WO2016156865A1 - Exosomes - Google Patents

Exosomes Download PDF

Info

Publication number
WO2016156865A1
WO2016156865A1 PCT/GB2016/050923 GB2016050923W WO2016156865A1 WO 2016156865 A1 WO2016156865 A1 WO 2016156865A1 GB 2016050923 W GB2016050923 W GB 2016050923W WO 2016156865 A1 WO2016156865 A1 WO 2016156865A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
exosomes
plasma
sample
patient
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2016/050923
Other languages
French (fr)
Inventor
Costanza Emanueli
Gianni Angelini
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Bristol
Original Assignee
University of Bristol
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Bristol filed Critical University of Bristol
Publication of WO2016156865A1 publication Critical patent/WO2016156865A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/32Cardiovascular disorders
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to microRNAs (miRs), especially to miRs found in exosomes from pericardial fluid (PF), blood derivatives, other biological fluids or tissue samples and therapeutic uses of the same.
  • miRs microRNAs
  • Methods for diagnosing myocardial injury and methods for making a prognosis of post-surgical complications are also provided.
  • Coronary-arteiy-by-pass-graft (CABG) surgery using cardiopulmonary by-pass (CPB) is one of the most commonly performed operations in the world.
  • the procedure when associated with cardioplegic arrest is associated with different degrees of myocardial damage, which is not always easy to quantify.
  • Cardiac troponins (cTn-I and cTn-T) and cardiac enzymes are used to quantify the extent of damage but they usually peak 4-6 hours after the actual myocardial insult, even if the newer highly-sensitive cTN assays have better performance.
  • LV biopsies left ventricle (LV) biopsies. These are also more frequently used to assess different techniques of CPB and myocardial protection.
  • LV biopsies have limitations since they are invasive and can only be obtained during the surgical procedure.
  • MicroRNAs are post-transcriptional inhibitors of gene expression which are attracting a lot of attention in the hope that they can be developed as diagnostic and prognostic biomarkers for cardiac conditions.
  • Plasma circulating miRs have been scrutinized for their capacity to recognise a myocardial infarction (MI) in patients presenting with chest pain and individual miRs and miR clusters have been identified.
  • MI myocardial infarction
  • miRs have been unable to surpass cTNs in the diagnosis of a MI.
  • Some miRs have also been proposed to predict the evolution to heart failure in MI patients.
  • miRs have not yet been developed as diagnostic or prognostic tools to be used in cardiovascular clinical practice. Moreover, only limited investigation of these potential biomarkers has been carried out in connection with cardiac surgery.
  • miRs released by mammalian cells are often embedded within extracellular vesicles such as exosomes, microvesicles/microparticles and apoptotic bodies. These vesicles appear to protect the miRs from adverse chemical and physical conditions as well providing protection from ribonucleases.
  • the extracellular vesicles can be taken up by recipient cells, into which the miRs are released to influence gene expression. Vascular cells, cardiac myocytes and cardiac fibroblasts have all been shown to secrete miR-containing extracellular vesicles in culture systems.
  • miR-1 A significant increase in miR-1 in the blood and urine of patients with rheumatic heart disease undergoing mitral valve surgery (MVR) has been shown at 1 and 24 hours post-surgery (Zhou et al).
  • MVR mitral valve surgery
  • miR-1 and miR-208a increased 24 minutes after aortic clamping in patients with rheumatic heart disease undergoing combined MVR and aortic valve replacement (AVR) (Yang et al 2015).
  • both TSAH and MVR procedures "cut the myocardium” (septum or papillary muscles) and are therefore expected to increase circulating markers of myocardial damage independently of CPB and cardiologic arrest induced ischemia/reperfusion.
  • a pharmaceutical composition comprising pericardial fluid (PF) exosomes and one or more pharmaceutically acceptable carriers or excipients.
  • PF exosomes as described herein may be endogenous or bioengineered.
  • a method for cardiac surgery comprising delivering PF or PF extracellular vesicles during or after surgery.
  • a method for making a prognosis or prediction of post-surgical complications following cardiac surgery comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the concentration or molecular cargo of exosomes or other extracellular vesicles in the PF, wherein a change in exosome or other extracellular vesicle concentration or the composition of the molecular cargo of the exosomes or other extracellular vesicles compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
  • PF pericardial fluid
  • a method for making a prognosis of post-surgical complications following cardiac surgery comprising analysing a sample obtained from a patient before, during or after surgery and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein a change in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
  • the sample may be a biological sample, such as a blood or blood-derivative sample.
  • a method for diagnosing a myocardial injury comprising analysing a sample obtained from a patient and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein an increase in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient has an increased probability of having suffered from a myocardial injury.
  • a method for the treatment or prevention of cardiovascular disease, kidney disease or ischemic disease comprising providing PF exosomes to a diseased area of a patient.
  • a method for diagnosing acute complications after surgery comprising analysing a sample obtained from a patient and measuring the concentration of exosomes in the sample, wherein an increase in exosome concentration compared to normal patient values indicates said patient has an increased probability of having an acute complication after surgery.
  • the method may comprise measuring the concentration of cardiac-expressed miRs within exosomes or extracellular vesicles in the sample. An increase in the concentration of the cardiac miRs compared to normal patient values indicates the patient has an increased probability of having an acute complication after surgery.
  • a method for making a prognosis of clinical outcome and/or post-surgical complications following cardiac surgery comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the expression of microRNAs in the PF, wherein a change in microRNA expression compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
  • PF pericardial fluid
  • Extracellular vesicles are cell derived vesicles of endosomal and plasma membrane origin, which include exosomes, microvesicles/microparticles and apoptotic bodies membrane. These vesicles are usually classified by size with exosomes being about 30 to 100 nm in diameter, microvesicles/microparticles being 100 to 1000 nm in diameter and apoptotic bodies being 1 to 5 ⁇ in diameter. However, it has been noted that the cut off values of 100 nm and 1 ⁇ should be used with caution, with cardiac myocyte exosomes of up to 120 nm diameter being identified. The present inventors have provided the first characterisation of extracellular vesicles and exosomal miRs in human PF.
  • PF is an important source of proteins as well as noncoding RNAs, including miRs and other RNA molecules, produced by cells of the heart and heart vessels and provides a novel source of cardiac biomarkers.
  • PF derived exosomes also provide novel cardio-protective and vascular regeneration therapeutic agents.
  • the present invention provides a pharmaceutical composition
  • pericardial fluid (PF) exosomes may be autologous, allogeneic or xenogenic or may be artificial.
  • the PF exosomes may be endogenous to a patient or may be bioengineered.
  • the exosomes are at least bioequivalent to autologous exosomes.
  • the exosomes may be modified to provide an improved therapeutic activity. The modification may include addition or subtraction of one or more factors. Modification is especially preferred when the exosomes are artificial.
  • the PF exosomes are derived from mammalian PF, especially human PF. Suitable materials for the production of artificial or bioengineered exosomes will be familiar to the person skilled in the art.
  • Suitable pharmaceutically acceptable carriers or excipients will be known to the skilled person.
  • the exosomes may further comprise one or more therapeutic agents.
  • agents may be contained within the body of the exosome or may be bound within or on the exosome membrane.
  • Suitable therapeutic agents will be known to the skilled person and might include noncoding RNA, growth factors and other pro-angiogenic molecules, cardioprotective enzymes, antibodies, etc.
  • the therapeutic agent may comprise one or more of the Argonaute-2 (Ago-2) protein, the Dicer enzyme and/or the RNA-induced silencing complex (RISC).
  • Ago-2 Argonaute-2
  • RISC RNA-induced silencing complex
  • the PF exosomes may comprise one or more miRs selected from 21-5p, 23a-3p, 24- 3p, 27a-3p, 29a-3p, 29a-5p, 29b-3p, 126-3p, 126-5p, 143-3p, 199-5p, 374a-5p. In embodiments of the invention the PF exosomes comprise at least 199-5p or 374a-5p. Additionally or alternatively the exosomes may comprise 143-3p in combination with one or more of 29a-3p, 29a-5p or 29b-3p. Optionally, the exosomes may comprise one or more of 126-5p, 126-3p, 29b-3p, 29a-5p or 29a-3p in combination with at least 27a-3p or 21-5p. In preferred embodiments of the invention the PF exosomes comprise at least let-7b-5p.
  • the relative expression of 21-5p is about 2.5xl0 "2 , 23a-3p is about 4xl0 "4 , 24-3p is about 3.5xl0 "2 , 27a-3p is about 4xl0 "3 , 29a-3p is about 0.5X10 "1 , 29a-5p is about 5xl0 "5 , 29b-3p is about 3xl0 "4 , 126-3p is about 0.5xl0 "3 , 126-5p is about 2xl0 "4 , 143-3p is about 0.6xl0 "3 , 199-5p is about 1.5xl0 "5 or 374a-5p is about 0.6xl0 "3 , relative to expression of cel-miR-39.
  • the relative expression of let-7b-5p may be about 0.5 x 10 relative to expression of cel-miR-39.
  • the ratio of PF exosome miRs selected from one or more of 21-5p, 23a-3p, 24-3p, 27a-3p, 29a-3p, 29a-5p, 29b-3p, 126-3p, 126-5p, 143-3p, 199-5p and 374a-5p to plasma exosome miRs is at least 2: 1, or at least 5 : 1, preferably at least 10: 1 or at least 20: 1 or more.
  • the ratio of PF exosome miRs selected from one or more of 29a-3p, 29a-5p or 29b-3p to plasma exosome miRs is at least 40: 1 or at least 60: 1 or more.
  • the ratio of let-7-5p to plasma exosome miRs may be at least 100: 1 or at least 200: 1 or more.
  • At least about 50% of the PF exosomes have a particle size of about 30 nm to about 120 nm.
  • at least about 60% or at least about 70%) of the PF exosomes have a particle size of about 30 nm to about 120 nm.
  • the modal particle size of the PF exosomes may be from about 70 nm to about 90 nm.
  • compositions of the present invention may be used in therapy or in the manufacture of a medicament for use in therapy.
  • the compositions may be for use in the prevention or treatment of diseases including cardiovascular disease, kidney disease or ischemic disease in different organs and tissues, neuropathies and dementia associated with vascular defects and to promote wound healing. Additionally or alternatively the compositions may be for use in protecting an organ, such as the heart, from surgery-induced damage.
  • the present invention additionally provides a method for cardiac surgery, the method comprising delivering PF or PF extracellular vesicles during or after surgery.
  • the PF extracellular vesicles may be PF exosomes as described herein.
  • the PF may be replaced with a pharmaceutical composition of the invention as herein described.
  • the method may comprise absorbing PF exosomes on a matrix and placing the matrix into contact with a patient's heart or great vessels such as the superior or inferior vena cava, the pulmonary artery, the pulmonary vein, or the aorta.
  • Suitable matrix materials may be selected from one or more biocompatible materials currently used in cardiac surgery, such as xenografts, homografts or prosthetic material, or may new include new materials suitable for such use.
  • the PF exosomes may be endogenous or artificial and may be bioprinted on the matrix.
  • PF extracellular vesicles such as PF exosomes
  • PF extracellular vesicles may be delivered in a cardioplegia solution, or via an intravascular access or by direct injection into the heart or heart wall.
  • the present invention also provides a method for making a prognosis or prediction of post-surgical complications following cardiac surgery, the method comprising analysing a sample of PF obtained from a patient during the surgery and measuring the concentration or molecular cargo of exosomes or other extracellular vesicles in the PF, wherein a change in exosome or other extracellular vesicle concentration or a change in composition of the molecular cargo of the exosomes or other extracellular vesicles compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
  • appropriate treatment may be administered to prevent the complications and/or to reduce the severity thereof.
  • an increase in the concentration of exosomes or other extracellular vesicles in the PF compared to normal patient values may indicate an increased risk.
  • a decrease in the concentration of exosomes in the PF or other extracellular vesicles compared to normal patient values may indicate an increased risk.
  • the other extracellular vesicles may be endothelial or cardiac myocyte derived microparticles or platelets.
  • the method may comprise measuring the concentration of miRs, preferably cardiac miRs, in the exosomes or other extracellular vesicles, wherein an increase in concentration of the miRs compared to normal patient values may indicate an increased risk of developing post-surgical complications. In the event of a positive diagnosis appropriate treatment may be administered to prevent the post-surgical complication and/or to reduce its severity.
  • Post-surgical complications as discussed herein may include acute complications such as one or more of bleeding, myocardial infarction, arrhythmia, acute kidney injury, lung failure, neurological complications including memory loss and chest wound infections. Post-surgical complications also include later complications such as coronary graft or valve failure.
  • normal patient values refer to reference levels based on average values (as per standard accepted clinical references) for the patient who did not develop acute complications or for a group of patients.
  • the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values.
  • the present inventors are the first to have characterised plasma exosome profiles in patients after cardiac surgery or myocardial infarction. The present invention demonstrates that exosomes increase in the peripheral plasma in a time-dependent manner starting very shortly after the end of the ischaemia period during cardiac surgery. Without being bound by theory, the inventors therefore believe that plasma exosomes can provide novel biomarkers for the myocardial response to ischemia or ischemia and reperfusion.
  • the present invention additionally provides a method for making a prognosis of postsurgical complications following cardiac surgery, the method comprising analysing a sample obtained from a patient before, during or after surgery and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein a change in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
  • appropriate treatment may be administered to prevent the complications and/or to reduce the severity thereof.
  • the concentration of exosomes or other extracellular vesicles in the sample is increased compared to normal patient values.
  • the other extracellular vesicles may be endothelial or cardiac myocyte derived microparticles.
  • the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values.
  • the concentration of cardiac-enriched, ischemia- responsive miRs and exosomes may increase in the sample. Additionally or alternatively, the exosome to whole plasma concentration ratios of individual miRs may change compared to normal patient values. Such a change may be indicative of an increased risk of developing post-surgical complications and may be an increase or decrease with respect to normal patient values.
  • the sample is obtained from the patient within 2 to 48 hours of surgery, more preferably the sample is obtained within 2 hours of surgery.
  • the sample may be a whole blood, plasma, serum or urine sample.
  • the sample may be a platelet-free plasma or whole plasma sample.
  • the exosomes or other extracellular vesicles comprise one or more microRNAs selected from miR-1, miR-24, miR-133a, miR-133b, miR-208a, miR- 208b and miR-210 or a combination thereof. Additionally or alternatively the exosomes may comprise one or more microRNAs selected from miR-23a, miR92a, miR-126, miR-223 and miR-451 or a combination thereof.
  • the present invention also provides a method for diagnosing a myocardial injury, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein an increase in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient has an increased probability of having suffered from a myocardial injury.
  • An increased probability of having suffered from a myocardial injury preferably results in a positive diagnosis of the patient. Following a positive diagnosis the patient may be treated for the myocardial injury as appropriate.
  • the other extracellular vesicles may be endothelial or cardiac myocyte derived microparticles.
  • the myocardial injury may be myocardial ischemia or a myocardial ischemia/reperfusion injury.
  • the concentration of cardiac-enriched, ischemia- responsive miRs and exosomes may increase in the sample. Additionally or alternatively, the exosome to whole plasma concentration ratios of individual miRs may change compared to normal patient values. Such a change may be indicative of an increased risk of an increased probability of having suffered from a myocardial injury and may be an increase or decrease with respect to normal patient values.
  • the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values.
  • the sample is obtained from the patient within 2 to 48 hours of the myocardial ischemia or the myocardial ischemia/reperfusion injury, more preferably the sample is obtained within 2 hours.
  • the sample may be a whole blood, plasma, serum, urine, biopsy or surgical leftover tissue sample.
  • the sample may be a platelet-free plasma or whole plasma sample.
  • a biopsy may be obtained from any tissue of interest. In a preferred embodiment of the invention the biopsy is obtained from the left ventricle of the heart.
  • the exosomes or other extracellular vesicles comprise one or more microRNAs selected from miR-1, miR-24, miR-133a, miR-133b, miR-208a, miR- 208b and miR-210 or a combination thereof. Additionally or alternatively the exosomes may comprise one or more microRNAs selected from miR-23a, miR92a, miR-126, miR-223 and miR-451 or a combination thereof.
  • the present invention also provides a method for the treatment or prevention of cardiovascular disease, kidney disease or ischemic disease, the method comprising providing PF exosomes to a diseased area of a patient.
  • the diseased area may be, for example, the heart or great vessels (in cardiovascular disease), the kidneys, ureter, renal vein or artery (in kidney disease) or any other area affected by ischemic disease such as ischemic limb muscle, peripheral nerves, the brain, skin, internal ulcers or a wound of any type.
  • the PF exosomes may be endogenous or artificial as described herein supra.
  • the method comprises absorbing PF exosomes on a matrix and placing the matrix into contact with the diseased area of the patient. Additionally or alternatively, PF exosomes may be delivered in a solution, or via an intravascular access or by direct injection into the diseased area.
  • the present invention additionally provides a method for diagnosing acute complications induced by surgery, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes in the sample, wherein an increase in exosome concentration compared to normal patient values indicates said patient has an increased probability of having an acute complication after surgery.
  • appropriate treatment may be administered to prevent the acute complication and/or to reduce its severity.
  • the acute complication may be acute kidney injury, perioperative bleeding or other acute complications.
  • the concentration of cardiac-enriched, ischemia- responsive miRs and exosomes may increase in the sample. Additionally or alternatively, the exosome to whole plasma concentration ratios of individual miRs may change compared to normal patient values. Such a change may be indicative of an increased risk of developing acute post-surgical complications and may be an increase or decrease with respect to normal patient values.
  • the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values.
  • the sample may be a whole blood, plasma, serum, urine, biopsy or surgery leftover sample.
  • the sample may be a platelet-free plasma or whole plasma sample.
  • the exosomes comprise one or more microRNAs selected from miR-1, miR-24, miR-133a, miR-133b, miR-208a, miR-208b and miR-210. Additionally or alternatively the exosomes may comprise one or more microRNAs selected from miR- 23a, miR92a, miR-126, miR-223 and miR-451 or a combination thereof.
  • the present invention additionally provides a method for making a prognosis of postsurgical complications following cardiac surgery, the method comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the expression of microRNAs in the PF, wherein a change in microRNA expression compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
  • PF pericardial fluid
  • microRNA expression may be measured relative to a control microRNA, such as cel-miR-39.
  • the expression of microRNAs in the PF may be increased compared to normal patient values.
  • MicroRNAs which may increase in expression include one or more of let-7b- 5p, miR-21-5p, miR23a-3p, miR-24-3p, miR29a-3p, miR-29c-3p and miR-451a.
  • the expression of microRNAs in the PF may be decreased compared to normal patient values.
  • Figures 3 and 4 show the relative concentrations of miRs in PF and plasma. Left axis: relative (to Cel-39 spike in normaliser) expression of each miR in PF and plasma. Right axis: PF/plasma ratio of the concentration for each miR.
  • Graphs A and B show averages of all samples for each group, C each data point represents one sample. The data for one sample are the average of results from six recordings, dilution factors are accounted for.
  • Figure 6 shows NanoSight and electron microscopy data from enriched preparations of PF EVs.
  • Figure 8 shows the PF/plasma gradients in miRs are still present when miRs in exosomes extracted from PF and plasma are measured.
  • Figure 9 shows that exosomes can be uptaken by cardiac cells: here endothelial cells (Figure 9a) and stem-cell derived cardiomyocytes (Figure 9b).
  • Figure 10 shows that PF-exosomes improve the capacity of endothelial cells (hypoxic HUVECs) to proliferate.
  • Figure 11 shows that PF-exosomes improve blood perfusion (Figure 11a) after ischemia and increase angiogenesis (assessed as increased number of capillaries in the ischaemic muscles) ( Figure l ib). Toe survival ( Figure 11c) and superficial blood-flow to the foot were also improved ( Figure l id). Plasma-exosomes do not reproduce these effects.
  • Figure 13 shows post-operation plasma circulating miR-1 and miR-133a distinguish between on-pump and off pump surgery.
  • miR-1, and miR-133a-b, miR-210 and miR-223 were observed to be significantly increased after surgery (p ⁇ 0.05) with miR-1 increasing the most (21.4 times, p ⁇ 0.001).
  • miRs levels also increased significantly in on-pump coronary artery bypass (ONCAB) compared to off-pump coronary artery bypass (OPCAB) samples.
  • ONCAB on-pump coronary artery bypass
  • OPCAB off-pump coronary artery bypass
  • B data are shown as mean + SEM.
  • C Plasma concentration of exosomes (here identified as the particles between 30 and 120 nm particle) per mL of plasma. The results are presented as individual data points and median.
  • EMPs Circulating microparticles of endothelial origin
  • CM-MPs Circulating microparticles of cardiac myocyte origin
  • CABG increases the concentration of microparticles of endothelial (A) and cardiac myocyte (B) origins in the peripheral blood of 3 patients.
