WO2016164884A1 - Lncrna serves as a biomarker and therapeutic target - Google Patents
Lncrna serves as a biomarker and therapeutic target Download PDFInfo
- Publication number
- WO2016164884A1 WO2016164884A1 PCT/US2016/026897 US2016026897W WO2016164884A1 WO 2016164884 A1 WO2016164884 A1 WO 2016164884A1 US 2016026897 W US2016026897 W US 2016026897W WO 2016164884 A1 WO2016164884 A1 WO 2016164884A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- linc00473
- cancer
- lkb
- subject
- lkbl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- LKBl Liver Kinase Bl
- STK11 Serine/Threonine Kinase 11
- NSCLC non- small cell lung cancer
- KRAS Kirsten rat sarcoma viral oncogene
- LKBl status is linked with cancer responsiveness to several targeted agents and chemotherapy in mouse tumor models. LKBl is thus implicated as diagnostic, prognostic and predictive biomarkers in human lung cancer. Moreover, LKB l mutations have been observed in other tumor types such as ovarian cancers and cervical cancers, and are important for tumor progression. However, clinical benefits that exploit LKB l deficiency cannot be achieved without studying the tumors produced by LKBl loss of function. BRIEF SUMMARY OF THE INVENTION
- the invention provides a long intergenic non-coding RNA (lincRNA), namely, LINC00473, as a gene regulator of oncogenesis. Increased LINC00473 expression was observed in cells with downregulation of LKB l protein expression/function and shown to have a critical role in carcinogenesis in the cells. Accordingly, an embodiment of the invention provides a method of diagnosing and treating a subject having a cancer involving loss or reduction in LKBl function, the method comprising:
- LKBl function based on the level of LINC00473 in the test sample and withholding the administration of the LINC00473 inhibitor to the subject, and optionally, administering a cancer therapy other than the LINC00473 inhibitor to the subject to treat the cancer.
- the LINC00473 inhibitor can be an inhibitor of LINC00473 expression and/or activity, for example, a small-inhibitory RNA (siRNA), a short hairpin RNA, a bifunctional
- an embodiment of the invention provides a pharmaceutical composition comprising a LINC00473 for the treatment of a cancer, for example, a cancer involving loss or reduced LKBl function or a cancer with high LINC00473 expression.
- FIG. 1A-1C LINC00473 up-regulation is correlated with LKBl loss in NSCLC cells.
- A LKBl loss induces LINC00473 transcription through CRTC activation.
- B, C A panel of LKB l -null (red) and wild-type (wt) NSCLC cell lines were assayed for LKB l protein levels via Western blotting (B) and LINC00473 expression via qRT-PCR (C).
- FIGS 2A-2B Human primary lung tumors and their matching normal tissues were analyzed for LKBl protein expression via Western blotting and LINC00473 expression via real-time RT-PCR.
- Tumors (T) and normal tissues (N) were indicated.
- human LKBl-WT NSCLC H3123 cells served as a control with its LINC00473 expression value considered as 1, and fold change of LINC00473 expression normalized against that of H3123 was shown.
- FIGS 3A-3D LINC00473 expression levels are negatively regulated by LKB l .
- A, B Retroviral -mediated LKBl expression in LKB l -null NSCLC cells (HI 57 and A549) caused reduced LINC00473 expression.
- C, D Lentiviral -mediated LKB l depletion in LKBl-wt NSCLC cells (H3123 and H322) resulted in enhanced LINC00473 expression.
- a similar effect was observed using an independent shRNA targeting LKBl .
- the upper panels present western blot analysis of LKB l levels in either over-expressed or depleted cells, and the lower panels show the relative LINC00473 transcript levels, with the control defined as 1.
- FIGS 4A-4F shRNA-mediated LINC00473 knockdown in A549 lung cancer cells resulted in reduced cell proliferation and survival.
- A549 (LKBl-null) cells were transduced with these lentiviruses and control viruses expressing scramble shRNA for 96 hours and harvested for evaluating LINC00473 expression by qRT-PCR (A), viable cell number counting by Trypan Blue assays (B), and apoptotic cells by Annexin V-PI staining (C).
- D-F A total of 2xl0 6 A549-luc cells transduced with control shRNA or shLINC00473 (-2 & -4) were injected to NOD.SCID mice and the tumor growth was monitored via bioluminescence imaging (BLI) and direct tumor measurement. The tumors were photographed at day 36. Figures 5A-5I.
- LINC00473 is induced by LKB l loss in NSCLC cells.
- A Western blotting analysis of expression of LKBl wild-type (wt) or kinase-dead K78I mutant in transduced LKBl -null lung adenocarcinoma A549 cells. A549 cells infected with pBabe vector retroviruses were used as controls (Ctl).
- B, C Volcano plots show differentially expressed IncRNAs after expression of LKB 1 wt (B) or LKB 1 K78I mutant (C) in A549 cells by LncRNA microarray (V3.0) analysis. The cutoff criteria were fold-change of > 2 and p ⁇ 0.05.
- a volcano plot shows differentially expressed IncRNAs in two LKB l-null cell lines (A549 and H460) compared with two LKBl-wt cell lines (H322 and H3123).
- E A heatmap shows expression levels of several LKB l -regulated protein-coding and non-coding genes measured in Nanostring assays.
- F, G Two LINC00473 transcript variants (tvl : NR_026860 and tv2: NR_026861) show significantly elevated expression in LKBl -mutant groups as compared to LKB l-wt groups based on the Nanostring assays.
- FIGS. 6A-6G Enhanced LINC00473 expression highly correlates with human lung adenocarcinoma with LKB l mutational status and is associated with poor survival.
- a heatmap shows gene expression levels in RNA samples isolated from 5 LKBl-wt and 5 LKBl-mut FFPE LUAD samples in Nanostring assays.
- B Expression of LINC00473 transcript variant (tvl), but not tv2, was significantly different between LKB l-wt and -mut groups.
- C,D Representative images for tumors with LINC00473 positive (C) and negative (D) signals based on RNAscope detection on FFPE LUAD sections.
- RNA in-situ hybridization (ISH) of the housekeep gene PPIB was performed for sample RNA quality control.
- D A schematic representation of the LINC00473 promoter reporter is shown.
- FIGS 8A-8E Depletion of LINC00473 expression in LKBl-null NSCLC cells causes reduced cell growth and survival in vitro and in vivo.
- (A) Luciferase-expressing A549 cells were infected with two independent lentiviral-based LINC00473 shRNAs and the scrambled shRNA control (shCtl), respectively. Transduced cells were harvested 96 hours later, and LINC00473 expression was quantified by qRT-PCR (n 3, *p ⁇ 0.05).
- LINC00473 shows predominantly nuclear localization with distinct nuclear structures.
- A The transcript levels of LINC00473 and U6 (a nuclear marker) in the nuclear (Nuc) and cytoplasmic (Cyt) fractions obtained from A549 cells were quantified by qRT-PCR assays.
- B LINC00473 transcripts were enriched in nuclear compartment when compared with nuclear marker U6 and cytoplasmic marker tRNA by Northern blotting analysis in three separate nuclear (N) and cytoplasmic (C) fractions obtained from A549 cells.
- C Nuclear localization of LINC00473 was detected by RNA-FISH in A549 cells.
- LINC00473 RNA-FISH probe sets were labeled with Quasar 570 dyes (red) and nuclei were labeled with the DNA dye DAPI (blue).
- LINC00473 is associated with NONO protein and stimulates CRTC-NONO interaction.
- A Coomassie blue staining of the LINC00473 -associated proteins by RNA pull-down in A549 cells.
- B Specific association of LINC00473 RNA with NONO protein was validated through RNA pull-down followed by Western blotting analysis. LINC00473 antisense and MEG RNA were used as controls.
- C Immunoprecipitation of endogenous NONO protein was validated via Western blotting (HC, heavy chain).
- D LINC00473 was significantly enriched in NONO immune-precipitates relative to the IgG control by qRT-PCR assay.
- LINC00473 caused reduced CRTC1-NONO interaction.
- Figure 11 A model for the molecular basis of LINC00473 induction and the role of sustained LINC00473 expression as a potential biomarker and prognostic marker, therapeutic target, and gene regulator for LKBl -inactivated NSCLC.
- FIGS 12A-12C Human lung adenocarcinomas with high LINC00473 expression were enriched with mutations in the LKBl gene coding region.
- A Expression patterns of LINC00473 and other genes in TCGA LUAD samples. Data was sorted by normalized expression value. Samples with high expression are red, samples with low expression are green, and samples with no expression data are grey.
- B LKB1 gene-level non-silent mutations in LUAD samples. Red means that a non-silent mutation was found in the gene. White means that no such mutation was found. Gray means that the sample has no data.
- C Somatic mutation S Ps and small INDELs in LKB 1, KRAS and TP53 genes in LUAD samples.
- Each colored dot shows a mutation along the transcript with each line being its own sample.
- Red indicates that the mutation is likely to prevent a functional protein from being made (nonsense mutations, frame shift, etc).
- Blue indicates that the protein is likely to be made, but may have an altered function (missense mutation, etc).
- Green indicates that the protein is unlikely to be affected (such as synonymous).
- FIGS 13A-13C Box plots show expression levels of LINC00473 (A), SIK1 (B), and LKB1 (C) genes in LKB1 mutant (Mut) and wildtype (Wt) human lung adenocarcinomas.
- the LUAD level 3 RNAseqv2 normalized data were downloaded from TCGA along with the Meta-Data for each patient.
- the RNA-seq gene expression data were combined with DNA-sequencing data to compare gene expression to LKB1 mutational status.
- the /?-value was generated by a two tailed, independent t-test.
- the data indicate that LINC00473 expression is a more significantly variant between LKB1 WT and Mutant than SIK1 or LKB 1.
- FIGS 14A-14E Analysis of the correlation between LINC00473 Expression, the LKB 1 -Loss Signature, LKB1 Expression, and SIK1 Expression.
- A Correlation of LINC00473 Gene Expression to LKB 1 -Loss Signature
- B Correlation of LINC00473 Gene Expression to LKB 1 Gene Expression
- C Correlation of SIK1 Gene Expression to LKB1- Loss Signature
- D Correlation of LKB 1 Gene Expression to SIK1 expression
- E Correlation of LKB1 Gene Expression to LKB1 Loss Signature.
- the data indicate that LINC00473 expression is more positively correlated with the LKBl-loss signature than SIK1 expression.
- the data also show that LKB1 expression is more significantly inversely correlated with LINC00473 expression than that of SIKl expression and LKB1 expression is significantly inversely correlated with the LKB 1 loss signature.
- FIGS. 15A-15C Kaplan-Meier survival analyses showed that high LINC00473 expression, but not LKB1 mutations in the coding regions, was associated with poor prognosis.
- A LKB1 mutation status was not significantly associated with survival.
- B, C High LINC00473 expression was associated with a poor survival in both LKB1 wt and mutant groups.
- the tumors in TCGA-LUAD dataset with the available data on LINC00473 expression, LKB1 mutations, and clinical information were analyzed.
- FIGS 16A-16F Knockdown of LINC00473 expression in LKBl-null human NSCLC HI 57 resulted in reduced cell growth and survival in vitro and in vivo.
- FIGS 17A-17C Overexpression of LINC00473 in LKBl-wt lung human NSCLC cells increased cell proliferation and expression of several CREB target genes.
- SEQ ID NO: 3 Sequence of shLINC00473-2.
- SEQ ID NO: 4 Sequence of shLINC00473-3.
- SEQ ID NO: 5 Sequence of shLINC00473-4.
- SEQ ID Nos: 6-62 for the sequences of primers and probes. Sequences are presented in the 5' to 3' direction.
- Lnc473 18 GGGCAATGGGTAAACCTTAC (SEQ ID NO: 53)
- Lnc473 19 ATAGGACACTCAGCTCTCAA (SEQ ID NO: 54)
- Lnc473 27 ATGAATATGACTTGGGTTCT (SEQ ID NO: 62)
- LKBl is mutated and inactivated in a significant subset of lung cancer; however, accurate diagnostics and effective targeted therapeutics are not available for tumors involving inactivated LKBl .
- LncRNAs have emerged as a novel class of gene regulators and are implicated in tumorigenesis and progression. Reliable tests are needed to accurately identify tumors with loss of LKBl function for patient stratification, to evaluate therapeutic responses and to assign individualized treatments.
- LncRNAs are non-protein coding transcripts longer than 200 nucleotides and represent a novel class of gene regulators.
- the human genome encodes more than 10,000 IncRNAs and currently only a handful of IncRNAs have been characterized. LncRNA expression is frequently de-regulated in cancer, and shows cell or tissue specificity. They participate in cancer cell proliferation, survival, migration, and invasion, likely through exerting multiple regulatory functions at the transcriptional, post-transcriptional, and epigenetic levels.
- Targeting cancer-associated IncRNAs such as HOX transcript antisense RNA (HOTAIR) and metastasis-associated lung adenocarcinoma transcript 1 (MALATl) results in inhibitory effects on cancer cell growth and survival in vitro and tumor growth and metastasis in mouse models. Therefore, IncRNAs are critical for various stages of cancer development and progression, indicating that IncRNAs are novel therapeutic targets.
- LINC00473 is a CRTC/CREB target gene and its expression is up-regulated by loss of LKB l signaling: (1) LINC00473 is transiently up-regulated in response to cAMP signaling in normal cells; (2) microarray analysis revealed LINC00473 as the top target for the CRTC1-MAML2 fusion oncogene that functionally mimics the activation of CRTC co- activators for the cAMP/CREB pathway; and (3) loss of LKBl results in CRTC/CREB transcriptional activation in cancer cells. Therefore, LINC00473 can be transcriptionally up- regulated by CRTC activation upon LKBl inactivation (Figure 1A).
- an embodiment of the invention provides assays to identify tumors with loss or reduction in LKBl function and to further understand the molecular basis for LKB l tumor suppressor and its clinical implications.
- the invention provides LINC00473 as a gene regulator of oncogenesis, a biomarker for LKBl -deficient tumors and an important mediator for LKB l -loss in lung cancer development and progression.
- an embodiment of the invention provides a method of treating a subject having a cancer involving loss or reduction in LKBl function, the method comprising:
- Another embodiment provides assays to identify tumors with loss or reduction in LKB1 function.
- the invention provides LINC00473 as a gene regulator of oncogenesis, a biomarker for LKB 1 -deficient tumors and an important mediator for LKB l-loss in lung cancer development and progression. Accordingly, an embodiment of the invention provides a method of diagnosing a subject having a cancer involving loss or reduction in LKB 1 function, the method comprising:
- step (e) identifying the subject with enhanced level of LINC00473 in the test sample and administering an effective amount of a LINC00473 inhibitor to the subject to treat the cancer.
- increased levels of LINC00473 are associated with a loss or reduction in LINC00473 function.
- this method can be performed by measuring LINC00473 levels of SEQ ID NO: 1, SEQ ID NO: 2 or both SEQ ID NO: 1 and SEQ ID NO: 2 in test samples and/or control samples.
- beneficial or desired clinical results include, but are not limited to, alleviation of symptoms in whole or in part, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Complete absence of the cancer is not required for effective treatment.
- a cancer involving loss or reduction in LKBl function refers to a cancer in which the cancer cells exhibit loss or reduction in the activity of LKBl protein.
- Loss or reduction in LKBl protein activity can arise from, for example, loss or reduction in LKBl gene expression, loss or reduction in LKBl mRNA translation, increased degradation of LKBl mRNA, reduced stability of LKB l mRNA, loss or reduction in LKBl protein activity, increased degradation of LKB l protein, reduced stability of LKBl protein or mutation in LKBl protein. Additional examples of molecular mechanism which can lead to loss or reduction in LKB l protein activity are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
- a cancer not involving loss or reduction in LKB l function refers to a cancer in which the cancer cells exhibit LKBl protein activity which is not different than non-cancerous cells from the same tissue. In such cancers, the cancer arises from other mechanisms of carcinogenesis.
- control sample and the test sample are obtained from the same type of an organ or tissue.
- organ or tissue which can be used as samples are brain, eyes, pineal gland, pituitary gland, thyroid gland, parathyroid glands, thorax, heart, lung, esophagus, thymus gland, pleura, adrenal glands, appendix, gall bladder, urinary bladder, large intestine, small intestine, kidneys, liver, pancreas, spleen, stoma, ovaries, prostate, testis, uterus, skin, or blood. Additional examples of organs and tissues are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
- a lung sample is obtained.
- control sample and the test sample are obtained from the same type of a body fluid.
- body fluids which can be used as samples include amniotic fluid, aqueous humor, vitreous humor, bile, blood, cerebrospinal fluid, chyle, endolymph, perilymph, female ejaculate, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sputum, synovial fluid, vaginal secretion, blood, serum or plasma. Additional examples of body fluids are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
- pleural fluid is obtained.
- the subject is a mammal.
- Non-limiting examples include human, ape, canine, pig, bovine, rodent, or feline subjects.
- the methods described herein are used to identify a human as having a cancer involving loss or reduction in LKB 1 function.
- control samples can be obtained from one or more of the following:
- the presence of LINC00473 relative to that of the control sample indicates that the level of LINC00473 when compared to that of the control sample is used to identify a subject as having or not having a cancer involving loss or reduction in LKB 1 function.
- a subject is identified as having a cancer involving loss or reduction in LKB1 function if the level of LINC00473 in a test sample is higher than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKB 1 function or the subject prior to having a cancer.
- a subject is identified as having a cancer involving loss or reduction in LKB1 function if the level of LINC00473 in the test sample is about 1 to 100 times, about 5 to 80 times, or about 10 to 50 times higher than the level of LINC00473 in the control sample obtained from an individual belonging to the same species as the subject and not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKBl function, or the subject prior to having a cancer.
- a subject is identified as having a cancer involving loss or reduction in LKBl function if the level of LINC00473 in the test sample is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 abuse 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 times higher than the level of LINC00473 in the control sample obtained from an individual belonging to the same species as the subject and not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKBl function, or the subject prior to having a cancer.
- a subject is identified as having a cancer involving loss or reduction in LKBl function if the level of LINC00473 in a test sample is not different than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and known to have a cancer involving loss or reduction in LKB l function.
- the term "the presence of LINC00473 relative to the reference value" indicates that the level of LINC00473 when compared to the reference value is used to identify a subject as having a cancer involving loss or reduction in LKB l function.
- the reference value corresponding to the level of LINC00473 can indicate the level of LINC00473 associated with the absence of a cancer, the presence of a cancer not involving loss or reduction in LKBl function or the presence of a cancer involving loss or reduction in LKB l function.
- the reference values corresponding to the level of LINC00473 may be indicative of the absence of a cancer, the presence of a cancer not involving loss or reduction in LKB l function or the presence of a cancer involving loss or reduction in LKBl function.
- a reference value associated with absence of a cancer may be obtained based on the level of LINC00473 in the samples obtained from individuals known to have the absence of cancer.
- a reference value associated a cancer not involving loss or reduction in LKB l function may be obtained based on the level of LINC00473 in the individuals known to have a cancer not involving loss or reduction in LKBl function.
- a reference value associated with a cancer involving loss or reduction in LKBl function may be obtained based on the level of LINC00473 in the samples obtained from individuals known to a cancer involving loss or reduction in LKB 1 function. For example, tissues from a group of healthy individuals can be obtained and LINC00473 level can be determined which indicates a reference value associated with the absence of a cancer.
- tissues from individuals known to have a cancer not involving loss or reduction in LKB1 function can be obtained and LINC00473 level can be determined which indicates a reference value associated with the presence of a cancer not involving loss or reduction in LKB1 function.
- tissues from individuals known to have a cancer involving loss or reduction in LKB 1 function can be obtained and LINC00473 level can be determined which indicates a reference value associated with the presence of a cancer involving loss or reduction in LKB1 function.
- references values associated with the absence of cancer, presence of a cancer not involving loss or reduction in LKB1 function or presence of a cancer involving loss or reduction in LKB1 function are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
- a subject can be identified as having a cancer involving a loss or reduction in LKB1 function. For example, a subject is identified as having a cancer involving loss or reduction in LKB 1 function if the level of LINC00473 in the test sample is higher than the reference value corresponding to a cancer not involving loss or reduction in LKB1 function. Alternately, a subject is identified as having a cancer involving loss or reduction in LKB1 function if the level of LINC00473 in the test sample is not different than the reference value corresponding to a cancer involving loss or reduction in LKB1 function.
- the step of determining the level of LINC00473 can be performed by a variety of techniques well-known to a person of ordinary skill in the art.
- the step of determining the level of LINC00473 comprises contacting the sample with selective reagents such as probes, primers or ligands, and thereby detecting the presence, or measuring the amount, of nucleic acids of interest originally in the sample. Contacting may be performed in any suitable device, such as a plate, microtiter dish, test tube, well, glass, column, and so forth.
- the contacting is performed on a substrate coated with the reagent, such as a nucleic acid array or chip or a specific ligand array.
- the substrate may be a solid or semi-solid substrate such as any suitable support comprising glass, plastic, nylon, paper, metal, polymers and the like.
- the substrate may be of various forms and sizes, such as a slide, a membrane, a bead, a column, a gel, etc.
- the contacting may be made under any condition suitable for a detectable complex, such as a nucleic acid hybrid or an antibody- antigen complex, to be formed between the reagent and the nucleic acids or proteins of the sample.
- the expression level may be determined by determining the quantity of mRNA.
- Methods for quantifying mRNA are well known in the art.
- the test sample and optionally, the control sample can be appropriately treated for producing of a RNA preparation used in the contacting step.
- a sample can be homogenized and proteins and DNA can be removed from the sample, for example, through degradation or precipitation, to purify RNA from the sample.
- Various techniques of isolating RNA from a sample are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.
- LINC00473 contained in the samples can be detected by hybridization (e. g, Northern blot analysis, RNA in situ hybridization) and/or amplification (e.g., reverse transcriptase-polymerase chain reaction (RT-PCR)).
- hybridization e.g, Northern blot analysis, RNA in situ hybridization
- amplification e.g., reverse transcriptase-polymerase chain reaction (RT-PCR)
- RT-PCR reverse transcriptase-polymerase chain reaction
- RT-PCR reverse transcriptase-polymerase chain reaction
- Nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to LINC00473 find utility as hybridization probes or amplification primers. It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-95% identical. In certain embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization. A wide variety of appropriate indicators are known in the art including, fluorescent, radioactive, and enzymatic or other labels (e.g., avidin/biotin).
- Probes typically comprise single-stranded nucleic acids of between 10 to 200 nucleotides in length, for instance of between 10 and 100, more preferably of between 15 and 80, typically of between 20 and 25.
- Primers typically are shorter single-stranded nucleic acids, of between 10 to 25 nucleotides in length, designed to perfectly or almost perfectly match a nucleic acid of interest, to be amplified, i.e., LINC00473.
- the probes and primers are "specific" to the nucleic acids to which they hybridize, i.e. they preferably hybridize under high stringency hybridization conditions (corresponding to the highest melting temperature Tm, e.g., 50 % formamide, 5x or 6x SCC.
- SCC is a 0.15 M NaCl, 0.015 M Na- citrate).
- the nucleic acid primers or probes used herein may be assembled as a kit.
- a kit includes consensus primers and molecular probes.
- a preferred kit also includes the components necessary to determine if amplification has occurred.
- the kit may also include, for example, PCR buffers and enzymes; positive control sequences, reaction control primers; and instructions for amplifying and detecting the specific sequences.
- the expression level is determined by DNA chip analysis.
- DNA chip or nucleic acid microarray consists of different nucleic acid probes that are chemically attached to a substrate, which can be a microchip, a glass slide or a microsphere-sized bead.
- a microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose.
- Probes comprise nucleic acids such as cDNAs or oligonucleotides that may be about 10 to about 60 base pairs.
- a sample from a test subject optionally first subjected to a reverse transcription, is labelled and contacted with the microarray under hybridization conditions, leading to the formation of complexes between target nucleic acids that are complementary to probe sequences attached to the microarray surface.
- the labelled hybridized complexes are then detected and can be quantified or semi- quantified. Labelling may be achieved by various methods, e.g. by using radioactive or fluorescent labelling. Many variants of the microarray hybridization technology are available to the man skilled in the art (see, for example, the review by Hoheisel, 2006).
- a LINC00473 inhibitor is administered to the subject to treat the cancer.
- the terms "LINC00473 inhibitor” or “inhibitor of LINC00473” refers to an agent capable of inhibiting the expression and/or activity of LINC00473.
- the LINC00473 inhibitor can be an siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme, aptamer or small molecule inhibitor.
- the sequence of siRNA, shRNA, a bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme or aptamer as the LINC00473 inhibitor can be designed based on the sequence of LINC00473 provided in SEQ ID NO: 1.
- Certain examples of computer programs which can be used to design LINC00473 inhibitor based on the sequence of LINC00473 are provided in Naito et al. The Naito et al. reference is incorporated herein in its entirety. Additional examples of computer programs which can be used to design LINC00473 inhibitor based on the sequence of LINC00473 are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
- inhibitors of non-coding RNAs are provided in Ling et al. and Li et al.
- the Ling et al. reference is incorporated herein by reference in its entirety, particularly, page 859, under "IncRNAs in cancer and therapeutic implications" to the end of page 862.
- the Li et al. reference is also incorporated herein by reference in its entirety, particularly, page 1902, right column, under "Prospective strategies for targeting IncRNAs" to the end of page 1907.
- the inhibitor of LINC00473, for example, an siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme or aptamer is encoded by a nucleic acid vector. Accordingly, an embodiment of the invention provides a vector comprising a LINC00473 inhibitor.
- the LINC00473 inhibitor encoded by a nucleic acid is introduced to a subject via gene therapy.
- the vector encoding the LINC00473 inhibitor encoded by a nucleic acid vector can be introduced specifically in to the cancer cells of a subject.
- Examples of viral vectors and procedures for gene therapy using the viral vectors are described in Waehler et al.
- the Waehler et al. reference is incorporated herein in its entirety.
- Examples of non-viral vectors and procedures for gene therapy using the non-viral vectors are described in Yin et al.
- the Yin et al. reference is incorporated herein in its entirety.
- Certain examples of introducing nucleic acid inhibitors of a target nucleotide are provided in Ling et al., particularly, page 855, under "Restoring miRNA levels with oligonucleotide- based approaches" to the end of page 857.
- a small molecule LINC00473 inhibitor can be obtained based on a screening of a compound library to identify specific compounds as LINC00473 inhibitor. Description of small molecule inhibitors of specific target oligonucleotides are provided in in Ling et al., for example, page 858, under Small molecules targeting miRNAs and Li et al., page 1905, under small molecules continuing on to page 1906.
- a further an embodiment of the invention provides a pharmaceutical composition comprising a LINC00473 inhibitor.
- the pharmaceutical composition can be used for the treatment of a cancer, for example, a cancer involving loss or reduced LKB 1 function.
