WO2016168683A2 - Methods and materials for using transgenic non-human animals expressing sodium iodide symporter polypeptides to monitor pathological processes, disease progression, or therapeutic responses over time - Google Patents
Methods and materials for using transgenic non-human animals expressing sodium iodide symporter polypeptides to monitor pathological processes, disease progression, or therapeutic responses over time Download PDFInfo
- Publication number
- WO2016168683A2 WO2016168683A2 PCT/US2016/027876 US2016027876W WO2016168683A2 WO 2016168683 A2 WO2016168683 A2 WO 2016168683A2 US 2016027876 W US2016027876 W US 2016027876W WO 2016168683 A2 WO2016168683 A2 WO 2016168683A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- promoter sequence
- animal
- radiotracer
- transgenic non
- nis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/025—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus inorganic Tc complexes or compounds
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/20—Animals treated with compounds which are neither proteins nor nucleic acids
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0393—Animal model comprising a reporter system for screening tests
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
- C12N2015/8527—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic for producing animal models, e.g. for tests or diseases
- C12N2015/859—Animal models comprising reporter system for screening tests
Definitions
- This document relates to methods and materials involved in radiotracer imaging using live transgenic non-human animals (e.g., non-human mammals) to monitor pathological processes, disease progression, or therapeutic responses in vivo over time.
- live transgenic non-human animals e.g., non-human mammals
- somatic and germline cells that include nucleic acid (e.g., a transgene) having a promoter sequence operably linked to a nucleic acid sequence encoding a sodium iodide symporter (NIS) polypeptide to monitor pathological processes, disease progression, or therapeutic responses in vivo over time.
- nucleic acid e.g., a transgene
- NIS sodium iodide symporter
- NIS polypeptides mediate the uptake and concentration of iodide in the thyroid gland, providing the basis for diagnostic thyroid radioimaging and radioiodine therapy.
- nucleic acid encoding a NIS polypeptide When nucleic acid encoding a NIS polypeptide is introduced into non-thyroid cells, they can, like thyroid cells, be detected using iodide/pertechnetate radioimaging and/or destroyed using iodide radiotherapy.
- This document provides methods and materials for using live transgenic non-human animals (e.g., non-human mammals) to perform radiotracer imaging to monitor pathological processes, disease progression, or therapeutic responses in vivo over time.
- live transgenic non-human animals e.g., non-human mammals
- somatic and germline cells that include nucleic acid (e.g., a transgene) having a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide to perform radiotracer imaging to monitor pathological processes, disease progression, or therapeutic responses in vivo over time.
- transgenic NIS non-human animals e.g., mice or larger mammals
- transgenic NIS non-human animals can be used as described herein for non-invasive quantitation and localization of changing levels of NIS polypeptide expression through the various stages of a pathological process of interest in a single living animal.
- NIS radiotracers can be efficiently concentrated by cells expressing a NIS polypeptide, and SPECT, PET, and ⁇ -camera images can be used to monitor the in vivo biodistribution of NIS radiotracers.
- imaging techniques that involve the uptake of radiotracers such as 123 I, 124 1, 125 I, B 18 F4 (tetrafluoroborate), and 99m Tc04 (pertechnetate) by expressed NIS polypeptides of a transgenic non-human animal (e.g., non-human mammal) provided herein can be used for accurate, sensitive, high resolution detection of NIS polypeptide expression and monitoring of pathological processes, disease progression, or therapeutic responses in vivo over time in living mammals (e.g., for longitudinal studies).
- NIS polypeptides can be used for quantitative expression monitoring in large mammals as well as in deep-seated tissues (e.g., mouse tissues) because, unlike photons, gamma rays are minimally attenuated by the tissues through which they pass.
- the methods and materials provided herein are based, at least in part, on the discovery that the sensitivity of detection of NIS polypeptide expressing cells in the context of a transgenic NIS animal is not too low to allow for the localization and quantitation of a pathological or developmental process within the transgenic animal even though other work may have indicated that NIS expressing cells could not be detected below a threshold number of at least about 100,000 cells in a single location ( Figure 15).
- the methods and materials provided herein also are based, at least in part, on the discovery that the changes in NIS polypeptide expression at sites of disease pathology are not too small to allow for accurate quantitative analyses over time.
- the methods and materials provided herein are based, at least in part, on the discovery that over-expression of a NIS polypeptide from a transgene at sites where it is not naturally expressed does not result in abnormal tissue development or other toxicities leading to premature death of the transgenic animal. Further, the methods and materials provided herein are based, at least in part, on the discovery that, while no regulatory element (e.g., promoter or enhancer) has a level of pathology specificity that does not result in at least some expression in normal tissues, this background NIS polypeptide expression in normal tissues does not confound the study of the pathological process itself.
- no regulatory element e.g., promoter or enhancer
- pathological processes, disease progression, and therapeutic responses can be assessed in vivo over time using the live transgenic non-human animals (e.g., non-human mammals) provided herein.
- live transgenic non-human animals e.g., non-human mammals
- one aspect of this document features a method of monitoring a pathological process over time within a living transgenic non-human animal comprising somatic and germline cells comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide.
- the method comprises, or consists essentially of, (a) administering a first preparation comprising a radiotracer to the animal during a first time point, wherein the radiotracer is transported into a cell that expresses the NIS polypeptide, (b) collecting imaging data of the radiotracer from within the animal to identify cells containing the radiotracer following the administration of the first preparation, (c) administering a second preparation comprising a radiotracer to the animal during a second time point after the first time point, and (d) collecting imaging data of the radiotracer from within the animal to identify cells containing the radiotracer following the administration of the second preparation.
- the pathological process can be fibrosis.
- the animal can be a mouse or rat.
- the promoter sequence can be a Collal promoter sequence.
- the NIS polypeptide can be a human NIS polypeptide.
- the second time point can be at least 5 days after the first time point.
- the second time point can be at least 20 days after the first time point.
- the radiotracer can be pertechnetate or radioiodide.
- this document features a transgenic non-human animal, whose somatic and germline cells comprise a transgene comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide, wherein radiotracer images of the animal at different time points, when a radiotracer that is transported into cells that express the NIS polypeptide is administered to the animal, provide imaging data with observable differences in the stages of a pathological process within the animal at the different time points.
- the pathological process can be fibrosis.
- the animal can be a mouse or rat.
- the promoter sequence can be a Collal promoter sequence.
- the NIS polypeptide can be a human NIS polypeptide.
- the different time points can be at least 5 days apart.
- the different time points can be at least 20 days apart.
