WO2016168565A1 - Methods for treatment of chronic obstructive pulmonary disease and/or therapy monitoring - Google Patents

Methods for treatment of chronic obstructive pulmonary disease and/or therapy monitoring Download PDF

Info

Publication number
WO2016168565A1
WO2016168565A1 PCT/US2016/027700 US2016027700W WO2016168565A1 WO 2016168565 A1 WO2016168565 A1 WO 2016168565A1 US 2016027700 W US2016027700 W US 2016027700W WO 2016168565 A1 WO2016168565 A1 WO 2016168565A1
Authority
WO
WIPO (PCT)
Prior art keywords
copd
expression level
subject
agent
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/027700
Other languages
French (fr)
Inventor
Donald E. Ingber
Kambez HAJIPOURAN BENAM
Richard Novak
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard University
Original Assignee
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harvard University filed Critical Harvard University
Publication of WO2016168565A1 publication Critical patent/WO2016168565A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/47042-Quinolinones, e.g. carbostyril
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/53Colony-stimulating factor [CSF]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors

Definitions

  • COPD chronic obstructive pulmonary disease
  • Methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from an anti-viral agent, an antibacterial agent, or a treatment for non-infective COPD exacerbation are also described herein.
  • Methods for detecting COPD patients using molecular signatures are also described herein.
  • COPD chronic obstructive pulmonary disease
  • biomarkers generally require biological samples obtained from human subjects (e.g., in the form of clinical trials).
  • studies and/or clinical trials using subjects' biological samples e.g., bronchoalveolar lavage content, serum, etc.
  • subjects' biological samples e.g., bronchoalveolar lavage content, serum, etc.
  • some clinical trials are hardly possible to justify for biomarker discovery when saving subjects' life is the highest priority.
  • a COPD subject suffers from an acute exacerbation episode - an exaggerated inflammatory response that commonly leads to hospitalization and requires medical intervention- it would be very difficult or even unethical to justify collection of airway brushings for medical research prior to treating the subject.
  • Yet discovery of cell- or tissue-specific biomarkers that can accurately and reliably indicate a pathological state is highly desired.
  • COPD is a complex disorder that affects predominantly the lungs and its genesis has been poorly defined.
  • Wright et al. American Journal of Physiology - Lung Cellular and Molecular Physiology (2008) 295: L1-L15.
  • Even the existing animal models of COPD e.g., induced by cigarette smoke
  • COPD exacerbations both bacterial and viral infections have been detected during COPD exacerbations.
  • Some examples of respiratory viruses involved in the etiology of COPD exacerbations include, but are not limited to, rhinoviruses, influenza viruses, coronaviruses, and respiratory syncytial virus (RSV), parainfluenza viruses, and human metapneumoviruses (HMPV). Alfredo et al., International Journal of COPD (2007) 2: 477-483. Determining the etiology of exacerbations can inform appropriate antibiotic and antiviral therapy. Antibiotic therapy has been widely used, but not always appropriately, in the treatment of COPD exacerbations.
  • Embodiments of various aspects described herein are, in part, based on the discovery that macrophage colony stimulating factor (M-CSF) is a novel biomarker for virus-induced exacerbation in chronic obstructive pulmonary disease (COPD).
  • M-CSF macrophage colony stimulating factor
  • COPD chronic obstructive pulmonary disease
  • the inventors have applied human lung small airway-on-a-chip technology, e.g., as described in the PCT Application No. PCT/US2014/07161 1 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety, to reconstruct healthy and COPD diseased epithelia on-chip.
  • the inventors have regenerated 3- dimensional well-differentiated, mucociliary bronchiolar epithelium - cells of the small airway where the damage in COPD airways typically occurs - in vitro in a microfluidic device, e.g., as described in the PCT Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated by reference in its entirety.
  • the inventors then used exogenous stimuli to mimic pathogenic infections in order to simulate bacterium- and virus-triggered exacerbation phenotypes.
  • the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with lipopolysaccharide (LPS) to mimic Gram negative bacteria-induced exacerbation.
  • LPS lipopolysaccharide
  • the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with polyinosinic:polycytidylic (poly I:C) acid to mimic respiratory virus-induced exacerbation.
  • poly I:C polyinosinic:polycytidylic
  • IL-8 interleukin 8
  • M- CSF macrophage colony-stimulating factor
  • a practitioner can differentially diagnose the cause of COPD exacerbation (e.g., virus-induced v. bacteria- induced), and thus select appropriate treatment to treat the COPD exacerbation.
  • the cause of COPD exacerbation e.g., virus-induced v. bacteria- induced
  • virus is indicated to be the cause of exacerbation and thus the subject can be administered an anti -viral agent instead of an antibacterial agent (e.g., antibiotics).
  • COPD chronic obstructive pulmonary disease
  • the categorizing, stratifying or classifying COPD exacerbations help to distinguish the COPD exacerbation that is due to a viral infection, a bacterial infection or irritant in the air.
  • the categorizing, stratifying or classifying or distinguishing COPD exacerbations help to distinguish the COPD exacerbations that are due to a viral infection, a bacterial infection or irritant in the air, thereby an appropriate treatment comprising anti-viral agent, or anti-bacterial agent, and/or an antiinflammatory agent can be administered to the subject depending on the root cause of the COPD exacerbation.
  • the genes disclosed in Tables 3 and 4 are biomarkers for a risk of developing COPD, upon prolong exposure to cigarette smoke irritants, genes disclosed in Table 3 are significantly increased in expression while genes disclosed in Table 4 are significantly decreased in expression in COPD subjects. Identification of such subjects at risk allows for early intervention of the disease.
  • the screening methods uses the lung in a chip assay under various induced simulated COPD situations, and involve analyses for agents, drugs, small chemicals etc that can reverse the direction of expression levels of M- CSF, IL-8 and/or genes disclosed in Tables 3 and 4 that is associated with the various COPD exacerbations.
  • agents, drugs, small chemicals etc that can reduce of expression levels of M- CSF (due to viral infection), IL-8 (due to bacterial infection, and/or genes disclosed in Table 3 (due to smoke particulate irritant).
  • a method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to an anti-viral agent comprises: (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject to be likely to be more responsive to an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject to be more likely to respond to an alternative treatment without the anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • COPD chronic obstructive pulmonary disease
  • the method can further comprise administering to the subject a treatment based on the expression level of M-CSF in the identifying step.
  • the subject when the expression level of M-CSF is greater than the M-CSF reference, the subject is not administered an anti -bacterial agent. Thus, administration of unnecessary antibiotics can be prevented.
  • the method can further comprise measuring expression level of IL-8 in the sample.
  • the subject is optionally further administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
  • the treatment administered to the subject can further comprise an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations.
  • an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof.
  • the anti-viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability.
  • anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof.
  • the anti-viral agent can comprise 2-methoxy-N-(3 -methyl -2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
  • the M-CSF or IL-8 reference can correspond to a level in a healthy subject.
  • the M-CSF or IL-8 reference can correspond to a level in the subject before onset of the COPD exacerbation.
  • the sample can be fluid sample.
  • the fluid sample can comprise a blood or serum sample.
  • COPD chronic obstructive pulmonary disease
  • the subject can exhibit an increased expression of M-CSF, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation).
  • a M-CSF reference e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation.
  • the subject can exhibit an increased expression of M-CSF, e.g., by at least about 1.1-fold or more, including, e.g., at least about 1.5- fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation).
  • a M-CSF reference e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation.
  • the subject can be further administered an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations.
  • an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof.
  • the anti-viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability.
  • anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof.
  • the anti-viral agent can comprise 2-methoxy-N-(3 -methyl -2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
  • a method of treating a patient diagnosed with COPD that exhibits an increased expression level of M-CSF and/or monitoring treatment therapy comprises: (a) determining a first expression level of M-CSF in a sample from a subject diagnosed with COPD that exhibits an increased expression level of M-CSF; (b) administering an anti-viral agent; (c) determining a second expression level of M-CSF after the administering; and (d) comparing the first and second expression levels of M-CSF.
  • the anti-viral agent is effective if the second expression level is lower that the first expression level, and wherein the anti-viral therapy is ineffective if the second expression level is the same as or higher than said first expression level.
  • the method can further comprise, when the anti-viral agent is effective, continuing to administer the agent.
  • the method can further comprise, when the anti-viral agent is ineffective, discontinuing the agent.
  • the method can further comprise, when the anti-viral agent is ineffective, administering the agent at a higher dose.
  • the method can further comprise, when the anti-viral agent is ineffective, administering a different anti-viral agent.
  • a method of identifying an agent for reducing at least one symptom of a viral- induced COPD exacerbation comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a virus-mimic agent; (c) measuring expression level of M-CSF in a sample; and (d) identifying the test agent as an effective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is same as or lower than a M- CSF reference; or identifying the test agent as an ineffective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is higher than the M-CSF reference.
  • the method can further comprise measuring expression level of IL-8 in the sample.
  • the identified effective agent can display the expression level of IL-8 same as or lower than an IL-8 reference.
  • the identified ineffective agent can display the expression level of IL-8 greater than the IL-8 reference.
  • the sample can comprise a culture medium sample.
  • the COPD-mimic cells can be derived from a subject diagnosed with
  • the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent.
  • COPD-phenotype inducing agents include, but are not limited to cigarette smoke and its derivatives (e.g., but not limited to cigarette smoke extract, cigarette smoke condensate, whole mainstream fresh cigarette smoke, passive second hand cigarette smoke), removal of certain nutrients and/or cell culture medium supplements such as retinoic acid, etc.
  • the virus-mimic agent can comprise any agent that induces or activates innate immune receptor(s) involved in an anti-viral response.
  • virus-mimic agents include, but are not limited to synthetic analogues of double-stranded RNA (e.g., polyinosinic:polycytidylic acid), ligands and/or agonists for melanoma differentiation-associated protein 5 (MDA-5), ligands and/or agonists for retinoic acid inducible gene (RIG-1), ligands and/or agonists for NOD-like receptors (NLR), ligands and/or agonists for members of TOLL-like receptors (TLR) such as TLR-7, TLR-8, and TLR-9, viral mimics such as inactivated viral particles (e.g., UV-inactivated human rhinovirus or fixed virus), whole live virus, and a combination of two or more thereof.
  • synthetic analogues of double-stranded RNA e.g., polyinosinic:polycytidylic acid
  • MDA-5 ligands and/or agonists for
  • the COPD-mimic cells can be grown in a microfluidic device.
  • An exemplary microfluidic device can comprise an organ-on-a-chip device.
  • the organ-on-a-chip device can comprise a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
  • Such exemplary organ-on-a-chip device includes any device described in the International Patent App. No. PCT/US2014/07161 1 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety.
  • the inventors have also found that when the virus mimic-stimulated COPD epithelial cells were treated with a Bromodomain Containing Protein 4 (BRD4) inhibitor of NFKB signaling (e.g., 2-methoxy- N-(3 -methyl -2 -oxo- l,2-dihydroquinolin-6-yl)benzenesulfonamide), the BRD4 inhibitor surprisingly suppressed neutrophil adhesion by more than 70%. Accordingly, a method of treating chronic obstructive pulmonary disease (COPD) exacerbation induced by a microbial infection in a subject is also provided herein.
  • COPD chronic obstructive pulmonary disease
  • the method comprises: administering to the subject a pharmaceutical composition comprising a bromodomain containing protein 4 (BRD4) inhibitor of NFK B signaling.
  • BRD4 inhibitor can comprise 2-methoxy-N-(3-methyl-2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
  • the microbial infection can be a viral-induced infection.
  • the inventors have, in part, discovered novel molecular signatures that can be used to detect or identify COPD patients using a non-pulmonary function test (non-PFT) method, where PFT is purely a clinical, not a molecular- or cellular-based, approach, and is currently the gold standard for the COPD diagnosis.
  • non-PFT non-pulmonary function test
  • changes in one or more of these novel molecular signatures can occur well before COPD development and thus can provide early diagnosis of COPD.
  • the novel molecular signatures can be used to distinguish non-infective COPD exacerbations from infective COPD exacerbations.
  • a microfluidic human airway-on-a-chip device (with COPD-derived well-differentiated epithelium cultured therein) is coupled to a smoke generator and a microrespirator in order to simulate breathing tobacco smoke in and out of an airway in vivo.
  • a smoke generator and a microrespirator in order to simulate breathing tobacco smoke in and out of an airway in vivo.
  • primary airway epithelial cells from healthy (normal non-COPD) and COPD patients were cultured in one of the channels to form an "airway lumen" in a lung airway-on-a-chip device and guided to full differentiation to form mucociliary epithelium under air-liquid interface (ALI).
  • ALI mucociliary epithelium under air-liquid interface
  • One end portion of the "airway lumen” channel was connected to a respirator device (e.g., a microrespirator) while the other end portion to an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen" channel (e.g., by freshly burning cigarettes to simulate smoking behavior) and thus to challenge airway epithelia cells cultured therein.
  • a respirator device e.g., a microrespirator
  • an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen” channel (e.g., by freshly burning cigarettes to simulate smoking behavior) and thus to challenge airway epithelia cells cultured therein.
  • Cells after exposure to cigarette smoke were then lysed in situ for their whole transcriptome profiling analysis and COPD- specific genes that are differentially (and statistically significant) up-regulated or down-regulated only in COPD airway epithelium upon exposure to cigarette smoke, not in healthy epithelia, were identified and listed in Table
  • the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, as therapeutic targets or diagnostic biomarkers. Accordingly, some aspects described herein provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) and/or therapy monitoring using at least one or more of these novel molecular signatures.
  • COPD chronic obstructive pulmonary disease
  • COPD chronic obstructive pulmonary disease
  • a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s).
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects.
  • the method can be used to identify a smoker subject who is more susceptible to COPD.
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non- COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
  • the method can comprise measuring expression level of at least one gene or a combination of two or more genes selected from the group consisting of MT1H, TMPRSS11E, MMP1, SPRR3, RPTN, ATP6V0D2, ANKRD22, TMPRSS 1 IF, TSPAN7, NRCAM.
  • a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference(s).
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects.
  • the method can be used to identify a smoker subject who is more susceptible to COPD.
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non-COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
  • the method can comprise measuring expression level of at least one gene or a combination of two or more genes comprising CFTR.
  • the method can further comprise administering to the subject a COPD treatment when the subject is identified to be likely to have, or have a risk, for COPD.
  • a bronchoscopy sample or a fluid sample can be collected or derived from the subject to perform the diagnosis methods described herein.
  • At least one or more of the genes as listed in Tables 3-4 herein can be used to discriminate between infectious (e.g., caused by viruses or bacteria) and non-infectious (e.g., cigarette smoke-induced as an example of non-infectious cause) causes of COPD exacerbations.
  • infectious e.g., caused by viruses or bacteria
  • non-infectious e.g., cigarette smoke-induced as an example of non-infectious cause
  • a gene as listed in Tables 3-4 when a gene as listed in Tables 3-4 does not differentially expressed in COPD cells upon exposure to an infectious agent (e.g., a virus and/or a bacterium), as compared to COPD cells without exposure to an infectious agent (e.g., a virus and/or a bacterium), the gene can be used as a biomarker to differentiate a non-infectious cause of COPD exacerbation from an infectious cause of COPD exacerbation. Accordingly, methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from a treatment for non-infective COPD exacerbation vs. a treatment for infective COPD exacerbation are also described herein.
  • an infectious agent e.g., a virus and/or a bacterium
  • COPD chronic obstructive pulmonary disease
  • the method comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s).
  • the method comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is lower than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or greater than the corresponding reference(s).
  • a bronchoscopy sample or fluid sample e.g., blood or serum
  • the method can further comprise administering to the subject a treatment based on the expression level of the measured gene(s) in the identifying step.
  • the treatment for non-infective COPD exacerbation can comprise an agent that reduces airway inflammation.
  • the method can further comprise, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, determining whether the subject will benefit from an anti -viral therapy or an anti -bacterial therapy.
  • expression level of M-CSF can be measured in a sample from the subject, wherein the subject is administered an anti-viral agent when the expression level of M- CSF is greater than the M-CSF reference; or the subject is not administered an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • expression level of IL-8 can be measured in a sample from the subject, wherein the subject is administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
  • the reference can correspond to expression level of the corresponding gene in healthy subject(s).
  • the reference can correspond to expression level of the corresponding gene in the subject before onset of the COPD exacerbation.
  • a treatment method comprises: administering to a subject diagnosed with COPD that exhibits an increased expression level of at least one gene or a combination of two or more genes as listed in Table 3, an agent that reduces the increased expression level of the gene(s) and optionally reduces airway inflammation.
  • a treatment method comprises: administering to a subject diagnosed with COPD that exhibits a decreased expression level of at least one gene or a combination of two or more genes as listed in Table 4, an agent that increases the decreased expression level of the gene(s) and optionally reduces airway inflammation.
  • the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, to monitor treatment progress. Accordingly, some aspects described herein relate to methods for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject.
  • a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from a subject diagnosed with COPD that exhibits an increased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing the first and second expression levels of the gene(s).
  • the treatment for non-infective COPD exacerbation is effective if the second expression level is lower than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is the same as or higher than the first expression level.
  • a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from a subject diagnosed with COPD that exhibits a decreased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after the administering; and (d) comparing the first and second expression levels of the gene(s).
  • the treatment for non-infective COPD exacerbation is effective if the second expression level is higher than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is the same as or lower than the first expression level.
  • the method can further comprise continuing administration of the treatment.
  • the ineffective treatment can be discontinued.
  • a new treatment can be administered to the subject.
  • the same therapeutic agent can be administered at a higher dose and/or a higher frequency, or a different treatment, e.g., for infective COPD exacerbation (e.g., an anti-viral agent or an antibacterial agent), can be administered to the subject.
  • the molecular signatures as listed in Tables 3-4 herein, individually or in any combinations, can be used in drug screening.
  • methods for identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation are described herein.
  • the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or lower than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is higher than the corresponding reference(s).
  • a non-infective agent e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents
  • the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or greater than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference(s).
  • a non-infective agent e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents
  • the reference can correspond to expression level of the corresponding gene(s) in the COPD-mimic cells prior to contact with the test agent or the non-infective agent. In some embodiments, the reference can correspond to expression level of the corresponding gene(s) in the healthy (non-COPD) cells contacted with the non-infective agent that induces COPD exacerbation.
  • a sample used in drug screening methods described herein can be derived from a COPD-mimic cell that is contacted with the test agent and the non-infective agent, and/or a culture medium sample that is exposed to the COPD-mimic cell.
  • the COPD-mimic cells can be derived from a subject diagnosed with COPD, thereby identifying an agent that is personalized to the subject.
  • the COPD- mimic cells can be derived from established COPD cells.
  • the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent.
  • the COPD-mimic cells can be cultured in any cell culture device known in the art.
  • the COPD-mimic cells can be grown in a microfluidic device such as an organ-on-a-chip device.
  • FIGs. 1A-1C show that the microengineered airway-on-a-chip device reconstitutes a human, pseudostratified, mucociliary, airway epithelium in vitro.
  • FIG. 1A Photograph of the airway-on-a-chip microdevice (airway channel is filled with a dark dye; microvascular channel is filled in a light dye; bar, 1 cm).
  • FIG. IB Schematic diagram of a cross section through the PDMS airway-on-a-chip shown in Fig. 1A, visualizing its two hollow linear channels separated by a thin, porous, polyester membrane which supports growth and differentiation of human primary airway epithelial cells on its upper surface and human primary endothelial cells on its lower surface.
  • FIG. 1C Schematic diagram of the tissue- tissue interface that forms on-chip, with a differentiated airway epithelium cultured on top of the porous collagen-coated membrane at an air-liquid interface in the upper channel, and endothelium below with medium flowing beneath it that feeds both tissue layers.
  • Figs. 2A-2D are experimental data showing modeling asthma in the airway-on-a-chip.
  • Human primary airway epithelial cells were differentiated in the airway chip and cultured in the absence or presence of IL-13 with or without Dexamethasone ( ⁇ ) or Tofacitinib (1 or 10 ⁇ ) for 8 days.
  • Immunofluorescence micrographic views of the epithelium stained for the goblet cell marker were taken to confirm the presence of goblet cells in the epithelium of the airway chip (data not shown).
  • Fig. 2A is the histologram depictions of total area covered by goblet cells under indicated treatment conditions.
  • FIG. 2B are the histolograms showing the production of the cytokines GM-CSF and G-CSF under indicated treatment conditions.
  • Fig. 2C is the histogram showing the cilia beating frequency (CBF) under indicated treatment conditions.
  • CBF cilia beating frequency
  • IL-13 -treatment induced goblet cell hyperplasia, GM-CSF and G-CSF secretion and suppression of cilia beating which were inhibited in a dose-dependent manner by Tofacitinib, but not by Dexamethasone (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001).
  • 2D are histograms showing production of the cytokines, RANTES, IL-6 and IP- 10, by the airway-on-a-chip containing differentiated epithelium in the presence (+) or absence (-) of an underlying endothelium, with (+) or without (-) poly I:C (10 ⁇ g/ml) stimulation (*p ⁇ 0.05, **p ⁇ 0.01).
  • FIGs. 3A-3E are experimental data showing modeling COPD in the airway-on-a-chip.
  • Figs. 3B-3E Stimulation of production of the cytokines, IL-8, M-CSF, RANTES, and IP-10, by healthy vs.
  • LPS lipopolysaccharide to mimic infection with Gram negative bacteria
  • poly I:C a synthetic nucleotide sequence that mimics infection with virus infections
  • COPD and not healthy cells induced M-CSF secretion upon viral-mimic challenge (** : p ⁇ 0.01).
  • Fig. 3E (left) actual amounts of the secreted IL-8 in pg/ml and (right) fold change as % compared to basal (unstimulated secreted amount) of IL-8 for both healthy and COPD.
  • LPS lipopolysaccharide
  • IL-8 secretion from COPD and not healthy epithelial cells While viral infection mimic poly I:C appeared to slightly induce IL-8 secretion from both healthy and COPD, these changes were not statistically significant.
  • FIGs. 4A-4B are experimental data showing pharmacological modulation of inflammation in the airway chip.
  • Figs. 5A-5B are experimental data showing therapeutic modulation of inflammatory activation of the endothelium in the airway chip.
  • FIGs. 6A-6B are experimental data showing additional assessment of the capability of an organ on a chip as shown in Figs. 1A-1C to reconstitute a well differentiated, ciliated airway epithelium on- chip.
  • Fig. 6A Lung epithelial barrier function was assessed by flowing Inulin-FITC for 5h through the upper channel of the airway-on-a-chip device containing well-differentiated hAECs or no cells, and measuring fluorescence in the effluent from the top and bottom channels. Calculation of barrier permeability of the airway-on-a-chip relative to that measured in an empty chip revealed that permeability was restricted by greater than 99.9%.
  • FIGs. 7A-7D are experimental data showing analysis of epithelial -endothelial interactions, neutrophil recruitment, and in the airway-on-a-chip stimulated with the viral mimic poly I:C.
  • FIG. 7A Schematic cross-section of the airway-on-a-chip device showing how poly I:C was added to the upper channel, and how circulating neutrophils were flowed through the lower channel to measure their recruitment and adhesion to the endothelial surface.
  • FIG. 7C Sequential time-lapse microscopic views showing freshly isolated neutrophils being recruited to the surface of living endothelium under physiological flow and shear stress (1 dyne/cm2) in the airway chip when stimulated with poly I:C, as described in the Example.
  • arrowhead indicates a neutrophil that is captured from the flowing medium in the second image that then adheres and spreads on the endothelial surface in subsequent images, directly adjacent to an already bound neutrophil (neutrophils were live stained with CellTracker Red; arrow indicates direction of flow; times are indicated in seconds).
  • Fig. 7D Fully differentiated hAECs co-cultured with or without endothelial cells were stimulated with 10 ⁇ g/ml poly I:C in PBS (+) or PBS alone (-). IL-8/CXCL8 and GRO/CXCL1 levels were measured in basal secretions 24 h later.
  • Fig. 8 is a schematic diagram illustrating an example of a microfluidic device system comprising a human airway-on-a-chip, an agent introduction device (e.g., a cigarette smoke generator), and a respirator (e.g., a microrespirator).
  • the microfluidic device system can be used for biomarker identification and/or target discovery to discover novel diagnostic markers or therapeutics.
  • Fig. 9 is a bar graph showing fold change in mR A expression of indicated genes of COPD or healthy cells subject to smoking relative to the corresponding cells without smoking.
  • FIGs. 10A-10D Testing effects of cigarette smoke on airway epithelium in vitro using a human small airway-on-a-chip.
  • Fig. 10A From left to right: a photograph of a small airway-on-a-chip microdevice (bar, 1 cm); and a schematic diagram showing differentiated human mucociliated airway epithelium cultured in the top channel of the device.
  • Fig. 10B Schematic describing the overall method for analyzing effects of inhaled whole cigarette smoke in the lung small airway-on-a-chip. Cigarettes are loaded into a custom-engineered cigarette smoke engine (top left) that breathes smoke directly in and out of the lumen of the upper airway channel of the microchip (bottom left).
  • Breathing and smoking topography parameters can be controlled as diagrammed schematically (top right) using the incubator shelf-compatible microrespirator component (bottom right).
  • Smoking person image at center was acquired from Science Photo Library/SCIEPRO/Getty Images. Photos of the smoke machine component alone loaded with cigarettes (left, Fig. IOC), and the microrespirator and smoke machine combined setup located inside the incubator (right, Fig. 10D).
  • FIGs 11A-11D On-chip recapitulation of smoke-induced oxidative stress.
  • FIG. 11C A pie chart showing the major biological processes with which genes that altered their expression in response to smoke exposure on-chip were associated, as determined using gene ontology analysis.
  • FIG. 11D A heat map comparing expression of 29 genes associated with cellular oxidation-reduction in bronchiolar epithelial cells obtained by bronchoscopy- guided brushing of small airways from 10 different normal human smokers compared with samples obtained from 3 different human small airway chips that were exposed to whole cigarette smoke on-chip for 75 minutes. Note the general similarity in the patterns of both induced and suppressed genes.
  • FIGs. 12A-12C Physiological recapitulation of cigarette smoke-induced ciliary dysfunction on- chip.
  • Fig. 12A Distributions of ciliary beat frequency (CBF) in a representative normal small airway chip before and after smoking. Note that normal Gaussian distribution changes to a flattened, non- normal distribution after smoke exposure.
  • Fig. 12B A plot of the deviations from the median of ciliary beating frequencies measured in normal bronchiolar epithelium in the absence (-) or presence (+) of exposure to whole cigarette smoke on-chip for 24 hours (data pooled from 2 different human donors with every symbol representing a measurement in one field of view, and approximately 50 fields being analyzed for each condition).
  • FIGs. 13A-13C Testing biological effects of e-cigarette smoke using the small airway-on-a-chip.
  • FIG. 13B CBF Distributions in a representative normal small airway chip exposed to e-cigarette smoke (e-smoking) versus that observed in a nonsmoking chip.
  • FIGs 14A-14B Modeling smoke-induced COPD exacerbations on-chip.
  • IL-8 interleukin 8
  • metallothionein 1H (MT1H), transmembrane protease serine HE (TMPRSS 11E), small proline-rich protein 3 (SPRR3), repetin (RPTN), ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2 (ATP6V0D2), ankyrin repeat domain 22 (ANKRD22), transmembrane protease, serine 11F (TMPRSS11F), tetraspanin 7 (TSPAN7), neuronal cell adhesion molecule (NRCAM).
  • FIGs 15A-15B Morphology of the human ciliated bronchiolar epithelium. Low (Fig. 15A) and high (Fig. 15B) magnification scanning electron micrographs showing the differentiated small airway epithelium formed on-chip, which contains multiple long apical cilia and short microvilli on its apical surface (bar, 10 um).
  • FIGs 16A-16B Flow diagram of the smoking chip method and a schematic of the experimental design.
  • Fig. 16A Air was flowed through the lit cigarette and cigarette holder (or empty holder in nonsmoking controls) to the mouthpiece and into a smoke reservoir within the smoke as a result of being pulled by an in-line pump. Opening of a valve allowed the smoke or air contained within the smoke reservoir to mix with air introduced from the incubator and then to flow through a second valve permitted the smoke/air to flow in and out of the lumen of the airway channel of the small airway-on-a-chip based on control by the linked microrespirator.
  • Fig. 16A Air was flowed through the lit cigarette and cigarette holder (or empty holder in nonsmoking controls) to the mouthpiece and into a smoke reservoir within the smoke as a result of being pulled by an in-line pump. Opening of a valve allowed the smoke or air contained within the smoke reservoir to mix with air introduced from the incubator and then to flow through a second valve
  • hAEC primary human airway epithelial cells isolated from normal or COPD patients were cultured in the upper channel of the organ-on-chip with culture medium flowing in both the upper and lower channels (i.e., in a submerged state) for 4 days, and then shifted to an air-liquid interface in the upper channel for 28 days while continuing to flow medium in the lower channel to induce mucociliary differentiation.
  • the differentiated epithelium was then exposed to either humidified 37°C air or smoke generated by nine 3R4F reference cigarettes over a period of 75 min, and analysis was carried out 24 hours later.
  • Fig. 17 Assessment of smoke deposition uniformity in the microfluidic channel. Phase contrast imaging of a microfluidic channel after exposure to 2 cigarettes demonstrated highly uniform deposition of particulates along its length.
  • FIGs 18A-18B Cigarette smoke-induced oxidative stress on-chip.
  • FIG. 18A Western blot depiction of increased phosphorylation of the antioxidant regulator Nrf2 in normal epithelial cells following smoke exposure on-chip. Note reproducibility of data from different donors over independently performed experiments; Exp. : an independent experiment; pNRF2: phosphorylated NRF2; NRF2: nuclear factor (erythroid-derived 2)-like 2; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.
  • Fig. 18A Western blot depiction of increased phosphorylation of the antioxidant regulator Nrf2 in normal epithelial cells following smoke exposure on-chip. Note reproducibility of data from different donors over independently performed experiments; Exp. : an independent experiment; pNRF2: phosphorylated NRF2; NRF2: nuclear factor (erythroid-derived 2)-like 2; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.
  • Figs 19A-19B Method for analyzing ciliary beating frequency on-chip.
  • Step 1 mapping regions of ciliary beating in top-down brightfield video recordings.
  • a simple way to detect local motion in video recordings - and to distinguish it from global jitter and noise - is to identify pixels whose frame-by-frame brightness changes significantly compared to the average of all pixels.
  • Step 2 segmenting the field of view into regions of interest.
  • the motion map in step 1 is thresholded to delineate regions of ciliary beat (in the white areas).
  • CBF ciliary beat frequency
  • sample points within these regions are selected randomly once every 10 ⁇ 2 (indicated by numbers) (data not shown).
  • Step 3 computing CBFs from brightness signals of sampled pixels.
  • the average CBF is computed from the periodic change of pixel brightness due to ciliary motion, including up to 300 neighboring pixels.
  • Step 4 (Fig. 19A) time -dependent brightness signal of two pixels located within a white rectangle in step 3. The periodic change in brightness corresponds to the ciliary beat pattern at this location.
  • Figs 20A-20B Characterization of COPD-specific responses to cigarette smoke on-chip.
  • Embodiments of various aspects described herein are, in part, based on the discovery that macrophage colony stimulating factor (M-CSF) is a novel biomarker for virus-induced exacerbation in chronic obstructive pulmonary disease (COPD).
  • M-CSF macrophage colony stimulating factor
  • COPD chronic obstructive pulmonary disease
  • the inventors have applied human lung small airway-on-a-chip technology, e.g., as described in the PCT Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety, to reconstruct healthy and COPD diseased epithelia on-chip.
  • the inventors have regenerated 3- dimensional well-differentiated, mucociliary bronchiolar epithelium - cells of the small airway where the damage in COPD airways typically occurs - in vitro in a microfluidic device, e.g., as described in the PCT Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated by reference in its entirety.
  • the inventors then used exogenous stimuli to mimic pathogenic infections in order to simulate bacterium- and virus-triggered exacerbation phenotypes.
  • the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with bacterial infection mimic, e.g., lipopolysaccharide (LPS) endotoxin, to mimic Gram negative bacteria-induced exacerbation.
  • bacterial infection mimic e.g., lipopolysaccharide (LPS) endotoxin
  • LPS lipopolysaccharide
  • the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with virus mimic, e.g., polyinosinic:polycytidylic (poly I:C) acid, to mimic respiratory virus-induced exacerbation.
  • virus mimic e.g., polyinosinic:polycytidylic (poly I:C) acid
  • IL-8 interleukin 8
  • M-CSF macrophage colony-stimulating factor
  • the inventors have discovered that virus and not bacterial mimic challenge can induce M-CSF secretion from COPD epithelial cells, and that COPD and not healthy cells induced M- CSF secretion upon viral -mimic challenge.
  • M-CSF as a novel biomarker for viral exacerbation, which can be distinguished from bacteria-induced COPD exacerbation.
  • a clinician Based on the expression level of M-CSF, alone or in combination with IL-8 level, in a sample from a COPD subject, a clinician can differentially diagnose the cause of exacerbation (acute excessive inflammatory reaction) in COPD patients and therefore select an appropriate treatment to target the culprit of the exacerbation.
  • a clinician can include an anti -viral agent in the treatment but not necessarily any antibacterial agents such as antibiotics.
  • virus-induced M-CSF secretion can provide an indicator of whether a subject has COPD or not.
  • a subject is diagnosed to have a viral infection and determined to exhibit an increased level of M-CSF expression (e.g., by at least about 30% or more as compared to a M-CSF reference such as the level in a healthy subject), the subject can be identified as likely to have COPD.
  • COPD chronic obstructive pulmonary disease
  • various aspects described herein provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) exacerbations and/or therapy monitoring. Methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from an anti -viral agent or an antibacterial agent are also described herein.
  • COPD chronic obstructive pulmonary disease
  • the inventors have, in part, discovered novel molecular signatures that can be used to detect or identify COPD patients using a non-pulmonary function test (non-PFT) method, where PFT is purely a clinical, not a molecular- or cellular-based, approach, and is currently the gold standard for the COPD diagnosis.
  • non-PFT non-pulmonary function test
  • changes in one or more of these novel molecular signatures can occur well before COPD development and thus can provide early diagnosis of COPD.
  • the novel molecular signatures can be used to distinguish non-infective COPD exacerbations from infective COPD exacerbations.
  • a microfluidic human airway-on-a-chip device (with COPD-derived well-differentiated epithelium cultured therein) was coupled to a smoke generator and a microrespirator in order to simulate breathing tobacco smoke in and out of an airway in vivo.
  • a smoke generator and a microrespirator in order to simulate breathing tobacco smoke in and out of an airway in vivo.
  • primary airway epithelial cells from healthy (normal non-COPD) and COPD patients were cultured in one of the channels to form an "airway lumen" in a lung airway-on-a-chip device and guided to full differentiation to form mucociliary epithelium under air-liquid interface (ALI).
  • ALI mucociliary epithelium under air-liquid interface
  • One end portion of the "airway lumen" channel was connected to a respirator device (e.g., a microrespirator) while the other end portion to an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen" channel (e.g., by freshly burning cigarettes to simulate smoking behavior) and thus to challenge airway epithelia cells cultured therein.
  • a respirator device e.g., a microrespirator
  • an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen” channel (e.g., by freshly burning cigarettes to simulate smoking behavior) and thus to challenge airway epithelia cells cultured therein.
  • agent introduction devices such as a cigarette smoke generator and/or respiration devices for analysis of response to shear stress and foreign agents on cells.
  • the cigarette smoke generator simulates smoking behavior by controlling smoking behavior-related parameters such as puff time, inter- puff interval, number of puffs per cigarette, etc.
  • Coupling a lung airway-on-a-chip device to a cigarette smoke generator and a respirator allows users to challenge epithelial cells in the device with cigarette smoke by effectively enabling the device to "breathe” whole fresh cigarette smoke into and out of the device.
  • Cells were then lysed in situ for their whole transcriptome profiling analysis and COPD-specific genes that are differentially (and statistically significant) up-regulated or down-regulated only in COPD airway epithelium upon exposure to cigarette smoke, not in healthy epithelia, were identified and listed in Tables 3-4 herein.
  • the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, as therapeutic targets or diagnostic biomarkers. Accordingly, some aspects described herein provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) and/or therapy monitoring using at least one or more of these novel molecular signatures.
  • COPD chronic obstructive pulmonary disease
  • molecular signatures as disclosed in Tables 3 and 4 can be used as lung cancer biomarkers.
  • MT1H Metallothionein 1H
  • TMPRSS1 IE Transmembrane Protease
  • SPRR3 Small Proline-Rich Protein 3
  • a method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to an anti-viral agent comprises: (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject to be likely to be more responsive to an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject to be more likely to respond to an alternative treatment without the anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • COPD chronic obstructive pulmonary disease
  • M-CSF Macrophage colony-stimulating factor
  • CSF1 colony stimulating factor 1
  • M-CSF is a cytokine (an inflammatory factor) that one of its functions is to accelerate maturation of immune cells to macrophages.
  • M-CSF generally refers to an M- CSF polypeptide or an M-CSF polynucleotide that is similar or identical to the sequence of a wild-type M-CSF.
  • M-CSF refers to a M-CSF polypeptide having an amino acid sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type M-CSF, and is capable of inducing macrophage differentiation.
  • M-CSF refers to a M-CSF polynucleotide having a nucleotide sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type M-CSF or a portion thereof, and encodes a M-CSF polypeptide as described herein.
  • the phrase "more likely to be responsive” generally refers to likelihood of a subject to respond to a treatment.
  • upregulation of macrophage colony-stimulating factor is a biomarker for virus- induced COPD exacerbation.
  • M-CSF macrophage colony-stimulating factor
  • the term "expression” refers to the protein or mRNA amount of a target molecule (e.g., M-CSF, IL-8, and/or any molecule disclosed in Tables 3-4 herein) in a sample.
  • a target molecule e.g., M-CSF, IL-8, and/or any molecule disclosed in Tables 3-4 herein.
  • the term "reference" refers to a pre-determined value for the level of expression or activity of a target molecule to be measured, which can be used in comparison with the expression or activity of the target molecule measured from a subject's sample.
  • a reference used for comparison to measured levels of M-CSF or IL-8 activity or expression in a subject's sample can be determined from a healthy subject, or from a subject who has shown responsiveness to a treatment.
  • a reference can correspond to the level of expression or activity of the target molecule (e.g., M-CSF or IL-8) in a healthy subject.
  • a reference can correspond to the level of expression or activity of the target molecule (e.g., M-CSF or IL- 8) at a prior time point in a subject from which a sample is derived or obtained.
  • a reference can correspond to the level of expression or activity of the target molecule (e.g., M-CSF or IL- 8) before the onset of the COPD exacerbation in a subject.
  • a reference can correspond to a threshold level of expression or activity of the target molecule (e.g., M-CSF or IL-8), above or below which the level of expression or activity of the target molecule (e.g., M-CSF or IL-8) measured in a subject's sample would indicate the likelihood of a subject to respond to a treatment.
  • a reference can be a standard numeric level or threshold.
  • the M-CSF reference can correspond to the level of expression or activity of M-CSF in a healthy subject.
  • the M-CSF reference can correspond to a threshold level of expression or activity of M-CSF, above which the level of M-CSF expression activity measured in a subject's sample would indicate the likelihood of a subject with COPD exacerbation to respond to an anti-viral treatment.
  • the subject is identified to be more likely to be responsive to an anti-viral agent.
  • the subject when the level of M-CSF activity or expression is greater than the M-CSF reference, e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3 -fold, at least about 4-fold, at least about 5 -fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50- fold, at least about 100-fold, or more, the subject can be identified to be more likely to be responsive to an anti -viral agent.
  • the level of M-CSF activity or expression is substantially the same as or less than the M-CSF reference, e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or less, the subject is identified as likely to respond to an alternative COPD treatment without any anti-viral agent.
  • nucleic acid molecules can be isolated from a subject's sample to measure M-CSF mRNA expression, or proteins can be isolated to measure M-CSF protein expression.
  • the method can further comprise administering to the subject a treatment based on the expression level of M-CSF in the identifying step.
  • the therapeutic agents e.g., an anti-viral agent, alone or in combination with an agent that reduces airway inflammation
  • oral administration forms are also contemplated.
  • injection includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion.
  • the anti-viral agent alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators) can be administered by inhalation.
  • an agent that reduces airway inflammation e.g., steroids and/or bronchodilators
  • the anti-viral agent alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators) can be administered orally.
  • an agent that reduces airway inflammation e.g., steroids and/or bronchodilators
  • the anti-viral agent alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators) can be administered by intravenous injection.
  • an agent that reduces airway inflammation e.g., steroids and/or bronchodilators
  • the term "in combination with” or “co-administer” in the context of therapy administration generally refers to administrating a first agent and at least a second agent.
  • the first agent and the second agent can be administered concurrently or simultaneously (e.g., in the same or separate unit dosage forms), or separately at different times.
  • the first agent and the second agent can be administered by the same or different route.
  • an anti-bacterial agent refers to an agent that has bactericidal and/or bacteriostatic activity.
  • the anti-bacterial agent can be naturally occurring or synthetic.
  • an anti-bacterial agent or therapy can comprise an antibiotic, e.g., to suppress the growth of other microorganisms.
  • Non-limiting examples of anti-bacterial agents include ⁇ - lactam antibacterial agents including, e.g., ampicillin, cloxacillin, oxacillin, and piperacillin, cephalosporins and other cephems including, e.g., cefaclor, cefamandole, cefazolin, cefoperazone, cefotaxime, cefoxitin, ceftazidime, ceftriaxone, and cephalothin; carbapenems including, e.g., imipenem and meropenem; and glycopeptides, macrolides, quinolones, tetracyclines, and aminoglycosides .
  • ⁇ - lactam antibacterial agents including, e.g., ampicillin, cloxacillin, oxacillin, and piperacillin, cephalosporins and other cephems including, e.g., cefaclor, cefamando
  • an antibacterial agent in general, if an antibacterial agent is bacteriostatic, it means that the agent essentially stops bacterial cell growth (but does not necessarily kill the bacteria); if the agent is bacteriocidal, it means that the agent kills the bacterial cells (and may stop growth before killing the bacteria).
  • the method can further comprise measuring expression level of IL-8 in the sample.
  • the subject is optionally further administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
  • the treatment administered to the subject can further comprise an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations.
  • an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof.
  • an "anti-viral agent” or “anti-viral therapy” is generally an agent or a therapy that kills or inhibits cellular process, development and/or replication of a target virus.
  • an antiviral agent can be an agent that interferes with one or more viral components and/or interferes with replication or propagation of a virus.
  • anti-viral agents include, but are not limited to, virus protein specific antibodies, reverse transcriptase inhibitors, protease inhibitors, immunomodulatory agents (e.g., cytokines, various nucleoside analogs, and/or Zn2+), plant extracts demonstrated to have an antiviral effect, and any combinations thereof.
  • the anti-viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability.
  • anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof.
  • the anti-viral agent can comprise 2-methoxy-N- (3-methyl-2 oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof.
  • the M-CSF or IL-8 reference can correspond to a level in a healthy subject.
  • the M-CSF or IL-8 reference can correspond to a level in the subject before onset of the COPD exacerbation.
  • the sample can be fluid sample.
  • the fluid sample can comprise a blood or serum sample.
  • COPD chronic obstructive pulmonary disease
  • the method comprises: administering to a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, an effective amount of an anti-viral agent that reduces the M-CSF expression level.
  • the subject can exhibit an increased expression of M-CSF, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation).
  • a M-CSF reference e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation.
  • the subject can exhibit an increased expression of M-CSF, e.g., by at least about 1.1-fold or more, including, e.g., at least about 1.5- fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation).
  • a M-CSF reference e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation.
  • the term "effective amount” as used herein refers to the amount of a therapeutic agent (e.g., an anti-viral agent) needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect, e.g., reducing COPD exacerbation or reducing M-CSF level, for example.
  • a therapeutic agent e.g., an anti-viral agent
  • therapeutically effective amount therefore refers to an amount of a therapeutic agent (e.g., an anti-viral agent) using the methods as disclosed herein, that is sufficient to effect a particular effect when administered to a subject.
  • an effective amount as used herein would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom of disease (for example but not limited to slow the progression of a symptom of the disease), or reverse a symptom of disease. Thus, it is not possible to specify the exact "effective amount”. However, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.
  • Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
  • the dosage can vary depending upon the dosage form employed and the route of administration utilized.
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50/ED50.
  • Compositions and methods that exhibit large therapeutic indices are preferred.
  • a therapeutically effective dose can be estimated initially from cell culture assays. In some embodiments, a therapeutically effective dose can be estimated using the methods described in the Examples.
  • COPD cells stimulated with a viral agent can be treated with different doses of an anti-viral agent, and the expression level of M-CSF can be measured to determine the appropriate concentration that is sufficient to reduce the M-CSF level or to restore to the M-CSF level before the onset of the stimulation, or to restore to the M-CSF level present in the unstimulated COPD cells, or normal cells.
  • a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of an anti -viral agent), which achieves a half-maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model.
  • Levels in plasma can be measured, for example, by high performance liquid chromatography.
  • the effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
  • the subject can be further administered an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations.
  • an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof.
  • the anti -viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability.
  • anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof.
  • the anti-viral agent can comprise 2-methoxy-N-(3 -methyl -2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
  • a method of treating a patient diagnosed with COPD that exhibits an increased expression level of M-CSF and/or monitoring treatment therapy comprises: (a) determining a first expression level of M-CSF in a sample from a subject diagnosed with COPD that exhibits an increased expression level of M-CSF; (b) administering an anti-viral agent; (c) determining a second expression level of M-CSF after the administering; and (d) comparing the first and second expression levels of M-CSF.
  • the anti-viral agent is effective if the second expression level is lower that the first expression level, and wherein the anti-viral therapy is ineffective if the second expression level is the same as or higher than said first expression level.
  • M-CSF expression and/or activity is "decreased” or “lower” as compared to a first level in the absence of an anti-viral agent if the amount or expression, or one or more signaling activities or downstream read-outs of M-CSF expression or activity is reduced by a statistically significant amount, such as by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100%, in the presence of an agent (e.g., an anti-viral agent) relative to the absence of such agent.
  • an agent e.g., an anti-viral agent
  • M-CSF expression and/or activity if M-CSF expression and/or activity is decreased or reduced, some downstream read-outs will decrease but others can increase (i.e. things that are normally suppressed by M-CSF expression and/or activity), and the converse would be in those embodiments where M-CSF expression and/or activity is increased.
  • M-CSF expression and/or activity is "increased” or “higher” as compared to a first level in the absence of an anti-viral agent if the amount or expression, or one or more signaling activities or downstream read-outs of M-CSF expression and/or activity is increased by a statistically significant amount, for example by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100% or more, at least 2-fold, at least 3 -fold, at least 4-fold, at least 5 -fold, at least 6- fold, at least 7-fold, at least 8-fold, at least 9-fold,at least 10-fold, at least 50-fold, at least 100-fold, or more, in the presence of an agent (e.g., an anti-viral agent), relative to the absence of such agent.
  • an agent e.g., an anti-vir
  • the method can further comprise, when the anti -viral agent is effective, continuing to administer the agent.
  • the method can further comprise, when the anti-viral agent is ineffective, discontinuing the agent.
  • the method can further comprise, when the anti-viral agent is ineffective, administering the agent at a higher dose.
  • the method can further comprise, when the anti-viral agent is ineffective, administering a different anti-viral agent.
  • a method of identifying an agent for reducing at least one symptom of a viral- induced COPD exacerbation comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a virus-mimic agent; (c) measuring expression level of M-CSF in a sample; and (d) identifying the test agent as an effective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is same as or lower than a M- CSF reference; or identifying the test agent as an ineffective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is higher than the M-CSF reference.
  • the method can further comprise measuring expression level of IL-8 in the sample.
  • the identified effective agent can display the expression level of IL-8 same as or lower than an IL-8 reference.
  • the identified ineffective agent can display the expression level of IL-8 greater than the IL-8 reference.
  • the sample can comprise a culture medium sample.
  • the COPD-mimic cells can be derived from a subject diagnosed with
  • the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent.
  • COPD-phenotype inducing agents include, but are not limited to cigarette smoke and its derivatives (e.g., but not limited to cigarette smoke extract, cigarette smoke condensate, whole mainstream fresh cigarette smoke, passive second hand cigarette smoke), removal of certain nutrients and/or cell culture medium supplements such as retinoic acid, etc.
  • the virus-mimic agent can comprise any agent that induces or activates innate immune receptor(s) involved in an anti-viral response.
  • virus-mimic agents include, but are not limited to synthetic analogues of double-stranded RNA (e.g., polyinosinic:polycytidylic acid), ligands and/or agonists for melanoma differentiation-associated protein 5 (MDA-5), ligands and/or agonists for retinoic acid inducible gene (RIG-1), ligands and/or agonists for NOD-like receptors (NLR), ligands and/or agonists for members of TOLL-like receptors (TLR) such as TLR-7, TLR-8, and TLR-9, viral mimics such as inactivated viral particles (e.g., UV-inactivated human rhinovirus or fixed virus), whole live virus, and a combination of two or more thereof.
  • MDA-5 melanoma differentiation-associated protein 5
  • the COPD-mimic cells can be grown in a microfluidic device.
  • An exemplary microfluidic device can comprise an organ-on-a-chip device.
  • the organ-on-a-chip device can comprise a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
  • Such exemplary organ-on-a-chip device includes any device described in the International Patent App. No. PCT/US2014/07161 1 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety.
  • the inventors have also found that when the virus mimic-stimulated COPD epithelial cells were treated with a Bromodomain Containing Protein 4 (BRD4) inhibitor of NFKB signaling (e.g., 2-methoxy- N-(3 -methyl -2 -oxo- l,2-dihydroquinolin-6-yl)benzenesulfonamide), the BRD4 inhibitor surprisingly suppressed neutrophil adhesion by more than 70%. Accordingly, a method of treating chronic obstructive pulmonary disease (COPD) exacerbation induced by a microbial infection in a subject is also provided herein.
  • COPD chronic obstructive pulmonary disease
  • the method comprises: administering to the subject a pharmaceutical composition comprising a bromodomain containing protein 4 (BRD4) inhibitor of NFK B signaling.
  • BRD4 inhibitor can comprise 2-methoxy-N-(3-methyl-2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
  • the microbial infection can be a viral-induced infection.
  • the terms “treat,” “treatment,” “treating,” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder.
  • the term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder, such as COPD exacerbation.
  • Treatment is generally “effective” if one or more symptoms or clinical markers are reduced.
  • treatment is “effective” if the progression of a disease is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but also a cessation of at least slowing of progress or worsening of symptoms that would be expected in absence of treatment.
  • Beneficial or desired clinical results include, but are not limited to alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • treatment also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
  • a method of treating COPD exacerbation in a subject comprising (a) identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation, and (b) administering an appropriate treatment to the subject depending on the result of step (a).
  • the causes are viral, bacterial and/or non-infectious agent dependent.
  • an anti-viral agent is administered; when the cause is bacterial, then an anti-bacterial agent is administered; and when the cause is non- infectious agent dependent, then an anti-inflammation agent is administered.
  • an anti -inflammation agent is administered in conjunction with an anti -bacterial agent and/or anti-viral agent to help with the exacerbation.
  • a method of treating COPD exacerbation in a subject comprising (a) identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-viral agent; and (b) administering an anti-viral agent when it is identified that the subject is likely to be responsive to an anti-viral agent in step (a).
  • a method of treating COPD exacerbation in a subject comprising (a) identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-bacterial agent; and (b) administering an anti-bacterial agent when it is identified that the subject is likely to be responsive to an anti-viral agent in step (a).
  • a method of treating COPD exacerbation in a subject comprising (a) identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to a treatment for non-infective COPD exacerbation (e.g. an anti -inflammation agent); and (b) administering an alternative treatment for infective COPD exacerbation when it is identified that the subject is likely to be responsive to a treatment for non-infective COPD exacerbation in step (a).
  • a treatment for non-infective COPD exacerbation e.g. an anti -inflammation agent
  • identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the cause is likely a viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the cause is non- viral when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, and (c) identifying the cause is likely a bacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the cause is likely to respond to non-bacterial when the expression level of IL-8 is same as or lower than the IL-8 is reference.
  • identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the cause is likely a non-infective agent or non-infectious agent related when the expression level of the gene(s) is greater than the corresponding reference; or identifying the cause is likely an infectious agent when the expression level of the gene(s) is same as or lower than the corresponding reference.
  • identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the cause is likely a non-infectious agent or non-infectious agent related when the expression level of the gene(s) is lower than the corresponding reference; or identifying the cause is likely an infectious when the expression level of the gene(s) is same as or greater than the corresponding reference.
  • identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-viral agent comprises (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti -viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-bacterial agent comprises comprises (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, and (c) identifying the subject is likely to be more responsive to an anti-bacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 is reference.
  • identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to a treatment for non-infective COPD exacerbation comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference.
  • identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to a treatment for non-infective COPD exacerbation comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference.
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, (c) identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; (d) and administering an appropriate anti-viral agent or an appropriate alternative treatment without an antiviral agent based on the results of step (c).
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, (c) administering an appropriate antiviral agent/treatment when the expression level of M-CSF is greater than the M-CSF reference; or the subject is not administered an anti -viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, (c) identifying the subject is likely to be more responsive to an anti-bacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 is reference; (d) and administering an appropriate anti-bacterial agent or an appropriate alternative treatment without an antibacterial agent based on the results of step (c).
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, (c) administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference; (d) and administering an appropriate anti-bacterial or anti-viral agent treatment, or an appropriate treatment without an anti-bacterial or anti-viral agent based on the results of step (c).
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference; (d) and administering an appropriate anti-bacterial or anti-viral agent treatment, or an appropriate treatment without an anti -bacterial or anti -viral agent based on the results of step (c).
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; comparing the expression level of M-CSF in the sample with a M-CSF reference, identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; (b) measuring expression level of IL-8 is in a sample from the subject; comparing the expression level of IL- 8 is in the sample with a IL-8 reference, identifying the subject is likely to be more responsive to an antibacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an anti -bacterial agent when the expression level of IL-8 is
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject, and comparing the expression level of M-CSF in the sample with a M-CSF reference; (b) measuring expression level of IL-8 is in a sample from the subject, and comparing the expression level of IL-8 is in the sample with a IL-8 reference; and (c) administering an appropriate anti-viral agent/treatment when the expression level of M- CSF is greater than the M-CSF reference; or the subject is not administered an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; or administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL- 8 reference.
  • a method of treating COPD exacerbation in a subject comprising (a) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference; (iii) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference; (b) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (iii)
  • a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; comparing the expression level of M-CSF in the sample with a M-CSF reference, identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; (b) measuring expression level of IL-8 is in a sample from the subject; comparing the expression level of IL- 8 is in the sample with a IL-8 reference, identifying the subject is likely to be more responsive to an antibacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an anti -bacterial agent when the expression level of IL-8 is
  • a method of treating COPD exacerbation in a subject comprising (a) identifying a subject who is likely to have COPD; and (b) administering an appropriate treatment to the subject depending on the result of step (a).
  • the causes are viral, bacterial and/or non-infectious agent dependent.
  • an anti-viral agent is administered when the cause is viral, then an anti-viral agent is administered; when the cause is bacterial, then an anti-bacterial agent is administered; and when the cause is non- infectious agent dependent, then an anti-inflammation agent is administered.
  • an anti-inflammation agent is administered in conjunction with an anti-bacterial agent and/or anti-viral agent to help with the exacerbation.
  • identifying a subject who is likely to have COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or lower than the corresponding reference.
  • the subject has not been diagnosed with COPD.
  • the subject has not previously been treated for COPD.
  • the subject presents symptoms of COPD but has not been diagnosed with COPD.
  • the subject presents symptoms of COPD but has not previously been treated for COPD.