- compositions as disclosed herein, can be formulated in accordance with standard pharmaceutical practice known by a person skilled in the art (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York).
- compositions for parenteral administration are generally physiologically compatible sterile solutions or suspensions which can optionally be prepared immediately before use from solid or lyophilized form.
- Adjuvants such as a local anesthetic, preservative and buffering agents can be dissolved in the vehicle and a surfactant or wetting agent can be included in the composition to facilitate uniform distribution of the active ingredient.
- the composition can be formulated into conventional oral dosage forms such as tablets, capsules, powders, granules and liquid preparations such as syrups, elixirs, and concentrated drops.
- Non toxic solid carriers or diluents may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, magnesium, carbonate, and the like.
- binders which are agents which impart cohesive qualities to powdered material, may also be necessary.
- starch, gelatin, sugars such as lactose or dextrose, and natural or synthetic gums can be used as binders.
- Disintegrants may also be necessary in the tablets to facilitate break-up of the tablet.
- Disintegrants include starches, clays, celluloses, algins, gums and crosslinked polymers.
- lubricants and glidants are also included in the tablets to prevent adhesion to the tablet material to surfaces in the manufacturing process and to improve the flow characteristics of the powder material during manufacture.
- Colloidal silicon dioxide is most commonly used as a glidant and compounds such as talc or stearic acids are most commonly used as lubricants.
- composition can be formulated into ointment, cream or gel form and appropriate penetrants or detergents could be used to facilitate permeation, such as dimethyl sulfoxide, dimethyl acetamide and dimethylformamide.
- the LINC00473 inhibitor can be incorporated into any of the known suppository bases by methods known in the art. Examples of such bases include cocoa butter, polyethylene glycols (carbowaxes), polyethylene sorbitan monostearate, and mixtures of these with other compatible materials to modify the melting point or dissolution rate.
- the method of treating lung cancer comprises administering to a subject in need thereof, a composition comprising LINC00473 inhibitor via inhalation.
- compositions of the invention appropriate for administration via inhalation can be a solution, suspension, or powder. These formulations are typically administered via an aerosol or a dry powder inhaler. Aerosol is a colloidal suspension of particles dispersed in air or gas. In aerosols, liquid or suspension droplets are the internal phase and a gas is the external phase.
- an aerosol delivery device is used to administer the compositions of the invention.
- An aerosol delivery device is used to produce aerosols, for example, for delivery to a subject via inhalation.
- Metered dose inhalers are aerosol delivery devices that deliver a fixed dose in a spray with each actuation of the device.
- atomizers are used as aerosol delivery devices. Additional examples of aerosol delivery devices are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.
- Atomizers break up a liquid into an aerosol.
- an atomizer comprises a squeeze bulb which is used to blow air into the device causing the drug solution to rise in a small dip tube and vaporizing in the air stream.
- the air stream is directed into a baffle or bead which breaks the droplets in to even smaller droplets as they collide with the device.
- the mixture of air and liquid then exits the atomizer in the form of an aerosol.
- a nebulizer contains an atomizing unit within a chamber. When the rubber bulb is depressed, the medication solutions is drawn up a dip tube and aerosolized by the passing air stream. Baffles or beads may also be present in the chamber. The fine droplets exit the nebulizer. The larger droplets collect on the chamber and fall back into the reservoir where they can be used again. Vaporizers produce a fine mist of steam. Volatile medication is added to the water in the vaporizer or to a special medication cup present in some models. The medication volatilizes and is inhaled by a patient as he/she breathes.
- the composition is a dry powder and the inhalers contain the dry powders in cartridges or disks.
- the device When a patient administers a dose, the device is first activated by some mechanical motion and the dry powder becomes ready for inspiration. The patient then inhales through the device mouthpiece and the powder is drawn into the pulmonary tract along with the inspired air.
- These devices have overcome a major problem of inhalation therapy, synchronizing deep inspiration with the administration of the drug.
- Some of the commercially available devices are Diskhaler®, Turbuhaler®, Diskus®, and Rotahaler®.
- a powdered composition is administered with insufflators or puffers. Squeezing the rubber bulb of an insufflator causes turbulence within the powder reservoir which forces some of the powder into the air stream and out of the device.
- a puffer is a plastic accordion-shaped container with a spout on one end. The powder is placed inside the container and the puffer is actuated by squeezing the device. A portion of the powder is ejected from the spout.
- the LINC00473 inhibitor is formulated in a composition wherein the LINC00473 inhibitor is specifically delivered to the cancer cells in the subject.
- the LINC00473 inhibitor is specifically delivered to the cancer cells in the subject. Examples of specifically delivering an agent to target cells, for example, target cancer cells are described in the Erkki Ruoslahti et al. (2010) reference which is incorporated herein by reference in its entirety.
- the LINC00473 inhibitor according to the present invention may be administered in effective amount to a subject in one or more "unit doses."
- Unit dose is defined as containing a predetermined-quantity of the therapeutic composition calculated to produce the desired responses upon administration to a subject, i.e., the appropriate route and treatment regimen.
- a quantity to be administered and a route of administration can be determined by a person of ordinary skill in the art depending upon the LINC00473 inhibitor to be administered and the status of cancer in a subject.
- the subject to be treated may be evaluated, in particular, for the state of the subject's cancer, subjects overall health, age and desired aggressiveness of the therapy.
- Unit dose of the LINC00473 inhibitors may be described in terms of mg LINC00473 inhibitor per Kg of body weight, which can be about 0.05, 0.10, 0.15, 0.20, 0.25, 0.5, 1, 10, 50, 100, 1,000, or more.
- a unit dose may be administered as a single dose or may be provided via multiple administrations over a predetermined period of time, for example, about one month to about six months, about two months to about five months, or about three to four months.
- LINC00473 inhibitor in connection with the LINC00473 inhibitor means an amount capable of alleviating symptoms of a cancer in whole or in parts, diminishment of extent of cancer, stabilized (i.e., not worsening) state of cancer, delaying or slowing of cancer progression, amelioration or palliation of the cancer state, and remission (whether partial or total), whether detectable or undetectable. Complete absence of the cancer may not be achieved by an effective amount of LINC00473 inhibitor.
- LINC00473 inhibitor can be administered via different routes of administration.
- routes of administration include oral, subcutaneous, intradermal, intravenous, intra-arterial, intratumoral, intraperitoneal, inhalation and intramuscular.
- the LINC00473 inhibitor is administered to a subject identified as having a cancer involving loss or reduction in LKB1 function in combination with one or more additional cancer therapies.
- the additional cancer therapy can be selected from radiotherapy, chemotherapy, surgery, immunotherapy, kinase inhibition, monoclonal antibody therapy (e.g., bevacizumab or cetuximab) or a combination thereof.
- a cancer therapy in addition to the LINC00473 inhibitor to be administered can be determined by a person of ordinary skill in the art depending upon the status of cancer in a subject, for example, the subject to be treated may be evaluated, in particular, for the state of the subject's cancer, subjects overall health, age and desired aggressiveness of the therapy.
- Non-limiting examples of the additional cancer therapy or the cancer treatments other than a LINC00473 inhibitor include, but are not limited to, administering one or more of: Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afinitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Aminolevulinic Acid, Anastrozole, Aprepitant, Ari
- the methods of current invention can be practiced to identify subjects having a cancer involving loss or reduction in LKB1 function, and optionally, for treating cancer, wherein the cancer is selected from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, cerebellar astrocytoma, basal cell carcinoma, bile duct cancer, extrahepatic bladder cancer, bladder cancer, bone cancer, osteosarcoma and malignant fibrous histiocytoma, brain stem glioma, brain tumor, central nervous system embryonal tumors, cerebral astrocytoma/malignant glioma, ependymoblastoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma,
- the methods of current invention can be practiced to identify subjects having a cancer involving loss or reduction in LKBl function, and optionally, for treating cancer, wherein the cancer is non-small cell carcinoma, squamous cell carcinoma, large cell carcinoma, mucoepidermoid carcinoma, bronchioloalveolar adenocarcinoma, mixed adenosquamous carcinoma or undifferentiated carcinoma.
- the methods of current invention are practiced to identify subjects having a cancer involving reduction or loss of LKBl function and optionally, for treating a lung cancer, for example, NSCLC.
- a subject is identified as having a cancer not involving loss or reduction in LKB l function. In one embodiment, a subject is identified as having a cancer not involving loss or reduction in LKBl function if the level of LINC00473 in a test sample is not different than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKBl function or the subject prior to having a cancer.
- a subject is identified as having a cancer not involving loss or reduction in LKBl function if the level of LINC00473 in a test sample is lower than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and known to have a cancer involving loss or reduction in LKBl function.
- a subject can also be identified as having a cancer not involving a loss or reduction in LKBl function based on the reference value used and the level of LINC00473 in a test sample. For example, a subject is identified as having a cancer not involving loss or reduction in LKB l function if the level of LINC00473 in the test sample is not different than the reference value corresponding to a cancer not involving loss or reduction in LKB l function. Alternately, a subject is identified as having a cancer not involving loss or reduction in LKBl function if the level of LINC00473 in the test sample is lower than the reference value corresponding to a cancer involving loss or reduction in LKB 1 function.
- a cancer therapy other than the LINC00473 inhibitor is administered to the subject to treat the cancer.
- the additional cancer therapies discussed above in connection with cancer therapies in combination with the LINC00473 inhibitor can be administered without the LINC00473 inhibitor to a person is identified as having a cancer not involving a loss or reduction in LKB 1 function.
- An appropriate cancer therapy to be administered to a subject can be determined by a person of ordinary skill in the art depending upon the status of cancer in the subject, for example, the subject to be treated may be evaluated, in particular, for the state of the subject's cancer, subjects overall health, age and desired aggressiveness of the therapy.
- Nanostring gene expression assay analyses were performed according to the manufacture's protocols (Nanostring Technologies, Seattle, WA) using customized nCounter GX CodeSet.
- Total RNA from cultured cells (100 ng) or RNA from FFPE tissues (150-200 ng) was hybridized with the specific capture probes and barcoded reporter probes at 65 °C for 18 hours and then loaded into the nCounter Pre-station for purifying the hybridized probes.
- Data collection was performed on the nCounter Digital Analyzer that counted and tabulated the individual fluorescent barcodes for target RNA molecules in each samples following the manufacturer's instructions.
- the raw data were analyzed with nSolverTM Analysis Software for gene expression analysis.
- the heatmap was generated with Heatmap.2 R package using the normalized Nanostring expression data.
- RNAscope In situ hybridization (RNA ISH)
- RNA ISH was performed on FFPE xenograft tumors and tissue microarrays (TMAs) using RNAscope® 2.0 HD Reagent Kit [BROWN 310033 or RED 310034, Advanced Cell Diagnostics (ACD), Hayward, CA]. Briefly, tissue sections were deparaffinized with xylene and 100% ethanol and incubated with pretreat-1 solution for 10 minutes, pretreat-2 for 15 minutes, and pretreat-3 for 30 minutes (Pretreatment kit 310020, ACD). The slides were then hybridized with a custom probe Hs-LINC00473-tvl (targeting 781-1755 of R_026860.1) in the HybEZ oven (ACD) at 40°C for 2 hours.
- ACD HybEZ oven
- the Hs-PPIB probe for human housekeeping gene PPIB was used as a control to ensure RNA quality.
- slides were subjected to signal amplification using HD 2.0 detection Kit, and hybridization signal was detected using a mixture of solutions A and B (1 :60).
- After counterstaining with hematoxylin slides were dried in a 60°C dry oven for 15 minutes and mounted with Ecomount (BioCare Medical, EM897L). The stained sections were scanned and digitized with Aperio Imagescope (Leica, Bannockburn, IL).
- RNA-FISH RNA- Fluorescence in situ hybridization
- RNA-FISH was performed using LINC00473 Stellaris® FISH probes labeled with Quasar 570 (Biosearch Technologies, Petaluma, CA) following the manufacturer's protocol. Imaging was performed immediately using Leica DM6000B fluorescence microscope (Bannockburn, IL).
- LncRNA was first transcribed in vitro using the MEGAscript® T7 Transcription Kit
- RNAs were covalently linked to adipic acid dihydrazide agarose beads by periodate oxidation of RNA 3'-OH terminus. The beads bound with RNAs were incubated with nuclear extracts of A549 cells to pull down the IncRNA-interacting proteins. After extensive washing, beads were boiled with a loading buffer to elute the IncRNA-interacting proteins, which were further separated by SDS-PAGE and subjected to mass spectrometric analysis.
- Luciferase-expressing A549 cells or HI 57 cells infected with control shRNA or shLINC00473 lentiviruses were subcutaneously injected to NOD/SCID mice (Jackson Laboratory, Bar Harbor, ME). Tumors were measured and bioluminescence imaging was performed as previously described.
- TCGA sequencing project Genome Atlas (TCGA) sequencing project and the accompanying clinical data were used for analysis. Normalized read counts (RSEM) for each LUAD sample aligned to LINC00473 were obtained and used for the survival curve analysis. All LUAD samples with > 90th percentile of LINC00473 expression and those with ⁇ 90th percentile were considered as high and low groups, respectively. The overall survival was analyzed by Kaplan-Meier curves and log-rank test for all LUAD patients, ⁇ -values of ⁇ 0.05 were considered statistically significant.
- RSEM Normalized read counts
- Nanostring assay is based on direct digital detection of mRNA molecules of interest using target-specific, color-coded probe pairs. Because Nanostring probes recognize small target regions ( ⁇ 100bp) and no enzymes are involved, nanostring assays have been successfully used in gene expression quantification in formalin-fixed paraffin embedded (FFPE) tumor samples in which RNA is frequently degraded, in contrast with RT-PCR or microarray analysis that requires good quality RNA. Such assays are valuable because of a large collection of FFPE tumors in Biobanks is available and because these assays are rapid, reproducible and cost-effective.
- the first Nanostring-based Breast Cancer Assay for assessing a patient's risk of distant recurrence of disease was approved by the FDA in 2014. Moreover, FDA-approved IncRNA PCA3 assay indicates clinical potential of IncRNA.
- a Nanostring-based IncRNA test for assessing LINC00473 expression as a surrogate marker for the LKB 1 status is provided. This assay offers several advantages:
- LKB1 inactivation can result from mutations across the entire LKB1 gene, or epigenetic silencing, or post-translational inactivation, posing a challenge to detect LKB1 mutations through direct genomic sequencing and to predict their functional consequences.
- nanostring assay provides a useful test for scoring LKB 1 -inactivated tumors.
- a nanostring-based assay for classifying LKBl-inactivacted tumors is provided.
- Nanostring technology allows simultaneous detection of multiple genes and a Codeset have been designed and synthesized.
- This Codeset includes a library of probes targeting 40 LKB 1 -regulated genes, including, for example, LINC00473, AGR2, SMOC1, NR4A1-3, CPS1, PPARGCIA, PDE10A, TFF1, etc., LKB1 and one or more internal control genes, for example, GAPDH, GUSB, PGK1, TUBB.
- the selection of the LKB 1 -regulated coding genes was based on a published dataset (GSE51266) that used Affymetrix human gene 1.1 ST Array (which does not include probes for LINC00473).
- the data from the Nanostring assays can help establish a correlation of LKB 1 -inactivated lung cancer cells with one or more LKB 1 -regulated genes.
- Each target gene can be detected using a pair of reporter and capture probes carrying 50-base target-specific sequences and each barcode specifically represents a single target molecule.
- the assay involves the steps of: hybridization, purification, immobilization, and digital data acquisition by Nanostring nCounter. 100 ng of RNA per sample can be tested initially. Gene expression is measured by counting the number of times the color-coded barcode for that gene is detected, and the barcode counts are then tabulated and analyzed.
- LKB 1 -null cell lines express highly increased, yet variable LINC00473 expression levels that might be due to co-existing mutations or other mechanisms and hence, the cutoff score are carefully evaluated.
- the data can provide the predictive value of LINC00473 as a surrogate marker for LKB 1 inactivation, as well as guiding subsequent validation studies.
- a large cohort of human lung tumors can be used to perform validation of LKB 1 mutational status based on LINC473 expression.
- IncRNAs contribute to loss of LKB1 tumor suppression in lung tumorigenesis and maintenance.
- genome-wide IncRNA transcriptional profiling was performed to identify IncRNAs associated with aberrant LKB1 signaling.
- Three groups of cells were generated by transducing LKB 1 -null A549 NSCLC cells with retroviruses harboring wild-type (wt) LKB 1, LKB1 kinase-dead mutant (K78I), or vector control (Ctl).
- Western blotting analysis confirmed the expression and kinase activity of LKBl-wt and - K78I proteins in an AMPK activation assay under glucose-free culture conditions ( Figures 5A).
- Arraystar Human LncRNA Expression Microarrays were used to profile changes in the expression of -30,000 IncRNAs in three experimental conditions. Using an absolute fold change > 2.0 and a p-va ⁇ ue ⁇ 0.05, 164 differentially expressed IncRNAs were identified (64 up-regulated and 100 down-regulated) in A549 cells upon LKBl-wt expression compared to control ( Figure 5B, Table 1).
- ASHGA5P031092 ENST00000563777 FBXL19-AS1 -2.35 0.03054
- ASHGA5P047405 TCONS 00014981 XLOC 007062 -2.23 0.00342
- ASHGA5P054980 ENST00000430109 RP4-758J18.10 -2.22 0.03927
- ASHGA5P022400 ENST00000556120 DI030S 2.40 0.04745
- LINC00473 consists of two exons and has two annotated Refseq transcript isoforms sharing exon 1 : transcript variant 1 (tvl; NR_026860, 1822 nt) and tv2 (NR 026861, 1123 nt).
- transcript variant 1 tvl; NR_026860, 1822 nt
- tv2 NR 026861, 1123 nt.
- 5' and 3' RACE assays identified 3 LINC00473 transcript variants, tvl . l, tv2.1 and tv2.2, but not two annotated transcripts.
- LINC00473-tvl . l had a shorter 5' end from the annotated tvl, while tv2.1 and tv2.2 had different 5' and 3' ends from the annotated tv2. Coding potential analysis strongly suggested that LINC00473 is a noncoding RNA. Both tvl and tv2 transcript variants showed significant activation in LKBl-null NSCLC cells (Table 2).
- LINC00473 tvl was the top differentially expressed lncRNA (> 10,000-fold change) comparing the 2 LKBl-null (A549 and H460) and 2 LKB1 -expressing cells (H322 and H3123), while LINC00473 tv2 showed about a 40-fold change.
- a Nanostring-based assay was used that allows direct digital detection of multiple RNA molecules of interest using target-specific, color- coded probe pairs.
- This platform enables to simultaneously evaluate multiple LKB1- regulated mRNA and lncRNA candidates (especially LINC00473).
- Hybridizations were performed on RNA samples from a pair of control and LKB1 -expressing A549 cells and a panel of NSCLC cell lines (7 LKB l-wt and 7 LKBl-mut) using a customized codeset.
- the codeset included several LKB1 -regulated lncRNA candidates, known LKB1 -regulated protein-coding genes, as well as three housekeeping genes (GAPDH, GUSB and TUBB).
- LKB1 expression in LKBl-null A549 cells caused significant down-regulation of known protein-coding genes (AVPI1, CTH, CPS1, DUSP4, FGA, NR4A2, PDE4B, PDE4D, PTGS2, PTP4A1, SIKl, SLC7A2, SNAI1, TESC and TFF1), as well as three IncRNAs (LINC00473, AL 109792, and BX64110).
- LINC00473 expression showed the best correlation with LKB 1 -inactivated status ( Figure 5E, left and middle panels).
- Other LKB1 -regulated genes including LncRNAs AL 109792 and BX64110, were only partially correlated with the LKB1 status, suggesting cell context-dependent gene regulation.
- Both LINC00473 tvl and tv2 isoforms showed low or absent expression in 7 LKB l- wt NSCLC cell lines but significantly enhanced expression in 7 LKB l-mut cell lines ( Figure 5F, G).
- LINC00473 differential expression in LKBl-wt and LKBl-mut cell lines was further corroborated by qRT-PCR data.
- Enhanced expression of a known LKB 1 target gene SIKl was also confirmed, but was not consistent across all cell lines tested.
- SIKl has relatively high basal expression.
- LINC00473 expression was surveyed in 130 NSCLC cell lines using Affymetrix microarray data from the Cancer Cell Line Encyclopedia (CCLE) and these arrays only contained the probes for LINC00473 tvl .
- CCLE Cancer Cell Line Encyclopedia
- a subset of NSCLC cell lines showed an outlier LINC00473 tvl expression ( Figure 5H, and Table 3).
- H292 is a lung mucoepidermoid carcinoma cell line that contains a t(l 1;19) translocation that leads to the generation of the CRTC1-MAML2 fusion and subsequent constitutive activation of CREB-mediated transcription, thus mimicking LKB1 loss.
- HCC-15 10.34715 M squamous cell carcinoma mutant NOS LKBl loss p.G196_L201
- LUDLU-1 5.432516 M squamous cell carcinoma Unknown LKB1 loss mixed_adenosquamous_ LKB1 loss,
- LINC00473 can serve as a potential biomarker for LKB1 status in human NSCLC cancers
- expression of LINC00473 and several other LKB1 targets was evaluated in formalin-fixed paraffin-embedded (FFPE) human adenocarcinoma (LUAD) specimens.
- FFPE formalin-fixed paraffin-embedded
- LAD human adenocarcinoma
- Target amplification-based strategies such as RT-PCR and microarray analyses for measuring RNA levels from fixed tissue is complicated by the fact that the RNA is highly cross-linked and significantly fragmented.
- Nanostring-based assays are optimal for gene expression quantification using FFPE tumor-derived RNA samples since the bar-coded fluorescent probes recognize small target regions ( ⁇ 100bp) allowing direct single-molecule counting without need for target amplification. Therefore, Nanostring assays were performed for FFPE tumor-derived RNAs from 5 LKBl-wt and 5 LKB l-mut human LUAD specimens. The LKB1 gene mutation status was analyzed by exon sequencing. LINC00473 expression was consistently found to best correlate with the tumor LKB 1 status among all the genes tested (Figure 6A). Expression of LINC00473 tvl, but not tv2, was significantly enhanced in LUAD with LKB1 mutations (Figure 6B). These data suggest that expression of LINC00473 tvl alone can predict tumor LKB 1 status.
- RNA in situ hybridizations was performed for detection of LINC00473 transcripts using customized LINC00473 probes (RNAscope).
- the specificity of LINC00473 probes was first validated by positive LINC00473 signals in LKB 1 -null A549 xenograft tumors and negative signals in LKBl-wt H522 xenograft tumors.
- LINC00473 transcripts were detected as easily distinguishable nuclear "dots" in A549 xenograft tumors.
- RNA ISH was the performed on FFPE human LUAD tissue array.
- PPIB peptidylprolyl isomerase
- Tumors carrying the LKBl gene mutations yet not showing LINC00473 induction could have intact LKB l function if the mutations do not impair LKBl function.
- one of the tumors with LKBl F354L mutation which was predicted not to have damaging effects on LKBl function based on PolyPhen-2 prediction, showed undetectable LINC00473 expression.
- LINC00473 is low or undetectable in normal lung tissues but exhibits elevated expression in the subset of lung NSCLC specifically with functional LKBl inactivation, indicating that LINC00473 is a potential robust surrogate biomarker for LKB 1 functional status in lung cancer.
- a lung adenocarcinoma (LUAD) RNAseq dataset from The Cancer Genome Atlas (TCGA) was analyzed.
- LUAD samples with high LINC00473 expression were enriched with LKBl gene-level nonsynonymous somatic mutations including small INDELs within the LKBl gene coding regions ( Figure 12).
- LINC00473 expression was not associated with KRAS and TP 53 gene mutations (Figure 12), which are two well-known somatic mutations that can occur concurrently with LKBl loss. Moreover, the difference in LINC00473 expression between LKBl wt and LKB l mutant populations was more significant compared to SIK1 or LKB l expression ( Figure 13). LINC00473 expression was positively correlated with LKBl -loss gene signature and inversely correlated with LKBl expression, and such correlations were more significant in comparison to SIK1 expression and LKBl expression ( Figure 14). These data support a strong association of LINC00473 expression with the LKBl inactivation in LUAD samples.
- LKBl regulates multiple downstream AMPK family members, influencing multiple signaling pathways.
- the loss of LKBl expression resulted in dephosphorylation and nuclear entry of CRTC transcriptional co-activators and subsequent CREB-mediated transcriptional activation in both lung and esophageal cancer cells.
- LINC00473 was transiently up-regulated in response to cAMP signaling in human ocular ciliary smooth muscle cells.
- the LINC00473 gene contains 2 CRE (cAMP -responsive element) half sites within the proximal promoter region.
- CREB was depleted using lentiviral-mediated shRNAs or expression of a dominant negative form of CRTC (dnCRTC) that interferes with CRTC- CREB interaction.
- dnCRTC dominant negative form of CRTC
- a reduction in LINC00473 transcript level was observed in CREB- depleted or dnCRTC-expressing A549 cells ( Figures 7C). LKBl over-expression further blocked LINC00473 expression.
- LINC00473 promoter sequence (-523 to +88) encompassing 2 CRE sites was cloned into the upstream region of a luciferase reporter (pGL3 basic) ( Figure 7D) and LINC00473 promoter activity was determined by modulating LKBl -CRTC -CREB signaling.
- the LINC00473 promoter reporter was significantly repressed by over-expression of LKB l, but not LKB l kinase-dead mutant K78I when transfected in LKB l -deficient A549 cells ( Figure 7E).
- LINC00473 depletion significantly reduced the tumor size and weight and blocked the growth of A549-luc xenografts over time ( Figures 8D and 4D-4F).
- EXAMPLE 9 - LINC00473 IS A NUCLEAR LNCRNA AND FUNCTIONS AS A REGULATOR OF GENE EXPRESSION IN PART THROUGH INTERACTING WITH NONO AND MODULATING CRTC/CREB TRANSCRIPTION
- the molecular mechanisms underlying LINC00473 functions are unknown.
- IncRNAs may be involved in various processes, including transcription, splicing, post-transcriptional regulation, organization of protein complexes, cell-cell signaling, and allosteric regulation of proteins. Knowledge of subcellular localization for IncRNAs can provide a clue for IncRNA functions.
- RNA-FISH RNA fluorescence in situ hybridization
- RNA-FISH RNA-FISH
- fixed cells were hybridized with a mixture of 27 oligonucleotide probes (20-mer) targeting LINC00473, with each probe linked with a single Quasar 570 fluorophore.
- Positive nuclear signals were observed with 1-2 distinctive dot-like structures as well as less intense, diffuse signals outside the dots ( Figure 9C).
- LINC00473 signals were undetectable when hybridizations were performed in the presence of RNase, indicating that the signal detection was RNA-dependent.
- exogenous LINC00473 showed similar nuclear localization when over-expressed in LKB l-wt H522 cells.
