WO2016172598A1 - Exosomes and uses thereof - Google Patents
Exosomes and uses thereof Download PDFInfo
- Publication number
- WO2016172598A1 WO2016172598A1 PCT/US2016/029003 US2016029003W WO2016172598A1 WO 2016172598 A1 WO2016172598 A1 WO 2016172598A1 US 2016029003 W US2016029003 W US 2016029003W WO 2016172598 A1 WO2016172598 A1 WO 2016172598A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- cell
- exosomes
- rna
- exosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/5176—Compounds of unknown constitution, e.g. material from plants or animals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
- C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1017—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by filtration, e.g. using filters, frits, membranes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
Definitions
- the present invention relates to the isolation and purification of exosomes from biological samples, and to methods for extracting RNA contained therein.
- the present invention provides methods and uses for the purification of exosomes, as well as compositions comprising same.
- the present invention further relates to the use of exosomes for diagnosis and prognosis purposes.
- the present invention also relates for the use of exosomes in therapeutics.
- Exosomes are small extracellular vesicles that have been shown to contain RNA.
- Exosomes can be isolated using ultracentrifugation steps. However, purified exosomes have proven to be difficult to isolate. In particular, the presence of cellular debris amounts to 'contaminant' in a preparation, jeopardizing genetic and biochemical analysis of exosomes. While exosomes are isolated using ultracentrifugation as described herein, other methods such as filtration, chemical precipitation, size exclusion chromatography, microfluidics are known in the art.
- RNA content of exosomes was previously reported as uncorrelated to corresponding cellular RNA content (Skog J, Wiirdinger T, van Rijn S, Meijer DH, Gainche L, Sena-Esteves M, Curry WT Jr, Carter BS, Krichevsky AM, Breakefield XO. Nat Cell Biol. 2008 Dec; 10(12): 1470-6. doi: 10.1038/ncbl800. Epub 2008 Nov 16.).
- exosomes could prove useful in the therapeutics field.
- the present invention proves a method for the isolation of exosomes from a biological sample.
- said method comprises:
- step (b) preparing an exosome-enriched fraction from the biological sample of step (a),
- step (c) subjecting the exosome-enriched fraction of step (b) to a treatment with a proteinase.
- the present invention also provides a method for the purification of exosomes from a biological sample.
- said method comprises:
- step (b) preparing an exosome-enriched fraction from the biological sample of step (a),
- step (c) subjecting the exosome-enriched fraction of step (b) to a treatment with a proteinase.
- the proteinase of step (c) may be one or more independently selected from serine proteases, threonine proteases, cysteine proteases, aspartate proteases, glutamic acid proteases and metalloproteases.
- step (c) may comprise a treatment with a proteinase and subsequent inactivation thereof.
- proteinase inactivation may be performed with one or more protease inhibitor(s).
- the proteinase of step (c) may be proteinase K.
- step (b) may comprise one or more centrifugation steps, so as to remove live cells, dead cells and larger cellular debris from the biological sample of step (a).
- step (b) may comprise one or more filtration steps.
- the filtration step may comprise filtration with a submicron filter, for example the submicron filter may be a 0.22 micron filter.
- step (b) may comprise one or more centrifugation steps, so as to remove live cells, dead cells and larger cellular debris from the biological sample of step (a), followed by a filtration step with a submicron filter.
- step (b) may comprise one or more ultracentrifugation steps.
- step (b) may comprise:
- step (b-4) performing a second ultracentrifugation step of the washed exosome-enriched fraction of step (b-3).
- step (c) may be performed after the final ultracentrifugation step of step (b).
- step (c) may comprise a treatment with proteinase K and subsequent inactivation thereof.
- the inhibitor may be diisopropyl fluorophosphate (DFP) or phenyl methane sulphonyl fluoride (PMSF).
- the method may further comprise:
- step (d) subjecting the proteinase K-treated fraction of step (c) to a treatment with an RNase.
- the RNase may be one or more independently selected from RNase A, B, C, 1, and Tl .
- the RNase may be RNAse A/Tl .
- step (d) may comprise a treatment with RNase and subsequent inactivation thereof.
- inactivation of RNase may comprise a treatment with one or more RNase inhibitor(s).
- the RNase inhibitor may be selected from protein-based RNase inhibitors.
- the method may provide exosomes which are essentially free of extra-exosomal material. In some aspects, the method may provide exosomes which are essentially free of extra-exosomal nucleic acid-protein complexes. In some aspects, the method may provide exosomes which are essentially free of extra-exosomal RNA-protein complexes.
- the method may further comprise after step (c) or (d) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
- the method comprises a cell population comprising one or more cell types, 2 or more cell types, preferably 3 or more cell types, 4 or more cell types or 5 or more cell types.
- the method comprises isolating or purifying cell type-specific exosomes, or cell- subtype-specific exosomes.
- the method wherein the one or more cell type comprises cells derived from the endoderm, cells derived from the mesoderm, or cells derived from the ectoderm.
- the method comprises cells, wherein the cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut.
- the method comprises cells, wherein the cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells).
- the method comprises cells, wherein the cells derived from the ectoderm comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland.
- the method comprises cells, wherein the cells from the central nervous system and the peripheral nervous system comprise neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes.
- the method comprises neurons wherein the neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
- the method provides cell types wherein the one or more cell-type is a cancer cell or a circulating tumor cell (CTC), such as cancer cell or CTC derived from any cell-types or cell subtypes.
- the method provides a prey exosome biomarker, wherein the biomarker comprises a surface biomarker.
- the method wherein the prey exosome biomarker comprises a membrane protein.
- the method comprises a prey exosome biomarker selected from the group consisting of proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M.
- the prey exosome biomarker is FLRT3 and/or L1CAM.
- the method provides a bait molecule comprising a protein and more preferentially an antibody, such as a monoclonal antibody.
- the bait molecule is recognized by an affinity ligand.
- the bait molecule can also be an RNA aptamer.
- the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody.
- the bait molecule or the affinity ligand is immobilized on a solid substate.
- the solid substrate is selced from a purification column, a microfluidic channel or beads, such as magnetic beads.
- the method provides a purification, wherein the purification comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification.
- the method provides a biological sample, wherein the biological sample comprises a body fluid or is derived from a body fluid, wherein the body fluid was obtained from a mammal.
- the body fluid is selected from the group consisting of amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
- the present invention provides a method for the isolation of exosomes from a cell population, comprising steps of: (1) providing isolated exosomes from a biological sample comprising exosomes from said cell population, (2) performing on the isolated exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
- the present invention provides a method for the purification of exosomes from a cell population, comprising steps of: (1) providing purified exosomes from a biological sample comprising exosomes from said cell population; (2) performing on the purified exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
- the invention provides a method for either isolation or purification of exosomes from a cell population, wherein the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types or 5 or more cell types.
- the method isolates or purifies cell type-specific exosomes, or cell-subtype- specific exosomes.
- the method comprises a cell population comprising one or more cell types, 2 or more cell types, preferably 3 or more cell types, 4 or more cell types or 5 or more cell types.
- the method comprises isolating or purifying cell type-specific exosomes, or cell-subtype-specific exosomes.
- the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell type comprises cells derived from the endoderm, cells derived from the mesoderm, or cells derived from the ectoderm.
- the method comprises cells, wherein the cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut.
- the method comprises cells, wherein the cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells).
- the method comprises cells, wherein the cells derived from the ectoderm comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland.
- the method comprises cells, wherein the cells from the central nervous system and the peripheral nervous system comprise neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes.
- the method comprises neurons wherein the neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
- the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell-type is a cancer cell or a circulating tumor cell (CTC), such as cancer cell or CTC derived from any cell-types or cell subtypes.
- the method provides a prey exosome biomarker, wherein the biomarker comprises a surface biomarker.
- the method wherein the prey exosome biomarker comprises a membrane protein.
- the method comprises a prey biomarker selected from the group consisting of proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M.
- the prey exosome biomarker is FLRT3 and/or LI CAM.
- the method provides for isolation or purification of exosomes from a cell population, wherein the bait molecule comprises a protein and more preferentially an antibody, such as a monoclonal antibody.
- the bait molecule is recognized by an affinity ligand.
- the bait molecule can also be an RNA aptamer.
- the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody.
- the bait molecule or the affinity ligand is immobilized on a solid substate.
- the solid substrate is selced from a purification column, a microfluidic channel or beads, such as magnetic beads.
- the method provides a purification, wherein the purification comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification.
- the present invention also provides a method for the preparation of exosomal RNA from a biological sample, said method comprising:
- step (ii) may comprise the method for the isolation/purification of exosomes as disclosed herein.
- the method for the preparation of exosomal RNA from a biological sample comprises a method wherein the purified exosomes prepared at step (ii) are exosomes from a single cell type or from a single cell subtype.
- the present invention provides a method for the preparation of exosomal RNA of a cell population, comprising steps of: (1) providing purified exosomes from a biological sample comprising exosomes from said cell population; (2) performing on the purified exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker, and (3) extracting RNA from the purified exosomes of step (2).
- the exosomal RNA may be total exosomal RNA. In some aspects, the exosomal RNA may comprise exosomal messenger RNA. In some aspects, the exosomal RNA may be total exosomal messenger RNA. In some aspects, the exosomal RNA is exosomal RNA from single cell type exosomes or single cell subtype exosomes.
- the present invention also provides for a use of a proteinase in the purification of exosomes from a biological sample.
- the present invention also provides for a use of a proteinase and of an RNase in the purification of exosomes from a biological sample.
- the present invention also provides for a use of a proteinase in the purification of an ultracentrifugated exosome- containing sample.
- the present invention also provides for a use of a proteinase and of an RNase in the purification of an ultracentrifugated exosome-containing sample.
- the proteinase may be proteinase K.
- the ultracentrifugated exosome-containing sample may be a washed ultracentrifugated exosome-containing sample.
- the ultracentrifugated exosome- containing sample may be a washed ultracentrifugated exosome-containing sample.
- the biological sample may be a bodily fluid or is derived from a bodily fluid, wherein the bodily fluid was obtained from a mammal.
- the bodily fluid may be selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
- the cell population may be a population of cells of the same cell type. In the methods and uses of the invention as disclosed herein, in some aspects, the cell population is a population of cells of different cell types. In another embodiment, the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types, or 5 or more cell types. [0039] In the methods and uses of the invention as disclosed herein, in some aspects, the biological sample comprises cultured cells. In some embodiments, the biological sample may comprise cells cultured in vitro. In some embodiments, the biological sample may comprise cells cultured ex vivo. In some embodiments, the biological sample may be a sample obtained by liquid biopsy.
- the biological sample may comprise a cell type selected from cells types present in amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit.
- a cell type selected from cells types present in amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph
- the present invention also provides exosome preparations and compositions comprising exosomes.
- the present invention provides an exosome preparation obtainable with the method or the use as disclosed herein.
- the present invention also provides a composition comprising exosomes, wherein the composition is essentially free of extra-exosomal material.
- the present invention also provides a composition comprising exosomes, wherein the composition is essentially free of extra-exosomal nucleic acid-protein complexes.
- the present invention also provides a composition comprising exosomes, wherein the composition is essentially free of extra-exosomal RNA-protein complexes.
- the invention provides a composition comprising cell type specific exosomes or cell subtype specific exosomes.
- the composition comprises exosomes, wherein the exosomes are specific for one or more cell types or cell subtypes.
- the composition comprises purified exosomes, wherein said purified exosomes are exosomes from a single cell- type or of a single cell subtype.
- the present invention provides a method for the determination of cellular RNA content in a cell population.
- said method comprises:
- step (c) extracting RNA from the purified exosomes of step (b), so as to provide exosomal RNA
- step (e) estimating, as a function of the result from step (d), the cellular RNA content in the cell population.
- step (b) may comprise the method for the purification of exosomes as disclosed herein.
- the invention provides a method for the determination of cellular RNA content of a cell population, said method comprising (a) providing a biological sample comprising exosomes from said cell population; (b) preparing purified exosomes from the sample of step (a); (c) extracting RNA from the purified exosomes of step (b), so as to provide exosomal RNA; (d) analyzing the exosomal RNA extracted at step (c); (e) estimating, as a function of the result from step (d), the cellular RNA content in the cell population; wherein step (b) further comprises performing on the purified exosomes one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
- the method comprises the method of step (b) wherein the method comprises the isolation or the purification of exosomes from a biological sample.
- the invention provides a method for either isolation or purification of exosomes from a cell population, wherein the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types or 5 or more cell types.
- the method isolates or purifies cell type-specific exosomes, or cell-subtype-specific exosomes.
- the method comprises a cell population comprising one or more cell types, 2 or more cell types, preferably 3 or more cell types, 4 or more cell types or 5 or more cell types.
- the method comprises isolating or purifying cell type-specific exosomes, or cell-subtype-specific exosomes.
- the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell type comprises cells derived from the endoderm, cells derived from the mesoderm, or cells derived from the ectoderm.
- the method comprises cells, wherein the cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut.
- the method comprises cells, wherein the cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells).
- the method comprises cells, wherein the cells derived from the ectoderm comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland.
- the method comprises cells, wherein the cells from the central nervous system and the peripheral nervous system comprise neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes.
- the method comprises neurons wherein the neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
- the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell-type is a cancer cell or a circulating tumor cell (CTC), such as cancer cell or CTC derived from any cell-types or cell subtypes.
- the method provides a prey exosome biomarker, wherein the biomarker comprises a surface biomarker.
- the method wherein the prey exosome biomarker comprises a membrane protein.
- the method comprises a prey exosome biomarker selected from the group consisting of proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M.
- the prey exosome biomarker is FLRT3 and/or LI CAM.
- the method provides for isolation or purification of exosomes from a cell population, wherein the bait molecule comprises a protein and more preferentially an antibody, such as a monoclonal antibody.
- the bait molecule is recognized by an affinity ligand.
- the bait molecule can also be an RNA aptamer.
- the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody.
- the bait molecule or the affinity ligand is immobilized on a solid substate.
- the solid substrate is selced from a purification column, a microfluidic channel or beads, such as magnetic beads.
- the method provides a purification, wherein the purification comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification.
- step (e) may be performed based on a predicted correlation between exosomal RNA content and cellular RNA content.
- said determination may comprise a qualitative determination.
- said determination may comprise a quantitative determination.
- said quantitative determination may comprise determination of relative abundance of two RNAs.
- said determination may comprise determination of mRNA profiles.
- said RNA may comprise messenger RNA (mRNA). In some aspects, said RNA may comprise micro RNA (miRNA). In some aspects, said RNA may comprise long non-coding RNA (IncRNA).
- mRNA messenger RNA
- miRNA micro RNA
- IncRNA long non-coding RNA
- step (D) may comprise a qualitative determination. In some aspects, step (D) may comprise a quantitative determination. In some aspects, step (D) may comprise RNA sequencing (RNA seq). In some aspects, step (D) may comprise array analysis. In some aspects, step (D) may comprise reverse transcription polymerase chain reaction (RT-PCR). In some aspects, step (D) may comprise quantitative reverse transcription polymerase chain reaction (qRT-PCR). In some aspects, step (D) may comprise analyzing one or more sequence/s of interest.
- RNA sequencing RNA sequencing
- step (D) may comprise array analysis.
- step (D) may comprise reverse transcription polymerase chain reaction (RT-PCR). In some aspects, step (D) may comprise quantitative reverse transcription polymerase chain reaction (qRT-PCR). In some aspects, step (D) may comprise analyzing one or more sequence/s of interest.
- RT-PCR reverse transcription polymerase chain reaction
- qRT-PCR quantitative reverse transcription polymerase chain reaction
- the method of the invention comprises testing for the presence or absence of said sequence/s of interest.
- step (D) may comprise analyzing for one or more allelic variants of a sequence of interest.
- step (D) may comprise testing for presence or absence of said allelic variants.
- step (D) may comprise genome-wide analysis.
- step (D) may comprise transcriptome profiling.
- the determination may be time-lapse.
- the cell population may be a population of cells of the same cell type. In some aspects, the cell population may be a population of cells of different cell types.
- the biological sample may comprise cultured cells.
- the biological sample may comprise cells cultured in vitro.
- the biological sample may comprise cells cultured ex vivo.
- the biological sample may be a sample obtained by liquid biopsy.
- the biological sample may comprise a cell type selected from blood, epithelia, muscle and neural cell types.
- the biological samples is obtained from a body fluid, selected from amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
- a body fluid selected from amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, ex
- the cell population of step (a) may be isolated as a subpart of a larger initial cell population. In some aspects, the cell population of step (a) may be obtained from a body fluid and isolated by immuno-magnetic separation.
- the method of the invention may be for use in diagnosis. In some aspects, the method of the invention may be for use in prognosis. In some aspects, the method of the invention may be for use in identifying markers. In some aspects, the method of the invention may be for use in a screening process. In another aspect, the method determines the cellular RNA content of a single cell type or of a single cell subtype.
- the present invention also provides a method for the diagnostic or prognostic of a disorder of interest in a subject.
- the method may comprise :
- step (III) estimating the cellular RNA content of said marker in the biological sample of step (II) by performing the method for the determination of cellular RNA content in a cell population as disclosed herein.
- the invention provides a method for the diagnostic or prognostic of a disorder of interest in a subject, wherein the cellular RNA content is the cellular content of a single cell type or of a single cell subtype.
- the method further comprises:
- step (IV) determining, from the results of step (III), the status of the marker selected at step (I).
- the marker may be selected from expression of a given open reading frame (ORF), overexpression of a given open reading frame (ORF), repression of a given open reading frame (ORF), over-repression of a given open reading frame (ORF), expression of a given allelic variant, relative level of expression of a given open reading frame (ORF), presence of a mutation in a given open reading frame (ORF).
- said disorder may be a blood disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with blood.
- said disorder may be a brain or spine disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with cerebrospinal fluid.
- said disorder may be a heart disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with blood or pericardial fluid.
- said disorder may be said disorder is a prostate or bladder disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with urine.
- said disorder may be an eye disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with tears.
- said disorder may be a lung disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with pleural fluid.
- the present invention also provides compositions comprising exosomes.
- the composition may be essentially free of extra-exosomal material, for use in diagnostics.
- the composition may be essentially free of extra-exosomal nucleic acid-protein complexes.
- the composition may be essentially free of extra- exosomal RNA-protein complexes.
- the present invention provides a method for the treatment or prophylaxis of a disorder in a patient.
- said method may comprise exosome-mediated delivery of a therapeutic RNA to a cell.
- said exosome-mediated delivery may occur from one donor cell to a recipient cell, and wherein the therapeutic RNA may result from transcription in the donor cell.
- transcription in the donor cell may be inducible.
- the delivery may be performed ex vivo. In some aspects, the delivery may be performed in vivo.
- the present invention also an exosome for use in therapy. In some aspects, the present invention provides an exosome for use in delivering a therapeutic RNA to a cell. In some aspects, the exosome may be produced in vitro. In some aspects, the exosome may be produced in vivo.
- the present invention also provides a therapeutic RNA for use in exosome-mediated delivery to a cell.
- the exosome may be produced in vitro. In some aspects, the exosome may be produced in vivo.
- the present invention also provides a pharmaceutical composition comprising an exosome.
- said exosome may comprise a therapeutic RNA for delivery into a cell.
- the delivery may be performed ex vivo.
- the delivery may be performed in vivo.
- the cell may be capable of producing exosomes comprising a therapeutic RNA.
- the pharmaceutical composition is in a form suitable for injection.
- the present invention also provides a use of a therapeutic RNA in the manufacture of a medicament for the treatment or prophylaxis of a disorder in a patient.
- the RNA may be delivered to a cell in an exosome-packaged form.
- the exosome may comprise a therapeutic RNA or delivery into a cell.
- the therapeutic RNA may be translated in the recipient cell.
- the therapeutic RNA may be a small interfering RNA (siRNA).
- the therapeutic RNA may be a short hairpin RNA (shRNA).
- Figure 1 shows graph of RNA fluorescence unit (FU) plotted against RNA size (nt) for various exosome purification methods.
- Figures 2A-2D show electron microscopy (EM) photographs of exosome preparations for various exosome purification methods;(2A) Electron microscopy of exosomes with no treatment; (2B) Electron microscopy of exosomes with proteinase treated after spins; (2C) Side-by-side comparison of EM of untreated versus proteinase-treated; (2D) Electron microscopy of exosomes with proteinase treated between spins.
- EM electron microscopy
- Figure 3 shows results of a qRT-PCR experiment for various exosome purification methods.
- Figure 4A-4C show RNA-Seq data, showing that the RNA profile of mRNAs in exosomes reflects that of the donor cells; (4A) illustrates mRNA profile in exosomes: PTMS; (4B) illustrates mRNA profile in exosomes: MT2A; (4C) illustrates mRNA profile in exosomes: Rabl3.
- Figures 5A-5K show principle and results for fluorescence imaging of cells using EU click chemistry, to assess possible exosome-mediated RNA transfer between cells;
- (5A) shows intercellular communication
- (5B) shows click-chemistry with 5-ethynyl uridine
- (5C) shows control HEK 293 cells grown in presence of 5-ethynyl uridine
- (5D) shows negative control of HEK 293 cells with no 5-ethynyl uridine
- (5E) illustrates RNA transfer experiment
- (5F) shows negative control of HEK 293/ K562 cells with no 5-ethynyl uridine
- (5G) shows negative control of HEK 293/ K562 cells with no 5-ethynyl uridine with 640x magnification zoomed in
- (5H) shows experimental #1 of HEK 293/ K562 cells with 5-ethynyl uridine
- (51) shows experimental #1 of HEK 293/ K562 cells with 5-ethyn
- Figures 6A-6D show principle and results of an experiment to assess possible exosome mediated RNA transfer between co-cultured cell lines; (6A) illustrates an alternative experiment of mouse-human co-culture; (6B) shows the experimental design; (6C) percentage of mouse genes with TMM > 2; (6D) shows mouse gene expression in human cells.
- Figures 7A-7D illustrates Poly A selected from mRNA from two replicates of K562 cells and their exosomes was compared using RNA-Seq; (7 A) compares cell 1 versus cell 2; (7B) compares exosome 1 versus exosome 2; (7C) compares cell 1 versus exosome 1 (7D) compares cell 2 versus exosome 2.
- Figure 8 illustrates that mRNA is inside the exosomes.
- Figure 9 illustrates Poly A enriched mRNA from untreated exosomes and proteinase/Rnase treated exosomes was compared using RNA-Seq.
- Figure 10 illustrates targeted pull down exosome subpopulations based on their protein marker using antibody conjugated magnetic beads.
- Figure 11 illustrates exosomes which were isolated from human CSF and mRNA for four genes (detected by qRT-PCR.) Cell RNA is used as a comparison.
- extracellular vesicles refer to extracellular vesicles, which are generally of between 30 and 200 nm, for example in the range of 50-100 nm in size. In some aspects, the extracellular vesicles can be in the range of 20-300 nm in size, for example 30-250 nm in size, for example 50-200 nm in size. In some aspects, the extracellular vesicles are defined by a lipidic bilayer membrane.
- a "biological sample” may contain whole cells and/or live cells and/or cell debris.
- the biological sample may contain (or be derived from) a "bodily fluid".
- the present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
- Biological samples include cell cultures, bodily fluids,
- subject means a vertebrate, preferably a mammal, more preferably a human.
- Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
- therapeutic agent refers to a molecule or compound that confers some beneficial effect upon administration to a subject.
- the beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
- treatment or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit.
- therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment.
- the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
- the term "effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to effect beneficial or desired results.
- the therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art.
- the term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein.
- the specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
- functional genomics screens allow for discovery of novel human and mammalian therapeutic applications, including the discovery of novel drugs, for, e.g., treatment of genetic diseases, cancer, fungal, protozoal, bacterial, and viral infection, ischemia, vascular disease, arthritis, immunological disorders, etc.
- assay systems may be used for a readout of cell state or changes in phenotype include, e.g., transformation assays, e.g., changes in proliferation, anchorage dependence, growth factor dependence, foci formation, growth in soft agar, tumor proliferation in nude mice, and tumor vascularization in nude mice; apoptosis assays, e.g., DNA laddering and cell death, expression of genes involved in apoptosis; signal transduction assays, e.g., changes in intracellular calcium, cAMP, cGMP, IP3, changes in hormone and neurotransmittor release; receptor assays, e.g., estrogen receptor and cell growth; growth factor assays, e.g., EPO, hypoxia and erythrocyte colony forming units assays; enzyme product assays, e.g., FAD-2 induced oil desaturation; transcription assays, e.g., reporter gene assays; and protein production assays,
- RNA-protein complexes In the purification methods of the invention, it was found advantageous to perform a proteinase treatment, especially after the final ultracentrifugation step carried out for exosome preparation. Without being bound by theory, it is hypothesized that such treatment allows the removal of non exosomal nucleic acid-protein complexes, such as RNA-protein complexes. The proteinase treatment (and inactivation thereof), may then be followed by an RNAse treatment.
- exosome purification methods of the invention allows one to prepare compositions comprising exosomes, wherein the composition is essentially free of extra- exosomal material, and/or essentially free of extra-exosomal nucleic acid-protein complexes, and/or essentially free of extra-exosomal RNA-protein complexes. Such compositions may be used for exosomal RNA preparation.
- the purification method of the invention may include the following: removal of live cells, dead cells and larger cell debris, which may be performed by centrifugation steps and collection of the corresponding supernatants; filtration using a submicron filter such as a 0.22 micron filter; collection of exosomes by ultracentrifugation (typically at lOOg-l 30,000 ⁇ , for example 120,000 ⁇ -); washing exosomes before an additional ultracentrifugation step; proteinase treatment and inactivation; RNase treatment and inactivation.
- RNA profile notably the mRNA profile, of isolated or purified exosomes and the RNA profile of the corresponding donor cells.
- a correlation has been shown between the mRNA profile of exosomes from K562 cells which have been isolated or purified as per the purification method or the invention, notably after treatment with protease and then RNAse, and the RNA profile of donor K562 cells.
- Such a correlation has been shown for the first time and is advantageous for diagnostic applications, as the transcriptome profile from exosomes of a cell population very faithfully reflects the corresponding cellular transcriptome.
- RNA exosomal content can be performed using any transcriptomics method (see notably Wang et.al, Nature Review Genetics (10) 57-63), such as RNA seq (for which a princeps protocol is notably described in Macosko E Z et al., 2015, Cell 161, 1202-1214) , RT-PCT (notably qRP-PCR), small RNA sequencing (Li et.al, NAR 41(6) 3619-3634) or microarray.
- RNA analysis can also be performed as described in "Chip-based analysis of exosomal mRNA mediating drug resistance in glioblastoma" .
- the purification method of the invention may further comprise a step of separating one or more sub-populations of exosomes from a purified pool of exosomes.
- a sub-population of exosomes from a mixed exosome population found for example in a biological sample obtained from a body fluid, can be further purified or isolated, for example according to one or more specific donor cell types or donor cell subtypes.
- the purification method of the invention allows to isolate or purify subpopulations of exosomes from one or more cell types or cell subtypes, preferentially from a single cell type, or from a single cell subtype.
- a cell population can comprise one or more cell types, notably 2 or more cell types, 3 or more cell types, 4 or more cell types, or 5 or more cell types.
- a cell population comprises at least 1 to 40 cell types, notably at least 1 to 30, at least 5 to 20, at least 5 to 10, at least 2 to 8 or at least 2 to 5 cell types. Therefore, cell type or cell subtype exosomes can be purified from a mixed exosome population obtained from a cell population.
- cell types according to the invention comprises cell types derived from the endoderm, cell types derived from the mesoderm, or cell types derived from the ectoderm.
- Cell types derived from the endoderm can comprise cell types of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut.
- Cell types derived from the mesoderm can comprise osteochondroprogenitor cells, muscle cells, cell types from the digestive system, renal stem cells, cell types from the reproductive system, bloods cell types or cell types from the circulatory system (such as endothelial cells).
- Cell types derived from the ectoderm can comprise epithelial cells, cell types of the anterior pituitary, cell types of the peripheral nervous system, cell types of the neuroendocrine system, cell types of the teeth, cell types of the eyes, cell types of the central nervous system, cell types of the ependymal or cell types of the pineal gland.
- a cell population from the central and peripheral nervous system can comprise cell types such as neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes.
- the one or more cell types comprise cancer cells or circulating tumor cells.
- said cancer cells or CTCs derive from the cell types as listed above.
- a cell type can also encompass one or more cell subtypes, notably 2 or more, 3 or more, 4 or more, 5 or more and up to 10 or more cell subtypes.
- neurons encompass various cell subtypes such as for example interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
- Different cell types or cell subtypes can also be discriminated according to their respective transcriptome profile.
- purification or isolation or exosomes according to a specific cell type or a cell subtype is achieved through one or more purification steps.
- the one or more purification steps are based on the affinity of a bait molecule for a prey exosome biomarker.
- bait molecules may be an antibody that binds exosome transmembrane protein.
- a bait molecule may be an RNA aptamer.
- Prey exosome biomarkers according to the invention can be specific for one or more cell types or cell subtypes.
- prey exosomes biomarkers are membrane proteins.
- analysis of exosomal RNA content is highly relevant for diagnostic applications, as compared to the analysis of circulating DNA or RNA because it allows identification of the donor cell type or cell subtype though specific trans-membrane protein affinity purification, such as protein pull-up.
- Exosome biomarkers can be typically identified through mass spectrometry analyses of exosomes obtained from specific cell types or cell subtypes, and if required confirmed through western blotting or qRT-PCR analysis in said exosomes.
- exosomes from induced pluripotent stem cells (IPS cells) or IPS-derived- neurons can be used, but exosomes from any cell types or cell subtypes as defined above can be subjected to mass spectrometry analysis for identification of specific trans-membrane protein biomarkers.
- mass spectrometry analysis can also be performed on total exosomes from a body fluid, such as CSF. Analysis of the transcriptome of CSF exosomes is of high interest because such exosome population is specific of the brain cell population.
- Data obtained from such mass spectrometry analysis can be combined with genome or transcriptome analysis of corresponding donor cells in order to identify relevant biomarkers. This facilitates the identification of relevant exosome biomarkers useful for the present invention.
- relevant exosome biomarkers useful for the present invention.