  • the subject presents symptoms of COPD.
  • the subject at present has no symptoms of COPD but is at risk of having COPD.
  • at risk individual for having COPD or developing COPD include but are not limited to smokers, people who work in places where the air quality is unhealthy or contaminated, e.g. shipyards, chemical plant, chemical or oil refinery, nail salons, wood working and carpentry, floor sanding, upholstery, fabric dye etc.
  • identifying a subject who is likely to have COPD comprises (a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference.
  • the subject has not previously been treated for COPD.
  • the subject presents symptoms of COPD but has not been diagnosed with COPD.
  • the subject presents symptoms of COPD but has not previously been treated for COPD.
  • the subject presents symptoms of COPD.
  • the subject at present has no symptoms of COPD but is at risk of having COPD.
  • at risk individual for having COPD or developing COPD include but are not limited to smokers, people who work in places where the air quality is unhealthy or contaminated, e.g. shipyards, chemical plant, chemical or oil refinery, nail salons, wood working and carpentry, floor sanding, upholstery, fabric dye etc.
  • a method of treating COPD in a subject comprising (a) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference; (iii) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or lower than the corresponding reference; (b) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (iii) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene
  • the subject has not previously been treated for COPD.
  • the subject presents symptoms of COPD but has not been diagnosed with COPD.
  • the subject presents symptoms of COPD but has not previously been treated for COPD.
  • the subject presents symptoms of COPD.
  • the subject at present has no symptoms of COPD but is at risk of having COPD.
  • at risk individual for having COPD or developing COPD include but are not limited to smokers, people who work in places where the air quality is unhealthy or contaminated, e.g. shipyards, chemical plant, chemical or oil refinery, nail salons, wood working and carpentry, floor sanding, upholstery, fabric dye etc.
  • COPD chronic obstructive pulmonary disease
  • a polypeptide encoded by a gene as disclosed in Tables 3-4 herein can have an amino acid sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type polypeptide, and is capable of performing a biological function as in the wild-type polypeptide.
  • a polynucleotide encoding a gene as disclosed in Tables 3-4 herein can have a nucleotide sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type gene or a portion thereof, and encodes the corresponding polypeptide.
  • a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s).
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects.
  • the method can be used to identify a smoker subject who is more susceptible to COPD.
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non-COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
  • the method can comprise measuring expression level of at least one gene or a combination of two or more genes selected from the group consisting of MT1H, TMPRSS 1 1E, MMP1, SPRR3, RPTN, ATP6V0D2, ANKRD22, TMPRSS 1 IF, TSPAN7, NRCAM.
  • the term "a combination of two or more genes” refers to a combination of at least 2 or more molecular signatures designed by gene symbols as disclosed in Table 3 and/or Table 4.
  • the activity and/or expression level of at least 2 or more can be measured from a sample of a subject to be diagnosed or treated.
  • the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be likely to have, or have a risk for COPD.
  • the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more, the subject can be identified to be likely to have, or have a risk for, COPD.
  • the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is substantially the same as or lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified as unlikely to have COPD.
  • a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference(s).
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects.
  • the method can be used to identify a smoker subject who is more susceptible to COPD.
  • the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non-COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
  • the method can comprise measuring expression level of at least one gene or a combination of two or more genes comprising CFTR.
  • the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified as likely to have, or have a risk for, COPD.
  • the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is substantially the same as or greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be unlikely to have COPD.
  • the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3 -fold, at least about 4-fold, at least about 5 -fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more, the subject can be identified to be unlikely to have COPD.
  • nucleic acid molecules can be isolated from a subject's sample to measure mRNA expression, or proteins can be isolated to measure protein expression.
  • the method can further comprise administering to the subject a COPD treatment when the subject is identified to be likely to have, or have a risk, for COPD.
  • the treatment can be administered to the subject by any mode of administration that delivers the agent systemically or to a desired surface, organ, or target, and can include, but is not limited to injection, infusion, instillation, and inhalation administration. To the extent that such agents can be protected from inactivation in the gut, oral administration forms are also contemplated.
  • a bronchoscopy sample or a fluid sample can be collected or derived from the subject to perform the diagnosis methods described herein.
  • At least one or more of the genes as listed in Tables 3-4 herein can be used to discriminate between infectious (e.g., caused by viruses or bacteria) and non-infectious (e.g., cigarette smoke-induced as an example of non-infectious cause) causes of COPD exacerbations.
  • infectious e.g., caused by viruses or bacteria
  • non-infectious e.g., cigarette smoke-induced as an example of non-infectious cause
  • a gene as listed in Tables 3-4 when a gene as listed in Tables 3-4 does not differentially expressed in COPD cells upon exposure to an infectious agent (e.g., a virus and/or a bacterium), as compared to COPD cells without exposure to an infectious agent (e.g., a virus and/or a bacterium), the gene can be used as a biomarker to differentiate a non-infectious cause of COPD exacerbation from an infectious cause of COPD exacerbation. Accordingly, methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from a treatment for non-infective COPD exacerbation vs. a treatment for infective COPD exacerbation are also described herein.
  • an infectious agent e.g., a virus and/or a bacterium
  • COPD chronic obstructive pulmonary disease
  • the method comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s).
  • the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be more likely to be responsive to a treatment for non-infective COPD exacerbation.
  • the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3 -fold, at least about 4-fold, at least about 5 -fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more
  • the subject can be identified to be more likely to be responsive to a treatment for non-infective COPD exacerbation.
  • the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is substantially the same as or lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified to be more likely to respond to an alternative treatment for infective COPD.
  • the method comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is lower than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or greater than the corresponding reference(s).
  • a bronchoscopy sample or fluid sample e.g., blood or serum
  • the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified to be likely to be more responsive to a treatment for non-infective COPD exacerbation.
  • the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is substantially the same as or greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation.
  • the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6- fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more, the subject can be identified is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation.
  • the method can further comprise administering to the subject a treatment based on the expression level of the measured gene(s) in the identifying step.
  • the treatment for non-infective COPD exacerbation can comprise an agent that reduces airway inflammation.
  • the method can further comprise, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, determining whether the subject will benefit from an anti -viral therapy or an anti -bacterial therapy as described earlier. If it is determined that bacteria is not a cause of exacerbation in a COPD subject, the COPD subject can avoid taking any unnecessary antibiotics. Stated another way, if it is determined that it is a viral exacerbation, the COPD subject can be administered an anti -viral drug, and not an antibiotic, steroids, corticosteroids, other anti-inflammatory drugs, or any art-recogized treatment for non-infective exacerbation.
  • expression level of M-CSF can be measured in a sample from the subject, wherein the subject is administered an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or the subject is not administered an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • expression level of IL-8 can be measured in a sample from the subject, wherein the subject is administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
  • the reference can correspond to expression level of the corresponding gene in healthy subject(s).
  • the reference can correspond to expression level of the corresponding gene in the subject before onset of the COPD exacerbation.
  • a treatment method comprises: administering to a subject diagnosed with COPD that exhibits an increased expression level of at least one gene or a combination of two or more genes as listed in Table 3, an agent that reduces the increased expression level of the gene(s) and optionally reduces airway inflammation.
  • the subject can exhibit an increased expression of at least one gene or a combination of two or more genes as listed in Table 3, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a corresponding reference (e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation).
  • a corresponding reference e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation.
  • the subject can exhibit an increased expression of at least one gene or a combination of two or more genes as listed in Table 3, e.g., by at least about 1.1-fold or more, including, e.g., at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold or more, as compared to a corresponding reference (e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation).
  • a corresponding reference e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation.
  • a treatment method comprises: administering to a subject diagnosed with COPD that exhibits a decreased expression level of at least one gene or a combination of two or more genes as listed in Table 4, an agent that increases the decreased expression level of the gene(s) and optionally reduces airway inflammation.
  • the subject can exhibit a decreased expression of at least one gene or a combination of two or more genes as listed in Table 4, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a corresponding reference (e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation).
  • a corresponding reference e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation.
  • the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, to monitor treatment progress. Accordingly, some aspects described herein relate to methods for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject.
  • a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from a subject diagnosed with COPD that exhibits an increased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing the first and second expression levels of the gene(s).
  • the treatment for non-infective COPD exacerbation is effective if the second expression level is lower than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is substantially the same as or higher than the first expression level.
  • a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from a subject diagnosed with COPD that exhibits a decreased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after the administering; and (d) comparing the first and second expression levels of the gene(s).
  • the treatment for non-infective COPD exacerbation is effective if the second expression level is higher than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is substantially the same as or lower than the first expression level.
  • Expression and/or activity of a molecular signature as disclosed in Table 3 or 3 is "decreased” or “lower” as compared to a first level in the absence of a therapeutic agent or a treatment if the amount or expression, or one or more signaling activities or downstream read-outs of the molecular signature expression or activity is reduced by a statistically significant amount, such as by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100%, in the presence of a therapeutic agent or a treatment relative to the absence of such agent or treatment.
  • expression and/or activity of a molecular signature as disclosed in Table 3 or 3 is "increased” or “higher” as compared to a first level in the absence of a therapeutic agent or a treatment if the amount or expression, or one or more signaling activities or downstream read-outs of the molecular signature expression and/or activity is increased by a statistically significant amount, for example by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100% or more, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold,at least 10-fold, at least 50-fold, at least 100-fold, or more, in the presence of a therapeutic agent or a treatment, relative to the absence of such agent or treatment.
  • the method can further comprise continuing administration of the treatment.
  • the ineffective treatment can be discontinued.
  • a new treatment can be administered to the subject.
  • the same therapeutic agent can be administered at a higher dose and/or a higher frequency, or a different treatment, e.g., for infective COPD exacerbation (e.g., an anti-viral agent or an antibacterial agent), can be administered to the subject.
  • the molecular signatures as listed in Tables 3-4 herein, individually or in any combinations, can be used in drug screening. Thus, methods for identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation are described herein.
  • the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or lower than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is higher than the corresponding reference(s).
  • a non-infective agent e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents
  • the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or greater than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference(s).
  • a non-infective agent e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents
  • the reference can correspond to expression level of the corresponding gene(s) in the COPD-mimic cells prior to contact with the test agent or the non-infective agent. In some embodiments, the reference can correspond to expression level of the corresponding gene(s) in the healthy (non-COPD) cells contacted with the non-infective agent that induces COPD exacerbation.
  • a sample used in drug screening methods described herein can be derived from a COPD-mimic cell that is contacted with the test agent and the non-infective agent, and/or a culture medium sample that is exposed to the COPD-mimic cell.
  • the COPD-mimic cells can be derived from a subject diagnosed with COPD, thereby identifying an agent that is personalized to the subject.
  • the COPD- mimic cells can be derived from established COPD cells.
  • the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent.
  • the COPD-mimic cells can be cultured in any cell culture device known in the art.
  • the COPD-mimic cells can be grown in a microfluidic device such as an organ-on-a-chip device.
  • the organ-on-a-chip device can comprise a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
  • Such exemplary organ-on-a-chip device includes any device described in the International Patent App. No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety.
  • a sample including any fluid or specimen (processed or unprocessed) or other biological sample, can be subjected to the methods of various aspects described herein.
  • the sample can include a biological fluid obtained from a subject.
  • biological fluids obtained from a subject can include, but are not limited to, blood (including whole blood, plasma, cord blood and serum), lactation products (e.g., milk), amniotic fluids (e.g., a sample collected during amniocentesis), sputum, saliva, urine, semen, cerebrospinal fluid, bronchial aspirate, perspiration, mucus, liquefied feces, synovial fluid, lymphatic fluid, tears, tracheal aspirate, and fractions thereof.
  • a biological fluid can include a homogenate of a tissue specimen (e.g., biopsy) from a subject.
  • a test sample can comprises a suspension obtained from homogenization of a solid sample obtained from a solid organ or a fragment thereof.
  • the sample can comprise a blood or serum sample.
  • a sample can be obtained from a subject who has or is suspected of having a COPD exacerbation.
  • a sample can be obtained from a subject who is being treated for the COPD exacerbation. In other embodiments, the sample can be obtained from a subject whose COPD exacerbation was treated. In other embodiments, the sample can be obtained from a subject who has a recurrence of COPD exacerbation.
  • a "subject” can mean a human or an animal.
  • subjects include primates (e.g., humans, and monkeys).
  • the animal is a vertebrate such as a primate, rodent, domestic animal or game animal.
  • Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus.
  • Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters.
  • Domestic and game animals include cattle, cows, horses, pigs, deer, bison, sheep, goats, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, and avian species, e.g., chicken, ducks, geese, turkeys, emu, ostrich.
  • a subject or a subject includes any subset of the foregoing, e.g., all of the above, or includes one or more groups or species such as humans, primates or rodents.
  • the subject is a mammal, e.g., a primate, e.g., a human. .
  • a subject can be male or female.
  • subject does not denote a particular age. Thus, any mammalian subjects from adult (e.g., young adult, middle-aged adult or senior adult) to pediatric subjects (e.g., infant, child, and adolescent) to newborn subjects, as well as fetuses, are intended to be covered. When the term is used in conjunction with administration of a compound or drug, then the subject has been the object of treatment, observation, and/or administration of the compound or drug.
  • the methods and/or pharmaceutical compositions described herein are also contemplated to be used to treat domesticated animals or pets such as cats and dogs.
  • the subject or subject is a mammal.
  • the mammal can be a human, non- human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples.
  • the subject is a human being.
  • the subject can be a domesticated animal and/or pet.
  • the term "selected therapy” or “selected treatment” refers to a therapy or treatment selected based on the level and/or activity of a target molecule (e.g., M-CSF and/or IL-8) as measured in a sample of a subject to be treated according to the methods of various aspects described herein.
  • a target molecule e.g., M-CSF and/or IL-8
  • upregulation of macrophage colony-stimulating factor (M-CSF) is a biomarker for virus-induced COPD exacerbation.
  • a target molecule e.g., M-CSF or IL-8
  • the increase can be at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 100% or more.
  • the increase can be at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3-fold, at least about 4- fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9- fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more.
  • administering refers to the placement of an agent (e.g., an anti-viral agent) into a subject by a method or route which results in at least partial localization of such agents at a desired site, such as a site of inflammation, such that a desired effect(s) is produced.
  • agent e.g., an anti-viral agent
  • parenteral administration refers to modes of administration other than enteral and topical administration, usually by injection.
  • systemic administration refers to the administration of an agent (e.g., an anti-viral agent, alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators)) other than directly into a target site, tissue, or organ, such as a tumor site, such that it enters the subject's circulatory system and, thus, is subject to metabolism and other like processes.
  • an agent e.g., an anti-viral agent, alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators)
  • a method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to an anti-viral agent comprising: (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject to be likely to be more responsive to an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject to be more likely to respond to an alternative treatment without the anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
  • COPD chronic obstructive pulmonary disease
  • the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
  • the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
  • a method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, an anti-viral agent that reduces the M-CSF expression level, thereby treating COPD exacerbation in the subject.
  • COPD chronic obstructive pulmonary disease
  • the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
  • the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
  • a method of treating a subject diagnosed with COPD that exhibits an increased expression level of M-CSF comprising: (a) determining a first expression level of M-CSF in a sample from a subject diagnosed with COPD that exhibits an increased expression level of M- CSF; (b) administering an anti-viral agent; (c) determining a second expression level of M-CSF after said administering; and (d) comparing said first and second expression levels of M-CSF, wherein the anti-viral agent is effective if said second expression level is lower that said first expression level, and wherein the anti-viral therapy is ineffective if said second expression level is the same as or higher than said first expression level.
  • a method of identifying an agent for reducing at least one symptom of a viral-induced COPD exacerbation comprising: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a virus-mimic agent; measuring expression level of M-CSF in a sample; (c) and identifying the test agent as an effective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is same as or lower than a M-CSF reference; or identifying the test agent as an ineffective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is higher than the M-CSF reference.
  • the COPD-mimic cells are derived from healthy cells contacted with a COPD-phenotype inducing agent.
  • the virus-mimic agent comprises polyinosinic:polycytidylic acid, ligands and/or agonists for melanoma differentiation-associated protein 5 (MDA-5), ligands and/or agonists for retinoic acid inducible gene (RIG-1), ligands and/or agonists for NOD-like receptors (NLR), ligands and/or agonists for members of TOLL- like receptors (TLR) such as TLR-7, TLR-8, and TLR-9, viral mimics such as inactivated viral particles (e.g., UV -inactivated human rhinovirus or fixed virus), whole live virus, and a combination of two or more thereof.
  • MDA-5 melanoma differentiation-associated protein 5
  • RAG-1 retinoic acid inducible gene
  • NLR NOD-like receptors
  • TLR TO
  • microfluidic device is an organ-on-a-chip device.
  • the organ-on-a-chip device comprises a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
  • a method of treating chronic obstructive pulmonary disease (COPD) exacerbation induced by a microbial infection in a subject comprising administering to the subject a pharmaceutical composition comprising a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling.
  • COPD chronic obstructive pulmonary disease
  • COPD chronic obstructive pulmonary disease
  • COPD chronic obstructive pulmonary disease
  • a method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non-infective COPD exacerbation comprising: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference.
  • COPD chronic obstructive pulmonary disease
  • a method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non-infective COPD exacerbation comprising: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference.
  • COPD chronic obstructive pulmonary disease
  • the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
  • the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
  • a method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits an increased expression level of at least one gene or a combination of two or more genes as listed in Table 3, a treatment for non-infective COPD exacerbation that reduces the increased expression level of the gene(s), thereby treating COPD exacerbation in the subject.
  • COPD chronic obstructive pulmonary disease
  • a method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits a decreased expression level of at least one gene or a combination of two or more genes as listed in Table 4, a treatment for non-infective COPD exacerbation that increases the decreased expression level of the gene(s), thereby treating COPD exacerbation in the subject.
  • COPD chronic obstructive pulmonary disease
  • a method of treating a subject diagnosed with COPD exacerbation comprising: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from a subject diagnosed with COPD that exhibits an increased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing said first and second expression levels of the gene(s), wherein the treatment for non-infective COPD exacerbation is effective if said second expression level is lower that said first expression level, and wherein the treatment for non-infective COPD exacerbation is ineffective if said second expression level is the same as or higher than said first expression level.
  • a method of treating a subject diagnosed with COPD exacerbation comprising: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from a subject diagnosed with COPD that exhibits a decreased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing said first and second expression levels of the gene(s), wherein the treatment for non-infective COPD exacerbation is effective if said second expression level is higher than said first expression level, and wherein the treatment for non-infective COPD exacerbation is ineffective if said second expression level is the same as or lower than said first expression level.
  • a method of identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation comprising: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or lower than a corresponding reference; or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is higher than the corresponding reference.
  • a non-infective agent e.g., cigarette smoke
  • a method of identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation comprising (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or greater than a corresponding reference; or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference.
  • a non-infective agent e.g., cigarette smoke,
  • microfluidic device is an organ-on-a-chip device.
  • the organ-on-a-chip device comprises a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
  • Example 1 Modeling human small airway structure and function in a microfluidic device
  • COPD chronic respiratory diseases
  • COPD chronic respiratory diseases
  • COPD chronic respiratory diseases
  • COPD is primarily a disease of small airways (diameter ⁇ 2mm) 2 and asthma can affect any part of the airways.
  • Subjects with one or both of these diseases frequently present with exacerbations, e.g., triggered by pathogens, which greatly contribute to disease-associated hospitalization and mortality 3" 5 .
  • Asthma exacerbations due to respiratory infections account for the majority of asthma-related deaths and represent half of the total healthcare cost associated with the disease 6 ' 7 .
  • Airway inflammatory diseases have been modeled in vitro using cultured primary or immortalized human bronchiolar epithelial cells 16 ' 17 .
  • a microengineered model of human airway smooth muscle has also been developed that exhibits hypercontractility in response to inflammatory cytokines that contribute to development of asthma 18 .
  • advances in microsystems engineering have made it possible to create microfluidic cell culture devices, known as "organs-on-chips," that contain continuously perfused microchannels lined by living human cells that were attempted to recapitulate the multicellular architectures, tissue-tissue interfaces, physicochemical microenvironments and vascular perfusion of the body 19 .
  • WO 2015/138034 the content of which is incorporated herein by reference in its entirety, can also be used to develop an "airway-on- chip.”
  • Primary human airway epithelial cells hAECs isolated from healthy donors or COPD subjects were cultured on top of the membrane until confluent with medium flowing in both channels.
  • hAECs Primary human airway epithelial cells isolated from healthy donors or COPD subjects were cultured on top of the membrane until confluent with medium flowing in both channels.
  • ALI air-liquid interface
  • retinoic acid ⁇ g/mL retinoic acid ⁇ g/mL
  • the well-differentiated human airway epithelial cells derived from healthy and COPD donors showed presence of high numbers of ciliated cells labeled for ⁇ -tubulin IV and goblet cells stained with anti-MUC5AC antibody (data not shown).
  • Sequential frames of a movie of the apical surface of a differentiated epithelium recorded over 100 milliseconds showing cilia beating at a frequency of -10 Hz. A single cilium is highlighted in white; time stamps and arrows indicate the duration and direction of one forward and return stroke (data not shown).
  • Synchronized cilia beating visualized by adding 1 ⁇ fluorescent beads to the apical side of an empty airway chip (data not shown) compared to its addition to an airway chip device with a fully differentiated, living airway epithelium (data not shown).
  • Electron microscopic analysis of the normal lung airway-on-a-chip showed that the cilia which appeared on the apical surface of the polarized epithelium (data not shown) exhibited the same structure (9+2 microtubule organization) and length ( ⁇ 6 ⁇ ) (Fig. 6B) as healthy cilia found in living human lung in vivo 24 .
  • High-speed microscopic imaging showed that these cilia beat actively at a frequency of 9-18 Hz (data not shown), which again is similar to that observed in human airways 24 ' 25 (Table 1).
  • Example 2 Modeling human pulmonary inflammatory diseases in a microfluidic lung airway-on-a- chip
  • Example 1 it was sought to determine the ability of the "airway-on-a-chip" in Example 1 to accurately mimic lung inflammatory responses relevant to asthma and COPD, and to evaluate its capability to identify new pulmonary therapies.
  • IL-13 plays a pivotal role in asthma as it is necessary and sufficient to induce all features of allergic asthma in animal models of the disease 26 .
  • IL-13 has a direct effect on the airway epithelium 27 and participates in airway inflammation, goblet cell hyperplasia and mucus hypersecretion as well as subepithelial fibrosis and airway hyper-responsiveness 26 .
  • human primary airway epithelial cells were differentiated in the airway chip and cultured in the absence or presence of IL-13 with or without Dexamethasone ( ⁇ ) or Tofacitinib (1 or 10 ⁇ ) for 8 days.
  • Immunofluorescence micrographic views of the epithelium were stained for the goblet cell marker, MUC5AC and DAPI (data not shown). Immunofluorescence micrographic views of the epithelium stained for the goblet cell marker were taken to confirm the presence of goblet cells in the epithelium of the airway chip (data not shown).
  • IL-13 e.g., at a concentration of about 100 ng/mL
  • Fig. 2C a reduction in cilia beating frequency similar to that observed in the airway mucosa of asthma subjects 28"30 .
  • the airway epithelium in the "airway-on-a-chip” was exposed to the viral mimic polyinosinic-polycytidylic acid (poly I:C) (e.g., at a concentration of about 10 ⁇ g/mL) for about 3 hours.
  • Poly I:C is a synthetic analogue of the double-stranded RNA that is produced in infected cells during viral replication by respiratory viruses 31 ' 32 .
  • RANTES IL-6 and IP-10
  • Fig. 2D basal secretion of RANTES, IL-6 and IP-10
  • Fig. 7B cytokines (or chemokines) that have been previously shown to accumulate in lungs of human subjects infected with respiratory viruses 20 ' 21 .
  • E-selectin and VCAM-1 expression in the underlying endothelium (Fig. 7B) that are involved in adhesion and rolling of neutrophils in inflamed living tissues 24 .
  • Fluorescence micrographs also showed the recruitment of cralcein AM-labeled circulating neutrophils to the surface of the endothelium with poly I:C stimulation of the airway chips for 6 hours compared to without poly I:C stimulation (data not shown).
  • Fig. 3B,left panel and Fig. 3E show that bacterial infection mimic LPS can induce IL-8 secretion from COPD and not healthy epithelial cells, and that while viral infection mimic poly I:C appeared to slightly induce IL-8 secretion from both healthy and COPD, the poly I:C induced changes in IL-8 between the healthy and COPD cells were not statistically significant.
  • Fig. 3B (right panel) and Fig. 3D show that virus and not bacterial mimic challenge can induce M-CSF secretion from COPD epithelial cells, and that COPD and not healthy cells induced M-CSF secretion upon viral-mimic challenge. This is a surprising result as the findings indicate that M-CSF can serve as a biomarker to distinguish viral-induced COPD exacerbation from bacteria-induced COPD exacerbation.
  • a clinician can use M-CSF as a marker to differentially diagnose the cause of exacerbation (acute excessive inflammatory reaction in patients) and therefore avoid prescribing antibiotics when virus is the cause of exacerbation.
  • virus-induced M-CSF secretion can provide an indicator of whether a person (e.g., admitted to hospital or at home) has COPD or not.
  • a subject is diagnosed to have a viral infection and determined to exhibit an increased level of M-CSF expression (e.g., by at least about 30% or more as compared to a M-CSF reference such as the level in a healthy subject), the subject can be identified as likely to have COPD.
  • M-CSF expression e.g., by at least about 30% or more as compared to a M-CSF reference such as the level in a healthy subject
  • poly I:C stimulation induced the cytokine RANTES in COPD chips, and also produced a small but significant increase in RANTES production in healthy airway chips.
  • the poly I:C stimulation also enhanced secretion of IP-10 to similarly high levels in both healthy and COPD chips (Fig. 3C).
  • Serum IP-10 has been described as a clinical marker for acute viral exacerbations in COPD subjects 3 .
  • the findings presented herein indicate that IL-8 and M-CSF are biomarkers for exacerbations induced by Gram-negative bacteria that produce LPS and respiratory viruses, respectively.
  • Biomarker identification discovery can be applied for other pathophysiological states, and is not limited to exacerbation-associated inflammation as shown in the Examples.
  • biomarkers are not restricted to secreted cytokines and chemokines and can include other relevant biological endpoints including but not limited to transcriptome, miRNA profile, tissue-secreted circulating molecules, and any combinations thereof.
  • cytokines such as IL-8
  • the BPvD4 inhibitor also significantly suppressed production of GM-CSF (Fig. 5B), which is a neutrophil chemokine that enhances functionality of neutrophils 44 , in addition to supporting bone marrow cell proliferation and survival of granulocytic precursors. While budesonide slightly lowered gene expression of selected cytokines (Fig. 5B).
  • cytokine secretion (Fig. 5B), which is an important determinant of the inflammatory response.
  • the findings presented herein are consistent with what has been previously observed in animal models of COPD and lung inflammation 45 ' 46 .
  • corticosteroid treatment similarly failed to reduce bronchoalveolar lavage fluid levels of GROa, GM-CSF or IL-6, and it did not inhibit neutrophil infiltration of airways in mice co-challenged with cigarette smoke and poly I:C46.
  • another small-molecule BRD4 inhibitor (JQ1) has been previously reported to lower serum levels of GM-CSF and IL-6 in a LPS-challenged animal model of lung inflammation 45 . Therefore, the "airway-on-a-chip" model of human asthma and COPD faithfully recapitulates in vivo organ-level responses to therapy, and offers a powerful complement to animal models for preclinical drug evaluation.
  • Chronic pulmonary inflammatory diseases are complex human disorders that cannot be accurately modeled in vitro and animal models often offer limited biological relevance.
  • a human lung "airway-on-a-chip” e.g., in one embodiment, composed of a fully differentiated pseudo- stratified mucociliary epithelium with an underlying endothelium and circulating immune cells. The inventors applied the "airway-on-a-chip" to model and study human pulmonary inflammatory diseases as well as to assess therapeutic responses.
  • the inventors were able to independently control and vary virtually all system parameters, including the presence or absence of different cell types, air and vascular flow conditions and soluble factors, while simultaneously analyzing human organ-level responses in real-time with molecular scale resolution.
  • new insight into how airway epithelium and microvascular endothelium interplay to control cytokine production and regulate immune cell recruitment were discovered.
  • the inventors have discovered IL-8 and M-CSF as biomarkers for COPD exacerbations induced by Gram-negative bacteria and respiratory viruses, respectively.
  • pan-JAK inhibitor used for treatment of rheumatoid arthritis, reversed IL-13 -induced phenotype to healthy levels, and this is also consistent with previous reports of Tofacitinib or other JAK inhibitors (e.g., encapsulated pyridone 6, R256) suppressing inflammation in animal models of allergy or asthma40.
  • JAK inhibitors e.g., encapsulated pyridone 6, R256
  • Tofacitinib has a direct effect on the human airway epithelium, as evidenced by inhibition of IL-13-induced goblet cells hyperplasia, cytokine (G-CSF and GM-CSF) secretion, and reduction of cilia beating frequency (Data not shown).
  • lung airway models While other lung airway models have been previously reported, including microfluidic models 22 ' 23 , they were not able to produce a fully differentiated, pseudostratified, mucociliary epithelium, and hence, they were not used to model inflammatory diseases of the lung, test therapeutics or analyze recruitment of circulating immune cells in vitro.
  • the structure and function of a fully differentiated airway epithelium were able to be reconstituted in the "airway-on-a-chip" as described in Example 1.
  • the ability of the microfluidic airway- on-a-chip were also leveraged to study recruitment of circulating immune cells, to image endothelium- leukocyte interactions in real-time and to quantitatively analyze neutrophil attachment under physiologically relevant flow conditions in vitro.
  • the inventors have identified a novel therapeutic agent in the form of a new BRD4 inhibitor (e.g., 2-methoxy-N-(3 -methyl -2 -oxo-1, 2-dihydroquinolin-6- yl)benzene sulfonamide) that reduces neutrophil capture by inhibiting NFKB transcriptional activity, and hence, can be used for treatment of COPD exacerbations.
  • a new BRD4 inhibitor e.g., 2-methoxy-N-(3 -methyl -2 -oxo-1, 2-dihydroquinolin-6- yl)benzene sulfonamide
  • a corticosteroid drug currently prescribed in clinic e.g., Budesonide
  • FIG. 1A-1B The upper and lower layers of the microfluidic device (Figs. 1A-1B) were produced by casting polydimethylsiloxane (PDMS) pre-polymer on molds prepared using stereolithography (Fineline, USA). Curing ( 10: 1 PDMS base to curing agent; w/w) was carried out overnight at 60°C to produce devices containing two adjacent parallel microchannels (top channel, 1000 ⁇ wide X 1000 um high; bottom channel, 1000 ⁇ wide X 200 um high), which were used to form the airway lumen and microvascular channel, respectively. The channels were separated by a thin (- 10 ⁇ ) semi-porous polyester membrane (0.4 ⁇ pores) that was purchased from Maine Manufacturing (USA).
  • PDMS polydimethylsiloxane
  • Microfluidic cell culture Primary human airway epithelial cells (hAECs) obtained from commercial suppliers (Promocell, Germany; Lonza, USA, and Epithelix, Switzerland) were expanded in 75 cm 2 tissue culture flasks using airway epithelial growth medium (BEBM; Catalog no.
  • CC-3171 supplemented with growth factors/supplements (BulletKit Supplements; Catalog no. CC-4175; Lonza) until 70-80% confluent.
  • the device porous membrane was coated on both sides with rat tail collagen type I (300 ⁇ g/ml; Corning, USA) at 37 ° C for 24 hours.
  • the hAECs were then trypsinized and seeded onto the collagen-coated porous membrane in the upper channel of the device at a concentration of about 2 to 5 X 10 6 cells/ml (about 2 to 5 X 10 5 cells/cm 2 or about 4 to 10 X 10 4 cells/chip) and allowed to attach under static conditions.
  • the cell monolayer was washed with fresh medium and the cultures were maintained in submerged state until fully confluent (typically 4 to 5 days after seeding) under constant flow (60 ⁇ /1 ⁇ ) using an IPC-N series peristaltic pump (Ismatec, Switzerland).
  • Ismatec Ismatec, Switzerland
  • ALI air-liquid interface
  • the apical surface of the epithelium was rinsed once weekly with growth medium to remove debris, and differentiation was assessed morphologically, and by analyzing the area of the epithelium covered with beating cilia 4 to 5 weeks after seeding. Mucociliary transport was visualized using ⁇ diameter fluorescent microbeads (Life Technologies, USA ) diluted in PBS, injected in the upper channel of a fully differentiated airway-on-a-chip and imaged using a high speed Hamamastu ORCA-Flash 4.0 camera mounted on a Zeiss AxioObserver Z 1 microscope.
  • HMVECs human microvascular endothelial cells
  • HAVECs Human umbilical vein endothelial cells
  • Angio-proteomie USA or Lonza
  • Endothelial cells were seeded in Lonza EBM-2 endothelial cell basal growth medium (catalog no. CC-3156) supplemented with EGM-2MV SingleQuot Kit growth factors/supplements (catalog no.
  • Cultures were stained for ciliated cells (anti- ⁇ -tubulin IV, 1 : 100, clone ONS.1A6; Genetex, Taiwan), goblet cells (anti-Muchi5AC, clone H-160, Santa Cruz Biotech., USA), tight junctions (anti-ZOl, clone 1A12; Life Technologies, USA), or PECAM-1 (clone WM-58; eBioscience, USA).
  • ciliated cells anti- ⁇ -tubulin IV, 1 : 100, clone ONS.1A6; Genetex, Taiwan
  • goblet cells anti-Muchi5AC, clone H-160, Santa Cruz Biotech., USA
  • tight junctions anti-ZOl, clone 1A12; Life Technologies, USA
  • PECAM-1 clone WM-58; eBioscience, USA
  • Cells were dehydrated sequentially in ethanol gradients, rinsed in hexamethyldisilazane, air dried overnight in a desiccator at room temperature and then mounted on a conductive carbon support, coated with gold and imaged with a VEGA III scanning electron microscope (Tescan, Czech Republic).
  • ciliated cells For example, for ciliated cells, fully differentiated epithelia from 3 airway chips were trypsinized, cytospins were performed ( 1000 x g for 2 min), cells were air-dried for 1 hour at RT, fixed with 100% ice cold acetone, rinsed with PBS, stained for ⁇ -tubulin (ciliated cells marker) and counterstained with DAPI. Ciliated cells were counted in 6 fields per chip and percentages calculated.
  • goblet cells fully differentiated epithelia from 4 airway chips were fixed with 4% paraformaldehyde and stained for MUC5AC (goblet cells marker). Quantification of goblet cells was done by measuring the area covered by MUC5AC staining in 5 different fields for each condition. Mucociliary transport was evaluated by measuring the displacement of ⁇ ⁇ polystyrene fluorescent beads diluted in PBS and introduced in the top channel of the airway chip for 1 second.
  • Real time PCR was carried out using a CFX-96 real-time PCR system (Bio-Rad, USA). Reactions contained 2 ⁇ cDNA, 10 ⁇ 2xUniversal SYBR® Green Supermix (Bio-Rad, USA) and 3 ⁇ of each forward and reverse primers (300 nM final concentration), and 2 ⁇ molecular biology-grade water, and results were quantified using 2- ⁇ me t noc [ 25 p or example, ⁇ Ct (Ct target gene - Ct housekeeping gene) was calculated initially, then ⁇ ⁇ Ct was obtained by subtracting ⁇ Ct of healthy donor or untreated condition from ⁇ Ct of COPD subject or stimulated chip.
  • ICAM-1 reverse CCTGCAGTGCCCATTATGAC SEQ. ID. NO: 12
  • HMOX1 forward ACTTTCAGAAGGGCCAGGTG (SEQ. ID. NO: 21)
  • HMOX1 reverse GACTGGGCTCTCCTTGTTGC (SEQ. ID. NO: 22)
  • chemokines and cytokines The effluent of flowing medium was analyzed for a panel of cytokines and chemokines (IL-8, IP- 10, RANTES, IL-6, M-CSF, G-CSF, GM-CSF and GROa) using custom Milliplex assay kits (Millipore, USA). Analyte concentrations were determined according to the manufacturer's instructions, using a LuminexFlexMap 3D system coupled with a Luminex XPONENT software (Luminex, USA). For endothelium depletion experiments, basal secretions were collected for each condition and RANTES, IL-6 and IP-10 were measured at 24 hours after poly I:C (InvivoGen, USA) treatment.
  • COPD and healthy epithelium were challenged with LPS 10 ⁇ g/ml or poly I:C 10 ⁇ g/ml for 1 hour and secreted IL-8, M- CSF, IP-10 and RANTES were measured 24 hours following treatment.
  • the endothelial cells were treated with 10 nM Budesonide (Sigma), 500 nM of the BRD4 inhibitor (provided by Pfizer) or 0.1% DMSO diluent (Sigma) under flow (60 ⁇ /1 ⁇ ) through the vascular channel for 24 hours before poly I:C (10 ⁇ g/ml) was delivered into the airway channel for 6 hours.
  • the vascular effluents were then collected for cytokine/chemokine analysis.
  • PBMCs peripheral blood mononuclear cells
  • PMN polymorphonuclear
  • Flow cytometry analysis for CD 15 and CD 16 expression confirmed purity of neutrophil population over 93%.
  • Isolated neutrophils were then live-stained for 30 minutes at 37 ° C using cell tracker red or Hoechst (Life Technologies, USA), re-suspended in RPMI containing 10% FBS (v/v) (Life Technologies, USA) and used within 3h for recruitment assays in chips.
  • Neutrophils (1 X 107 cells/ml) were flowed (2.7 ml/h; 1 dyne/cm 2 ) through the microvascular channel of the device while it was flipped upside-down to mimic the physiological hemodynamic conditions that exist in human post-capillary venules50. After 10 minutes, unbound neutrophils were washed away by flowing cell-free RPMI 10% FBS medium for 5 minutes and pictures of 4-5 random areas were taken for subsequent counting; quantification was done by counting attached neutrophils using Image J and CellProfiler software.
  • Example 5 Identification of COPD-specific markers using a lung airway-on-a-chip coupled to a respirator device and an agent introduction apparatus
  • COPD is the third leading cause of death worldwide. WHO (2014).
  • Some of the major problems that COPD patients encounter are scarcity of therapeutic options, low availability of biomarkers that can effectively differentiate pathogenic vs. non-pathogenic causes of COPD exacerbation, and lack of molecular signature(s) that can distinguish between COPD vs. healthy (non-COPD) airway tissue in order to improve diagnosis.
  • Current COPD diagnosis is purely a clinical, not a molecular- or cellular- based, approach where the level of airflow obstruction is evaluated by pulmonary function test (PFT), e.g., to determine the ratio of forced expiratory volume in one second (FEV1) - i.e.
  • PFT pulmonary function test
  • neutrophils in circulation
  • rodents are obligate nose-breathers and cannot take cigarette smoke into their lungs as human smokers do and are unable to simulate smoking behavior
  • inability to recreate severe disease pathology in animal compared to humans Wood et al. "Animal models of chronic obstructive pulmonary disease.” American journal of physiology. Lung cellular and molecular physiology (2008) 295, Ll-15; and Kolaczkowska & Kubes "Neutrophil recruitment and function in health and inflammation.” Nature reviews. Immunology (2013) 13, 159-175) these factors have, in part, rendered low predictive ability of animal models to identify targets that were translated into humans.
  • a microfluidic human airway-on-a-chip device with COPD-derived well- differentiated epithelium cultured therein
  • a smoke generator and a microrespirator is used to simulate breathing tobacco smoke in and out of an airway.
  • primary airway epithelial cells from healthy (normal non-COPD) and COPD patients were cultured in lung airway-on-a-chip devices and guided to full differentiation to form mucociliary epithelium under air-liquid interface (ALI) (normally take about 6 weeks). See, e.g., the International Patent Application No. PCT/US2014/071611 (PCT Publication No.
  • the top channel of the lung airway-on-a-chip device comprises an epithelium on a membrane that separates the top channel from the bottom channel of the device.
  • the top channel with an epithelium simulates an airway lumen of human small airway (generations 8-16 of the respiratory tree).
  • One end of the "airway lumen” channel was connected to a respirator device (e.g., a microrespirator) while the other end to an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen” channel from freshly burning cigarettes to simulate smoking behavior.
  • a respirator device e.g., a microrespirator
  • an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen” channel from freshly burning cigarettes to simulate smoking behavior.
  • agent introduction devices such as a cigarette smoke generator and/or respiration devices for analysis of response to shear stress and foreign agents on cells. Breathing air shear was mimicked by inhaling-exhaling air into and out of the "airway lumen" channel through a respirator device.
  • the cigarette smoke generator was programmed to burn 9 X cigarettes (3R4F research-grade reference cigarettes purchased from University of Kentucky).
  • the cigarette smoke generator simulates a smoking behavior by controlling smoking behavior-related parameters such as puff time, inter-puff interval, number of puffs per cigarette, etc.
  • Coupling a lung airway-on-a-chip device to a cigarette smoke generator and a respirator allows users to challenge epithelial cells in the device with cigarette smoke by effectively enabling the device to "breathe" whole fresh cigarette smoke into and out of the device. Healthy (non-COPD normal) and COPD-derived epithelial cells were used and differentiated in a lung airway-on-a-chip device and both were challenged with the same amount of smoke exposure.
  • Fig. 9 display a list of COPD-specific genes that are differentially upregulated upon smoking in COPD cells only, not in healthy cells.
  • Fig. 9 also shows that smoking -induced expression change in 10 representative genes (chosen from the ones disclosed in Table 3) as simulated in the in vitro system (e.g., an airway-on-a-chip device coupling to a microrespirator and a cigarette smoke generator) agrees with the corresponding gene expression change as observed in bronchoscopy samples of non-COPD, smoker subjects.
  • Table 4 below displays a list of COPD-specific genes that are differentially downregulated upon smoking in COPD cells only, not in healthy cells.
  • ANT.X.R 1 8.459860201 0.1 2016499 0.5.17403033 0.746410247
  • ADH1 C 0.459670026 0.236248525 0, «2739745 1.2252.77576
  • Tables 3 and 4 compare smoking vs. non-smoking gene expression changes in COPD and healthy epithelial cells separately to understand stimulated phenotypes. The fold changes between healthy and COPD cells are then compared to identify responsive genes that are COPD-specific.
  • Fig. 9 shows that the healthy cells cultured in an airway-on-a-chip device display similar trend in fold change in mRNA expression as measured in clinical bronchoscopy samples derived from healthy smokers and healthy non- smokers, when the cultured cells were subject to either a smoking condition or a non-smoking condition.
  • the agreement between the "airway-on-a-chip device" data and the clinical data on healthy cells indicates that the air-on-a-chip device can be used to identify disease-specific response.
  • the distinct patterns of gene expression in COPD cells as shown in Tables 3 and 4, and Fig. 9, show COPD- specific responses to smoking.
  • Biomarker identification for COPD exacerbation has been previously conducted on sputum, bronchoalveolar lavage fluid (BALF), blood or bronchoscopy-isolated samples (Koutsokera et al. "Pulmonary biomarkers in COPD exacerbations: a systematic review.” Respiratory research (2013) 14, 111; Bafadhel et al. "Acute exacerbations of chronic obstructive pulmonary disease: identification of biologic clusters and their biomarkers.” American journal of respiratory and critical care medicine (2011) 184, 662-671. However, those biomarkers in many cases lack tissue-specificity and their production/expression cannot be accurately attributed to specific cell types, like airway epithelium.
  • biomarkers especially systemic (bloodstream) ones are nonspecific - i.e. not COPD specific, biomarkers such as C-reactive protein (CRP).
  • CRP C-reactive protein
  • At least one or more of the genes listed in Tables 3-4 can be used as a lung cancer biomarker.
  • genes e.g., Metallothionein 1H (MT1H), Transmembrane Protease, Serine HE (TMPRSS 11E) and Small Proline-Rich Protein 3 (SPRR3), as listed in Table 3, have recently been reported to be involved in development of human malignancies (but not in the lungs). Therefore, the expression and/or secretion of at least one or more of the genes listed in Tables 3-4 can be correlated to lung cancer.
  • MT1H Metallothionein 1H
  • TMPRSS 11E Transmembrane Protease
  • SPRR3 Small Proline-Rich Protein 3
  • At least one or more of the genes listed in Tables 3-4 can be used to discriminate between infectious (e.g., caused by viruses or bacteria) and non-infectious (e.g., cigarette smoke-induced as an example of non-infectious cause) causes of COPD exacerbations.
  • infectious e.g., caused by viruses or bacteria
  • non-infectious e.g., cigarette smoke-induced as an example of non-infectious cause
  • the gene when a gene listed in Tables 3-4 does not differentially expressed in COPD cells upon exposure to an infectious agent (e.g., a virus and/or a bacterium), as compared to COPD cells without exposure to an infectious agent (e.g., a virus and/or a bacterium), the gene can be used as a biomarker to differentiate a non-infectious cause of COPD exacerbation from an infectious cause of COPD exacerbation.
  • an infectious agent e.g., a virus and/or a bacterium
  • transcriptome analysis was performed on the cells in this Example to discover COPD- specific biomarkers
  • the methodology as described in this Example can be extended to discover other disease-unique novel biomarkers using various approaches including, e.g., transcriptome analysis, metabolomics, proteomics, epigenomics, or a combination of two or more thereof.
  • the cells cultured in the lung airway-on-a-chip device are not limited to COPD-derived cells, but can include a "sub-population" or "whole population" of cells derived from any diseased or healthy cell types or tissue types.
  • the COPD-derived cells can be derived from one or more different COPD patient subgroups (GOLD stages 1-4).
  • any organ-on-a-chip device as known in the art can be used.
  • the smoking behavior parameters e.g., but not limited to puff time, inter-puff interval, and number of puffs per cigarette
  • the smoking behavior parameters can be changed to simulate other desired smoking profiles.
  • Cigarette smoking is a common cause of lung disorders and it is the primary risk factor for the development of chronic obstructive pulmonary disease (COPD), which is the third leading cause of death worldwide 1 ' 2 .
  • COPD chronic obstructive pulmonary disease
  • Smoke-induced disease exacerbations represent one of the common causes for COPD patients to seek medical care 3 .
  • tobacco-related products such as electronic cigarettes (e- cigarettes) are drastically gaining popularity, but the biological impact of their emissions on lung airway cells is poorly characterized 4 ' 5 .
  • Neither small airway disease nor COPD exacerbations caused by cigarette smoke can be effectively modeled in animals 6"8 .
  • the smoking airway-on-a-chip consists of four integrated components: an organ-on-a-chip microfluidic device lined by human bronchiolar epithelium, a smoke generator, a microrespirator, and control software that recapitulates human smoking behavior.
  • the organ-on-a-chip is an optically clear, microfluidic culture device composed of poly(dimethylsiloxane) (PDMS) polymer the size of a computer memory stick that contains an upper microchannel (1 mm high x 1 mm wide) separated from a lower microchannel (0.2 mm high x 1 mm wide) by a thin, porous, polyester membrane (10 ⁇ thick with 0.4 ⁇ pores) coated with type I collagen (Fig. 10A).
  • hAECs Primary human airway epithelial cells obtained from healthy donors or COPD patients were cultured on top of the membrane in medium flowing through both channels until they reached confluency.
  • hAECs formed a highly differentiated pseudostratified ciliated airway epithelium that fully recapitulated the morphology and functions of the living lung small airway (Fig. 10A; Fig. 15) 20 .
  • the integrated microrespirator and smoking machine components worked in synchrony to flow freshly generated whole cigarette smoke over the differentiated epithelium only during the inhalation phase of the respiration cycle in the airway chip, and to flow the smoke out during the exhalation phase.
  • Cigarette smoke contains a complex combination of thousands of chemicals, some of which are oxidants and free radicals 21 , and this is reflected by higher oxidative stress levels in the lungs of smokers and COPD patients compared to healthy individuals 22 ' 23 .
  • oxidants and free radicals 21 oxidants and free radicals 21 .
  • the differentially expressed genes were analyzed for functional annotation of gene ontology biological processes using Database for Annotation, Visualization and Integrated Discovery (DAVID) software. P-values were corrected for multiple sampling using the Benjamini-Hochberg correction. This analysis verified that oxidation-reduction pathway changes observed in human smokers are similarly modulated in our model. Moreover, closer examination of expression changes of genes associated with oxidation-reduction revealed striking similarities between human smokers and our smoking chips for a majority of genes (Fig. 13B).
  • CYP1A1 Aldo-Keto Reductase Family 1 Member B 10
  • CYP1B 1 Cytochrome P450 Family 1 Subfamily B Polypeptide 1
  • Fig. 18B quantitative real-time PCR
  • Physiological recapitulation of cigarette smoke-induced ciliary dysfunction on-chip was performed.
  • Fig. 12 A plot of the deviations from the median of ciliary beating frequencies measured in normal bronchiolar epithelium in the absence (-) or presence (+) of exposure to whole cigarette smoke on-chip for 24 hours (data pooled from 2 different human donors with every symbol representing a measurement in one field of view, and approximately 50 fields being analyzed for each condition).
  • Representative time-lapse images of ciliary beating on the apical surface of the bronchiolar epithelium cultured on-chip in the absence (Non-Smoking) or presence (Smoking) of whole cigarette smoke were taken and analysed.
  • Cigarette smoke is known to be a major noninfectious cause of clinical exacerbations in patients with COPD3, and it cannot be modeled effectively in animals.
  • Clinical reports have demonstrated increased lung neutrophil accumulation and interleukin 8 (IL-8) levels in COPD patients compared with healthy subjects.34, 35.
  • IL-8 interleukin 8
  • metallothionein 1H metallothionein 1H
  • TMPPvSS l lE & TMPRSS 1 IF matrix metallopeptidase 1
  • SPRR3 matrix metallopeptidase 1
  • SPRR3 small proline-rich protein 3
  • RPTN repetin
  • ATPase H+ transporting
  • lysosomal 38kDa V0 subunit D2 (ATP6V0D2)
  • ANKRD22 ankyrin repeat domain 22
  • TSPAN7 neuronal cell adhesion molecule
  • NPvCAM neuronal cell adhesion molecule
  • Some of these genes have not been associated with the COPD phenotype previously.
  • MT1H, TMPRSS 11E and SPRR3 have been implicated in development of human malignancies 36"38 , and this could explain at least in part why there is higher risk of lung cancer development in COPD smokers 39 .
  • selective upregulation of serine protease genes TMPRSS11E and TMPRSS 11F is consistent with increased extracellular matrix degradation, airspace enlargement and emphysema development in COPD lungs 40 .
  • TMPPvSS l lE has recently been reported to activate respiratory viruses such as influenza A viruses 41 ; thus, our observation may in part explain higher susceptibility of COPD individuals to viral infections 42 .
  • induced expression of RPTN gene which has been associated with epidermal and keratinocyte differentiation 43, 44 , can explain squamous metaplasia development observed in advanced stages of COPD pathogenesis 45 .
  • MMP1 Another gene included in this list of key markers of the response of COPD epithelium to smoke exposure was MMP1, in line with published clinical reports on involvement of MMP-1 in COPD pathogenesis 46 ' 47 .
  • CCA4 carboxypeptidase A4
  • ADAMTS1 disintegrin-like and metalloprotease with thrombospondin type 1 motif 1
  • This smoking airway-on-a-chip culture system effectively recapitulated clinically important smoke -triggered molecular changes in lung epithelial cells, such as increased oxidative stress.
  • Using the system with a highly sensitive automated imaging approach to evaluate smoke -related ciliopathies we gained new insight into how smoke exposure alters ciliary motion in lung epithelium.
  • this system provided a novel, reliable and versatile approach to study fine micropathologies like the pattern of ciliary beating.
  • the smoking human small airway chip method provides a new way to study airway pathophysiology in response to inhaled whole cigarette smoke, study e-cigarette biological effects, identify COPD-specific biological responses, and discover novel molecular signatures that may serve as therapeutic targets or diagnostic biomarkers.
  • Microfluidic chip fabrication Molds for the microfluidic devices were fabricated out of Prototherm 12120 using stereolithography (Protolabs, Maple Plain, MN). The top and bottom components of the devices were cast from polydimethyl siloxane (PDMS) at a 10: 1 w/w base to curing agent ratio, degassed, and cured for 4 h to overnight at 60°C. The top component contains a fluidic channel (l x l mm cross section) and ports for the top and bottom channels.
  • PDMS polydimethyl siloxane
  • Microfluidic organ-on-a-chip cell culture Primary human small airway epithelial cells obtained from commercial suppliers (Promocell and Lonza) were expanded in 75 cm 2 tissue culture flasks using small airway epithelial growth medium supplemented with growth factors (Promocell) until ⁇ 80% confluent. Detailed methods for culture and differentiation of human lung epithelial cells in airway chip have been recently described48. Briefly, bronchiolar cells were seeded onto the membrane, maintained in a submerged state for 5 days and an air-liquid interface was established in the upper channel for 3 to 5 weeks, while the bottom channel was perfused with medium. Chips were then transferred to designated incubators for smoke exposure.
  • the smoking instrument was designed to accommodate up to 10 cigarettes of various brands and mimic the range of typical smoker behaviors. Briefly, the instrument holds up to 10 cigarettes in a revolving holder with airtight silicone sealing rings.
  • the control software triggers the ignition of each cigarette using a solenoid-actuated nichrome wire coil mounted on a ceramic mount inside a Teflon conical adapter.
  • a miniature vacuum pump provides air intake during ignition and during each "puff and draws air from the cigarette, through a Teflon mouthpiece, to a 5 mL smoke reservoir. This action occurs at arbitrary user-selectable intervals (Fig. 16).
  • a first pinch valve is used to programmatically select the timing of smoke and incubator air entering the chips during each inhalation.
  • a second pinch valve directs the flow of air, routing smoke or air into the chips during inhalation and out of the chips into the exhaust during exhalation.
  • An onboard microcontroller, relays, and a power supply provide support and communication with an external laptop. The system is controlled by custom Lab View software that enables users to define a broad range of smoker behavior parameters; however, we used a clinically relevant range in the present study (Table 5).
  • microrespirator design and operation The microrespirator consists of 8 air-tight 500 ml glass syringes cyclically actuated using a stepper motor-driven leadscrew and mounted in an aluminum and acrylic frame.
  • the PC control software provides configurable sinusoidal respiratory flow of 150 in 2.5 s inhalation and 2.5 s exhalation times and is monitored by the smoking instrument. This air volume was calculated to meet our goal of modeling bronchiole generations 8-16, which are on average approximately 1 mm in diameter.
  • Quantitative RT-PCR Gene expression analyses of cells were performed as previously described. Cycle of threshold (Ct) values were extracted, and results were analyzed comparatively using 2-AACt method following normalization against housekeeping gene hypoxanthine phosphorribosyltransferase (HPRT) as previously described. Primers sequences are listed in Table 2.
  • Microarray analysis Total RNA from four chips per condition was extracted as above and submitted to the Dana Farber Microarray Core for analysis using Affymetrix Human ST 2.0 arrays/ The results obtained were robust multi-array average (RMA) data normalized and assessed for quality using Affymetrix Power Tools, and then further processed and analyzed using custom scripts in MATLAB; duplicate genes and data lacking gene IDs were removed prior to analysis. Each smoke-exposed condition was compared to donor-matched non-exposed chips, and genes with both a Student's t-test p- value ⁇ 0.05 and a fold change > 2 were identified for both non-COPD and COPD donor chips to generate lists of significant genes. For differential gene expression, means were subtracted and standard deviations were error propagated.
  • the non-COPD significant gene list was used to compare our small airway chip data with clinical data from bronchoscopic sampling of 10 smokers and 12 non-smokers obtained from the Gene Expression Omnibus (GSE4498)25. Smoking samples were normalized to each gene's mean non-smoking control value for both in vitro and clinical data. Heat maps were generated using clustering linkages based on mean Euclidean distance for both biological samples and individual genes. DAVID software 58 was used to further break down the significant gene lists into functional processes with p-values ⁇ 0.05. P-values were corrected for multiple sampling using the Benjamini- Hochberg correction method.
  • Cilia beat frequencies were measured by applying Fourier spectral analysis to bright field video recordings of the ciliated surface. Using an inverted transmission microscope, the ciliated surfaces were recorded at 190-200 frames per second and at 512 x 512 pixel resolution. Each ciliated chip was recorded at 5 tolO fields of view (FOV), each spanning 166 x 166 ⁇ 2 .
  • FOV tolO fields of view
  • ciliary beat frequency was determined from the time -dependent pixel brightness of up to 300 neighboring pixels, with each pixel's signal reflecting the periodicities of the ciliary movement (Fig. 19).
  • a bandwidth filter of 1 to 30 Hz to remove noise After applying a bandwidth filter of 1 to 30 Hz to remove noise, a Hamming window to reduce sampling artifacts, and Fast Fourrier Transform to convert the temporal signal to the frequency domain, the resulting frequency power spectra were averaged to detect one or two dominant frequencies per sample point (Fig. 19).
  • the average ciliary beat frequency was computed for all sample points, resulting in 5 to 10 data points per chip.
  • Huh, D. et al. A human disease model of drug toxicity-induced pulmonary edema in a lung-on- a-chip microdevice. Science translational medicine 4, 159ral47, (2012).
  • Toll-like receptor 3 is induced by and mediates antiviral activity against rhinovirus infection of human bronchial epithelial cells. Journal of virology 79, 12273-12279, (2005).
  • Teijaro, J. R. et al. Endothelial cells are central orchestrators of cytokine amplification during influenza virus infection. Cell 146, 980-991, (201 1).
  • TLR4 Epithelial expression of TLR4 is modulated in COPD and by steroids, salmeterol and cigarette smoke. Respiratory research 8, 84, (2007).
  • Bronchial epithelial spheroids an alternative culture model to investigate epithelium inflammation-mediated COPD. Respiratory research 8, 86, (2007).
  • JAK-3 inhibitor CP-690550 is a potent anti-inflammatory agent in a murine model of pulmonary eosinophiliA. European journal of pharmacology 582, 154-161, (2008).
  • Interleukin-6 neutralization alleviates pulmonary inflammation in mice exposed to cigarette smoke and poly(I:C). Clin Sci (Lond) 125, 483-493, (2013).
  • Cigarette smoke induces interleukin-8 release from human bronchial epithelial cells.
  • Cigarette smoke extract modulates respiratory defence mechanisms through effects on T-cells and airway epithelial cells. Respiratory medicine 100, 818-827 (2006).
  • Cigarette smoke extract stimulates interleukin-8 production in human airway epithelium and is attenuated by superoxide dismutase in vitro.
  • Table 8 Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
  • Table 8 Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
  • Table 8 Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
  • Table 8 Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
  • Table 8 Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
  • Table 8 Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
  • Table 8 Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Described herein are methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) exacerbation and/or therapy monitoring based in part on the level of macrophage colony-stimulating factor (M-CSF) expression and/or activity. Methods for diagnosis and treatment of COPD patients using novel molecular signature(s) are also provided. Methods for identifying subjects with COPD exacerbations who are more likely to be responsive to and benefit from a therapy that targets virus-induced exacerbations or non-infective COPD exacerbations are also described herein.