- RNA pull-down assay was performed followed by a proteomic analysis of the LINC00473 -associated protein complex in A549 cells.
- the in vitro transcribed LINC00473 bound to beads were incubated with A549 nuclear extracts to purify LINC00473 RNA-protein complex.
- the LINC00473 -associated protein complex components were separated by SDS-PAGE ( Figure 10A) and the protein identity was revealed by mass spectrometry (MS).
- MS mass spectrometry
- a notable protein was a known CRTC interacting protein, NONO, with 115 peptides detected in this MS analysis (Table 4).
- RNA pull-down was performed followed by Western blotting with NONO antibodies. NONO was readily detected in LINC00473 RNA pull-down complex but not in the control samples including LINC00473 antisense RNA (AS), LncRNA MEG3 and beads only ( Figure 10B).
- An RNA immune- precipitation (RNA-IP) was also performed for the RNA-NONO complex using NONO antibodies and measured the amount of LINC00473 associated with NONO immune- precipitates. The immune-precipitated NONO protein levels were confirmed by Western blotting (Figure IOC).
- the qRT-PCR results showed significant enrichment of LINC00473, but not the negative control ASNS in NONO immune-precipitates ( Figure 10D).
- NONO interacts with CRTC co-activators upon cAMP stimulation, which is essential for CREB-mediated transcription. Since LINC00473 physically interacted with NONO, LINC00473 appears to regulate NONO recruitment to CRTCs and promotes subsequent activation of CREB target gene transcription. The interaction of NONO and CRTC was tested when LINC00473 was either depleted or over-expressed using mammalian two-hybrid assays. Depletion of LINC00473 caused a reduced interaction of gal4-NONO and CRTC1, which was indicated by reduced activation of a Gal4 promoter reporter ( Figure 10E). Conversely, enhanced LINC00473 expression promoted NONO-CRTC1 interaction ( Figure 10F).
- LINC00473 facilitates the recruitment of NONO to CRTC and subsequently promotes CREB-mediated transcription.
- gene expression analysis was performed in lentiviral-based scrambled shRNA control and LINC00473 -depleted A549 cells as well as in retroviral -based vector control and LKB l -expressing A549 cells in Nanostring assays.
- LINC00473 depletion impaired expression of several known and potential CRTC/CREB targets including CTH, CPS1, DUSP4, FGA, NR4A2, PDE4B, PDE4D, PTGS2, PTP4A1, SIKl, SLC7A2, TESC and TFFI, whose expression were induced by LKB 1 loss ( Figure 10G).
- EDD9 a CRTC-CREB target gene implicated in regulating cell proliferation and metastasis, was down-regulated in LINC00473-depeleted A549 cells, although its expression was not significantly different between LKBl-mut and -wt cell lines.
- Table 4 A list of top potential LINC00473-interacting protein candidates in A549 cells based on proteomic analysis.
- HNRNPL 3191 heterogeneous nuclear ribonucleoprotein L 37 173
- ILF3 3609 interleukin enhancer binding factor 3, 90kDa 47 127
- NONO 4841 non-POU domain containing, octamer-binding 33 115
- HNRNPM 4670 heterogeneous nuclear ribonucleoprotein M 41 101
- RANBP2 5903
- RAN binding protein 2 54 64 synaptotagmin binding, cytoplasmic RNA
- HNRNPR 10236 heterogeneous nuclear ribonucleoprotein R 27 54
- HNRNPU 3192 heterogeneous nuclear ribonucleoprotein U 27 52
- HNRNPA1 heterogeneous nuclear ribonucleoprotein Al- L2 144983 like 2 9 43
- EPRS 2058 glutamyl-prolyl-tRNA synthetase 37 39
- HNRNPLL 92906 heterogeneous nuclear ribonucleoprotein L-like 22 39
- EXAMPLE 10 - LINC00473 AS A CANCER BIOMARKER Lung cancer is the leading cause of cancer death. Progress in lung cancer treatment improvements will require improved predictive biomarkers so that cancer patients can be provided with the most effective treatments available as well as a larger repertoire of therapeutic targets.
- a novel IncRNA namely, LINC00473, is provided whose elevated expression is highly associated with the loss of the tumor suppressor LKB1 gene function, which is one of the most common mutational events in lung cancer.
- the gene expression and functional data provided herein support the potential utility of LINC00473 as a biomarker and as a therapeutic target for lung cancers with impaired LKB1 signaling.
- mechanistic insights into LINC00473 as a critical nuclear regulator of gene expression in lung cancer are provided.
- LKB1 functional inactivation could result from mutations across the entire LKB1 gene, epigenetic silencing, or post-translational inactivation, posing a great challenge to detect LKB1 functional loss through direct genomic sequencing.
- LKB 1 IHC assay was shown for specific detection of LKB 1 protein loss; however, those LKB1 antibodies used were not highly specific.
- a 16-gene signature was reported to be capable of predicting tumor cells with LKB 1 inactivation, yet the expression of those individual genes is not completely correlated with the tumor LKB1 status and combined scoring of multiple genes for individual tumors require complicated analysis.
- LINC00473 gene is induced in J 57-inactivated primary NSCLC samples and derived cell lines, supporting the concept that that LINC00473 expression could be used for predicting LKB1 functional status in clinically relevant FFPE tumor specimens.
- LINC00473 expression is a functional readout for LKB1 inactivation; thus LINC00473 -based detection will be advantageous over direct sequencing of the entire LKBl gene or IHC analysis of LKBl protein detection.
- a subset of human lung tumors without detectable mutations in the coding region of the LKBl gene showed positive staining for LINC00473.
- LKBl inactivation is caused by epigenetic affects such as promoter hypermethylation or functional suppression by other mechanisms, including alterations in other components of the LKBl pathway.
- BRAF activating mutations were shown to suppress LKBl kinase activity and thus inactivated LKB l signaling.
- a subset of tumors with LKBl mutations had non-detectable LINC00473 expression.
- These tumors may have LKBl mutations that have no significant impact on LKB l functions.
- tumor cells having the mutation(s) on one allele of the LKBl gene may express sufficient level of functional LKB l proteins.
- LINC00473 normally expresses at a low or undetectable level but at a significantly high level in LKBl -inactivated cells, detection of up-regulated LINC00473 expression will not be affected by the presence of stromal cells.
- LINC00473 has sufficiently high expression in LKBl -inactivated lung cancer and can be detected in biopsy specimens in the clinic.
- LINC00473 patients with high LINC00473 -expressing lung cancers had worse survival, suggesting that LINC00473 likely confers lung cancer cells with aggressive behaviors.
- a significant number of IncRNAs in human genome seem to have arisen within the primate lineage based on sequence conservation and LINC00473 belongs to this group. It is unclear whether LINC00473 may contribute to any unique features associated with human cancers.
- LINC00473 plays a role in maintaining human NSCLC cell growth and survival.
- LINC00473 has low or undetectable expression in normal tissues; therefore, targeting LINC00473 expression is an attractive approach of specifically blocking lung cancer without significantly affecting normal tissues.
- anticancer drugs mainly target DNA or proteins in tumor cells.
- RNAi RNA interference
- LNP lipid nanoparticles
- Liposomal vector mediated delivery of the 3p FUS1 gene demonstrates potent antitumor activity against human lung cancer in vivo. Cancer Gene Ther 11, 733-9 (2004).
- RNA MALATl is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer Res 73, 1180-9 (2013).
- DDX5 is a positive regulator of oncogenic NOTCH1 signaling in T cell acute lymphoblastic leukemia. Oncogene 32, 4845-53 (2013).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Pharmacology & Pharmacy (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention pertains to increased LINC00473 as an indicator of a cancer involving loss or reduction in LKB 1 function. LINC00473 is also provided as a therapeutic target for treating a cancer involving loss or reduction in LKB1 function. The invention provides a method of identifying a subject as having a cancer involving loss or reduction in LKB 1 function based on the level of LINC00473 in the test sample obtained from the subject and administering an effective amount of a LINC00473 inhibitor to the subject to treat the cancer. The LINC00473 inhibitor can be a small-inhibitory RNA, short hairpin RNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme, aptamer or small molecule inhibitor. A pharmaceutical composition comprising a LINC00473 inhibitor is also provided for the treatment of a cancer involving loss or reduction in LKB 1 function.
Description
DESCRIPTION
LncRNA SERVES AS A BIOMARKER AND THERAPEUTIC TARGET CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application Serial No. 62/145,825, filed April 10, 2015, and U.S. Provisional Application Serial No. 62/320,510, filed April 9, 2016, the disclosures of which are hereby incorporated by reference in their entirety, including all figures, tables and amino acid or nucleic acid sequences.
This invention was made with government support under grant number is 1R21CA187730 - 01A1 awarded by the National Cancer Institute. The government has certain rights in the invention.
The Sequence Listing for this application is labeled "Seq-List.txt" which was created on April 9, 2016 and is 16 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
Lung cancer is the leading cause of cancer deaths in the United States and worldwide. The tumor suppressor gene Liver Kinase Bl (LKBl), also known as Serine/Threonine Kinase 11 (STK11), encodes a serine/threonine kinase that is critical for cellular metabolism, polarity and growth control. LKBl gene is somatically inactivated in approximately 30% of non- small cell lung cancer (NSCLC) cases and third most frequently mutated gene in NSCLC. The loss of LKBl in the context of Kirsten rat sarcoma viral oncogene (KRAS) mutations promotes lung cancer metastasis in mouse models and is associated with poor prognosis. The LKBl status is linked with cancer responsiveness to several targeted agents and chemotherapy in mouse tumor models. LKBl is thus implicated as diagnostic, prognostic and predictive biomarkers in human lung cancer. Moreover, LKB l mutations have been observed in other tumor types such as ovarian cancers and cervical cancers, and are important for tumor progression. However, clinical benefits that exploit LKB l deficiency cannot be achieved without studying the tumors produced by LKBl loss of function.
BRIEF SUMMARY OF THE INVENTION
The invention provides a long intergenic non-coding RNA (lincRNA), namely, LINC00473, as a gene regulator of oncogenesis. Increased LINC00473 expression was observed in cells with downregulation of LKB l protein expression/function and shown to have a critical role in carcinogenesis in the cells. Accordingly, an embodiment of the invention provides a method of diagnosing and treating a subject having a cancer involving loss or reduction in LKBl function, the method comprising:
(a) determining the level of LINC00473 in:
i) a test sample obtained from the subject, and
ii) optionally a control sample;
(b) optionally obtaining a reference value corresponding to a level of LINC00473, wherein the level of LINC00473 in the test sample relative to the control sample or the reference value indicates the presence or absence of the cancer involving loss or reduction in LKB l function in the subject; and
(c) identifying the subject as having the cancer involving loss or reduction in LKBl function based on the level of LINC00473 in the test sample and administering an effective amount of a LINC00473 inhibitor to the subject to treat the cancer, or
(d) identifying the subject as having the cancer not involving loss or reduction in
LKBl function based on the level of LINC00473 in the test sample and withholding the administration of the LINC00473 inhibitor to the subject, and optionally, administering a cancer therapy other than the LINC00473 inhibitor to the subject to treat the cancer.
The LINC00473 inhibitor can be an inhibitor of LINC00473 expression and/or activity, for example, a small-inhibitory RNA (siRNA), a short hairpin RNA, a bifunctional
RNA, an antisense oligonucleotide, a ribozyme, a deoxyribozyme, an aptamer or a small molecule inhibitor. Accordingly, an embodiment of the invention provides a pharmaceutical composition comprising a LINC00473 for the treatment of a cancer, for example, a cancer involving loss or reduced LKBl function or a cancer with high LINC00473 expression.
BRIEF DESCRIPTION OF THE DRAWINGS
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication, with color drawing(s), will be provided by the Office upon request and payment of the necessary fee.
Figures 1A-1C. LINC00473 up-regulation is correlated with LKBl loss in NSCLC cells. (A) LKBl loss induces LINC00473 transcription through CRTC activation. (B, C) A panel of LKB l -null (red) and wild-type (wt) NSCLC cell lines were assayed for LKB l protein levels via Western blotting (B) and LINC00473 expression via qRT-PCR (C).
Figures 2A-2B. Human primary lung tumors and their matching normal tissues were analyzed for LKBl protein expression via Western blotting and LINC00473 expression via real-time RT-PCR. Three human primary lung adenocarcinoma cases (1L, 3L and 4L) and their matching normal controls were assayed for LKBl expression by Western blotting (A) and for LINC00473 expression by qRT-PCR (B). Tumors (T) and normal tissues (N) were indicated. For qRT-PCR, human LKBl-WT NSCLC H3123 cells served as a control with its LINC00473 expression value considered as 1, and fold change of LINC00473 expression normalized against that of H3123 was shown.
Figures 3A-3D. LINC00473 expression levels are negatively regulated by LKB l . (A, B) Retroviral -mediated LKBl expression in LKB l -null NSCLC cells (HI 57 and A549) caused reduced LINC00473 expression. (C, D) Lentiviral -mediated LKB l depletion in LKBl-wt NSCLC cells (H3123 and H322) resulted in enhanced LINC00473 expression. A similar effect was observed using an independent shRNA targeting LKBl . The upper panels present western blot analysis of LKB l levels in either over-expressed or depleted cells, and the lower panels show the relative LINC00473 transcript levels, with the control defined as 1.
Figures 4A-4F. shRNA-mediated LINC00473 knockdown in A549 lung cancer cells resulted in reduced cell proliferation and survival. Three independent lentiviral pLKO. l- based shLINC00473 were generated, including shLIN473-2: (AACTGGATCTTTGCAGACAGG, SEQ ID NO: 3); shLINC473-3 (AAAGATCCAGTTTAATACAGA, SEQ ID NO: 4); shLINC473-4 (AAGAACCCAAGTCATATTCAT, SEQ ID NO: 5). A549 (LKBl-null) cells were transduced with these lentiviruses and control viruses expressing scramble shRNA for 96 hours and harvested for evaluating LINC00473 expression by qRT-PCR (A), viable cell number counting by Trypan Blue assays (B), and apoptotic cells by Annexin V-PI staining (C). (D-F) A total of 2xl06 A549-luc cells transduced with control shRNA or shLINC00473 (-2 & -4) were injected to NOD.SCID mice and the tumor growth was monitored via bioluminescence imaging (BLI) and direct tumor measurement. The tumors were photographed at day 36.
Figures 5A-5I. LINC00473 is induced by LKB l loss in NSCLC cells. (A) Western blotting analysis of expression of LKBl wild-type (wt) or kinase-dead K78I mutant in transduced LKBl -null lung adenocarcinoma A549 cells. A549 cells infected with pBabe vector retroviruses were used as controls (Ctl). (B, C) Volcano plots show differentially expressed IncRNAs after expression of LKB 1 wt (B) or LKB 1 K78I mutant (C) in A549 cells by LncRNA microarray (V3.0) analysis. The cutoff criteria were fold-change of > 2 and p < 0.05. (D) A volcano plot shows differentially expressed IncRNAs in two LKB l-null cell lines (A549 and H460) compared with two LKBl-wt cell lines (H322 and H3123). (E) A heatmap shows expression levels of several LKB l -regulated protein-coding and non-coding genes measured in Nanostring assays. (F, G) Two LINC00473 transcript variants (tvl : NR_026860 and tv2: NR_026861) show significantly elevated expression in LKBl -mutant groups as compared to LKB l-wt groups based on the Nanostring assays. (H) CCLE data analysis identified NSCLC cell lines (n=130) with outlier LINC00473 expression levels. (I) Enhanced LINC00473 expression was significantly associated with LKBl mutations in CCLE NSCLC cell lines. See also Tables 1-3.
Figures 6A-6G. Enhanced LINC00473 expression highly correlates with human lung adenocarcinoma with LKB l mutational status and is associated with poor survival. (A) A heatmap shows gene expression levels in RNA samples isolated from 5 LKBl-wt and 5 LKBl-mut FFPE LUAD samples in Nanostring assays. (B) Expression of LINC00473 transcript variant (tvl), but not tv2, was significantly different between LKB l-wt and -mut groups. (C,D) Representative images for tumors with LINC00473 positive (C) and negative (D) signals based on RNAscope detection on FFPE LUAD sections. RNA in-situ hybridization (ISH) of the housekeep gene PPIB was performed for sample RNA quality control. (E) Survey of human LUAD arrays indicated that 0% of normal lung tissues (n = 38), 10.11% of NSCLC tumors with annotated wild-type LKB l (n=89), and 55.54% of NSCLC tumors with annotated LKB l mutations (n = 22) were positive for LINC00473 expression. Only those tissues positive for the housekeeping gene PPIB expression were included in this analysis. LINC00473 expression positively correlated with LKBl mutations based on Fisher Exact Test (p = 1.93E-05). (F) TCGA-LUAD dataset showed outlier LINC00473 expression in matched tumor (T) (n = 57) compared to adjacent normal tissues (N) (n = 57) as well as unpaired tumor (UT) (n = 454). (G) Kaplan-Meier survival analysis of high LINC00473 expression (n = 48) and low LINC00473 expression (n = 421) in lung cancer patients (p < 0.001). See also Figures 12-15.
Figures 7A-7H. LINC00473 expression is regulated by LKB 1 -CRTC 1 -CREB signaling axis. (A) qRT-PCR analysis showed that LINC00473 expression was significantly reduced in two LKB l-null NSCLC cell lines (HI 57 and A549) after the transduction with LKB1 retroviruses (LKB l) for 96 hours, with cells transduced with vector retroviruses (Ctl) as controls. Western blotting confirmed LKB l expression (n = 3, **p < 0.001). (B) LINC00473 expression was enhanced upon LKBl shRNA lentiviral infection in two LKB1- wt NSCLC cell lines (H3123 and H322) (n = 3, *p < 0.05 and ***p < 0.0001). (C) LINC00473 expression was significantly reduced in A549 cells after the transduction with 2 independent CREB shRNAs (n = 3, *p <0.05). (D) A schematic representation of the LINC00473 promoter reporter is shown. (E) Expression of LKBl, but not the kinase-dead K78I mutant in LKBl-null A549 cells, caused significant repression in LINC00473 promoter reporter activity (n = 3, *p < 0.05). (F) Expression of A-CREB in A549 cells significantly inhibited the LINC00473 promoter activity (n = 3, *p < 0.05). (G) Expression of wt or constitutively activated S151A CRTC1 increased the LINC00473 promoter activity in LKB1- expressing H322 cells (n = 3, **p < 0.001 and ***p < 0.0001). (H) ChIP analysis indicated that CREB and CRTC1 were significantly enriched on the LINC00473 promoter encompassing the CRE half sites in A549 cells (n = 3, *p < 0.05 and ***p < 0.0001).
Figures 8A-8E. Depletion of LINC00473 expression in LKBl-null NSCLC cells causes reduced cell growth and survival in vitro and in vivo. (A) Luciferase-expressing A549 cells were infected with two independent lentiviral-based LINC00473 shRNAs and the scrambled shRNA control (shCtl), respectively. Transduced cells were harvested 96 hours later, and LINC00473 expression was quantified by qRT-PCR (n = 3, *p < 0.05). (B, C) Transduced cells at 96 hours post-transduction were cultured at 2>< 105 per well in 6-well plates for another 96 hours and viable cell number was measured using Trypan blue assay (B) and apoptotic cells were detected by Annexin V/PI staining (C) (n = 3, *p < 0.05 and **p < 0.001). (D) A total of 1 * 106 A549-luc cells after transduction with shLINC00473 or shCtl for 72 hours were injected subcutaneously to the dorsal flanks of NOD-SCID mice. The weights of excised tumors at the end points are shown. (E) Immunohistochemical staining of A549-control and A549-shLINC00473 xenograft tumor sections with Ki-67 antibody. See also Figures 16-17.
Figures 9A-9C. LINC00473 shows predominantly nuclear localization with distinct nuclear structures. (A) The transcript levels of LINC00473 and U6 (a nuclear marker) in the nuclear (Nuc) and cytoplasmic (Cyt) fractions obtained from A549 cells were quantified by
qRT-PCR assays. (B) LINC00473 transcripts were enriched in nuclear compartment when compared with nuclear marker U6 and cytoplasmic marker tRNA by Northern blotting analysis in three separate nuclear (N) and cytoplasmic (C) fractions obtained from A549 cells. (C) Nuclear localization of LINC00473 was detected by RNA-FISH in A549 cells. LINC00473 RNA-FISH probe sets were labeled with Quasar 570 dyes (red) and nuclei were labeled with the DNA dye DAPI (blue).
Figures 10A-10G. LINC00473 is associated with NONO protein and stimulates CRTC-NONO interaction. (A) Coomassie blue staining of the LINC00473 -associated proteins by RNA pull-down in A549 cells. (B) Specific association of LINC00473 RNA with NONO protein was validated through RNA pull-down followed by Western blotting analysis. LINC00473 antisense and MEG RNA were used as controls. (C) Immunoprecipitation of endogenous NONO protein was validated via Western blotting (HC, heavy chain). (D) LINC00473 was significantly enriched in NONO immune-precipitates relative to the IgG control by qRT-PCR assay. ASNS was used as a negative control, (n = 3, ***p < 0.0001). (E) Depletion of LINC00473 caused reduced CRTC1-NONO interaction. A549 cells, after the transduction with LINC00473 shRNA (shLINC00473-2 and 4) or the scramble shRNA lentiviruses (Ctl) for 72 hours, were co-transfected with Gal4-NONO, pSG5-luc (a firefly luciferase reporter containing GAL4-binding sites), pEF-RL (Renilla luciferase) as well as vector control or CRTC1. The luciferase activity was measured 24 hours after transfection (n = 3, *p < 0.05). (F) Overexpression of LINC00473 enhanced CRTC1-NONO interaction. HEK293T cells were transfected with GAL4-NONO, CRTC1, pSG5-luc, pEF-RL in the presence of vector or LINC00473 construct. The luciferase activity was determined at 24 hours after transfection. (n = 3, ***p < 0.0001). (G) Relative expression levels of LKBl -regulated genes in shLINC00473- vs. shCtl- A549 cells and in LKBl vs vector control (Ctl) A549 cells showed that LINC00473 depletion attenuated some common target gene expression induced by LKB l loss.
Figure 11. A model for the molecular basis of LINC00473 induction and the role of sustained LINC00473 expression as a potential biomarker and prognostic marker, therapeutic target, and gene regulator for LKBl -inactivated NSCLC.
Figures 12A-12C. Human lung adenocarcinomas with high LINC00473 expression were enriched with mutations in the LKBl gene coding region. (A) Expression patterns of LINC00473 and other genes in TCGA LUAD samples. Data was sorted by normalized expression value. Samples with high expression are red, samples with low expression are
green, and samples with no expression data are grey. (B) LKB1 gene-level non-silent mutations in LUAD samples. Red means that a non-silent mutation was found in the gene. White means that no such mutation was found. Gray means that the sample has no data. (C) Somatic mutation S Ps and small INDELs in LKB 1, KRAS and TP53 genes in LUAD samples. Each colored dot shows a mutation along the transcript with each line being its own sample. Red indicates that the mutation is likely to prevent a functional protein from being made (nonsense mutations, frame shift, etc). Blue indicates that the protein is likely to be made, but may have an altered function (missense mutation, etc). Green indicates that the protein is unlikely to be affected (such as synonymous).
Figures 13A-13C. Box plots show expression levels of LINC00473 (A), SIK1 (B), and LKB1 (C) genes in LKB1 mutant (Mut) and wildtype (Wt) human lung adenocarcinomas. The LUAD level 3 RNAseqv2 normalized data were downloaded from TCGA along with the Meta-Data for each patient. The RNA-seq gene expression data were combined with DNA-sequencing data to compare gene expression to LKB1 mutational status. There were 479 patients with DNA sequencing information: 402 were WT and the other 77 were LKB 1 mutant. The /?-value was generated by a two tailed, independent t-test. The data indicate that LINC00473 expression is a more significantly variant between LKB1 WT and Mutant than SIK1 or LKB 1.
Figures 14A-14E. Analysis of the correlation between LINC00473 Expression, the LKB 1 -Loss Signature, LKB1 Expression, and SIK1 Expression. (A) Correlation of LINC00473 Gene Expression to LKB 1 -Loss Signature; (B) Correlation of LINC00473 Gene Expression to LKB 1 Gene Expression; (C) Correlation of SIK1 Gene Expression to LKB1- Loss Signature; (D) Correlation of LKB 1 Gene Expression to SIK1 expression; (E) Correlation of LKB1 Gene Expression to LKB1 Loss Signature. The data indicate that LINC00473 expression is more positively correlated with the LKBl-loss signature than SIK1 expression. The data also show that LKB1 expression is more significantly inversely correlated with LINC00473 expression than that of SIKl expression and LKB1 expression is significantly inversely correlated with the LKB 1 loss signature.
Figures 15A-15C. Kaplan-Meier survival analyses showed that high LINC00473 expression, but not LKB1 mutations in the coding regions, was associated with poor prognosis. (A) LKB1 mutation status was not significantly associated with survival. The tumors in TCGA-LUAD dataset with the available data on LKB1 mutations and clinical information were analyzed. (B, C) High LINC00473 expression was associated with a poor
survival in both LKB1 wt and mutant groups. The tumors in TCGA-LUAD dataset with the available data on LINC00473 expression, LKB1 mutations, and clinical information were analyzed.
Figures 16A-16F. Knockdown of LINC00473 expression in LKBl-null human NSCLC HI 57 resulted in reduced cell growth and survival in vitro and in vivo. (A) LKB l- null human NSCLC HI 57 cells were infected with lentiviral -based LINC00473 shRNAs and the scrambled shRNA control (shCtl), respectively. Transduced cells were harvested 96 hours later, and LINC00473 expression was quantified by qRT-PCR (n=3, *p<0.05). (B, C) Transduced cells at 96 hours post-transduction were cultured at 5χ 105 per well in 6-well plates for another 96 hours and viable cell number was measured using Trypan blue assay (B) and apoptotic cells were detected by Annexin V/PI staining (C) (n=3, *p<0.05). (D, E, F) A total of 1 106 HI 57 cells after transduction with shLINC00473 or shRNA control for 72 hours were injected subcutaneously to the dorsal flanks of NOD-SCID mice (control shCtl n = 5 and shLINC00473 n = 6). The excised tumor (D) and the tumor weights (E) were shown at the end points were shown. Tumor growth was measured at different days after tumor cell injection (F) < 0.001).
Figures 17A-17C. Overexpression of LINC00473 in LKBl-wt lung human NSCLC cells increased cell proliferation and expression of several CREB target genes. (A) LKB l-wt human lung NSCLC cells (H522) were transduced with pLNCX empty vector or LINC00473 retroviruses and LINC00473 expression was confirmed by qRT-PCR (n=3, **p<0.001). (B) LINC00473 expression resulted in a moderate yet significant increase cell proliferation (n=3, *p<0.05). (C) qRT-PCR analysis showed that LINC00473 expression enhanced expression of several CREB target genes, (n = 3, *p < 0.05 and **p < 0.001.)
BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NOs: 1-2: LINC00473 sequences.
SEQ ID NO: 3: Sequence of shLINC00473-2.
SEQ ID NO: 4: Sequence of shLINC00473-3.
SEQ ID NO: 5: Sequence of shLINC00473-4.
SEQ ID NOs: 6-62 for the sequences of primers and probes. Sequences are presented in the 5' to 3' direction.
Lnc473 5 AATCAACCAAGACTGTTTCA (SEQ ID NO: 40)
Lnc473 6 GGCCGAGCATAAAGTAGTAT (SEQ ID NO: 41)
Lnc473 7 GGCAGCTACTTGCCAACAAC (SEQ ID NO: 42)
Lnc473 8 TAATCAAGGGCGCGTACAGA (SEQ ID NO: 43)
Lnc473 9 GTTAAAACACATGCAGTGGA (SEQ ID NO: 44)
Lnc473 10 TGGCCCAAATAAACGTGGAA (SEQ ID NO: 45)
Lnc473 11 ACTGGATCTTTGCAGACAGG (SEQ ID NO: 46)
Lnc473 12 GCACGTAGACTCAAATCTGT (SEQ ID NO: 47)
Lnc473 13 GTCTTTAGTACATTTCCAGG (SEQ ID NO: 48)
Lnc473 14 TTCTTTCAGCAATATGTTGT (SEQ ID NO: 49)
Lnc473 15 TCCGCTTTGCATTCAGAATA (SEQ ID NO: 50)
Lnc473 16 CCCCAAAACTGAGCACATAA (SEQ ID NO: 51)
Lnc473 17 CGTGACAATGACTAAGCCTT (SEQ ID NO: 52)
Lnc473 18 GGGCAATGGGTAAACCTTAC (SEQ ID NO: 53)
Lnc473 19 ATAGGACACTCAGCTCTCAA (SEQ ID NO: 54)
Lnc473 20 AAGTTCTTGGGCAGCAGAAG (SEQ ID NO: 55)
Lnc473 21 TGATTTCTCCAGTTACCACC (SEQ ID NO: 56)
Lnc473 22 GAGAATCCCGCACAACCAAG (SEQ ID NO: 57)
Lnc473 23 GAAAACCCGTCAGAAGGAGG (SEQ ID NO: 58)
Lnc473 24 AGTGTTCGACACAGAGTGTG (SEQ ID NO: 59)
Lnc473 25 TGTCTGCACATCGCTAATTA (SEQ ID NO: 60)
Lnc473 26 TGGCATTTTTATTCCTGTAA (SEQ ID NO: 61)
Lnc473 27 ATGAATATGACTTGGGTTCT (SEQ ID NO: 62)
DETAILED DISCLOSURE OF THE INVENTION LKBl is mutated and inactivated in a significant subset of lung cancer; however, accurate diagnostics and effective targeted therapeutics are not available for tumors involving inactivated LKBl . LncRNAs have emerged as a novel class of gene regulators and are implicated in tumorigenesis and progression. Reliable tests are needed to accurately identify tumors with loss of LKBl function for patient stratification, to evaluate therapeutic responses and to assign individualized treatments.
LncRNAs are non-protein coding transcripts longer than 200 nucleotides and represent a novel class of gene regulators. The human genome encodes more than 10,000 IncRNAs and currently only a handful of IncRNAs have been characterized. LncRNA expression is frequently de-regulated in cancer, and shows cell or tissue specificity. They participate in cancer cell proliferation, survival, migration, and invasion, likely through exerting multiple regulatory functions at the transcriptional, post-transcriptional, and epigenetic levels. Targeting cancer-associated IncRNAs, such as HOX transcript antisense RNA (HOTAIR) and metastasis-associated lung adenocarcinoma transcript 1 (MALATl),
results in inhibitory effects on cancer cell growth and survival in vitro and tumor growth and metastasis in mouse models. Therefore, IncRNAs are critical for various stages of cancer development and progression, indicating that IncRNAs are novel therapeutic targets.
The mechanisms responsible for deregulated lncRNA levels in cancers are largely unknown. Enhanced transcription of LINC00473 (identified by SEQ ID NO: 1) was observed in human NSCLC cells with loss of LKBl function (Figures 1-2). An inverse relationship was observed between LKBl and LINC00473 expression in NSCLC cells, e.g., overexpression of LKB l decreased LINC00473 expression, while LKBl depletion enhanced LINC00473 expression (Figure 3). LKBl has multiple downstream targets and LKB l negatively regulates the family of three CREB -regulated transcriptional co-activators (CRTC). LINC00473 is a CRTC/CREB target gene and its expression is up-regulated by loss of LKB l signaling: (1) LINC00473 is transiently up-regulated in response to cAMP signaling in normal cells; (2) microarray analysis revealed LINC00473 as the top target for the CRTC1-MAML2 fusion oncogene that functionally mimics the activation of CRTC co- activators for the cAMP/CREB pathway; and (3) loss of LKBl results in CRTC/CREB transcriptional activation in cancer cells. Therefore, LINC00473 can be transcriptionally up- regulated by CRTC activation upon LKBl inactivation (Figure 1A).
Accordingly, an embodiment of the invention provides assays to identify tumors with loss or reduction in LKBl function and to further understand the molecular basis for LKB l tumor suppressor and its clinical implications. The invention provides LINC00473 as a gene regulator of oncogenesis, a biomarker for LKBl -deficient tumors and an important mediator for LKB l -loss in lung cancer development and progression. Accordingly, an embodiment of the invention provides a method of treating a subject having a cancer involving loss or reduction in LKBl function, the method comprising:
(a) determining the level of LINC00473 in:
i) a test sample obtained from the subject, and
ii) optionally, a control sample;
(b) optionally obtaining a reference value corresponding to a level of LINC00473, wherein the level of LINC00473 in the test sample relative to the control sample or the reference value indicates the presence or absence of the cancer involving loss or reduction in LKBl function in the subject; and
(c) identifying the subject as having the cancer involving loss or reduction in LKB1 function based on the level of LINC00473 in the test sample and administering an effective amount of a LINC00473 inhibitor to the subject to treat the cancer, or
(d) identifying the subject as having the cancer not involving loss or reduction in LKB1 function based on the level of LINC00473 in the test sample and withholding the administration of the LINC00473 inhibitor to the subject, and optionally, administering a cancer therapy other than the LINC00473 inhibitor to the subject to treat the cancer.
Another embodiment provides assays to identify tumors with loss or reduction in LKB1 function. The invention provides LINC00473 as a gene regulator of oncogenesis, a biomarker for LKB 1 -deficient tumors and an important mediator for LKB l-loss in lung cancer development and progression. Accordingly, an embodiment of the invention provides a method of diagnosing a subject having a cancer involving loss or reduction in LKB 1 function, the method comprising:
(a) determining the level of LINC00473 in:
i) a test sample obtained from the subject, and
ii) optionally, a control sample;
(b) optionally obtaining a reference value corresponding to a level of LINC00473, wherein the level of LINC00473 in the test sample relative to the control sample or the reference value indicates the presence or absence of the cancer involving loss or reduction in LKB1 function in the subject; and
(c) identifying the subject as having the cancer involving loss or reduction in LKB1 function based on the level of LINC00473 in the test sample and guide cancer treatment.
(d) identifying the subject as having the cancer not involving loss or reduction in LKB1 function based on the level of LINC00473 in the test sample and guide cancer treatment and, optionally,
(e) identifying the subject with enhanced level of LINC00473 in the test sample and administering an effective amount of a LINC00473 inhibitor to the subject to treat the cancer. With respect to steps (c) and (d), increased levels of LINC00473 are associated with a loss or reduction in LINC00473 function. Additionally, this method can be performed by measuring LINC00473 levels of SEQ ID NO: 1, SEQ ID NO: 2 or both SEQ ID NO: 1 and SEQ ID NO: 2 in test samples and/or control samples.
As used herein, the terms "treat," "treating," or "treatment" and synonyms thereof refer to both therapeutic treatment measures, wherein the object is to slow down cancer
development and/or spread of a cancer. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms in whole or in part, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Complete absence of the cancer is not required for effective treatment.
For the purposes of the invention, the phrase "a cancer involving loss or reduction in LKBl function" refers to a cancer in which the cancer cells exhibit loss or reduction in the activity of LKBl protein. Loss or reduction in LKBl protein activity can arise from, for example, loss or reduction in LKBl gene expression, loss or reduction in LKBl mRNA translation, increased degradation of LKBl mRNA, reduced stability of LKB l mRNA, loss or reduction in LKBl protein activity, increased degradation of LKB l protein, reduced stability of LKBl protein or mutation in LKBl protein. Additional examples of molecular mechanism which can lead to loss or reduction in LKB l protein activity are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
For the purposes of the invention, the phrase "a cancer not involving loss or reduction in LKB l function" refers to a cancer in which the cancer cells exhibit LKBl protein activity which is not different than non-cancerous cells from the same tissue. In such cancers, the cancer arises from other mechanisms of carcinogenesis.
In certain embodiments, the control sample and the test sample are obtained from the same type of an organ or tissue. Non-limiting examples of the organ or tissue which can be used as samples are brain, eyes, pineal gland, pituitary gland, thyroid gland, parathyroid glands, thorax, heart, lung, esophagus, thymus gland, pleura, adrenal glands, appendix, gall bladder, urinary bladder, large intestine, small intestine, kidneys, liver, pancreas, spleen, stoma, ovaries, prostate, testis, uterus, skin, or blood. Additional examples of organs and tissues are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention. In one embodiment, a lung sample is obtained.
In certain other embodiments, the control sample and the test sample are obtained from the same type of a body fluid. Non-limiting examples of the body fluids which can be used as samples include amniotic fluid, aqueous humor, vitreous humor, bile, blood, cerebrospinal fluid, chyle, endolymph, perilymph, female ejaculate, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum,
saliva, sputum, synovial fluid, vaginal secretion, blood, serum or plasma. Additional examples of body fluids are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention. In one embodiment, pleural fluid is obtained.
For the purposes of this application, the subject is a mammal. Non-limiting examples include human, ape, canine, pig, bovine, rodent, or feline subjects. In one embodiment, the methods described herein are used to identify a human as having a cancer involving loss or reduction in LKB 1 function.
To practice the methods described herein for identifying a subject as having a cancer involving loss or reduction in LKB 1 function, control samples can be obtained from one or more of the following:
a) an individual belonging to the same species as the subject and not having cancer, b) an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKB 1 function,
c) the subject prior to having a cancer, or
d) an individual belonging to the same species as the subject and known to have a cancer involving loss or reduction in LKB 1 function. Additional examples of control samples appropriate for use in the methods described herein are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.
The term "the presence of LINC00473 relative to that of the control sample" indicates that the level of LINC00473 when compared to that of the control sample is used to identify a subject as having or not having a cancer involving loss or reduction in LKB 1 function. In one embodiment, a subject is identified as having a cancer involving loss or reduction in LKB1 function if the level of LINC00473 in a test sample is higher than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKB 1 function or the subject prior to having a cancer.
In certain embodiments, a subject is identified as having a cancer involving loss or reduction in LKB1 function if the level of LINC00473 in the test sample is about 1 to 100 times, about 5 to 80 times, or about 10 to 50 times higher than the level of LINC00473 in the control sample obtained from an individual belonging to the same species as the subject and
not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKBl function, or the subject prior to having a cancer.
In further embodiments, a subject is identified as having a cancer involving loss or reduction in LKBl function if the level of LINC00473 in the test sample is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25„ 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 times higher than the level of LINC00473 in the control sample obtained from an individual belonging to the same species as the subject and not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKBl function, or the subject prior to having a cancer.
In another embodiment, a subject is identified as having a cancer involving loss or reduction in LKBl function if the level of LINC00473 in a test sample is not different than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and known to have a cancer involving loss or reduction in LKB l function.
The term "the presence of LINC00473 relative to the reference value" indicates that the level of LINC00473 when compared to the reference value is used to identify a subject as having a cancer involving loss or reduction in LKB l function. The reference value corresponding to the level of LINC00473 can indicate the level of LINC00473 associated with the absence of a cancer, the presence of a cancer not involving loss or reduction in LKBl function or the presence of a cancer involving loss or reduction in LKB l function. As such, the reference values corresponding to the level of LINC00473 may be indicative of the absence of a cancer, the presence of a cancer not involving loss or reduction in LKB l function or the presence of a cancer involving loss or reduction in LKBl function.
A reference value associated with absence of a cancer may be obtained based on the level of LINC00473 in the samples obtained from individuals known to have the absence of cancer. A reference value associated a cancer not involving loss or reduction in LKB l function may be obtained based on the level of LINC00473 in the individuals known to have a cancer not involving loss or reduction in LKBl function. A reference value associated with a cancer involving loss or reduction in LKBl function may be obtained based on the level of LINC00473 in the samples obtained from individuals known to a cancer involving loss or reduction in LKB 1 function.
For example, tissues from a group of healthy individuals can be obtained and LINC00473 level can be determined which indicates a reference value associated with the absence of a cancer. Similarly, tissues from individuals known to have a cancer not involving loss or reduction in LKB1 function can be obtained and LINC00473 level can be determined which indicates a reference value associated with the presence of a cancer not involving loss or reduction in LKB1 function. Further, tissues from individuals known to have a cancer involving loss or reduction in LKB 1 function can be obtained and LINC00473 level can be determined which indicates a reference value associated with the presence of a cancer involving loss or reduction in LKB1 function. Additional examples of determining references values associated with the absence of cancer, presence of a cancer not involving loss or reduction in LKB1 function or presence of a cancer involving loss or reduction in LKB1 function are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
Based on the reference value used and the level of LINC00473 in a test sample, a subject can be identified as having a cancer involving a loss or reduction in LKB1 function. For example, a subject is identified as having a cancer involving loss or reduction in LKB 1 function if the level of LINC00473 in the test sample is higher than the reference value corresponding to a cancer not involving loss or reduction in LKB1 function. Alternately, a subject is identified as having a cancer involving loss or reduction in LKB1 function if the level of LINC00473 in the test sample is not different than the reference value corresponding to a cancer involving loss or reduction in LKB1 function.
The step of determining the level of LINC00473 can be performed by a variety of techniques well-known to a person of ordinary skill in the art. In an embodiment, the step of determining the level of LINC00473 comprises contacting the sample with selective reagents such as probes, primers or ligands, and thereby detecting the presence, or measuring the amount, of nucleic acids of interest originally in the sample. Contacting may be performed in any suitable device, such as a plate, microtiter dish, test tube, well, glass, column, and so forth.
In one embodiment, the contacting is performed on a substrate coated with the reagent, such as a nucleic acid array or chip or a specific ligand array. The substrate may be a solid or semi-solid substrate such as any suitable support comprising glass, plastic, nylon, paper, metal, polymers and the like. The substrate may be of various forms and sizes, such as a slide, a membrane, a bead, a column, a gel, etc. The contacting may be made under any
condition suitable for a detectable complex, such as a nucleic acid hybrid or an antibody- antigen complex, to be formed between the reagent and the nucleic acids or proteins of the sample.
In a preferred embodiment, the expression level may be determined by determining the quantity of mRNA. Methods for quantifying mRNA are well known in the art. The test sample and optionally, the control sample, can be appropriately treated for producing of a RNA preparation used in the contacting step. For example, a sample can be homogenized and proteins and DNA can be removed from the sample, for example, through degradation or precipitation, to purify RNA from the sample. Various techniques of isolating RNA from a sample are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.
LINC00473 contained in the samples (e.g., cell or tissue prepared from the patient) can be detected by hybridization (e. g, Northern blot analysis, RNA in situ hybridization) and/or amplification (e.g., reverse transcriptase-polymerase chain reaction (RT-PCR)). Preferably quantitative or semi -quantitative RT-PCR and RNA hybridization are preferred since they are particularly advantageous. Other methods of amplification include ligase chain reaction (LCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA).
Nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to LINC00473 find utility as hybridization probes or amplification primers. It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-95% identical. In certain embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization. A wide variety of appropriate indicators are known in the art including, fluorescent, radioactive, and enzymatic or other labels (e.g., avidin/biotin).
Probes typically comprise single-stranded nucleic acids of between 10 to 200 nucleotides in length, for instance of between 10 and 100, more preferably of between 15 and 80, typically of between 20 and 25. Primers typically are shorter single-stranded nucleic acids, of between 10 to 25 nucleotides in length, designed to perfectly or almost perfectly match a nucleic acid of interest, to be amplified, i.e., LINC00473. The probes and primers are "specific" to the nucleic acids to which they hybridize, i.e. they preferably hybridize under high stringency hybridization conditions (corresponding to the highest melting
temperature Tm, e.g., 50 % formamide, 5x or 6x SCC. SCC is a 0.15 M NaCl, 0.015 M Na- citrate).
The nucleic acid primers or probes used herein may be assembled as a kit. Such a kit includes consensus primers and molecular probes. A preferred kit also includes the components necessary to determine if amplification has occurred. The kit may also include, for example, PCR buffers and enzymes; positive control sequences, reaction control primers; and instructions for amplifying and detecting the specific sequences.
In another preferred embodiment, the expression level is determined by DNA chip analysis. Such DNA chip or nucleic acid microarray consists of different nucleic acid probes that are chemically attached to a substrate, which can be a microchip, a glass slide or a microsphere-sized bead. A microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose. Probes comprise nucleic acids such as cDNAs or oligonucleotides that may be about 10 to about 60 base pairs. To determine the level of LINC00473, a sample from a test subject, optionally first subjected to a reverse transcription, is labelled and contacted with the microarray under hybridization conditions, leading to the formation of complexes between target nucleic acids that are complementary to probe sequences attached to the microarray surface. The labelled hybridized complexes are then detected and can be quantified or semi- quantified. Labelling may be achieved by various methods, e.g. by using radioactive or fluorescent labelling. Many variants of the microarray hybridization technology are available to the man skilled in the art (see, for example, the review by Hoheisel, 2006).
If a subject is identified as having a cancer involving loss or reduction in LKB function or having a cancer with high LINC00473 expression, a LINC00473 inhibitor is administered to the subject to treat the cancer. For the purposes of this invention, the terms "LINC00473 inhibitor" or "inhibitor of LINC00473" refers to an agent capable of inhibiting the expression and/or activity of LINC00473. The LINC00473 inhibitor can be an siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme, aptamer or small molecule inhibitor.
The sequence of siRNA, shRNA, a bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme or aptamer as the LINC00473 inhibitor can be designed based on the sequence of LINC00473 provided in SEQ ID NO: 1. Certain examples of computer programs which can be used to design LINC00473 inhibitor based on the sequence of LINC00473 are provided in Naito et al. The Naito et al. reference is incorporated herein in
its entirety. Additional examples of computer programs which can be used to design LINC00473 inhibitor based on the sequence of LINC00473 are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
Certain examples of inhibitors of non-coding RNAs (ncRNAs), for example, inhibitors of lincRNAs, are provided in Ling et al. and Li et al. The Ling et al. reference is incorporated herein by reference in its entirety, particularly, page 859, under "IncRNAs in cancer and therapeutic implications" to the end of page 862. The Li et al. reference is also incorporated herein by reference in its entirety, particularly, page 1902, right column, under "Prospective strategies for targeting IncRNAs" to the end of page 1907.
In one embodiment, the inhibitor of LINC00473, for example, an siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme or aptamer is encoded by a nucleic acid vector. Accordingly, an embodiment of the invention provides a vector comprising a LINC00473 inhibitor.
In another embodiment, the LINC00473 inhibitor encoded by a nucleic acid is introduced to a subject via gene therapy. For example, the vector encoding the LINC00473 inhibitor encoded by a nucleic acid vector can be introduced specifically in to the cancer cells of a subject.
Examples of viral vectors and procedures for gene therapy using the viral vectors are described in Waehler et al. The Waehler et al. reference is incorporated herein in its entirety. Examples of non-viral vectors and procedures for gene therapy using the non-viral vectors are described in Yin et al. The Yin et al. reference is incorporated herein in its entirety. Certain examples of introducing nucleic acid inhibitors of a target nucleotide are provided in Ling et al., particularly, page 855, under "Restoring miRNA levels with oligonucleotide- based approaches" to the end of page 857. Additional examples of techniques used to introduce a nucleic acid inhibitor of LINC00473 in to cancer cells via gene therapy are provided in Amer and such embodiments are within the purview of the invention. The Amer reference is also incorporated herein in its entirety, particularly, page 2, under Method of Gene Therapy to page 6, right column, first paragraph.
A small molecule LINC00473 inhibitor can be obtained based on a screening of a compound library to identify specific compounds as LINC00473 inhibitor. Description of small molecule inhibitors of specific target oligonucleotides are provided in in Ling et al., for example, page 858, under Small molecules targeting miRNAs and Li et al., page 1905, under small molecules continuing on to page 1906.
A further an embodiment of the invention provides a pharmaceutical composition comprising a LINC00473 inhibitor. The pharmaceutical composition can be used for the treatment of a cancer, for example, a cancer involving loss or reduced LKB 1 function.
Pharmaceutical compositions, as disclosed herein, can be formulated in accordance with standard pharmaceutical practice known by a person skilled in the art (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York).
Compositions for parenteral administration are generally physiologically compatible sterile solutions or suspensions which can optionally be prepared immediately before use from solid or lyophilized form. Adjuvants such as a local anesthetic, preservative and buffering agents can be dissolved in the vehicle and a surfactant or wetting agent can be included in the composition to facilitate uniform distribution of the active ingredient.
For oral administration, the composition can be formulated into conventional oral dosage forms such as tablets, capsules, powders, granules and liquid preparations such as syrups, elixirs, and concentrated drops. Non toxic solid carriers or diluents may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, magnesium, carbonate, and the like. For compressed tablets, binders, which are agents which impart cohesive qualities to powdered material, may also be necessary. For example, starch, gelatin, sugars such as lactose or dextrose, and natural or synthetic gums can be used as binders.
Disintegrants may also be necessary in the tablets to facilitate break-up of the tablet. Disintegrants include starches, clays, celluloses, algins, gums and crosslinked polymers. Moreover, lubricants and glidants are also included in the tablets to prevent adhesion to the tablet material to surfaces in the manufacturing process and to improve the flow characteristics of the powder material during manufacture. Colloidal silicon dioxide is most commonly used as a glidant and compounds such as talc or stearic acids are most commonly used as lubricants.
For transdermal administration, the composition can be formulated into ointment, cream or gel form and appropriate penetrants or detergents could be used to facilitate permeation, such as dimethyl sulfoxide, dimethyl acetamide and dimethylformamide.
For transmucosal administration, nasal sprays, rectal or vaginal suppositories can be used. The LINC00473 inhibitor can be incorporated into any of the known suppository bases
by methods known in the art. Examples of such bases include cocoa butter, polyethylene glycols (carbowaxes), polyethylene sorbitan monostearate, and mixtures of these with other compatible materials to modify the melting point or dissolution rate. In a particular embodiment, the method of treating lung cancer comprises administering to a subject in need thereof, a composition comprising LINC00473 inhibitor via inhalation.
Compositions of the invention appropriate for administration via inhalation can be a solution, suspension, or powder. These formulations are typically administered via an aerosol or a dry powder inhaler. Aerosol is a colloidal suspension of particles dispersed in air or gas. In aerosols, liquid or suspension droplets are the internal phase and a gas is the external phase.
In one embodiment, an aerosol delivery device is used to administer the compositions of the invention. An aerosol delivery device is used to produce aerosols, for example, for delivery to a subject via inhalation. Metered dose inhalers (MDI) are aerosol delivery devices that deliver a fixed dose in a spray with each actuation of the device.
In certain embodiments, atomizers, nebulizers, or vaporizers are used as aerosol delivery devices. Additional examples of aerosol delivery devices are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.
Atomizers break up a liquid into an aerosol. Typically, an atomizer comprises a squeeze bulb which is used to blow air into the device causing the drug solution to rise in a small dip tube and vaporizing in the air stream. The air stream is directed into a baffle or bead which breaks the droplets in to even smaller droplets as they collide with the device. The mixture of air and liquid then exits the atomizer in the form of an aerosol.
A nebulizer contains an atomizing unit within a chamber. When the rubber bulb is depressed, the medication solutions is drawn up a dip tube and aerosolized by the passing air stream. Baffles or beads may also be present in the chamber. The fine droplets exit the nebulizer. The larger droplets collect on the chamber and fall back into the reservoir where they can be used again. Vaporizers produce a fine mist of steam. Volatile medication is added to the water in the vaporizer or to a special medication cup present in some models. The medication volatilizes and is inhaled by a patient as he/she breathes.
In one embodiment, the composition is a dry powder and the inhalers contain the dry powders in cartridges or disks. When a patient administers a dose, the device is first activated by some mechanical motion and the dry powder becomes ready for inspiration. The
patient then inhales through the device mouthpiece and the powder is drawn into the pulmonary tract along with the inspired air. These devices have overcome a major problem of inhalation therapy, synchronizing deep inspiration with the administration of the drug. Some of the commercially available devices are Diskhaler®, Turbuhaler®, Diskus®, and Rotahaler®.
In a further embodiment, a powdered composition is administered with insufflators or puffers. Squeezing the rubber bulb of an insufflator causes turbulence within the powder reservoir which forces some of the powder into the air stream and out of the device. A puffer is a plastic accordion-shaped container with a spout on one end. The powder is placed inside the container and the puffer is actuated by squeezing the device. A portion of the powder is ejected from the spout.
Additional devices appropriate for administration of the composition of the claimed invention via inhalation are well known to a person of ordinary skill in the art and such embodiments are within the purview of the invention. For example, Advanced Drug Delivery Reviews (2014), Volume 75, Pages 1-148 contains several articles directed to "Improving the efficacy of inhaled drugs for severe lung diseases: emerging pulmonary delivery strategies." The contents of these articles are herein incorporated by reference in their entirety, particularly, Angelo et al., "Improving the efficacy of inhaled drugs in CF: Challenges and emerging drug delivery strategies." Certain devices and methods for delivery of therapeutic substances via inhalation are also described "A Guide to Aerosol Delivery Devices for Respiratory Therapists, 3rd Edition (2013)" published by American Association for Respiratory Care, the contents of which are incorporated herein by reference in their entirety.
In one embodiment, the LINC00473 inhibitor is formulated in a composition wherein the LINC00473 inhibitor is specifically delivered to the cancer cells in the subject. Examples of specifically delivering an agent to target cells, for example, target cancer cells are described in the Erkki Ruoslahti et al. (2010) reference which is incorporated herein by reference in its entirety.