- the radiotracer can be pertechnetate or radioiodide.
- this document features a transgenic non-human animal, whose somatic and germline cells comprise a transgene comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide, wherein the promoter sequence is a Collal promoter sequence, an osteocalcin promoter sequence, a bone sialoprotein (BSP) promoter sequence, a VEGFR2 promoter sequence, a prostate-specific antigen (PSA) promoter sequence, an Epo promoter sequence, a serum amyloid A-1 (Saal) promoter sequence, a TNF promoter sequence, an iNOS promoter sequence, a 3 NFkB site from the Igk light chain promoter sequence, an heme oxygenase-1 (Hoi or Hmox-1) promoter sequence, a superoxide dismutase (SOD1) promoter sequence, a cytochrome p450 isoform 3A (Cyp3A4) promoter sequence, a rat insulin gene (
- Figure 1 is a diagram of a transgene construct used to make mice and rats transgenic for human NIS nucleic acid operably linked to a rat collagen al(l) promoter.
- Figure 2 is a diagram of a transgene construct used to make mice and rats transgenic for human NIS nucleic acid operably linked to a human ⁇ -actin promoter.
- Figure 3 is a photograph of a gel showing the indicated PCR results.
- Figure 4 Plasmid construct used for derivation of transgenic mice and rats.
- Figure 4A Plasmid map.
- Figure 4B Radioiodine uptake assay in transfected HTl 080 cells.
- Figure 4C Mlul/Pvul digest. The 7.6 kb fragment was used for pronuclear injections.
- Figure 5 contains photographs of SPECT-CT images obtained from a control non- transgenic rat injected with Tc99m (1 mCi/animal).
- Figure 6 contains photographs of SPECT-CT images obtained from a transgenic rCollalpro/hNIS rat injected with Tc99m (1 mCi/animal).
- Figure 7 contains photographs of SPECT-CT images obtained from a transgenic hActinpro/hNIS rat injected with Tc99m (1 mCi/animal). High NIS expression was observed in heart muscle. Even with this ubiquitous NIS expression, the rats were healthy and fertile.
- Figure 8 contains photographs of SPECT-CT images obtained from three transgenic rCollalpro/hNIS mice and one control non-transgenic mouse injected with Tc99m (1 mCi/animal) and monitored over the indicated times.
- Figure 9 SPECT-CT image obtained from transgenic rCollalpro/hNIS mouse demonstrating NIS signal in the bone.
- Figure 10 contains photographs of SPECT-CT images obtained from three transgenic rCollalpro/hNIS rats with induced rotator cuff injury to the left shoulder. The rats were injected with Tc99m (1 mCi/animal) and monitored over the indicated times.
- Figure 11 contains photographs of SPECT/CT images obtained from transgenic rCollalpro/hNIS rat with induced rotator cuff injury to the left shoulder demonstrating change in NIS expression over time (day 3 and day 35) during healing process.
- Figure 12 contains photographs of SPECT-CT images obtained from transgenic rCollalpro/hNIS rats and control non-transgenic rats with induced rotator cuff injury to the left shoulder. The rats were injected with Tc99m (1 mCi/animal) and monitored over the indicated times.
- FIG. 13 One hour before SPECT-CT imaging, rats were injected with Tc99m at 1 mCi/rat. NIS signals on both shoulders were quantitated using PMOD program. Graph shows the fold increase of NIS uptake signal on the injured over control shoulder in each animal. Rat #20.3.37 is PCR negative and was used as negative control. There is no increase in NIS expression between both shoulders in the control rat.
- Figure 14 contains photographs of SPECT-CT images obtained from five transgenic rCollalpro/hNIS rats after rotator cuff injury was induced to the left shoulder. The rats were injected with Tc99m (1 mCi/animal).
- Figure 15 demonstrates the sensitivity of detection of NIS expressing cells by SPECT/CT. 2e5, 6.7e5, and 2e6 dog MSC expressing NIS were transplanted
- mice subcutaneously into mice (A), and the animals were imaged by SPECT/CT (B).
- This document provides methods and materials for using live transgenic non-human animals (e.g., non-human mammals) to perform radiotracer imaging to monitor pathological processes, disease progression, or therapeutic responses in vivo over time.
- pathological processes that can be monitored in vivo over time using the methods and materials provided herein include, without limitation, wound healing, organ fibrosis, tumorigenesis, growth and dissemination of spontaneously occurring tumors, and inflammation.
- the methods and materials provided herein can be used to monitor immune responses in vivo over time.
- transgenic non-human animal e.g., transgenic non-human mammal
- transgenic non-human mammal can be designed to have somatic and germline cells that include nucleic acid (e.g., a transgene) having a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide.
- nucleic acid e.g., a transgene
- Such transgenic non-human animals can be farm animals such as pigs, goats, sheep, cows, and horses, rabbits, rodents such as rats, guinea pigs, and mice, and non-human primates such as baboons, monkeys, and chimpanzees.
- the term "transgenic non-human animal” as used herein includes, without limitation, founder transgenic non-human animals as well as progeny of the founders, progeny of the progeny, and so forth, provided that the progeny retain the transgene.
- the nucleated cells of the transgenic non-human animals provided herein can contain a transgene that includes a promoter sequence (e.g., a collagen la(l) promoter sequence) operably linked to a nucleic acid sequence encoding a NIS polypeptide.
- a promoter sequence e.g., a collagen la(l) promoter sequence
- the promoter sequence and nucleic acid sequence encoding a NIS polypeptide of a transgene described herein are heterologous.
- a promoter sequence of a transgene described herein can be one that drives NIS polypeptide expression in cells involved in a particular pathological process, cells involved in progression of a particular disease, cells involved in a particular immune response, or cells involved in a particular therapeutic response.
- a transgene can be designed to make a transgenic animal (e.g., a transgenic mammal) where a collagen la(l) promoter sequence drives NIS polypeptide expression.
- a transgenic animal e.g., a transgenic mammal
- a collagen la(l) promoter sequence drives NIS polypeptide expression.
- Such a transgenic animal can be used to assess organ fibrosis.
- Other examples of promotors that can be used to drive NIS polypeptide expression within a transgenic animal to monitor a particular condition are set forth in Table 1.
- Heme oxygenase- 1 promoter Hoi or Drug metabolism/toxicology and hypoxia Hmox-1
- SOD1 Superoxide dismutase promoter
- PSA Prostate-specific antigen promoter
- a regulatory element other than a promoter sequence can be used to direct the expression of aNIS polypeptide of a transgene to particular cells.