Description

METHODS FOR TREATMENT OF CHRONIC OBSTRUCTIVE PULMONARY DISEASE
AND/OR THERAPY MONITORING
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit under 35 U.S.C. § 119(e) of the U.S. provisional application No. 62/148,542 filed April 16, 2015, and the of the U.S. provisional application No. 62/219,912 filed September 17, 2015, the contents of each are incorporated herein by reference in its entirety.
GOVERNMENT SUPPORT
[0002] This invention was made with government support under Grant No. W911NF-12-2-0036 awarded by DARPA. The government has certain rights in the invention.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 31, 2016, is named 002806-084612-PCT_SL.txt and is 5,780 bytes in size.
FIELD OF THE DISCLOSURE
[0004] Various aspects of the present embodiments provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) exacerbations and/or therapy monitoring. Methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from an anti-viral agent, an antibacterial agent, or a treatment for non-infective COPD exacerbation are also described herein. Methods for detecting COPD patients using molecular signatures are also described herein.
BACKGROUND
[0005] One of the major challenges to categorize subjects that suffer from complex disorders such as chronic obstructive pulmonary disease (COPD), for clinical management and therapeutic administration purposes, includes scarcity of specific biomarkers that reliably provide a diagnosis of a known pathophysiological state (e.g., a pathogen-induced inflammatory reaction).
[0006] Discovery and identification of biomarkers generally require biological samples obtained from human subjects (e.g., in the form of clinical trials). However, studies and/or clinical trials using subjects' biological samples (e.g., bronchoalveolar lavage content, serum, etc.) have failed or missed to identify a biomarker. In some cases, some clinical trials are hardly possible to justify for biomarker discovery when saving subjects' life is the highest priority. For example, when a COPD subject suffers from an acute exacerbation episode - an exaggerated inflammatory response that commonly leads to hospitalization and requires medical intervention- it would be very difficult or even unethical to justify collection of airway brushings for medical research prior to treating the subject. Yet discovery of cell- or tissue-specific biomarkers that can accurately and reliably indicate a pathological state is highly desired.
[0007] In vitro cell culture systems that can faithfully mimic healthy and diseased human tissues and organs offer an alternative to identify disease biomarkers. For example, COPD is a complex disorder that affects predominantly the lungs and its genesis has been poorly defined. Wright et al., American Journal of Physiology - Lung Cellular and Molecular Physiology (2008) 295: L1-L15. This has tremendously hindered in vitro disease modeling; and the current animal models of COPD suffer major drawbacks including, e.g., inability to reproduce severe disabling disease observed in humans. Even the existing animal models of COPD (e.g., induced by cigarette smoke) require several months to develop (Id.) and yet they do not recapitulate certain pathological features as seen in humans. Therefore, a human-derived in vitro system that can as accurately as possibly simulate human lungs tissue can advance biomarker identification and discovery for COPD.
[0008] In addition, both bacterial and viral infections have been detected during COPD exacerbations. Some examples of respiratory viruses involved in the etiology of COPD exacerbations include, but are not limited to, rhinoviruses, influenza viruses, coronaviruses, and respiratory syncytial virus (RSV), parainfluenza viruses, and human metapneumoviruses (HMPV). Alfredo et al., International Journal of COPD (2007) 2: 477-483. Determining the etiology of exacerbations can inform appropriate antibiotic and antiviral therapy. Antibiotic therapy has been widely used, but not always appropriately, in the treatment of COPD exacerbations. Therefore, there is a need to identify biological markers that can be used to stratify subjects into bacterial -induced versus viral -induced exacerbations, and/or to identify subjects with COPD exacerbations who are likely to benefit an antibiotic therapy versus an anti -viral therapy. There is also a need to identify biological markers that can be used to stratify subjects into infective COPD exacerbations versus non-infective COPD exacerbations for appropriate treatment.
SUMMARY
[0009] Embodiments of various aspects described herein are, in part, based on the discovery that macrophage colony stimulating factor (M-CSF) is a novel biomarker for virus-induced exacerbation in chronic obstructive pulmonary disease (COPD). In one aspect, the inventors have applied human lung small airway-on-a-chip technology, e.g., as described in the PCT Application No. PCT/US2014/07161 1 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety, to reconstruct healthy and COPD diseased epithelia on-chip. The inventors have regenerated 3- dimensional well-differentiated, mucociliary bronchiolar epithelium - cells of the small airway where the damage in COPD airways typically occurs - in vitro in a microfluidic device, e.g., as described in the PCT Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated by reference in its entirety. The inventors then used exogenous stimuli to mimic pathogenic infections in order to simulate bacterium- and virus-triggered exacerbation phenotypes. For example, in one embodiment, the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with lipopolysaccharide (LPS) to mimic Gram negative bacteria-induced exacerbation. In one embodiment, the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with polyinosinic:polycytidylic (poly I:C) acid to mimic respiratory virus-induced exacerbation. By analyzing secreted cytokine and chemokines from healthy and COPD epithelium with or without exacerbation, the inventors discovered that stimulation with LPS and poly I:C significantly up-regulated secretion of interleukin 8 (IL-8) and macrophage colony-stimulating factor (M- CSF), respectively, in COPD airway cells, but it did not produce any significant change in the healthy airway epithelial cells. Accordingly, the inventors have identified IL-8 as a biomarker for bacterial exacerbation and M-CSF as novel biomarker for viral exacerbation. By measuring the expression level of M-CSF, alone or in combination with expression level of IL-8, in a sample from a COPD subject, a practitioner can differentially diagnose the cause of COPD exacerbation (e.g., virus-induced v. bacteria- induced), and thus select appropriate treatment to treat the COPD exacerbation. For example, when the expression level of M-CSF is up-regulated in a COPD subject, virus is indicated to be the cause of exacerbation and thus the subject can be administered an anti -viral agent instead of an antibacterial agent (e.g., antibiotics). For example, increased expressions of genes disclosed in Table 3 and/or decreased expressions of genes disclosed in Table 4 indicate that the cause of COPD exacerbation is unlikely that of an infectious agent such as a virus or a bacterial infection. Rather the cause of the COPD exacerbation is likely due to irritant in the air, e.g., dust or smoke particles. Accordingly, various aspects described herein provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) exacerbations and/or therapy monitoring. Methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from an anti-viral agent or an antibacterial agent are also described herein.
[0010] In one aspect, it is the objective of this disclosure to provide methods for categorizing, stratifying, classifying or distinguishing COPD exacerbations arising from different causes based on expressions levels of M-CSF, IL-8 and/or genes disclosed in Tables 3 and 4 in order to provide timely and effective, targeted treatment to the COPD subjects, the treatment administered in directed at the particular cause of the COPD exacerbation. The categorizing, stratifying or classifying COPD exacerbations help to distinguish the COPD exacerbation that is due to a viral infection, a bacterial infection or irritant in the air.
[0011] In one aspect, it is also the objective of this disclosure to provide treatment methods for COPD subjects by first categorizing, stratifying or classifying or distinguishing the subjects' COPD exacerbations arising from different causes based on expressions levels of M-CSF, IL-8 and/or genes disclosed in Tables 3 and 4 in order to provide timely and effective, targeted treatment to the COPD subjects. The categorizing, stratifying or classifying or distinguishing COPD exacerbations help to distinguish the COPD exacerbations that are due to a viral infection, a bacterial infection or irritant in the air, thereby an appropriate treatment comprising anti-viral agent, or anti-bacterial agent, and/or an antiinflammatory agent can be administered to the subject depending on the root cause of the COPD exacerbation.
[0012] In one aspect, it is also the objective of this disclosure to provide methods for identifying subjects who are at risk of developing COPD, the method comprising analysis of the change in expression levels of any one of the genes disclosed in Tables 3 and 4 in the presence of cigarette smoke irritants. The genes disclosed in Tables 3 and 4 are biomarkers for a risk of developing COPD, upon prolong exposure to cigarette smoke irritants, genes disclosed in Table 3 are significantly increased in expression while genes disclosed in Table 4 are significantly decreased in expression in COPD subjects. Identification of such subjects at risk allows for early intervention of the disease. [0013] In one aspect, it is also the objective of this disclosure to provide methods for the early intervention and treatment management of COPD, the method comprising first identifying subjects who are at risk of developing COPD analysis of the change in expression levels of any one of the genes disclosed in Tables 3 and 4 in the presence of cigarette smoke irritants, and then implementing an early intervention and treatment management of COPD for the identified subjects.
[0014] In one aspect, it is also the objective of this disclosure to provide screening methods for identifying new agents, drugs, small chemicals etc that can treat COPD exacerbations. The screening methods uses the lung in a chip assay under various induced simulated COPD situations, and involve analyses for agents, drugs, small chemicals etc that can reverse the direction of expression levels of M- CSF, IL-8 and/or genes disclosed in Tables 3 and 4 that is associated with the various COPD exacerbations. For example, agents, drugs, small chemicals etc that can reduce of expression levels of M- CSF (due to viral infection), IL-8 (due to bacterial infection, and/or genes disclosed in Table 3 (due to smoke particulate irritant).
[0015] In one aspect, a method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to an anti-viral agent is described herein. The method comprises: (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject to be likely to be more responsive to an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject to be more likely to respond to an alternative treatment without the anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
[0016] In some embodiments, the method can further comprise administering to the subject a treatment based on the expression level of M-CSF in the identifying step.
[0017] In some embodiments, when the expression level of M-CSF is greater than the M-CSF reference, the subject is not administered an anti -bacterial agent. Thus, administration of unnecessary antibiotics can be prevented.
[0018] The inventors have discovered that COPD epithelium stimulated with a bacterial agent (e.g., LPS) does not significantly increase M-CSF, but significantly up-regulate IL-8 instead. Accordingly, in some embodiments, the method can further comprise measuring expression level of IL-8 in the sample. The subject is optionally further administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
[0019] In some embodiments, the treatment administered to the subject can further comprise an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations. Examples of an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof. [0020] In some embodiments, the anti-viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability. Examples of anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof. In one embodiment, the anti-viral agent can comprise 2-methoxy-N-(3 -methyl -2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
[0021] In some embodiments of this aspect and other aspects described herein, the M-CSF or IL-8 reference can correspond to a level in a healthy subject.
[0022] In some embodiments of this aspect and other aspects described herein, the M-CSF or IL-8 reference can correspond to a level in the subject before onset of the COPD exacerbation.
[0023] In some embodiments, the sample can be fluid sample. For example, the fluid sample can comprise a blood or serum sample.
[0024] In another aspect, a method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject is described herein. The method comprises: administering to a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, an anti-viral agent that reduces the M-CSF expression level.
[0025] In some embodiments of this aspect and other aspects described herein, the subject can exhibit an increased expression of M-CSF, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation). In some embodiments, the subject can exhibit an increased expression of M-CSF, e.g., by at least about 1.1-fold or more, including, e.g., at least about 1.5- fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation).
[0026] In some embodiments, the subject can be further administered an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations. Examples of an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof.
[0027] In some embodiments, the anti-viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability. Examples of anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof. In one embodiment, the anti-viral agent can comprise 2-methoxy-N-(3 -methyl -2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
[0028] A method of treating a patient diagnosed with COPD that exhibits an increased expression level of M-CSF and/or monitoring treatment therapy is also provided herein. The method comprises: (a) determining a first expression level of M-CSF in a sample from a subject diagnosed with COPD that exhibits an increased expression level of M-CSF; (b) administering an anti-viral agent; (c) determining a second expression level of M-CSF after the administering; and (d) comparing the first and second expression levels of M-CSF. The anti-viral agent is effective if the second expression level is lower that the first expression level, and wherein the anti-viral therapy is ineffective if the second expression level is the same as or higher than said first expression level.
[0029] In some embodiments, the method can further comprise, when the anti-viral agent is effective, continuing to administer the agent.
[0030] In some embodiments, the method can further comprise, when the anti-viral agent is ineffective, discontinuing the agent.
[0031] In some embodiments, the method can further comprise, when the anti-viral agent is ineffective, administering the agent at a higher dose.
[0032] In some embodiments, the method can further comprise, when the anti-viral agent is ineffective, administering a different anti-viral agent.
[0033] In a further aspect, a method of identifying an agent for reducing at least one symptom of a viral- induced COPD exacerbation is described herein. The method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a virus-mimic agent; (c) measuring expression level of M-CSF in a sample; and (d) identifying the test agent as an effective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is same as or lower than a M- CSF reference; or identifying the test agent as an ineffective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is higher than the M-CSF reference.
[0034] In some embodiments, the method can further comprise measuring expression level of IL-8 in the sample. The identified effective agent can display the expression level of IL-8 same as or lower than an IL-8 reference. The identified ineffective agent can display the expression level of IL-8 greater than the IL-8 reference.
[0035] In some embodiments, the sample can comprise a culture medium sample.
[0036] In some embodiments, the COPD-mimic cells can be derived from a subject diagnosed with
COPD.
[0037] In some embodiments, the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent. Examples of COPD-phenotype inducing agents include, but are not limited to cigarette smoke and its derivatives (e.g., but not limited to cigarette smoke extract, cigarette smoke condensate, whole mainstream fresh cigarette smoke, passive second hand cigarette smoke), removal of certain nutrients and/or cell culture medium supplements such as retinoic acid, etc. [0038] In some embodiments, the virus-mimic agent can comprise any agent that induces or activates innate immune receptor(s) involved in an anti-viral response. Examples of virus-mimic agents include, but are not limited to synthetic analogues of double-stranded RNA (e.g., polyinosinic:polycytidylic acid), ligands and/or agonists for melanoma differentiation-associated protein 5 (MDA-5), ligands and/or agonists for retinoic acid inducible gene (RIG-1), ligands and/or agonists for NOD-like receptors (NLR), ligands and/or agonists for members of TOLL-like receptors (TLR) such as TLR-7, TLR-8, and TLR-9, viral mimics such as inactivated viral particles (e.g., UV-inactivated human rhinovirus or fixed virus), whole live virus, and a combination of two or more thereof.
[0039] In some embodiments, the COPD-mimic cells can be grown in a microfluidic device. An exemplary microfluidic device can comprise an organ-on-a-chip device. In some embodiments, the organ-on-a-chip device can comprise a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber. Such exemplary organ-on-a-chip device includes any device described in the International Patent App. No. PCT/US2014/07161 1 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety.
[0040] The inventors have also found that when the virus mimic-stimulated COPD epithelial cells were treated with a Bromodomain Containing Protein 4 (BRD4) inhibitor of NFKB signaling (e.g., 2-methoxy- N-(3 -methyl -2 -oxo- l,2-dihydroquinolin-6-yl)benzenesulfonamide), the BRD4 inhibitor surprisingly suppressed neutrophil adhesion by more than 70%. Accordingly, a method of treating chronic obstructive pulmonary disease (COPD) exacerbation induced by a microbial infection in a subject is also provided herein. The method comprises: administering to the subject a pharmaceutical composition comprising a bromodomain containing protein 4 (BRD4) inhibitor of NFK B signaling. In some embodiments, the BRD4 inhibitor can comprise 2-methoxy-N-(3-methyl-2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
[0041] In some embodiments, the microbial infection can be a viral-induced infection.
[0042] In other aspects, the inventors have, in part, discovered novel molecular signatures that can be used to detect or identify COPD patients using a non-pulmonary function test (non-PFT) method, where PFT is purely a clinical, not a molecular- or cellular-based, approach, and is currently the gold standard for the COPD diagnosis. In some embodiments, changes in one or more of these novel molecular signatures can occur well before COPD development and thus can provide early diagnosis of COPD. In some embodiments, the novel molecular signatures can be used to distinguish non-infective COPD exacerbations from infective COPD exacerbations. In one aspect, a microfluidic human airway-on-a-chip device (with COPD-derived well-differentiated epithelium cultured therein) is coupled to a smoke generator and a microrespirator in order to simulate breathing tobacco smoke in and out of an airway in vivo. For example, primary airway epithelial cells from healthy (normal non-COPD) and COPD patients were cultured in one of the channels to form an "airway lumen" in a lung airway-on-a-chip device and guided to full differentiation to form mucociliary epithelium under air-liquid interface (ALI). One end portion of the "airway lumen" channel was connected to a respirator device (e.g., a microrespirator) while the other end portion to an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen" channel (e.g., by freshly burning cigarettes to simulate smoking behavior) and thus to challenge airway epithelia cells cultured therein. Cells after exposure to cigarette smoke were then lysed in situ for their whole transcriptome profiling analysis and COPD- specific genes that are differentially (and statistically significant) up-regulated or down-regulated only in COPD airway epithelium upon exposure to cigarette smoke, not in healthy epithelia, were identified and listed in Tables 3-4 herein. The molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, as therapeutic targets or diagnostic biomarkers. Accordingly, some aspects described herein provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) and/or therapy monitoring using at least one or more of these novel molecular signatures.
[0043] In some aspects, methods of identifying a subject who is likely to have, or have a risk for, chronic obstructive pulmonary disease (COPD) based in part on the novel molecular signatures as listed in Tables 3 and 4 are described herein. In one aspect, a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s). In some embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects. In some embodiments, the method can be used to identify a smoker subject who is more susceptible to COPD. In these embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non- COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
[0044] In some embodiments, the method can comprise measuring expression level of at least one gene or a combination of two or more genes selected from the group consisting of MT1H, TMPRSS11E, MMP1, SPRR3, RPTN, ATP6V0D2, ANKRD22, TMPRSS 1 IF, TSPAN7, NRCAM.
[0045] In another aspect, a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference(s). In some embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects. In some embodiments, the method can be used to identify a smoker subject who is more susceptible to COPD. In these embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non-COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
[0046] In some embodiments, the method can comprise measuring expression level of at least one gene or a combination of two or more genes comprising CFTR.
[0047] In some embodiments of these aspects, the method can further comprise administering to the subject a COPD treatment when the subject is identified to be likely to have, or have a risk, for COPD.
[0048] A bronchoscopy sample or a fluid sample (e.g., a blood or serum) can be collected or derived from the subject to perform the diagnosis methods described herein.
[0049] In some embodiments, at least one or more of the genes as listed in Tables 3-4 herein can be used to discriminate between infectious (e.g., caused by viruses or bacteria) and non-infectious (e.g., cigarette smoke-induced as an example of non-infectious cause) causes of COPD exacerbations. For example, when a gene as listed in Tables 3-4 does not differentially expressed in COPD cells upon exposure to an infectious agent (e.g., a virus and/or a bacterium), as compared to COPD cells without exposure to an infectious agent (e.g., a virus and/or a bacterium), the gene can be used as a biomarker to differentiate a non-infectious cause of COPD exacerbation from an infectious cause of COPD exacerbation. Accordingly, methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from a treatment for non-infective COPD exacerbation vs. a treatment for infective COPD exacerbation are also described herein.
[0050] In some aspects, methods of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non- infective COPD exacerbation are described herein. In one aspect, the method comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s). In another aspect, the method comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is lower than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or greater than the corresponding reference(s). A bronchoscopy sample or fluid sample (e.g., blood or serum) can be collected from the subject to perform the methods described herein.
[0051] In some embodiments of these aspects described herein, the method can further comprise administering to the subject a treatment based on the expression level of the measured gene(s) in the identifying step.
[0052] In some embodiments of these aspects described herein, the treatment for non-infective COPD exacerbation can comprise an agent that reduces airway inflammation.
[0053] In some aspects of these aspects described herein, the method can further comprise, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, determining whether the subject will benefit from an anti -viral therapy or an anti -bacterial therapy. For example, in some embodiments, expression level of M-CSF can be measured in a sample from the subject, wherein the subject is administered an anti-viral agent when the expression level of M- CSF is greater than the M-CSF reference; or the subject is not administered an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference. Additionally or alternatively, expression level of IL-8 can be measured in a sample from the subject, wherein the subject is administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
[0054] In some embodiments of these aspects described herein, the reference can correspond to expression level of the corresponding gene in healthy subject(s). Alternatively, the reference can correspond to expression level of the corresponding gene in the subject before onset of the COPD exacerbation.
[0055] As the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, as therapeutic targets, methods of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject are also described herein. In one aspect, a treatment method comprises: administering to a subject diagnosed with COPD that exhibits an increased expression level of at least one gene or a combination of two or more genes as listed in Table 3, an agent that reduces the increased expression level of the gene(s) and optionally reduces airway inflammation. In another aspect, a treatment method comprises: administering to a subject diagnosed with COPD that exhibits a decreased expression level of at least one gene or a combination of two or more genes as listed in Table 4, an agent that increases the decreased expression level of the gene(s) and optionally reduces airway inflammation.
[0056] In some embodiments, the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, to monitor treatment progress. Accordingly, some aspects described herein relate to methods for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject. In one aspect, a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from a subject diagnosed with COPD that exhibits an increased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing the first and second expression levels of the gene(s). The treatment for non-infective COPD exacerbation is effective if the second expression level is lower than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is the same as or higher than the first expression level. In another aspect, a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from a subject diagnosed with COPD that exhibits a decreased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after the administering; and (d) comparing the first and second expression levels of the gene(s). The treatment for non-infective COPD exacerbation is effective if the second expression level is higher than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is the same as or lower than the first expression level.
[0057] When the administered treatment is effective, the method can further comprise continuing administration of the treatment. In contrast, when the administered treatment is ineffective, the ineffective treatment can be discontinued. Instead, a new treatment can be administered to the subject. For example, the same therapeutic agent can be administered at a higher dose and/or a higher frequency, or a different treatment, e.g., for infective COPD exacerbation (e.g., an anti-viral agent or an antibacterial agent), can be administered to the subject.
[0058] In some aspects, the molecular signatures as listed in Tables 3-4 herein, individually or in any combinations, can be used in drug screening. Thus, methods for identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation are described herein. In one aspect, the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or lower than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is higher than the corresponding reference(s). In another aspect, the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or greater than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference(s).
[0059] In some embodiments, the reference can correspond to expression level of the corresponding gene(s) in the COPD-mimic cells prior to contact with the test agent or the non-infective agent. In some embodiments, the reference can correspond to expression level of the corresponding gene(s) in the healthy (non-COPD) cells contacted with the non-infective agent that induces COPD exacerbation.
[0060] A sample used in drug screening methods described herein can be derived from a COPD-mimic cell that is contacted with the test agent and the non-infective agent, and/or a culture medium sample that is exposed to the COPD-mimic cell.
[0061] In some embodiments, the COPD-mimic cells can be derived from a subject diagnosed with COPD, thereby identifying an agent that is personalized to the subject. In some embodiments, the COPD- mimic cells can be derived from established COPD cells. In some embodiments, the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent.
[0062] The COPD-mimic cells can be cultured in any cell culture device known in the art. In some embodiments, the COPD-mimic cells can be grown in a microfluidic device such as an organ-on-a-chip device.
BRIEF DESCRIPTION OF THE DRAWINGS
[0063] Figs. 1A-1C show that the microengineered airway-on-a-chip device reconstitutes a human, pseudostratified, mucociliary, airway epithelium in vitro. (Fig. 1A) Photograph of the airway-on-a-chip microdevice (airway channel is filled with a dark dye; microvascular channel is filled in a light dye; bar, 1 cm). (Fig. IB) Schematic diagram of a cross section through the PDMS airway-on-a-chip shown in Fig. 1A, visualizing its two hollow linear channels separated by a thin, porous, polyester membrane which supports growth and differentiation of human primary airway epithelial cells on its upper surface and human primary endothelial cells on its lower surface. (Fig. 1C) Schematic diagram of the tissue- tissue interface that forms on-chip, with a differentiated airway epithelium cultured on top of the porous collagen-coated membrane at an air-liquid interface in the upper channel, and endothelium below with medium flowing beneath it that feeds both tissue layers.
[0064] Figs. 2A-2D are experimental data showing modeling asthma in the airway-on-a-chip. Human primary airway epithelial cells were differentiated in the airway chip and cultured in the absence or presence of IL-13 with or without Dexamethasone (Ιμπι) or Tofacitinib (1 or 10 μπι) for 8 days. Immunofluorescence micrographic views of the epithelium stained for the goblet cell marker were taken to confirm the presence of goblet cells in the epithelium of the airway chip (data not shown). Fig. 2A is the histologram depictions of total area covered by goblet cells under indicated treatment conditions. Fig. 2B are the histolograms showing the production of the cytokines GM-CSF and G-CSF under indicated treatment conditions. Fig. 2C is the histogram showing the cilia beating frequency (CBF) under indicated treatment conditions. IL-13 -treatment induced goblet cell hyperplasia, GM-CSF and G-CSF secretion and suppression of cilia beating which were inhibited in a dose-dependent manner by Tofacitinib, but not by Dexamethasone (*p<0.05, **p<0.01, ***p<0.001). Fig. 2D are histograms showing production of the cytokines, RANTES, IL-6 and IP- 10, by the airway-on-a-chip containing differentiated epithelium in the presence (+) or absence (-) of an underlying endothelium, with (+) or without (-) poly I:C (10 μg/ml) stimulation (*p<0.05, **p<0.01).
[0065] Figs. 3A-3E are experimental data showing modeling COPD in the airway-on-a-chip. (Fig. 3A) TLR4 (top) and TLR3 (bottom) gene expression levels are significantly lower in airway chips created using primary human airway epithelial cells isolated from COPD subjects (n=4) compared to healthy non-smokers (n=6) when analyzed by real-time RT-PCR. (Figs. 3B-3E) Stimulation of production of the cytokines, IL-8, M-CSF, RANTES, and IP-10, by healthy vs. COPD airway epithelium (n=4) in the absence or presence of TLR stimulation by LPS (10 μg/ml; open triangles) or poly I:C (10 μg/ml; open squares). For example, lung airway epithelial cells from healthy subjects and subjects who had been diagnosed with COPD (chronic obstructive pulmonary disease) were cultured and differentiated on chips to mucociliary epithelium. The differentiated epithelial cells were then stimulated with LPS (lipopolysaccharide to mimic infection with Gram negative bacteria) or poly I:C (a synthetic nucleotide sequence that mimics infection with virus infections) for about 1 hour. About 24 hours later, secretions of epithelial cells were collected and titrated with M-CSF along with IL-8. Note that TLR activation by these simulants of bacterial and viral infection significantly induced IL-8 and M-CSF release only in COPD chips (Fig. 3B), whereas IP-10 and RANTES release increased in both healthy and COPD epithelia (Fig. 3C) (*p<0.05, **p<0.01). (Fig. 3D) (left) actual amounts of the secreted M-CSF in pg/ml and (right) fold change as % compared to basal (unstimulated secreted amount) of M-CSF for both healthy and COPD. The data shows that virus and not bacterial mimic challenge can induce M-CSF secretion from COPD epithelial cells. In addition, COPD and not healthy cells induced M-CSF secretion upon viral-mimic challenge (** : p < 0.01). (Fig. 3E) (left) actual amounts of the secreted IL-8 in pg/ml and (right) fold change as % compared to basal (unstimulated secreted amount) of IL-8 for both healthy and COPD. The data shows that bacterial infection mimic LPS (lipopolysaccharide) can induce IL-8 secretion from COPD and not healthy epithelial cells. In addition, while viral infection mimic poly I:C appeared to slightly induce IL-8 secretion from both healthy and COPD, these changes were not statistically significant.
[0066] Figs. 4A-4B are experimental data showing pharmacological modulation of inflammation in the airway chip. (Fig. 4A) Graphic depiction of neutrophil adhesion results obtained in fluorescence microscopy studies (data not shown) of the recruitment of Hoechst-stained circulating neutrophils to the surface of the endothelium in the airway-on-a-chip containing a differentiated COPD epithelium with an underlying endothelium pre-treated with 10 nM Budesonide, 500 nM BRD-4 inhibitor, or 0.1% DMSO diluent (untreated) for 24 hours prior to poly I:C (10 μg/ml) stimulation of the epithelial cells (n=3 donors/condition). Note that the BRD-4 inhibitor significantly lowered neutrophil adhesion compared with the untreated groups, whereas the effect of budesonide was not significant (***p<0.001). (Fig. 4B) Effects of 10 nM Budesonide and 500 nM BRD-4 inhibitor on expression of genes encoding the endothelial cell adhesion molecules, E-selectin, VCAM-1 and ICAM-1, compared to the untreated (0.1% DMSO) group, as measured using real time PCR. Note that the BRD-4 inhibitor significantly down- regulated transcript levels of the cell adhesion molecules (n=3-4; *p<0.05, **p< 0.01).
[0067] Figs. 5A-5B are experimental data showing therapeutic modulation of inflammatory activation of the endothelium in the airway chip. (Fig. 5 A) Quantitative RT-PCR analysis of transcripts encoding the pro-inflammatory genes, IL-8, GRO-a, MCP-1, and IL-6 in microvascular endothelial cells in COPD airway chips treated with ΙΟηΜ Budesonide, 500 nM BRD-4 inhibitor, or 0.1% DMSO prior to stimulation with poly I:C (10 μg/ml) for 6 hours, as described in Figs. 4A-4B (n=3-4; *p<0.05, **p<0.01, ***p<0 001). (Fig. 5B) Analysis of the effects on secretion of protein cytokines and chemokines into the microvascular channel that are encoded by the transcripts shown in Fig. 5A (n=5-6; *p<0.05, **p<0.01, ***p<0.001).
[0068] Figs. 6A-6B are experimental data showing additional assessment of the capability of an organ on a chip as shown in Figs. 1A-1C to reconstitute a well differentiated, ciliated airway epithelium on- chip. (Fig. 6A) Lung epithelial barrier function was assessed by flowing Inulin-FITC for 5h through the upper channel of the airway-on-a-chip device containing well-differentiated hAECs or no cells, and measuring fluorescence in the effluent from the top and bottom channels. Calculation of barrier permeability of the airway-on-a-chip relative to that measured in an empty chip revealed that permeability was restricted by greater than 99.9%. (Fig. 6B) Transmission electron micrographic views of cilia formed on the apical surface of human airway epithelial cells grown in the airway-on-a-chip; white arrows indicate two cilia (bar, 200 nm); inset shows a cross section of an axoneme at higher magnification, highlighting the typical 9+2 structure (bar, 100 nm).
[0069] Figs. 7A-7D are experimental data showing analysis of epithelial -endothelial interactions, neutrophil recruitment, and in the airway-on-a-chip stimulated with the viral mimic poly I:C. (Fig. 7A) Schematic cross-section of the airway-on-a-chip device showing how poly I:C was added to the upper channel, and how circulating neutrophils were flowed through the lower channel to measure their recruitment and adhesion to the endothelial surface. (Fig. 7B) Quantitative RT-PCR analysis of the effect of 6 hr of poly I:C (10 μg/ml) stimulation on expression of genes encoding the endothelial cell adhesion molecules VCAM-1 and E-Selectin (n=3; *p < 0.05). (Fig. 7C) Sequential time-lapse microscopic views showing freshly isolated neutrophils being recruited to the surface of living endothelium under physiological flow and shear stress (1 dyne/cm2) in the airway chip when stimulated with poly I:C, as described in the Example. The arrowhead indicates a neutrophil that is captured from the flowing medium in the second image that then adheres and spreads on the endothelial surface in subsequent images, directly adjacent to an already bound neutrophil (neutrophils were live stained with CellTracker Red; arrow indicates direction of flow; times are indicated in seconds). (Fig. 7D) Fully differentiated hAECs co-cultured with or without endothelial cells were stimulated with 10 μg/ml poly I:C in PBS (+) or PBS alone (-). IL-8/CXCL8 and GRO/CXCL1 levels were measured in basal secretions 24 h later.
[0070] Fig. 8 is a schematic diagram illustrating an example of a microfluidic device system comprising a human airway-on-a-chip, an agent introduction device (e.g., a cigarette smoke generator), and a respirator (e.g., a microrespirator). The microfluidic device system can be used for biomarker identification and/or target discovery to discover novel diagnostic markers or therapeutics.
[0071] Fig. 9 is a bar graph showing fold change in mR A expression of indicated genes of COPD or healthy cells subject to smoking relative to the corresponding cells without smoking.
[0072] Figs. 10A-10D. Testing effects of cigarette smoke on airway epithelium in vitro using a human small airway-on-a-chip. (Fig. 10A) From left to right: a photograph of a small airway-on-a-chip microdevice (bar, 1 cm); and a schematic diagram showing differentiated human mucociliated airway epithelium cultured in the top channel of the device. (Fig. 10B) Schematic describing the overall method for analyzing effects of inhaled whole cigarette smoke in the lung small airway-on-a-chip. Cigarettes are loaded into a custom-engineered cigarette smoke engine (top left) that breathes smoke directly in and out of the lumen of the upper airway channel of the microchip (bottom left). Breathing and smoking topography parameters, including respiration cycle, puff time, and inter-puff interval, can be controlled as diagrammed schematically (top right) using the incubator shelf-compatible microrespirator component (bottom right). Smoking person image at center was acquired from Science Photo Library/SCIEPRO/Getty Images. Photos of the smoke machine component alone loaded with cigarettes (left, Fig. IOC), and the microrespirator and smoke machine combined setup located inside the incubator (right, Fig. 10D).
[0073] Figs 11A-11D. On-chip recapitulation of smoke-induced oxidative stress. (Fig. 11A) Real-time PCR analysis showed considerable upregulation of anti -oxidant heme oxygenase 1 (HMOX1) gene expression with smoke exposure (**p<0.01; pooled data from 3 human donors with 4 biological replicates [chips] per donor; n = 12). (Fig. 11B) Graphic depiction of Western blot analysis showing smoke-induced phosphorylation of the antioxidant regulator Nrf2 in epithelial cells on-chip (***p<0.001; pooled data from 2 different normal human donors tested in 3 independent experiments (Fig. 18 A) with two biological replicates per donor; n = 4). (Fig. 11C) A pie chart showing the major biological processes with which genes that altered their expression in response to smoke exposure on-chip were associated, as determined using gene ontology analysis. (Fig. 11D) A heat map comparing expression of 29 genes associated with cellular oxidation-reduction in bronchiolar epithelial cells obtained by bronchoscopy- guided brushing of small airways from 10 different normal human smokers compared with samples obtained from 3 different human small airway chips that were exposed to whole cigarette smoke on-chip for 75 minutes. Note the general similarity in the patterns of both induced and suppressed genes.
[0074] Figs. 12A-12C. Physiological recapitulation of cigarette smoke-induced ciliary dysfunction on- chip. (Fig. 12A) Distributions of ciliary beat frequency (CBF) in a representative normal small airway chip before and after smoking. Note that normal Gaussian distribution changes to a flattened, non- normal distribution after smoke exposure. (Fig. 12B) A plot of the deviations from the median of ciliary beating frequencies measured in normal bronchiolar epithelium in the absence (-) or presence (+) of exposure to whole cigarette smoke on-chip for 24 hours (data pooled from 2 different human donors with every symbol representing a measurement in one field of view, and approximately 50 fields being analyzed for each condition). (Fig. 12C) A plot showing the fold change in variance of ciliary beating frequencies in normal airway epithelium cultured in the absence (-) or presence (+) of exposure to whole cigarette smoke on-chip (left) compared to similar results obtained with normal airway epithelium cultured in a Transwell insert at an air-liquid interface before (ALI) and after (all results at right) being submerged in culture medium and exposed to 0, 1, 2 or 4% cigarette smoke extract (CSE; ***p<0.001). n.s.: not significant.
[0075] Figs. 13A-13C. Testing biological effects of e-cigarette smoke using the small airway-on-a-chip. (Fig. 13A) Real-time PCR analysis did not detect a significant change in expression of (HMOX1) when normal lung epithelium was exposed on-chip to smoke generated from e-cigarettes generated and inhaled under the same regimen as 3R4F tobacco cigarettes, as shown in Fig. 2 (pooled data from 2 human donors with 3-4 biological replicates per donor; n = 8). (Fig. 13B) CBF Distributions in a representative normal small airway chip exposed to e-cigarette smoke (e-smoking) versus that observed in a nonsmoking chip. (Fig. 13C) A graph of the deviations from the median of CBF measured in normal bronchiolar epithelium in the absence (-) or presence (+) of exposure to e-cigarette smoke for 24 hours (left) and the fold-change in variance of the ciliary beating frequencies measured under these conditions (right).
[0076] Figs 14A-14B. Modeling smoke-induced COPD exacerbations on-chip. (Fig. 14A) Quantitation of changes in secretion of interleukin 8 (IL-8) in small airway chips lined with bronchiolar epithelial cells isolated from normal or COPD patients with or without exposure to whole cigarette smoke for 75 min (Smoking) (**p<0.01; pooled data from 5 human donors, with 2-5 biological replicates per donor; n=l 1). (Fig. 14B) Graph showing relative expression levels for the 10 genes that were most significantly upregulated in COPD chips (black bars) or normal chips (white bars) after smoke exposure for 75 min compared with induction of expression levels of the same genes in bronchoscopy samples of bronchiolar epithelial cells from normal human smokers relative to non-smokers (gray bars). Note the close match between results obtained with the chips and the clinical donor samples; metallothionein 1H (MT1H), transmembrane protease serine HE (TMPRSS 11E), small proline-rich protein 3 (SPRR3), repetin (RPTN), ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2 (ATP6V0D2), ankyrin repeat domain 22 (ANKRD22), transmembrane protease, serine 11F (TMPRSS11F), tetraspanin 7 (TSPAN7), neuronal cell adhesion molecule (NRCAM).
[0077] Figs 15A-15B. Morphology of the human ciliated bronchiolar epithelium. Low (Fig. 15A) and high (Fig. 15B) magnification scanning electron micrographs showing the differentiated small airway epithelium formed on-chip, which contains multiple long apical cilia and short microvilli on its apical surface (bar, 10 um).
[0078] Figs 16A-16B. Flow diagram of the smoking chip method and a schematic of the experimental design. (Fig. 16A) Air was flowed through the lit cigarette and cigarette holder (or empty holder in nonsmoking controls) to the mouthpiece and into a smoke reservoir within the smoke as a result of being pulled by an in-line pump. Opening of a valve allowed the smoke or air contained within the smoke reservoir to mix with air introduced from the incubator and then to flow through a second valve permitted the smoke/air to flow in and out of the lumen of the airway channel of the small airway-on-a-chip based on control by the linked microrespirator. (Fig. 16B) In our experiments, primary human airway epithelial cells (hAEC) isolated from normal or COPD patients were cultured in the upper channel of the organ-on-chip with culture medium flowing in both the upper and lower channels (i.e., in a submerged state) for 4 days, and then shifted to an air-liquid interface in the upper channel for 28 days while continuing to flow medium in the lower channel to induce mucociliary differentiation. The differentiated epithelium was then exposed to either humidified 37°C air or smoke generated by nine 3R4F reference cigarettes over a period of 75 min, and analysis was carried out 24 hours later.
[0079] Fig. 17. Assessment of smoke deposition uniformity in the microfluidic channel. Phase contrast imaging of a microfluidic channel after exposure to 2 cigarettes demonstrated highly uniform deposition of particulates along its length.
[0080] Figs 18A-18B. Cigarette smoke-induced oxidative stress on-chip. (Fig. 18A) Western blot depiction of increased phosphorylation of the antioxidant regulator Nrf2 in normal epithelial cells following smoke exposure on-chip. Note reproducibility of data from different donors over independently performed experiments; Exp. : an independent experiment; pNRF2: phosphorylated NRF2; NRF2: nuclear factor (erythroid-derived 2)-like 2; GAPDH: glyceraldehyde 3-phosphate dehydrogenase. (Fig. 18B) A graph showing independent confirmation of upregulation of CYP 1A1 gene expression induced by smoke exposure on-chip by quantitative real-time PCR (* *p<0.01; pooled data from 2 independent normal human donors, with 2 biological replicates per donor, n = 4).
[0081] Figs 19A-19B. Method for analyzing ciliary beating frequency on-chip. Step 1, mapping regions of ciliary beating in top-down brightfield video recordings. A simple way to detect local motion in video recordings - and to distinguish it from global jitter and noise - is to identify pixels whose frame-by-frame brightness changes significantly compared to the average of all pixels. Using this approach, we computed the standard deviation of each pixel's brightness across the entire stack of movie frames (400 frames; 2 seconds of recording time). Values near zero (black) indicate a lack of motion whereas values approaching the maximum of one (white) reveal areas of rapid ciliary beating. Step 2, segmenting the field of view into regions of interest. The motion map in step 1 is thresholded to delineate regions of ciliary beat (in the white areas). For analysis of ciliary beat frequency (CBF), sample points within these regions are selected randomly once every 10 μπι2 (indicated by numbers) (data not shown). Step 3, computing CBFs from brightness signals of sampled pixels. For each sample point, the average CBF is computed from the periodic change of pixel brightness due to ciliary motion, including up to 300 neighboring pixels. Step 4, (Fig. 19A) time -dependent brightness signal of two pixels located within a white rectangle in step 3. The periodic change in brightness corresponds to the ciliary beat pattern at this location. Next, we apply a bandwidth filter to remove low and high frequency noise, and a Hamming window to decrease artifacts due to the finite length of the signal. Then, we conduct Fast Fourier Transform to extract the signal frequency spectrum. Step 5 (Fig. 19B), averaging all signal frequency spectra of sampled region results in a mean power spectrum that peaks at the local beat frequency (here -16 Hz). [0082] Figs 20A-20B. Characterization of COPD-specific responses to cigarette smoke on-chip. (Fig. 20A) Quantitation of changes in secretion of matrix metallopeptidase 1 (MMP-1) in small airway chips lined with bronchiolar epithelial cells isolated from normal or COPD patients in the presence (+) or absence (-) of breathing motions (Breathing) or exposure to whole cigarette smoke for 75 min (Smoking) (*p<0.05, **p<0.01, n.s.: not significant; data from one representative COPD donor from Fig. 14, with 4-5 biological replicates per condition; n = 4-5). (Fig. 20B) Heat map showing relative changes in expression of 8 genes with metallopeptidase activity demonstrating how they were differentially modulated by smoke exposure in a consistent manner in 3 normal chips and 4 COPD chips; pregnancy- associated plasma protein A (PAPPA), matrix metallopeptidase 2 (MMP2), a disintegrin and metalloproteinase domain 19 (ADAM 19), matrix metallopeptidase 13 (MMP13), a disintegrin and metalloproteinase domain 28 (ADAM28), a disintegrin-like and metalloprotease with thrombospondin type 1 motif 1 (ADAMTS1), carboxypeptidase A4 (CPA4). PAPPA, MMP2, ADAM 19, MMP13 and ADAM28 are down regulated, ie. decreased expression in the COPD patients. ADAMTS1, MMP1 and CPA4 are upregulated, ie. increased expression in the COPD patients.