  • Figure 17 shows early changes in plasma exosome concentration after CABG:
  • CBP cardiopulmonary by-pass
  • Plasma exosome concentration (here identified as particles between 30 and 100 nm in size) per mL of plasma at each of the four time points. Results presented as individual data points and median, with each individual patient in a unique colour. * P ⁇ 0.05, ** p ⁇ 0.01 vs. pre-op; ⁇ p ⁇ 0.05, ⁇ p ⁇ 0.01 vs. pre-CPB; repeated-measures ANOVA with post hoc Tukey's test.
  • Figure 19 shows a time-course of miR changes in the total plasma in CABG patients: Expression of each miR in the total plasma relative to pre-op levels. Results presented as mean + SEM. ** P ⁇ 0.01 vs. pre-op; ⁇ p ⁇ 0.05 vs. pre-CPB; repeated measures ANOVA with post hoc Tukey's test.
  • Figure 20 shows a time-course of miR changes in the total plasma and plasma exosomal fraction associated with CABG, and exosomal miR/total plasma miR ratios at different time-points: Validation of exosome enrichment from the plasma of CABG patients.
  • A Analysis of the exosome preparation by Nanoparticle Tracking Analysis.
  • Figure 21 shows linear regression analyses. Linear regression of: A) relative expression of plasma concentration of individual miRs and cTn-I; B) exosome plasma concentration versus cardiac troponin I (cTn-I); C) each exosomal miR and plasma exosome concentration; D) relative expression of each exosomal miR and cTn-I. All time-points were included. The regression coefficients ( ⁇ ⁇ standard error) and P values are indicated in the plots.
  • Figure 25 shows the angiogenic action of PF exosomes is partially mediated by let-7b- 5p.
  • ECs were transfected with scramble siRNA (scramble) or Dicer siRNA (siRNA) for 24 hrs, followed by treatment with 10 ⁇ g/ml of PF derived exosomes (exosome) or 10 ⁇ g/ml of PF derived exosomes transfected with let-7b-5p inhibitor (exosome let-7b- 5p KD) for an additional 24 hrs.
  • scramble siRNA scramble siRNA
  • siRNA Dicer siRNA
  • the citrate-containing vacutainers were centrifuged at 1500 g, 4°C for 15 minutes, and the supernatant removed. The supernatant underwent further centrifugation at 13500 g, room temperature (RT), for 5 minutes to deplete the sample of miRNA-rich platelets. After noting the volume of PF collected, the fluid was centrifugated at 13500 g, RT, 5 minutes to deplete the samples of cells. The final platelet-poor plasma, PF and tissue samples were stored at -80°C until required.
  • RNA extraction from solid tissues TA, RAA
  • 1ml QIAzol Qiagen
  • gentleMACS M tube using the gentleMACS dissociator (both from Miltenyi Biotech, Surrey, UK).
  • 200 ⁇ of sample was used with 1ml QIAzol.
  • a synthetic analogue of the non- human Caenorhabditis elegans microRNA-39 (cel-miR-39, Qiagen) was spiked-in ( ⁇ of a 5 ⁇ 1/ ⁇ 1 stock) to normalise for RNA extraction efficiency.
  • RNA extracted to be used for the miR array a carrier RNA (MS2 RNA, Roche, West Wales, UK) was added to increase the yield. RNA was stored at -80°C.
  • miR array (below), total RNA was converted to cDNA using a reverse transcription kit (Universal cDNA Synthesis Kit, Exiqon, Woburn, MA). Reverse transcription for individual microRNAs was performed using the TaqMan miRNA Reverse Transcription Kit and miR-specific stem-loop primers (Life Technologies, Paisley, UK), and quantitative PCR (qPCR) was then performed using 2x Universal PCR Master Mix with No AmpErase UNG (Life Technologies, Paisley, UK).
  • a reverse transcription kit Universal cDNA Synthesis Kit, Exiqon, Woburn, MA
  • Reverse transcription for individual microRNAs was performed using the TaqMan miRNA Reverse Transcription Kit and miR-specific stem-loop primers (Life Technologies, Paisley, UK), and quantitative PCR (qPCR) was then performed using 2x Universal
  • miR-specific stem-loop primers (Life Technologies, Paisley, UK) identification numbers were as follows: miR-l-3p 002222, miR-21-5p 000397, miR-21-3p 002438, miR-23a-3p 000399, miR-24-3p 000402, miR-27a-3p 000408, miR-27a-5p 002445, miR-29a-3p 002112, miR-29a-5p 002447, miR-29b 000413, miR-126-3p 002228, miR-126-5p 000451, miR-143-3p 002249, miR-144-3p 002676, miR-144-5p 002148, miR-199a-5p 000498, miR-374a-5p 000563, cel-miR- 39 000200, U6 snRNA 001973.
  • each miR was normalised to either cel- miR-39 (for biological fluids) or the small nuclear U6 snRNA (for solid tissues).
  • each PCR reaction was performed in triplicate and analyzes were performed by either the 2-ddCt method or after obtaining relative miR abundance, using a standard curve built on serial dilutions of synthetic mature double- stranded miR templates (Ambion). miRs concentration ratios were calculated by dividing the miR relative expressions. miR array on human pericardial fluid
  • the processing setting were as follows: 1) detection scoring was applied, miRs not detectable in all 3 samples or Ct > 37 in at least 2 patients of the AVR group were not considered for future calculation; 2) average of inter plate calibrator (UniSp3 IPC) was calculated for each run (representing one sample) and the median was subtracted to each miRs Ct; 3) expression for each miR was derived using the 2-ACT method.
  • arrays data were inspected using the NormFinder algorithm to assess the variance in expression levels. The best normalizer was found to be the average of assays detected in all 3 AVR samples. Therefore, array data were normalized to the average of assays detected in all samples.
  • PF and plasma nanoparticle profiling NanoSight (Amesbury, UK) is an optical nanoparticle tracking system allowing for obtaining concentration and size distribution of the smallest EV populations.
  • a laser beam is scattered by particles in the sample, and the mean velocity of each particle is calculated by the Stokes-Einstein equation on the basis of Brownian motion recorded by a CCD camera.
  • a suitable concentration was determined and 1 mL of this sample was passed through the NanoSight flow cell. Once the temperature of the flow cell had stabilised at 25°C, six 30-second videos of each sample were taken with a high-resolution camera, with a 30 second pause between each. The videos were then processed by NanoSight Beta7 Nanoparticle Tracking Analysis software, version 2.3 (NanoSight), giving the concentration of particles per mL for each nanometre size.
  • the data presented is an average of the 6 videos.
  • Exosomes were enriched from the PF and plasma by using ExoQuick kit (System Biosciences). Briefly, 250 ⁇ of PF or plasma was centrifuged at 3,000 g for 15 minutes at 4°C to remove cells and cell debris. The supernatant was transferred to a fresh tube and 5 ⁇ . thrombin (500 U/mL) per 0.5 mL plasma or PF added to each sample, to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 minutes at RT. The supernatant was then filtered through a sterile a 0.22 ⁇ filter (Merck Millipore, Cork, Ireland) into a fresh tube and 75 ⁇ ExoQuick solution added.
  • ExoQuick kit System Biosciences
  • the grids were then incubated in a solution of 1.8% 25cP methylcellulose (Sigma Aldrich, Gillingham, UK) and 0.3% uranyl acetate (BDH, Poole, UK) for 10 minutes on ice. They were then removed using a loop and excess fluid removed using Whatman 1 filter paper. The grids were air dried for 30 minutes, then detached from the loop. Samples were analysed on a Tecnai T12 transmission electron microscope (FEI, Eindhoven, the Netherlands).
  • PF-derived exosomes were labelled using Exo- Glow (Exo-Green and/or Exo-Red, System Biosciences) according to the manufacturer recommendation.
  • ECs were seeded at density of 5xl0 4 cells/well on a 24 wells plate coverslip and 20 ⁇ g/mL of labelled PF-derived exosomes were added to target ECs in culture for 24 h at 37°C.
  • Cells were washed twice with PBS and fixed with 4% buffered PFA (Sigma Aldrich, Gillingham, UK) in PBS for 20 min at RT. Exosome uptake into ECs was visualized by confocal microscopy.
  • HUVECs were seeded in 6-well plates (2xl0 5 /well) and treated with lC ⁇ g/ml of PF- exosomes or PF-depleted exosome for 24h in hypoxia (control: normoxia), then trypsinized and plated in a flat-bottomed 96-well plates (8xl0 3 /well) coated with a growth factors-reduced Matrigel (Corning Incorporated, UK). Endothelial network formation was quantified at 6 h in randomly captured microscopic fields (magnification 5 x) by calculating the length of cellular network and by measuring the % of area covered by connected vascular-like structures.
  • HUVECs were seeded in 96-well plates (5xl0 3 /well) and treated 5, 10 and 20 ⁇ g/ml of PF-exosomes or PF-depleted exosome for 24h in hypoxia and normoxia. The medium was then replaced with a complete medium added with BrdU (10 ⁇ >1/1) for 24 hours. BrdU incorporation was measured by the BrdU ELISA assay kit (Roche). Caspase-3/7 activity was measured at 24 h using a luminescent cell death detection kit (Caspase-GLO assay, Promega, Southampton, UK).
  • mice were covered by project and personal licenses issued by the United Kingdome Home Office and they were performed in accordance with the Guide for the Care and Use of Laboratory Animals (the Institute of Laboratory Animal Resources, 1996).
  • CD1 male mice underwent surgical induction of unilateral limb ischemia was obtained by occlusion of the left femoral artery. The following day, mice were injected with 100 ⁇ g of exosomes derived from either the PF or the plasma. A control group received PBS. The superficial blood flow to both feet was measured using high resolution laser color Doppler imaging system (Moor LDI2, Moor Instruments, Devon, UK) at day 0 and days 7 after limb ischemia.
  • the functional impact of PF and plasma derived exosome on treatment in CD1- ischemic mice was assessed by measuring capillary in the adductor muscle.
  • Isolectin B4 (Life Technologies) was used to detect endothelial cells, followed by staining with a red-conjugated rabbit polyclonal anti- a-smooth muscle actin (Sigma) used to stain smooth muscle cells (which are present in arterioles, but not in capillaries). Nuclei were stained with DAPI (4',6-diamidino-2-phenylindole). The slides were mounted using a mounting medium (Vector Labs, Peterborough, UK). The relative amount of positive cells was counted in 8 randomly selected high-power fields (magnification 20X) using Zeiss inverted fluorescent microscope. Analyses were performed using muscles from eight mice per group.
  • Table 1 shows a list of highly expressed miRs in PF of aortic valve replacement (AVR) patients and also in PF of different cardiac surgery cases including mitral valve replacement (MVR), coronary artery bypass graft (CABG) and AVRCABG.
  • AVR aortic valve replacement
  • MVR mitral valve replacement
  • CABG coronary artery bypass graft
  • AVRCABG AVRCABG
  • Figures 3 and 4 show the relative concentrations of miRs in PF and plasma.
  • Left axis relative (to Cel-39 spike in normaliser) expression of each miR in PF and plasma.
  • Right axis PF/plasma ratio of the concentration for each miR.
  • most of cardiac expressed miRs are more concentrated in PF and hence PF is better source to measure them when looking at biomarkers of cardiac conditions.
  • extracellular vesicles EVs
  • EVs from PF can be enriched. NanoSight and electron microscopy data from the these enriched preparations of EVs is shown in Figure 6.
  • Exosomes can be uptaken by cardiac cells: here endothelial cells (Figure 9a) and stem-cell derived cardiomyocytes (Figure 9b). Exosomes were incubated for 24 hours and washed away. Only exosomes uptaken by cells are evident in the confocal microscopy. This shows that exosomes from human PF have the potential of being used in living cells to transfer their cargos and elicit cellular responses. PF-exosomes improve the capacity of endothelial cells (hypoxic HUVECs) to proliferate (which is conductive for angiogenesis in ischaemic tissues) (see Figure 10).
  • COPTIC Coagulation and Platelet Function Testing in Cardiac Surgery
  • ISORCTN20778544 NIHR-funded single-centre observational study which has recruited 2,427 patients undergoing cardiac surgery at the Bristol Heart Institute. It has collected citrate plasma (from the arterial blood line) before (prior to chest opening) and on completion of surgery (before chest closure). The former sample (pre-op sample) is taken before heparin administration and the latter (post-op sample) within 30 minutes of reversal of heparin anticoagulation by protamine sulfate, which is important given that heparin has been suggested to create artefacts in miR analyses.
  • Pre-op sample is taken before heparin administration and the latter (post-op sample) within 30 minutes of reversal of heparin anticoagulation by protamine sulfate, which is important given that heparin has been suggested to create artefacts in miR analyses.
  • Prospectively collected clinical data are also available for these patients, including in
  • ARCADIA (Association of non-coding RNAs with Coronary Artery Disease and type 2 Diabetes) (REC 13/LO/1687) is an National Institute of Health Research (NIHR) portfolio study developed at the Bristol Heart Institute, University Hospital Bristol NHS Foundation Trust and London Hammersmith Hospital, Imperial College Healthcare NHS Trust.
  • NIHR National Institute of Health Research
  • ARCADIA has been specifically designed to carry out non- coding RNA (ncRNA) in patients with a LV ejection fraction (LVEF) >40% undergoing first time CABG using CPB and cold blood cardioplegic arrest and control groups. Blood samples are taken at 4 times: 1) in the anaesthetic room (before heparin administration); 2) during surgery before and after establishment of CPB; 3) at 24h and, 4) 48h after the operation.
  • Plasma samples were analysed for EV content by using a nanoparticle tracking system NanoSight. To perform this analysis, from each sample, lul of diluted plasma is sufficient. Noteworthy, this volume is dramatically less than what required for cTn analyses.
  • NanoSight passes a laser beam through a fluid sample and tracks the speed of individual particles. This is done by tracking the distance travelled by each particle over a set time to calculate its speed under Brownian motion. As larger particles travel slower than smaller ones under Brownian motion, the NanoSight is able to compute the size of each of the nanoparticles in the sample.
  • the software provides information on the number of particles at each given size, from 0 to ⁇ 450nm, and plots a histogram demonstrating the number of particles of each size.
  • the plasma concentration of exosomes (identified as the particles between 30 and 100 nm particles) per mL of plasma were quantified. In the COPTIC- 1, average particle distributions by size were also analysed.
  • exosomes were enriched from the ARCADIA plasma. Briefly, 100 ⁇ . of plasma prepared as described above, was further centrifuged at 20,000 g for 30 minutes at 4°C to remove any remaining cell debris. The supernatant was transferred to a fresh tube and 5 ⁇ . thrombin (500 U/mL) per 0.5 mL plasma was added to each sample, to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 minutes at RT.
  • thrombin 500 U/mL
  • the supernatant was then filtered through a sterile a 0.22 ⁇ filter (Merck Millipore, Cork, Ireland) into a fresh tube.
  • a volume ⁇ of exosome-containing sample were applied to the top of the column and centrifuge at 50 g for 60 seconds. After discarding the elute, 200 ⁇ 1 of PBS was applied to the top of the column, the sample was centrifuge at 50 g for 60 seconds and the elute contains purified exosomes was stored at -20°C until required.
  • the quality of the preparations was preliminary assessed using NanoSight.
  • the exosomes preparation protein content was measured using MicroBCA protein assay (Thermo Scientific).
  • exosomes miRs were extracted using the miRNeasy from Qiagen (Valencia, CA). Briefly, ImL of Qiazol was added at the exosomes preparation and a synthetic analogue of the non-human Caenorhabditis elegans microRNA-39 (cel-miR-39, Qiagen) was spiked-in ( ⁇ . of a 5 ⁇ 1/ ⁇ stock) to normalise for RNA extraction efficiency 19 and then the manufacture protocol was followed.
  • Cardiac troponin I and T were measured in the all the ARCADIA samples.
  • CABG surgery is associated with a rapid increase in cardiac miRs in the peripheral plasma, which is more pronounced in on-pump cases.
  • CABG surgery is associated with a rapid increase in exosomes in the peripheral plasma, which is more pronounced in on-pump cases
  • the COPTIC exosome analyses were integrated by ARCADIA, which collected blood at additional time points around surgery. As shown in Figure 15, the increase in plasma exosome concentration induced in on-pump patients was not present before the patients was put on CPB and it was time-dependent.
  • COPTIC ⁇ Coagulation and Platelet Function Testing in Cardiac Surgery a registered (ISRCTN20778544) UK National Institute of Health Research (NIHR)- funded single-centre prospective observational study, recruited 2,427 patients undergoing cardiac surgery at the Bristol Heart Institute. It has collected citrate plasma (from the arterial blood line) before (prior to chest opening) and on completion of surgery (before chest closure). The former sample (pre-operation: pre-op) is taken before heparin administration and the latter (post-operation: post-op) within 30 minutes of reversal of heparin anticoagulation by protamine sulfate, when the patient is still in the operating theatre.
  • NIHR National Institute of Health Research
  • Diabetes n, %) 0/15 0% eGFR (median, IQR) 79.9 (66.5, 108.3)
  • BM I (kg/m 2 ; median, IQR) 26.3 (24.3, 28.4)
  • ARCADIA ⁇ Association of non-coding RNAs with Coronary Artery Disease and type 2 Diabetes) (REC 13/LO/1687) is a prospective observational study conducted at the Bristol Heart Institute and at the London Hammersmith Hospital.
  • ARCADIA has been specifically designed to carry out analyses of non-coding RNAs (ncRNA), including miRs and extracellular vesicles (EVs), including exosomes, in patients undergoing first time CABG using CPB and cold blood cardioplegic arrest. Blood samples are taken at 4 time points: 1) in the anaesthetic room; 2) during surgery before establishment of CPB, and at 3) 24h and 4) 48h after the end of the operation.
  • Diabetes (n, %) 0/6 0% eGFR (median, IQR) 81 (75, 90)
  • BM I (kg/m 2 ; median, IQR) 28.2 (26.8, 30.4)
  • the plasma exosome concentration was analysed using a Nanoparticle Tracking Analysis (NTA) machine (NanoSight).
  • NTA Nanoparticle Tracking Analysis
  • the plasma concentration of particles of a size (30 to lOOnm) typical of exosomes was determined together with the particle distribution by size.
  • exosomes were enriched from the ARCADIA patients' plasma.
  • Table 5 presents the individual miRs measured (RT-PCR) in plasma and plasma exosomes, with PCR primers and reasons for their inclusion in this study.
  • Table 5 List of microRNAs (miR) measured in the present study in the COPTIC and ARCADIA cohorts, with miR sequences and reasons for inclusion in the study.
  • Hs-cTn-I was measured in serial ARCADIA serum samples (ARCHITECT STAT, Abbott).
  • the COPTIC samples were analysed with a non-hs cTn-I ELISA (Sigma) since the available hs-cTn-1 assay (and of other hs-cTn assays) is unsuitable for citrate plasma samples.
  • the plasma exosome concentration was analysed using a Nanoparticle Tracking Analysis (NTA) system (NanoSight, Amesbury, UK).
  • NTA Nanoparticle Tracking Analysis
  • One ⁇ _, of neat plasma was diluted with ultra-clean, sterile water to obtain a concentration of particles suitable to be read on the machine in a lmL sample, according to the manufacturer's guidelines. This was then passed through a flow cell at a constant flow rate using a syringe driver, where a laser beam was shone through the stream of particles.
  • 6 individual videos of 30 sec duration were recorded consecutively, with a 5 sec delay in between each.
  • exosomes were enriched from the ARCADIA patients' plasma. Briefly, 100 ⁇ _, of plasma prepared as described above was further centrifuged at 17,000 g for 30 min at 4°C to remove any remaining cell debris. The supernatant was transferred to a fresh tube and 5 ⁇ . thrombin (500 U/mL) per 0.5 mL plasma was added to each sample, to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 min at RT.
  • the supernatant was then passed through a sterile a 0.22 ⁇ filter (Merck Millipore, Cork, Ireland) into a fresh tube.
  • a sample volume of ⁇ . was applied to the top of the column and centrifuged at 500 g for 60 sec. After discarding the elute, 200 ⁇ . of PBS was applied to the top of the column, the sample was centrifuge at 500 g for 60 seconds and the elute containing purified exosomes was stored at -20°C until required.
  • Exosomes from Patient 6 of the ARCADIA cohort were extracted using the ExoSpin columns as described above. Negative staining and TEM was carried out using an adapted, previously described protocol. Briefly, 3 ⁇ _, of the exosome preparation was incubated on a Pioloform carbon-coated grid at RT for 10 minutes. The grid was then washed on a droplet of distilled water for 10 minutes. Finally, the grid was incubated in a solution of 1.8% methylcellulose and 0.3% uranyl acetate for 5 minutes on ice. The grid was then removed with a loop, the excess liquid drained off using a Whatman 1 filter and allowed to air dry. The grids were imaged using a Tecnail2 120 kV BioTwin Spirit transmission electron microscope (FEI Company, Eindhoven, Netherlands) equipped with a bottom-mounted Eagle CCD camera (FEI).