- CNS genetic information lists of genes are available from e.g. "Establishing the Proteome of Normal Human Cerebrospinal Fluid” Schutzer S E et al., PLoS One, 2010; 5(6): el0980.
- prey exosome biomarkers from neurons comprise one or more selected from proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M.
- the prey exosome biomarker is FLRT3 and/or L1CAM. The presence of the at least one of these trans-membrane protein biomarkers in neuron exosomes can be confirmed through western blotting or RT-PCT analysis or neuron exosomes.
- the present invention provides methods for accessing information on tissue- or cell-type- specific exosomes, in particular tissue- or cell-type- specific transcription profiles.
- the present invention also provides very-high resolution diagnostic methods, wherein a subtle change in transcription profiles (e.g. a small up- or down-regulation in the transcription of a given gene in a given cell type or a given cell sub -type) can advantageously be efficiently detected, while it could not be in a total RNA or total exosome analysis.
- the one or more purification steps can comprise a microfluidic affinity based purification (see for example "Chip-based analysis of exosomal mRNA mediating drug resistance in glioblastoma” .
- a microfluidic affinity based purification see for example "Chip-based analysis of exosomal mRNA mediating drug resistance in glioblastoma” .
- PMID 25959588
- Microfluidic isolation and transcriptome analysis of serum microvesicles see for example "Chip-based analysis of exosomal mRNA mediating drug resistance in glioblastoma” .
- the bait molecule can be a bait protein, such as an antibody and in some aspects is preferentially a monoclonal antibody directed against a prey exosome biomarker.
- the bait molecule can also be an RNA aptamer. If several prey exosomes are to be combined for purification, a mix of corresponding monoclonal antibodies directed against each of the said prey exosomes biomarkers to be pull-up can be used.
- the bait molecule is recognized by an affinity ligand.
- Said affinity ligand can be a divalent metal-based complex, a protein, a peptide such as fusion protein tag or more preferentially an antibody.
- the bait molecule or the affinity ligand is immobilized or "coupled” directly, or indirectly to a solid substrate material such as by formation of covalent chemical bonds between particular functional groups on the ligand (for example primary amines, thiols, carboxylic acids, aldehydes) and reactive groups on the substrate.
- a substrate, or a matrix, in the affinity purification steps of the method of the invention can be any material to which a biospecific ligand (i.e., the bait molecule or the affinity ligand) is coupled.
- Useful affinity supports may be those with a high surface-area to volume ratio, chemical groups that are easily modified for covalent attachment of ligands, minimal nonspecific binding properties, good flow characteristics and/or mechanical and chemical stability.
- Magnetic particles may also be used as a substrate instead of beaded agarose or other porous resins. Their small size provides the sufficient surface area-to-volume ratio needed for effective ligand immobilization and affinity purification.
- Magnetic beads may be produced as superparamagnetic iron oxide particles that may be covalently coated with silane derivatives. The coating makes the beads inert (i.e., to minimize nonspecific binding) and provides the particular chemical groups needed for attaching any affinity ligands of interest. Affinity purification with magnetic particles is generally not performed in-column.
- a few microliters of beads may be mixed with several hundred microliters of sample as a loose slurry. During mixing, the beads remain suspended in the sample solution, allowing affinity interactions to occur with the immobilized ligand. After sufficient time for binding has been given, the beads are collected and separated from the sample using a powerful magnet.
- An exemplary bead purification method can be found in "Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes ' " . Kowal J, Arras G, Colombo M, Jouve M, Morath JP, Primdal-Bengtson B, Dingli F, Loew D, Tkach M, Thery C. Proc Natl Acad Sci U S A. 2016 Feb 23; 113(8):E968-77. doi: 10.1073/pnas. l521230113. Epub 2016 Feb 8. PMID: 26858453.
- a pull down assay can be performed for the purification or isolation of a subpopulation of exosomes by pulling-down of one or more specific prey exosome biomarkers (preferentially a membrane protein as described below).
- Said prey exosome biomarkers may be specific of a at least one cell type or cell subtype and advantageously lead to enriching in exosomes from said selected cell type or cell subtype.
- the at least one or more purification steps for the purification of an exosome subpopulation comprise a pull down purification.
- the prey exosome biomarker is generally a (trans)membrane protein, which has been found to be expressed in a cell type or a cell subtype.
- the bait protein is preferentially a monocolonal antibody directed against any of the prey exosome biomarker(s) which is to be pulled-up.
- Magnetic beads for example Dynabeads® from Thermo Fisher Scientific
- coated with an affinity ligand for the bait protein can be used to isolate said bait protein bound to said prey exosome biomarker(s).
- the affinity ligand is preferentially a class specific or a species specific antibody.
- magnetic beads coated with anti-mouse antibodies can be used together with monoclonal mouse antibodies directed against a specific surface protein of a cell type or cell subtype subpopulation of exosomes (such as for example CD63 or CD81).
- a control antibody such as a mouse mcherry monoclonal antibody, can be used.
- a pull down assay can therefore be used to illustrate and validate the purification, or isolation of at least two exosome subpopulations expressing each at least one specific membrane protein, such as the canonical exosomes markers CD63 and CD81, which have previously been pooled. As shown in the results examples, said at least two exosomes subpopulations can be re- separated based on the selected protein biomarker. The purification or isolation of exosome subpopulations by at least one specific prey exosome biomarker (preferentially a membrane protein) can be further confirmed using wastern blot or qRT-PCT.
- transcriptome profile of at least two subpopulations of exosomes purified from a mixed exosome population (e.g.: obtained from a cell population comprising one or more cell types, such as the K562 cells) using specific exosome biomarkers (such as CD63 or CD81) as described above (e.g. : using magnetic beads pull-down purification).
- the transcriptome profile of said exosomes subpopulations can also be further compared to the transcriptome profile of the total exosome population.
- RNA seq analysis of exosomes is particulary well suited for such transcriptome comparisons.
- mRNA micro RNA
- IncRNA long non coding RNA
- transcriptome profile analysis notably the RNA seq analysis
- exosomes from the said different cell types or subtypes isolated according through the purification method of the invention (notably using antibody-conjugated magnetic beads as described above) in order to enrich for exosomes expressing at least one cell type or cell subtype specific biomarker, with (ii) the transcriptome profile of total exosomes.
- transcriptome profile analysis notably the RNA seq analysis
- the transcriptome profile of total exosomes can be compared to the RNA profile of total exosomes from both cell types.
- exosomes subspopulations are purified or isolated from a complex biological sample obtained from at least two cell populations, cell types, or cell subtypes. For example, from a mix of media obtained from cell culture of different cell types such as IPS cells and neurons. Exosomes of the specific cells types are then purified as described above and their transcriptome is analysed. Such an experiment allows reconstructing, ex post facto, the transcriptome of the original cell type.
- exosome subpopulations can be further purified through any of the purification steps as described above, and enrichment in expression of specific cell type biomarkers can be searched through transcriptome analysis of this subpopulation as compared to the total exosome population. Said analysis is of particular interest for CSF analysis and identification of exosomes from specific neuronal subtypes
- the RNA content of exosomes is found to correlate the RNA content of the corresponding cell.
- a correlation was found between said exosomal RNA content and corresponding cellular RNA content. Therefore, analyzing exosomal RNA provides both qualitative and quantitative information about the cellular RNA content of the corresponding cells.
- this makes it possible to provide non-invasive diagnostic methods. Indeed, the analysis (whether by RNA seq, transcriptome profiling, qRT-PCR or array) is performed on a biological sample derived from body fluids, such as derived from urine, blood or cerebrospinal fluid.
- the present invention provides diagnostic methods that are non-invasive and yet reliable.
- exosomes could provide a delivery system in therapeutics. This would allow the delivery of a therapeutic RNA to a cell, wherein said therapeutic RNA may silence or express a gene in a cell.
- the present invention contemplates delivery of the exosome itself, or of an exosome-shedding cell. The delivery may occur in vivo or ex vivo. Delivery may rely on a targeting ligang. Said targeting ligand may be one or more prey exosome biomarker as decribed herein.
- the prey exosome biomarker may be selected from proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M; the prey exosome biomarker may be FLRT3 and/or L1CAM; or efficient fragments thereof.
- library generally means a multiplicity of member components constituting the library which member components individually differ with respect to at least one property, for example, a scFv library.
- library means a plurality of nucleic acids / polynucleotides, preferably in the form of vectors comprising functional elements (promoter, transcription factor binding sites, enhancer, etc.) necessary for expression of polypeptides or RNA molecules, either in vitro or in vivo, which are functionally linked to coding sequences for polypeptides or RNA molecules.
- the vector can be a plasmid or a viral-based vector suitable for expression in prokaryotes or eukaryotes or both, preferably for expression in mammalian cells.
- the cloning sites can be restriction endonuclease recognition sequences, or other recombination based recognition sequences such as loxP sequences for Cre recombinase, or the Gateway system (Therm oFisher, Inc.) as described in U.S. Pat. No. 5,888,732, the contents of which is incorporated by reference herein.
- Coding sequences for polypeptides can be cDNA, genomic DNA fragments, or random/semi-random polynucleotides.
- the methods for cDNA or genomic DNA library construction are well-known in the art, which can be found in a number of commonly used laboratory molecular biology manuals described herein.
- the present invention provides for libraries of polynucleotide sequences encoding for interacting protein or RNA molecules.
- Methods of making libraries are well known in the art, in which the methods may use any of a variety of reverse transcriptases and optionally other DNA polymerases, vectors for cloning cDNAs, as well as adapters, linkers, restriction enzymes, and ligases or recombination enzymes for combining synthesized cDNA molecules with vectors.
- recombinational cloning is employed to insert cDNA molecules into expression vectors, and in these embodiments, adapters comprise recognition sites for recombination enzymes.
- Members of a library may include any protein or RNA molecule chosen from any protein or RNA molecule of interest and includes protein or RNA molecules of unknown, known, or suspected diagnostic, therapeutic, or pharmacological importance.
- the protein of interest can be a protein or RNA molecule suspected of being involved in a cellular process, for example, receptor signaling, apoptosis, cell proliferation, cell differentiation, immune responses or import or export of toxins and nutrients.
- the present invention can allow for genome wide interaction studies of key proteins expressed during these different immune cell states.
- protein or RNA molecules of interest may be protein or RNA molecules expressed from an entire genome. Protein or RNA molecules expressed from a single cell type or from cells having a specific cell state may also be chosen.
- the protein molecules of the present invention can be derived from all or a portion of a known protein or a mutant thereof, all or a portion of an unknown protein (e.g., encoded by a gene cloned from a cDNA library), or a random polypeptide sequence.
- Members of a DNA expression library such as a cDNA or synthetic DNA library may be used.
- the full length of the protein or RNA molecule of interest, or a portion thereof, can be used. In the instance when the protein of interest is of a large size, e.g., has a molecular weight of over 20 kDa, it may be more convenient to use a portion of the protein.
- Polynucleotide sequences which encode the protein or RNA molecule of interest may be inserted into a vector such that the desired protein or RNA molecule is produced in a host mammalian cell.
- the vectors may include a proximity detection molecule.
- the proximity detection molecules may be encoded in-frame with a polynucleotide sequence encoding for a protein library member.
- the vector encoding an RNA molecule or a separate vector may encode for a fusion protein that recognizes a loop structure within the RNA molecule.
- the fusion protein is encoded by a polynucleotide sequence on the same vector as the RNA molecule, such that if a cell expresses the RNA molecule it will also express the fusion protein.
- the fusion protein includes a proximity detection molecule, thereby allowing the RNA molecule to be bound by a proximity detection molecule after expression.
- the recombinant expression vector includes one or more regulatory sequences operably linked to the polynucleotide sequence to be expressed.
- the term "regulatory sequence” includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals).
- a cDNA library may be constructed from an mRNA population and inserted into an expression vector.
- a library of choice may be constructed de novo using commercially available kits or using well established preparative procedures (see, for example, Current Protocols in Molecular Biology, Eds. Ausubel et al. John Wiley & Sons: 1992).
- a number of cDNA libraries are publicly and commercially available.
- the DNA sequences are inserted into a vector which contains an appropriate origin of replication.
- protein or RNA molecules need not be naturally occurring full-length protein or RNA molecules.
- protein or RNA molecules can be encoded by synthetic DNA sequences.
- the polynucleotide sequences encoding the desired protein or RNA molecule are typically operably linked to suitable transcriptional or translational regulatory elements.
- the regulatory elements typically include a transcriptional promoter, a sequence encoding suitable mRNA ribosomal binding sites, and sequences that control the termination of transcription and translation.
- the ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants may additionally be incorporated.
- the nucleic acid sequences encoding the proteins or RNA molecules may be expressed in a variety of host cells, including E. coli and other bacterial hosts, and preferably eukaryotic host cells including but not limited to yeast, insect cells, and mammalian cells.
- the polynucleotide sequences will be operably linked to appropriate expression control sequences for each host.
- the host cells comprise mammalian cells.
- Cells suitable for use include primary cultures, cultures of immortalized cells or genetically manipulated strains of cells.
- One of the main criteria for selection of a particular cell type may be the nature of post translational modification of target proteins expressed where the binding of such modified target proteins to a protein, RNA or small molecule may more accurately mimic the natural state.
- Cells that are associated with a particular disease state, or that originate from a particular tissue type may be chosen.
- Another criteria is the selection of a suitable cellular background to mimic the activity of a small molecule in its target tissue or cell type. If studying toxicity it may be appropriate to select a cell type associated with that toxicity, e.g. liver. Cell lines recognized in the art as easy to transfect are particularly preferred. Different mammalian cell types may also be selected according to their permeability.
- Cells may also be selected on the basis of their adherence to the chosen substrate, their rate of growth, and the ease with which they can be maintained in culture.
- the cells are human cells.
- Any cultured mammalian cell can be used in the present invention, e.g., a primary, secondary, or immortalized cell.
- exemplary mammalian cells are those of mouse, hamster, rat, rabbit, dog, cow, and primate including human. They may be of a wide variety of tissue types, including mast cells, endothelial cells, hepatic cells, kidney cells, or other cell types.
- primary cell means cells isolated from a mammal (e.g., from a tissue source), which are grown in culture for the first time before subdivision and transfer to a subculture.
- secondary cell means cells at all subsequent steps in culturing. That is, the first time a primary cell is removed from the culture substrate and passaged, it is referred to as a secondary cell, as are all cells in subsequent passages.
- mammalian primary and secondary cells which can be transfected include fibro-blasts, keratinocytes, epithelial cells (e.g., mammary epithelial cells, intestinal epithelial cells), endothelial cells, glial cells, neural cells, formed elements of the blood (e.g., lymphocytes, bone marrow cells), muscle cells and precursors of these somatic cell types.
- epithelial cells e.g., mammary epithelial cells, intestinal epithelial cells
- endothelial cells e.g., glial cells
- neural cells e.g., neural cells, formed elements of the blood (e.g., lymphocytes, bone marrow cells), muscle cells and precursors of these somatic cell types.
- Immortalized cells are cell lines that exhibit an apparently unlimited lifespan in culture.
- Examples of immortalized human cell lines useful for the present invention include, but are not limited to, HEK 293 cells and derivatives of HEK 293 cells (ATCC CRL 1573), HT1080 cells (ATCC CCL 121), HeLa cells and derivatives of HeLa cells (ATCC CCL 2, 2.1 and 2.2), MCF-7 breast cancer cells (ATCC HTB 22), K-562 leukemia cells (ATCC CCL 243), KB carcinoma cells (ATCC CCL 17), Raji cells (ATCC CCL 86), Jurkat cells (ATCC TIB 152), Namalwa cells (ATCC CRL 1432), HL-60 cells (ATCC CCL 240), Daudi cells (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cells (ATCC CRL 1593), Bowes Melanoma cells (ATCC CRL 9607), WI-38 cells (ATCC CLL 75), and MO
- the exosomes of the present invention may be loaded with exogenous cargoes, such as a therapeutic RNA, using electroporation protocols adapted for nanoscale applications (see, e.g., Alvarez-Erviti et al. 2011, Nat Biotechnol 29: 341).
- electroporation protocols adapted for nanoscale applications (see, e.g., Alvarez-Erviti et al. 2011, Nat Biotechnol 29: 341).
- electroporation for membrane particles at the nanometer scale is not well-characterized, nonspecific Cy5-labeled siRNA was used for the empirical optimization of the electroporation protocol.
- the amount of encapsulated siRNA was assayed after ultracentrifugation and lysis of exosomes. Electroporation at 400 V and 125 ⁇ resulted in the greatest retention of siRNA and was used for all subsequent experiments.
- siRNA-RVG exosomes induced immune responses in vivo by assessing IL-6, IP- 10, TNFa and IFN-a serum concentrations.
- siRNA-RVG exosome treatment nonsignificant changes in all cytokines were registered similar to siRNA-transfection reagent treatment in contrast to siRNA-RVG-9R, which potently stimulated IL-6 secretion, confirming the immunologically inert profile of the exosome treatment.
- exosome delivery with RVG-exosome appears to be more efficient than RVG-9R delivery as comparable mRNA knockdown and greater protein knockdown was achieved with fivefold less siRNA without the corresponding level of immune stimulation.
- This experiment demonstrated the therapeutic potential of RVG- exosome technology, which is potentially suited for long-term silencing of genes related to neurodegenerative diseases.
- the exosome delivery system of Alvarez-Erviti et al. may be applied to deliver the exosome of the present invention to therapeutic targets, especially neurodegenerative diseases.
- a dosage of about 100 to 1000 mg of a target RNA encapsulated in about 100 to 1000 mg of exosomes may be contemplated for the present invention.
- El-Andaloussi et al. discloses how exosomes derived from cultured cells can be harnessed for delivery of siRNA in vitro and in vivo. This protocol first describes the generation of targeted exosomes through transfection of an expression vector, comprising an exosomal protein fused with a peptide ligand. Next, El-Andaloussi et al. explain how to purify and characterize exosomes from transfected cell supernatant. Next, El- Andaloussi et al. detail crucial steps for loading siRNA into exosomes. Finally, El-Andaloussi et al.
- exosome-mediated siRNA delivery is evaluated by functional assays and imaging.
- the entire protocol takes ⁇ 3 weeks. Delivery or administration according to the invention may be performed using exosomes produced from self- derived dendritic cells.
- Exosomes are nano-sized vesicles (30- 90nm in size) produced by many cell types, including dendritic cells (DC), B cells, T cells, mast cells, epithelial cells and tumor cells. These vesicles are formed by inward budding of late endosomes and are then released to the extracellular environment upon fusion with the plasma membrane. Because exosomes naturally carry RNA between cells, this property might be useful in gene therapy.
- DC dendritic cells
- B cells B cells
- T cells T cells
- mast cells epithelial cells
- tumor cells tumor cells.
- exosomes may be conducted similarly to siRNA (see, e.g., Wahlgren et al. Nucleic Acids Research, 2012, Vol. 40, No. 17 el30).
- the exosomes may be co-cultured with monocytes and lymphocytes isolated from the peripheral blood of healthy donors. Therefore, it may be contemplated that exosomes containing a target RNA may be introduced to monocytes and lymphocytes of and autologously reintroduced into a human.
- Markers are identified for a number of disorders. Such markers are useful in the diagnostic, prognostic and/or therapy of respective disorders. Such markers include disease- associated genes and polynucleotides.
- Examples of disease-associated genes and polynucleotides are listed in Tables A and B. Disease specific information is available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web. Examples of signaling biochemical pathway-associated genes and polynucleotides are listed in Table C. Mutations in these genes and pathways can result in production of improper proteins or proteins in improper amounts which affect function.
- Parkinson's Disease x-Synuclein DM
- LRRK2 Parkin
- Blood and Anemia CDANl, CDAl, RPS19, DBA, PKLR, PKl, NT5C3, UMPHl, coagulation diseases PSN1, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB, and disorders ABCB7, ABC7, ASAT); Bare lymphocyte syndrome (TAPBP, TPSN,
- BCL7A BCL7
- BCL7A BCL7
- Leukemia TALI, and oncology TCL5, SCL, TAL2, FLT3, NBSl, NBS, ZNFN1A1, IK1, LYF1, diseases and disorders HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2,
- GMPS GMPS, AFIO, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPMl, NUP214, D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3, FLT3, AF1Q, NPM1, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B,
- SCIDXI SCIDX
- FMD4 HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2,
- CF CF, MRP7; Glycogen storage diseases (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); Hepatic adenoma, 142330 (TCF1, HNFIA, MODY3), Hepatic failure, early onset, and neurologic disorder (SCOD1, SCOl), Hepatic lipase deficiency (LIPC), Hepatoblastoma, cancer and carcinomas (CTNNBl, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNBl, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5; Medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); Phenylketonuria (PAH, PKU1, QDPR, DHPR
- DMD Muscular / Skeletal Becker muscular dystrophy
- DMD Muscular / Skeletal Becker muscular dystrophy
- DMD Duchenne Muscular diseases and disorders Dystrophy
- LMNA Emery-Dreifuss muscular dystrophy
- LGMD2I LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCAP, LGMD2G, CMD1N, TRFM32, HT2A, LGMD2H, FKRP, MDC1C, LGMD2I, TTN, CMD1G, TMD, LGMD2J, POMT1, CAV3, LGMD1C, SEPN1, SELN,
- LRP5 BMND1, LRP7, LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTM1, GL, TCIRG1, TIRC7, OC116, OPTB1
- Muscular atrophy VAPB, VAPC, ALS8, SMNl, SMAl, SMA2, SMA3, SMA4, BSCL2, SPG17,
- Neurological and ALS SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b, neuronal diseases and VEGF-c); Alzheimer disease (APP, AAA, CVAP, ADl, APOE, AD2, disorders PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE,
- VLDLR VLDLR
- Occular diseases and Age-related macular degeneration Abcr, Ccl2, Cc2, cp (ceruloplasmin), disorders Timp3, cathepsinD, Vldlr, Ccr2); Cataract (CRYAA, CRYAl, CRYBB2,
- Corneal clouding and dystrophy (APOAl, TGFBI, CSD2, CDGG1, CSD, BIGH3, CDG2, TACSTD2, TROP2, Ml SI, VSX1, RINX, PPCD, PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD); Cornea plana congenital (KERA, CNA2); Glaucoma (MYOC, TIGR, GLC1A, JO AG, GPOA, OPTN, GLCIE, FIP2, HYPL, NRP, CYPIBI, GLC3A, OPAl,
- NTG, NPG, CYPIBI, GLC3A Leber congenital amaurosis (CRBl, RP12, CRX, CORD2, CRD, RPGRIPl, LCA6, CORD9, RPE65, RP20, AIPL1, LCA4, GUCY2D, GUC2D, LCAl, CORD6, RDH12, LCA3); Macular dystrophy (ELOVL4, ADMD, STGD2, STGD3, RDS, RP7,
- IGF-1 Signaling IGF1; PRKCZ; ELK1; MAPKl; PTPN11; EDD4; AKT2;
- PIK3CA PRKCI; PTK2; FOS; PIK3CB; PIK3C3; MAPK8;
- IGF1R insulin receptor
- IRS1 MAPK3
- IGFBP7 IGFBP7
- KRAS PIK3C2A
- PDPK1 MAP2K1; IGFBP2; SFN; JUN; CYR61; AKT3;
- NRF2-mediated PRKCE EP300; SOD2; PRKCZ; MAPKl; SQSTM1;
- PRKD1 PRKD1; MAPK3; KRAS; PRKCD; GSTP1; MAPK9; FTL;
- MAP2K2 AKT1; PIK3R1; MAP2K1; PPIB; JUN; KEAPl;
- GSK3B ATF4; PRKCA; EIF2AK3; HSP90AA1
- IGF1R IGF1R
- IL6R RELA
- TLR4 PDGFRB
- TNF RELB
- IL8 IL8
- PDGFRA NFKB1; TGFBR1; SMAD4; VEGFA; BAX;
- IL1R1 IL1R1; CCL2; HGF; MMP1; STAT1; IL6; CTGF; MMP9
- NRIP1 KRAS; PPARG; RELA; STAT 5 A; TRAF2;
- PRKD1 MAPK3; MAPK10; KRAS; MAPK13; PRKCD;
- MAPK9 MAPK9; PIK3C2A; BTK; MAPKl 4; TNF; RAFl; FYN;
- MAP2K2 MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; AKT3;
- PIK3CA Receptor Signaling PIK3CA; CREB1; GNAQ; NFKB2; CAMK2A; PIK3CB;
- PIK3C3 MAPK3; KRAS; RELA; SRC; PIK3C2A; RAFl;
- PDPK1 PDPK1; STAT3; MAP2K1; NFKBl; BRAF; ATF4; AKT3;
- Inositol Phosphate PRKCE Inositol Phosphate PRKCE; IRAKI; PRKAA2; EIF2AK2; PTEN; GRK6;
- MAPKl Metabolism MAPKl; PLKl; AKT2; PIK3CA; CDK8; PIK3CB; PIK3C3;
- PFM1 PIK3C2A; DYRK1A; MAP2K2; PIP5K1A; PIK3R1;
- MAP2K1 MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK
- EIF2AK2 ELK1; ABL2; MAPKl; PIK3CA; FOS; PIK3CB;
- PIK3C3 PIK3C3
- MAPK8 CAV1; ABLl
- MAPK3 MAPK3
- KRAS KRAS
- SRC SRC
- PIK3C2A PIK3C2A
- PDGFRB PDGFRB
- RAFl RAFl
- MAP2K2 MAP2K2
- JAK1 JAK2
- JAK2 JAK2
- Trpal Pome; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca;
- Wnt2b Wnt3a; Wnt4; Wnt5a; Wnt6; Wnt7b; Wnt8b;
- Col. A-C in Table D are data derived from the published literature
- This paper provides a list of proteins detected through mass spectrometry analysis in cell- free CSF.
- This paper compares gene expression in different cells of the brain in human.
- Col. D-F in Table D are data obtained from intersection of the data from col. A-C
- Col. H-M in Table D are data obtained from intersection between data from the applicant (col. G) and data derived from the published literature (Col. A-F).
- the present invention may be applied to genetic mutations further described in Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012.
- Several further aspects of the invention relate to diagnosing, prognosing and/or treating defects associated with a wide range of genetic diseases which are further described on the website of the National Institutes of Health under the topic subsection Genetic Disorders (website at health.nih.gov/topic/Genetic Disorders).
- the genetic brain diseases may include but are not limited to Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Aicardi Syndrome, Alpers' Disease, Alzheimer's Disease, Barth Syndrome, Batten Disease, CADASIL, Cerebellar Degeneration, Fabry's Disease, Gerstmann-Straussler-Scheinker Disease, Huntington's Disease and other Triplet Repeat Disorders, Leigh's Disease, Lesch-Nyhan Syndrome, Menkes Disease, Mitochondrial Myopathies and NINDS Colpocephaly. These diseases are further described on the website of the National Institutes of Health under the subsection Genetic Brain Disorders.
- the condition may be neoplasia.
- the genes to be diagnosed, prognosed and/or targeted are any of those listed in Table A (in this case PTEN and so forth).
- the condition may be Age-related Macular Degeneration.
- the condition may be a Schizophrenic Disorder.
- the condition may be a Trinucleotide Repeat Disorder.
- the condition may be Fragile X Syndrome.
- the condition may be a Secretase Related Disorder.
- the condition may be a Prion - related disorder.
- the condition may be ALS. In some embodiments, the condition may be a drug addiction. In some embodiments, the condition may be Autism. In some embodiments, the condition may be Alzheimer's Disease. In some embodiments, the condition may be inflammation. In some embodiments, the condition may be Parkinson's Disease.
- proteins associated with Parkinson's disease include but are not limited to a-synuclein, DJ-1, LRRK2, PINK1, Parkin, UCHL1, Synphilin-1, and NURR1.
- Examples of addiction-related proteins may include ABAT for example.
- inflammation-related proteins may include the monocyte chemoattractant protein- 1 (MCP1) encoded by the Ccr2 gene, the C-C chemokine receptor type 5 (CCR5) encoded by the Ccr5 gene, the IgG receptor IIB (FCGR2b, also termed CD32) encoded by the Fcgr2b gene, or the Fc epsilon Rig (FCERlg) protein encoded by the Fcerlg gene, for example.
- MCP1 monocyte chemoattractant protein- 1
- CCR5 C-C chemokine receptor type 5
- FCGR2b also termed CD32
- FCERlg Fc epsilon Rig
- cardiovascular diseases associated proteins may include ILIB (interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin 12 (prostacyclin) synthase), MB (myoglobin), IL4 (interleukin 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP -binding cassette, sub-family G (WHITE), member 8), or CTSK (cathepsin K), for example.
- ILIB interleukin 1, beta
- XDH xanthine dehydrogenase
- TP53 tumor protein p53
- PTGIS prostaglandin 12 (prostacyclin) synthase)
- MB myoglobin
- IL4 interleukin 4
- ANGPT1 angiopoietin 1
- ABCG8 ATP -binding cassette, sub-family G (WHITE), member 8
- CTSK
- Examples of Alzheimer's disease associated proteins may include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme 1 (UBA1) encoded by the UBA1 gene, or the EDD8 -activating enzyme El catalytic subunit protein (UBE1C) encoded by the UBA3 gene, for example.
- VLDLR very low density lipoprotein receptor protein
- UBA1 ubiquitin-like modifier activating enzyme 1
- UBE1C El catalytic subunit protein
- proteins associated Autism Spectrum Disorder may include the benzodiazapine receptor (peripheral) associated protein 1 (BZRAPl) encoded by the BZRAP1 gene, the AF4/FMR2 family member 2 protein (AFF2) encoded by the AFF2 gene (also termed MFR2), the fragile X mental retardation autosomal homolog 1 protein (FXRl) encoded by the FXRl gene, or the fragile X mental retardation autosomal homolog 2 protein (FXR2) encoded by the FXR2 gene, for example.
- BZRAPl benzodiazapine receptor (peripheral) associated protein 1
- AFF2 AF4/FMR2 family member 2 protein
- FXRl fragile X mental retardation autosomal homolog 1 protein
- FXR2 fragile X mental retardation autosomal homolog 2 protein
- proteins associated Macular Degeneration may include the ATP -binding cassette, sub-family A (ABCl) member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein E protein (APOE) encoded by the APOE gene, or the chemokine (C-C motif) Ligand 2 protein (CCL2) encoded by the CCL2 gene, for example.