The LINC00473 inhibitor according to the present invention may be administered in effective amount to a subject in one or more "unit doses." Unit dose is defined as containing a predetermined-quantity of the therapeutic composition calculated to produce the desired responses upon administration to a subject, i.e., the appropriate route and treatment regimen. A quantity to be administered and a route of administration can be determined by a person of
ordinary skill in the art depending upon the LINC00473 inhibitor to be administered and the status of cancer in a subject. For example, the subject to be treated may be evaluated, in particular, for the state of the subject's cancer, subjects overall health, age and desired aggressiveness of the therapy. Unit dose of the LINC00473 inhibitors may be described in terms of mg LINC00473 inhibitor per Kg of body weight, which can be about 0.05, 0.10, 0.15, 0.20, 0.25, 0.5, 1, 10, 50, 100, 1,000, or more.
A unit dose may be administered as a single dose or may be provided via multiple administrations over a predetermined period of time, for example, about one month to about six months, about two months to about five months, or about three to four months.
The term "effective amount" in connection with the LINC00473 inhibitor means an amount capable of alleviating symptoms of a cancer in whole or in parts, diminishment of extent of cancer, stabilized (i.e., not worsening) state of cancer, delaying or slowing of cancer progression, amelioration or palliation of the cancer state, and remission (whether partial or total), whether detectable or undetectable. Complete absence of the cancer may not be achieved by an effective amount of LINC00473 inhibitor.
LINC00473 inhibitor can be administered via different routes of administration. Non- limiting examples of routes of administration include oral, subcutaneous, intradermal, intravenous, intra-arterial, intratumoral, intraperitoneal, inhalation and intramuscular.
In a further embodiment of the invention, the LINC00473 inhibitor is administered to a subject identified as having a cancer involving loss or reduction in LKB1 function in combination with one or more additional cancer therapies. The additional cancer therapy can be selected from radiotherapy, chemotherapy, surgery, immunotherapy, kinase inhibition, monoclonal antibody therapy (e.g., bevacizumab or cetuximab) or a combination thereof. A cancer therapy in addition to the LINC00473 inhibitor to be administered can be determined by a person of ordinary skill in the art depending upon the status of cancer in a subject, for example, the subject to be treated may be evaluated, in particular, for the state of the subject's cancer, subjects overall health, age and desired aggressiveness of the therapy.
Non-limiting examples of the additional cancer therapy or the cancer treatments other than a LINC00473 inhibitor include, but are not limited to, administering one or more of: Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afinitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed
Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Aminolevulinic Acid, Anastrozole, Aprepitant, Arimidex (Anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Avastin (Bevacizumab), Axitinib, Azacitidine, BEACOPP, Bendamustine Hydrochloride, BEP, Bevacizumab, Bexarotene, Bexxar (Tositumomab and I 131 Iodine Tositumomab), Bleomycin, Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Cabazitaxel, Cabozantinib-S-Malate, CAF, Campath (Alemtuzumab), Camptosar (Irinotecan, ydrochloride), Capecitabine, CAPOX, Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, CeeNU (Lomustine), Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar (Clofarabine), CMF, Cometriq (Cabozantinib-S- Malate), COPP, Cosmegen (Dactinomycin), Crizotinib, CVP (COP), Cyclophosphamide, Cyfos (Ifosfamide), Cytarabine, Cytarabine, Liposomal, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dacarbazine, Dacogen, (Decitabine), Dactinomycin, Dasatinib, Daunorubicin Hydrochloride, Decitabine, Degarelix, Denileukin, diftitox, Denosumab, DepoCyt (Liposomal Cytarabine), DepoFoam (Liposomal Cytarabine), Dexrazoxane hydrochloride, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC-Dome (Dacarbazine), Efudex (Fluorouracil), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista (Raloxifene Hydrochloride), Exemestane, Fareston (Toremifene), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil), Fluorouracil, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine, ydrochloride), Gleevec (Imatinib Mesylate), Glucarpidase, Halaven (Eribulin Mesylate), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV
Quadrivalent Vaccine (Recombinant), Hycamtin (Topotecan Hydrochloride), Ibritumomab Tiuxetan, ICE, Iclusig (Ponatinib Hydrochloride), Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), Imatinib Mesylate, Imiquimod, Inlyta (Axitinib), Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Istodax (Romidepsin), Ixabepilone, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), Jevtana (Cabazitaxel), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Kyprolis (Carfilzomib), Lapatinib Ditosylate, Lenalidomide, Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Levulan (Aminolevulinic (Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Liposomal Cytarabine, Lomustine, Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lupron Depot-3 Month (Leuprolide Acetate), Lupron Depot-4 Month (Leuprolide Acetate), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Mexate (Methotrexate), Mexate-AQ (Methotrexate), Mitomycin C, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine hydrochloride), Mutamycin (Mitomycin C), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Nelarabine, Neosar (Cyclophosphamide), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilotinib, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Ofatumumab, Omacetaxine, Mepesuccinate, Oncaspar (Pegaspargase), Ontak (Denileukin Diftitox), Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, Palifermin, Palonosetron Hydrochloride, Panitumumab, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, Pegaspargase, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Ponatinib Hydrochloride, Pralatrexate, Prednisone, Procarbazine Hydrochloride, Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Provenge (Sipuleucel-T), Raloxifene hydrochloride, Rasburicase, R-CHOP, R-CVP, Recombinant HPV Bivalent Vaccine, Recombinant HPV, Quadrivalent Vaccine, Regorafenib, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Rituxan (Rituximab), Rituximab, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Ruxolitinib Phosphate, Sclerosol Intrapleural Aerosol (Talc), Sipuleucel-T, Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent
(Sunitinib Malate), Synovir (Thalidomide), Synribo (Omacetaxine Mepesuccinate), Talc, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel), Taxotere (Docetaxel), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Toposar (Etoposide), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and I 131 Iodine Tositumomab, Totect (Dexrazoxane Hydrochloride), Trastuzumab, Treanda (Bendamustine Hydrochloride), Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Vandetanib, VAMP, Vectibix (Panitumumab), VelP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, VePesid (Etoposide), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, Vismodegib, Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELOX, Xgeva (Denosumab), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Zaltrap (Ziv-Aflibercept), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-Aflibercept, Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), and Zytiga (Abiraterone Acetate).
The methods of current invention can be practiced to identify subjects having a cancer involving loss or reduction in LKB1 function, and optionally, for treating cancer, wherein the cancer is selected from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, cerebellar astrocytoma, basal cell carcinoma, bile duct cancer, extrahepatic bladder cancer, bladder cancer, bone cancer, osteosarcoma and malignant fibrous histiocytoma, brain stem glioma, brain tumor, central nervous system embryonal tumors, cerebral astrocytoma/malignant glioma, ependymoblastoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma, visual pathway and hypothalamic glioma, brain and spinal cord tumors, breast cancer, bronchial tumors, Burkitt lymphoma, carcinoid tumor, gastrointestinal cancer, carcinoma of head and neck, central nervous system embryonal tumors, central nervous system lymphoma, cervical cancer, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colorectal cancer, cutaneous T-cell lymphoma, embryonal tumors, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, ewing
family of tumors, extracranial germ cell tumor, extrahepatic bile duct cancer, eye Cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), extracranial germ cell tumor, germ cell tumor, extragonadal germ cell tumor, ovarian, gestational trophoblastic tumor, glioma, brain stem glioma, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, intraocular melanoma, islet cell tumors (endocrine pancreas), Kaposi sarcoma, kidney (renal cell) cancer, kidney cancer, laryngeal cancer, chronic lymphocytic leukemia, chronic leukemia, myelogenous leukemia, lip and oral cavity cancer, lung cancer, non-small cell lung cancer, small cell lymphoma, AIDS-related lymphoma, Burkitt lymphoma, cutaneous T-cell lymphoma, non-Hodgkin lymphoma, macroglobulinemia, Waldenstrom macroglobulinemia, malignant fibrous histiocytoma of bone and osteosarcoma, medulloblastoma, medulloepithelioma, melanoma, intraocular Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma/plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myelogenous leukemia, multiple myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Small cell lung cancer, oral cancer, oral cavity cancer, lip and oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, pancreatic cancer, islet cell tumors, papillomatosis, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal parenchymal tumors of intermediate differentiation, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, breast cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal pelvis and ureter cancer, transitional cell cancer, respiratory tract carcinoma involving the NUT gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Ewing family of tumors sarcoma, Kaposi Sarcoma, soft tissue sarcoma, uterine Sezary syndrome, skin cancer (nonmelanoma), skin carcinoma, Merkel cell, small cell lung cancer, small intestine cancer, squamous cell carcinoma, squamous neck cancer with occult primary cancer, supratentorial primitive neuroectodermal tumors, T-cell lymphoma, testicular cancer, throat cancer,
thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer of the renal pelvis and ureter, gestational trophoblastic tumor, carcinoma of unknown primary site, urethral cancer, uterine cancer, endometrial uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, vulvar cancer, and Wilms tumor.
In certain embodiments, the methods of current invention can be practiced to identify subjects having a cancer involving loss or reduction in LKBl function, and optionally, for treating cancer, wherein the cancer is non-small cell carcinoma, squamous cell carcinoma, large cell carcinoma, mucoepidermoid carcinoma, bronchioloalveolar adenocarcinoma, mixed adenosquamous carcinoma or undifferentiated carcinoma.In a specific embodiment, the methods of current invention are practiced to identify subjects having a cancer involving reduction or loss of LKBl function and optionally, for treating a lung cancer, for example, NSCLC.
In one embodiment, a subject is identified as having a cancer not involving loss or reduction in LKB l function. In one embodiment, a subject is identified as having a cancer not involving loss or reduction in LKBl function if the level of LINC00473 in a test sample is not different than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and not having cancer, an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKBl function or the subject prior to having a cancer.
In another embodiment, a subject is identified as having a cancer not involving loss or reduction in LKBl function if the level of LINC00473 in a test sample is lower than the level of LINC00473 in a control sample obtained from an individual belonging to the same species as the subject and known to have a cancer involving loss or reduction in LKBl function.
A subject can also be identified as having a cancer not involving a loss or reduction in LKBl function based on the reference value used and the level of LINC00473 in a test sample. For example, a subject is identified as having a cancer not involving loss or reduction in LKB l function if the level of LINC00473 in the test sample is not different than the reference value corresponding to a cancer not involving loss or reduction in LKB l function. Alternately, a subject is identified as having a cancer not involving loss or reduction in LKBl function if the level of LINC00473 in the test sample is lower than the reference value corresponding to a cancer involving loss or reduction in LKB 1 function.
In a further embodiment of the invention, if a person is identified as having a cancer not involving a loss or reduction in LKBl function, a cancer therapy other than the
LINC00473 inhibitor is administered to the subject to treat the cancer. The additional cancer therapies discussed above in connection with cancer therapies in combination with the LINC00473 inhibitor can be administered without the LINC00473 inhibitor to a person is identified as having a cancer not involving a loss or reduction in LKB 1 function. An appropriate cancer therapy to be administered to a subject can be determined by a person of ordinary skill in the art depending upon the status of cancer in the subject, for example, the subject to be treated may be evaluated, in particular, for the state of the subject's cancer, subjects overall health, age and desired aggressiveness of the therapy. MATERIALS AND METHODS
LncRNA microarray analysis
Total RNA was extracted from A549 cells after the transduction of wildtype LKB1, LKB1 K78I mutant, or control retroviruses for 96 hours and two biological replicates were set up. Total RNA was subjected to human IncRNA expression microarray (V3.0) analyses (Array Star, Rockville, MA). The microarray data were deposited in NCBI Gene Expression Omnibus (GEO: GSE73414). Genes with an absolute fold change of > 2 and p-value < 0.05 were considered as significantly differentially expressed.
Nanostring nCounter gene expression analysis
Nanostring gene expression assay analyses were performed according to the manufacture's protocols (Nanostring Technologies, Seattle, WA) using customized nCounter GX CodeSet. Total RNA from cultured cells (100 ng) or RNA from FFPE tissues (150-200 ng) was hybridized with the specific capture probes and barcoded reporter probes at 65 °C for 18 hours and then loaded into the nCounter Pre-station for purifying the hybridized probes. Data collection was performed on the nCounter Digital Analyzer that counted and tabulated the individual fluorescent barcodes for target RNA molecules in each samples following the manufacturer's instructions. The raw data were analyzed with nSolver™ Analysis Software for gene expression analysis. The heatmap was generated with Heatmap.2 R package using the normalized Nanostring expression data.
RNAscope In situ hybridization (RNA ISH)
RNA ISH was performed on FFPE xenograft tumors and tissue microarrays (TMAs) using RNAscope® 2.0 HD Reagent Kit [BROWN 310033 or RED 310034, Advanced Cell
Diagnostics (ACD), Hayward, CA]. Briefly, tissue sections were deparaffinized with xylene and 100% ethanol and incubated with pretreat-1 solution for 10 minutes, pretreat-2 for 15 minutes, and pretreat-3 for 30 minutes (Pretreatment kit 310020, ACD). The slides were then hybridized with a custom probe Hs-LINC00473-tvl (targeting 781-1755 of R_026860.1) in the HybEZ oven (ACD) at 40°C for 2 hours. The Hs-PPIB probe for human housekeeping gene PPIB was used as a control to ensure RNA quality. After hybridizations, slides were subjected to signal amplification using HD 2.0 detection Kit, and hybridization signal was detected using a mixture of solutions A and B (1 :60). After counterstaining with hematoxylin, slides were dried in a 60°C dry oven for 15 minutes and mounted with Ecomount (BioCare Medical, EM897L). The stained sections were scanned and digitized with Aperio Imagescope (Leica, Bannockburn, IL).
RNA- Fluorescence in situ hybridization (RNA-FISH)
RNA-FISH was performed using LINC00473 Stellaris® FISH probes labeled with Quasar 570 (Biosearch Technologies, Petaluma, CA) following the manufacturer's protocol. Imaging was performed immediately using Leica DM6000B fluorescence microscope (Bannockburn, IL).
Proteomic analysis of the LINC00473-associated protein complex
LncRNA was first transcribed in vitro using the MEGAscript® T7 Transcription Kit
(AM1333, Life Technologies) according to the manufacturer's instructions. Identification of lncRNA interacting protein complexes was performed as previously described with modifications (55, 55). Briefly, RNAs were covalently linked to adipic acid dihydrazide agarose beads by periodate oxidation of RNA 3'-OH terminus. The beads bound with RNAs were incubated with nuclear extracts of A549 cells to pull down the IncRNA-interacting proteins. After extensive washing, beads were boiled with a loading buffer to elute the IncRNA-interacting proteins, which were further separated by SDS-PAGE and subjected to mass spectrometric analysis. Mouse xenograft studies
Luciferase-expressing A549 cells or HI 57 cells infected with control shRNA or shLINC00473 lentiviruses were subcutaneously injected to NOD/SCID mice (Jackson
Laboratory, Bar Harbor, ME). Tumors were measured and bioluminescence imaging was performed as previously described.
Analysis of RNA sequencing and clinical data
RNA sequencing data from the lung adenocarcinoma (LUAD) dataset of The Cancer
Genome Atlas (TCGA) sequencing project and the accompanying clinical data were used for analysis. Normalized read counts (RSEM) for each LUAD sample aligned to LINC00473 were obtained and used for the survival curve analysis. All LUAD samples with > 90th percentile of LINC00473 expression and those with < 90th percentile were considered as high and low groups, respectively. The overall survival was analyzed by Kaplan-Meier curves and log-rank test for all LUAD patients, ^-values of < 0.05 were considered statistically significant.
Statistical analyses
Data from real-time PCR, reporter assay, cell proliferation, apoptosis and in vivo xenograft experiments were analyzed using Student's t-test. Results were expressed as mean and standard deviation (± s.d.) and a p < 0.05 was considered statistically significant. The biological replicates for each experiment were indicated in the figure legends. All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
Following are examples which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
EXAMPLE 1 - A NANOSTRING ASSAY TO ASSESS LINC00473 AS A BIOMARKER
FOR LKB1 STATUS
Nanostring assay is based on direct digital detection of mRNA molecules of interest using target-specific, color-coded probe pairs. Because Nanostring probes recognize small target regions (~100bp) and no enzymes are involved, nanostring assays have been successfully used in gene expression quantification in formalin-fixed paraffin embedded (FFPE) tumor samples in which RNA is frequently degraded, in contrast with RT-PCR or
microarray analysis that requires good quality RNA. Such assays are valuable because of a large collection of FFPE tumors in Biobanks is available and because these assays are rapid, reproducible and cost-effective. The first Nanostring-based Breast Cancer Assay for assessing a patient's risk of distant recurrence of disease was approved by the FDA in 2014. Moreover, FDA-approved IncRNA PCA3 assay indicates clinical potential of IncRNA. A Nanostring-based IncRNA test for assessing LINC00473 expression as a surrogate marker for the LKB 1 status is provided. This assay offers several advantages:
(1) LINC00473 expression is a functional readout of the LKB 1 status and will be superior to testing LKB1 gene mutation or protein level. LKB1 inactivation can result from mutations across the entire LKB1 gene, or epigenetic silencing, or post-translational inactivation, posing a challenge to detect LKB1 mutations through direct genomic sequencing and to predict their functional consequences.
(2) A significant number of LKBl-wt stromal cells within tumors can obscure detection of LKBl-null tumor cells in LKB 1 Western blotting and immunohistochemistry (THC) studies. Since LINC00473 normally expresses at a low level but shows a significant high expression in LKBl-null cells, the measurement is not affected by the presence of stromal cells.
(3) The assay requires minimal hands-on time and runs on NanoString nCounter System, which is rapid and reproducible in clinical laboratories. It provides quantitative expression scores, likely reflecting the degree of LKB 1 functional impairment. In contrast, tumor IHC requires manual scoring due to variable levels of IHC staining. Therefore, nanostring assay provides a useful test for scoring LKB 1 -inactivated tumors.
EXAMPLE 2 - A NANOSTRING ASSAY TO IDENTIFY LKB 1 -INACTIVATED
TUMORS BASED ON LINC00473 UPREGULATION
A nanostring-based assay for classifying LKBl-inactivacted tumors is provided. Nanostring technology allows simultaneous detection of multiple genes and a Codeset have been designed and synthesized. This Codeset includes a library of probes targeting 40 LKB 1 -regulated genes, including, for example, LINC00473, AGR2, SMOC1, NR4A1-3, CPS1, PPARGCIA, PDE10A, TFF1, etc., LKB1 and one or more internal control genes, for example, GAPDH, GUSB, PGK1, TUBB. The selection of the LKB 1 -regulated coding genes was based on a published dataset (GSE51266) that used Affymetrix human gene 1.1 ST Array (which does not include probes for LINC00473). Though their expressions seem
only partially correlated with LKB1 mutational status in a panel of NSCLC cell lines, the data from the Nanostring assays can help establish a correlation of LKB 1 -inactivated lung cancer cells with one or more LKB 1 -regulated genes. Each target gene can be detected using a pair of reporter and capture probes carrying 50-base target-specific sequences and each barcode specifically represents a single target molecule. The assay involves the steps of: hybridization, purification, immobilization, and digital data acquisition by Nanostring nCounter. 100 ng of RNA per sample can be tested initially. Gene expression is measured by counting the number of times the color-coded barcode for that gene is detected, and the barcode counts are then tabulated and analyzed.
Initial validation using human lung tumor specimens is performed. Based on a power analysis of the pilot experiment, a sample size of 9 matched tumor/normal pairs can have 95% power to reach the similar observed difference as that of the pilot study. Therefore, 10 LKBl-wt and 10 LKB 1 -null human lung adenocarcinoma samples and their matching tumor- adjacent normal tissues (both frozen and FFPE samples) can be analyzed. An initial cutoff score and assay sensitivity and specificity can be determined using the described approaches.
LKB 1 -null cell lines express highly increased, yet variable LINC00473 expression levels that might be due to co-existing mutations or other mechanisms and hence, the cutoff score are carefully evaluated. The data can provide the predictive value of LINC00473 as a surrogate marker for LKB 1 inactivation, as well as guiding subsequent validation studies. A large cohort of human lung tumors can be used to perform validation of LKB 1 mutational status based on LINC473 expression.
EXAMPLE 3 - GENOME-WIDE LNCRNA PROFILING IDENTIFIED LINC00473 AS A
TOP LKB1 SIGNALING-REGULATED LNCRNA IN NSCLC CELLS LncRNA involvement in altered LKB1 signaling in lung cancer is currently unknown.
To investigate whether IncRNAs contribute to loss of LKB1 tumor suppression in lung tumorigenesis and maintenance, genome-wide IncRNA transcriptional profiling was performed to identify IncRNAs associated with aberrant LKB1 signaling. Three groups of cells were generated by transducing LKB 1 -null A549 NSCLC cells with retroviruses harboring wild-type (wt) LKB 1, LKB1 kinase-dead mutant (K78I), or vector control (Ctl). Western blotting analysis confirmed the expression and kinase activity of LKBl-wt and - K78I proteins in an AMPK activation assay under glucose-free culture conditions (Figures 5A). Arraystar Human LncRNA Expression Microarrays were used to profile changes in the
expression of -30,000 IncRNAs in three experimental conditions. Using an absolute fold change > 2.0 and a p-va\ue < 0.05, 164 differentially expressed IncRNAs were identified (64 up-regulated and 100 down-regulated) in A549 cells upon LKBl-wt expression compared to control (Figure 5B, Table 1).
