WO2016168708A1 - Synthesis of omega functionalized methylketones, 2-alcohols, 2-amines, and derivatives thereof - Google Patents

Synthesis of omega functionalized methylketones, 2-alcohols, 2-amines, and derivatives thereof Download PDF

Info

Publication number
WO2016168708A1
WO2016168708A1 PCT/US2016/027903 US2016027903W WO2016168708A1 WO 2016168708 A1 WO2016168708 A1 WO 2016168708A1 US 2016027903 W US2016027903 W US 2016027903W WO 2016168708 A1 WO2016168708 A1 WO 2016168708A1
Authority
WO
WIPO (PCT)
Prior art keywords
coa
omega
group
functionalized
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/027903
Other languages
French (fr)
Inventor
Ramon Gonzalez
Seokjung CHEONG
James M. CLOMBURG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
William Marsh Rice University
Original Assignee
William Marsh Rice University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by William Marsh Rice University filed Critical William Marsh Rice University
Publication of WO2016168708A1 publication Critical patent/WO2016168708A1/en
Priority to US15/784,691 priority Critical patent/US20180135059A1/en
Anticipated expiration legal-status Critical
Priority to US17/021,338 priority patent/US20210002677A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/40Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44Polycarboxylic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/001Amines; Imines
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/24Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26Ketones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01003Glucan 1,4-alpha-glucosidase (3.2.1.3), i.e. glucoamylase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the disclosure generally relates to the use of microorganisms to make omega- functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, ⁇ , ⁇ -l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, ⁇ , ⁇ -1-diols.
  • Reactions that catalyze the iterative formation of carbon-carbon bonds are instrumental for many metabolic pathways, such as the biosynthesis of fatty acids, polyketides, and many other molecules with applications ranging from biofuels and green chemicals to therapeutic agents. These pathways typically start with small precursor metabolites that serve as building blocks that are subsequently condensed and modified in an iterative fashion until the desired chain length and functionality are achieved.
  • Most iterative carbon-carbon bond forming reactions in natural biological systems take place through a Claisen condensation mechanism in which the nucleophilic a- anion of an acyl-thioester, serving as the extender unit, attacks the electrophilic carbonyl carbon of another acyl-thioester, serving as the primer. Depending on how the nucleophilic a- anion is generated, the Claisen condensation reaction can be classified as decarboxylative or non-decarboxylative.
  • thiolases catalyze the non-decarboxylative Claisen condensation in which acetyl-CoA, instead of malonyl thioesters, serves as the extender unit, and subsequent ⁇ - reduction reactions by hydroxyacyl-CoA dehydrogenases (HACDs), enoyl-CoA hydratases (ECHs) and enoyl-CoA reductases (ECRs) enable iteration.
  • HACDs hydroxyacyl-CoA dehydrogenases
  • EHs enoyl-CoA hydratases
  • ECRs enoyl-CoA reductases
  • the intermediate after the thiolase reaction is ⁇ -ketoacyl-CoA.
  • ⁇ -keto acid can be decarboxylated to methyl ketone spontaneously or by beta-keto acid decarboxylase.
  • Methyl ketone can be converted to 2- amine and 2-alcohol by transaminase and keto-dehydrogenase respectively. If non- decarboxylative thiolases able to accept wider range of functionalized primers and proceed in an iterative manner were available, methyl ketones, 2-amines and 2-alcohols with diverse functionalities and chain lengths could be produced.
  • This disclosure demonstrates a general CoA-dependent carbon elongation platform based on the use of de novo thiolase-catalyzed non-decarboxylative Claisen condensation which accepts omega-functionalized primers, along with suitable HACDs, ECHs and ECRs which catalyzes the ⁇ -reduction reactions to enable the iteration of carbon elongation (FIG. 1).
  • Thioesterases or CoA-transferases or phosphotransacylases+kinases terminate the carbon elongation at the beta-ketoacyl-CoA intermediate, the product of thiolase-catalyzed non-decarboxylative Claisen condensation, and generates ⁇ -keto acid, which is then decarboxylated to methyl ketone by decarboxylases (DCs).
  • Transaminase and keto-dehydrogenase then convert methyl ketone to 2-amine and 2-alcohol respectively.
  • the disclosure generally relates to the use of microorganisms to make omega- functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, ⁇ , ⁇ -l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, ⁇ , ⁇ -1-diols.
  • the engineered pathway consists of five core enzymatic steps that generate omega-functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths.
  • omega-functionalized CoA thioesters to be used as primers are generated, mainly by activation of their acid form, which can be either supplemented in the media or derived from carbon sources. Alternatively, these primers can be derived from carbon sources without aforementioned Step 1.
  • Step 2 thiolase catalyzed non-decarboxylative Claisen condensation between omega-functionalized primer and acetyl-CoA yields an omega-functionalized ⁇ -keto acyl-CoA. Further carbon chain elongation is achieved by subsequent dehydrogenation (Step 3) catalyzed by HACDs, dehydration (Step 4) catalyzed by ECHs and reduction (Step 5) catalyzed by ECRs and iterations of Steps 2-5, which taken together generate omega- functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths.
  • omega-functionalized beta-keto acyl-CoA intermediates are then used as substrates for enzymes that convert them to different products.
  • CoA removal (Step 6) by thioesterase or CoA-transferase or phosphotransacylase+kinase and decarboxylation (Step 7) catalyzed by decarboxylase of omega-functionalized beta-keto acyl- CoA intermediates generate omega-functionalized methyl ketones.
  • Step 8 by keto-dehydrogenase and amino group transfer (Step 9) by transaminase convert omega-functionalized methyl ketone into omega-functionalized 2- alochol and 2-amine respectively.
  • methyl ketones, 2-alcohols and 2-amines are omega- carboxylated, use of additional enzymatic steps can convert them to lactams, lactones, ⁇ , ⁇ -1- diamines, ⁇ -l -amino- 1 -alcohols, co-amino methyl ketones, ⁇ -hydroxy methyl ketones, co- amino-2-alcohols, ⁇ , ⁇ -1-diols.
  • the process involves performing traditional fermentations using industrial organisms (such as E. coli, S. cerevisiae) that convert different feedstocks into longer-chain products (e.g. omega-functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, ⁇ , ⁇ -1-diamines, ⁇ -1-amino-l-alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, ⁇ , ⁇ -1-diols).
  • industrial organisms such as E. coli, S. cerevisiae
  • a "primer” is a starting molecule for the iterative cycle to add two carbon donor units to a growing acyl-CoA thioester.
  • the initial primer can be any kind of omega-functionalized acyl-CoA.
  • the primer will accordingly increase in size.
  • the "extender unit” is the donor of the 2 carbon units of each cycle of carbon elongation. In this disclosure, the extender unit is acetyl-CoA.
  • Thiolases are ubiquitous enzymes that have key roles in many vital biochemical pathways, including the beta-oxidation pathway of fatty acid degradation and various biosynthetic pathways.
  • Members of the thiolase family can be divided into two broad categories: degradative thiolases (EC 2.3.1.16), and biosynthetic thiolases (EC 2.3.1.9). The forward and reverse reactions are shown below:
  • thiolase acetoacetyl-CoA thiolase (EC:2.3.1.9) and 3-ketoacyl-CoA thiolase (EC:2.3.1.16).
  • 3-ketoacyl-CoA thiolase also called thiolase I
  • thiolase I has a broad chain-length specificity for its substrates and is involved in degradative pathways such as fatty acid beta- oxidation.
  • Acetoacetyl-CoA thiolase (also called thiolase II) is specific for the thiolysis of acetoacetyl-CoA and involved in biosynthetic pathways such as poly beta-hydroxybutyric acid synthesis or steroid biogenesis.
  • the degradative thiolases can be made to run in the forward direction by building up the level of left hand side reactants (primer and extender unit), thus driving the equilibrium in the forward direction and/or by overexpressing same or by expressing a mutant of same.
  • native or engineered thiolases able to use functionalized primers and extender units is an enzyme that catalyzes the condensation of omega- functionalized acyl-CoA thioester with acetyl-CoA as the 2-carbon donor for chain elongation to produce an omega-functionalized ⁇ -keto acyl-CoA in a non-decarboxylative condensation reaction (R represents the omega):
  • HACDs hydroxyacyl-CoA dehydrogenases
  • enoyl-CoA hydratase is an enzyme that catalyzes the dehydration of an omega-functionalized ⁇ -hydroxy acyl-CoA to an omega-functionalized enoyl-CoA:
  • an “enoyl-CoA reductase (ECR)” is an enzyme that catalyzes the reduction of an omega-functionalized tram , -enoyl-CoA to an omega-functionalized acyl- CoA:
  • terminal pathway refers to one or more enzymes (or genes encoding same) that will pull reaction CoA thioester intermediates out the iterative cycle and produce the desired end product.
  • an "omega functionalized" product or primer has an R group at the end of the straight carbon chain— e.g., in the last position, the first position being determined by the CoA linkage, even after removal of CoA.
  • R can be any group and is preferably a branched alkyl, aryl, -OH, -COOH, amine, and the like.
  • microorganism As used herein, the expressions "microorganism,” “microbe,” “strain” and the like may be used interchangeably and all such designations include their progeny. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included. Where distinct designations are intended, it will be clear from the context.
  • a "cell” is generally understood to include a culture of such cells, as the work described herein is done in cultures having 10 9"15 cells.
  • homolog means an enzyme with at least 40% identity to one of the listed sequences and also having the same general catalytic activity, although of course K m , K cat and the like can vary. While higher identity (60%, 70%, 80%) and the like may be preferred, it is typical for bacterial sequences to diverge significantly (40-60%), yet still be identifiable as homologs, while mammalian species tend to diverge less (80-90%).
  • references to proteins herein can be understood to include reference to the gene encoding such protein.
  • a claimed "permease” protein can include the related gene encoding that permease.
  • Another way of finding suitable enzymes/genes for use in the invention is to consider other enzymes with the same EC number, since these numbers are assigned based on the reactions performed by a given enzyme.
  • An enzyme that thus be obtained e.g., from AddGene or from the author of the work describing that enzyme, and tested for functionality as described herein.
  • many sites provide lists of proteins that all catalyze the same reaction.
  • NCBITM provides codon usage databases for optimizing DNA sequences for protein expression in various species. Using such databases, a gene or cDNA may be "optimized" for expression in E. coli, yeast, algal or other species using the codon bias for the species in which the gene will be expressed.
  • Initial cloning experiments have proceeded in E. coli for convenience since most of the required genes are already available in plasmids suitable for bacterial expression, but the addition of genes to bacteria is of nearly universal applicability.
  • Such species include e.g., Bacillus, Streptomyces, Azotobacter, Trichoderma, Rhizobium, Pseudomonas, Micrococcus, Nitrobacter, Proteus, Lactobacillus, Pediococcus, Lactococcus, Salmonella, Streptococcus, Paracoccus, Methanosarcina, and Methylococcus, or any of the completely sequenced bacterial species.
  • yeasts such as Saccharomyces
  • Saccharomyces are a common species used for microbial manufacturing, and many species can be successfully transformed. Indeed, yeast are already available that express recombinant thioesterases— one of the termination enzymes described herein— and the reverse beta oxidation pathway has also been achieved in yeast.
  • Other species include but are not limited to Candida, Aspergillus, Arxula adeninivorans, Candida boidinii, Hansenula polymorpha (Pichia angusta), Kluyveromyces lactis, Pichia pastoris, and Yarrowia lipolytica, to name a few.
  • Spirulina Spirulina, Apergillus, Chlamydomonas, Laminaria japonica, Undaria pinnatifida, Porphyra, Eucheuma, Kappaphycus, Gracilaria, Monostroma, Enteromorpha, Arthrospira, Chlorella, Dunaliella, Aphanizomenon, Isochrysis, Pavlova, Phaeodactylum, Ulkenia, Haematococcus, Chaetoceros, Nannochloropsis, Skeletonema, Thalassiosira, and Laminaria japonica, and the like.
  • microalga Pavlova lutheri is already being used as a source of economically valuable docosahexaenoic (DHA) and eicosapentaenoic acids (EPA), and Crypthecodinium cohnii is the heterotrophic algal species that is currently used to produce the DHA used in many infant formulas.
  • DHA docosahexaenoic
  • EPA eicosapentaenoic acids
  • Crypthecodinium cohnii is the heterotrophic algal species that is currently used to produce the DHA used in many infant formulas.
  • a number of databases include vector information and/or a repository of vectors and can be used to choose vectors suitable for the chosen host species. See e.g., AddGene.org which provides both a repository and a searchable database allowing vectors to be easily located and obtained from colleagues. See also Plasmid Information Database (PlasmID) and DNASU having over 191,000 plasmids.
  • Plasmid Information Database PlasmID
  • DNASU having over 191,000 plasmids.
  • a collection of cloning vectors of E. coli is also kept at the National Institute of Genetics as a resource for the biological research community. Furthermore, vectors (including particular ORFS therein) are usually available from colleagues.
  • the enzymes can be added to the genome or via expression vectors, as desired.
  • multiple enzymes are expressed in one vector or multiple enzymes can be combined into one operon by adding the needed signals between coding regions. Further improvements can be had by overexpressing one or more, or even all of the enzymes, e.g., by adding extra copies to the cell via plasmid or other vector.
  • Initial experiments may employ expression plasmids hosting 3 or more OR s for convenience, but it may be preferred to insert operons or individual genes into the genome for long term stability.
  • % identity number of aligned residues in the query sequence/length of reference sequence. Alignments are performed using BLAST homology alignment as described by Tatusova TA & Madden TL (1999) FEMS Microbiol. Lett. 174:247-250, and available through the NCBI website. The default parameters were used, except the filters were turned OFF.
  • “Operably associated” or “operably linked”, as used herein, refer to functionally coupled nucleic acid or amino acid sequences.
  • Recombinant is relating to, derived from, or containing genetically engineered material. In other words, the genetics of an organism was intentionally manipulated by the hand of man in some way.
  • Reduced activity is defined herein to be at least a 75% reduction in protein activity, as compared with an appropriate control species (e.g., the wild type gene in the same host species). Preferably, at least 80, 85, 90, 95% reduction in activity is attained, and in the most preferred embodiment, the activity is eliminated (100%). Proteins can be inactivated with inhibitors, by mutation, or by suppression of expression or translation, by knock-out, by adding stop codons, by frame shift mutation, and the like. All reduced activity genes or proteins are signified herein by
  • null or “knockout” what is meant is that the mutation produces undetectable active protein.
  • a gene can be completely (100%) reduced by knockout or removal of part of all of the gene sequence.
  • Use of a frame shift mutation, early stop codon, point mutations of critical residues, or deletions or insertions, and the like, can also completely inactivate (100%) gene product by completely preventing transcription and/or translation of active protein. All null mutants herein are signified by ⁇ .
  • “Overexpression” or “overexpressed” is defined herein to be at least 150% of protein activity as compared with an appropriate control species, or any detectable expression in a species that lacks the activity altogether. Preferably, the activity is increased 100-500%) or even ten fold. Overexpression can be achieved by mutating the protein to produce a more active form or a form that is resistant to inhibition, by removing inhibitors, or adding activators, and the like. Overexpression can also be achieved by removing repressors, adding multiple copies of the gene to the cell, or up-regulating the endogenous gene, and the like. All overexpressed genes or proteins are signified herein by "+".
  • endogenous or “native” means that a gene originated from the species in question, without regard to subspecies or strain, although that gene may be naturally or intentionally mutated, or placed under the control of a promoter that results in overexpression or controlled expression of said gene.
  • genes from Clostridia would not be endogenous to Escherichia, but a plasmid expressing a gene from E. coli or would be considered to be endogenous to any genus of Escherichia, even though it may now be overexpressed.
  • Expression vectors are used in accordance with the art-accepted definition of a plasmid, virus or other propagatable sequence designed for protein expression in cells. There are thousands of such vectors commercially available, and typically each has an origin of replication (ori); a multiple cloning site; a selectable marker; ribosome binding sites; a promoter and often enhancers; and the needed termination sequences. Most expression vectors are inducible, although constitutive expression vectors also exist.
  • inducible means that gene expression can be controlled by the hand of man, by adding e.g., a ligand to induce expression from an inducible promoter.
  • exemplary inducible promoters include the lac operon, inducible by IPTG, the yeast AOXl promoter inducible with methanol, the strong LAC4 promoter inducible with lactate, and the like. Low level of constitutive protein synthesis may occur even in expression vectors with tightly controlled promoters.
  • an "integrated sequence” means the sequence has been integrated into the host genome, as opposed to being maintained on an expression vector. It will still be expressible, and preferably is inducible as well.
  • FIG. 1 Platform for the synthesis of omega-functionalized methyl ketones, 2- alcohols and 2-amines.