  • FEI bottom-mounted Eagle CCD camera
  • MiR-451 was measured as a quality control against haemolysis since it is enriched in red blood cells and miR-23a because it is supposedly stably expressed in plasma. Moreover, miR-233 was measured because it is enriched in platelets, its circulating level are correlated with platelet reactivity index in patients requiring revascularization for coronary artery disease and there is a platelet response to cardiac surgery. We did not measure exosomal miRs in COPTIC due to the low volume of available plasma making it insufficient to prepare exosome fractions suitable for miR analyses.
  • the reverse transcription reaction for each individual miR was performed using the TaqMan miR Reverse Transcription Kit and miR-specific stem-loop primers (Life Technologies, Paisley, UK), and quantitative PCR (qPCR) was then performed using 2x Universal PCR Master Mix with No AmpErase UNG (Life Technologies, Paisley, UK). MiR-specific stem-loop primer identification numbers are presented in Table 5. Expression of each miR was normalised to cel-miR-39. Each PCR reaction was performed in triplicate and data were calculated using the 2-ddCt method.
  • Table 7 Results of the tests of the effect of heparinase I treatment on RT-PCR cycles for an endogenous miR (miR-21) and of the spiked-in Cel-39 normalizer starting from heparinase I-treated and non-heparinase I-treated human plasma.
  • hsa-miR-21 31.08 30.82 B Exemplar effect of Heparinase I treatment in plasma prepared from blood taken during heparin treatment. without with Heparinase I
  • CABG is associated with a rapid increase in plasma cardiac miRs
  • COPTIC (ISRCTN20778544) was a prospective observational study in patients undergoing heart surgery in which citrate plasma samples were collected at two time points: 1) in the anaesthetic room before surgery and 2) post-CPB immediately after heparin reversal before chest closure.
  • Table 3 summarizes the characteristics of the COPTIC patients who contributed samples to in this study.
  • the COPTIC biobank offered the possibility for studying early responses after CABG using CPB and cold blood cardioplegic arrest (a subgroup of the COPTIC population).
  • a set of miRs that are reportedly expressed by cardiac myocytes and upregulated by ischemia in the heart (see Table 5) increased early after CABG (Table 8).
  • CABG increased the plasma level of platelet- enriched miR-223.
  • the vascular expressed miR-92a and miR- 126 and the "quality control" miR-23a (supposedly stably expressed in plasma) and miR-451 (used as control against plasma sample haemolysis since it is enriched in red blood cells) were unaffected by CABG.
  • Table 8 Summary of the mean differences between miR levels before and after CABG with corresponding standard errors (SE) and levels of significance.
  • CABG is associated with a rapid increase in plasma exosomes
  • the concentrations of miR-1, miR- 133a and miR- 133b increased in the whole plasma at 24h post-surgery. By contrast, the concentration of miR-24 did not. No other miR expressional changes in the measured were observed. As shown in the Table 5, the numbers of miRs measured in ARCADIA were reduced in comparisons to COPTIC.
  • Pre-op pre-operation (in the anaesthetic room); pre-CPB: during surgery before establishment of the cardiopulmonary by-pass (CPB); 24 hours: 24 hours after end of CBP; 48 hours: 48 hours after end of CBP.
  • CPB cardiopulmonary by-pass
  • Table 9B Supplemental to Figure 20C. Mean values, and standard deviations (SD), of relative expression data for each microRNA in the ARCADIA plasma exosomal fraction. MicroRNA expression was calculated relative to exogenous cel-miR-39, using the formula 2"K mR CT " (cel-miR-39 CT)] microRNAs Average relative expression (SD)
  • Pre-op pre-operation (in the anaesthetic room); pre-CPB: during surgery before establishment of the cardiopulmonary by-pass (CPB); 24 hours: 24 hours after end of CBP; 48 hours: 48 hours after end of CBP.
  • CPB cardiopulmonary by-pass
  • the heart-derived exosomes that circulate in the peripheral blood may be reporters of the myocardial injury, thus enabling for diagnosis and monitoring of cardiac patients. Consequently, we propose that blood exosome-based analyses should be further considered in the attempt to develop novel semi-invasive biomarkers of cardiac damage. Analyses of blood exosomes and exosomal miRs hold several properties that make them particularly interesting. From a mechanistic standpoint, exosomes are actively secreted from living cells and thus they might provide complementary information to markers, like cTns and cardiac enzymes that mainly leak out of dying cardiomyocytes.
  • exosomes are not merely inert products: they reportedly elicit functional responses in recipient cells in a paracrine fashion and at distance. Consequently, exosomes could represent functional biomarkers directly involved in the development and progression of the pathological condition that we aim to diagnose or monitor. Analyses on left ventricle biopsies collected at different phases of cardiac surgeries may help validate the capacity of circulating exosome to grade the level of myocardial injury.
  • Exosomes are released by a variety of cell types and hence changes in their plasma concentration cannot be assumed to be dependent solely on their release from the heart cells.
  • the cardiomyocytes contribution to the circulating exosomes is strongly suggested by the presence of myocyte-enriched miRs (miR-1, miR-133a. miR-133b) in the plasma exosome cargo and in the fact that abundance of exosomal cardiac miRs increased after CABG.
  • miR-24 and miR-210 were substantially enriched in the total pool of plasma exosomes.
  • the exosome/whole plasma concentration ratios of miR-1, miR-133a and miR-133b were mostly unchanged. This suggests the possibility that after CABG miR-24 and miR-210 are predominantly released via exosomes, while miR-1 and miR-133 are released via exosomes and exosome-independent mechanisms in similar proportions.
  • RNA Extraction and quantitative real-time analysis Total RNA was extracted using the miRNeasy (Qiagen), according to the manufacturer's instructions.
  • RNA extraction from solid tissues around 50 mg of tissue was first homogenized in 1 ml QIAzol (Qiagen) in a gentleMACS M tube using the gentleMACS dissociator (both from Miltenyi Biotec).
  • QIAzol Qiagen
  • PF and plasma 200 ⁇ of sample was used with 1 ml of QIAzol.
  • a synthetic analogue of the non-human Caenorhabditis elegans microRNA-39 (cel-miRNA-39, Qiagen) was spiked-in (10 ⁇ of a 5 fmol/ ⁇ stock) to normalise for RNA extraction efficiency23.
  • TGFBR1 (ID: Hs00610320_ml), CASPASE3 (Hs00234387_ml), LOX (Hs00942480_ml), UBC (ID: Hs00824723_ml) (all Life Technologies).
  • Real-time quantification to measure gene expression for DICER was performed using Power SYBR Green PCR Master Mix (Life Technologies) and normalized against GAPDH. Primers were the following:
  • Quantification was performed by the 2-AACT method84-86.
  • the Ct value obtained from a dilution series (ranging from 100 nM down to 10 fM) of chemically synthesized RNA oligonucleotides corresponding to the mature miRNA sequence of let-7b-5p (UGAGGUAGUAGGUUGUGUGGUU) and miRNA- 122-5p
  • RNA array on human pericardial fluid was converted to cDNA using a reverse transcription kit (Universal cDNA Synthesis Kit, Exiqon, Woburn, MA).
  • Universal cDNA Synthesis Kit Universal cDNA Synthesis Kit, Exiqon, Woburn, MA.
  • Three (unpooled) PF samples of the AVR surgical patients' groups were randomly selected to be run in a PCR-based miRNA array enabling the profiling of 752 human miRNAs (miRNACURY LNATM microRNA polymerase chain reaction (PCR) human panels I and II (version 3, Exiqon).
  • the miRNA array plates were run using a LightCycler 480 (Roche).
  • miRNA array bioinformatic analyses For the bioinformatics analyses, the processing setting were as follows: 1) detection scoring: miRNAs not detectable in all 3 samples or Ct > 37 in at least 2 patients were not considered for future calculations; 2) average of inter-plate calibrator (UniSp3 IPC) was calculated for each run (representing one sample) and the median was subtracted to each miRNAs Ct; 3) expression of each miRNA was derived using the 2-AACT method. On the basis of these criteria, arrays data were inspected using the NormFinder algorithm to assess the variance in expression levels. The best normalizer was found to be the average of assays detected in all 3 AVR samples; therefore it was used to normalize the array.
  • detection scoring miRNAs not detectable in all 3 samples or Ct > 37 in at least 2 patients were not considered for future calculations
  • average of inter-plate calibrator UniSp3 IPC
  • Exosomes enrichment from the PF and plasma Exosomes enrichment from the PF and plasma. Exosomes were enriched from 250 ⁇ of PF and plasma using ExoQuick kit (System Biosciences). 2.5 ⁇ _, thrombin (500 U/ml, System Biosciences) per 250 ⁇ plasma was added to each sample to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 minutes at RT. PF and fibrin-depleted plasma were then filtered through a sterile a 0.22 ⁇ filter (Merck Millipore) into a fresh tube and 75 ⁇ ExoQuick solution was added.
  • ExoQuick kit System Biosciences
  • 2.5 ⁇ _, thrombin 500 U/ml, System Biosciences
  • HUVECs were grown in EBM-2 endothelial cell basal medium (Lonza) with addition of 2% FBS and SingleQuots Kit (EGM-2 medium, Lonza) at 37°C with 5% C02. After the first expansion cells were then grown in EGM-2 medium using 2% exosome-depleted FBS (System Biosciences). To mimic ischemia in vitro, ECs were exposed to hypoxia (1% p02) for 24 h followed by treatment with different concentrations of PF/plasma-derived exosomes or exosome- depleted PF/plasma for 24 h. HUVECs were used between passages 2 and 6.
  • Lipofectamine RNAiMAX (Life Technologies) was used to transfect HUVECs with scramble (75 nM total), siRNAs against DICER (25 nM for each siRNA, 75 nM total), mirVana® miRNA mimic let-7b-5p (12.5mM, MCI 1050), mirVana® miRNA inhibitor let-7b-5p (12.5mM, MH11050), Pre-miR Negative Control (12.5mM, AM17120) and Anti-miR Negative Control (12.5mM, AM17011) (all Life Technologies), according to the manufacturer's instructions. Published sequences56,89 of siRNA against DICER and scramble were used (all purchased from Qiagen).
  • Exosomes were transfected with mirVana® miRNA inhibitor let-7b-5p (MH11050, Life Technologies) using Exo-FectTM Exosome Transfection Kit (System Biosciences) and following the guideline's recommendations.
  • the human PF is enriched with miRNAs of potential cardiovascular origin.
  • the PF is enriched with miRNAs released from the heart and thoracic vasculature, under ethical approval, we obtained the PF, peripheral blood-derived plasma and leftover tissue samples of myocardium (right atrium appendage) and vasculature (ascending thoracic aorta) from surgical patients undergoing aortic valve replacement (AVR).
  • AVR aortic valve replacement
  • Table 11 Characteristics of the surgical patients used in the study. All patients were operated for aortic valve replacement
  • We started our miRNA analyses by performing a PCR-based miRNA microarray (Exiqon) including 752 miRNAs in n 3 non-pooled, randomly selected PF samples. The array revealed that 359 miRNAs included in the array were ubiquitously present in the tested PF samples. Of those miRNAs, several miRNAs known to be present in human or animal cardiovascular cells were abundantly expressed in the PF samples. We arbitrary selected 15 of those PF expressed, putative cardiovascular miRNAs for validation.
  • miRNAs (let-7b-5p, miR-15a-5p, miR-16-5p, miR-19b- 3p, miR-21-5p, miR-22-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR- 29c-3p, miR-451a) chosen between the top-expressed miRNAs in the 3 samples.
  • miR-27a-3p was chosen because it is clustered in a poly-cystronic unit with 2 miRNAs in the list above (miR-23a-3p, miR-24-3p) and known to be proangiogenic; 2) miR-29b-3p is co-transcribed with miR-29a-3p and miR-29c-3p from the above list and is expressed by cardiac fibroblasts; 3) miR-126- 3p is the prototypical endothelial miRNA. Finally, even if not detected by the array in the PF, miR-208a was chosen because of its enrichment in cardiac tissue.
  • miRNAs are associated with the protein Ago-2 and miRNA- Ago-2 complexes are reportedly present in the conditioned medium of cells as well as in patients' serum.
  • Ago2 immunoprecipitation IP was performed. Immunoblotting for Ago-2 confirmed the correct execution of the approach (Fig. 24b).
  • exosomes contain miRNAs that are co-expressed and possibly physically associated with the RISC. Consequently, exosomes could deliver a RISC machinery ready to act in recipient cells, thus immediately eliciting expressional changes commanding for functional responses.
  • let-7b-5p could be transferred from PF exosomes to ECs and the expressional and functional impact of exosomal let-7b-5p in recipient cells.
  • Dicer knockdown KD
  • PF exosomes restored the angiogenic capacity of Dicer KO-ECs (Fig. 25c).
  • let-7b-5p we suppressed let-7b-5p inside the exosomes using a dedicated inhibitor and a commercially available kit (see Material and Methods). The reduction of exosomal let-7b-5p in PF exosomes transfected with the miRNA inhibitor was confirmed by PCR (data not shown).
  • the PF let-7b-5p KD-exosomes could not: 1) restore let-7b-5p level (Fig. 25a); 2) decrease TGFBR1 expression (Fig. 25b), or improve angiogenesis (Fig. 25c) in recipient Dicer-KD ECs.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for diagnosing a myocardial injury, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein an increase in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient has an increased probability of having suffered from a myocardial injury. Methods for making a prognosis of post-surgical complications following cardiac surgery and a pharmaceutical composition comprising pericardial fluid (PF) exosomes and one or more pharmaceutically acceptable carriers or excipients are also provided.

Description

Exosomes
Field of Invention
The present invention relates to microRNAs (miRs), especially to miRs found in exosomes from pericardial fluid (PF), blood derivatives, other biological fluids or tissue samples and therapeutic uses of the same. Methods for diagnosing myocardial injury and methods for making a prognosis of post-surgical complications are also provided.
Background to the Invention
Coronary-arteiy-by-pass-graft (CABG) surgery using cardiopulmonary by-pass (CPB) is one of the most commonly performed operations in the world. The procedure when associated with cardioplegic arrest is associated with different degrees of myocardial damage, which is not always easy to quantify. Cardiac troponins (cTn-I and cTn-T) and cardiac enzymes are used to quantify the extent of damage but they usually peak 4-6 hours after the actual myocardial insult, even if the newer highly-sensitive cTN assays have better performance. A better understanding of the ischemic-reperfusion mechanism of action can be obtained from left ventricle (LV) biopsies. These are also more frequently used to assess different techniques of CPB and myocardial protection. However, LV biopsies have limitations since they are invasive and can only be obtained during the surgical procedure.
MicroRNAs (miRs) are post-transcriptional inhibitors of gene expression which are attracting a lot of attention in the hope that they can be developed as diagnostic and prognostic biomarkers for cardiac conditions. Plasma circulating miRs have been scrutinized for their capacity to recognise a myocardial infarction (MI) in patients presenting with chest pain and individual miRs and miR clusters have been identified. However, so far miRs have been unable to surpass cTNs in the diagnosis of a MI. Some miRs have also been proposed to predict the evolution to heart failure in MI patients. However, miRs have not yet been developed as diagnostic or prognostic tools to be used in cardiovascular clinical practice. Moreover, only limited investigation of these potential biomarkers has been carried out in connection with cardiac surgery. miRs released by mammalian cells are often embedded within extracellular vesicles such as exosomes, microvesicles/microparticles and apoptotic bodies. These vesicles appear to protect the miRs from adverse chemical and physical conditions as well providing protection from ribonucleases. The extracellular vesicles can be taken up by recipient cells, into which the miRs are released to influence gene expression. Vascular cells, cardiac myocytes and cardiac fibroblasts have all been shown to secrete miR-containing extracellular vesicles in culture systems. A significant increase in miR-1 in the blood and urine of patients with rheumatic heart disease undergoing mitral valve surgery (MVR) has been shown at 1 and 24 hours post-surgery (Zhou et al). A similar study has found miR-1 and miR-208a increased 24 minutes after aortic clamping in patients with rheumatic heart disease undergoing combined MVR and aortic valve replacement (AVR) (Yang et al 2015). However, both TSAH and MVR procedures "cut the myocardium" (septum or papillary muscles) and are therefore expected to increase circulating markers of myocardial damage independently of CPB and cardiologic arrest induced ischemia/reperfusion.
A recent study on the kinetics of circulating muscle-enriched miRs in patients undergoing transcoronary ablation of septal hypertrophy (TSAH) (Liebetrau et al 2013) was widely criticised due to possible heparin interference with the PCR reactions used to measure the plasma expression of miRs. Methods therefore need to be developed in order to properly translate miRs to the clinical laboratory.
There is therefore a need for improved biomarkers for myocardial ischemia or a myocardial ischemia/reperfusion injury and to predict adverse events and complications following cardiac surgery. There is also a need for therapeutic agents for use in cardiology interventions and improved diagnostics for myocardial injury. Summary of the Invention
According to a first aspect of the invention there is provided a pharmaceutical composition comprising pericardial fluid (PF) exosomes and one or more pharmaceutically acceptable carriers or excipients. PF exosomes as described herein may be endogenous or bioengineered.
According to a second aspect of the invention there is provided a method for cardiac surgery, the method comprising delivering PF or PF extracellular vesicles during or after surgery.
According to a third aspect of the invention there is provided a method for making a prognosis or prediction of post-surgical complications following cardiac surgery, the method comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the concentration or molecular cargo of exosomes or other extracellular vesicles in the PF, wherein a change in exosome or other extracellular vesicle concentration or the composition of the molecular cargo of the exosomes or other extracellular vesicles compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
According to a fourth aspect of the invention there is provided a method for making a prognosis of post-surgical complications following cardiac surgery, the method comprising analysing a sample obtained from a patient before, during or after surgery and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein a change in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications. The sample may be a biological sample, such as a blood or blood-derivative sample.
According to a fifth aspect of the invention there is provided a method for diagnosing a myocardial injury, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein an increase in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient has an increased probability of having suffered from a myocardial injury.
According to a sixth aspect of the invention there is provided a method for the treatment or prevention of cardiovascular disease, kidney disease or ischemic disease, the method comprising providing PF exosomes to a diseased area of a patient.
According to a seventh aspect of the invention there is provided a method for diagnosing acute complications after surgery, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes in the sample, wherein an increase in exosome concentration compared to normal patient values indicates said patient has an increased probability of having an acute complication after surgery. Additionally or alternatively, the method may comprise measuring the concentration of cardiac-expressed miRs within exosomes or extracellular vesicles in the sample. An increase in the concentration of the cardiac miRs compared to normal patient values indicates the patient has an increased probability of having an acute complication after surgery.
According to an eighth aspect of the invention, there is provided a method for making a prognosis of clinical outcome and/or post-surgical complications following cardiac surgery, the method comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the expression of microRNAs in the PF, wherein a change in microRNA expression compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
Description
Extracellular vesicles are cell derived vesicles of endosomal and plasma membrane origin, which include exosomes, microvesicles/microparticles and apoptotic bodies membrane. These vesicles are usually classified by size with exosomes being about 30 to 100 nm in diameter, microvesicles/microparticles being 100 to 1000 nm in diameter and apoptotic bodies being 1 to 5 μπι in diameter. However, it has been noted that the cut off values of 100 nm and 1 μπι should be used with caution, with cardiac myocyte exosomes of up to 120 nm diameter being identified. The present inventors have provided the first characterisation of extracellular vesicles and exosomal miRs in human PF. Without being bound by theory, the inventors believe that PF is an important source of proteins as well as noncoding RNAs, including miRs and other RNA molecules, produced by cells of the heart and heart vessels and provides a novel source of cardiac biomarkers. PF derived exosomes also provide novel cardio-protective and vascular regeneration therapeutic agents.
The present invention provides a pharmaceutical composition comprising pericardial fluid (PF) exosomes and one or more pharmaceutically acceptable carriers or excipients. The PF exosomes may be autologous, allogeneic or xenogenic or may be artificial. For example, the PF exosomes may be endogenous to a patient or may be bioengineered. Preferably the exosomes are at least bioequivalent to autologous exosomes. In embodiments of the invention the exosomes may be modified to provide an improved therapeutic activity. The modification may include addition or subtraction of one or more factors. Modification is especially preferred when the exosomes are artificial. Preferably the PF exosomes are derived from mammalian PF, especially human PF. Suitable materials for the production of artificial or bioengineered exosomes will be familiar to the person skilled in the art.
Suitable pharmaceutically acceptable carriers or excipients will be known to the skilled person.