ASHGA5P048909 ENST00000568297 RP11-386M24.6 -3.12 0.00997
ASHGA5P038205 NR 033947 LIMD1-AS1 -3.12 0.03420
ASHGA5P043207 TCONS 00018388 XLOC 008668 -3.11 0.02634
ASHGA5P045599 TCONS 00002581 XLOC 001195 -3.09 0.02916
ASHGA5P032042 ENST00000568947 AC137934.1 -3.05 0.04090
ASHGA5P047720 ENST00000433085 RP11-383C6.2 -3.04 0.03970
ASHGA5P021076 ENST00000524512 RP 11-6013.4 -3.03 0.03021
ASHGA5P042171 NR 026861 LINC00473 -2.93 0.02140
ASHGA5P049614 ENST00000582184 RP11-640N20.1 -2.93 0.04547
ASHGA5P027993 ucOOldzn. l BC069739 -2.84 0.00828
ASHGA5P036158 uc002tte.3 BX648270 -2.81 0.04173
ASHGA5P032729 ENST00000575085 RP13-638C3.3 -2.79 0.02690
ASHGA5P053420 ENST00000443799 GAS5 -2.77 0.04272
ASHGA5P057723 TCONS 00021137 XLOC 009763 -2.76 0.01660
ASHGA5P034881 ENST00000340444 AC010969.1 -2.67 0.02171
ASHGA5P032021 ENST00000565150 RP11-566K11.5 -2.66 0.01226
ASHGA5P041101 ENST00000576302 CTD-2031P19.5 -2.65 0.00780
ASHGA5P029364 ucOOlynv. l AX746968 -2.61 0.04128
ASHGA5P022710 ENST00000561275 OIP5-AS 1 -2.61 0.01084
ASHGA5P036254 ENST00000444196 AC010894.3 -2.60 0.03453
ASHGA5P049639 ENST00000581922 AC124789.1 -2.60 0.03681
ASHGA5P049296 ENST00000566217 RP11-296110.6 -2.58 0.00650
ASHGA5P036712 ENST00000453921 RP4-56404.1 -2.55 0.02081
ASHGA5P027910 ENST00000537346 DENND5B-AS1 -2.51 0.04699
ASHGA5P016018 ucOOleho. l BC063600 -2.51 0.01200
ASHGA5P023498 ENST00000582261 AC015818.3 -2.51 0.04689
ASHGA5P028123 ENST00000421943 RP11-426L16.3 -2.48 0.03215
ASHGA5P020949 ENST00000522416 KB-1639H6.2 -2.45 0.02119
ASHGA5P014957 ENST00000415154 LINC00226 -2.44 0.03633
ASHGA5P047777 ENST00000440388 RP11-500G10.5 -2.44 0.02796
ASHGA5P033095 ENST00000577557 RP5-1028K7.2 -2.43 0.03239
ASHGA5P047324 ENST00000438202 RP11-534G20.3 -2.41 0.01113
ASHGA5P040455 uc003jsd. l BX641110 -2.40 0.00593
ASHGA5P031595 ENST00000444326 CRYM-AS 1 -2.40 0.03788
ASHGA5P030942 ENST00000565648 RP11-473I1.5 -2.39 0.03802
ASHGA5P030140 ENST00000560337 RP11-272D12.2 -2.39 0.00377
ASHGA5P031271 uc002ezq.3 BC033164 -2.36 0.01131
ASHGA5P028900 NR 027350 MIR17HG -2.35 0.02070
ASHGA5P031092 ENST00000563777 FBXL19-AS1 -2.35 0.03054
ASHGA5P043735 ENST00000452986 AC004878.2 -2.33 0.01133
ASHGA5P033372 NR 028439 C17orfl09 -2.31 0.00300
ASHGA5P050764 ENST00000457387 RP4-717I23.3 -2.30 0.03935
ASHGA5P051192 ENST00000540720 DGCR5 -2.26 0.01158
ASHGA5P026001 ucOlOady. l THSD1P1 -2.25 0.01503
ASHGA5P047405 TCONS 00014981 XLOC 007062 -2.23 0.00342
ASHGA5P054980 ENST00000430109 RP4-758J18.10 -2.22 0.03927
ASHGA5P015132 NR 045768 ATF2 -2.19 0.00759
ASHGA5P037609 ENST00000417194 GUSBP11 -2.18 0.04156
ASHGA5P027688 ENST00000541797 RP11-749H20.1 -2.18 0.00278
ASHGA5P030904 ENST00000576943 RP11-473M20.15 -2.17 0.03074
ASHGA5P055197 ENST00000532315 RP11-166D19.1 -2.17 0.04056
ASHGA5P019723 ENST00000501954 RP11-847H18.2 -2.17 0.02701
ASHGA5P043181 ENST00000471553 RP5-1121E10.2 -2.17 0.02604
ASHGA5P043280 ENST00000451832 IMMP2L-IT1 -2.15 0.01517
ASHGA5P023124 ENST00000570454 RP11-669E14.6 -2.14 0.01135
ASHGA5P027657 ENST00000542427 RP11-282018.3 -2.13 0.02031
ASHGA5P051337 uc003azm.3 BC040700 -2.12 0.02353
ASHGA5P057321 TCONS 00016063 XLOC 007452 -2.11 0.01685
ASHGA5P019895 ENST00000504833 CTD-2001C12.1 -2.11 0.01846
ASHGA5P042232 uc003mwn. l AK094934 -2.10 0.03267
ASHGA5P041222 ENST00000504769 TMEM161B-AS 1 -2.09 0.01682
ASHGA5P043145 uc003ucm.3 PMS2L14 -2.07 0.03668
ASHGA5P056937 TCONS 00010747 XLOC 004478 -2.07 0.02858
ASHGA5P042300 NR 026790 HCG11 -2.05 0.01810
ASHGA5P030798 ENST00000559400 CTD-3076O17.2 -2.01 0.02744
ASHGA5P039775 AA151944 -2.01 0.04605
ASHGA5P049116 uc002dkc2 AF086126 -2.00 0.01360
ASHGA5P052552 ENST00000505870 RP1-80B9.2 -2.00 0.02029
ASHGA5P028659 TCONS 00009877 XLOC 004299 2.00 0.03789
ASHGA5P041590 ENST00000519491 RP11-281015.4 2.06 0.04277
ASHGA5P056387 TCONS 00003845 XLOC 001650 2.09 0.03754
ASHGA5P019979 NR 038989 LOC100507584 2.10 0.04541
ASHGA5P023807 HMlincRNA507- HMlincRNA507 2.12 0.03666
ASHGA5P018130 ENST00000449772 AC068535.3 2.15 0.00524
ASHGA5P027701 ENST00000539532 RP11-117L5.4 2.16 0.03470
ASHGA5P054017 ucOlOpqo. l LINC00303 2.31 0.01077
ASHGA5P034879 ENST00000474667 RP11-521D12.5 2.32 0.03665
ASHGA5P047002 uc001kjn.4 BC035380 2.33 0.02899
ASHGA5P026246 ENST00000528204 NAV2-IT1 2.34 0.01867
ASHGA5P032309 ENST00000582320 MIR451B 2.39 0.04210
ASHGA5P026754 ENST00000434606 RP13-221M14.3 2.40 0.03211
ASHGA5P022400 ENST00000556120 DI030S 2.40 0.04745
ASHGA5P019377 NR 023345 CNKSR1 2.42 0.03385
ASHGA5P030322 uc021sxp. l AK093600 2.45 0.04415
ASHGA5P034153 ENST00000561778 CTC-523E23.1 2.46 0.03038
ASHGA5P019066 ENST00000466730 ABCA17P 2.47 0.02535
ASHGA5P058606 ucOlOvzg. l AK295707 2.54 0.02267
ASHGA5P033292 ENST00000412483 RP4-799P18.2 2.60 0.03655
ASHGA5P019188 ENST00000472193 PLCL1 2.65 0.02660
ASHGA5P032925 ENST00000577087 RP11-311F12.1 2.73 0.02057
ASHGA5P025683 NR 026782 HEATR8 2.77 0.04836
ASHGA5P045689 ENST00000439960 RP11-296L22.8 2.86 0.03930
ASHGA5P027787 TCONS 00010156 XLOC 004622 2.90 0.02240
ASHGA5P025958 NR 047601 UTY 2.91 0.03915 chr3: 120042175- chr3: 120042175-
ASHGA5P000386 120054600+ 120054600 2.92 0.04485
ASHGA5P050152 TCONS 00019041 XLOC 008978 3.00 0.04731
ASHGA5P041516 ENST00000519327 CTC-340A15.2 3.00 0.04236
ASHGA5P040581 TCONS 00021912 XLOC 010505 3.13 0.03295
ASHGA5P031889 ENST00000567721 CTD-2520I13.1 3.15 0.03209
ASHGA5P035710 ENST00000566840 RP11-254F7.1 3.18 0.03356
ASHGA5P029582 TCONS 00008273 XLOC 003714 3.23 0.03527
ASHGA5P053840 ENST00000536815 RP11-395P17.3 3.24 0.00405
ASHGA5P043886 ENST00000418215 AC000123.4 3.25 0.03529
ASHGA5P058314 TCONS 00029913 XLOC 014386 3.30 0.03561
ASHGA5P037514 ENST00000400362 BX322557.10 3.31 0.01866 chr6:63131625- chr6:63131625-
ASHGA5P000480 63144250+ 63144250 3.37 0.00885
ASHGA5P027762 ENST00000537192 RP11-1038A11.3 3.43 0.03621
ASHGA5P057099 TCONS 00013289 XLOC 005957 3.78 0.02449
ASHGA5P000112 BF986711 3.79 0.04501
ASHGA5P054466 ENST00000448017 RP11-556E13.1 3.81 0.00705
ASHGA5P038359 ENST00000486726 RP11-231E6.1 3.82 0.01401
ASHGA5P026072 BF869766 3.85 0.03082
ASHGA5P041947 ENST00000434493 RP1-177I10.1 3.91 0.02967
ASHGA5P031972 ENST00000567093 CTD-2542L18.1 3.99 0.03710
ASHGA5P054842 ENST00000530412 TRIM51HP 4.08 0.04952
ASHGA5P056805 TCONS 00008798 XLOC 003555 4.12 0.00758
ASHGA5P022501 ENST00000558097 RP11-798K3.2 4.25 0.02854
ASHGA5P050918 NR 040710 LOC100131208 4.64 0.00356
ASHGA5P030689 TCONS 00006338 XLOC 002953 4.71 0.04584 chr2 : 90959050- chr2 : 90959050-
ASHGA5P000374 90986900+ 90986900 4.93 0.01312
ASHGA5P041498 ENST00000522975 CTC-436K13.1 4.93 0.00571
ASHGA5P058850 UC.468+ uc.468 5.01 0.03627
ASHGA5P031046 ENST00000564381 RP11-673P17.4 5.06 0.02052
ASHGA5P044241 ENST00000527318 RP11-412B14.1 5.19 0.04234
ASHGA5P042137 ENST00000415477 RP1-292B18.4 5.20 0.04016
ASHGA5P054514 NR 038986 GRID 1 -AS 1 5.24 0.00955
ASHGA5P050022 ENST00000563752 SLC25A3P1 5.55 0.01846
ASHGA5P023783 HMlincRNA407- HMlincRNA407 5.68 0.01251
ASHGA5P029035 AF083119R 8.05 0.00593
ASHGA5P029153 ENST00000554160 RP11-108M12.3 8.35 0.00206
ASHGA5P019501 ucOl lkur.2 LOC401431 9.70 0.00594
ASHGA5P042997 AA810436 11.31 0.01310
17 up-regulated and 49 down-regulated IncRNAs associated with LKB1-K78I mutant expression compared to control were also observed (Figure 5C). Comparing expression profiles of LKBl-wt- and K78I-expressing cells, 33 up-regulated and 83 down-regulated IncRNAs were identified, suggesting that their expression is dependent on LKB l kinase activity. Furthermore, IncRNA expression patterns were profiled and compared between 2 groups of cell lines: LKB l -null (A549, H460) and LKBl-wt (H322, H3123), and 1449 up- regulated and 918 down-regulated IncRNAs were observed in LKB l -null cell lines (Figure 5D). Finally, by integrating LKBl -regulated IncRNAs and IncRNAs differentially expressed in LKBl-null cell lines (Table 1), a list of LKB l -regulated IncRNAs were identified (10 up- regulated and 1 down-regulated) that are differentially expressed between LKB l-null and -wt cancer cells (Table 2).
Notably, this list contained 3 transcripts for LINC00473 gene (aka. C6orfl76, abbreviated as Lnc473 in the figures), which encodes an intergenic IncRNA from the chromosome 6q27 locus. LINC00473 consists of two exons and has two annotated Refseq transcript isoforms sharing exon 1 : transcript variant 1 (tvl; NR_026860, 1822 nt) and tv2 (NR 026861, 1123 nt). 5' and 3' RACE assays identified 3 LINC00473 transcript variants, tvl . l, tv2.1 and tv2.2, but not two annotated transcripts. LINC00473-tvl . l had a shorter 5' end from the annotated tvl, while tv2.1 and tv2.2 had different 5' and 3' ends from the
annotated tv2. Coding potential analysis strongly suggested that LINC00473 is a noncoding RNA. Both tvl and tv2 transcript variants showed significant activation in LKBl-null NSCLC cells (Table 2). LINC00473 tvl was the top differentially expressed lncRNA (> 10,000-fold change) comparing the 2 LKBl-null (A549 and H460) and 2 LKB1 -expressing cells (H322 and H3123), while LINC00473 tv2 showed about a 40-fold change.
EXAMPLE 4 - ELEVATED LINC00473 EXPRESSION TIGHTLY CORRELATES WITH
NSCLC LKB1 INACTIVATION STATUS
To validate LKB1 -regulated IncRNAs, a Nanostring-based assay was used that allows direct digital detection of multiple RNA molecules of interest using target-specific, color- coded probe pairs. This platform enables to simultaneously evaluate multiple LKB1- regulated mRNA and lncRNA candidates (especially LINC00473). Hybridizations were performed on RNA samples from a pair of control and LKB1 -expressing A549 cells and a panel of NSCLC cell lines (7 LKB l-wt and 7 LKBl-mut) using a customized codeset. The codeset included several LKB1 -regulated lncRNA candidates, known LKB1 -regulated protein-coding genes, as well as three housekeeping genes (GAPDH, GUSB and TUBB). As shown in the heatmap (Figure 5E, right panel), LKB1 expression in LKBl-null A549 cells caused significant down-regulation of known protein-coding genes (AVPI1, CTH, CPS1, DUSP4, FGA, NR4A2, PDE4B, PDE4D, PTGS2, PTP4A1, SIKl, SLC7A2, SNAI1, TESC and TFF1), as well as three IncRNAs (LINC00473, AL 109792, and BX64110). However, when examined across various cell lines with the confirmed status of cellular LKB1 protein expression, LINC00473 expression showed the best correlation with LKB 1 -inactivated status (Figure 5E, left and middle panels). Other LKB1 -regulated genes, including LncRNAs AL 109792 and BX64110, were only partially correlated with the LKB1 status, suggesting cell context-dependent gene regulation.
Both LINC00473 tvl and tv2 isoforms showed low or absent expression in 7 LKB l- wt NSCLC cell lines but significantly enhanced expression in 7 LKB l-mut cell lines (Figure 5F, G). LINC00473 differential expression in LKBl-wt and LKBl-mut cell lines was further corroborated by qRT-PCR data. Enhanced expression of a known LKB 1 target gene SIKl was also confirmed, but was not consistent across all cell lines tested. Moreover, SIKl has relatively high basal expression. Additionally, LINC00473 expression was surveyed in 130 NSCLC cell lines using Affymetrix microarray data from the Cancer Cell Line Encyclopedia (CCLE) and these arrays only contained the probes for LINC00473 tvl . A subset of NSCLC
cell lines showed an outlier LINC00473 tvl expression (Figure 5H, and Table 3). Analysis of cell lines with annotated LKB 1 mutation status revealed that LINC00473 expression was significantly enhanced in LKB 1 -mutant NSCLC cell lines (n = 32) in comparison to LKB l- wt lines (n=59) (Table 3, Figure 51) and the enhancement was more significant as compared to SIKl expression. Furthermore, two LKBl-wt cell lines with high LINC00473 expression, H292 and DV90, were predicted to have LKB1 loss based on a 16-gene signature score. H292 is a lung mucoepidermoid carcinoma cell line that contains a t(l 1;19) translocation that leads to the generation of the CRTC1-MAML2 fusion and subsequent constitutive activation of CREB-mediated transcription, thus mimicking LKB1 loss. Collectively, these data strongly support that LINC00473 is consistently the most elevated gene in LKB 1 -inactivated
NSCLC cell lines regardless of other co-existing gene mutations.
Table 3. Lnc473 expression in human NSCLC cell lines from CCLE database and their associated LKB1 mutation status. All samples had primary site of lung and histology of carcinoma.
Predicted
Cell line LKB1
RMA Gen LKB1 by a 16- primary Hist Subtypel mutation
(Log2) -der status gene name (#) score (##)
LKB1 loss,
NCI-H1944 10.5141 F non small cell carcinoma mutant NOS LKBl loss
ChaGo-K-1 10.41772 M NS mutant P.G56V LKB1 loss
Large
deletion,
HCC-15 10.34715 M squamous cell carcinoma mutant NOS LKBl loss p.G196_L201
LU65 9.971215 M non small cell carcinoma mutant deletion LKBl loss
NCI-H1563 9.964172 M adenocarcinoma mutant p.Y272* LKBl loss
E98-G155
NCI-H1437 9.547726 M adenocarcinoma mutant del. LKBl loss
NCI-H460 9.288111 M large cell carcinoma mutant p.Q37* LKBl loss
NCI-H2172 9.228016 F non small cell carcinoma Unknown LKBl loss
NCI-H2023 9.205874 M adenocarcinoma Unknown LKBl loss
Large
RERF-LC- deletion,
MS 9.093593 non small cell carcinoma mutant NOS LKBl loss
NCI-H1915 9.004812 F large cell carcinoma Unknown LKBl loss
NCI-H1623 8.511945 M adenocarcinoma mutant P.L285Q LKBl loss
NCI-H838 8.424098 M non small cell carcinoma mutant p.T212fs LKBl loss
NCI-H2122 8.404129 F adenocarcinoma mutant p.P281fs*6 LKBl loss
DV-90 8.195443 M adenocarcinoma wt WT LKBl loss
NCI-H1395 8.166507 F adenocarcinoma mutant p.E57fs LKBl loss
NCI-H292 8.095381 F mucoepidermoid car- wt LKBl loss
cinoma
NCI-H2110 7.841765 non small cell carcinoma Unknown LKB1 loss
NCI-H1355 7.839176 M adenocarcinoma mutant p.K48fs LKB1 loss
A549 7.755318 M non small cell carcinoma mutant p.Q37* LKB1 loss
NCI-H1755 7.620098 F adenocarcinoma mutant p.P281fs*6 LKB1 loss
LKB1 loss,
NCI-H1568 7.58 F non small cell carcinoma mutant NOS LKB1 loss
MOR/CPR 7.421945 adenocarcinoma mutant LKB1 loss
COR-L105 7.362305 M adenocarcinoma Unknown LKB1 loss
NCI-H23 6.667511 M non small cell carcinoma mutant P.W332* LKB1 loss bronchioloalveolar adeno-
NCI-H1666 6.613 F carcinoma mutant p.V236fs*30 LKB1 loss c.465 862del
NCI-H2126 6.287378 M adenocarcinoma mutant 398 LKB1 loss
LKB1 loss,
NCI-H1385 5.867911 F squamous cell carcinoma mutant NOS LKB1 loss
DFCI024 5.738737 adenocarcinoma Mutant
P.M51I;
HCC-44 5.686449 F adenocarcinoma mutant p.52fs LKB1 loss
LUDLU-1 5.432516 M squamous cell carcinoma Unknown LKB1 loss mixed_adenosquamous_ LKB1 loss,
NCI-H647 5.342878 M carcinoma mutant NOS LKB1 loss
NCI-H1651 5.267038 M adenocarcinoma mutant P? LKB1 loss
VMRC- p.G155_splic
LCD 5.254231 M adenocarcinoma mutant e LKB1 loss
NCI-H810 5.184853 M large cell carcinoma mutant P.P179S LKB1 wt p.M51fs*14;
p.E357K;
NCI-H1734 4.985246 F adenocarcinoma mutant P.M392I LKB1 loss
T3M-10 4.954805 M large cell carcinoma Unknown
NCI-H2030 4.837931 M non small cell carcinoma mutant p.E317* LKB1 loss
Hs 229.T 4.561258 M adenocarcinoma Unknown LKB1 wt
Calu-6 4.434085 F undifferentiated carcinoma wt WT LKB1 wt
HARA 4.360481 M squamous cell carcinoma Unknown LKB1 wt
KNS-62 4.312017 M squamous cell carcinoma wt WT LKB1 wt
NCI-H1838 4.282615 F non small cell carcinoma wt WT LKB1 wt
LC-l/sq-SF 4.266397 M squamous cell carcinoma Unknown LKB1 wt
HCC-2108 4.262532 M adenocarcinoma Unknown
LXF-289 4.26104 M adenocarcinoma wt WT LKB1 loss
NCI-H322 4.254947 M adenocarcinoma wt WT LKB1 wt
HCC-827- GR5 4.251327 adenocarcinoma wt WT
HCC-1359 4.230968 F large cell carcinoma wt WT
RERF-LC- KJ 4.229279 M non small cell carcinoma Unknown LKB1 loss
IA-LM 4.213694 M large cell carcinoma wt WT LKB1 wt
NCI-H520 4.154591 M squamous cell carcinoma wt WT LKB1 wt
CAL-12T 4.130446 M non small cell carcinoma wt WT LKB1 loss
LC-1F 4.118675 M squamous cell carcinoma wt WT LKB 1 wt
HCC-95 4.111587 M squamous cell carcinoma wt WT LKB 1 wt
EPLC- 272H 4.111317 M squamous cell carcinoma wt WT LKB 1 wt
BEN 4.109393 M NS wt WT LKB1 loss
SK-LU-1 4.106286 F adenocarcinoma wt WT LKB 1 wt
NCI-H2085 4.100357 M adenocarcinoma Unknown LKB 1 wt
HLC-1 4.093439 adenocarcinoma Unknown LKB1 loss
EBC-1 4.088854 M squamous cell carcinoma Unknown LKB 1 wt
NCI-H2291 4.088074 M adenocarcinoma wt WT LKB 1 wt
LK-2 4.082802 M squamous cell carcinoma wt WT LKB 1 wt
LKB 1 loss,
NCI-H1573 4.077617 F adenocarcinoma mutant NOS LKB1 loss bronchioloalveolar adeno-
NCI-H650 4.065019 M carcinoma wt WT LKB 1 wt
RERF-LC- AI 4.059075 M squamous cell carcinoma Unknown LKB 1 wt
SW 900 4.038099 M squamous cell carcinoma wt WT LKB 1 wt
NCI-H2087 4.033823 M adenocarcinoma wt WT LKB 1 wt
NCI-H2342 4.029915 M adenocarcinoma wt WT LKB 1 wt
NCI-H3255 4.026813 F adenocarcinoma wt WT LKB 1 wt
NCI-H1373 4.024774 M adenocarcinoma Unknown LKB 1 wt
HCC-78 4.018615 M adenocarcinoma wt WT LKB 1 wt mixed_adenosquamous_
HCC-1195 4.01556 M carcinoma Unknown LKB1 loss
NCI-H854 4.014536 adenocarcinoma Unknown LKB1 loss
ABC-1 3.994741 M non small cell carcinoma wt WT LKB 1 wt
RERF-LC- Adl 3.993486 M adenocarcinoma Unknown LKB1 loss
NCI-H1299 3.992889 M non small cell carcinoma wt WT LKB 1 wt
HCC-1897 3.990146 squamous cell carcinoma Unknown
RERF-LC- Sql 3.986817 F squamous cell carcinoma Unknown LKB 1 wt
LCLC- 97TM1 3.986306 M large cell carcinoma wt WT LKB 1 wt
RERF-LC- Ad2 3.975413 M adenocarcinoma Unknown LKB 1 wt
NCI-H1869 3.972442 M squamous cell carcinoma Unknown LKB 1 wt
Hs 618.T 3.970786 F adenocarcinoma Unknown LKB 1 wt
HCC-2814 3.970314 squamous cell carcinoma Unknown
NCI-H1793 3.95608 F non small cell carcinoma wt WT LKB 1 wt
NCI-H1155 3.954891 M large cell carcinoma wt WT LKB1 loss
NCI-H2170 3.95321 M squamous cell carcinoma wt WT LKB1 loss
NCI-H1792 3.944311 M adenocarcinoma wt WT LKB 1 wt mixed_adenosquamous_
NCI-H596 3.940438 M carcinoma wt WT LKB 1 wt
NCI-H441 3.93946 M adenocarcinoma wt WT LKB 1 wt
COR-L23 3.917462 M large cell carcinoma wt WT LKB 1 wt
Sq-1 3.915144 squamous cell carcinoma Unknown LKB 1 wt
NCI-H226 3.913636 M squamous cell carcinoma wt WT LKB 1 wt
Large
mixed_adenosquamous_ deletion,
HCC-366 3.911762 F carcinoma mutant NOS LKB 1 wt
HCC-1588 3.911081 F squamous cell carcinoma Unknown
SW 1573 3.90113 F squamous cell carcinoma wt WT LKB 1 wt
SK-MES-1 3.88507 M squamous cell carcinoma wt WT LKB 1 wt bronchioloalveolar adeno-
NCI-H1781 3.880625 F carcinoma Unknown LKB 1 wt
NCI-H1975 3.878402 F non small cell carcinoma wt WT LKB 1 wt
NCI-H2228 3.87466 F adenocarcinoma wt WT LKB 1 wt bronchioloalveolar adeno-
NCI-H358 3.874099 M carcinoma wt WT LKB 1 wt
Calu-1 3.872414 M squamous cell carcinoma wt WT LKB 1 wt bronchioloalveolar adeno-
NCI-H1650 3.866959 M carcinoma wt WT LKB 1 wt
NCI-H1703 3.859445 M adenocarcinoma wt WT LKB 1 wt
Calu-3 3.858251 M adenocarcinoma wt WT LKB 1 wt
HLF-a 3.857518 F squamous cell carcinoma Unknown LKB 1 wt
NCI-H2405 3.854325 M adenocarcinoma wt WT LKB 1 wt
NCI-H1581 3.852179 M large cell carcinoma wt WT LKB 1 wt
HCC-2279 3.848194 F adenocarcinoma wt WT LKB 1 wt
NCI-H2106 3.839763 M non small cell carcinoma Unknown LKB 1 wt
HCC827 3.835911 F adenocarcinoma Unknown LKB 1 wt
HCC2935 3.834708 M non small cell carcinoma wt WT LKB 1 wt
NCI-H2009 3.8344 F adenocarcinoma wt WT LKB 1 wt
NCI-H1693 3.824201 F adenocarcinoma wt WT LKB 1 wt
NCI-H522 3.811081 M non small cell carcinoma wt WT LKB 1 wt
HCC364 3.806596 adenocarcinoma Unknown
LU99 3.791267 M large cell carcinoma Unknown LKB 1 wt
HCC-1438 3.786822 M large cell carcinoma Unknown
LCLC- 103H 3.766306 M large cell carcinoma wt WT LKB 1 wt
NCI-H661 3.752467 M large cell carcinoma wt WT LKB 1 wt
NCI-H1435 3.748322 F non small cell carcinoma Unknown LKB1 loss
NCI-H2347 3.745148 F adenocarcinoma wt WT LKB 1 wt
VMRC- LKB 1 loss,
LCP 3.741747 squamous cell carcinoma mutant NOS LKB1 loss
LOU-NH91 3.734531 F squamous cell carcinoma Unknown LKB 1 wt
PC-14 3.706141 non small cell carcinoma wt WT LKB 1 wt
HCC4006 3.657913 M adenocarcinoma wt WT LKB 1 wt
HCC-1833 3.646418 adenocarcinoma Unknown
NCI-H2444 3.609546 M non small cell carcinoma Unknown LKB 1 wt
NCI-H1648 3.599074 M adenocarcinoma wt WT LKB 1 wt
HCC-1171 3.578131 M non small cell carcinoma wt WT LKB 1 wt
#: References Jemal et al., Janku et al., Koivunen et al., Paez et al., Shackelford et al.,
Alessi et al. and Hemminki et al.
##: Reference Hemminki et al.
EXAMPLE 5 - LINC00473 EXPRESSION IS ELEVATED IN NSCLC THAT HAVE
MUTATIONS IN THE LKB 1 GENE CODING REGIONS To investigate whether LINC00473 can serve as a potential biomarker for LKB1 status in human NSCLC cancers, expression of LINC00473 and several other LKB1 targets was evaluated in formalin-fixed paraffin-embedded (FFPE) human adenocarcinoma (LUAD) specimens. Target amplification-based strategies such as RT-PCR and microarray analyses for measuring RNA levels from fixed tissue is complicated by the fact that the RNA is highly cross-linked and significantly fragmented. Nanostring-based assays are optimal for gene expression quantification using FFPE tumor-derived RNA samples since the bar-coded fluorescent probes recognize small target regions (~100bp) allowing direct single-molecule counting without need for target amplification. Therefore, Nanostring assays were performed for FFPE tumor-derived RNAs from 5 LKBl-wt and 5 LKB l-mut human LUAD specimens. The LKB1 gene mutation status was analyzed by exon sequencing. LINC00473 expression was consistently found to best correlate with the tumor LKB 1 status among all the genes tested (Figure 6A). Expression of LINC00473 tvl, but not tv2, was significantly enhanced in LUAD with LKB1 mutations (Figure 6B). These data suggest that expression of LINC00473 tvl alone can predict tumor LKB 1 status.
To examine whether LINC00473 expression could be directly visualized at cellular levels in human FFPE tumors, RNA in situ hybridizations (RNA ISH) was performed for detection of LINC00473 transcripts using customized LINC00473 probes (RNAscope). The specificity of LINC00473 probes was first validated by positive LINC00473 signals in LKB 1 -null A549 xenograft tumors and negative signals in LKBl-wt H522 xenograft tumors. LINC00473 transcripts were detected as easily distinguishable nuclear "dots" in A549 xenograft tumors. RNA ISH was the performed on FFPE human LUAD tissue array. This array also included FFPE cell pellets from LKB 1 -null A549 and LKB 1 -positive H322 as controls, which showed respective positive and negative LINC00473 signals. Only those tumors were analyzed that were positive for a housekeeping gene PPIB (peptidylprolyl isomerase), indicative of tumors with good RNA quality. Representative positive and negative LINC00473 staining results were shown (Figures 6C, D). All normal human lung
tissues (n = 38) were negative for LINC00473 staining while exhibiting positive staining for PPIB staining (Figures 6E), indicating absent or low basal LINC00473 expression in normal lung tissues. 9 out of 89 NSCLC specimens (10.11%) with annotated LKB 1 wt and 12 out of 22 lung tumors (54.54%) with annotated LKBl mutations were positive for LINC00473 staining (Figures 6E). LINC00473 expression showed significant positive correlation with LKBl mutations based on Fisher Exact Test (p = 1.93E-05). It is likely that those tumors carrying the LKBl wt gene yet showing elevated LINC00473 expression have LKB l functional inactivation due to other mechanisms besides LKB l mutations such as epigenetic silencing, or post-translational modifications, or alteration in LKBl signaling components. On the other hand, not all mutations found in LKB l are inactivating. Tumors carrying the LKBl gene mutations yet not showing LINC00473 induction could have intact LKB l function if the mutations do not impair LKBl function. For example, one of the tumors with LKBl F354L mutation, which was predicted not to have damaging effects on LKBl function based on PolyPhen-2 prediction, showed undetectable LINC00473 expression. In addition, negative LINC00473 staining was found in several other cancer types and tissues including prostate cancer, IDC breast, large cell Lymphoma, hepatocellular carcinoma, colon adenocarcinoma and osteosarcoma as well as placenta, tonsil, and normal spleen (n = 1; data not shown). These data strongly indicate that LINC00473 is low or undetectable in normal lung tissues but exhibits elevated expression in the subset of lung NSCLC specifically with functional LKBl inactivation, indicating that LINC00473 is a potential robust surrogate biomarker for LKB 1 functional status in lung cancer.