  • Omega-functionalized primer is mainly activated from its acid form, which can be either supplemented in the media or derived from carbon sources, catalyzed by CoA-synthetase, CoA transferase or phosphotransacylase + kinase (Step 1).
  • Primer can also be derived from carbon sources without via Step 1.
  • Condensation between omega- functionalized primer and acetyl-CoA catalyzed by thiolase (Step 2) forms omega- functionalized ⁇ -keto acyl-CoA.
  • Step 3 Further carbon chain elongation is achieved by subsequent reactions by dehydrogenase (Step 3), dehydratase (Step 4) and reductase (Step 5) and iterations of Steps 2-5.
  • CoA removal by thioesterase or CoA transferase and phosphotransacylase + kinase (Step 6) and decarboxylation by decarboxylase (Step 7) generate omega-functionalized methyl ketone from omega-functionalized ⁇ -keto acyl-CoA.
  • FIG. 3 Derivatives of co-l ketoacids, hydroxyacids and amino acids, which could be synthesized through additional enzymatic and metabolic reactions.
  • Products shown include omega-functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, ⁇ , ⁇ -l -diamines, ⁇ -l -amino- 1 -alcohols, ⁇ -amino methyl ketones, ⁇ -hydroxy methyl ketones, co-amino-2-alcohols, ⁇ , ⁇ -1-diols
  • FIG. 4 Example of synthesis of levulinic acid (4-oxopentanoic acid) through the proposed platform with succinyl-CoA as the primer.
  • Succinyl-CoA is activated from succinate by Catl (Step 1).
  • Levulinic acid is produced after subsequent condensation between succinyl-CoA and acetyl-CoA catalyzed by PaaJ (Step 2), CoA removal catalyzed by PcalJ (Step 3) and decarboxylation by Mksl/Adc (Step 4).
  • FIG. 5 Titers of levulinic acid synthesized through the platform depicted in FIG. 4 with different enzymes catalyzing Steps 1-4.
  • JST06(DE3) AsdhB an E. coli strain deficient of mixed-acid fermentations, thioesterases and TCA cycle, served as the host strain.
  • the engineered strains were grown for 48 hours at 37 ° C in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 20 mM succinate.
  • FIG. 5 Titers of levulinic acid synthesized through the platform depicted in FIG. 4 with different enzymes catalyzing Steps 1-4.
  • JST06(DE3) AsdhB an E. coli strain deficient of mixed-acid fermentations, thioesterases and TCA cycle, served as the host strain.
  • the engineered strains were grown for 48 hours at 37 ° C in 20 mL LB-like MOPS media supplemented with 20 g/
  • FIG. 7 Titers of omega-phenylalkanoic acids produced with phenylacetyl-
  • Endogenous refers to native enzymes without overexpression. The engineered strain was grown for 48 hours at 30°C in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 5 mM phenylacetic acid. [0066] FIG.
  • the engineered strains were grown for 48 hours at 37 ° C (when using succinyl-CoA or glutaryl-CoA as the primer) or 30°C (when using isobutyryl-CoA as the primer) in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 20 mM succinate or glutaric acid or isobutyric acid.
  • the following enzymes provided the individual components of the pathway: BktB (thiolase) and PhaBl (HACDH) from Ralstonia eutropha, Aeromonas caviae PhaJ (ECH), Treponema denticola TdTer (ECR) with native enzymes catalyzing the acid-forming termination and Megasphaera elsdenii transferase Pet activating glycolic acid to glycolyl-CoA.
  • MG1655 (DE3) AglcD served as the host strain.
  • FIG. 10 Improvement of adipic acid synthesis and synthesis of dicarboxylic acids of different chain lengths through the iterative system depicted in FIG. 6 with succinyl- CoA priming and specified pathway enzymes listed in the bottom part.
  • the engineered strains were grown for 48 hours at 37°C in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 20 mM succinate.
  • FIG. 11 Adipic acid production from glycerol through the pathway depicted in FIG. 6 priming from succinyl-CoA without the addition of primer precursor succinic acid in either shake flasks or controlled bioreactors.
  • Omega-phenylacyl-CoA which is activated from omega-phenylalkanoic acid, serves as the primer.
  • Omega- 1 -methyl acyl- CoA which is activated from omega- 1 -methylated carboxylic acid, serves as the primer.
  • FIG. 14 Synthesis of ⁇ -hydroxy methyl ketones, ⁇ , ⁇ -1-diols and ⁇ -1-amino-
  • Omega-hydroxyacyl-CoA which is activated from omega-hydroxyacid, serves as the primer.
  • FIG. 15 Synthesis of ⁇ -amino methyl ketones, a amino-2-alcohols and ⁇ , ⁇ -
  • Omega-amino acyl-CoA which is activated from omega-amino acid, serves as the primer.
  • Omega-halogenated acyl-CoA which is activated from omega-halogenated carboxylic acid, serves as the primer.
  • FIG. 17 A partial listing of embodiments, any one or more or which can be combined with any other, even if not yet so combined. DETAILED DESCRIPTION
  • the disclosure generally relates to the use of microorganisms to make omega- functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, ⁇ , ⁇ -l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, ⁇ , ⁇ -1-diols.
  • the engineered pathway consists of five core enzymatic steps that generate omega-functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths.
  • omega-functionalized CoA thioesters to be used as primers are generated, mainly by activation of their acid form, which can be either supplemented in the media or derived from carbon sources. Alternatively, these primers can be derived from carbon sources without aforementioned Step 1.
  • Step 2 thiolase catalyzed non-decarboxylative Claisen condensation between omega-functionalized primer and acetyl-CoA yields an omega-functionalized ⁇ -keto acyl-CoA.
  • carbon chain elongation is achieved by subsequent dehydrogenation (Step 3) catalyzed by HACDs, dehydration (Step 4) catalyzed by ECHs and reduction (Step 5) catalyzed by ECRs and iterations of Steps 2-5, which taken together generate omega- functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths.
  • omega-functionalized beta-keto acyl-CoA intermediates are then used as substrates for enzymes that convert them to different products.
  • CoA removal (Step 6) by ACTs and decarboxylation (Step 7) catalyzed by DCs of omega-functionalized beta-keto acyl-CoA intermediates generate omega-functionalized methyl ketones.
  • Subsequent dehydrogenation (Step 8) by keto-dehydrogenases and amino group transfer (Step 9) by transaminases convert omega-functionalized methyl ketone into omega-functionalized 2- alochol and 2-amine respectively.
  • omega-carboxylated primers When omega-carboxylated primers are used, products methyl ketones, 2- alcohols and 2-amines are omega-carboxylated, namely ⁇ -1-keto acids, co-l -hydroxy acids and co-l -amino acids.
  • Use of additional enzymatic steps can convert ⁇ -1-keto acids, co-l- hydroxy acids and ⁇ -1-amino acids to lactams, lactones, ⁇ , ⁇ -1-diamines, co- 1 -amino- 1- alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, ⁇ , ⁇ -1- diols.
  • Amidohydrolases convert co-l -amino acid to lactam. Lactonases convert co-l -hydroxy acid to lactone. Acyl-CoA synthetases or acyl-CoA transferases or phosphotransacylases+kinase activate ⁇ -1-keto acid, co-l -hydroxy acid and co-l -amino acid to ⁇ -1-ketoacyl-CoA, ⁇ -1-hydroxyacyl-CoA and co-l-aminoacyl-CoA respectively. Keto- dehydrogenases and transaminases convert ⁇ -1-ketoacyl-CoA to ⁇ -1-hydroxyacyl-CoA and co-l-aminoacyl-CoA respectively.
  • ACTs release CoA from ⁇ -1-ketoacyl-CoA to co-l- hydroxyacyl-CoA and co-l-aminoacyl-CoA, generating their acid forms. Therefore, the conversion of ⁇ -1-keto acid to co-l -hydroxy acid and co-l -amino acid can be via their CoA forms.
  • Acyl-CoA reductases convert ⁇ -1-ketoacyl-CoA, ⁇ -1-hydroxyacyl-CoA and co-l-aminoacyl-CoA to ⁇ -1-keto aldehyde, ⁇ -1-hydroxy aldehyde and ⁇ -1-amino aldehyde, co-transaminase convert ⁇ -1-keto aldehyde, co-l -hydroxy aldehyde and co-l -amino aldehyde to co-amino methyl ketone, co-amino-2-alcohol and ⁇ , ⁇ -l -diamine respectively.
  • Alcohol dehydrogenases convert ⁇ -1-keto aldehyde, co-l -hydroxy aldehyde and co-l -amino aldehyde to co-hydroxy methyl ketone, ⁇ , ⁇ -1-diol and co-l -amino- 1 -alcohol.
  • the process involves performing traditional fermentations using industrial organisms (E. coli, S. cerevisiae) that convert different feedstocks into longer-chain products (e.g.
  • omega-functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives including lactams, lactones, ⁇ , ⁇ -l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, ⁇ , ⁇ -1-diols).
  • lactams lactones
  • ⁇ , ⁇ -l -diamines co-l -amino- 1 -alcohols
  • co-amino methyl ketones co-hydroxy methyl ketones
  • co-amino-2-alcohols ⁇ , ⁇ -1-diols
  • This technology takes the above thiolase initiated pathway one step further to make omega functionalized products.
  • the method entails developing a new pathway that is based on native or engineered thiolases capable of catalyzing the condensation of omega- functionalized acyl-CoA primers with an acetyl-CoA as the extender unit. This has been reported in neither the scientific, peer-reviewed literature nor the patent literature.
  • Vibrio flu vial is ⁇ - AEA39183.1 TA
  • Wild-type K12 Escherichia coli strain MG1655 was used as the host for all genetic modifications. All resulting strains used in this study are listed in Table E. Gene deletions were performed using PI phage transduction with single-gene knockout mutants from the National BioResource Project (NIG, Japan) as the specific deletion donor. The ⁇ 3 prophage, carrying the T7 RNA polymerase gene and laclq, was integrated into the chromosome through ⁇ 3 lysogenization kit (Novagen, Darmstadt, Germany). All strains were stored in 32.5% glycerol stocks at -80°C.
  • Plates were prepared using LB medium containing 1.5% agar, and appropriate antibiotics were included at the following concentrations: ampicillin (100 ⁇ g/mL), spectinomycin (50 ⁇ g/ mL), kanamycin (50 ⁇ g/ mL), and chloramphenicol (34 ⁇ g/mL).
  • Plasmid based gene overexpression was achieved by cloning the desired gene(s) into either pETDuet-1 or pCDFDuet-1 (Novagen, Darmstadt, Germany) digested with appropriate restriction enzymes using In-Fusion PCR cloning technology (Clontech Laboratories, Inc., Mountain View, CA). Cloning inserts were created via PCR of ORFs of interest from their respective genomic or codon-optimized DNA with Phusion polymerase (Thermo Scientific, Waltham, MA) E.
  • coli genes were obtained from genomic DNA, while heterologous genes were synthesized by GenScript (Piscataway, NJ) or GeneArt (Life Technologies, Carlsbad, CA) with codon optimization except for bktB, phaBl, pet, cbjALD and mksl, which were amplified from genomic DNA or cDNA of their source organisms.
  • GenScript Procataway, NJ
  • GeneArt GeneArt (Life Technologies, Carlsbad, CA) with codon optimization except for bktB, phaBl, pet, cbjALD and mksl, which were amplified from genomic DNA or cDNA of their source organisms.
  • the recognition site of Ndel in the paaH sequence was eliminated via overlap PCR.
  • the resulting In-Fusion products were used to transform E. coli Stellar cells (Clontech Laboratories, Inc., Mountain View, CA) and PCR identified clones were confirmed by DNA sequencing.
  • ppfadB-f1 5'-ACGTGTTTAAGAATTTAAGGAGGAATAAACC ATGATCTATGAAGGCAAAGCC-3'
  • ppfadB-r1 5'-CGCCGAGCTCGAATTCTTAGTTAAAAAAGCGCTGACC-3'
  • dcaH-f1 5'-TGTGAGCTAAGAATTTAAGGAGGAATAAACC ATGACCCACCCGATCAAAAA-3'
  • dcaH-r1 5'-CGCCGAGCTCGAATTCTTAGGTGGTAAAGGTCAGCG-3'
  • Na 2 HP0 4 in place of K 2 HP0 4 (1.48 mM for fermentations in flasks; 2.8 mM for fermentations in bioreactors), supplemented with 20 g/L glycerol, 10 g/L tryptone, 5 g/L yeast extract, 100 ⁇ FeS0 4 , 5 mM calcium pantothenate, 5 mM (NH ) 2 S0 4 , and 30 mM NH C1 was used for all fermentations unless otherwise stated.
  • Neutralized 5 mM phenylacetic acid or 20 mM succinic acid, glutaric acid, isobutyric acid, glycolic acid, or propionic acid was supplemented as needed.
  • Erlenmeyer flasks (narrow mouth/heavy duty rim, Corning Inc., Corning, NY) filled with 20 mL fermentation medium and sealed with foam plugs filling the necks.
  • a single colony of the desired strain was cultivated overnight (14-16 h) in LB medium with appropriate antibiotics and used as the inoculum (1%).
  • flasks were incubated in a NBS 124 Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, NJ) at 200 rpm and 37°C, except fermentations supplemented with phenylacetic acid or isobutyric acid in which the temperature was 30°C.
  • IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
  • Fermentations with glycolyl-CoA as a primer were conducted in 250 mL Erlenmeyer Flasks filled with 50 mL LB media supplemented with 10 g/L glucose and appropriate antibiotics. The cultivation of inoculum was same as above but 2% inoculation was used. After inoculation, cells were cultivated at 30°C and 250 rpm in a NBS 124 Benchtop Incubator Shaker until an optical density of -0.8 was reached, at which point IPTG (0.1 mM) and neutralized glycolic acid (40 mM) were added. Flasks were then incubated under the same conditions for 96 h for production of 4-hydroxybutyric acid.
  • GC-MS metabolite identification Except identifications of 4-hydroxybutyric acid, metabolite identification was conducted via GC-MS as previously described in an Agilent 7890A GC system (Agilent Technologies, Santa Clara, CA), equipped with a 5975C inert XL mass selective detector (Agilent) and Rxi-5Sil column (0.25 mm internal diameter, 0.10 ⁇ film thickness, 30 m length; Restek, Bellefonte, PA). The sample injection amount was 2 ⁇ _, with 40: 1 split ratio. The injector and detector were maintained at 280°C.
  • the column temperature was held initially at 35°C for 1 min and increased to 200°C at the rate of 6°C/min, then to 270 °C at the rate of 30°C/min. That final temperature was maintained for 1 min before cooling back to initial temperature.
  • the carrier gas was helium (2.6 mL/min, Matheson Tri-Gas, Longmont, CO).
  • Quantification was performed in Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, CA), equipped with a flame ionization detector (GC-FID) and an Agilent HP-5 capillary column (0.32 mm internal diameter, 0.50 ⁇ film thickness, 30 m length. Agilent). The temperature was initially 50°C, held for 3 min, then increased to 250°C at 10°C/min, and finally 250°C was held for 10 min. Helium (1.8 mL/min, Matheson Tri-Gas) was used as the carrier gas. The injector and detector temperatures were 220 and 275°C, respectively. The sample was injected at 1 ⁇ _, without splits.
  • the concentration of glycerol, adipic acid, 6-hydroxyhexanoic acid, 7- hydroxyheptanoic acid and 4-methylpentanoic acid were determined via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system (Shimadzu Scientific Instruments, Inc., Columbia, MD) equipped with an HPX-87H organic acid column (Bio-Rad, Hercules, CA) with operating conditions to optimize peak separation (0.3 ml/min flow rate, 30 mM H 2 SO 4 mobile phase, column temperature 42°C).
  • Omega-carboxylated primers can support the synthesis of products such as co- hydroxyacids and dicarboxylic acids.
  • succinyl-CoA and glutaryl- CoA which can be generated from corresponding acids by the Clostridium kluyveri CoA transferase Catl .
  • ⁇ -hydroxylated primer glycolyl-CoA can lead to the synthesis of ⁇ - hydroxyacid 4-hydroxybutyric acid through the proposed pathway (FIG. 2, FIG. 9).
  • the following enzymes provided the individual components of the pathway: BktB (thiolase) and PhaB l (HACD) from Ralstonia eutropha, Aeromonas caviae PhaJ (ECH), Treponema denticola TdTer (ECR) with native enzymes catalyzing the acid-forming termination and Megasphaera elsdenii transferase Pet activating gly colic acid to glycolyl-CoA.
  • MG1655 (DE3) AglcD served as the host strain.
  • sub-terminal functionalized primers for example, co-l- functionalization
  • isobutyryl-CoA priming with the following individual pathway components: Megasphaera elsdenii Pet (transferase for isobutyric acid activation), Ralstonia eutropha BktB (thiolase), E. coli FadB (HADC and ECH), Euglena gracilis EgTer (ECR), a d E. coli Ydil (ACT). JCOl overexpressing these enzymes produced 45 mg/L of 4-methylpentanoic acid (FIG. 8).
  • This deletion was introduced into JST06 to reduce undesirable hydrolysis of priming (succinyl-CoA) and extending units (acetyl-CoA) by native thioesterases, with Mus musculus dicarboxylic ACT Acot8 then overexpressed as the termination enzyme.
  • This re-engineered strain produced a higher adipic acid titer (334 mg/L compared to 170 mg/L in the JCOl background) in the presence of succinic acid (FIG. 10).
  • the intracellular generation of succinic acid/succinyl-CoA was accomplished using strain MG1655 AldhAApoxBAptaAadhE (MB263), which retains the reductive branch of the TCA cycle, along with the overexpression of PaaJ, PaaH, PaaF, TdTer, Catl, and Acot8, resulting in 0.24 g/L adipic acid from a single carbon source (glycerol, Figure 11). Maximization of primer availability through deletion of sucD, which encodes a subunit of succinyl-CoA synthetase, part of the TCA cycle, was again used to improve product titer (0.35 g/L, Figure 11).
  • 3- oxoadipic acid was believed to be spontaneously decarboxylated to levulinic acid in this strain.
  • Additional overexpression of the decarboxylases Solarium habrochaites Mksl or Clostridium acetobutylicum Adc increased levulinic acid titers to 71 mg/L and 159 mg/L, respectively (FIG. 5). All the strains were grown with glycerol and succinic acid for the synthesis of levulinic acid.
  • pathway and process optimization in line with industrial biotechnology approaches, can improve performance for a specific target product, as the underlying carbon and energy efficiency enables the feasibility of further advancing product titer, rate, and yield.
  • Important areas include generating and balancing pools of priming and extender units and optimization of required pathway enzymes for a given target product.
  • the former can exploit previously developed pathways for primers and extender units, whereas the latter includes identifying and engineering enzymes that may be flux limiting due to suboptimal enzyme specificity or activity.
  • yeast E. co ⁇ shuttle vectors are available for ease of the experiments. Since the FAS genes are ubiquitous, the invention is predicted to function in yeast, especially since yeasts are already available with exogenous functional TE genes and the reverse beta oxidation pathway has also been made to run in yeast.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The use of microorganisms to make omega-functionalized methyl ketones, 2-alcohols, 2- amines, and their derivatives, including lactams, lactones, α,ω-l -diamines, co- 1 -amino- 1- alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1- diols. This is achieved through an iterative carbon chain elongation pathway that uses omega- functionalized CoA thioesters as primers and acetyl-CoA as the extender unit, in combination with various termination enzymes that act on the omega-functionalized beta-keto acyl-CoA intermediates of the pathway. The action of these termination enzymes on such intermediates yield the aforementioned products.