DETAILED DESCRIPTION
[0083] Embodiments of various aspects described herein are, in part, based on the discovery that macrophage colony stimulating factor (M-CSF) is a novel biomarker for virus-induced exacerbation in chronic obstructive pulmonary disease (COPD). In one aspect, the inventors have applied human lung small airway-on-a-chip technology, e.g., as described in the PCT Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety, to reconstruct healthy and COPD diseased epithelia on-chip. The inventors have regenerated 3- dimensional well-differentiated, mucociliary bronchiolar epithelium - cells of the small airway where the damage in COPD airways typically occurs - in vitro in a microfluidic device, e.g., as described in the PCT Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated by reference in its entirety. The inventors then used exogenous stimuli to mimic pathogenic infections in order to simulate bacterium- and virus-triggered exacerbation phenotypes. For example, in one embodiment, the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with bacterial infection mimic, e.g., lipopolysaccharide (LPS) endotoxin, to mimic Gram negative bacteria-induced exacerbation. In one embodiment, the inventors stimulated the differentiated bronchiolar epithelium (healthy and COPD epithelium) with virus mimic, e.g., polyinosinic:polycytidylic (poly I:C) acid, to mimic respiratory virus-induced exacerbation. By analyzing secreted cytokine and chemokines from healthy and COPD epithelium with or without exacerbation, the inventors discovered that stimulation with LPS and poly I:C significantly upregulated secretion of interleukin 8 (IL-8) and macrophage colony-stimulating factor (M-CSF), respectively, in COPD airway cells, but it did not produce any significant change in the healthy airway epithelial cells.
[0084] In one aspect, the inventors have discovered that virus and not bacterial mimic challenge can induce M-CSF secretion from COPD epithelial cells, and that COPD and not healthy cells induced M- CSF secretion upon viral -mimic challenge. Thus, the inventors have identified M-CSF as a novel biomarker for viral exacerbation, which can be distinguished from bacteria-induced COPD exacerbation. Based on the expression level of M-CSF, alone or in combination with IL-8 level, in a sample from a COPD subject, a clinician can differentially diagnose the cause of exacerbation (acute excessive inflammatory reaction) in COPD patients and therefore select an appropriate treatment to target the culprit of the exacerbation. For example, when virus is determined as the cause of COPD exacerbation based on an increased level of M-CSF in a COPD subject, a clinician can include an anti -viral agent in the treatment but not necessarily any antibacterial agents such as antibiotics. In addition, since normal healthy epithelium did not produce M-CSF even when it was stimulated with a viral-like mimic, it is contemplated that virus-induced M-CSF secretion can provide an indicator of whether a subject has COPD or not. For example, if a subject is diagnosed to have a viral infection and determined to exhibit an increased level of M-CSF expression (e.g., by at least about 30% or more as compared to a M-CSF reference such as the level in a healthy subject), the subject can be identified as likely to have COPD. Accordingly, various aspects described herein provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) exacerbations and/or therapy monitoring. Methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from an anti -viral agent or an antibacterial agent are also described herein.
[0085] In other aspects, the inventors have, in part, discovered novel molecular signatures that can be used to detect or identify COPD patients using a non-pulmonary function test (non-PFT) method, where PFT is purely a clinical, not a molecular- or cellular-based, approach, and is currently the gold standard for the COPD diagnosis. In some embodiments, changes in one or more of these novel molecular signatures can occur well before COPD development and thus can provide early diagnosis of COPD. In some embodiments, the novel molecular signatures can be used to distinguish non-infective COPD exacerbations from infective COPD exacerbations. In one aspect, a microfluidic human airway-on-a-chip device (with COPD-derived well-differentiated epithelium cultured therein) was coupled to a smoke generator and a microrespirator in order to simulate breathing tobacco smoke in and out of an airway in vivo. For example, primary airway epithelial cells from healthy (normal non-COPD) and COPD patients were cultured in one of the channels to form an "airway lumen" in a lung airway-on-a-chip device and guided to full differentiation to form mucociliary epithelium under air-liquid interface (ALI). One end portion of the "airway lumen" channel was connected to a respirator device (e.g., a microrespirator) while the other end portion to an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen" channel (e.g., by freshly burning cigarettes to simulate smoking behavior) and thus to challenge airway epithelia cells cultured therein. See, e.g., the U.S. Provisional Application No. 62/141,560, the contents of which is incorporated herein by reference, for information about agent introduction devices such as a cigarette smoke generator and/or respiration devices for analysis of response to shear stress and foreign agents on cells. The cigarette smoke generator simulates smoking behavior by controlling smoking behavior-related parameters such as puff time, inter- puff interval, number of puffs per cigarette, etc. Coupling a lung airway-on-a-chip device to a cigarette smoke generator and a respirator allows users to challenge epithelial cells in the device with cigarette smoke by effectively enabling the device to "breathe" whole fresh cigarette smoke into and out of the device. Cells were then lysed in situ for their whole transcriptome profiling analysis and COPD-specific genes that are differentially (and statistically significant) up-regulated or down-regulated only in COPD airway epithelium upon exposure to cigarette smoke, not in healthy epithelia, were identified and listed in Tables 3-4 herein. The molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, as therapeutic targets or diagnostic biomarkers. Accordingly, some aspects described herein provide for methods for diagnosis and treatment of chronic obstructive pulmonary disease (COPD) and/or therapy monitoring using at least one or more of these novel molecular signatures.
[0086] In a further aspect, molecular signatures as disclosed in Tables 3 and 4 can be used as lung cancer biomarkers. For example, several genes such as Metallothionein 1H (MT1H), Transmembrane Protease, Serine 1 IE (TMPRSS1 IE) and Small Proline-Rich Protein 3 (SPRR3) have been reported to be involved in development of human malignancies, but none of them has been reported to be involved in lung cancer. Accordingly, in one aspect, one can correlate their expression or secretion to lung cancers.
[0087] Methods of diagnosis, treatment, therapy monitoring, and drug screening involving expression level of M-CSF
[0088] In one aspect, a method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to an anti-viral agent is described herein. The method comprises: (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject to be likely to be more responsive to an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject to be more likely to respond to an alternative treatment without the anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
[0089] Macrophage colony-stimulating factor (M-CSF) is also known as the colony stimulating factor 1 (CSF1). M-CSF is a cytokine (an inflammatory factor) that one of its functions is to accelerate maturation of immune cells to macrophages. As used herein, the term "M-CSF" generally refers to an M- CSF polypeptide or an M-CSF polynucleotide that is similar or identical to the sequence of a wild-type M-CSF.
[0090] In some embodiments, the term "M-CSF" refers to a M-CSF polypeptide having an amino acid sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type M-CSF, and is capable of inducing macrophage differentiation.
[0091] In some embodiments, the term "M-CSF" refers to a M-CSF polynucleotide having a nucleotide sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type M-CSF or a portion thereof, and encodes a M-CSF polypeptide as described herein.
[0092] As used herein, the phrase "more likely to be responsive" generally refers to likelihood of a subject to respond to a treatment. By way of example only, in accordance with one aspect of the discovery, upregulation of macrophage colony-stimulating factor (M-CSF) is a biomarker for virus- induced COPD exacerbation. By determining the level of M-CSF expression, one can determine if a COPD exacerbation is induced by virus. If a COPD subject is diagnosed with virus-induced exacerbation, the subject will be more likely to respond to an anti-viral therapy than to an antibacterial therapy.
[0093] As used herein, the term "expression" refers to the protein or mRNA amount of a target molecule (e.g., M-CSF, IL-8, and/or any molecule disclosed in Tables 3-4 herein) in a sample.
[0094] As used herein, the term "reference" refers to a pre-determined value for the level of expression or activity of a target molecule to be measured, which can be used in comparison with the expression or activity of the target molecule measured from a subject's sample. In the methods of various aspects described herein, a reference used for comparison to measured levels of M-CSF or IL-8 activity or expression in a subject's sample can be determined from a healthy subject, or from a subject who has shown responsiveness to a treatment. In some embodiments, a reference can correspond to the level of expression or activity of the target molecule (e.g., M-CSF or IL-8) in a healthy subject. The term "healthy subject" generally refers to a subject who has no symptoms of any diseases or disorders, or who is not identified with any diseases or disorders, or who is not on any medication treatment, or a subject who is identified as healthy by a physician based on medical examinations. In some embodiments, a reference can correspond to the level of expression or activity of the target molecule (e.g., M-CSF or IL- 8) at a prior time point in a subject from which a sample is derived or obtained. In some embodiments, a reference can correspond to the level of expression or activity of the target molecule (e.g., M-CSF or IL- 8) before the onset of the COPD exacerbation in a subject. In some embodiments, a reference can correspond to a threshold level of expression or activity of the target molecule (e.g., M-CSF or IL-8), above or below which the level of expression or activity of the target molecule (e.g., M-CSF or IL-8) measured in a subject's sample would indicate the likelihood of a subject to respond to a treatment. In some embodiments, a reference can be a standard numeric level or threshold.
[0095] Accordingly, in some embodiments, the M-CSF reference can correspond to the level of expression or activity of M-CSF in a healthy subject. In some embodiments, the M-CSF reference can correspond to a threshold level of expression or activity of M-CSF, above which the level of M-CSF expression activity measured in a subject's sample would indicate the likelihood of a subject with COPD exacerbation to respond to an anti-viral treatment. When the level of M-CSF activity or expression is greater than the M-CSF reference, e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be more likely to be responsive to an anti-viral agent. In some embodiments, when the level of M-CSF activity or expression is greater than the M-CSF reference, e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3 -fold, at least about 4-fold, at least about 5 -fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50- fold, at least about 100-fold, or more, the subject can be identified to be more likely to be responsive to an anti -viral agent. On the other hand, when the level of M-CSF activity or expression is substantially the same as or less than the M-CSF reference, e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or less, the subject is identified as likely to respond to an alternative COPD treatment without any anti-viral agent.
[0096] In various aspects described herein, methods for measuring M-CSF or a fragment thereof from a sample are known in the art, including, but not limited to mRNA expression using PCR or real-time PCR, protein analysis using western blot, immunoassay, and/or ELISA, and/or sequencing analysis. Thus, in some embodiments, nucleic acid molecules can be isolated from a subject's sample to measure M-CSF mRNA expression, or proteins can be isolated to measure M-CSF protein expression.
[0097] In some embodiments, the method can further comprise administering to the subject a treatment based on the expression level of M-CSF in the identifying step.
[0098] In some embodiments of this aspect and other aspects described herein, the therapeutic agents (e.g., an anti-viral agent, alone or in combination with an agent that reduces airway inflammation) can be administered to a subject by any mode of administration that delivers the agent systemically or to a desired surface, organ, or target, and can include, but is not limited to injection, infusion, instillation, and inhalation administration. To the extent that such agents can be protected from inactivation in the gut, oral administration forms are also contemplated. "Injection" includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion.
[0099] In some embodiments, the anti-viral agent, alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators) can be administered by inhalation.
[0100] In some embodiments, the anti-viral agent, alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators) can be administered orally.
[0101] In some embodiments, the anti-viral agent, alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators) can be administered by intravenous injection.
[0102] As used herein, the term "in combination with" or "co-administer" in the context of therapy administration generally refers to administrating a first agent and at least a second agent. The first agent and the second agent can be administered concurrently or simultaneously (e.g., in the same or separate unit dosage forms), or separately at different times. The first agent and the second agent can be administered by the same or different route.
[0103] In some embodiments, when the expression level of M-CSF is greater than the M-CSF reference, the subject is not administered an anti -bacterial agent. Thus, administration of unnecessary antibiotics can be prevented. As used herein, the term "anti-bacterial agent" or "anti-bacterial therapy" refers to an agent that has bactericidal and/or bacteriostatic activity. The anti-bacterial agent can be naturally occurring or synthetic. In some embodiments, an anti-bacterial agent or therapy can comprise an antibiotic, e.g., to suppress the growth of other microorganisms. Non-limiting examples of anti-bacterial agents include β- lactam antibacterial agents including, e.g., ampicillin, cloxacillin, oxacillin, and piperacillin, cephalosporins and other cephems including, e.g., cefaclor, cefamandole, cefazolin, cefoperazone, cefotaxime, cefoxitin, ceftazidime, ceftriaxone, and cephalothin; carbapenems including, e.g., imipenem and meropenem; and glycopeptides, macrolides, quinolones, tetracyclines, and aminoglycosides . In general, if an antibacterial agent is bacteriostatic, it means that the agent essentially stops bacterial cell growth (but does not necessarily kill the bacteria); if the agent is bacteriocidal, it means that the agent kills the bacterial cells (and may stop growth before killing the bacteria).
[0104] The inventors have discovered that COPD epithelium stimulated with a bacterial agent (e.g., LPS) does not significantly increase M-CSF, but significantly up-regulate IL-8 instead. Accordingly, in some embodiments, the method can further comprise measuring expression level of IL-8 in the sample. The subject is optionally further administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
[0105] In some embodiments, the treatment administered to the subject can further comprise an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations. Examples of an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof.
[0106] As used herein, an "anti-viral agent" or "anti-viral therapy" is generally an agent or a therapy that kills or inhibits cellular process, development and/or replication of a target virus. For example, an antiviral agent can be an agent that interferes with one or more viral components and/or interferes with replication or propagation of a virus. Examples of anti-viral agents include, but are not limited to, virus protein specific antibodies, reverse transcriptase inhibitors, protease inhibitors, immunomodulatory agents (e.g., cytokines, various nucleoside analogs, and/or Zn2+), plant extracts demonstrated to have an antiviral effect, and any combinations thereof. In some embodiments, the anti-viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability. Examples of anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof. In one embodiment, the anti-viral agent can comprise 2-methoxy-N- (3-methyl-2 oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof.
[0107] In some embodiments of this aspect and other aspects described herein, the M-CSF or IL-8 reference can correspond to a level in a healthy subject.
[0108] In some embodiments of this aspect and other aspects described herein, the M-CSF or IL-8 reference can correspond to a level in the subject before onset of the COPD exacerbation.
[0109] In some embodiments, the sample can be fluid sample. For example, the fluid sample can comprise a blood or serum sample. [0110] In another aspect, a method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject is described herein. The method comprises: administering to a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, an effective amount of an anti-viral agent that reduces the M-CSF expression level.
[0111] In some embodiments of this aspect and other aspects described herein, the subject can exhibit an increased expression of M-CSF, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation). In some embodiments, the subject can exhibit an increased expression of M-CSF, e.g., by at least about 1.1-fold or more, including, e.g., at least about 1.5- fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold or more, as compared to a M-CSF reference (e.g., the M-CSF level in a healthy subject or in the subject before onset of the COPD exacerbation).
[0112] The term "effective amount" as used herein refers to the amount of a therapeutic agent (e.g., an anti-viral agent) needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect, e.g., reducing COPD exacerbation or reducing M-CSF level, for example. The term "therapeutically effective amount" therefore refers to an amount of a therapeutic agent (e.g., an anti-viral agent) using the methods as disclosed herein, that is sufficient to effect a particular effect when administered to a subject. An effective amount as used herein would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom of disease (for example but not limited to slow the progression of a symptom of the disease), or reverse a symptom of disease. Thus, it is not possible to specify the exact "effective amount". However, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.
[0113] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dosage can vary depending upon the dosage form employed and the route of administration utilized. The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50/ED50. Compositions and methods that exhibit large therapeutic indices are preferred. A therapeutically effective dose can be estimated initially from cell culture assays. In some embodiments, a therapeutically effective dose can be estimated using the methods described in the Examples. For example, COPD cells stimulated with a viral agent can be treated with different doses of an anti-viral agent, and the expression level of M-CSF can be measured to determine the appropriate concentration that is sufficient to reduce the M-CSF level or to restore to the M-CSF level before the onset of the stimulation, or to restore to the M-CSF level present in the unstimulated COPD cells, or normal cells. Also, a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of an anti -viral agent), which achieves a half-maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model. Levels in plasma can be measured, for example, by high performance liquid chromatography. The effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
[0114] In some embodiments, the subject can be further administered an agent that reduces airway inflammation and/or any art-recognized pharmacologic management of COPD exacerbations. Examples of an agent that reduces airway inflammation and/or pharmacologic management of COPD exacerbations include, but are not limited to, oxygen supplementation, bronchodilators (e.g., beta2 agonists), anticholinergics (e.g., ipratropium), corticosteroids, methylxanthines (e.g., aminophylline, theophylline), and a combination of two or more thereof.
[0115] In some embodiments, the anti -viral agent can be any agent, drug or compound that prevents viral replication and/or host-infective capability. Examples of anti-viral agents include, but are not limited to PI3K inhibitors, bromodomain containing protein 4 (BRD4) inhibitors of NFKB signaling, steroids, agents that prevent replication and/or host-infective capability of rhinovirus, and/or respiratory syncytial virus, non-antibacterial therapeutics, and a combination of two or more thereof. In one embodiment, the anti-viral agent can comprise 2-methoxy-N-(3 -methyl -2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
[0116] A method of treating a patient diagnosed with COPD that exhibits an increased expression level of M-CSF and/or monitoring treatment therapy is also provided herein. The method comprises: (a) determining a first expression level of M-CSF in a sample from a subject diagnosed with COPD that exhibits an increased expression level of M-CSF; (b) administering an anti-viral agent; (c) determining a second expression level of M-CSF after the administering; and (d) comparing the first and second expression levels of M-CSF. The anti-viral agent is effective if the second expression level is lower that the first expression level, and wherein the anti-viral therapy is ineffective if the second expression level is the same as or higher than said first expression level.
[0117] M-CSF expression and/or activity is "decreased" or "lower" as compared to a first level in the absence of an anti-viral agent if the amount or expression, or one or more signaling activities or downstream read-outs of M-CSF expression or activity is reduced by a statistically significant amount, such as by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100%, in the presence of an agent (e.g., an anti-viral agent) relative to the absence of such agent. As will be understood by one of ordinary skill in the art, in some embodiments, if M-CSF expression and/or activity is decreased or reduced, some downstream read-outs will decrease but others can increase (i.e. things that are normally suppressed by M-CSF expression and/or activity), and the converse would be in those embodiments where M-CSF expression and/or activity is increased.
[0118] Conversely, M-CSF expression and/or activity is "increased" or "higher" as compared to a first level in the absence of an anti-viral agent if the amount or expression, or one or more signaling activities or downstream read-outs of M-CSF expression and/or activity is increased by a statistically significant amount, for example by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100% or more, at least 2-fold, at least 3 -fold, at least 4-fold, at least 5 -fold, at least 6- fold, at least 7-fold, at least 8-fold, at least 9-fold,at least 10-fold, at least 50-fold, at least 100-fold, or more, in the presence of an agent (e.g., an anti-viral agent), relative to the absence of such agent.
[0119] In some embodiments, the method can further comprise, when the anti -viral agent is effective, continuing to administer the agent.
[0120] In some embodiments, the method can further comprise, when the anti-viral agent is ineffective, discontinuing the agent.
[0121] In some embodiments, the method can further comprise, when the anti-viral agent is ineffective, administering the agent at a higher dose.
[0122] In some embodiments, the method can further comprise, when the anti-viral agent is ineffective, administering a different anti-viral agent.
[0123] In a further aspect, a method of identifying an agent for reducing at least one symptom of a viral- induced COPD exacerbation is described herein. The method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a virus-mimic agent; (c) measuring expression level of M-CSF in a sample; and (d) identifying the test agent as an effective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is same as or lower than a M- CSF reference; or identifying the test agent as an ineffective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is higher than the M-CSF reference.
[0124] In some embodiments, the method can further comprise measuring expression level of IL-8 in the sample. The identified effective agent can display the expression level of IL-8 same as or lower than an IL-8 reference. The identified ineffective agent can display the expression level of IL-8 greater than the IL-8 reference.
[0125] In some embodiments, the sample can comprise a culture medium sample.
[0126] In some embodiments, the COPD-mimic cells can be derived from a subject diagnosed with
COPD.
[0127] In some embodiments, the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent. Examples of COPD-phenotype inducing agents include, but are not limited to cigarette smoke and its derivatives (e.g., but not limited to cigarette smoke extract, cigarette smoke condensate, whole mainstream fresh cigarette smoke, passive second hand cigarette smoke), removal of certain nutrients and/or cell culture medium supplements such as retinoic acid, etc.
[0128] In some embodiments, the virus-mimic agent can comprise any agent that induces or activates innate immune receptor(s) involved in an anti-viral response. Examples of virus-mimic agents include, but are not limited to synthetic analogues of double-stranded RNA (e.g., polyinosinic:polycytidylic acid), ligands and/or agonists for melanoma differentiation-associated protein 5 (MDA-5), ligands and/or agonists for retinoic acid inducible gene (RIG-1), ligands and/or agonists for NOD-like receptors (NLR), ligands and/or agonists for members of TOLL-like receptors (TLR) such as TLR-7, TLR-8, and TLR-9, viral mimics such as inactivated viral particles (e.g., UV-inactivated human rhinovirus or fixed virus), whole live virus, and a combination of two or more thereof.
[0129] In some embodiments, the COPD-mimic cells can be grown in a microfluidic device. An exemplary microfluidic device can comprise an organ-on-a-chip device. In some embodiments, the organ-on-a-chip device can comprise a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber. Such exemplary organ-on-a-chip device includes any device described in the International Patent App. No. PCT/US2014/07161 1 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety.
[0130] The inventors have also found that when the virus mimic-stimulated COPD epithelial cells were treated with a Bromodomain Containing Protein 4 (BRD4) inhibitor of NFKB signaling (e.g., 2-methoxy- N-(3 -methyl -2 -oxo- l,2-dihydroquinolin-6-yl)benzenesulfonamide), the BRD4 inhibitor surprisingly suppressed neutrophil adhesion by more than 70%. Accordingly, a method of treating chronic obstructive pulmonary disease (COPD) exacerbation induced by a microbial infection in a subject is also provided herein. The method comprises: administering to the subject a pharmaceutical composition comprising a bromodomain containing protein 4 (BRD4) inhibitor of NFK B signaling. In some embodiments, the BRD4 inhibitor can comprise 2-methoxy-N-(3-methyl-2 oxo-l,2-dihydroquinolin-6- yl)benzenesulfonamide or a derivative thereof.
[0131] In some embodiments, the microbial infection can be a viral-induced infection.
[0132] As used herein, the terms "treat," "treatment," "treating," refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder, such as COPD exacerbation. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" if the progression of a disease is reduced or halted. That is, "treatment" includes not just the improvement of symptoms or markers, but also a cessation of at least slowing of progress or worsening of symptoms that would be expected in absence of treatment. Beneficial or desired clinical results include, but are not limited to alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
[0133] In one aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation, and (b) administering an appropriate treatment to the subject depending on the result of step (a). In some embodiments, the causes are viral, bacterial and/or non-infectious agent dependent. In some embodiments, when the cause is viral, then an anti-viral agent is administered; when the cause is bacterial, then an anti-bacterial agent is administered; and when the cause is non- infectious agent dependent, then an anti-inflammation agent is administered. In other embodiments, an anti -inflammation agent is administered in conjunction with an anti -bacterial agent and/or anti-viral agent to help with the exacerbation.
[0134] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-viral agent; and (b) administering an anti-viral agent when it is identified that the subject is likely to be responsive to an anti-viral agent in step (a).
[0135] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-bacterial agent; and (b) administering an anti-bacterial agent when it is identified that the subject is likely to be responsive to an anti-viral agent in step (a).
[0136] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to a treatment for non-infective COPD exacerbation (e.g. an anti -inflammation agent); and (b) administering an alternative treatment for infective COPD exacerbation when it is identified that the subject is likely to be responsive to a treatment for non-infective COPD exacerbation in step (a).
[0137] In one aspect of the treatment method described, identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the cause is likely a viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the cause is non- viral when the expression level of M-CSF is same as or lower than the M-CSF reference.
[0138] In one aspect of the treatment method described, identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, and (c) identifying the cause is likely a bacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the cause is likely to respond to non-bacterial when the expression level of IL-8 is same as or lower than the IL-8 is reference.
[0139] In one aspect of the treatment method described, identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the cause is likely a non-infective agent or non-infectious agent related when the expression level of the gene(s) is greater than the corresponding reference; or identifying the cause is likely an infectious agent when the expression level of the gene(s) is same as or lower than the corresponding reference. [0140] In one aspect of the treatment method described, identifying, classifying or distinguishing the cause of the COPD exacerbation in the subject who is diagnosed with the COPD exacerbation comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the cause is likely a non-infectious agent or non-infectious agent related when the expression level of the gene(s) is lower than the corresponding reference; or identifying the cause is likely an infectious when the expression level of the gene(s) is same as or greater than the corresponding reference.
[0141] In one aspect of the treatment method described, identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-viral agent comprises (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti -viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
[0142] In one aspect of the treatment method described, identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to an anti-bacterial agent comprises comprises (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, and (c) identifying the subject is likely to be more responsive to an anti-bacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 is reference.
[0143] In one aspect of the treatment method described, identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to a treatment for non-infective COPD exacerbation comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference.
[0144] In one aspect of the treatment method described, identifying whether a subject who is diagnosed with the COPD exacerbation is more likely to be responsive to a treatment for non-infective COPD exacerbation comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference.
[0145] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, (c) identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; (d) and administering an appropriate anti-viral agent or an appropriate alternative treatment without an antiviral agent based on the results of step (c).
[0146] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, (c) administering an appropriate antiviral agent/treatment when the expression level of M-CSF is greater than the M-CSF reference; or the subject is not administered an anti -viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
[0147] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, (c) identifying the subject is likely to be more responsive to an anti-bacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 is reference; (d) and administering an appropriate anti-bacterial agent or an appropriate alternative treatment without an antibacterial agent based on the results of step (c).
[0148] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of IL-8 is in a sample from the subject; (b) comparing the expression level of IL-8 is in the sample with a IL-8 reference, (c) administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
[0149] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference; (d) and administering an appropriate anti-bacterial or anti-viral agent treatment, or an appropriate treatment without an anti-bacterial or anti-viral agent based on the results of step (c).
[0150] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference; (d) and administering an appropriate anti-bacterial or anti-viral agent treatment, or an appropriate treatment without an anti -bacterial or anti -viral agent based on the results of step (c).
[0151] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; comparing the expression level of M-CSF in the sample with a M-CSF reference, identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; (b) measuring expression level of IL-8 is in a sample from the subject; comparing the expression level of IL- 8 is in the sample with a IL-8 reference, identifying the subject is likely to be more responsive to an antibacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an anti -bacterial agent when the expression level of IL-8 is same as or lower than the IL-8 is reference; and (c) administering an appropriate treatment to the subject depending on the result of steps (a) and (b).
[0152] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject, and comparing the expression level of M-CSF in the sample with a M-CSF reference; (b) measuring expression level of IL-8 is in a sample from the subject, and comparing the expression level of IL-8 is in the sample with a IL-8 reference; and (c) administering an appropriate anti-viral agent/treatment when the expression level of M- CSF is greater than the M-CSF reference; or the subject is not administered an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; or administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL- 8 reference.
[0153] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference; (iii) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference; (b) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (iii) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference; and (c) administering an appropriate treatment to the subject depending on the result of steps (a) and (b).
[0154] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) measuring expression level of M-CSF in a sample from the subject; comparing the expression level of M-CSF in the sample with a M-CSF reference, identifying the subject is likely to be more responsive to an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject is likely to be more responsive to an alternative treatment without an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference; (b) measuring expression level of IL-8 is in a sample from the subject; comparing the expression level of IL- 8 is in the sample with a IL-8 reference, identifying the subject is likely to be more responsive to an antibacterial agent when the expression level of IL-8 is greater than the IL-8 is reference; or identifying the subject is more likely to respond to an alternative treatment without an anti -bacterial agent when the expression level of IL-8 is same as or lower than the IL-8 is reference; (c) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference; (iii) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference; (d) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (iii) identifying the subject is likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject is more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference; and (e) administering an appropriate treatment to the subject depending on the result of steps (a), (b), (c) and (d).
[0155] In another aspect, provided herein is a method of treating COPD exacerbation in a subject comprising (a) identifying a subject who is likely to have COPD; and (b) administering an appropriate treatment to the subject depending on the result of step (a). In some embodiments, the causes are viral, bacterial and/or non-infectious agent dependent. In some embodiments, when the cause is viral, then an anti-viral agent is administered; when the cause is bacterial, then an anti-bacterial agent is administered; and when the cause is non- infectious agent dependent, then an anti-inflammation agent is administered. In other embodiments, an anti-inflammation agent is administered in conjunction with an anti-bacterial agent and/or anti-viral agent to help with the exacerbation.
[0156] In one aspect of the treatment method described, identifying a subject who is likely to have COPD, comprises: (a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or lower than the corresponding reference. In one embodiment, the subject has not been diagnosed with COPD. In another embodiment, the subject has not previously been treated for COPD. In another embodiment, the subject presents symptoms of COPD but has not been diagnosed with COPD. In another embodiment, the subject presents symptoms of COPD but has not previously been treated for COPD. In another embodiment, the subject presents symptoms of COPD. In another embodiment, the subject at present has no symptoms of COPD but is at risk of having COPD. In some embodiments, at risk individual for having COPD or developing COPD include but are not limited to smokers, people who work in places where the air quality is unhealthy or contaminated, e.g. shipyards, chemical plant, chemical or oil refinery, nail salons, wood working and carpentry, floor sanding, upholstery, fabric dye etc.
[0157] In one aspect of the treatment method described, identifying a subject who is likely to have COPD, comprises (a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference. In another embodiment, the subject has not previously been treated for COPD. In another embodiment, the subject presents symptoms of COPD but has not been diagnosed with COPD. In another embodiment, the subject presents symptoms of COPD but has not previously been treated for COPD. In another embodiment, the subject presents symptoms of COPD. In another embodiment, the subject at present has no symptoms of COPD but is at risk of having COPD. In some embodiments, at risk individual for having COPD or developing COPD include but are not limited to smokers, people who work in places where the air quality is unhealthy or contaminated, e.g. shipyards, chemical plant, chemical or oil refinery, nail salons, wood working and carpentry, floor sanding, upholstery, fabric dye etc.
[0158] In another aspect, provided herein is a method of treating COPD in a subject comprising (a) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference; (iii) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or lower than the corresponding reference; (b) (i) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (ii) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (iii) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference; and (c) administering an appropriate treatment to the subject depending on the result of steps (a) and (b). In another embodiment, the subject has not previously been treated for COPD. In another embodiment, the subject presents symptoms of COPD but has not been diagnosed with COPD. In another embodiment, the subject presents symptoms of COPD but has not previously been treated for COPD. In another embodiment, the subject presents symptoms of COPD. In another embodiment, the subject at present has no symptoms of COPD but is at risk of having COPD. In some embodiments, at risk individual for having COPD or developing COPD include but are not limited to smokers, people who work in places where the air quality is unhealthy or contaminated, e.g. shipyards, chemical plant, chemical or oil refinery, nail salons, wood working and carpentry, floor sanding, upholstery, fabric dye etc.
Methods of diagnosis, treatment, therapy monitoring, and drug screening involving expression level of molecular signatures as disclosed in Tables 3-4 herein
[0159] In some aspects, methods of identifying a subject who is likely to have, or have a risk for, chronic obstructive pulmonary disease (COPD) based in part on the novel molecular signatures as listed in 3 and 4 are described herein. Each gene as disclosed in Tables 3-4 generally refers to a polypeptide encoded by the corresponding gene or a polynucleotide encoding the corresponding gene that is similar or identical to the sequence of a wild-type gene. For example, a polypeptide encoded by a gene as disclosed in Tables 3-4 herein can have an amino acid sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type polypeptide, and is capable of performing a biological function as in the wild-type polypeptide. A polynucleotide encoding a gene as disclosed in Tables 3-4 herein can have a nucleotide sequence that is at least 70% or more (including at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100%) identical to that of a wild-type gene or a portion thereof, and encodes the corresponding polypeptide.
[0160] In one aspect, a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s). In some embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects. In some embodiments, the method can be used to identify a smoker subject who is more susceptible to COPD. In these embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non-COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
[0161] In some embodiments, the method can comprise measuring expression level of at least one gene or a combination of two or more genes selected from the group consisting of MT1H, TMPRSS 1 1E, MMP1, SPRR3, RPTN, ATP6V0D2, ANKRD22, TMPRSS 1 IF, TSPAN7, NRCAM.
[0162] As used herein, the term "a combination of two or more genes" refers to a combination of at least 2 or more molecular signatures designed by gene symbols as disclosed in Table 3 and/or Table 4. For example, the activity and/or expression level of at least 2 or more (including, e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30 or more) molecular signatures as disclosed in Table 3 and/or Table 4 can be measured from a sample of a subject to be diagnosed or treated.
[0163] When the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be likely to have, or have a risk for COPD. In some embodiments, when the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more, the subject can be identified to be likely to have, or have a risk for, COPD. On the other hand, when the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is substantially the same as or lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified as unlikely to have COPD.
[0164] In another aspect, a method of identifying a subject who is likely to have, or have a risk for, COPD comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference(s); or identifying the subject to be unlikely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference(s). In some embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one healthy subject or expression levels of the corresponding gene(s) in a population of healthy subjects. In some embodiments, the method can be used to identify a smoker subject who is more susceptible to COPD. In these embodiments, the reference used for comparison can correspond to expression level of the corresponding gene(s) in at least one non-COPD smoker subject or expression levels of the corresponding gene(s) in a population of non-COPD smoker subjects.
[0165] In some embodiments, the method can comprise measuring expression level of at least one gene or a combination of two or more genes comprising CFTR.
[0166] When the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified as likely to have, or have a risk for, COPD. On the other hand, when the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is substantially the same as or greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be unlikely to have COPD. In some embodiments, when the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3 -fold, at least about 4-fold, at least about 5 -fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more, the subject can be identified to be unlikely to have COPD.
[0167] In various aspects described herein, methods for measuring any molecular signatures as disclosed in Tables 3-4 or a fragment thereof from a sample are known in the art, including, but not limited to mR A expression using PCR or real-time PCR, protein analysis using western blot, immunoassay, and/or ELISA, and/or sequencing analysis. Thus, in some embodiments, nucleic acid molecules can be isolated from a subject's sample to measure mRNA expression, or proteins can be isolated to measure protein expression.
[0168] In some embodiments of these aspects, the method can further comprise administering to the subject a COPD treatment when the subject is identified to be likely to have, or have a risk, for COPD. The treatment can be administered to the subject by any mode of administration that delivers the agent systemically or to a desired surface, organ, or target, and can include, but is not limited to injection, infusion, instillation, and inhalation administration. To the extent that such agents can be protected from inactivation in the gut, oral administration forms are also contemplated.
[0169] A bronchoscopy sample or a fluid sample (e.g., a blood or serum) can be collected or derived from the subject to perform the diagnosis methods described herein.
[0170] In some embodiments, at least one or more of the genes as listed in Tables 3-4 herein can be used to discriminate between infectious (e.g., caused by viruses or bacteria) and non-infectious (e.g., cigarette smoke-induced as an example of non-infectious cause) causes of COPD exacerbations. For example, when a gene as listed in Tables 3-4 does not differentially expressed in COPD cells upon exposure to an infectious agent (e.g., a virus and/or a bacterium), as compared to COPD cells without exposure to an infectious agent (e.g., a virus and/or a bacterium), the gene can be used as a biomarker to differentiate a non-infectious cause of COPD exacerbation from an infectious cause of COPD exacerbation. Accordingly, methods for identifying subjects with COPD exacerbation who are more likely to be responsive to and benefit from a treatment for non-infective COPD exacerbation vs. a treatment for infective COPD exacerbation are also described herein.
[0171] In some aspects, methods of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non- infective COPD exacerbation are described herein. In one aspect, the method comprises: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is greater than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or lower than the corresponding reference(s).
[0172] When the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be more likely to be responsive to a treatment for non-infective COPD exacerbation. In some embodiments, when the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3 -fold, at least about 4-fold, at least about 5 -fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more, the subject can be identified to be more likely to be responsive to a treatment for non-infective COPD exacerbation. On the other hand, when the activity or expression level of the measured gene(s) as disclosed in Table 3 herein is substantially the same as or lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified to be more likely to respond to an alternative treatment for infective COPD.
[0173] In another aspect, the method comprises (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the measured gene(s) in the sample with corresponding reference(s); and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the measured gene(s) is lower than the corresponding reference(s); or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the measured gene(s) is same as or greater than the corresponding reference(s). A bronchoscopy sample or fluid sample (e.g., blood or serum) can be collected from the subject to perform the methods described herein.
[0174] When the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is lower than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more, the subject is identified to be likely to be more responsive to a treatment for non-infective COPD exacerbation. On the other hand, when the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is substantially the same as or greater than the corresponding reference(s), e.g., by at least about 10% or more, including, e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100% or more, the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation. In some embodiments, when the activity or expression level of the measured gene(s) as disclosed in Table 4 herein is greater than the corresponding reference(s), e.g., by at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6- fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more, the subject can be identified is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation.
