WO2016161153A2 - Prognostic and diagnostic methods for colorectal cancer - Google Patents

Prognostic and diagnostic methods for colorectal cancer Download PDF

Info

Publication number
WO2016161153A2
WO2016161153A2 PCT/US2016/025334 US2016025334W WO2016161153A2 WO 2016161153 A2 WO2016161153 A2 WO 2016161153A2 US 2016025334 W US2016025334 W US 2016025334W WO 2016161153 A2 WO2016161153 A2 WO 2016161153A2
Authority
WO
WIPO (PCT)
Prior art keywords
rasgrpl
cancer
level
egfr
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/025334
Other languages
French (fr)
Other versions
WO2016161153A3 (en
Inventor
Jeroen ROOSE
Phillipe DEPEILLE
Robert Warren
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to US15/563,493 priority Critical patent/US10676792B2/en
Publication of WO2016161153A2 publication Critical patent/WO2016161153A2/en
Publication of WO2016161153A3 publication Critical patent/WO2016161153A3/en
Anticipated expiration legal-status Critical
Priority to US16/878,973 priority patent/US20200283856A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57535Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • CRC Colorectal cancer
  • EGFR epidermal growth factor receptor
  • a method for selecting a drug therapy for a subject with cancer e.g., colorectal cancer, pancreatic cancer, lung cancer or breast cancer.
  • the method includes (a) determining the level of RasGRPl in a sample obtained from the subject; and (b) selecting a non anti-EGFR therapy for the subject if the level of RasGRPl is higher than a threshold value.
  • the sample from the subject can be a tumor biopsy sample, a circulating tumor cell, or a fine needle aspirate,.
  • the level of RasGRPl can be the level, amount or concentration of RasGRPl polynucleotide or the level, amount or concentration of RasGRPl polypeptide in the sample.
  • the level of RasGRPl polynucleotide is determined using an amplification assay or a hybridization assay.
  • the amplification assay is a probe-based quantitative amplification assay, such as a TaqMan ® assay.
  • the level of RasGRPl polypeptide is determined using an immunoassay, immunohistochemistry, western blot or mass spectrometry.
  • the method can also include determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, Kl 17N, A146P, A146T or A146V.
  • the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37
  • the method can also include administering an effective amount of the non anti-EGFR therapy to the subject to alleviate at least one symptom of the cancer.
  • the non anti-EGFR therapy can be a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGR inhibitor or other kinase inhibitor.
  • a method for predicting a likelihood of a good prognosis for a subject with cancer such as colorectal cancer, pancreatic cancer, lung cancer or breast cancer.
  • the method includes (a) determining the level of RasGRPl in a sample obtained from the subject; and (b) predicting a likelihood of a good prognosis for the subject if the level of RasGRPl is higher than a threshold value.
  • a good prognosis includes overall survival, progression-free survival, or response to therapy. If the level of RasGRPl is lower than a threshold value, a likelihood of a poor prognosis for the subject is predicted.
  • the method can also include determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, Kl 17N, A146P, A146T or A146V. Additionally, the method can include predicting that the subject will not respond to an anti-EGFR therapy.
  • the sample obtained from the subject can be such as a tumor biopsy sample, a circulating tumor cell, or a fine needle aspirate.
  • the level of RasGRPl can be the level, amount or concentration of RasGRPl polynucleotide or the level, amount or concentration of RasGRPl polypeptide in the sample. In some embodiments, the level of RasGRPl polynucleotide is determined using an amplification assay or a hybridization assay.
  • the amplification assay is a probe-based quantitative polymerase chain reaction assay, such as a TaqMan ® assay.
  • the level of RasGRPl polypeptide is determined using an immunoassay, immunohistochemistry, western blot or mass
  • a method for predicting a likelihood of a negative clinical response to an anti-EGFR therapy in a subject with cancer includes (a) d determining the level of RasGRPl in a sample obtained from the subject, such as a tumor biopsy sample, a circulating tumor cell, and a fine needle aspirate, and (b) predicting a likelihood of a negative clinical response to the anti-EGFR therapy if the level of RasGRPl is higher than a control value.
  • the method can also include determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, Kl 17N, A146P, A146T, A146V or a combination thereof.
  • the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G
  • the level of RasGRPl can be the level, amount or concentration of RasGRPl polynucleotide or the level, amount or concentration of RasGRPl polypeptide in the sample. In some embodiments, the level of RasGRPl polynucleotide is determined using an amplification assay or a
  • the method can also include administering an effective amount of the non anti- EGFR therapy to the subject to alleviate at least one symptom of the cancer.
  • the non anti-EGFR therapy includes a BRAF inhibitor, AKT inhibitor, MEK inhibitor, cMET inhibitor, VEGR inhibitor or other kinase inhibitor.
  • the method can include predicting a likelihood of a positive clinical response to the anti-EGFR therapy in the subject if the level of RasGRPl is lower than a threshold value.
  • the method can also comprise recommending or administering an anti-EGFR therapy to the subject.
  • the he anti-EGFR therapy is an EGFR blocking antibody or an EGFR inhibitor drug.
  • Figs, la-le shows that RasGRPl is expressed in CRC cell lines and CRC patient tumor samples.
  • EGF dose is 10 ng/ml.
  • Tubulin serves as protein loading control.
  • Fig. la now analyzing the effects of 25, 5, and 1 ng/ml EGF in a 3-minute stimulation (Fig. lb).
  • Figs, la and lb are representative results of 3 or more independent experiments.
  • RasGRPl mRNA expression z-scores are plotted against KRAS mRNA expression z-scores for the 276 patient samples in Fig. le (Fig. If). Colors represent mutational status. RasGRPl mRNA expression determined by Taqman PCR on liver metastases samples surgically removed from 30 colorectal cancer patients (Fig. lg).
  • Figs. 2a-21 illustrate that Rasgrpl plays a role in intestinal epithelial cell
  • mice per genotype and fifty crypts per mouse were counted and averages ⁇ s.e.m are depicted. ***/? ⁇ 0.0001 ⁇ t-tesf ⁇ .
  • Fig. 2e.. long-term (48 hr.) in vivo BrdU labeling in the small intestine Fig. 2g. Scale bars, ⁇ . Positioning of BrdU-positive cells in the small intestine (Fig. 2h).
  • Three mice per genotype and twenty crypt-villus axes were counted. Data were represented as percentage of cells per position ⁇ s.e.m.
  • Figs. 3a-3h shows that loss of one or two Rasgrpl alleles exacerbates serrated dysplasia of KRasG12D epithelium. Representative sections of colon with H&E (Fig. 3a) or Ki67 stainings (Fig. 3b), revealing the serrated dysplasia of the colonic epithelium in
  • Figs. 4a-4f shows that EGFR connects to both RasGRPl and SOSl . Detection of RasGRPl - and EGFR- expression by western blot in eighteen colorectal cancer (CRC) cell lines. Asterisks indicate KRAS mutations KRAS MUT ) (Fig. 4a). RasGRPl phosphorylation in EGF- or BCR-stimulated DT40 B cells (Fig. 4b). PKC inhibitor (Rottlerin) and genetic deletion of RasGRPl/3 function as specificity controls and Tubulin as protein loading control.
  • Figs. 5a-5d illustrates that hyperactivation of RAS in EGF-stimulated KRASMUT CRC cells.
  • Total baseline RAS-GTP levels in serum-starved CRC cells reveals elevated levels in CRC cell lines with KRAS MUT (Fig. 5a). Levels are normalized to RAS and arbitrarily set at 1.0 in WiDr cells.
  • KRAS-GTP profile of time courses with EGF-stimulated (5 ng/ml) KRAS wild type cells (KRAS WT ) (Fig. 5b) and KRAS mutant cells KRAS MUT ) (Fig. 5c). Results in Figs. 5a-c are representative of three or more independent experiments.
  • FIGs. 6a-6e illustrate that EGFR- SO SI signals promote EGFR-Ras signalling and tumorigenesis of KRAS ⁇ 1 CRC cells. Detection of SOSl expression in HCT15 cells with knockdown for human SOSl (shRNAhSOSl) (Fig. 6a). shRNA for murine Sosl (shRNAmSOSl) is used as specificity control. Detection of KRAS-GTP in the indicated EGF-stimulated (5ng/ml) HCT15 cell populations (Fig.
  • Fig. 7a Detection of RasGRPl expression in KRA ⁇ UT HCT ⁇ 5 cells analogous to Fig. 6a (Fig. 7a). Knockdown for murine Rasgrpl (shRNAmRgl) functions as control. KRAS-GTP levels in the indicated EGF-stimulated (5ng/ml) HCT15 cell populations (Fig. 7b). Note the increase KRAS-GTP levels at the 10-minute time point when RasGRPl expression levels are reduced. Analysis of ERK phosphorylation and total ERK protein levels in the same cell lysates presented in Fig. 7b (Fig. 7c). Unstimulated WT HCT15 cells are arbitrarily set at 1.0.
  • Figs. 8a-8j show that RasGRPl limits CRC cell proliferation and in vivo tumor growth.
  • Soft-agar colony formation assays analogous to the ones presented in Figs. 6c and d but now analyzing RasGRPl function (Figs. 8a and 8b).
  • HCT15 cells xenografted into nude mice and measured 40 days after injection (5 mice/group) (Fig. 8c).
  • HCT15 cells with reduced RasGRPl levels result in statistically significant larger tumors compared to the WT and the mouse Rasgrpl shRNA controls. * /> ⁇ 0.05.
  • Growth rates of the indicated xenografted HCT15 cells (Fig. 8d).
  • Specifics of HCT15 cells with shRNAhSOS l are inserted in blue for comparison.
  • Fig. 8j is representative result of three independent experiments.
  • P-ERK in Apc Mm/+ micQ was arbitrarily set at 1.0.
  • Figs. 9a-9c show representative sections of colon with H&E (Fig. 9a) or Ki67 stainings (Fig. 9c), revealing the serrated dysplasia of the colonic epithelium in KRas G12D mice that is further exacerbated with loss of Rasgrpl .
  • Fig. 9c provides a comparison between Ki67-positive cells/crypt for each genotype.
  • Figs. 10a- lOd show representative sections of colon with H&E (Fig. 10a) or Ki67 stainings (Fig. 10b), revealing different villi length for the different mouse genotypes.
  • Fig. 10c quantification of villi length for the different mouse genotypes.
  • Fig. lOd shows the length of the intestinal track from the different mouse genotypes.
  • Figs. 1 la- 1 lb show representative sections of colon with cleaved caspase-3 stainings (Fig. 11a) and quantification (Fig. l ib).
  • Figs. 12a-12e provides expression data in seven CRC lines that represent each of the significant genotypes in Table 1. The expression of RasGRPl (Figs. 12a and 12b), RasGRP2 (Fig. 12c), RasGRP3 (Fig. 12d), and RasGRP4 (Fig. 12e) were measured in the cell lines.
  • Figs. 13a-13e show N-RAS and H-RAS activation upon EGF induction in different colorectal cancer (CRC) cell lines by western blotting of pull down assays.
  • Fig. 13a shows the pull-down assays. Quantification of the assays for NRAS-GTP is shown in Figs. 13b andl3c for different cell lines. Quantification of the assays for HRAS-GTP is shown in Figs. 13d andl3e for different cell lines.
  • Figs. 14a-14b shows sustained ERK phosphorylation in RasGRPl knockdown cells. Figs. 14a and 14b represent two independent experiments. [0026] Figs. 15 a- 15b shows Kaplan-Meier survival curves from human patient samples showing correlation between RasGRPl expression level and clinical patients survival in GSE12945 (Fig. 15a) and GSE14333 (Fig. 15a).
  • Figs. 16a- 16k shows that RasGRPl suppresses proliferative ERK signaling in the context of aberrant Wnt signaling.
  • Apc Mm/+ mice develop large numbers of tumors in the small intestine (Fig. 16a) and additional loss of Rasgrpl did not lead to significant changes in tumor numbers or size in the small intestine (Figs. 16a and 16b).
  • Fig. 16c shows cross sections of colonic tumors from Apc Min/+ and Apc Min/+ : Rasgrpl ⁇ ' ⁇ mice.
  • Fig. 16d shows Ki67- staining of colonic tumors from Apc Min/+ and Apc Min/+ : Rasgrpl ⁇ ' ⁇ mice.
  • FIG. 16e provides quantification of Ki67-positive cells.
  • FIG. 16f shows phospho-ERK staining of colonic tumors in the mice.
  • Fig. 16g shows that colonic tumors in Apc Min/+ :Rasgrpl ⁇ ⁇ mice contain more BrdU positive cells compared to Apc Mm/+ mice.
  • Apc Min/+ :Rasgrpl ⁇ ⁇ mice have higher levels of pERK in normal crypt (Fig. 16h) and colonic tumors (Fig. 16i), compared to Ap ' 1 '" mice.
  • Fig. 16h normal crypt
  • Fig. 16i colonic tumors
  • FIG. 17 is a block diagram of computer system 1700 that may incorporate an embodiment, be incorporated into an embodiment, or be used to practice any of the innovations, embodiments, and/or examples found within this disclosure.
  • the present disclosure provides, in part, methods for detecting the level of the Ras activator RasGRPl in tumor cells (e.g., circulating cells, fine needle aspirates, or tissue biopsies) from a patient with cancer (e.g., colorectal cancer, pancreatic cancer, lung cancer or breast cancer).
  • cancer e.g., colorectal cancer, pancreatic cancer, lung cancer or breast cancer.
  • the presence or level of RasGRPl polynucleotide (mRNA) or polypeptide can be used for therapy selection, predicting drug response, and cancer prognosis.
  • the methods are useful for determining whether a cancer patient is likely to have a good prognosis.
  • the presence or level of RasGRPl in a patient' s sample can also be used as an indicator whether a patient will not respond to an anti-EGFR therapy, such as an anti-EGFR antibody or an EGFR inhibitor drug.
  • colonal cancer is used in the broadest sense and refers to (1) all stages and all forms of cancer arising from epithelial cells of the large intestine and/or rectum and/or (2) all stages and all forms of cancer affecting the lining of the large intestine and/or rectum.
  • the colon and rectum are treated as one organ.
  • EGFR epidermal growth factor receptor
  • EGFR epidermal growth factor receptor
  • An exemplary EGFR is the human epidermal growth factor receptor (see Ullrich et al. (1984) Nature 309:418-425; Genbank accession number NP_005219.2; complete cds AY588246.1). Binding of an EGF ligand activates the EGFR (e.g. resulting in activation of intracellular mitogenic signaling, autophosphorylation of EGFR).
  • Intracellular domain of, a human, EGFR comprises a polypeptide sequence from amino acid adjacent to the transmembrane domain up to COOH- terminus of the EGFR. Intracellular domain comprises, inter alia, tyrosine kinase domain.
  • Anti-EGFR therapy refers to any therapeutic agent, molecule, or compound capable of directly or indirectly inhibiting activation of EGFR.
  • An anti-EGFR therapy include agents that bind to an EGFR molecule and inhibit its activation.
  • Anti-EGFR therapy includes antibodies that bind to an EGFR and inhibit activation of the EGFR; as well as small molecule tyrosine kinase inhibitors or "kinase inhibitors” that inhibit activation of an EGFR.
  • Antibodies to EGFR include IgG; IgM; IgA; antibody fragments that retain EGFR binding capability, e.g., Fv, Fab, F(ab) 2 , single-chain antibodies, and the like; chimeric antibodies; etc.
  • Small molecule tyrosine kinase inhibitors of EGFR include EGFR- selective tyrosine kinase inhibitors. Small molecule tyrosine kinase inhibitors of EGFR can have a molecular weight in a range of from about 50 Da to about 10,000 Da.
  • non anti-EGFR therapy refers to any therapeutic agent, molecule, or compound that does not directly bind to EGFR (e.g., EGFR polynucleotide or EGFR polypeptide) or directly inhibit EGFR activation, and does directly bind to a different kinase or inhibit its activity.
  • a non anti-EGFR therapy can be an anti-BRAF therapy, anti-AKT therapy, anti-MEK therapy, anti-cMET therapy, anti-VEGR therapy, other anti- receptor tyrosine kinase therapy, or other anti-kinase therapy.
  • RasGRPl refers to the RasGFPl gene identified as NCBI GenelD No. 10125 and/or its expression products, including the RasGFPl coding sequence or mRNA (Genbank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank Accession No. NM 001128602) and the Ras
  • KRAS refers to the KRAS gene identified as NCBI GenBank Accession No. NM_004985.3, and/or its expression products. "KRAS”is also identified in literature as KRAS 1 , KRAS2, RASK2, KI-RAS, K-RAS4 A, K-RAS4B or p21.
  • amino acid variant is used to refer to an amino acid change to a reference human protein sequence resulting from genetic variants or nucleotide variants to the reference human gene encoding the reference protein.
  • amino acid variant is intended to encompass not only single amino acid substitutions, but also amino acid deletions, insertions, and other significant changes of amino acid sequence in the reference protein.
  • EGFR inhibitor refers to a compound that inhibits, decreases, lowers, or reduces at least one activity of an epidermal growth factor receptor (EGFR).
  • EGFR inhibitors include, but are not limited to, [6,7-bis(2-methoxyethoxy)-4-quinazolin-4- yl]-(3-ethynylphenyl)amine (also known as OSI-774), erlotinib, CI-1033 (formerly known as PD183805), AG-1478, CGP-59326, PKI-166, EKB-569, lapatinib or lapatinib ditosylate; and gefitinib, AG490 (a tyrphostin), ARRY-334543, BIBW-2992, EKB-569, ZD6474, BMS- 599626 (Bristol-Myers Squibb), cetuximab, and MDX-447.
  • the term "high level” as used herein with respect to the level of RasGRPl polynucleotide or polypeptide level refers to any level that is above a threshold value that is established from the level of RasGRPl polynucleotide or polypeptide in a sample from a reference (control) population.
  • the reference population is one or more CRC patients receiving an anti-EGFR therapy. In some instances, this reference population includes one or more CRC patients receiving an anti-EGFR therapy in
  • the reference population is one or more CRC patients that are not receiving therapy.
  • the reference population is one or more normal individual.
  • elevated polynucleotide (e.g., mRNA) levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold greater than the threshold level of RasGRPl RNA detected in a sample from one or more CRC patients a CRC patient on an anti-EGFR therapy or from a plurality of CRC patients on an anti-EGFR therapy an anti-EGFR therapy.
  • Elevated polypeptide levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold greater than the threshold level of RasGRPl polypeptide detected in a sample from one or more CRC patients receiving an anti-EGFR therapy.
  • the term "low level" as used herein with respect to the level of RasGRPl polynucleotide or polypeptide level refers to any level that is below a threshold value that is established from the level of RasGRPl polynucleotide or polypeptide in a sample from a reference (control population).
  • the reference population is one or more CRC patients receiving an anti-EGFR therapy.
  • this reference population includes one or more CRC patients receiving an anti-EGFR therapy in
  • the reference population is one or more CRC patients that are not receiving therapy.
  • the reference population is one or more normal individual.
  • decreased polynucleotide (e.g., mRNA) levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold lower than the threshold level of RasGRPl RNA detected in a sample from one or more CRC patients receiving an anti-EGFR therapy.
  • Decreased polypeptide levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold lower than the threshold level of RasGRPl polypeptide detected in a sample from one or more CRC patients receiving an anti- EGFR therapy.
  • responsive As used in the context of a patient's response to an anticancer therapy, are used interchangeably and refer to a favorable patient response to a drug as opposed to unfavorable responses, i.e. adverse events.
  • beneficial response can be expressed in terms of a number of clinical parameters, including loss of detectable tumor (complete response, CR), decrease in tumor size and/or cancer cell number (partial response, PR), tumor growth arrest (stable disease, SD), enhancement of anti-tumor immune response, possibly resulting in regression or rejection of the tumor; relief, to some extent, of one or more symptoms associated with the tumor; increase in the length of survival following treatment; and/or decreased mortality at a given point of time following treatment.
  • CR complete response
  • PR tumor growth arrest
  • SD tumor growth arrest
  • enhancement of anti-tumor immune response possibly resulting in regression or rejection of the tumor
  • relief, to some extent, of one or more symptoms associated with the tumor increase in the length of survival following treatment; and/or decreased mortality at a given point of time following treatment.
  • Continued increase in tumor size and/or cancer cell number and/or tumor metastasis is indicative of lack of beneficial response to treatment.
  • the clinical benefit of a drug i.e., its efficacy can be evaluated on the basis of
  • a positive clinical response can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of tumor growth, including slowing down and complete growth arrest; (2) reduction in the number of tumor cells; (3) reduction in tumor size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of tumor cell infiltration into adjacent peripheral organs and/or tissues; (5) inhibition of metastasis; (6) enhancement of anti-tumor immune response, possibly resulting in regression or rejection of the tumor; (7) relief, to some extent, of one or more symptoms associated with the tumor; (8) increase in the length of survival following treatment; and/or (9) decreased mortality at a given point of time following treatment.
  • Positive clinical response may also be expressed in terms of various measures of clinical outcome.
  • Positive clinical outcome can also be considered in the context of an individual's outcome relative to an outcome of a population of patients having a comparable clinical diagnosis, and can be assessed using various endpoints such as an increase in the duration of recurrence-free interval (RFI), an increase in the time of survival as compared to overall survival (OS) in a population, an increase in the time of disease-free survival (DFS), an increase in the duration of distant recurrence-free interval (DRFI), and the like.
  • An increase in the likelihood of positive clinical response corresponds to a decrease in the likelihood of cancer recurrence.
  • the term "good prognosis” refers to the prediction of the likelihood of disease- specific survival, overall survival or disease free survival, including partial remission, complete remission, and suppression of cancer cell proliferation and/or metastasis.
  • a good prognosis for a patient with a solid tumor cancer includes a positive response rate in terms of disease remission or tumor shrinkage, or any other form of evaluating reduced tumor burden or growth.
  • a good prognosis can be measured as the length (time) of survival.
  • pool prognosis refers to the prediction of the likelihood of cancer- attributable death or progression, including recurrence, relapse, metastatic spread, and drug resistance.
  • all survival refers to the time interval from either the time of diagnosis or the start of treatment that the patient is still alive.
  • progression-free survival refers to the time interval from treatment of the patient until the progression of cancer or death of the patient, whichever occurs first.
  • responder refers to a patient who has cancer, and who exhibits a beneficial clinical response following treatment with an anti-cancer therapy.
  • non-responder or “non-responsive” refers to a patient who has a cancer, and who does not exhibit a beneficial clinical response following treatment with an anti- cancer
  • subject is intended to include animals. Examples of subjects include mammals, e.g., humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In certain embodiments, the subject is a human, e.g., a human suffering from, at risk of suffering from, or potentially capable of suffering from cancers.
  • inhibitor in the context of a specific polynucleotide or polypeptide, refers to inhibitory molecules identified using in vitro and/or in vivo assays for binding or signaling of the specific polynucleotide or polypeptide, e.g., naturally-occurring ligands and synthetically-designed ligands, antibodies and antibody fragments, antagonists, agonists, small molecules including carbohydrate-containing molecules, siRNAs, RNA aptamers, homologs thereof, mimetics thereof, and the like.
  • the inhibitor directly or indirectly binds to the specific polypeptide, such as a neutralizing antibody or blocking antibody.
  • Inhibitors, as used herein, are synonymous with inactivators and antagonists.
  • RasGRPl in a biological sample.
  • RasGRPl includes a nucleotide sequence of a RasGRPl gene containing one or more changes as compared to the wild-type RasGRPl gene or an amino acid sequence of a RasGRPl polypeptide containing one or more changes as compared to the wild-type RasGRPl polypeptide sequence.
  • Human RasGRPl is set forth in NCBI GenelD No. 10125.
  • the mRNA (coding) and polypeptide sequences of human RasGRPl are set forth in, e.g., Genbank Accession Nos. NM_001128602 and NP 001122074, respectively.
  • RasGRPl polynucleotide e.g., mRNA
  • PCR polymerase chain reaction
  • Probes may be used in hybridization techniques to detect polynucleotides.
  • the technique generally involves contacting and incubating nucleic acids obtained from a sample from a patient with a probe under conditions favorable for the specific annealing of the probes to complementary sequences in the nucleic acids (e.g. under stringent conditions). After incubation, the non-annealed nucleic acids are removed, and the presence of nucleic acids that have hybridized to the probe if any are detected.
  • Nucleotide probes for use in the detection of polynucleotide sequences in samples may be constructed using conventional methods known in the art.
  • the probes may comprise DNA or DNA mimics corresponding to a portion of an organism's genome, or complementary RNA or RNA mimics.
  • the nucleic acids can be modified at the base moiety, at the sugar moiety, or at the phosphate backbone.
  • DNA can be obtained using standard methods such as PCR amplification of genomic DNA or cloned sequences. Computer programs known in the art can be used to design primers with the required specificity and optimal amplification properties.
  • a nucleotide probe may be labeled with a detectable substance such as a radioactive label which provides for an adequate signal and has sufficient half-life.
  • detectable substances include antigens that are recognized by a specific labeled antibody, fluorescent compounds, enzymes, antibodies specific for a labeled antigen, and luminescent compounds.
  • An appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleic acids to be detected and the amount of nucleic acids available for hybridization.
  • oligonucleotide primers may be employed in a PCR based assay to amplify a portion of a polynucleotide and to amplify a portion of a polynucleotide derived from a sample, wherein the oligonucleotide primers are specific for (i.e. hybridize to) the oligonucleotide primers.
  • the amplified cDNA is then separated and detected using techniques well known in the art, such as gel electrophoresis.
  • exemplary methods known in the art for the quantification of polynucleotide (e-g, mRNA) expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNase protection assays (Hod, Biotechniques 13 :852-854 (1992)); and PCR-based methods, such as reverse transcription PCT (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)).
  • RT-PCR reverse transcription PCT
  • the level of RasGRPl polynucleotide is measured using a reverse transcriptase-polymerase chain reaction (RT-PCR) or a variant thereof.
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • Useful fluorogenic probe based quantitative PCR methods are described in, e.g., Heid et al., Genome Res, 6:986-94, 1996. The principle of such probe-based quantitative PCR methods utilizes the 5'-3' exonuclease activity of Taq DNA polymerase for direct and specific detection of PCR products via release of fluorescence reporter dyes.
  • the PCR employs a doubly fluorescently labeled probe (e.g., TaqMan ® probe) which hybridizes to a sequence of the PCR product.
  • the probe is labeled 5' with a reporter dye (e.g., FAM) and 3' with a quencher dye (e.g., TAMRA). If the probe is intact, the spatial proximity of reporter to quencher suppresses the emission of reporter fluorescence. I f the probe hybridizes to the PCR product during the PCR, said probe is cleaved by the 5'-3' exonuclease activity of Taq DNA polymerase and suppression of the reporter fluorescence is removed.
  • a reporter dye e.g., FAM
  • TAMRA quencher dye
  • the increase in reporter fluorescence as a consequence of the amplification of the target is measured after each PCR cycle and utilized for quantification.
  • Expression of the target gene e.g., RasGRPl
  • a TaqMan® Gene Expression Assay (Life Technologies), such as Hs00996727, Hs00996728, Hs00996724, Hs00996725 and Hs00996729 is used.
  • Polypeptide expression of RasGRPl can be detected in suitable cells and tissues, such as tumor sample or tumor cell material obtained by biopsy. Various assay methods are known to those of ordinary skill in the art.
  • the method can include (a) contacting the sample from the subject with a binding agent (e.g., an antibody, an antibody fragment, or an aptamer); (b) detecting in the sample a level of polypeptide that binds to the binding agent; and (c) comparing the level of polypeptide with a predetermined standard or cut-off value.
  • a binding agent e.g., an antibody, an antibody fragment, or an aptamer
  • the patient sample which can be immobilized, can be contacted with an antibody, an antibody fragment, or an aptamer, that selectively binds to RasGFPl, and determining whether the antibody, fragment thereof or aptamer has bound to the protein.
  • Protein expression can be measured using a variety of methods standard in the art, including, but not limited to: Western blot, immunoblot, enzyme-linked immunosorbant assay (ELISA), sandwich immunoassay, radioimmunoassay (RIA), bead-based immunoassay,
  • the methods of the invention further comprise determining the presence or absence of an activating KRAS gene present in a tumor sample from the patient.
  • KRAS mutant or “KRAS variant” includes a nucleotide sequence of a KRAS gene containing one or more changes as compared to the wild-type KRAS gene or an amino acid sequence of a KRAS polypeptide containing one or more changes as compared to the wild-type KRAS polypeptide sequence.
  • Human KRAS is set forth in NCBI GenelD No. 3845.
  • the mRNA (coding) and polypeptide sequences of human KRAS are set forth in, e.g., Genbank Accession Nos.
  • the complete sequence of human chromosome 12 assembly GRCh38, which includes KRAS is set forth in, e.g., Genbank Accession No. NC_000012.12.
  • sequence of KRAS from other species can be found in the GenBank database.
  • Activating KRAS variants can include mutations in exon 2 (codons 12 and 13) and exon 3 (codon 61) of the human KRAS gene.
  • the variant can be, but is not limited to, a
  • KRAS mutation detection kits include Cobas KRAS mutation test (Roche Molecular Diagnostics), Droplet Digital TM PCR (Bio-Rad), TaqMan ® Mutation Detection Assay (Thermo Fisher), and TheraScreen ® KRAS RGQ (Roto- Gene Q) PCR Kit (Qiagen). Detection of an activating KRAS mutation can be carried out using any of a variety of methods Numerous methods are known in the art for detection of sequence variations (polymorphisms and mutations) in nucleic acid samples, and can be used for detecting an activating KRAS mutation.
  • Such methods include methods based on polymerase chain reaction, or allele specific amplification in combination with DNA sequencing, or TaqMan ® .
  • methods can be designed to detect sequence variants (e.g., known variants) at a targeted position in the nucleic acid sequence. Sequence variants are detected using as probes or primers oligonucleotides that hybridize differentially to each variant. Many approaches have been developed to increase the selectivity of hybridization of sequence specific probes to targeted variants; the extent of hybridization is of the sequence specific probes is often detected based on detecting and/or quantifying the amount of product formed in a subsequent polymerase chain reaction.
  • kits, probes and/or primers that can be used to stratify patients between responders and non-responders.
  • kits can include reagents that detect the presence of KRAS and RasGRPl (DNA or mRNA or protein).
  • the kit can include probes and/or primers that selectively hybridize to KRAS DNA or mRNA and can detect the one or more KRAS mutations disclosed herein.
  • the kit can further include reagents such as probes, primers and/or antibodies to detect the presence and quantity of RasGRPl .
  • a kit herein can furthermore include reagents useful for detecting the presence and/or quantity of any one or more of the following markers EGFR, SOS1 and SOS2.
  • a reference population of subjects can be used.
  • a population of CRC patients receiving an anti-EGFR therapy or another molecular targeted therapy can be used.
  • the CRC patients in the reference group may receive an anti-EGFR therapy or another molecular targeted therapy, in combination with chemotherapy, radiation therapy and/or surgical resection of the tumor.
  • the reference population includes subjects who do not have CRC.
  • the reference population includes subjects who have CRC and are not receiving targeted therapy.
  • These patients are within the appropriate parameters, if applicable, for the purpose of screening for and/or monitoring cancer using the methods of the present invention.
  • the patients are of same gender, similar age, or similar ethnic background.
  • the selected group of patients must be of a reasonable size, such that the average level/amount/concentration of human RasGRPl polynucleotide (mRNA) or RasGRPl protein in the sample obtained from the group can be reasonably regarded as representative of the normal or average level among this population of patients.
  • mRNA RasGRPl polynucleotide
  • RasGRPl protein Once an average value for the RasGRPl polynucleotide (mRNA) or RasGRPl protein is established based on the individual values found in each subject of the selected group, this average or median or representative value or profile is considered a threshold value. A standard deviation is also determined during the same process. In some cases, separate threshold values may be established for separately defined groups having distinct characteristics such as age, gender, or ethnic background.
  • the presence or level of RasGRPl in the patient's sample is compared to one or more reference or threshold values.
  • the level of RasGRPl is deemed “high' if it is at least 1, 2, 3, 4, 5, 10, 15, 20 or more standard deviations greater than the reference value subjects.
  • the level of RasGRPl is "low” if it is at least 1, 2, 3, 4, 5, 10, 15, 20 or more standard deviations lower than the reference or threshold value.
  • the reference value may represent the level, amount or concentration of a RasGRPl in a sample from a plurality of CRC patient receiving an anti- EGFR therapy.
  • reference CRC patients also receive chemotherapy, radiation therapy and/or surgery for tumor removal.
  • a level, amount or concentration in a sample from the test subject is significantly higher ⁇ e.g., 1.01-fold, 1.05-fold, 1.10-fold, 1.2- fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold or more higher) than the threshold value, this would indicate, e.g., a likelihood of a good prognosis or a negative clinical response to an anti-EGFR therapy.
  • a level, amount or concentration in a sample from the test subject is significantly lower (e.g., 1.01-fold, 1.05-fold, 1.10-fold, 1.2-fold, 1.3-fold, 1.4- fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20- fold, 30-fold, 40-fold, 50-fold, 100-fold or more higher) than the threshold value, this would indicate, e.g., a likelihood of a poor prognosis or a positive clinical response to an anti-EGFR therapy.
  • a drug therapy that is not an anti- EGFR therapy is selected for the patient. Rather, a drug therapy comprising a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGFR inhibitor, or other kinase inhibitor can be recommended to treat the patient with cancer.
  • a drug therapy comprising a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGFR inhibitor, or other kinase inhibitor can be recommended to treat the patient with cancer.
  • tumor cells of this test patient also carry an activating KRAS mutation.
  • it is determined that tumor cells of this test patient are wild-type for KRAS.
  • an anti-EGFR therapy is selected for the patient.
  • the anti-EGFR therapy can include an EGFR blocking antibody or an EGFR inhibitor.
  • tumor cells of this test patient also carry an activating KRAS mutation.
  • it is determined that tumor cells of this test patient are wild-type for KRAS.
  • an index value may represent the level of the biomarkers.
  • Other markers that can be evaluated include EGFR, SOS 1 and SOS2.
  • a test value may be provided by (a) weighting the determined level of each biomarker with a predefined coefficient, and (b) combining the weighted level to provide a test value.
  • the combining step can be either by straight addition or averaging (i.e., weighted equally) or by a different predefined coefficient.
  • the invention also provides the use of a computer system, such as that described above, which comprises: (1) a computer; (2) a stored bit pattern encoding the biomarker testing results obtained by the methods of the invention, which may be stored in the computer; (3) and, optionally, (4a) a program for selecting a drug therapy for a patient having cancer, (4b) a program for predicting the likelihood of a positive prognosis for a patient having cancer, or (4c) a program for predicting the likelihood of a negative response to an anti-EGFR therapy in a patient having cancer.
  • a computer system such as that described above, which comprises: (1) a computer; (2) a stored bit pattern encoding the biomarker testing results obtained by the methods of the invention, which may be stored in the computer; (3) and, optionally, (4a) a program for selecting a drug therapy for a patient having cancer, (4b) a program for predicting the likelihood of a positive prognosis for a patient having cancer, or (4c) a program for predicting the likelihood of
  • a computer system in which a value of RasGRPl levels in a sample from a patient undergoing testing is entered into the computer and compared to a threshold value. If RasGRPl level in the sample from the patient undergoing testing is significantly higher than or above the threshold value received by the computer, a drug therapy employing a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGFR inhibitor, or other kinase inhibitor is identified as a drug therapy to treat the patient.
  • a drug therapy employing a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGFR inhibitor, or other kinase inhibitor is identified as a drug therapy to treat the patient.
  • an anti-EGFR drug therapy such as an EGFR blocking antibody or EGFR inhibitor is identified as a drug therapy to treat the patient.
  • the following describes an illustrative computer -implemented method for selecting a drug therapy for a patient based on RasGRPl levels or for determining the likelihood of a good prognosis or poor porgnonis using RasGRPl levels.