In embodiments of the invention the exosomes may further comprise one or more therapeutic agents. Such agents may be contained within the body of the exosome or may be bound within or on the exosome membrane. Suitable therapeutic agents will be known to the skilled person and might include noncoding RNA, growth factors and other pro-angiogenic molecules, cardioprotective enzymes, antibodies, etc. In embodiments of the invention the therapeutic agent may comprise one or more of the Argonaute-2 (Ago-2) protein, the Dicer enzyme and/or the RNA-induced silencing complex (RISC). The PF exosomes may comprise one or more miRs selected from 21-5p, 23a-3p, 24- 3p, 27a-3p, 29a-3p, 29a-5p, 29b-3p, 126-3p, 126-5p, 143-3p, 199-5p, 374a-5p. In embodiments of the invention the PF exosomes comprise at least 199-5p or 374a-5p. Additionally or alternatively the exosomes may comprise 143-3p in combination with one or more of 29a-3p, 29a-5p or 29b-3p. Optionally, the exosomes may comprise one or more of 126-5p, 126-3p, 29b-3p, 29a-5p or 29a-3p in combination with at least 27a-3p or 21-5p. In preferred embodiments of the invention the PF exosomes comprise at least let-7b-5p.
Preferably the relative expression of 21-5p is about 2.5xl0"2, 23a-3p is about 4xl0"4, 24-3p is about 3.5xl0"2, 27a-3p is about 4xl0"3, 29a-3p is about 0.5X10"1, 29a-5p is about 5xl0"5, 29b-3p is about 3xl0"4, 126-3p is about 0.5xl0"3, 126-5p is about 2xl0"4, 143-3p is about 0.6xl0"3, 199-5p is about 1.5xl0"5 or 374a-5p is about 0.6xl0"3, relative to expression of cel-miR-39. The relative expression of let-7b-5p may be about 0.5 x 10 relative to expression of cel-miR-39.
Additionally or alternatively, the ratio of PF exosome miRs selected from one or more of 21-5p, 23a-3p, 24-3p, 27a-3p, 29a-3p, 29a-5p, 29b-3p, 126-3p, 126-5p, 143-3p, 199-5p and 374a-5p to plasma exosome miRs is at least 2: 1, or at least 5 : 1, preferably at least 10: 1 or at least 20: 1 or more. In embodiments of the invention the ratio of PF exosome miRs selected from one or more of 29a-3p, 29a-5p or 29b-3p to plasma exosome miRs is at least 40: 1 or at least 60: 1 or more. The ratio of let-7-5p to plasma exosome miRs may be at least 100: 1 or at least 200: 1 or more.
Preferably, at least about 50% of the PF exosomes have a particle size of about 30 nm to about 120 nm. In embodiments of the invention at least about 60% or at least about 70%) of the PF exosomes have a particle size of about 30 nm to about 120 nm. The modal particle size of the PF exosomes may be from about 70 nm to about 90 nm.
Pharmaceutical compositions of the present invention may be used in therapy or in the manufacture of a medicament for use in therapy. The compositions may be for use in the prevention or treatment of diseases including cardiovascular disease, kidney disease or ischemic disease in different organs and tissues, neuropathies and dementia associated with vascular defects and to promote wound healing. Additionally or alternatively the compositions may be for use in protecting an organ, such as the heart, from surgery-induced damage.
The present invention additionally provides a method for cardiac surgery, the method comprising delivering PF or PF extracellular vesicles during or after surgery. The PF extracellular vesicles may be PF exosomes as described herein. Optionally, the PF may be replaced with a pharmaceutical composition of the invention as herein described.
The method may comprise absorbing PF exosomes on a matrix and placing the matrix into contact with a patient's heart or great vessels such as the superior or inferior vena cava, the pulmonary artery, the pulmonary vein, or the aorta. Suitable matrix materials may be selected from one or more biocompatible materials currently used in cardiac surgery, such as xenografts, homografts or prosthetic material, or may new include new materials suitable for such use. The PF exosomes may be endogenous or artificial and may be bioprinted on the matrix.
In alternative embodiments of the invention, PF extracellular vesicles, such as PF exosomes, may be delivered in a cardioplegia solution, or via an intravascular access or by direct injection into the heart or heart wall.
The present invention also provides a method for making a prognosis or prediction of post-surgical complications following cardiac surgery, the method comprising analysing a sample of PF obtained from a patient during the surgery and measuring the concentration or molecular cargo of exosomes or other extracellular vesicles in the PF, wherein a change in exosome or other extracellular vesicle concentration or a change in composition of the molecular cargo of the exosomes or other extracellular vesicles compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications. In the event of a prognosis or prediction that the patient is at increased risk of developing post-surgical complications appropriate treatment may be administered to prevent the complications and/or to reduce the severity thereof. In embodiments of the invention an increase in the concentration of exosomes or other extracellular vesicles in the PF compared to normal patient values may indicate an increased risk. Alternatively, a decrease in the concentration of exosomes in the PF or other extracellular vesicles compared to normal patient values may indicate an increased risk. The other extracellular vesicles may be endothelial or cardiac myocyte derived microparticles or platelets. Additionally or alternatively, the method may comprise measuring the concentration of miRs, preferably cardiac miRs, in the exosomes or other extracellular vesicles, wherein an increase in concentration of the miRs compared to normal patient values may indicate an increased risk of developing post-surgical complications. In the event of a positive diagnosis appropriate treatment may be administered to prevent the post-surgical complication and/or to reduce its severity.
Post-surgical complications as discussed herein may include acute complications such as one or more of bleeding, myocardial infarction, arrhythmia, acute kidney injury, lung failure, neurological complications including memory loss and chest wound infections. Post-surgical complications also include later complications such as coronary graft or valve failure.
As used herein, normal patient values refer to reference levels based on average values (as per standard accepted clinical references) for the patient who did not develop acute complications or for a group of patients. In embodiments of the invention, the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values. The present inventors are the first to have characterised plasma exosome profiles in patients after cardiac surgery or myocardial infarction. The present invention demonstrates that exosomes increase in the peripheral plasma in a time-dependent manner starting very shortly after the end of the ischaemia period during cardiac surgery. Without being bound by theory, the inventors therefore believe that plasma exosomes can provide novel biomarkers for the myocardial response to ischemia or ischemia and reperfusion.
The present invention additionally provides a method for making a prognosis of postsurgical complications following cardiac surgery, the method comprising analysing a sample obtained from a patient before, during or after surgery and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein a change in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications. In the event of a prognosis that the patient is at increased risk of developing post-surgical complications appropriate treatment may be administered to prevent the complications and/or to reduce the severity thereof. In embodiments of the invention the concentration of exosomes or other extracellular vesicles in the sample is increased compared to normal patient values. The other extracellular vesicles may be endothelial or cardiac myocyte derived microparticles. In embodiments of the invention, the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values. In embodiments of the invention the concentration of cardiac-enriched, ischemia- responsive miRs and exosomes may increase in the sample. Additionally or alternatively, the exosome to whole plasma concentration ratios of individual miRs may change compared to normal patient values. Such a change may be indicative of an increased risk of developing post-surgical complications and may be an increase or decrease with respect to normal patient values.
Preferably the sample is obtained from the patient within 2 to 48 hours of surgery, more preferably the sample is obtained within 2 hours of surgery. The sample may be a whole blood, plasma, serum or urine sample. In embodiments of the invention the sample may be a platelet-free plasma or whole plasma sample. Preferably the exosomes or other extracellular vesicles comprise one or more microRNAs selected from miR-1, miR-24, miR-133a, miR-133b, miR-208a, miR- 208b and miR-210 or a combination thereof. Additionally or alternatively the exosomes may comprise one or more microRNAs selected from miR-23a, miR92a, miR-126, miR-223 and miR-451 or a combination thereof.
The present invention also provides a method for diagnosing a myocardial injury, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein an increase in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient has an increased probability of having suffered from a myocardial injury. An increased probability of having suffered from a myocardial injury preferably results in a positive diagnosis of the patient. Following a positive diagnosis the patient may be treated for the myocardial injury as appropriate. The other extracellular vesicles may be endothelial or cardiac myocyte derived microparticles. The myocardial injury may be myocardial ischemia or a myocardial ischemia/reperfusion injury.
In embodiments of the invention the concentration of cardiac-enriched, ischemia- responsive miRs and exosomes may increase in the sample. Additionally or alternatively, the exosome to whole plasma concentration ratios of individual miRs may change compared to normal patient values. Such a change may be indicative of an increased risk of an increased probability of having suffered from a myocardial injury and may be an increase or decrease with respect to normal patient values.
In embodiments of the invention, the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values.
Preferably the sample is obtained from the patient within 2 to 48 hours of the myocardial ischemia or the myocardial ischemia/reperfusion injury, more preferably the sample is obtained within 2 hours. The sample may be a whole blood, plasma, serum, urine, biopsy or surgical leftover tissue sample. In embodiments of the invention the sample may be a platelet-free plasma or whole plasma sample. A biopsy may be obtained from any tissue of interest. In a preferred embodiment of the invention the biopsy is obtained from the left ventricle of the heart.
Preferably the exosomes or other extracellular vesicles comprise one or more microRNAs selected from miR-1, miR-24, miR-133a, miR-133b, miR-208a, miR- 208b and miR-210 or a combination thereof. Additionally or alternatively the exosomes may comprise one or more microRNAs selected from miR-23a, miR92a, miR-126, miR-223 and miR-451 or a combination thereof.
The present invention also provides a method for the treatment or prevention of cardiovascular disease, kidney disease or ischemic disease, the method comprising providing PF exosomes to a diseased area of a patient. The diseased area may be, for example, the heart or great vessels (in cardiovascular disease), the kidneys, ureter, renal vein or artery (in kidney disease) or any other area affected by ischemic disease such as ischemic limb muscle, peripheral nerves, the brain, skin, internal ulcers or a wound of any type.
The PF exosomes may be endogenous or artificial as described herein supra. In one embodiment the method comprises absorbing PF exosomes on a matrix and placing the matrix into contact with the diseased area of the patient. Additionally or alternatively, PF exosomes may be delivered in a solution, or via an intravascular access or by direct injection into the diseased area.
The present invention additionally provides a method for diagnosing acute complications induced by surgery, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes in the sample, wherein an increase in exosome concentration compared to normal patient values indicates said patient has an increased probability of having an acute complication after surgery. In the event that an increased probability of having an acute complication after surgery is diagnosed appropriate treatment may be administered to prevent the acute complication and/or to reduce its severity. The acute complication may be acute kidney injury, perioperative bleeding or other acute complications.
In embodiments of the invention the concentration of cardiac-enriched, ischemia- responsive miRs and exosomes may increase in the sample. Additionally or alternatively, the exosome to whole plasma concentration ratios of individual miRs may change compared to normal patient values. Such a change may be indicative of an increased risk of developing acute post-surgical complications and may be an increase or decrease with respect to normal patient values.
In embodiments of the invention, the concentration of exosomes or other extracellular vesicles may increase by at least 20%, or at least 40% or at least 50% compared to normal patient values. In preferred embodiments of the invention the concentration of exosomes or other extracellular vesicles may increase by about 55% compared to normal patient values.
The sample may be a whole blood, plasma, serum, urine, biopsy or surgery leftover sample. In embodiments of the invention the sample may be a platelet-free plasma or whole plasma sample.
Preferably, the exosomes comprise one or more microRNAs selected from miR-1, miR-24, miR-133a, miR-133b, miR-208a, miR-208b and miR-210. Additionally or alternatively the exosomes may comprise one or more microRNAs selected from miR- 23a, miR92a, miR-126, miR-223 and miR-451 or a combination thereof.
The present invention additionally provides a method for making a prognosis of postsurgical complications following cardiac surgery, the method comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the expression of microRNAs in the PF, wherein a change in microRNA expression compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications. As discussed above, microRNA expression may be measured relative to a control microRNA, such as cel-miR-39. The expression of microRNAs in the PF may be increased compared to normal patient values. MicroRNAs which may increase in expression include one or more of let-7b- 5p, miR-21-5p, miR23a-3p, miR-24-3p, miR29a-3p, miR-29c-3p and miR-451a. Alternatively, the expression of microRNAs in the PF may be decreased compared to normal patient values.
Brief Description of the Drawings
The invention will now be described in relation to specific embodiments, in which:
Figure 1 shows human cardiovascular expression of the top expressed miRs in PF using ascending thoracic aorta (n=8) and atrium (n=4) samples from cardiac surgery patients as a reference. The presence of "miR*" forms was noted in the array. miR- 122 (produced by the liver) was used as a control.
Figure 2 shows miR*/miR ratios in PF compared to the ascending aortic (n=8) and atrium (n=4) samples. The different types of samples were obtained from the same patients. Figures 3 and 4 show the relative concentrations of miRs in PF and plasma. Left axis: relative (to Cel-39 spike in normaliser) expression of each miR in PF and plasma. Right axis: PF/plasma ratio of the concentration for each miR.
Figure 5 shows the expression of extracellular vesicles (EVs) in PF (n=8) and plasma (n=8). Graphs A and B show averages of all samples for each group, C each data point represents one sample. The data for one sample are the average of results from six recordings, dilution factors are accounted for. *p < 0.05, ** p < 0.01 *** p < 0.001.
Figure 6 shows NanoSight and electron microscopy data from enriched preparations of PF EVs. Figure 7 shows miRs of Figures 3 and 4 measured again in exosomes from PF (n=10) and plasma (n=7) and found to be present. Figure 8 shows the PF/plasma gradients in miRs are still present when miRs in exosomes extracted from PF and plasma are measured.
Figure 9 shows that exosomes can be uptaken by cardiac cells: here endothelial cells (Figure 9a) and stem-cell derived cardiomyocytes (Figure 9b). Figure 10 shows that PF-exosomes improve the capacity of endothelial cells (hypoxic HUVECs) to proliferate.
Figure 11 shows that PF-exosomes improve blood perfusion (Figure 11a) after ischemia and increase angiogenesis (assessed as increased number of capillaries in the ischaemic muscles) (Figure l ib). Toe survival (Figure 11c) and superficial blood-flow to the foot were also improved (Figure l id). Plasma-exosomes do not reproduce these effects.
Figure 12 shows plasma circulating miR levels before and at completion of CABG. Relative expression of a selection of microRNAs in plasma from paired patient samples pre- and post-CABG (n=20 per group) in COPTIC- 1. miR-451 was measured as a quality control against haemolysis since it is enriched in red blood cells and miR- 23 because it is supposedly stably expressed in plasma. Individual data points and the median are shown. All expressional analyses are relative to a spiked-in synthetic miR (syn-cel-miR-39). * p < 0.05, ** p < 0.01, *** p < 0.001 for pre-op vs. post-op, Wilcoxon matched-pairs signed rank test.
Figure 13 shows post-operation plasma circulating miR-1 and miR-133a distinguish between on-pump and off pump surgery. In COPTIC-2, using cluster-matched regression analysis, miR-1, and miR-133a-b, miR-210 and miR-223 were observed to be significantly increased after surgery (p<0.05) with miR-1 increasing the most (21.4 times, p<0.001). miRs levels also increased significantly in on-pump coronary artery bypass (ONCAB) compared to off-pump coronary artery bypass (OPCAB) samples. miR-23a, miR-92a, miR-126, miR-208a-b and miR-451 did not change significantly after surgery. Figure 14 shows NanoSight data on the COPTIC- 1 study: A and B): Average particle distributions by size in the plasma samples taken from CABG patients (n=l l) immediately before (pre-operation, pre-op) and after (post-operation, post-op, circa 2 hours after initiation of cardiopulmonary bypass). Exosomes in the plasma of healthy donors (controls, n=4) are also shown. Exosomes are considered to have a size between 30 and 100 nm. Cardiac myocyte-derived exosomes have been reported to be sized up to 120 nm). In B, data are shown as mean + SEM. # p < 0.05 and ]j p < 0.001 vs. Control, § p < 0.01 and & p < 0.001 vs. Pre-op.; C) Plasma concentration of exosomes (here identified as the particles between 30 and 120 nm particle) per mL of plasma. The results are presented as individual data points and median. * p < 0.05 vs. pre-op, paired ratio t-test, §§ p < 0.01 vs. healthy controls, Mann- Witney U test.
Figure 15 shows NanoSight data on the ARCADIA: A and B): Average particle distributions by size in the plasma samples taken from CABG patients (n=6) immediately before (pre-operation, pre-op), during the operation before putting the patient on cardiopulmonary-by-pass (pre-CPB) and at 24h and 48h after the operation. In B, data are shown as mean + SEM. $ p < 0.05 v Pre-op, If p < 0.01 v Pre-CPB, & p < 0.01 v Pre-op, § p < 0.001 v Pre-CPB; C) Plasma concentration of exosomes (here identified as the particles between 30 and 120 nm particle) per mL of plasma. The results are presented as individual data points and median. * p < 0.05 vs. pre-op, paired ratio t-test, §§ p < 0.01 vs. healthy controls, Mann- Witney U test.
Figure 16 shows cardiovascular cell-derived microparticles (MPs) increase at 24 h from coronary surgery in the platelet-free plasma prepared from the peripheral blood (n=3 CABG cases). A) Circulating microparticles of endothelial origin (EMPs) were identified by flow cytometry for Annexin V and VE-cadherin; B) Circulating microparticles of cardiac myocyte origin (CM-MPs) were recognized by Annexin V and alfa-sarcomeric staining. In summary, CABG increases the concentration of microparticles of endothelial (A) and cardiac myocyte (B) origins in the peripheral blood of 3 patients.
Figure 17 shows early changes in plasma exosome concentration after CABG: A) Average particle distributions by size in the serial plasma samples taken from CABG patients (n=15) immediately before (pre-operation= pre-op) and at termination of surgery, before chest closure (post-operation= post-op. B) Graph showing the average size distribution of particles from all of the pre- and post-operative blood samples as determined by Nanoparticle Tracking Analysis. Data are shown as mean + SEM; repeated measures ANOVA with post hoc Tukey's test. C) Regression analyses of changes in plasma exosome concentration (here identified as particles between 30 and 100 nm in size) per mL of plasma after the operation. The graph shows pre- vs. post- operation exosome levels (the solid line represents no change between the pre and post levels). Data were analysed by linear regression method. The P values of the different analyses are presented as part of the graphs in panels B and C.
Figure 18 shows a time-course of plasma exosome changes in CABG patients: A) Average particle distributions by size in the serial plasma samples taken from CABG patients (n=6) immediately before (pre-operation= pre-op), during the operation before starting coronary grafting with the patient on cardiopulmonary-by-pass (pre- CPB) and at 24h and 48h after the operation. B) Average particle distributions by size in the serial plasma samples (n=6). Plasma was prepared from blood collected immediately before (pre-operation, pre-op); during the operation, before starting coronary grafting with the patient on cardiopulmonary by-pass (CBP) (pre-CPB) and at 24h and 48h from completion of surgery. Data are shown as mean + SEM. *** p < 0.001 vs. pre-op; ΛΛρ < 0.01, ΛΛΛρ < 0.001 vs. pre-CPB; repeated measures ANOVA with post hoc Tukey's test. C) Plasma exosome concentration (here identified as particles between 30 and 100 nm in size) per mL of plasma at each of the four time points. Results presented as individual data points and median, with each individual patient in a unique colour. * P< 0.05, ** p < 0.01 vs. pre-op; Λ p < 0.05, ΛΛ p < 0.01 vs. pre-CPB; repeated-measures ANOVA with post hoc Tukey's test.
Figure 19 shows a time-course of miR changes in the total plasma in CABG patients: Expression of each miR in the total plasma relative to pre-op levels. Results presented as mean + SEM. ** P < 0.01 vs. pre-op; Λ p < 0.05 vs. pre-CPB; repeated measures ANOVA with post hoc Tukey's test. Figure 20 shows a time-course of miR changes in the total plasma and plasma exosomal fraction associated with CABG, and exosomal miR/total plasma miR ratios at different time-points: Validation of exosome enrichment from the plasma of CABG patients. (A) Analysis of the exosome preparation by Nanoparticle Tracking Analysis. Data shown are the average from 6 individual patients (30-second videos recorded concurrently and in one run). (B) Western blot analyses for exosome antigens Alix, Flot-1, EpCAM and CD63. The results on exosome fractions prepared from one patient's plasma collected at each of the time points used in ARCADIA are shown (C) Electron micrographs of exosomes extracted from plasma from the same patient as in (B). Expression of each studied miR in the plasma exosome fraction (D), and exosome/plasma miR expression ratio (E) relative to pre-op levels. Results presented as mean + SEM. ** P < 0.01 vs. pre-op; Λρ < 0.05 and ΛΛρ < 0.01 vs. pre-CPB;†† p < 0.01 vs. 24 hours; repeated measures ANOVA with post hoc Tukey's test.