[0175] In some embodiments of these aspects described herein, the method can further comprise administering to the subject a treatment based on the expression level of the measured gene(s) in the identifying step.
[0176] In some embodiments of these aspects described herein, the treatment for non-infective COPD exacerbation can comprise an agent that reduces airway inflammation.
[0177] In some aspects of these aspects described herein, the method can further comprise, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, determining whether the subject will benefit from an anti -viral therapy or an anti -bacterial therapy as described earlier. If it is determined that bacteria is not a cause of exacerbation in a COPD subject, the COPD subject can avoid taking any unnecessary antibiotics. Stated another way, if it is determined that it is a viral exacerbation, the COPD subject can be administered an anti -viral drug, and not an antibiotic, steroids, corticosteroids, other anti-inflammatory drugs, or any art-recogized treatment for non-infective exacerbation.
[0178] By way of example only, in some embodiments, expression level of M-CSF can be measured in a sample from the subject, wherein the subject is administered an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or the subject is not administered an anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference. Additionally or alternatively, expression level of IL-8 can be measured in a sample from the subject, wherein the subject is administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
[0179] In some embodiments of these aspects described herein, the reference can correspond to expression level of the corresponding gene in healthy subject(s). Alternatively, the reference can correspond to expression level of the corresponding gene in the subject before onset of the COPD exacerbation.
[0180] As the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, as therapeutic targets, methods of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject are also described herein. In one aspect, a treatment method comprises: administering to a subject diagnosed with COPD that exhibits an increased expression level of at least one gene or a combination of two or more genes as listed in Table 3, an agent that reduces the increased expression level of the gene(s) and optionally reduces airway inflammation.
[0181] In some embodiments, the subject can exhibit an increased expression of at least one gene or a combination of two or more genes as listed in Table 3, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a corresponding reference (e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation). In some embodiments, the subject can exhibit an increased expression of at least one gene or a combination of two or more genes as listed in Table 3, e.g., by at least about 1.1-fold or more, including, e.g., at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold or more, as compared to a corresponding reference (e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation).
[0182] In another aspect, a treatment method comprises: administering to a subject diagnosed with COPD that exhibits a decreased expression level of at least one gene or a combination of two or more genes as listed in Table 4, an agent that increases the decreased expression level of the gene(s) and optionally reduces airway inflammation.
[0183] In some embodiments, the subject can exhibit a decreased expression of at least one gene or a combination of two or more genes as listed in Table 4, e.g., by at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more, as compared to a corresponding reference (e.g., the level in a healthy subject or in the subject before onset of the COPD exacerbation).
[0184] In some embodiments, the molecular signatures as listed in Tables 3-4 herein can be used, individually or in any combinations, to monitor treatment progress. Accordingly, some aspects described herein relate to methods for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject. In one aspect, a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from a subject diagnosed with COPD that exhibits an increased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing the first and second expression levels of the gene(s). The treatment for non-infective COPD exacerbation is effective if the second expression level is lower than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is substantially the same as or higher than the first expression level. In another aspect, a method for treating a subject diagnosed with COPD exacerbation or for monitoring efficacy of a treatment in a COPD subject comprises: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from a subject diagnosed with COPD that exhibits a decreased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after the administering; and (d) comparing the first and second expression levels of the gene(s). The treatment for non-infective COPD exacerbation is effective if the second expression level is higher than the first expression level, whereas the treatment for non-infective COPD exacerbation is ineffective if the second expression level is substantially the same as or lower than the first expression level.
[0185] Expression and/or activity of a molecular signature as disclosed in Table 3 or 3 is "decreased" or "lower" as compared to a first level in the absence of a therapeutic agent or a treatment if the amount or expression, or one or more signaling activities or downstream read-outs of the molecular signature expression or activity is reduced by a statistically significant amount, such as by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100%, in the presence of a therapeutic agent or a treatment relative to the absence of such agent or treatment. As will be understood by one of ordinary skill in the art, in some embodiments, if a molecular signature expression and/or activity is decreased or reduced, some downstream read-outs will decrease but others can increase (i.e. things that are normally suppressed by the molecular signature expression and/or activity), and the converse would be in those embodiments where the molecular signature expression and/or activity is increased.
[0186] Conversely, expression and/or activity of a molecular signature as disclosed in Table 3 or 3 is "increased" or "higher" as compared to a first level in the absence of a therapeutic agent or a treatment if the amount or expression, or one or more signaling activities or downstream read-outs of the molecular signature expression and/or activity is increased by a statistically significant amount, for example by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or more, up to and including at least 100% or more, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold,at least 10-fold, at least 50-fold, at least 100-fold, or more, in the presence of a therapeutic agent or a treatment, relative to the absence of such agent or treatment. [0187] When the administered treatment is effective, the method can further comprise continuing administration of the treatment. In contrast, when the administered treatment is ineffective, the ineffective treatment can be discontinued. Instead, a new treatment can be administered to the subject. For example, the same therapeutic agent can be administered at a higher dose and/or a higher frequency, or a different treatment, e.g., for infective COPD exacerbation (e.g., an anti-viral agent or an antibacterial agent), can be administered to the subject.
[0188] In some aspects, the molecular signatures as listed in Tables 3-4 herein, individually or in any combinations, can be used in drug screening. Thus, methods for identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation are described herein. In one aspect, the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or lower than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is higher than the corresponding reference(s). In another aspect, the drug screening method comprises: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 herein in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or greater than corresponding reference(s); or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference(s).
[0189] In some embodiments, the reference can correspond to expression level of the corresponding gene(s) in the COPD-mimic cells prior to contact with the test agent or the non-infective agent. In some embodiments, the reference can correspond to expression level of the corresponding gene(s) in the healthy (non-COPD) cells contacted with the non-infective agent that induces COPD exacerbation.
[0190] A sample used in drug screening methods described herein can be derived from a COPD-mimic cell that is contacted with the test agent and the non-infective agent, and/or a culture medium sample that is exposed to the COPD-mimic cell.
[0191] In some embodiments, the COPD-mimic cells can be derived from a subject diagnosed with COPD, thereby identifying an agent that is personalized to the subject. In some embodiments, the COPD- mimic cells can be derived from established COPD cells. In some embodiments, the COPD-mimic cells can be derived from healthy cells contacted with a COPD-phenotype inducing agent.
[0192] The COPD-mimic cells can be cultured in any cell culture device known in the art. In some embodiments, the COPD-mimic cells can be grown in a microfluidic device such as an organ-on-a-chip device. In some embodiments, the organ-on-a-chip device can comprise a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber. Such exemplary organ-on-a-chip device includes any device described in the International Patent App. No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety.
Sample
[0193] In accordance with various embodiments described herein, a sample, including any fluid or specimen (processed or unprocessed) or other biological sample, can be subjected to the methods of various aspects described herein.
[0194] In some embodiments, the sample can include a biological fluid obtained from a subject. Exemplary biological fluids obtained from a subject can include, but are not limited to, blood (including whole blood, plasma, cord blood and serum), lactation products (e.g., milk), amniotic fluids (e.g., a sample collected during amniocentesis), sputum, saliva, urine, semen, cerebrospinal fluid, bronchial aspirate, perspiration, mucus, liquefied feces, synovial fluid, lymphatic fluid, tears, tracheal aspirate, and fractions thereof. In some embodiments, a biological fluid can include a homogenate of a tissue specimen (e.g., biopsy) from a subject. In one embodiment, a test sample can comprises a suspension obtained from homogenization of a solid sample obtained from a solid organ or a fragment thereof. In some embodiments, the sample can comprise a blood or serum sample.
[0195] In some embodiments, a sample can be obtained from a subject who has or is suspected of having a COPD exacerbation.
[0196] In some embodiments, a sample can be obtained from a subject who is being treated for the COPD exacerbation. In other embodiments, the sample can be obtained from a subject whose COPD exacerbation was treated. In other embodiments, the sample can be obtained from a subject who has a recurrence of COPD exacerbation.
[0197] As used herein, a "subject" can mean a human or an animal. Examples of subjects include primates (e.g., humans, and monkeys). Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cattle, cows, horses, pigs, deer, bison, sheep, goats, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, and avian species, e.g., chicken, ducks, geese, turkeys, emu, ostrich. A subject or a subject includes any subset of the foregoing, e.g., all of the above, or includes one or more groups or species such as humans, primates or rodents. In certain embodiments of the aspects described herein, the subject is a mammal, e.g., a primate, e.g., a human. . A subject can be male or female. The term "subject" does not denote a particular age. Thus, any mammalian subjects from adult (e.g., young adult, middle-aged adult or senior adult) to pediatric subjects (e.g., infant, child, and adolescent) to newborn subjects, as well as fetuses, are intended to be covered. When the term is used in conjunction with administration of a compound or drug, then the subject has been the object of treatment, observation, and/or administration of the compound or drug. The methods and/or pharmaceutical compositions described herein are also contemplated to be used to treat domesticated animals or pets such as cats and dogs.
[0198] In one embodiment, the subject or subject is a mammal. The mammal can be a human, non- human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples. In one embodiment, the subject is a human being. In another embodiment, the subject can be a domesticated animal and/or pet.
[0199] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
Some selected definitions
[0200] As used herein and in the claims, the singular forms include the plural reference and vice versa unless the context clearly indicates otherwise. The term "or" is inclusive unless modified, for example, by "either." Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about." The term "about" with respect to numerical values means within 5%
[0201] As used herein, the term "selected therapy" or "selected treatment" refers to a therapy or treatment selected based on the level and/or activity of a target molecule (e.g., M-CSF and/or IL-8) as measured in a sample of a subject to be treated according to the methods of various aspects described herein. In accordance with one aspect of the discovery, upregulation of macrophage colony-stimulating factor (M-CSF) is a biomarker for virus-induced COPD exacerbation. By determining the level of M- CSF expression, one can determine if a COPD exacerbation is induced by virus, and thus select for the subject an appropriate therapy to which the subject is more likely to respond.
[0202] As used herein, the term "greater than" in the context of an increase in the activity level and/or expression of a target molecule (e.g., M-CSF or IL-8) relative to its corresponding reference (e.g., a M- CSF reference or an IL-8 reference), the increase can be at least about 30% or more, including, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 100% or more. In some embodiments, the increase can be at least about 1.1-fold or more, including, e.g., at least about 2-fold, at least about 3-fold, at least about 4- fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9- fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, or more.
[0203] As used herein, the term "administering," or "administration" refer to the placement of an agent (e.g., an anti-viral agent) into a subject by a method or route which results in at least partial localization of such agents at a desired site, such as a site of inflammation, such that a desired effect(s) is produced.
[0204] The phrases "parenteral administration" and "administered parenterally" as used herein, refer to modes of administration other than enteral and topical administration, usually by injection. The phrases "systemic administration," "administered systemically", "peripheral administration" and "administered peripherally" as used herein refer to the administration of an agent (e.g., an anti-viral agent, alone or in combination with an agent that reduces airway inflammation (e.g., steroids and/or bronchodilators)) other than directly into a target site, tissue, or organ, such as a tumor site, such that it enters the subject's circulatory system and, thus, is subject to metabolism and other like processes.
[0205] All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0206] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 201 1 (ISBN 978-0-91 1910-19-3); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1 -56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305, 9780815345305); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471 142735, 9780471 142737), the contents of which are all incorporated by reference herein in their entireties.
[0207] The present invention can be defined in any of the following numbered paragraphs:
[1] A method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to an anti-viral agent, the method comprising: (a) measuring expression level of M-CSF in a sample from the subject; (b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and (c) identifying the subject to be likely to be more responsive to an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject to be more likely to respond to an alternative treatment without the anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
[2] The method of paragraph [1], further comprising administering to the subject a treatment based on the expression level of M-CSF in the identifying step.
[3] The method of paragraph [1], wherein when the expression level of M-CSF is greater than the M-CSF reference, the subject is not administered an anti-bacterial agent.
[4] The method of any of paragraphs [l]-[3], further comprising measuring expression level of IL-8 in the sample, wherein the subject is further administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
[5] The method of any of paragraphs [2]-[4], wherein the treatment further comprises an agent that reduces airway inflammation.
[6] The method of any of paragraphs [l]-[5], wherein the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
[7] The method of any of paragraphs [l]-[6], wherein the anti-viral agent comprises 2-methoxy-N- (3-methyl-2-oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof
[8] The method of any of paragraphs [l]-[7], wherein the reference corresponds to a level in a healthy subject.
[9] The method of any of paragraphs [l]-[7], wherein the reference corresponds to a level in the subject before onset of the COPD exacerbation.
[10] The method of any of paragraphs [l]-[9], wherein the sample is fluid sample.
[11] The method of paragraph [10], wherein the fluid sample comprises a blood or serum sample.
[12] A method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, an anti-viral agent that reduces the M-CSF expression level, thereby treating COPD exacerbation in the subject.
[13] The method of paragraph [12], wherein the subject is further administered an agent that reduces airway inflammation.
[14] The method of any of paragraphs [12]-[13], wherein the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
[15] The method of any of paragraphs [12]-[14], wherein the anti-viral agent comprises 2-methoxy- N-(3 -methyl -2 -oxo- l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof
[16] A method of treating a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, the method comprising: (a) determining a first expression level of M-CSF in a sample from a subject diagnosed with COPD that exhibits an increased expression level of M- CSF; (b) administering an anti-viral agent; (c) determining a second expression level of M-CSF after said administering; and (d) comparing said first and second expression levels of M-CSF, wherein the anti-viral agent is effective if said second expression level is lower that said first expression level, and wherein the anti-viral therapy is ineffective if said second expression level is the same as or higher than said first expression level.
[17] The method of paragraph [16], further comprising, when the anti -viral agent is effective, continuing to administer the agent.
[18] The method of paragraph [16], further comprising, when the anti-viral agent is ineffective, discontinuing the agent.
[19] The method of paragraph [18], further comprising, when the anti-viral agent is ineffective, administering the agent at a higher dose.
[20] The method of paragraph [18], further comprising, when the anti -viral agent is ineffective, administering a different anti-viral agent.
[21] The method of any of paragraphs [16]-[20], wherein the sample is fluid sample.
[22] The method of paragraph [21], wherein the fluid sample comprises a blood or serum sample.
[23] A method of identifying an agent for reducing at least one symptom of a viral-induced COPD exacerbation comprising: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a virus-mimic agent; measuring expression level of M-CSF in a sample; (c) and identifying the test agent as an effective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is same as or lower than a M-CSF reference; or identifying the test agent as an ineffective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is higher than the M-CSF reference.
[24] The method of paragraph [23], further comprising measuring expression level of IL-8 in the sample, wherein the identified effective agent displays the expression level of IL-8 same as or lower than a IL-8 reference; and the identified ineffective agent displays the expression level of IL-8 greater than the IL-8 reference.
[25] The method of paragraph [23] or [24], wherein the sample is a culture medium sample.
[26] The method of any of paragraphs [23]-[25], wherein the COPD-mimic cells are derived from a subject diagnosed with COPD.
[27] The method of any of paragraphs [23]-[26], wherein the COPD-mimic cells are derived from healthy cells contacted with a COPD-phenotype inducing agent. [28] The method of any of paragraphs [23]-[27], wherein the virus-mimic agent comprises polyinosinic:polycytidylic acid, ligands and/or agonists for melanoma differentiation-associated protein 5 (MDA-5), ligands and/or agonists for retinoic acid inducible gene (RIG-1), ligands and/or agonists for NOD-like receptors (NLR), ligands and/or agonists for members of TOLL- like receptors (TLR) such as TLR-7, TLR-8, and TLR-9, viral mimics such as inactivated viral particles (e.g., UV -inactivated human rhinovirus or fixed virus), whole live virus, and a combination of two or more thereof.
[29] The method of any of paragraphs [23]-[28], wherein the COPD-mimic cells are grown in a microfluidic device.
[30] The method of paragraph [29], wherein the microfluidic device is an organ-on-a-chip device.
[31] The method of paragraph [30], wherein the organ-on-a-chip device comprises a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
[32] A method of treating chronic obstructive pulmonary disease (COPD) exacerbation induced by a microbial infection in a subject comprising administering to the subject a pharmaceutical composition comprising a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling.
[33] The method of paragraph [32], wherein the BRD4 inhibitor comprises 2 -methoxy-N-(3 -methyl - 2-oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof.
[34] The method of paragraph [32] or [33], wherein the microbial infection is a viral-induced infection.
[35] A method of identifying a subject who is likely to have, or have a risk for, chronic obstructive pulmonary disease (COPD), the method comprising: (a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or lower than the corresponding reference.
[36] A method of identifying a subject who is likely to have, or have a risk for, chronic obstructive pulmonary disease (COPD), the method comprising (a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference. [37] The method of paragraph [35] or [36], further comprising administering to the subject a COPD treatment when the subject is identified to be likely to have, or have a risk, for COPD.
[38] The method of any of paragraphs [35]-[37], wherein the reference corresponds to expression level of the corresponding gene in healthy subject(s).
[39] The method of any of paragraphs [35]-[38], wherein the subject is a smoker.
[40] The method of paragraph [39], wherein the reference corresponds to expression level of the corresponding gene in non-COPD smoker(s).
[41] The method of any of paragraphs [35]-[40], wherein the sample is a bronchoscopy sample or a fluid sample.
[42] The method of paragraph [41], wherein the fluid sample comprises a blood or serum sample.
[43] A method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non-infective COPD exacerbation, the method comprising: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference.
[44] A method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non-infective COPD exacerbation, the method comprising: (a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject; (b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and (c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference.
[45] The method of paragraph [43] or [44], further comprising administering to the subject a treatment based on the expression level of the gene(s) in the identifying step.
[46] The method of any of paragraphs [43]-[45], further comprising, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, measuring expression level of M-CSF in a sample from the subject, wherein the subject is administered an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or the subject is not administered an anti-viral agent when the expression level of M- CSF is same as or lower than the M-CSF reference. [47] The method of any of paragraphs [43]-[46], further comprising, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, measuring expression level of IL-8 in the sample, wherein the subject is administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
[48] The method of any of paragraphs [43]-[47], wherein the treatment for non-infective COPD exacerbation comprises an agent that reduces airway inflammation.
[49] The method of any of paragraphs [46]-[48], wherein the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
[50] The method of any of paragraphs [46]-[49], wherein the anti-viral agent comprises 2-methoxy-
N-(3 -methyl -2 -oxo- l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof
[51] The method of any of paragraphs [43]-[50], wherein the reference corresponds to expression level of the corresponding gene in healthy subject(s).
[52] The method of any of paragraphs [43]-[50], wherein the reference corresponds to expression level of the corresponding gene in the subject before onset of the COPD exacerbation.
[53] The method of any of paragraphs [43]-[52], wherein the sample is a bronchoscopy sample or fluid sample.
[54] The method of paragraph [53], wherein the fluid sample comprises a blood or serum sample.
[55] A method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits an increased expression level of at least one gene or a combination of two or more genes as listed in Table 3, a treatment for non-infective COPD exacerbation that reduces the increased expression level of the gene(s), thereby treating COPD exacerbation in the subject.
[56] A method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits a decreased expression level of at least one gene or a combination of two or more genes as listed in Table 4, a treatment for non-infective COPD exacerbation that increases the decreased expression level of the gene(s), thereby treating COPD exacerbation in the subject.
[57] The method of paragraph [55] or [56], wherein the treatment for non-infective COPD exacerbation comprises an agent that reduces airway inflammation.
[58] A method of treating a subject diagnosed with COPD exacerbation, the method comprising: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from a subject diagnosed with COPD that exhibits an increased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing said first and second expression levels of the gene(s), wherein the treatment for non-infective COPD exacerbation is effective if said second expression level is lower that said first expression level, and wherein the treatment for non-infective COPD exacerbation is ineffective if said second expression level is the same as or higher than said first expression level.
[59] A method of treating a subject diagnosed with COPD exacerbation, the method comprising: (a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from a subject diagnosed with COPD that exhibits a decreased expression level of the gene(s); (b) administering a treatment for non-infective COPD exacerbation; (c) determining a second expression level of the gene(s) after said administering; and (d) comparing said first and second expression levels of the gene(s), wherein the treatment for non-infective COPD exacerbation is effective if said second expression level is higher than said first expression level, and wherein the treatment for non-infective COPD exacerbation is ineffective if said second expression level is the same as or lower than said first expression level.
[60] The method of paragraph [58] or [59], further comprising, when the administered treatment is effective, continuing to administer the treatment.
[61] The method of paragraph [58] or [59], further comprising, when the administered treatment is ineffective, discontinuing the treatment.
[62] The method of paragraph [58] or [59], further comprising, when the administered treatment is ineffective, administering the treatment at a higher dose and/or a higher frequency.
[63] The method of paragraph [58] or [59], further comprising, when the administered treatment is ineffective, administering an alternative treatment for infective COPD exacerbation (e.g., an anti -viral agent or an anti -bacterial agent).
[64] The method of any of paragraphs [58]-[63], wherein the sample is a bronchoscopy sample or a fluid sample.
[65] The method of paragraph [64], wherein the fluid sample comprises a blood or serum sample.
[66] A method of identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation comprising: (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or lower than a corresponding reference; or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is higher than the corresponding reference. [67] A method of identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation comprising (a) contacting COPD-mimic cells with a test agent; (b) contacting the COPD-mimic cells with a non-infective agent (e.g., cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; (c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample; and (d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or greater than a corresponding reference; or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference.
[68] The method of paragraph [66] or [67], wherein the sample is a culture medium sample or the COPD-mimic cells contacted with the test agent and the non-infective agent.
[69] The method of any of paragraphs [66]-[68], wherein the COPD-mimic cells are derived from a subject diagnosed with COPD.
[70] The method of any of paragraphs [66]-[68], wherein the COPD-mimic cells are derived from healthy cells contacted with a COPD-phenotype inducing agent.
[71] The method of any of paragraphs [66]-[70], wherein the COPD-mimic cells are grown in a microfluidic device.
[72] The method of paragraph [71], wherein the microfluidic device is an organ-on-a-chip device.
[73] The method of paragraph [72], wherein the organ-on-a-chip device comprises a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
[74] The method of any of paragraphs [66]-[73], wherein the reference corresponds to expression level of the corresponding gene(s) in the COPD-mimic cells prior to contact with the test agent or the non-infective agent.
[75] The method of any of paragraphs [66]-[73], wherein the reference corresponds to expression level of the corresponding gene(s) in the healthy (non-COPD) cells contacted with the non- infective agent.
[0208] This invention is further illustrated by the following example which should not be construed as limiting. The contents of all references cited throughout this application, as well as the figures and table are incorporated herein by reference.
[0209] Those skilled in the art will recognize, or be able to ascertain using not more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
EXAMPLES
Example 1. Modeling human small airway structure and function in a microfluidic device
[0210] Chronic respiratory diseases, such as asthma and COPD, are common pulmonary disorders in humans that pose a huge public health burden, and COPD is the fourth leading cause of death worldwide 1. COPD is primarily a disease of small airways (diameter < 2mm)2 and asthma can affect any part of the airways. Subjects with one or both of these diseases frequently present with exacerbations, e.g., triggered by pathogens, which greatly contribute to disease-associated hospitalization and mortality3" 5. Asthma exacerbations due to respiratory infections account for the majority of asthma-related deaths and represent half of the total healthcare cost associated with the disease6'7. Unfortunately, advances in the understanding of the molecular basis of these diseases, how they are exacerbated by infections or other environmental stimuli (e.g., airborne particulates, cigarette smoke), and development of effective therapeutics, have been limited by the lack of availability of robust models of human pulmonary inflammatory disease.
[0211] While animal models of asthma and COPD have been developed, it is well known that the lung anatomy, immune system and inflammatory responses to infection differ greatly between animals and humans8'9. For example, mucin-producing cells, which are central to the development of asthma, are less frequent in the respiratory tree of mice and rats compared with humans 10, and neutrophils that increase dramatically in the airways and lung parenchyma of subjects with COPD and severe asthma2 11"13, comprise only 10-25% of the circulating leukocyte pool in mice whereas they represent 50-70% of circulating leukocytes in humans9. More importantly, because many animal models fail to predict drug activity in human disease, industry strives to reduce or replace animal models for drug testing whenever possible14 15.
[0212] Airway inflammatory diseases have been modeled in vitro using cultured primary or immortalized human bronchiolar epithelial cells16'17. A microengineered model of human airway smooth muscle has also been developed that exhibits hypercontractility in response to inflammatory cytokines that contribute to development of asthma18. In addition, advances in microsystems engineering have made it possible to create microfluidic cell culture devices, known as "organs-on-chips," that contain continuously perfused microchannels lined by living human cells that were attempted to recapitulate the multicellular architectures, tissue-tissue interfaces, physicochemical microenvironments and vascular perfusion of the body19. This approach has been used to model the alveolar-capillary interface and inflammation of the human lung air sac, or an airway20"23. However, none of these models successfully reconstitute the key features of pulmonary inflammation, asthma or COPD, because they fail to accurately regenerate the differentiated features of the mucosal lining of the living small airway or contain a vasculature lined by an activated endothelium exposed to fluid flow that recruits circulating immune cells in response to inflammatory activation.
[0213] To this end, a microfluidic human lung "airway-on-a-chip" that can support differentiation of a human mucociliary airway epithelium underlined by functional microvascular endothelium, was developed.
[0214] To model the human small airway-on-a-chip, soft lithography was used to create a microfluidic device made of poly(dimethylsiloxane) (PDMS) containing a upper channel with a height and width (both 1 mm) similar to the radius of a small airway separated from a parallel lower microvascular channel (0.1 mm high x 1 mm wide) by a thin ( ΙΟμιη), porous (0.4 μιη), polyester membrane coated on both sides with type I collagen (Figs. 1A-1B). Different embodiments of the organ-on-a-chip devices as described in the PCT Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the content of which is incorporated herein by reference in its entirety, can also be used to develop an "airway-on- chip." Primary human airway epithelial cells (hAECs) isolated from healthy donors or COPD subjects were cultured on top of the membrane until confluent with medium flowing in both channels. To trigger lung airway epithelial differentiation, the apical medium was removed after five days and air was introduced to create an air-liquid interface (ALI) while retinoic acid ^g/mL) was added to the medium flowing in the lower channel. Three to five weeks later, primary pulmonary human lung microvascular endothelial cells were seeded on the opposite side of the porous membrane and cultured at the same flow rate until confluent to create a tissue-tissue interface (Figs. 1B-1C).
[0215] Confocal immunofluorescence views of cells grown in the airway chip were taken and studied. A 3D reconstruction showing fully differentiated, pseudostratified airway epithelium formed on-chip by cultured hAECs underlined by human primary endothelial cells on the opposite side of the membrane (Fig. IB). The differentiated human airway epithelium exhibits continuous tight junctional connections on-chip, as evidenced by ZOl staining (data not shown). The human endothelial monolayer formed on chip also contains continuous adherens junctions between adjacent cells, as indicated by PECAM-1 staining (data not shown). The well-differentiated human airway epithelial cells derived from healthy and COPD donors showed presence of high numbers of ciliated cells labeled for β-tubulin IV and goblet cells stained with anti-MUC5AC antibody (data not shown). Scanning electron micrograph of cilia on the apical surface of the differentiated airway epithelium formed on-chip (data not shown). Sequential frames of a movie of the apical surface of a differentiated epithelium recorded over 100 milliseconds showing cilia beating at a frequency of -10 Hz. A single cilium is highlighted in white; time stamps and arrows indicate the duration and direction of one forward and return stroke (data not shown). Synchronized cilia beating visualized by adding 1 μιη fluorescent beads to the apical side of an empty airway chip (data not shown) compared to its addition to an airway chip device with a fully differentiated, living airway epithelium (data not shown).
[0216] Immunofluorescence confocal microscopic analysis revealed that these culture conditions resulted in the formation of a pseudo-stratified mucociliary epithelium and a planar microvascular endothelium on opposite sides of the same ECM-coated membrane (data not shown). The epithelial cells were linked by a continuous band of ZO 1 -containing tight junctions along the lateral borders of their apical surfaces (data not shown), and endothelial cells were similarly joined by adherens junctions containing PECAM-1 (data not shown). This was accompanied by formation of a robust epithelial barrier that restricted the passage of fluorescent inulin between the parallel channels by greater than 99.9% compared to channels without cells, mimicking the barrier function exhibited by living lung mucosa (Fig. 6A). The epithelium formed from cells isolated from the small airway epithelium of lungs from both normal humans and COPD subjects contained many ciliated epithelial cells as well as mucus- producing Goblet cells that appeared in similar proportions to those found in normal human lung (Table 1). Table 1. Comparison of the structure and function of the living human airway with the human "airway- on-a-chip."
HUMAN AIRWAY AIRWAY-ON-A-CHIP
CELL TYPES
Ciliated Cells ~30%54 -20-30%
Goblet Cells ~10-15%54 -10-20%
CILIA
Structure 9+2 structure55 9+2 structure
Length ~6 μιη55 -6 μιη
Beating Frequency 9-20 Hz55'24 9-18 Hz
Transport Velocity 40-150 μιη/sec55'24 40-100 μιη/sec
[0217] Electron microscopic analysis of the normal lung airway-on-a-chip showed that the cilia which appeared on the apical surface of the polarized epithelium (data not shown) exhibited the same structure (9+2 microtubule organization) and length (~ 6 μιη) (Fig. 6B) as healthy cilia found in living human lung in vivo24. High-speed microscopic imaging showed that these cilia beat actively at a frequency of 9-18 Hz (data not shown), which again is similar to that observed in human airways24'25 (Table 1). Moreover, when mucociliary transport was measured by introducing fluorescent polystyrene microbeads into the top channel, rapid coordinated movement of the beads were observed along the surface of the epithelium (data not shown) as a result of active synchronized cilia beating; again, the particle velocity measured (50-100 μιη/sec) was nearly identical to that observed in the normal human lung airway (Table 1). Thus, the human lung airway-on-a-chip effectively recapitulates many of the structures and functions of the normal lung bronchiole and sustains them for weeks in vitro.
Example 2. Modeling human pulmonary inflammatory diseases in a microfluidic lung airway-on-a- chip
[0218] Next, it was sought to determine the ability of the "airway-on-a-chip" in Example 1 to accurately mimic lung inflammatory responses relevant to asthma and COPD, and to evaluate its capability to identify new pulmonary therapies.
[0219] IL-13 plays a pivotal role in asthma as it is necessary and sufficient to induce all features of allergic asthma in animal models of the disease26. IL-13 has a direct effect on the airway epithelium27 and participates in airway inflammation, goblet cell hyperplasia and mucus hypersecretion as well as subepithelial fibrosis and airway hyper-responsiveness26. To study the effects of IL-13, human primary airway epithelial cells were differentiated in the airway chip and cultured in the absence or presence of IL-13 with or without Dexamethasone (Ιμτη) or Tofacitinib (1 or 10 μπι) for 8 days. Immunofluorescence micrographic views of the epithelium were stained for the goblet cell marker, MUC5AC and DAPI (data not shown). Immunofluorescence micrographic views of the epithelium stained for the goblet cell marker were taken to confirm the presence of goblet cells in the epithelium of the airway chip (data not shown). [0220] When the "airway-on-a-chip" was treated with IL-13 (e.g., at a concentration of about 100 ng/mL) for 8 days, there were significant increases in both Goblet cell number (Fig. 2A), higher production of the inflammatory cytokines, G-CSF and GM-CSF at day 2 and 8 respectively (Fig. 2B), and a reduction in cilia beating frequency (Fig. 2C) similar to that observed in the airway mucosa of asthma subjects28"30. As mucosal inflammation and its exacerbation by viral infections are major components of both asthma and COPD that cannot be studied in existing in vitro models, the airway epithelium in the "airway-on-a-chip" was exposed to the viral mimic polyinosinic-polycytidylic acid (poly I:C) (e.g., at a concentration of about 10 μg/mL) for about 3 hours. Poly I:C is a synthetic analogue of the double-stranded RNA that is produced in infected cells during viral replication by respiratory viruses31'32. Stimulation with poly I:C triggered a pro-inflammatory response similar to what occurs in acute severe asthma exacerbations12, including large increases in basal secretion of RANTES, IL-6 and IP-10 (Fig. 2D), which are cytokines (or chemokines) that have been previously shown to accumulate in lungs of human subjects infected with respiratory viruses20'21. It also induced upregulation of E-selectin and VCAM-1 expression in the underlying endothelium (Fig. 7B) that are involved in adhesion and rolling of neutrophils in inflamed living tissues24. This resulted in enhanced adhesion, rolling and total recruitment of circulating human neutrophils in the "airway-on-a-chip" when primary human neutrophils were flowed through the lower channel under physiological flow and shear stress (1 dyne/cm2) (Figs. 7A and 7C). Moreover, because of the synthetic nature of the engineered lung airway model, the contribution of the microvascular endothelium to this inflammatory response was able to be analyzed, which is not possible in the existing in vitro experiments, animal models or human studies. In addition, treatment of the differentiated epithelium with the same dose of poly I:C in the absence of an underlying endothelium resulted in a 3- to 6-fold reduction in the levels of secretion of RANTES, IL-6 and IP-10 (Fig. 2D), and this effect appeared to be specific for these cytokines in that removal of the endothelium had no effect on the secretion of IL-8 or GROa (Fig. 7D). These findings corroborate previous studies in animals, which indicate that the pulmonary endothelium contributes significantly to viral-induced inflammation by acting as a central regulator of the cytokine storm33.
[0221] Fluorescence micrographs also showed the recruitment of cralcein AM-labeled circulating neutrophils to the surface of the endothelium with poly I:C stimulation of the airway chips for 6 hours compared to without poly I:C stimulation (data not shown).
Example 3. Modeling COPD and infectious exacerbations on-chip
[0222] To explore whether the lung "airway-on-a-chip" can be used to model COPD in vitro, chips fabricated using primary human bronchiolar epithelial cells from human COPD subjects were compared with cells from normal controls. Quantitative real-time RT-PCR showed that expression levels for Tolllike receptor-3 TLR3 and TLR4 pathogen-recognition innate receptors were significantly lower in the airway chips formed with cells from COPD subjects compared to controls (Fig. 3A), which for TLR4 precisely mimics levels of expression previously reported in the lungs of COPD subjects34.
[0223] One of the most difficult features of COPD to model experimentally in the existing in vitro devices is its exacerbation by pathogenic infections. The inventors used the "airway-on-a-chip" to mimic these conditions by stimulating the normal and COPD epithelial cells with the viral mimic poly I:C and lipopolysaccharide endotoxin (LPS), which is a bacterial-derived molecule that has been widely used in vitro to simulate bacterial infections35. Stimulation with LPS significantly upregulated secretion of IL-8 in the COPD airway chips, but it did not produce any significant change in chips lined by healthy airway epithelial cells (Fig. 3B, left panel and Fig. 3E). This finding is consistent with previous findings that showed bronchial epithelial spheroids from COPD subjects exhibit higher LPS-induced IL-8 release compared with healthy controls36. Fig. 3B,left panel and Fig. 3E show that bacterial infection mimic LPS can induce IL-8 secretion from COPD and not healthy epithelial cells, and that while viral infection mimic poly I:C appeared to slightly induce IL-8 secretion from both healthy and COPD, the poly I:C induced changes in IL-8 between the healthy and COPD cells were not statistically significant.
[0224] Surprisingly, in contrast, stimulation with poly I:C significantly upregulated secretion of M-CSF, not IL-8, in the COPD airway chips, and the stimulation did not produce any significant change in chips lined by healthy airway epithelial cells (Fig. 3B,right panel and Fig. 3D). Without wishing to be bound by theory, this finding can partly explain the elevated pulmonary accumulation of macrophages that is
2 11 13 37
observed in COPD subjects ' ' since M-CSF is a driver of macrophage differentiation . Fig. 3B (right panel) and Fig. 3D show that virus and not bacterial mimic challenge can induce M-CSF secretion from COPD epithelial cells, and that COPD and not healthy cells induced M-CSF secretion upon viral-mimic challenge. This is a surprising result as the findings indicate that M-CSF can serve as a biomarker to distinguish viral-induced COPD exacerbation from bacteria-induced COPD exacerbation. Thus, a clinician can use M-CSF as a marker to differentially diagnose the cause of exacerbation (acute excessive inflammatory reaction in patients) and therefore avoid prescribing antibiotics when virus is the cause of exacerbation. In addition, as the data shows a normal healthy epithelium does not produce M-CSF even when stimulated with a viral-like mimic, it is contemplated that virus-induced M-CSF secretion can provide an indicator of whether a person (e.g., admitted to hospital or at home) has COPD or not. For example, if a subject is diagnosed to have a viral infection and determined to exhibit an increased level of M-CSF expression (e.g., by at least about 30% or more as compared to a M-CSF reference such as the level in a healthy subject), the subject can be identified as likely to have COPD.
[0225] In contrast to M-CSF, poly I:C stimulation induced the cytokine RANTES in COPD chips, and also produced a small but significant increase in RANTES production in healthy airway chips. The poly I:C stimulation also enhanced secretion of IP-10 to similarly high levels in both healthy and COPD chips (Fig. 3C). Serum IP-10 has been described as a clinical marker for acute viral exacerbations in COPD subjects3. The findings presented herein indicate that IL-8 and M-CSF are biomarkers for exacerbations induced by Gram-negative bacteria that produce LPS and respiratory viruses, respectively.
[0226] In this Example, while COPD-derived epithelial cells were cultured and differentiated to simulate exacerbation phenotype, the approach and methods described herein are not limited to COPD and small airway chip, and can be extended to simulate other disease or disorder in any desired organ-on-chip or similar in vitro platforms (e.g., by culturing cells from a disease or disorder of interest in an organ-on- chip device) for biomarker identification and discovery. Various organ chip devices described in the International Patent Application Nos. PCT/US2009/050830; PCT/US2012/026934; PCT/US2012/068725; PCT/US2012/068766; PCT/US2014/07161 1 (PCT Publication No. WO 2015/138034); and PCT/US2014/071570, the contents of each of which are incorporated herein by reference in their entireties, can be used to simulate diseases or disorders of interest, e.g., for biomarker identification and/or discovery.
[0227] Biomarker identification discovery can be applied for other pathophysiological states, and is not limited to exacerbation-associated inflammation as shown in the Examples. Thus, biomarkers are not restricted to secreted cytokines and chemokines and can include other relevant biological endpoints including but not limited to transcriptome, miRNA profile, tissue-secreted circulating molecules, and any combinations thereof.
Example 4. Evaluation of therapeutics in the lung airway-on-a-chip
[0228] Having established the microfluidic models of human asthmatic and COPD airways in vitro as described in Examples 2 and 3, it was next sought to evaluate the capability of these organs-on-chips for drug discovery. Upon exposure of the normal airway epithelium on-chip to IL-13 to produce asthmatic changes in the epithelium and inflammatory activation in vitro, the airway chip was treated with the JAK signaling inhibitor Tofacitinib, which has been shown to inhibit inflammation in subjects with rheumatoid arthritis38. It was found that it inhibited goblet cell hyperplasia, suppressed G-CSF and GM- CSF secretion and restored normal cilia beat frequency (Fig. 2A). In contrast, the corticosteroid, dexamethasone, was found to be ineffective, which is consistent with the clinical finding that although moderate to severe asthma subjects receive dexamethasone inhalation therapy, they often fail to respond to this treatment39. In addition, the findings presented herein also validate previous reports suggesting that immunosuppressant JAK inhibitors represent potential new therapeutics for allergic airway diseases40'41.