- ABCl sub-family A
- APOE apolipoprotein E protein
- CCL2 Ligand 2 protein
- proteins associated Schizophrenia may include RG1, ErbB4, CPLX1, TPH1, TPH2, RXN1, GSK3A, BD F, DISCI, GSK3B, and combinations thereof.
- proteins involved in tumor suppression may include ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia and Rad3 related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2), ERBB3 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 3), ERBB4 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 4), Notch 1, Notch2, Notch 3, or Notch 4, for example.
- proteins associated with a secretase disorder may include PSENEN (presenilin enhancer 2 homolog (C. elegans)), CTSB (cathepsin B), PSEN1 (presenilin 1), APP (amyloid beta (A4) precursor protein), APHIB (anterior pharynx defective 1 homolog B (C. elegans)), PSEN2 (presenilin 2 (Alzheimer disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1), for example.
- proteins associated with Amyotrophic Lateral Sclerosis may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- proteins associated with prion diseases may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
- proteins related to neurodegenerative conditions in prior disorders may include A2M (Alpha-2-Macroglobulin), AATF (Apoptosis antagonizing transcription factor), ACPP (Acid phosphatase prostate), ACTA2 (Actin alpha 2 smooth muscle aorta), ADAM22 (ADAM metallopeptidase domain), ADORA3 (Adenosine A3 receptor), or ADRAID (Alpha-ID adrenergic receptor for Alpha- ID adrenoreceptor), for example.
- A2M Alpha-2-Macroglobulin
- AATF Apoptosis antagonizing transcription factor
- ACPP Acid phosphatase prostate
- ACTA2 Actin alpha 2 smooth muscle aorta
- ADAM22 ADAM metallopeptidase domain
- ADORA3 Addenosine A3 receptor
- ADRAID Alpha-ID adrenergic receptor for Alpha- ID adrenoreceptor
- proteins associated with Immunodeficiency may include A2M [alpha-2- macroglobulin]; AANAT [arylalkylamine N-acetyl transferase]; ABCAl [ATP -binding cassette, sub-family A (ABCl), member 1]; ABCA2 [ATP-binding cassette, sub-family A (ABCl), member 2]; or ABC A3 [ATP-binding cassette, sub-family A (ABCl), member 3]; for example.
- proteins associated with Trinucleotide Repeat Disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtin), or DMPK (dystrophia myotonica-protein kinase), FXN (frataxin), ATXN2 (ataxin 2), for example.
- proteins associated with Neurotransmission Disorders include SST (somatostatin), NOS1 (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic, alpha-2A-, receptor), ADRA2C (adrenergic, alpha-2C-, receptor), TACR1 (tachykinin receptor 1), or HTR2c (5-hydroxytryptamine (serotonin) receptor 2C), for example.
- neurodevelopmental-associated sequences include A2BP1 [ataxin 2- binding protein 1], AADAT [aminoadipate aminotransferase], AANAT [arylalkyl amine N- acetyl transferase], ABAT [4-aminobutyrate aminotransferase], ABCAl [ATP -binding cassette, sub-family A (ABCl), member 1], or ABCA13 [ATP -binding cassette, sub-family A (ABCl), member 13], for example.
- A2BP1 ataxin 2- binding protein 1
- AADAT aminoadipate aminotransferase
- AANAT arylalkyl amine N- acetyl transferase
- ABAT 4-aminobutyrate aminotransferase
- ABCAl ATP -binding cassette, sub-family A (ABCl), member 1
- ABCA13 ATP -binding cassette, sub-family A (ABCl), member 13
- FIG. 1 Aicardi-Goutieres Syndrome; Alexander Disease; Allan-Herndon-Dudley Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alstrom Syndrome; Angelman; Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid-Lipofuscinoses; Beta- Thalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS1]; Cerebrotendinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Related Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dystrophy; Galactosial
- disorders conditions or diseases
- genes or markers currently associated with those disorders are also provided there.
- the genes exemplified are not exhaustive.
- kits containing any one or more of the elements disclosed in the above methods and compositions. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube. In some embodiments, the kit includes instructions in one or more languages, for example in more than one language.
- a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein.
- Reagents may be provided in any suitable container.
- a kit may provide one or more reaction or storage buffers.
- Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form).
- a buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof.
- the buffer is alkaline.
- the buffer has a pH from about 7 to about 10.
- the kit comprises one or more oligonucleotides corresponding to a guide sequence for insertion into a vector so as to operably link the guide sequence and a regulatory element.
- the kit comprises a homologous recombination template polynucleotide.
- the kit comprises one or more of the vectors and/or one or more of the polynucleotides described herein. The kit may advantageously allows to provide all elements of the systems of the invention.
- Example 1 isolation/purification of exosomes, and RNA extraction therefrom (no proteinase treatment): standard exosome isolation
- RNA from suspension cells such as K562 Cells. Buffers and some reagents refer to a mirVana RNA kit (Life technologies).
- Example 2 isolation/purification of exosomes, and RNA extraction therefrom (with proteinase and RNase treatment): removal of Protein-RNA Complexes from the Exosome Pellet
- RNA-protein complexes from the exosomes.
- Buffers refer to a mirVana RNA kit (Life technologies).
- exosome pellet - either at the wash step between ultracentrifugations or after the final ultracentrifugation, as indicated - was resuspended in 50-500 ⁇ ⁇ PBS or 0.5% Triton X-100 as indicated.
- Proteinase K (Life Technologies) was added to a final concentration of 500 ⁇ g/mL, and samples were incubated at 37°C for 30 minutes. Treatment was initially done in Proteinase K activity buffer (0.1 M NaCl, 10 mM Tris pH 8, 1 mM EDTA) rather than PBS, however reduced RNA yields from untreated exosomes resuspended in this buffer were observed; thus, all further treatments were performed in PBS. Proteinase was subsequently inactivated by the addition of phenylmethylsulfonyl fluoride (PMSF; Millipore) to 1 mM concentration.
- PMSF phenylmethylsulfonyl fluoride
- RNase Cocktail Enzyme Mix (Life Technologies) was added to a final concentration of 1.25 and 50 U/mL RNase A and Tl, respectively, and samples incubated at 37°C for 30 minutes.
- RNase was inactivated by the addition of SUPERasein (Life Technologies) to 20 U/mL concentration and the addition of > 2 volumes lysis buffer from mirVana miRNA isolation kit (Life Technologies).
- Turbo DNase (Life Technologies) was added to a concentration of 26 U/mL, with Turbo DNase buffer added to IX concentration where indicated, and samples incubated at 37°C for 30 minutes.
- DNase was inactivated by the addition of EDTA to 15 mM followed by incubation at 75°C for 10 minutes.
- Example 5 analysis of RNA contents of exosomes as a function of exosome purification method
- Figure 1 shows graph of RNA fluorescence unit (FU) plotted against RNA size (nt), wherein “final spin” refers to the final centrifugation step.
- Example 6 analysis of RNA contents of exosomes as a function of exosome purification method
- Figures 2A-D show electron microscopy (EM) photographs of exosome preparations, wherein “no treatment” refers to a protocol according to example 1; “after spins” refers to a protocol according to example 2; “between spins” denotes a protocol according to example 1, except that additional proteinase treatment occurred between the two ultracentrifugation steps.
- EM electron microscopy
- Wipe beaker with Kim wipe, throw this, gloves, syringe and filter into radioactive waste Sample prep
- Example 7 analysis of RNA contents of exosomes as a function of exosome purification method - qRT-PCR analysis - validation of the purification method
- Figure 3 shows qRT-PCR data of exosome RNA for 4 mRNAs that were previously found in exosome RNA-Seq data.
- the qRT-PCR is performed for various conditions of exosome purification methods. All runs are normalized to RNA from the 'regular' exosome isolation (Example 1). The conditions for exosome purification are as follows :
- the qRT-PCR results show a decrease in mRNA levels.
- PBS Label the four unlabeled tubes NT1, NT2, PR1 and PR2.
- Example 8 correlation of exosomal RNA content with cellular RNA content
- Figures 4A-C show RNA-Seq data, showing that the RNA profile of mRNAs in exosomes reflects that of the donor cells. This indicates that the exosomes provide an accurate snapshot of the transcriptome of the cells they come from. Exosome preparation was according to the standard exosome isolation procedure (as in Example 1, without proteinase/RNase).
- Example 9 exosome-mediated RNA transfer experiment between HEK293 and K562 cells
- Figures 5A-K show fluorescence imaging of cells using EUclick chemistry.
- This example shows results from a system that allows detection of potential endogenous RNA transfer between cells in a co-culture system by feeding donor cells with a modified nucleotide (5-ethynyl uridine, EU) that gets incorporated into its RNA and then co- culturing donor cells with unlabeled acceptor cells.
- a modified nucleotide (5-ethynyl uridine, EU) that gets incorporated into its RNA and then co- culturing donor cells with unlabeled acceptor cells.
- K562 cells were incubated with 5-ethynyl uridine (Lifetech) diluted to 2 mM for 24 hours.
- K562 and HEK 293 cells were co-cultured for 24 hours.
- Example 10 exosome-mediated RNA transfer experiment between co-cultured cell lines.
- Figures 6A-D show principle and results of an experiment to assess possible exosome mediated RNA transfer between co-cultured cell lines.
- This example illustrates a way to detect potential RNA transfer using unlabeled RNA.
- the principle is to co-culture mouse and human cells, separate them back out and use regular RNA-Seq to detect mouse transcripts in human cells.
- This technique relies on a principle similar to that of Example 7, but without using labeled nucleotides. Using this method, it was possible to detect some RNAs transferred but the strongest signal came from two mouse endogenous retrovirus RNAs (labeled as Gm3168 and Ctse).
- K562 cells were infected with virus expressing GFP.
- K562 cells were FACS sorted to all be GFP positive.
- K562 GFP cells were co-cultured with Mouse RAW cells for 24 hours or 0 hours (as a control).
- K562 GFP cells were FACS sorted for GFP positive cells to separate from Mouse cells after 24 hour co-culture (2 biological replicates: Mix 1 and Mix 2). The 0 hour co-culture was also sorted, as well as a control of just K562 cells that never interacted with mouse cells.
- RNA was extracted using MirVana kit (Lifetech), - 200 ng cell RNA to 100 ⁇ L ⁇ with H20. Add 2 ⁇ L ⁇ Turbo DNase (Lifetech), 2 ⁇ L ⁇ Superasin (Life technologies), and 10 ⁇ . DNase buffer to each sample.
- RNA-Seq library prep protocol as described in: Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites.
- Schwartz S Mumbach MR, Jovanovic M, Wang T, Maciag K, Bushkin GG, Mertins P, Ter-Ovanesyan D, Habib N, Cacchiarelli D, Sanjana NE, Freinkman E, Pacold ME, Satija R, Mikkelsen TS, Hacohen N, Zhang F, Carr SA, Lander ES, Regev A. Cell Rep. 2014 Jul 10;8(l):284-96. doi: 10.1016/j .celrep.2014.05.048. Epub 2014 Jun 26.
- Figures 7A-D show poly A selected mRNA from two replicates of K562 cells and their exosomes was compared using RNA-Seq. The bottom two panels show that cell and exosome mRNA is correlated in expression for protein-coding genes.
- Applicants have sequenced the mRNA of exosomes from K562 cells and compared the RNA profile of the donor cells to that of the exosomes. Applicants have found that the mRNA profiles of exosomes reflects the trasnscriptome of the donor cells. Thus, using exosomes as a non-invasive read-out of the transcriptome of inaccessible cell types is possible.
- Figure 8 illustrates mRNA in exosome pellet following enzymatic treatments. RNA from untreated exosomes and proteinase/RNase treated exosomes was compared using qRT-PCR for four mRNAs. There was very little or no change, indicating that the RNA is inside. As a control, vesicles with the detergent Triton were lysed and then treated with RNase.
- Figure 9 illustrates Poly A enriched mRNA from untreated exosomes and proteinase/RNAse treated exosomes was compared using RNA-Seq. The mRNA is strongly correlated, indicating that the mRNA isolated via ultracentrifugation in the exosome pellet is inside the vesicles.
- Applicants have confirmed that the mRNA in the exosome isolated product is really inside exosomes after developing a protocol to degrade all RNAs not in vesicles by enzymatic treatment with proteinase and then RNAse. Applicants find a very high correlation between the mRNA profiles in the untreated exosome pellet and the proteinase/RNAse treated pellet, indicating the sequenced mRNA is really inside the vesicles. Applicants have confirmed these results through qRT-PCR as well.
- Figure 10 illustrates targeted pull down exosome subpopulations based on their protein marker using antibody conjugated magnetic beads.
- CD63 is a glycosylated protein between 30 and 60 kDa.
- CD81 shows up as a distinct band between 20 and 30 kDa.
- mCherry is used as a non-specific control. This protocol/technique was developed to isolate specific exosome subpopulations by specific membrane proteins using antibody-conjugated magnetic beads. Further, the technique has been validated in K562 exosomes using the canonical exosome markers CD63 and CD81.
- Figure 11 illustrates exosomes which were isolated from human CSF and mRNA for four genes (detected by qRT-PCR.)
- Cell RNA is used as a comparison.
- Two methods of isolating exosomes from CSF were demonstrated: one by running through 0.22 micron filter pelleting at 120,000g for 2 hours (CSF pellet) and one by extracting RNA directly from CSF after running through 0.22 micron filter without pellet. Similar results were observed by both methods.
- Mass spectrometry of exosomes from iPS cells and iPS-derived neurons is conducted to find neurons specific membrane proteins found on exosomes. These markers are verified by western blots in iPS and neurons exosomes.
- RNA-Seq of exosomes from K562 cells are isolated using CD81 or CD63 antibody- conjugated magnetic beads. The RNA-Seq profiles of exosome subpopulation are compared to the RNA profiles of total exosomes.
- RNA-Seq of mRNA from both cells and exosomes from iPS cells and iPS-derived neurons were assessed for their expression of mRNA.
- the RNA-Seq profiles of these exosome subpopulations are compared to the RNA profiles of total exosomes from each cell type.
- [00217] In vitro proof of principle by mixing experiments where Applicants mix cell culture media from iPS cells and neurons and isolate exosomes from the mixed media. Applicants isolate exosomes from the original cell type using antibody-conjugated magnetic beads using the cell type specific markers. Applicants isolate RNA from these exosome subpopulations and perform RNA-Seq to confirm reconstruction of the transcriptome of the original cell type (iPS cells or neurons).
- Applicants enrich for neuron specific exosomes in CSF using antibody-conjugated magnetic beads or a microfluidic device with immobilized antibodies. Applicants then sequence the RNA from these neuron-derived exosomes and to observe enriched expression of neuron- specific genes relative to total CSF exosomes.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Nanotechnology (AREA)
- Optics & Photonics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the isolation and purification of exosomes from biological samples, and to methods for extracting RNA contained therein. The present invention provides methods and uses for the purification of exosomes, as well as compositions comprising same.
Description
EXOSOMES AND USES THEREOF
RELATED APPLICATIONS AND INCORPORATION BY REFERENCE
[0001] This application claims benefit of and priority to U.S. Provisional Application Nos. 62/151, 142, 62/151, 166 and 62/151,289 all filed April 22, 2015.
[0002] All documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
FEDERAL FUNDING LEGEND
[0003] This invention was made with government support under grant numbers HG006193 and HG005550 awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
[0004] The present invention relates to the isolation and purification of exosomes from biological samples, and to methods for extracting RNA contained therein. The present invention provides methods and uses for the purification of exosomes, as well as compositions comprising same.
[0005] The present invention further relates to the use of exosomes for diagnosis and prognosis purposes. Provided are methods, uses and kits of parts useful in particular for RNA profiling, as well as for diagnostic and prognostic methods in a subject.
[0006] The present invention also relates for the use of exosomes in therapeutics. Provided are methods for treatment or prophylaxis of a disorder of interest.
BACKGROUND OF THE INVENTION
[0007] Exosomes are small extracellular vesicles that have been shown to contain RNA.
[0008] Exosomes can be isolated using ultracentrifugation steps. However, purified exosomes have proven to be difficult to isolate. In particular, the presence of cellular debris
amounts to 'contaminant' in a preparation, jeopardizing genetic and biochemical analysis of exosomes. While exosomes are isolated using ultracentrifugation as described herein, other methods such as filtration, chemical precipitation, size exclusion chromatography, microfluidics are known in the art.
[0009] Further, RNA content of exosomes was previously reported as uncorrelated to corresponding cellular RNA content (Skog J, Wiirdinger T, van Rijn S, Meijer DH, Gainche L, Sena-Esteves M, Curry WT Jr, Carter BS, Krichevsky AM, Breakefield XO. Nat Cell Biol. 2008 Dec; 10(12): 1470-6. doi: 10.1038/ncbl800. Epub 2008 Nov 16.).
[0010] Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention.
SUMMARY OF THE INVENTION
[0011] It would be of interest to provide methods that allow to establish a relationship between exosomal RNA content and corresponding cellular RNA content. This would have broad diagnostic and prognostic applications.
[0012] Further, exosomes could prove useful in the therapeutics field.
[0013] The present invention proves a method for the isolation of exosomes from a biological sample. In some aspects, said method comprises:
(a) providing a biological sample comprising exosomes from a cell population,
(b) preparing an exosome-enriched fraction from the biological sample of step (a),
(c) subjecting the exosome-enriched fraction of step (b) to a treatment with a proteinase.
[0014] The present invention also provides a method for the purification of exosomes from a biological sample. In some aspects, said method comprises:
(a) providing a biological sample comprising exosomes from a cell population,
(b) preparing an exosome-enriched fraction from the biological sample of step (a),
(c) subjecting the exosome-enriched fraction of step (b) to a treatment with a proteinase.
[0015] In some aspects, the proteinase of step (c) may be one or more independently selected from serine proteases, threonine proteases, cysteine proteases, aspartate proteases, glutamic acid proteases and metalloproteases. In some aspects, step (c) may comprise a treatment with a proteinase and subsequent inactivation thereof. According to some embodiments, proteinase
inactivation may be performed with one or more protease inhibitor(s). In some aspects, the proteinase of step (c) may be proteinase K.
[0016] In some aspects, step (b) may comprise one or more centrifugation steps, so as to remove live cells, dead cells and larger cellular debris from the biological sample of step (a). In some aspects, step (b) may comprise one or more filtration steps. In some embodiments, the filtration step may comprise filtration with a submicron filter, for example the submicron filter may be a 0.22 micron filter. In some aspects, wherein step (b) may comprise one or more centrifugation steps, so as to remove live cells, dead cells and larger cellular debris from the biological sample of step (a), followed by a filtration step with a submicron filter. In some aspects, step (b) may comprise one or more ultracentrifugation steps. In some aspects, step (b) may comprise:
(b-1) filtrating with a submicron filter,
(b-2) performing a first ultracentrifugation step, so as to provide a first exosome-enriched fraction,
(b-3) washing the exosome-enriched fraction of step (b-2), and
(b-4) performing a second ultracentrifugation step of the washed exosome-enriched fraction of step (b-3).
[0017] In some aspects, step (c) may be performed after the final ultracentrifugation step of step (b). In some aspects, step (c) may comprise a treatment with proteinase K and subsequent inactivation thereof. In some embodiments, the inhibitor may be diisopropyl fluorophosphate (DFP) or phenyl methane sulphonyl fluoride (PMSF).
[0018] In some aspects, the method may further comprise:
(d) subjecting the proteinase K-treated fraction of step (c) to a treatment with an RNase.
[0019] In some embodiments, the RNase may be one or more independently selected from RNase A, B, C, 1, and Tl . In some embodiments, the RNase may be RNAse A/Tl . In some aspects, step (d) may comprise a treatment with RNase and subsequent inactivation thereof. In some aspects, inactivation of RNase may comprise a treatment with one or more RNase inhibitor(s). In some embodiments, the RNase inhibitor may be selected from protein-based RNase inhibitors.
[0020] In some aspects, the method may provide exosomes which are essentially free of extra-exosomal material. In some aspects, the method may provide exosomes which are
essentially free of extra-exosomal nucleic acid-protein complexes. In some aspects, the method may provide exosomes which are essentially free of extra-exosomal RNA-protein complexes.
[0021] In still further aspects, the method may further comprise after step (c) or (d) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker. In an embodiment, the method comprises a cell population comprising one or more cell types, 2 or more cell types, preferably 3 or more cell types, 4 or more cell types or 5 or more cell types. In an embodiment, the method comprises isolating or purifying cell type-specific exosomes, or cell- subtype-specific exosomes. In an embodiment, the method wherein the one or more cell type comprises cells derived from the endoderm, cells derived from the mesoderm, or cells derived from the ectoderm.
[0022] In another aspect, the method comprises cells, wherein the cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut. In an embodiment, the method comprises cells, wherein the cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells). In another embodiment, the method comprises cells, wherein the cells derived from the ectoderm comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland. In an embodiment, the method comprises cells, wherein the cells from the central nervous system and the peripheral nervous system comprise neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes. In a further embodiment, the method comprises neurons wherein the neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
[0023] In an aspect of the invention, the method provides cell types wherein the one or more cell-type is a cancer cell or a circulating tumor cell (CTC), such as cancer cell or CTC derived from any cell-types or cell subtypes. In an embodiment, the method provides a prey exosome biomarker, wherein the biomarker comprises a surface biomarker. In a further embodiment, the method wherein the prey exosome biomarker comprises a membrane protein. In another embodiment, the method comprises a prey exosome biomarker selected from the group
consisting of proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M. In one embodiment, the prey exosome biomarker is FLRT3 and/or L1CAM.
[0024] In an aspect, the method provides a bait molecule comprising a protein and more preferentially an antibody, such as a monoclonal antibody. In an embodiment, the bait molecule is recognized by an affinity ligand. In an embodiment, the bait molecule can also be an RNA aptamer. In a further embodiment, the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody. In an embodiment, the bait molecule or the affinity ligand is immobilized on a solid substate. In another embodiment, the solid substrate is selced from a purification column, a microfluidic channel or beads, such as magnetic beads. In an embodiment, the method provides a purification, wherein the purification comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification. In another embodiment, the method provides a biological sample, wherein the biological sample comprises a body fluid or is derived from a body fluid, wherein the body fluid was obtained from a mammal. In a further aspect, the body fluid is selected from the group consisting of amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
[0025] The present invention provides a method for the isolation of exosomes from a cell population, comprising steps of: (1) providing isolated exosomes from a biological sample comprising exosomes from said cell population, (2) performing on the isolated exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
[0026] In another aspect, the present invention provides a method for the purification of exosomes from a cell population, comprising steps of: (1) providing purified exosomes from a biological sample comprising exosomes from said cell population; (2) performing on the purified
exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
[0027] In an embodiment, the invention provides a method for either isolation or purification of exosomes from a cell population, wherein the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types or 5 or more cell types. In an embodiment, the method isolates or purifies cell type-specific exosomes, or cell-subtype- specific exosomes. the method comprises a cell population comprising one or more cell types, 2 or more cell types, preferably 3 or more cell types, 4 or more cell types or 5 or more cell types. In an embodiment, the method comprises isolating or purifying cell type-specific exosomes, or cell-subtype-specific exosomes. In an embodiment, the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell type comprises cells derived from the endoderm, cells derived from the mesoderm, or cells derived from the ectoderm. In another aspect, the method comprises cells, wherein the cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut. In an embodiment, the method comprises cells, wherein the cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells). In another embodiment, the method comprises cells, wherein the cells derived from the ectoderm comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland. In an embodiment, the method comprises cells, wherein the cells from the central nervous system and the peripheral nervous system comprise neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes. In a further embodiment, the method comprises neurons wherein the neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
[0028] In an aspect of the invention, the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell-type is a cancer cell or a circulating tumor cell (CTC), such as cancer cell or CTC derived from any cell-types or cell subtypes. In an embodiment, the method provides a prey exosome biomarker, wherein the
biomarker comprises a surface biomarker. In a further embodiment, the method wherein the prey exosome biomarker comprises a membrane protein. In another embodiment, the method comprises a prey biomarker selected from the group consisting of proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M. In one embodiment, the prey exosome biomarker is FLRT3 and/or LI CAM.
[0029] In an aspect, the method provides for isolation or purification of exosomes from a cell population, wherein the bait molecule comprises a protein and more preferentially an antibody, such as a monoclonal antibody. In an embodiment, the bait molecule is recognized by an affinity ligand. In an embodiment, the bait molecule can also be an RNA aptamer. In a further embodiment, the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody. In an embodiment, the bait molecule or the affinity ligand is immobilized on a solid substate. In another embodiment, the solid substrate is selced from a purification column, a microfluidic channel or beads, such as magnetic beads. In an embodiment, the method provides a purification, wherein the purification comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification.
[0030] The present invention also provides a method for the preparation of exosomal RNA from a biological sample, said method comprising:
(i) providing a biological sample comprising exosomes from a cell population,
(ii) preparing purified exosomes from the biological sample of step (i),
(iii) extracting RNA from the purified exosomes of step (i).
[0031] In some aspects, step (ii) may comprise the method for the isolation/purification of exosomes as disclosed herein. In other aspects, the method for the preparation of exosomal RNA from a biological sample comprises a method wherein the purified exosomes prepared at step (ii) are exosomes from a single cell type or from a single cell subtype.
[0032] The present invention provides a method for the preparation of exosomal RNA of a cell population, comprising steps of: (1) providing purified exosomes from a biological sample comprising exosomes from said cell population; (2) performing on the purified exosomes of step
(1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker, and (3) extracting RNA from the purified exosomes of step (2).
[0033] In some aspects, the exosomal RNA may be total exosomal RNA. In some aspects, the exosomal RNA may comprise exosomal messenger RNA. In some aspects, the exosomal RNA may be total exosomal messenger RNA. In some aspects, the exosomal RNA is exosomal RNA from single cell type exosomes or single cell subtype exosomes.
[0034] The present invention also provides for a use of a proteinase in the purification of exosomes from a biological sample. The present invention also provides for a use of a proteinase and of an RNase in the purification of exosomes from a biological sample. The present invention also provides for a use of a proteinase in the purification of an ultracentrifugated exosome- containing sample. The present invention also provides for a use of a proteinase and of an RNase in the purification of an ultracentrifugated exosome-containing sample.
[0035] In the uses of the invention, in some aspects, the proteinase may be proteinase K. In the uses of the invention, in some aspects, the ultracentrifugated exosome-containing sample may be a washed ultracentrifugated exosome-containing sample.
[0036] In the uses of the invention, in some aspects, the ultracentrifugated exosome- containing sample may be a washed ultracentrifugated exosome-containing sample.
[0037] In the methods and uses of the invention as disclosed herein, in some aspects, the biological sample may be a bodily fluid or is derived from a bodily fluid, wherein the bodily fluid was obtained from a mammal. In some embodiments, the bodily fluid may be selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
[0038] In the methods and uses of the invention as disclosed herein, in some aspects, the cell population may be a population of cells of the same cell type. In the methods and uses of the invention as disclosed herein, in some aspects, the cell population is a population of cells of different cell types. In another embodiment, the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types, or 5 or more cell types.
[0039] In the methods and uses of the invention as disclosed herein, in some aspects, the biological sample comprises cultured cells. In some embodiments, the biological sample may comprise cells cultured in vitro. In some embodiments, the biological sample may comprise cells cultured ex vivo. In some embodiments, the biological sample may be a sample obtained by liquid biopsy. In some embodiments, the biological sample may comprise a cell type selected from cells types present in amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit.
[0040] The present invention also provides exosome preparations and compositions comprising exosomes. The present invention provides an exosome preparation obtainable with the method or the use as disclosed herein. The present invention also provides a composition comprising exosomes, wherein the composition is essentially free of extra-exosomal material. The present invention also provides a composition comprising exosomes, wherein the composition is essentially free of extra-exosomal nucleic acid-protein complexes. The present invention also provides a composition comprising exosomes, wherein the composition is essentially free of extra-exosomal RNA-protein complexes. In another aspect, the invention provides a composition comprising cell type specific exosomes or cell subtype specific exosomes. In an embodiment, the composition comprises exosomes, wherein the exosomes are specific for one or more cell types or cell subtypes. In another embodiment, the composition comprises purified exosomes, wherein said purified exosomes are exosomes from a single cell- type or of a single cell subtype.
[0041] The present invention provides a method for the determination of cellular RNA content in a cell population. In some aspects, said method comprises:
(a) providing a biological sample comprising exosomes from said cell population,
(b) preparing purified exosomes from the sample of step (a),
(c) extracting RNA from the purified exosomes of step (b), so as to provide exosomal RNA,
(d) analyzing the exosomal RNA extracted at step (c),
(e) estimating, as a function of the result from step (d), the cellular RNA content in the cell population.
[0042] In some aspects, step (b) may comprise the method for the purification of exosomes as disclosed herein.
[0043] In some aspects, the invention provides a method for the determination of cellular RNA content of a cell population, said method comprising (a) providing a biological sample comprising exosomes from said cell population; (b) preparing purified exosomes from the sample of step (a); (c) extracting RNA from the purified exosomes of step (b), so as to provide exosomal RNA; (d) analyzing the exosomal RNA extracted at step (c); (e) estimating, as a function of the result from step (d), the cellular RNA content in the cell population; wherein step (b) further comprises performing on the purified exosomes one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
[0044] In an embodiment, the method comprises the method of step (b) wherein the method comprises the isolation or the purification of exosomes from a biological sample. In an embodiment, the invention provides a method for either isolation or purification of exosomes from a cell population, wherein the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types or 5 or more cell types. In an embodiment, the method isolates or purifies cell type-specific exosomes, or cell-subtype-specific exosomes. the method comprises a cell population comprising one or more cell types, 2 or more cell types, preferably 3 or more cell types, 4 or more cell types or 5 or more cell types. In an embodiment, the method comprises isolating or purifying cell type-specific exosomes, or cell-subtype-specific exosomes. In an embodiment, the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell type comprises cells derived from the endoderm, cells derived from the mesoderm, or cells derived from the ectoderm. In another aspect, the method comprises cells, wherein the cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut. In an embodiment, the method comprises cells, wherein the cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells). In another embodiment, the method comprises cells, wherein the cells derived from the ectoderm comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the
pineal gland. In an embodiment, the method comprises cells, wherein the cells from the central nervous system and the peripheral nervous system comprise neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes. In a further embodiment, the method comprises neurons wherein the neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
[0045] In an aspect of the invention, the method provides for isolation or purification of exosomes from a cell population, wherein the one or more cell-type is a cancer cell or a circulating tumor cell (CTC), such as cancer cell or CTC derived from any cell-types or cell subtypes. In an embodiment, the method provides a prey exosome biomarker, wherein the biomarker comprises a surface biomarker. In a further embodiment, the method wherein the prey exosome biomarker comprises a membrane protein. In another embodiment, the method comprises a prey exosome biomarker selected from the group consisting of proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M. In one embodiment, the prey exosome biomarker is FLRT3 and/or LI CAM.