  • Implementations of or processing in the computer-implemented method may be performed by software (e.g., instructions or code modules) when executed by a central processing unit (CPU or processor) of a logic machine, such as a computer system or information processing device, by hardware components of an electronic device or application-specific integrated circuits, or by combinations of software and hardware elements.
  • information is received describing the level of RasGRPl in a sample obtained from a subject.
  • input data includes a text file (e.g., a tab-delimited text file) of RasGRPl values.
  • input data includes a text file (e.g., a tab-delimited text file) of RasGRPl levels in the sample from the subject.
  • the information describing the RasGRPl levels is compared to a threshold value recorded by the computer.
  • a subject's estimated likelihood of a good prognosis if the value is higher than a threshold value, or of a poor prognosis if the RasGRPl level is lower than the threshold value is determined, added to a summary plot, and output as a new report.
  • the information describing the RasGRPl levels is compared to a threshold value recorded by the computer.
  • the identification of the subject as being a candidate for a non-anti-EGFR therapy if the level of RasGRPl is higher than a threshold value is determined, added to a summary plot, and output as a new report.
  • the identification of the subject as being a candidate for an anti-EGFR therapy if the level of RasGRPl is lower than the threshold value is determined, added to a summary plot, and output as a new report.
  • the information obtained from the RasGRl analysis may be stored in a computer readable form.
  • a computer system typically comprises major subsystems such as a central processor, a system memory (typically RAM), an input/output (I/O) controller, an external device such as a display screen via a display adapter, serial ports, a keyboard, a fixed disk drive via a storage interface and a floppy disk drive operative to receive a floppy disc, and a CD-ROM (or DVD-ROM) device operative to receive a CD-ROM.
  • Many other devices can be connected, such as a network interface connected via a serial port.
  • the computer system may also be linked to a network, comprising a plurality of computing devices linked via a data link, such as an Ethernet cable (coax or lOBaseT), telephone line, ISDN line, wireless network, optical fiber, or other suitable signal
  • a data link such as an Ethernet cable (coax or lOBaseT), telephone line, ISDN line, wireless network, optical fiber, or other suitable signal
  • the computer system can comprise code for interpreting the results of a study evaluating RasGRPl levels in a sample from a patient.
  • the RasGRPl analysis results are provided to a computer where a central processor executes a computer program for determining the likelihood of a good prognosis or of a poor prognonis.
  • the central processor executes a code for selecting a drug therapy where a non-anti-EGFR therapy is selected if the level of RasGRPl is higher than a threshold value. In some embodiments, the central processor executes a code for selecting a drug therapy where an anti-EGFR therapy is selected if the level of RasGRPl is lower than a threshold value.
  • the invention thus includes a computer system to implement the method for determining the likelihood of a good prognosis or a poor prognosis; or to implement the methjod for selecting a drug therapy.
  • a computer system can comprise code for interpreting the results of an analysis evaluating the level of RasGRPl levels in a sample obtained from the subject.
  • the expression analysis results are provided to a computer where a central processor executes a computer program for determining the likelihood of a good or poor prognosis in the subject and/or for selecting a drug therapy for the subject.
  • the invention also provides the use of a computer system, such as that described above, which comprises: (1) a computer; (2) a stored bit pattern encoding the RasGRPl levels in a sample obtained from the patient, e.g., a tumor biopsy sample, which may be stored in the computer; and, optionally, (3) a program for determining the level compared to a threshold level.
  • a computer system such as that described above, which comprises: (1) a computer; (2) a stored bit pattern encoding the RasGRPl levels in a sample obtained from the patient, e.g., a tumor biopsy sample, which may be stored in the computer; and, optionally, (3) a program for determining the level compared to a threshold level.
  • the invention further provides methods of generating a report based on the
  • FIG. 17 is a block diagram of a computer system 1700 that may incorporate an embodiment, be incorporated into an embodiment, or be used to practice any of the innovations, embodiments, and/or examples found within this disclosure.
  • FIG. 17 is merely illustrative of a computing device, general-purpose computer system programmed according to one or more disclosed techniques, or specific information processing device for an embodiment incorporating an invention whose teachings may be presented herein and does not limit the scope of the invention as recited in the claims.
  • One of ordinary skill in the art would recognize other variations, modifications, and alternatives.
  • Computer system 1700 can include hardware and/or software elements configured for performing logic operations and calculations, input/output operations, machine communications, or the like.
  • Computer system 1700 may include familiar computer components, such as one or more one or more data processors or central processing units (CPUs) 1705, one or more graphics processors or graphical processing units (GPUs) 1210, memory subsystem 1715, storage subsystem 1720, one or more input/output (I/O) interfaces 1725, communications interface 1730, or the like.
  • Computer system 1700 can include system bus 1735 interconnecting the above components and providing functionality, such
  • Computer system 1700 may be embodied as a computing device, such as a personal computer (PC), a workstation, a mini -computer, a mainframe, a cluster or farm of computing devices, a laptop, a notebook, a netbook, a PDA, a smartphone, a consumer electronic device, a gaming console, or the like.
  • PC personal computer
  • workstation a workstation
  • mini -computer a mainframe
  • cluster or farm of computing devices such as a laptop, a notebook, a netbook, a PDA, a smartphone, a consumer electronic device, a gaming console, or the like.
  • PDA personal digital assistant
  • smartphone a consumer electronic device
  • gaming console or the like.
  • the one or more data processors or central processing units (CPUs) 1705 can include hardware and/or software elements configured for executing logic or program code or for providing application-specific functionality. Some examples of CPU(s) 1705 can include one or more microprocessors (e.g., single core and multi-core) or micro-controllers. CPUs 1705 may include 4-bit, 8-bit, 12-bit, 16-bit, 32-bit, 64-bit, or the like architectures with similar or divergent internal and external instruction and data designs. CPUs 1705 may further include a single core or multiple cores.
  • processors may include those provided by Intel of Santa Clara, California (e.g., x86, x86_64, PENTIUM, CELERON, CORE, CORE 2, CORE ix, ITANR7M, XEON, etc.) or by Advanced Micro Devices of Sunnyvale, California (e.g., x86, AMC 64, ATHLON, DURON, TURION, ATHLON XP/64, OPTERON, PHENOM, etc).
  • processors may further include those conforming to the Advanced RISC Machine (ARM) architecture (e.g., ARMv7-9), POWER and POWERPC architecture, CELL architecture, and or the like.
  • ARM Advanced RISC Machine
  • CPU(s) 1705 may also include one or more field-gate programmable arrays (FPGAs), application-specific integrated circuits (ASICs), or other microcontrollers.
  • the one or more data processors or central processing units (CPUs) 1705 may include any number of registers, logic units, arithmetic units, caches, memory interfaces, or the like.
  • the one or more data processors or central processing units (CPUs) 1705 may further be integrated, irremovably or moveably, into one or more motherboards or daughter boards.
  • the one or more graphics processor or graphical processing units (GPUs) 1710 can include hardware and/or software elements configured for executing logic or program code associated with graphics or for providing graphics-specific functionality.
  • GPUs 1710 may include any conventional graphics processing unit, such as those provided by conventional video cards. Some examples of GPUs are commercially available from NVIDIA, ATI, and other vendors. In various embodiments, GPUs 1710 may include one or more vector or parallel processing units. These GPUs may be user programmable, and include hardware elements for encoding/decoding specific types of data (e.g., video data) or for accelerating 2D or 3D drawing operations, texturing operations, shading operations, or the like.
  • the one or more graphics processors or graphical processing units (GPUs) 1710 may include any number of registers, logic units, arithmetic units, caches, memory interfaces, or the like.
  • the one or more data processors or central processing units (CPUs) 1705 may further be integrated, irremovably or moveably, into one or more motherboards or daughter boards that include dedicated video memories, frame buffers, or the like.
  • Memory subsystem 1715 can include hardware and/or software elements configured for storing information. Memory subsystem 1715 may store information using machine- readable articles, information storage devices, or computer-readable storage media. Some examples of these articles used by memory subsystem 1715 can include random access memories (RAM), read-only-memories (ROMS), volatile memories, non-volatile memories, and other semiconductor memories. In various embodiments, memory subsystem 1715 can include data and program code 1740.
  • Storage subsystem 1720 can include hardware and/or software elements configured for storing information. Storage subsystem 1720 may store information using machine- readable articles, information storage devices, or computer-readable storage media. Storage subsystem 1720 may store information using storage media 1745. Some examples of storage media 1745 used by the storage subsystem 1720 can include floppy disks, hard disks, optical storage media such as CD-ROMS, DVDs and bar codes, removable storage devices, networked storage devices, or the like. In some embodiments, all or part of the RasGRPl data and program code 1740 may be stored using the storage subsystem 1720.
  • computer system 1700 may include one or more hypervisors or operating systems, such as WINDOWS, WINDOWS NT, WINDOWS XP, VISTA, WINDOWS 7 or the like from Microsoft of Redmond, Washington, Mac OS or Mac OS X from Apple Inc. of Cupertino, California, SOLARIS from Sun Microsystems, LINUX, UNIX, and other UNIX-based or UNIX-like operating systems.
  • Computer system 1700 may also include one or more applications configured to execute, perform, or otherwise implement techniques disclosed herein. These applications may be embodied as cancer prognosis data and the program code 1740.
  • computer programs, executable computer code, human-readable source code, shader code, rendering engines, or the like, and data, such as image files, models including geometrical descriptions of objects, ordered geometric descriptions of objects, procedural descriptions of models, scene descriptor files, or the like, may be stored in the memory subsystem 1715 and/or storage subsystem 1720.
  • the one or more input/output (I/O) interfaces 1725 can include hardware and/or software elements configured for performing I/O operations.
  • One or more input devices 1750 and/or one or more output devices 1755 may be communicatively coupled to the one or more I/O interfaces 1725.
  • the one or more input devices 1750 can include hardware and/or software elements configured for receiving information from one or more sources for computer system 1700. Some examples of the one or more input devices 1750 may include a computer mouse, a trackball, a track pad, a joystick, a wireless remote, a drawing tablet, a voice command system, an eye tracking system, external storage systems, a monitor appropriately configured as a touch screen, a communications interface appropriately configured as a transceiver, or the like.
  • the one or more input devices 1750 may allow a user of the computer system 1700 to interact with one or more non-graphical or graphical user interfaces to enter a comment, select objects, icons, text, user interface widgets, or other user interface elements that appear on a monitor/display device via a command, a click of a button, or the like.
  • the one or more output devicesl755 can include hardware and/or software elements configured for outputting information to one or more destinations for computer system 1700.
  • Some examples of the one or more output devices 1755 can include a printer, a fax, a feedback device for a mouse or joystick, external storage systems, a monitor or other display device, a communications interface appropriately configured as a transceiver, or the like.
  • the one or more output devices 1755 may allow a user of the computer system 1700 to view objects, icons, text, user interface widgets, or other user interface elements.
  • a display device or monitor may be used with computer system 1700 and can include hardware and/or software elements configured for displaying information. Some examples include familiar display devices, such as a television monitor, a cathode ray tube (CRT), a liquid crystal display (LCD), or the like.
  • Communications interface 1730 can include hardware and/or software elements configured for performing communications operations, including sending and receiving data. Some examples of the communications interface 1730 may include a network
  • communications interface 1730 may be coupled to communications network/external bus 1780, such as a computer network, to a FireWire bus, a USB hub, or the like.
  • communications interface 1730 may be physically integrated as hardware on a motherboard or daughter board of computer system 1700, may be implemented as a software program, or the like, or may be implemented as a combination thereof.
  • computer system 1700 may include software that enables communications over a network, such as a local area network or the Internet, using one or more communications protocols, such as the HTTP, TCP/IP, RTP/RTSP protocols, or the like.
  • communications protocols such as the HTTP, TCP/IP, RTP/RTSP protocols, or the like.
  • other communications software and/or transfer protocols may also be used, for example IPX, UDP or the like, for communicating with hosts over the network or with a device directly connected to computer system 1700.
  • FIG. 17 is merely representative of a general -purpose computer system
  • a computer system or data processing device may include desktop, portable, rack-mounted, or tablet configurations.
  • a computer system or information processing device may include a series of networked computers or clusters/grids of parallel processing devices.
  • a computer system or information processing device may perform techniques described above as implemented upon a chip or an auxiliary processing board.
  • a computer system or data processing device may include desktop, portable, rack-mounted, or tablet configurations.
  • a computer system or information processing device may include a series of networked computers or clusters/grids of parallel processing devices.
  • a computer system or information processing device may use techniques described above as implemented upon a chip or an auxiliary processing board.
  • Various embodiments of an algorithm as described herein can be implemented in the form of logic in software, firmware, hardware, or a combination thereof.
  • the logic may be stored in or on a machine-accessible memory, a machine-readable article, a tangible computer-readable medium, a computer-readable storage medium, or other
  • An anti- EGFR therapy includes any therapeutic agent that blocks or inhibits the expression or activity of the EGFR gene and/or its expression products and any signaling molecule acting in the EGFR signaling pathway.
  • Non-limiting anti-EGFR therapies include an EGFR blocking antibody, such as, cetuximab (Erbitux ® ) and panitumumab (VectibixTM), or an EGFR inhibitor, such as erlotinib (Tarceva ® ), gefitinib (Iressa ® ), lapatinib (GW-572016; Tykerb ® ), and vandetanib (ZACTFMATM; ZD6474).
  • an EGFR blocking antibody such as, cetuximab (Erbitux ® ) and panitumumab (VectibixTM
  • an EGFR inhibitor such as erlotinib (Tarceva ® ), gefitinib (Iressa ® ), lapatinib (GW-572016; Tykerb ® ), and vandetanib (ZACTFMATM; ZD6474).
  • Non-limiting non anti-EGFR therapies include a BRAF inhibitor, such as vemurafenib and abrafenib; Akt inhibitor such as GSK2141795 and MK2206; MEK inhibitor, such as trametinib (MekinistTM), TAK-733, selumetinib, and MEK162; VEGF inhibitor, such as bevacizumab (Avastin ® ), Aflibercept and BAY43-9006; and other kinase inhibitors, such as sunitinib (Sutent ® ), canertinib (CI 1033), semaxinib (SU5416), vatalanib (PTK787/ZK222584), sorafenib (BAY 43-9006; Nexavar ® ), regorafenib, imatinib mesylate (Gleevec ® ), leflunomide (SU101), alisertib (MLN82
  • Non-limiting examples of c-Met inhibitors include monoclonal antibodies such as AMG102 and MetMAb; small molecule inhibitors of c-Met such as ARQ197, JNJ-38877605, PF-04217903, SGX523, GSK
  • the molecular targeted therapies described herein can be administered to a patient with cancer in combination with other types of cancer therapy.
  • cancer therapies or cancer treatments include chemotherapy, radiation therapy, and surgical removal of tumors.
  • a patient with receiving an anti-EGFR therapy can also receive chemotherapy, radiation therapy, and/or surgical resectioning.
  • a patient with receiving a non anti-EGFR therapy can also receive chemotherapy, radiation therapy, and/or surgical resectioning. III. Examples
  • Example 1 The Ras Exchange Factor RasGRPl Opposes Proliferative EGFR-SOSl Ras Signals and Restricts Intestinal Epithelial Cell Growth
  • RasGRPl Ras nucleotide exchange factors
  • SOS1 Ras nucleotide exchange factors
  • Ras is a molecular switch, activated through GTP-loading by Ras guanine nucleotide exchange factors (RasGEFs) in response to receptor signals ⁇
  • Ras guanine nucleotide exchange factors RosGEFs
  • pheochromocytoma (PC-12) cells leads to transient Ras activation and proliferation.
  • NGF or EGF stimulation of PC12 cells overexpressing the EGFR results in sustained Ras-MAPK activation, exit from mitosis, and differentiation 1 .
  • Lymphocytes stimulated through the T-cell receptor (TCR) also display distinct patterns of Ras-MAPK activation 3 ' 4 and deficiency of either Rasgrpl or Sosl RasGEFs impact T cell development at distinct stages 5"8 .
  • RasGEF guanine nucleotide releasing protein-1
  • SOS1 Syn of Sevenless-1
  • Digital Ras activation critically relies on allosteric activation of SOS, which is accomplished by Ras-GTP binding to an allosteric pocket in SOS 9 and creates a positive feedback loop in various cell types 4 ' 10 ' u [0104]
  • Ras plays an important role in cancer and thirty percent of metastatic cancers carry somatic KRAS mutations (termed KRAS MUT here), such as KRAS 0120 .
  • CRC Colorectal cancer
  • Cetuximab, Gefitinib, or Erlotinib have been disappointing for CRC, particularly when tumors carry KRAl iUT 18 ' 19 .
  • such therapies have been successful in non-small-cell lung cancer (NSCLC) patients with EGFR mutations 19 .
  • NSCLC non-small-cell lung cancer
  • the most intuitive explanation for failure of anti-EGFR therapy in KRAl iUT CRC is that the constitutive activity of KRAl iUT bypasses regulation mediated by the EGFR.
  • recent studies indicate that EGFR signals can modulate tumor growth in the context of KRAS MUT .
  • EGFR signalling is essential for ⁇ -driven pancreatic ductal carcinoma (PDAC) 20 ' 21 and in the clinic Erlotinib is beneficial for a limited number of PDAC patients 22 .
  • PDAC pancreatic ductal carcinoma
  • RasGRPl is also expressed in the normal intestinal epithelium, responds to EGF signal input, but restricts proliferation in the normal epithelium. Genetic ablation of Rasgrpl alleles exacerbates KRas G12D -induced proliferative dysplasia of the intestinal epithelium, resembling human hyperplastic, serrated polyps .
  • RasGRPl and SOSl act in functional opposition to one another in the context of KRA ⁇ 4UT . Rasgrpl plays an unexpected suppressive role by constituting a negative feedback loop to the EGFR.
  • RasGRPl expression increases EGFR-SOS-Ras signalling and enhances the in vitro and in vivo growth of KRA ⁇ 4UT CRC cells.
  • higher RasGRPl expression not only correlates with better clinical outcome of patients with KRA ⁇ 4UT tumors but also when tumors are wildtype for KRAS.
  • loss of this RasGEF also exacerbates the phenotype of the Apc Mm/+ mouse model of colorectal cancer.
  • Our results reveal significant new insights in the EGFR-Ras pathway and how nuances in EGFR-Ras signals impact cell biology.
  • BCR B cell receptor
  • RasGRPl SOSl is ubiquitously expressed while RasGRPl has specific expression patterns in cells of the immune system, skin, and brain 5 .
  • Rasgrpl deficient mice have a T cell development defect 8 , suggesting an immune cell-centric role for Rasgrpl .
  • Rasgrpl was originally identified through a fibroblast transformation assay 29 , arguing that Rasgrpl can affect the function of multiple cell lineages.
  • Our DT40 data implied that RasGRPl might play an unappreciated role downstream of EGFR signalling and in epithelial cell lineages that respond to EGF.
  • RasGRPl RasGRPl and plotted RasGRPl expression levels in 60 cancer cell lines (NCI-60 panel 31 ).
  • High expression of this RasGEF occurs in T cell leukaemia lines MOLT4 and CEM, as we previously reported 32 , but RasGRPl expression can also be detected in various CRC cell lines, albeit at lower levels (Figs lc).
  • RasGRPl mRNA levels covered a dynamic range, both in 56 established CRC cell lines (Fig Id) and in 276 CRC patient samples (Fig le).
  • the RasGRPl expressed typically consists of the wild type sequence, and variants or mutations in RasGRPl are rare in CRC samples (5 out of 276, Fig le).
  • RasGRPl expression levels can be observed in the 276 tumors when these are stratified and color-coded for CRC with either wild type KRAS or with KRA ⁇ UT (Fig If), an observation that we confirmed by Taqman-based RasGRPl expression in liver metastases of colorectal cancer patients recovered from surgeries (Fig. lg).
  • Oncomine database at the oncomine.org website
  • RasGRPl expression levels in colonic adenocarcinomas are at a statistically significantly lower level when compared to RasGRPl in the normal colonic epithelium (Fig lh), 33-36 suggesting that RasGRPl may play a protective role in CRC.
  • the single-layered intestinal epithelium is a conveyer belt of cells that turns over every 4-5 days; Wnt signals in the bottom of the crypt regulate self-renewal of stem cells and the production of daughter cells that move up to undergo a proliferative phase in response to EGFR signals, followed by terminal differentiation, apoptosis, and shedding into the lumen 33 ' 34.
  • EGFR signalling is critical for intestinal maintenance 35 ' 36.
  • deficiency in egfr results in disorganized crypts 23 and fine-tuning of EGFR signalling is critical to regulate proliferation in the intestinal stem cell niche 37 .
  • EGFR-Ras signalling occurs in progenitor cells in the transit-amplifying (T/A) zone in the intestinal crypts, where it is thought to control proliferation and differentiation 24 .
  • Rasgrpl ' ' mice showed partial protection from DSS (dextran sulfate sodium)-induced colitis and retained a relatively normal architecture of the colonic epithelium (Fig. 2b and c).
  • DSS disulfate sodium
  • the lack of T lymphocytes in Rasgrpl ' ' mice unlikely provides the protection since DSS induces profound colitis in other mouse models devoid of T lymphocytes 38 .
  • the partial protection could be caused by a difference intrinsic to the epithelial cells in Rasgrpl ' ' mice and characterized the proliferative capacity next.
  • BrdU-labeling at 2 hours (Fig. 2d) and 48 hours (Fig.
  • Rasgrpl deficiency alters normal intestinal homeostasis and leads to increased proliferation of intestinal cells accompanied by increased apoptosis at the tip of the villi.
  • loss of Rasgrpl resulted in small but consistent increases in numbers of goblet cells in the small intestine, revealed by Alcian blue staining (Fig. 2k and 21).
  • the increased numbers of goblet cells that typically produce mucus may provide an additional explanation for the reduced DSS colitis in Rasgrpl ' ' mice.
  • Serrated polyps are now recognized as an important subcategory of hyperplastic polyps that provide a route to CRC that is to be distinguished from the progression of conventional adenomas to CRC 26 .
  • loss of either one or both Rasgrpl alleles resulted in exacerbated serrated dysplasia, typified by further lengthening and increased serration of villi-like projections into the colonic lumen.
  • goblet cells Figs. 3d, 3e, and 9c. The increased goblet cell presence
  • RasGRPl and SOS1 are likely to both play a role in CRC cells with either a KRAS ⁇ 111 or a KRAS WT allele, since both RasGEFs are phosphorylated in both in HCT15 and SW48 cells response to EGF signal input (Fig. 4f).
  • KRAS ⁇ 117 CRC cell lines demonstrate EGFR-induced hyperactivation of RAS.
  • RasGRPl in these cells is specific and selective; thus these cell lines express essentially no RasGRP 3 or RasGRP '4.
  • RasGRP2 while expressed e.g. in CaC02 and SW48 (Figs. 12a-12e), is an exchange factor for the small GTPase Rap 5 ' 46 .
  • Table 1 RasGRPl expression profile and KRAS mutational status in selected colorectal cancer cell lines.
  • Ras-GTP Binding of Ras-GTP to an allosteric pocket in SOS greatly enhances the RasGEF activity of SOS 9 and in cells this creates a positive feedback loop of Ras-GTP/SOS/Ras- GTP 4 ' 10 ' 11 (Fig. 5d).
  • SOSl promotes EGF -induced RAS activation and growth of KRAS MVT CRC cells [0125] To investigate the role of SOSl downstream of the EGFR in the context of a
  • KRAS MUT allele we reduced human SOSl expression in HCT15 CRC cells, which respond to EGF but are insensitive to the EGFR inhibitor Erlotinib (Fig. 6a and Table 2). Reduction of SOSl expression resulted in less sustained KRAS activation following EGF stimulation, compared to parental HCT15 cells or to HCT15 cells treated with a control shRNA (against murine Sosl) (Fig. 6b). The impaired KRAS activation in cells with a 52% reduction in SOSl was accompanied by diminished in vitro colony formation, particularly noticeable when EGF was used as the exclusive growth factor (Figs. 6c and 6d).
  • RasGRPl restricts EGF-SOS1 induced KRAS-ERK signalling through negative feedback.
  • RasGRPl is structurally distinct from SOSl and possesses 1000-fold lower intrinsic RasGEF activity than SOSl 25 . Moreover, RasGRPl is not activated allosterically by RAS- GTP 25 but is recruited to the membrane by diacyl glycerol 5 .
  • reduction of RasGRPl expression via shRNA could affect HCT15 cells differently than depletion of SOSl (Fig. 7a).
  • 53% reduction of RasGRP 1 from HCT 15 cells resulted in increased EGFR-driven hyperactivation of KRAS (Fig. 7b), which translated in sustained ERK phosphorylation downstream of RasGTP (Figs. 7c, 7d, 14a and 14b).
  • RasGRPl may impact SOSl .
  • P-Y1068-EGFR phospho-tyrosine 1068 in the EGFR
  • Grb2-SOSl a major auto-phosphorylation site 48 to which Grb2-SOSl is recruited 43 , when cells are stimulated with EGF.
  • diacyl glycerol -RasGRPl signalling constitutes a negative feedback loop to limit P-Yio68-EGFR-Grb2/SOS-RAS-ERK signals.
  • diacyl glycerol -RasGRPl signalling constitutes a negative feedback loop that limits EGFR-SOS-RAS signalling and has a growth suppressive role.
  • RasGRPl suppresses proliferative ERK signalling in the context of aberrant Wnt signalling.
  • RasGRPl plays a suppressive role in CRC in the context of both KRASMUT and ApcMin/+ by limiting proliferative ERK signals.
  • RasGRPl and SOS1 two structurally distinct RasGEFs 9 ' 25 , both lie downstream of the EGFR.
  • RasGRPl and SOS1 play opposing roles in the same CRC cell downstream of the EGFR.
  • Biochemically, reduction of RasGRPl levels relieves the negative feedback to EGFR-SOS1, sustains EGFR-RAS-ERK signalling, and promotes cell proliferation.
  • RasGRPl plays a negative regulatory role in CRC and that depletion of one or two Rasgrpl alleles exacerbates ERK signalling and serrated dysplasia and hyperproliferation of the KRas G12D intestinal epithelium.
  • Rasgrpl suppressed ERK signalling and proliferation in the Apc Mm/+ model of aberrant Wnt signaling.
  • RasGRPl reveals a range of expression in tumors of CRC patients and that high expression of RasGRPl correlates with better clinical outcome.
  • KRAS° 12L '.-Rasgrpr'- mice that were up to 9 months of age (not shown). Epithelial cells in these two models return to the normal simple columnar pattern further up the villus, despite the severely altered T/A zone, and loss of Rasgrpl results in increased levels of cell apoptosis.
  • KRAS° 12D requires additional events such as loss of the APC (Adenomatous Polyposis Coli) tumor suppressor 40 .
  • perturbation of APC requires EGFR signaling for tumor maintenance 58 ' 59 .
  • Rasgrpl also impacts homeostasis of the normal intestinal epithelium. Deletion of Rasgrpl results in increased proliferation of epithelial cells, increases levels of apoptosis at the tip of the villi, and a modest increase in the numbers of goblet cells. T/A progenitors derive from stem cells in the underlying crypt and produce the epithelial lining in the intestine. It is poorly understood how progenitor cells balance proliferation and terminal differentiation and whether distinct EGFR-Ras signals play a role herein. Deletion of Lrigl, a negative regulator of EGFR signalling, leads to loss of normal intestinal stem cell homeostasis 37 . RasGRPl and SOS1 have unique roles at distinct stages of T cell
  • RasGRPl but not SOS 1
  • SOS1 has been implicated in several cancer types ' ' 61
  • SOS1 in embryonic stem lineage commitment was described 62
  • the possibility that RasGRPl and SOS1 may play opposing roles in the same T/A cell downstream of the same EGFR is a novel and intriguing concept that requires future research.
  • RasGRP3 appears to connect to cMET(HGF)- signal input 63 .
  • Our results here show that RasGRPl responds to EGFR signal input.
  • RasGRP RasGEFs can couple to receptor tyrosine kinases but the mechanistic details and the biological consequences are not yet fully understood.
  • RasGRP3 has been implicated to promote growth of melanoma- and prostate- cancer cells 63 ' 64 whereas our findings here demonstrate that RasGRPl opposes the growth of CRC.
  • the suppressive function of RasGRPl in CRC also contrasts its growth- promoting role in T cell leukaemia 32 and in skin cancer 61 . Thus, not all RasGRPl -generated Ras signals are the same.
  • RasGRPl may function as a context-dependent tumor suppressor protein or a protein with oncogenic functions.
  • K RAS MUT cdls where S0S 1 is aiiosterically activated by the elevated levels of KRAS-GTP 4 ' 10 ' u . It is of interest to note that somatic KRAS MUT emerge as mediators of acquired resistance to anti-EGFR therapy 68 ' 69 . Possibly anti-EGFR therapy inhibits the negative feedback coming from EGFR-RasGRPl signals. Previous studies have shown that Grb2 can impair access of phosphatases to the FGFR 70 ' 71 . It is possible that RasGRPl indirectly promotes phosphatase access to the EGFR, reducing Grb2-SOSl-P-Yio 6 8-EGFR complexes.
  • EGFR-RasGRPl may influence the function of phosphatases directly.
  • the phosphatase Cdc25A binds to and dephosphorylates the EGFR 72 .
  • Vemurafenib (PLX4032) treatment of CRC cells with somatic BRAF(V600E) was recently shown to relieve a negative feedback loop to the EGFR by decreasing the activity of the phosphatase Cdc25C, resulting in increased P-Y1068-EGFR levels .
  • Adenocarcinoma 75 databases were evaluated for RasGRPl mRNA expression and copy levels.
  • cBio Cancer Genomics Portal 30 to interrogate above cancer genomic database (www.cbioportal.org).
  • RasGRPl expression has clinical significance in colon cancer
  • Oncomine database www.oncomine.org
  • TCGA Cancer Genome Atlas
  • Cell lines were cultured in ATCC-recommended media at 37 °C in 5% C0 2 .
  • Stable cell lines infected with lentivirus containing small hairpin RNA (shRNA) against SOS1 or RasGRPl were selected with puromycin lC ⁇ g/ml (Mediatech, inc, Cellgro) and subsequently sorted for GFP levels. Cells were maintained under selection.
  • Colorectal cancer cell line mutational status was obtained from the Wellcome Trust Sanger Institute Cancer Genome Project Web site (www.sanger.ac.uk/genetics/CGP/) and verified by UCSF sequencing core facility (Supplementary Table 1).
  • BrdU, DAPI, and Alcian blue were purchased from Sigma- Aldrich, Diacylglycerol kinase inhibitor II (R59949) was purchased from Enzo Life Science (Alexis) and dissolved in DMSO, human Epithelial Growth Factor (hEGF) recombinant protein was purchased from Life Technologies and dissolved in PBS, PKC inhibitor Rottlerin was purchased from Calbiochem and dissolved in DMSO.
  • Diacylglycerol kinase inhibitor II R59949
  • DMSO Diacylglycerol kinase inhibitor II
  • hEGF human Epithelial Growth Factor
  • Rottlerin was purchased from Calbiochem and dissolved in DMSO.
  • Antibodies were obtained from the following sources and used at indicated concentration: SOS1 (1 : 1000 for western blot; 1 : 100 for immunoprecipitation) from BD
  • KRAS 0120 ' .-Rasgrpl WT/' and KRA ⁇ 12D Rasgrpl ⁇ respectively.
  • Apc Mm/+ mice were crossed to Rasgrpl ' ' mice to obtained complete deletion of Rasgrpl (Apc Mm/+ :Rasgrpl ' ' ) .
  • Primers used for genotyping of Rasgrpl Primer 1, GCAGCTGTCAATAAGATCATCCAGGC (SEQ ID NO: 1); primer 2, ATATTGCTGAAGAGCTTGGCGGCGAATGGG (SEQ ID NO: 2); primer 3, CTATCCTCACTTGAGTCTCTCTTTCC (SEQ ID NO: 3). All other primers were recommended by Jackson laboratory (Bar Harbor, Maine).
  • oligonucleotides containing Hap I and Xho I sites were annealed and ligated into Hap 1- and Xho I-digested pSicoR-puro-t2a-eGFP to ere- ate mRasgrpl-1503-pSicoR-puro-t2a-eGFP and hRasGRPl-1503- pSicoR-puro-t2a-eGFP.
  • the oligonucleotide sequences are as follows. For mRasgrpl-1503 : sense oligonucleotide, 5'- TGATCGCTGCAAGC-
  • TTTCCATTCAAGAGATGGAAAGCTTGCAGCGATCTTTTTTC-3' SEQ ID NO: 4
  • antisense oligonucleotide 5 '-TCGAGAAAAAAGATCGCTGC AAGCTT- TCCATCTCTTGAATGGAAAGCTTGCAGCGATCA-3' (SEQ ID NO: 5).
  • hRasGRPl- 1503 sense oligonucleotide, 5 '-TGATT- GCTGCG-AGT-TTTCCATTCA- AGAGATGGAAAACTCGC AGCAATCTTTTTTC-3 ' (SEQ ID NO: 6); antisense oligonucleotide, 5 '-TCGAGAAAAAAGATTGCTGCGAGTTTTCCATCTC- TTGAATGGAAAACTCGCAGC AATC A-3 ' (SEQ ID NO: 7).
  • Targeting of the 1503 region was based on previous work (Roose et al. n ).
  • the hRasGRPl-1503 targets human RasGRPl, has three mismatches with the same sequence in mRasgrpl-1503, and served as a specificity control. Briefly, CRC cell lines were seeded in 24-well plate. Cells were infected with lentivirus (5MOI) and polybrene through standard spin infections (2200rpm for 1 hour) and selected by culture in the presence of puromycin (10 ⁇ g/ml) 48h after infection.
  • 5MOI lentivirus
  • polybrene through standard spin infections (2200rpm for 1 hour) and selected by culture in the presence of puromycin (10 ⁇ g/ml) 48h after infection.
  • oligonucleotides were ligated into pSicoR-puro-t2a-eGFP to create mSosl-1313- pSicoR-puro- t2a-eGFP and hSOSl-1313-pSicoR-puro-t2a-eGFP, based on published targeting sequences (Roose et al. (MCB, 2007)).
  • hSOSl-1313 targets human SOS1, has two mismatches with the same sequence in mSosl-1313, and served as a specificity control.
  • sense oligonucleotide 5 '-TGAC AGTGTTGC AA-
  • TGAGTTTTCAAGAGAAACTCATTGCAACACTGTCTTTTTTC-3' SEQ ID NO: 8
  • antisense oligonucleotide 5 '-TCGAGAAAAAAGAC AGTGTTGC AAT- GAGTTTCTCTTGAAAACTCATTGCAACACTGTCA-3' (SEQ ID NO: 9).
  • sense oligonucleotide 5 '-TGAC AGTGTTGT-AATGAA-TTTTCAAGA- GAAATTC ATTACAACACTGTCTTTTTTC-3 ' (SEQ ID NO: 10); antisense
  • oligonucleotide 5 '-TCGAGAAAAAAGAC AGTGTTGTAATGAATTTCTCTTGA- AAATTC ATTAC AAC ACTGTC A-3 ' (SEQ ID NO: 11).
  • RNA extraction and Real time PCR [0156] Total RNA was isolated from human tissue and cell lines using RNeasy kit (Qiagen) following the manufacturer's protocol. RNA was reverse-transcribed with random primers (Invitrogen) and Moloney murine leukaemia virus reverse transcriptase. Real-time PCR was performed in triplicate using Eppendorf RealPlex2. Gene expression was normalized to that of GAPDH and quantified with the comparative CT method according to the manufacturer's instructions.
  • RasGRP2, 3 and 4 probes and primers were obtained at Applied Bio System.
  • Cells were plated in 6 or 10 cm dishes and starved for 2 h at 37C in PBS. After resting, cells were EGF-stimulated for different time 3, 10 or 30 min. Cells were lysed with ice-cold 2% NP40 supplemented with protease and phosphatase inhibitors [10 mM sodium fluoride, 2 mM sodium orthovanadate, 0.5 mM EDTA, 2 mM phenyl- methyl sulfonyl fluoride, 1 mM sodium molybdate, aprotonin (lOmg/ml), leupeptin (lOmg/ml), pepstatin (lmg/ml)].
  • protease and phosphatase inhibitors 10 mM sodium fluoride, 2 mM sodium orthovanadate, 0.5 mM EDTA, 2 mM phenyl- methyl sulfonyl fluoride, 1 mM sodium molyb
  • Ras-GTP pull-down assay essentially according to the manufacturer' s instructions (Upstate). Briefly, cells were rested with PBS with Ca/Mg in 6-well plates at 37°C for 2 hours and stimulated with 5ng/ml hEGF for 3 and 10 min. Cells were then lyse with ice-cold lx MLB for pull downs (Millipore) and scraped. 20% of the lysate was used for whole cell lysate and 80% was used for pull down.
  • mice were sacrificed when their tumor volume reached 2,000 mm 3 or became excessively ulcerated. Experiments were repeated twice with 5 mice in each group.
  • DSS Dextran Sodium Sulfate-induced colitis
  • Tissues were dissected, fixed in 4% PFA and paraffin-embedded. Then 5 ⁇ m-thick sections were de-waxed in Histo-Clear (National Diagnostics) and rehydrated in graded alcohol baths. Antigen retrieval was performed in pressure cooker for 20 min in 10 mM sodium citrate buffer, pH 6.0. Endogenous peroxidase activity was inhibited with 1.5% H 2 0 2 in methanol for 20 min and washed in PBS. Nonspecific binding sites were blocked in blocking buffer (PBS, pH 7.4, 3% Serum, 1% BSA, and 0.1% Tween) for 60 min at RT. Sections were then incubated with primary antibodies diluted in blocking buffer overnight at 4°C.
  • PBS pH 7.4, 3% Serum, 1% BSA, and 0.1% Tween
  • mice were injected intraperitoneally (2 ⁇ 200 ⁇ 1) for 2 hours or 48 hours.
  • slides were treated with Alcian blue (pH2.5) for 30 min. and
  • Tissues were dissected, fixed in 4% PFA, incubated overnight at 4C in Sucrose 30% and embedded in OCT (Tissue-Tek, Dublin, Ireland) /Sucrose 30% (2vol/lvol). 10 ⁇ -thick sections (Cryostat Leica) were dried and wash in PBS. After 0.1% PBS-Tween (Sigma- Aldrich) wash, section were incubated in blocking buffer (1% BSA, 3% normal goat serum and 0.2% Triton X-100-PBS) for lh at RT. Sections were then incubated with primary antibodies diluted in blocking buffer overnight at 4°C.
  • EGFR/Ras/MAPK signaling mediates adult midgut epithelial homeostasis and regeneration in Drosophila.
  • RasGRP3 a Ras activator, contributes to signaling and the tumorigenic phenotype in human melanoma. Oncogene (2011).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • General Engineering & Computer Science (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Medical Informatics (AREA)
  • Evolutionary Biology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)