EXAMPLE 6 - ELEVATED LINC00473 EXPRESSION IS ASSOCIATED WITH TUMOR LKBl MUTATIONS AND CORRELATES WITH POOR PROGNOSIS IN TCGA LUNG
ADENOCARCINOMAS
To investigate any potential association between LINC00473 expression, LKB l mutation status, and clinical data of lung cancers, a lung adenocarcinoma (LUAD) RNAseq dataset from The Cancer Genome Atlas (TCGA) was analyzed. A subset of lung cancers with outlier LINC00473 expression (90 percentile rank) and a significant difference in LINC00473 expression between tumors (either paired n = 57 or unpaired n = 454) and normal tissues (n = 57) (Figure 6F) was observed. LUAD samples with high LINC00473 expression were enriched with LKBl gene-level nonsynonymous somatic mutations including small INDELs within the LKBl gene coding regions (Figure 12). LINC00473 expression was
not associated with KRAS and TP 53 gene mutations (Figure 12), which are two well-known somatic mutations that can occur concurrently with LKBl loss. Moreover, the difference in LINC00473 expression between LKBl wt and LKB l mutant populations was more significant compared to SIK1 or LKB l expression (Figure 13). LINC00473 expression was positively correlated with LKBl -loss gene signature and inversely correlated with LKBl expression, and such correlations were more significant in comparison to SIK1 expression and LKBl expression (Figure 14). These data support a strong association of LINC00473 expression with the LKBl inactivation in LUAD samples.
Kaplan-Meier survival analysis showed highly significant difference in overall survival between high expression (n = 48) and low expression (n = 421) groups (p < 0.001, Figure 6G). The elevated LINC00473 expression significantly correlated with a shorter survival time in LUAD patients (< 50 months). When analyzing those tumors with the available data on LINC00473 expression, LKB l mutations, and clinical information, LKB l mutation status was not significantly associated with survival, but high LINC00473 expression was associated with a poor survival within both LKBl-wt and mutant groups (Figure 15). These data indicate that LINC00473 has a prognostic value and may play an important role in cancer progression.
EXAMPLE 7 - LINC00473 EXPRESSION IS PROMOTED BY LKBl -LOSS -INDUCED
CRTC/CREB ACTIVATION
High LINC00473 expression has a positive correlation with LKBl functional inactivation in NSCLC cell lines and human primary tumors, suggesting that LKB l inactivation leads to increased expression of LINC00473. To further examine LKB l regulation of LINC00473 expression, whether cellular LKB l levels directly impacted LINC00473 expression was tested. Introduction of exogenous LKB l in LKBl -null cancer cell lines (HI 57, A549) resulted in a significant decrease in LINC00473 transcript level (Figure 7 A), whereas shRNA-mediated depletion of endogenous LKBl expression in LKB 1- positive cells (H3123, H322) led to an increase in LINC00473 level (Figure 7B). Therefore, modulating cellular LKB l protein expression affects LINC00473 expression in NSCLC cells.
LKBl regulates multiple downstream AMPK family members, influencing multiple signaling pathways. The loss of LKBl expression resulted in dephosphorylation and nuclear entry of CRTC transcriptional co-activators and subsequent CREB-mediated transcriptional activation in both lung and esophageal cancer cells. LINC00473 was transiently up-regulated
in response to cAMP signaling in human ocular ciliary smooth muscle cells. The LINC00473 gene contains 2 CRE (cAMP -responsive element) half sites within the proximal promoter region. To test whether the loss of LKBl induces CRTC-CREB activation and promotes LINC00473 expression, CREB was depleted using lentiviral-mediated shRNAs or expression of a dominant negative form of CRTC (dnCRTC) that interferes with CRTC- CREB interaction. A reduction in LINC00473 transcript level was observed in CREB- depleted or dnCRTC-expressing A549 cells (Figures 7C). LKBl over-expression further blocked LINC00473 expression. These data demonstrate that LINC00473 is regulated by LKBl loss and CRTC/CREB activation. Next, the proximal LINC00473 promoter sequence (-523 to +88) encompassing 2 CRE sites was cloned into the upstream region of a luciferase reporter (pGL3 basic) (Figure 7D) and LINC00473 promoter activity was determined by modulating LKBl -CRTC -CREB signaling. The LINC00473 promoter reporter was significantly repressed by over-expression of LKB l, but not LKB l kinase-dead mutant K78I when transfected in LKB l -deficient A549 cells (Figure 7E). Moreover, promoter activity was significantly inhibited by expression of A-CREB (Figure 7F), a dominant-negative mutant that specifically blocked CREB binding to DNA. Also, the LINC00473 promoter reporter was activated by over-expression of CRTC1 and to a larger extent, by constitutively activated form of CRTC1 (S151A) (Figure 7G). Finally, chromatin immunoprecipitation (ChIP) assays demonstrated that CRTC1 and CREB were enriched in the LINC00473 promoter region spanning the CRE sites (Figure 7H). These data suggest that LINC00473 transcription is directly induced by CRTC-CREB activation in LKBl -inactivated NSCLC cells.
EXAMPLE 8 - IN VITRO AND IN VIVO APPROACHES REVEALED CRITICAL FUNCTIONS OF LINC00473 IN THE GROWTH OF LKB 1 -NULL LUNG CANCER
CELLS
High LINC00473 expression correlated with poor survival of lung cancer patients (Figure 6G), indicating a role of LINC00473 in cancer progression. Therefore, functional significance of sustained LINC00473 expression in LKBl -inactivated NSCLC cells was investigated. The functional impact of LINC00473 depletion on cell growth and survival was determined using 2 independent lentiviral pLKO. l -based shRNAs targeting exon 2 of LINC00473tvl (shLnc473-2 and -4). Two shLnc473 caused approximately 90% reduction in LINC00473 transcript levels in A549 cells at 96 hours after lentiviral infection (Figure 8A).
The shLnc473-expressing as well as scrambled shRNA control (shCtl)-expressing cells were subsequently assayed for cell growth and survival. LINC00473 knockdown reduced cell proliferation and enhanced apoptosis in LKBl-null A549 cells (Figure 8B-8C). Similar effects of LINC00473 depletion on LKBl-null NSCLC cell line H157 were also observed (Figure 16). Conversely, exogenous LINC00473 over-expression via retroviral transduction in LKB l-wt H522 lung cancer cells resulted in a moderate, yet significant increase in cell proliferation (Figures 17A-17B). These data demonstrate that LINC00473 is essential for maintaining LKB1 -inactivated lung cancer cell growth and survival.
The effect of LINC00473 depletion on the growth of NSCLC xenografts was determined. The luciferase-expressing A549 (A549-luc) cells were transduced with lentiviral- based shLnc473 or scrambled shRNA control for 72 hours and then equal numbers of LINC00473 -depleted and control cells were implanted to NOD.SCID mice by subcutaneous injection. LINC00473 depletion significantly reduced the tumor size and weight and blocked the growth of A549-luc xenografts over time (Figures 8D and 4D-4F). IHC analysis showed that LINC00473 -depleted xenograft tumors contained a reduced number of cells that were positive for the cell proliferation marker Ki-67 (Figure 8E). Similarly, deletion of LINC0473 expression decreased the growth of HI 57 xenografts in NOD.SCID mice (Figures 16D-16F). Therefore, both in vitro and in vivo evidence supports critical functions of LINC00473 in regulating lung cancer growth and survival.
EXAMPLE 9 - LINC00473 IS A NUCLEAR LNCRNA AND FUNCTIONS AS A REGULATOR OF GENE EXPRESSION IN PART THROUGH INTERACTING WITH NONO AND MODULATING CRTC/CREB TRANSCRIPTION The molecular mechanisms underlying LINC00473 functions are unknown. IncRNAs may be involved in various processes, including transcription, splicing, post-transcriptional regulation, organization of protein complexes, cell-cell signaling, and allosteric regulation of proteins. Knowledge of subcellular localization for IncRNAs can provide a clue for IncRNA functions. Nuclear localization of LINC00473 transcripts in FFPE human lung cancer specimens using customized LINC00473 probes in RNAscope RNA-ISH assays (Figure 6C). To validate LINC00473 as a nuclear IncRNA, subcellular fractionation assay and RNA fluorescence in situ hybridization (RNA-FISH) were performed. For fractionation assay, cytoplasmic and nuclear fractions were prepared and LINC00473 transcript levels were determined in both fractions. By comparing with the respective cytoplasmic (tRNA) and
nuclear (U6) controls, LINC00473 was found to be enriched in the nuclear fraction (Figures 9A-9B). For RNA-FISH, fixed cells were hybridized with a mixture of 27 oligonucleotide probes (20-mer) targeting LINC00473, with each probe linked with a single Quasar 570 fluorophore. Positive nuclear signals were observed with 1-2 distinctive dot-like structures as well as less intense, diffuse signals outside the dots (Figure 9C). LINC00473 signals were undetectable when hybridizations were performed in the presence of RNase, indicating that the signal detection was RNA-dependent. Moreover, exogenous LINC00473 showed similar nuclear localization when over-expressed in LKB l-wt H522 cells. These data strongly support that LINC00473 has distinct nuclear localization and participates in nuclear functions.
To investigate LINC00473 -interacting proteins, RNA pull-down assay was performed followed by a proteomic analysis of the LINC00473 -associated protein complex in A549 cells. The in vitro transcribed LINC00473 bound to beads were incubated with A549 nuclear extracts to purify LINC00473 RNA-protein complex. The LINC00473 -associated protein complex components were separated by SDS-PAGE (Figure 10A) and the protein identity was revealed by mass spectrometry (MS). A notable protein was a known CRTC interacting protein, NONO, with 115 peptides detected in this MS analysis (Table 4). To validate the physical interaction between LINC00473 and NONO, RNA pull-down was performed followed by Western blotting with NONO antibodies. NONO was readily detected in LINC00473 RNA pull-down complex but not in the control samples including LINC00473 antisense RNA (AS), LncRNA MEG3 and beads only (Figure 10B). An RNA immune- precipitation (RNA-IP) was also performed for the RNA-NONO complex using NONO antibodies and measured the amount of LINC00473 associated with NONO immune- precipitates. The immune-precipitated NONO protein levels were confirmed by Western blotting (Figure IOC). The qRT-PCR results showed significant enrichment of LINC00473, but not the negative control ASNS in NONO immune-precipitates (Figure 10D). These data indicate that NONO is an LINC00473 -associated protein.
NONO interacts with CRTC co-activators upon cAMP stimulation, which is essential for CREB-mediated transcription. Since LINC00473 physically interacted with NONO, LINC00473 appears to regulate NONO recruitment to CRTCs and promotes subsequent activation of CREB target gene transcription. The interaction of NONO and CRTC was tested when LINC00473 was either depleted or over-expressed using mammalian two-hybrid assays. Depletion of LINC00473 caused a reduced interaction of gal4-NONO and CRTC1,
which was indicated by reduced activation of a Gal4 promoter reporter (Figure 10E). Conversely, enhanced LINC00473 expression promoted NONO-CRTC1 interaction (Figure 10F). These data suggest that LINC00473 facilitates the recruitment of NONO to CRTC and subsequently promotes CREB-mediated transcription. To further examine whether LINC00473 regulates endogenous CRTC/CREB target genes, gene expression analysis was performed in lentiviral-based scrambled shRNA control and LINC00473 -depleted A549 cells as well as in retroviral -based vector control and LKB l -expressing A549 cells in Nanostring assays. LINC00473 depletion impaired expression of several known and potential CRTC/CREB targets including CTH, CPS1, DUSP4, FGA, NR4A2, PDE4B, PDE4D, PTGS2, PTP4A1, SIKl, SLC7A2, TESC and TFFI, whose expression were induced by LKB 1 loss (Figure 10G). Moreover, EDD9, a CRTC-CREB target gene implicated in regulating cell proliferation and metastasis, was down-regulated in LINC00473-depeleted A549 cells, although its expression was not significantly different between LKBl-mut and -wt cell lines. Furthermore, quantitative RT-PCR analysis showed that expression of exogenous LINC00473 in LKB l-wt H522 significantly promoted transcription of several CREB target genes such as CPS1, PDE4B, PTGS2 and PDE4D (Figure 17C). These data support a model where LINC00473 acts as a co-activator with CRTC/CREB in a positive feedback mechanism to maintain high steady-state levels and induce expression of other LKB 1- regulated targets (Figure 11).
Table 4: A list of top potential LINC00473-interacting protein candidates in A549 cells based on proteomic analysis.
Gene Gene Unique Total
Description
Symbol ID peptides peptides
DHX9 1660 DEAH (Asp-Glu-Ala-His) box helicase 9 59 251
HNRNPL 3191 heterogeneous nuclear ribonucleoprotein L 37 173
SFPQ 6421 splicing factor proline/glutamine-rich 34 166
ILF3 3609 interleukin enhancer binding factor 3, 90kDa 47 127
PTBP1 5725 polypyrimidine tract binding protein 1 26 118
NONO 4841 non-POU domain containing, octamer-binding 33 115
MATR3 9782 matrin 3 39 109
HNRNPM 4670 heterogeneous nuclear ribonucleoprotein M 41 101
YLPM1 56252 YLP motif containing 1 56 98
ASPH 444 aspartate beta-hydroxylase 35 87
ILF2 3608 interleukin enhancer binding factor 2 24 87
NCL 4691 nucleolin 31 76
HNRNPA2
Bl 3181 heterogeneous nuclear ribonucleoprotein A2/B 1 24 74
RRBP1 6238 ribosome binding protein 1 46 72
HNRNPH1 3187 heterogeneous nuclear ribonucleoprotein HI (H) 15 69
MYBBP1A 10514 MYB binding protein (PI 60) la 40 68
MYH9 4627 myosin, heavy chain 9, non-muscle 56 66
PRPF8 10594 pre-mRNA processing factor 8 59 65
RANBP2 5903 RAN binding protein 2 54 64 synaptotagmin binding, cytoplasmic RNA
SYNCRIP 10492 interacting protein 30 63
SNRNP200 23020 small nuclear ribonucleoprotein 200kDa (U5) 54 56
HNRNPR 10236 heterogeneous nuclear ribonucleoprotein R 27 54
HDLBP 3069 high density lipoprotein binding protein 44 52
HNRNPU 3192 heterogeneous nuclear ribonucleoprotein U 27 52
DDX21 9188 DEAD (Asp-Glu-Ala-Asp) box helicase 21 31 51
HNRNPF 3185 heterogeneous nuclear ribonucleoprotein F 12 50
RBMX 27316 RNA binding motif protein, X-linked 18 50
LRPPRC 10128 leucine -rich pentatricopeptide repeat containing 47 49
CLTC 1213 clathrin, heavy chain (He) 42 47
IQGAP1 8826 IQ motif containing GTPase activating protein 1 44 47
DDX54 79039 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 32 46
THRAP3 9967 thyroid hormone receptor associated protein 3 23 46
U2AF2 11338 U2 small nuclear RNA auxiliary factor 2 20 46
WDR33 55339 WD repeat domain 33 34 46
HNRNPK 3190 heterogeneous nuclear ribonucleoprotein K 21 45
SF3B1 23451 splicing factor 3b, subunit 1, 155kDa 36 45 cleavage and polyadenylation specific factor 1,
CPSF1 29894 160kDa 34 44
DDX5 1655 DEAD (Asp-Glu-Ala-Asp) box helicase 5 20 44
ELAVL1 1994 ELAV like RNA binding protein 1 20 43
HNRNPA1 heterogeneous nuclear ribonucleoprotein Al- L2 144983 like 2 9 43
DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-
DDX3X 1654 linked 23 42
SF3B2 10992 splicing factor 3b, subunit 2, 145kDa 30 42
DDX17 10521 DEAD (Asp-Glu-Ala-Asp) box helicase 17 26 41
DHX36 170506 DEAH (Asp-Glu-Ala-His) box polypeptide 36 26 41 staphylococcal nuclease and tudor domain
SND1 27044 containing 1 34 41
SF3B3 23450 splicing factor 3b, subunit 3, 130kDa 34 40
XRN2 22803 5'-3' exoribonuclease 2 30 40
EPRS 2058 glutamyl-prolyl-tRNA synthetase 37 39
HNRNPLL 92906 heterogeneous nuclear ribonucleoprotein L-like 22 39
DHX37 57647 DEAH (Asp-Glu-Ala-His) box polypeptide 37 32 38
EXAMPLE 10 - LINC00473 AS A CANCER BIOMARKER Lung cancer is the leading cause of cancer death. Progress in lung cancer treatment improvements will require improved predictive biomarkers so that cancer patients can be
provided with the most effective treatments available as well as a larger repertoire of therapeutic targets. A novel IncRNA, namely, LINC00473, is provided whose elevated expression is highly associated with the loss of the tumor suppressor LKB1 gene function, which is one of the most common mutational events in lung cancer. The gene expression and functional data provided herein support the potential utility of LINC00473 as a biomarker and as a therapeutic target for lung cancers with impaired LKB1 signaling. Moreover, mechanistic insights into LINC00473 as a critical nuclear regulator of gene expression in lung cancer are provided.
Recent studies reveal that specific IncRNA expression is associated with disease state, strongly supporting the utility of IncRNAs in clinical diagnosis and prognosis. Loss of LKB1 function in NSCLC cells caused differential responses to therapeutic agents in vitro and in animal studies. LKB 1 inactivation sensitized NSCLC cells to the metabolism drug phenformin and a COX2 inhibitor while conferred resistance to PI3K/Akt and MEK inhibitors. However, specific effective treatments are currently not available for patients with LKB1 -deficient lung cancer. A big barrier is the lack of reliable assessment for tumor LKB 1 inactivation that can be used in clinical trials for patient selection and treatment evaluation. Current clinical LKB1 analysis includes evaluation of LKB1 mutations through sequencing 9 coding exons and flanking region of the LKB1 gene as well as immunohistochemistry (IHC) assay of LKB 1 protein expression. However, LKB1 functional inactivation could result from mutations across the entire LKB1 gene, epigenetic silencing, or post-translational inactivation, posing a great challenge to detect LKB1 functional loss through direct genomic sequencing. Also, not all LKB1 mutations impair LKB1 function. LKB 1 IHC assay was shown for specific detection of LKB 1 protein loss; however, those LKB1 antibodies used were not highly specific. Recently, a 16-gene signature was reported to be capable of predicting tumor cells with LKB 1 inactivation, yet the expression of those individual genes is not completely correlated with the tumor LKB1 status and combined scoring of multiple genes for individual tumors require complicated analysis.
The invention provides that LINC00473 gene is induced in J 57-inactivated primary NSCLC samples and derived cell lines, supporting the concept that that LINC00473 expression could be used for predicting LKB1 functional status in clinically relevant FFPE tumor specimens. There are advantages of using LINC00473 as a surrogate marker for tumor LKB1 functional inactivation. First, LINC00473 expression is a functional readout for LKB1 inactivation; thus LINC00473 -based detection will be advantageous over direct sequencing of
the entire LKBl gene or IHC analysis of LKBl protein detection. A subset of human lung tumors without detectable mutations in the coding region of the LKBl gene showed positive staining for LINC00473. These tumors likely reflect scenarios where functional LKBl inactivation is caused by epigenetic affects such as promoter hypermethylation or functional suppression by other mechanisms, including alterations in other components of the LKBl pathway. For example, BRAF activating mutations were shown to suppress LKBl kinase activity and thus inactivated LKB l signaling. On the other hand, a subset of tumors with LKBl mutations had non-detectable LINC00473 expression. These tumors may have LKBl mutations that have no significant impact on LKB l functions. Also, tumor cells having the mutation(s) on one allele of the LKBl gene may express sufficient level of functional LKB l proteins. Second, a significant number of LKBl -wt stromal cells within tumors can obscure detection of LKBl -null tumor cells in LKB l IHC studies. Since LINC00473 normally expresses at a low or undetectable level but at a significantly high level in LKBl -inactivated cells, detection of up-regulated LINC00473 expression will not be affected by the presence of stromal cells. Third, LINC00473 has sufficiently high expression in LKBl -inactivated lung cancer and can be detected in biopsy specimens in the clinic.
Patients with high LINC00473 -expressing lung cancers had worse survival, suggesting that LINC00473 likely confers lung cancer cells with aggressive behaviors. Interestingly, a significant number of IncRNAs in human genome seem to have arisen within the primate lineage based on sequence conservation and LINC00473 belongs to this group. It is unclear whether LINC00473 may contribute to any unique features associated with human cancers. LINC00473 plays a role in maintaining human NSCLC cell growth and survival. LINC00473 has low or undetectable expression in normal tissues; therefore, targeting LINC00473 expression is an attractive approach of specifically blocking lung cancer without significantly affecting normal tissues. Currently, anticancer drugs mainly target DNA or proteins in tumor cells. Therapeutic development for RNA-based targeting is in the infancy but various new approaches are being explored such as antisense oligonucleotides and RNA interference (RNAi). Progress has been made to improve delivery and specificity. For example, RNAi therapeutics based on RNAi and lipid nanoparticles (LNP) has been tested in humans supporting further development of RNA targeting drugs in treating cancers. Therefore, targeting LINC00473 expression for blocking NSCLC provides a novel approach for treating NSCLC.
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.
REFERENCES Ulitsky, I. & Bartel, D.P. lincRNAs: genomics, evolution, and mechanisms. Cell 154, 26-46 (2013).
Li, C.H. & Chen, Y. Targeting long non-coding RNAs in cancers: progress and prospects. IntJBiochem Cell Biol 45, 1895-910 (2013).
Geisler, S. & Coller, J. RNA in unexpected places: long non-coding RNA functions in diverse cellular contexts. Nat RevMol Cell Biol (2013).
Moran, V.A., Perera, R.J. & Khalil, A.M. Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs. Nucleic Acids Res 40, 6391-400 (2012).
Wapinski, O. & Chang, H.Y. Long noncoding RNAs and human disease. Trends Cell Biol 21, 354-61 (2011).
Jemal, A., Bray, F., Center, M.M., Ferlay, J., Ward, E. & Forman, D. Global cancer statistics. CA Cancer J Clin 61, 69-90 (2011).
Villaflor, V.M. & Salgia, R. Targeted agents in non-small cell lung cancer therapy: What is there on the horizon? J Carcinog 12, 7 (2013).
Savas, P., Hughes, B. & Solomon, B. Targeted therapy in lung cancer: IPASS and beyond, keeping abreast of the explosion of targeted therapies for lung cancer. J Thorac Dis 5, S579-S592 (2013).
Minuti, G., D'Incecco, A. & Cappuzzo, F. Targeted therapy for NSCLC with driver mutations. Expert Opin Biol Ther 13, 1401-12 (2013).
Vaahtomeri, K. & Makela, T.P. Molecular mechanisms of tumor suppression by LKBl . FEBS Lett 585, 944-51 (2011).
Sanchez-Cespedes, M. The role of LKBl in lung cancer. Fam Cancer 10, 447-53 (2011).
Shackelford, D.B. & Shaw, R.J. The LKBl-AMPK pathway: metabolism and growth control in tumour suppression. Nat Rev Cancer 9, 563-75 (2009).
Ji, H., Ramsey, M.R., Hayes, D.N., Fan, C, McNamara, K., Kozlowski, P., Torrice, C, Wu, M.C., Shimamura, T., Perera, S.A., Liang, M.C., Cai, D., Naumov, G.N., Bao, L., Contreras, CM., Li, D., Chen, L., Krishnamurthy, J., Koivunen, J., Chirieac, L.R., Padera, R.F., Bronson, R.T., Lindeman, N.I., Christiani, D.C., Lin, X., Shapiro, G.I., Janne, P. A., Johnson, B.E., Meyerson, M., Kwiatkowski, D.J., Castrillon, D.H.,
Bardeesy, N., Sharpless, N.E. & Wong, K.K. LKB 1 modulates lung cancer differentiation and metastasis. Nature 448, 807-10 (2007).
Chen, Z., Cheng, K., Walton, Z., Wang, Y., Ebi, H., Shimamura, T., Liu, Y., Tupper, T., Ouyang, J., Li, J., Gao, P., Woo, M.S., Xu, C, Yanagita, M., Altabef, A., Wang, S., Lee, C, Nakada, Y., Pena, C.G., Sun, Y., Franchetti, Y., Yao, C, Saur, A., Cameron, M.D., Nishino, M., Hayes, D.N., Wilkerson, M.D., Roberts, P.J., Lee, C.B., Bardeesy, N., Butaney, M., Chirieac, L.R., Costa, D.B., Jackman, D., Sharpless, N.E., Castrillon, D.H., Demetri, G.D., Janne, P.A., Pandolfi, P.P., Cantley, L.C., Kung, A.L., Engelman, J. A. & Wong, K.K. A murine lung cancer co-clinical trial identifies genetic modifiers of therapeutic response. Nature 483, 613-7 (2012).
Liu, Y., Marks, K., Cowley, G.S., Carretero, J., Liu, Q., Nieland, T.J., Xu, C, Cohoon, T.J., Gao, P., Zhang, Y., Chen, Z., Altabef, A.B., Tchaicha, J.H., Wang, X., Choe, S., Driggers, E.M., Zhang, J., Bailey, S.T., Sharpless, N.E., Hayes, D.N., Patel, N.M., Janne, P. A., Bardeesy, N., Engelman, J.A., Manning, B.D., Shaw, R.J., Asara, J.M., Scully, R., Kimmelman, A., Byers, L.A., Gibbons, D.L., Wistuba, II, Heymach, J.V., Kwiatkowski, D.J., Kim, W.Y., Kung, A.L., Gray, N.S., Root, D.E., Cantley, L.C. & Wong, K.K. Metabolic and functional genomic studies identify deoxythymidylate kinase as a target in LKB 1 -mutant lung cancer. Cancer Discov 3, 870-9 (2013).
Shackelford, D.B., Abt, E., Gerken, L., Vasquez, D.S., Seki, A., Leblanc, M., Wei, L., Fishbein, M.C., Czernin, J., Mischel, P.S. & Shaw, R.J. LKB 1 inactivation dictates therapeutic response of non-small cell lung cancer to the metabolism drug phenformin. Cancer Cell 23, 143-58 (2013).
Reitmair, A., Sachs, G., Im, W.B. & Wheeler, L. C6orfl76: a novel possible regulator of cAMP-mediated gene expression. Physiol Genomics 44, 152-61 (2012).
Chen, Z., Chen, J., Gu, Y., Hu, C, Li, J.L., Lin, S., Shen, H., Cao, C, Gao, R., Li, J., Ha, P.K., Kaye, F.J., Griffin, J.D. & Wu, L. Aberrantly activated AREG-EGFR signaling is required for the growth and survival of CRTC1-MAML2 fusion-positive mucoepidermoid carcinoma cells. Oncogene (2013).