[0229] It was next sought to determine if the human small airway-on-a-chip model of COPD exacerbation by microbial infection can be used to identify pharmacological agents that can suppress associated inflammation by inhibiting neutrophil recruitment. Fluorescence microscopy was used to determine the recruitment of Hoechst-stained circulating neutrophils to the surface of the endothelium in the airway-on-a-chip containing a differentiated COPD epithelium with an underlying endothelium pre- treated with 10 nM Budesonide, 500 nM BRD-4 inhibitor, as compared to 0.1% DMSO diluent (untreated) for 24 hours prior to poly I:C (10 μg/ml) stimulation of the epithelial cells (n=3 donors/condition). When COPD epithelial cells that were stimulated with poly I:C on-chip were treated with the glucocorticoid drug, Budesonide, there was no reduction in neutrophil adhesion (Fig. 4A), which is consistent with its noted lack of significant activity in some COPD subjects42. In contrast, when the poly I:C stimulated COPD epithelial cells were treated with a new experimental anti -inflammatory drug, 2-methoxy-N-(3-methyl-2-oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide43, that is a Bromodomain Containing Protein 4 (BRD4) inhibitor of NFKB signaling, the BRD4 inhibitor surprisingly suppressed neutrophil adhesion by more than 70%. Analysis of the drug's mechanism of action showed that endothelial cells in these inflamed chips exhibited more than 50-fold lower levels of E-selectin and VCAM-1, and a 50% reduction in ICAM-1 levels, whereas budesonide was unable to significantly reduce expression of these cell adhesion molecules (Fig. 4B). Consistent with its neutrophil adhesion- suppressive properties, the BRD4 inhibitor also proved greatly superior to the corticosteroid in down- regulating expression of chemoattractants that are important for neutrophils in vivo, e.g., IL-8, GROa, MCP-1, and IL-6 genes, in human lung microvascular endothelial cells (Fig. 5A), as well as suppressing secretion of all of these cytokines into the lower microvascular channel (Fig. 5B). While the IL-8 level was not significantly increased in the poly I:C stimulated COPD epithelial cells, the anti -inflammatory properties of the BRD4 inhibitor can also lower the basal cytokine secretion for cytokines such as IL-8. The BPvD4 inhibitor also significantly suppressed production of GM-CSF (Fig. 5B), which is a neutrophil chemokine that enhances functionality of neutrophils44, in addition to supporting bone marrow cell proliferation and survival of granulocytic precursors. While budesonide slightly lowered gene expression of selected cytokines (Fig. 5A), it failed to significantly suppress cytokine secretion (Fig. 5B), which is an important determinant of the inflammatory response. The findings presented herein are consistent with what has been previously observed in animal models of COPD and lung inflammation45'46. For example, corticosteroid treatment similarly failed to reduce bronchoalveolar lavage fluid levels of GROa, GM-CSF or IL-6, and it did not inhibit neutrophil infiltration of airways in mice co-challenged with cigarette smoke and poly I:C46. Additionally, another small-molecule BRD4 inhibitor (JQ1) has been previously reported to lower serum levels of GM-CSF and IL-6 in a LPS-challenged animal model of lung inflammation45. Therefore, the "airway-on-a-chip" model of human asthma and COPD faithfully recapitulates in vivo organ-level responses to therapy, and offers a powerful complement to animal models for preclinical drug evaluation.
Discussion based on Examples 1-4
[0230] Chronic pulmonary inflammatory diseases are complex human disorders that cannot be accurately modeled in vitro and animal models often offer limited biological relevance. To this end, a human lung "airway-on-a-chip", e.g., in one embodiment, composed of a fully differentiated pseudo- stratified mucociliary epithelium with an underlying endothelium and circulating immune cells, was developed. The inventors applied the "airway-on-a-chip" to model and study human pulmonary inflammatory diseases as well as to assess therapeutic responses. Because the organ-on-chip approach essentially represents "synthetic biology" at the organ level, the inventors were able to independently control and vary virtually all system parameters, including the presence or absence of different cell types, air and vascular flow conditions and soluble factors, while simultaneously analyzing human organ-level responses in real-time with molecular scale resolution. Using this approach, new insight into how airway epithelium and microvascular endothelium interplay to control cytokine production and regulate immune cell recruitment were discovered. In particular, the inventors have discovered IL-8 and M-CSF as biomarkers for COPD exacerbations induced by Gram-negative bacteria and respiratory viruses, respectively. In addition, many of the features of human asthma and COPD were able to be recapitulated in vitro using the "airway-on-a-chip." [0231] Remodeling of airway epithelium plays a central role in asthma, and by stimulating the "airway- on-a-chip" with IL-13, several key features of the asthmatic airway epithelium47 were recapitulated. For example, the increased numbers of goblet cells, enhanced secretion of Th2 cytokines (GM-CSF) and decreased cilia beat frequency following IL-13 stimulation were observed in the "airway-on-a-chip" and the observations are all consistent with previous results obtained both in vitro and in vivo studies26'29'30'48'49. Treatment of the "airway-on-a-chip" with Tofacitinib, a pan-JAK inhibitor used for treatment of rheumatoid arthritis, reversed IL-13 -induced phenotype to healthy levels, and this is also consistent with previous reports of Tofacitinib or other JAK inhibitors (e.g., encapsulated pyridone 6, R256) suppressing inflammation in animal models of allergy or asthma40. However, using the "airway- on-a-chip" model as presented herein to develop in vitro airway disease model, it was discovered for the first time that Tofacitinib has a direct effect on the human airway epithelium, as evidenced by inhibition of IL-13-induced goblet cells hyperplasia, cytokine (G-CSF and GM-CSF) secretion, and reduction of cilia beating frequency (Data not shown).
[0232] The "airway-on-a-chip" was tested as in vitro method for drug discovery. As IL-13 signals through the JAK-STAT pathway, tofacitinib, a potent inhibitor of JAKl, -2 and -3 used for patients with rheumatoid arthritis, was investigated whether it could reverse the IL-13-induced phenotype. Normal airway epithelium on-chip were exposed to IL-13 to produce asthmatic changes in the epithelium and then treated with high doses of tofacitinib (1 and 10 μΜ) to inhibit JAK signaling. It was observed that there was suppressed goblet cell hyperplasia, decreased secretion of G-CSF and GM-CSF, and restoration of normal cilia beating frequency. In contrast, when similar chips exposed to IL-13 were treated with the corticosteroid dexamethasone, it was found to be ineffective, which is consistent with the clinical finding that although patients with moderate to severe asthma receive dexamethasone inhalation therapy, they often fail to respond to the treatment. These results also validate recent reports suggesting that immunosuppressant JAK inhibitors may represent potential new therapeutics for allergic airway diseases.
[0233] Further, the hypersensitivity of epithelia for TLR-induced chemokine release can be recapitulated in the on-chip COPD model, mimicking exacerbations of this disease by viral or bacterial infection. Moreover, by validating the ability of the "airway-on-a-chip" to identify IP- 10 as a marker of viral infection3, the inventors discovered that IL-8 and M-CSF serve as markers for Gram negative bacterial and viral infections, respectively, that causes COPD exacerbations. These data emphasize the value of the "airway-on-a-chip" for studies characterizing innate immune responses within diseased human respiratory epithelium in vitro, and for discovery of both mechanistic and diagnostic biomarkers.
[0234] The in vitro models that are most commonly used to study airway differentiation and function involve growing human airway epithelium under an air-liquid interface within Transwell culture inserts. However, these culture systems are unable to recapitulate processes that are critical to lung inflammation in vivo, for example, recruitment of circulating human leukocytes in response to cytokine production and endothelial activation resulting in expression of surface adhesion receptors (e.g., E-selectin, ICAM-1, VCAM-1) that mediate neutrophil rolling and adhesion under flow50. While other lung airway models have been previously reported, including microfluidic models22'23, they were not able to produce a fully differentiated, pseudostratified, mucociliary epithelium, and hence, they were not used to model inflammatory diseases of the lung, test therapeutics or analyze recruitment of circulating immune cells in vitro. In contrast, the structure and function of a fully differentiated airway epithelium were able to be reconstituted in the "airway-on-a-chip" as described in Example 1. The ability of the microfluidic airway- on-a-chip were also leveraged to study recruitment of circulating immune cells, to image endothelium- leukocyte interactions in real-time and to quantitatively analyze neutrophil attachment under physiologically relevant flow conditions in vitro.
[0235] Using this novel approach, the inventors have identified a novel therapeutic agent in the form of a new BRD4 inhibitor (e.g., 2-methoxy-N-(3 -methyl -2 -oxo-1, 2-dihydroquinolin-6- yl)benzene sulfonamide) that reduces neutrophil capture by inhibiting NFKB transcriptional activity, and hence, can be used for treatment of COPD exacerbations. In Example 4, the BRD4 inhibitor proved superior to a corticosteroid drug currently prescribed in clinic (e.g., Budesonide) in terms of suppressing inflammatory cytokine secretion, reducing endothelial activation, and inhibiting neutrophil recruitment. This is of particular importance because rolling interactions mediated by neutrophil binding to E-selectin are best investigated under flow, as they occur in vivo, and not in static conditions. Finally, the finding presented herein are also consistent with effects produced in vivo using the glucocorticoid dexamethasone and another small-molecule BRD4 inhibitor, JQ 145,46. Thus, not only does reconstitution of the COPD inflammatory phenotype on-chip enable testing for efficacy of new experimental therapeutics, it also allows dissection of the mechanism of drug action at the molecular level in a complex human organ-level model. Thus, as there is a need to discover new effective anti -inflammatory therapeutics for disorders, such as COPD and asthma, and given the inability of current in vitro models to co-culture human airway endothelium with microvascular endothelium exposed to both flow and circulating leukocytes under physiological flow conditions, the human "airway-on-a-chip" is a valuable new tool to facilitate analysis of disease mechanisms and advance preclinical drug discovery.
Exemplary Methods and Materials for Examples 1-4
[0236] Device fabrication— The upper and lower layers of the microfluidic device (Figs. 1A-1B) were produced by casting polydimethylsiloxane (PDMS) pre-polymer on molds prepared using stereolithography (Fineline, USA). Curing ( 10: 1 PDMS base to curing agent; w/w) was carried out overnight at 60°C to produce devices containing two adjacent parallel microchannels (top channel, 1000 μπι wide X 1000 um high; bottom channel, 1000 μπι wide X 200 um high), which were used to form the airway lumen and microvascular channel, respectively. The channels were separated by a thin (- 10 μπι) semi-porous polyester membrane (0.4 μπι pores) that was purchased from Maine Manufacturing (USA). The membrane was laser cut, plasma-treated using Plasma Etcher PE-100 (Plasma Etch, USA) with one cycle of 50 Watts of oxygen gas ( 15 standard cm /min) for 15 sec, sandwiched between the aligned top and bottom channels (Fig. IB), and treated with ultraviolet light in a UVO-Cleaner (Model 342; Jelight, USA) for 30 minutes before applying a collagen coating. [0237] Microfluidic cell culture — Primary human airway epithelial cells (hAECs) obtained from commercial suppliers (Promocell, Germany; Lonza, USA, and Epithelix, Switzerland) were expanded in 75 cm2 tissue culture flasks using airway epithelial growth medium (BEBM; Catalog no. CC-3171) supplemented with growth factors/supplements (BulletKit Supplements; Catalog no. CC-4175; Lonza) until 70-80% confluent. The device porous membrane was coated on both sides with rat tail collagen type I (300 μg/ml; Corning, USA) at 37°C for 24 hours. The hAECs were then trypsinized and seeded onto the collagen-coated porous membrane in the upper channel of the device at a concentration of about 2 to 5 X 106 cells/ml (about 2 to 5 X 105 cells/cm2 or about 4 to 10 X 104cells/chip) and allowed to attach under static conditions. Three hours later, the cell monolayer was washed with fresh medium and the cultures were maintained in submerged state until fully confluent (typically 4 to 5 days after seeding) under constant flow (60 μΕ/1ι) using an IPC-N series peristaltic pump (Ismatec, Switzerland). When confluent, the apical medium was removed and an air-liquid interface (ALI) was generated to trigger differentiation. The hAECs were maintained at ALI for 3 to 5 weeks with constant flow of growth medium in the bottom channel, which was sufficient to support epithelial cell viability and function for weeks in culture. The apical surface of the epithelium was rinsed once weekly with growth medium to remove debris, and differentiation was assessed morphologically, and by analyzing the area of the epithelium covered with beating cilia 4 to 5 weeks after seeding. Mucociliary transport was visualized using Ιμπι diameter fluorescent microbeads (Life Technologies, USA ) diluted in PBS, injected in the upper channel of a fully differentiated airway-on-a-chip and imaged using a high speed Hamamastu ORCA-Flash 4.0 camera mounted on a Zeiss AxioObserver Z 1 microscope.
[0238] Once differentiation of the hAECs was accomplished, human microvascular endothelial cells (HMVECs; Lonza) or Human umbilical vein endothelial cells (HUVECs; Angio-proteomie; USA or Lonza) were seeded onto the lower side of the porous membrane through the bottom channel at a density of about 2 X 107 cells/ml (about 2 X 105 cells/cm2 or about 4 X 104 cells/chip). Endothelial cells were seeded in Lonza EBM-2 endothelial cell basal growth medium (catalog no. CC-3156) supplemented with EGM-2MV SingleQuot Kit growth factors/supplements (catalog no. CC-4147) under static conditions with the chip oriented upside down to allow cell adhesion to undersurface of the porous membrane. Two hours later, flowing of growth medium (60 μ]^/1ι) was resumed until cells were fully confluent (usually 3 to 6 days after seeding).
[0239] Immunofluorescence Microscopy—To carry out immunofluorescence staining, cells were washed by flowing PBS (phosphate-buffered saline) in both top and bottom channels, fixed with 4% paraformaldehyde (Electron Microscopy Sciences, USA) for 15 minutes without flow, and washed gently by flowing additional PBS before being stored at 4°C until use. The cells cultured on-chip were washed again with PBS, permeabilized with 0.2% Triton X-100 (Sigma) in PBS for 2 hours and exposed to blocking buffer composed of PBS containing 1% BSA (Sigma) and 5% fetal bovine serum (Life Technologies, USA)] for 30 minutes at room temperature. Cultures were stained for ciliated cells (anti- β-tubulin IV, 1 : 100, clone ONS.1A6; Genetex, Taiwan), goblet cells (anti-Muchi5AC, clone H-160, Santa Cruz Biotech., USA), tight junctions (anti-ZOl, clone 1A12; Life Technologies, USA), or PECAM-1 (clone WM-58; eBioscience, USA). When cell adhesion molecules were stained on endothelial cells, the cells were not permeabilized to visualize surface antigens. In the experiments, antibodies diluted in blocking buffer were introduced in the channels, incubated for 1 hour at room temperature or overnight at 4°C and cultures were washed with PBS three times each for 5 minutes at room temperature. Secondary antibodies (Life Technologies, USA) were incubated for 45 minutes at room temperature and washed three times with PBS. In some studies, TO-PRO-3 (Life Technologies, USA) was used to label nuclei following secondary antibody staining. Devices were then cut using a razor blade and membranes were delicately lifted from the PDMS and mounted on microscopy slides in mounting medium (Vectashield; Vector Laboratories, USA) with or without DAPI. Fluorescence imaging was carried out using confocal laser scanning microscopy (SP5 X MP DMI-6000, Germany). Image processing and 3-dimensional Z-stack reconstruction was done using Imaris (Bitplane, Switzerland) and Image J software (National Institute of Health USA). When using two primary antibodies of the same species, Zenon® Antibody Labeling Kit (Life Technologies; USA) was used to pre-conjugate the antibodies separately prior to addition to fixed cells. For IL-13 experiments, cultures were treated with IL-13 (Peprotech, USA), dexamethasone (Sigma-Aldrich, USA) or Tofacitinib (CP- 690550, Selleckchem, USA), fixed after 8 days of treatment, and stained for MUC5AC and DAPI. Quantification of goblet cells hyperplasia was done by measuring the area covered by goblet cells in eight different fields for each condition.
[0240] Scanning and transmission electron microscopy—For electron microscopic analysis, the porous membranes supporting the cell cultures were excised from the devices using a razor blade, and cells were fixed using 2.5% glutaraldehyde (Electron Microscopy Sciences, USA) in 1% sodium cacodylate (Sigma) for lh at room temperature. Fixed cells were rinsed with 1% sodium cacodylate and post-fixed with 1% osmium tetroxide (Electron Microscopy Sciences; USA) in 1% sodium cacodylate for 90 minutes in a fume hood. Cells were dehydrated sequentially in ethanol gradients, rinsed in hexamethyldisilazane, air dried overnight in a desiccator at room temperature and then mounted on a conductive carbon support, coated with gold and imaged with a VEGA III scanning electron microscope (Tescan, Czech Republic).
[0241] For transmission electron microscopy, fixed cells were and embedded in Taab 812 Resin (Marivac Ltd., Nova Scotia, Canada) and incubated at 60°C for one day. Samples were cut in 80 nm sections with Leica ultracut microtome, picked up on 300 mesh formvar/carbon coated Cu grids, stained with 0.2% Lead Citrate and viewed and imaged under the Philips Technai BioTwin Spirit Electron Microscope.
[0242] Measurements and quantification of cilia beating frequency, ciliated cells, goblet cells and mucociliary transport— Cilia beating frequency measurements were performed using a high speed Hamamastu ORCA -Flash 4.0 camera mounted on a Zeiss AxioObserver Zl microscope. High speed movies of beating cilia were recorded at approximately 200 frames per second and played at 30 frames per second for 1 second allowing manual counting. Four to five random areas of each chip were counted and cilia beating frequencies were averaged for each condition. For IL-13 treatment experiments, cilia beating frequency was recorded and measured after 8 days of treatment (n=3-4 chips). Ciliated and goblet cells were quantified as previously described in Ref. 51. For example, for ciliated cells, fully differentiated epithelia from 3 airway chips were trypsinized, cytospins were performed ( 1000 x g for 2 min), cells were air-dried for 1 hour at RT, fixed with 100% ice cold acetone, rinsed with PBS, stained for β-tubulin (ciliated cells marker) and counterstained with DAPI. Ciliated cells were counted in 6 fields per chip and percentages calculated. For goblet cells, fully differentiated epithelia from 4 airway chips were fixed with 4% paraformaldehyde and stained for MUC5AC (goblet cells marker). Quantification of goblet cells was done by measuring the area covered by MUC5AC staining in 5 different fields for each condition. Mucociliary transport was evaluated by measuring the displacement of Ι μπι polystyrene fluorescent beads diluted in PBS and introduced in the top channel of the airway chip for 1 second.
[0243] Gene expression analysis—Total RNA was extracted from differentiated epithelial or endothelial cells in chip in situ using RNeasy Mini Kit (Qiagen, USA). The RNA was incubated with DNase I (Qiagen, USA) for 15 minutes at room temperature to remove residual contaminating genomic DNA, enzyme heat-inactivated at 65°C for 5 minutes, and then reverse transcribed into cDNA using Superscript® Reverse Transcriptase III kit (Invitrogen, USA). cDNA synthesis was primed by mixing 1 μΐ of oligodT (50 μΜ) and 1 μΐ of dNTP mix (10 mM) with up to 500 ng total RNA. Real time PCR was carried out using a CFX-96 real-time PCR system (Bio-Rad, USA). Reactions contained 2 μΐ cDNA, 10 μΐ 2xUniversal SYBR® Green Supermix (Bio-Rad, USA) and 3 μΐ of each forward and reverse primers (300 nM final concentration), and 2 μΐ molecular biology-grade water, and results were quantified using 2-ΔΔα metnoc[25 por example, Δ Ct (Ct target gene - Ct housekeeping gene) was calculated initially, then Δ Δ Ct was obtained by subtracting Δ Ct of healthy donor or untreated condition from Δ Ct of COPD subject or stimulated chip.
[0244] Primers were either designed using Primer3 application that can be accessible online (at the website of Frodo primer3 at the Whitehead Institute) or used from previous reports52 and sequences are depicted in following Table 2.
[0245] Table 2. Exemplary primer sequences of target genes
Figure imgf000064_0001
HPRT reverse52 AGTCTGGCTTATATCCAACACTTCG (SEQ. ID. NO: 10)
ICAM-1 forward GAGGGCACCTACCTCTGTCG (SEQ. ID. NO: 11)
ICAM-1 reverse CCTGCAGTGCCCATTATGAC (SEQ. ID. NO: 12)
MCP-1 forward GATCTCAGTGCAGAGGCTCG (SEQ. ID. NO: 13)
MCP-1 reverse TGCTTGTCCAGGTGGTCCAT (SEQ. ID. NO: 14)
IL-8 forward CCACCCCAAATTTATCAAAGAA (SEQ. ID. NO: 15)
IL-8 reverse CAGACAGAGCTCTCTTCCATCA (SEQ. ID. NO: 16)
IL-6 forward53 AGGAGACTTGCCTGGTGAAA (SEQ. ID. NO: 17)
IL-6 reverse53 GTCAGGGGTGGTTATTGCAT (SEQ. ID. NO: 18)
GROa forward TCACCCCAAGAACATCCAAA (SEQ. ID. NO: 19)
GROa reverse CTATGGGGGATGCAGGATTG (SEQ. ID. NO: 20)
HMOX1 forward ACTTTCAGAAGGGCCAGGTG (SEQ. ID. NO: 21)
HMOX1 reverse GACTGGGCTCTCCTTGTTGC (SEQ. ID. NO: 22)
CYP1A1 forward ACCTACCCAACCCTTCCCTGA (SEQ. ID. NO: 23)
CYP1A1 reverse AGGCTGTCTGTGATGTCCCG (SEQ. ID. NO: 24)
[0246] Analysis of chemokines and cytokines—The effluent of flowing medium was analyzed for a panel of cytokines and chemokines (IL-8, IP- 10, RANTES, IL-6, M-CSF, G-CSF, GM-CSF and GROa) using custom Milliplex assay kits (Millipore, USA). Analyte concentrations were determined according to the manufacturer's instructions, using a LuminexFlexMap 3D system coupled with a Luminex XPONENT software (Luminex, USA). For endothelium depletion experiments, basal secretions were collected for each condition and RANTES, IL-6 and IP-10 were measured at 24 hours after poly I:C (InvivoGen, USA) treatment. For TLR stimulation experiments, COPD and healthy epithelium were challenged with LPS 10 μg/ml or poly I:C 10 μg/ml for 1 hour and secreted IL-8, M- CSF, IP-10 and RANTES were measured 24 hours following treatment. For COPD drug studies, in co- culture chips of differentiated COPD epithelium and microvascular pulmonary endothelium, the endothelial cells were treated with 10 nM Budesonide (Sigma), 500 nM of the BRD4 inhibitor (provided by Pfizer) or 0.1% DMSO diluent (Sigma) under flow (60 μί/1ι) through the vascular channel for 24 hours before poly I:C (10 μg/ml) was delivered into the airway channel for 6 hours. The vascular effluents were then collected for cytokine/chemokine analysis.
[0247] Analysis of neutrophil recruitment—Neutrophils were isolated from fresh human blood by two- step gradient sedimentation. The peripheral blood mononuclear cells (PBMCs) were removed from the polymorphonuclear (PMN) cell population using Ficoll (Stem Cell Technologies, Canada) density centrifugation and then the PMNs were isolated using a modified Percoll (Sigma) protocol. Flow cytometry analysis for CD 15 and CD 16 expression confirmed purity of neutrophil population over 93%. Isolated neutrophils were then live-stained for 30 minutes at 37°C using cell tracker red or Hoechst (Life Technologies, USA), re-suspended in RPMI containing 10% FBS (v/v) (Life Technologies, USA) and used within 3h for recruitment assays in chips. Neutrophils (1 X 107 cells/ml) were flowed (2.7 ml/h; 1 dyne/cm2) through the microvascular channel of the device while it was flipped upside-down to mimic the physiological hemodynamic conditions that exist in human post-capillary venules50. After 10 minutes, unbound neutrophils were washed away by flowing cell-free RPMI 10% FBS medium for 5 minutes and pictures of 4-5 random areas were taken for subsequent counting; quantification was done by counting attached neutrophils using Image J and CellProfiler software.
[0248] Statistical analysis— All results and error bars are presented as mean standard error of the mean (SEM). Data were analyzed with an unpaired Student's t test using Graphpad Prism (GraphPad Software Inc., San Diego, CA, USA) or Excel software (Microsoft, USA). Differences between groups were considered statistically significant when p<0.05 (*p<0.05, **p<0.01, ***p<0.001).
Example 5. Identification of COPD-specific markers using a lung airway-on-a-chip coupled to a respirator device and an agent introduction apparatus
[0249] COPD is the third leading cause of death worldwide. WHO (2014). Some of the major problems that COPD patients encounter are scarcity of therapeutic options, low availability of biomarkers that can effectively differentiate pathogenic vs. non-pathogenic causes of COPD exacerbation, and lack of molecular signature(s) that can distinguish between COPD vs. healthy (non-COPD) airway tissue in order to improve diagnosis. Current COPD diagnosis is purely a clinical, not a molecular- or cellular- based, approach where the level of airflow obstruction is evaluated by pulmonary function test (PFT), e.g., to determine the ratio of forced expiratory volume in one second (FEV1) - i.e. the volume of air forcefully exhaled in 1 second - to forced vital capacity (FVC) - i.e. total exhaled breath. The FEV1/FVC ratio in COPD patients is < 70%. Johns et al. "Diagnosis and early detection of COPD using spirometry" Journal of Thoracic Disease (2014) 6: 1557-1569.
[0250] Currently there are no pharmacotherapies that can stop/reverse COPD disease progression (Krimmer et al., "What can in vitro models of COPD tell us?" Pulmonary pharmacology & therapeutics (2011) 24: 471-477) and in the past 25 years only one drug (roflumilast) has been launched in the market (Vestbo &Lange, "COPD drugs" the urgent need for innovation" The Lancet. Respiratory medicine (2014) 2: 14-15. In addition, exacerbation episodes often lead to hospitalization and necessitate medical intervention - clinically, corticosteroids and antibiotics form the first line of treatment regardless of the cause of exacerbation. Laue et al. "When should acute exacerbations of COPD be treated with systemic corticosteroids and antibiotics in primary care: a systematic review of current COPD guidelines." NPJ primary care respiratory medicine (2015) 25, 15002.
[0251] Animal models and conventional static cell culture systems have been used to either identify therapeutic targets or to test efficacy of candidate lead compounds. However, none of them can accurately reflect COPD pathophysiology. Vlahos & Bozinovski "Recent advances in pre-clinical mouse models of COPD." Clin Sci (Lond) (2014) 126, 253-265. Given significant inter-species differences in lung anatomy (e.g., rodents have a lot less mucous-producing cells, and airway branching and COPD small airway disease cannot be replicated in mice), in immune compartment (e.g., different distribution profiles of immune cells [e.g. neutrophils] in circulation), in route of exposure to aerosols and inhaled particles (e.g., rodents are obligate nose-breathers and cannot take cigarette smoke into their lungs as human smokers do and are unable to simulate smoking behavior), and inability to recreate severe disease pathology in animal compared to humans (Wright et al. "Animal models of chronic obstructive pulmonary disease." American journal of physiology. Lung cellular and molecular physiology (2008) 295, Ll-15; and Kolaczkowska & Kubes "Neutrophil recruitment and function in health and inflammation." Nature reviews. Immunology (2013) 13, 159-175) these factors have, in part, rendered low predictive ability of animal models to identify targets that were translated into humans. Vlahos & Bozinovski "Recent advances in pre-clinical mouse models of COPD." Clin Sci (Lond) (2014) 126, 253- 265. On the other hand, in vitro static cell cultures cannot replicate airway lumen of human lungs and therefore fail to reproduce breathing and inhalation-exhalation-coupled smoking as human smokers do.
[0252] To identify and/or discover new targets/biomarkers for therapeutic or diagnostic applications, in one aspect, coupling a microfluidic human airway-on-a-chip device (with COPD-derived well- differentiated epithelium cultured therein) to a smoke generator and a microrespirator is used to simulate breathing tobacco smoke in and out of an airway. For example, primary airway epithelial cells from healthy (normal non-COPD) and COPD patients were cultured in lung airway-on-a-chip devices and guided to full differentiation to form mucociliary epithelium under air-liquid interface (ALI) (normally take about 6 weeks). See, e.g., the International Patent Application No. PCT/US2014/071611 (PCT Publication No. WO 2015/138034), the contents of which are incorporated herein by reference in its entirety, for exemplary methods of differentiating airway epithelial cells to mucociliary cells in a lung airway-on-a-chip device. The top channel of the lung airway-on-a-chip device comprises an epithelium on a membrane that separates the top channel from the bottom channel of the device. The top channel with an epithelium simulates an airway lumen of human small airway (generations 8-16 of the respiratory tree). One end of the "airway lumen" channel was connected to a respirator device (e.g., a microrespirator) while the other end to an agent introduction device such as a cigarette smoke generator to introduce whole cigarette smoke into the "airway lumen" channel from freshly burning cigarettes to simulate smoking behavior. See, e.g., the U.S. Provisional Application No. 62/141,560, the contents of which is incorporated herein by reference, for information about agent introduction devices such as a cigarette smoke generator and/or respiration devices for analysis of response to shear stress and foreign agents on cells. Breathing air shear was mimicked by inhaling-exhaling air into and out of the "airway lumen" channel through a respirator device. In some embodiments, the cigarette smoke generator was programmed to burn 9 X cigarettes (3R4F research-grade reference cigarettes purchased from University of Kentucky). The cigarette smoke generator simulates a smoking behavior by controlling smoking behavior-related parameters such as puff time, inter-puff interval, number of puffs per cigarette, etc. Coupling a lung airway-on-a-chip device to a cigarette smoke generator and a respirator allows users to challenge epithelial cells in the device with cigarette smoke by effectively enabling the device to "breathe" whole fresh cigarette smoke into and out of the device. Healthy (non-COPD normal) and COPD-derived epithelial cells were used and differentiated in a lung airway-on-a-chip device and both were challenged with the same amount of smoke exposure. Following treatment, cells were lysed in situ for their whole transcriptome profiling analysis to identify COPD-specific genes that are differentially (and statistically significant) regulated only in COPD airway epithelium upon exposure to cigarette smoke, not in healthy epithelia. Genes differentially expressed (Student's t-test; p < 0.05) upon smoking in each group - i.e., "healthy smoking vs. healthy non-smoking," and "COPD smoking vs. COPD nonsmoking" were identified. Then the gene lists were compared to find the overlapping and non- overlapping genes. 147 genes were identified as differentially expressed in COPD cells only - that is, their expression did not significantly change in healthy epithelial cells upon smoking. These genes are listed in Table 3 and Table 4. Table 3 below and Fig. 9 display a list of COPD-specific genes that are differentially upregulated upon smoking in COPD cells only, not in healthy cells. Fig. 9 also shows that smoking -induced expression change in 10 representative genes (chosen from the ones disclosed in Table 3) as simulated in the in vitro system (e.g., an airway-on-a-chip device coupling to a microrespirator and a cigarette smoke generator) agrees with the corresponding gene expression change as observed in bronchoscopy samples of non-COPD, smoker subjects. Table 4 below displays a list of COPD-specific genes that are differentially downregulated upon smoking in COPD cells only, not in healthy cells.
[0253] Table 3. Relative fold change in expression of genes that were significantly up-regulated in COPD epithelial cells, but did not significantly change in healthy cells, upon smoking.
COPD-imiquc Genes - Smoking vs. Non-sniofcitig
Gene .Symlwl COPD Fft!ti Change COPD Standard Deviation Healthy Folf! Chan ige Healthy Standard Deviation
M i i !f 4. J 553iS17 i i ! . 3677! 4 1.392985268 0.45034565
TMPRSSH E 3.949317894 0.294984061 1.566421983 0.084309805
ΜΜΡΊ 3.047490556 0.559949493 1.10692872? 0.203737899
SPRR3 3.31060! 245 0.323263682 1.3857989 0.2.09506188
RPT 3.646(04726 0.24670588 1.765479925 0.516140219
ATP6Y0.D2 3.289080544 0.253799204 1.472740929 0.553186915
A RB22 3.0375! 335 i 0.12196(452 1.31 131246? 0.713793215
TMPRSS11 F 3.05124706 0.259555819 1.531759606 0.22 Ϊ 184061
TSPAN7 2.992780042 0.243900529 1.719(6647 0.129895707
RCAM ) ·■·:· r: >>·.>:· 0.200461 SOS. 0.87599533 0.2.1.3345883
AD AMIS f 2.9579800! 0.184126487 1.895001483 0.6290336&6
ZNF165 3.04648999 0.2,16646175 1.960016886 0.726544999
G,M.TT!2 0. S 0! 10707 1.503249262 0.35403008
ZSCANS2F1 3.359700085 0.329572304 2.49353796! 1.056922817
A XA.H) 2.679965633 0.564807335 5 720966483 0.5491285 5 5
FAM172RP 2.238764459 0.2,1020842» 1.372206 (62 0.096860318
LRPS 2.S63474S6! 0.236965224 5 730452891 0.3 ! 7663725
DYNCl!l 2.22365! 62 0. 68256J91 1.531765199 0.189793357
.LCE3D 2.015928541 0.47 ! 79845 7 5 385893039 0.556489352
CYF4F3 2.4500 S 8548 0. 94855666 1.817619646 9.381742407
A8IJ4 2.538566846 0.436943954 5 9637507 ! 0.87325473.2
B4GALNT1 2.123535534 0.218275404 1.621 ! 98973 0.2.8827! 578
SSAO'2 2.741889557 0.854584326 2 259827785 0.7 ! 203692
KNUMSP 2.026313644 0.402178489 1.55734) 764 0.6638 ! ! 517
PT.PRH 2.427.147862 0.54i948821 5.96503843 0.067027082
UNC00707 2.420502359 0.3712S7833 1.97180253$ 0.392666042
Μ.Ϊ.Ρ.23Λ 2. ί 3*627 S 6 0.31208918 5.76473! 157 0.54497.3673
V N1 2.32460324 0.16S217822 1.921709481 0.2532 (3276
I IA 2.006*79204 0.248! 88758 5.609743648 0.275129954
.A XR 20A5P 2.289828421 0.349395991 1.921500031 0.2239 956S
PTGS5 2.037579875 0.059885798 1.722355168 0.067545022
RNUM P 2.977 f 38832 0.259806745 2.666(82895 0.79322 ! 591
RNU 4P 2.494560657 0.268458686 2.214( 5 505 i .5 7430737
YOK 2.263958872 0.157675877 2.031 50 09 0.5S0735905
ALDH3A! 2,5)668762.3 ! 0.168772866 5.9080628( 5 0.98(208506
R Ui ί 2.20585( 239 0.673423338 2.1570(468? i .553478547
TSPYL2 2,234S3! 0(9 0.206768749 2.4306935 5.05362864
UNC0O52O z. mt wn 0.307447656 2.5809(0745 0.833530143
REIN 2.6! 733 i 66 0.275365539 3.050932652 0 897450468
MTR22HG 2.06666206! 0.227199( 7 2.558752153 i .057374738
ZFAND2A 2.9095247)3 0.624(48713 3.444209739 5 594712139
ODCi 2.214 (73463 0.202848668 3.132068.105 0.6677 (7714
Table 4. Relative fold change in expression of genes that were significantly down-regulated in COPD epithelial cells, but did not significantly change in healthy cells, upon smoking. COPD-iniitpe Geat's - SoiftMng vs. »n-$m<ikfag
Gene S>min>i COPD Fi>lii Change COPD Standard Deviation Healthy FeW hange Healthy Standard Deviation
CYP26AS 0.474263748 0.1(525593447 0.11 668153 1.758133521
MMP2 0,44955332 0.402435222 0.26183138 0.8366161 Π
SUTRK6 0.38OP95S 0.12838448 0.20459224 1,359445507
U8A7 0,489825403 0.090980698 0.328367823 0,70153907
1:1· V> I 0.496623W 0.099867881 0,346734789 0,720992744
ST6GALNACS 8,46! 757244 0.100233529 0.318125021 1.2415766· 4
ST6GA1. AC2 G.438266709 0.304378176 0,297038979 0.7**987396
S1.C15A2 0,488381599 0.0966282 0.356806219 1.006 11345
M.CAR2 0.46497288? 0.2698S6861 0,342485109 0.802602251
ΑΪ 28 8,490237755 0.1 5! 44077 0.38! 119303 0.740.176404
KM A 0.4779314% 0.2*16057577 0,378334086 0.71178907
TLR5 0.424376743 0.205806873 0.335759161 0.744843259
ΛΤΟΗ8 0,434530997 0.354152909 0.369856128 0.749544718
CFT 8,471078126 0.330648392 0.40924*3079 0.595696791
SELE RI'S 0.470086775 0.248335213 0,421382922 0.75721036
LX 0.4870 J 9266 0.27881225! 0.460481707 !. 11987594
CYP2B6 0.403829931 0.11338475 0,391919384 0.749857069
KC RG 0.4193758ft? 0.40467714! 0.423353362 1.283254285
CLIC6 0.482678844 0.321 13688 0.489623542 0,679269208
E5.F5 0.495427463 0-350*83645 0.50643563? 0.660415303
NFTB 0.486391 S« 0.061335033 0.498969862 0,7.34262993
HTfUD 0,4897978.17 0.38372442 0.502908235 0,410216589
GPXi* 0.418774137 0.370979216 0,444741982 0.94.3015802
M G! A 8,481621933 0.1 2028148 0.51810703? 0.222872849
MMP53 0.472738248 0.124529278 0,513037789 0.483531882
WJPKl 0.462444456 0.475202024 0.504718136 0..588788791
SRD5A2 0.45.5659043 0. 13419932 0.505 (50965 0.78 174289
ANT.X.R 1 8.459860201 0.1 2016499 0.5.17403033 0.746410247
FAM21 B 0.499811586 0.423304749 0.557448107 .1.148423738
DVYD 8,458961645 0.135897489 0.524908094 0.667699878
SI.C4A4 0.145992534 0.3544 749 0,211955981 1.085983878
ΜΕΤΤ1.7Λ 0.485705255 0.260543*108 0.564546146 0.842898827
LOCSQ01292 7 0.391535968 0.216902941 0,476599139 1.379967758
TG 2 0.320488834 0.! 67228879 0.4055663S9 0,7823823
TBC 0.4Ο 061Ί7 0.24922651 0.49449.8769 0.41868293
CYGB 0.455978277 0.243063088 0,542861565 0,349599856
CYP4X1 0.337873! 24 0.151227072 0,424907437 0.849200923
GSTA2 0,31 6553 1 0.3 1552434 0.3987 1 5? 1.313994597
TPPP3 0.475380704 0.438071155 0,567503948 1.021515807
L1F 8,460 ) 4426 0.146060674 0.557409019 0.133289922
F1BI 0.4990 166? 0.139869766 0,595892984 0.27412661
GST A J 0.339! 94692 0.! 85816982 0.437801 63 0.8898799 1
F0STSK4L 0.454579974 0.145054921 0.559S5O2S5 0.445104717 PL42GiO 0.372459509 0.648745008 0.482227S07 0.720160962
TNi !<:·>! ··! 0.367267655 0.11 1273695 0.493009522 0.864967603 oj 0.404457843 0.12458016 0.535836857 0,52981238
ΪΜΕ 212 0.29000471 0.20219562 0.429853786 1.063538194
C.LDN1G 0.340662606 O.3 2O50769 0,482063326 0.917978658
M-GR1 0.48*412414 0,07487519 0,6266069 J 0.217706281 A.P2K6 » U <.: :·;■·< 0.356612279 0.443357612 0.833926003 Ρ ΒΪΑ 0.478386556 0. 158703752. O.64509275S 0. 12619674
CNGA4 0,418581923 0,326944017 0.58 118803 0.456817325
CT i 0.46.5977662 0.147072784 0.6335 54496 0.420055486
JOGAP2 0.464502299 0.31903540 Ϊ 0.636528125 0,516470903
ONE 0.458424721 0.183203914 0.632052842 0.684 -6071 IR4773-2 0.437573392 0.417337528 0.617543285 0.392750599
LDC9S548 0.49896257 0.167755183 0.680953764 0.4871.10797
U C00284 0.275619764 0.11 15427 J 0.465875139 0.556479024
ATP 52 A 0.326813277 0. 7943534 0.558565577 0,385550128
LOCI 09505633 0.499739445 0.214056952 0.694276543 0.497575643
IL6 0.456373207 0.216898907 0.652156371 0.128009975
CXCL3 0.344901187 0,395968902 0.544248054 0,304875003
P1XB4 0.441233581 0.150878761 0.643970386 0.708427877
MSMB 0.43038 163 0.09199 509 0.636396659 0.650098678 mx2ip 0.3922SS206 0.380544224 0.609456363 .465O47O 7
PCDHB6 0.496829072 0.25638658 0.716062457 0.400 -01632
C2orJ73 0.48557919 0.319647223 0.706628944 0. 140266 !.S
CCT.20 0.3 -3748942 0,467492596 0.537858314 0,364505279
LRRC46 0.39S! 70226 0.332756457 0.625537343 0.456801988 UC5.B 0.477337803 0.266152929 0,706081155 0.547558332
PRKA82B 0.355791081 0.265210543 0.587592358 0.804849682
PADT3 0.4677(54004 0.182577889 0.7004S3235 0.265788889
CYP26B1 0.441748763 0.146418051 0.674676118 0,066152999
CYP2.Fi 0,425005525 0,250266934 0.672179951 0.140640413
ALS2C. 52 0.468385072 0.158804631 0.722350893 0.468693577
SRGAP3-AS2. 0.43.2794029 0.37067704 0.692454092 0.806144284 C K 0.447000856 0.065990221 0.711478673 0,653931167
PSATi 0.4- 7487454 0.4671 7568 0,683280882 0.3719026 1
0.466281631 0.277048489 0.732325656 0,634087499
S'J..Ct3 5 0.252 i 53254 0.407393214 0.520584465 0.282612797
TNFA1P3 0.474509212 0.326697278 0.7475 5972 0.612329534
LOC284561 0.416848558 0.248246394 0.689769503 0. 144034274
HNMT 0.472427303 0.24I7 5482 0.758331426 0.320506807
C1orfJ89 0.45*862194 0.3 19S6005 0.747592068 0.544722003
ACTA! 0.423788766 0, 1 634979 0.715827852 0,488067307
LDLRADi 0.44! Π 0574 0.287303855 0.741186923 1.354018309
C.XCL2 0.38 M 13205 0.146593732 0.707587393 0.272278572
OMG 0.430761136 0.48534731 1 0.763713272 1.850305917 F.DA28 0.45*79 ! 4073 0.230508945 0,822 ( 03391 0. 142787777
N .05 0.48865 J S3 0.195569404 0.83S62239J 0.38673225
ADH1 C 0.459670026 0.236248525 0, «2739745 1.2252.77576
OH9 0.3524477*5 0.06304897? 0.72S836949 0.835909212
ATP6V IC2 0.498507547 0.240529917 0.897433GS8 0. 1 4863 ) 1
ccocn 0.447553793 0.14873275* 0.849503865 033 ) 638225
I.OC541472 0.349 J ¥9298 0. 192784355 0.784272 0.272670657
cxc o 0.29883955 0.275452.5-67 0.74431304 0.214440194
MIR3 S 42 0.435 ! 27695 0,220 ! 29476 0.882 ( 51796 0.7851 24315
T T 0356957136 0 J 39798097 0.816545396 . J 16385696
KCNJ2 0.421463836 0. 13746362.1 0.S94 ! 23.177 0.215598328
TXt. .8 0,451945355 0.332835373 0.95 123826 0.404077S77
L1 CO0862 0.21 7024 ( 88 0.1404J45O5 0.755629.1 0.35 77539
&QP5 0,422935261 0.068091737 0.964775661 0.103324707
TEX26 0.399681 9 0.197512J 7 0.959859067 0.543586245
SL17C 0.26.1510907 0,255.153736 0.9J485637 0.124288104
) V! i · 1 » 0,403443556 0. 77800376 1 . 383.16879 0.602745303
[0254] Tables 3 and 4 compare smoking vs. non-smoking gene expression changes in COPD and healthy epithelial cells separately to understand stimulated phenotypes. The fold changes between healthy and COPD cells are then compared to identify responsive genes that are COPD-specific.
[0255] When the top 10 genes from Table 3 were compared between healthy cells in the airway-on-a- chip device and clinical healthy samples from a publicly available dataset, a close similarity between the healthy cells in airway-on-a-chip devices and in clinical samples were observed. Fig. 9 shows that the healthy cells cultured in an airway-on-a-chip device display similar trend in fold change in mRNA expression as measured in clinical bronchoscopy samples derived from healthy smokers and healthy non- smokers, when the cultured cells were subject to either a smoking condition or a non-smoking condition. The agreement between the "airway-on-a-chip device" data and the clinical data on healthy cells indicates that the air-on-a-chip device can be used to identify disease-specific response. Accordingly, the distinct patterns of gene expression in COPD cells, as shown in Tables 3 and 4, and Fig. 9, show COPD- specific responses to smoking. These genes, individually or combined, can be used as therapeutic targets or diagnostic biomarkers for COPD.
[0256] Biomarker identification for COPD exacerbation has been previously conducted on sputum, bronchoalveolar lavage fluid (BALF), blood or bronchoscopy-isolated samples (Koutsokera et al. "Pulmonary biomarkers in COPD exacerbations: a systematic review." Respiratory research (2013) 14, 111; Bafadhel et al. "Acute exacerbations of chronic obstructive pulmonary disease: identification of biologic clusters and their biomarkers." American journal of respiratory and critical care medicine (2011) 184, 662-671. However, those biomarkers in many cases lack tissue-specificity and their production/expression cannot be accurately attributed to specific cell types, like airway epithelium. For example, some biomarkers, especially systemic (bloodstream) ones are nonspecific - i.e. not COPD specific, biomarkers such as C-reactive protein (CRP). Koutsokera et al. "Pulmonary biomarkers in COPD exacerbations: a systematic review." Respiratory research (2013) 14, 111. In terms of biomarkers for COPD vs. healthy, the COPD Biomarker Qualification Consortium (CBQC) previously reported blood fibrinogen, interleukin 6 (IL-6), and CRP. Merrill et al., "New Biomarkers: Why Are They Critical to the Future of COPD Research? How the COPD Biomarker Qualification Consortium (CBQC) Work Will Deliver Results" Lung Health Professional Magazine (2013) 4: 30-36. Yet, these reported biomarkers are serum and not necessarily airway epithelium -specific. To our knowledge, COPD-specific biomarkers as presented in Tables 3-4 and Fig. 9 are novel over the previous reports.
[0257] In some embodiments, at least one or more of the genes listed in Tables 3-4 can be used as a lung cancer biomarker. For example, several genes, e.g., Metallothionein 1H (MT1H), Transmembrane Protease, Serine HE (TMPRSS 11E) and Small Proline-Rich Protein 3 (SPRR3), as listed in Table 3, have recently been reported to be involved in development of human malignancies (but not in the lungs). Therefore, the expression and/or secretion of at least one or more of the genes listed in Tables 3-4 can be correlated to lung cancer.
[0258] In some embodiments, at least one or more of the genes listed in Tables 3-4 can be used to discriminate between infectious (e.g., caused by viruses or bacteria) and non-infectious (e.g., cigarette smoke-induced as an example of non-infectious cause) causes of COPD exacerbations. For example, when a gene listed in Tables 3-4 does not differentially expressed in COPD cells upon exposure to an infectious agent (e.g., a virus and/or a bacterium), as compared to COPD cells without exposure to an infectious agent (e.g., a virus and/or a bacterium), the gene can be used as a biomarker to differentiate a non-infectious cause of COPD exacerbation from an infectious cause of COPD exacerbation.
[0259] While transcriptome analysis was performed on the cells in this Example to discover COPD- specific biomarkers, the methodology as described in this Example can be extended to discover other disease-unique novel biomarkers using various approaches including, e.g., transcriptome analysis, metabolomics, proteomics, epigenomics, or a combination of two or more thereof.
[0260] The cells cultured in the lung airway-on-a-chip device are not limited to COPD-derived cells, but can include a "sub-population" or "whole population" of cells derived from any diseased or healthy cell types or tissue types. In some embodiments, the COPD-derived cells can be derived from one or more different COPD patient subgroups (GOLD stages 1-4).
[0261] In some embodiments, any organ-on-a-chip device as known in the art can be used.
[0262] In some embodiments, instead of using the 3R4F research-grade reference cigarettes, other tobacco products (e.g., commercially available cigarettes, or cigars, high tar, low tar, high nicotine, low nicotine, etc.) or even tobacco-related products such as electronic cigarettes can be used. In some embodiments, the smoking behavior parameters (e.g., but not limited to puff time, inter-puff interval, and number of puffs per cigarette) can be changed to simulate other desired smoking profiles.
Example 6. Modeling normal and COPD human lung small airway responses to inhaled tobacco smoke in vitro
[0263] Cigarette smoking is a common cause of lung disorders and it is the primary risk factor for the development of chronic obstructive pulmonary disease (COPD), which is the third leading cause of death worldwide1'2. Smoke-induced disease exacerbations represent one of the common causes for COPD patients to seek medical care3. In addition, tobacco-related products such as electronic cigarettes (e- cigarettes) are drastically gaining popularity, but the biological impact of their emissions on lung airway cells is poorly characterized4'5. Neither small airway disease nor COPD exacerbations caused by cigarette smoke can be effectively modeled in animals6"8. Because commonly used laboratory animals (e.g., mice, rats) are obligate nose-breathers, their applicability for smoke exposure studies, either from conventional cigarettes or e-cigarettes, is debatable. Culture systems have been developed to study the effects of smoke on human lung epithelium9"12; however, they are unable to reproduce physiological breathing air movements that are responsible for delivering smoke to the lung mucosa. Moreover, these models have predominantly focused on the toxicity aspect of tobacco smoke exposure. Therefore, there is a great need for a novel, versatile and physiologically relevant experimental model that faithfully recapitulates inhaled smoke-induced airway pathologies to study of tobacco products and reconstitutes clinically validated tissue-level responses of diseased lung epithelium for therapeutic target and diagnostic biomarker discovery.
[0264] The majority of published in vitro models used to study effects of smoking continuously expose cultured lung epithelial cells under static conditions to cigarette smoke extract (CSE) that primarily contains only its hydrophilic constituents10"12, or to cigarette smoke condensate (CSC) composed of hydrophobic particulate matter13. However, exposure to whole cigarette smoke, which contains particulate, hydrophobic, hydrophilic and gaseous components, is required to induce the full complement of pathological phenotypes associated with smoke-induced airway injury14' 15. In in vitro studies, lung cells are also often continuously exposed to CSE when submerged in liquid, rather than being cultured at air-liquid interface (ALI), which is known to be critical for normal lung airway biology16. A method for generating, diluting and delivering whole cigarette smoke to lung epithelium cultured at an ALI was recently reported9' 11 ; however, this model only permits exposure of cells to vertically delivered puffs of smoke under static conditions. In contrast, human smokers commonly exhibit characteristic patterns of puff durations and volumes and inter-puff intervals that result in dynamic exposure to smoke compounds under conditions of flow that apply shear forces to the airway epithelium18' 19.
[0265] In the present study, we set out to develop a new in vitro model of smoke-induced lung injury by connecting a recently described Organ-on-a-chip' microfluidic culture device lined by living human bronchiolar epithelium cultured at an ALI20 to a smoking instrument that inhales and exhales whole smoke from burning cigarettes in and out of the chip under dynamic conditions that faithfully recapitulate human smoking behavior. We then compared the effects of inhaled smoke on chips containing bronchiolar epithelium isolated from normal lungs or from lungs of COPD patients. In addition, we explored whether our platform can be used to study biological effects of e-cigarettes, which is a major challenge for tobacco companies and regulatory agencies today.