Figure 21 shows linear regression analyses. Linear regression of: A) relative expression of plasma concentration of individual miRs and cTn-I; B) exosome plasma concentration versus cardiac troponin I (cTn-I); C) each exosomal miR and plasma exosome concentration; D) relative expression of each exosomal miR and cTn-I. All time-points were included. The regression coefficients (β ± standard error) and P values are indicated in the plots.
Figure 22 shows the human PF is enriched with miRNAs of potential cardiovascular origin. Expression of selected miRNAs was measured by RT-qPCR in the PF and peripheral plasma prepared from the same patients. PF/plasma gradient was calculated by dividing the corresponding expression values; mir-122-5p was used as negative control. Exogenous spike-in cel-miR-39 was used as the normaliser. Unpaired two- tailed Student's t-test was applied. All values are mean ± s.e.m. * = P < 0.05; ** = P < 0.01; *** = P < 0.001; **** = P < 0.0001. n=5-9. Figure 23 shows the human PF contains exosomes carrying cardiovascular miRNAs. Expression of mature miRNAs were detected by RT-qPCR in exosomes isolated from 250μ1 of PF and plasma samples. Exogenous spike-in cel-miR-39 was used as normaliser. Unpaired two-tailed Student's t-test was applied. All values are mean ± s.e.m. n=5 * = P < 0.05; ** = P < 0.01; *** = P < 0.001; **** = P < 0.0001. Figure 24 shows PF exosomes contain Dicer and Ago-2. (a) Exosome/total PF ratios was calculated by dividing the corresponding relative expression value, (b) Western blot analysis of PF AG02 together with negative normal mouse IgG control and positive controls (ECs).(c) miRNAs expression of selected miRNAs by RNA- immunoprecipitation. n=5 (d) Representative western-blot images of AG02 protein incorporated in exosomes. (e) Expression of miRNAs associated to Ago2 immunoprecipitate from PF exosome samples. n=2 (f) Representative western-blot images of DICER protein incorporated in exosomes.
Figure 25 shows the angiogenic action of PF exosomes is partially mediated by let-7b- 5p. ECs were transfected with scramble siRNA (scramble) or Dicer siRNA (siRNA) for 24 hrs, followed by treatment with 10 μg/ml of PF derived exosomes (exosome) or 10μg/ml of PF derived exosomes transfected with let-7b-5p inhibitor (exosome let-7b- 5p KD) for an additional 24 hrs. Relative expression of (a) let-7b-5p and (b) TGFBR1 on ECs treated as previously describe, (c) Photomicrographs shown are the endothelial network formation on Matrigel (scale bar ΙΟΟμιη) while bar graphs show total length of tube-like structure of ECs transfected as previously indicated. Unpaired two-tailed Student's t-test or one-way ANOVA with Dunnett's post test was applied. All values are mean ± s.e.m. * = P < 0.05. n=4-6. (*) Indicates statistical difference between scramble and siRNA while (#) indicates statistical difference between control and siRNA
Example 1
MATERIALS AND METHODS
Clinical sample collection and processing
Studies complied with the ethical principles stated in the "Declaration of Helsinki" and were covered by an ethical approval allowing the use of cardiac surgery leftover samples for research purposes at the Bristol Royal Infirmary. We collected leftover samples from aortic valve replacement (AVR) surgery performed on cardiopulmonary-by-pass (CPB). The total PF volume was collected on initial opening of the pericardium in plain, sterile 50ml containers. Peripheral blood was collected from an arterial source in citrate-containing vacutainers (BD, Oxford, UK). Samples of TA and right atrium appendage (RAA) were collected and placed immediately in RNA Later™ stabilizing solution (Life Technologies) and stored at -20°C until processed. Blood and PF were processed immediately after collection, as follows. To obtain plasma, the citrate-containing vacutainers were centrifuged at 1500 g, 4°C for 15 minutes, and the supernatant removed. The supernatant underwent further centrifugation at 13500 g, room temperature (RT), for 5 minutes to deplete the sample of miRNA-rich platelets. After noting the volume of PF collected, the fluid was centrifugated at 13500 g, RT, 5 minutes to deplete the samples of cells. The final platelet-poor plasma, PF and tissue samples were stored at -80°C until required. RNA Extraction and Expressional Analyses by Taqman PCR
Total RNA was isolated using the miRNeasy from Qiagen (Valencia, CA), according to the manufacturer's instructions. For RNA extraction from solid tissues (TA, RAA), around 50mg of tissue was first homogenized in 1ml QIAzol (Qiagen) in a gentleMACS M tube using the gentleMACS dissociator (both from Miltenyi Biotech, Surrey, UK). For RNA extraction from PF and plasma, 200 μΐ of sample was used with 1ml QIAzol. A synthetic analogue of the non- human Caenorhabditis elegans microRNA-39 (cel-miR-39, Qiagen) was spiked-in (ΙΟμΙ of a 5ίπιο1/μ1 stock) to normalise for RNA extraction efficiency. In addition, for RNA extracted to be used for the miR array, a carrier RNA (MS2 RNA, Roche, West Sussex, UK) was added to increase the yield. RNA was stored at -80°C. For the miR array (below), total RNA was converted to cDNA using a reverse transcription kit (Universal cDNA Synthesis Kit, Exiqon, Woburn, MA). Reverse transcription for individual microRNAs was performed using the TaqMan miRNA Reverse Transcription Kit and miR-specific stem-loop primers (Life Technologies, Paisley, UK), and quantitative PCR (qPCR) was then performed using 2x Universal PCR Master Mix with No AmpErase UNG (Life Technologies, Paisley, UK). miR-specific stem-loop primers (Life Technologies, Paisley, UK) identification numbers were as follows: miR-l-3p 002222, miR-21-5p 000397, miR-21-3p 002438, miR-23a-3p 000399, miR-24-3p 000402, miR-27a-3p 000408, miR-27a-5p 002445, miR-29a-3p 002112, miR-29a-5p 002447, miR-29b 000413, miR-126-3p 002228, miR-126-5p 000451, miR-143-3p 002249, miR-144-3p 002676, miR-144-5p 002148, miR-199a-5p 000498, miR-374a-5p 000563, cel-miR- 39 000200, U6 snRNA 001973. Expression of each miR was normalised to either cel- miR-39 (for biological fluids) or the small nuclear U6 snRNA (for solid tissues). For miRs expression, each PCR reaction was performed in triplicate and analyzes were performed by either the 2-ddCt method or after obtaining relative miR abundance, using a standard curve built on serial dilutions of synthetic mature double- stranded miR templates (Ambion). miRs concentration ratios were calculated by dividing the miR relative expressions. miR array on human pericardial fluid
Three (unpooled) PF samples of the AVR surgical patients' groups were randomly selected to be run in a PCR-based miR array enabling to profile 752 human miRs (miRCURY LNA™ microRNA polymerase chain reaction (PCR) human panels I and II (version 3, Exiqon). The microRNA array plates were run using a LightCycler 480 (Roche). MiR array bioinformatic analyses
For the bioinformatics analyses the processing setting were as follows: 1) detection scoring was applied, miRs not detectable in all 3 samples or Ct > 37 in at least 2 patients of the AVR group were not considered for future calculation; 2) average of inter plate calibrator (UniSp3 IPC) was calculated for each run (representing one sample) and the median was subtracted to each miRs Ct; 3) expression for each miR was derived using the 2-ACT method. On the basis of these criteria, arrays data were inspected using the NormFinder algorithm to assess the variance in expression levels. The best normalizer was found to be the average of assays detected in all 3 AVR samples. Therefore, array data were normalized to the average of assays detected in all samples.
PF and plasma nanoparticle profiling NanoSight (Amesbury, UK) is an optical nanoparticle tracking system allowing for obtaining concentration and size distribution of the smallest EV populations. A laser beam is scattered by particles in the sample, and the mean velocity of each particle is calculated by the Stokes-Einstein equation on the basis of Brownian motion recorded by a CCD camera. In order to characterize the EVs present in the unfractioned PF and plasma, starting from 1 μΐ. of PF or plasma, a suitable concentration was determined and 1 mL of this sample was passed through the NanoSight flow cell. Once the temperature of the flow cell had stabilised at 25°C, six 30-second videos of each sample were taken with a high-resolution camera, with a 30 second pause between each. The videos were then processed by NanoSight Beta7 Nanoparticle Tracking Analysis software, version 2.3 (NanoSight), giving the concentration of particles per mL for each nanometre size. The data presented is an average of the 6 videos.
Exosomes enrichment from the PF and plasma
Exosomes were enriched from the PF and plasma by using ExoQuick kit (System Biosciences). Briefly, 250 μΕ of PF or plasma was centrifuged at 3,000 g for 15 minutes at 4°C to remove cells and cell debris. The supernatant was transferred to a fresh tube and 5μΙ. thrombin (500 U/mL) per 0.5 mL plasma or PF added to each sample, to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 minutes at RT. The supernatant was then filtered through a sterile a 0.22μπι filter (Merck Millipore, Cork, Ireland) into a fresh tube and 75 μΕ ExoQuick solution added. The samples were incubated for 30 minutes at 4°C, then centrifuged for 30 minutes at 1500 g and 4°C. The supernatant was removed, and following an additional centrifugation of the sample at 1500 g for 5 minutes at 4°C, the fluid was removed and the pellet re- suspended in ΙΟΟμΕ of sterile, nuclease-free water. At the end of the process, the presence of exosomes in the preparation has been confirmed by NanoSight tracking analysis (NTA) and electron microscopy {vide infra). Exosomes miRs were extracted using the miRNeasy from Qiagen. Briefly, 1ml of Qiazol was added to the pellet obtained after the second centrifugation and cel-miR-39 was spiked-in (ΙΟμΙ of a 5ίτηο1/μ1 stock) to normalise for RNA extraction efficiency and then the manufacture protocol was followed. The protein content was measured using MicroBCA protein assay (Thermo Scientific).
Electron Microscopy
Five μΐ. of the exosome preparation was placed on a copper grid and incubated for 15 minutes at RT. The grids were then transferred to 0.1% acetylated BSA (acBSA) (AURION, Wageningen, The Netherlands) in PBS for 10 minutes. They were then incubated on a 5 μΐ. drop of undiluted antibody for 1 hour in a darkened, humidified chamber at RT, followed by 3 washes in 0.1% PBS acBSA. This was followed by incubation of the grids in a 1 :20 solution of gold nanoparticles (AURION) (6nm or lOnm when two different antibodies used, or 6nm for single staining) for 30 minutes at RT. The grids were then incubated in a solution of 1.8% 25cP methylcellulose (Sigma Aldrich, Gillingham, UK) and 0.3% uranyl acetate (BDH, Poole, UK) for 10 minutes on ice. They were then removed using a loop and excess fluid removed using Whatman 1 filter paper. The grids were air dried for 30 minutes, then detached from the loop. Samples were analysed on a Tecnai T12 transmission electron microscope (FEI, Eindhoven, the Netherlands).
PF exosome incorporation by endothelial cells (ECs)
For exosome uptake experiments, PF-derived exosomes were labelled using Exo- Glow (Exo-Green and/or Exo-Red, System Biosciences) according to the manufacturer recommendation. ECs were seeded at density of 5xl04cells/well on a 24 wells plate coverslip and 20μg/mL of labelled PF-derived exosomes were added to target ECs in culture for 24 h at 37°C. Cells were washed twice with PBS and fixed with 4% buffered PFA (Sigma Aldrich, Gillingham, UK) in PBS for 20 min at RT. Exosome uptake into ECs was visualized by confocal microscopy.
Cell culture and cell biology
Human umbilical cord vein endothelial cells (HUVECs, Lonza, Slough, UK) were expanded by culture at 37 °C with 5% C02 in EBM-2 endothelial cell basal medium (Lonza) with addition of 10% FBS and SingleQuot Kit (EGM-2 medium, Lonza) as instructed. In hypoxia experiments, cells were exposed to hypoxia (<2% p02) (normoxia control: 21% p02). The treatment with PF-exosomes or PF-depleted exosomes was performed in EGM-2 medium using 10% exosome-depleted FBS (System Biosciences). In vitro angiogenesis
HUVECs were seeded in 6-well plates (2xl05/well) and treated with lC^g/ml of PF- exosomes or PF-depleted exosome for 24h in hypoxia (control: normoxia), then trypsinized and plated in a flat-bottomed 96-well plates (8xl03/well) coated with a growth factors-reduced Matrigel (Corning Incorporated, UK). Endothelial network formation was quantified at 6 h in randomly captured microscopic fields (magnification 5 x) by calculating the length of cellular network and by measuring the % of area covered by connected vascular-like structures.
Evaluation of apoptosis and BrdU incorporation assay in ECs
HUVECs were seeded in 96-well plates (5xl03/well) and treated 5, 10 and 20 μg/ml of PF-exosomes or PF-depleted exosome for 24h in hypoxia and normoxia. The medium was then replaced with a complete medium added with BrdU (10 μπ >1/1) for 24 hours. BrdU incorporation was measured by the BrdU ELISA assay kit (Roche). Caspase-3/7 activity was measured at 24 h using a luminescent cell death detection kit (Caspase-GLO assay, Promega, Southampton, UK).
In vivo experiments
The experiments involving mice were covered by project and personal licenses issued by the United Kingdome Home Office and they were performed in accordance with the Guide for the Care and Use of Laboratory Animals (the Institute of Laboratory Animal Resources, 1996). CD1 male mice underwent surgical induction of unilateral limb ischemia was obtained by occlusion of the left femoral artery. The following day, mice were injected with 100μg of exosomes derived from either the PF or the plasma. A control group received PBS. The superficial blood flow to both feet was measured using high resolution laser color Doppler imaging system (Moor LDI2, Moor Instruments, Devon, UK) at day 0 and days 7 after limb ischemia. Blood flow recovery was calculated (n = 20 mice/group) as a ratio of ischemic over contralateral foot blood flow. After the last Doppler analysis (at day 7 after surgery), mice were perfusion-fixed under terminal anesthesia and limb muscles were harvested for histological and immunohistochemical analyses. Histology
The functional impact of PF and plasma derived exosome on treatment in CD1- ischemic mice was assessed by measuring capillary in the adductor muscle. Isolectin B4 (Life Technologies) was used to detect endothelial cells, followed by staining with a red-conjugated rabbit polyclonal anti- a-smooth muscle actin (Sigma) used to stain smooth muscle cells (which are present in arterioles, but not in capillaries). Nuclei were stained with DAPI (4',6-diamidino-2-phenylindole). The slides were mounted using a mounting medium (Vector Labs, Peterborough, UK). The relative amount of positive cells was counted in 8 randomly selected high-power fields (magnification 20X) using Zeiss inverted fluorescent microscope. Analyses were performed using muscles from eight mice per group.
Statistical analysis
Continuous variables were compared between cases and controls by using Student t test and analysis of variance [ANOVA] using Prism 6 GraphPad v6. Results were considered statistically significant at P<0.05.
RESULTS
Table 1 shows a list of highly expressed miRs in PF of aortic valve replacement (AVR) patients and also in PF of different cardiac surgery cases including mitral valve replacement (MVR), coronary artery bypass graft (CABG) and AVRCABG.
Table 1
AVR MVR CABG AVRCABG hsa-mi -302c-3p hsa~niiR-29b-3p hsa-miR-509-3-5p hsa-mi R-29b-3p
hsa-miR-199b-5p hsa-mi -144-Sp hsa-miR-126-5p hsa-let-7g-5p hsa-miR-374a-5p hsa-miR-199a-5p hsa-miR-199a-5p hsa-miR-532-5p hsa-miR-126-5p hsa-miR-27a-5p hsa-miR-513c-5p hsa-miR-421 hsa-miR-144-3p hsa-miR-374a-5p hsa-miR-214-5p hsa-miR-339-5p hsa-miR-150-5p hsa-miR-181c-5p hsa-miR-125-3p hsa-miR-376c-3p hsa-miR-409-3p sa :sR-29a-Sp hsa-miR-514a-3p hsa-miR-22-5p hsa--niR- 2e-3p hsa-miR-126-5p hsa-miR-21-3p hsa-miR-199a-5p hsa-miR-29a-5p hsa-miR-16-2-3p hsa-let-7g-3p hsa-miR-485-3p hsa-miR-363-3p hsa-miR-214-5p hsa-miR-508-3p hsa-miR-215 hsa-miR-27a-5p hsa-miR-223-5p hsa-miR-509-3p hsa-miR-205-5p hsa-miR-142-3p hsa-miR-221-5p hsa-miR-374a-5p hsa-miR-19a-3p hsa-miR-26a-5p hsa-miR-1271-5p hsa-miR-513b hsa-miR-627 hsa-miR-27a-3p hsa-miR-30a-3p hsa-miR-33a-5p hsa-miR-299-5p hsa-miR-196b-5p hsa-miR-320b hsa-miR-29a-5p hsa-miR-326 hsa-miR-18a-5p hsa-let-7a-3p hsa-miR-340-5p hsa-miR-296-5p hsa-miR-155-5p hsa-miR-21-3p hsa-miR-21-5p hsa-miR-361-3p hsa-miR-199a-5p hsa-miR-663a hsa-miR-30b-5p hsa-let-7b-5p hsa-miR-708-5p hsa-miR-340-5p hsa-miR-17-3p hsa-miR-140-3p hsa-miR-194-5p hsa-miR-451a hsa-miR-193a-3p hsa-miR-22-3p hsa-miR-942 hsa-miR-504 hsa-miR-145-3p hsa-miR-582-5p hsa-miR-451a hsa-miR-200a-5p hsa-miR-769-5p hsa-miR-33b-5p hsa-miR-514a-3p hsa-miR-196b-5p hsa-miR-488-3p hsa-miR-1227-3p hsa-miR-340-5p hsa-miR-103a-3p hsa-miR-31-5p hsa-miR-505-3p hsa-miR-101-3p hsa-miR-24-l-5p hsa-miR-199a-3p hsa-miR-92a-3p hsa-miR-26b-5p hsa-miR-29a-3p hsa-let-7a-3p hsa-miR-887 hsa-miR-192-5p hsa-let-7f-2-3p hsa-miR-196b-5p hsa-miR-423-3p hsa-miR-218-5p hsa-mi -942 hsa-miR-142-3p hsa-miR-125a-5p hsa-miR-7-l-3p hsa-miR-514a-3p hsa-miR-363-3p hsa-miR-107 hsa-miR-454-3p
Human cardiovascular expression of the top expressed miRs in PF was validated using ascending thoracic aorta (n=8) and atrium (n=4) samples from AVR patients (see Figure 1). The presence of "miR*" forms was noted in the array. miR-122 was used as a control because this miR is produced by liver cells and not cardiovascular cells. Figure 2 shows miR*/miR ratios in PF compared to the ascending aortic and atrium samples.
Figures 3 and 4 show the relative concentrations of miRs in PF and plasma. Left axis: relative (to Cel-39 spike in normaliser) expression of each miR in PF and plasma. Right axis: PF/plasma ratio of the concentration for each miR. As can be seen from the figures, most of cardiac expressed miRs are more concentrated in PF and hence PF is better source to measure them when looking at biomarkers of cardiac conditions. We have provided the first report that extracellular vesicles (EVs) are present in PF (see Figure 5). While less expressed than in plasma, but EVs are present in PF and have potential roles as biomarkers and for therapeutics.
EVs from PF can be enriched. NanoSight and electron microscopy data from the these enriched preparations of EVs is shown in Figure 6.
The miRs of Figures 3 and 4 were measured again in exosomes from PF (n=10) and plasma (n=7) and were found to be present (see Figure 7). This means that the miRs are released in the PF inside exosomes. This implies that PF exosome function could be in part mediated by miRs.
The PF/plasma gradients in miRs are still present when we measure miRs in exosome extracted from PF and plasma (see Figure 8). This suggests that not all the exosomes are equivalent and hence the use of unmodified easily accessible plasma exosomes cannot replace the use of PF-exosomes.
Exosomes can be uptaken by cardiac cells: here endothelial cells (Figure 9a) and stem-cell derived cardiomyocytes (Figure 9b). Exosomes were incubated for 24 hours and washed away. Only exosomes uptaken by cells are evident in the confocal microscopy. This shows that exosomes from human PF have the potential of being used in living cells to transfer their cargos and elicit cellular responses. PF-exosomes improve the capacity of endothelial cells (hypoxic HUVECs) to proliferate (which is conductive for angiogenesis in ischaemic tissues) (see Figure 10).
We have shown that PF-exosomes improve blood perfusion (Figure 11a) after ischemia and increase angiogenesis (assessed as increased number of capillaries in the ischaemic muscles) (Figure 1 lb). Toe survival (Figure 11c) and superficial blood-flow to the foot were also improved (Figure l id). Plasma-exosomes do not reproduce these effects.