- a transgene can be designed to include a non-specific promoter in combination with a tissue- or cell-specific enhancer.
- a transgene used to make a transgenic non-human animal can include a nucleic acid sequence that encodes aNIS polypeptide.
- Any appropriate nucleic acid sequence that encodes a NIS polypeptide can be used as described herein.
- a nucleic acid sequence that encodes a human, mouse, rat, monkey, dog, horse, cattle, or pig NIS polypeptide can be used.
- a nucleic acid sequence that encodes a mutant NIS polypeptide can be used, provided that the mutant NIS polypeptide retains the ability to transport at least one radioactive tracer.
- a nucleic acid sequence that encodes a wild-type or mutant NIS polypeptide that transports radioiodide and/or pertechnetate can be used included as part of a transgene of a transgenic non-human animal provided herein.
- An example of a mutant NIS polypeptide that can be used as described herein includes, without limitation, NIS-93E.
- operably linked refers to positioning a regulatory element (e.g., a promoter sequence, an inducible element, or an enhancer sequence) relative to a nucleic acid sequence encoding a polypeptide (e.g., a NIS polypeptide) in such a way as to permit or facilitate expression of the encoded polypeptide.
- a promoter sequence e.g., a Collal promoter sequence
- a NIS polypeptide e.g., a human NIS polypeptide
- transgenes into non-human animals to produce founder lines, in which the transgene is integrated into the genome.
- Such techniques include, without limitation, pronuclear microinjection (See, e.g., U. S. Patent No. 4,873,191), retrovirus mediated gene transfer into germ lines (Van der Putten et al, Proc. Natl. Acad. Sci. USA, 82:6148-1652 (1985)), gene targeting into embryonic stem cells (Thompson et al., Cell 56:313-321 (1989)), electroporation of embryos (Lo, Mol. Cell.
- fetal fibroblasts can be genetically modified to contain a Coll alpro/hNIS construct ( Figure 1), and then fused with enucleated oocytes. After activation of the oocytes, the eggs are cultured to the blastocyst stage. See, for example, Cibelli et al, Science, 280: 1256-1258 (1998). Standard breeding techniques can be used to create animals that are homozygous for the transgene from the initial heterozygous founder animals.
- transgenic NIS non-human animal provided herein can be homozygous for the NIS transgene. In some cases, a transgenic NIS non-human animal provided herein can be heterozygous for the NIS transgene.
- PCR polymerase chain reaction
- PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA.
- Primers typically are 14 to 40 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length.
- Expression of a nucleic acid sequence encoding a NIS polypeptide in particular cells of interest in a transgenic non-human animal can be assessed using techniques that include, without limitation, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, Western analysis, immunoassays such as enzyme- linked immunosorbent assays, and reverse-transcriptase PCR (RT-PCR).
- RT-PCR reverse-transcriptase PCR
- a radiotracer or combination of radiotracers can be given to the animal, and radiotracer imaging techniques can be used to identify those cells within the animal that express a NIS polypeptide.
- Control, non-transgenic animals can be used to differentiate those cells that express an endogenous NIS polypeptide from those cells that express a NIS polypeptide from a transgene.
- transgenic non-human animal having a nucleic acid e.g., a transgene
- a regulatory element e.g., a promoter
- radiotracer imaging techniques can be used to identify those cells within the transgenic animal that express the NIS polypeptide from the transgene.
- control, non-transgenic animals can be used to differentiate those cells that express an endogenous NIS polypeptide from those cells that express a NIS polypeptide from a transgene.
- the same transgenic non-human animal or group of transgenic non-human animals can be repeatedly administered a radiotracer or combination of radiotracers and imaged over time (e.g., days, weeks, months, or years) to monitor pathological processes, disease progression, or therapeutic responses within the living animals.
- a radiotracer or combination of radiotracers e.g., days, weeks, months, or years
- imaged over time e.g., days, weeks, months, or years
- hNIS human NIS
- rCollalpro Figure 1
- hActinpro Figure 2
- BNP human brain natriuretic peptide promoter
- mIP2pro mouse insulin promoter
- the DNA constructs were injected into zygotes and transferred into
- pseudopregnant female recipients which resulted in the birth of offspring rats.
- Pups were imaged by SPECT/CT imaging and screened for hNIS expression. Tail snips were taken, and PCR analysis was performed to genotype the rodents (Figure 3). Three pairs of primers with specificity for human NIS and not rat or mouse NIS were used to identify the transgenic animals.
- the primer pairs were set 1 (1489.1511 : GCTCTCCTCC- CTGCTAACGACTC, SEQ ID NO: l; and 1835.1813: AGACGATCCTCATTG- GTGGGCAG, SEQ ID NO:2), set 2 (1447.1467: TGCGTGGCTCTCAGTCAAC, SEQ ID NO:3; and 1781.1761 : AGTTCTTCAGGACCCTTGACC, SEQ ID NO:4), and set 3 (1447.1467: TGCGTGGCTCTCTCAGTCAAC, SEQ ID NO:5; and 1824.1805: ATTGGTGGGCAGGAAGCCAG, SEQ ID NO:6).
- rCollalpro/hNIS rats 7 female and 12 male transgenic hActinpro/hNIS rats, 12 female and 6 male transgenic hBNPpro/hNIS rats, and 8 female and 7 male transgenic mIP2pro/hNIS rats were obtained.
- 3 female and 7 male transgenic rCollalpro/hNIS mice, 3 female and 9 male transgenic hActinpro/hNIS mice, 1 female and 5 male transgenic hBNPpro/hNIS mice, and 6 female and 7 male transgenic mIP2pro/hNIS mice were obtained.
- transgenic animals were quarantined for 8 weeks to insure that they did not have any transmissible parasites or diseases. While in quarantine, two transgenic rCollalpro/hNIS rats started to exhibit thin hair coats and gait abnormalities. These abnormalities were monitored on a weekly basis.
- Rat #579 male
- Rat #576 female
- Rat #576 female
- Rat #576 female
- the rats remained stable since these abnormalities were first noted.
- PCR and positive imaging animals were then paired with a wild-type mates to produce the Fl generation. Heterozygous littermate animals were then continuously bred until homogyzyous.
- DNA from a tail snip was used at the age of 3 weeks or older for PCR screening with two pairs of primers specific for the transgenic construct.
- PCR confirmed transgenic animals were screened for NIS expression using SPECT-CT.
- SPECT-CT imaging confirmed the expression of NIS above that observed in wild type control animals ( Figures 5-7).
