic thrombocytopenic purpura (I P), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, multiple sclerosis, psoriasis, IgA nephropathy , IgM polyneuropathies, myasthenia gravis, vasculitis, diabetes meiiitus, Reynaud's syndrome, Sjorgen's syndrome, scleroderma, polymyositis and glomerulonephritis.

71. The method of claim 70, wherein the autoimmune disease is systemic lupus

erythematosus (SLE).

72. The method of claim 70, wherein the autoimmune disease is rheumatoid arthritis (RA).

73. The method of claim 69, wherein the autoimmune disease involves inhibition of cGAS activity.

74. The method of any of claims 49-68, for the treatment of a monogenic disorder.

75. The method of claim. 74, wherein the monogenic disorder is Aicardi-Goutierre's Syndrome (AGS) or spondyloenchondrodysplasia (SPENCD).

76. The method of claim 75, wherein the monogenic disorder is Aicardi-Goutierre's Syndrome (AGS).