[0046] In an aspect, the method provides for isolation or purification of exosomes from a cell population, wherein the bait molecule comprises a protein and more preferentially an antibody, such as a monoclonal antibody. In an embodiment, the bait molecule is recognized by an affinity ligand. In an embodiment, the bait molecule can also be an RNA aptamer. In a further embodiment, the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody. In an embodiment, the bait molecule or the affinity ligand is immobilized on a solid substate. In another embodiment, the solid substrate is selced from a purification column, a microfluidic channel or beads, such as magnetic beads. In an embodiment, the method provides a purification, wherein the purification comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification.
[0047] In some aspects, step (e) may be performed based on a predicted correlation between exosomal RNA content and cellular RNA content.
[0048] In some aspects, said determination may comprise a qualitative determination. In some aspects, said determination may comprise a quantitative determination. In some embodiments, said quantitative determination may comprise determination of relative abundance of two RNAs. In some aspects, said determination may comprise determination of mRNA profiles.
[0049] In some aspects, said RNA may comprise messenger RNA (mRNA). In some aspects, said RNA may comprise micro RNA (miRNA). In some aspects, said RNA may comprise long non-coding RNA (IncRNA).
[0050] In some aspects, step (D) may comprise a qualitative determination. In some aspects, step (D) may comprise a quantitative determination. In some aspects, step (D) may comprise RNA sequencing (RNA seq). In some aspects, step (D) may comprise array analysis. In some aspects, step (D) may comprise reverse transcription polymerase chain reaction (RT-PCR). In some aspects, step (D) may comprise quantitative reverse transcription polymerase chain reaction (qRT-PCR). In some aspects, step (D) may comprise analyzing one or more sequence/s of interest.
[0051] In some aspects, the method of the invention comprises testing for the presence or absence of said sequence/s of interest. In some embodiments, step (D) may comprise analyzing for one or more allelic variants of a sequence of interest.
[0052] In some aspects, step (D) may comprise testing for presence or absence of said allelic variants. In some aspects, step (D) may comprise genome-wide analysis. In some aspects, step (D) may comprise transcriptome profiling.
[0053] In some aspects, the determination may be time-lapse.
[0054] In some aspects, the cell population may be a population of cells of the same cell type. In some aspects, the cell population may be a population of cells of different cell types.
[0055] In some aspects, the biological sample may comprise cultured cells. In some aspects, the biological sample may comprise cells cultured in vitro. In some aspects, the biological sample may comprise cells cultured ex vivo. In some aspects, the biological sample may be a sample obtained by liquid biopsy. In some aspects, the biological sample may comprise a cell type selected from blood, epithelia, muscle and neural cell types.
[0056] In some aspects, the biological samples is obtained from a body fluid, selected from amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal
fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
[0057] In some aspects, the cell population of step (a) may be isolated as a subpart of a larger initial cell population. In some aspects, the cell population of step (a) may be obtained from a body fluid and isolated by immuno-magnetic separation.
[0058] In some aspects, the method of the invention may be for use in diagnosis. In some aspects, the method of the invention may be for use in prognosis. In some aspects, the method of the invention may be for use in identifying markers. In some aspects, the method of the invention may be for use in a screening process. In another aspect, the method determines the cellular RNA content of a single cell type or of a single cell subtype.
[0059] The present invention also provides a method for the diagnostic or prognostic of a disorder of interest in a subject. In some aspects, the method may comprise :
(I) selecting a marker, wherein said marker is associated with said disorder and wherein said marker may be determined in a cell type that is found in the subject to be in contact with a body fluid,
(II) providing a biological sample from said body fluid from said subject,
(III) estimating the cellular RNA content of said marker in the biological sample of step (II) by performing the method for the determination of cellular RNA content in a cell population as disclosed herein.
[0060] In an embodiment, the invention provides a method for the diagnostic or prognostic of a disorder of interest in a subject, wherein the cellular RNA content is the cellular content of a single cell type or of a single cell subtype.
[0061] In some aspects, the method further comprises:
(IV) determining, from the results of step (III), the status of the marker selected at step (I).
[0062] In some aspects, the marker may be selected from expression of a given open reading frame (ORF), overexpression of a given open reading frame (ORF), repression of a given open reading frame (ORF), over-repression of a given open reading frame (ORF), expression of a given allelic variant, relative level of expression of a given open reading frame (ORF), presence of a mutation in a given open reading frame (ORF).
[0063] In some aspects, said disorder may be a blood disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with blood.
[0064] In some aspects, said disorder may be a brain or spine disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with cerebrospinal fluid.
[0065] In some aspects, said disorder may be a heart disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with blood or pericardial fluid.
[0066] In some aspects, said disorder may be said disorder is a prostate or bladder disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with urine.
[0067] In some aspects, said disorder may be an eye disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with tears.
[0068] In some aspects, said disorder may be a lung disorder and said marker may be a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with pleural fluid.
[0069] The present invention also provides compositions comprising exosomes. In some aspects, the composition may be essentially free of extra-exosomal material, for use in diagnostics. In some aspects, the composition may be essentially free of extra-exosomal nucleic acid-protein complexes. In some aspects, the composition may be essentially free of extra- exosomal RNA-protein complexes.
[0070] The present invention provides a method for the treatment or prophylaxis of a disorder in a patient. In some aspects, said method may comprise exosome-mediated delivery of a therapeutic RNA to a cell.
[0071] In some aspects, said exosome-mediated delivery may occur from one donor cell to a recipient cell, and wherein the therapeutic RNA may result from transcription in the donor cell.
[0072] In some aspects, transcription in the donor cell may be inducible.
[0073] In some aspects, the delivery may be performed ex vivo. In some aspects, the delivery may be performed in vivo.
[0074] The present invention also an exosome for use in therapy. In some aspects, the present invention provides an exosome for use in delivering a therapeutic RNA to a cell. In some aspects, the exosome may be produced in vitro. In some aspects, the exosome may be produced in vivo.
[0075] The present invention also provides a therapeutic RNA for use in exosome-mediated delivery to a cell. In some aspects, the exosome may be produced in vitro. In some aspects, the exosome may be produced in vivo.
[0076] The present invention also provides a pharmaceutical composition comprising an exosome. In some aspects, said exosome may comprise a therapeutic RNA for delivery into a cell. In some aspects, the delivery may be performed ex vivo. In some aspects, the delivery may be performed in vivo. In some aspects, the cell may be capable of producing exosomes comprising a therapeutic RNA. In some aspects, the pharmaceutical composition is in a form suitable for injection.
[0077] The present invention also provides a use of a therapeutic RNA in the manufacture of a medicament for the treatment or prophylaxis of a disorder in a patient. In some aspects, the RNA may be delivered to a cell in an exosome-packaged form. In some aspects, the exosome may comprise a therapeutic RNA or delivery into a cell.
[0078] In the method, composition or use as disclosed herein, the therapeutic RNA may be translated in the recipient cell.
[0079] In the method, composition or use as disclosed herein, the therapeutic RNA may be a small interfering RNA (siRNA).
[0080] In the method, composition or use as disclosed herein, the therapeutic RNA may be a short hairpin RNA (shRNA).
[0081] Accordingly, it is an object of the invention not to encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described
product, process of making the product, or method of using the product. It may be advantageous in the practice of the invention to be in compliance with Art. 53(c) EPC and Rule 28(b) and (c) EPC. Nothing herein is to be construed as a promise.
[0082] It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as "comprises", "comprised", "comprising" and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean "includes", "included", "including", and the like; and that terms such as "consisting essentially of and "consists essentially of have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
[0083] These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0084] The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings.
[0085] Figure 1 shows graph of RNA fluorescence unit (FU) plotted against RNA size (nt) for various exosome purification methods.
[0086] Figures 2A-2D show electron microscopy (EM) photographs of exosome preparations for various exosome purification methods;(2A) Electron microscopy of exosomes with no treatment; (2B) Electron microscopy of exosomes with proteinase treated after spins; (2C) Side-by-side comparison of EM of untreated versus proteinase-treated; (2D) Electron microscopy of exosomes with proteinase treated between spins.
[0087] Figure 3 shows results of a qRT-PCR experiment for various exosome purification methods.
[0088] Figure 4A-4C show RNA-Seq data, showing that the RNA profile of mRNAs in exosomes reflects that of the donor cells; (4A) illustrates mRNA profile in exosomes: PTMS; (4B) illustrates mRNA profile in exosomes: MT2A; (4C) illustrates mRNA profile in exosomes: Rabl3.
[0089] Figures 5A-5K show principle and results for fluorescence imaging of cells using EU click chemistry, to assess possible exosome-mediated RNA transfer between cells; (5A) shows intercellular communication (5B) shows click-chemistry with 5-ethynyl uridine (5C) shows control HEK 293 cells grown in presence of 5-ethynyl uridine; (5D) shows negative control of HEK 293 cells with no 5-ethynyl uridine; (5E) illustrates RNA transfer experiment; (5F) shows negative control of HEK 293/ K562 cells with no 5-ethynyl uridine (5G) shows negative control of HEK 293/ K562 cells with no 5-ethynyl uridine with 640x magnification zoomed in; (5H) shows experimental #1 of HEK 293/ K562 cells with 5-ethynyl uridine (51) shows experimental #1 of HEK 293/ K562 cells with 5-ethynyl uridine (6J) shows experimental #1 of HEK 293/ K562 cells with 5-ethynyl uridine (zoomed in); (5K) shows experimental #2 of HEK 293/ K562 cells with 5-ethynyl uridine.
[0090] Figures 6A-6D show principle and results of an experiment to assess possible exosome mediated RNA transfer between co-cultured cell lines; (6A) illustrates an alternative experiment of mouse-human co-culture; (6B) shows the experimental design; (6C) percentage of mouse genes with TMM > 2; (6D) shows mouse gene expression in human cells.
[0091] Figures 7A-7D illustrates Poly A selected from mRNA from two replicates of K562 cells and their exosomes was compared using RNA-Seq; (7 A) compares cell 1 versus cell 2; (7B) compares exosome 1 versus exosome 2; (7C) compares cell 1 versus exosome 1 (7D) compares cell 2 versus exosome 2.
[0092] Figure 8 illustrates that mRNA is inside the exosomes.
[0093] Figure 9 illustrates Poly A enriched mRNA from untreated exosomes and proteinase/Rnase treated exosomes was compared using RNA-Seq.
[0094] Figure 10 illustrates targeted pull down exosome subpopulations based on their protein marker using antibody conjugated magnetic beads.
[0095] Figure 11 illustrates exosomes which were isolated from human CSF and mRNA for four genes (detected by qRT-PCR.) Cell RNA is used as a comparison.
DETAILED DESCRIPTION OF THE INVENTION
[0096] The terms "exosomes", "micro-vesicles" and "extracellular vesicles" are herein used interchangeably. They refer to extracellular vesicles, which are generally of between 30 and 200
nm, for example in the range of 50-100 nm in size. In some aspects, the extracellular vesicles can be in the range of 20-300 nm in size, for example 30-250 nm in size, for example 50-200 nm in size. In some aspects, the extracellular vesicles are defined by a lipidic bilayer membrane.
[0097] As used herein, a "biological sample" may contain whole cells and/or live cells and/or cell debris. The biological sample may contain (or be derived from) a "bodily fluid". The present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.
[0098] The terms "subject," "individual," and "patient" are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
[0099] The terms "therapeutic agent", "therapeutic capable agent" or "treatment agent" are used interchangeably and refer to a molecule or compound that confers some beneficial effect upon administration to a subject. The beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.
[00100] As used herein, "treatment" or "treating," or "palliating" or "ameliorating" are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to
a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
[00101] The term "effective amount" or "therapeutically effective amount" refers to the amount of an agent that is sufficient to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein. The specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
[00102] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANFMAL CELL CULTURE (R.I. Freshney, ed. (1987)).
[00103] In aspects of the invention functional genomics screens allow for discovery of novel human and mammalian therapeutic applications, including the discovery of novel drugs, for, e.g., treatment of genetic diseases, cancer, fungal, protozoal, bacterial, and viral infection, ischemia, vascular disease, arthritis, immunological disorders, etc. As used herein assay systems may be used for a readout of cell state or changes in phenotype include, e.g., transformation assays, e.g., changes in proliferation, anchorage dependence, growth factor dependence, foci formation, growth in soft agar, tumor proliferation in nude mice, and tumor vascularization in nude mice; apoptosis assays, e.g., DNA laddering and cell death, expression of genes involved in apoptosis; signal transduction assays, e.g., changes in intracellular calcium, cAMP, cGMP, IP3, changes in hormone and neurotransmittor release; receptor assays, e.g., estrogen receptor and cell growth;
growth factor assays, e.g., EPO, hypoxia and erythrocyte colony forming units assays; enzyme product assays, e.g., FAD-2 induced oil desaturation; transcription assays, e.g., reporter gene assays; and protein production assays, e.g., VEGF ELISAs.
[00104] In the purification methods of the invention, it was found advantageous to perform a proteinase treatment, especially after the final ultracentrifugation step carried out for exosome preparation. Without being bound by theory, it is hypothesized that such treatment allows the removal of non exosomal nucleic acid-protein complexes, such as RNA-protein complexes. The proteinase treatment (and inactivation thereof), may then be followed by an RNAse treatment.
[00105] The exosome purification methods of the invention allows one to prepare compositions comprising exosomes, wherein the composition is essentially free of extra- exosomal material, and/or essentially free of extra-exosomal nucleic acid-protein complexes, and/or essentially free of extra-exosomal RNA-protein complexes. Such compositions may be used for exosomal RNA preparation.
[00106] The purification method of the invention may include the following: removal of live cells, dead cells and larger cell debris, which may be performed by centrifugation steps and collection of the corresponding supernatants; filtration using a submicron filter such as a 0.22 micron filter; collection of exosomes by ultracentrifugation (typically at lOOg-l 30,000^, for example 120,000^-); washing exosomes before an additional ultracentrifugation step; proteinase treatment and inactivation; RNase treatment and inactivation.
[00107] According to one aspect of the invention, a strong correlation can advantageously be established between the RNA profile, and notably the mRNA profile, of isolated or purified exosomes and the RNA profile of the corresponding donor cells. In particular, a correlation has been shown between the mRNA profile of exosomes from K562 cells which have been isolated or purified as per the purification method or the invention, notably after treatment with protease and then RNAse, and the RNA profile of donor K562 cells. Such a correlation has been shown for the first time and is advantageous for diagnostic applications, as the transcriptome profile from exosomes of a cell population very faithfully reflects the corresponding cellular transcriptome.
[00108] Furthermore, a correlation can also be established between the RNA content (notably the mRNA content) of purified or isolated exosomes treated with protease and RNase and the RNA content of protease/RNAse untreated exosomes. These results illustrate that the analyzed
RNA content of exosomes isolated or purified as per the purification method of the invention is actually inside said exosomes and not simply externally associated with exosomes. Analyses of the RNA exosomal content can be performed using any transcriptomics method (see notably Wang et.al, Nature Review Genetics (10) 57-63), such as RNA seq (for which a princeps protocol is notably described in Macosko E Z et al., 2015, Cell 161, 1202-1214) , RT-PCT (notably qRP-PCR), small RNA sequencing (Li et.al, NAR 41(6) 3619-3634) or microarray. RNA analysis can also be performed as described in "Chip-based analysis of exosomal mRNA mediating drug resistance in glioblastoma" . Shao H, Chung J, Lee K, Balaj L, Min C, Carter BS, Hochberg FH, Breakefield XO, Lee H, Weissleder R. Nat Commun. 2015 May 11;6:6999. doi: 10.1038/ncomms7999. PMID: 25959588; "Microfluidic isolation and transcriptome analysis of serum microvesicles" . Chen C, Skog J, Hsu CH, Lessard RT, Balaj L, Wurdinger T, Carter BS, Breakefield XO, Toner M, Irimia D. Lab Chip. 2010 Feb 21; 10(4):505-11. doi: 10.1039 916199f. Epub 2009 Dec 8. PMID: 20126692.
[00109] In some aspects, the purification method of the invention may further comprise a step of separating one or more sub-populations of exosomes from a purified pool of exosomes. Indeed in some aspects of the invention, a sub-population of exosomes from a mixed exosome population, found for example in a biological sample obtained from a body fluid, can be further purified or isolated, for example according to one or more specific donor cell types or donor cell subtypes. In some aspects, the purification method of the invention allows to isolate or purify subpopulations of exosomes from one or more cell types or cell subtypes, preferentially from a single cell type, or from a single cell subtype.
[00110] In some aspects, a cell population can comprise one or more cell types, notably 2 or more cell types, 3 or more cell types, 4 or more cell types, or 5 or more cell types. In some aspects, a cell population comprises at least 1 to 40 cell types, notably at least 1 to 30, at least 5 to 20, at least 5 to 10, at least 2 to 8 or at least 2 to 5 cell types. Therefore, cell type or cell subtype exosomes can be purified from a mixed exosome population obtained from a cell population.
[00111] In some aspects, cell types according to the invention comprises cell types derived from the endoderm, cell types derived from the mesoderm, or cell types derived from the ectoderm. Cell types derived from the endoderm can comprise cell types of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid
or the hindgut. Cell types derived from the mesoderm can comprise osteochondroprogenitor cells, muscle cells, cell types from the digestive system, renal stem cells, cell types from the reproductive system, bloods cell types or cell types from the circulatory system (such as endothelial cells). Cell types derived from the ectoderm can comprise epithelial cells, cell types of the anterior pituitary, cell types of the peripheral nervous system, cell types of the neuroendocrine system, cell types of the teeth, cell types of the eyes, cell types of the central nervous system, cell types of the ependymal or cell types of the pineal gland. For example, a cell population from the central and peripheral nervous system can comprise cell types such as neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes. In some aspects of the invention, the one or more cell types comprise cancer cells or circulating tumor cells. Preferentially, said cancer cells or CTCs derive from the cell types as listed above. A cell type can also encompass one or more cell subtypes, notably 2 or more, 3 or more, 4 or more, 5 or more and up to 10 or more cell subtypes. For example neurons encompass various cell subtypes such as for example interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons. Different cell types or cell subtypes can also be discriminated according to their respective transcriptome profile.
[00112] In some aspects, purification or isolation or exosomes according to a specific cell type or a cell subtype is achieved through one or more purification steps. In some aspects the one or more purification steps are based on the affinity of a bait molecule for a prey exosome biomarker.
[00113] In some aspects, bait molecules may be an antibody that binds exosome transmembrane protein. In some aspects, a bait molecule may be an RNA aptamer.
[00114] Prey exosome biomarkers according to the invention can be specific for one or more cell types or cell subtypes. Preferentially, prey exosomes biomarkers are membrane proteins. In this context, analysis of exosomal RNA content is highly relevant for diagnostic applications, as compared to the analysis of circulating DNA or RNA because it allows identification of the donor cell type or cell subtype though specific trans-membrane protein affinity purification, such as protein pull-up.
[00115] Exosome biomarkers can be typically identified through mass spectrometry analyses of exosomes obtained from specific cell types or cell subtypes, and if required confirmed through
western blotting or qRT-PCR analysis in said exosomes. For example exosomes from induced pluripotent stem cells (IPS cells) or IPS-derived- neurons can be used, but exosomes from any cell types or cell subtypes as defined above can be subjected to mass spectrometry analysis for identification of specific trans-membrane protein biomarkers. For example, mass spectrometry analysis can also be performed on total exosomes from a body fluid, such as CSF. Analysis of the transcriptome of CSF exosomes is of high interest because such exosome population is specific of the brain cell population.
[00116] Data obtained from such mass spectrometry analysis can be combined with genome or transcriptome analysis of corresponding donor cells in order to identify relevant biomarkers. This facilitates the identification of relevant exosome biomarkers useful for the present invention. For example, regarding CNS genetic information, lists of genes are available from e.g. "Establishing the Proteome of Normal Human Cerebrospinal Fluid" Schutzer S E et al., PLoS One, 2010; 5(6): el0980. "An RNA-Sequencing Transcriptome and Splicing Database of Glia, Neurons, and Vascular Cells of the Cerebral Cortex" Zhang Y et al., The Journal of Neuroscience, 2014, 34(36): 11929 -11947. "Purification and Characterization of Progenitor and Mature Human Astrocytes Reveals Transcriptional and Functional Differences with Mouse " Zhang et al., 2016, Neuron 89, 37-53.
[00117] In some aspects of the invention, prey exosome biomarkers from neurons comprise one or more selected from proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M. In one embodiment, the prey exosome biomarker is FLRT3 and/or L1CAM. The presence of the at least one of these trans-membrane protein biomarkers in neuron exosomes can be confirmed through western blotting or RT-PCT analysis or neuron exosomes.
[00118] "Dysfunctionally phosphorylated type 1 insulin receptor substrate in neural-derived blood exosomes of preclinical Alzheimer's disease" . Kapogiannis D, Boxer A, Schwartz JB, Abner EL, Biragyn A, Masharani U, Frassetto L, Petersen RC, Miller BL, Goetzl EJ. FASEB J. 2015 Feb;29(2):589-96. doi: 10.1096/fj .14-262048. Epub 2014 Oct 23. PMID: 25342129 and "Plasma exosomal a-synuclein is likely CNS-derived and increased in Parkinson's disease". Shi M, Liu C, Cook TJ, Bullock KM, Zhao Y, Ginghina C, Li Y, Aro P, Dator R, He C, Hipp MJ, Zabetian CP, Peskind ER, Hu SC, Quinn JF, Galasko DR, Banks WA, Zhang J. Acta
Neuropathol. 2014 Nov; 128(5):639-50. doi: 10.1007/s00401-014-1314-y. Epub 2014 Jul 6. PMID: 24997849 describe analysis of exosomes obtained from plasma, but as such do not provide informative or conclusive evidence establishing a relationship with a specific organ of origin (such as brain) or specific tissue of origin or a fortiori specific cell types of origin such as neurons. This is because of the circulating nature of plasma that comes into contact with a number of various organs, tissues, etc., and thus may comprise exosomes stemming from a plurality of different cell types altogether. Further, it is unclear whether some exosomes are capable of corrsing the blood brain barrier. As a consequence, the data reported in these papers do not allow to identify the exact origin of the exosomes, and in particular cannot relate to exosomes from a specific cell type (such as neurons). Further, these papers do not disclose any RNA profiling, in particular, no RNA-seq analysis..
[00119] By contrast, the present invention provides methods for accessing information on tissue- or cell-type- specific exosomes, in particular tissue- or cell-type- specific transcription profiles. The present invention also provides very-high resolution diagnostic methods, wherein a subtle change in transcription profiles (e.g. a small up- or down-regulation in the transcription of a given gene in a given cell type or a given cell sub -type) can advantageously be efficiently detected, while it could not be in a total RNA or total exosome analysis.
[00120] In some aspects the one or more purification steps can comprise a microfluidic affinity based purification (see for example "Chip-based analysis of exosomal mRNA mediating drug resistance in glioblastoma" . Shao H, Chung J, Lee K, Balaj L, Min C, Carter BS, Hochberg FH, Breakefield XO, Lee H, Weissleder R. Nat Commun. 2015 May 11;6:6999. doi: 10.1038/ncomms7999. PMID: 25959588; "Microfluidic isolation and transcriptome analysis of serum microvesicles" . Chen C, Skog J, Hsu CH, Lessard RT, Balaj L, Wurdinger T, Carter BS, Breakefield XO, Toner M, Irimia D. Lab Chip. 2010 Feb 21; 10(4):505-11. doi: 10.1039 916199f. Epub 2009 Dec 8. PMID: 20126692. ), a magnetic based purification, a pulldown purification or a fluorescence activated vesicle sorting-based purification (FAVS, see for example Van der Pol E et al., J Thromb Haemost, 2013 Jun; l l Suppl 1 :36-45 "Innovation in detection of microparticles and exosomes"'' and Van des Pol E. et al., J Thromb Haemost. 2012 May; 10(5): 919-30), "Single vs. swarm detection of microparticles and exosomes by flow cytometry"; "Glypican-1 identifies cancer exosomes and detects early pancreatic cancer". Melo SA, Luecke LB, Kahlert C, Fernandez AF, Gammon ST, Kaye J, LeBleu VS, Mittendorf EA,
Weitz J, Rahbari N, Reissfelder C, Pilarsky C, Fraga MF, Piwnica-Worms D, Kalluri R. Nature. 2015 Jul 9;523(7559): 177-82. doi: 10.1038/naturel4581. Epub 2015 Jun 24. PMID: 26106858).. Commercial precipitation kits like ExoQuick™ and Total Exosome Isolation™ precipitation solutions are also available. Such kits are easy to use with only 1 or 2 steps and do not require any expensive equipment or advanced technical know-how..
[00121] In some aspects, the bait molecule can be a bait protein, such as an antibody and in some aspects is preferentially a monoclonal antibody directed against a prey exosome biomarker. In some aspects, the bait molecule can also be an RNA aptamer. If several prey exosomes are to be combined for purification, a mix of corresponding monoclonal antibodies directed against each of the said prey exosomes biomarkers to be pull-up can be used.
[00122] In some aspects, the bait molecule is recognized by an affinity ligand. Said affinity ligand can be a divalent metal-based complex, a protein, a peptide such as fusion protein tag or more preferentially an antibody.
[00123] In some aspects, the bait molecule or the affinity ligand is immobilized or "coupled" directly, or indirectly to a solid substrate material such as by formation of covalent chemical bonds between particular functional groups on the ligand (for example primary amines, thiols, carboxylic acids, aldehydes) and reactive groups on the substrate. A substrate, or a matrix, in the affinity purification steps of the method of the invention can be any material to which a biospecific ligand (i.e., the bait molecule or the affinity ligand) is coupled. Useful affinity supports may be those with a high surface-area to volume ratio, chemical groups that are easily modified for covalent attachment of ligands, minimal nonspecific binding properties, good flow characteristics and/or mechanical and chemical stability. Several substrates may be utilized as solid substrate, including for example agarose, cellulose, dextran, polyacrylamide, latex or controlled pore glass. Magnetic particles may also be used as a substrate instead of beaded agarose or other porous resins. Their small size provides the sufficient surface area-to-volume ratio needed for effective ligand immobilization and affinity purification. Magnetic beads may be produced as superparamagnetic iron oxide particles that may be covalently coated with silane derivatives. The coating makes the beads inert (i.e., to minimize nonspecific binding) and provides the particular chemical groups needed for attaching any affinity ligands of interest. Affinity purification with magnetic particles is generally not performed in-column. Instead, a few microliters of beads may be mixed with several hundred microliters of sample as a loose slurry.
During mixing, the beads remain suspended in the sample solution, allowing affinity interactions to occur with the immobilized ligand. After sufficient time for binding has been given, the beads are collected and separated from the sample using a powerful magnet. An exemplary bead purification method can be found in "Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes'" . Kowal J, Arras G, Colombo M, Jouve M, Morath JP, Primdal-Bengtson B, Dingli F, Loew D, Tkach M, Thery C. Proc Natl Acad Sci U S A. 2016 Feb 23; 113(8):E968-77. doi: 10.1073/pnas. l521230113. Epub 2016 Feb 8. PMID: 26858453.
[00124] In some aspects of the invention, a pull down assay can be performed for the purification or isolation of a subpopulation of exosomes by pulling-down of one or more specific prey exosome biomarkers (preferentially a membrane protein as described below). Said prey exosome biomarkers may be specific of a at least one cell type or cell subtype and advantageously lead to enriching in exosomes from said selected cell type or cell subtype.
[00125] In some aspects the at least one or more purification steps for the purification of an exosome subpopulation comprise a pull down purification. In such pull-down purification, the prey exosome biomarker is generally a (trans)membrane protein, which has been found to be expressed in a cell type or a cell subtype. The bait protein is preferentially a monocolonal antibody directed against any of the prey exosome biomarker(s) which is to be pulled-up. Magnetic beads (for example Dynabeads® from Thermo Fisher Scientific) coated with an affinity ligand for the bait protein can be used to isolate said bait protein bound to said prey exosome biomarker(s). The affinity ligand is preferentially a class specific or a species specific antibody. As a matter of example, magnetic beads coated with anti-mouse antibodies can be used together with monoclonal mouse antibodies directed against a specific surface protein of a cell type or cell subtype subpopulation of exosomes (such as for example CD63 or CD81). Generally, a control antibody, such as a mouse mcherry monoclonal antibody, can be used.
[00126] A pull down assay can therefore be used to illustrate and validate the purification, or isolation of at least two exosome subpopulations expressing each at least one specific membrane protein, such as the canonical exosomes markers CD63 and CD81, which have previously been pooled. As shown in the results examples, said at least two exosomes subpopulations can be re- separated based on the selected protein biomarker. The purification or isolation of exosome
subpopulations by at least one specific prey exosome biomarker (preferentially a membrane protein) can be further confirmed using wertern blot or qRT-PCT.
[00127] Several control experiments can also be envisioned to compare the transcriptome of subpopulation of exosomes, purified or isolated by pull-up of at least one specific exosome biomarker, according to the method of the invention.
It is advantageously possible to compare the transcriptome profile of at least two subpopulations of exosomes, purified from a mixed exosome population (e.g.: obtained from a cell population comprising one or more cell types, such as the K562 cells) using specific exosome biomarkers (such as CD63 or CD81) as described above (e.g. : using magnetic beads pull-down purification). The transcriptome profile of said exosomes subpopulations can also be further compared to the transcriptome profile of the total exosome population. Typically RNA seq analysis of exosomes is particulary well suited for such transcriptome comparisons.