- mice also were imaged early after birth and followed over time. From these results, NIS polypeptide expression was observed to change over time ( Figures 8 and 9). In particular, the NIS signals were strong in the growth plates, vertebrate, and joints, but this diminished over time as the mice matured.
- SPECT-CT imaging was performed to monitor the recruitment of cells expressing hNIS as a surrogate for type 1 collagen expression at days 3, 7, 14, 21, 25, and 35 days post injury ( Figures 10 and 11).
- the baseline NIS expression in the skin (high collagen synthesis) remained stable, while there was increasing NIS expression in the
- Rat #20.3.37 was PCR negative and was used as negative control. There was no increase in NIS expression between both shoulders in the control rat.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Environmental Sciences (AREA)
- Veterinary Medicine (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Husbandry (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Optics & Photonics (AREA)
- Physics & Mathematics (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Inorganic Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This document provides methods and materials for using live transgenic non-human animals (e.g., non-human mammals) to perform radiotracer imaging to monitor pathological processes, disease progression, or therapeutic responses in vivo over time. For example, methods and materials for using live transgenic non-human animals (e.g., non-human mammals) having somatic and germline cells that include nucleic acid (e.g., a transgene) having a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide to perform radiotracer imaging to monitor pathological processes, disease progression, or therapeutic responses in vivo over time are provided.
Description
METHODS AND MATERIALS FOR USING TRANSGENIC NON-HUMAN ANIMALS EXPRESSING SODIUM IODIDE SYMPORTER POLYPEPTIDES TO MONITOR PATHOLOGICAL PROCESSES, DISEASE PROGRESSION, OR
THERAPEUTIC RESPONSES OVER TIME
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims benefit of the U.S. Provisional Application Serial No. 62/149,425, filed on April 17, 2015. The disclosure of the prior application is considered part of the disclosure of this application, and is incorporated in its entirety into this application.
1. Technical Field
This document relates to methods and materials involved in radiotracer imaging using live transgenic non-human animals (e.g., non-human mammals) to monitor pathological processes, disease progression, or therapeutic responses in vivo over time. For example, this document relates to using live transgenic non-human animals (e.g., non- human mammals) having somatic and germline cells that include nucleic acid (e.g., a transgene) having a promoter sequence operably linked to a nucleic acid sequence encoding a sodium iodide symporter (NIS) polypeptide to monitor pathological processes, disease progression, or therapeutic responses in vivo over time.
2. Background Information
NIS polypeptides mediate the uptake and concentration of iodide in the thyroid gland, providing the basis for diagnostic thyroid radioimaging and radioiodine therapy. When nucleic acid encoding a NIS polypeptide is introduced into non-thyroid cells, they can, like thyroid cells, be detected using iodide/pertechnetate radioimaging and/or destroyed using iodide radiotherapy.
SUMMARY
This document provides methods and materials for using live transgenic non- human animals (e.g., non-human mammals) to perform radiotracer imaging to monitor
pathological processes, disease progression, or therapeutic responses in vivo over time. For example, this document provides methods and materials for using live transgenic non-human animals (e.g., non-human mammals) having somatic and germline cells that include nucleic acid (e.g., a transgene) having a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide to perform radiotracer imaging to monitor pathological processes, disease progression, or therapeutic responses in vivo over time. In some cases, transgenic NIS non-human animals (e.g., mice or larger mammals) can be used as described herein for non-invasive quantitation and localization of changing levels of NIS polypeptide expression through the various stages of a pathological process of interest in a single living animal.
NIS radiotracers can be efficiently concentrated by cells expressing a NIS polypeptide, and SPECT, PET, and γ-camera images can be used to monitor the in vivo biodistribution of NIS radiotracers. As described herein, imaging techniques that involve the uptake of radiotracers such as 123I, 1241, 125I, B18F4 (tetrafluoroborate), and 99mTc04 (pertechnetate) by expressed NIS polypeptides of a transgenic non-human animal (e.g., non-human mammal) provided herein can be used for accurate, sensitive, high resolution detection of NIS polypeptide expression and monitoring of pathological processes, disease progression, or therapeutic responses in vivo over time in living mammals (e.g., for longitudinal studies).
Unlike luciferase and GFP reporter genes, which rely on optical imaging, NIS polypeptides can be used for quantitative expression monitoring in large mammals as well as in deep-seated tissues (e.g., mouse tissues) because, unlike photons, gamma rays are minimally attenuated by the tissues through which they pass.
The methods and materials provided herein are based, at least in part, on the discovery that the sensitivity of detection of NIS polypeptide expressing cells in the context of a transgenic NIS animal is not too low to allow for the localization and quantitation of a pathological or developmental process within the transgenic animal even though other work may have indicated that NIS expressing cells could not be detected below a threshold number of at least about 100,000 cells in a single location (Figure 15). The methods and materials provided herein also are based, at least in part, on the discovery that the changes in NIS polypeptide expression at sites of disease pathology are
not too small to allow for accurate quantitative analyses over time. In addition, the methods and materials provided herein are based, at least in part, on the discovery that over-expression of a NIS polypeptide from a transgene at sites where it is not naturally expressed does not result in abnormal tissue development or other toxicities leading to premature death of the transgenic animal. Further, the methods and materials provided herein are based, at least in part, on the discovery that, while no regulatory element (e.g., promoter or enhancer) has a level of pathology specificity that does not result in at least some expression in normal tissues, this background NIS polypeptide expression in normal tissues does not confound the study of the pathological process itself.
As described herein, pathological processes, disease progression, and therapeutic responses can be assessed in vivo over time using the live transgenic non-human animals (e.g., non-human mammals) provided herein.
In general, one aspect of this document features a method of monitoring a pathological process over time within a living transgenic non-human animal comprising somatic and germline cells comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide. The method comprises, or consists essentially of, (a) administering a first preparation comprising a radiotracer to the animal during a first time point, wherein the radiotracer is transported into a cell that expresses the NIS polypeptide, (b) collecting imaging data of the radiotracer from within the animal to identify cells containing the radiotracer following the administration of the first preparation, (c) administering a second preparation comprising a radiotracer to the animal during a second time point after the first time point, and (d) collecting imaging data of the radiotracer from within the animal to identify cells containing the radiotracer following the administration of the second preparation. The pathological process can be fibrosis. The animal can be a mouse or rat. The promoter sequence can be a Collal promoter sequence. The NIS polypeptide can be a human NIS polypeptide. The second time point can be at least 5 days after the first time point. The second time point can be at least 20 days after the first time point. The radiotracer can be pertechnetate or radioiodide.