[0266] Engineering of a breathing human small airway-on-a-chip to smoke cigarettes—The smoking airway-on-a-chip consists of four integrated components: an organ-on-a-chip microfluidic device lined by human bronchiolar epithelium, a smoke generator, a microrespirator, and control software that recapitulates human smoking behavior. The organ-on-a-chip is an optically clear, microfluidic culture device composed of poly(dimethylsiloxane) (PDMS) polymer the size of a computer memory stick that contains an upper microchannel (1 mm high x 1 mm wide) separated from a lower microchannel (0.2 mm high x 1 mm wide) by a thin, porous, polyester membrane (10 μιη thick with 0.4 μιη pores) coated with type I collagen (Fig. 10A). Primary human airway epithelial cells (hAECs) obtained from healthy donors or COPD patients were cultured on top of the membrane in medium flowing through both channels until they reached confluency. Subsequently, air was introduced into the upper channel to create an ALI that was maintained for four weeks while medium continuously flowed through the lower channel. Under these conditions, the hAECs formed a highly differentiated pseudostratified ciliated airway epithelium that fully recapitulated the morphology and functions of the living lung small airway (Fig. 10A; Fig. 15)20.
[0267] To mimic exposure of the engineered human lung small airway to cigarette smoke on-chip, we constructed a microrespirator that cyclically breathes in and out microliter volumes of air through the upper epithelium-lined channel of the airway chip, and a programmable smoke machine to regulate smoking behavioral parameters, such as puff duration and volume, inter-puff interval, puffs per cigarette and the number of cigarettes smoked (Fig. 10B and IOC). The channel geometry, air volume, and shear stress were scaled to reflect the expected values found in the generation 8-16 of airways in the lung. The entire apparatus was then placed in a standard culture incubator and connected with the chips and a peristaltic pump that controlled medium perfusion (Fig. 10D). In the final assembly, the integrated microrespirator and smoking machine components worked in synchrony to flow freshly generated whole cigarette smoke over the differentiated epithelium only during the inhalation phase of the respiration cycle in the airway chip, and to flow the smoke out during the exhalation phase.
[0268] Induction of oxidative stress in the smoking human airway chip— Cigarette smoke contains a complex combination of thousands of chemicals, some of which are oxidants and free radicals21, and this is reflected by higher oxidative stress levels in the lungs of smokers and COPD patients compared to healthy individuals22' 23. To determine our ability to mimic acute smoke-induced airway injury responses and validate our system, we had the instrument sequentially 'breathe' freshly produced whole cigarette smoke from nine research-grade 3R4F cigarettes into the upper, differentiated epithelium-lined channel of the chip over a period of 75 minutes and then analyzed responses the next day (Fig. 16A, 16B). Analysis by phase-contrast microcopy showed homogenous deposition of particulates over the entire length of the cell-seeding channel (Fig. 17). When exposed to whole cigarette smoke using a physiologically relevant smoking regimen (12 puffs per cigarette, 2 seconds puff duration, 22 seconds inter-puff intervals; sinusoidal respiratory flow of 150 mL air/smoke per breath, 12 breaths per minute Table 5), human airway chips fabricated using cells from normal (healthy) human donors consistently exhibited almost a 15-fold increase (p < 0.01) in expression of the anti-oxidant gene, heme oxygenase 1 (HMOX1), compared to untreated controls when analyzed by quantitative PCR (Fig. 11A). Western blot analysis further revealed a significant increase (p < 0.001) in phosphorylation of the transcription factor, Nuclear Factor (erythroid-derived 2)-Like 2 (Nrf2) (Fig. 11B and Fig. 18A), which has been shown to induce expression of cytoprotective genes, including HMOX1, to protect against oxidative stress and chemical toxicity24. Table 5. Comparison of smoking parameters used on-chip versus in human smokers. Clinical values were obtained from published reports18' 19.
Parameters Clinical Range On Chip
Puff duration 0.7 - 3.0 sec 2 sec
Inter-puff interval 17 - 26 sec 22 sec
Number of puffs per cigarette 8 - 14 12
[0269] To more comprehensively validate our model against human patient data, we performed genome-wide gene microarray analysis and compared our acute exposure results against those obtained by similar analysis of small airway epithelial cells isolated during bronchoscopy from phenotypically normal human smokers versus non-smokers using a published dataset (GEO# GSE4498)25. We identified 335 genes that exhibited significant changes (p < 0.05, fold change > 2) in expression in normal smoking chips compared to non-smoking chips (Table 6), and a gene ontology functional enrichment analysis revealed 23 enriched biological processes (Fig. 11C and Table 7). Table 6 shows differential gene expression mean and error propagated standard deviation from both the smoking condition and nonsmoking control. The differentially expressed genes were analyzed for functional annotation of gene ontology biological processes using Database for Annotation, Visualization and Integrated Discovery (DAVID) software. P-values were corrected for multiple sampling using the Benjamini-Hochberg correction. This analysis verified that oxidation-reduction pathway changes observed in human smokers are similarly modulated in our model. Moreover, closer examination of expression changes of genes associated with oxidation-reduction revealed striking similarities between human smokers and our smoking chips for a majority of genes (Fig. 13B). The top three highly induced genes in all samples were Aldo-Keto Reductase Family 1 Member B 10 (AKR1B 10), Cytochrome P450 Family 1 Subfamily B Polypeptide 1 (CYP1B 1) and CYP1A1, and we independently confirmed this change in CYP1A1 expression by quantitative real-time PCR (Fig. 18B). These findings are also consistent with past clinical studies, which showed that CYP1A1 is highly upregulated in airway epithelium of healthy smokers26.
[0270] Smoke-induced ciliary dysfunction on-chip — Smokers are often plagued by decreased mucociliary clearance; however, it is unclear whether this symptom is caused directly by ciliary dysfunction because previous studies in humans and animal models have reported conflicting results, including increases, decreases and no change in average ciliary beating frequencies (CBF) in response to smoke exposure27"29. Given the novel accessibility and visualization capabilities offered by the organ-on- chip method, we conducted an automated analysis of ciliary beat frequency in smoking versus untreated small airway chips using high-speed video-microscopy to elucidate the effect of cigarette smoking on ciliary function. By using automated image processing to segment the images into regions with ciliary motion and then applying signal analysis to determine CBFs in the extracted regions (Fig. 19), we were able to quantitatively map CBFs with single cell resolution and at greater throughput than possible with traditional side view analysis of ciliary beating30' 31.
[0271] Physiological recapitulation of cigarette smoke-induced ciliary dysfunction on-chip was performed. (Fig. 12). A plot of the deviations from the median of ciliary beating frequencies measured in normal bronchiolar epithelium in the absence (-) or presence (+) of exposure to whole cigarette smoke on-chip for 24 hours (data pooled from 2 different human donors with every symbol representing a measurement in one field of view, and approximately 50 fields being analyzed for each condition). Representative time-lapse images of ciliary beating on the apical surface of the bronchiolar epithelium cultured on-chip in the absence (Non-Smoking) or presence (Smoking) of whole cigarette smoke were taken and analysed. We notice that there was increased range (variance) of beating frequencies in the smoke-exposed chips compared to control. Distributions of CBF in a representative normal small airway chip before and after smoking was diagramized for analysis. We note that the normal Gaussian distribution changes to a flattened, non-normal distribution after smoke exposure. (Data not shown) A plot showing the fold change in variance of ciliary beating frequencies in normal airway epithelium cultured in the absence (-) or presence (+) of exposure to whole cigarette smoke on-chip (left) compared to similar results obtained with normal airway epithelium cultured in a Transwell insert at an air-liquid interface before (ALI) and after (all results at right) being submerged in culture medium and exposed to 0, 1, 2 or 4% cigarette smoke extract (CSE; ***p<0.001). n.s.: not significant. (Fig. 12A).
[0272] This analysis revealed that untreated small airway chips derived from multiple human donors faithfully recapitulated the normal Gaussian distribution of CBFs (data not shown) previously reported from analysis of nasal brushings or tissue (tracheal or bronchial) explants from healthy human donors cultured ex vivo32, . Airway chips exposed to cigarette smoke exhibited a comparable median CBF; however, the distribution of their CBFs was characterized by a 4-fold (p<0.05) increase in variance (Fig. 12A and 12B), as well as a negatively skewed shape of the distribution with a long tail extending into lower beat frequencies that no longer could be described by a normal distribution. Intriguingly, this analysis revealed for the first time that smoking produces a heterogeneous effect on ciliary beating across the surface of the epithelium, with some areas beating normally and other beating at much reduced rates. Further, the skewed CBF distributions seen in smoke-exposed samples invalidate the use of statistics and associated tests of significance that assume a Gaussian distribution, such as the mean (average) value and the popular Student's t-test. This may explain why past studies of human samples that only measured the effect of cigarette smoke on the average CBF produced conflicting results27"29.
[0273] When compared the smoking airway chips with the same cells grown in Transwell cultures, we found that this static model created artifacts that made it impossible to detect subtle changes in the distribution of CBFs. In particular, the most commonly used Transwell models require that the differentiated epithelium be submerged in medium in order to be exposed to CSE. We found that this treatment alone increased the variance of CBFs by ~3-fold compared to cells maintained at the ALI, and subsequent exposure of these submerged cells to increasing concentrations (1-4%) of CSE produced a decrease in variance of CBFs, rather than the increase we observed on-chip in epithelium exposed to whole smoke under more physiological ALI conditions (Fig. 12C). Our work further supports the recent shift away from CSE studies and toward approaches that rely upon ALI-mediated smoke exposure.
[0274] Airway chip platform to study biological impact of e-cigarette — To test the breadth and versatility of our platform, we explored whether the human small airway chip can be applied to study biological effects of e-cigarettes, specifically oxidative stress and ciliary dysfunction. We observed that when human small airway chips were exposed acutely to emissions from commercially available blu® e- cigarette under the same exposure regimen as 3R4F tobacco cigarettes, no significant change in gene expression of HMOX-1 occurred (Fig. 13A). Interestingly, while the e-cigarette challenge transformed the ciliary beating from normal Gaussian to a non-normal distribution (Fig. 13B), there was no significant change in CBF variance (Fig. 13C). Thus, this chip-based model system can be used to discriminate differences in effects of conventional versus e-cigarettes.
[0275] Smoke-induced exacerbation of COPD on-chip— Cigarette smoke is known to be a major noninfectious cause of clinical exacerbations in patients with COPD3, and it cannot be modeled effectively in animals. We, therefore, set out to explore if we could mimic this relationship in human airway chips created with epithelial cells obtained from COPD patients, which have been previously shown to form a similarly well differentiated mucociliary epithelium after being maintained at ALI for 4 weeks on-chip20 as this has never been examined previously in vitro. Clinical reports have demonstrated increased lung neutrophil accumulation and interleukin 8 (IL-8) levels in COPD patients compared with healthy subjects.34, 35. When we stimulated airway chips with whole cigarette smoke, we observed that the COPD epithelium responded by producing large increases in secretion of IL-8, whereas there was no significant change in the healthy epithelium (Fig. 14A).
[0276] We then compared gene expression profiles in COPD chips with or without smoke exposure using microarray analysis and identified 276 genes that were differentially expressed (p < 0.05, fold change > 2) when COPD cells were exposed to cigarette smoke, (Table 8), of which 147 were COPD- specific and 129 were shared with smoke-exposed normal chips. Table 8 shows differential gene expression mean and error propagated standard deviation from both the smoking condition and nonsmoking control.We ranked the 147 diseased tissue-unique genes based on their change in expression relative to that observed in normal airway chips exposed to smoke (Tables 3 and 4). This analysis revealed that the top 10 genes represent a potentially novel set of genes that appear to distinguish differential responses to smoke exposure in COPD epithelium compared to healthy normal lung tissue (Fig. 14B). These genes include: metallothionein 1H (MT1H), transmembrane protease serine HE & 11F (TMPPvSS l lE & TMPRSS 1 IF), matrix metallopeptidase 1 (MMP1), small proline-rich protein 3 (SPRR3), repetin (RPTN), ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2 (ATP6V0D2), ankyrin repeat domain 22 (ANKRD22), tetraspanin 7 (TSPAN7) and neuronal cell adhesion molecule (NPvCAM). Importantly, changes in expression of these genes measured in normal airway epithelium on- chip were highly similar to those identified in human samples from normal donors (Fig. 14B).
[0277] Some of these genes, such as MT1H, TMPRSS11E, TMPRSS11F, RPTN and SPRR3, have not been associated with the COPD phenotype previously. MT1H, TMPRSS 11E and SPRR3 have been implicated in development of human malignancies36"38, and this could explain at least in part why there is higher risk of lung cancer development in COPD smokers39. Moreover, selective upregulation of serine protease genes TMPRSS11E and TMPRSS 11F is consistent with increased extracellular matrix degradation, airspace enlargement and emphysema development in COPD lungs40. Interestingly, TMPPvSS l lE has recently been reported to activate respiratory viruses such as influenza A viruses41; thus, our observation may in part explain higher susceptibility of COPD individuals to viral infections42. In addition, induced expression of RPTN gene, which has been associated with epidermal and keratinocyte differentiation43, 44, can explain squamous metaplasia development observed in advanced stages of COPD pathogenesis45.
[0278] Another gene included in this list of key markers of the response of COPD epithelium to smoke exposure was MMP1, in line with published clinical reports on involvement of MMP-1 in COPD pathogenesis46' 47. We validated smoke-induced MMP-1 upregulation at the protein level and, similar to IL-8, observed a hyperreactive response in COPD chips compared to normal chips (Fig. 20A). Importantly, this effect was directly due to the combined effect of inhalation and whole smoke, and not to breathing alone (Fig. 20A).
[0279] When we further analyzed relative expression of other metalloproteinase genes identified by the gene ontology analysis that differed in their expression between COPD and normal chips, we found that carboxypeptidase A4 (CPA4) and a disintegrin-like and metalloprotease with thrombospondin type 1 motif 1 (ADAMTS1) were also selectively induced in COPD cells (Fig. 20B). To our knowledge, this is the first report demonstrating the potential association of these genes with COPD and smoke-induced airway pathology.
[0280] In this study, we described the development of a novel in vitro method for administrating whole smoke from tobacco or electronic cigarettes to differentiated normal or diseased human bronchiolar epithelium via inhaled and exhaled movements that mimic human smoking behavior. This method leverages a recently developed human small airway-on-a-chip model48 and integrates it with a system comprised of a smoke machine, microrespirator, and computer control system. The model provides a way to expose primary human airway cells from healthy normal donors and COPD patients matured into a differentiated airway epithelium at an ALI to physiological movements of air containing whole cigarette smoke using dynamic, clinically relevant smoking patterns in vitro and without empirical smoke dilutions. This smoking airway-on-a-chip culture system effectively recapitulated clinically important smoke -triggered molecular changes in lung epithelial cells, such as increased oxidative stress. Using the system with a highly sensitive automated imaging approach to evaluate smoke -related ciliopathies, we gained new insight into how smoke exposure alters ciliary motion in lung epithelium. Moreover, this system provided a novel, reliable and versatile approach to study fine micropathologies like the pattern of ciliary beating. We also reconstituted diseased tissue-specific responses in vitro, and identified novel biomarkers in the form of a unique transcriptional signature that appears to distinguish responses to smoke exposure in COPD epithelium from those in healthy normal lung epithelium. [0281] In conclusion, the smoking human small airway chip method provides a new way to study airway pathophysiology in response to inhaled whole cigarette smoke, study e-cigarette biological effects, identify COPD-specific biological responses, and discover novel molecular signatures that may serve as therapeutic targets or diagnostic biomarkers.
Exemplary Methods and Materials for Example 5
[0282] Study design— This work was initiated by engineering a microrespirator and a smoke machine to enable exposure of mucociliated bronchiolar epithelia in small airway-on-a-chip to tobacco smoke under physiological inhalation-exhalation airflow. We validated our model by recapitulating a clinically important phenotype - smoke-induced oxidative stress, and then tested its applicability for (1) identification of previously unknown ciliary micro-pathologies, (2) exploring cytotoxicity of electronic cigarettes, and (3) discovering novel COPD-specific molecular signatures.
[0283] Microfluidic chip fabrication — Molds for the microfluidic devices were fabricated out of Prototherm 12120 using stereolithography (Protolabs, Maple Plain, MN). The top and bottom components of the devices were cast from polydimethyl siloxane (PDMS) at a 10: 1 w/w base to curing agent ratio, degassed, and cured for 4 h to overnight at 60°C. The top component contains a fluidic channel (l x l mm cross section) and ports for the top and bottom channels. This is bonded, using oxygen plasma treatment (40 W, 800 mbar, 40 s; Plasma Nano, Diener Electronic, Ebhausen, Germany), to the bottom component containing the endothelial channel (1 mm wide x 0.2 mm high). A laser cut 0.4 μπι pore diameter track-etched PET membrane (-10 mm thick; Maine Manufacturing, Sanford, ME) is sandwiched between the components to provide a semi-permeable barrier between the airway epithelium and microvascular endothelium layers. Devices were sterilized using oxygen plasma treatment (100 W, 15 seem, 30 s; PlasmaEtcher PE-100, Plasma Etch, Reno, NV).
[0284] Microfluidic organ-on-a-chip cell culture — Primary human small airway epithelial cells obtained from commercial suppliers (Promocell and Lonza) were expanded in 75 cm2 tissue culture flasks using small airway epithelial growth medium supplemented with growth factors (Promocell) until ~ 80% confluent. Detailed methods for culture and differentiation of human lung epithelial cells in airway chip have been recently described48. Briefly, bronchiolar cells were seeded onto the membrane, maintained in a submerged state for 5 days and an air-liquid interface was established in the upper channel for 3 to 5 weeks, while the bottom channel was perfused with medium. Chips were then transferred to designated incubators for smoke exposure.
[0285] Design of biochip-compatible breathing-smoking instrument— The smoking instrument was designed to accommodate up to 10 cigarettes of various brands and mimic the range of typical smoker behaviors. Briefly, the instrument holds up to 10 cigarettes in a revolving holder with airtight silicone sealing rings. The control software triggers the ignition of each cigarette using a solenoid-actuated nichrome wire coil mounted on a ceramic mount inside a Teflon conical adapter. A miniature vacuum pump provides air intake during ignition and during each "puff and draws air from the cigarette, through a Teflon mouthpiece, to a 5 mL smoke reservoir. This action occurs at arbitrary user-selectable intervals (Fig. 16). A first pinch valve is used to programmatically select the timing of smoke and incubator air entering the chips during each inhalation. A second pinch valve directs the flow of air, routing smoke or air into the chips during inhalation and out of the chips into the exhaust during exhalation. An onboard microcontroller, relays, and a power supply provide support and communication with an external laptop. The system is controlled by custom Lab View software that enables users to define a broad range of smoker behavior parameters; however, we used a clinically relevant range in the present study (Table 5).
[0286] Microrespirator design and operation— The microrespirator consists of 8 air-tight 500 ml glass syringes cyclically actuated using a stepper motor-driven leadscrew and mounted in an aluminum and acrylic frame. The Arduino control software provides configurable sinusoidal respiratory flow of 150 in 2.5 s inhalation and 2.5 s exhalation times and is monitored by the smoking instrument. This air volume was calculated to meet our goal of modeling bronchiole generations 8-16, which are on average approximately 1 mm in diameter. Using measurements of human lung total cross sectional areas at these bifurcations (25-50 cm2)56 and a typical breath volume of 0.5 liter at 5-second cycle times, we calculated an approximate air volume of 150 per inhalation would be required to model in vivo conditions for our 0.01 cm2 epithelial channel cross sectional area.
[0287] Exposure of small airway epithelium to flowing whole cigarette smoke on-chip— One outlet of 'airway lumen' channel of well-differentiated small airway chip was connected to smoke tubing exiting the smoke machine and the other outlet was connected to the microrespirator. The whole setup fit in a 37°C cell culture incubator. Nine research-grade cigarettes (3R4F; University of Kentucky) were loaded into the moving wheel of the smoke machine. WCS exposure was initiated by the software that controlled and synchronized the breathing-smoking instrument. Key smoking topography parameters we applied were: puff = 2 seconds; average inter-puff interval = 22 seconds; 9 cigarettes with 12 puffs/cigarette; inter-cigarette time = 60 sec; inhalation time = 2.5 seconds; exhalation time = 2.5 seconds; smoke-in time = 1.2 seconds ( 150 μΐ air/smoke volume) at 12 breaths/min. Respiration cycles were 5 seconds long with 2.5 seconds for inhalation and exhalation steps. One day following smoke exposure, cells were analyzed for smoke-induced pathologies; the selected breathing and smoking parameters were selected to be representative of what is observed in humans 18. A second smoke machine was generated with a slight modification so that its mouthpiece supports loading blu® Classic Tobacco- Flavor e-cigarettes (blu® eCigs, USA). Every 12 puffs of the e-cigarette was considered equivalent to one full 3R4F tobacco cigarette.
[0288] Exposure of airway epithelium to cigarette smoke extract in Transwell inserts — Airway epithelial cells were cultured on Transwell inserts (0.4 μπι pore; Corning) under an air-liquid interface. Following differentiation to ciliated epithelium, culture medium (Promocell) with (1, 2 or 4% v/v) or without diluted CSE was added apically and incubated for 24h at 37°C before cilia beat analysis. CSE was prepared fresh by combusting 2 X 3R4F cigarettes (University of Kentucky) and bubbling the mainstream smoke through 5 ml of DMEM cell culture medium (Life Technologies). This was subsequently sterilized by passing through a 0.22 um filter and defined as 100% CSE, and all CSE preparations were used within 20 min after being generated. [0289] Scanning and transmission electron microscopy— Electron microscopic analysis was performed as previously described. In brief, cells were fixed in 2.5% glutaraldehyde (Electron Microscopy Sciences, USA) for 60 min at room temperature, rinsed with 1% sodium cacodylate and subsequently treated with 1% osmium tetroxide (Electron Microscopy Sciences; USA) for 90 min. Following sequential dehydration in ethanol gradients, fixed cells were rinsed in hexamethyldisilazane (Sigma), air-dried overnight and then mounted on a conductive carbon support for imaging with a VEGA III scanning electron microscope (Tescan, Czech Republic).
[0290] Quantitative RT-PCR — Gene expression analyses of cells were performed as previously described. Cycle of threshold (Ct) values were extracted, and results were analyzed comparatively using 2-AACt method following normalization against housekeeping gene hypoxanthine phosphorribosyltransferase (HPRT) as previously described. Primers sequences are listed in Table 2.
[0291] Microarray analysis—Total RNA from four chips per condition was extracted as above and submitted to the Dana Farber Microarray Core for analysis using Affymetrix Human ST 2.0 arrays/ The results obtained were robust multi-array average (RMA) data normalized and assessed for quality using Affymetrix Power Tools, and then further processed and analyzed using custom scripts in MATLAB; duplicate genes and data lacking gene IDs were removed prior to analysis. Each smoke-exposed condition was compared to donor-matched non-exposed chips, and genes with both a Student's t-test p- value < 0.05 and a fold change > 2 were identified for both non-COPD and COPD donor chips to generate lists of significant genes. For differential gene expression, means were subtracted and standard deviations were error propagated. The non-COPD significant gene list was used to compare our small airway chip data with clinical data from bronchoscopic sampling of 10 smokers and 12 non-smokers obtained from the Gene Expression Omnibus (GSE4498)25. Smoking samples were normalized to each gene's mean non-smoking control value for both in vitro and clinical data. Heat maps were generated using clustering linkages based on mean Euclidean distance for both biological samples and individual genes. DAVID software58 was used to further break down the significant gene lists into functional processes with p-values < 0.05. P-values were corrected for multiple sampling using the Benjamini- Hochberg correction method.
[0292] Analysis of ciliary beat frequency— Cilia beat frequencies (CBF) were measured by applying Fourier spectral analysis to bright field video recordings of the ciliated surface. Using an inverted transmission microscope, the ciliated surfaces were recorded at 190-200 frames per second and at 512 x 512 pixel resolution. Each ciliated chip was recorded at 5 tolO fields of view (FOV), each spanning 166 x 166 μπι2. To extract ciliary beat frequencies from these movies, we first identified regions of ciliary motion by calculating the standard deviation of brightness at each pixel over time. High values correspond to notable dynamic changes in pixel brightness, indicating motion and hence ciliary beating. Next, areas with ciliary motion were thresholded and sampled randomly once per 10 μπι2, resulting in a map of ciliary beat frequency at single cell resolution (Fig. 19). At each sample point, average ciliary beat frequency was determined from the time -dependent pixel brightness of up to 300 neighboring pixels, with each pixel's signal reflecting the periodicities of the ciliary movement (Fig. 19). After applying a bandwidth filter of 1 to 30 Hz to remove noise, a Hamming window to reduce sampling artifacts, and Fast Fourrier Transform to convert the temporal signal to the frequency domain, the resulting frequency power spectra were averaged to detect one or two dominant frequencies per sample point (Fig. 19). Then, for each FOV, the average ciliary beat frequency was computed for all sample points, resulting in 5 to 10 data points per chip.
[0293] For statistical analysis of ciliary beat frequencies across different chip conditions, we first tested whether the measured values of each condition followed normal distributions by using the Shapiro-Wilk Test (alpha level 0.05). To compare the dispersion of sample sets, we used the non-parametric Ansari- Bradley Test to test for inequality of population variance (alpha level 0.05). This test assumes similar medians, and thus, in cases where this condition was not fulfilled, we first equalized medians by subtracting the median value from each data set.
[0294] Western blot analysis— Whole cell extracts were lysed with RIPA buffer (50mM Tris-HCl, 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS), fractionated by SDS-PAGE and transferred to a nitrocellulose membrane using a transfer apparatus according to the manufacturer's protocols (Bio-Rad). After incubation with 5% nonfat milk in TBST (50mM Tris-HCl, 150mM NaCl, 0.1%Tween-20®) for blocking, the membrane was incubated with rabbit anti-Nrf2 (phosphor S40) antibody, rabbit anti-Nrf2 antibody (Abeam), or mouse anti-GAPDH antibody (Millipore). A horseradish peroxidase -conjugated goat anti-rabbit or mouse antibody was then added, and membrane was developed with the ECL Plus system (GE Healthcare) according to the manufacture's protocol.
[0295] Statistical analysis — Microarray and CBF statistical analyses are detailed in the respective methods sections. All other results and error bars are presented as mean standard error of the mean (SEM). Data were analyzed with an unpaired Student's t test using Excel software (Microsoft). Differences between groups were considered statistically significant when p < 0.05 (*p < 0.05, **p < 0.01, ***p < 0.001).
References for Examples 1-4
1 WHO. (2014).
2 Hogg, J. C. et al. The nature of small-airway obstruction in chronic obstructive pulmonary disease. The New England journal of medicine 350, 2645-2653, (2004).
3 Bafadhel, M. et al. Acute exacerbations of chronic obstructive pulmonary disease: identification of biologic clusters and their biomarkers. American journal of respiratory and critical care medicine 184, 662-671,(2011).
4 Evensen, A. E. Management of COPD exacerbations. American family physician 81, 607-613 (2010).
5 Jackson, D. J et al. Asthma exacerbations: origin, effect, and prevention. The Journal of allergy and clinical immunology 128, 1165-1174, (2011).
6 Smith, K. et al. Evaluation of risk factors and health outcomes among persons with asthma. The
Journal of asthma: official journal of the Association for the Care of Asthma 46, 234-237, (2009).
7 Watson, L., et al. Factors associated with mortality after an asthma admission: a national United Kingdom database analysis. Respiratory medicine 101, 1659-1664, (2007). Hyde, D. M., et al. Anatomy, pathology, and physiology of the tracheobronchial tree: emphasis on the distal airways. The Journal of allergy and clinical immunology 124, S72-77, (2009). Kolaczkowska, E. & Kubes, P. Neutrophil recruitment and function in health and inflammation. Nature reviews. Immunology 13, 159-175, (2013).
Wright, J. L., et al. Animal models of chronic obstructive pulmonary disease. American journal of physiology. Lung cellular and molecular physiology 295, Ll-15, (2008).
Barnes, P. J. Immunology of asthma and chronic obstructive pulmonary disease. Nature reviews. Immunology 8, 183-192, (2008).
Fahy, J. V. Eosinophilic and neutrophilic inflammation in asthma: insights from clinical studies.
Proceedings of the American Thoracic Society 6, 256-259, (2009).
Kunz, L. I. et al. Smoking status and anti -inflammatory macrophages in bronchoalveolar lavage and induced sputum in COPD. Respiratory research 12, 34, (2011).
Bueters, T., et al. The virtue of translational PKPD modeling in drug discovery: selecting the right clinical candidate while sparing animal lives. Drug discovery today 18, 853-862, (2013). Gaines Das, et al. Planning for reduction. Alternatives to laboratory animals: ATLA 37, 27-32
(2009) .
Binker, M. G et al. LPS-stimulated MUC5AC production involves Racl -dependent MMP-9 secretion and activation in NCI-H292 cells. Biochemical and biophysical research communications 386, 124-129, (2009).
Fulcher, M. L., Gabriel, S., Burns, K. A., Yankaskas, J. R. & Randell, S. H. Well-differentiated human airway epithelial cell cultures. Methods in molecular medicine 107, 183-206 (2005). Nesmith, A. P., et al. Human airway musculature on a chip: an in vitro model of allergic asthmatic bronchoconstriction and bronchodilation. Lab on a chip 14, 3925-3936 (2014).
Bhatia, S. N. & Ingber, D. E. Microfluidic organs-on-chips. Nature biotechnology 32, 760-772, (2014).
Huh, D. et al. A human disease model of drug toxicity-induced pulmonary edema in a lung-on- a-chip microdevice. Science translational medicine 4, 159ral47, (2012).
Huh, D. et al. Reconstituting organ-level lung functions on a chip. Science 328, 1662-1668,
(2010) .
Sellgren, K. L., Butala, E. J., Gilmour, B. P., Randell, S. H. & Grego, S. A biomimetic multicellular model of the airways using primary human cells. Lab on a chip 14, 3349-3358, (2014).
Stucki, A. O. et al. A lung-on-a-chip array with an integrated bio-inspired respiration mechanism. Lab on a chip 15, 1302-1310, (2015).
Wanner, A., et al. Mucociliary clearance in the airways. American journal of respiratory and critical care medicine 154, 1868-1902, (1996).
Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408, (2001).
Wills-Karp, M. Interleukin-13 in asthma pathogenesis. Immunological reviews 202, 175-190, (2004).
Kuperman, D. A. et al. Direct effects of interleukin-13 on epithelial cells cause airway hyperreactivity and mucus overproduction in asthma. Nature medicine 8, 885-889, (2002).
Sousa, A. R, Poston, R. N., Lane, S. J., Nakhosteen, J. A. & Lee, T. H. Detection of GM-CSF in asthmatic bronchial epithelium and decrease by inhaled corticosteroids. The American review of respiratory disease 147, 1557-1561, (1993). Ordonez, C. L. et al. Mild and moderate asthma is associated with airway goblet cell hyperplasia and abnormalities in mucin gene expression. American journal of respiratory and critical care medicine 163, 517-523, (2001).
Thomas, B. et al. Ciliary dysfunction and ultrastructural abnormalities are features of severe asthma. The Journal of allergy and clinical immunology 126, 722-729 e722, (2010).
Hewson, C. A et al. Toll-like receptor 3 is induced by and mediates antiviral activity against rhinovirus infection of human bronchial epithelial cells. Journal of virology 79, 12273-12279, (2005).
Le Goffic, R. et al. Cutting Edge: Influenza A virus activates TLR3 -dependent inflammatory and RIG-I -dependent antiviral responses in human lung epithelial cells. J Immunol 178, 3368- 3372 (2007).
Teijaro, J. R. et al. Endothelial cells are central orchestrators of cytokine amplification during influenza virus infection. Cell 146, 980-991, (201 1).
MacRedmond, R. E., et al. Epithelial expression of TLR4 is modulated in COPD and by steroids, salmeterol and cigarette smoke. Respiratory research 8, 84, (2007).
Mayer, A. K. et al. Differential recognition of TLR-dependent microbial ligands in human bronchial epithelial cells. J Immunol 178, 3134-3142 (2007).
Deslee, G. et al. Bronchial epithelial spheroids: an alternative culture model to investigate epithelium inflammation-mediated COPD. Respiratory research 8, 86, (2007).
Stanley, E. R., et al. The biology and action of colony stimulating factor-1. Stem Cells 12 Suppl 1, 15-24; discussion 25 (1994).
Fleischmann, R. et al. Placebo-controlled trial of tofacitinib monotherapy in rheumatoid arthritis. The New England journal of medicine 367, 495-507, (2012).
Bush, A. et al. Severe childhood asthma: a common international approach? Lancet 372, 1019- 1021, (2008).
Kudlacz, E., et al. The JAK-3 inhibitor CP-690550 is a potent anti-inflammatory agent in a murine model of pulmonary eosinophiliA. European journal of pharmacology 582, 154-161, (2008).
Matsunaga, Y. et al. Effects of a Janus kinase inhibitor, pyridone 6, on airway responses in a murine model of asthmA. Biochemical and biophysical research communications 404, 261-267, (201 1).
Ammit, A. J. Glucocorticoid insensitivity as a source of drug targets for respiratory disease. Current opinion in pharmacology 13, 370-376, (2013).
Wu, J. et al. Design and chemoproteomic functional characterization of a chemical probe targeted to bromodomains of BET family proteins. Med. Chem. Commun. 5, 1871-1878, (2014). Gomez-Cambronero, J et al. Granulocyte-macrophage colony-stimulating factor is a chemoattractant cytokine for human neutrophils: involvement of the ribosomal p70 S6 kinase signaling pathway. J Immunol 171, 6846-6855 (2003).
Belkina, A. C, et al. BET protein function is required for inflammation: Brd2 genetic disruption and BET inhibitor JQ 1 impair mouse macrophage inflammatory responses. J Immunol 190, 3670-3678, (2013).
Hubeau, C, et al. Interleukin-6 neutralization alleviates pulmonary inflammation in mice exposed to cigarette smoke and poly(I:C). Clin Sci (Lond) 125, 483-493, (2013).
Elias, J. A et al. Airway remodeling in asthma. The Journal of clinical investigation 104, 1001- 1006, (1999).
Thavagnanam, S. et al. Effects of IL-13 on mucociliary differentiation of pediatric asthmatic bronchial epithelial cells. Pediatric research 69, 95-100, (2011). 9 Laoukili, J. et al. IL-13 alters mucociliary differentiation and ciliary beating of human respiratory epithelial cells. The Journal of clinical investigation 108, 1817-1824, (2001).
0 Lawrence, M. B. & Springer, T. A. Neutrophils roll on E-selectin. J Immunol 151, 6338-6346 (1993).
1 Villenave, R. et al. In vitro modeling of respiratory syncytial virus infection of pediatric bronchial epithelium, the primary target of infection in vivo. Proceedings of the National Academy of Sciences of the United States of America 109, 5040_,5045, (2012).
2 Benam, K. H., Kok, W. L., McMichael, A. J. & Ho, L. P. Alternative spliced CD Id transcripts in human bronchial epithelial cells. PloS one 6, e22726, (2011).
3 Douillet, C. D et al. Nucleotides induce IL-6 release from human airway epithelia via P2Y2 and p38 MAPK-dependent pathways. American journal of physiology . Lung cellular and molecular physiology 291, L734-746 (2006).
4 Mercer, R. R., et al. Cell number and distribution in human and rat airways. American journal of respiratory cell and molecular biology 10, 613-624 (1994).
5 Livraghi, A. & Randell, S. H. Cystic fibrosis and other respiratory diseases of impaired mucus clearance. Toxicologic pathology 35, 116-129, (2007).
References for Examples 5-6
. H. A. Powell, et al. Chronic obstructive pulmonary disease and risk of lung cancer: the importance of smoking and timing of diagnosis. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer 8, e34-35 (2013).. S. I. Rennard, M. B. Drummond, Early chronic obstructive pulmonary disease: definition, assessment, and prevention. Lancet 385, 1778-1788 (2015).
. E. Sapey, R. A. Stockley, COPD exacerbations . 2: aetiology. Thorax 61, 250-258 (2006).
. L. Neilson, et al. Development of an in vitro cytotoxicity model for aerosol exposure using 3D reconstructed human airway tissue; application for assessment of e-cigarette aerosol. Toxicology in vitro : an international journal published in association with BIBRA 29, 1952-1962 (2015).. T. R. Rowell, R. Tarran, Will chronic e-cigarette use cause lung disease? American journal of physiology. Lung cellular and molecular physiology 309, L1398-1409 (2015).
. R. Vlahos, S. Bozinovski, Recent advances in pre-clinical mouse models of COPD. Clin Sci (Lond) 126, 253-265 (2014).
. J. L. Wright, et al. Animal models of chronic obstructive pulmonary disease. American journal of physiology. Lung cellular and molecular physiology 295, Ll-15 (2008).
. J. Adamson, Haswell, L. E., Phillips, G., & Gaca, M. D., in Bronchitis, I. MartA-n-Loeches, Ed.
(2011).
. C. Mathis, et /.Human bronchial epithelial cells exposed in vitro to cigarette smoke at the air- liquid interface resemble bronchial epithelium from human smokers. American journal of physiology. Lung cellular and molecular physiology 304, L489-503 (2013).
0. T. Mio, et al. Cigarette smoke induces interleukin-8 release from human bronchial epithelial cells.
American journal of respiratory and critical care medicine 155, 1770-1776 (1997).
1. P. Glader, et al. Cigarette smoke extract modulates respiratory defence mechanisms through effects on T-cells and airway epithelial cells. Respiratory medicine 100, 818-827 (2006).
2. R. M. Mulligan, et al. Cigarette smoke extract stimulates interleukin-8 production in human airway epithelium and is attenuated by superoxide dismutase in vitro. American journal of rhinology & allergy 23, el -4 (2009).
3. G. R. Hellermann, et al. Mechanism of cigarette smoke condensate-induced acute inflammatory response in human bronchial epithelial cells. Respiratory research 3, 22 (2002). J. Adamson, et a/.Assessment of an in vitro whole cigarette smoke exposure system: The Borgwaldt RM20S 8-syringe smoking machine. Chemistry Central journal 5, 50 (2011).
D. Thorne, J. Adamson, A review of in vitro cigarette smoke exposure systems. Experimental and toxicologic pathology : official journal of the Gesellschaft fur Toxikologische Pathologie 65, 1183-1193 (2013).
A. A. Pezzulo et al. The air-liquid interface and use of primary cell cultures are important to recapitulate the transcriptional profile of in vivo airway epithelia. American journal of physiology. Lung cellular and molecular physiology 300, L25-31 (2011).
J. Phillips, et /.Exposure of bronchial epithelial cells to whole cigarette smoke: assessment of cellular responses. Alternatives to laboratory animals : ATLA 33, 239-248 (2005).
E. M. Lee, et al. Smoking topography: reliability and validity in dependent smokers. Nicotine & tobacco research : official journal of the Society for Research on Nicotine and Tobacco 5, 673- 679 (2003).
A. A. Strasser, et al. Smoking topography predicts abstinence following treatment with nicotine replacement therapy. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 13, 1800-1804 (2004).
K. H. Benam, et al. Small airway-on-a-chip enables analysis of human lung inflammation and drug responses in vitro. Nat Methods 13, 151-157 (2016).
J. B. Wooten, et al. Cigarette Smoke and Oxidative Stress, H. E. P. Barry B. Halliwell, Ed. (Springer, 2006), vol. XII, chap. 2, pp. 407.
A. Comandini et /.Markers of antioxidant response in tobacco smoke exposed subjects: a data- mining review. Pulmonary pharmacology & therapeutics 23, 482-492 (2010).
S. Pierrou, et al. Expression of genes involved in oxidative stress responses in airway epithelial cells of smokers with chronic obstructive pulmonary disease. American journal of respiratory and critical care medicine 175, 577-586 (2007).
Q. Ma, Role of nrf2 in oxidative stress and toxicity. Annual review of pharmacology and toxicology 53, 401-426 (2013).
B. G. Harvey, et al. Modification of gene expression of the small airway epithelium in response to cigarette smoking. J Mol Med (Berl) 85, 39-53 (2007).
S. Anttila, et al. CYP1A1 levels in lung tissue of tobacco smokers and polymorphisms of CYP1A1 and aromatic hydrocarbon receptor. Pharmacogenetics 11, 501-509 (2001).
P. J. Stanley, et al. Effect of cigarette smoking on nasal mucociliary clearance and ciliary beat frequency. Thorax 41, 519-523 (1986).
A. Yaghi, et al. Ciliary beating is depressed in nasal cilia from chronic obstructive pulmonary disease subjects. Respiratory medicine 106, 1139-1147 (2012).
H. Zhou, et al. Increased nasal epithelial ciliary beat frequency associated with lifestyle tobacco smoke exposure. Inhalation toxicology 21, 875-881 (2009).
C. M. Smith, et al. ciliaFA: a research tool for automated, high-throughput measurement of ciliary beat frequency using freely available software. Cilia 1, 14 (2012).
W. Kim, et al. An Automated Measurement of Ciliary Beating Frequency using a Combined Optical Flow and Peak Detection. Healthcare informatics research 17, 111-119 (2011).
L. B. Wong, et al. Neuropeptide Y inhibits ciliary beat frequency in human ciliated cells via nPKC, independently of PKA. The American journal of physiology 275, C440-448 (1998).
M. A. Olm, et al. Primary ciliary dyskinesia: evaluation using cilia beat frequency assessment spectral analysis of digital microscopy images. J Appl Physiol (1985) 111, 295-302 (2011). V. M. Keatings et al. Differences in interleukin-8 and tumor necrosis factor-alpha in induced sputum from patients with chronic obstructive pulmonary disease or asthma. American journal of respiratory and critical care medicine 153, 530-534 (1996).
J. A. Dickens, et /. COPD association and repeatability of blood biomarkers in the ECLIPSE cohort. Respiratory research 12, 146 (2011).
Y. C. Han et al. Metallothionein 1 h tumour suppressor activity in prostate cancer is mediated by euchromatin methyltransferase 1. The Journal of pathology 230, 184-193 (2013).
C. G. Viloria, et al. Human DESC1 serine protease confers tumorigenic properties to MDCK cells and it is upregulated in tumours of different origin. British journal of cancer 97, 201-209 (2007).
H. Gao et al. Combination of meta-analysis and graph clustering to identify prognostic markers of ESCC. Genetics and molecular biology 35, 530-537 (2012).
G. Caramori, et al. Unbalanced oxidant-induced DNA damage and repair in COPD: a link towards lung cancer. Thorax 66, 521-527 (2011).
C. A. Owen, Roles for proteinases in the pathogenesis of chronic obstructive pulmonary disease. Intl. J. chronic obstructive pulmonary disease 3, 253-268 (2008).
P. Zmora, et /.DESCl and MSPL activate influenza A viruses and emerging coronaviruses for host cell entry. J Virol 88, 12087-12097 (2014).
A. C. Hsu et /.Innate immunity to influenza in chronic airways diseases. Respirology 17, 1166- 1175 (2012).
M. Huber, et al. Isolation and characterization of human repetin, a member of the fused gene family of the epidermal differentiation complex. J Invest Dermatol 124, 998-1007 (2005).
P. Krieg, et al. Repetin (Rptn), a new member of the "fused gene" subgroup within the S 100 gene family encoding a murine epidermal differentiation protein. Genomics 43, 339-348 (1997).
E. Puchelle, et al. Airway epithelial repair, regeneration, and remodeling after injury in chronic obstructive pulmonary disease. Proceedings of the American Thoracic Society 3, 726-733 (2006).
K. Imai, et al. Human collagenase (matrix metalloproteinase-1) expression in the lungs of patients with emphysema. American journal of respiratory and critical care medicine 163, 786- 791 (2001).
B. A. Mercer, et al. Extracellular regulated kinase/mitogen activated protein kinase is up- regulated in pulmonary emphysema and mediates matrix metalloproteinase-1 induction by cigarette smoke. The Journal of biological chemistry 279, 17690-17696 (2004).
K. H. Benam, et al. Small airway-on-a-chip enables analysis of human lung inflammation and drug responses in vitro. Nat Methods, (2015).
H. Chen, L et al. EGR-1 regulates Ho-1 expression induced by cigarette smoke. Biochemical and biophysical research communications 396, 388-393 (2010).
C. Cipollina et al. Dual anti-oxidant and anti-inflammatory actions of the electrophilic cyclooxygenase-2 -derived 17-oxo-DHA in lipopoly saccharide- and cigarette smoke-induced inflammation. Biochimica et biophysica acta 1840, 2299-2309 (2014).
S. P. Guan, et al. Andrographolide protects against cigarette smoke-induced oxidative lung injury via augmentation ofNrf2 activity. British journal of pharmacology 168, 1707-1718 (2013). E. Vastag, et al. Mucociliary clearance in smokers. European journal of respiratory diseases 68, 107-113 (1986).
P. C. Shivalingappa, et al. Airway Exposure to E-Cigarette Vapors Impairs Autophagy and Induces Aggresome Formation. Antioxid Redox Signal, (2015). M. Misra et al. Comparative in vitro toxicity profile of electronic and tobacco cigarettes, smokeless tobacco and nicotine replacement therapy products: e-liquids, extracts and collected aerosols. International journal of environmental research and public health 11, 1 1325-1 1347 (2014).
F. Cervellati, et al. Comparative effects between electronic and cigarette smoke in human keratinocytes and epithelial lung cells. Toxicology in vitro : an international journal published in association with BIBRA 28, 999-1005 (2014).
J. C. Hogg, et al. Small airway obstruction in COPD: new insights based on micro-CT imaging and MRI imaging. Chest 143, 1436-1443 (2013).
K. H. Benam, et al. Alternative spliced CD ld transcripts in human bronchial epithelial cells. PloS one 6, e22726 (201 1).
W. Huang et al. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols 4, 44-57 (2009).
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000090_0001
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000091_0001
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000092_0001
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000093_0001
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000094_0001
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000095_0001
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000096_0001
Table 6. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a normal human small airway-on-a-chip.
Figure imgf000097_0001
Table 7. Biological processes identified in normal airway chips exposed to cigarette smoke using gene ontology analysis.
Figure imgf000098_0001
Table 8. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
Figure imgf000099_0001
Table 8. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
Figure imgf000100_0001
Table 8. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
Figure imgf000101_0001
Table 8. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
Figure imgf000102_0001
Table 8. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
Figure imgf000103_0001
Table 8. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
Figure imgf000104_0001
Table 8. Genes that were differentially expressed in response to exposure to whole cigarette smoke in a small airway on a chip lined by bronchiolar epithelial cells isolated from COPD patients.
Figure imgf000105_0001