Abstract

Provided herein are methods for selecting a drug therapy for a patient with cancer, such as colorectal cancer, pancreatic cancer, lung cancer or breast cancer. The method includes determining or measuring the level of RasGRP1 polynucleotide or polypeptide in a sample from the patient. Also provided herein are methods for determining the likelihood of a good prognosis for a patient with cancer. Additionally, provided herein are methods for predicting the likelihood of a negative clinical response to an anti-EGFR therapy in a subject with cancer.

Description

PROGNOSTIC AND DIAGNOSTIC METHODS FOR COLORECTAL
CANCER
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] The present application claims benefit of priority to U.S. Provisional Patent Application No. 62/141,537, filed April 1, 2015, the disclosure is hereby incorporated by reference in its entirety for all purposes.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0002] This invention was made with government support under grants no. U54 CA143874 and P01 AI091580 awarded by the National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND OF THE INVENTION
[0003] Colorectal cancer (CRC) causes 655,000 deaths worldwide per year and is the third most common cancer in the United States. Patients with late-stage CRC have limited treatment options and molecular therapies are highly desired. The epidermal growth factor receptor (EGFR) plays a growth-promoting role in many types of cancer. Inhibition of EGFR signals by EGFR blocking antibodies and by EGFR kinase inhibitors is a successful molecular therapy for lung cancer patients. Despite widespread expression of EGFR in CRC, clinical trials with anti-EGFR therapy have been largely disappointing for CRC. Patients with mutations in KRAS have not responded well in these trials. Moreover, stratification of CRC patients based on the presence or absence of KRAS mutations has not been an effective or sensitive prognostic or predictive method.
[0004] In clinical trials of panitumumab (Vectibix®) and cetuximab (Erbitux®), patients with KRAS"1"' tumors did not benefit from these drugs. However, other studies have shown that a subpopulation of CRC patients with KRAS"1"' tumors do respond to anti-EGFR therapies. Thus, KRASwt and KRAS"1"' status alone are not effective indicators of anti-EGFR response. BRIEF SUMMARY OF ASPECTS THE INVENTION
[0005] In one aspect, provided herein is a method for selecting a drug therapy for a subject with cancer, e.g., colorectal cancer, pancreatic cancer, lung cancer or breast cancer. The method includes (a) determining the level of RasGRPl in a sample obtained from the subject; and (b) selecting a non anti-EGFR therapy for the subject if the level of RasGRPl is higher than a threshold value. The sample from the subject can be a tumor biopsy sample, a circulating tumor cell, or a fine needle aspirate,. The level of RasGRPl can be the level, amount or concentration of RasGRPl polynucleotide or the level, amount or concentration of RasGRPl polypeptide in the sample. In some embodiments, the level of RasGRPl polynucleotide is determined using an amplification assay or a hybridization assay. In some instances, the amplification assay is a probe-based quantitative amplification assay, such as a TaqMan® assay. In some embodiments, the level of RasGRPl polypeptide is determined using an immunoassay, immunohistochemistry, western blot or mass spectrometry. The method can also include determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, Kl 17N, A146P, A146T or A146V.
[0006] In some embodiments, the method can also include administering an effective amount of the non anti-EGFR therapy to the subject to alleviate at least one symptom of the cancer. The non anti-EGFR therapy can be a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGR inhibitor or other kinase inhibitor.
[0007] In second aspect, provided herein is a method for predicting a likelihood of a good prognosis for a subject with cancer, such as colorectal cancer, pancreatic cancer, lung cancer or breast cancer. The method includes (a) determining the level of RasGRPl in a sample obtained from the subject; and (b) predicting a likelihood of a good prognosis for the subject if the level of RasGRPl is higher than a threshold value. A good prognosis includes overall survival, progression-free survival, or response to therapy. If the level of RasGRPl is lower than a threshold value, a likelihood of a poor prognosis for the subject is predicted. The method can also include determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, Kl 17N, A146P, A146T or A146V. Additionally, the method can include predicting that the subject will not respond to an anti-EGFR therapy. If it is determined that the subject is a non- responder to an anti-EGFR therapy, a non anti-EGFR therapy can be recommended or administered to the subject. [0008] The sample obtained from the subject can be such as a tumor biopsy sample, a circulating tumor cell, or a fine needle aspirate. The level of RasGRPl can be the level, amount or concentration of RasGRPl polynucleotide or the level, amount or concentration of RasGRPl polypeptide in the sample. In some embodiments, the level of RasGRPl polynucleotide is determined using an amplification assay or a hybridization assay. In some instances, the amplification assay is a probe-based quantitative polymerase chain reaction assay, such as a TaqMan® assay. In some embodiments, the level of RasGRPl polypeptide is determined using an immunoassay, immunohistochemistry, western blot or mass
spectrometry.
[0009] In third aspect, provided herein is a method for predicting a likelihood of a negative clinical response to an anti-EGFR therapy in a subject with cancer, such as colorectal cancer, pancreatic cancer, lung cancer or breast cancer. The method includes (a) d determining the level of RasGRPl in a sample obtained from the subject, such as a tumor biopsy sample, a circulating tumor cell, and a fine needle aspirate, and (b) predicting a likelihood of a negative clinical response to the anti-EGFR therapy if the level of RasGRPl is higher than a control value. The method can also include determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, Kl 17N, A146P, A146T, A146V or a combination thereof. The level of RasGRPl can be the level, amount or concentration of RasGRPl polynucleotide or the level, amount or concentration of RasGRPl polypeptide in the sample. In some embodiments, the level of RasGRPl polynucleotide is determined using an amplification assay or a
hybridization assay. In some instances, the amplification assay is a probe-based quantitative polymerase chain reaction assay, such as a TaqMan® assay. In some embodiments, the level of RasGRPl polypeptide is determined using an immunoassay, immunohistochemistry, western blot or mass spectrometry. [0010] The method can also include administering an effective amount of the non anti- EGFR therapy to the subject to alleviate at least one symptom of the cancer. In some instances, the non anti-EGFR therapy includes a BRAF inhibitor, AKT inhibitor, MEK inhibitor, cMET inhibitor, VEGR inhibitor or other kinase inhibitor. [0011] Optionally, the method can include predicting a likelihood of a positive clinical response to the anti-EGFR therapy in the subject if the level of RasGRPl is lower than a threshold value. As such, the method can also comprise recommending or administering an anti-EGFR therapy to the subject. In some cases, the he anti-EGFR therapy is an EGFR blocking antibody or an EGFR inhibitor drug. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figs, la-le shows that RasGRPl is expressed in CRC cell lines and CRC patient tumor samples. Time course of EGF-induced ERK phosphorylation in DT40 B cells that are wild type or genetically deleted for SOS1 and SOS2, or for RasGRPl and RasGRP3 (Fig. la). EGF dose is 10 ng/ml. Tubulin serves as protein loading control. As in Fig. la, now analyzing the effects of 25, 5, and 1 ng/ml EGF in a 3-minute stimulation (Fig. lb). Figs, la and lb are representative results of 3 or more independent experiments. Plots showing RasGRPl mRNA expression z-scores versus copy number value in NCI-60 Cell Lines were obtained via cBio Portal (Fig. lc). Each blue dot represents one cell line. Some colorectal cancer cell lines and leukemia cell lines were noted as reference. Plots showing RasGRPl mRNA expression z-scores versus copy number value in 56 colorectal cancer cell lines (Fig. Id). Various colorectal cancer cell lines used in our study were noted on the plot. RasGRPl mRNA expression z-scores versus copy number value in human colon cancer patients (n = 276) from TCGA (The Cancer Genome Atlas) Colorectal Adenocarcinoma dataset (Fig. le). Each dot represents a sample with either, no mutation on RasGRPl (blue), missense mutation (red, n=5) or nonsense (yellow). RasGRPl mRNA expression z-scores are plotted against KRAS mRNA expression z-scores for the 276 patient samples in Fig. le (Fig. If). Colors represent mutational status. RasGRPl mRNA expression determined by Taqman PCR on liver metastases samples surgically removed from 30 colorectal cancer patients (Fig. lg). Oncomine analysis was performed to examine RASGRPl expression in human colon adenocarcinoma (n=101) (dark blue boxplot) and normal colon (n=19) (light blue boxplot) using online TCGA microarray data (Fig. lh). RASGRPl levels are decreased in colon adenocarcinoma compared with normal tissues (p=6.73E-10, fold change= -2.244). [0013] Figs. 2a-21 illustrate that Rasgrpl plays a role in intestinal epithelial cell
proliferation and goblet cell generation. Immunohistochemistry for Rasgrpl protein in the small intestines of wildtype or Rasgrpl ~'~ mice. The asterisks denote nonspecific staining observed in both mouse models (Fig. 2a). Rasgrpl deficient mice demonstrate resistance to DSS-induced colitis (Fig. 2b). Representative images of a cohort of n = 5 for WT and n = 6 for Rasgrpl' '; 5 days of DSS treatment. Colonic fields were scored for mucosal damage, ranging from 0-12, following published parameters 79. Average WT score = 10, Rasgrpl' ' score = 5. Scores are presented in Fig. lc. Bar graphs of mucosal damage scores following 5 days of DSS treatment, n = 5 for WT and n = 6 for Rasgrpl' ' (Fig. 2c). Colonic fields were scored for mucosal damage, ranging from 0-12, following published parameters, p = 0.0115 {unpaired t test). Short- (2 hr., Fig. 2d) and long-term (48 hr., Fig. 2e) in vivo BrdU labeling assay revealing proliferating cells in the colon of wildtype ox Rasgrpl' ' mice. Scale bars, ΙΟΟμπι. Quantification and statistical analysis of BrdU-positive cells counted in the colon (Fig. 2f). Three mice per genotype and fifty crypts per mouse were counted and averages ± s.e.m are depicted. ***/?<0.0001 {t-tesf}. As in Fig. 2e.. long-term (48 hr.) in vivo BrdU labeling in the small intestine (Fig. 2g). Scale bars, ΙΟΟμπι. Positioning of BrdU-positive cells in the small intestine (Fig. 2h). Three mice per genotype and twenty crypt-villus axes were counted. Data were represented as percentage of cells per position ± s.e.m.
Representative images of small intestines of WT- and Rasgrpl' '- mice stained for cleaved caspase-3 (red) and DAPI (blue) (Fig. 2i). Scale bars, ΙΟΟμπι. Quantification of cleaved caspase-3 -positive cells in the small intestine from mice with the indicated genotype (Fig. 2j). Fifty villi per genotype (n=3) that were transversally sectioned were counted and averages ± s.e.m are depicted. * ?<0.05 {t-tesf). Alcian blue staining (Fig. 2k) to visualize goblet cell presence in the small intestine (duodenum). (Fig. 21) Two mice per genotype and fifty villi per mouse were counted and averages ± s.e.m are depicted. ***/?<0.001 {t-tesf).
[0014] Figs. 3a-3h shows that loss of one or two Rasgrpl alleles exacerbates serrated dysplasia of KRasG12D epithelium. Representative sections of colon with H&E (Fig. 3a) or Ki67 stainings (Fig. 3b), revealing the serrated dysplasia of the colonic epithelium in
KRasG12D mice that is further exacerbated with loss of Rasgrpl . Scale bars, 50μπι.
Quantification of diving cells in crypts regions of the colon following a short-term (2 hr.) in vivo BrdU labeling assay (Fig. 3c). Five mice per genotype and fifty crypts per mouse were counted and averages ± s.e.m are depicted. */><0.05, ***/><0.0001. Representative images of colonic section with Alcian blue staining to reveal goblet cells (Fig. 3d). Quantification and statistical analysis of the frequency of goblet cells in the distal colon (Fig. 3e). Three mice per genotype and fifty open crypts per mouse were counted and averages ± s.e.m are depicted. */><0.05, **/><0.001. Representative H&E-stained sections of small intestine demonstrating the branched villi in KRas Gl 2D and KRas Gl 2D :Rasgrpl~ / ' mice (Figs. 3f-3h). Scale bars, 50μιη. Quantification of branching villi in the small intestine following the approach of Fig. 2C (Fig. 3i). ***/ 0.0001. Higher magnifications of branching villi (Figs. 3j-31) with Ki67 stainings (Figs. 3n-3p). Detail of the aberrant transit-amplifying (T/A) zone in KRasG12D :Rasgrpl' ' small intestine (from Figs. 31 and 3p) (Figs. 3m and 3q). All mice were euthanized at 6 months of age. [0015] Figs. 4a-4f shows that EGFR connects to both RasGRPl and SOSl . Detection of RasGRPl - and EGFR- expression by western blot in eighteen colorectal cancer (CRC) cell lines. Asterisks indicate KRAS mutations KRASMUT) (Fig. 4a). RasGRPl phosphorylation in EGF- or BCR-stimulated DT40 B cells (Fig. 4b). PKC inhibitor (Rottlerin) and genetic deletion of RasGRPl/3 function as specificity controls and Tubulin as protein loading control. Detection of RasGRPl phosphorylation in EGF-stimulated HCT15 and SW48 CRC cells from which RasGRPl protein was immunoprecipitated (IP) (Fig. 4c). Blotting for total RasGRPl levels reveals equal efficiency of the IP and Tubulin expression of whole cell lysates (WCL) demonstrates equal protein input for the IP. Detection of EGF -induced SOSl mobility shifts and ERK phosphorylation in WCL of HCT15 and SW48 cells (Figs. 4d and 4e). All panels are representative results of three or more independent experiments. Cartoon of EGFR-RasGRP 1 and EGFR-SOS1 signalling (Fig. 4f)
[0016] Figs. 5a-5d illustrates that hyperactivation of RAS in EGF-stimulated KRASMUT CRC cells. Total baseline RAS-GTP levels in serum-starved CRC cells reveals elevated levels in CRC cell lines with KRASMUT (Fig. 5a). Levels are normalized to RAS and arbitrarily set at 1.0 in WiDr cells. KRAS-GTP profile of time courses with EGF-stimulated (5 ng/ml) KRAS wild type cells (KRASWT) (Fig. 5b) and KRAS mutant cells KRASMUT) (Fig. 5c). Results in Figs. 5a-c are representative of three or more independent experiments.
Cartoon of Grb2/SOSl recruitment to tyrosine-phosphorylated EGFR and allosteric activation of SOSl through a positive feedback loop by Ras-GTP (Fig. 5d). [0017] Figs. 6a-6e illustrate that EGFR- SO SI signals promote EGFR-Ras signalling and tumorigenesis of KRAS^1 CRC cells. Detection of SOSl expression in HCT15 cells with knockdown for human SOSl (shRNAhSOSl) (Fig. 6a). shRNA for murine Sosl (shRNAmSOSl) is used as specificity control. Detection of KRAS-GTP in the indicated EGF-stimulated (5ng/ml) HCT15 cell populations (Fig. 6b). KRAS-GTP levels are quantitated and corrected for by total KRAS levels. Unstimulated WT HCT15 cells are arbitrarily set at 1.0. Representative results of four independent experiments. Soft-agar colony formation assays of the indicated HCT15 cell populations that were grown in growth medium with 5% serum (Fig. 6c) or in serum-free medium supplemented with lOng/ml EGF (Fig. 6d). Relative tumor size of the indicated HCT15 cells xenografted into nude mice and measured 40 days after injection (5 mice/group) (Fig. 5e). Figs. 6c-e represent averages with standard errors; ns = not significant, * ><0.05, *** ><0.0001. [0018] Figs. 7a-7i show that RasGRPl feedback restricts EGFR-SOSl-Ras signals.
Detection of RasGRPl expression in KRA^UT HCT\5 cells analogous to Fig. 6a (Fig. 7a). Knockdown for murine Rasgrpl (shRNAmRgl) functions as control. KRAS-GTP levels in the indicated EGF-stimulated (5ng/ml) HCT15 cell populations (Fig. 7b). Note the increase KRAS-GTP levels at the 10-minute time point when RasGRPl expression levels are reduced. Analysis of ERK phosphorylation and total ERK protein levels in the same cell lysates presented in Fig. 7b (Fig. 7c). Unstimulated WT HCT15 cells are arbitrarily set at 1.0.
Quantification of ERK phosphorylation from Fig. 7c and two independent experiments (Figs. 14a and 14b) (Fig. 7d). Averages in fold difference ± s.e.m are depicted. *p<0.05 comparing the 10-minue time point of shRNAhRGl to that for WT and shRNAmRGl . Analysis of EGFR phosphorylation in WCL of EGF-stimulated (25ng/ml) cells (Fig. 7e). Analysis of EGF-induced complexes of Grb2/SOSl with P-Yi068-EGFR (Fig. 7f). SOS 1 was
immunoprecipitated (SOS1 IP) from the indicated HCT15 cells and IP's were blotted with specific antibodies against the indicated proteins. Note the increased levels of P-Yio68-EGFR that IP with SOS1 in an EGF-stimulatory dependent manner when RasGRPl levels are reduced. Analysis of P-Yio68-EGFR in the indicated EGF-stimulated HCT15 populations as in Fig. 7e (Fig. 7g). Cells were treated with R59949 DGK inhibitor to enhance DAG- RasGRPl signalling or with DMSO as control. R59949 exposure results in decreased levels of P-Yio68-EGFR. All panels in figure 7 are representative examples of three or more independent experiments. Immunohistochemical analysis of ERK phosphorylation levels in brown staining in the colonic epithelium of the indicated mouse genotypes (Fig. 7h). Images of distal colonic epithelium are representative results of two mice per genotype. Analysis of ERK phosphorylation and total ERK protein level of mouse intestinal epithelial cells (IEC)
Gl 2D Gl 2D JVT/
isolated from colon of control WT-, KRas - KRas Rasgrpl ' -mice (6 month-old) (Fig. 7i). Blots show three independent experiments. P-ERK in IEC from WT mice is arbitrarily set at 1.0 for each experiment.
[0019] Figs. 8a-8j show that RasGRPl limits CRC cell proliferation and in vivo tumor growth. Soft-agar colony formation assays analogous to the ones presented in Figs. 6c and d but now analyzing RasGRPl function (Figs. 8a and 8b). Reduction of RasGRPl expression by 53% results in increased growth under both indicated growth conditions. Averages with standard errors are depicted; NS = not significant, *** /?<0.0001 {One-way ANOVA).
Relative tumor size of the indicated HCT15 cells xenografted into nude mice and measured 40 days after injection (5 mice/group) (Fig. 8c). HCT15 cells with reduced RasGRPl levels result in statistically significant larger tumors compared to the WT and the mouse Rasgrpl shRNA controls. * /><0.05. Growth rates of the indicated xenografted HCT15 cells (Fig. 8d). Specifics of HCT15 cells with shRNAhSOS l are inserted in blue for comparison. Kaplan- Meier survival curve from 172 humans patient samples showing correlation between
RasGRPl expression level and clinical patients survival in GSE17536 (Fig. 8e). High RasGRPl expression level (red line) (n=155) correlates with better prognosis than low RasGRPl expression level (blue line) (n=17) (p = 0.0243). Kaplan-Meier survival curve showing decreased survival of 'ApcMm/+ mice deleted for Rasgrpl (n = 20) compared to ApcMm/+ mice (n = 12) (Fig. 8f). *** p < 0.0006, Log-rank (Mantel-Cox) Test. Representative image of a ApcMm/+ :Rasgrpl ~'~ colon with tumors in the distal portion (Fig. 8g).
Quantification of colonic tumor incidence in ApcMin/+ and ApcMin :Rasgrpl~ ~ mice (n = 16 and 19, respectively) (Fig. 8h). **p < 0.01 (unpaired t-test). Bar graph analysis of colonic tumor sizes for ApcMm/+ and ApcMm .-Rasgrpl^ mice (Fig. 8i). Analysis of ERK
phosphorylation and total ERK protein levels of normal colon and colonic tumors of individual ApcMm/+ and ApcMm/+:Rasgrplv- mice (3-6 month-old) (Fig. 8j). Fig. 8j is representative result of three independent experiments. P-ERK in ApcMm/+micQ was arbitrarily set at 1.0.
[0020] Figs. 9a-9c show representative sections of colon with H&E (Fig. 9a) or Ki67 stainings (Fig. 9c), revealing the serrated dysplasia of the colonic epithelium in KRasG12D mice that is further exacerbated with loss of Rasgrpl . Fig. 9c provides a comparison between Ki67-positive cells/crypt for each genotype.
[0021] Figs. 10a- lOd show representative sections of colon with H&E (Fig. 10a) or Ki67 stainings (Fig. 10b), revealing different villi length for the different mouse genotypes. Fig. 10c quantification of villi length for the different mouse genotypes. Fig. lOd shows the length of the intestinal track from the different mouse genotypes.
[0022] Figs. 1 la- 1 lb show representative sections of colon with cleaved caspase-3 stainings (Fig. 11a) and quantification (Fig. l ib). [0023] Figs. 12a-12e provides expression data in seven CRC lines that represent each of the significant genotypes in Table 1. The expression of RasGRPl (Figs. 12a and 12b), RasGRP2 (Fig. 12c), RasGRP3 (Fig. 12d), and RasGRP4 (Fig. 12e) were measured in the cell lines.
[0024] Figs. 13a-13e show N-RAS and H-RAS activation upon EGF induction in different colorectal cancer (CRC) cell lines by western blotting of pull down assays. Fig. 13a shows the pull-down assays. Quantification of the assays for NRAS-GTP is shown in Figs. 13b andl3c for different cell lines. Quantification of the assays for HRAS-GTP is shown in Figs. 13d andl3e for different cell lines.
[0025] Figs. 14a-14b shows sustained ERK phosphorylation in RasGRPl knockdown cells. Figs. 14a and 14b represent two independent experiments. [0026] Figs. 15 a- 15b shows Kaplan-Meier survival curves from human patient samples showing correlation between RasGRPl expression level and clinical patients survival in GSE12945 (Fig. 15a) and GSE14333 (Fig. 15a).
[0027] Figs. 16a- 16k shows that RasGRPl suppresses proliferative ERK signaling in the context of aberrant Wnt signaling. ApcMm/+ mice develop large numbers of tumors in the small intestine (Fig. 16a) and additional loss of Rasgrpl did not lead to significant changes in tumor numbers or size in the small intestine (Figs. 16a and 16b). Fig. 16c shows cross sections of colonic tumors from ApcMin/+ and ApcMin/+ : Rasgrpl ~'~ mice. Fig. 16d shows Ki67- staining of colonic tumors from ApcMin/+ and ApcMin/+ : Rasgrpl ~'~ mice. Fig. 16e provides quantification of Ki67-positive cells. Fig. 16f shows phospho-ERK staining of colonic tumors in the mice. Fig. 16g shows that colonic tumors in ApcMin/+ :Rasgrpl~ ~ mice contain more BrdU positive cells compared to ApcMm/+ mice. ApcMin/+ :Rasgrpl~ ~ mice have higher levels of pERK in normal crypt (Fig. 16h) and colonic tumors (Fig. 16i), compared to Ap ' 1'" mice. Fig. 16j shows cleaved caspase-3 staining in Ap ' 1"' and ApcMm/+ .-Rasgrpl ~'~ tumors. Fig. 16k shows the quantification of data from Fig. 16j . [0028] FIG. 17 is a block diagram of computer system 1700 that may incorporate an embodiment, be incorporated into an embodiment, or be used to practice any of the innovations, embodiments, and/or examples found within this disclosure.
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0029] The present disclosure provides, in part, methods for detecting the level of the Ras activator RasGRPl in tumor cells (e.g., circulating cells, fine needle aspirates, or tissue biopsies) from a patient with cancer (e.g., colorectal cancer, pancreatic cancer, lung cancer or breast cancer). The presence or level of RasGRPl polynucleotide (mRNA) or polypeptide can be used for therapy selection, predicting drug response, and cancer prognosis. The methods are useful for determining whether a cancer patient is likely to have a good prognosis. The presence or level of RasGRPl in a patient' s sample can also be used as an indicator whether a patient will not respond to an anti-EGFR therapy, such as an anti-EGFR antibody or an EGFR inhibitor drug. II. Definitions
[0030] The term "colorectal cancer" is used in the broadest sense and refers to (1) all stages and all forms of cancer arising from epithelial cells of the large intestine and/or rectum and/or (2) all stages and all forms of cancer affecting the lining of the large intestine and/or rectum. In the staging systems used for classification of colorectal cancer, the colon and rectum are treated as one organ.
[0031] The term "epidermal growth factor receptor" ("EGFR") refers to a gene that encodes a membrane polypeptide that binds, and is thereby activated by, epidermal growth factor (EGF). EGFR is also known in the literature as ERBB, ERBB l and HER1. An exemplary EGFR is the human epidermal growth factor receptor (see Ullrich et al. (1984) Nature 309:418-425; Genbank accession number NP_005219.2; complete cds AY588246.1). Binding of an EGF ligand activates the EGFR (e.g. resulting in activation of intracellular mitogenic signaling, autophosphorylation of EGFR). One of skill in the art will appreciate that other ligands, in addition to EGF, can bind to and activate the EGFR. Examples of such ligands include, but are not limited to, amphiregulin, epiregulin, TGF-a, betacellulin, and heparin-binding EGF (HB-EGF). Intracellular domain of, a human, EGFR comprises a polypeptide sequence from amino acid adjacent to the transmembrane domain up to COOH- terminus of the EGFR. Intracellular domain comprises, inter alia, tyrosine kinase domain.
[0032] "Anti-EGFR therapy" or "anti-EGFR drug" refers to any therapeutic agent, molecule, or compound capable of directly or indirectly inhibiting activation of EGFR. An anti-EGFR therapy include agents that bind to an EGFR molecule and inhibit its activation. Anti-EGFR therapy includes antibodies that bind to an EGFR and inhibit activation of the EGFR; as well as small molecule tyrosine kinase inhibitors or "kinase inhibitors" that inhibit activation of an EGFR. Antibodies to EGFR include IgG; IgM; IgA; antibody fragments that retain EGFR binding capability, e.g., Fv, Fab, F(ab)2, single-chain antibodies, and the like; chimeric antibodies; etc. Small molecule tyrosine kinase inhibitors of EGFR include EGFR- selective tyrosine kinase inhibitors. Small molecule tyrosine kinase inhibitors of EGFR can have a molecular weight in a range of from about 50 Da to about 10,000 Da.
[0033] The term "non anti-EGFR therapy" refers to any therapeutic agent, molecule, or compound that does not directly bind to EGFR (e.g., EGFR polynucleotide or EGFR polypeptide) or directly inhibit EGFR activation, and does directly bind to a different kinase or inhibit its activity. For instance, a non anti-EGFR therapy can be an anti-BRAF therapy, anti-AKT therapy, anti-MEK therapy, anti-cMET therapy, anti-VEGR therapy, other anti- receptor tyrosine kinase therapy, or other anti-kinase therapy.
[0034] The term "RasGRPl" refers to the RasGFPl gene identified as NCBI GenelD No. 10125 and/or its expression products, including the RasGFPl coding sequence or mRNA (Genbank Accession No. NM 001128602) and the RasGFPl polypeptide (GenBank
Accession No. NP_001122074).
[0035] The term "KRAS" refers to the KRAS gene identified as NCBI GenBank Accession No. NM_004985.3, and/or its expression products. "KRAS"is also identified in literature as KRAS 1 , KRAS2, RASK2, KI-RAS, K-RAS4 A, K-RAS4B or p21.
[0036] As used herein, the term "amino acid variant" is used to refer to an amino acid change to a reference human protein sequence resulting from genetic variants or nucleotide variants to the reference human gene encoding the reference protein. The term "amino acid variant" is intended to encompass not only single amino acid substitutions, but also amino acid deletions, insertions, and other significant changes of amino acid sequence in the reference protein. [0037] The term "EGFR inhibitor" refers to a compound that inhibits, decreases, lowers, or reduces at least one activity of an epidermal growth factor receptor (EGFR). Examples of EGFR inhibitors include, but are not limited to, [6,7-bis(2-methoxyethoxy)-4-quinazolin-4- yl]-(3-ethynylphenyl)amine (also known as OSI-774), erlotinib, CI-1033 (formerly known as PD183805), AG-1478, CGP-59326, PKI-166, EKB-569, lapatinib or lapatinib ditosylate; and gefitinib, AG490 (a tyrphostin), ARRY-334543, BIBW-2992, EKB-569, ZD6474, BMS- 599626 (Bristol-Myers Squibb), cetuximab, and MDX-447.
[0038] The term "high level" as used herein with respect to the level of RasGRPl polynucleotide or polypeptide level refers to any level that is above a threshold value that is established from the level of RasGRPl polynucleotide or polypeptide in a sample from a reference (control) population. In some embodiments, the reference population is one or more CRC patients receiving an anti-EGFR therapy. In some instances, this reference population includes one or more CRC patients receiving an anti-EGFR therapy in
combination with another molecular therapy, e.g., aVEGR inhibitor, BRAF inhibitor, MEK inhibitor, etc., chemotherapy, radiotherapy or surgery. In yet other embodiments, the reference population is one or more CRC patients that are not receiving therapy. In some embodiments, the reference population is one or more normal individual. In some cases, elevated polynucleotide (e.g., mRNA) levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold greater than the threshold level of RasGRPl RNA detected in a sample from one or more CRC patients a CRC patient on an anti-EGFR therapy or from a plurality of CRC patients on an anti-EGFR therapy an anti-EGFR therapy. Elevated polypeptide levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold greater than the threshold level of RasGRPl polypeptide detected in a sample from one or more CRC patients receiving an anti-EGFR therapy. [0039] The term "low level" as used herein with respect to the level of RasGRPl polynucleotide or polypeptide level refers to any level that is below a threshold value that is established from the level of RasGRPl polynucleotide or polypeptide in a sample from a reference (control population). In some embodiments, the reference population is one or more CRC patients receiving an anti-EGFR therapy. In some instances, this reference population includes one or more CRC patients receiving an anti-EGFR therapy in
combination with another molecular therapy, e.g., aVEGR inhibitor, BRAF inhibitor, MEK inhibitor, etc., chemotherapy, radiotherapy or surgery. In yet other embodiments, the reference population is one or more CRC patients that are not receiving therapy. In some embodiments, the reference population is one or more normal individual. In some cases, decreased polynucleotide (e.g., mRNA) levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold lower than the threshold level of RasGRPl RNA detected in a sample from one or more CRC patients receiving an anti-EGFR therapy. Decreased polypeptide levels of RasGRPl can be 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more fold lower than the threshold level of RasGRPl polypeptide detected in a sample from one or more CRC patients receiving an anti- EGFR therapy.
[0040] The terms "responsive," "clinical response," " positive clinical response," and the like, as used in the context of a patient's response to an anticancer therapy, are used interchangeably and refer to a favorable patient response to a drug as opposed to unfavorable responses, i.e. adverse events. In a patient, beneficial response can be expressed in terms of a number of clinical parameters, including loss of detectable tumor (complete response, CR), decrease in tumor size and/or cancer cell number (partial response, PR), tumor growth arrest (stable disease, SD), enhancement of anti-tumor immune response, possibly resulting in regression or rejection of the tumor; relief, to some extent, of one or more symptoms associated with the tumor; increase in the length of survival following treatment; and/or decreased mortality at a given point of time following treatment. Continued increase in tumor size and/or cancer cell number and/or tumor metastasis is indicative of lack of beneficial response to treatment. In a population the clinical benefit of a drug, i.e., its efficacy can be evaluated on the basis of one or more endpoints. For example, analysis of overall response rate (ORR) classifies as responders those patients who experience CR or PR after treatment with drug. Analysis of disease control (DC) classifies as responders those patients who experience CR, PR or SD after treatment with drug.
[0041] A positive clinical response can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of tumor growth, including slowing down and complete growth arrest; (2) reduction in the number of tumor cells; (3) reduction in tumor size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of tumor cell infiltration into adjacent peripheral organs and/or tissues; (5) inhibition of metastasis; (6) enhancement of anti-tumor immune response, possibly resulting in regression or rejection of the tumor; (7) relief, to some extent, of one or more symptoms associated with the tumor; (8) increase in the length of survival following treatment; and/or (9) decreased mortality at a given point of time following treatment. Positive clinical response may also be expressed in terms of various measures of clinical outcome. Positive clinical outcome can also be considered in the context of an individual's outcome relative to an outcome of a population of patients having a comparable clinical diagnosis, and can be assessed using various endpoints such as an increase in the duration of recurrence-free interval (RFI), an increase in the time of survival as compared to overall survival (OS) in a population, an increase in the time of disease-free survival (DFS), an increase in the duration of distant recurrence-free interval (DRFI), and the like. An increase in the likelihood of positive clinical response corresponds to a decrease in the likelihood of cancer recurrence.
[0042] The term "good prognosis" refers to the prediction of the likelihood of disease- specific survival, overall survival or disease free survival, including partial remission, complete remission, and suppression of cancer cell proliferation and/or metastasis. A good prognosis for a patient with a solid tumor cancer includes a positive response rate in terms of disease remission or tumor shrinkage, or any other form of evaluating reduced tumor burden or growth. A good prognosis can be measured as the length (time) of survival.
[0043] The term "poor prognosis" refers to the prediction of the likelihood of cancer- attributable death or progression, including recurrence, relapse, metastatic spread, and drug resistance.
[0044] The term "overall survival" refers to the time interval from either the time of diagnosis or the start of treatment that the patient is still alive.