In another aspect, this document features a transgenic non-human animal, whose somatic and germline cells comprise a transgene comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide, wherein
radiotracer images of the animal at different time points, when a radiotracer that is transported into cells that express the NIS polypeptide is administered to the animal, provide imaging data with observable differences in the stages of a pathological process within the animal at the different time points. The pathological process can be fibrosis. The animal can be a mouse or rat. The promoter sequence can be a Collal promoter sequence. The NIS polypeptide can be a human NIS polypeptide. The different time points can be at least 5 days apart. The different time points can be at least 20 days apart. The radiotracer can be pertechnetate or radioiodide.
In another aspect, this document features a transgenic non-human animal, whose somatic and germline cells comprise a transgene comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide, wherein the promoter sequence is a Collal promoter sequence, an osteocalcin promoter sequence, a bone sialoprotein (BSP) promoter sequence, a VEGFR2 promoter sequence, a prostate- specific antigen (PSA) promoter sequence, an Epo promoter sequence, a serum amyloid A-1 (Saal) promoter sequence, a TNF promoter sequence, an iNOS promoter sequence, a 3 NFkB site from the Igk light chain promoter sequence, an heme oxygenase-1 (Hoi or Hmox-1) promoter sequence, a superoxide dismutase (SOD1) promoter sequence, a cytochrome p450 isoform 3A (Cyp3A4) promoter sequence, a rat insulin gene (RIP) promoter sequence, a resistin (Retn) promoter sequence, or an elastase I (ELI) promoter sequence.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and
advantages of the invention will be apparent from the description and drawings, and from the claims.
DESCRIPTION OF DRAWINGS
Figure 1 is a diagram of a transgene construct used to make mice and rats transgenic for human NIS nucleic acid operably linked to a rat collagen al(l) promoter.
Figure 2 is a diagram of a transgene construct used to make mice and rats transgenic for human NIS nucleic acid operably linked to a human β-actin promoter.
Figure 3 is a photograph of a gel showing the indicated PCR results.
Figure 4. Plasmid construct used for derivation of transgenic mice and rats. Figure 4A. Plasmid map. Figure 4B. Radioiodine uptake assay in transfected HTl 080 cells. Figure 4C. Mlul/Pvul digest. The 7.6 kb fragment was used for pronuclear injections.
Figure 5 contains photographs of SPECT-CT images obtained from a control non- transgenic rat injected with Tc99m (1 mCi/animal).
Figure 6 contains photographs of SPECT-CT images obtained from a transgenic rCollalpro/hNIS rat injected with Tc99m (1 mCi/animal).
Figure 7 contains photographs of SPECT-CT images obtained from a transgenic hActinpro/hNIS rat injected with Tc99m (1 mCi/animal). High NIS expression was observed in heart muscle. Even with this ubiquitous NIS expression, the rats were healthy and fertile.
Figure 8 contains photographs of SPECT-CT images obtained from three transgenic rCollalpro/hNIS mice and one control non-transgenic mouse injected with Tc99m (1 mCi/animal) and monitored over the indicated times.
Figure 9. SPECT-CT image obtained from transgenic rCollalpro/hNIS mouse demonstrating NIS signal in the bone.
Figure 10 contains photographs of SPECT-CT images obtained from three transgenic rCollalpro/hNIS rats with induced rotator cuff injury to the left shoulder. The rats were injected with Tc99m (1 mCi/animal) and monitored over the indicated times.
Figure 11 contains photographs of SPECT/CT images obtained from transgenic rCollalpro/hNIS rat with induced rotator cuff injury to the left shoulder demonstrating change in NIS expression over time (day 3 and day 35) during healing process.
Figure 12 contains photographs of SPECT-CT images obtained from transgenic rCollalpro/hNIS rats and control non-transgenic rats with induced rotator cuff injury to the left shoulder. The rats were injected with Tc99m (1 mCi/animal) and monitored over the indicated times.
Figure 13. One hour before SPECT-CT imaging, rats were injected with Tc99m at 1 mCi/rat. NIS signals on both shoulders were quantitated using PMOD program. Graph shows the fold increase of NIS uptake signal on the injured over control shoulder in each animal. Rat #20.3.37 is PCR negative and was used as negative control. There is no increase in NIS expression between both shoulders in the control rat.
Figure 14 contains photographs of SPECT-CT images obtained from five transgenic rCollalpro/hNIS rats after rotator cuff injury was induced to the left shoulder. The rats were injected with Tc99m (1 mCi/animal).
Figure 15 demonstrates the sensitivity of detection of NIS expressing cells by SPECT/CT. 2e5, 6.7e5, and 2e6 dog MSC expressing NIS were transplanted
subcutaneously into mice (A), and the animals were imaged by SPECT/CT (B).
DETAILED DESCRIPTION
This document provides methods and materials for using live transgenic non- human animals (e.g., non-human mammals) to perform radiotracer imaging to monitor pathological processes, disease progression, or therapeutic responses in vivo over time. Examples of pathological processes that can be monitored in vivo over time using the methods and materials provided herein include, without limitation, wound healing, organ fibrosis, tumorigenesis, growth and dissemination of spontaneously occurring tumors, and inflammation. In some cases, the methods and materials provided herein can be used to monitor immune responses in vivo over time.
As described herein, a transgenic non-human animal (e.g., transgenic non-human mammal) can be designed to have somatic and germline cells that include nucleic acid (e.g., a transgene) having a promoter sequence operably linked to a nucleic acid sequence
encoding a NIS polypeptide. Such transgenic non-human animals can be farm animals such as pigs, goats, sheep, cows, and horses, rabbits, rodents such as rats, guinea pigs, and mice, and non-human primates such as baboons, monkeys, and chimpanzees. The term "transgenic non-human animal" as used herein includes, without limitation, founder transgenic non-human animals as well as progeny of the founders, progeny of the progeny, and so forth, provided that the progeny retain the transgene.
The nucleated cells of the transgenic non-human animals provided herein can contain a transgene that includes a promoter sequence (e.g., a collagen la(l) promoter sequence) operably linked to a nucleic acid sequence encoding a NIS polypeptide. In general, the promoter sequence and nucleic acid sequence encoding a NIS polypeptide of a transgene described herein are heterologous. A promoter sequence of a transgene described herein can be one that drives NIS polypeptide expression in cells involved in a particular pathological process, cells involved in progression of a particular disease, cells involved in a particular immune response, or cells involved in a particular therapeutic response. For example, a transgene can be designed to make a transgenic animal (e.g., a transgenic mammal) where a collagen la(l) promoter sequence drives NIS polypeptide expression. Such a transgenic animal can be used to assess organ fibrosis. Other examples of promotors that can be used to drive NIS polypeptide expression within a transgenic animal to monitor a particular condition (e.g., a pathological process or disease progression) are set forth in Table 1.