Description

SYNTHESIS OF OMEGA FUNCTIONALIZED METHYLKETONES, 2- ALCOHOLS, 2-AMINES, AND DERIVATIVES THEREOF
PRIOR RELATED APPLICATIONS
[0001] This application claims priority to US Serial No. 62/148,248, SYNTHESIS
OF OMEGA FUNCTIONALIZED METHYLKETONES, 2-ALCOHOLS, 2-AMINES, AND DERIVATIVES THEREOF, filed April 16, 2015, and incorporated by reference herein in its entirety for all purposes.
FEDERALLY SPONSORED RESEARCH STATEMENT
[0002] Not applicable.
FIELD OF THE DISCLOSURE
[0003] The disclosure generally relates to the use of microorganisms to make omega- functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, α,ω-l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1-diols. This is achieved through an iterative carbon chain elongation pathway that uses omega-functionalized CoA thioesters as primers and acetyl- CoA as the extender unit, in combination with various termination enzymes that act on the omega-functionalized beta-keto acyl-CoA intermediates of the pathway. The action of these termination enzymes on such intermediates generates the aforementioned products.
BACKGROUND OF THE DISCLOSURE
[0004] Reactions that catalyze the iterative formation of carbon-carbon bonds are instrumental for many metabolic pathways, such as the biosynthesis of fatty acids, polyketides, and many other molecules with applications ranging from biofuels and green chemicals to therapeutic agents. These pathways typically start with small precursor metabolites that serve as building blocks that are subsequently condensed and modified in an iterative fashion until the desired chain length and functionality are achieved. [0005] Most iterative carbon-carbon bond forming reactions in natural biological systems take place through a Claisen condensation mechanism in which the nucleophilic a- anion of an acyl-thioester, serving as the extender unit, attacks the electrophilic carbonyl carbon of another acyl-thioester, serving as the primer. Depending on how the nucleophilic a- anion is generated, the Claisen condensation reaction can be classified as decarboxylative or non-decarboxylative.
[0006] Many natural iterative carbon chain elongation pathways, like fatty acid and polyketide biosynthesis pathways, utilize decarboxylative Claisen condensation reactions with malonyl thioesters as extender units. Their potential products include fatty acids, alcohols, polyketides, esters, alkanes and alkenes with diverse chain lengths, structures and functionalities due to usage of functionalized primers, usage of a-functionalized malonyl thioesters as extender units and diverse pathways for termination of carbon chain elongation and subsequent product modification. However, despite the structural and functional diversity of these products, the use of malonyl thioester as C2 extender unit requires the ATP- dependent activation of acetyl-CoA to malonyl-CoA, which in turn limits the energy efficiency of these pathways. Furthermore, owing to the decarboxylation mechanism, the β- site of extender units of the decarboxylative Claisen condensation must be a carboxylate group, restricting the range of extender units and potentially limiting the diversity of products that can be generated through these carbon chain elongation pathways.
[0007] In order to overcome this limitation, we have recently implemented a novel approach by driving beta-oxidation in reverse to make fatty acids instead of degrading them (see US20130316413, WO2013036812, each incorporated by reference in its entirety for all purposes). Unlike the fatty acid biosynthesis pathway, the reversal of the β-oxidation cycle operates with coenzyme-A (CoA) thioester intermediates and uses acetyl-CoA directly for acyl-chain elongation (rather than first requiring ATP-dependent activation to malonyl-CoA). In these pathways, thiolases catalyze the non-decarboxylative Claisen condensation in which acetyl-CoA, instead of malonyl thioesters, serves as the extender unit, and subsequent β- reduction reactions by hydroxyacyl-CoA dehydrogenases (HACDs), enoyl-CoA hydratases (ECHs) and enoyl-CoA reductases (ECRs) enable iteration. Compared to pathways utilizing decarboxylative Claisen condensation, these pathways are more energy efficient due to less ATP consumption for the supply of extender unit acetyl-CoA than malonyl thioesters. However, these thiolases only utilize acetyl-CoA as the extender unit, thus limiting the functionality of synthesized products. A novel non-decarboxylative Claisen condensation reaction able to accept wider range of functionalized primers and proceed in an iterative manner is required to diversify the product range of carbon-chain elongation.
[0008] In the beta-oxidation reversal pathway, the intermediate after the thiolase reaction is β-ketoacyl-CoA. When acid-forming termination reaction catalyzed by thioesterase or CoA-transferase or phosphotransacylase+kinase terminates the beta-oxidation reversal, β-keto acid is formed, β-keto acid can be decarboxylated to methyl ketone spontaneously or by beta-keto acid decarboxylase. Methyl ketone can be converted to 2- amine and 2-alcohol by transaminase and keto-dehydrogenase respectively. If non- decarboxylative thiolases able to accept wider range of functionalized primers and proceed in an iterative manner were available, methyl ketones, 2-amines and 2-alcohols with diverse functionalities and chain lengths could be produced.
[0009] This disclosure demonstrates a general CoA-dependent carbon elongation platform based on the use of de novo thiolase-catalyzed non-decarboxylative Claisen condensation which accepts omega-functionalized primers, along with suitable HACDs, ECHs and ECRs which catalyzes the β-reduction reactions to enable the iteration of carbon elongation (FIG. 1). Thioesterases or CoA-transferases or phosphotransacylases+kinases (ACTs) terminate the carbon elongation at the beta-ketoacyl-CoA intermediate, the product of thiolase-catalyzed non-decarboxylative Claisen condensation, and generates β-keto acid, which is then decarboxylated to methyl ketone by decarboxylases (DCs). Transaminase and keto-dehydrogenase then convert methyl ketone to 2-amine and 2-alcohol respectively.
[0010] Wide-ranging product diversity (FIG. 1) in functionalities and chain lengths is achieved through the use of primers with omega-functionalization (R in FIG. 1) and iterative operation of carbon chain elongation. When a primer is omega-carboxylated, more products, including lactams, lactones, α,ω-l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols and α,ω-1-diols, can be derived from methyl ketone, 2-alcohol and 2-amine. The proposed platform possesses the potential for the high product diversity of a biosynthetic pathway combined with the high efficiency of a fermentative pathway.
SUMMARY OF THE DISCLOSURE [0011] The disclosure generally relates to the use of microorganisms to make omega- functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, α,ω-l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1-diols. This is achieved through an iterative carbon chain elongation pathway that uses omega-functionalized CoA thioesters as primers and acetyl- CoA as the extender unit, in combination with various termination enzymes that act on the omega-functionalized beta-keto acyl-CoA intermediates of the pathway. The action of these termination enzymes on such intermediates yields the aforementioned products.
[0012] The engineered pathway consists of five core enzymatic steps that generate omega-functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths. In the first step (Step 1), omega-functionalized CoA thioesters to be used as primers are generated, mainly by activation of their acid form, which can be either supplemented in the media or derived from carbon sources. Alternatively, these primers can be derived from carbon sources without aforementioned Step 1.
[0013] In Step 2, thiolase catalyzed non-decarboxylative Claisen condensation between omega-functionalized primer and acetyl-CoA yields an omega-functionalized β-keto acyl-CoA. Further carbon chain elongation is achieved by subsequent dehydrogenation (Step 3) catalyzed by HACDs, dehydration (Step 4) catalyzed by ECHs and reduction (Step 5) catalyzed by ECRs and iterations of Steps 2-5, which taken together generate omega- functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths.
[0014] These omega-functionalized beta-keto acyl-CoA intermediates are then used as substrates for enzymes that convert them to different products. For example, CoA removal (Step 6) by thioesterase or CoA-transferase or phosphotransacylase+kinase and decarboxylation (Step 7) catalyzed by decarboxylase of omega-functionalized beta-keto acyl- CoA intermediates generate omega-functionalized methyl ketones. Subsequent dehydrogenation (Step 8) by keto-dehydrogenase and amino group transfer (Step 9) by transaminase convert omega-functionalized methyl ketone into omega-functionalized 2- alochol and 2-amine respectively. If methyl ketones, 2-alcohols and 2-amines are omega- carboxylated, use of additional enzymatic steps can convert them to lactams, lactones, α,ω-1- diamines, ω-l -amino- 1 -alcohols, co-amino methyl ketones, ω-hydroxy methyl ketones, co- amino-2-alcohols, α,ω-1-diols.
[0015] The process involves performing traditional fermentations using industrial organisms (such as E. coli, S. cerevisiae) that convert different feedstocks into longer-chain products (e.g. omega-functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, α,ω-1-diamines, ω-1-amino-l-alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1-diols). These organisms are considered workhorses of modern biotechnology. Media preparation, sterilization, inoculum preparation, and fermentation are the main steps of the process, once the requisite strains have been created.
[0016] As used herein, a "primer" is a starting molecule for the iterative cycle to add two carbon donor units to a growing acyl-CoA thioester. The initial primer can be any kind of omega-functionalized acyl-CoA. As the chain grows by adding donor units in each cycle, the primer will accordingly increase in size. [0017] As used herein, the "extender unit" is the donor of the 2 carbon units of each cycle of carbon elongation. In this disclosure, the extender unit is acetyl-CoA.
[0018] Thiolases are ubiquitous enzymes that have key roles in many vital biochemical pathways, including the beta-oxidation pathway of fatty acid degradation and various biosynthetic pathways. Members of the thiolase family can be divided into two broad categories: degradative thiolases (EC 2.3.1.16), and biosynthetic thiolases (EC 2.3.1.9). The forward and reverse reactions are shown below:
-CoA
Figure imgf000006_0001
egra at on
[0019] These two different types of thiolase are found both in eukaryotes and in prokaryotes: acetoacetyl-CoA thiolase (EC:2.3.1.9) and 3-ketoacyl-CoA thiolase (EC:2.3.1.16). 3-ketoacyl-CoA thiolase (also called thiolase I) has a broad chain-length specificity for its substrates and is involved in degradative pathways such as fatty acid beta- oxidation. Acetoacetyl-CoA thiolase (also called thiolase II) is specific for the thiolysis of acetoacetyl-CoA and involved in biosynthetic pathways such as poly beta-hydroxybutyric acid synthesis or steroid biogenesis.
[0020] Furthermore, the degradative thiolases can be made to run in the forward direction by building up the level of left hand side reactants (primer and extender unit), thus driving the equilibrium in the forward direction and/or by overexpressing same or by expressing a mutant of same.
[0021] As used herein, native or engineered thiolases able to use functionalized primers and extender units is an enzyme that catalyzes the condensation of omega- functionalized acyl-CoA thioester with acetyl-CoA as the 2-carbon donor for chain elongation to produce an omega-functionalized β-keto acyl-CoA in a non-decarboxylative condensation reaction (R represents the omega):
Figure imgf000007_0001
{e ¾is isr ϊ.ϊί·;;}
[0022] As used herein a "hydroxyacyl-CoA dehydrogenases (HACDs)", is an enzyme that catalyzes the reduction of a an omega-functionalized β-keto acyl-CoA to a β-hydroxy acyl-CoA:
Figure imgf000007_0002
[0023] As used herein, "enoyl-CoA hydratase (ECH)" is an enzyme that catalyzes the dehydration of an omega-functionalized β-hydroxy acyl-CoA to an omega-functionalized enoyl-CoA:
Figure imgf000008_0001
A ^ ydmxyacy!-CoA anoytCc*
[0024] As used herein, an "enoyl-CoA reductase (ECR)" is an enzyme that catalyzes the reduction of an omega-functionalized tram,-enoyl-CoA to an omega-functionalized acyl- CoA:
Figure imgf000008_0002
[0025] As used herein "termination pathway" refers to one or more enzymes (or genes encoding same) that will pull reaction CoA thioester intermediates out the iterative cycle and produce the desired end product.
[0026] As used herein, an "omega functionalized" product or primer, has an R group at the end of the straight carbon chain— e.g., in the last position, the first position being determined by the CoA linkage, even after removal of CoA. R can be any group and is preferably a branched alkyl, aryl, -OH, -COOH, amine, and the like.
[0027] As used herein, the expressions "microorganism," "microbe," "strain" and the like may be used interchangeably and all such designations include their progeny. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included. Where distinct designations are intended, it will be clear from the context.
[0028] As used herein, reference to a "cell" is generally understood to include a culture of such cells, as the work described herein is done in cultures having 109"15 cells.
[0029] As used herein, "growing" cells used it its art accepted manner, referring to exponential growth of a culture of cells, not the few cells that may not have completed their cell cycle at stationary phase or have not yet died in the death phase or after harvesting. [0030] As used in the claims, "homolog" means an enzyme with at least 40% identity to one of the listed sequences and also having the same general catalytic activity, although of course Km, Kcat and the like can vary. While higher identity (60%, 70%, 80%) and the like may be preferred, it is typical for bacterial sequences to diverge significantly (40-60%), yet still be identifiable as homologs, while mammalian species tend to diverge less (80-90%).
[0031] Reference to proteins herein can be understood to include reference to the gene encoding such protein. Thus, a claimed "permease" protein can include the related gene encoding that permease. However, it is preferred herein to refer to the protein by standard name per ecoliwiki or HUGO since both enzymatic and gene names have varied widely, especially in the prokaryotic arts.
[0032] Once an exemplary protein is obtained, many additional examples of proteins with similar activity can be identified by BLAST search. Further, every protein record is linked to a gene record, making it easy to design overexpression vectors. Many of the needed enzymes are already available in vectors, and can often be obtained from cell depositories or from the researchers who cloned them. But, if necessary, new clones can be prepared based on available sequence information using RT-PCR techniques. Thus, it should be easily possible to obtain all of the needed enzymes/genes for overexpression.
[0033] Another way of finding suitable enzymes/genes for use in the invention is to consider other enzymes with the same EC number, since these numbers are assigned based on the reactions performed by a given enzyme. An enzyme that thus be obtained, e.g., from AddGene or from the author of the work describing that enzyme, and tested for functionality as described herein. In addition, many sites provide lists of proteins that all catalyze the same reaction.
[0034] Understanding the inherent degeneracy of the genetic code allows one of ordinary skill in the art to design multiple nucleotides that encode the same amino acid sequence. NCBI™ provides codon usage databases for optimizing DNA sequences for protein expression in various species. Using such databases, a gene or cDNA may be "optimized" for expression in E. coli, yeast, algal or other species using the codon bias for the species in which the gene will be expressed. [0035] Initial cloning experiments have proceeded in E. coli for convenience since most of the required genes are already available in plasmids suitable for bacterial expression, but the addition of genes to bacteria is of nearly universal applicability. Indeed, since recombinant methods were invented in the 70' s and are now so commonplace, even school children perform genetic engineering experiments using bacteria. Such species include e.g., Bacillus, Streptomyces, Azotobacter, Trichoderma, Rhizobium, Pseudomonas, Micrococcus, Nitrobacter, Proteus, Lactobacillus, Pediococcus, Lactococcus, Salmonella, Streptococcus, Paracoccus, Methanosarcina, and Methylococcus, or any of the completely sequenced bacterial species. Indeed, hundreds of bacterial genomes have been completely sequenced, and this information greatly simplifies both the generation of vectors encoding the needed genes, as well as the planning of a recombinant engineering protocol. Such species are listed along with links at http://en.wikipedia.org/wiki/List_of_sequenced_bacterial_genomes.