[0045] The term "progression-free survival" refers to the time interval from treatment of the patient until the progression of cancer or death of the patient, whichever occurs first.
[0046] The term "responder" or "responsive" refers to a patient who has cancer, and who exhibits a beneficial clinical response following treatment with an anti-cancer therapy.
[0047] The term "non-responder" or "non-responsive" refers to a patient who has a cancer, and who does not exhibit a beneficial clinical response following treatment with an anti- cancer
[0048] The term "subject" is intended to include animals. Examples of subjects include mammals, e.g., humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In certain embodiments, the subject is a human, e.g., a human suffering from, at risk of suffering from, or potentially capable of suffering from cancers. [0049] The term "inhibitor" in the context of a specific polynucleotide or polypeptide, refers to inhibitory molecules identified using in vitro and/or in vivo assays for binding or signaling of the specific polynucleotide or polypeptide, e.g., naturally-occurring ligands and synthetically-designed ligands, antibodies and antibody fragments, antagonists, agonists, small molecules including carbohydrate-containing molecules, siRNAs, RNA aptamers, homologs thereof, mimetics thereof, and the like. In some cases, the inhibitor directly or indirectly binds to the specific polypeptide, such as a neutralizing antibody or blocking antibody. Inhibitors, as used herein, are synonymous with inactivators and antagonists.
A. Detecting RasGRPl Levels [0050] The methods provided herein are based on the determination of the level of
RasGRPl in a biological sample. As used herein, the term "RasGRPl" includes a nucleotide sequence of a RasGRPl gene containing one or more changes as compared to the wild-type RasGRPl gene or an amino acid sequence of a RasGRPl polypeptide containing one or more changes as compared to the wild-type RasGRPl polypeptide sequence. Human RasGRPl is set forth in NCBI GenelD No. 10125. The mRNA (coding) and polypeptide sequences of human RasGRPl are set forth in, e.g., Genbank Accession Nos. NM_001128602 and NP 001122074, respectively. In addition, the complete sequence of human chromosome 15 assembly GRCh38, which includes RasGRPl, is set forth in, e.g., Genbank Accession No. NC 000015.10. Furthermore, the sequence of RasGRPl from other species can be found in the GenBank database.
[0051] The levels of RasGRPl polynucleotide (e.g., mRNA) can be detected using techniques known to those of ordinary skill in the art, such as polymerase chain reaction (PCR) and hybridization assays.
[0052] Probes may be used in hybridization techniques to detect polynucleotides. The technique generally involves contacting and incubating nucleic acids obtained from a sample from a patient with a probe under conditions favorable for the specific annealing of the probes to complementary sequences in the nucleic acids (e.g. under stringent conditions). After incubation, the non-annealed nucleic acids are removed, and the presence of nucleic acids that have hybridized to the probe if any are detected. Nucleotide probes for use in the detection of polynucleotide sequences in samples may be constructed using conventional methods known in the art. The probes may comprise DNA or DNA mimics corresponding to a portion of an organism's genome, or complementary RNA or RNA mimics. The nucleic acids can be modified at the base moiety, at the sugar moiety, or at the phosphate backbone. DNA can be obtained using standard methods such as PCR amplification of genomic DNA or cloned sequences. Computer programs known in the art can be used to design primers with the required specificity and optimal amplification properties. A nucleotide probe may be labeled with a detectable substance such as a radioactive label which provides for an adequate signal and has sufficient half-life. Other detectable substances that may be used include antigens that are recognized by a specific labeled antibody, fluorescent compounds, enzymes, antibodies specific for a labeled antigen, and luminescent compounds. An appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleic acids to be detected and the amount of nucleic acids available for hybridization.
[0053] The detection of polynucleotides in a sample may involve the amplification of specific gene sequences using an amplification method such as PCR, followed by the analysis of the amplified molecules using techniques known to those skilled in the art. By way of example, oligonucleotide primers may be employed in a PCR based assay to amplify a portion of a polynucleotide and to amplify a portion of a polynucleotide derived from a sample, wherein the oligonucleotide primers are specific for (i.e. hybridize to) the
polynucleotides. The amplified cDNA is then separated and detected using techniques well known in the art, such as gel electrophoresis.
[0054] Other exemplary methods known in the art for the quantification of polynucleotide (e-g, mRNA) expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNase protection assays (Hod, Biotechniques 13 :852-854 (1992)); and PCR-based methods, such as reverse transcription PCT (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)).
[0055] In some embodiments, the level of RasGRPl polynucleotide is measured using a reverse transcriptase-polymerase chain reaction (RT-PCR) or a variant thereof. Useful fluorogenic probe based quantitative PCR methods are described in, e.g., Heid et al., Genome Res, 6:986-94, 1996. The principle of such probe-based quantitative PCR methods utilizes the 5'-3' exonuclease activity of Taq DNA polymerase for direct and specific detection of PCR products via release of fluorescence reporter dyes. In addition to sense and antisense primers, the PCR employs a doubly fluorescently labeled probe (e.g., TaqMan® probe) which hybridizes to a sequence of the PCR product. The probe is labeled 5' with a reporter dye (e.g., FAM) and 3' with a quencher dye (e.g., TAMRA). If the probe is intact, the spatial proximity of reporter to quencher suppresses the emission of reporter fluorescence. I f the probe hybridizes to the PCR product during the PCR, said probe is cleaved by the 5'-3' exonuclease activity of Taq DNA polymerase and suppression of the reporter fluorescence is removed. The increase in reporter fluorescence as a consequence of the amplification of the target, is measured after each PCR cycle and utilized for quantification. Expression of the target gene (e.g., RasGRPl) is quantified absolutely or relative to expression of a control gene with constant expression in the tissues to be studied. In some embodiments of the method, a TaqMan® Gene Expression Assay (Life Technologies), such as Hs00996727, Hs00996728, Hs00996724, Hs00996725 and Hs00996729 is used. [0056] Polypeptide expression of RasGRPl can be detected in suitable cells and tissues, such as tumor sample or tumor cell material obtained by biopsy. Various assay methods are known to those of ordinary skill in the art. The method can include (a) contacting the sample from the subject with a binding agent (e.g., an antibody, an antibody fragment, or an aptamer); (b) detecting in the sample a level of polypeptide that binds to the binding agent; and (c) comparing the level of polypeptide with a predetermined standard or cut-off value. For example, the patient sample, which can be immobilized, can be contacted with an antibody, an antibody fragment, or an aptamer, that selectively binds to RasGFPl, and determining whether the antibody, fragment thereof or aptamer has bound to the protein. Protein expression can be measured using a variety of methods standard in the art, including, but not limited to: Western blot, immunoblot, enzyme-linked immunosorbant assay (ELISA), sandwich immunoassay, radioimmunoassay (RIA), bead-based immunoassay,
immunoprecipitation, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, microcytometry, microarray, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry.
[0057] Commercially available antibodies that specifically bind to RasGRPl are from, e.g., Life Technologies (Cat. No. PA5-25750), Abeam (Cat. No. ab l3987), Novus Biologicals (Cat. No. NBPl-98413), Millipore (Cat. No. MABS 146), and Santa Cruz Biotechnology (sc- 28581), are useful for the methods provided herein. Antibodies that bind to phosphorylated RasGRPl are available from Sigma-Aldrich (Cat. No. AB4200337). B. Detecting Activating KRAS Variants
[0058] In some embodiments, the methods of the invention further comprise determining the presence or absence of an activating KRAS gene present in a tumor sample from the patient. As used herein, the term "KRAS mutant" or "KRAS variant" includes a nucleotide sequence of a KRAS gene containing one or more changes as compared to the wild-type KRAS gene or an amino acid sequence of a KRAS polypeptide containing one or more changes as compared to the wild-type KRAS polypeptide sequence. Human KRAS is set forth in NCBI GenelD No. 3845. The mRNA (coding) and polypeptide sequences of human KRAS are set forth in, e.g., Genbank Accession Nos. NM_033360.3, NM_004985.4, NP_203524.1, and NP_004976.2, respectively. In addition, the complete sequence of human chromosome 12 assembly GRCh38, which includes KRAS, is set forth in, e.g., Genbank Accession No. NC_000012.12. Furthermore, the sequence of KRAS from other species can be found in the GenBank database.
[0059] Activating KRAS variants can include mutations in exon 2 (codons 12 and 13) and exon 3 (codon 61) of the human KRAS gene. The variant can be, but is not limited to, a
KRAS G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, Kl 17N, A146P, A146T or A146V variant.
[0060] Commercially available assays for detecting KRAS mutations in a biological sample can be used. Non-limiting examples of KRAS mutation detection kits include Cobas KRAS mutation test (Roche Molecular Diagnostics), Droplet Digital PCR (Bio-Rad), TaqMan® Mutation Detection Assay (Thermo Fisher), and TheraScreen® KRAS RGQ (Roto- Gene Q) PCR Kit (Qiagen). Detection of an activating KRAS mutation can be carried out using any of a variety of methods Numerous methods are known in the art for detection of sequence variations (polymorphisms and mutations) in nucleic acid samples, and can be used for detecting an activating KRAS mutation. Such methods include methods based on polymerase chain reaction, or allele specific amplification in combination with DNA sequencing, or TaqMan®. In addition, methods can be designed to detect sequence variants (e.g., known variants) at a targeted position in the nucleic acid sequence. Sequence variants are detected using as probes or primers oligonucleotides that hybridize differentially to each variant. Many approaches have been developed to increase the selectivity of hybridization of sequence specific probes to targeted variants; the extent of hybridization is of the sequence specific probes is often detected based on detecting and/or quantifying the amount of product formed in a subsequent polymerase chain reaction.
C. Kits, Probes and Primers
[0061] The present invention contemplates the use of kits, probes and/or primers that can be used to stratify patients between responders and non-responders. Such kits can include reagents that detect the presence of KRAS and RasGRPl (DNA or mRNA or protein). For example, the kit can include probes and/or primers that selectively hybridize to KRAS DNA or mRNA and can detect the one or more KRAS mutations disclosed herein. The kit can further include reagents such as probes, primers and/or antibodies to detect the presence and quantity of RasGRPl . A kit herein can furthermore include reagents useful for detecting the presence and/or quantity of any one or more of the following markers EGFR, SOS1 and SOS2.
D. Establishing a Threshold Value
[0062] In order to establish a threshold value for practicing the method of this invention, a reference population of subjects can be used. In some embodiments, a population of CRC patients receiving an anti-EGFR therapy or another molecular targeted therapy can be used. In some embodiments, the CRC patients in the reference group may receive an anti-EGFR therapy or another molecular targeted therapy, in combination with chemotherapy, radiation therapy and/or surgical resection of the tumor. In other embodiments, the reference population includes subjects who do not have CRC. In yet other embodiments, the reference population includes subjects who have CRC and are not receiving targeted therapy. These patients are within the appropriate parameters, if applicable, for the purpose of screening for and/or monitoring cancer using the methods of the present invention. Optionally, the patients are of same gender, similar age, or similar ethnic background. [0063] The status of the selected patients is confirmed by well established, routinely employed methods including but not limited to general physical examination of the individuals and general review of their medical history.
[0064] Furthermore, the selected group of patients must be of a reasonable size, such that the average level/amount/concentration of human RasGRPl polynucleotide (mRNA) or RasGRPl protein in the sample obtained from the group can be reasonably regarded as representative of the normal or average level among this population of patients. [0065] Once an average value for the RasGRPl polynucleotide (mRNA) or RasGRPl protein is established based on the individual values found in each subject of the selected group, this average or median or representative value or profile is considered a threshold value. A standard deviation is also determined during the same process. In some cases, separate threshold values may be established for separately defined groups having distinct characteristics such as age, gender, or ethnic background.
E. Selecting Drug Therapies or Predicting Response to Drug Therapies
[0066] According to the methods described herein, the presence or level of RasGRPl in the patient's sample is compared to one or more reference or threshold values. In some embodiments, the level of RasGRPl is deemed "high' if it is at least 1, 2, 3, 4, 5, 10, 15, 20 or more standard deviations greater than the reference value subjects. In other embodiments, the level of RasGRPl is "low" if it is at least 1, 2, 3, 4, 5, 10, 15, 20 or more standard deviations lower than the reference or threshold value.
[0067] Those skilled in the art are familiar with various ways of deriving and using threshold values. For example, the reference value may represent the level, amount or concentration of a RasGRPl in a sample from a plurality of CRC patient receiving an anti- EGFR therapy. In some instances, reference CRC patients also receive chemotherapy, radiation therapy and/or surgery for tumor removal. If a level, amount or concentration in a sample from the test subject is significantly higher {e.g., 1.01-fold, 1.05-fold, 1.10-fold, 1.2- fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold or more higher) than the threshold value, this would indicate, e.g., a likelihood of a good prognosis or a negative clinical response to an anti-EGFR therapy. If a level, amount or concentration in a sample from the test subject is significantly lower (e.g., 1.01-fold, 1.05-fold, 1.10-fold, 1.2-fold, 1.3-fold, 1.4- fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20- fold, 30-fold, 40-fold, 50-fold, 100-fold or more higher) than the threshold value, this would indicate, e.g., a likelihood of a poor prognosis or a positive clinical response to an anti-EGFR therapy.
[0068] In some embodiments, if RasGRPl level in the sample from the test patient is significantly higher than or above the threshold value, a drug therapy that is not an anti- EGFR therapy is selected for the patient. Rather, a drug therapy comprising a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGFR inhibitor, or other kinase inhibitor can be recommended to treat the patient with cancer. In some instances, it is determined that tumor cells of this test patient also carry an activating KRAS mutation. In other instances, it is determined that tumor cells of this test patient are wild-type for KRAS.
[0069] In other embodiments, if RasGRPl level in the sample from the test patient is significantly lower than or below the threshold value, an anti-EGFR therapy is selected for the patient. The anti-EGFR therapy can include an EGFR blocking antibody or an EGFR inhibitor. In some instances, it is determined that tumor cells of this test patient also carry an activating KRAS mutation. In other instances, it is determined that tumor cells of this test patient are wild-type for KRAS. [0070] If two or more biomarkers (e.g., RasGRPl level and presence or absence of activating KRAS variant) are used, an index value may represent the level of the biomarkers. Other markers that can be evaluated include EGFR, SOS 1 and SOS2. When two or more biomarkers are used in the method described herein, the level of each biomarker can be weighted and combined. Thus, a test value may be provided by (a) weighting the determined level of each biomarker with a predefined coefficient, and (b) combining the weighted level to provide a test value. The combining step can be either by straight addition or averaging (i.e., weighted equally) or by a different predefined coefficient.
[0071] The invention also provides the use of a computer system, such as that described above, which comprises: (1) a computer; (2) a stored bit pattern encoding the biomarker testing results obtained by the methods of the invention, which may be stored in the computer; (3) and, optionally, (4a) a program for selecting a drug therapy for a patient having cancer, (4b) a program for predicting the likelihood of a positive prognosis for a patient having cancer, or (4c) a program for predicting the likelihood of a negative response to an anti-EGFR therapy in a patient having cancer. [0072] In some embodiments, a computer system is used in which a value of RasGRPl levels in a sample from a patient undergoing testing is entered into the computer and compared to a threshold value. If RasGRPl level in the sample from the patient undergoing testing is significantly higher than or above the threshold value received by the computer, a drug therapy employing a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGFR inhibitor, or other kinase inhibitor is identified as a drug therapy to treat the patient. In other embodiments, if a RasGRPl level in the sample from the patient undergoing testing is significantly lower than or below the threshold value, an anti-EGFR drug therapy, such as an EGFR blocking antibody or EGFR inhibitor is identified as a drug therapy to treat the patient.
[0073] The following describes an illustrative computer -implemented method for selecting a drug therapy for a patient based on RasGRPl levels or for determining the likelihood of a good prognosis or poor porgnonis using RasGRPl levels. Implementations of or processing in the computer-implemented method may be performed by software (e.g., instructions or code modules) when executed by a central processing unit (CPU or processor) of a logic machine, such as a computer system or information processing device, by hardware components of an electronic device or application-specific integrated circuits, or by combinations of software and hardware elements.
[0074] In the computer-implemented method, information is received describing the level of RasGRPl in a sample obtained from a subject. For example, the level of
RasGRPl associated may be recorded. In one embodiment, input data includes a text file (e.g., a tab-delimited text file) of RasGRPl values. In one embodiment, input data includes a text file (e.g., a tab-delimited text file) of RasGRPl levels in the sample from the subject.
[0075] The information describing the RasGRPl levels is compared to a threshold value recorded by the computer. A subject's estimated likelihood of a good prognosis if the value is higher than a threshold value, or of a poor prognosis if the RasGRPl level is lower than the threshold value is determined, added to a summary plot, and output as a new report. In some embodiments, the information describing the RasGRPl levels is compared to a threshold value recorded by the computer. In some embodiments, the identification of the subject as being a candidate for a non-anti-EGFR therapy if the level of RasGRPl is higher than a threshold value is determined, added to a summary plot, and output as a new report. In some embodiments, the identification of the subject as being a candidate for an anti-EGFR therapy if the level of RasGRPl is lower than the threshold value is determined, added to a summary plot, and output as a new report.
Hardware Description
[0076] The information obtained from the RasGRl analysis may be stored in a computer readable form. Such a computer system typically comprises major subsystems such as a central processor, a system memory (typically RAM), an input/output (I/O) controller, an external device such as a display screen via a display adapter, serial ports, a keyboard, a fixed disk drive via a storage interface and a floppy disk drive operative to receive a floppy disc, and a CD-ROM (or DVD-ROM) device operative to receive a CD-ROM. Many other devices can be connected, such as a network interface connected via a serial port.
[0077] The computer system may also be linked to a network, comprising a plurality of computing devices linked via a data link, such as an Ethernet cable (coax or lOBaseT), telephone line, ISDN line, wireless network, optical fiber, or other suitable signal
transmission medium, whereby at least one network device (e.g., computer, disk array, etc.) comprises a pattern of magnetic domains (e.g., magnetic disk) and/or charge domains (e.g., an array of DRAM cells) composing a bit pattern encoding data acquired from an assay of the invention. [0078] The computer system can comprise code for interpreting the results of a study evaluating RasGRPl levels in a sample from a patient. Thus, in an exemplary embodiment, the RasGRPl analysis results are provided to a computer where a central processor executes a computer program for determining the likelihood of a good prognosis or of a poor prognonis. In some embodiments, the central processor executes a code for selecting a drug therapy where a non-anti-EGFR therapy is selected if the level of RasGRPl is higher than a threshold value. In some embodiments, the central processor executes a code for selecting a drug therapy where an anti-EGFR therapy is selected if the level of RasGRPl is lower than a threshold value.
[0079] The invention thus includes a computer system to implement the method for determining the likelihood of a good prognosis or a poor prognosis; or to implement the methjod for selecting a drug therapy. Such a computer system can comprise code for interpreting the results of an analysis evaluating the level of RasGRPl levels in a sample obtained from the subject. Thus in an exemplary embodiment, the expression analysis results are provided to a computer where a central processor executes a computer program for determining the likelihood of a good or poor prognosis in the subject and/or for selecting a drug therapy for the subject.
[0080] The invention also provides the use of a computer system, such as that described above, which comprises: (1) a computer; (2) a stored bit pattern encoding the RasGRPl levels in a sample obtained from the patient, e.g., a tumor biopsy sample, which may be stored in the computer; and, optionally, (3) a program for determining the level compared to a threshold level. [0081] The invention further provides methods of generating a report based on the
RasGRPl level in a sample obtained from the patient.
[0082] FIG. 17 is a block diagram of a computer system 1700 that may incorporate an embodiment, be incorporated into an embodiment, or be used to practice any of the innovations, embodiments, and/or examples found within this disclosure. FIG. 17 is merely illustrative of a computing device, general-purpose computer system programmed according to one or more disclosed techniques, or specific information processing device for an embodiment incorporating an invention whose teachings may be presented herein and does not limit the scope of the invention as recited in the claims. One of ordinary skill in the art would recognize other variations, modifications, and alternatives.
[0083] Computer system 1700 can include hardware and/or software elements configured for performing logic operations and calculations, input/output operations, machine communications, or the like. Computer system 1700 may include familiar computer components, such as one or more one or more data processors or central processing units (CPUs) 1705, one or more graphics processors or graphical processing units (GPUs) 1210, memory subsystem 1715, storage subsystem 1720, one or more input/output (I/O) interfaces 1725, communications interface 1730, or the like. Computer system 1700 can include system bus 1735 interconnecting the above components and providing functionality, such
connectivity and inter-device communication. Computer system 1700 may be embodied as a computing device, such as a personal computer (PC), a workstation, a mini -computer, a mainframe, a cluster or farm of computing devices, a laptop, a notebook, a netbook, a PDA, a smartphone, a consumer electronic device, a gaming console, or the like.
[0084] The one or more data processors or central processing units (CPUs) 1705 can include hardware and/or software elements configured for executing logic or program code or for providing application-specific functionality. Some examples of CPU(s) 1705 can include one or more microprocessors (e.g., single core and multi-core) or micro-controllers. CPUs 1705 may include 4-bit, 8-bit, 12-bit, 16-bit, 32-bit, 64-bit, or the like architectures with similar or divergent internal and external instruction and data designs. CPUs 1705 may further include a single core or multiple cores. Commercially available processors may include those provided by Intel of Santa Clara, California (e.g., x86, x86_64, PENTIUM, CELERON, CORE, CORE 2, CORE ix, ITANR7M, XEON, etc.) or by Advanced Micro Devices of Sunnyvale, California (e.g., x86, AMC 64, ATHLON, DURON, TURION, ATHLON XP/64, OPTERON, PHENOM, etc). Commercially available processors may further include those conforming to the Advanced RISC Machine (ARM) architecture (e.g., ARMv7-9), POWER and POWERPC architecture, CELL architecture, and or the like.
CPU(s) 1705 may also include one or more field-gate programmable arrays (FPGAs), application-specific integrated circuits (ASICs), or other microcontrollers. The one or more data processors or central processing units (CPUs) 1705 may include any number of registers, logic units, arithmetic units, caches, memory interfaces, or the like. The one or more data processors or central processing units (CPUs) 1705 may further be integrated, irremovably or moveably, into one or more motherboards or daughter boards. [0085] The one or more graphics processor or graphical processing units (GPUs) 1710 can include hardware and/or software elements configured for executing logic or program code associated with graphics or for providing graphics-specific functionality. GPUs 1710 may include any conventional graphics processing unit, such as those provided by conventional video cards. Some examples of GPUs are commercially available from NVIDIA, ATI, and other vendors. In various embodiments, GPUs 1710 may include one or more vector or parallel processing units. These GPUs may be user programmable, and include hardware elements for encoding/decoding specific types of data (e.g., video data) or for accelerating 2D or 3D drawing operations, texturing operations, shading operations, or the like. The one or more graphics processors or graphical processing units (GPUs) 1710 may include any number of registers, logic units, arithmetic units, caches, memory interfaces, or the like. The one or more data processors or central processing units (CPUs) 1705 may further be integrated, irremovably or moveably, into one or more motherboards or daughter boards that include dedicated video memories, frame buffers, or the like.
[0086] Memory subsystem 1715 can include hardware and/or software elements configured for storing information. Memory subsystem 1715 may store information using machine- readable articles, information storage devices, or computer-readable storage media. Some examples of these articles used by memory subsystem 1715 can include random access memories (RAM), read-only-memories (ROMS), volatile memories, non-volatile memories, and other semiconductor memories. In various embodiments, memory subsystem 1715 can include data and program code 1740.
[0087] Storage subsystem 1720 can include hardware and/or software elements configured for storing information. Storage subsystem 1720 may store information using machine- readable articles, information storage devices, or computer-readable storage media. Storage subsystem 1720 may store information using storage media 1745. Some examples of storage media 1745 used by the storage subsystem 1720 can include floppy disks, hard disks, optical storage media such as CD-ROMS, DVDs and bar codes, removable storage devices, networked storage devices, or the like. In some embodiments, all or part of the RasGRPl data and program code 1740 may be stored using the storage subsystem 1720.
[0088] In various embodiments, computer system 1700 may include one or more hypervisors or operating systems, such as WINDOWS, WINDOWS NT, WINDOWS XP, VISTA, WINDOWS 7 or the like from Microsoft of Redmond, Washington, Mac OS or Mac OS X from Apple Inc. of Cupertino, California, SOLARIS from Sun Microsystems, LINUX, UNIX, and other UNIX-based or UNIX-like operating systems. Computer system 1700 may also include one or more applications configured to execute, perform, or otherwise implement techniques disclosed herein. These applications may be embodied as cancer prognosis data and the program code 1740. Additionally, computer programs, executable computer code, human-readable source code, shader code, rendering engines, or the like, and data, such as image files, models including geometrical descriptions of objects, ordered geometric descriptions of objects, procedural descriptions of models, scene descriptor files, or the like, may be stored in the memory subsystem 1715 and/or storage subsystem 1720.
[0089] The one or more input/output (I/O) interfaces 1725 can include hardware and/or software elements configured for performing I/O operations. One or more input devices 1750 and/or one or more output devices 1755 may be communicatively coupled to the one or more I/O interfaces 1725.
[0090] The one or more input devices 1750 can include hardware and/or software elements configured for receiving information from one or more sources for computer system 1700. Some examples of the one or more input devices 1750 may include a computer mouse, a trackball, a track pad, a joystick, a wireless remote, a drawing tablet, a voice command system, an eye tracking system, external storage systems, a monitor appropriately configured as a touch screen, a communications interface appropriately configured as a transceiver, or the like. In various embodiments, the one or more input devices 1750 may allow a user of the computer system 1700 to interact with one or more non-graphical or graphical user interfaces to enter a comment, select objects, icons, text, user interface widgets, or other user interface elements that appear on a monitor/display device via a command, a click of a button, or the like.
[0091] The one or more output devicesl755 can include hardware and/or software elements configured for outputting information to one or more destinations for computer system 1700. Some examples of the one or more output devices 1755 can include a printer, a fax, a feedback device for a mouse or joystick, external storage systems, a monitor or other display device, a communications interface appropriately configured as a transceiver, or the like. The one or more output devices 1755 may allow a user of the computer system 1700 to view objects, icons, text, user interface widgets, or other user interface elements. [0092] A display device or monitor may be used with computer system 1700 and can include hardware and/or software elements configured for displaying information. Some examples include familiar display devices, such as a television monitor, a cathode ray tube (CRT), a liquid crystal display (LCD), or the like.
[0093] Communications interface 1730 can include hardware and/or software elements configured for performing communications operations, including sending and receiving data. Some examples of the communications interface 1730 may include a network
communications interface, an external bus interface, an Ethernet card, a modem (telephone, satellite, cable, ISDN), (asynchronous) digital subscriber line (DSL) unit, FireWire interface, USB interface, or the like. For example, communications interface 1730 may be coupled to communications network/external bus 1780, such as a computer network, to a FireWire bus, a USB hub, or the like. In other embodiments, communications interface 1730 may be physically integrated as hardware on a motherboard or daughter board of computer system 1700, may be implemented as a software program, or the like, or may be implemented as a combination thereof. [0094] In various embodiments, computer system 1700 may include software that enables communications over a network, such as a local area network or the Internet, using one or more communications protocols, such as the HTTP, TCP/IP, RTP/RTSP protocols, or the like. In some embodiments, other communications software and/or transfer protocols may also be used, for example IPX, UDP or the like, for communicating with hosts over the network or with a device directly connected to computer system 1700.
[0095] FIG. 17 is merely representative of a general -purpose computer system