Table 1.
iNOS gene promoter inflammation
3 NFkB site from the Igk light chain inflammation
promoter
Heme oxygenase- 1 promoter (Hoi or Drug metabolism/toxicology and hypoxia Hmox-1)
Superoxide dismutase promoter (SOD1) Drug metabolism/toxicology toxicity
Cytochrome p450 isoform 3A promoter Drug metabolism/toxicology toxicity (Cyp3A4)
Rat insulin gene promoter (RIP) Atrophy
Resistin promoter (Retn) Obesity
Elastase I promoter (ELI) Neoplasia
Prostate-specific antigen promoter (PSA) Neoplasia
In some cases, a regulatory element other than a promoter sequence can be used to direct the expression of aNIS polypeptide of a transgene to particular cells. For example, a transgene can be designed to include a non-specific promoter in combination with a tissue- or cell-specific enhancer.
As described herein, a transgene used to make a transgenic non-human animal provided herein can include a nucleic acid sequence that encodes aNIS polypeptide. Any appropriate nucleic acid sequence that encodes a NIS polypeptide can be used as described herein. For example, a nucleic acid sequence that encodes a human, mouse, rat, monkey, dog, horse, cattle, or pig NIS polypeptide can be used. In some cases, a nucleic acid sequence that encodes a mutant NIS polypeptide can be used, provided that the mutant NIS polypeptide retains the ability to transport at least one radioactive tracer. Examples of radioactive tracers that can be transported into cells via aNIS polypeptide include, without limitation, 123I, 124I, 125I, mI, B18F4, 186Re04, 188Re04, 99mTc04, 94Tc04, and 6C104. For example, a nucleic acid sequence that encodes a wild-type or mutant NIS polypeptide that transports radioiodide and/or pertechnetate can be used included as part of a transgene of a transgenic non-human animal provided herein. An example of a
mutant NIS polypeptide that can be used as described herein includes, without limitation, NIS-93E.
The term "operably linked" as used herein refers to positioning a regulatory element (e.g., a promoter sequence, an inducible element, or an enhancer sequence) relative to a nucleic acid sequence encoding a polypeptide (e.g., a NIS polypeptide) in such a way as to permit or facilitate expression of the encoded polypeptide. In the transgenes disclosed herein, for example, a promoter sequence (e.g., a Collal promoter sequence) can be positioned 5' relative to a nucleic acid encoding a NIS polypeptide (e.g., a human NIS polypeptide).
Various techniques can be used to introduce transgenes into non-human animals to produce founder lines, in which the transgene is integrated into the genome. Such techniques include, without limitation, pronuclear microinjection (See, e.g., U. S. Patent No. 4,873,191), retrovirus mediated gene transfer into germ lines (Van der Putten et al, Proc. Natl. Acad. Sci. USA, 82:6148-1652 (1985)), gene targeting into embryonic stem cells (Thompson et al., Cell 56:313-321 (1989)), electroporation of embryos (Lo, Mol. Cell. Biol , 3 : 1803-1814 (1983)), and in vitro transformation of somatic cells, such as cumulus or mammary cells, followed by nuclear transplantation (Wilmut et al, Nature, 385: 810-813 (1997); and Wakayama et al, Nature, 394:369-374 (1998)). For example, fetal fibroblasts can be genetically modified to contain a Coll alpro/hNIS construct (Figure 1), and then fused with enucleated oocytes. After activation of the oocytes, the eggs are cultured to the blastocyst stage. See, for example, Cibelli et al, Science, 280: 1256-1258 (1998). Standard breeding techniques can be used to create animals that are homozygous for the transgene from the initial heterozygous founder animals.
Homozygosity is not required, however, as the phenotype can be observed in hemizygotic animals. In some cases, a transgenic NIS non-human animal provided herein can be homozygous for the NIS transgene. In some cases, a transgenic NIS non-human animal provided herein can be heterozygous for the NIS transgene.
Once transgenic non-human animals have been generated, expression of an encoded NIS polypeptide can be assessed. Initial screening can be accomplished by Southern blot analysis to determine whether or not integration of the transgene has taken place. For a description of Southern analysis, see sections 9.37-9.52 of Sambrook et al,
1989, Molecular Cloning. A Laboratory Manual, second edition, Cold Spring Harbor Press, Plainview; NY. Polymerase chain reaction (PCR) techniques also can be used in the initial screening. PCR refers to a procedure or technique in which target nucleic acids are amplified. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Primers typically are 14 to 40 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length.
Expression of a nucleic acid sequence encoding a NIS polypeptide in particular cells of interest in a transgenic non-human animal can be assessed using techniques that include, without limitation, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, Western analysis, immunoassays such as enzyme- linked immunosorbent assays, and reverse-transcriptase PCR (RT-PCR). In some cases, a radiotracer or combination of radiotracers can be given to the animal, and radiotracer imaging techniques can be used to identify those cells within the animal that express a NIS polypeptide. Control, non-transgenic animals can be used to differentiate those cells that express an endogenous NIS polypeptide from those cells that express a NIS polypeptide from a transgene.
Once a transgenic non-human animal having a nucleic acid (e.g., a transgene) that includes a regulatory element (e.g., a promoter) and a nucleic acid sequence that encodes a NIS polypeptide is obtained, a radiotracer or combination of radiotracers can be given to the transgenic animal, and radiotracer imaging techniques can be used to identify those cells within the transgenic animal that express the NIS polypeptide from the transgene. Again, control, non-transgenic animals can be used to differentiate those cells that express an endogenous NIS polypeptide from those cells that express a NIS polypeptide from a transgene. In some cases, the same transgenic non-human animal or group of transgenic non-human animals can be repeatedly administered a radiotracer or combination of radiotracers and imaged over time (e.g., days, weeks, months, or years) to monitor pathological processes, disease progression, or therapeutic responses within the living animals.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1 - Transgenic NIS animals
A human NIS (hNIS) cDNA was subcloned into an expression vector, and hNIS expression was driven by a 3.6 kb fragment of the rat collagen al(l) promoter
(rCollalpro; Figure 1), a 2.3 kb fragment of the human beta actin promoter (hActinpro; Figure 2), a human brain natriuretic peptide (BNP) promoter (hBNPpro), or a mouse insulin promoter (mIP2pro).