It is advantageously possible to compare the RNA seq analysis of total RNA, mRNA, micro RNA (miRNA), or long non coding RNA (IncRNA) of (i) at least one cell type and (ii) exosomes obtained from said at least one cell type. As a matter of example, it is possible to perform RNA seq analysis of mRNA from (i) IPS cells and IPS-derived neurons, and (ii) exosomes obtained respectively from said IPS cells and IPS-derived neurons and and then compare the obtained results.
It is advantageously possible to compare (i) transcriptome profile analysis (notably the RNA seq analysis) of exosomes from the said different cell types or subtypes, isolated according through the purification method of the invention (notably using antibody-conjugated magnetic beads as described above) in order to enrich for exosomes expressing at least one cell type or cell subtype specific biomarker, with (ii) the transcriptome profile of total exosomes. For example the RNA seq results of exosomes from IPS cells and neuron exosomes isolated according to the pull down assay as described above can be compared to the RNA profile of total exosomes from both cell types.
In vitro experiments for the control of the purification of exosome subpopulations can also comprise experiments, wherein exosomes subspopulations are purified or isolated from a complex biological sample obtained from at least two cell
populations, cell types, or cell subtypes. For example, from a mix of media obtained from cell culture of different cell types such as IPS cells and neurons. Exosomes of the specific cells types are then purified as described above and their transcriptome is analysed. Such an experiment allows reconstructing, ex post facto, the transcriptome of the original cell type.
[00128] Isolation or purification of total exosomes from biological samples derived from any body fluid such as CSF, urine, or blood etc. and transcriptome analysis of the obtained exosome population can also be envisioned. Using cell-type specific biomarkers, exosome subpopulations can be further purified through any of the purification steps as described above, and enrichment in expression of specific cell type biomarkers can be searched through transcriptome analysis of this subpopulation as compared to the total exosome population. Said analysis is of particular interest for CSF analysis and identification of exosomes from specific neuronal subtypes
[00129] According to the present invention, the RNA content of exosomes is found to correlate the RNA content of the corresponding cell. In other terms, in particular when exosomes are purified in accordance with purification method of the present invention, a correlation was found between said exosomal RNA content and corresponding cellular RNA content. Therefore, analyzing exosomal RNA provides both qualitative and quantitative information about the cellular RNA content of the corresponding cells. Advantageously, this makes it possible to provide non-invasive diagnostic methods. Indeed, the analysis (whether by RNA seq, transcriptome profiling, qRT-PCR or array) is performed on a biological sample derived from body fluids, such as derived from urine, blood or cerebrospinal fluid. Such fluids are more easily and readily available than corresponding organs (bladder, heart or brain). Correspondingly, the present invention provides diagnostic methods that are non-invasive and yet reliable. In some aspects, it is envisioned to use a subpopulation of exosomes as starting material to extract RNA. This may allow the analysis of exosome subpools/subpopulations.
[00130] If reasoning that exosomes contribute to RNA transport, then exosomes could provide a delivery system in therapeutics. This would allow the delivery of a therapeutic RNA to a cell, wherein said therapeutic RNA may silence or express a gene in a cell. The present invention contemplates delivery of the exosome itself, or of an exosome-shedding cell. The delivery may occur in vivo or ex vivo. Delivery may rely on a targeting ligang. Said targeting ligand may be one or more prey exosome biomarker as decribed herein. For example, the prey exosome
biomarker may be selected from proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M; the prey exosome biomarker may be FLRT3 and/or L1CAM; or efficient fragments thereof.
[00131] The term "library" as used herein generally means a multiplicity of member components constituting the library which member components individually differ with respect to at least one property, for example, a scFv library. Particularly, as will be apparent to the skilled artisan, "library" means a plurality of nucleic acids / polynucleotides, preferably in the form of vectors comprising functional elements (promoter, transcription factor binding sites, enhancer, etc.) necessary for expression of polypeptides or RNA molecules, either in vitro or in vivo, which are functionally linked to coding sequences for polypeptides or RNA molecules. The vector can be a plasmid or a viral-based vector suitable for expression in prokaryotes or eukaryotes or both, preferably for expression in mammalian cells. There should also be at least one, preferably multiple pairs of cloning sites for insertion of coding sequences into the library, and for subsequent recovery or cloning of those coding sequences. The cloning sites can be restriction endonuclease recognition sequences, or other recombination based recognition sequences such as loxP sequences for Cre recombinase, or the Gateway system (Therm oFisher, Inc.) as described in U.S. Pat. No. 5,888,732, the contents of which is incorporated by reference herein. Coding sequences for polypeptides can be cDNA, genomic DNA fragments, or random/semi-random polynucleotides. The methods for cDNA or genomic DNA library construction are well-known in the art, which can be found in a number of commonly used laboratory molecular biology manuals described herein.
[00132] In an aspect, the present invention provides for libraries of polynucleotide sequences encoding for interacting protein or RNA molecules. Methods of making libraries are well known in the art, in which the methods may use any of a variety of reverse transcriptases and optionally other DNA polymerases, vectors for cloning cDNAs, as well as adapters, linkers, restriction enzymes, and ligases or recombination enzymes for combining synthesized cDNA molecules with vectors. In some preferred embodiments of the invention, recombinational cloning is employed to insert cDNA molecules into expression vectors, and in these embodiments, adapters comprise recognition sites for recombination enzymes.
[00133] Members of a library may include any protein or RNA molecule chosen from any protein or RNA molecule of interest and includes protein or RNA molecules of unknown, known, or suspected diagnostic, therapeutic, or pharmacological importance. For example, the protein of interest can be a protein or RNA molecule suspected of being involved in a cellular process, for example, receptor signaling, apoptosis, cell proliferation, cell differentiation, immune responses or import or export of toxins and nutrients. The present invention can allow for genome wide interaction studies of key proteins expressed during these different immune cell states. As such, protein or RNA molecules of interest may be protein or RNA molecules expressed from an entire genome. Protein or RNA molecules expressed from a single cell type or from cells having a specific cell state may also be chosen.
[00134] The protein molecules of the present invention can be derived from all or a portion of a known protein or a mutant thereof, all or a portion of an unknown protein (e.g., encoded by a gene cloned from a cDNA library), or a random polypeptide sequence. Members of a DNA expression library, such as a cDNA or synthetic DNA library may be used. The full length of the protein or RNA molecule of interest, or a portion thereof, can be used. In the instance when the protein of interest is of a large size, e.g., has a molecular weight of over 20 kDa, it may be more convenient to use a portion of the protein.
[00135] Polynucleotide sequences which encode the protein or RNA molecule of interest may be inserted into a vector such that the desired protein or RNA molecule is produced in a host mammalian cell. The vectors may include a proximity detection molecule. The proximity detection molecules may be encoded in-frame with a polynucleotide sequence encoding for a protein library member. In the case of RNA molecules, the vector encoding an RNA molecule or a separate vector may encode for a fusion protein that recognizes a loop structure within the RNA molecule. In preferred embodiments, the fusion protein is encoded by a polynucleotide sequence on the same vector as the RNA molecule, such that if a cell expresses the RNA molecule it will also express the fusion protein. The fusion protein includes a proximity detection molecule, thereby allowing the RNA molecule to be bound by a proximity detection molecule after expression. Preferably, the recombinant expression vector includes one or more regulatory sequences operably linked to the polynucleotide sequence to be expressed. The term "regulatory sequence" includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals).
[00136] In an exemplary embodiment, a cDNA library may be constructed from an mRNA population and inserted into an expression vector. Such a library of choice may be constructed de novo using commercially available kits or using well established preparative procedures (see, for example, Current Protocols in Molecular Biology, Eds. Ausubel et al. John Wiley & Sons: 1992). Alternatively, a number of cDNA libraries (from a number of different organisms) are publicly and commercially available. In the instance where it is preferable to replicate and store the polynucleotide sequences using a bacterial host cell, the DNA sequences are inserted into a vector which contains an appropriate origin of replication. It is also noted that protein or RNA molecules need not be naturally occurring full-length protein or RNA molecules. In certain embodiments, protein or RNA molecules can be encoded by synthetic DNA sequences.
[00137] The polynucleotide sequences encoding the desired protein or RNA molecule are typically operably linked to suitable transcriptional or translational regulatory elements. The regulatory elements typically include a transcriptional promoter, a sequence encoding suitable mRNA ribosomal binding sites, and sequences that control the termination of transcription and translation. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants may additionally be incorporated.
[00138] The nucleic acid sequences encoding the proteins or RNA molecules may be expressed in a variety of host cells, including E. coli and other bacterial hosts, and preferably eukaryotic host cells including but not limited to yeast, insect cells, and mammalian cells. The polynucleotide sequences will be operably linked to appropriate expression control sequences for each host. In a most preferred embodiment, the host cells comprise mammalian cells.
[00139] Many different mammalian cell types may be used in the practice of the invention. Cells suitable for use include primary cultures, cultures of immortalized cells or genetically manipulated strains of cells.
[00140] One of the main criteria for selection of a particular cell type may be the nature of post translational modification of target proteins expressed where the binding of such modified target proteins to a protein, RNA or small molecule may more accurately mimic the natural state. Cells that are associated with a particular disease state, or that originate from a particular tissue type may be chosen. Another criteria is the selection of a suitable cellular background to mimic the activity of a small molecule in its target tissue or cell type. If studying toxicity it may be appropriate to select a cell type associated with that toxicity, e.g. liver. Cell lines recognized in
the art as easy to transfect are particularly preferred. Different mammalian cell types may also be selected according to their permeability.
[00141] Cells may also be selected on the basis of their adherence to the chosen substrate, their rate of growth, and the ease with which they can be maintained in culture. Preferably the cells are human cells.
[00142] Any cultured mammalian cell can be used in the present invention, e.g., a primary, secondary, or immortalized cell. Exemplary mammalian cells are those of mouse, hamster, rat, rabbit, dog, cow, and primate including human. They may be of a wide variety of tissue types, including mast cells, endothelial cells, hepatic cells, kidney cells, or other cell types.
[00143] As used herein, the term primary cell means cells isolated from a mammal (e.g., from a tissue source), which are grown in culture for the first time before subdivision and transfer to a subculture. The term secondary cell means cells at all subsequent steps in culturing. That is, the first time a primary cell is removed from the culture substrate and passaged, it is referred to as a secondary cell, as are all cells in subsequent passages. Examples of mammalian primary and secondary cells which can be transfected include fibro-blasts, keratinocytes, epithelial cells (e.g., mammary epithelial cells, intestinal epithelial cells), endothelial cells, glial cells, neural cells, formed elements of the blood (e.g., lymphocytes, bone marrow cells), muscle cells and precursors of these somatic cell types.
[00144] Immortalized cells are cell lines that exhibit an apparently unlimited lifespan in culture. Examples of immortalized human cell lines useful for the present invention include, but are not limited to, HEK 293 cells and derivatives of HEK 293 cells (ATCC CRL 1573), HT1080 cells (ATCC CCL 121), HeLa cells and derivatives of HeLa cells (ATCC CCL 2, 2.1 and 2.2), MCF-7 breast cancer cells (ATCC HTB 22), K-562 leukemia cells (ATCC CCL 243), KB carcinoma cells (ATCC CCL 17), Raji cells (ATCC CCL 86), Jurkat cells (ATCC TIB 152), Namalwa cells (ATCC CRL 1432), HL-60 cells (ATCC CCL 240), Daudi cells (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cells (ATCC CRL 1593), Bowes Melanoma cells (ATCC CRL 9607), WI-38 cells (ATCC CLL 75), and MOLT-4 cells (ATCC CRL 1582).
[00145] The exosomes of the present invention may be loaded with exogenous cargoes, such as a therapeutic RNA, using electroporation protocols adapted for nanoscale applications (see, e.g., Alvarez-Erviti et al. 2011, Nat Biotechnol 29: 341). As electroporation for membrane particles at the nanometer scale is not well-characterized, nonspecific Cy5-labeled siRNA was
used for the empirical optimization of the electroporation protocol. The amount of encapsulated siRNA was assayed after ultracentrifugation and lysis of exosomes. Electroporation at 400 V and 125 μ¥ resulted in the greatest retention of siRNA and was used for all subsequent experiments.
[00146] Alvarez-Erviti et al. administered 150 μg of each BACE1 siRNA encapsulated in 150 μg of RVG exosomes to normal C57BL/6 mice and compared the knockdown efficiency to four controls: untreated mice, mice injected with RVG exosomes only, mice injected with BACE1 siRNA complexed to an in vivo cationic liposome reagent and mice injected with BACE1 siRNA complexed to RVG-9R, the RVG pep tide conjugated to 9 D-arginines that electrostatically binds to the siRNA. Cortical tissue samples were analyzed 3 d after administration and a significant protein knockdown (45%, P < 0.05, versus 62%, P < 0.01) in both siRNA-RVG-9R-treated and siRNARVG exosome-treated mice was observed, resulting from a significant decrease in BACE1 mRNA levels (66% [+ or -] 15%, P < 0.001 and 61% [+ or -] 13% respectively, P < 0.01). Moreover, Applicants demonstrated a significant decrease (55%, P < 0.05) in the total [beta]-amyloid 1-42 levels, a main component of the amyloid plaques in Alzheimer's pathology, in the RVG-exosome-treated animals. The decrease observed was greater than the β-amyloid 1- 40 decrease demonstrated in normal mice after intraventricular injection of BACE1 inhibitors. Alvarez-Erviti et al. carried out 5'-rapid amplification of cDNA ends (RACE) on BACE1 cleavage product, which provided evidence of RNAi-mediated knockdown by the siRNA.
[00147] Finally, Alvarez-Erviti et al. investigated whether siRNA-RVG exosomes induced immune responses in vivo by assessing IL-6, IP- 10, TNFa and IFN-a serum concentrations. Following siRNA-RVG exosome treatment, nonsignificant changes in all cytokines were registered similar to siRNA-transfection reagent treatment in contrast to siRNA-RVG-9R, which potently stimulated IL-6 secretion, confirming the immunologically inert profile of the exosome treatment. Given that exosomes encapsulate only 20% of siRNA, delivery with RVG-exosome appears to be more efficient than RVG-9R delivery as comparable mRNA knockdown and greater protein knockdown was achieved with fivefold less siRNA without the corresponding level of immune stimulation. This experiment demonstrated the therapeutic potential of RVG- exosome technology, which is potentially suited for long-term silencing of genes related to neurodegenerative diseases. The exosome delivery system of Alvarez-Erviti et al. may be applied to deliver the exosome of the present invention to therapeutic targets, especially
neurodegenerative diseases. A dosage of about 100 to 1000 mg of a target RNA encapsulated in about 100 to 1000 mg of exosomes may be contemplated for the present invention.
[00148] El-Andaloussi et al. (Nature Protocols 7,2112-2126(2012)) discloses how exosomes derived from cultured cells can be harnessed for delivery of siRNA in vitro and in vivo. This protocol first describes the generation of targeted exosomes through transfection of an expression vector, comprising an exosomal protein fused with a peptide ligand. Next, El-Andaloussi et al. explain how to purify and characterize exosomes from transfected cell supernatant. Next, El- Andaloussi et al. detail crucial steps for loading siRNA into exosomes. Finally, El-Andaloussi et al. outline how to use exosomes to efficiently deliver siRNA in vitro and in vivo in mouse brain. Examples of anticipated results in which exosome-mediated siRNA delivery is evaluated by functional assays and imaging are also provided. The entire protocol takes ~3 weeks. Delivery or administration according to the invention may be performed using exosomes produced from self- derived dendritic cells.
[00149] In another embodiment, the plasma exosomes of Wahlgren et al. (Nucleic Acids Research, 2012, Vol. 40, No. 17 el 30) are contemplated. Exosomes are nano-sized vesicles (30- 90nm in size) produced by many cell types, including dendritic cells (DC), B cells, T cells, mast cells, epithelial cells and tumor cells. These vesicles are formed by inward budding of late endosomes and are then released to the extracellular environment upon fusion with the plasma membrane. Because exosomes naturally carry RNA between cells, this property might be useful in gene therapy.
[00150] The chemical transfection of a target RNA into exosomes may be conducted similarly to siRNA (see, e.g., Wahlgren et al. Nucleic Acids Research, 2012, Vol. 40, No. 17 el30). The exosomes may be co-cultured with monocytes and lymphocytes isolated from the peripheral blood of healthy donors. Therefore, it may be contemplated that exosomes containing a target RNA may be introduced to monocytes and lymphocytes of and autologously reintroduced into a human.
[00151] Markers are identified for a number of disorders. Such markers are useful in the diagnostic, prognostic and/or therapy of respective disorders. Such markers include disease- associated genes and polynucleotides.
[00152] Examples of disease-associated genes and polynucleotides are available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.)
and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md).
[00153] Examples of disease-associated genes and polynucleotides are listed in Tables A and B. Disease specific information is available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.), available on the World Wide Web. Examples of signaling biochemical pathway-associated genes and polynucleotides are listed in Table C. Mutations in these genes and pathways can result in production of improper proteins or proteins in improper amounts which affect function.
Table A
Parkinson's Disease x-Synuclein; DM; LRRK2; Parkin; PINK1
Table B:
Blood and Anemia (CDANl, CDAl, RPS19, DBA, PKLR, PKl, NT5C3, UMPHl, coagulation diseases PSN1, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB, and disorders ABCB7, ABC7, ASAT); Bare lymphocyte syndrome (TAPBP, TPSN,
TAP2, ABCB3, PSF2, RING11, MHC2TA, C2TA, RFX5, RFXAP, RFX5), Bleeding disorders (TBXA2R, P2RX1, P2X1); Factor H and factor H-like 1 (HF1, CFH, HUS); Factor V and factor VIII (MCFD2); Factor VII deficiency (F7); Factor X deficiency (F10); Factor XI deficiency (Fl 1); Factor XII deficiency (F12, HAF); Factor XIIIA deficiency (F13A1, F13A); Factor XIIIB deficiency (F13B); Fanconi anemia (FANCA, FACA, FA1, FA, FAA, FAAP95, FAAP90, FLJ34064, FANCB, FANCC, FACC, BRCA2, FANCD1, FANCD2, FANCD, FACD, FAD, FANCE, FACE, FANCF, XRCC9, FANCG, BRIP1, BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596);
Hemophagocytic lymphohistiocytosis disorders (PRF1, HPLH2,
UNCI 3D, MUNC13-4, HPLH3, HLH3, FHL3); Hemophilia A (F8, F8C, HEMA); Hemophilia B (F9, HEMB), Hemorrhagic disorders (PI, ATT, F5); Leukocyde deficiencies and disorders (ITGB2, CD 18, LCAMB, LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5, LVWM, CACH, CLE, EIF2B4); Sickle cell anemia (HBB); Thalassemia (HBA2, HBB, HBD, LCRB, HBA1).
Cell dysregulation B-cell non-Hodgkin lymphoma (BCL7A, BCL7); Leukemia (TALI, and oncology TCL5, SCL, TAL2, FLT3, NBSl, NBS, ZNFN1A1, IK1, LYF1, diseases and disorders HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2,
GMPS, AFIO, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPMl, NUP214, D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3,
FLT3, AF1Q, NPM1, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B,
AFIO, CALM, CLTH, ARL11, ARLTS1, P2RX7, P2X7, BCR, CML, PHL, ALL, GRAF, NF1, VRNF, WSS, NFNS, PTPN11, PTP2C, SHP2, NS1, BCL2, CCND1, PRAD1, BCL1, TCRA, GATA1, GF1, ERYF1, NFE1, ABLl, NQOl, DIA4, NMORl, NUP214, D9S46E, CAN, CAIN).
Inflammation and AIDS (KIR3DL1, NKAT3, NKBl, AMBl l, KIR3DS1, IFNG, CXCL12, immune related SDF1); Autoimmune lymphoproliferative syndrome (TNFRSF6, APTl, diseases and disorders FAS, CD95, ALPSIA); Combined immunodeficiency, (IL2RG,
SCIDXI, SCIDX, FMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2,
CMKBR5, CCCKR5 (CCR5)); Immunodeficiencies (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI); Inflammation (IL-10, IL-1 (IL-la, IL-lb), IL-13, IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-17f), 11-23, Cx3crl, ptpn22, TNFa, NOD2/CARD15 for IBD, IL-6, IL-12 (IL-12a, IL-12b), CTLA4, Cx3cll); Severe combined immunodeficiencies (SCIDs)(JAK3, JAKL, DCLRE1C, ARTEMIS, SCIDA, RAG1, RAG2, ADA, PTPRC, CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDXI, SCIDX, FMD4).
Metabolic, liver, Amyloid neuropathy (TTR, PALB); Amyloidosis (APOA1, APP, AAA, kidney and protein CVAP, ADl, GSN, FGA, LYZ, TTR, PALB); Cirrhosis (KRT18, KRT8, diseases and disorders CIRH1A, NAIC, TEX292, KIAA1988); Cystic fibrosis (CFTR, ABCC7,
CF, MRP7); Glycogen storage diseases (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); Hepatic adenoma, 142330 (TCF1, HNFIA, MODY3), Hepatic failure, early onset, and neurologic disorder (SCOD1, SCOl), Hepatic lipase deficiency (LIPC), Hepatoblastoma, cancer and carcinomas (CTNNBl, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNBl, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5; Medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); Phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS); Polycystic kidney and hepatic disease (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63).
Muscular / Skeletal Becker muscular dystrophy (DMD, BMD, MYF6), Duchenne Muscular diseases and disorders Dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA,
LMN1, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMN1, EMD2, FPLD, CMD1A); Facioscapulohumeral muscular dystrophy (FSHMD1A, FSHD1A); Muscular dystrophy (FKRP, MDC1C,
LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCAP, LGMD2G, CMD1N, TRFM32, HT2A, LGMD2H, FKRP, MDC1C, LGMD2I, TTN,
CMD1G, TMD, LGMD2J, POMT1, CAV3, LGMD1C, SEPN1, SELN,
RSMD1, PLEC1, PLTN, EBS1); Osteopetrosis (LRP5, BMND1, LRP7, LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTM1, GL, TCIRG1, TIRC7, OC116, OPTB1); Muscular atrophy (VAPB, VAPC, ALS8, SMNl, SMAl, SMA2, SMA3, SMA4, BSCL2, SPG17, GARS, SMADl, CMT2D, HEXB, IGHMBP2, SMUBP2, CATF1, SMARD1).
Neurological and ALS (SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b, neuronal diseases and VEGF-c); Alzheimer disease (APP, AAA, CVAP, ADl, APOE, AD2, disorders PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE,
DCP1, ACE1, MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH, PSEN1, AD3); Autism (Mecp2, BZRAPl, MDGA2, Sema5A, Neurexin 1, GLOl, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2); Fragile X Syndrome (FMR2, FXR1, FXR2, mGLUR5); Huntington's disease and disease like disorders (HD, IT 15, PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17); Parkinson disease (NR4A2, NURR1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA, NACP, PARK1, PARK4, DJ1, PARK7, LRRK2, PARK8, PINK1, PARK6, UCHL1, PARK5, SNCA, NACP, PARK1, PARK4, PRKN, PARK2, PDJ, DBH, NDUFV2); Rett syndrome (MECP2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16, MRX79, x-Synuclein, DJ-1); Schizophrenia (Neuregulinl (Nrgl), Erb4 (receptor for Neuregulin), Complexinl (Cplxl), Tphl Tryptophan hydroxylase, Tph2, Tryptophan hydroxylase 2, Neurexin 1, GSK3, GSK3a, GSK3b, 5 -HTT (Slc6a4), COMT, DRD (Drdla), SLC6A3, DAOA, DTNBPl, Dao (Daol)); Secretase Related Disorders (APH-1 (alpha and beta), Presenilin (Psenl), nicastrin, (Ncstn), PEN-2, Nosl, Parpl, Natl, Nat2); Trinucleotide Repeat Disorders (HTT (Huntington's Dx), SBMA/SMAX1/AR (Kennedy's Dx), FXN/X25 (Friedrich's Ataxia), ATX3 (Machado- Joseph's Dx), ATXN1 and ATXN2
(spinocerebellar ataxias), DMPK (myotonic dystrophy), Atrophin-1 and Atnl (DRPLA Dx), CBP (Creb-BP - global instability), VLDLR
(Alzheimer's), Atxn7, AtxnlO).
Occular diseases and Age-related macular degeneration (Abcr, Ccl2, Cc2, cp (ceruloplasmin), disorders Timp3, cathepsinD, Vldlr, Ccr2); Cataract (CRYAA, CRYAl, CRYBB2,
CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYAl, PAX6, AN2, MGDA, CRYBAl, CRYBl, CRYGC, CRYG3, CCL, LFM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQPO, CRYAB, CRYA2, CTPP2, CRYBBl, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYAl, GJA8, CX50, CAEl, GJA3, CX46, CZP3, CAE3, CCM1, CAM, KRIT1);
Corneal clouding and dystrophy (APOAl, TGFBI, CSD2, CDGG1, CSD, BIGH3, CDG2, TACSTD2, TROP2, Ml SI, VSX1, RINX, PPCD, PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD); Cornea plana congenital (KERA, CNA2); Glaucoma (MYOC, TIGR, GLC1A, JO AG,
GPOA, OPTN, GLCIE, FIP2, HYPL, NRP, CYPIBI, GLC3A, OPAl,
NTG, NPG, CYPIBI, GLC3A); Leber congenital amaurosis (CRBl, RP12, CRX, CORD2, CRD, RPGRIPl, LCA6, CORD9, RPE65, RP20, AIPL1, LCA4, GUCY2D, GUC2D, LCAl, CORD6, RDH12, LCA3); Macular dystrophy (ELOVL4, ADMD, STGD2, STGD3, RDS, RP7, |PRPH2, PRPH, AVMD, AOFMD, VMD2).
Table C:
PIK3CA; PRKCI; PTK2; FOS; PIK3CB; PIK3C3; MAPK8;
IGF1R; IRS1; MAPK3; IGFBP7; KRAS; PIK3C2A;
YWHAZ; PXN; RAFl; CASP9; MAP2K2; AKT1; PIK3R1;
PDPK1; MAP2K1; IGFBP2; SFN; JUN; CYR61; AKT3;
FOXOl; SRF; CTGF; RPS6KB1
NRF2-mediated PRKCE; EP300; SOD2; PRKCZ; MAPKl; SQSTM1;
Oxidative
Stress Response NQOl; PIK3CA; PRKCI; FOS; PIK3CB; PIK3C3; MAPK8;
PRKD1; MAPK3; KRAS; PRKCD; GSTP1; MAPK9; FTL;
NFE2L2; PIK3C2A; MAPKl 4; RAFl; MAP3K7; CREBBP;
MAP2K2; AKT1; PIK3R1; MAP2K1; PPIB; JUN; KEAPl;
GSK3B; ATF4; PRKCA; EIF2AK3; HSP90AA1
Hepatic Fibrosis/Hepatic EDN1; IGF1; KDR; FLT1; SMAD2; FGFR1; MET; PGF;
Stellate Cell Activation SMAD3; EGFR; FAS; CSF1; NFKB2; BCL2; MYH9;
IGF1R; IL6R; RELA; TLR4; PDGFRB; TNF; RELB; IL8;
PDGFRA; NFKB1; TGFBR1; SMAD4; VEGFA; BAX;
IL1R1; CCL2; HGF; MMP1; STAT1; IL6; CTGF; MMP9
PPAR Signaling EP300; F S; TRAF6; PPARA; RXRA; MAPKl; IKBKB;
NCOR2; FOS; NFKB2; MAP3K14; STAT5B; MAPK3;
NRIP1 ; KRAS; PPARG; RELA; STAT 5 A; TRAF2;
PPARGC1A; PDGFRB; TNF; INSR; RAFl; IKBKG;
RELB; MAP3K7; CREBBP; MAP2K2; CHUK; PDGFRA;
MAP2K1; NFKBl; JUN; IL1R1; HSP90AA1
Fc Epsilon RI Signaling PRKCE; RAC1; PRKCZ; LYN; MAPKl; RAC2; PTPN11;
AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; MAPK8;
PRKD1; MAPK3; MAPK10; KRAS; MAPK13; PRKCD;
MAPK9; PIK3C2A; BTK; MAPKl 4; TNF; RAFl; FYN;
MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; AKT3;
VAV3; PRKCA
G-Protein Coupled PRKCE; RAPIA; RGS16; MAPKl; GNAS; AKT2; IKBKB;
Receptor Signaling PIK3CA; CREB1; GNAQ; NFKB2; CAMK2A; PIK3CB;
PIK3C3; MAPK3; KRAS; RELA; SRC; PIK3C2A; RAFl;
IKBKG; RELB; FYN; MAP2K2; AKT1; PIK3R1; CHUK;
PDPK1; STAT3; MAP2K1; NFKBl; BRAF; ATF4; AKT3;
PRKCA
Inositol Phosphate PRKCE; IRAKI; PRKAA2; EIF2AK2; PTEN; GRK6;
Metabolism MAPKl; PLKl; AKT2; PIK3CA; CDK8; PIK3CB; PIK3C3;
MAPK8; MAPK3; PRKCD; PRKAA1; MAPK9; CDK2;
PFM1 ; PIK3C2A; DYRK1A; MAP2K2; PIP5K1A; PIK3R1;
MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK
PDGF Signaling EIF2AK2; ELK1; ABL2; MAPKl; PIK3CA; FOS; PIK3CB;
PIK3C3; MAPK8; CAV1; ABLl; MAPK3; KRAS; SRC;
Signaling
Coagulation System BDKRB1; F2R; SERPINE1; F3
Dopamine Receptor PPP2R1A; PPP2CA; PPPICC; PPP2R5C
Signaling
Glutathione Metabolism IDH2; GSTP1; ANPEP; IDH1
Glycerolipid Metabolism ALDH1A1; GPAM; SPHK1; SPHK2
Linoleic Acid PRDX6; GRN; YWHAZ; CYP1B 1
Metabolism
Methionine Metabolism DNMTl; DNMT3B; AHCY; DNMT3A
Pyruvate Metabolism GLOl; ALDHIAI; PKM2; LDHA
Arginine and Proline ALDH1A1; NOS3; NOS2A
Metabolism
Eicosanoid Signaling PRDX6; GRN; YWHAZ
Fructose and Mannose HK2; GCK; HK1
Metabolism
Galactose Metabolism HK2; GCK; HK1
Stilbene, Coumarine and PRDX6; PRDX1; TYR
Lignin Biosynthesis
Antigen Presentation CALR; B2M
Pathway
Biosynthesis of Steroids NQOl; DHCR7
Butanoate Metabolism ALDHIAI; NLGNl
Citrate Cycle IDH2; IDH 1
Fatty Acid Metabolism ALDHIAI; CYP1B1
Glycerophospholipid PRDX6; CHKA
Metabolism
Histidine Metabolism PRMT5; ALDHIAI
Inositol Metabolism EROIL; APEX1
Metabolism of GSTP1; CYP1B 1
Xenobiotics
by Cytochrome p450
Methane Metabolism PRDX6; PRDX1
Phenylalanine PRDX6; PRDX1
Metabolism
Propanoate Metabolism ALDHIAI; LDHA
Selenoamino Acid PRMT5; AHCY
Metabolism
Sphingolipid Metabolism SPHK1; SPHK2
Aminophosphonate PRMT5
Metabolism
Androgen and Estrogen PRMT5
Metabolism
Ascorbate and Aldarate ALDHIAI
Metabolism
Bile Acid Biosynthesis ALDHIAI
Cysteine Metabolism LDHA
Fatty Acid Biosynthesis FASN
Glutamate Receptor G B2L1
Signaling
NRF2-mediated PRDX1
Oxidative
Stress Response
Pentose Phosphate GPI
Pathway
Pentose and Glucuronate UCHL1
Interconversions
Retinol Metabolism ALDH1A1
Riboflavin Metabolism TYR
Tyrosine Metabolism PRMT5, TYR
Ubiquinone Biosynthesis PRMT5
Valine, Leucine and ALDH1A1
Isoleucine Degradation
Glycine, Serine and CHKA
Threonine Metabolism
Lysine Degradation ALDH1A1
Pain/Taste TRPM5; TRPA1
Pain TRPM7; TRPC5; TRPC6; TRPC1; Cnrl; cnr2; Grk2;
Trpal; Pome; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca;
Prkacb; Prkarla; Prkar2a
Mitochondrial Function AIF; CytC; SMAC (Diablo); Aifm-1; Aifin-2
Developmental BMP-4; Chordin (Chrd); Noggin (Nog); WNT (Wnt2; Neurology
Wnt2b; Wnt3a; Wnt4; Wnt5a; Wnt6; Wnt7b; Wnt8b;
Wnt9a; Wnt9b; WntlOa; WntlOb; Wntl6); beta-catenin;
Dkk-1; Frizzled related proteins; Otx-2; Gbx2; FGF-8;
Reelin; Dabl; unc-86 (Pou4fl or Brn3a); Numb; Rein
Table D:
Continuation of Data from Table D: CSF mass spec transmembrane protein gene names No. 209 onwards
Continuation of Data from Table D: neuron specific genes in mouse, gene numbers 209 onwards
1,855-1,869
protein
DKFZp686P18250
BTCC-1
PVRL1
FU00329
DKFZp686J1169
DKFZp779F0871
FU00385
PVRL2
DKFZp434F011
Nbla00271
FU00095
DKFZp686B1310
DKFZp686F1789
KIAA1149
Continuation of Data from Table D: neuron specific genes in mouse, gene numbers 209 onwards
Table E: Key to Table D
Col. A-C in Table D are data derived from the published literature
Col. A Transmembrane proteins detected "Establishing the Proteome of Normal
in cell-free CSF through mass Human Cerebrospinal Fluid" Schutzer S E et spectrometry analysis. al., PLoS One, 2010; 5(6): el0980.