appropriately configured or specific data processing device capable of implementing or incorporating various embodiments of an invention presented within this disclosure. Many other hardware and/or software configurations may be apparent to the skilled artisan which are suitable for use in implementing an invention presented within this disclosure or with various embodiments of an invention presented within this disclosure. For example, a computer system or data processing device may include desktop, portable, rack-mounted, or tablet configurations. Additionally, a computer system or information processing device may include a series of networked computers or clusters/grids of parallel processing devices. In still other embodiments, a computer system or information processing device may perform techniques described above as implemented upon a chip or an auxiliary processing board. [0096] Many hardware and/or software configurations of a computer system may be apparent to the skilled artisan, which are suitable for use in implementing a computer-based method of determining the likelihood of a good or poor prognosis RasGRPl levels desribed herein. For example, a computer system or data processing device may include desktop, portable, rack-mounted, or tablet configurations. Additionally, a computer system or information processing device may include a series of networked computers or clusters/grids of parallel processing devices. In still other embodiments, a computer system or information processing device may use techniques described above as implemented upon a chip or an auxiliary processing board.
[0097] Various embodiments of an algorithm as described herein can be implemented in the form of logic in software, firmware, hardware, or a combination thereof. The logic may be stored in or on a machine-accessible memory, a machine-readable article, a tangible computer-readable medium, a computer-readable storage medium, or other
computer/machine-readable media as a set of instructions adapted to direct a central processing unit (CPU or processor) of a logic machine to perform a set of steps that may be disclosed in various embodiments of an invention presented within this disclosure. The logic may form part of a software program or computer program product as code modules become operational with a processor of a computer system or an information-processing device when executed to perform a method or process in various embodiments of an invention presented within this disclosure. Based on this disclosure and the teachings provided herein, a person of ordinary skill in the art will appreciate other ways, variations, modifications, alternatives, and/or methods for implementing in software, firmware, hardware, or combinations thereof any of the disclosed operations or functionalities of various embodiments of one or more of the presented inventions. F. Drug Therapies
[0098] The methods provided herein can be used to select or predict a response (negative response or positive response) to an anti-EGFR therapy in a patient with cancer. An anti- EGFR therapy includes any therapeutic agent that blocks or inhibits the expression or activity of the EGFR gene and/or its expression products and any signaling molecule acting in the EGFR signaling pathway. Non-limiting anti-EGFR therapies include an EGFR blocking antibody, such as, cetuximab (Erbitux®) and panitumumab (Vectibix™), or an EGFR inhibitor, such as erlotinib (Tarceva®), gefitinib (Iressa®), lapatinib (GW-572016; Tykerb®), and vandetanib (ZACTFMA™; ZD6474).
[0099] Non-limiting non anti-EGFR therapies include a BRAF inhibitor, such as vemurafenib and abrafenib; Akt inhibitor such as GSK2141795 and MK2206; MEK inhibitor, such as trametinib (Mekinist™), TAK-733, selumetinib, and MEK162; VEGF inhibitor, such as bevacizumab (Avastin®), Aflibercept and BAY43-9006; and other kinase inhibitors, such as sunitinib (Sutent®), canertinib (CI 1033), semaxinib (SU5416), vatalanib (PTK787/ZK222584), sorafenib (BAY 43-9006; Nexavar®), regorafenib, imatinib mesylate (Gleevec®), leflunomide (SU101), alisertib (MLN8237), pelitinib, CP-654577, CP-724714, HKI-272, PKI-166, AEE788, BMS-599626, HKI-357, BIBW 2992, ARRY-334543, JNJ- 26483327, and JNJ-26483327; and combinations thereof. Non-limiting examples of c-Met inhibitors include monoclonal antibodies such as AMG102 and MetMAb; small molecule inhibitors of c-Met such as ARQ197, JNJ-38877605, PF-04217903, SGX523, GSK
1363089/XL880, XL184, MGCD265, and MK-2461; and combinations thereof.
[0100] The molecular targeted therapies described herein, such as anti-EGFR therapies and non anti-EGFR therapies, can be administered to a patient with cancer in combination with other types of cancer therapy. Non-limiting examples of cancer therapies or cancer treatments include chemotherapy, radiation therapy, and surgical removal of tumors. In some embodiments, a patient with receiving an anti-EGFR therapy can also receive chemotherapy, radiation therapy, and/or surgical resectioning. In other embodiments, a patient with receiving a non anti-EGFR therapy can also receive chemotherapy, radiation therapy, and/or surgical resectioning. III. Examples
[0101] The following examples are offered to illustrate, but not to limit the claimed invention. Those of skill in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield essentially similar results. Example 1. The Ras Exchange Factor RasGRPl Opposes Proliferative EGFR-SOSl Ras Signals and Restricts Intestinal Epithelial Cell Growth
[0102] The character of EGFR signals can influence cell fate but mechanistic insights into intestinal EGFR-Ras signalling are limiting. Here we show that two distinct Ras nucleotide exchange factors, RasGRPl and SOS1, lie downstream of the EGFR but act in functional opposition. RasGRPl is expressed in the intestinal crypt compartment where it restricts epithelial growth. RasGRPl is also expressed in colorectal cancer (CRC) cell lines and patient samples and high RasGRPl expression correlates with a better clinical outcome. Biochemically, we find that RasGRPl creates a negative feedback loop that limits proliferative EGFR-SOSl -Ras signals in CRC cells. Genetic Rasgrpl depletion from mice with either an activating mutation in KRas (KRasG12D) or with aberrant Wnt signalling due to a mutation in Ape (ApcMm/+) resulted in both cases in exacerbated Ras-ERK signalling and cell proliferation. The unexpected opposing cell biological effects of EGFR-RasGRPl and EGFR-SOSl signals in the same cell shed new light on the intricacy of EGFR-Ras signalling in the normal epithelium and in carcinoma. Introduction
[0103] Ras is a molecular switch, activated through GTP-loading by Ras guanine nucleotide exchange factors (RasGEFs) in response to receptor signals \ The amplitude and duration of epidermal growth factor receptor (EGFR) signalling to Ras and its downstream target MAPK (MAP kinase) affects cell fate; EGF stimulation of rat adrenal
pheochromocytoma (PC-12) cells leads to transient Ras activation and proliferation. By contrast, NGF or EGF stimulation of PC12 cells overexpressing the EGFR results in sustained Ras-MAPK activation, exit from mitosis, and differentiation 1. Lymphocytes stimulated through the T-cell receptor (TCR) also display distinct patterns of Ras-MAPK activation 3' 4 and deficiency of either Rasgrpl or Sosl RasGEFs impact T cell development at distinct stages 5"8. We have shown that the type of RasGEF utilized dictates the pattern of Ras activation; RasGRPl (Ras guanine nucleotide releasing protein- 1) transmits analog Ras signals while SOS1 (Son of Sevenless-1) transmits digital Ras signals 4. Digital Ras activation critically relies on allosteric activation of SOS, which is accomplished by Ras-GTP binding to an allosteric pocket in SOS 9 and creates a positive feedback loop in various cell types 4' 10' u [0104] Ras plays an important role in cancer and thirty percent of metastatic cancers carry somatic KRAS mutations (termed KRASMUT here), such as KRAS0120. These mutations impair RasGAP-mediated Ras inactivation, culminating in high levels of constitutively active KRAS-GTP and strong proliferative signals l' 12' 13. Colorectal cancer (CRC) is the third most common cancer in the United States 14 and CRC tumors carry KRAl iUT in approximately 40% of patients 15. Cancer therapy via molecular inhibition of specific targets is a highly sought-after goal but the complexity of cancer signalling pathways is a major challenge 16' 11. There is widespread EGFR expression in CRC 15 but clinical trials with anti-EGFR blocking antibodies or inhibitors of the EGFR kinase (e.g. Cetuximab, Gefitinib, or Erlotinib) have been disappointing for CRC, particularly when tumors carry KRAl iUT 18' 19. By contrast, such therapies have been successful in non-small-cell lung cancer (NSCLC) patients with EGFR mutations 19. The most intuitive explanation for failure of anti-EGFR therapy in KRAl iUT CRC is that the constitutive activity of KRAl iUT bypasses regulation mediated by the EGFR. However, recent studies indicate that EGFR signals can modulate tumor growth in the context of KRASMUT. In mice, EGFR signalling is essential for ^^^-driven pancreatic ductal carcinoma (PDAC) 20' 21 and in the clinic Erlotinib is beneficial for a limited number of PDAC patients 22. Thus, KRAl iUT appear not to operate entirely autonomously but seem influenced by EGFR signalling but mechanistic insights in CRC are largely lacking.
[0105] Egfr deficiency in mice results in crypt defects in the normal intestine 23 and EGFR- Ras signalling in intestinal progenitor cells are believed to balance proliferation and differentiation 24, although mechanistic insights in the cell biology are very limited. We recently established that RasGRPl is structurally distinct from SOS1 and lacks an allosteric activation mechanism triggered by Ras-GTP 9' 25. We postulated that RasGRPl and SOS1 RasGEFs may play distinct roles in EGFR signalling. Through database mining, we first revealed that RasGRPl is expressed in CRC cell lines and in CRC patient samples. We confirmed RasGRPl expression in patient specimens recovered from surgeries. We established that RasGRPl is also expressed in the normal intestinal epithelium, responds to EGF signal input, but restricts proliferation in the normal epithelium. Genetic ablation of Rasgrpl alleles exacerbates KRasG12D -induced proliferative dysplasia of the intestinal epithelium, resembling human hyperplastic, serrated polyps . We show that upon EGF stimulation, RasGRPl and SOSl act in functional opposition to one another in the context of KRA^4UT . Rasgrpl plays an unexpected suppressive role by constituting a negative feedback loop to the EGFR. Reduction of RasGRPl expression increases EGFR-SOS-Ras signalling and enhances the in vitro and in vivo growth of KRA^4UT CRC cells. We established that higher RasGRPl expression not only correlates with better clinical outcome of patients with KRA^4UT tumors but also when tumors are wildtype for KRAS. In agreement with a more general suppressive role of RasGRPl, loss of this RasGEF also exacerbates the phenotype of the ApcMm/+ mouse model of colorectal cancer. Our results reveal significant new insights in the EGFR-Ras pathway and how nuances in EGFR-Ras signals impact cell biology.
Results
[0106] RasGRPl expression in CRC
[0107] A DT40 B cell model engineered to express the EGFR in addition to the
endogenously expressed B cell receptor (BCR) has been useful to dissect different signalling pathways. Initially, it was proposed that SOSl couples to the EGFR in these cells but not to the BCR, whereas the inverse was suggested for RasGRPl 27. These conclusions were subsequently adjusted when it became clear that SOSl does play a role downstream of the BCR when the strength of stimulation is at lower, more physiological levels 4' 11 (for review see 28). Here we explored this DT40 system and utilized more modest levels of EGF stimulation. In contrast to the initial report 27 , we found that ERK activation is reduced in EGF-stimulated DT40 cells that lack RasGRPl and RasGRP3 (Figs la and lb). SOSl is ubiquitously expressed while RasGRPl has specific expression patterns in cells of the immune system, skin, and brain 5. Rasgrpl deficient mice have a T cell development defect 8, suggesting an immune cell-centric role for Rasgrpl . However, Rasgrpl was originally identified through a fibroblast transformation assay 29 , arguing that Rasgrpl can affect the function of multiple cell lineages. Our DT40 data implied that RasGRPl might play an unappreciated role downstream of EGFR signalling and in epithelial cell lineages that respond to EGF.
[0108] We next used cBio portal 30 to mine The Cancer Genome Atlas (TCGA) for RasGRPl and plotted RasGRPl expression levels in 60 cancer cell lines (NCI-60 panel 31). High expression of this RasGEF occurs in T cell leukaemia lines MOLT4 and CEM, as we previously reported 32 , but RasGRPl expression can also be detected in various CRC cell lines, albeit at lower levels (Figs lc). RasGRPl mRNA levels covered a dynamic range, both in 56 established CRC cell lines (Fig Id) and in 276 CRC patient samples (Fig le). The RasGRPl expressed typically consists of the wild type sequence, and variants or mutations in RasGRPl are rare in CRC samples (5 out of 276, Fig le). A very similar range of RasGRPl expression levels can be observed in the 276 tumors when these are stratified and color-coded for CRC with either wild type KRAS or with KRA^UT (Fig If), an observation that we confirmed by Taqman-based RasGRPl expression in liver metastases of colorectal cancer patients recovered from surgeries (Fig. lg). We next used the Oncomine database (at the oncomine.org website) and uncovered that the RasGRPl expression levels in colonic adenocarcinomas are at a statistically significantly lower level when compared to RasGRPl in the normal colonic epithelium (Fig lh), 33-36 suggesting that RasGRPl may play a protective role in CRC.
[0109] Rasgrpl regulates homeostasis of normal intestinal epithelial cells
[0110] The single-layered intestinal epithelium is a conveyer belt of cells that turns over every 4-5 days; Wnt signals in the bottom of the crypt regulate self-renewal of stem cells and the production of daughter cells that move up to undergo a proliferative phase in response to EGFR signals, followed by terminal differentiation, apoptosis, and shedding into the lumen 33 ' 34. In Drosophila, EGFR signalling is critical for intestinal maintenance 35 ' 36. In the mouse, deficiency in egfr results in disorganized crypts 23 and fine-tuning of EGFR signalling is critical to regulate proliferation in the intestinal stem cell niche 37. In the human intestine, EGFR-Ras signalling occurs in progenitor cells in the transit-amplifying (T/A) zone in the intestinal crypts, where it is thought to control proliferation and differentiation 24.
[0111] Immunohistochemistry revealed Rasgrpl -positive cells in the crypts of the small intestine of wild type mice and no Rasgrpl -staining in the comparable regions of Rasgrpl - deficient mice (Fig. 2a). Rasgrpl' ' mice do not display wasting disease or other gross intestinal abnormalities. To test if a role for Rasgrpl in intestinal epithelium may be revealed under circumstances of injury and repair, we exposed Rasgrpl' ' mice to a well-established model of colitis 38. Remarkably, Rasgrpl' ' mice showed partial protection from DSS (dextran sulfate sodium)-induced colitis and retained a relatively normal architecture of the colonic epithelium (Fig. 2b and c). The lack of T lymphocytes in Rasgrpl' ' mice unlikely provides the protection since DSS induces profound colitis in other mouse models devoid of T lymphocytes 38. We postulated that the partial protection could be caused by a difference intrinsic to the epithelial cells in Rasgrpl' ' mice and characterized the proliferative capacity next. In vivo BrdU-labeling at 2 hours (Fig. 2d) and 48 hours (Fig. 2e) revealed that colonic intestinal epithelial cells without Rasgrpl proliferate more extensively compared to wildtype cells (Fig. 2f). In the Rasgrpl deficient small intestine, BrdU+ cells were found at the top of the villus, 2 days after BrdU administration, whereas the furthest-progressed wildtype BrdU+ cells positioned midway along the crypt-villus axis (Figs. 2g and 2h). We also observed increased numbers of cells that stained positive for cleaved caspase-3 in Rasgrpl' ' mice compared to WT mice (Figs. 2i and 2j). Thus, Rasgrpl deficiency alters normal intestinal homeostasis and leads to increased proliferation of intestinal cells accompanied by increased apoptosis at the tip of the villi. In addition, loss of Rasgrpl resulted in small but consistent increases in numbers of goblet cells in the small intestine, revealed by Alcian blue staining (Fig. 2k and 21). Of note, the increased numbers of goblet cells that typically produce mucus may provide an additional explanation for the reduced DSS colitis in Rasgrpl' ' mice.
[0112] Deletion of Rasgrpl exacerbates intestinal dysplasia in KRasG12D mice [0113] Given the findings in figures 1 and 2, we next explored the role of RasGRPl in the intestinal epithelium in the context of KRASMUT, a somatic mutation found in ~ 40% of CRC patients 15. Expression of KRasG12D in the intestinal epithelium of mice produces aberrant cell proliferation and hyperplasia accompanied by relatively intact terminal differentiation 39"41. To test the role of Rasgrpl when the intestinal epithelium expresses KRasG12D, we reduced the Rasgrpl expression in Villin-Cre.KRas181'0120 mice 40 (termed KRasG12D here) by crossing them to Rasgrpl' ' mice 8. We used Villin-Cre mice as control (termed wildtype - WT- here). Heterozygosity for Rasgrpl result in half the Rasgrpl protein dosage 2 , whereas Rasgrpl deficient mice express no Rasgrpl protein 8 (Fig. 2a).
[0114] In the normal colon, proliferation is confined to cells in the bottom of the crypt. KRasG12D mice displayed colonic crypt hyperplasia compared to wild type littermates with increased numbers of Ki67-positive cells further up in the differentiated zone and loss of Rasgrpl in the context of KRasG12D resulted in further increases of Ki67-positive cells (Figs.
Gl 2D Gl 2D
3a, 3b, and Supplementary Figs, la and lb). Both KRas and KRas mice heterozygous for Rasgrpl demonstrated increased proliferation of the colonic epithelium compared to wildtype control mice, measured via in vivo BrdU-labeling. Deletion of the second allele of Rasgrpl resulted in a further augmentation of the KRasG12D -induced proliferation (Fig. 3 c). Serrated dysplasia is a notable feature of the KRasG12D mouse colon and is also seen in KRAl iUT human hyperplastic polyps 39-41 (Figs. 3a, 3b, middle panels). Serrated polyps are now recognized as an important subcategory of hyperplastic polyps that provide a route to CRC that is to be distinguished from the progression of conventional adenomas to CRC 26. At 6 months of age, we found that loss of either one or both Rasgrpl alleles resulted in exacerbated serrated dysplasia, typified by further lengthening and increased serration of villi-like projections into the colonic lumen. These features were also accompanied by an increased abundance of goblet cells (Figs. 3d, 3e, and 9c). The increased goblet cell presence
Gl 2D JVT/ Gl 2D /
and heavily serrated nature in these KRas Rasgrpl ' and KRas . -Rasgrpl' ' mice share remarkable resemblance with human hyperplastic or serrated polyps of the goblet cell
26
subtype
[0115] In the normal small intestine, proliferation mainly takes place in the crypt and T/A zone, which is only one epithelial cell layer thick 33 and is the site of EGFR signalling 24. Depletion of Rasgrpl resulted in three distinct cell biological abnormalities in the context of
Gl 2D Gl 2D
KRas . First, compared to WT controls, villi of KRas small intestine were longer and had a branched appearance in 20% of the cases, as has been suggested previously 1. Deletion of one or two Rasgrpl alleles resulted in a more profound branching of the villi (Fig. 3f-3i and lOa-lOb). As reported 41, we also observed increases in crypt fissions in KRasG12D small intestine, but did not observe overt changes upon loss of Rasgrpl (data not shown). Second, expression of KRasG12D resulted in thickening and increase cellularity of the T/A zone, accompanied by an expansion of Ki67-positive cells higher up on the crypt-villus axis (Figs. 3j, k, n, o). Deletion of Rasgrpl exacerbated this feature of the KRasG12D phenotype substantially; we observed 15 to 20 cell-wide T/A zones of pseudo-stratified cells that stained positive for Ki67 and displayed heterochromatin features (Figs. 31, m, p, q). These characteristics are indicative of active cell division and are used to type dysplastic tissues from patients 26. Third, despite these increases in proliferation, complete deletion of Rasgrpl did not trigger a further lengthening of the already elongated KRasG12D villi nor did it lead to an overall increase in length of the intestinal track (Figs. 10c- lOd). Instead, we observed increased levels of cleaved caspase-3 when Rasgrpl is deleted in the context of KRasG12D (Figs. 1 la-1 lb). As previously reported 41, we did not see differences in apoptosis between KRasG12D and WT small intestines.
[0116] In summary, deletion of Rasgrpl increased proliferation in the context of KRasG12D and exacerbated the dysplasia, but also resulted in elevated levels of cell apoptosis (Figs. 3 and 9a-9c, lOa-lOd, and 1 la-1 lb). [0117] EGFR-Ras GRPl and EGFR-SOS1 signals in epithelial cells
[0118] The genetic studies above reveal that Rasgrpl restricts the dysplastic effects of KRasG12D in the intestinal epithelium. To investigate the underlying mechanism, we first established the presence of the RasGRPl protein in 16 of 18 human CRC cell lines and found that the EGFR is also commonly expressed in these CRC lines (Fig. 4a). Eleven of eighteen CRC cell lines carried the stereotypic KRA^4UT found in patients 15.
[0119] In stimulated lymphocytes, the GEF activity of RasGRPl is enhanced via PKC- dependent phosphorylation of threonine 184 5. We used the earlier-mentioned DT40 cell system to demonstrate that phospho-Ti84 -RasGRPl levels were induced upon B cell receptor- but also EGFR- stimulation in a RasGRP- and PKC- dependent manner (Fig. 4b). We subsequently immunoprecipitated RasGRPl from KRASWT SW48 and KRA^UT Yi l\5 CRC cells, two lines of similar stage (Dukes' type C colorectal adenocarcinoma, ATCC
information) that behave predictable in tissue culture and xenograft assays. We found that EGF transiently elevated the phosphorylation of RasGRPl in both cell types (Fig. 4c). SOS1, pre-complexed with Grb2, is recruited to phosphorylated tyrosine 1068 in the EGFR 43 and is subsequently subject to feedback mechanisms that include EGF -induced phosphorylation 44' 45. Consequently, and as anticipated, EGFR stimulation induced a mobility shift of SOS1 in HCT15 and SW48 cells (Fig. 4d). To investigate the RAF-MEK-ERK effectors pathway downstream of RasGTP, we examined ERK phosphorylation and noted that both cell lines display EGF-induced activation of ERK kinases (Fig. 4e). RasGRPl and SOS1 are likely to both play a role in CRC cells with either a KRAS^111 or a KRASWT allele, since both RasGEFs are phosphorylated in both in HCT15 and SW48 cells response to EGF signal input (Fig. 4f).
[0120] KRAS^117 CRC cell lines demonstrate EGFR-induced hyperactivation of RAS.
[0121] To investigate the mechanistic underpinnings of RasGRPl, SOS1, and KRA^4UT in the cellular response to signalling through the EGFR, we selected seven CRC lines that represent each significant genotype (Table 1). We first established that expression of
RasGRPl in these cells is specific and selective; thus these cell lines express essentially no RasGRP 3 or RasGRP '4. RasGRP2, while expressed e.g. in CaC02 and SW48 (Figs. 12a-12e), is an exchange factor for the small GTPase Rap 5' 46. Table 1. RasGRPl expression profile and KRAS mutational status in selected colorectal cancer cell lines.
Figure imgf000038_0001
(+) presence of RASGRPl, (-) absence of RasGRPl .
[0122] As expected from the impaired RasGAP -mediated inactivation oiKRA^4UT ι· 12' 13, the four colorectal cancer lines carrying KRAl iUT alleles expressed elevated constitutive RAS-GTP levels compared to CaC02, WiDr, and SW48 cells with KRASWT (Fig. 5a). The otherwise low baseline KRAS-GTP levels were efficiently, but only transiently, induced by EGF stimulation of KRASWT cell lines (Fig. 5b). Significantly, the elevated constitutive KRAS-GTP levels in KRASMUT colorectal cancer cells were further increased by stimulation with EGF (Fig. 5c). This latter observation, combined with our data in figure 4, suggests that the EGFR acts through RasGEFs to provide further exchange factor input to hyperactivate KRAS in KRA^UT cells. Moreover, EGF also induced sustained activation of N- and H-RAS in KRAl iUT cells, whereas EGF only transiently augmented the levels of N- and H-RAS-GTP in KRASWT cells (Figs. 13a-13e).
[0123] Binding of Ras-GTP to an allosteric pocket in SOS greatly enhances the RasGEF activity of SOS 9 and in cells this creates a positive feedback loop of Ras-GTP/SOS/Ras- GTP 4' 10' 11 (Fig. 5d). Recent work revealed allosteric priming of SOS1 in cancer cells; in unstimulated PDAC cell lines, KRASMUT primes SOS and results in elevated constitutive levels of HRAS-GTP 4V. Here, our RAS-GTP pull down experiments demonstrated that EGF stimulation induces sustained N- and H-RAS activation as well as K-RAS hyperactivation in KRASMUT CRC cells. This is in marked contrast with the transient activation of N-, H- and K- RAS in KRASWT cells. Therefore, allosteric SOS1 activation by KRA^UT may also play a role in cancer cells under condition of EGF stimulation (Fig. 5d). Together, these observations led us to next explore how SOSl and RasGRPl shape the character of EGFR-Ras signals and impact cell biology in the context of KRA^4UT.
[0124] SOSl promotes EGF -induced RAS activation and growth of KRASMVT CRC cells [0125] To investigate the role of SOSl downstream of the EGFR in the context of a
KRASMUT allele, we reduced human SOSl expression in HCT15 CRC cells, which respond to EGF but are insensitive to the EGFR inhibitor Erlotinib (Fig. 6a and Table 2). Reduction of SOSl expression resulted in less sustained KRAS activation following EGF stimulation, compared to parental HCT15 cells or to HCT15 cells treated with a control shRNA (against murine Sosl) (Fig. 6b). The impaired KRAS activation in cells with a 52% reduction in SOSl was accompanied by diminished in vitro colony formation, particularly noticeable when EGF was used as the exclusive growth factor (Figs. 6c and 6d). The effect of reduced SOSl expression on in vivo tumorigenesis was similarly apparent; the average tumor size of subcutaneously xenografted cells decreased four-fold (Fig. 6e). These results demonstrate that EGFR- SOS 1 -Ras signals contribute to tumorigenesis when CRC cells carry a KRAl iUT allele.
Table 2. Sensitivity of colorectal cancer cell lines to the Erlotinib EGFR inhibitor.
Figure imgf000039_0001
[0126] RasGRPl restricts EGF-SOS1 induced KRAS-ERK signalling through negative feedback. [0127] RasGRPl is structurally distinct from SOSl and possesses 1000-fold lower intrinsic RasGEF activity than SOSl 25. Moreover, RasGRPl is not activated allosterically by RAS- GTP 25 but is recruited to the membrane by diacyl glycerol 5. We postulated that reduction of RasGRPl expression via shRNA could affect HCT15 cells differently than depletion of SOSl (Fig. 7a). In contrast to the effects of SOS 1 , 53% reduction of RasGRP 1 from HCT 15 cells resulted in increased EGFR-driven hyperactivation of KRAS (Fig. 7b), which translated in sustained ERK phosphorylation downstream of RasGTP (Figs. 7c, 7d, 14a and 14b).
[0128] We subsequently investigated if RasGRPl may impact SOSl . We examined levels of P-Y1068-EGFR (phospho-tyrosine 1068 in the EGFR) a major auto-phosphorylation site 48 to which Grb2-SOSl is recruited 43 , when cells are stimulated with EGF (Fig. 5d). Reduction of RasGRPl expression significantly and selectively increased P-Y1068-EGFR levels (Fig. 7e) and increased P-Y1068-EGFR levels complexed to SOSl-Grb2 (Fig. 7f). Conversely, enhancing diacyl glycerol -RasGRPl signalling in EGF-stimulated HCT 15 cells via exposure to an inhibitor of the diacyglycerol-converting enzyme DGK (diacylglycerol kinase) 49 resulted in reduced P-Y1068-EGFR levels (Fig. 7g). Thus, diacyl glycerol -RasGRPl signalling constitutes a negative feedback loop to limit P-Yio68-EGFR-Grb2/SOS-RAS-ERK signals.
[0129] Having established the existence of this RasGRPl -dependent negative feedback loop, we next went back to the colonic epithelium of our mouse models with the different genetic perturbations. Analogous to our findings in the human CRC HCT15 cell line, we observed that deletion of one or two alleles of Rasgrpl in the context of KRasG12D substantially increased the relative staining for phosphorylated ERK kinases in sections of colonic epithelium (Fig. 7h). Furthermore, direct, side-by-side comparisons of isolated epithelial cells confirmed the increased ERK phosphorylation in KRasG12D colonic epithelial cells when Rasgrpl levels are reduced (Fig. 7i). [0130] RasGRPl expression levels limit growth ofKRASMUT CRC cells.
[0131] To further test the cell biological impact of decreasing Rasgrpl ' s negative feedback on EGFR-SOSl-RAS signalling, we examined colony formation and xenografted tumors. Reduction of RasGRPl expression led to increased colony formation of HCT 15 CRC cells in vitro, induced by either serum or by EGF (Figs. 8a and 8b). The reduced expression levels of RasGRPl elicited increased size and enhanced growth rate of xenograft tumors, compared to the parental HCT15 cells or HCT15 cells with a mouse Rasgrpl shRNA construct as specificity controls; the exact opposite result obtained with HCT15 cells carrying SOSl shRNA (Figs. 8c and 8d). Thus, in contrast to the capacity of SOS1 to enable EGFR-RAS signalling and CRC cell growth, diacyl glycerol -RasGRPl signalling constitutes a negative feedback loop that limits EGFR-SOS-RAS signalling and has a growth suppressive role.
[0132] To investigate if levels of RasGRPl in CRC impact patients clinically, we explored three published gene expression studies linked to clinical outcome of CRC patients
(GSE17536 50; GSE12945 51; GSE14333 52). We applied an established cut-off finder 53 to divide CRC patients from these studies in two groups based on RasGRPl expression. We observed that high expression of RasGRPl correlates with a better clinical outcome in all three studies (Figs. 8e, 15a and 15b). CRC from patients in these studies do not all contain KRASMUT and low RasGRP 1 levels may therefore also lead to worse clinical outcome of CRC cause by other (non- KRAl 11^) genetic lesions. To test this possibility, we next explored the ApcMm/+ mouse model (APC = Adenomatous Polyposis Coli) with aberrant Wnt signalling 54 that is widely used to model human CRC 55"57.
[0133] RasGRPl suppresses proliferative ERK signalling in the context of aberrant Wnt signalling.
[0134] We crossed ApcMin/+ mice to our Rasgrpl deficient mouse and observed that the mean survival period of 164 days for ApcMin/+ mice reduced to 126 days when ApcMin/+ mice were also deficient for Rasgrpl (Fig. 8f). As reported 55"57, we found that ApcMin/+ mice develop large numbers of tumors in the small intestine and additional loss of Rasgrpl did not lead to significant changes in tumor numbers or size in the small intestine (Figs. 16a and 16b). By contrast, deletion of Rasgrpl led to a significant increase in the number of colonic tumors that rarely develop in ApcMin/+ mice (Figs 8g and 8h). The more frequent colonic tumors in ApcMin/+:Rasgrpl-/- mice demonstrated a similar overall architecture compared to the colonic tumors from ApcMin/+ mice (Fig. 16c) but displayed increased individual tumor size (Fig. 8i). In agreement with these findings, normal crypts and tumors of ApcMin/+:Rasgrpl-/- mice revealed increases in proliferative markers compared to
ApcMin/+mice (Figs. 16d and 16e). Moreover, loss of Rasgrpl resulted in significant increases in phopho-ERK signals in both the normal tissue (crypts) and in tumors in the context of ApcMin/+ (Figs. 8i and 16f). Cleaved caspase-3 -positive, apoptotic cells were rare in ApcMin/+ tumors and remained sparse, tough slightly increased, in the tumors from
ApcMin/+:Rasgrpl-/- mice (Figs. 16g and 16h). Thus, RasGRPl plays a suppressive role in CRC in the context of both KRASMUT and ApcMin/+ by limiting proliferative ERK signals. Discussion
[0135] RasGRPl as a suppressor of CRC
[0136] Here we revealed that RasGRPl and SOS1, two structurally distinct RasGEFs 9' 25 , both lie downstream of the EGFR. We show that RasGRPl and SOS1 play opposing roles in the same CRC cell downstream of the EGFR. Biochemically, reduction of RasGRPl levels relieves the negative feedback to EGFR-SOS1, sustains EGFR-RAS-ERK signalling, and promotes cell proliferation. We find that RasGRPl plays a negative regulatory role in CRC and that depletion of one or two Rasgrpl alleles exacerbates ERK signalling and serrated dysplasia and hyperproliferation of the KRasG12D intestinal epithelium. Similarly, Rasgrpl suppressed ERK signalling and proliferation in the ApcMm/+ model of aberrant Wnt signaling. Considering these results and taking a clinical point of view, it is of interest to note that RasGRPl reveals a range of expression in tumors of CRC patients and that high expression of RasGRPl correlates with better clinical outcome.
[0137] KRAS0120 alone does not lead to full CRC in mice 39"41. Consistent with the conclusion that perturbed Ras function by itself is insufficient to produce CRC, we did not observe high-grade dysplasia or adenocarcinomas
Figure imgf000042_0001
and
KRAS°12L '.-Rasgrpr'- mice that were up to 9 months of age (not shown). Epithelial cells in these two models return to the normal simple columnar pattern further up the villus, despite the severely altered T/A zone, and loss of Rasgrpl results in increased levels of cell apoptosis. In order for full CRC to develop in mice, KRAS°12D requires additional events such as loss of the APC (Adenomatous Polyposis Coli) tumor suppressor 40. Vice versa, perturbation of APC requires EGFR signaling for tumor maintenance 58' 59. In agreement with the concept that these two pathways intersect in CRC, we observe that loss of Rasgrpl in addition to the ApcMm/+ allele leads to increases in colonic tumor numbers and sizes and reduced mean survival of ApcMin .-Rasgrpl' - mice.
[0138] EGFR signalling in T/A cells and the balance between proliferation and differentiation
[0139] Our studies reveal that Rasgrpl also impacts homeostasis of the normal intestinal epithelium. Deletion of Rasgrpl results in increased proliferation of epithelial cells, increases levels of apoptosis at the tip of the villi, and a modest increase in the numbers of goblet cells. T/A progenitors derive from stem cells in the underlying crypt and produce the epithelial lining in the intestine. It is poorly understood how progenitor cells balance proliferation and terminal differentiation and whether distinct EGFR-Ras signals play a role herein. Deletion of Lrigl, a negative regulator of EGFR signalling, leads to loss of normal intestinal stem cell homeostasis 37. RasGRPl and SOS1 have unique roles at distinct stages of T cell