Example 2
MATERIALS AND METHODS
Clinical Studies
COPTIC (Coagulation and Platelet Function Testing in Cardiac Surgery) is a registered (ISRCTN20778544) NIHR-funded single-centre observational study which has recruited 2,427 patients undergoing cardiac surgery at the Bristol Heart Institute. It has collected citrate plasma (from the arterial blood line) before (prior to chest opening) and on completion of surgery (before chest closure). The former sample (pre-op sample) is taken before heparin administration and the latter (post-op sample) within 30 minutes of reversal of heparin anticoagulation by protamine sulfate, which is important given that heparin has been suggested to create artefacts in miR analyses. Prospectively collected clinical data are also available for these patients, including in- hospital morbidity. COPTIC includes 1,370 patients who underwent CABG as the only procedure. We have amended the research protocol to perform the additional analyses necessary for this study. This study has used matched pre-op and post-op citrate plasma samples (banked at 80°C) from non-diabetic patients (n=40) undergoing conventional CABG with CPB and cardioplegic arrest (on-pump) or on the beating heart (off-pump). The miR and exosomes study has been performed in two sets of experiments (COPTIC- 1 one and COPTIC-2), each of them including equal numbers of on-pump and off-pump CABG cases.
ARCADIA (Association of non-coding RNAs with Coronary Artery Disease and type 2 Diabetes) (REC 13/LO/1687) is an National Institute of Health Research (NIHR) portfolio study developed at the Bristol Heart Institute, University Hospital Bristol NHS Foundation Trust and London Hammersmith Hospital, Imperial College Healthcare NHS Trust. ARCADIA has been specifically designed to carry out non- coding RNA (ncRNA) in patients with a LV ejection fraction (LVEF) >40% undergoing first time CABG using CPB and cold blood cardioplegic arrest and control groups. Blood samples are taken at 4 times: 1) in the anaesthetic room (before heparin administration); 2) during surgery before and after establishment of CPB; 3) at 24h and, 4) 48h after the operation. This study has used anonymized citrate plasma samples from non-diabetic CABG patients (n=6 cases) that have been previously banked at -80°C.
Extracellular vesicles analyses
Plasma samples were analysed for EV content by using a nanoparticle tracking system NanoSight. To perform this analysis, from each sample, lul of diluted plasma is sufficient. Noteworthy, this volume is dramatically less than what required for cTn analyses. NanoSight passes a laser beam through a fluid sample and tracks the speed of individual particles. This is done by tracking the distance travelled by each particle over a set time to calculate its speed under Brownian motion. As larger particles travel slower than smaller ones under Brownian motion, the NanoSight is able to compute the size of each of the nanoparticles in the sample. The software provides information on the number of particles at each given size, from 0 to ~450nm, and plots a histogram demonstrating the number of particles of each size. The plasma concentration of exosomes (identified as the particles between 30 and 100 nm particles) per mL of plasma were quantified. In the COPTIC- 1, average particle distributions by size were also analysed.
Exosome extraction from plasma samples
Using a column-based system, Exo-spin Mini-Columns (CELL guidance systems), exosomes were enriched from the ARCADIA plasma. Briefly, 100 μΐ. of plasma prepared as described above, was further centrifuged at 20,000 g for 30 minutes at 4°C to remove any remaining cell debris. The supernatant was transferred to a fresh tube and 5μΙ. thrombin (500 U/mL) per 0.5 mL plasma was added to each sample, to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 minutes at RT. The supernatant was then filtered through a sterile a 0.22μπι filter (Merck Millipore, Cork, Ireland) into a fresh tube. A volume οίΊΟΟμΙ of exosome-containing sample were applied to the top of the column and centrifuge at 50 g for 60 seconds. After discarding the elute, 200μ1 of PBS was applied to the top of the column, the sample was centrifuge at 50 g for 60 seconds and the elute contains purified exosomes was stored at -20°C until required. The quality of the preparations was preliminary assessed using NanoSight. The exosomes preparation protein content was measured using MicroBCA protein assay (Thermo Scientific). For miR analyses in exosomes, exosomes miRs were extracted using the miRNeasy from Qiagen (Valencia, CA). Briefly, ImL of Qiazol was added at the exosomes preparation and a synthetic analogue of the non-human Caenorhabditis elegans microRNA-39 (cel-miR-39, Qiagen) was spiked-in (ΙΟμΙ. of a 5βηο1/μΕ stock) to normalise for RNA extraction efficiency 19 and then the manufacture protocol was followed.
MicroRNA analyses
A selection of miRs known to be enriched in the myocardium and/or regulated by ischemia and of miR controls (see Table 2) were measured in the total plasma (both COPTIC and ARCADIA) and in exosomes preparation enriched from the ARCADIA plasma samples. The latter could not be done in COPTIC given the insufficient remaining volume of banked samples. Total RNA was isolated using the miRNeasy from Qiagen according to the manufacturer's instructions. For RNA extraction from plasma, 200 μΐ of sample was used with lmL QIAzol. Cel-miR-39 was spiked-in (ΙΟμΙ of a 5ήηο1/μ1 stock) to normalise for RNA extraction efficiency. Reverse transcription for each individual miR was performed using the TaqMan miRNA Reverse Transcription Kit and miR-specific stem-loop primers (Life Technologies, Paisley, UK), and quantitative PCR (qPCR) was then performed using 2x Universal PCR Master Mix with No AmpErase UNG (Life Technologies, Paisley, UK). MiR- specific stem-loop primers (Life Technologies, Paisley, UK) identification numbers are presented in Table 2. Expression of each miR was normalised to cel-miR-39. Each PCR reaction was performed in triplicate and data were calculated using the 2-ddCt method.
Table 2: miRs known to be enriched in the myocardium and/or regulated by ischemia and miR controls
Figure imgf000031_0001
SUBSTITUTE SHEET RULE 26 hsa-miR- 002245 Y Up- UGGAGUGU 5'- 122-5p regulated in GACAAUGG CCUUAGCAGAGCUGU
Angina UGUUUG GGAGUGUGACAAUG patients. GUGUUUGUGUCUAA
ACUAUCAAACGCCAU UAUCACACUAAAUAG CUACUGCUAGGC-3' hsa-miR- 000451 Y Role in UCGUACCG 5'- 126-3p neoangiogen UGAGUAAU CGGCCCAUUAUUACU esis and AAUGC UUUGGUACGCGCUA cardiac UGCCACUCUCAACUC repair in GUACCGUGAGUAAU ischemic AAUGC-3' myocardium hsa-miR- 002246 Y Y Myocardial UUUGGUCC 5'- 133a-3p infarction, CCUUCAACC ACAAUGCUUUGCUA cardiac AGCUG GAGCUGGUAAAAUG developmen GAACCAAAUCGCCUC t. UUCAAUGGAUUUGG
UCCCCUUCAACCAGC UGUAGCUAUGCAUU GA-3'
has-mir- 002247 Y Y Repair in UUUGGUCC 5'- 133b ischemic CCUUCAACC UUGAUUGGACAAGG myocardium AGCUA UAUGCUAUGACGGAC
AUUUACAUACCUGG
UUGUAGUCGAACCAA
AUUGUUAUAUUUUU
AAAAUCAAUUGGUCC
CCUUCAACCAGCUAU
GUUUCUCCUCCUGUA
AACAUCUAGUUAA-3' hsa-miR- 000511 Y Myocardial AUAAGACG 5'- 208a-3p infarction. AGCAAAAAG UGACGGGCGAGCUU
CUUGU UUGGCCCGGGUUAU
ACCUGAUGCUCACGU
AUAAGACGAGCAAA
AAGCUUGUUGGUCA-
3'
hsa-miR- 002290 Y Myocardial AUAAGACG 5'- 208b-3p damage. AACAAAAGG CCUCUCAGGGAAGCU
UUUGU UUUUGCUCGAAUUA
UGUUUCUGAUCCGA
AUAUAAGACGAACA
AAAGGUUUGUCUGA
GGGCAG-3'
SUBSTITUTE SHEET RULE 26 hsa-miR- 000512 Y Y Elevated CUGUGCGU 5'- 210-3p during GUGACAGC ACCCGGCAGUGCCUC hypoxic GGCUGA CAGGCGCAGGGCAGC conditions, CCCUGCCCACCGCACA novel CUGCGCUGCCCCAGA therapeutic CCCACUGUGCGUGU approach for GACAGCGGCUGAUC treatment of UGUGCCUGGGCAGC ischemic GCGACCC-3' heart
disease.
hsa-miR- 002295 Y Role in UGUCAGUU 5'- 223-3p angiogenesis UGUCAAAU CCUGGCCUCCUGCAG of ischemic ACCCCA UGCCACGCUCCGUGU cardiac AUUUGACAAGCUGA microvascul GUUGGACACUCCAUG ar. UGGUAGAGUGUCAG
UUUGUCAAAUACCCC
AAGUGCGGCACAUGC
UUACCAG-3' hsa-miR-451 001141 Y Down- AAACCGUUA 5'- regulated in CCAUUACU CUUGGGAAUGGCAA hypertrophic GAGUU GGAAACCGUUACCAU cardiomyop UACUGAGUUUAGUA athy (HCM). AUGGUAAUGGUUCU Elevated CUUGCUAUACCCAGA Coronary -3'
artery
disease.
hsa-miR- 002365 Y UGAAACAU 5'- 494-3p ACACGGGAA GAUACUCGAAGGAGA
ACCUC GGUUGUCCGUGUUG
UCUUCUCUUUAUUU
AUGAUGAAACAUAC
ACGGGAAACCUCUU
UUUUAGUAUC-3' hsa-miR- 001352 Y Myocardial UUAAGACU 5'- 499a-5p damage, UGCAGUGA GCCCUGUCCCCUGUG
Myocardial UGUUU CCUUGGGCGGGCGGC infarction. UGUUAAGACUUGCA
GUGAUGUUUAACUC
CUCUCCACGUGAACA UCACAGCAAGUCUGU GCUGCUUCCCGUCCC UACGCUGCCUGGGCA GGGU-3'
SUBSTITUTE SHEET RULE 26 hsa-miR- 002427 Y Myocardial AACAUCACA 5'- 499a-3p damage. GCAAGUCU GCCCUGUCCCCUGUG
GUGCU CCUUGGGCGGGCGGC UGUUAAGACUUGCA GUGAUGUUUAACUC
CUCUCCACGUGAACA UCACAGCAAGUCUGU GCUGCUUCCCGUCCC UACGCUGCCUGGGCA GGGU-3' cel-miR-39- 000200 Y Y UCACCGGG 5'- 3p UGUAAAUC UAUACCGAGAGCCCA
AGCUUG GCUGAUUUCGUCUU
GGUAAUAAGCUCGUC
AUUGAGAUUAUCACC
GGGUGUAAAUCAGC
UUGGCUCUGGUGUC-
3'
Troponins analyses
Cardiac troponin I and T (cTnl and cTnT) were measured in the all the ARCADIA samples.
RESULTS
CABG surgery is associated with a rapid increase in cardiac miRs in the peripheral plasma, which is more pronounced in on-pump cases.
As shown in Figure 12, analyses on COPTIC- 1 samples showed that a set of miRs that are cardiac enriched and/or influenced by ischemia increased significantly immediately after CABG. COPTIC-2 reported similar data and allowed to appreciate that some of these changes in miR concentration (miR-1 and miR-133a) were more pronounced in patients receiving on-pump surgery (Figure 13). This suggests that the myocardium might release subsets of miRs in response to CABG surgery and that the magnitude of this response depends on the level of "damage" induced by the operation.
CABG surgery is associated with a rapid increase in exosomes in the peripheral plasma, which is more pronounced in on-pump cases
As shown in Figure 14, analyses on COPTIC- 1 samples already employed for miR analyses showed an increase in plasma circulating particle of the size of exosomes
SUBSTITUTE SHEET RULE 26 immediately after completion of surgery. There were no differences in exosome concentration between pre-operation plasma samples and plasma samples from healthy volunteers. COPTIC-2 allowed us to investigate whether on-pump surgery with CPB and cardioplegic arrest, which submits the myocardium to ischemia and reperfusion, is associated with a higher post-operation rise of exosomes in the peripheral blood, thus supporting the concept that exosomes can be novel biomarkers of the myocardial response to ischemia and reperfusion.
Time course of circulating exosome changes in patients receiving on-pump CABG surgery
The COPTIC exosome analyses were integrated by ARCADIA, which collected blood at additional time points around surgery. As shown in Figure 15, the increase in plasma exosome concentration induced in on-pump patients was not present before the patients was put on CPB and it was time-dependent.
Example 3
MATERIALS AND METHODS
Clinical Studies
The clinical studies were approved by UK National Health Service research ethics committees and were conducted in accordance with the principles of the International Conference on Harmonisation-Good Clinical Practice under the oversight of University Hospitals Bristol National Health Service Foundation Trust (COPTIC) and the Imperial College Health Service Foundation Trust (ARCADIA). All patients provided written informed consent.
COPTIC {Coagulation and Platelet Function Testing in Cardiac Surgery), a registered (ISRCTN20778544) UK National Institute of Health Research (NIHR)- funded single-centre prospective observational study, recruited 2,427 patients undergoing cardiac surgery at the Bristol Heart Institute. It has collected citrate plasma (from the arterial blood line) before (prior to chest opening) and on completion of surgery (before chest closure). The former sample (pre-operation: pre-op) is taken before heparin administration and the latter (post-operation: post-op) within 30 minutes of reversal of heparin anticoagulation by protamine sulfate, when the patient is still in the operating theatre. The COPTIC research protocol was amended and ethically approved to perform microRNA (miR) and exosome analyses. In this study, we have used pre-op and post-op samples (banked at a temperature of between -70°C and -80°C) from a subgroups of male non-diabetic patients (n=15), aged less than 75 years undergoing coronary artery bypass graft (CABG) surgery using cardiopulmonary bypass (CPB). See Table 3 for patients' characteristics.
Table 3: Characteristics of the COPTIC- coronary artery bypass graft (CABG) patients used in the study
Characteristic Total n=15
Age (years; median, IQR) 67.8 (63.2, 71.6)
Sex (males; n, %) 15/15 100%
Previous M l (n, %) 10/15 67%
Hypertension (n, %) 13/15 87%
Diabetes (n, %) 0/15 0% eGFR (median, IQR) 79.9 (66.5, 108.3)
BM I (kg/m2; median, IQR) 26.3 (24.3, 28.4)
* Euroscore (median, IQR) 3.5 (2.0, 5.0)
NYHA class (n, %) Class 1 7/15 47%
Class 2 6/15 40%
Class 3 2/15 13%
CCS class (n, %) Class 0 2/15 13%
Class 1 4/15 27%
Class 2 5/15 33%
Class 3 0/15 0%
Class 4 4/15 27%
Operative priority (n, %) elective 8/15 53%
urgent 7/15 47%
CPB time (minutes; median, IQR) 70 (50, 93)
Cross-clamp time (minutes; median, IQR) 39 (30, 48)
Number of grafts (n, %) 2 6/15 40.0% 3 7/15 46.7%
4 2/15 13.3%
In-hospital mortality 0/15 0.0%
* Logistic Euroscore is missing for 1 patient
ARCADIA {Association of non-coding RNAs with Coronary Artery Disease and type 2 Diabetes) (REC 13/LO/1687) is a prospective observational study conducted at the Bristol Heart Institute and at the London Hammersmith Hospital. ARCADIA has been specifically designed to carry out analyses of non-coding RNAs (ncRNA), including miRs and extracellular vesicles (EVs), including exosomes, in patients undergoing first time CABG using CPB and cold blood cardioplegic arrest. Blood samples are taken at 4 time points: 1) in the anaesthetic room; 2) during surgery before establishment of CPB, and at 3) 24h and 4) 48h after the end of the operation. For this study, we used anonymized citrate plasma (for miR and exosome analyses) and serum (for hs-cTn-I) samples from 6 male non-diabetic CABG patients previously stored at - 80°C. See Table 4 for patients' characteristics.
Table 4: Characteristics of the ARCADIA- coronary artery bypass graft (CABG) patients used in the study
Characteristic Total n=6
Age (years; median, IQR) 67.5 (63.0, 74.0)
Sex (males; n, %) 6/6 100%
Previous M l (n, %) 3/6 50%
Hypertension (n, %) 5/6 83%
Diabetes (n, %) 0/6 0% eGFR (median, IQR) 81 (75, 90)
BM I (kg/m2; median, IQR) 28.2 (26.8, 30.4)
Logistic Euroscore (median, IQR) 2.5 (1.5, 4.0)
NYHA class (n, %) Class 1 5/6 83%
Class 2 1/6 17%
CCS class (n, %) Class 0 2/6 33% Class 1 2/6 33%
Class 2 1/6 17%
Class 3 1/6 17%
Class 4 0/6 0%
Operative priority (n, %) Elective 1/6 17%
Urgent 5/6 83%
CPB time (minutes; median, IQR) 76.5 (69, 90)
Cross-clamp time (minutes; median, IQR) 44 (37, 61)
Number of grafts (n, %) 2 2/6 33%
3 3/6 50%
4 1/6 17% ln-hospital mortality (n, %) 0/6 0%
Methods Overview
The plasma exosome concentration was analysed using a Nanoparticle Tracking Analysis (NTA) machine (NanoSight). The plasma concentration of particles of a size (30 to lOOnm) typical of exosomes was determined together with the particle distribution by size.
Using a column-based system, exosomes were enriched from the ARCADIA patients' plasma.
Table 5 presents the individual miRs measured (RT-PCR) in plasma and plasma exosomes, with PCR primers and reasons for their inclusion in this study.
Table 5: List of microRNAs (miR) measured in the present study in the COPTIC and ARCADIA cohorts, with miR sequences and reasons for inclusion in the study.
microRNA Reasons for COPTIC ARCADIA Stem-loop Sequence Catalogue number
Base ID inclusion (plasma ) (plasma (5'-3'), including the (Life technologies Ltd) and mature form
exosome) sequence (in bold)
hsa-miR-1- Enriched in Y Y 5'- 002222
3p muscles; UGGGAAACAUACUUC
Increased in UU
peripheral UAUAUGCCCAUAUGG
blood after Ml, ACCUGCUAAGCUAUG
open heart GAAUGUAAAGAAGU
surgery and AUGUAUCUCA-3'
trans-coronary
ablation of
SUBSTITUTE SHEET RULE 26 septal
hypertrophy.
hsa-miR- Control: 5'- 000399 23a-3p Supposedly GGCCGGCUGGGGUUC
stable CU
expressed in GGGGAUGGGAUUUG
plasma. CUUCCUGUCACAAAU
CACAUUGCCAGGGAU UUCCAACCGACC-3'
hsa-miR- Expressed in V 000402 24-3p the mouse CUCCGGUGCCUACUG
myocardium, AGC
where it is UGAUAUCAGUUCUCA
increased after UUUUACACACUGGCU
a Ml, but it is CAGUUCAGCAGGAAC
reduced by Ml AGGAG-3'
in cardiac
myocytes,
suggesting their
extracellular
release of miR- 24.
hsa-miR Expressed in 5'- 000431 92a-3p the vasculature CUUUCUACACAGGUU
and in GGG
increased by AUCGGUUGCAAUGCU
ischemia in the GUGUUUCUGUAUGG
mouse and pig UAUUGCACUUGUCCC
ischemic heart. GGCCUGUUGAGUUU
GG-3'
hsa-miR- Control: 5'- 002245 122-5p Highly enriched CCUUAGCAGAGCUGU
in liver and GGA
supposedly not GUGUGACAAUGGUG
expressed in UUUGUGUCUAAACUA
the heart UCAAACGCCAUUAUC
ACACUAAAUAGCUAC
UGCUAGGC-3'
hsa-miR- Expressed by 5'- 000451 126-3p endothelial cells CGGCCCAUUAUUACU
and platelets. UUU
GGUACGCGCUAUGCC ACUCUCAACUCGUAC CGUGAGUAAUAAUGC
-3'
hsa-miR- Enriched in 5'- 002246 133a-3p muscles and ACAAUGCUUUGCUAG
increased in the AGC
blood of UGGUAAAAUGGAACC
patients with AAAUCGCCUCUUCAA
myocardial UGGAUUUGGUCCCCU
infarction and UCAACCAGCUGUAGC
transcoronary UAUGCAUUGA-3'
ablation of
septal
hypertrophy.
hsa-miR Enriched in 5'- 002247 133b muscles and UUGAUUGGACAAGGU
increased in the AUGCUAUGACGGACA
blood of UUUACAUACCUGGUU
patients with GUAGUCGAACCAAAU
myocardial UGUUAUAUUUUUAA
infarct. AAUCAAUUGGUCCCC
UUCAACCAGCUAUGU
UUCUCCUCCUGUAAA
CAUCUAGUUAA-3'
hsa-miR- Enriched in 5'- 000511 208a-3p cardiac UGACGGGCGAGCUUU
SUBSTITUTE SHEET RULE 26 myocytes; UGG
Increased in the CCCGGGUUAUACCUG
blood of AUGCUCACGUAUAAG
patients with ACGAGCAAAAAGCUU
either a GUUGGUCA-3'
myocardial
infarct or
receiving trans- coronary
ablation of
septal
hypertrophy.
hsa-miR- Enriched in 5'- 002290
208b-3p cardiac CCUCUCAGGGAAGCU
myocytes; It UUU
increases in the UGCUCGAAUUAUGUU
blood of UCUGAUCCGAAUAUA
patients with a AGACGAACAAAAGGU
myocardial UUGUCUGAGGGCAG- infarct. 3'
hsa-miR- "Hypoxia 5'- 000512
210-3p microRNA": ACCCGGCAGUGCCUCC
It increases AGGCGCAGGGCAGCC
under hypoxic CCUGCCCACCGCACAC
condition, UGCGCUGCCCCAGACC
including in CACUGUGCGUGUGAC
cardiac AGCGGCUGAUCUGUG
myocytes. It is CCUGGGCAGCGCGAC
expressed in CC-3'
the heart.
hsa-miR- Expressed in 5'- 002295
223-3p platelets; it CCUGGCCUCCUGCAG
increases in the UGCCACGCUCCGUGU
blood following AUUUGACAAGCUGAG
platelets UUGGACACUCCAUGU
activation. GGUAGAGUGUCAGU
UUGUCAAAUACCCCA
AGUGCGGCACAUGCU
UACCAG-3'
hsa-miR- Control: Y 5'- 001141
451 measured as a CUUGGGAAUGGCAAG
quality control GAA
against ACCGUUACCAUUACU
haemolysis GAGUUUAGUAAUGG
since it is UAAUGGUUCUCUUGC
enriched in red UAUACCCAGA-3'
blood cells.
cel-miR- Control: Y Y 5'- 000200
39-3p Spike in control UAUACCGAGAGCCCA
used to GCU
normalize has- GAUUUCGUCUUGGUA
miRs AUAAGCUCGUCAUUG
expressional AGAUUAUCACCGGGU
data. GUAAAUCAGCUUGGC
UCUGGUGUC-3'
Hs-cTn-I was measured in serial ARCADIA serum samples (ARCHITECT STAT, Abbott). The COPTIC samples were analysed with a non-hs cTn-I ELISA (Sigma) since the available hs-cTn-1 assay (and of other hs-cTn assays) is unsuitable for citrate plasma samples.