The DNA constructs were injected into zygotes and transferred into
pseudopregnant female recipients, which resulted in the birth of offspring rats. Pups were imaged by SPECT/CT imaging and screened for hNIS expression. Tail snips were taken, and PCR analysis was performed to genotype the rodents (Figure 3). Three pairs of primers with specificity for human NIS and not rat or mouse NIS were used to identify the transgenic animals. The primer pairs were set 1 (1489.1511 : GCTCTCCTCC- CTGCTAACGACTC, SEQ ID NO: l; and 1835.1813: AGACGATCCTCATTG- GTGGGCAG, SEQ ID NO:2), set 2 (1447.1467: TGCGTGGCTCTCTCAGTCAAC, SEQ ID NO:3; and 1781.1761 : AGTTCTTCAGGACCCTTGACC, SEQ ID NO:4), and set 3 (1447.1467: TGCGTGGCTCTCTCAGTCAAC, SEQ ID NO:5; and 1824.1805: ATTGGTGGGCAGGAAGCCAG, SEQ ID NO:6).
As confirmed from the PCR results, 6 female and 3 male transgenic
rCollalpro/hNIS rats, 7 female and 12 male transgenic hActinpro/hNIS rats, 12 female and 6 male transgenic hBNPpro/hNIS rats, and 8 female and 7 male transgenic mIP2pro/hNIS rats were obtained. In addition, 3 female and 7 male transgenic rCollalpro/hNIS mice, 3 female and 9 male transgenic hActinpro/hNIS mice, 1 female and 5 male transgenic hBNPpro/hNIS mice, and 6 female and 7 male transgenic mIP2pro/hNIS mice were obtained.
The transgenic animals were quarantined for 8 weeks to insure that they did not have any transmissible parasites or diseases. While in quarantine, two transgenic rCollalpro/hNIS rats started to exhibit thin hair coats and gait abnormalities. These
abnormalities were monitored on a weekly basis. Rat #579 (male) exhibited a uniformly thin fur coat, hind leg dysmetria (e.g., ataxia with lack of coordination of movement, hypermetria-ataxia with overreaching), and a hind limb proprioceptive deficit, and occasionally walked on curled toes. Rat #576 (female) exhibited a uniformly thin fur coat, kyphosis, and mild hind leg dysmetria (hypermetria). The rats remained stable since these abnormalities were first noted.
After all animals completed quarantine, SPECT/CT and I125 or Tc99m
pertechnetate imaging was performed. PCR and positive imaging animals were then paired with a wild-type mates to produce the Fl generation. Heterozygous littermate animals were then continuously bred until homogyzyous. DNA from a tail snip was used at the age of 3 weeks or older for PCR screening with two pairs of primers specific for the transgenic construct. PCR confirmed transgenic animals were screened for NIS expression using SPECT-CT. SPECT-CT imaging confirmed the expression of NIS above that observed in wild type control animals (Figures 5-7).
The rCollalpro/hNIS mice also were imaged early after birth and followed over time. From these results, NIS polypeptide expression was observed to change over time (Figures 8 and 9). In particular, the NIS signals were strong in the growth plates, vertebrate, and joints, but this diminished over time as the mice matured.
Example 2 - Following rotator cuff injury in transgenic NIS animals Rotator cuff injury was induced on the left shoulder of transgenic
rCollalpro/hNIS rats. The right shoulder was used as a non-injury control. Rotator cuff injury also was induced on the left shoulder of non-transgenic control rats.
SPECT-CT imaging was performed to monitor the recruitment of cells expressing hNIS as a surrogate for type 1 collagen expression at days 3, 7, 14, 21, 25, and 35 days post injury (Figures 10 and 11). The baseline NIS expression in the skin (high collagen synthesis) remained stable, while there was increasing NIS expression in the
shoulder/rotator cuff area for the rats undergoing active fibrogenesis post rotator cuff injury (Figures 10 and 11). It was apparent from the images that NIS imaging yielded important information on the variability of fibrogenesis in different rodents and allowed for an in-depth analysis into understand the correlation between fibrogenesis and the
quality of repair in living animals over time. The control non-transgenic rats did not exhibit any change in uptake of radioactive material at baseline, before surgery (day -3), or post-surgery (Figure 12). In contrast, the transgenic rCollalpro/hNIS rats exhibited a strong NIS expression circling the site of rotator cuff injury (Figure 12).
One hour before SPECT-CT imaging, rats were injected with Tc99m at 1 mCi/rat. NIS signals on both shoulders were quantitated using PMOD program. The fold increase of NIS uptake signal on the injured over control shoulder in each animal was determined (Figure 13). Rat #20.3.37 was PCR negative and was used as negative control. There was no increase in NIS expression between both shoulders in the control rat.
In addition, skin NIS expression in the transgenic rCollalpro/hNIS rats was stable over time. Stable NIS expression in the skin over time was observed in control Colal-Al-NIS transgenic rats that did not receive rotator cuff injury (Figure 14).
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A method of monitoring a pathological process over time within a living transgenic non-human animal comprising somatic and germline cells comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide, wherein said method comprises:
(a) administering a first preparation comprising a radiotracer to said animal during a first time point, wherein said radiotracer is transported into a cell that expresses said NIS polypeptide,
(b) collecting imaging data of said radiotracer from within said animal to identify cells containing said radiotracer following said administration of said first preparation,
(c) administering a second preparation comprising a radiotracer to said animal during a second time point after said first time point, and
(d) collecting imaging data of said radiotracer from within said animal to identify cells containing said radiotracer following said administration of said second preparation.
2. The method of claim 1 , wherein said pathological process is fibrosis.
3. The method of claim 1 , wherein said animal is a mouse or rat.
4. The method of claim 1 , wherein said promoter sequence is a Coll al promoter sequence.
5. The method of claim 1 , wherein said NIS polypeptide is a human NIS
polypeptide.
6. The method of claim 1 , wherein said second time point is at least 5 days after said first time point.
7. The method of claim 1 , wherein said second time point is at least 20 days after said first time point.
8. The method of claim 1 , wherein said radiotracer is pertechnetate or radioiodide.
9. A transgenic non-human animal, whose somatic and germline cells comprise a transgene comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide, wherein radiotracer images of said animal at different time points, when a radiotracer that is transported into cells that express said NIS polypeptide is administered to said animal, provide imaging data with observable differences in the stages of a pathological process within said animal at said different time points.