5 8 28 32 60 development . RasGRPl, but not SOS 1, has been implicated in several cancer types ' ' 61, whereas a recent role for SOS1 in embryonic stem lineage commitment was described 62. The possibility that RasGRPl and SOS1 may play opposing roles in the same T/A cell downstream of the same EGFR is a novel and intriguing concept that requires future research.
[0140] RasGRP RasGEFs downstream of growth factor receptors
[0141] RasGRP3 appears to connect to cMET(HGF)- signal input 63. Our results here show that RasGRPl responds to EGFR signal input. Thus, RasGRP RasGEFs can couple to receptor tyrosine kinases but the mechanistic details and the biological consequences are not yet fully understood. RasGRP3 has been implicated to promote growth of melanoma- and prostate- cancer cells 63' 64 whereas our findings here demonstrate that RasGRPl opposes the growth of CRC. The suppressive function of RasGRPl in CRC also contrasts its growth- promoting role in T cell leukaemia 32 and in skin cancer 61. Thus, not all RasGRPl -generated Ras signals are the same. Similarly, different Ras signals in genetic mouse models have been known to evoke opposing cell biological responses 65-67 and different intensity of EGFR stimuli can impact PC12 cell fate 1. We propose that RasGRPl may function as a context- dependent tumor suppressor protein or a protein with oncogenic functions. [0142] Negative feedback mechanisms in cancer cells with aberrant Ras signalling
[0143] Here we revealed non-intuitive feedback between two RasGEFs; i.e., EGFR- RasGRPl signals that dampen EGFR-SOS signals. We characterized this feedback in
KRASMUT cdls where S0S 1 is aiiosterically activated by the elevated levels of KRAS-GTP 4' 10' u. It is of interest to note that somatic KRASMUT emerge as mediators of acquired resistance to anti-EGFR therapy 68' 69. Possibly anti-EGFR therapy inhibits the negative feedback coming from EGFR-RasGRPl signals. Previous studies have shown that Grb2 can impair access of phosphatases to the FGFR 70' 71. It is possible that RasGRPl indirectly promotes phosphatase access to the EGFR, reducing Grb2-SOSl-P-Yio68-EGFR complexes.
Alternatively, EGFR-RasGRPl may influence the function of phosphatases directly. The phosphatase Cdc25A binds to and dephosphorylates the EGFR 72. Interestingly, Vemurafenib (PLX4032) treatment of CRC cells with somatic BRAF(V600E) was recently shown to relieve a negative feedback loop to the EGFR by decreasing the activity of the phosphatase Cdc25C, resulting in increased P-Y1068-EGFR levels . Regardless of the exact biochemical nature, the realization that EGFR-RasGRPl and EGFR-SOS1 signals can elicit opposing cell biological behaviour is a novel concept of relevance to normal intestinal epithelial homeostasis and to CRC. Methods
[0144] Bioinformatics and TCGA datamining
[0145] NCI-60 Cell Lines 31, Cancer Cell Line Encyclopedia 74 and Colorectal
Adenocarcinoma 75 databases were evaluated for RasGRPl mRNA expression and copy levels. We used the online bioinformatics tools, "cBio Cancer Genomics Portal" 30 to interrogate above cancer genomic database (www.cbioportal.org). We analysed RasGRPl mRNAs expression z-scores correlated with copy number level in NCI-60 Cell Lines, Cancer Cell Line Encyclopedia and TCGA Colorectal Adenocarcinoma, and we computed KRAS mutation association z-score with RasGRPl mRNA expression 30.
[0146] To investigate whether RasGRPl expression has clinical significance in colon cancer, we compared RasGRPl gene expression in human colon cancer and normal tissues using the Oncomine database (www.oncomine.org). Statistical analysis of the differences in RasGRPl expression between these tissues used Oncomine standard algorithms: for each microarray, data were log2 -transformed, median-centered, and standard deviation
normalized 76. The Cancer Genome Atlas (TCGA) dataset obtained from Oncomine are embedded in the TCGA database (at the website address: tcga-data.nci.nih.gov/tcga/)
[0147] To validate the correlation for RasGRPl expression and patient outcome, three public colon cancer datasets (GSE17536 50; GSE12945 51; GSE14333 52) were downloaded from the NCBI GEO database (National Center for Biotechnology Information, Gene Expression Omnibus). Data were normalized using the Robust Multichip Average (RMA) and annotated in GEO 7V. A cut-off finder using the R statistical engine was performed to defining two groups of patients with different survival curves using RasGRPl gene expression (low or high) 53. We analysed data at follow-up time of ten years because the number of samples with longer follow-up was too small. The Kaplan-Meier estimator was used to evaluate patients' prognostic. The log-rank (Mantel-Cox) test was carrying out to compare survival curves and to measure Hazard ratios. Analyses were performed and graphs were generated using GraphPad Prism version 6.04. [0148] Cell lines and Reagents
[0149] Cell lines were cultured in ATCC-recommended media at 37 °C in 5% C02. Stable cell lines infected with lentivirus containing small hairpin RNA (shRNA) against SOS1 or RasGRPl were selected with puromycin lC^g/ml (Mediatech, inc, Cellgro) and subsequently sorted for GFP levels. Cells were maintained under selection. Colorectal cancer cell line mutational status was obtained from the Wellcome Trust Sanger Institute Cancer Genome Project Web site (www.sanger.ac.uk/genetics/CGP/) and verified by UCSF sequencing core facility (Supplementary Table 1). BrdU, DAPI, and Alcian blue were purchased from Sigma- Aldrich, Diacylglycerol kinase inhibitor II (R59949) was purchased from Enzo Life Science (Alexis) and dissolved in DMSO, human Epithelial Growth Factor (hEGF) recombinant protein was purchased from Life Technologies and dissolved in PBS, PKC inhibitor Rottlerin was purchased from Calbiochem and dissolved in DMSO.
[0150] Antibodies
[0151] Antibodies were obtained from the following sources and used at indicated concentration: SOS1 (1 : 1000 for western blot; 1 : 100 for immunoprecipitation) from BD
Bioscience; a-tubulin (1 :2000) from Sigma Aldrich; anti-Ras (1 : 1000) from Millipore; Grb2, KRas, Ras and URas (1 :200) from Santa Cruz biotechnology; Epithelium Growth Factor Receptor (EGFR), phospho-EGFR (Y-1068), phospho-EGFR (Y-1045), phospho-ERKl/2, ERK1/2 (1 : 1000) and cleaved caspase-3 (Aspl75) (1 :200) from Cell Signaling Technology; Ki-67 (1 :500) from Abeam; anti-BrdU from the developmental Study Hybridoma bank (G3G4, 1 :300), murine RasGRPl (ml99) (immunoprecipitation 1 :50) from Jim Stone (University of Alberta, Edmonton, AB, Canada); human RasGRPl (JR-E160) (1 : 1000) generated by our laboratory together with Epitomic, phospho-RasGRPl T184 was generated by immunization with the peptide SRKL-pT-QRIKSNTC by our laboratory and
Eurogentech/AnaSpec (Fremont, CA).
[0152] Mice
[0153] All mice were handled according to the Institutional Animal Care and Use
Committee regulations, described in the Roose laboratory University of California, San Francisco (UCSF) mouse protocol AN084051 "Ras Signal Transduction in Lymphocytes and Cancer".
Figure imgf000045_0001
here) previously described were kindly provided by Tyler Jacks (MIT). We crossed these mice to VillinCre transgenic mice provided by Averil Ma (UCSF) to activate the mutant KRAS allele in the intestinal tract. This mouse was used as a control and noted WT. Progenies were then crossed a Rasgrpl knock-out (Rasgrpl' ") provided by Jim Stone (University of Alberta, Edmonton, AB, Canada) to generate a mouse mice expressing KRAS0120 in the context of 1 and 2 Rasgrpl alleles deleted
KRAS0120 ' .-Rasgrpl WT/' and KRA^12D : Rasgrpl^ respectively. ApcMm/+ mice were crossed to Rasgrpl' ' mice to obtained complete deletion of Rasgrpl (ApcMm/+ :Rasgrpl' ') . Primers used for genotyping of Rasgrpl : Primer 1, GCAGCTGTCAATAAGATCATCCAGGC (SEQ ID NO: 1); primer 2, ATATTGCTGAAGAGCTTGGCGGCGAATGGG (SEQ ID NO: 2); primer 3, CTATCCTCACTTGAGTCTCTCTTTCC (SEQ ID NO: 3). All other primers were recommended by Jackson laboratory (Bar Harbor, Maine).
[0154] shRNA constructs and experiments
[0155] Knockdown of human RasGRPl and human SOS1 has been described previously in Roose et al. (MCB, 2007). Briefly, oligonucleotides containing Hap I and Xho I sites were annealed and ligated into Hap 1- and Xho I-digested pSicoR-puro-t2a-eGFP to ere- ate mRasgrpl-1503-pSicoR-puro-t2a-eGFP and hRasGRPl-1503- pSicoR-puro-t2a-eGFP. The oligonucleotide sequences are as follows. For mRasgrpl-1503 : sense oligonucleotide, 5'- TGATCGCTGCAAGC-
TTTCCATTCAAGAGATGGAAAGCTTGCAGCGATCTTTTTTC-3' (SEQ ID NO: 4); antisense oligonucleotide, 5 '-TCGAGAAAAAAGATCGCTGC AAGCTT- TCCATCTCTTGAATGGAAAGCTTGCAGCGATCA-3' (SEQ ID NO: 5). For hRasGRPl- 1503 : sense oligonucleotide, 5 '-TGATT- GCTGCG-AGT-TTTCCATTCA- AGAGATGGAAAACTCGC AGCAATCTTTTTTC-3 ' (SEQ ID NO: 6); antisense oligonucleotide, 5 '-TCGAGAAAAAAGATTGCTGCGAGTTTTCCATCTC- TTGAATGGAAAACTCGCAGC AATC A-3 ' (SEQ ID NO: 7). Targeting of the 1503 region was based on previous work (Roose et al. n). The hRasGRPl-1503 targets human RasGRPl, has three mismatches with the same sequence in mRasgrpl-1503, and served as a specificity control. Briefly, CRC cell lines were seeded in 24-well plate. Cells were infected with lentivirus (5MOI) and polybrene through standard spin infections (2200rpm for 1 hour) and selected by culture in the presence of puromycin (10 μg/ml) 48h after infection. Similarly, annealed oligonucleotides were ligated into pSicoR-puro-t2a-eGFP to create mSosl-1313- pSicoR-puro- t2a-eGFP and hSOSl-1313-pSicoR-puro-t2a-eGFP, based on published targeting sequences (Roose et al. (MCB, 2007)). hSOSl-1313 targets human SOS1, has two mismatches with the same sequence in mSosl-1313, and served as a specificity control. For mSosl-1313 : sense oligonucleotide, 5 '-TGAC AGTGTTGC AA-
TGAGTTTTCAAGAGAAACTCATTGCAACACTGTCTTTTTTC-3' (SEQ ID NO: 8); antisense oligonucleotide, 5 '-TCGAGAAAAAAGAC AGTGTTGC AAT- GAGTTTCTCTTGAAAACTCATTGCAACACTGTCA-3' (SEQ ID NO: 9). For hSOSl- 1313 : sense oligonucleotide, 5 '-TGAC AGTGTTGT-AATGAA-TTTTCAAGA- GAAATTC ATTACAACACTGTCTTTTTTC-3 ' (SEQ ID NO: 10); antisense
oligonucleotide, 5 '-TCGAGAAAAAAGAC AGTGTTGTAATGAATTTCTCTTGA- AAATTC ATTAC AAC ACTGTC A-3 ' (SEQ ID NO: 11).
[0156] RNA extraction and Real time PCR [0157] Total RNA was isolated from human tissue and cell lines using RNeasy kit (Qiagen) following the manufacturer's protocol. RNA was reverse-transcribed with random primers (Invitrogen) and Moloney murine leukaemia virus reverse transcriptase. Real-time PCR was performed in triplicate using Eppendorf RealPlex2. Gene expression was normalized to that of GAPDH and quantified with the comparative CT method according to the manufacturer's instructions. The following combinations of primers and probes were used to analyse the expression of human RasGRPl : forward, AAGCTCCACCAACTACAGAACT (SEQ ID NO: 12); reverse, AGGGAGATGAGGTCCTTGAGAT (SEQ ID NO: 13); probe, FAM- CCACATGAAATCAATAAGGTTCTCGGTGAG-TAMRA (SEQ ID NO: 14) and human GAPDH forward, GA AGGTGA AGGTC GGAGT (SEQ ID NO: 15); reverse,
GAAGATGGTGATGGGATTTC (SEQ ID NO: 16); probe, FAM-
AGGCTGAGAACGGGAAGCTTGT-TAMRA (SEQ ID NO: 17). RasGRP2, 3 and 4 probes and primers were obtained at Applied Bio System.
[0158] Western blot
[0159] Cells were plated in 6 or 10 cm dishes and starved for 2 h at 37C in PBS. After resting, cells were EGF-stimulated for different time 3, 10 or 30 min. Cells were lysed with ice-cold 2% NP40 supplemented with protease and phosphatase inhibitors [10 mM sodium fluoride, 2 mM sodium orthovanadate, 0.5 mM EDTA, 2 mM phenyl- methyl sulfonyl fluoride, 1 mM sodium molybdate, aprotonin (lOmg/ml), leupeptin (lOmg/ml), pepstatin (lmg/ml)]. After 30min on ice, lysates were centrifuged and supernatant were mix with 2X sample buffer. Protein lysates were separated on acrylamide gel 10%, transferred on PVDF membrane and incubated with primary antibodies of interest. Inhibitors such as Rottlerin (20μΜ) and DGK were pre-incubated for 30min before stimulation. Western blots were visualized with enhanced chemo-luminescence and imaging on a Fuji LAS 4000 image station (GE Healthcare). The protein bands in Western blots were quantified with Multi Gauge software, and densitometry (pixel intensity) was determined within the linear range of the exposure. Amounts of the proteins of interest were typically presented as a ratio of the indicated loading control. Values were then normalized to an indicated sample and noted as a fold difference. Results represent at least three independent experiments.
[0160] Ras pull down assay
[0161] Activation of Ras was analysed by a Ras-GTP pull-down assay essentially according to the manufacturer' s instructions (Upstate). Briefly, cells were rested with PBS with Ca/Mg in 6-well plates at 37°C for 2 hours and stimulated with 5ng/ml hEGF for 3 and 10 min. Cells were then lyse with ice-cold lx MLB for pull downs (Millipore) and scraped. 20% of the lysate was used for whole cell lysate and 80% was used for pull down. MLB lysates were tumbled in the cold room with RAF-1 RBD agarose for 50min, washed 3 times in ice-cold 1% P40 buffer after which the agarose was resuspended in sample buffer, boiled. Lysates were loaded on precast bis-tris gel 4-12% (Invitrogen) and transfer on PVDF membrane for blocking. Membranes were incubated with primary antibody and specific signals have been quantified has described in Western blot paragraph. Results represent at least three independent experiments.
[0162] Immunoprecipitation [0163] Cells were grown in 10 cm dishes and starved for 2 h at 37C in PBS. After resting, cells were EGF (5ng/ml or 25ng/ml) stimulated for 3, 10 or 30 min and lysed in 1% P40 has already described above. Supernatant has been spited in 2 parts. 20% used for whole cell lysates and 80% was incubated with anti-human SOS 1 and tumbled for 2h at 4C. The G- sepharose beads (GE Healthcare) were added and tumbled for 50min at 4°C. After several washes using 1% P40, sample buffer was added before being boiled and loaded on acrylamide gels 8% and 10%. Results represent at least three independent experiments.
[0164] Isolation of Intestinal Epithelial Cells
[0165] Methods were adapted from Sato and colleague 78. In short, large intestines were dissected, rinsed with PBS, opened and cut in 1-2 cm fragments before incubation in a conical tube with PBS. Debris was removed by PBS washes and fragments were transferred to clean tubes containing pre-warmed PBS with 2.5 mM EDTA. 15-minute incubations at 37°C water bath and removal of supernatant containing epithelial cells at crypt structures were repeated 2-3 times and cells were collected by centrifugation at 1200 rpm and cells were lysed in P40 lysis buffer to extract proteins.
[0166] Extraction of colonic epithelium and tumors [0167] Colon of mice were dissected and washed with PBS. Tumors were isolated and flash-frozen. Healthy tissues adjacent to tumors were collected to serve as controls. Tissues were incubated in 200ul of IX RIP A buffer on ice and homogenized using electric dounce. Lysates were process as described elsewhere. Protein quantification was evaluated using BCA assay (Thermo Scientific). [0168] Soft Agar Colony Formation Assay
[0169] Colorectal cell lines were seeded (1.105) in duplicate into 60-mm cell culture dishes in 1 ml of 0.3% agar (Noble agar, SIGMA) in RPMI containing 5% FBS, 1%
penicillin/streptomycin, 1% glutamine, and 2.37 g/L Na2C03, on top of a layer of 1 ml of 1% agar. For complete culture condition, normal culture media has been added and changed every other day. Cultures were maintained for 15 days. For EGF condition, hEGF (10 ng/ml) has been added to minimal culture media. Colonies were fixed with 70% ethanol and stained with 0.005%) crystal violet. Colonies were visualized, and at least 5 randomly chosen fields were photographed with a digital camera Nikon DXM1200 coupled to a light microscope. Results are combination of three-independent experiments. [0170] Xenograft mouse studies
[0171] HCT15 Cell line with or without shRNA (2 χ 105) were injected subcutaneously into flank of 6- to 8-weeks-old male Nude-Foxnlnu mice (n=5 at least per group) (Harlan lab). Tumor volume was determined by external calliper measurement every other day as soon as it reached a palpable size. Calculation has been done as follows: tumor volume = 1/2 (length x width2). Mice were monitored daily for body weight and general condition.
According to institutional guidelines, mice were sacrificed when their tumor volume reached 2,000 mm3 or became excessively ulcerated. Experiments were repeated twice with 5 mice in each group.
[0172] Dextran Sodium Sulfate-induced colitis [0173] DSS (3%, MP Biomedicals) was added to the drinking water of co-housed, 10-12 week old C57B16 and Rasgrpl" " mice for 5 days. Mice were assessed daily for diarrhea, bloody stool and body weight. At day 5, mice were euthanized and small and large intestine were processed as described in "immunohistochemistry" section. DSS damage scores were determined by the sum of three parameters as previously described 79 : surface epithelial loss, crypt destruction, and inflammatory cell infiltration into the mucosa. A score of "0" represents no change, "1" localized and mild change, "2" localized and moderate change, "3" extensive and moderate change, "4" extensive and severe change.
[0174] Immunohistochemistry
[0175] Tissues were dissected, fixed in 4% PFA and paraffin-embedded. Then 5^m-thick sections were de-waxed in Histo-Clear (National Diagnostics) and rehydrated in graded alcohol baths. Antigen retrieval was performed in pressure cooker for 20 min in 10 mM sodium citrate buffer, pH 6.0. Endogenous peroxidase activity was inhibited with 1.5% H202 in methanol for 20 min and washed in PBS. Nonspecific binding sites were blocked in blocking buffer (PBS, pH 7.4, 3% Serum, 1% BSA, and 0.1% Tween) for 60 min at RT. Sections were then incubated with primary antibodies diluted in blocking buffer overnight at 4°C. Slides were then washed twice with 0.1% PBS-Tween before incubation in Universal Immuno-peroxydase polymer anti-mouse/rabbit Histofine® for mouse tissues (Nichirei Biosciences, Japan) used as a secondary reagent. Stainings were visualized with DAB (3, 3'- diaminobenzidine, Sigma-Aldrich) and a hematoxylin counterstain (Sigma-Aldrich) was performed before dehydratation. After dehydration, sections were mounted in Cytoseal 60 (Thermo Scientific). To study the structure of tissue, Haematoxylin & Eosin (H&E) was performed. For quantification, images were acquired using a Nikon Optiphot microscope equipped with an AxioCam HR a fixed exposure (objective 20X and 40X). For BrdU experiments, mice were injected intraperitoneally (2π^200μ1) for 2 hours or 48 hours. To detect goblet cells, slides were treated with Alcian blue (pH2.5) for 30 min. and
counterstained using Nuclear Red (Sigma-Aldrich) followed by standard mounting techniques.
[0176] Immunofluorescence
[0177] Tissues were dissected, fixed in 4% PFA, incubated overnight at 4C in Sucrose 30% and embedded in OCT (Tissue-Tek, Dublin, Ireland) /Sucrose 30% (2vol/lvol). 10 μιη-thick sections (Cryostat Leica) were dried and wash in PBS. After 0.1% PBS-Tween (Sigma- Aldrich) wash, section were incubated in blocking buffer (1% BSA, 3% normal goat serum and 0.2% Triton X-100-PBS) for lh at RT. Sections were then incubated with primary antibodies diluted in blocking buffer overnight at 4°C. Slides were washed twice with 0.1% PBS-Tween and PBS before incubation in secondary antibody conjugated with Alexa 546 (Molecular Probes, Life technologies) and DAPI in PBS-Triton X-100 0.5% (Sigma-Aldrich) for 45min at RT. Slides were washed twice with PBS before mounting with mounting medium (Dako). Images were taken by using a micro-lensed, spinning disk confocal scan- head coupled to a motorized, inverted fluorescence microscope (Zeiss Axiovert 200M; Carl Zeiss Inc.). Images were collected using an ICCD camera (XR-Mega-10EX S-30, Stanford Photonics, Palo Alto, CA).
[0178] Positioning of In vivo BrdU labelled cells [0179] Mice were injected with BrdU as described before and euthanized 48 hours post- injection. Swiss roll gut preparations were produced, stained and fixed as described above. BrdU-positive cells from twenty crypt-villus axes in duodenum were analysed per mouse. Cells were counted from bottom (position 1) of open crypts (transversally sectioned) to the top of villi. Percentage of cells per position was representative of two mice per genotype. Counting method was adapted from Sansom and colleagues54.
[0180] Quantification and Statistical analysis
[0181] In short-term BrdU experiments at 2 hours after injection, fifty crypts were counted per mouse (n = 3). For cleaved caspase-3 experiments (IF), 50 open villi per genotype were counted (n = 3). Results were combined for each genotype. For branching villi, a total fifty villi per mouse (n = 4) were counted in different area of the duodenum. Results are average of number of branched villi for ten villi counted. For goblet cells in intestine, fifty open villi (transversally sectioned) in duodenum per mouse were counted; two mice per genotype. For goblet cells and Ki67-positive cells in colon, fifty crypts in distal colon were counted with 3 mice per genotype. For cleaved caspase-3 and BrdU in tumors, numbers of positive cells were evaluated per field (100 μπι x 100 μπι) with 3 to 6 fields taken per tumor (n = 3 mice per genotype). Results were combined for each genotype. For the Kaplan-Meier survival curve of the ApcMm/+ mice, a Log-rank (Mantel -Cox) test was applied. For villi lengths, pictures were taken and length of villi in duodenum was determined using Image J software. Pixel values were transformed in metric values using microscope scale. Fifty villi were counted and values are representative of three mice per genotype.
[0182] All data were represented as mean ± SEM. For xenograft experiments, damage score after DSS treatment, and immunostainings, unpaired t test were used for two-group comparisons. For comparisons of phospho-ERK immunoblot quantification, a paired t test was applied. All specific statistical analyses are mentioned in the respective paragraphs. All other experiments a one-way ANOVA followed by a Bonferroni post hoc test was used for comparisons of three or more groups. For all tests, a P value of <0.05 was considered statistically significant. Analyses and graphs were done using Prism 5 software.
References
1. Vigil, D., Cherfils, J., Rossman, K.L. & Der, C.J. Ras superfamily GEFs and GAPs: validated and tractable targets for cancer therapy? Nat Rev Cancer 10, 842-857 (2010).
2. Marshall, C.J. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80, 179-185 (1995).
3. Prasad, A. et al. Origin of the sharp boundary that discriminates positive and negative selection of thymocytes. Proc Natl Acad Sci U S A 106, 528-533 (2009).
4. Das, J. et al. Digital signaling and hysteresis characterize ras activation in lymphoid cells. Cell 136, 337-351 (2009). 5. Ksionda, O., Limnander, A., Roose, J. Rasgrp Ras Guanine Nucleotide Exchange
Factors in Cancer. Frontiers in Biology 8, 508-532 (2013).
6. Kortum, R.L. et al. Targeted Sosl deletion reveals its critical role in early T-cell development. Proc Natl Acad Sci U S A 108, 12407-12412 (2011).
7. Kortum, R.L., Rouquette-Jazdanian, A.K. & Samelson, L.E. Ras and extracellular signal-regulated kinase signaling in thymocytes and T cells. Trends Immunol (2013).
8. Dower, N.A. et al. RasGRP is essential for mouse thymocyte differentiation and TCR signaling. Nat Immunol 1, 317-321 (2000).
9. Margarit, S.M. et al. Structural evidence for feedback activation by Ras.GTP of the Ras-specific nucleotide exchange factor SOS. Cell 112, 685-695 (2003). 10. Boykevisch, S. et al. Regulation of ras signaling dynamics by Sos-mediated positive feedback. Current biology : CB 16, 2173-2179 (2006).
11. Roose, J.P., Mollenauer, M., Ho, M., Kurosaki, T. & Weiss, A. Unusual interplay of two types of Ras activators, RasGRP and SOS, establishes sensitive and robust Ras activation in lymphocytes. Mol Cell Biol 27, 2732-2745 (2007). 12. Bos, J.L., Rehmann, H. & Wittinghofer, A. GEFs and GAPs: critical elements in the control of small G proteins. Cell 129, 865-877 (2007).
13. Malumbres, M. & Barbacid, M. RAS oncogenes: the first 30 years. Nat Rev Cancer 3, 459-465 (2003). 14. Jemal, A. et al. Cancer statistics, 2009. CA Cancer J Clin 59, 225-249 (2009).
15. Di Fiore, F., Sesboue, R., Michel, P., Sabourin, J.C. & Frebourg, T. Molecular determinants of anti-EGFR sensitivity and resistance in metastatic colorectal cancer. Br J Cancer 103, 1765-1772 (2010).
16. Chandarlapaty, S. Negative feedback and adaptive resistance to the targeted therapy of cancer. Cancer Discov 2, 311-319 (2012).
17. Pratilas, C.A. & Solit, D.B. Targeting the mitogen-activated protein kinase pathway: physiological feedback and drug response. Clin Cancer Res 16, 3329-3334 (2010).
18. Normanno, N. et al. Implications for KRAS status and EGFR-targeted therapies in metastatic CRC. Nat Rev Clin Oncol 6, 519-527 (2009). 19. Wheeler, D.L., Dunn, E.F. & Harari, P.M. Understanding resistance to EGFR inhibitors-impact on future treatment strategies. Nat Rev Clin Oncol 7, 493-507 (2010).
20. Ardito, CM. et al. EGF receptor is required for KRAS-induced pancreatic tumorigenesis. Cancer cell 22, 304-317 (2012).
21. Navas, C. et al. EGF receptor signaling is essential for k-ras oncogene-driven pancreatic ductal adenocarcinoma. Cancer cell 22, 318-330.
22. Moore, M.J. et al. Erlotinib plus gemcitabine compared with gemcitabine alone in patients with advanced pancreatic cancer: a phase III trial of the National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol 25, 1960-1966 (2007).
23. Threadgill, D.W. et al. Targeted disruption of mouse EGF receptor: effect of genetic background on mutant phenotype. Science 269, 230-234 (1995).
24. Aliaga, J.C, Deschenes, C, Beaulieu, J.F., Calvo, E.L. & Rivard, N. Requirement of the MAP kinase cascade for cell cycle progression and differentiation of human intestinal cells. The American journal of physiology 277, G631-641 (1999). 25. Iwig, J.S. et al. Structural analysis of autoinhibition in the Ras-specific exchange factor RasGRPl . eLife 2, e00813 (2013).
26. Noffsinger, A.E. Serrated polyps and colorectal cancer: new pathway to
malignancy. Annual review of pathology 4, 343-364 (2009). 27. Oh-hora, M., Johmura, S., Hashimoto, A., Hikida, M. & Kurosaki, T. Requirement for Ras guanine nucleotide releasing protein 3 in coupling phospholipase C-gamma2 to Ras in B cell receptor signaling. J Exp Med 198, 1841-1851 (2003).
28. Jun, J.E., Rubio, I. & Roose, J. P. Regulation of Ras Exchange Factors and Cellular Localization of Ras Activation by Lipid Messengers in T Cells. Frontiers in immunology 4, 239 (2013).
29. Ebinu, J.O. et al. RasGRP, a Ras guanyl nucleotide- releasing protein with calcium- and diacylglycerol -binding motifs. Science 280, 1082-1086 (1998).
30. Cerami, E. et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov 2, 401-404 (2012). 31. Reinhold, W.C. et al. CellMiner: a web-based suite of genomic and pharmacologic tools to explore transcript and drug patterns in the NCI-60 cell line set. Cancer Res 72, 3499- 3511 (2012).
32. Hartzell, C. et al. Dysregulated RasGRPl Responds to Cytokine Receptor Input in T Cell Leukemogenesis. Science signaling 6, ra21 (2013). 33. van der Flier, L.G. & Clevers, H. Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annual review of physiology 71, 241-260 (2009).
34. Krausova, M. & Korinek, V. Wnt signaling in adult intestinal stem cells and cancer. Cell Signal 26, 570-579 (2014).
35. Biteau, B. & Jasper, H. EGF signaling regulates the proliferation of intestinal stem cells in Drosophila. Development 138, 1045-1055 (2011).
36. Jiang, H., Grenley, M.O., Bravo, M.J., Blumhagen, R.Z. & Edgar, B.A.
EGFR/Ras/MAPK signaling mediates adult midgut epithelial homeostasis and regeneration in Drosophila. Cell stem cell 8, 84-95 (2011). 37. Wong, V.W. et al. Lrigl controls intestinal stem-cell homeostasis by negative regulation of ErbB signalling. Nat Cell Biol 14, 401-408 (2012).
38. Dieleman, L.A. et al. Dextran sulfate sodium-induced colitis occurs in severe combined immunodeficient mice. Gastroenterology 107, 1643-1652 (1994). 39. Feng, Y. et al. Mutant KRAS promotes hyperplasia and alters differentiation in the colon epithelium but does not expand the presumptive stem cell pool. Gastroenterology 141, 1003-1013 el001-1010 (2011).
40. Haigis, K.M. et al. Differential effects of oncogenic K-Ras and N-Ras on proliferation, differentiation and tumor progression in the colon. Nature genetics 40, 600-608 (2008).
41. Bennecke, M. et al. Ink4a/Arf and oncogene-induced senescence prevent tumor progression during alternative colorectal tumorigenesis. Cancer Cell 18, 135-146 (2010).
42. Daley, S.R. et al. Rasgrpl mutation increases naive T-cell CD44 expression and drives mTOR-dependent accumulation of Helios+ T cells and autoantibodies. eLife 2, e01020 (2013).
43. Buday, L. & Downward, J. Epidermal growth factor regulates p21ras through the formation of a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor. Cell 73, 611-620 (1993).
44. Porfiri, E. & McCormick, F. Regulation of epidermal growth factor receptor signaling by phosphorylation of the ras exchange factor hSOSl . The Journal of biological chemistry 271, 5871-5877 (1996).
45. Baltensperger, K. et al. Binding of the Ras activator son of sevenless to insulin receptor substrate-1 signaling complexes. Science 260, 1950-1952 (1993).
46. Kawasaki, H. et al. A Rap guanine nucleotide exchange factor enriched highly in the basal ganglia. Proceedings of the National Academy of Sciences of the United States of
America 95, 13278-13283 (1998).
47. Jeng, H.H., Taylor, L.J. & Bar-Sagi, D. Sos-mediated cross-activation of wild-type Ras by oncogenic Ras is essential for tumorigenesis. Nat Commun 3, 1168 (2012). 48. Downward, J., Parker, P. & Waterfield, M.D. Autophosphorylation sites on the epidermal growth factor receptor. Nature 311, 483-485 (1984).
49. Topham, M.K. & Prescott, S.M. Diacylglycerol kinase zeta regulates Ras activation by a novel mechanism. J Cell Biol 152, 1135-1143 (2001). 50. Smith, J.J. et al. Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer. Gastroenterology 138, 958-968 (2010).
51. Staub, E. et al. An expression module of WIPFl-coexpressed genes identifies patients with favorable prognosis in three tumor types. Journal of molecular medicine 87, 633-644 (2009). 52. Jorissen, R.N. et al. Metastasis-Associated Gene Expression Changes Predict Poor Outcomes in Patients with Dukes Stage B and C Colorectal Cancer. Clin Cancer Res 15, 7642-7651 (2009).
53. Budczies, J. et al. Cutoff Finder: a comprehensive and straightforward Web application enabling rapid biomarker cutoff optimization. PloS one 7, e51862 (2012). 54. Sansom, O.J. et al. Loss of Ape in vivo immediately perturbs Wnt signaling, differentiation, and migration. Genes Dev 18, 1385-1390 (2004).
55. Moser, A.R., Pitot, H.C. & Dove, W.F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science 247, 322-324 (1990).
56. Su, L.K. et al. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science 256, 668-670 (1992).
57. Taketo, M.M. & Edelmann, W. Mouse models of colon cancer. Gastroenterology 136, 780-798 (2009).
58. Lee, D. et al. Tumor-specific apoptosis caused by deletion of the ERBB3 pseudo- kinase in mouse intestinal epithelium. J Clin Invest 119, 2702-2713 (2009). 59. Roberts, R.B. et al. Importance of epidermal growth factor receptor signaling in establishment of adenomas and maintenance of carcinomas during intestinal tumorigenesis. Proc Natl Acad Sci U S A 99, 1521-1526 (2002). 60. Luke, C.T., Oki-Idouchi, C.E., Cline, J.M. & Lorenzo, P.S. RasGRPl
overexpression in the epidermis of transgenic mice contributes to tumor progression during multistage skin carcinogenesis. Cancer research 67, 10190-10197 (2007).
61. Oki-Idouchi, C.E. & Lorenzo, P.S. Transgenic overexpression of RasGRPl in mouse epidermis results in spontaneous tumors of the skin. Cancer research 67, 276-280
(2007).
62. Findlay, G.M. et al. Interaction domains of sosl/grb2 are finely tuned for cooperative control of embryonic stem cell fate. Cell 152, 1008-1020 (2013).
63. Yang, D. et al. RasGRP3, a Ras activator, contributes to signaling and the tumorigenic phenotype in human melanoma. Oncogene (2011).
64. Yang, D. et al. RasGRP3 contributes to formation and maintenance of the prostate cancer phenotype. Cancer Res 70, 7905-7917 (2010).
65. Diaz, R. et al. The N-ras proto-oncogene can suppress the malignant phenotype in the presence or absence of its oncogene. Cancer Res 62, 4514-4518 (2002). 66. Matallanas, D. et al. Mutant K-Ras activation of the proapoptotic MST2 pathway is antagonized by wild-type K-Ras. Mol Cell 44, 893-906 (2011).
67. To, M.D. et al. Kras regulatory elements and exon 4A determine mutation specificity in lung cancer. Nature genetics 40, 1240-1244 (2008).
68. Diaz, L.A., Jr. et al. The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers. Nature 486, 537-540 (2012).
69. Misale, S. et al. Emergence of KRAS mutations and acquired resistance to anti- EGFR therapy in colorectal cancer. Nature 486, 532-536 (2012).
70. Ahmed, Z. et al. Grb2 controls phosphorylation of FGFR2 by inhibiting receptor kinase and Shp2 phosphatase activity. J Cell Biol 200, 493-504 (2013). 71. Lin, C.C. et al. Inhibition of basal FGF receptor signaling by dimeric Grb2. Cell 149, 1514-1524 (2012).
72. Wang, Z., Wang, M., Lazo, J.S. & Carr, B.I. Identification of epidermal growth factor receptor as a target of Cdc25A protein phosphatase. J Biol Chem 277, 19470-19475 (2002). 73. Prahallad, A. et al. Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedback activation of EGFR. Nature 483, 100-103 (2012).
74. Barretina, J. et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 483, 603-607 (2012). 75. Network, C.G.A. Comprehensive molecular characterization of human colon and rectal cancer. Nature 487, 330-337 (2012).
76. Rhodes, D.R. et al. ONCOMINE: a cancer microarray database and integrated data- mining platform. Neoplasia 6, 1-6 (2004).
77. Edgar, R., Domrachev, M. & Lash, A.E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 30, 207-210 (2002).
78. Sato, T. et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459, 262-265 (2009).
79. Nishiyama, Y., Kataoka, T., Yamato, K., Taguchi, T. & Yamaoka, K. Suppression of dextran sulfate sodium-induced colitis in mice by radon inhalation. Mediators of inflammation 2012, 239617 (2012).
[0183] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, accession numbers, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Claims