This paper provides a list of proteins detected through mass spectrometry analysis in cell- free CSF.
Col. B Neuron specific genes expressed in "An RNA-Sequencing Transcriptome and mouse Splicing Database of Glia, Neurons, and
Vascular Cells of the Cerebral Cortex" Zhang Y et al., The Journal of Neuroscience, 2014, 34(36): 11929 -11947.
This paper compares gene expression in different cells of the brain in mouse
Col. C Neuron specific genes expressed in "Purification and Characterization of
human Progenitor and Mature Human Astrocytes
Reveals Transcriptional and Functional Differences with Mouse " Zhang et al., 2016, Neuron 89, 37-53
This paper compares gene expression in different cells of the brain in human.
Col. D-F in Table D are data obtained from intersection of the data from col. A-C
Col. D CSF transmembrane proteins that Intersect of (A,B)
are neuron specific in mouse
Col. E CSF transmembrane proteins that Intersect of (A, C)
are neuron specific in human
Col. F CSF transmembrane proteins that Intersect of (A, B, C)
are neuron specific in mouse AND
human
Col. G Proteins found in neuron exosomes. Data from the applicants obtained from mass spectrometry analysis of IPSC-derived neurons.
Col. H-M in Table D are data obtained from intersection between data from the applicant (col. G) and data derived from the published literature (Col. A-F).
Col. H CSF transmembrane proteins Intersect of (G, F) = intersect of (A, B, C, G)
(detected through mass
spectrometry analysis) in neuron
exosomes
Col. I neuron specific genes in mouse Intersect of (G, B)
AND in neuron exosomes
Col. J neuron specific genes expressed in Intersect of (G, C)
human AND in neuron exosomes
Col. K CSF transmembrane proteins that Intersect of (G, D) = intersect of (G, A, B) are neuron specific in mouse AND
in neuron exosomes
Col. L CSF transmembrane proteins that Intersect of (G, E) = intersect of (G A, C) are neuron specific in human AND
in neuron exosomes
Col. M CSF transmembrane proteins that Intersect of (K, L) = intersect of (G, A, B, C) are neuron specific in mouse AND
human AND in neuron exosomes
[00154] The present invention may be applied to genetic mutations further described in Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012. Several further aspects of the invention relate to diagnosing, prognosing and/or treating defects associated with a wide range of genetic diseases which are further described on the website of the National Institutes of Health under the topic subsection Genetic Disorders (website at health.nih.gov/topic/Genetic Disorders). The genetic brain diseases may include but are not limited to Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Aicardi Syndrome, Alpers' Disease, Alzheimer's Disease, Barth Syndrome, Batten Disease, CADASIL, Cerebellar Degeneration, Fabry's Disease, Gerstmann-Straussler-Scheinker Disease, Huntington's Disease and other Triplet Repeat Disorders, Leigh's Disease, Lesch-Nyhan Syndrome, Menkes Disease, Mitochondrial Myopathies and NINDS Colpocephaly. These diseases are further described on the website of the National Institutes of Health under the subsection Genetic Brain Disorders.
[00155] In some embodiments, the condition (disorder) may be neoplasia. In some embodiments, where the condition is neoplasia, the genes to be diagnosed, prognosed and/or targeted are any of those listed in Table A (in this case PTEN and so forth). In some embodiments, the condition may be Age-related Macular Degeneration. In some embodiments, the condition may be a Schizophrenic Disorder. In some embodiments, the condition may be a Trinucleotide Repeat Disorder. In some embodiments, the condition may be Fragile X Syndrome. In some embodiments, the condition may be a Secretase Related Disorder. In some embodiments, the condition may be a Prion - related disorder. In some embodiments, the condition may be ALS. In some embodiments, the condition may be a drug addiction. In some embodiments, the condition may be Autism. In some embodiments, the condition may be
Alzheimer's Disease. In some embodiments, the condition may be inflammation. In some embodiments, the condition may be Parkinson's Disease.
[00156] Examples of proteins associated with Parkinson's disease include but are not limited to a-synuclein, DJ-1, LRRK2, PINK1, Parkin, UCHL1, Synphilin-1, and NURR1.
[00157] Examples of addiction-related proteins may include ABAT for example.
[00158] Examples of inflammation-related proteins may include the monocyte chemoattractant protein- 1 (MCP1) encoded by the Ccr2 gene, the C-C chemokine receptor type 5 (CCR5) encoded by the Ccr5 gene, the IgG receptor IIB (FCGR2b, also termed CD32) encoded by the Fcgr2b gene, or the Fc epsilon Rig (FCERlg) protein encoded by the Fcerlg gene, for example.
[00159] Examples of cardiovascular diseases associated proteins may include ILIB (interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin 12 (prostacyclin) synthase), MB (myoglobin), IL4 (interleukin 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP -binding cassette, sub-family G (WHITE), member 8), or CTSK (cathepsin K), for example.
[00160] Examples of Alzheimer's disease associated proteins may include the very low density lipoprotein receptor protein (VLDLR) encoded by the VLDLR gene, the ubiquitin-like modifier activating enzyme 1 (UBA1) encoded by the UBA1 gene, or the EDD8 -activating enzyme El catalytic subunit protein (UBE1C) encoded by the UBA3 gene, for example.
[00161] Examples of proteins associated Autism Spectrum Disorder may include the benzodiazapine receptor (peripheral) associated protein 1 (BZRAPl) encoded by the BZRAP1 gene, the AF4/FMR2 family member 2 protein (AFF2) encoded by the AFF2 gene (also termed MFR2), the fragile X mental retardation autosomal homolog 1 protein (FXRl) encoded by the FXRl gene, or the fragile X mental retardation autosomal homolog 2 protein (FXR2) encoded by the FXR2 gene, for example.
[00162] Examples of proteins associated Macular Degeneration may include the ATP -binding cassette, sub-family A (ABCl) member 4 protein (ABCA4) encoded by the ABCR gene, the apolipoprotein E protein (APOE) encoded by the APOE gene, or the chemokine (C-C motif) Ligand 2 protein (CCL2) encoded by the CCL2 gene, for example.
[00163] Examples of proteins associated Schizophrenia may include RG1, ErbB4, CPLX1, TPH1, TPH2, RXN1, GSK3A, BD F, DISCI, GSK3B, and combinations thereof.
[00164] Examples of proteins involved in tumor suppression may include ATM (ataxia telangiectasia mutated), ATR (ataxia telangiectasia and Rad3 related), EGFR (epidermal growth factor receptor), ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2), ERBB3 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 3), ERBB4 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 4), Notch 1, Notch2, Notch 3, or Notch 4, for example.
[00165] Examples of proteins associated with a secretase disorder may include PSENEN (presenilin enhancer 2 homolog (C. elegans)), CTSB (cathepsin B), PSEN1 (presenilin 1), APP (amyloid beta (A4) precursor protein), APHIB (anterior pharynx defective 1 homolog B (C. elegans)), PSEN2 (presenilin 2 (Alzheimer disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1), for example.
[00166] Examples of proteins associated with Amyotrophic Lateral Sclerosis may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
[00167] Examples of proteins associated with prion diseases may include SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma), TARDBP (TAR DNA binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.
[00168] Examples of proteins related to neurodegenerative conditions in prior disorders may include A2M (Alpha-2-Macroglobulin), AATF (Apoptosis antagonizing transcription factor), ACPP (Acid phosphatase prostate), ACTA2 (Actin alpha 2 smooth muscle aorta), ADAM22 (ADAM metallopeptidase domain), ADORA3 (Adenosine A3 receptor), or ADRAID (Alpha-ID adrenergic receptor for Alpha- ID adrenoreceptor), for example.
[00169] Examples of proteins associated with Immunodeficiency may include A2M [alpha-2- macroglobulin]; AANAT [arylalkylamine N-acetyl transferase]; ABCAl [ATP -binding cassette, sub-family A (ABCl), member 1]; ABCA2 [ATP-binding cassette, sub-family A (ABCl), member 2]; or ABC A3 [ATP-binding cassette, sub-family A (ABCl), member 3]; for example.
Examples of proteins associated with Trinucleotide Repeat Disorders include AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (huntingtin), or DMPK (dystrophia myotonica-protein kinase), FXN (frataxin), ATXN2 (ataxin 2), for example.
[00170] Examples of proteins associated with Neurotransmission Disorders include SST (somatostatin), NOS1 (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic, alpha-2A-, receptor), ADRA2C (adrenergic, alpha-2C-, receptor), TACR1 (tachykinin receptor 1), or HTR2c (5-hydroxytryptamine (serotonin) receptor 2C), for example.
[00171] Examples of neurodevelopmental-associated sequences include A2BP1 [ataxin 2- binding protein 1], AADAT [aminoadipate aminotransferase], AANAT [arylalkyl amine N- acetyl transferase], ABAT [4-aminobutyrate aminotransferase], ABCAl [ATP -binding cassette, sub-family A (ABCl), member 1], or ABCA13 [ATP -binding cassette, sub-family A (ABCl), member 13], for example.
[00172] Further examples of preferred conditions treatable with the present system include may be selected from: Aicardi-Goutieres Syndrome; Alexander Disease; Allan-Herndon-Dudley Syndrome; POLG-Related Disorders; Alpha-Mannosidosis (Type II and III); Alstrom Syndrome; Angelman; Syndrome; Ataxia-Telangiectasia; Neuronal Ceroid-Lipofuscinoses; Beta- Thalassemia; Bilateral Optic Atrophy and (Infantile) Optic Atrophy Type 1; Retinoblastoma (bilateral); Canavan Disease; Cerebrooculofacioskeletal Syndrome 1 [COFS1]; Cerebrotendinous Xanthomatosis; Cornelia de Lange Syndrome; MAPT-Related Disorders; Genetic Prion Diseases; Dravet Syndrome; Early-Onset Familial Alzheimer Disease; Friedreich Ataxia [FRDA]; Fryns Syndrome; Fucosidosis; Fukuyama Congenital Muscular Dystrophy; Galactosialidosis; Gaucher Disease; Organic Acidemias; Hemophagocytic Lymphohistiocytosis; Hutchinson-Gilford Progeria Syndrome; Mucolipidosis II; Infantile Free Sialic Acid Storage Disease; PLA2G6-Associated Neurodegeneration; Jervell and Lange-Nielsen Syndrome; Junctional Epidermolysis Bullosa; Huntington Disease; Krabbe Disease (Infantile); Mitochondrial DNA- Associated Leigh Syndrome and NARP; Lesch-Nyhan Syndrome; LIS1- Associated Lissencephaly; Lowe Syndrome; Maple Syrup Urine Disease; MECP2 Duplication Syndrome; ATP7A-Related Copper Transport Disorders; LAMA2 -Related Muscular Dystrophy; Arylsulfatase A Deficiency; Mucopolysaccharidosis Types I, II or III; Peroxisome Biogenesis Disorders, Zellweger Syndrome Spectrum; Neurodegeneration with Brain Iron Accumulation Disorders; Acid Sphingomyelinase Deficiency; Niemann-Pick Disease Type C; Glycine
Encephalopathy; ARX-Related Disorders; Urea Cycle Disorders; COLlAl/2-Related Osteogenesis Imperfecta; Mitochondrial DNA Deletion Syndromes; PLP1 -Related Disorders; Perry Syndrome; Phelan-McDermid Syndrome; Glycogen Storage Disease Type II (Pompe Disease) (Infantile); MAPT-Related Disorders; MECP2-Related Disorders; Rhizomelic Chondrodysplasia Punctata Type 1; Roberts Syndrome; Sandhoff Disease; Schindler Disease - Type 1; Adenosine Deaminase Deficiency; Smith-Lemli-Opitz Syndrome; Spinal Muscular Atrophy; Infantile-Onset Spinocerebellar Ataxia; Hexosaminidase A Deficiency; Thanatophoric Dysplasia Type 1; Collagen Type VI-Related Disorders; Usher Syndrome Type I; Congenital Muscular Dystrophy; Wolf-Hirschhorn Syndrome; Lysosomal Acid Lipase Deficiency; and Xeroderma Pigmentosum.
[00173] Some examples of disorders (conditions or diseases) that might be usefully treated, prognosed and/or diagnosed using the present invention are included in the Tables above and examples of genes or markers currently associated with those disorders are also provided there. However, the genes exemplified are not exhaustive.
[00174] In one aspect, the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube. In some embodiments, the kit includes instructions in one or more languages, for example in more than one language.
[00175] In some embodiments, a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein. Reagents may be provided in any suitable container. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 7 to about 10. In some embodiments, the kit comprises one or more oligonucleotides corresponding to a guide sequence for insertion into a vector so as to operably link the guide sequence and a regulatory element. In some embodiments, the kit comprises a homologous recombination template polynucleotide. In some embodiments, the kit comprises
one or more of the vectors and/or one or more of the polynucleotides described herein. The kit may advantageously allows to provide all elements of the systems of the invention.
[00176] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined in the appended claims.
[00177] The present invention will be further illustrated in the following Examples which are given for illustration purposes only and are not intended to limit the invention in any way.
Examples
Example 1: isolation/purification of exosomes, and RNA extraction therefrom (no proteinase treatment): standard exosome isolation
[00178] The following protocol was used to isolate RNA from suspension cells such as K562 Cells. Buffers and some reagents refer to a mirVana RNA kit (Life technologies).
[00179] Day 1
Spin down about 72 million cells total in 6 50 mL Falcon tubes (12 million cells per tube) at 300xg for 5 minutes.
Aspirate media and resuspend each cell pellet in 43 mL exosome-free media. Transfer contents of each Falcon tube to T75 flask.
[00180] Day 2
After 24 hours, take off all media and divide among 50 mL falcon tubes. Spin at 300xg for 10 minutes at 4 degrees.
Transfer supernatant to new 50 mL tubes leaving cell pellet behind. Spin at 2000xg for 10 minutes at 4 degrees. Transfer supernatant to new 50 mL tubes leaving cell pellet behind. Spin supernatant at 16,500xg for 20 minutes at 4 degrees.
Transfer supernatant to new 50 mL tubes, leaving pellet behind.
Pass supernatant through Steriflip 0.22 micron filter.
Transfer supernatant to pollyallomer ultracentrifuge tubes. Centrifuge at 120,000xg (26,500 RPM with SW32Ti rotor) for 70 minutes at 4 degrees.
Remove supernatant, leaving ~2 cm of media above pellet. Add 5 mL PBS to each tube. Vortex on medium speed for a few seconds. Fill to top of each tube with PBS.
Again, centrifuge at 120,000xg for 70 minutes at 4 degrees.
Aspirate all of supernatant with Pasteur pipet without touching bottom of tube (where pellet is located).
Add 2 μΐ^ Superasin to each tube (SUPERase* In™ RNase Inhibitor from Life technologies).
Add 200 μΐ^ of Lysis/Binding Solution directly to the bottom of each ultracentrifuge tube. Pipet up and down. Transfer the contents of 3 ultracentrifuge tubes to one 1.5 mL Eppendorf tube.
Vortex briefly and place on ice.
Add 60 μΕ of miRNA Homogenate Additive to each tube (1/10 volume of lysate).
Vortex each tube and place on ice for 10 minutes.
Add a 600 μΕ of Acid-Phenol: Chloroform to each tube (volume that is equal to lysate volume before addition of miRNA Homogenate Additive).
Vortex for 30 seconds to mix thoroughly.
Centrifuge at maximum speed for 5 minutes (all spins at room temperature).
While tubes are spinning, transfer some Elution Solution to new 1.5 mL tube and pre-heat
Elution Solution in heating block to 95°C. Also, put filter cartridges into collection tubes.
Carefully remove the upper (aqueous) phase and transfer to a new 1.5 mL tube.
Add 1.25 volumes of 100% ethanol to the transferred aqueous phase.
Pipet up and down and transfer up to 700 μΕ to a filter cartridge. Centrifuge at 10,000 RCF (10,000 RPM) for 15-30 seconds.
Discard flow-through and load the rest of the lysate/ethanol mixture. Centrifuge at 10,000 RCF (10,000 RPM) for 15-30 seconds.
Add 700 μΐ, of miRNA Wash Solution 1 to filter and centrifuge at 10,000 RCF (10,000 RPM) for 15 seconds. Discard flow-through.
Add 500 μΐ, of miRNA Wash Solution 2/3 to filter and centrifuge at 10,000 RCF (10,000 RPM) for 15 seconds. Discard flow-through.
Again, add 500 μΐ, of miRNA Wash Solution 2/3 to filter and centrifuge at 10,000 RCF (10,000 RPM) for 15 seconds. Discard flow-through.
Put filter back in collection tube and spin for 1 minute at 10,000 RCF (10,000 RPM) to remove any residual ethanol from the filter.
Transfer filter cartridge with bound RNA to a new collection tube.
Add 100 μL· of pre-heated Elution Buffer to the center of each filter. Centrifuge for 30 seconds at maximum speed to recover the RNA.
- Store RNA at -80°C.
Example 2: isolation/purification of exosomes, and RNA extraction therefrom (with proteinase and RNase treatment): removal of Protein-RNA Complexes from the Exosome Pellet
[00181] The following protocol was used to isolate RNA from suspension cells such as K562 Cells. This protocol removes RNA-protein complexes from the exosomes. Buffers refer to a mirVana RNA kit (Life technologies).
Execute exosome isolation protocol (see example 1) on 6 x 12 million cells up to the end of first ultracentrifugal spin.
Take off complete supernatant of all six tubes. Resuspend each in 150μΙ. PBS. Label two tubes PI and P2 and to these, add 5 uL of proteinase K (active cone. 500μg/mL).
Incubate all tubes at 37°C for 30 minutes.
Fill tubes with PBS and ultracentrifuge again.
After second spin, take off complete supernatant of all six tubes. Resuspend each in 150μΕ PBS. Label the four unlabeled tubes NT1, NT2, PR1 and PR2.
Add 5 μΕ of proteinase K (active cone. 500 μg/mL) to PR1 and PR2.
Incubate all tubes at 37°C for 30 minutes.
- Add 5μL· PMSF (from 20 mM stock; active cone. ImM) to PR1 and PR2.
Leave all tubes at RT for 10 minutes.
- Add 0.5μί RNase A/Tl (active cone. ~3 μg/mL) to PR1 and PR2.
Incubate all tubes at 37°C for 30 minutes.
Add 2μΕ superasin to each tube. (SUPERase* In™ RNase Inhibitor from Life technologies). Move contents of each tube to 1 Eppendorf tube (total volume should be ~200μΕ per tube due to residual liquid in UC tube), labeled accordingly, and proceed with mirVana RNA isolation using 300μΕ lysis buffer.
Example 3: Chemical and enzymatic treatment of exosomes
To achieve purified exosomes which are essentially free of extra-exosomal nucleic acid-protein complexes, the following procedure is provided. In sum, DNase is added during the preparation, then inactivated prior to lysing all of the vesicles which affords a composition which is
essentially free of extra-exosomal nucleic acid-protein complexes. Briefly, exosome pellet - either at the wash step between ultracentrifugations or after the final ultracentrifugation, as indicated - was resuspended in 50-500 μΐ^ PBS or 0.5% Triton X-100 as indicated. For proteinase treatment, Proteinase K (Life Technologies) was added to a final concentration of 500 μg/mL, and samples were incubated at 37°C for 30 minutes. Treatment was initially done in Proteinase K activity buffer (0.1 M NaCl, 10 mM Tris pH 8, 1 mM EDTA) rather than PBS, however reduced RNA yields from untreated exosomes resuspended in this buffer were observed; thus, all further treatments were performed in PBS. Proteinase was subsequently inactivated by the addition of phenylmethylsulfonyl fluoride (PMSF; Millipore) to 1 mM concentration. For RNase treatment, RNase Cocktail Enzyme Mix (Life Technologies) was added to a final concentration of 1.25 and 50 U/mL RNase A and Tl, respectively, and samples incubated at 37°C for 30 minutes. RNase was inactivated by the addition of SUPERasein (Life Technologies) to 20 U/mL concentration and the addition of > 2 volumes lysis buffer from mirVana miRNA isolation kit (Life Technologies). For DNase treatment, Turbo DNase (Life Technologies) was added to a concentration of 26 U/mL, with Turbo DNase buffer added to IX concentration where indicated, and samples incubated at 37°C for 30 minutes. DNase was inactivated by the addition of EDTA to 15 mM followed by incubation at 75°C for 10 minutes.
Example 4: CD81 and CD63 exosome isolation with Mouse IgG beads (pull down purification)
[00182] Day 0 (or earlier)
1. Mix 50 mL FBS with 500 mL FMDM and 5 mL P/S. Filter through 0.22 μΜ filter. Grow cells.
[00183] Day 1
2. Spin down 72 million cells total in 6 50 mL Falcon tubes at 300xg for 5 minutes.
3. Aspirate media and resuspend each cell pellet in 43 mL AFM-V. Transfer contents of each Falcon tube to T75 flask.
[00184] Day 2
4. After 24 hours, take off all media and divide among 50 mL falcon tubes. Spin at 300xg for 10 minutes at RT.
5. Transfer supernatant to new 50 mL tubes leaving cell pellet behind. Spin at 2000xg for 10 minutes at RT. Transfer supernatant to new 50 mL tubes leaving cell pellet behind.
6. Spin supernatant at 16,500xg for 20 minutes at 4 degrees.
7. Transfer supernatant to new 50 mL tubes, leaving pellet behind.
8. Pass supernatant through Steriflip 0.22 micron filter.
9. Transfer supernatant to pollyallomer ultracentrifuge tubes. Centrifuge at 120,000xg (26,500 RPM with SW32Ti rotor) for 70 minutes at 4 degrees.
10. During this spin, make fresh Isolation Buffer (PBS supplemented with 1 mg/mL BSA, filtered through 0.22μπι filter) and prepare hot plate at 95°C
1 1. Also during first ultracentrifuge spin, prepare beads:
a. resuspend anti -mouse IgG Dynabeads by mixing for >10 min or vortexing gently for 30s.
b. transfer ΙΟΟμΙ. (4x107) beads each into 3 different Biotix 2mL tubes labelled C, 81 and 63.
c. wash the magnetic beads by adding 1 mL of Isolation Buffer. Mix well.
d. place tubes on the magnet for 2 minutes and remove supernatant carefully.
e. remove tubes from magnet and add ΙΟΟμΙ. isolation buffer.
f. To 81, add 20μΙ, (4μ¾) anti-human CD81 antibody, clone 1.3.3.22
g. To 63, add 8μΙ. (4μg) anti-human CD63 antibody, clone h5c6
h. To C, add 4μΙ. (4μg) Ctrl antibody (mouse mAb mCherry, 1C51)
i. Incubate on rotating rack in cold room until end of isolation (~3 hours)
12. Remove supernatant, leaving ~2 cm of media above pellet. Add 5 mL PBS to each tube. Vortex on medium speed for a few seconds. Fill to top of each tube with PBS.
13. Again, centrifuge at 120,000xg for 70 minutes at 4 degrees.
14. Aspirate all of supernatant with Pasteur pipet without touching bottom of tube (where pellet is located).
15. Add 80μL PBS to each tube and let sit for -15 minutes.
16. Resuspend and pool all tubes into a biotix tube labelled P. Measure total volume, should be ~600μL due to 20μL residual liquid after aspiration.
17. Retrieve bead tubes from cold room, spin briefly and place on magnet.
18. Do 2X 900μL washes in isolation buffer to remove excess antibody.
19. Split pooled pellets 1/6 into each of the biotix tubes. Add isolation buffer to each bead tube to 200μL total volume. Put all on rotating rack in cold room overnight (16 hours)
20. Add 33μΤ 4X SB (133μΤ total volume) to remaining ΙΟΟμΙ. of exosomes in P and boil at 95° for 5 min. Place immediately on ice and freeze at -80°
[00185] Day 3
21. After 16h, centrifuge all tubes from cold room briefly to collect samples.
22. Place C, 81 and 63. on magnet for two minutes. Collect supernatants and store in new tubes labelled C-FT, 81-FT, 63-FT respectively.
23. Wash beads in each tube with 500μΙ. Isolation Buffer. Leave 2 min on magnet before collecting wash supernatants. Add each wash to respective FT tube. Store at 4°C.
24. Add 133μί IX Sample Buffer to C, 81 and 63. and boil at 95° for 5 min. Place immediately on ice for 5 min, then place on magnet for 2 min, collect supernatants and freeze at -80° in new tubes.
25. Assemble all flow-through tubes and add each to its own ultracentrifuge tube. Fill tubes with PBS and spin 180 minutes at 120 OOOg-.
26. After ultracentrifugation, remove supernatant entirely, add 80μΙ. PBS and leave pellets for -15 minutes.
27. Resuspend (should be about ΙΟΟμΙ.) move to labelled biotix tubes and add 33μΙ. 4X Sample Buffer to each.
28. Boil at 95°C for 5 min. Place immediately on ice and freeze at -80°C.
Example 5: analysis of RNA contents of exosomes as a function of exosome purification method
- size distribution
[00186] Figure 1 shows graph of RNA fluorescence unit (FU) plotted against RNA size (nt), wherein "final spin" refers to the final centrifugation step.
[00187] The results allow comparison and validation of corresponding purification methods.
Example 6: analysis of RNA contents of exosomes as a function of exosome purification method
- electron microscopy imaging
[00188] Figures 2A-D show electron microscopy (EM) photographs of exosome preparations, wherein "no treatment" refers to a protocol according to example 1; "after spins" refers to a protocol according to example 2; "between spins" denotes a protocol according to example 1, except that additional proteinase treatment occurred between the two ultracentrifugation steps.
[00189] The results show that the method used for exosome preparation affects exosome integrity. EM data allow comparison and validation of exosome purification methods.
[00190] Vesicles Electron Microscopy Prep
Stain prep
Weigh 60 mg powdered Uranyl Formate into clean lOmL beaker with stir stick in radioactivity hood.
Move this to the stir plate (make sure stirring is OFF) and cover with the big beaker with tin foil.
Fill another clean 10 mL beaker with 3 mL water and heat this up (not on the same hot plate) until it's super boiling/as hot as possible. Ensure not to lose too much water to evaporation. Quickly pour this into other beaker with powder and start stirring. Stir vigorously for 2 minutes protected by tin foil.
Using BD 5 mL syringe (with black lining inside, not the normject ones) suck up stain and then using corning 0.45 μπι filter to filter it, deposit into 15 mL falcon tube. Label and wrap in tin foil.
Wipe beaker with Kim wipe, throw this, gloves, syringe and filter into radioactive waste Sample prep
Good sample concentration is in the range of 1 nM
Use special tweezers to put grids on parafilm-covered slide, dark shiny side up.
Put slide in glow discharger, close lid carefully, hit start.
Pick up grids with tweezers at the edge, don't pinch too hard. Put tweezers down (still holding grid) and pipet 3.5 μΕ of sample onto it. Leave 1 minute. This time changes depending on salt concentration etc.
Wick away liquid with a piece of filter paper
Add 3.5 μΕ stain, leave 30 seconds, then wick away this as well.