[0036] Additionally, yeasts, such as Saccharomyces, are a common species used for microbial manufacturing, and many species can be successfully transformed. Indeed, yeast are already available that express recombinant thioesterases— one of the termination enzymes described herein— and the reverse beta oxidation pathway has also been achieved in yeast. Other species include but are not limited to Candida, Aspergillus, Arxula adeninivorans, Candida boidinii, Hansenula polymorpha (Pichia angusta), Kluyveromyces lactis, Pichia pastoris, and Yarrowia lipolytica, to name a few. [0037] It is also possible to genetically modify many species of algae, including e.g.,
Spirulina, Apergillus, Chlamydomonas, Laminaria japonica, Undaria pinnatifida, Porphyra, Eucheuma, Kappaphycus, Gracilaria, Monostroma, Enteromorpha, Arthrospira, Chlorella, Dunaliella, Aphanizomenon, Isochrysis, Pavlova, Phaeodactylum, Ulkenia, Haematococcus, Chaetoceros, Nannochloropsis, Skeletonema, Thalassiosira, and Laminaria japonica, and the like. Indeed, the microalga Pavlova lutheri is already being used as a source of economically valuable docosahexaenoic (DHA) and eicosapentaenoic acids (EPA), and Crypthecodinium cohnii is the heterotrophic algal species that is currently used to produce the DHA used in many infant formulas.
[0038] Furthermore, a number of databases include vector information and/or a repository of vectors and can be used to choose vectors suitable for the chosen host species. See e.g., AddGene.org which provides both a repository and a searchable database allowing vectors to be easily located and obtained from colleagues. See also Plasmid Information Database (PlasmID) and DNASU having over 191,000 plasmids. A collection of cloning vectors of E. coli is also kept at the National Institute of Genetics as a resource for the biological research community. Furthermore, vectors (including particular ORFS therein) are usually available from colleagues.
[0039] The enzymes can be added to the genome or via expression vectors, as desired.
Preferably, multiple enzymes are expressed in one vector or multiple enzymes can be combined into one operon by adding the needed signals between coding regions. Further improvements can be had by overexpressing one or more, or even all of the enzymes, e.g., by adding extra copies to the cell via plasmid or other vector. Initial experiments may employ expression plasmids hosting 3 or more OR s for convenience, but it may be preferred to insert operons or individual genes into the genome for long term stability.
[0040] Still further improvements in yield can be had by reducing competing pathways, such as those pathways for making e.g., acetate, formate, ethanol, and lactate, and it is already well known in the art how to reduce or knockout these pathways. See e.g., the Rice patent portfolio by Ka-Yiu San and George Bennett (US7569380, US7262046, US8962272, US8795991) and patents by these inventors (US8129157 and US8691552) (each incorporated by reference herein in its entirety for all purposes). Many others have worked in this area as well.
[0041] In calculating "% identity" the unaligned terminal portions of the query sequence are not included in the calculation. The identity is calculated over the entire length of the reference sequence, thus short local alignments with a query sequence are not relevant (e.g., % identity = number of aligned residues in the query sequence/length of reference sequence). Alignments are performed using BLAST homology alignment as described by Tatusova TA & Madden TL (1999) FEMS Microbiol. Lett. 174:247-250, and available through the NCBI website. The default parameters were used, except the filters were turned OFF. [0042] "Operably associated" or "operably linked", as used herein, refer to functionally coupled nucleic acid or amino acid sequences.
[0043] "Recombinant" is relating to, derived from, or containing genetically engineered material. In other words, the genetics of an organism was intentionally manipulated by the hand of man in some way.
[0044] "Reduced activity" is defined herein to be at least a 75% reduction in protein activity, as compared with an appropriate control species (e.g., the wild type gene in the same host species). Preferably, at least 80, 85, 90, 95% reduction in activity is attained, and in the most preferred embodiment, the activity is eliminated (100%). Proteins can be inactivated with inhibitors, by mutation, or by suppression of expression or translation, by knock-out, by adding stop codons, by frame shift mutation, and the like. All reduced activity genes or proteins are signified herein by
[0045] By "null" or "knockout" what is meant is that the mutation produces undetectable active protein. A gene can be completely (100%) reduced by knockout or removal of part of all of the gene sequence. Use of a frame shift mutation, early stop codon, point mutations of critical residues, or deletions or insertions, and the like, can also completely inactivate (100%) gene product by completely preventing transcription and/or translation of active protein. All null mutants herein are signified by Δ.
[0046] "Overexpression" or "overexpressed" is defined herein to be at least 150% of protein activity as compared with an appropriate control species, or any detectable expression in a species that lacks the activity altogether. Preferably, the activity is increased 100-500%) or even ten fold. Overexpression can be achieved by mutating the protein to produce a more active form or a form that is resistant to inhibition, by removing inhibitors, or adding activators, and the like. Overexpression can also be achieved by removing repressors, adding multiple copies of the gene to the cell, or up-regulating the endogenous gene, and the like. All overexpressed genes or proteins are signified herein by "+".
[0047] In certain species it is possible to genetically engineer the endogenous protein to be overexpressed by changing the regulatory sequences or removing repressors. However, overexpressing the gene by inclusion on selectable plasmids or other vectors that exist in hundreds of copies in the cell may be preferred due to its simplicity and ease of exerting externals controls, although permanent modifications to the genome may be preferred in the long term for stability reasons.
[0048] The term "endogenous" or "native" means that a gene originated from the species in question, without regard to subspecies or strain, although that gene may be naturally or intentionally mutated, or placed under the control of a promoter that results in overexpression or controlled expression of said gene. Thus, genes from Clostridia would not be endogenous to Escherichia, but a plasmid expressing a gene from E. coli or would be considered to be endogenous to any genus of Escherichia, even though it may now be overexpressed.
[0049] "Expression vectors" are used in accordance with the art-accepted definition of a plasmid, virus or other propagatable sequence designed for protein expression in cells. There are thousands of such vectors commercially available, and typically each has an origin of replication (ori); a multiple cloning site; a selectable marker; ribosome binding sites; a promoter and often enhancers; and the needed termination sequences. Most expression vectors are inducible, although constitutive expression vectors also exist.
[0050] As used herein, "inducible" means that gene expression can be controlled by the hand of man, by adding e.g., a ligand to induce expression from an inducible promoter. Exemplary inducible promoters include the lac operon, inducible by IPTG, the yeast AOXl promoter inducible with methanol, the strong LAC4 promoter inducible with lactate, and the like. Low level of constitutive protein synthesis may occur even in expression vectors with tightly controlled promoters.
[0051] As used herein, an "integrated sequence" means the sequence has been integrated into the host genome, as opposed to being maintained on an expression vector. It will still be expressible, and preferably is inducible as well.
[0052] The use of the word "a" or "an" when used in conjunction with the term
"comprising" in the claims or the specification means one or more than one, unless the context dictates otherwise. [0053] The term "about" means the stated value plus or minus the margin of error of measurement or plus or minus 10% if no method of measurement is indicated.
[0054] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or if the alternatives are mutually exclusive.
[0055] The terms "comprise", "have", "include" and "contain" (and their variants) are open-ended linking verbs and allow the addition of other elements when used in a claim.
[0056] The phrase "consisting of is closed, and excludes all additional elements.
[0057] The phrase "consisting essentially of excludes additional material elements, but allows the inclusions of non-material elements that do not substantially change the nature of the invention, such as instructions for use, buffers, background mutations that do not effect the invention, and the like.
[0058] The following abbreviations are used herein:
Figure imgf000014_0001
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] FIG. 1: Platform for the synthesis of omega-functionalized methyl ketones, 2- alcohols and 2-amines. Omega-functionalized primer is mainly activated from its acid form, which can be either supplemented in the media or derived from carbon sources, catalyzed by CoA-synthetase, CoA transferase or phosphotransacylase + kinase (Step 1). Primer can also be derived from carbon sources without via Step 1. Condensation between omega- functionalized primer and acetyl-CoA catalyzed by thiolase (Step 2) forms omega- functionalized β-keto acyl-CoA. Further carbon chain elongation is achieved by subsequent reactions by dehydrogenase (Step 3), dehydratase (Step 4) and reductase (Step 5) and iterations of Steps 2-5. CoA removal by thioesterase or CoA transferase and phosphotransacylase + kinase (Step 6) and decarboxylation by decarboxylase (Step 7) generate omega-functionalized methyl ketone from omega-functionalized β-keto acyl-CoA. Subsequent dehydrogenation by keto-dehydrogenase (Step 8) and amino group transfer by transaminase (Step 9) convert omega-functionalized methyl ketone into omega- functionalized 2-alcohol and 2-amine respectively. R means functionalized omega group and n means length of primers, intermediates and products. Dashed line means multiple reaction steps or iteration. [0060] FIG. 2: Synthesis of omega-carboxylated methyl ketones, 2-alcohols and 2- amines, namely co-l ketoacids, hydroxyacids and amino acids, through the platform depicted in FIG. 1 (R in FIG. 1 = -COOH). Omega-carboxylated acyl-CoA, which is activated from α,ω-diacid, serves as the primer.
[0061] FIG. 3: Derivatives of co-l ketoacids, hydroxyacids and amino acids, which could be synthesized through additional enzymatic and metabolic reactions. Products shown include omega-functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, α,ω-l -diamines, ω-l -amino- 1 -alcohols, ω-amino methyl ketones, ω-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1-diols
[0062] FIG. 4: Example of synthesis of levulinic acid (4-oxopentanoic acid) through the proposed platform with succinyl-CoA as the primer. Succinyl-CoA is activated from succinate by Catl (Step 1). Levulinic acid is produced after subsequent condensation between succinyl-CoA and acetyl-CoA catalyzed by PaaJ (Step 2), CoA removal catalyzed by PcalJ (Step 3) and decarboxylation by Mksl/Adc (Step 4).
[0063] FIG. 5: Titers of levulinic acid synthesized through the platform depicted in FIG. 4 with different enzymes catalyzing Steps 1-4. JST06(DE3) AsdhB, an E. coli strain deficient of mixed-acid fermentations, thioesterases and TCA cycle, served as the host strain. The engineered strains were grown for 48 hours at 37 °C in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 20 mM succinate. [0064] FIG. 6: The pathway to validate and demonstrate the iterative carbon elongation platform utilizing thiolase-catalyzed non-decarboxylative Claisen condensation which accepts omega-functionalized acyl-CoA primers. The validation is through analyzing whether omega-functionalized carboxylic acids or omega-functionalized alcohols are produced after adding termination pathways acyl-CoA thioesterase/transferase (ACT) or acyl-CoA reductase + alcohol dehydrogenase (ACR + ADH) respectively at the acyl-CoA node of the platform. Omega-functionalization was demonstrated (see FIG. 7-11): omega- phenylation (R=-Ph); omega-carboxylation (R=-COOH); omega-hydroxylation (R=-OH) and omega- 1-methylati on (R=- -CH(CH3)2). [0065] FIG. 7: Titers of omega-phenylalkanoic acids produced with phenylacetyl-
CoA (R=-Ph) as the primer. Utilized host strain and enzymatic components are listed in the bottom part. "Endogenous" refers to native enzymes without overexpression. The engineered strain was grown for 48 hours at 30°C in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 5 mM phenylacetic acid. [0066] FIG. 8: Titers of dicarboxylic acids and omega-hyroxy acids produced with succinyl-CoA and glutaryl-CoA (R=-COOH) as the primer, and omega- 1 -methyl fatty acid and omega- 1 -methyl alcohol with isobutyryl-CoA (R=- -CH(CH3)2) as the primer. Utilized host strain and enzymatic components are listed in the bottom part. "Endogenous" refers to native enzymes without overexpression. The engineered strains were grown for 48 hours at 37 °C (when using succinyl-CoA or glutaryl-CoA as the primer) or 30°C (when using isobutyryl-CoA as the primer) in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 20 mM succinate or glutaric acid or isobutyric acid.
[0067] FIG. 9: Total ion GC-MS chromatogram showing peak of 4-hydroxybutyric acid synthesized with glycolyl-CoA (R= -OH) as the primer. The following enzymes provided the individual components of the pathway: BktB (thiolase) and PhaBl (HACDH) from Ralstonia eutropha, Aeromonas caviae PhaJ (ECH), Treponema denticola TdTer (ECR) with native enzymes catalyzing the acid-forming termination and Megasphaera elsdenii transferase Pet activating glycolic acid to glycolyl-CoA. MG1655 (DE3) AglcD served as the host strain. The engineered strain was grown for 96 hours at 30°C in 50 mL LB media supplemented with 10 g/L glucose and 40 mM glycolic acid. [0068] FIG. 10: Improvement of adipic acid synthesis and synthesis of dicarboxylic acids of different chain lengths through the iterative system depicted in FIG. 6 with succinyl- CoA priming and specified pathway enzymes listed in the bottom part. The engineered strains were grown for 48 hours at 37°C in 20 mL LB-like MOPS media supplemented with 20 g/L glycerol and 20 mM succinate.
[0069] FIG. 11: Adipic acid production from glycerol through the pathway depicted in FIG. 6 priming from succinyl-CoA without the addition of primer precursor succinic acid in either shake flasks or controlled bioreactors.
[0070] FIG. 12: Synthesis of omega-phenyl methyl ketones, 2-alcohols and 2-amines, through the platform depicted in FIG. 1 (R = -Ph). Omega-phenylacyl-CoA, which is activated from omega-phenylalkanoic acid, serves as the primer.
[0071] FIG. 13: Synthesis of omega- 1 -methyl methyl ketones, 2-alcohols and 2- amines, through the platform depicted in FIG. 1 (R = -CH(CH3)2). Omega- 1 -methyl acyl- CoA, which is activated from omega- 1 -methylated carboxylic acid, serves as the primer. [0072] FIG. 14: Synthesis of ω-hydroxy methyl ketones, α,ω-1-diols and ω-1-amino-
1 -alcohols, through the platform depicted in FIG. 1 (R = -OH). Omega-hydroxyacyl-CoA, which is activated from omega-hydroxyacid, serves as the primer.
[0073] FIG. 15: Synthesis of ω-amino methyl ketones, a amino-2-alcohols and α,ω-
1 -diamines, through the platform depicted in FIG. 1 (R = - H2). Omega-amino acyl-CoA, which is activated from omega-amino acid, serves as the primer.
[0074] FIG. 16: Synthesis of ω-halogenated methyl ketones, ω-halogenated 2- alcohols and ω-halogenated 2-amines, through the platform depicted in FIG. 1 (R = -X). Omega-halogenated acyl-CoA, which is activated from omega-halogenated carboxylic acid, serves as the primer. [0075] FIG. 17. A partial listing of embodiments, any one or more or which can be combined with any other, even if not yet so combined. DETAILED DESCRIPTION