WHAT IS CLAIMED IS: 1. A method for selecting a drug therapy for a subject with a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer colorectal cancer, said method comprising:
(a) determining the level of RasGRPl in a sample obtained from the subject; and
(b) selecting a non anti-EGFR therapy for the subject if the level of RasGRPl is higher than a threshold value 2. The method of claim 1, further comprising determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, K117N, A146P, A146T or A146V.
3. The method of claim 1, wherein the non anti-EGFR therapy comprises a BRAF inhibitor, IGFR inhibitor, MEK inhibitor, PI3K inhibitor, VEGR inhibitor or other kinase inhibitor.
4. The method of any one of claims 1 to 3, wherein the cancer is colorectal cancer.
5. The method of claim 1, wherein the sample is a tumor biopsy sample.
6. The method of claim 1, wherein the level of RasGRPl is the level of RasGRPl polynucleotide or the level of RasGRPl polypeptide.
7. The method of claim 6, wherein determining the level of RasGRPl polynucleotide comprises an amplification assay or a hybridization assay.
8. The method of claim 7, wherein the amplification assay is a probe- based quantitative amplification assay.
9. The method of claim 6, wherein determining the level of RasGRPl polypeptide comprises an immunoassay, immunohistochemistry, western blot or mass spectrometry.
10. The method of claim 1, further comprising administering an effective amount of the non anti-EGFR therapy to the subject to alleviate at least one symptom of the cancer.
11. A method for predicting a likelihood of a good prognosis for a subject with a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer, said method comprising:
(a) determining the level of RasGRPl in a sample obtained from the subject; and
(b) predicting a likelihood of a good prognosis for the subject if the level of RasGRPl is higher than a threshold value.
12. The method of claim 11, wherein the good prognosis comprises overall survival, progression-free survival, or response to therapy.
13. The method of claim 11, further comprising determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S, G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, K117N, A146P, A146T or A146V.
14. The method of claim 11, wherein the cancer is colorectal cancer.
15. The method of claim 11, wherein the sample is a tumor biopsy sample.
16. The method of claim 11, wherein the level of RasGRPl is the level of RasGRPl polynucleotide or the level of RasGRPl polypeptide.
17. The method of claim 16, wherein determining the level of RasGRPl polynucleotide comprises an amplification assay or a hybridization assay.
18. The method of claim 17, wherein the amplification assay is a probe- based quantitative amplification assay.
19. The method of claim 16, wherein determining the level of RasGRPl polypeptide comprises an immunoassay, immunohistochemistry, western blot or mass spectrometry.
20. The method of claim 11, further comprising recording that the subject is a candidate for a non anti-EGFR therapy or further comprising or administering a non anti- EGFR therapy to the subj ect.
21. A method for determining a likelihood of a negative clinical response to an anti-EGFR therapy in a subject with cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer, said method comprising:
(a) determining the level of RasGRPl in a sample obtained from the subject; and
(b) recording a likelihood of a negative clinical response to the anti-EGFR therapy if the level of RasGRPl is higher than a control value.
22. The method of claim 21, further comprising determining the presence or absence of a KRAS mutation in an equivalent sample obtained from the subject, wherein the KRAS mutation is G12C, G12R, G12S,G12A, G12D, G12V, G13C, G13R, G13S, G13A, G13D, G13V, G34T, G34A, G34C, G35T, G35C, G35A, G37T, G37C, G37A, G48T, G38A, G38A, Q61K, Q61L, Q61R, Q61H, K117N, A146P, A146T or A146V.
23. The method of claim 21, wherein the cancer is colorectal cancer.
24. The method of claim 21, where the sample is a tumor biopsy sample.
25. The method of claim 21, wherein the level of RasGRPl is the level of RasGRPl polynucleotide or the level of RasGRPl polypeptide.
26. The method of claim 25, wherein determining the level of RasGRPl polynucleotide comprises an amplification assay or a hybridization assay.
27. The method of claim 26, wherein the amplification assay is a a probe- based quantitative amplification assay.
28. The method of claim 25, wherein determining the level of RasGRPl polypeptide comprises an immunoassay, immunohistochemistry, western blot or mass spectrometry.
29. The method of claim 21, further comprising administering an effective amount of the non anti-EGFR therapy to the subject to alleviate at least one symptom of the cancer.
30. The method of claim 29, wherein the non anti-EGFR therapy comprises a BRAF inhibitor, AKT inhibitor, MEK inhibitor, cMET inhibitor, VEGR inhibitor or other kinase inhibitor.
31. A method for determining a likelihood of a positive clinical response to an anti-EGFR therapy in a subject with cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer, said method comprising:
(a) determining the level of RasGRPl in a sample obtained from the subject; and
(b) recording a likelihood of a negative clinical response to the anti-EGFR therapy if the level of RasGRPl is lower than a control value.
32. The method of claim 31, further comprising selecting an anti-EGFR therapy to be administered to the subject; or further ocmprising or administering an anti- EGFR therapy to the subj ect.
33. The method of claim 32, wherein the anti-EGFR therapy is an EGFR blocking antibody or an EGFR inhibitor drug.
34. A computer-implemented method for selecting a drug therapy for a subject with a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer colorectal cancer, said method comprising:
(a) receiving, at one or more computer systems, information describing the level of RasGRPl in a sample obtained from the subject;
(b) performing, with one or more processors associated with the computer system, a comparison of the level of RasGRPl in the sample to a threshold value;
(c) generating, with the one or more processors associated with the one or more computer systems, a determination of whether the level of RasGRPl is higher than the threshold value.
35. The method of claim 34, further comprising generating a recommendation for a non-anti-EGFR therapy.
36. The method of claim 34, wherein the cancer is colorectal cancer.
37. The method of claim 34, wherein the sample is a tumor biopsy sample.
38. The method of claim 34, wherein the level of RasGRPl is the level of RasGRPl polynucleotide in the sample.
39. The method of claim 34, wherein the level of RasGRPl is the level of RASGRP1 polypeptide in the sample.
40. The method of claim 1, further comprising administering an effective amount of the non anti-EGFR therapy to the subject to alleviate at least one symptom of the cancer.
41. A computer implemented method for predicting a likelihood of a good prognosis for a subject with a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer, said method comprising:
receiving, at one or more computer systems, information describing the level of expression of RASGRPl in a sample obtained from the subject ; and
performing, with one or more processors associated with the computer system, a comparison of the level of RasGRPl in the sample to a threshold value;
generating, with the one or more processors associated with the one or more computer systems, a determination of whether the level of RasGRPl is higher than the threshold value, wherein a level of RasGRPl that is higher than the threshold value predicts a likelihood of a good prognosis for the subject.
42. The method of claim 41, wherein the cancer is colorectal cancer.
43. The method of claim 41, wherein the sample is a tumor biopsy sample.
44. A computer-implemented method for determining a likelihood of a negative clinical response to an anti-EGFR therapy in a subject with cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer, said method comprising: receiving, at one or more computer systems, information describing the level of expression of RASGRP1 in a sample obtained from the subject;
performing, with one or more processors associated with the computer system, a comparison of the level of RasGRPl in the sample to a control value;
generating, with the one or more processors associated with the one or more computer systems, a determination of whether the level of RasGRPl is higher than the control value, wherein a level of RasGRPl that is higher than the control value predicts a negative clinical response to an anti-EGFR therapy.
45. A computer-implemented method for determining a likelihood of a positive clinical response to an anti-EGFR therapy in a subject with cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer and breast cancer, said method comprising:
receiving, at one or more computer systems, information describing the level of expression of RASGRPl in a sample obtained from the subject;
performing, with one or more processors associated with the computer system, a comparison of the level of RasGRPl in the sample to a control value;
generating, with the one or more processors associated with the one or more computer systems, a determination of whether the level of RasGRPl is lower than the control value, wherein a level of RasGRPl that is lower than the control value predicts a negative clinical response to an anti-EGFR therapy.
PCT/US2016/025334 2015-04-01 2016-03-31 Prognostic and diagnostic methods for colorectal cancer Ceased WO2016161153A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/563,493 US10676792B2 (en) 2015-04-01 2016-03-31 Prognostic and diagnostic methods for colorectal cancer
US16/878,973 US20200283856A1 (en) 2015-04-01 2020-05-20 Prognostic and diagnostic methods for colorectal cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562141537P 2015-04-01 2015-04-01
US62/141,537 2015-04-01