Claims

CLAIMS What is claimed is:
1. A method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to an anti-viral agent, the method comprising:
a) measuring expression level of M-CSF in a sample from the subject;
b) comparing the expression level of M-CSF in the sample with a M-CSF reference, and c) identifying the subject to be likely to be more responsive to an anti -viral agent when the expression level of M-CSF is greater than the M-CSF reference; or identifying the subject to be more likely to respond to an alternative treatment without the anti-viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
2. The method of claim 1, further comprising administering to the subject a treatment based on the expression level of M-CSF in the identifying step.
3. The method of claim 1, wherein when the expression level of M-CSF is greater than the M-CSF reference, the subject is not administered an anti-bacterial agent.
4. The method of any of claims 1-3, further comprising measuring expression level of IL-8 in the sample, wherein the subject is further administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
5. The method of any of claims 2-4, wherein the treatment further comprises an agent that reduces airway inflammation.
6. The method of any of claims 1-5, wherein the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRIM) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
7. The method of any of claims 1-6, wherein the anti-viral agent comprises 2-methoxy-N-(3- methyl-2-oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof
8. The method of any of claims 1-7, wherein the reference corresponds to a level in a healthy subject.
9. The method of any of claims 1-7, wherein the reference corresponds to a level in the subject before onset of the COPD exacerbation.
10. The method of any of claims 1-9, wherein the sample is fluid sample.
1 1. The method of claim 10, wherein the fluid sample comprises a blood or serum sample.
12. A method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, an anti-viral agent that reduces the M-CSF expression level, thereby treating COPD exacerbation in the subject.
13. The method of claim 12, wherein the subject is further administered an agent that reduces airway inflammation.
14. The method of any of claims 12-13, wherein the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRIM) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
15. The method of any of claims 12-14, wherein the anti-viral agent comprises 2-methoxy-N-(3- methyl-2-oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof
16. A method of treating a subject diagnosed with COPD that exhibits an increased expression level of M-CSF, the method comprising:
a) determining a first expression level of M-CSF in a sample from a subject diagnosed with COPD that exhibits an increased expression level of M-CSF;
b) administering an anti-viral agent;
c) determining a second expression level of M-CSF after said administering; and
d) comparing said first and second expression levels of M-CSF, wherein the anti-viral agent is effective if said second expression level is lower that said first expression level, and wherein the anti-viral therapy is ineffective if said second expression level is the same as or higher than said first expression level.
17. The method of claim 16, further comprising, when the anti-viral agent is effective, continuing to administer the agent.
18. The method of claim 16, further comprising, when the anti -viral agent is ineffective, discontinuing the agent.
19. The method of claim 18, further comprising, when the anti -viral agent is ineffective, administering the agent at a higher dose.
20. The method of claim 18, further comprising, when the anti -viral agent is ineffective, administering a different anti-viral agent.
21. The method of any of claims 16-20, wherein the sample is fluid sample.
22. The method of claim 21, wherein the fluid sample comprises a blood or serum sample.
23. A method of identifying an agent for reducing at least one symptom of a viral-induced COPD exacerbation comprising:
a) contacting COPD-mimic cells with a test agent;
b) contacting the COPD-mimic cells with a virus-mimic agent;
c) measuring expression level of M-CSF in a sample; and
d) identifying the test agent as an effective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is same as or lower than a M-CSF reference; or identifying the test agent as an ineffective agent for treating a viral-induced COPD exacerbation when the expression level of M-CSF is higher than the M-CSF reference.
24. The method of claim 23, further comprising measuring expression level of IL-8 in the sample, wherein the identified effective agent displays the expression level of IL-8 same as or lower than a IL-8 reference; and the identified ineffective agent displays the expression level of IL-8 greater than the IL-8 reference.
25. The method of claim 23 or 24, wherein the sample is a culture medium sample.
26. The method of any of claims 23-25, wherein the COPD-mimic cells are derived from a subject diagnosed with COPD.
27. The method of any of claims 23-26, wherein the COPD-mimic cells are derived from healthy cells contacted with a COPD-phenotype inducing agent.
28. The method of any of claims 23-27, wherein the virus-mimic agent comprises polyinosinic:polycytidylic acid, ligands and/or agonists for melanoma differentiation-associated protein 5 (MDA-5), ligands and/or agonists for retinoic acid inducible gene (RIG-1), ligands and/or agonists for NOD-like receptors (NLR), ligands and/or agonists for members of TOLL- like receptors (TLR) such as TLR-7, TLR-8, and TLR-9, viral mimics such as inactivated viral particles (e.g. , UV -inactivated human rhinovirus or fixed virus), whole live virus, and a combination of two or more thereof.
29. The method of any of claims 23-28, wherein the COPD-mimic cells are grown in a microfluidic device.
30. The method of claim 29, wherein the microfluidic device is an organ-on-a-chip device.
31. The method of claim 30, wherein the organ-on-a-chip device comprises a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
32. A method of treating chronic obstructive pulmonary disease (COPD) exacerbation induced by a microbial infection in a subject comprising administering to the subject a pharmaceutical composition comprising a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling.
33. The method of claim 32, wherein the BRD4 inhibitor comprises 2-methoxy-N-(3 -methyl -2 -oxo- l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof.
34. The method of claim 32 or 33, wherein the microbial infection is a viral-induced infection.
35. A method of identifying a subject who is likely to have, or have a risk for, chronic obstructive pulmonary disease (COPD), the method comprising:
a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 3 in a sample from the subject;
b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and
c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or lower than the corresponding reference.
36. A method of identifying a subject who is likely to have, or have a risk for, chronic obstructive pulmonary disease (COPD), the method comprising:
a) measuring expression level of at least one gene or a combination of two or more genes listed in Table 4 in a sample from the subject;
b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and
c) identifying the subject to be likely to have, or have a risk for, COPD when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be not likely to have COPD when the expression level of the gene(s) is same as or greater than the corresponding reference.
37. The method of claim 35 or 36, further comprising administering to the subject a COPD treatment when the subject is identified to be likely to have, or have a risk, for COPD.
38. The method of any of claims 35-37, wherein the reference corresponds to expression level of the corresponding gene in healthy subject(s).
39. The method of any of claims 35-38, wherein the subject is a smoker.
40. The method of claim 39, wherein the reference corresponds to expression level of the corresponding gene in non-COPD smoker(s).
41. The method of any of claims 35-40, wherein the sample is a bronchoscopy sample or a fluid sample.
42. The method of claim 41, wherein the fluid sample comprises a blood or serum sample.
43. A method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non-infective COPD exacerbation, the method comprising:
a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from the subject;
b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and
c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is greater than the corresponding reference; or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or lower than the corresponding reference.
44. A method of identifying a subject who is diagnosed with chronic obstructive pulmonary disease (COPD) exacerbation and is more likely to be responsive to a treatment for non-infective COPD exacerbation, the method comprising: a) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from the subject;
b) comparing the expression level of the gene(s) in the sample with a corresponding reference, and
c) identifying the subject to be likely to be more responsive to a treatment for non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference; or identifying the subject to be more likely to respond to an alternative treatment for infective COPD exacerbation when the expression level of the gene(s) is same as or greater than the corresponding reference.
45. The method of claim 43 or 44, further comprising administering to the subject a treatment based on the expression level of the gene(s) in the identifying step.
46. The method of any of claims 43-45, further comprising, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, measuring expression level of M-CSF in a sample from the subject, wherein the subject is administered an anti-viral agent when the expression level of M-CSF is greater than the M-CSF reference; or the subject is not administered an anti -viral agent when the expression level of M-CSF is same as or lower than the M-CSF reference.
47. The method of any of claims 43-46, further comprising, when the subject is identified to be more likely to respond to an alternative treatment for infective COPD exacerbation, measuring expression level of IL-8 in the sample, wherein the subject is administered an antibacterial agent when the expression level of IL-8 is greater than the IL-8 reference; or the subject is not administered an antibacterial agent when the expression level of IL-8 is same as or lower than the IL-8 reference.
48. The method of any of claims 43-47, wherein the treatment for non-infective COPD exacerbation comprises an agent that reduces airway inflammation.
49. The method of any of claims 46-48, wherein the anti-viral agent comprises a PI3K inhibitor, a bromodomain containing protein 4 (BRD4) inhibitor of NFKB signaling, a steroid, or an agent that prevents viral replication or host-infective capability, or a combination of two or more thereof.
50. The method of any of claims 46-49, wherein the anti-viral agent comprises 2-methoxy-N-(3- methyl-2-oxo-l,2-dihydroquinolin-6-yl)benzenesulfonamide or a derivative thereof
5 1. The method of any of claims 43-50, wherein the reference corresponds to expression level of the corresponding gene in healthy subject(s).
52. The method of any of claims 43-50, wherein the reference corresponds to expression level of the corresponding gene in the subject before onset of the COPD exacerbation.
53. The method of any of claims 43-52, wherein the sample is a bronchoscopy sample or fluid sample.
54. The method of claim 53, wherein the fluid sample comprises a blood or serum sample.
55. A method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits an increased expression level of at least one gene or a combination of two or more genes as listed in Table 3, a treatment for non-infective COPD exacerbation that reduces the increased expression level of the gene(s), thereby treating COPD exacerbation in the subject.
56. A method of treating chronic obstructive pulmonary disease (COPD) exacerbation in a subject comprising: administering to a subject diagnosed with COPD that exhibits a decreased expression level of at least one gene or a combination of two or more genes as listed in Table 4, a treatment for non-infective COPD exacerbation that increases the decreased expression level of the gene(s), thereby treating COPD exacerbation in the subject.
57. The method of claim 55 or 56, wherein the treatment for non-infective COPD exacerbation comprises an agent that reduces airway inflammation.
58. A method of treating a subject diagnosed with COPD exacerbation, the method comprising: a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample from a subject diagnosed with COPD that exhibits an increased expression level of the gene(s);
b) administering a treatment for non-infective COPD exacerbation;
c) determining a second expression level of the gene(s) after said administering; and d) comparing said first and second expression levels of the gene(s), wherein the treatment for non-infective COPD exacerbation is effective if said second expression level is lower that said first expression level, and wherein the treatment for non-infective COPD exacerbation is ineffective if said second expression level is the same as or higher than said first expression level.
59. A method of treating a subject diagnosed with COPD exacerbation, the method comprising: a) determining a first expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample from a subject diagnosed with COPD that exhibits a decreased expression level of the gene(s);
b) administering a treatment for non-infective COPD exacerbation;
c) determining a second expression level of the gene(s) after said administering; and d) comparing said first and second expression levels of the gene(s), wherein the treatment for non-infective COPD exacerbation is effective if said second expression level is higher than said first expression level, and wherein the treatment for non-infective COPD exacerbation is ineffective if said second expression level is the same as or lower than said first expression level.
60. The method of claim 58 or 59, further comprising, when the administered treatment is effective, continuing to administer the treatment.
61. The method of claim 58 or 59, further comprising, when the administered treatment is ineffective, discontinuing the treatment.
62. The method of claim 58 or 59, further comprising, when the administered treatment is ineffective, administering the treatment at a higher dose and/or a higher frequency.
63. The method of claim 58 or 59, further comprising, when the administered treatment is ineffective, administering an alternative treatment for infective COPD exacerbation (e.g. , an antiviral agent or an anti -bacterial agent).
64. The method of any of claims 58-63, wherein the sample is a bronchoscopy sample or a fluid sample.
65. The method of claim 64, wherein the fluid sample comprises a blood or serum sample.
66. A method of identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation comprising:
a) contacting COPD-mimic cells with a test agent;
b) contacting the COPD-mimic cells with a non-infective agent (e.g. , cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation; c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 3 in a sample; and
d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or lower than a corresponding reference; or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is higher than the corresponding reference.
67. A method of identifying an agent for reducing at least one symptom of a non-infective COPD exacerbation comprising:
a) contacting COPD-mimic cells with a test agent;
b) contacting the COPD-mimic cells with a non-infective agent (e.g. , cigarette smoke, air pollutants and/or other environmental, non-infective agents) that induces COPD exacerbation ; c) measuring expression level of at least one gene or a combination of two or more genes as listed in Table 4 in a sample; and
d) identifying the test agent as an effective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is same as or greater than a corresponding reference; or identifying the test agent as an ineffective agent for treating a non-infective COPD exacerbation when the expression level of the gene(s) is lower than the corresponding reference.
68. The method of claim 66 or 67, wherein the sample is a culture medium sample or the COPD- mimic cells contacted with the test agent and the non-infective agent.
69. The method of any of claims 66-68, wherein the COPD-mimic cells are derived from a subject diagnosed with COPD.
70. The method of any of claims 66-68, wherein the COPD-mimic cells are derived from healthy cells contacted with a COPD-phenotype inducing agent.
71. The method of any of claims 66-70, wherein the COPD-mimic cells are grown in a microfluidic device.
72. The method of claim 71, wherein the microfluidic device is an organ-on-a-chip device.
73. The method of claim 72, wherein the organ-on-a-chip device comprises a first structure defining a first chamber, a second structure defining a second chamber, and a membrane at the interface between the first chamber and the second chamber.
74. The method of any of claims 66-73, wherein the reference corresponds to expression level of the corresponding gene(s) in the COPD-mimic cells prior to contact with the test agent or the non- infective agent.
75. The method of any of claims 66-73, wherein the reference corresponds to expression level of the corresponding gene(s) in the healthy (non-COPD) cells contacted with the non-infective agent.
PCT/US2016/027700 2015-04-16 2016-04-15 Methods for treatment of chronic obstructive pulmonary disease and/or therapy monitoring Ceased WO2016168565A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562148542P 2015-04-16 2015-04-16
US62/148,542 2015-04-16
US201562219912P 2015-09-17 2015-09-17
US62/219,912 2015-09-17

Publications (1)

Publication Number Publication Date
WO2016168565A1 true WO2016168565A1 (en) 2016-10-20

Family

ID=57126118

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/027700 Ceased WO2016168565A1 (en) 2015-04-16 2016-04-15 Methods for treatment of chronic obstructive pulmonary disease and/or therapy monitoring

Country Status (1)

Country Link
WO (1) WO2016168565A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109557005A (en) * 2018-11-14 2019-04-02 云南中烟工业有限责任公司 A kind of cigarette smoke mouse mouth and nose process for exposing
WO2020194211A1 (en) * 2019-03-26 2020-10-01 The University Of British Columbia Methods and compositions for monitoring acute exacerbation of copd
CN112444466A (en) * 2019-09-05 2021-03-05 上海新型烟草制品研究院有限公司 Method for evaluating in-vitro absorption of nicotine buccal nicotine
EP3630957A4 (en) * 2017-05-23 2021-10-06 Emulate, Inc. ADVANCED PULMONARY MODELS
CN114410772A (en) * 2021-01-28 2022-04-29 中国医学科学院北京协和医院 Acute exacerbation susceptibility genes of chronic obstructive pulmonary disease and its application in predicting susceptibility to acute exacerbation of chronic obstructive pulmonary disease

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5614183A (en) * 1985-02-05 1997-03-25 Chiron Corporation Use of CSF-1 to treat bacterial infections
US20070072246A1 (en) * 2003-09-03 2007-03-29 Berg Ellen L Cell-based assays for determining drug action
US20100119474A1 (en) * 2007-03-06 2010-05-13 Cornell University Chronic obstructive pulmonary disease susceptibility and related compositions and methods
US20110243893A1 (en) * 2010-02-11 2011-10-06 Axtell Robert C Markers for determination of patient responsiveness
US20130004480A1 (en) * 2006-07-04 2013-01-03 Paul Parren CD20 Binding Molecules for the Treatment of Copd
US20140142102A1 (en) * 2012-11-21 2014-05-22 Rvx Therapeutics Inc. Cyclic amines as bromodomain inhibitors
US20140162971A1 (en) * 2011-12-30 2014-06-12 Abbvie Inc. Bromodomain inhibitors

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5614183A (en) * 1985-02-05 1997-03-25 Chiron Corporation Use of CSF-1 to treat bacterial infections
US20070072246A1 (en) * 2003-09-03 2007-03-29 Berg Ellen L Cell-based assays for determining drug action
US20130004480A1 (en) * 2006-07-04 2013-01-03 Paul Parren CD20 Binding Molecules for the Treatment of Copd
US20100119474A1 (en) * 2007-03-06 2010-05-13 Cornell University Chronic obstructive pulmonary disease susceptibility and related compositions and methods
US20110243893A1 (en) * 2010-02-11 2011-10-06 Axtell Robert C Markers for determination of patient responsiveness
US20140162971A1 (en) * 2011-12-30 2014-06-12 Abbvie Inc. Bromodomain inhibitors
US20140142102A1 (en) * 2012-11-21 2014-05-22 Rvx Therapeutics Inc. Cyclic amines as bromodomain inhibitors

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ISHIKAWA ET AL.: "Macrophage Colony-Stimulating Factor Aggravates Rather than Regenerates Emphysematous Lungs in Mice", RESPIRATION, vol. 73, 3 April 2006 (2006-04-03), pages 538 - 545 *
SHARMA ET AL.: "Reduction of influenza virus-induced lung inflammation and mortality in animals treated with a phosophodisestrase-4 inhibitor and a selective serotonin reuptake inhibitor", EMERGING MICROBES AND INFECTIONS, vol. 2, no. 8, 21 August 2013 (2013-08-21), pages 1 - 9, XP055321415 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3630957A4 (en) * 2017-05-23 2021-10-06 Emulate, Inc. ADVANCED PULMONARY MODELS
CN109557005A (en) * 2018-11-14 2019-04-02 云南中烟工业有限责任公司 A kind of cigarette smoke mouse mouth and nose process for exposing
WO2020194211A1 (en) * 2019-03-26 2020-10-01 The University Of British Columbia Methods and compositions for monitoring acute exacerbation of copd
CN112444466A (en) * 2019-09-05 2021-03-05 上海新型烟草制品研究院有限公司 Method for evaluating in-vitro absorption of nicotine buccal nicotine
CN112444466B (en) * 2019-09-05 2023-02-28 上海新型烟草制品研究院有限公司 A method for evaluating the in vitro absorption of snus nicotine
CN114410772A (en) * 2021-01-28 2022-04-29 中国医学科学院北京协和医院 Acute exacerbation susceptibility genes of chronic obstructive pulmonary disease and its application in predicting susceptibility to acute exacerbation of chronic obstructive pulmonary disease

Similar Documents

Publication Publication Date Title
Benam et al. Small airway-on-a-chip enables analysis of human lung inflammation and drug responses in vitro
de Souza Xavier Costa et al. Early and late pulmonary effects of nebulized LPS in mice: An acute lung injury model
Benam et al. Matched-comparative modeling of normal and diseased human airway responses using a microengineered breathing lung chip
Lösslein et al. Monocyte progenitors give rise to multinucleated giant cells
Headland et al. Oncostatin M expression induced by bacterial triggers drives airway inflammatory and mucus secretion in severe asthma
Wei et al. Macrophage peroxisomes guide alveolar regeneration and limit SARS-CoV-2 tissue sequelae
Hasegawa et al. Pulmonary osteoclast-like cells in silica induced pulmonary fibrosis
Han et al. Distinctive CD39+ CD9+ lung interstitial macrophages suppress IL-23/Th17-mediated neutrophilic asthma by inhibiting NETosis
Wang et al. PM2. 5 increases systemic inflammatory cells and associated disease risks by inducing NRF2-dependent myeloid-biased hematopoiesis in adult male mice
Kastelberg et al. NLRX1 is a key regulator of immune signaling during invasive pulmonary aspergillosis
Liu et al. TLR7 promotes smoke-induced experimental lung damage through the activity of mast cell tryptase
Wang et al. PIEZO1 mediates mechanical reprogramming of neutrophils for proangiogenic specialization in the lung
Yin et al. Using high-throughput sequencing to explore the anti-inflammatory effects of α-mangostin
Shin et al. Intranasal inoculation of IFN-λ resolves SARS-CoV-2 lung infection via the rapid reduction of viral burden and improvement of tissue damage
Woo et al. Polystyrene particles induces asthma-like Th2-mediated lung injury through IL-33 secretion
Chen et al. A paracrine circuit of IL-1β/IL-1R1 between myeloid and tumor cells drives glioblastoma progression
Jordakieva et al. Peripheral erythrocytes decrease upon specific respiratory challenge with grass pollen allergen in sensitized mice and in human subjects
Yu et al. Prolonged immune activation in post-acute sequelae of SARS-CoV-2: neutrophil dynamics and therapeutic insights
EP4399276A2 (en) Methods and compositions for modulating goblet cells and for muco-obstructive diseases
Liu et al. Reversing Immunosenescence with Senolytics to Enhance Tumor Immunotherapy
Wang et al. Assessing the Adverse Impacts of PM2. 5 on Olfactory System Using an Air-liquid Interface Culture Model of Primary Olfactory Epithelial Cells
Wohnhaas Investigation of molecular mechanisms underlying immunological and respiratory disorders using single-cell RNA sequencing
Sendama Mechanisms of pulmonary inflammation in ageing and chronic lung disease
Vitucci Investigating Intercellular Signaling between the Alveolar Epithelium and Microvascular Endothelium with an Organotypic Model of the Alveolar Capillary Region
Carvajal Ibanez Interferon modulates adult neurogenesis by regulating mRNA translation and cell cycle in neural stem cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16780812

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16780812

Country of ref document: EP

Kind code of ref document: A1