[0076] The disclosure generally relates to the use of microorganisms to make omega- functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, α,ω-l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1-diols. This is achieved through an efficient and iterative carbon chain elongation pathway that uses omega-functionalized CoA thioesters as primers and acetyl-CoA as the extender unit, in combination with various termination enzymes that act on the omega-functionalized beta-keto acyl-CoA intermediates of the pathway. The action of these termination enzymes on such intermediates yields the aforementioned products.
[0077] The engineered pathway consists of five core enzymatic steps that generate omega-functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths. In the first step (Step 1), omega-functionalized CoA thioesters to be used as primers are generated, mainly by activation of their acid form, which can be either supplemented in the media or derived from carbon sources. Alternatively, these primers can be derived from carbon sources without aforementioned Step 1.
[0078] In Step 2, thiolase catalyzed non-decarboxylative Claisen condensation between omega-functionalized primer and acetyl-CoA yields an omega-functionalized β-keto acyl-CoA. Further, carbon chain elongation is achieved by subsequent dehydrogenation (Step 3) catalyzed by HACDs, dehydration (Step 4) catalyzed by ECHs and reduction (Step 5) catalyzed by ECRs and iterations of Steps 2-5, which taken together generate omega- functionalized beta-keto acyl-CoA intermediates of different carbon chain lengths.
[0079] These omega-functionalized beta-keto acyl-CoA intermediates are then used as substrates for enzymes that convert them to different products. For example, CoA removal (Step 6) by ACTs and decarboxylation (Step 7) catalyzed by DCs of omega-functionalized beta-keto acyl-CoA intermediates generate omega-functionalized methyl ketones. Subsequent dehydrogenation (Step 8) by keto-dehydrogenases and amino group transfer (Step 9) by transaminases convert omega-functionalized methyl ketone into omega-functionalized 2- alochol and 2-amine respectively. [0080] When omega-carboxylated primers are used, products methyl ketones, 2- alcohols and 2-amines are omega-carboxylated, namely ω-1-keto acids, co-l -hydroxy acids and co-l -amino acids. Use of additional enzymatic steps can convert ω-1-keto acids, co-l- hydroxy acids and ω-1-amino acids to lactams, lactones, α,ω-1-diamines, co- 1 -amino- 1- alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1- diols. Amidohydrolases convert co-l -amino acid to lactam. Lactonases convert co-l -hydroxy acid to lactone. Acyl-CoA synthetases or acyl-CoA transferases or phosphotransacylases+kinase activate ω-1-keto acid, co-l -hydroxy acid and co-l -amino acid to ω-1-ketoacyl-CoA, ω-1-hydroxyacyl-CoA and co-l-aminoacyl-CoA respectively. Keto- dehydrogenases and transaminases convert ω-1-ketoacyl-CoA to ω-1-hydroxyacyl-CoA and co-l-aminoacyl-CoA respectively. ACTs release CoA from ω-1-ketoacyl-CoA to co-l- hydroxyacyl-CoA and co-l-aminoacyl-CoA, generating their acid forms. Therefore, the conversion of ω-1-keto acid to co-l -hydroxy acid and co-l -amino acid can be via their CoA forms. Acyl-CoA reductases (ACRs) convert ω-1-ketoacyl-CoA, ω-1-hydroxyacyl-CoA and co-l-aminoacyl-CoA to ω-1-keto aldehyde, ω-1-hydroxy aldehyde and ω-1-amino aldehyde, co-transaminase convert ω-1-keto aldehyde, co-l -hydroxy aldehyde and co-l -amino aldehyde to co-amino methyl ketone, co-amino-2-alcohol and α,ω-l -diamine respectively. Alcohol dehydrogenases (ADHs) convert ω-1-keto aldehyde, co-l -hydroxy aldehyde and co-l -amino aldehyde to co-hydroxy methyl ketone, α,ω-1-diol and co-l -amino- 1 -alcohol. [0081] The process involves performing traditional fermentations using industrial organisms (E. coli, S. cerevisiae) that convert different feedstocks into longer-chain products (e.g. omega-functionalized methyl ketones, 2-alcohols, 2-amines, and their derivatives, including lactams, lactones, α,ω-l -diamines, co-l -amino- 1 -alcohols, co-amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols, α,ω-1-diols). These organisms are considered workhorses of modern biotechnology. Media preparation, sterilization, inoculum preparation, and fermentation are the main steps of the process.
[0082] Many examples of thiolase enzymes which can potentially catalyze the non- decarboxylative condensation of an acyl-CoA primer and acetyl-CoA extender unit are provided herein and the following Table 1 provides several additional examples which can also serve as templates for engineered variants:
Figure imgf000020_0001
[0083] This technology takes the above thiolase initiated pathway one step further to make omega functionalized products. The method entails developing a new pathway that is based on native or engineered thiolases capable of catalyzing the condensation of omega- functionalized acyl-CoA primers with an acetyl-CoA as the extender unit. This has been reported in neither the scientific, peer-reviewed literature nor the patent literature.
Materials that can be used with the invention include those in Tables A-D
Figure imgf000020_0002
TABLE A: Activation enzymes
Reaction Illustration EC Enzyme Source organism Protein
Numb names and gene name Accession ers Numbers
Salmonella AAL19325.1 typhimurium LT2 prpE
Bacillus subtilis bioW AAC00261.1
Cupriavidus ADE20402.1 basilensis hmfD
Rhodopseudomonas CAJ18317.1 palustris badA
R. palustris hbaA CAE26113.1
Pseudomonas NP_249687.1 aeruginosa PA01
pqsA
Arabidopsis thaliana Q42524.1 4cl
2.8.3- CoA E. coli atoD NP_416725.1 transferase
E. coli atoA NP_416726.1
E. coli scpC NP_417395.1
Clostridium kluyveri AAA92346.1 catl
Clostridium kluyveri AAA92344.1 cat2
Clostridium NP_149326.1 , acetobutylicum ctfAB NP_149327.1
Pseudomonas putida NP_746081.1 pcalJ NP_746082.1
Megasphaera elsdenii WP_014015705.1 pet
Acidaminococcus CAA57199.1 TABLE A: Activation enzymes
Reaction Illustration EC Enzyme Source organism Protein
Numb names and gene name Accession ers Numbers
fermentans gctAB CAA57200.1
Acetobacter aceti AGG68319.1 aarC
E. coliydiF NP_416209.1
2.3.1.-; Phosphotra Clostridium NP_349676.1 2.7.2.1 nsacylase + acetobutylicum ptb
Carboxylate
kinase Enterococcus faecalis AAD55374.1
2.7.2.1 ptb
5
Salmonella enterica AAD3901 1.1 pduL
Clostridium AAK81015.1 acetobutylicum buk
Enterococcus faecalis AAD55375.1 buk
Salmonella enterica AAD39021.1 pduW
Figure imgf000022_0001
Figure imgf000023_0001
TABLE B: Reactions of the platform
Reaction Illustration EC Enzyme Source organism Protein
Numbers names and gene name Accession
Numbers enoyl-[acyl-c
E. coli fabl NP_415804.1 arrier-protein
] reductase
Enterococcus
NP_816503.1 faecalis fabK
Bacillus subtilis
KFK80655.1 fabL
Vibrio cholerae
ABX38717.1 fabV
acyl-CoA
dehydrogen E. coli fadE NP_414756.2 ase
E. coli ydiO NP_416210.4
Figure imgf000024_0001
TABLE C: Termination Pathways
Reaction Illustration EC Enzyme Source organism Protein
Numb names and gene name Accession ers Numbers
Acidaminococcus CAA57199.1 fermentans gctAB CAA57200.1
Acetobacter aceti AGG68319.1 aarC
E. coliydiF NP_416209.1
2.3.1.-; Phosphotransa Clostridium NP_349676.1 2.7.2.1 cylase + acetobutylicum ptb
Carboxylate
Enterococcus AAD55374.1
2.7.2.1 kinase
faecalis ptb
5
Salmonella enterica AAD3901 1.1 pduL
Clostridium AAK81015.1 acetobutylicum buk
Enterococcus AAD55375.1 faecalis buk
Salmonella enterica AAD39021.1 pduW
β-keto acid O . o
■ .c°2 4.1 .1.5 Decarboxylase Lycopersicon ADK38535.1 -> methyl A OOH ϋ hirsutum f
R »~ R'" 6;
ketone glabratum mks1
A p-keto acid A methyl ketone
Clostridium AAA63761 .1 acetobutylicum adc
Ketone -> Amino donor ^H2 2.6.1.- Transaminase Arabidopsis NP 001 189947. Amine thaliana At3g22200 1
R{ R2 — ^ -^→- R, R2 Alcaligenes AAP92672.1
A ketone An amine denitrificans AptA
Bordetella WP 015041039 bronchi septica .1
BB0869
Bordetella WP 010927683 parapertussis .1
BPP0784
Brucella melitensis EEW88370.1 BAWG 0478
Burkholderia AFI65333.1 pseudomallei
BP1026B I0669
Chromobacterium AAQ59697.1 violaceum CV2025
Oceanicola WP 007254984 granulosus .1
OG2516 07293
Paracoccus ABL72050.1 denitrificans
PD1222
Pden 3984
Pseudogulbenkiani WP 008952788 a ferrooxidans ω- .1
TA
Pseudomonas P28269.1 putida ω -TA
Ralstonia YP 002258353. solanacearum ω- 1
TA
Rhizobium meliloti NP_386510.1 S c01534
Vibrio flu vial is ω - AEA39183.1 TA
Mus musculus AAH58521.1 TABLE C: Termination Pathways
Reaction Illustration EC Enzyme Source organism Protein
Numb names and gene name Accession ers Numbers abaT
Flavobacterium BAB13756.1 lutescens lat
Streptomyces AAB39899.1 clavuliqerus lat
E. coli gabT YP_490877.1
E. coli puuE NP_415818.1
E. coli ygjG NP_417544.5
Ketone -> NAD{P)H ?H 1 .1 .1- Keto- Clostridium AAA23199.2 Alcohol dehydrogenas beijerinckii adh
R,' j ^ *~ Ry R2 e E. coli serA NP 417388.1
A ketone An alcohol Gordonia sp. TY-5 BAD03962.1 adhl
Gordonia sp. TY-5 BAD03964.1 adh2
Gordonia sp. TY-5 BAD03961.1 adh3
Rhodococcus ruber WP 043801412 adh-A .1
Acidaminococcus ADB47349.1 fermentans hqdH
Figure imgf000026_0001
TABLE D: Enzymes for derivatizations of ω -1 keto acid, ω -1 hydroxy acid and ω -1 amino acid
Figure imgf000027_0001
Figure imgf000028_0001
[0085] Wild-type K12 Escherichia coli strain MG1655 was used as the host for all genetic modifications. All resulting strains used in this study are listed in Table E. Gene deletions were performed using PI phage transduction with single-gene knockout mutants from the National BioResource Project (NIG, Japan) as the specific deletion donor. The λϋΕ3 prophage, carrying the T7 RNA polymerase gene and laclq, was integrated into the chromosome through λϋΕ3 lysogenization kit (Novagen, Darmstadt, Germany). All strains were stored in 32.5% glycerol stocks at -80°C. Plates were prepared using LB medium containing 1.5% agar, and appropriate antibiotics were included at the following concentrations: ampicillin (100 μg/mL), spectinomycin (50 μg/ mL), kanamycin (50 μg/ mL), and chloramphenicol (34 μg/mL).
[0086] All plasmids used in this study and oligonucleotides used in their construction are listed in Tables E and F. Plasmid based gene overexpression was achieved by cloning the desired gene(s) into either pETDuet-1 or pCDFDuet-1 (Novagen, Darmstadt, Germany) digested with appropriate restriction enzymes using In-Fusion PCR cloning technology (Clontech Laboratories, Inc., Mountain View, CA). Cloning inserts were created via PCR of ORFs of interest from their respective genomic or codon-optimized DNA with Phusion polymerase (Thermo Scientific, Waltham, MA) E. coli genes were obtained from genomic DNA, while heterologous genes were synthesized by GenScript (Piscataway, NJ) or GeneArt (Life Technologies, Carlsbad, CA) with codon optimization except for bktB, phaBl, pet, cbjALD and mksl, which were amplified from genomic DNA or cDNA of their source organisms. The recognition site of Ndel in the paaH sequence was eliminated via overlap PCR. The resulting In-Fusion products were used to transform E. coli Stellar cells (Clontech Laboratories, Inc., Mountain View, CA) and PCR identified clones were confirmed by DNA sequencing.
Table E. Strains and plasmids used in this study.
Figure imgf000029_0001
Figure imgf000029_0002
paaH-r2 5'-CGTCTTGGGGTGAATTATCCATACGGCCCACTTGCCTGGG-3'
acot8-f1 5 '- AAG G AG ATATAC ATATG AG C GCCCCGGAAG-3'
acot8-r1 5'-TTGAGATCTGCCATATGTTACAGCTTCGATTCTGAGACTTGC-3'
cbjALD-f1 5 '- AAG GAG ATATAC ATATG AATAAAG AC AC AC TAATAC C- 3 '
cbjALD-r1 5'-TTGAGATCTGCCATATGTTAGCCGGCAAGTACACATC-3'
paaK-f1 5'- AG GAG ATATAC C ATG ATAAC C AATAC AAAG CTTG - 3'
paaK-r1 5'- CGCCGAGCTCGAATTCTCAGGCACCAACAATATTGC-3'
fabl-f1 5 '- AAG GAG ATATAC ATATG G GTTTTC TTTC C G GTAAG - 3'
fabl-r1 5'-TTGAGATCTGCCATATGTTATTTCAGTTCGAGTTCGTTC-3'
ppfadA-f1 5'-AGGAGATATACC ATGAGCCTGAATCCGCGTG-3'
ppfadA-r1 5'-CGCCGAGCTCGAATTCTTAAACACGTTCAAAAACGGTG-3'
ppfadB-f1 5'-ACGTGTTTAAGAATTTAAGGAGGAATAAACC ATGATCTATGAAGGCAAAGCC-3' ppfadB-r1 5'-CGCCGAGCTCGAATTCTTAGTTAAAAAAGCGCTGACC-3'
dcaF-f1 5'-AGGAGATATACC ATGCTGAACGCCTATATCTATG-3'
dcaF-r1 5'-CGCCGAGCTCGAATTCTTAGCTCACATTTTCAATAACC-3'
dcaH-f1 5'-TGTGAGCTAAGAATTTAAGGAGGAATAAACC ATGACCCACCCGATCAAAAA-3' dcaH-r1 5'-CGCCGAGCTCGAATTCTTAGGTGGTAAAGGTCAGCG-3'
dcaE-fl 5 '- C ATG AAATAAG AATTTAAG GAG G AATAAAC C ATGATTC C G GATC AG G ATAAC - 3' dcaE-r1 5'-CGCCGAGCTCGAATTCTTATTTGCCATGATAGCTCGG-3'
pcaJ-f1 5 '- AAG GAG ATATAC AT ATGACCATCAC C AAAAAAC TG- 3'
pcaJ-r1 5'-TTGAGATCTGCCATATGTTATTTGATCAGCGGAACACC-3'
pcal-f1 5'-AAGGAGATATACATATGATCAACAAAACCTATGAGAG-3'
pcal-r1 5'-TTGGTGATGGTCATAGTTTATTCCTCCTTATTTAATTAAACTGCT TTGGCAATGCTG-3' mks1 -f1 5'- AAG GAG ATATAC ATATG GAG AAAAG CATGTCGCC-3'
mks-r1 5'- TTGAGATCTGCCATATGTTATTTATACTTGTTAGCGATGC-3'
adc-f1 5'- AAG GAG ATATAC AT ATGCTGAAAGACGAGGTGATC-3'
adc-r1 5'-TTGAGATCTGCCATATGTTATTTCAGGTAGTCATAAATAAC
bktB-f1 5'-AGGAGATATACCATGATGACGCGTGAAGTGGTAGT-3'
bktB-r1 5'-CGCCGAGCTCGAATTCTCAGATACGCTCGAAGATGG-3'
phaB1 -f1 5'-GCGTATCTGAGAATTAGGAGGCTCTCT ATGACTCAGCGCATTGCGTA
phaB1 -r1 5'-CGCCGAGCTCGAATTCTCAGCCCATGTGCAGGCC-3'
phaJ-f1 5'-AAGGAGATATACATATGTCGGCACAAAGCCTG-3'
phaJ-r1 5'-TTGAGATCTGCCATATGTTACGGCAGTTTCACCACC-3'
[0087] The minimal medium designed by Neidhardt et al. with 125 mM MOPS and
Na2HP04 in place of K2HP04 (1.48 mM for fermentations in flasks; 2.8 mM for fermentations in bioreactors), supplemented with 20 g/L glycerol, 10 g/L tryptone, 5 g/L yeast extract, 100 μΜ FeS04, 5 mM calcium pantothenate, 5 mM (NH )2S04, and 30 mM NH C1 was used for all fermentations unless otherwise stated. Neutralized 5 mM phenylacetic acid or 20 mM succinic acid, glutaric acid, isobutyric acid, glycolic acid, or propionic acid was supplemented as needed. Antibiotics (50 μg/mL carbenicillin and 50 μg/mL spectinomycin) were included when appropriate. All chemicals were obtained from Fisher Scientific Co. (Pittsburg, PA) and Sigma-Aldrich Co. (St. Louis, MO). [0088] Unless otherwise stated, fermentations were performed in 25 mL Pyrex
Erlenmeyer flasks (narrow mouth/heavy duty rim, Corning Inc., Corning, NY) filled with 20 mL fermentation medium and sealed with foam plugs filling the necks. A single colony of the desired strain was cultivated overnight (14-16 h) in LB medium with appropriate antibiotics and used as the inoculum (1%). After inoculation, flasks were incubated in a NBS 124 Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, NJ) at 200 rpm and 37°C, except fermentations supplemented with phenylacetic acid or isobutyric acid in which the temperature was 30°C. When optical density (550 nm, OD550) reached -0.3-0.5, 5 μΜ isopropyl β-D-l-thiogalactopyranoside (IPTG) was added for plasmid based gene expression in all cases except the following: 1 μΜ IPTG was used for adipic acid production from glycerol without succinic acid supplementation and 10 μΜ IPTG was used during production of ω-phenylalkanoic acids. For induction of controlled chromosomal expression constructs, 0.1 mM cumate and 15 ng/mL anhydrotetracycline were also added when appropriate. Flasks were then incubated under the same conditions for 48 h post-induction unless otherwise stated. [0089] Additional fermentations were conducted in a SixFors multi-fermentation system (Infors HT, Bottmingen, Switzerland) with an air flow rate of 2 N L/hr, independent control of temperature (37°C), pH (controlled at 7.0 with NaOH and H2SO4), and stirrer speed (660 rpm for adipic acid production and 720 rpm for tiglic acid production). Fermentations for adipic acid production used the above fermentation media with 45 g/L glycerol, the inclusion of 5 μΜ sodium selenite, and 1 μΜ IPTG. Pre-cultures were grown in 25 mL Pyrex Erlenmeyer flasks as described above and incubated for 24 h post-induction. An appropriate amount of this pre-culture was centrifuged, washed twice with fresh media, and used for inoculation (400 mL initial volume).
[0090] Fermentations with glycolyl-CoA as a primer were conducted in 250 mL Erlenmeyer Flasks filled with 50 mL LB media supplemented with 10 g/L glucose and appropriate antibiotics. The cultivation of inoculum was same as above but 2% inoculation was used. After inoculation, cells were cultivated at 30°C and 250 rpm in a NBS 124 Benchtop Incubator Shaker until an optical density of -0.8 was reached, at which point IPTG (0.1 mM) and neutralized glycolic acid (40 mM) were added. Flasks were then incubated under the same conditions for 96 h for production of 4-hydroxybutyric acid.
[0091] For analysis of dicarboxylic acids and ω-hydroxy acids, extractions were performed as previously described (Clomburg et al. 2015), with 12-hydroxydodecanoic acid as the internal standard and diethyl ether as the organic solvent. With the exception of 4- methylpentanol analysis, extraction of all other analysis samples was conducted as previously described (Kim et al. 2015), with tridecanoic acid as the internal standard and hexane:MTBE (1 : 1) as the organic solvent. Extracted products were then derivatized by BSTFA (N,O- bis(trimethylsilyl)trifluoroacetamide) as previously described (Clomburg et al. 2015) for GC- MS or GC-FID analysis. For GC-FID analysis of 4-methylpentanol, extraction was performed with hexane:MTBE as described above with tridecanol as the additional internal standard. Acetylation was then conducted by adding a 1 : 1 pyridine:acetic anhydride mixture, following the previously described method (Kim et al. 2015). For GC-MS analysis of 4- methylpentanol, samples were extracted with hexane, with 1-heptanol as the internal standard, with subsequent BSTFA derivatization