SUBSTITUTE SHEET RULE 26 Statistical analyses
For the COPTIC samples, regression analysis was used to investigate differences between pre- and post-cardiac surgery levels of extracellular miRs and exosomes. Results are illustrated graphically as scatter plots on a log scale with pre-surgery against post-surgery levels for either each miR or exosome concentration. Summary statistics are presented as mean difference, standard error (SE) and confidence interval for both pre- and post-surgery levels. For the ARCADIA samples, comparisons over each of the four time points were performed using repeated measures ANOVA with the post hoc Tukey's test. Data are presented as the mean ± standard error of the mean (SEM). Comparisons between individual miR expression levels, exosome concentrations and loge hs-cTn-I concentrations were made using simple linear regression, with the regression coefficient (± SE) reported in each case to indicate the predictive power of the explanatory variable. Significance levels were determined using the F test, and data from all time points were analysed simultaneously. Statistical analyses were performed using STATA (vl3, STATA Corp., TX, USA) and Prism (v6, GraphPad Software, CA, USA). The level of significance was taken as p<0.05.
Detailed Methods
Exosome analyses
The plasma exosome concentration was analysed using a Nanoparticle Tracking Analysis (NTA) system (NanoSight, Amesbury, UK). One μΙ_, of neat plasma was diluted with ultra-clean, sterile water to obtain a concentration of particles suitable to be read on the machine in a lmL sample, according to the manufacturer's guidelines. This was then passed through a flow cell at a constant flow rate using a syringe driver, where a laser beam was shone through the stream of particles. Once the temperature of the flow cell had stabilised at 25°C, 6 individual videos of 30 sec duration were recorded consecutively, with a 5 sec delay in between each. These videos were then processed using the NTA software, which uses the Stokes-Einstein Equation to determine the size of the particles from their Brownian motion. The data were elaborated to be presented as the average of these 6 videos taken in one run. The equipment used determines the size of the particles in the solution up to around 1-2μπι and a histogram of the concentration of particles per mL for each nanometre size can be plotted with the resulting data. Taking exosomes as those particles within the size range of 30-100nm, their concentration in the plasma was determined. In the ARCADIA sample set, the average particle distribution by size was also determined. Exosome enrichment from plasma samples and western blot analyses
Using a column-based system, Exo-spin Mini-Columns (Cell Guidance Systems, Cambridge, UK), exosomes were enriched from the ARCADIA patients' plasma. Briefly, 100 μΙ_, of plasma prepared as described above was further centrifuged at 17,000 g for 30 min at 4°C to remove any remaining cell debris. The supernatant was transferred to a fresh tube and 5μΙ. thrombin (500 U/mL) per 0.5 mL plasma was added to each sample, to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 min at RT. The supernatant was then passed through a sterile a 0.22μπι filter (Merck Millipore, Cork, Ireland) into a fresh tube. A sample volume of ΙΟΟμΙ. was applied to the top of the column and centrifuged at 500 g for 60 sec. After discarding the elute, 200μΙ. of PBS was applied to the top of the column, the sample was centrifuge at 500 g for 60 seconds and the elute containing purified exosomes was stored at -20°C until required.
Exosomes from Patient 6 of the ARCADIA cohort were extracted using the ExoSpin columns as described above. Negative staining and TEM was carried out using an adapted, previously described protocol. Briefly, 3 μΙ_, of the exosome preparation was incubated on a Pioloform carbon-coated grid at RT for 10 minutes. The grid was then washed on a droplet of distilled water for 10 minutes. Finally, the grid was incubated in a solution of 1.8% methylcellulose and 0.3% uranyl acetate for 5 minutes on ice. The grid was then removed with a loop, the excess liquid drained off using a Whatman 1 filter and allowed to air dry. The grids were imaged using a Tecnail2 120 kV BioTwin Spirit transmission electron microscope (FEI Company, Eindhoven, Netherlands) equipped with a bottom-mounted Eagle CCD camera (FEI).
Western blot analyses for exosome markers were performed on the plasma exosomal fractions extracted as above. Exosome preparations were lysed with RIPA buffer (Santa Cruz Biotechnology) with added protease inhibitor cocktail. Samples were centrifuged at 14,000 g for 15 min at 4°C and the supernatant fractions were used for Western blot. The protein content was measured using MicroBCA protein assay (Thermo Scientific, Hemel Hempstead, UK). Primary and secondary western blot antibodies are shown in Table 6.
Table 6: Western Blot antibodies.
Antibody Supplier Size host Antibody Cat Dilution
(kDa) Number
Flotillin-1 BD 48 Mouse Primary A610820 1 : 1,000
Monoclonal
CD63 Abeam 26 Mouse Primary ab59479 1 : 1,000
Monoclonal
ECL GE Sheep Secondary NA931 1 :2,000
Mouse Healthcare
IgG
MicroRNA analyses All the miRs measured in COPTIC and ARCADIA, together with their sequences, reasons for inclusion in the analyses and the miR assay codes are summarized in Table 5. In the COPTIC plasma samples, we measured a selection of miRs known to be enriched in the myocardium (miR-1, miR- 133a, miR- 133b, miR-208a, miR-208b) and regulated by ischemia in cardiovascular cells and/or patients with an acute myocardial infarction (miR-1, miR-24, miR-92a, miR- 126, miR-133a, miR-133b, miR-208a, miR-208b, miR-210) (see in Table 5). MiR-451 was measured as a quality control against haemolysis since it is enriched in red blood cells and miR-23a because it is supposedly stably expressed in plasma. Moreover, miR-233 was measured because it is enriched in platelets, its circulating level are correlated with platelet reactivity index in patients requiring revascularization for coronary artery disease and there is a platelet response to cardiac surgery. We did not measure exosomal miRs in COPTIC due to the low volume of available plasma making it insufficient to prepare exosome fractions suitable for miR analyses. In ARCADIA, a selection of the aforementioned miRs (miR-1, miR-24, miR-133a, miR-133b, miR-210) together with the negative control (for cardiac expression) liver-specific-miR-122 were measured both in whole plasma and its exosomal fraction. In preparation for PCR analyses, RNA was isolated using the miRNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. For RNA extraction from plasma, 200 μΐ. of exosome sample was used with lmL QIAzol. Cel-miR-39 was spiked-in (ΙΟμΙ of a 5fmol^L stock) to normalize for RNA extraction efficiency. In ARCADIA (where the second time point was collected in heparinized patients), all the RNA samples were treated with heparinase-I (2 U/ μΐ- Sigma- Aldrich, catalogue number: H2519). Table 7 provides evidence that this treatment does not affect PCR analyses in plasma derived from non-heparinized subject, while it can "resuscitate" miR detection by PCR in plasma contaminated with heparin(30). All COPTIC and ARCADIA samples were treated with RNase inhibitor (50 U/ μΐ). The reverse transcription reaction for each individual miR was performed using the TaqMan miR Reverse Transcription Kit and miR-specific stem-loop primers (Life Technologies, Paisley, UK), and quantitative PCR (qPCR) was then performed using 2x Universal PCR Master Mix with No AmpErase UNG (Life Technologies, Paisley, UK). MiR-specific stem-loop primer identification numbers are presented in Table 5. Expression of each miR was normalised to cel-miR-39. Each PCR reaction was performed in triplicate and data were calculated using the 2-ddCt method. Table 7: Results of the tests of the effect of heparinase I treatment on RT-PCR cycles for an endogenous miR (miR-21) and of the spiked-in Cel-39 normalizer starting from heparinase I-treated and non-heparinase I-treated human plasma.
A. Exemplar effect of Heparinase I treatment in plasma prepared from blood taken before anticoagulation treatment. without with Heparinase I
Heparinase I
MicroRNA Ct Values Ct Values
18.49 19.01
cel-miR-39 18.59 19.00
18.73 18.88
30.30 30.63
hsa-miR-21 31.08 30.82 B. Exemplar effect of Heparinase I treatment in plasma prepared from blood taken during heparin treatment. without with Heparinase I
Heparinase I
MicroRNA Ct Values Ct Values
25.34 18.45
cel-miR-39 25.41 18.30
25.67 18.45
37.31 30.14
hsa-miR-21 37.59 30.04
37.44 29.76
Cardiac troponin-I measurement
High Sensitive (hs) cardiac Troponin-I (cTn-I) (hs-cTn-I) was measured in serial ARCADIA serum samples by using the ARCHITECT STAT High Sensitive Troponin-I assay (Abbott). In the COPTIC samples, we measured cTn-I by ELISA (Sigma), because the ARCHITECT or other kits for either hs-cTn-I or hs-cTn-T do not work on plasma citrate samples.
RESULTS
CABG is associated with a rapid increase in plasma cardiac miRs
COPTIC (ISRCTN20778544) was a prospective observational study in patients undergoing heart surgery in which citrate plasma samples were collected at two time points: 1) in the anaesthetic room before surgery and 2) post-CPB immediately after heparin reversal before chest closure. Table 3 summarizes the characteristics of the COPTIC patients who contributed samples to in this study. The COPTIC biobank offered the possibility for studying early responses after CABG using CPB and cold blood cardioplegic arrest (a subgroup of the COPTIC population). A set of miRs that are reportedly expressed by cardiac myocytes and upregulated by ischemia in the heart (see Table 5) increased early after CABG (Table 8). Moreover, in line with the known CBP-induced platelet activation, CABG increased the plasma level of platelet- enriched miR-223. By contrast, the vascular expressed miR-92a and miR- 126 and the "quality control" miR-23a (supposedly stably expressed in plasma) and miR-451 (used as control against plasma sample haemolysis since it is enriched in red blood cells) were unaffected by CABG.
Table 8. Summary of the mean differences between miR levels before and after CABG with corresponding standard errors (SE) and levels of significance.
Figure imgf000046_0001
CABG is associated with a rapid increase in plasma exosomes
In the COPTIC samples, plasma circulating nanoparticles of the size of exosomes increased immediately after completion of CABG, when the patients were still in the operating theatre (Figure 17 A). The analysis of the size distribution of EVs provided evidences that CABG increased the density of vesicles of the size of exosomes (30 to 100 nm circa), but it did not affect the amount of larger particles (above 120 nm) (Figure 17B). The concentration of exosomes increased by 55% compared to before surgery (mean difference in the natural logarithm of the exosome concentration was 0.46±0.17 (95% CI [0.10, 0.82]), p= 0.0155 (Figure 17C). Time course of changes in circulating cardiac miRs, exosomes, and exosomal miRs induced by CABG
We next investigated the time-course of plasma miRs and exosomes response to cardiac surgery and changes in the exosomal miRs cargo. These tasks were developed using samples from a subgroup of CABG patients (see Table 4 for the patients' characteristics) belonging to a different cardiac surgery cohort: ARCADIA (REC 13/LO/1687), an ongoing prospective observational study. Citrate plasma and serum samples were collected at four time points: 1) in the anaesthetic room before surgery; 2) during surgery before establishment of CPB, 3) at 24h post-CPB and 4) 48h post- CPB. As shown in Figures 18A to 18C, there were no changes in plasma exosome concentration during the operation, before the CPB initiation. By contrast, plasma exosomes were elevated at 24h and 48h after the operation. These changes followed similar patterns in individual patients (data not shown).
As shown in Figure 19 and Table 9 A, the concentrations of miR-1, miR- 133a and miR- 133b increased in the whole plasma at 24h post-surgery. By contrast, the concentration of miR-24 did not. No other miR expressional changes in the measured were observed. As shown in the Table 5, the numbers of miRs measured in ARCADIA were reduced in comparisons to COPTIC.
Next, we prepared exosomes enriched fraction out of aliquots from the same plasma samples employed for the analyses of above. Exosome preparations were validated for size (by NTA) (Figures 20A) and expression of exosome antigens (Figures 20B). Interestingly, the pattern of miR changes associated with CABG was different when miRs were measured in the plasma exosomal fraction rather than in whole plasma (Figure 20C and Table 9B). In detail, concentrations of exosomal miR-1, miR-24, miR- 133a and miR- 133b all increased at both 24h and 48h post-surgery, while some □ f these changes were not detected in the whole plasma (see above). The calculation of individual miR concentration ratios between whole plasma and plasma exosomes showed that miR-24 was especially enriched in the exosomal fraction after CABG. The miR-210 exosome/whole plasma concentration ratio also increased (Figure 20D) at 24h post-CPB. Table 9A: Supplemental to Figure 19. Mean values, and standard deviations (SD), of relative expression data for each microRNA in the whole ARCADIA plasma. MicroRNA expression was calculated relative to exogenous cel-miR-39, using the formula 2-KmR CT - (cel-miR-39 CT ].
microRNAs Average relative expression (SD)
(miRs) Pre-op Pre-CPB 24 hours 48 hours miR-1 x1 0-4 1 .14 (0.62) 2.31 (0.63) 5.00 (2.70) 1 .51 (0.93) miR-24 x1 0-2 1 .72 (0.87) 1 .45 (0.36) 0.79 (0.19) 1 .80 (1 .33) miR-133a x1 0-4 6.46 (4.86) 10.13 (5.82) 15.46 (9.68) 5.39 (1 .04) miR-133b x1 0-4 4.32 (1 .71 ) 7.54 (2.44) 12.70 (6.38) 5.36 (2.17) miR-210 x1 0-4 4.00 (3.36) 2.76 (1 .46) 2.40 (1 .65) 3.88 (1 .44) miR-122 x1 0-2 5.50 (3.04) 8.00 (5.49) 2.23 (2.97) 2.04 (1 .45)
Pre-op: pre-operation (in the anaesthetic room); pre-CPB: during surgery before establishment of the cardiopulmonary by-pass (CPB); 24 hours: 24 hours after end of CBP; 48 hours: 48 hours after end of CBP.
Table 9B: Supplemental to Figure 20C. Mean values, and standard deviations (SD), of relative expression data for each microRNA in the ARCADIA plasma exosomal fraction. MicroRNA expression was calculated relative to exogenous cel-miR-39, using the formula 2"KmR CT " (cel-miR-39 CT)] microRNAs Average relative expression (SD)
(miRs) Pre-op Pre-CPB 24 hours 48 hours miR-1 x1 0-7 3.76 (0.62) 4.88 (1 .54) 9.20 (2.45) 9.78 (2.63) miR-24 x1 0-7 51 .51 (14.62) 75.90 (15.71 ) 135.69 (23.94) 1 16.89 (34.52) miR-133a x1 0-7 5.31 (2.1 1 ) 4.77 (1 .50) 15.15 (2.80) 13.16 (4.41 ) miR-133b x1 0-7 3.86 (1 .39) 5.93 (3.60) 15.64 (4.39) 8.79 (3.57) miR-210 x1 0-7 0.80 (0.17) 0.89 (0.25) 1 .57 (0.31 ) 1 .41 (0.72) miR-122 x1 0-7 21 .61 (3.26) 19.32 (3.84) 13.82 (4.50) 8.47 (2.57)
Pre-op: pre-operation (in the anaesthetic room); pre-CPB: during surgery before establishment of the cardiopulmonary by-pass (CPB); 24 hours: 24 hours after end of CBP; 48 hours: 48 hours after end of CBP.
Correlations between exosomes, miRs, exosomal miRs and cTn-I
CTn-I was unchanged at completion of surgery (data not shown). However, the hs- cTn-I concentration increased at 24h and 48h post-CPB (Table 10). The whole plasma concentration of individual miRs was not correlated with hs-cTn-I (Figure 21 A). By contrast, the plasma exosome concentration was strongly positively correlated with hs-cTn-I (β=9.1χ10"14 ± 2.0xl0"14, PO.0001) (Figure 21B). The concentration of total exosomes was positively correlated with the concentration of exosomal miR-1, miR- 133a, miR-24, miR-210 and miR-133b (Figure 21C). Finally, the exosomal concentrations of miR-1, miR-133a, miR-24, miR-210 and miR-133b were strongly positively correlated with cTn-I (Figure 2 ID).
Table 10: High Sensitive cardiac troponin I (hs-cTn-I) measurements in consecutive samples of the ARCADIA patients Patient hs-cTn-l values (pg/mL)
24 hours 48 hours
Pre-op Pre-CPB
post-CPB post-CPB
1 14.4 9.7 4335.8 6914.6
2 1.4 2.0 236.0 244.7
3 12.4 9.8 346.0 152.3
4 2.0 2.2 279.5 207.9
5 110.2 98.8 1772.4
6 3.5 2.9 638.1 369.6
The plasma sample for this time point was unavailable.
Serial plasma cardiac troponin I values in the individual patients from the ARCADIA study set, measured using a high-sensitivity assay. Samples were collected immediately before the operation (pre-op), during the operation before initiation of cardiopulmonary bypass (pre-CPB), and at 24h and 48h post-operatively. All values are given in pg/mL.
CONCLUSIONS
This study provides novel evidence that: 1) the concentration of cardiac-enriched, ischemia-responsive miRs and of exosomes increase in the plasma early after CABG; 2) miRs of possible cardiac origin circulate as part of exosomes and in non-exosomal plasma fractions, with the exosome to whole plasma concentration ratios of individual miRs differently affected by surgery; 3) the concentrations of exosomes and of exosomal cardiac miRs after CABG are positively correlate with the concentration of hs-cTn-I; 4) Following CABG, exosomes increased in the peripheral circulation earlier than cardiac troponins.
Based on the above data, we propose that the heart-derived exosomes that circulate in the peripheral blood may be reporters of the myocardial injury, thus enabling for diagnosis and monitoring of cardiac patients. Consequently, we propose that blood exosome-based analyses should be further considered in the attempt to develop novel semi-invasive biomarkers of cardiac damage. Analyses of blood exosomes and exosomal miRs hold several properties that make them particularly interesting. From a mechanistic standpoint, exosomes are actively secreted from living cells and thus they might provide complementary information to markers, like cTns and cardiac enzymes that mainly leak out of dying cardiomyocytes. Moreover, differently from the current biochemical biomarkers of myocardial injury, exosomes are not merely inert products: they reportedly elicit functional responses in recipient cells in a paracrine fashion and at distance. Consequently, exosomes could represent functional biomarkers directly involved in the development and progression of the pathological condition that we aim to diagnose or monitor. Analyses on left ventricle biopsies collected at different phases of cardiac surgeries may help validate the capacity of circulating exosome to grade the level of myocardial injury.
In this study, we have shown that the plasma exosomes concentration is highly positively correlated with hs-cTn and that increases in plasma exosomes precede the pick cTn in the blood after CABG 1. Hence, in the cardiac surgery and interventional cardiology settings, changes in the blood exosome concentration after a procedure could per se be a biomarker of the response of the patients to the intervention, enabling prediction of clinical outcomes.