Find a holder and carefully put grids down with dark side up, use this to carry to EM room
Example 7: analysis of RNA contents of exosomes as a function of exosome purification method - qRT-PCR analysis - validation of the purification method
[00191] Figure 3 shows qRT-PCR data of exosome RNA for 4 mRNAs that were previously found in exosome RNA-Seq data.
[00192] The qRT-PCR is performed for various conditions of exosome purification methods. All runs are normalized to RNA from the 'regular' exosome isolation (Example 1). The conditions for exosome purification are as follows :
(1) RNase treatment only
(which is expected not be sufficient if RNA is also protected by proteins as was shown for extracellular microRNAs in Arroyo et al, Proc Natl Acad Sci U S A. 201 1 Mar 22; 108(12):5003 - 8. doi: 10.1073/pnas. l019055108. Epub 201 1 Mar 7.201 1 ; Turchinovich et al Nucleic Acids Res. 201 1 Sep l ;39(16):7223-33. doi: 10.1093/nar/gkr254. Epub 201 1 May 24.)
(2) proteinase + RNase treatments after spins
(protocol as per Example 2; also see below)
(3) proteinase treatment (between spins)
This is the method described in previous publications such as Valadi et al, Nat Cell Biol. 2007 Jun;9(6):654-9. Epub 2007 May 7. As shown by EM (see above and Fig. 2d), this method compromises exosome integrity.
In accordance with the EM data, the qRT-PCR results show a decrease in mRNA levels.
(4) Triton + RNase treatments
This is a control run, wherein where Triton treatment is used to break open the vesicles, and samples are further treated with RNase. The results show drastic reduction in levels of mRNA.
[00193] R/T isolation for qPCR
1. Execute exosome isolation protocol on 6 x 12 million cells up to the end of second
ultracentrifugal spin.
2. Take off complete supernatant of all six tubes.
3. Resuspend 4 pellets in 150μί PBS. Label them NT1, NT2, Rl and R2.
4. Resuspend other 2 pellets in 3% Triton. Label them TR1 and TR2,
5. Add 0.5μί RNase A/Tl (active cone. ~3μg/mL) to Rl, R2, TR1 and TR2,
6. Incubate all tubes at 37°C for 30 minutes.
7. Add 2 iL superasin to each tube (SUPERase* in™ RNase Inhibitor from f ife
technologies).
8. Proceed with mirVana RNA isolation using 300μΕ lysis buffer (mirVana RNA kit from Life technologies).
[00194] P/R isolation for qPCR
1. Execute exosome isolation protocol on 6 x 12 million cells up to the end of first ultracentrifugal spin.
2. Take off complete supernatant of all six tubes. Resuspend each in 150μΙ. PBS. Label two tubes PI and P2 and to these, add 5 μΐ^ of proteinase K (active cone. 50C^g/mL).
3. Incubate all tubes at 37°C for 30 minutes.
4. Fill tubes with PBS and ultracentrifuge again.
5. After second spin, take off complete supernatant of all six tubes. Resuspend each in 150
PBS. Label the four unlabeled tubes NT1, NT2, PR1 and PR2.
6. Add 5 uL of proteinase K (active cone. 500 μg/mL) to PR1 and PR2.
7. Incubate all tubes at 37°C for 30 minutes.
8. Add 5μΙ, PMSF (from 20 mM stock; active cone. 1 mM) to PR1 and PR2.
9. Leave all tubes at RT for 10 minutes.
10. Add 0.5μί RNase A/Tl (active cone. ~3μg/mL) to PR1 and PR2.
1 1. Incubate all tubes at 37°C for 30 minutes.
12. Add 2 μΐ^ superasin to each tube (SUPERase* In™ RNase inhibitor from Life
technologies).
13. Proceed with mirVana RNA isolation using 300 μΐ^ lysis buffer (mirVana RNA kit from Life technologies).
[00195] qRT-PCR
1. After collecting cell and exosome RNA, dilute 100 ng cell RNA to 100 μΐ, with H20.
Add 2 μΐ^ Turbo DNase (Lifetech), 2 μΐ^ Superasin, and 10 μΐ^ DNase buffer to each sample.
2. Incubate at 37°C for 30 minutes.
3. Clean and concentrate using Zymo RNA Clean and Conncentrate kit according to
instructions and elute in 16 μΐ^ H20.
4. Perform reverse transcription using Superscript VILO cDNA Synthesis kit with 14 μΐ^ of RNA in a 20 μΐ^ reaction.
5. Perform qPCR using KAPA Fast qPCR SYBR mix (KAPA Biosystems) with 2 μΐ, of cDNA per reaction.
[00196] The following primers were used:
SRP 14-F GGGT ACTGTG G AGGGCTTTG
SRP14-R AGGAGGTTTG A AT A AGC C ATC TG A
B2M-F GTATGCCTGCCGTGTGAAC
B2M-R AAAGCAAGCAAGCAGAATTTGG
ACTB-F CGGCATCGTCACCAACTG
ACTB-R AACATGATCTGGGTCATCTTCTC
GAPDH-F GGTGGTCTCCTCTGACTTCAACA
GAPDH-R GTTGCTGTAGCCAAATTCGTTGT
Example 8: correlation of exosomal RNA content with cellular RNA content
[00197] Figures 4A-C show RNA-Seq data, showing that the RNA profile of mRNAs in exosomes reflects that of the donor cells. This indicates that the exosomes provide an accurate snapshot of the transcriptome of the cells they come from. Exosome preparation was according to the standard exosome isolation procedure (as in Example 1, without proteinase/RNase).
[00198] RNA-Seq
1. After collecting cell and exosome RNA, dilute 100 ng cell RNA to 100 μΐ. with H20.
Add 2 μΐ. Turbo DNase (Lifetech), 2 μΐ. Superasin, and 10 μΐ. DNase buffer to each sample.
2. Incubate at 37°C for 30 minutes.
3. Clean and concentrate using Zymo RNA Clean and Conncentrate kit according to
instructions and elute in 10 μΐ. H20.
4. Perform a PolyA Selection using Dynabeads mRNA Purification kit (Lifetech).
5. Proceed with RNA-Seq library prep protocol as described in: Perturbation of m6A
writers reveals two distinct classes of mRNA methylation at internal and 5' sites.
Schwartz S, Mumbach MR, Jovanovic M, Wang T, Maciag K, Bushkin GG, Mertins P, Ter-Ovanesyan D, Habib N, Cacchiarelli D, Sanjana NE, Freinkman E, Pacold ME, Satija R, Mikkelsen TS, Hacohen N, Zhang F, Carr SA, Lander ES, Regev A. Cell Rep. 2014 Jul 10;8(l):284-96. doi: 10.1016/j .celrep.2014.05.048. Epub 2014 Jun 26.
Example 9: exosome-mediated RNA transfer experiment between HEK293 and K562 cells
[00199] Figures 5A-K show fluorescence imaging of cells using EUclick chemistry.
[00200] This example shows results from a system that allows detection of potential endogenous RNA transfer between cells in a co-culture system by feeding donor cells with a
modified nucleotide (5-ethynyl uridine, EU) that gets incorporated into its RNA and then co- culturing donor cells with unlabeled acceptor cells.
[00201] Click Chemistry is then used to detect RNA with the modified nucleotides by conjugate of a fluorophore to the EU. These results suggest the presence of RNA transfer. The white arrows point to spots of transferred RNA in the HEK293 acceptor cells. The green arrows just show the donor K562 cells.
[00202] EU-RNA Transfer Experiments
- K562 and HEK293 cells were both obtained from ATCC.
K562 cells were incubated with 5-ethynyl uridine (Lifetech) diluted to 2 mM for 24 hours.
K562 and HEK 293 cells were co-cultured for 24 hours.
Cells were imaged using Click-IT RNA Alexa Fluor 594 Imaging kit (Lifetech)
Example 10: exosome-mediated RNA transfer experiment between co-cultured cell lines.
[00203] Figures 6A-D show principle and results of an experiment to assess possible exosome mediated RNA transfer between co-cultured cell lines.
[00204] This example illustrates a way to detect potential RNA transfer using unlabeled RNA. The principle is to co-culture mouse and human cells, separate them back out and use regular RNA-Seq to detect mouse transcripts in human cells. This technique relies on a principle similar to that of Example 7, but without using labeled nucleotides. Using this method, it was possible to detect some RNAs transferred but the strongest signal came from two mouse endogenous retrovirus RNAs (labeled as Gm3168 and Ctse).
[00205] Mouse Human RNA Transfer Experiments
Human K562 and Mouse RAW Macrophage cells were both obtained from ATCC.
K562 cells were infected with virus expressing GFP.
K562 cells were FACS sorted to all be GFP positive.
K562 GFP cells were co-cultured with Mouse RAW cells for 24 hours or 0 hours (as a control).
K562 GFP cells were FACS sorted for GFP positive cells to separate from Mouse cells after 24 hour co-culture (2 biological replicates: Mix 1 and Mix 2). The 0 hour co-culture was also sorted, as well as a control of just K562 cells that never interacted with mouse cells. RNA was extracted using MirVana kit (Lifetech),
- 200 ng cell RNA to 100 μL· with H20. Add 2 μL· Turbo DNase (Lifetech), 2 μL· Superasin (Life technologies), and 10 μΐ. DNase buffer to each sample.
Incubation at 37°C for 30 minutes.
Clean and concentrate using Zymo RNA Clean and Concentrate kit according to instructions and elute in 10 μΐ. H20.
PolyA Selection using Dynabeads mRNA Purification kit (Lifetech).
Proceed with RNA-Seq library prep protocol as described in: Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Schwartz S, Mumbach MR, Jovanovic M, Wang T, Maciag K, Bushkin GG, Mertins P, Ter-Ovanesyan D, Habib N, Cacchiarelli D, Sanjana NE, Freinkman E, Pacold ME, Satija R, Mikkelsen TS, Hacohen N, Zhang F, Carr SA, Lander ES, Regev A. Cell Rep. 2014 Jul 10;8(l):284-96. doi: 10.1016/j .celrep.2014.05.048. Epub 2014 Jun 26.
Exosome Key Results.
[00206] Figures 7A-D show poly A selected mRNA from two replicates of K562 cells and their exosomes was compared using RNA-Seq. The bottom two panels show that cell and exosome mRNA is correlated in expression for protein-coding genes.
[00207] Applicants have sequenced the mRNA of exosomes from K562 cells and compared the RNA profile of the donor cells to that of the exosomes. Applicants have found that the mRNA profiles of exosomes reflects the trasnscriptome of the donor cells. Thus, using exosomes as a non-invasive read-out of the transcriptome of inaccessible cell types is possible.
[00208] Figure 8 illustrates mRNA in exosome pellet following enzymatic treatments. RNA from untreated exosomes and proteinase/RNase treated exosomes was compared using qRT-PCR for four mRNAs. There was very little or no change, indicating that the RNA is inside. As a control, vesicles with the detergent Triton were lysed and then treated with RNase.
[00209] Figure 9 illustrates Poly A enriched mRNA from untreated exosomes and proteinase/RNAse treated exosomes was compared using RNA-Seq. The mRNA is strongly correlated, indicating that the mRNA isolated via ultracentrifugation in the exosome pellet is inside the vesicles.
[00210] Applicants have confirmed that the mRNA in the exosome isolated product is really inside exosomes after developing a protocol to degrade all RNAs not in vesicles by enzymatic
treatment with proteinase and then RNAse. Applicants find a very high correlation between the mRNA profiles in the untreated exosome pellet and the proteinase/RNAse treated pellet, indicating the sequenced mRNA is really inside the vesicles. Applicants have confirmed these results through qRT-PCR as well.
[00211] Figure 10 illustrates targeted pull down exosome subpopulations based on their protein marker using antibody conjugated magnetic beads. CD63 is a glycosylated protein between 30 and 60 kDa. CD81 shows up as a distinct band between 20 and 30 kDa. mCherry is used as a non-specific control. This protocol/technique was developed to isolate specific exosome subpopulations by specific membrane proteins using antibody-conjugated magnetic beads. Further, the technique has been validated in K562 exosomes using the canonical exosome markers CD63 and CD81.
[00212] Figure 11 illustrates exosomes which were isolated from human CSF and mRNA for four genes (detected by qRT-PCR.) Cell RNA is used as a comparison. Two methods of isolating exosomes from CSF were demonstrated: one by running through 0.22 micron filter pelleting at 120,000g for 2 hours (CSF pellet) and one by extracting RNA directly from CSF after running through 0.22 micron filter without pellet. Similar results were observed by both methods.
Additional Examples
[00213] Mass spectrometry of exosomes from iPS cells and iPS-derived neurons is conducted to find neurons specific membrane proteins found on exosomes. These markers are verified by western blots in iPS and neurons exosomes.
[00214] RNA-Seq of exosomes from K562 cells are isolated using CD81 or CD63 antibody- conjugated magnetic beads. The RNA-Seq profiles of exosome subpopulation are compared to the RNA profiles of total exosomes.
[00215] RNA-Seq of mRNA from both cells and exosomes from iPS cells and iPS-derived neurons.
[00216] RNA-Seq of exosomes from iPS and neuron exosomes isolated using antibody- conjugated magnetic beads to enrich for exosomes expressing the cell type specific proteins. The RNA-Seq profiles of these exosome subpopulations are compared to the RNA profiles of total exosomes from each cell type.
[00217] In vitro proof of principle by mixing experiments where Applicants mix cell culture media from iPS cells and neurons and isolate exosomes from the mixed media. Applicants isolate exosomes from the original cell type using antibody-conjugated magnetic beads using the cell type specific markers. Applicants isolate RNA from these exosome subpopulations and perform RNA-Seq to confirm reconstruction of the transcriptome of the original cell type (iPS cells or neurons).
[00218] Applicants isolate exosomes from human cerebrospinal fluid (CSF) and perform RNA-Seq.
[00219] Applicants enrich for neuron specific exosomes in CSF using antibody-conjugated magnetic beads or a microfluidic device with immobilized antibodies. Applicants then sequence the RNA from these neuron-derived exosomes and to observe enriched expression of neuron- specific genes relative to total CSF exosomes.
* * *
[00220] Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.
Claims
1. A method for the isolation of exosomes from a biological sample, said method comprising:
(a) providing a biological sample comprising exosomes from a cell population,
(b) preparing an exosome-enriched fraction from the biological sample of step (a),
(c) subjecting the exosome-enriched fraction of step (b) to a treatment with a proteinase.
2. A method for the purification of exosomes from a biological sample, said method comprising:
(a) providing a biological sample comprising exosomes from a cell population,
(b) preparing an exosome-enriched fraction from the biological sample of step (a),
(c) subjecting the exosome-enriched fraction of step (b) to a treatment with a proteinase.
3. The method of any one of the preceding claims, wherein the proteinase of step (c) is one or more independently selected from serine proteases, threonine proteases, cysteine proteases, aspartate proteases, glutamic acid proteases and metalloproteases.
4. The method of any one of the preceding claims, wherein step (c) comprises a treatment with a proteinase and subsequent inactivation thereof.
5. The method of the preceding claim, wherein proteinase inactivation is performed with one or more protease inhibitor(s).
6. The method of any one of the preceding claims, wherein the proteinase of step (c) is proteinase K.
7. The method of any one of the preceding claims, wherein step (b) comprises one or more centrifugation steps, so as to remove live cells, dead cells and larger cellular debris from the biological sample of step (a).
8. The method of any one of the preceding claims, wherein step (b) comprises one or more filtration steps.
9. The method of the preceding claim, wherein the filtration step comprises filtration with a submicron filter.
10. The method of the preceding claim, wherein the submicron filter is a 0.22 micron filter.
11. The method of any one of the preceding claims, wherein step (b) comprises one or more centrifugation steps, so as to remove live cells, dead cells and larger cellular debris from the biological sample of step (a), followed by a filtration step with a submicron filter.
12. The method of any one of the preceding claims, wherein step (b) comprises one or more ultracentrifugation steps.
13. The method of any one of the preceding claims,
wherein step (b) comprises:
(b-1) filtrating with a submicron filter,
(b-2) performing a first ultracentrifugation step, so as to provide a first exosome-enriched fraction,
(b-3) washing the exosome-enriched fraction of step (b-2), and
(b-4) performing a second ultracentrifugation step of the washed exosome-enriched fraction of step (b-3).
14. The method of any one of claims 12-13, wherein step (c) is performed after the final ultracentrifugation step of step (b).
15. The method of any one of the preceding claims, wherein step (c) comprises a treatment with proteinase K and subsequent inactivation thereof.
16. The method of the preceding claim, wherein the inhibitor is diisopropyl fluorophosphate (DFP) or phenyl methane sulphonyl fluoride (PMSF).
17. The method of any one of the preceding claims, further comprising:
(d) subjecting the proteinase K-treated fraction of step (c) to a treatment with an RNase.
18. The method of the preceding claim, wherein the RNase is one or more independently selected from RNase A, B, C, 1, and Tl .
19. The method of the preceding claim, wherein the RNase is RNAse A/Tl .
20. The method of any one of claims 17-19, wherein step (d) comprises a treatment with RNase and subsequent inactivation thereof.
21. The method of the preceding claim, wherein inactivation of RNase is comprises a treatment with one or more RNase inhibitor(s).
22. The method of the preceding claim, wherein the RNase inhibitor is selected from protein-based RNase inhibitors.
23. The method of any one of the preceding claims, wherein the method provides exosomes which are essentially free of extra-exosomal material.
24. The method of any one of the preceding claims, wherein the method provides exosomes which are essentially free of extra-exosomal nucleic acid-protein complexes.
25. The method of any one of the preceding claims, wherein the method provides exosomes which are essentially free of extra-exosomal RNA-protein complexes.
26. The method of any one of the preceding claims, wherein the method further comprises after step (c) or (d) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
27. The method of any one of the preceding claims, wherein the cell population comprises one or more cell types, 2 or more cell types, preferably 3 or more cell types, 4 or more cell types or 5 or more cell types.
28. The method of any one of the preceding claims, wherein the method isolates or purifies cell type-specific exosomes, or cell-subtype-specific exosomes.
29. The method of any one of the preceding claims, wherein the one or more cell type comprises cells derived from the endoderm, cells derived from the mesoderm, or cells derived from the ectoderm.
30. The method of claim 29, wherein cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut.
31. The method of claim 29, wherein cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells).
32. The method of claim 29, wherein cells derived from the ectoderm, comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland.
33. The method of claim 32, wherein cells from the central nervous system and the peripheral nervous system comprise neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes.
34. The method of claim 33, wherein neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
35. The method of any one of claims 27 to 29, wherein the one or more cell-type is a cancer cell or a circulating tumor cell (CTC), such as cancer cell or CTC derived from any cell- types or cell subtypes as defined in claims 29 to 34.
36. The method of any one of claims 26 to 35, wherein the prey exosome biomarker comprises a surface biomarker.
37. The method of claim 36 wherein the prey exosome biomarker comprises a membrane protein.
38. The method of claim 36 or 37 wherein the prey biomarker is selected from the group comprising proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M; preferably the prey exosome biomarker is FLRT3 and/or L1CAM.
39. The method of any one of claims 26 to 38, wherein the bait molecule comprises a protein and preferentially an antibody, such as a monoclonal antibody or RNA aptamer.
40. The method of any one of claims 26 to 39, wherein the bait molecule is recognized by an affinity ligand.
41. The method of claim 40, wherein the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody.
42. The method of claim of any one of claims 26 to 41, wherein the bait molecule or the affinity ligand is immobilized on a solid substrate.
43. The method of claim 42, wherein the solid substrate is selected from a purification column, a microfluidic channel or beads, such as magnetic beads.
44. The method of claim any one of claim 26 to 43, wherein the purification comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification.
45. The method of any one of the preceding claims, wherein the biological sample comprises a body fluid or is derived from a body fluid, wherein the body fluid was obtained from a mammal.
46. The method of the preceding claim, wherein the body fluid is selected from amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
47. A method for the isolation of exosomes from a cell population, comprising steps of:
(1) providing isolated exosomes from a biological sample comprising exosomes from said cell population,
(2) performing on the isolated exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
48. A method for the purification of exosomes from a cell population, comprising steps of:
(1) providing purified exosomes from a biological sample comprising exosomes from said cell population,
(2) performing on the purified exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
49. The method of claim 47 or 48, wherein step (1) comprises the method for the isolation or the purification of exosomes from a biological sample as defined in claims 1 to 25.
50. The method of any one claims 47 to 49, wherein the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types or 5 or more cell types.
51. The method of any one claims 47 to 50, wherein the method isolates or purifies cell type-specific exosomes, or cell-subtype-specific exosomes.
52. The method of any one of claims 47 to 51, wherein the one or more cell type comprises from cells derived from the endoderm, cells derived from the mesoderm, and cells derived from the ectoderm.
53. The method of claim 52, wherein cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut.
54. The method of claim 52, wherein cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells).
55. The method of claim 52, wherein cells derived from the ectoderm, comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland.
56. The method of claim 55, wherein cells from the central nervous system and the peripheral nervous system comprises neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes.
57. The method of claim 56, wherein neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
58. The method of any one of claims 50 to 52, wherein the cell-type is a cancer cell or a circulating tumor cell (CTC), such as a cancer cell or a CTC derived from any cell -types or cell subtypes as defined in claims 52 to 57.
59. The method of any one of claims 47 to 58, wherein the prey exosome biomarker comprises a surface biomarker.
60. The method of claim 59, wherein the prey exosome biomarker comprises a membrane protein.
61. The method of any of claim 59 or 60, wherein the prey biomarker is selected from the group comprising proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M; preferably the prey exosome biomarker is FLRT3 and/or L1CAM.
62. The method of any one of claims 47 to 61, wherein the bait molecule comprises a protein and more preferentially an antibody, such as a monoclonal antibody or RNA aptamer.
63. The method of any one of claims 47 to 62, wherein the bait molecule is recognized by an affinity ligand.
64. The method of claim 63, wherein the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody.
65. The method of any one of claims 47 to 64, wherein the bait molecule or the affinity ligand is immobilized on a solid substrate.
66. The method of claim 65 wherein the solid substrate is selected from a purification column, a microfluidic channel or beads, such as magnetic beads.
67. The method of any one of claims 47 to 66, wherein the one or more purification steps comprises a microfluidic affinity based purification, a magnetic based purification, a pulldown purification or a fluorescence activated sorting-based purification.
68. A method for the preparation of exosomal RNA from a biological sample, said method comprising:
(i) providing a biological sample comprising exosomes from a cell population,
(ii) preparing purified exosomes from the biological sample of step (i),
(iii) extracting RNA from the purified exosomes of step (ii).
69. The method of claim 68, wherein step (ii) comprises the method of any one of claims 1-46.
70. The method of any one of claim 68 or 69, wherein the purified exosomes prepared at step (ii) are exosomes from a single cell type or from a single cell-subtype.
71. A method for the preparation of exosomal RNA of a cell population, comprising steps of
(1) providing purified exosomes from a biological sample comprising exosomes from said cell population,
(2) performing on the purified exosomes of step (1) one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker, and
(3) extracting RNA from the purified exosomes of step (2).
72. The method of claim 71 wherein step (1) comprises the method of any one of claims 1-25.
73. The method of any one of claim 71 or 72 wherein step (2) is performed as defined in any one of claims 26 to 46 or as defined in any one of claims 47 to 67..
74. The method of any one of claims 71to 73, wherein the exosomal RNA is total exosomal RNA.
75. The method of any one of claims 71 to 74, wherein the exosomal RNA comprises exosomal messenger RNA.
76. The method of any one of claims 71-75, wherein the exosomal RNA is total exosomal messenger RNA.
77. The method of any one of claims 71 to 76 wherein the exosomal RNA is exosomal RNA from single cell type exosomes or single cell subtype exosomes.
78. Use of a proteinase in the purification of exosomes from a biological sample.
79. Use of a proteinase and of an RNase in the purification of exosomes from a biological sample.
80. Use of a proteinase in the purification of an ultracentrifugated exosome- containing sample.
81. Use of a proteinase and of an RNase in the purification of an ultracentrifugated exosome-containing sample.
82. Use according to any one of claims 78-81, wherein the proteinase is proteinase K.
83. Use according to any one of claims 78-82, wherein the ultracentrifugated exosome-containing sample is a washed ultracentrifugated exosome-containing sample.
84. Use according to any one of claims 78-83, wherein the ultracentrifugated exosome-containing sample is a washed ultracentrifugated exosome-containing sample.
85. The method or use of any one of the preceding claims, wherein the biological sample is a bodily fluid or is derived from a bodily fluid, wherein the bodily fluid was obtained from a mammal.
86. The method or use of the preceding claim, wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
87. The method or use of any one of the preceding claims, wherein the cell population is a population of cells of the same cell type.
88. The method or use of any one of the preceding claims, wherein the cell population is a population of cells of different cell types.
89. The method or use of any one of the preceding claims, wherein the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types, or 5 or more cell types.
90. The method or use of any one of the preceding claims, wherein the biological sample comprises cultured cells.
91. The method or use of any one of the preceding claims, wherein the biological sample comprises cells cultured in vitro.
92. The method or use of any one of the preceding claims, wherein the biological sample comprises cells cultured ex vivo.
93. The method or use of any one of the preceding claims, wherein the biological sample is a sample obtained by liquid biopsy.
94. The method or use of any one of the preceding claims, wherein the biological sample comprises a cell type selected from cells types present in amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit.
95. An exosome preparation obtainable with the method or the use of any one of the preceding claims.
96. A composition comprising exosomes, wherein the composition is essentially free of extra-exosomal material.
97. A composition comprising exosomes, wherein the composition is essentially free of extra-exosomal nucleic acid-protein complexes.
98. A composition comprising exosomes, wherein the composition is essentially free of extra-exosomal RNA-protein complexes.
99. A composition comprising cell type specific exosomes or cell subtype specific exosomes.
100. The composition of claim 99, wherein the exosomes are specific for one or more cell types or cell subtypes.
101. The composition of claim 100 comprising purified exosomes, wherein said purified exosomes are exosomes from a single cell-type or of a single cell subtype.
102. A method for the determination of cellular RNA content in a cell population, said method comprising:
(a) providing a biological sample comprising exosomes from said cell population,
(b) preparing purified exosomes from the sample of step (a),
(c) extracting RNA from the purified exosomes of step (b), so as to provide exosomal
RNA,
(d) analyzing the exosomal RNA extracted at step (c),
(e) estimating, as a function of the result from step (d), the cellular RNA content in the cell population.
103. The method of the preceding claim, wherein step (b) comprises the method for the purification of exosomes as disclosed in any of claims 1 to 46.
104. The method of claim 102 or 103, wherein step (B) comprises the method for the purification of exosomes from a cell population as disclosed in any of claims 48 to 67.
105. A method for the determination of cellular RNA content of a cell population, said method comprising:
(a) providing a biological sample comprising exosomes from said cell population;
(b) preparing purified exosomes from the sample of step (a);
(d) extracting RNA from the purified exosomes of step (b), so as to provide exosomal
RNA;
(d) analyzing the exosomal RNA extracted at step (c);
(e) estimating, as a function of the result from step (d), the cellular RNA content in the cell population
wherein step (b) further comprises performing on the purified exosomes one or more purification steps based on the affinity of a bait molecule for a prey exosome biomarker.
106. The method of claim 105, wherein step (b) comprises the method for the isolation or the purification of exosomes from a biological sample as defined in claims 1 to 25.
107. The method of claims 105 or 106, wherein the cell population comprises one or more cell types, 2 or more cell types, 3 or more cell types, 4 or more cell types, 5 or more cell types.
108. The method of any one claims 105 to 107, wherein the method isolates or purifies cell type-specific exosomes, or cell subtype-specific exosomes.
109. The method of any one of claims 105 to 108, wherein the cell type comprises cells derived from the endoderm, cells derived from the mesoderm or cells derived from the ectoderm.
110. The method of claim 109, wherein cells derived from the endoderm comprise cells of the respiratory system, the intestine, the liver, the gallbladder, the pancreas, the islets of Langerhans, the thyroid or the hindgut.
111. The method of claim 109, wherein cells derived from the mesoderm comprise osteochondroprogenitor cells, muscle cells, cells from the digestive systems, renal stem cells, cells from the reproductive system, bloods cells or cells from the circulatory system (such as endothelial cells).
112. The method of claim 109, wherein cells derived from the ectoderm, comprise epithelial cells, cells of the anterior pituitary, cells of the peripheral nervous system, cells of the neuroendocrine system, cell of the teethes, cell of the eyes, cells of the central nervous system, cells of the ependymal or cells of the pineal gland.
113. The method of claim 112, wherein cells from the central nervous system and the peripheral nervous system comprises neurons, Schwann cells, satellite glial cells, oligodendrocytes or astrocytes.
114. The method of claim 113, wherein neurons comprise interneurons, pyramidal neurons, gabaergic neurons, dopaminergic neurons, serotoninergic neurons, glutamatergic neurons, motor neurons from the spinal cord, or inhibitory spinal neurons.
115. The method of any one of claims 107 to 109, wherein the cell-type is a cancer cell or a circulating tumor cell (CTC), such as a cancer cell or a CTC derived from any cell-types or cell subtypes as defined in claims 107 to 114.
116. The method of any one of claims 105 to 115, wherein the prey exosome biomarker comprises a surface biomarker.
117. The method of claim 116, wherein the prey exosome biomarker comprises a membrane protein.
118. The method of claim 116 or 117, wherein the prey exosome biomarker is selected from the group comprising proteins as per Table D, column G; or proteins as per Table D, column H; or proteins as per Table D, column I; or proteins as per Table D, column J; or proteins as per Table D, column K; or proteins as per Table D, column L; or proteins as per Table D, column M; preferably the prey exosome biomarker is FLRT3 and/or L1CAM.
119. The method of any one of claims 105 to 118, wherein the bait molecule comprises a protein and more preferentially an antibody, such as a monoclonal antibody or RNA aptamer.
120. The method of any one of claims 105 to 119, wherein the bait molecule is recognized by an affinity ligand.
121. The method of claim 120, wherein the affinity ligand comprises a protein, a peptide, a divalent metal-based complex or an antibody.
122. The method of claim 120 or 121, wherein the bait molecule or the affinity ligand is immobilized on a solid substrate.