[0092] GC-MS metabolite identification: Except identifications of 4-hydroxybutyric acid, metabolite identification was conducted via GC-MS as previously described in an Agilent 7890A GC system (Agilent Technologies, Santa Clara, CA), equipped with a 5975C inert XL mass selective detector (Agilent) and Rxi-5Sil column (0.25 mm internal diameter, 0.10 μπι film thickness, 30 m length; Restek, Bellefonte, PA). The sample injection amount was 2 μΙ_, with 40: 1 split ratio. The injector and detector were maintained at 280°C. The column temperature was held initially at 35°C for 1 min and increased to 200°C at the rate of 6°C/min, then to 270 °C at the rate of 30°C/min. That final temperature was maintained for 1 min before cooling back to initial temperature. The carrier gas was helium (2.6 mL/min, Matheson Tri-Gas, Longmont, CO).
[0093] Identification of 4-hydroxbutyric acid was conducted by the Baylor College of Medicine Analyte Center (www.bcm.edu/research/centers/analyte, Houston, TX). An Agilent 6890 GC system (Agilent Technologies, Santa Clara, CA), equipped with a 5973 mass selective detector (Agilent Technologies) and FIP-5ms column (Agilent Technologies) was used. Sample extraction was conducted using Agilent Chem Elut liquid extraction columns (Agilent Technologies) according to manufacturer protocols. [0094] Product quantification was conducted using previously reported gas chromatography methods. Quantification was performed in Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, CA), equipped with a flame ionization detector (GC-FID) and an Agilent HP-5 capillary column (0.32 mm internal diameter, 0.50 μπι film thickness, 30 m length. Agilent). The temperature was initially 50°C, held for 3 min, then increased to 250°C at 10°C/min, and finally 250°C was held for 10 min. Helium (1.8 mL/min, Matheson Tri-Gas) was used as the carrier gas. The injector and detector temperatures were 220 and 275°C, respectively. The sample was injected at 1 μΙ_, without splits.
[0095] The concentration of glycerol, adipic acid, 6-hydroxyhexanoic acid, 7- hydroxyheptanoic acid and 4-methylpentanoic acid were determined via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system (Shimadzu Scientific Instruments, Inc., Columbia, MD) equipped with an HPX-87H organic acid column (Bio-Rad, Hercules, CA) with operating conditions to optimize peak separation (0.3 ml/min flow rate, 30 mM H2SO4 mobile phase, column temperature 42°C).
[0096] We first validated the iterative operation of proposed carbon chain elongation platform consisting thiolase accepting various ω-functionalized primers along with HACD, ECH and ECR, and achieved synthesis of various ω-functionalized carboxylic acids and alcohols after termination at the acyl-CoA node by ACT and ACR + ADH respectively (FIG. 6).
[0097] The aromatic primer phenylacetyl-CoA, with acetyl-CoA as the extender unit, was used to achieve iterative pathway operation and synthesis of corresponding aromatic products. Pseudomonas putida thiolase FadA (ppFadA) was used, with P. putida FadB (ppFadB) providing HACD and ECH activities, Escherichia coli FabI as the ECR, and E. coli acyl-CoA synthetase PaaK to activate externally supplied phenylacetic acid. These and subsequent enzymes for all of the pathways described in this report were selected on the basis of literature reports of the specific enzymes' and organisms' ability to function with the required intermediates. When expressed in mixed-acid fermentation-deficient E. coli MG1655 AldhAApoxBAptaAadhEAfrdA (JCOl), these enzymes enabled the synthesis of 4- phenylbutyric acid (177 mg/L) and 6-phenylhexanoic acid (49 mg/L) (FIG. 7). These products result from the action of endogenous termination pathways, possibly native ACTs, on acyl-CoAs that are generated by one and two turns of the pathway, respectively.
[0098] Omega-carboxylated primers can support the synthesis of products such as co- hydroxyacids and dicarboxylic acids. In this context, we selected succinyl-CoA and glutaryl- CoA, which can be generated from corresponding acids by the Clostridium kluyveri CoA transferase Catl . Overexpression of E. coli PaaJ (thiolase), PaaH (HACD), and PaaF (ECH), with Treponema denticola tram,-enoyl-CoA reductase (TdTer) as ECR in JCOl led to production of C6 (adipic, 170 mg/L) and C7 (pimelic, 25 mg/L) dicarboxylic acids from endogenous acid-producing termination enzymes following succinic or glutaric acid supplementation, respectively (FIG. 8). The system's modularity was exploited to achieve the synthesis of co-hydroxyacids by manipulation of termination pathways. Minimizing activity of endogenous acid-producing termination reactions (by deletion of native thioesterases) and using Clostridium beijerinckii ACR cbjALD (with native ADH enzymes) in combination with the other pathway components enabled the synthesis of 6- hydroxyhexanoic acid (34 mg/L) and 7-hydroxyheptanoic acid (87 mg/L) following supplementation with exogenous succinic or glutaric acid, respectively (FIG. 8). This strategy used the thioesterase-deficient strain JST06 (JCOl AyciAAybgCAydilAtesAAfadMAtesB), as co-hydroxyacids were not observed when JCOl was used as the host strain. This demonstrates the importance of engineering the termination pathway(s) for product selectivity, and it represents an area in which further optimization could improve target product synthesis and reduce byproduct formation via nonspecific and/or endogenous enzymes.
[0099] Usage of ω -hydroxylated primer glycolyl-CoA can lead to the synthesis of ω- hydroxyacid 4-hydroxybutyric acid through the proposed pathway (FIG. 2, FIG. 9). The following enzymes provided the individual components of the pathway: BktB (thiolase) and PhaB l (HACD) from Ralstonia eutropha, Aeromonas caviae PhaJ (ECH), Treponema denticola TdTer (ECR) with native enzymes catalyzing the acid-forming termination and Megasphaera elsdenii transferase Pet activating gly colic acid to glycolyl-CoA. MG1655 (DE3) AglcD served as the host strain. [00100] The use of sub-terminal functionalized primers (for example, co-l- functionalization) was assessed through isobutyryl-CoA priming with the following individual pathway components: Megasphaera elsdenii Pet (transferase for isobutyric acid activation), Ralstonia eutropha BktB (thiolase), E. coli FadB (HADC and ECH), Euglena gracilis EgTer (ECR), a d E. coli Ydil (ACT). JCOl overexpressing these enzymes produced 45 mg/L of 4-methylpentanoic acid (FIG. 8). Engineering of the termination pathway by replacing Ydil with Marinobacter aquaeolei ACR maqu2507, along with the use of the host JST07 (JST06 AfadE), enabled the production of 4-methylpentanol (26 mg/L) (FIG. 8).
[00101] The use of functionalized primers and termination pathways enables the synthesis of a wide range of products, albeit at relatively low titers. One potential cause of low product titers is the intracellular concentrations of primers and/or extender units available for condensation. To determine whether low primer concentrations affected product synthesis, we attempted to maximize succinyl-CoA availability by deleting sdhB (encoding a subunit of succinate dehydrogenase), thereby reducing succinate consumption through the tricarboxylic acid (TCA) cycle. This deletion was introduced into JST06 to reduce undesirable hydrolysis of priming (succinyl-CoA) and extending units (acetyl-CoA) by native thioesterases, with Mus musculus dicarboxylic ACT Acot8 then overexpressed as the termination enzyme. This re-engineered strain produced a higher adipic acid titer (334 mg/L compared to 170 mg/L in the JCOl background) in the presence of succinic acid (FIG. 10).
[00102] Further product diversification from the use of succinyl-CoA can be achieved through iterative pathway operation. Replacement of the thiolase (PaaJ), HACD (PaaH) and ECH (PaaF) pathway components with the Acinetobacter sp. ADPl enzymes DcaF, DcaH, and DcaE resulted in the production of suberic (34 mg/L) and sebacic (13 mg/L) acids in addition to adipic acid (95 mg/L) (FIG. 10). These C8 and CIO diacids, products of two and three turns of the pathway, respectively, were not observed when using PaaJHF, demonstrating how selecting individual pathway components with desired specificity can control product synthesis. This type of approach could be used to further increase product diversity, as well as overall performance, through the selection and engineering of enzymes with required specificity and efficiency for desired functionalization.
[00103] Although our system can synthesize functionalized products, primer precursor supplementation and low overall titers need to be overcome to achieve industrial scale viability. To show the potential for higher product titer from a single carbon source, improvement in adipic acid production was targeted, given the industrial importance of this compound. The intracellular generation of succinic acid/succinyl-CoA was accomplished using strain MG1655 AldhAApoxBAptaAadhE (MB263), which retains the reductive branch of the TCA cycle, along with the overexpression of PaaJ, PaaH, PaaF, TdTer, Catl, and Acot8, resulting in 0.24 g/L adipic acid from a single carbon source (glycerol, Figure 11). Maximization of primer availability through deletion of sucD, which encodes a subunit of succinyl-CoA synthetase, part of the TCA cycle, was again used to improve product titer (0.35 g/L, Figure 11). When grown in a controlled bioreactor with a higher initial glycerol concentration, this strain produced 2.5 g/L adipic acid (4.1% mol/mol glycerol) (FIG. 11). Further improvement is envisioned through minimizing acetate formed directly through the transferase for primer activation. Acetate recycling (to acetyl-CoA) or use of an acetyl-CoA- independent activation enzyme offers a potential solution to improve adipic acid titer, a strategy that can also be applied to other combinations of primer and extenders. [00104] Once we demonstrated the iterative operation of the proposed platform and its acceptance of various ω-functionalized primers, we then utilized this platform to demonstrate the synthesis of co-functionalized methyl ketone. We chose ω-carboxylated succinyl-CoA as the primer, and ω-carboxylated methyl ketone levulinic acid, the product from first cycle of β-ketoacyl-CoA node and a key building block for the chemical industry. Levulinic acid production was observed in JST06 AsdhB strain overexpressing PaaJ, and Catl along with P. putida CoA transferase PcalJ which generates 3-oxoadipic acid from 3-oxoadipyl-CoA, the product of condensation between succinyl-CoA and acetyl-CoA (48 mg/L) (FIG. 5). 3- oxoadipic acid was believed to be spontaneously decarboxylated to levulinic acid in this strain. Additional overexpression of the decarboxylases Solarium habrochaites Mksl or Clostridium acetobutylicum Adc increased levulinic acid titers to 71 mg/L and 159 mg/L, respectively (FIG. 5). All the strains were grown with glycerol and succinic acid for the synthesis of levulinic acid.
[00105] With the aid of protein engineering and systems biology, we believe more co- functionalized primers and enzymatic components will be utilized and the synthesis of various omega-functionalized methyl ketones (other than levulinic acid), 2-alcohols, 2- amines, and their derivatives, lactams, lactones, α,ω-l -diamines, co-l -amino- 1 -alcohols, co- amino methyl ketones, co-hydroxy methyl ketones, co-amino-2-alcohols and α,ω-1-diols will be achieved. In addition, pathway and process optimization, in line with industrial biotechnology approaches, can improve performance for a specific target product, as the underlying carbon and energy efficiency enables the feasibility of further advancing product titer, rate, and yield. Important areas include generating and balancing pools of priming and extender units and optimization of required pathway enzymes for a given target product. The former can exploit previously developed pathways for primers and extender units, whereas the latter includes identifying and engineering enzymes that may be flux limiting due to suboptimal enzyme specificity or activity. These approaches will be continually aided by developments in protein and metabolic engineering and synthetic and systems biology.
[00106] The host strains and plasmids used for production of above products are summarized in Table G.
Figure imgf000037_0001
[00107] The above experiments are repeated in Bacillus subtilis. The same genes can be used, especially since Bacillus has no significant codon bias. A protease-deficient strain like WB800N is preferably used for greater stability of heterologous protein. The E. coli - B. subtilis shuttle vector pMTLBS72 exhibiting full structural stability can be used to move the genes easily to a more suitable vector for Bacillus. Alternatively, two vectors pHTOl and pHT43 allow high-level expression of recombinant proteins within the cytoplasm. As yet another alternative, plasmids using the theta-mode of replication such as those derived from the natural plasmids ρΑΜβΙ and pBS72 can be used. Several other suitable expression systems are available. Since the FAS genes are ubiquitous, the invention is predicted to function in Bacillus.
[00108] The above experiments are repeated in yeast. The same genes can be used, but it may be preferred to accommodate codon bias. Several yeast E. co\\ shuttle vectors are available for ease of the experiments. Since the FAS genes are ubiquitous, the invention is predicted to function in yeast, especially since yeasts are already available with exogenous functional TE genes and the reverse beta oxidation pathway has also been made to run in yeast.
[00109] Each of the following is incorporated by reference herein in its entirety for all purposes:
[00110] US20130316413 Reverse beta-oxidation pathway
[00111] 62/140,628 BIOCONVERSION OF SHORT-CHAIN HYDROCARBONS
TO FUELS AND CHEMICALS, March 31, 2015
[00112] PCT/US 15/12932 TYPE II FATTY ACID SYNTHESIS ENZYMES IN REVERSE beta-OXIDATION, January 26, 2015 and 61/932,057, January 27, 2014.
[00113] 62/069,850 SYNTHETIC PATHWAY FOR BIOSYNTHESIS FROM 1-
CARBON COMPOUNDS, October 29, 2014
[00114] WO2013036812 Functionalized carboxylic acids and alcohols by reverse fatty acid oxidation [00115] Cheong, S., et al., (2016). Energy- and carbon-efficient synthesis of functionalized small molecules in bacteria using non-decarboxylative Claisen condensation reactions. Nat. Biotechnol. 34 (5): doi: 10.1038/nbt.3505. [00116] Choi, K.H., et al., β-Ketoacyl-Acyl Carrier Protein Synthase III (FabH) Is a
Determining Factor in Branched-Chain Fatty Acid Biosynthesis. J. Bacteriol. 182, 365-370 (2000).
[00117] Clomburg, J.M. et al. Integrated engineering of β-oxidation reversal and co- oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids. Metab. Eng. 28, 202-212 (2015).
[00118] Clomburg, J.M., et al., A Synthetic Biology Approach to Engineer a
Functional Reversal of the β-Oxidation Cycle. ACS Synthetic Biology 1, 541-554 (2012).
[00119] Dellomonaco, C, et al., Engineered reversal of the β-oxidation cycle for the synthesis of fuels and chemicals. Nature 476, 355-359 (2011).
[00120] Haapalainen, A.M., et al., The thiolase superfamily: condensing enzymes with diverse reaction specificities. Trends in Biochemical Sciences 31, 64-71 (2006).
[00121] Heath, R.J. & Rock, CO. The Claisen condensation in biology. Nat. Prod. Rep. 19, 581-596 (2002). [00122] Jiang, C, et al., Divergent evolution of the thiolase superfamily and chalcone synthase family. Molecular Phylogenetics and Evolution 49, 691-701 (2008).
[00123] Lan, E.I., et al., Metabolic engineering of 2-pentanone synthesis in
Escherichia coli. Aiche J. 59, 3167-3175 (2013).
[00124] Neidhardt, F.C., et al., Culture medium for enterobacteria. J. Bacteriol. 119, 736-747 (1974).
[00125] Pfleger, B.F., et al., Metabolic engineering strategies for microbial synthesis of oleochemicals. Metab. Eng. 29, 1-11 (2015).
[00126] Vick, J.E. et al. Escherichia coli enoyl-acyl carrier protein reductase (Fabl) supports efficient operation of a functional reversal of the β-oxidation cycle. Appl. Environ. Microbiol. 81, 1406-1416 (2015). [00127] Kim, S., Clomburg, J.M. & Gonzalez, R. Synthesis of medium-chain length
(C6-C10) fuels and chemicals via β-oxidation reversal in Escherichia coli. J. Ind. Microbiol. Biotechnol. 42, 465-475 (2015).
[00128] The following claims are provided to add additional clarity to this disclosure. Future applications claiming priority to this application may or may not include the following claims, and may include claims broader, narrower, or entirely different from the following claims. Furthermore, any detail from any claim may be combined with any other detail from another claim, even if not yet so combined.