Wu, L., Liu, J., Gao, P., Nakamura, M., Cao, Y., Shen, H. & Griffin, J.D. Transforming activity of MECT1-MAML2 fusion oncoprotein is mediated by constitutive CREB activation. Embo J 24, 2391-402 (2005).
Gu, Y., Lin, S., Li, J.L., Nakagawa, H., Chen, Z., Jin, B., Tian, L., Ucar, D.A., Shen, H., Lu, J., Hochwald, S.N., Kaye, F.J. & Wu, L. Altered LKB1 /CREB -regulated
transcription co-activator (CRTC) signaling axis promotes esophageal cancer cell migration and invasion. Oncogene 31, 469-79 (2012).
21. Komiya, T., Coxon, A., Park, Y., Chen, W.D., Zajac-Kaye, M., Meltzer, P., Karpova, T.
& Kaye, F.J. Enhanced activity of the CREB co-activator Crtcl in LKB1 null lung cancer. Oncogene (2009).
22. Northcott, P.A., Shih, D.J., Remke, M., Cho, Y.J., Kool, M, Hawkins, C, Eberhart, C.G., Dubuc, A., Guettouche, T., Cardentey, Y., Bouffet, E., Pomeroy, S.L., Marra, M., Malkin, D., Rutka, J.T., Korshunov, A., Pfister, S. & Taylor, M.D. Rapid, reliable, and reproducible molecular sub-grouping of clinical medulloblastoma samples. Acta Neuropathol 123, 615-26 (2012).
23. Beard, R.E., Abate-Daga, D., Rosati, S.F., Zheng, Z., Wunderlich, J.R., Rosenberg, S.A. & Morgan, R.A. Gene Expression Profiling using Nanostring Digital RNA Counting to Identify Potential Target Antigens for Melanoma Immunotherapy. Clin Cancer Res 19, 4941-50 (2013).
24. Geiss, G.K., Bumgarner, R.E., Birditt, B., Dahl, T., Dowidar, N., Dunaway, D.L., Fell,
H.P., Ferree, S., George, R.D., Grogan, T., James, J. J., Maysuria, M., Mitton, J.D., Oliveri, P., Osborn, J.L., Peng, T., Ratcliffe, A.L., Webster, P.J., Davidson, E.H., Hood, L. & Dimitrov, K. Direct multiplexed measurement of gene expression with color- coded probe pairs. Nat Biotechnol 26, 317-25 (2008).
25. Malkov, V.A., Serikawa, K.A., Balantac, N., Watters, J., Geiss, G., Mashadi-Hossein,
A. & Fare, T. Multiplexed measurements of gene signatures in different analytes using the Nanostring nCounter Assay System. BMC Res Notes 2, 80 (2009).
26. Sestak, L, Dowsett, M., Zabaglo, L., Lopez-Knowles, E., Ferree, S., Cowens, J.W. & Cuzick, J. Factors predicting late recurrence for estrogen receptor-positive breast cancer. J Natl Cancer Inst 105, 1504-11 (2013).
27. Filipits, M., Nielsen, T.O., Rudas, M., Greil, R., Stoger, H., Jakesz, R., Bago-Horvath, Z., Dietze, O., Regitnig, P., Gruber-Rossipal, C, Muller-Holzner, E., Singer, C.F., Mlineritsch, B., Dubsky, P., Bauernhofer, T., Hubalek, M., Knauer, M., Trapl, H., Fesl, C, Schaper, C, Ferree, S., Liu, S., Cowens, J.W., Gnant, M., Austrian, B. & Colorectal Cancer Study, G. The PAM50 risk-of-recurrence score predicts risk for late distant recurrence after endocrine therapy in postmenopausal women with endocrine- responsive early breast cancer. Clin Cancer Res 20, 1298-305 (2014).
Gittelman, M.C., Hertzman, B., Bailen, J., Williams, T., Koziol, L, Henderson, R.J., Efros, M., Bidair, M. & Ward, J.F. PCA3 molecular urine test as a predictor of repeat prostate biopsy outcome in men with previous negative biopsies: a prospective multicenter clinical study. J Urol 190, 64-9 (2013).
Esteller, M., Avizienyte, E., Corn, P.G., Lothe, R.A., Baylin, S.B., Aaltonen, L A. & Herman, J.G. Epigenetic inactivation of LKB1 in primary tumors associated with the Peutz-Jeghers syndrome. Oncogene 19, 164-8 (2000).
Zheng, B., Jeong, J.H., Asara, J.M., Yuan, Y.Y., Granter, S.R., Chin, L. & Cantley, L.C. Oncogenic BRAF negatively regulates the tumor suppressor LKB 1 to promote melanoma cell proliferation. Mol Cell 33, 237-47 (2009).
Nakada, Y., Stewart, T.G., Pena, C.G., Zhang, S., Zhao, N., Bardeesy, N., Sharpless, N.E., Wong, K.K., Hayes, D.N. & Castrillon, D.H. The LKB1 tumor suppressor as a biomarker in mouse and human tissues. PLoS One 8, e73449 (2013).
Tonon, G, Modi, S., Wu, L., Kubo, A., Coxon, A.B., Komiya, T., O'Neil, K., Stover, K., El-Naggar, A., Griffin, J.D., Kirsch, I.R. & Kaye, F.J. t(l I; 19)(q21;pl3) translocation in mucoepidermoid carcinoma creates a novel fusion product that disrupts a Notch signaling pathway. Nat Genet 33, 208-13 (2003).
Barretina, J., Caponigro, G., Stransky, N., Venkatesan, K., Margolin, A. A., Kim, S., Wilson, C.J., Lehar, J., Kryukov, G.V., Sonkin, D., Reddy, A., Liu, M., Murray, L., Berger, M.F., Monahan, J.E., Morais, P., Meltzer, J., Korejwa, A., Jane-Valbuena, J., Mapa, F.A., Thibault, J., Bric-Furlong, E., Raman, P., Shipway, A., Engels, I.H., Cheng, J., Yu, G.K., Yu, J., Aspesi, P., Jr., de Silva, M., Jagtap, K., Jones, M.D., Wang, L., Hatton, C, Palescandolo, E., Gupta, S., Mahan, S., Sougnez, C, Onofrio, R.C., Liefeld, T., MacConaill, L., Winckler, W., Reich, M., Li, N., Mesirov, J.P., Gabriel, S.B., Getz, G, Ardlie, K., Chan, V., Myer, V.E., Weber, B.L., Porter, J., Warmuth, M., Finan, P., Harris, J.L., Meyerson, M., Golub, T.R., Morrissey, M.P., Sellers, W.R., Schlegel, R. & Garraway, L.A. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 483, 603-7 (2012).
Pfister, T.D., Reinhold, W.C., Agama, K., Gupta, S., Khin, S.A., Kinders, R.J., Parchment, R.E., Tomaszewski, J.E., Doroshow, J.H. & Pommier, Y. Topoisomerase I levels in the NCI-60 cancer cell line panel determined by validated ELISA and microarray analysis and correlation with indenoisoquinoline sensitivity. Mol Cancer Ther 8, 1878-84 (2009).
35. Bittinger, M.A., McWhinnie, E., Meltzer, J., lourgenko, V., Latario, B., Liu, X., Chen, C.H., Song, C, Garza, D. & Labow, M. Activation of cAMP response element- mediated gene expression by regulated nuclear transport of TORC proteins. Curr Biol 14, 2156-61 (2004).
36. Ahn, S., Olive, M., Aggarwal, S., Krylov, D., Ginty, D.D. & Vinson, C. A dominant- negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol 18, 967-77 (1998).
37. Kaufman, J.M., Amann, J.M., Park, K., Arasada, R.R., Li, H., Shyr, Y. & Carbone, D.P.
LKB1 Loss induces characteristic patterns of gene expression in human tumors associated with NRF2 activation and attenuation of PI3K-AKT. J Thorac Oncol 9, 794-
804 (2014).
38. Ito, L, Ji, L., Tanaka, F., Saito, Y., Gopalan, B., Branch, CD., Xu, K., Atkinson, E.N., Bekele, B.N., Stephens, L.C, Minna, J.D., Roth, J.A. & Ramesh, R. Liposomal vector mediated delivery of the 3p FUS1 gene demonstrates potent antitumor activity against human lung cancer in vivo. Cancer Gene Ther 11, 733-9 (2004).
39. Gutschner, T., Hammerle, M., Eissmann, M., Hsu, J., Kim, Y., Hung, G., Revenko, A., Arun, G., Stentrup, M., Gross, M., Zornig, M., MacLeod, A.R., Spector, D.L. & Diederichs, S. The noncoding RNA MALATl is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer Res 73, 1180-9 (2013).
40. Groskopf, J., Aubin, S.M., Deras, I.L., Blase, A., Bodrug, S., Clark, C, Brentano, S.,
Mathis, J., Pham, J., Meyer, T., Cass, M., Hodge, P., Macairan, M.L., Marks, L.S. & Rittenhouse, H. APTJJVIA PCA3 molecular urine test: development of a method to aid in the diagnosis of prostate cancer. Clin Chem 52, 1089-95 (2006).
41. Lin, S., Tian, L., Shen, H., Gu, Y., Li, J.L., Chen, Z., Sun, X., James You, M. & Wu, L.
DDX5 is a positive regulator of oncogenic NOTCH1 signaling in T cell acute lymphoblastic leukemia. Oncogene 32, 4845-53 (2013).
42. Yang, F., Huo, X.S., Yuan, S.X., Zhang, L., Zhou, W.P., Wang, F. & Sun, S.H.
Repression of the long noncoding RNA-LET by histone deacetylase 3 contributes to hypoxia-mediated metastasis. Mol Cell 49, 1083-96 (2013).
43. Rinn, J.L., Kertesz, M., Wang, J.K., Squazzo, S.L., Xu, X., Brugmann, S.A.,
Goodnough, L.H., Helms, J.A., Farnham, P.J., Segal, E. & Chang, H.Y. Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell 129, 1311-23 (2007).
44. Batista, P.J. & Chang, H.Y. Long noncoding RNAs: cellular address codes in development and disease. Cell 152, 1298-307 (2013).
45. Lin, S., Shen, H., Li, J.L., Tang, S., Gu, Y., Chen, Z., Hu, C, Rice, J.C., Lu, J. & Wu, L. Proteomic and functional analyses reveal the role of chromatin reader SFMBT1 in regulating epigenetic silencing and the myogenic gene program. J Biol Chem 288,
6238-47 (2013).
46. Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S. & Mesirov, J.P. Gene set enrichment analysis: a knowledge based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA 102, 15545-50 (2005).
47. Tang, M., Shen, H., Jin, Y., Lin, T., Cai, Q., Pinard, M.A., Biswas, S., Tran, Q., Li, G, Shenoy, A.K., Tongdee, E., Lin, S., Gu, Y., Law, B.K., Zhou, L., McKenna, R., Wu, L. & Lu, J. The Malignant Brain Tumor (MBT) Domain Protein SFMBT1 Is an Integral Histone Reader Subunit of the LSD1 Demethylase Complex for Chromatin Association and Epithelial-to-mesenchymal Transition. J Biol Chem 288, 27680-91 (2013).
48. Hoheisel, Microarray technology: beyond transcript profiling and genotype analysis, Nature Reviews Genetics 7, 200-210 (2006).
49. Reinhard Waehler, Stephen J. Russell & David T. Curiel, Engineering targeted viral vectors for gene therapy, Nature Reviews Genetics 8, 573-587 (2007).
50. Hao Yin, Rosemary L. Kanasty, Ahmed A. Eltoukhy, Arturo J. Vegas, J. Robert Dorkin
& Daniel G. Anderson, Non-viral vectors for gene-based therapy, Nature Reviews
Genetics 15, 541-555 (2014).
51. Erkki Ruoslahti, Sangeeta N. Bhatia and Michael J. Sailor, Targeting of drugs and nanoparticles to tumors, Journal of Cell Biology, 188(6): 759-768.
52. Amer, Gene therapy for cancer: present status and future perspective, Molecular and
Cellular Therapies, 2:27 (2014).
53. Ling, H., Fabbri, M. and Calin, G. A., MicroRNAs and other non-coding RNAs as targets for anticancer drug development, Nature Reviews Drug Discovery, Vol. 12, 847-
865 (2013).
54. Naito, Y. and Ui-Tei, K., siRNA Design Software for a Target Gene-Specific RNA
Interference, Frontiers in Genetics, 3 : 102 (2012).
Yin, H., Kanasty, R. L., Eltoukhy, A. A., Vegas, A. J., Dorkin, J. R. & Anderson, D. G., Non-viral vectors for gene-based therapy, Nature Reviews Genetics 15, 541-555 (2014).
Janku, F., Stewart, D.J., Kurzrock, R. Targeted therapy in non-small-cell lung cancer—is it becoming a reality? Nat Rev Clin Oncol. 2010; 7:401-414.
Koivunen, J.P., et al. EML4-ALK fusion gene and efficacy of an ALK kinase inhibitor in lung cancer. Clin Cancer Res. 2008; 14:4275-4283.
Paez, J.G., et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science. 2004; 304: 1497-1500.
Alessi, D.R., Sakamoto, K., Bayascas, J.R. LKBl -dependent signaling pathways. Annu Rev Biochem. 2006; 75: 137-163.
Hemminki, A., et al. A serine/threonine kinase gene defective in Peutz-Jeghers syndrome. Nature. 1998; 391 : 184-187.
Claims
1. A method of treating a subject having a cancer involving loss or reduction in LKBl function, the method comprising:
(a) determining the level of LINC00473 in:
i) a test sample obtained from the subject, and
ii) optionally a control sample;
(b) optionally obtaining a reference value corresponding to a level LINC00473, wherein the level of LINC00473 in the test sample relative to the control sample or the reference value indicates the presence or absence of the cancer involving loss or reduction in LKB l function in the subject; and
(c) identifying the subject as having the cancer involving loss or reduction in LKBl function based on the level of LINC00473 in the test sample and administering an effective amount of a LINC00473 inhibitor to the subject to treat the cancer, or
(d) identifying the subject as having the cancer not involving loss or reduction in LKBl function based on the level of LINC00473 in the test sample and withholding the administration of the LINC00473 inhibitor to the subject, and optionally, administering a cancer therapy other than the LINC00473 inhibitor to the subject to treat the cancer.
2. The method of claim 1, wherein the control sample is obtained from:
a) an individual belonging to the same species as the subject and not having cancer,
b) an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in LKBl function, or
c) the subject prior to having the cancer,
and the method comprises identifying the subject as having the cancer involving loss or reduction in LKB l based on higher level of LINC00473 in the test sample as compared to that of the control sample.
3. The method of claim 1, wherein the control sample is obtained from an individual belonging to the same species as the subject and known to have a cancer involving loss or reduction in LKBl function and the method comprises identifying the subject as
having the cancer involving loss or reduction in LKBl based on the level of LINC00473 in the test sample not being different than that of the control sample.
4. The method of claim 1, wherein the reference value corresponds to the level of LINC00473 associated with:
a) the absence of a cancer, or
b) the presence of a cancer not involving loss or reduction in LKB 1 function and the method comprises identifying the subject as having the cancer involving loss or reduction in LKBl based on higher level of LINC00473 in the test sample as compared to the reference value.
5. The method of claim 1, wherein the reference value corresponds to the level of LINC00473 associated with the presence of a cancer involving loss or reduction in LKB l function and the method comprises identifying the subject as having the cancer involving loss or reduction in LKBl based on the level of LINC00473 in the test sample not being different than the reference value.
6. The method of claim 1, wherein the LINC00473 inhibitor is a small-inhibitory RNA (siRNA), short hairpin RNA (shRNA), bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme, aptamer or small molecule.
7. The method of claim 6, wherein the LINC00473 inhibitor is the siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme, or aptamer and is encoded by a nucleic acid.
8. The method of claim 7, wherein the LINC00473 inhibitor is administered to the subject via gene therapy.
9. The method of claim 1, wherein a cancer therapy other than the LINC00473 inhibitor is administered to the subject identified as having the cancer not involving loss or reduction in LKB l activity.
10. The method of claim 9, wherein the cancer therapy other than the LINC00473 inhibitor is radiotherapy, chemotherapy, surgery, immunotherapy, kinase inhibition, monoclonal antibody therapy or a combination thereof.
11. The method of claim 1, wherein a cancer therapy in addition to the LINC00473 inhibitor is administered to the subject identified as having the cancer involving loss or reduction in LKB 1.
12. The method of claim 11, wherein the cancer therapy in addition to the LINC00473 inhibitor is radiotherapy, chemotherapy, surgery, immunotherapy, kinase inhibition, monoclonal antibody therapy or a combination thereof.
13. The method of claim 1, wherein the step of determining the level of LINC00473 is performed by Northern blot analysis, quantitative or semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), ligase chain reaction (LCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA).
14. The method of claim 1, wherein the subject is a mammal.
15. The method of claim 14, wherein the mammal is a human, ape, canine, pig, bovine, rodent, or feline.
16. The method of claim 1, wherein the control sample and the test sample are obtained from the same type of an organ or tissue.
17. The method of claim 16, wherein the organ or tissue is brain, eyes, pineal gland, pituitary gland, thyroid gland, parathyroid glands, thorax, heart, lung, esophagus, thymus gland, pleura, adrenal glands, appendix, gall bladder, urinary bladder, large intestine, small intestine, kidneys, liver, pancreas, spleen, stoma, ovaries, uterus, testes, prostate, skin, or blood.
18. The method of claim 16, wherein the organ or tissue is lung.
19. The method of any one of claims 1-18, wherein the levels of LINC00473 are determined my measuring levels of SEQ ID NO: 1, SEQ ID NO: 2 or both SEQ ID NO: 1 and SEQ ID NO: 2 in the test sample and/or control sample.
20. A pharmaceutical composition comprising a LINC00473 inhibitor.
21. The pharmaceutical composition of claim 20, wherein the LINC00473 inhibitor is an siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme, aptamer or small molecule.
22. The pharmaceutical composition of claim 21, wherein the siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme or aptamer is encoded by a nucleic acid.
23. A nucleic acid vector comprising the nucleic acid encoding the siRNA, shRNA, bifunctional RNA, antisense oligonucleotide, ribozyme, deoxyribozyme or aptamer of claim 22.
24. The method of claims 1-18, wherein the cancer is non-small cell carcinoma, squamous cell carcinoma, large cell carcinoma, mucoepidermoid carcinoma, bronchioloalveolar adenocarcinoma, mixed adenosquamous carcinoma or undifferentiated carcinoma.
25. The method of claim 19, wherein the cancer is non-small cell carcinoma, squamous cell carcinoma, large cell carcinoma, mucoepidermoid carcinoma, bronchioloalveolar adenocarcinoma, mixed adenosquamous carcinoma or undifferentiated carcinoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/564,740 US10415095B2 (en) | 2015-04-10 | 2016-04-11 | LncRNA serves as a biomarker and therapeutic target |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562145825P | 2015-04-10 | 2015-04-10 | |
| US62/145,825 | 2015-04-10 | ||
| US201662320510P | 2016-04-09 | 2016-04-09 | |
| US62/320,510 | 2016-04-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016164884A1 true WO2016164884A1 (en) | 2016-10-13 |
Family
ID=57072743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/026897 Ceased WO2016164884A1 (en) | 2015-04-10 | 2016-04-11 | Lncrna serves as a biomarker and therapeutic target |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10415095B2 (en) |
| WO (1) | WO2016164884A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371136A (en) * | 2018-12-28 | 2019-02-22 | 北京泱深生物信息技术有限公司 | One kind lncRNA relevant to adenocarcinoma of lung and its application |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107881249B (en) * | 2017-12-18 | 2020-05-15 | 中国农业科学院北京畜牧兽医研究所 | Application of lncRNA and target gene thereof in breeding high-quality livestock and poultry variety |
| KR102915151B1 (en) * | 2019-04-15 | 2026-01-19 | 세르비조 갈레고 데 사우데 | In vitro method for diagnosing or predicting the prognosis of colon cancer or its precancerous stage |
| KR102238594B1 (en) * | 2019-06-07 | 2021-04-08 | 한양대학교 산학협력단 | Pharmaceutical composition for preventing or treating squamos cell carcinoma containing expression inhibitor of HERES |
| CN111321226B (en) * | 2020-03-03 | 2023-03-17 | 武汉轻工大学 | Application of nucleic acid for detecting or inhibiting LncRNA PPP1R14B-AS1 |
| CN112831497B (en) * | 2020-05-19 | 2023-07-14 | 中南大学湘雅医院 | A novel lncRNA and its inhibitors, diagnostic reagents, drugs and applications |
| CN112553208B (en) * | 2020-12-31 | 2023-09-26 | 重庆市畜牧科学院 | New long-chain non-coding RNA gene and application thereof in preparation of reagent for detecting or diagnosing early-stage melanosis |
| JP7840033B2 (en) * | 2021-11-02 | 2026-04-03 | 学校法人日本医科大学 | Oxaliplatin-induced peripheral neuropathy biomarkers |
| AU2023293118A1 (en) | 2022-06-15 | 2025-01-02 | Genetic Intelligence, Inc | Pyridazinone-derived compounds for the modulation of myc and for medical uses |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130178428A1 (en) * | 2011-11-30 | 2013-07-11 | Dave S.B. HOON | Long noncoding rna (lncrna) as a biomarker and therapeutic marker in cancer |
| WO2015024986A1 (en) * | 2013-08-20 | 2015-02-26 | Vib Vzw | INHIBITION OF A lncRNA FOR TREATMENT OF MELANOMA |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130323835A1 (en) * | 2009-07-15 | 2013-12-05 | Zirus, Inc. | Mammalian Genes Involved in Infection |
| HK1199068A1 (en) | 2011-08-03 | 2015-06-19 | 西格诺药品有限公司 | Identification of gene expression profile as a predictive biomarker for lkb1 status |
-
2016
- 2016-04-11 US US15/564,740 patent/US10415095B2/en active Active
- 2016-04-11 WO PCT/US2016/026897 patent/WO2016164884A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130178428A1 (en) * | 2011-11-30 | 2013-07-11 | Dave S.B. HOON | Long noncoding rna (lncrna) as a biomarker and therapeutic marker in cancer |
| WO2015024986A1 (en) * | 2013-08-20 | 2015-02-26 | Vib Vzw | INHIBITION OF A lncRNA FOR TREATMENT OF MELANOMA |
Non-Patent Citations (3)
| Title |
|---|
| DATABASE Genbank [O] 15 March 2015 (2015-03-15), "Homo sapiens long intergenic non-protein coding RNA 473 (LINC00473), transcript variant 1, long non-coding RNA", XP055322740, Database accession no. NR_026860.1 * |
| LIANG ET AL.: "Non-coding RNA LINC00473 mediates decidualization of human endometrial stromal cells in response to cAMP signaling", SCIENTIFIC REPORTS, vol. 6, 7 March 2016 (2016-03-07), pages 1 - 9, XP055322742 * |
| REITMAIR ET AL.: "C6orf176: a novel possible regulator of cAMP-mediated gene expression", PHYSIOLOGICAL GENOMICS, vol. 44, no. 2, 2012, pages 152 - 161, XP055322734 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371136A (en) * | 2018-12-28 | 2019-02-22 | 北京泱深生物信息技术有限公司 | One kind lncRNA relevant to adenocarcinoma of lung and its application |
| CN109371136B (en) * | 2018-12-28 | 2021-07-02 | 青岛泱深生物医药有限公司 | Lung adenocarcinoma-related lncRNA and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20180112272A1 (en) | 2018-04-26 |
| US10415095B2 (en) | 2019-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10415095B2 (en) | LncRNA serves as a biomarker and therapeutic target | |
| Yang et al. | Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer | |
| Zhu et al. | Elevated TRIP13 drives the AKT/mTOR pathway to induce the progression of hepatocellular carcinoma via interacting with ACTN4 | |
| Chen et al. | cAMP/CREB-regulated LINC00473 marks LKB1-inactivated lung cancer and mediates tumor growth | |
| Rong et al. | Circular RNA CircEYA3 induces energy production to promote pancreatic ductal adenocarcinoma progression through the miR-1294/c-Myc axis | |
| US9410206B2 (en) | Long noncoding RNA (lncRNA) as a biomarker and therapeutic marker in cancer | |
| Fu et al. | MicroRNA-222-3p/GNAI2/AKT axis inhibits epithelial ovarian cancer cell growth and associates with good overall survival | |
| CA2835179A1 (en) | Markers for cancer prognosis and therapy and methods of use | |
| Ren et al. | Long non-coding RNA MIR155HG knockdown suppresses cell proliferation, migration and invasion in NSCLC by upregulating TP53INP1 directly targeted by miR-155-3p and miR-155-5p. | |
| WO2017008046A1 (en) | Loss of transcriptional fidelity leads to immunotherapy resistance in cancers | |
| EP2681330B1 (en) | Use of the olfactomedin-4 protein (olfm4) in colorectal cancer diagnosis | |
| CN105435228A (en) | New anti-tumor application and anti-tumor preparation of arsenic trioxide | |
| Mao et al. | Salinomycin reduces epithelial–mesenchymal transition-mediated multidrug resistance by modifying long noncoding RNA HOTTIP expression in gastric cancer cells | |
| Wu et al. | Long non-coding RNA CCAT2 promotes the development of esophageal squamous cell carcinoma by inhibiting miR-200b to upregulate the IGF2BP2/TK1 axis | |
| Du et al. | Hsa_circ_0125356 promotes gemcitabine resistance by modulating WNT canonical and non-canonical pathways via miR-582-5p/FGF9 axis in non-small cell lung cancer | |
| WO2010040083A2 (en) | Gene expression predictors of chemoresistance | |
| Bae et al. | A new KSRP-binding compound suppresses distant metastasis of colorectal cancer by targeting the oncogenic KITENIN complex | |
| Wei et al. | RETRACTED ARTICLE: MicroRNA-503 Inhibits Non-Small Cell Lung Cancer Progression By Targeting PDK1/PI3K/AKT Pathway | |
| Song et al. | circANKRD28 inhibits cisplatin resistance in non‐small‐cell lung cancer through the miR‐221‐3p/SOCS3 axis | |
| JP2022506463A (en) | How to Treat Cancer with Farnesyltransferase Inhibitors | |
| US20180148789A1 (en) | Methods for treating and assessing tumor invasion and metastasis | |
| Fu et al. | The molecular mechanism of circRHOBTB3 inhibits the proliferation and invasion of epithelial ovarian cancer by serving as the ceRNA of miR-23a-3p | |
| Dong et al. | Effects of miR-143 overexpression on proliferation, apoptosis, EGFR and downstream signaling pathways in PC9/GR cell line. | |
| CN114058699B (en) | Application of PPDPF in pancreatic cancer diagnosis and medicine preparation | |
| WO2019052708A1 (en) | Mafg as a potential therapeutic target to restore chemosensitivity in platinum-resistant cancer cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16777471 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15564740 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16777471 Country of ref document: EP Kind code of ref document: A1 |