123. The method of claim 122, wherein the solid substrate is selected from a purification column, a microfluidic channel or beads such as magnetic beads.
124. The method of any one of claims 105 to 123, wherein the purification is comprises a microfluidic affinity based purification, a magnetic based purification, a pull-down purification or a fluorescence activated sorting-based purification.
125. The method of any one of claims 102-124, wherein step (e) is performed based on a predicted correlation between exosomal RNA content and cellular RNA content.
126. The method of any one of claims 102-125, wherein said determination comprises a qualitative determination.
127. The method of any one of claims 102-126, wherein said determination comprises a quantitative determination.
128. The method of any one of claims 102-127, wherein said quantitative determination comprises determination of relative abundance of two RNAs.
129. The method of any one of claims 102-128, wherein said determination comprises determination of mRNA profiles.
130. The method of any one of claims 102-129, wherein said RNA comprises messenger RNA (mRNA).
131. The method of any one of claims 102-160, wherein said RNA comprises micro RNA (miRNA).
132. The method of any one of claims 102-131, wherein said RNA comprises long non-coding RNA (IncRNA).
133. The method of any one of claims 102-132, wherein step (D) comprises a qualitative determination.
134. The method of any one of claims 102-133, wherein step (D) comprises a quantitative determination.
135. The method of any one of claims 102-134, wherein step (D) comprises RNA sequencing (RNA seq).
136. The method of any one of claims 102-135, wherein step (D) comprises array analysis.
137. The method of any one of claims 102-136, wherein step (D) comprises reverse transcription polymerase chain reaction (RT-PCR).
138. The method of claim 137, wherein step (d) comprises quantitative reverse transcription polymerase chain reaction (qRT-PCR).
139. The method of any one of claims 102-138, wherein step (d) comprises analyzing one or more sequence/s of interest.
140. The method of claim 139, comprising testing for the presence or absence of said sequence/s of interest.
141. The method of claim 140, wherein step (d) comprises analyzing for one or more allelic variants of a sequence of interest.
142. The method according to claims 102-141, wherein step (d) comprises testing for presence or absence of said allelic variants.
143. The method of any one of claims 102-142, wherein step (d) comprises genome- wide analysis.
144. The method of any one of claims 102-143, wherein step (d) comprises transcriptome profiling.
145. The method of any one of claims 102-144, wherein the determination is time- lapse.
146. The method of any one of claims 102-145, wherein the cell population is a population of cells of the same cell type.
147. The method of any one of claims 102-146, wherein the cell population is a population of cells of different cell types.
148. The method of any one of claims 102-147, wherein the biological sample comprises cultured cells.
149. The method of any one of claims 102-148, wherein the biological sample comprises cells cultured in vitro.
150. The method of any one of claims 102-149, wherein the biological sample comprises cells cultured ex vivo.
151. The method of any one of claims 102-150, wherein the biological sample is a sample obtained by liquid biopsy.
152. The method of any one of claims 102-151, wherein the biological sample comprises a cell type selected from blood, epithelia, muscle and neural cell types.
153. The method of any of claims 102-152, wherein the biological sample is obtained from a body fluid selected from amniotic fluid, aqueous humor, vitreous humor, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof.
154. The method of any one of claims 102-153, wherein the cell population of step (a) is isolated as a subpart of a larger initial cell population.
155. The method of any one of claims 102-154, wherein the cell population of step (a) is obtained from a body fluid and isolated by immuno-magnetic separation.
156. The method of any one of any one of claims 102-155, for use in diagnosis.
157. The method of any one of claims 102-156, for use in prognosis.
158. The method of any one of claims 102-157, for use in identifying markers.
159. The method of any one of claims 102-158, for use in a screening process.
160. The method of any one of claims 102-159, wherein the method determines the cellular RNA content of a single cell type or of a single cell subtype.
161. A method for the diagnostic or prognostic of a disorder of interest in a subject, comprising:
(I) selecting a marker, wherein said marker is associated with said disorder and wherein said marker may be determined in a cell type that is found in the subject to be in contact with a body fluid,
(II) providing a biological sample from said body fluid from said subject,
(III) estimating the cellular RNA content of said marker in the biological sample of step (II) by performing the method of any one of claims 102-155.
162. The method of claim 161, wherein the cellular RNA content is the cellular content of a single cell type or of a single cell subtype.
163. The method of claim 161 or 162, further comprising (IV) determining, from the results of step (III), the status of the marker selected at step (I).
164. The method of any one of claims 160-163, wherein the marker is selected from expression of a given open reading frame (ORF), overexpression of a given open reading frame (ORF), repression of a given open reading frame (ORF), over-repression of a given open reading
frame (ORF), expression of a given allelic variant, relative level of expression of a given open reading frame (ORF), presence of a mutation in a given open reading frame (ORF),
165. The method of any one of claims 161-164, wherein said disorder is a blood disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with blood.
166. The method of any one of claims 161-165, wherein said disorder is a brain or spine disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with cerebrospinal fluid.
167. The method of any one of claims 161-166, wherein said disorder is a heart disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with blood or pericardial fluid.
168. The method of any one of claims 161-167, wherein said disorder is a prostate or bladder disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with urine.
169. The method of any one of claims 161-168, wherein said disorder is an eye disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with tears.
170. The method of any one of claims 161-169, wherein said disorder is a lung disorder and said marker is a marker that may be determined in one or more cell type/s that is/are found in the subject to be in contact with pleural fluid.
171. Composition comprising exosomes, wherein the composition is essentially free of extra-exosomal material, for use in diagnostics.
172. Composition comprising exosomes, wherein the composition is essentially free of extra-exosomal nucleic acid-protein complexes.
173. Composition comprising exosomes, wherein the composition is essentially free of extra-exosomal RNA-protein complexes.
174. A method for the treatment or prophylaxis of a disorder in a patient, said method comprising exosome-mediated delivery of a therapeutic RNA to a cell.
175. The method of claim 174, wherein said exosome-mediated delivery occurs from one donor cell to a recipient cell, and wherein the therapeutic RNA results from transcription in the donor cell.
176. The method of claim 175, wherein transcription in the donor cell is inducible.
177. The method of any one of claims 174-176, wherein the delivery is performed ex vivo.
178. The method of any one of claims 174-176, wherein the delivery is performed in vivo.
179. Exosome for use in delivering a therapeutic RNA to a cell.
180. Exosome of claim 179, wherein the exosome is produced according to the method or the use as defined in any one of claims 1-70 and 78-94.
181. Exosome of claim 179, wherein the exosome is in a preparation obtainable according to claim 95.
182. Exosome of claim 179, wherein the exosome is produced in vitro
183. Exosome of claim 179, wherein the exosome is produced in vivo.
184. Therapeutic RNA for use in exosome-mediated delivery to a cell.
185. Therapeutic RNA of claim 184, wherein the exosome is produced in vitro
186. Therapeutic RNA of claim 184, wherein the exosome is produced in vivo.
187. Therapeutic RNA of claim 184, wherein the exosome is produced according to the method or the use as defined in any one of claims 1-70 and 78-94.
188. Therapeutic RNA of claim 184, wherein the exosome is in a preparation obtainable according to claim 95.
189. Pharmaceutical composition comprising an exosome, wherein said exosome comprises a therapeutic RNA for delivery into a cell.
190. The pharmaceutical composition of claim 189, wherein the delivery is performed ex vivo.
191. The pharmaceutical composition of claim 189, wherein the delivery is performed in vivo.
192. Pharmaceutical composition comprising a cell, wherein the cell is capable of producing exosomes comprising a therapeutic RNA.
193. Pharmaceutical composition of any one of claims any one of claims 189-192, in a form suitable for injection.
194. Use of a therapeutic RNA in the manufacture of a medicament for the treatment or prophylaxis of a disorder in a patient, wherein the RNA is delivered to a cell in an exosome- packaged form.
195. Use of an exosome in the manufacture of a medicament for the treatment or prophylaxis of a disorder in a patient, wherein the exosome comprises a therapeutic RNA or delivery into a cell.
196. The method, composition or use of any one of claims 174-195, wherein the therapeutic RNA is translated in the recipient cell.
197. The method, composition or use of any one of claims 174-195, wherein the therapeutic RNA is a small interfering RNA (siRNA).
198. The method, composition or use of any one of claims 174-195, wherein the therapeutic RNA is a short hairpin RNA (shRNA).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/790,830 US20180066307A1 (en) | 2015-04-22 | 2017-10-23 | Exosomes and uses thereof |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562151142P | 2015-04-22 | 2015-04-22 | |
| US201562151166P | 2015-04-22 | 2015-04-22 | |
| US201562151189P | 2015-04-22 | 2015-04-22 | |
| US62/151,189 | 2015-04-22 | ||
| US62/151,166 | 2015-04-22 | ||
| US62/151,142 | 2015-04-22 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/790,830 Continuation-In-Part US20180066307A1 (en) | 2015-04-22 | 2017-10-23 | Exosomes and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016172598A1 true WO2016172598A1 (en) | 2016-10-27 |
Family
ID=57144308
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/029003 Ceased WO2016172598A1 (en) | 2015-04-22 | 2016-04-22 | Exosomes and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20180066307A1 (en) |
| WO (1) | WO2016172598A1 (en) |
Cited By (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6231252B1 (en) * | 2016-07-08 | 2017-11-15 | 花王株式会社 | Nucleic acid sample preparation method |
| WO2018096481A1 (en) * | 2016-11-23 | 2018-05-31 | Aman Sharma | Method and kit for exosomes and associated biomacromolecules capture |
| CN108103063A (en) * | 2017-12-06 | 2018-06-01 | 张灏 | A kind of saRNA and application thereof |
| WO2018107129A1 (en) | 2016-12-09 | 2018-06-14 | The Broad Institute, Inc. | Crispr effector system based diagnostics |
| GB2559319A (en) * | 2016-12-23 | 2018-08-08 | Cs Genetics Ltd | Reagents and methods for the analysis of linked nucleic acids |
| WO2018170340A1 (en) | 2017-03-15 | 2018-09-20 | The Broad Institute, Inc. | Crispr effector system based diagnostics for virus detection |
| WO2019060719A1 (en) * | 2017-09-22 | 2019-03-28 | University Of Miami | Methods and compositions for the treatment of epidermolysis bullosa |
| WO2019099942A1 (en) * | 2017-11-17 | 2019-05-23 | Codiak Biosciences, Inc. | Compositions of engineered exosomes and methods of loading luminal exosomes payloads |
| WO2019122279A1 (en) | 2017-12-22 | 2019-06-27 | Roche Innovation Center Copenhagen A/S | Oligonucleotides comprising a phosphorodithioate internucleoside linkage |
| WO2019122282A1 (en) | 2017-12-22 | 2019-06-27 | Roche Innovation Center Copenhagen A/S | Gapmer oligonucleotides comprising a phosphorodithioate internucleoside linkage |
| WO2019122277A1 (en) | 2017-12-22 | 2019-06-27 | Roche Innovation Center Copenhagen A/S | Novel thiophosphoramidites |
| WO2019148206A1 (en) | 2018-01-29 | 2019-08-01 | The Broad Institute, Inc. | Crispr effector system based diagnostics |
| WO2019153748A1 (en) * | 2018-02-09 | 2019-08-15 | 北京大学 | Method for enriching or detecting exosome of astrocyte source in biological fluid |
| CN110200998A (en) * | 2019-05-24 | 2019-09-06 | 清华大学 | The preparation of neuronal origin excretion body and its application in treatment senile dementia |
| CN110592002A (en) * | 2019-10-10 | 2019-12-20 | 山东大学齐鲁医院 | Preparation method and application of bladder urothelial single cell suspension for single cell sequencing |
| WO2020043750A1 (en) | 2018-08-28 | 2020-03-05 | Roche Innovation Center Copenhagen A/S | Neoantigen engineering using splice modulating compounds |
| EP3620519A1 (en) * | 2018-09-04 | 2020-03-11 | F. Hoffmann-La Roche AG | Use of isolated milk extracellular vesicles for delivering oligonucleotides orally |
| WO2020124050A1 (en) | 2018-12-13 | 2020-06-18 | The Broad Institute, Inc. | Tiled assays using crispr-cas based detection |
| WO2020186223A1 (en) | 2019-03-14 | 2020-09-17 | The Broad Institute, Inc. | Sherlock assays for tick-borne diseases |
| CN112126643A (en) * | 2020-09-11 | 2020-12-25 | 上海长征医院 | A method for separating ecDNA from exosomes based on magnetic beads |
| EP3674704A4 (en) * | 2017-08-22 | 2021-05-05 | Hiroshima University | EXOSOME ISOLATION PROCESS AND EXOSOME ISOLATION KIT |
| US11058729B2 (en) | 2018-01-25 | 2021-07-13 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Exosomes and miRNA to treat glaucoma |
| CN113286603A (en) * | 2018-11-16 | 2021-08-20 | 科迪亚克生物科学公司 | Engineered extracellular vesicles and their uses |
| EP3655531A4 (en) * | 2017-07-18 | 2021-09-08 | Exosome Diagnostics, Inc. | SEQUENCING OF NUCLEIC ACIDS ASSOCIATED WITH EXOSOMAL ISOLATION IN PATIENTS WITH MULTIFORM GLIOBLASTOMA |
| WO2021211351A1 (en) | 2020-04-12 | 2021-10-21 | Aethlon Medical, Inc. | Devices and methods for treating a coronavirus infection and symptoms thereof |
| US11174515B2 (en) | 2017-03-15 | 2021-11-16 | The Broad Institute, Inc. | CRISPR effector system based diagnostics |
| WO2022058881A1 (en) | 2020-09-15 | 2022-03-24 | Neurodex, Inc. | Diagnostic assays employing neuron-derived exosomes |
| US11339125B2 (en) | 2011-01-03 | 2022-05-24 | The William M. Yarbrough Foundation | Use of isothiocyanate functional surfactants as NRF2 inducers to treat epidermolysis bullosa simplex and related diseases |
| CN119291204A (en) * | 2024-12-13 | 2025-01-10 | 成都市第三人民医院 | A marker, detection reagent, kit and application for gastric fluid exosomes |
| US12453745B2 (en) | 2013-03-13 | 2025-10-28 | University Of Miami | Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids |
| US12558316B2 (en) | 2013-03-13 | 2026-02-24 | University Of Miami | Methods and compositions for the treatment of epidermolysis bullosa |
| US12618101B2 (en) | 2020-03-13 | 2026-05-05 | The Broad Institute, Inc. | Sherlock assays for tick-borne diseases |
Families Citing this family (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7075594B2 (en) | 2015-11-18 | 2022-05-26 | ユニバーシティ オブ ジョージア リサーチ ファウンデーション, インコーポレーテッド | Extracellular vesicles of nerve cells |
| US11161902B2 (en) * | 2016-05-09 | 2021-11-02 | Helmholtz Zentrum Muenchen—Deutsches Forschungszentrum Fuer Gesundheit Und Umwelt (Gmbh) | Tissue-specific exosomes as biomarkers |
| CN106124282B (en) * | 2016-07-26 | 2019-07-16 | 广州海力特生物科技有限公司 | A kind of method of lamination centrifugal filtration separation and Extraction excretion body |
| CN112040955A (en) * | 2018-03-14 | 2020-12-04 | 加利福尼亚大学董事会 | Inhibitory exosomes in cancer and for immunosuppression |
| US20220099686A1 (en) * | 2018-11-30 | 2022-03-31 | Cha University Industry-Academic Cooperation Foundation | Brain-derived vesicle-specific marker and brain disease diagnostic method using same |
| WO2020223523A1 (en) * | 2019-04-30 | 2020-11-05 | Chase Therapeutics Corporation | Alpha-synuclein assays |
| AU2020299633B2 (en) * | 2019-07-02 | 2026-03-26 | Ohio State Innovation Foundation | Neurodegenerative disease therapies utilizing the skin-brain axis |
| CN112553139A (en) * | 2019-09-25 | 2021-03-26 | 深圳光彩生命工程技术有限公司 | Method for separating exosomes in urine |
| WO2021091185A1 (en) * | 2019-11-05 | 2021-05-14 | 주식회사 한국줄기세포뱅크 | Composition for cell culture, comprising paracrine factor |
| JP7645514B2 (en) * | 2019-12-27 | 2025-03-14 | 国立大学法人大阪大学 | Method for recovering extracellular vesicles derived from nervous system cells |
| WO2021147922A1 (en) | 2020-01-20 | 2021-07-29 | 医微细胞生物技术(广州)有限公司 | Extracellular vesicle and use thereof in skin products |
| CN117965431A (en) * | 2020-01-20 | 2024-05-03 | 医微细胞生物技术(广州)有限公司 | Vesicle and application thereof |
| WO2021153798A1 (en) * | 2020-01-31 | 2021-08-05 | 国立大学法人北海道大学 | Method for assessing possibility of onset or progression of chronic kidney graft rejection and chronic kidney disease, test kit, and pharmaceutical composition |
| US12077780B2 (en) | 2020-02-14 | 2024-09-03 | Allergan Sales, Llc | Conditioned medium from cells cultured under hypoxic conditions and uses thereof |
| WO2021222295A1 (en) * | 2020-04-27 | 2021-11-04 | Aruna Bio, Inc. | Binding agents and uses thereof for central nervous system delivery |
| CN111521826A (en) * | 2020-05-21 | 2020-08-11 | 江海松 | Application of Notch3 protein in peripheral blood exosome as molecular marker and detection kit |
| CN114836375B (en) * | 2020-12-31 | 2023-07-21 | 国典(北京)医药科技有限公司 | Exosome secretion inducer, induction medium and application thereof |
| KR20250053782A (en) * | 2022-05-16 | 2025-04-22 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Isolation and diagnostic methods using cell type-specific and/or organ-specific extracellular vesicle (EV) markers |
| WO2024192141A1 (en) | 2023-03-13 | 2024-09-19 | Dana-Farber Cancer Institute, Inc. | Treatment of cancers having a drug-resistant mesenchymal cell state |
| CN117821394B (en) * | 2024-03-05 | 2024-05-10 | 苏州唯思尔康科技有限公司 | Exosome scaffold proteins and their applications |
| CN118460477B (en) * | 2024-07-09 | 2024-11-05 | 苏州唯思尔康科技有限公司 | Exosome scaffold protein especially suitable for carrying effective cargoes and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011009104A1 (en) * | 2009-07-16 | 2011-01-20 | The General Hospital Corporation | Nucleic acid analysis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3077528B1 (en) * | 2013-12-02 | 2018-08-22 | Albert-Ludwigs-Universität Freiburg | Process for the diagnosis of cancer by using exosomes |
-
2016
- 2016-04-22 WO PCT/US2016/029003 patent/WO2016172598A1/en not_active Ceased
-
2017
- 2017-10-23 US US15/790,830 patent/US20180066307A1/en not_active Abandoned
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011009104A1 (en) * | 2009-07-16 | 2011-01-20 | The General Hospital Corporation | Nucleic acid analysis |
Non-Patent Citations (1)
| Title |
|---|
| BOUKOURIS S ET AL: "Exosomes in bodily fluids are a highly stable resource of disease biomarkers", PROTEOMICS - CLINICAL APPLICATIONS 20150401 WILEY-VCH VERLAG DEU, vol. 9, no. 3-4, 1 April 2015 (2015-04-01), pages 358 - 367, XP002760118, ISSN: 1862-8346 * |
Cited By (56)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11339125B2 (en) | 2011-01-03 | 2022-05-24 | The William M. Yarbrough Foundation | Use of isothiocyanate functional surfactants as NRF2 inducers to treat epidermolysis bullosa simplex and related diseases |
| US12558316B2 (en) | 2013-03-13 | 2026-02-24 | University Of Miami | Methods and compositions for the treatment of epidermolysis bullosa |
| US12453745B2 (en) | 2013-03-13 | 2025-10-28 | University Of Miami | Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids |
| WO2018008319A1 (en) * | 2016-07-08 | 2018-01-11 | 花王株式会社 | Method for preparing nucleic acid sample |
| JP2018000206A (en) * | 2016-07-08 | 2018-01-11 | 花王株式会社 | Method of preparing nucleic acid sample |
| US11913061B2 (en) | 2016-07-08 | 2024-02-27 | Kao Corporation | Method for preparing nucleic acid sample |
| JP6231252B1 (en) * | 2016-07-08 | 2017-11-15 | 花王株式会社 | Nucleic acid sample preparation method |
| WO2018096481A1 (en) * | 2016-11-23 | 2018-05-31 | Aman Sharma | Method and kit for exosomes and associated biomacromolecules capture |
| CN110073195B (en) * | 2016-11-23 | 2022-03-29 | 阿曼·沙马 | Method and kit for extracting exosomes and biomacromolecules bound with exosomes |
| US11493412B2 (en) | 2016-11-23 | 2022-11-08 | Aman Sharma | Method and kit for exosomes and associated biomacromolecules capture |
| CN110073195A (en) * | 2016-11-23 | 2019-07-30 | 阿曼·沙马 | Method and kit for extracting exosomes and biomacromolecules combined with them |
| EP4119663A1 (en) | 2016-12-09 | 2023-01-18 | The Broad Institute, Inc. | Crispr effector system based diagnostics |
| WO2018107129A1 (en) | 2016-12-09 | 2018-06-14 | The Broad Institute, Inc. | Crispr effector system based diagnostics |
| US10640811B2 (en) | 2016-12-23 | 2020-05-05 | Cs Genetics Limited | Reagents and methods for the analysis of linked nucleic acids |
| US10287624B2 (en) | 2016-12-23 | 2019-05-14 | Cs Genetics Limited | Reagents and methods for the analysis of linked nucleic acids |
| GB2559319B (en) * | 2016-12-23 | 2019-01-16 | Cs Genetics Ltd | Reagents and methods for the analysis of linked nucleic acids |
| US11268131B2 (en) | 2016-12-23 | 2022-03-08 | Cs Genetics Limited | Reagents and methods for the analysis of linked nucleic acids |
| GB2559319A (en) * | 2016-12-23 | 2018-08-08 | Cs Genetics Ltd | Reagents and methods for the analysis of linked nucleic acids |
| US11174515B2 (en) | 2017-03-15 | 2021-11-16 | The Broad Institute, Inc. | CRISPR effector system based diagnostics |
| US12203145B2 (en) | 2017-03-15 | 2025-01-21 | The Broad Institute, Inc. | CRISPR effector system based diagnostics for virus detection |
| WO2018170340A1 (en) | 2017-03-15 | 2018-09-20 | The Broad Institute, Inc. | Crispr effector system based diagnostics for virus detection |
| US11345957B2 (en) | 2017-07-18 | 2022-05-31 | Exosome Diagnostics, Inc. | Methods of treating glioblastoma in a subject informed by exosomal RNA signatures |
| EP3655531A4 (en) * | 2017-07-18 | 2021-09-08 | Exosome Diagnostics, Inc. | SEQUENCING OF NUCLEIC ACIDS ASSOCIATED WITH EXOSOMAL ISOLATION IN PATIENTS WITH MULTIFORM GLIOBLASTOMA |
| US12117440B2 (en) | 2017-08-22 | 2024-10-15 | Hiroshima University | Method for isolating exosome and exosome isolation kit |
| EP3674704A4 (en) * | 2017-08-22 | 2021-05-05 | Hiroshima University | EXOSOME ISOLATION PROCESS AND EXOSOME ISOLATION KIT |
| IL273407B1 (en) * | 2017-09-22 | 2025-05-01 | Univ Miami | Methods and preparations for the treatment of epidermolysis bullosa |
| IL273407B2 (en) * | 2017-09-22 | 2025-09-01 | Univ Miami | Methods and preparations for the treatment of epidermolysis bullosa |
| WO2019060719A1 (en) * | 2017-09-22 | 2019-03-28 | University Of Miami | Methods and compositions for the treatment of epidermolysis bullosa |
| WO2019099942A1 (en) * | 2017-11-17 | 2019-05-23 | Codiak Biosciences, Inc. | Compositions of engineered exosomes and methods of loading luminal exosomes payloads |
| CN108103063A (en) * | 2017-12-06 | 2018-06-01 | 张灏 | A kind of saRNA and application thereof |
| CN108103063B (en) * | 2017-12-06 | 2021-08-13 | 张灏 | SaRNA and application thereof |
| WO2019122282A1 (en) | 2017-12-22 | 2019-06-27 | Roche Innovation Center Copenhagen A/S | Gapmer oligonucleotides comprising a phosphorodithioate internucleoside linkage |
| EP4092117A1 (en) | 2017-12-22 | 2022-11-23 | Roche Innovation Center Copenhagen A/S | Gapmer oligonucleotides comprising a phosphorodithioate internucleoside linkage |
| WO2019122279A1 (en) | 2017-12-22 | 2019-06-27 | Roche Innovation Center Copenhagen A/S | Oligonucleotides comprising a phosphorodithioate internucleoside linkage |
| WO2019122277A1 (en) | 2017-12-22 | 2019-06-27 | Roche Innovation Center Copenhagen A/S | Novel thiophosphoramidites |
| US11597926B2 (en) | 2017-12-22 | 2023-03-07 | Roche Innovation Center Copenhagen A/S | Thiophosphoramidites |
| US11058729B2 (en) | 2018-01-25 | 2021-07-13 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Exosomes and miRNA to treat glaucoma |
| US11806369B2 (en) | 2018-01-25 | 2023-11-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Exosomes and miRNA to treat glaucoma |
| WO2019148206A1 (en) | 2018-01-29 | 2019-08-01 | The Broad Institute, Inc. | Crispr effector system based diagnostics |
| WO2019153748A1 (en) * | 2018-02-09 | 2019-08-15 | 北京大学 | Method for enriching or detecting exosome of astrocyte source in biological fluid |
| WO2020043750A1 (en) | 2018-08-28 | 2020-03-05 | Roche Innovation Center Copenhagen A/S | Neoantigen engineering using splice modulating compounds |
| EP3620519A1 (en) * | 2018-09-04 | 2020-03-11 | F. Hoffmann-La Roche AG | Use of isolated milk extracellular vesicles for delivering oligonucleotides orally |
| CN113286603A (en) * | 2018-11-16 | 2021-08-20 | 科迪亚克生物科学公司 | Engineered extracellular vesicles and their uses |
| WO2020124050A1 (en) | 2018-12-13 | 2020-06-18 | The Broad Institute, Inc. | Tiled assays using crispr-cas based detection |
| WO2020186223A1 (en) | 2019-03-14 | 2020-09-17 | The Broad Institute, Inc. | Sherlock assays for tick-borne diseases |
| CN110200998B (en) * | 2019-05-24 | 2021-04-16 | 清华大学 | Preparation of neuron-derived exosomes and their application in the treatment of Alzheimer's disease |
| CN110200998A (en) * | 2019-05-24 | 2019-09-06 | 清华大学 | The preparation of neuronal origin excretion body and its application in treatment senile dementia |
| CN110592002B (en) * | 2019-10-10 | 2021-04-02 | 山东大学齐鲁医院 | Preparation method and application of bladder urothelium single cell suspension for single cell sequencing |
| CN110592002A (en) * | 2019-10-10 | 2019-12-20 | 山东大学齐鲁医院 | Preparation method and application of bladder urothelial single cell suspension for single cell sequencing |
| US12618101B2 (en) | 2020-03-13 | 2026-05-05 | The Broad Institute, Inc. | Sherlock assays for tick-borne diseases |
| WO2021211351A1 (en) | 2020-04-12 | 2021-10-21 | Aethlon Medical, Inc. | Devices and methods for treating a coronavirus infection and symptoms thereof |
| EP4647092A2 (en) | 2020-04-12 | 2025-11-12 | Aethlon Medical, Inc. | Devices and methods for treating a coronavirus infection and symptoms thereof |
| CN112126643B (en) * | 2020-09-11 | 2022-04-15 | 上海长征医院 | A method for separating ecDNA from exosomes based on magnetic beads |
| CN112126643A (en) * | 2020-09-11 | 2020-12-25 | 上海长征医院 | A method for separating ecDNA from exosomes based on magnetic beads |
| WO2022058881A1 (en) | 2020-09-15 | 2022-03-24 | Neurodex, Inc. | Diagnostic assays employing neuron-derived exosomes |
| CN119291204A (en) * | 2024-12-13 | 2025-01-10 | 成都市第三人民医院 | A marker, detection reagent, kit and application for gastric fluid exosomes |
Also Published As
| Publication number | Publication date |
|---|---|
| US20180066307A1 (en) | 2018-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2016172598A1 (en) | Exosomes and uses thereof | |
| AU2022203759B2 (en) | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications | |
| AU2013359123B2 (en) | Engineering of systems, methods and optimized guide compositions for sequence manipulation | |
| US20200354751A1 (en) | Genome editing using cas9 nickases | |
| CA2915795C (en) | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using viral components | |
| EP3011030B1 (en) | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation | |
| US12065678B2 (en) | Constructs, compositions and methods thereof having improved genome editing efficiency and specificity | |
| US8999641B2 (en) | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains | |
| EP3011035B1 (en) | Assay for quantitative evaluation of target site cleavage by one or more crispr-cas guide sequences | |
| EP3064585B1 (en) | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation | |
| EP3011032A1 (en) | Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells | |
| EP3011033A1 (en) | Functional genomics using crispr-cas systems, compositions methods, screens and applications thereof | |
| CA2915834A1 (en) | Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation | |
| US12571006B2 (en) | Constructs and uses thereof for efficient and specific genome editing | |
| US20230304047A1 (en) | Improved gene editing | |
| US20220010336A1 (en) | Improved gene editing | |
| EP3935165A1 (en) | Mesophilic argonaute systems and uses thereof | |
| CN116457462A (en) | Constructs for efficient and specific genome editing and uses thereof | |
| Class et al. | Patent application title: FUNCTIONAL GENOMICS USING CRISPR-CAS SYSTEMS, COMPOSITIONS, METHODS, KNOCK OUT LIBRARIES AND APPLICATIONS THEREOF Inventors: Feng Zhang (Cambridge, MA, US) Feng Zhang (Cambridge, MA, US) Neville Espi Sanjana (Cambridge, MA, US) Ophir Shalem (Boston, MA, US) | |
| HK1223645B (en) | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16720652 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16720652 Country of ref document: EP Kind code of ref document: A1 |





