Claims

A genetically engineered microorganism comprising means for: a) an overexpressed activation enzyme(s) able to produce an omega-functionalized CoA thioester primer, wherein said activation enzyme is selected from: i) an acyl-CoA synthase which generates the omega-functionalized CoA thioester primer from an omega-functionalized acid; ii) an acyl-CoA transferase which generates the omega-functionalized CoA thioester primer from an omega-functionalized acid; iii) a phosphotransacylase and a carboxylate kinase which generates the omega- functionalized CoA thioester primer from an omega-functionalized acid; iv) other one or multiple enzymes that allow the production of the omega- functionalized CoA thioester primer from the carbon source without proceeding via the omega-functionalized acid; b) an overexpressed thiolase enzyme that catalyzes the condensation of an omega- functionalized acyl-CoA primer with acetyl-CoA to form an omega-functionalized b eta-ketoacy 1 -C o A; c) an overexpressed 3-hydroxyacyl-CoA dehydrogenase or 3-oxoacyl-[acyl-carrier- protein] reductase enzyme that catalyzes the reduction of said omega-functionalized b eta-ketoacy 1 -CoA to produce an omega-functionalized beta-hydroxyacyl-CoA; d) an overexpressed enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydratase, or 3- hydroxyacyl-[acyl-carrier-protein] dehydratase enzyme that catalyzes the dehydration of said omega-functionalized beta-hydroxyacyl-CoA to an omega-functionalized trans-enoyl-CoA; e) an overexpressed acyl-CoA dehydrogenase, trans-enoyl-CoA reductase, or enoyl- [acyl-carrier-protein] reductase enzyme that catalyzes the reduction of said omega- functionalized trans-enoyl-CoA to an omega-functionalized acyl-CoA; f) an overexpressed termination enzyme(s) able to use as a substrate the omega- functionalized beta ketoacyl-CoA-thioester product generated in step b, wherein said termination enzyme(s) is selected from: i) the group consisting of a thioesterase, or an acyl-CoA transferase, or a
phosphotransacylase and a carboxylate kinase catalyzing the conversion of the CoA moiety of the omega-functionalized beta-ketoacyl-CoA thioester to a carboxylic acid group and a decarboxylase catalyzing the conversion of the beta- keto-acid to a methyl-ketone; the group consisting of a thioesterase, or an acyl-CoA transferase, or a phosphotransacylase and a carboxylate kinase catalyzing the conversion of the CoA moiety of the omega-functionalized beta-ketoacyl-CoA thioester to a carboxylic acid group and a decarboxylase catalyzing the conversion of the beta- keto-acid to a methyl-ketone and a keto-dehydrogenase catalyzing the conversion of a methyl-ketone to a 2-alcohol; iii) the group consisting of a thioesterase, or an acyl-CoA transferase, or a
phosphotransacylase and a carboxylate kinase catalyzing the conversion of the CoA moiety of the omega-functionalized beta-ketoacyl-CoA thioester to a carboxylic acid group and a decarboxylase catalyzing the conversion of the beta- keto-acid to a methyl-ketone and a transaminase catalyzing the conversion of a methyl-ketone to a 2-amine; g) optionally reduced expression of fermentation genes leading to reduced production of lactate, acetate, ethanol and succinate; and wherein said microorganism has a reverse beta-oxidation pathway beginning with said omega-functionalized CoA thioester primer and running in a biosynthetic direction.
2) The microorganism of claim 1, wherein said omega-functionalized primer is an acyl CoA thioester whose omega group is selected from the group consisting of hydrogen, alkyl group, hydroxyl group, carboxyl group, aryl group, halogen, amino group, hydroxyacyl group, carboxyacyl group, aminoacyl group, ketoacyl group, halogenated acyl group, and any other functionalized acyl groups.
The microorganism of claim 1, wherein said omega-functionalized acid is the acid form of omega-functionalized primer whose omega group is selected from the group consisting of hydrogen, alkyl group, hydroxyl group, carboxyl group, aryl group, halogen, amino group, hydroxyacyl group, carboxyacyl group, aminoacyl group, ketoacyl group, halogenated acyl group, and any other functionalized acyl groups.
The microorganism of claim 1, wherein said omega-functionalized acid is supplemented in the media or supplied through the intracellular pathway from the carbon source.
The microorganism of claim 1, wherein said microorganism produces a product selected from the group consisting of methyl ketones, 2-alcohols and 2-amines whose omega group is selected from the group consisting of hydrogen, alkyl group, hydroxyl group, carboxyl group, aryl group, halogen, amino group, hydroxyacyl group, carboxyacyl group, aminoacyl group, ketoacyl group, halogenated acyl group, and any other functionalized acyl groups.
The microorganism of claim 1, utilizing an omega-carboxylated CoA thioester primer and further comprising: a) an overexpressed activation enzyme(s) able to convert an omega-carboxylated methyl ketone, namely an omega- 1 ketoacid, to an omega- 1 ketoacyl-CoA, wherein said activation enzyme is selected from: i) an acyl-CoA synthase; ii) an acyl-CoA transferase; iii) a phosphotransacylase and a carboxylate kinase; and, b) an overexpressed CoA-dependent product modification pathway able to use a
substrate omega-1 ketoacyl-CoA generated in step a, wherein said CoA-dependent product modification pathway is selected from: i) a keto-dehydrogenase catalyzing the conversion of an omega-1 ketoacyl-CoA to an omega-1 hydroxyacyl-CoA and the group consisting of a thioesterase, or an acyl-CoA transferase, or a phosphotransacylase and a carboxylate kinase catalyzing the conversion of the CoA moiety of the omega-1 hydroxyacyl-CoA to a carboxylic acid group; and, ii) a transaminase catalyzing the conversion of an omega-1 ketoacyl-CoA to an
omega-1 aminoacyl-CoA and the group consisting of a thioesterase, or an acyl- CoA transferase, or a phosphotransacylase and a carboxylate kinase catalyzing the conversion of the CoA moiety of the omega-1 aminoacyl-CoA to a carboxylic acid group.
7) The microorganism of claim 6, wherein said microorganism produces a product selected from the group consisting omega-1 ketoacids, omega-1 hydroxyacids and omega-1 amino acids.
8) The microorganism of claims 1 or 6 utilizing an omega-carboxylated CoA thioester
primer and further comprising an overexpressed lactonase that converts an omega- carboxylated 2-alcohol, namely an omega-1 hydroxy acid, to a lactone.
9) The microorganism of claim 8, wherein said microorganism produces a lactone. 10) The microorganism of claims 1 or 6 utilizing an omega-carboxylated CoA thioester
primer and further comprising an overexpressed amidohydrolase that converts an omega- carboxylated 2-amine, namely an omega-1 amino acid, to a lactam.
11) The microorganism of claim 10, wherein said microorganism produces a lactam.
12) The microorganism of claim 6, further comprising: a) an overexpressed aldehyde-forming acyl-CoA reductase enzyme catalyzing the
conversion of the CoA moiety of a substrate selected from the group consisting omega-1 ketoacyl-CoAs, omega-1 hydroxyacyl-CoAs and omega-1 aminoacyl-CoAs to an aldehyde group; and, b) an overexpressed aldehyde modification enzyme(s) able to use an aldehyde generated in step a, wherein said aldehyde modification enzyme is selected from: i) an alcohol dehydrogenase enzyme that converts an aldehyde generated in step a to an alcohol; ii) a transaminase enzyme that converts an aldehyde generated in step a to an amine.
13) The microorganism of claim 12, wherein said microorganism produces a product selected from the group consisting omega-hydroxy methyl ketones; omega-amino methyl ketones; alpha, omega-1 diols; omega-amino-2-alcohols; alpha, omega-1 -diamines; and omega- amino- 1 -alcohols.
14) The microorganism of claims 1 or 6, wherein said overexpressed acyl-CoA synthase is encoded by a gene(s) selected from the group consisting of E. coli sucC, E. coli sucD, E. coli paaK, E. coliprpE, E. coli menE, E. colifadK, E. colifadD, Penicillium
chrysogenum phi, Salmonella typhimurium LT2 prpE, Bacillus subtilis bioW, Cupriavidus basilensis hmfD, Rhodopseudomonas palustris badA, R. palustris hbaA, Pseudomonas aeruginosa PAOl pqsA, Arabidopsis thaliana 4cl and homologs.
15) The microorganism of claim 1, wherein said overexpressed thiolase is encoded by a
gene(s) selected from the group consisting of E. coli atoB, E. coli yqeF, E. colifadA, E. colifadl, Ralstonia eutropha bktB, Pseudomonas sp. B13 catF, E colipaaJ, Rhodococcus opacus pcaF, Pseudomonas putida pcaF, Streptomyces sp. pcaF, P. putida fadAx, P. putida fadA, Ralstonia eutropha phaA, Acinetobacter sp. ADP1 dcaF, Clostridium acetobutylicum thlA, Clostridium acetobutylicum MB and homologs. 16) The microorganism of claim 1, wherein said overexpressed 3-hydroxyacyl-CoA
dehydrogenase or 3-oxoacyl-[acyl-carrier-protein] reductase is encoded by a gene(s) selected from the group consisting of E. colifabG, E. colifadB, E. colifadJ, E. coli paaH, P. putida fadB, P. putida fadB2x, Acinetobacter sp. ADP1 dcaH, Ralstonia eutrophus phaB, Clostridium acetobutylicum hbd and homologs. 17) The microorganism of claim 1, wherein said overexpressed enoyl-CoA hydratase, 3- hydroxyacyl-CoA dehydratase, or 3-hydroxyacyl-[acyl-carrier-protein] dehydratase is encoded by a gene(s) selected from the group consisting of E. colifabA, E. colifabZ, E. colifadB, E. colifadJ, E. colipaaF, P. putida fadB, P. putida fadBlx, Acinetobacter sp. ADP1 dcaE, Clostridium acetobutylicum crt, Aeromonas caviae phaJ and homologs.
18) The microorganism of claim 1, wherein said acyl-CoA dehydrogenase, trans-enoyl-CoA reductase, or enoyl-[acyl-carrier-protein] reductase is encoded by a gene(s) selected from the group consisting of E. colifadE, E. coliydiO, Euglena gracilis TER, Treponema denticola TER, Clostridium acetobutylicum TER, E. colifabl, Enterococcus faecalis fabK, Bacillus subtilis fabL, Vibrio cholerea fabV and homologs.
19) The microorganism of claims 1 or 6, wherein said overexpressed thioesterase is encoded by a gene(s) selected from the group consisting of E. coli tesA, E. coli tesB, E. coliyciA, E. colifadM, E. coli ydil, E. coli ybgC, E. colipaal, Mus musculus acot8, Alcanivorax borkumensis tesB2, Fibrobacter succinogenes Fs2108, Prevotella ruminicola Pr655, Prevotella ruminicola Prl687, Lycopersicon hirsutum f glabratum mks2 and homologs.
20) The microorganism of claims 1 or 6, wherein said overexpressed acyl-CoA transferase is encoded by a gene(s) selected from the group consisting of E. coli atoD, E. coli scpC, E. coli ydiF, E. coli atoA, E. coli atoD, Clostridium acetobutylicum ctfA, C. acetobutylicum ctfB, Clostridium kluyveri cat2, C. kluyveri catl, P. putida peal, P. putida pcaJ, Megasphaera elsdenii pet, Acidaminococcus fermentans gctA, Acidaminococcus fermentans gctB, Acetobacter aceti aarC and homologs.
21) The microorganism of claims 1 or 6, wherein said overexpressed phosphotransacylase is encoded by a gene(s) selected from the group consisting of Clostridium acetobutylicum ptb, Enterococcus faecalis ptb, Salmonella enterica pduL and homologs.
22) The microorganism of claims 1 or 6, wherein said overexpressed carboxylate kinase is encoded by a gene(s) selected from the group consisting of Clostridium acetobutylicum buk , Enterococcus faecalis buk, Salmonella enterica pduW and homologs. 23) The microorganism of claim 1, wherein said overexpressed keto-acid decarboxylase is encoded by a gene(s) selected from the group consisting of Clostridium acetobutylicum adc, Lycopersicon hirsutum f glabratum mksl and homologs. 24) The microorganism of claims 1 or 6, wherein said overexpressed keto-dehydrogenase is encoded by a gene(s) selected from the group consisting of Clostridium beijerinckii adh, Acidaminococcus fermentans hgdH, E. coli serA, Gordonia sp. TY-5 adhl, Gordonia sp. TY-5 adhl, Gordonia sp. TY-5 adh3, Rhodococcus ruber adh-A and homologs. 25) The microorganism of claims 1, 6 or 12, wherein said overexpressed transaminase is encoded by a gene(s) selected from the group consisting of Arabidopsis thaliana
At3g22200, Alcaligenes denitrifwans aptA, Bordetella bronchiseptica BB0869,
Bordetella parapertussis BPP0784, Brucella melitensis BAWG 0478, Burkholderia pseudomallei BP1026B I0669, Chromobacterium violaceum CV2025, Oceanicola granulosus OG2516 07293, Paracoccus denitrifwans PD1222 Pden_3984, Caulobacter crescentus CC 3143, Pseudogulbenkiania ferrooxidans co-TA, Pseudomonas putida ω - TA, Ralstonia solanacearum ω -TA, Rhizobium meliloti SMc01534, Vibrio fluvialis ω - TA, Bacillus megaterium SC6394 ω -TA, Mus musculus abaT, Flavobacterium lutescens lat, Streptomyces clavuligerus lat, E. coli gabT, E. colipuuE, E. coliygjG and homologs. 26) The microorganism of claim 8, wherein said overexpressed lactonase is encoded by a gene(s) selected from the group consisting Xanthomonas campestris XCC1745, Homo sapiens PON 1, Mesorhizobium loti Mlr6805, Pseudomonas sp. P51 tcbE, Comamonas testosteroni pmdD and homologs.
27) The microorganism of claim 10, wherein said overexpressed amidohydrolase is encoded by a gene(s) selected from the group consisting Flavobacterium sp. KI72 nylB,
Arthrobacter sp. KI72 nylA, Homo sapiens DPYS, Brevibacillus agri pydB, E. coli pyrC, Pseudomonas putida crnA, Pseudomonas fluorescens puuE and homologs.
28) The microorganism of claim 12, wherein said overexpressed aldehyde-forming acyl-CoA reductase is encoded by a gene(s) selected from the group consisting Acinetobacter calcoaceticus acrl, Acinetobacter sp Strain M-l acrM, Clostridium beijerinckii aid, E. coli eutE, Salmonella enterica eutE, E. coli mhpF, Clostridium kluyveri sucD and homologs.
29) The microorganism of claim 12, wherein said overexpressed alcohol dehydrogenase is encoded by a gene(s) selected from the group consisting E. coli betA, E. coli dkgA, E. coli eutG, E. colifucO, E. coli ucpA, E. coliyahK, E. coliybbO, E. coli ybdH, E. coliyiaY, E. coliyjgB, Clostridium kluyveri 4hbD, Acinetobacter sp. SE19 chnD and homologs.
30) The microorganism of claims 1, 6, 8, 10 or 12, wherein said reduced expression of
fermentation enzymes are AadhE, (Apia or AackA or AackApta), ApoxB, AldhA, and AfrdA and less acetate, lactate, ethanol and succinate are thereby produced.
31) The microorganism of claims 1, 6, 8, 10 or 12, comprising one or more of the following mutations: fadR, atoC(c), AarcA, Acrp, crp*.
32) A recombinant microorganism comprising overexpressed enzymes including 1) thiolase catalyzing a non-decarboxylative Claisen condensation between an omega-functionalized primer and acetyl-CoA, 2) a hydroxyacyl-CoA dehydrogenase, 3) an enoyl-CoA hydratase, 4) an enoyl-CoA reductases and 5) a termination enzyme(s).
33) A recombinant microorganism being a bacteria comprising overexpressed enzymes
including 1) a thiolase catalyzing a non-decarboxylative Claisen condensation between an omega-functionalized primer and acetyl-CoA, 2) a hydroxyacyl-CoA dehydrogenase, 3) an enoyl-CoA hydratase, 4) an enoyl-CoA reductases and 5) a termination enzyme(s), preferably TE.
34) A recombinant microorganism being E. coli comprising inducible expression vector or inducible integrated sequences for overexpressing enzymes including 1) a thiolase catalyzing a non-decarboxylative Claisen condensation between an omega-functionalized primer and acetyl-CoA, 2) a hydroxyacyl-CoA dehydrogenase, 3) an enoyl-CoA hydratase, 4) an enoyl-CoA reductases and 5) a termination enzyme(s) preferably TE.
35) A method of making omega functionalized products, comprising growing a
microorganism of any of claims 1-34 in a nutrient broth under conditions such that said enzymes are overexpressed, said microorganism producing omega functionalized product using said overexpressed enzymes, and isolating said omega functionalized product.
36) A method of making omega functionalized products, comprising growing a
microorganism of any of claims 1-35 in a nutrient broth under conditions such that said enzymes are overexpressed, said microorganism producing omega functionalized product using said overexpressed enzymes, and isolating said omega functionalized product.
PCT/US2016/027903 2015-04-16 2016-04-15 Synthesis of omega functionalized methylketones, 2-alcohols, 2-amines, and derivatives thereof Ceased WO2016168708A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/784,691 US20180135059A1 (en) 2015-04-16 2017-10-16 Synthesis of omega functionalized products
US17/021,338 US20210002677A1 (en) 2015-04-16 2020-09-15 Synthesis of omega functionalized products