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/563,493 A-371-Of-International US10676792B2 (en) 2015-04-01 2016-03-31 Prognostic and diagnostic methods for colorectal cancer
US16/878,973 Division US20200283856A1 (en) 2015-04-01 2020-05-20 Prognostic and diagnostic methods for colorectal cancer

Publications (2)

Publication Number Publication Date
WO2016161153A2 true WO2016161153A2 (en) 2016-10-06
WO2016161153A3 WO2016161153A3 (en) 2016-11-03

Family

ID=57006319

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/025334 Ceased WO2016161153A2 (en) 2015-04-01 2016-03-31 Prognostic and diagnostic methods for colorectal cancer

Country Status (2)

Country Link
US (2) US10676792B2 (en)
WO (1) WO2016161153A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107022619A (en) * 2017-04-28 2017-08-08 上海赛安生物医药科技有限公司 KRAS gene mutation detection primer probe and its kit
WO2018078143A1 (en) 2016-10-28 2018-05-03 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Means and methods for determining efficacy of anti-egfr inhibitors in colorectal cancer (crc) therapy

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022226377A1 (en) * 2021-04-22 2022-10-27 Molecular Axiom, Llc Compositions and methods for modulating sos gene expressions
CN116298295B (en) * 2023-05-18 2023-09-01 上海秤信生物科技有限公司 Tumor autoantigen/antibody combination for early detection of colorectal cancer and application thereof

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2624863T3 (en) * 2005-06-08 2017-07-17 Millennium Pharmaceuticals, Inc. Methods for identification, evaluation, and treatment of patients with cancer therapy
US8445198B2 (en) * 2005-12-01 2013-05-21 Medical Prognosis Institute Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
CA2648021A1 (en) * 2006-03-31 2007-10-11 Ordway Research Institute, Inc. Prognostic and diagnostic method for cancer therapy
WO2012112315A2 (en) 2011-02-20 2012-08-23 The Board Of Trustees Of The Leland Stanford Junior University Methods for diagnosis of kawasaki disease
WO2014009319A1 (en) 2012-07-11 2014-01-16 Boehringer Ingelheim International Gmbh Indolinone derivatives anticancer compounds
US9915660B2 (en) 2013-03-15 2018-03-13 Morphotek, Inc. Methods for determining prognosis of colorectal cancer

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018078143A1 (en) 2016-10-28 2018-05-03 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Means and methods for determining efficacy of anti-egfr inhibitors in colorectal cancer (crc) therapy
CN107022619A (en) * 2017-04-28 2017-08-08 上海赛安生物医药科技有限公司 KRAS gene mutation detection primer probe and its kit

Also Published As

Publication number Publication date
US20190119755A1 (en) 2019-04-25
US20200283856A1 (en) 2020-09-10
US10676792B2 (en) 2020-06-09
WO2016161153A3 (en) 2016-11-03

Similar Documents

Publication Publication Date Title
EP2971113B1 (en) Method for the prognosis and treatment of cancer metastasis
CA2891609C (en) Method for the prognosis and treatment of cancer metastasis
AU2013273242B2 (en) Method for the diagnosis, prognosis and treatment of lung cancer metastasis
Shaw et al. Pemetrexed-based chemotherapy in patients with advanced, ALK-positive non-small cell lung cancer
ES2537631T3 (en) Methods for predicting the clinical outcome for epidermal growth factor receptor inhibitors for cancer patients
Liu et al. Silencing of receptor tyrosine kinase ROR1 inhibits tumor-cell proliferation via PI3K/AKT/mTOR signaling pathway in lung adenocarcinoma
Depeille et al. RasGRP1 opposes proliferative EGFR–SOS1–Ras signals and restricts intestinal epithelial cell growth
EP3055429B1 (en) Method for the prognosis and treatment of metastasizing cancer of the bone originating from breast cancer
US20200283856A1 (en) Prognostic and diagnostic methods for colorectal cancer
US11680298B2 (en) Method of identifying risk of cancer and therapeutic options
Roudnicky et al. High expression of insulin receptor on tumour‐associated blood vessels in invasive bladder cancer predicts poor overall and progression‐free survival
CA2864306A1 (en) Cancer patient selection for administration of wnt signaling inhibitors using rnf43 mutation status
WO2014184679A2 (en) Method for the prognosis and treatment of renal cell carcinoma metastasis
Masago et al. Effect of vascular endothelial growth factor polymorphisms on survival in advanced‐stage non‐small‐cell lung cancer
Sasaki et al. Epidermal growth factor receptor gene amplification in surgical resected Japanese lung cancer
US20180100153A1 (en) Method and kit for use in inhiiting tumor progression, predicting or determining tumor progression state in VGF expressing cancers
Epistolio Targeted therapies in lung adenocarcinomas: new methodologies and new markers
Matli et al. RasGRP1 opposes proliferative EGFR–SOS1–Ras signals and restricts intestinal epithelial cell growth
HK1206431B (en) Method for the prognosis and treatment of cancer metastasis
HK1208501B (en) Method for the diagnosis and prognosis of lung cancer metastasis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16774226

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16774226

Country of ref document: EP

Kind code of ref document: A2