10. The transgenic non-human animal of claim 9, wherein said pathological process is fibrosis.
11. The transgenic non-human animal of claim 9, wherein said animal is a mouse or rat.
12. The transgenic non-human animal of claim 9, wherein said promoter sequence is a Coll al promoter sequence.
13. The transgenic non-human animal of claim 9, wherein said NIS polypeptide is a human NIS polypeptide.
14. The transgenic non-human animal of claim 9, wherein said different time points are at least 5 days apart.
15. The transgenic non-human animal of claim 9, wherein said different time points are at least 20 days apart.
16. The transgenic non-human animal of claim 9, wherein said radiotracer is pertechnetate or radioiodide.
17. A transgenic non-human animal, whose somatic and germline cells comprise a transgene comprising a promoter sequence operably linked to a nucleic acid sequence encoding a NIS polypeptide, wherein said promoter sequence is a Collal promoter sequence, an osteocalcin promoter sequence, a bone sialoprotein (BSP) promoter sequence, a VEGFR2 promoter sequence, a prostate-specific antigen (PSA) promoter sequence, an Epo promoter sequence, a serum amyloid A-1 (Saal) promoter sequence, a TNF promoter sequence, an iNOS promoter sequence, a 3 NFkB site from the Igk light chain promoter sequence, an heme oxygenase- 1 (Hoi or Hmox-1) promoter sequence, a superoxide dismutase (SOD1) promoter sequence, a cytochrome p450 isoform 3A (Cyp3A4) promoter sequence, a rat insulin gene (RIP) promoter sequence, a resistin (Retn) promoter sequence, or an elastase I (ELI) promoter sequence.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/566,827 US20180103620A1 (en) | 2015-04-17 | 2016-04-15 | Methods and materials for using transgenic non-human animals expressing sodium iodide symporter polypeptides to monitor pathological processes, disease progression, or therapeutic responses over time |
| CA2982994A CA2982994A1 (en) | 2015-04-17 | 2016-04-15 | Methods and materials for using transgenic non-human animals expressing sodium iodide symporter polypeptides to monitor pathological processes, disease progression, or therapeuticresponses over time |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562149425P | 2015-04-17 | 2015-04-17 | |
| US62/149,425 | 2015-04-17 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2016168683A2 true WO2016168683A2 (en) | 2016-10-20 |
| WO2016168683A3 WO2016168683A3 (en) | 2016-11-17 |
Family
ID=57126363
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/027876 Ceased WO2016168683A2 (en) | 2015-04-17 | 2016-04-15 | Methods and materials for using transgenic non-human animals expressing sodium iodide symporter polypeptides to monitor pathological processes, disease progression, or therapeutic responses over time |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20180103620A1 (en) |
| CA (1) | CA2982994A1 (en) |
| WO (1) | WO2016168683A2 (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6586411B1 (en) * | 2000-08-16 | 2003-07-01 | Mayo Foundation For Medical Education And Research | System for monitoring the location of transgenes |
| US20140227182A1 (en) * | 2013-02-19 | 2014-08-14 | The Johns Hopkins University | Cancer imaging with therapy: theranostics |
| US20160228577A1 (en) * | 2013-10-15 | 2016-08-11 | Biogen Ma Inc. | Transgenic animals for in vivo imaging |
-
2016
- 2016-04-15 WO PCT/US2016/027876 patent/WO2016168683A2/en not_active Ceased
- 2016-04-15 CA CA2982994A patent/CA2982994A1/en not_active Abandoned
- 2016-04-15 US US15/566,827 patent/US20180103620A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016168683A3 (en) | 2016-11-17 |
| CA2982994A1 (en) | 2016-10-20 |
| US20180103620A1 (en) | 2018-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kuang et al. | Merosin-deficient congenital muscular dystrophy. Partial genetic correction in two mouse models. | |
| JP6236461B2 (en) | HLA class I expressing non-human animals | |
| JP6998656B2 (en) | lincRNA deletion non-human animal | |
| Horie et al. | Investigation of Oxtr-expressing neurons projecting to nucleus accumbens using Oxtr-ires-Cre knock-in prairie voles (Microtus ochrogaster) | |
| CN116114656B (en) | A method for constructing a lupus erythematosus mouse model and its application | |
| Wong et al. | Transgenic Mice Bearing a Human Mutant Thyroid Hormone β l Receptor Manifest Thyroid Function Anomalies, Weight Reduction, and Hyperactivity | |
| JP7765403B2 (en) | Non-human animals carrying a humanized CXCL13 gene | |
| CN106521638A (en) | Resource library of rat with gene mutation and preparation method thereof | |
| US20180103620A1 (en) | Methods and materials for using transgenic non-human animals expressing sodium iodide symporter polypeptides to monitor pathological processes, disease progression, or therapeutic responses over time | |
| Motojima et al. | Conditional knockout of Foxc2 gene in kidney: efficient generation of conditional alleles of single-exon gene by double-selection system | |
| CN106399369B (en) | Build the method and targeting vector and kit in the mouse model of hippocampus regiospecificity knockout IKK α genes | |
| CN110846321A (en) | Mutant gene and application thereof in constructing speckled ichthyosis miniature pig model | |
| CN102203249A (en) | A method for introducing a mutant gene, a gene for introducing a mutation, a cassette for introducing a mutation, a vector for introducing a mutation, and knocking in a gene into a non-human mammal | |
| Hong et al. | Production of offspring from cloned transgenic RFP female dogs and stable generational transmission of the RFP gene | |
| JP6267986B2 (en) | In vivo evaluation method for molecular target substances that bind to specific human molecules | |
| Kim et al. | The promoter of brain-specific angiogenesis inhibitor 1-associated protein 4 drives developmentally targeted transgene expression mainly in adult cerebral cortex and hippocampus | |
| CN118256559B (en) | Method for preparing animal model of heart failure with preserved ejection fraction | |
| JP7735260B2 (en) | Methods for identifying substances that affect aging | |
| CN116058335B (en) | Construction method and application of spontaneous ankylosing spondylitis model | |
| CN103525850A (en) | Clec3b gene knockout and targeting vector | |
| WO2018085967A1 (en) | Genetically humanized mammals expressing human serum albumin and uses thereof | |
| JP2004267002A (en) | Senescence marker protein 30-deficient animal, antibody and method for preparing the antibody | |
| JPH119140A (en) | 25-hydroxyvitamin D3 24-hydroxylase transgenic animal | |
| JP2002084923A (en) | Histamine-producing animals | |
| Dosay-Akbulut | Advantages and disadvantages of transgenic animal technology with genetic engineering |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16780892 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2982994 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16780892 Country of ref document: EP Kind code of ref document: A2 |