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562148248P 2015-04-16 2015-04-16
US62/148,248 2015-04-16

Related Child Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2016/029583 Continuation WO2016176339A1 (en) 2015-04-16 2016-04-27 Synthesis of omega-phenyl products and derivatives thereof
US15/784,691 Continuation US20180135059A1 (en) 2015-04-16 2017-10-16 Synthesis of omega functionalized products

Publications (1)

Publication Number Publication Date
WO2016168708A1 true WO2016168708A1 (en) 2016-10-20

Family

ID=57126477

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/027903 Ceased WO2016168708A1 (en) 2015-04-16 2016-04-15 Synthesis of omega functionalized methylketones, 2-alcohols, 2-amines, and derivatives thereof

Country Status (1)

Country Link
WO (1) WO2016168708A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109486784A (en) * 2018-11-30 2019-03-19 江南大学 A kind of ω that can be catalyzed sitafloxacin five-membered ring key intermediate-transaminase mutant
WO2020150362A1 (en) * 2019-01-18 2020-07-23 Genomatica, Inc. Enzymatic biosynthesis of lactones
CN114752516A (en) * 2022-04-25 2022-07-15 中国科学院天津工业生物技术研究所 A kind of recombinant Saccharomyces cerevisiae producing methyl ketone and its construction method and application
US12163177B2 (en) 2015-04-15 2024-12-10 Ramon Gonzalez Modified fatty acid biosynthesis with ACP-dependent thiolases

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130217081A1 (en) * 2011-06-17 2013-08-22 Invista North America S.A. R.L. Biocatalytic methods to convert cyclohexane oxidation process waste streams to useful products
US20140273110A1 (en) * 2011-09-07 2014-09-18 William Marsh Rice University Functionalized carboxylic acids and alcohols by reverse fatty acid oxidation
US20140377820A1 (en) * 2009-09-09 2014-12-25 Genomatica, Inc. Microorganisms and methods for the co-production of isopropanol with primary alcohols, diols and acids

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140377820A1 (en) * 2009-09-09 2014-12-25 Genomatica, Inc. Microorganisms and methods for the co-production of isopropanol with primary alcohols, diols and acids
US20130217081A1 (en) * 2011-06-17 2013-08-22 Invista North America S.A. R.L. Biocatalytic methods to convert cyclohexane oxidation process waste streams to useful products
US20140273110A1 (en) * 2011-09-07 2014-09-18 William Marsh Rice University Functionalized carboxylic acids and alcohols by reverse fatty acid oxidation

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ASANO, Y ET AL.: "The Screening, Characterization, and Use of Omega-Laurolactam Hydrolase: A New Enzymatic Synthesis of 12-Aminolauric Acid.", BIOSCIENCE, BIOTECHNOLOGY AND BIOCHEMISTRY, vol. 72, no. 8, 7 August 2000 (2000-08-07), pages 2141 - 2150, XP002660391 *
CAI, CQ ET AL.: "Requirement for the Enzymes Acetoacetyl Coenzyme A Synthetase and Poly-3-Hydroxybutyrate (PHB) Synthase for Growth of Sinorhizobium meliloti on PHB Cycle Intermediates", JOURNAL OF BACTERIOLOGY., vol. 182, no. 8, April 2000 (2000-04-01), pages 2113 - 2118, XP055321332 *
DELLOMONACO, C ET AL.: "Engineered Reversal of the Beta-Oxidation Cycle for the Synthesis of Fuels and Chemicals.", NATURE, vol. 476, no. 7360, 10 August 2011 (2011-08-10), pages 355 - 359, XP055169557 *
MARTIN, CH ET AL.: "Integrated Bioprocessing for the pH-Dependent Production of 4-Valerolactone from Levulinate in Pseudomonas putida KT2440.", APPLIED AND ENVIRONMENTAL MICROBIOLOGY., vol. 76, no. 2, January 2010 (2010-01-01), pages 417 - 424, XP009133848 *
SAMSONOVA, NN ET AL.: "Molecular Cloning and Characterization of Escherichia coli K12 ygjG Gene .", BMC MICROBIOLOGY;, vol. 3, no. 2, 31 January 2003 (2003-01-31), pages 1 - 10, XP021014831 *
SOHLING, B ET AL.: "Molecular Analysis of the Anaerobic Succinate Degradation Pathway in Clostridium kluyveri.", JOURNAL OF BACTERIOLOGY., vol. 178, no. 3, February 1996 (1996-02-01), pages 871 - 880, XP055323204 *
WEIMAR, JD ET AL.: "Functional Role of Fatty Acyl-Coenzyme A Synthetase in the Transmembrane Movement and Activation of Exogenous Long-chain Fatty Acids.", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 277, no. 33, 28 May 2002 (2002-05-28), pages 29369 - 29376, XP055098149 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12163177B2 (en) 2015-04-15 2024-12-10 Ramon Gonzalez Modified fatty acid biosynthesis with ACP-dependent thiolases
CN109486784A (en) * 2018-11-30 2019-03-19 江南大学 A kind of ω that can be catalyzed sitafloxacin five-membered ring key intermediate-transaminase mutant
CN109486784B (en) * 2018-11-30 2020-06-09 江南大学 An ω-transaminase mutant capable of catalyzing the key intermediate of sitafloxacin five-membered ring
WO2020150362A1 (en) * 2019-01-18 2020-07-23 Genomatica, Inc. Enzymatic biosynthesis of lactones
US12595496B2 (en) 2019-01-18 2026-04-07 Genomatica, Inc. Enzymatic biosynthesis of lactones
CN114752516A (en) * 2022-04-25 2022-07-15 中国科学院天津工业生物技术研究所 A kind of recombinant Saccharomyces cerevisiae producing methyl ketone and its construction method and application
CN114752516B (en) * 2022-04-25 2023-11-10 中国科学院天津工业生物技术研究所 A recombinant Saccharomyces cerevisiae producing methyl ketone and its construction method and application

Similar Documents

Publication Publication Date Title
Clomburg et al. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids
Cheong et al. Energy-and carbon-efficient synthesis of functionalized small molecules in bacteria using non-decarboxylative Claisen condensation reactions
US12391937B2 (en) Biosynthesis of products from 1-carbon compounds
US20240309417A1 (en) Bioconversion of Short-Chain Hydrocarbons to Fuels and Chemicals
US20190002848A1 (en) Biosynthesis of polyketides
WO2015191972A2 (en) Omega-carboxylated carboxylic acids and derivities
US20180135059A1 (en) Synthesis of omega functionalized products
WO2016168708A1 (en) Synthesis of omega functionalized methylketones, 2-alcohols, 2-amines, and derivatives thereof
US10450593B2 (en) Type II fatty acid synthesis enzymes in reverse β-oxidation
US20180142273A1 (en) Iterative platform for the synthesis of alpha functionalized products
US11781120B2 (en) Biosynthesis of polyketides
US20230383319A1 (en) Iterative platform for the synthesis of alpha functionalized products
US11697830B2 (en) Iterative platform for the synthesis of alpha functionalized products
US20180127730A1 (en) Modified fatty acid biosynthesis with acp-dependent thiolases
US12163177B2 (en) Modified fatty acid biosynthesis with ACP-dependent thiolases
WO2016176347A1 (en) Synthesis of omega-1 functionalized products and derivatives thereof
US20210002677A1 (en) Synthesis of omega functionalized products
US10774349B2 (en) Alpha omega bifunctional fatty acids
WO2016176339A1 (en) Synthesis of omega-phenyl products and derivatives thereof
HK40072049A (en) Biosynthesis of products from 1-carbon compounds

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16780912

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16780912

Country of ref document: EP

Kind code of ref document: A1