Exosomes are released by a variety of cell types and hence changes in their plasma concentration cannot be assumed to be dependent solely on their release from the heart cells. However, in the setting of cardiac surgery, the cardiomyocytes contribution to the circulating exosomes is strongly suggested by the presence of myocyte-enriched miRs (miR-1, miR-133a. miR-133b) in the plasma exosome cargo and in the fact that abundance of exosomal cardiac miRs increased after CABG.
We have found that after surgery, miR-24 and miR-210 were substantially enriched in the total pool of plasma exosomes. In contrast, the exosome/whole plasma concentration ratios of miR-1, miR-133a and miR-133b were mostly unchanged. This suggests the possibility that after CABG miR-24 and miR-210 are predominantly released via exosomes, while miR-1 and miR-133 are released via exosomes and exosome-independent mechanisms in similar proportions.
In conclusion, the plasma concentrations of exosomes and their cargo of cardiac miRs change significantly in patients undergoing CABG. The circulating exosome numbers and their cargo of cardiac miRs are associated with hs-cTnl release. Moreover, the change in exosome concentration precedes the cTn-I increase. Our findings suggest the existence of an exosome-mediated miRs trafficking from the heart, which is amplified by cardiac surgery. Moreover, the data suggest a potential role for exosomes as new biomarkers of myocardial injury.
Example 4
MATERIALS AND METHODS
Clinical sample collection and processing. Studies complied with the ethical principles stated in the "Declaration of Helsinki" and were covered by an ethical approval allowing the use of cardiac surgery leftover samples for research purposes at the Bristol Royal Infirmary. We collected leftover samples from aortic valve replacement (AVR) surgery performed during cardiopulmonary-bypass (CPB). The total PF volume was collected on initial opening of the pericardium in plain, sterile 50 ml containers. Peripheral blood was collected from an arterial source in citrate- containing vacutainers (BD, Oxford, UK) . Samples of TA and right atrium appendage (RAA) were collected and placed immediately in RNA Later™ stabilizing solution (Life Technologies) and stored at -80°C until processed. Blood and PF were processed immediately after collection, as follows. To obtain plasma, the citrate-containing vacutainers were centrifuged at 1,500 g, 4°C for 15 minutes and the supernatant was collected. The supernatant underwent further centrifugation at 13,500 g, room temperature (RT), for 5 minutes to deplete the sample of miRNA-rich platelets. The platelet fluid was centrifuged at 13,500 g, RT, for 5 minutes to deplete the samples of cells. The final platelet-poor plasma, PF and tissue samples were stored at -80°C until required. RNA Extraction and quantitative real-time analysis. Total RNA was extracted using the miRNeasy (Qiagen), according to the manufacturer's instructions. For RNA extraction from solid tissues (TA, RAA), around 50 mg of tissue was first homogenized in 1 ml QIAzol (Qiagen) in a gentleMACS M tube using the gentleMACS dissociator (both from Miltenyi Biotec). For RNA extraction from PF and plasma, 200 μΐ of sample was used with 1 ml of QIAzol. A synthetic analogue of the non-human Caenorhabditis elegans microRNA-39 (cel-miRNA-39, Qiagen) was spiked-in (10 μΐ of a 5 fmol/μΐ stock) to normalise for RNA extraction efficiency23. Reverse transcription of individual miRNAs was performed using the TaqMan miRNA Reverse Transcription Kit and miRNA-specific stem-loop primers (see Supplementary Table 2: Life Technologies). Quantitative PCR (qPCR) was performed in triplicate using 2x Universal PCR Master Mix with No AmpErase UNG (Life Technologies) using QuantStudio™ 6 Flex Real-Time PCR System (Life Technology)Roche LightCycler 480 (Roche). miRNA expression was normalized with either cel-miRNA-39 (for biological fluids) or with the small nuclear U6 snRNA (for solid tissues). For mRNA analysis, cDNA, obtained using High-Capacity RNA- to-cDNA™ Kit (Life Technologies) was amplified by quantitative real-time PCR (qPCR). TaqMan® Gene Expression Assays (Life Technologies) and 2x Universal PCR Master Mix with No AmpErase UNG (Life Technologies) were used to analyse the gene expression of
TGFBR1 (ID: Hs00610320_ml), CASPASE3 (Hs00234387_ml), LOX (Hs00942480_ml), UBC (ID: Hs00824723_ml) (all Life Technologies). Real-time quantification to measure gene expression for DICER was performed using Power SYBR Green PCR Master Mix (Life Technologies) and normalized against GAPDH. Primers were the following:
DICER Fw - ATTCTAGTGCAGGTTTTTCAAGCC,
DICER Rw - ACCTCAGATTCCACACTTTCCTG,
GAPDH Fw - AGCCGCATCTTCTTTTGCGT,
GAPDH Rw - TGACGAACATGGGGCATCA).
Quantification was performed by the 2-AACT method84-86.
For absolute miRNA quantification, the Ct value obtained from a dilution series (ranging from 100 nM down to 10 fM) of chemically synthesized RNA oligonucleotides corresponding to the mature miRNA sequence of let-7b-5p (UGAGGUAGUAGGUUGUGUGGUU) and miRNA- 122-5p
(UGGAGUGUGACAAUGGUGUUUG) were used to generate standard curves (both were purchased from Sigma).
miRNA array on human pericardial fluid. Total RNA was converted to cDNA using a reverse transcription kit (Universal cDNA Synthesis Kit, Exiqon, Woburn, MA). Three (unpooled) PF samples of the AVR surgical patients' groups were randomly selected to be run in a PCR-based miRNA array enabling the profiling of 752 human miRNAs (miRNACURY LNA™ microRNA polymerase chain reaction (PCR) human panels I and II (version 3, Exiqon). The miRNA array plates were run using a LightCycler 480 (Roche).
miRNA array bioinformatic analyses. For the bioinformatics analyses, the processing setting were as follows: 1) detection scoring: miRNAs not detectable in all 3 samples or Ct > 37 in at least 2 patients were not considered for future calculations; 2) average of inter-plate calibrator (UniSp3 IPC) was calculated for each run (representing one sample) and the median was subtracted to each miRNAs Ct; 3) expression of each miRNA was derived using the 2-AACT method. On the basis of these criteria, arrays data were inspected using the NormFinder algorithm to assess the variance in expression levels. The best normalizer was found to be the average of assays detected in all 3 AVR samples; therefore it was used to normalize the array.
Exosomes enrichment from the PF and plasma. Exosomes were enriched from 250 μΐ of PF and plasma using ExoQuick kit (System Biosciences). 2.5 μΙ_, thrombin (500 U/ml, System Biosciences) per 250 μΐ plasma was added to each sample to remove the fibrin proteins. The samples were incubated at RT for 15 minutes while mixing, then centrifuged at 10,000 g for 5 minutes at RT. PF and fibrin-depleted plasma were then filtered through a sterile a 0.22 μπι filter (Merck Millipore) into a fresh tube and 75 μΐ ExoQuick solution was added. The samples were incubated for 30 minutes at 4°C, then centrifuged for 30 minutes at 1,500 g and 4°C. The supernatant was removed, and following an additional centrifugation of the sample at 1,500 g for 5 minutes at 4°C, the fluid was taken off and the pellet re-suspended in 100 μΐ of sterile PBS. At the end of the process, the presence of exosomes in the preparation has been confirmed by NTA, electron microscopy (vide infra) and western blotting. Protein concentrations were determined using Micro BCA protein assay (Thermo Scientific) and specified exosome doses used in experiments are based on these. miRNAs from exosomes were isolated using the miRNANeasy kit (Qiagen) (vide supra).
Cell culture and cell biology. HUVECs (Lonza) were grown in EBM-2 endothelial cell basal medium (Lonza) with addition of 2% FBS and SingleQuots Kit (EGM-2 medium, Lonza) at 37°C with 5% C02. After the first expansion cells were then grown in EGM-2 medium using 2% exosome-depleted FBS (System Biosciences). To mimic ischemia in vitro, ECs were exposed to hypoxia (1% p02) for 24 h followed by treatment with different concentrations of PF/plasma-derived exosomes or exosome- depleted PF/plasma for 24 h. HUVECs were used between passages 2 and 6.
HUVECs and exosomes transfections. Lipofectamine RNAiMAX (Life Technologies) was used to transfect HUVECs with scramble (75 nM total), siRNAs against DICER (25 nM for each siRNA, 75 nM total), mirVana® miRNA mimic let-7b-5p (12.5mM, MCI 1050), mirVana® miRNA inhibitor let-7b-5p (12.5mM, MH11050), Pre-miR Negative Control (12.5mM, AM17120) and Anti-miR Negative Control (12.5mM, AM17011) (all Life Technologies), according to the manufacturer's instructions. Published sequences56,89 of siRNA against DICER and scramble were used (all purchased from Qiagen).
Exosomes were transfected with mirVana® miRNA inhibitor let-7b-5p (MH11050, Life Technologies) using Exo-Fect™ Exosome Transfection Kit (System Biosciences) and following the guideline's recommendations.
Statistical analysis. Comparisons between different conditions were assessed using two-tailed Student's t-test. If the normality test failed, the Mann- Whitney test was performed. Experiments with three or more experimental groups were compared by one-way ANOVA with Dunnett's multi comparison test. Toe survival was tested using Log-rank analysis. Continuous data are expressed as mean ± s.e.m. P-values less than 0.05 are considered significant *P <0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Analyses were performed using Prism software V6 (Graph Pad, San Diego, CA, USA).
RESULTS
The human PF is enriched with miRNAs of potential cardiovascular origin. In search for evidence in support of our hypothesis that the PF is enriched with miRNAs released from the heart and thoracic vasculature, under ethical approval, we obtained the PF, peripheral blood-derived plasma and leftover tissue samples of myocardium (right atrium appendage) and vasculature (ascending thoracic aorta) from surgical patients undergoing aortic valve replacement (AVR). Table 11 shows the characteristics of the patients contributing to this study.
Characteristic Total n=11
Age (Years; mean, SD) 71 .6 (8.1)
Sex (males;n,%) 8/1 1 (72.7%)
Diabetic (n,%) 1/9 (1 1 .1 %)
Hypertension (n,%) 9/9 (100%)
Valve stenotic (n,%) 1 1/1 1 (100%)
NYHA Class (n,%) Class 2 1 1 (100%)
LVEF (left ventricular ejection fraction) Good 10/1 1 (91 %)
Moderate 1/1 1 (9%)
Table 11: Characteristics of the surgical patients used in the study. All patients were operated for aortic valve replacement We started our miRNA analyses by performing a PCR-based miRNA microarray (Exiqon) including 752 miRNAs in n=3 non-pooled, randomly selected PF samples. The array revealed that 359 miRNAs included in the array were ubiquitously present in the tested PF samples. Of those miRNAs, several miRNAs known to be present in human or animal cardiovascular cells were abundantly expressed in the PF samples. We arbitrary selected 15 of those PF expressed, putative cardiovascular miRNAs for validation. They included 12 miRNAs (let-7b-5p, miR-15a-5p, miR-16-5p, miR-19b- 3p, miR-21-5p, miR-22-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR- 29c-3p, miR-451a) chosen between the top-expressed miRNAs in the 3 samples. Three additionally putative cardiovascular miRNAs expressed in all PF samples were also selected for further analyses: 1) miR-27a-3p was chosen because it is clustered in a poly-cystronic unit with 2 miRNAs in the list above (miR-23a-3p, miR-24-3p) and known to be proangiogenic; 2) miR-29b-3p is co-transcribed with miR-29a-3p and miR-29c-3p from the above list and is expressed by cardiac fibroblasts; 3) miR-126- 3p is the prototypical endothelial miRNA. Finally, even if not detected by the array in the PF, miR-208a was chosen because of its enrichment in cardiac tissue. Working on surgical leftover myocardial and vascular samples, we confirmed the cardiovascular expression of the above 16 miRNAs in our patients. The liver-enriched miR-122-5p was very low not detectable in either the aorta or myocardium of our patients (data not shown) and hence used as a negative control. Next, we investigated our hypothesis that the PF is enriched of miRNAs released from cardiovascular tissue. To do this, the 16 cardiovascular expressed miRNAs and miR-122-5p were measured by PCR in the PF and peripheral plasma prepared from the same patients. As shown in Figure 22, 7 miRNAs (let-7b-5p, miR-21-5p, miR-23a-3p, miR-24-3p, miR-29a-3p, miR-29c-3p and miR-451a) were more expressed the PF samples in comparison to the plasma (P<0.05 or 0.005 vs plasma expression), while two miRNAs (miR-16-5p and miR- 208a-3p) were not detectable in plasma. Four additional miRNAs (miR-22-3p, miR- 27a-3p, miR-27b-3p and miR-29b-3p) showed trends (P between 0.08 and 0.3) toward increased PF expression. Among the putative cardiovascular miRNAs, only miR-19- 3p showed a trend (P=0.11) toward increase in plasma. Moreover, miR-15a-5p and miR-126-3p were more abundant in plasma (P<0.05 for both comparisons vs PF). Figure 22 (right axes) additional reports the PF to plasma concentration ratio for individual miRNAs. Taken together these data are in line with our hypothesis that the PF represents a liquid compartment where expressional information and executive commands from the heart and thoracic vessels are released in form of miRNAs. PF exosomes contain the RISC components Ago-2 and Dicer
In the RISC complex, miRNAs are associated with the protein Ago-2 and miRNA- Ago-2 complexes are reportedly present in the conditioned medium of cells as well as in patients' serum. To establish if Ago2-miRNA complexes were present in the PF samples, Ago2 immunoprecipitation (IP) was performed. Immunoblotting for Ago-2 confirmed the correct execution of the approach (Fig. 24b). Next, by miRNAs RT- qPCR analyses, we found 12 miRNAs (let-7b-5p, miR-21-5p, miR-22-3p, miR-23a- 3p, miR-24-3p, miR27a-3p, miR-27b-3p, miR-29a-3p, miR-29b-3p, miR-29c-3p, miR-126-3p, miR-451a) out of the 16 cardiovascular miRNAs initially selected for this study that were conjugated to Ago-2 (Fig. 24c). The relative expression of the individual miRNAs conjugated to Ago-2 was variable (Fig. 24c) and did not follow the same trends of exosomal miRNA expression (see Fig. 23). Nonetheless, 10 miRNAs (let-7b-5p, miR-21-5p, miR-22-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29b-3p, miR-29c-3p, miR-451a) of our 16 miRNAs were co- expressed in exosomes and Ago-2 complexes. Therefore, we investigated the possibility that PF exosomes contain Ago-miRNA complexes. Interestingly, Ago-2 was detected in PF exosome preparations (Fig. 24d). Next, to answer the question if exosomes might contain miRNAs conjugated to Ago-2, we performed Ago-2-IP of PF exosomes, followed by PCR for some (let-7b-5p, miR-21-5p, miR-23a-3p, miR-24- 3p, miR-27a-3p, miR-29a-3p, miR-29b-3p, miR-126-3p) of the miRNAs expressed in the Ago2 complexes we previously detected in unfractioned PF samples (see Fig. 24c). This approach allowed us to reveal the presence of Ago-2-miRNAs complexes in the exosomal compartment of the human PF (Fig. 24e). Finally, we found evidence of Dicer presence by immunoblotting (Fig. 24f). Taken together, the above data provide evidences that exosomes contain miRNAs that are co-expressed and possibly physically associated with the RISC. Consequently, exosomes could deliver a RISC machinery ready to act in recipient cells, thus immediately eliciting expressional changes commanding for functional responses.
The angiogenic action ofPF exosomes is partially mediated by let-7b-5p
We next interrogated the possibility that let-7b-5p could be transferred from PF exosomes to ECs and the expressional and functional impact of exosomal let-7b-5p in recipient cells. For these experiments, we adopted a model where the endogenous miRNA expression is reduced. It was previously reported that miRNAs biogenesis and hence intracellular miRNAs levels can be decreased in cultured ECs by silencing Dicer, the enzyme that is responsible for the maturation of biologically active miRNA forms from their precursor miRNAs. It was also known that Dicer knockdown (KD) impairs the angiogenic capacity of cultured ECs, with this effect being prevented by co-transfection of a cluster of proangiogenic miRNAs, not including let-7b-5p. After transfection of ECs with oligos for silencing RNA (siRNA), we confirmed Dicer KD at both mRNA and protein expression level (data not shown) and we confirmed the antiangiogenic impact of this approach (data not shown). Next, ECs with either Dicer KD or a preserved Dicer expression were stimulated with PF exosomes. PBS and the PF exosome-free fraction served as controls. As shown in Fig. 25a, after 24 hours, let- 7b-5p was found reduced in the Dicer KD cells which had not received the exosomes. Moreover, we found evidences that treatment with PF exosomes restored intracellular let-7b-5p expression which had been compromised by Dicer KD (Fig. 25a), thus supporting the hypothesis that this proangiogenic miRNA is transferred from the exosomes to the recipient ECs. In line with the hypothesis that the let-7b-5p delivered from the PF exosomes into ECs is functionally active, ECs treated with PF exosomes responded with a decreased expression of TGFBR1 mRNA (Fig. 25b). Noteworthy, in ECs with Dicer KD, treatment with PF exosomes were also able to restore Dicer expression at protein, but not mRNA level (data not shown). This together with the aforementioned finding of Dicer in PF exosomes (see Fig. 24d), further suggests that PF exosomes pass on miRNAs and other component of the RISC machinery to recipient cells. Finally and in line with their induced let-7b-5p and TGFBR1 expressional changes, PF exosomes restored the angiogenic capacity of Dicer KO-ECs (Fig. 25c). To further investigate the transfer of PF exosomal let-7b-5p to ECs and its functional consequence, we suppressed let-7b-5p inside the exosomes using a dedicated inhibitor and a commercially available kit (see Material and Methods). The reduction of exosomal let-7b-5p in PF exosomes transfected with the miRNA inhibitor was confirmed by PCR (data not shown). Moreover, at difference with scramble-treated PF exosomes, the PF let-7b-5p KD-exosomes could not: 1) restore let-7b-5p level (Fig. 25a); 2) decrease TGFBR1 expression (Fig. 25b), or improve angiogenesis (Fig. 25c) in recipient Dicer-KD ECs.
Taken together, the above data support the hypothesis that PF exosomes are functionally active and stimulate angiogenesis via the passage of the proangiogenic let-7b-5p to ECs.
CONCLUSIONS
The results obtained by us using samples from patients undergoing open-heart surgery show that miRNAs were successfully detectable in the PF of a cohort of these patients. We provide the first evidence that the PF represents a unique compartment where cardiac miRNAs are enriched in comparison to the peripheral circulation and therefore it could be used as a possible new source of biomarkers. In fact, increase of miRNAs expression in the total PF (let-7b-5p, miR-21-3p, miR-21-5p, miR-23a-3p, miR-24-3p, miR-27a-5p, miR-29a-3p, miR-29a-5p, miR-29c-3p, miR-208a-3p, miR- 451a) and in PF-derived exosomes (let-7b-5p, miR-21-3p, miR-21-5p, miR-23a-3p, miR-24-3p, miR-miR-29a-3p, miR-29a-5p, miR-29c-3p) in comparison to the corresponding plasma samples, suggests that the PF-miRNAs are more reliable as new potential therapeutic biomarkers in cardiovascular pathologies.
References
Liebetrau C, Mollman H, Dorr O, et al. (2013), Release kinetics of circulating muscle- enriched microRNAs in patients undergoing transcoronary ablation of septal hypertrophy. Journal of the American College of Cardiology 62: 992-998
Yang W, Shao J, Bai X, Zhang G. (2015). Expression of Plasma microRNA- l/21/208a/499 in Myocardial Ischemic Reperfusion Injury. Cardiology 130: 237-241
Zhou X, Mao A, Wang X, Duan X, Tao Y, Zhang C. (2013). Urine and serum microRNA as novel biomarkers for myocardial injury in open-heart surgeries with novel cardiopulmonay bypass. PLoS One 8: e62245

Claims

Claims
1. A method for diagnosing a myocardial injury, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein an increase in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient has an increased probability of having suffered from a myocardial injury.
2. A method according to claim 1, wherein the myocardial injury is myocardial ischemia or a myocardial ischemia/reperfusion injury.
3. A method according to claim 1 or 2, wherein the sample is obtained from the patient within 2 hours of the myocardial ischemia or the myocardial ischemia/reperfusion injury.
4. A method according to any of claims 1 to 3, wherein the sample is a whole blood, plasma, serum, urine, biopsy or surgery leftover sample.
5. A method according to any of claims 1 to 4, wherein the exosomes or other extracellular vesicles comprise one or more microRNAs selected from miR-1, miR- 24, miR-133a, miR-133b, miR-208a, miR-208b and miR-210.
6. A method for making a prognosis of post-surgical complications following cardiac surgery, the method comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the concentration or molecular cargo of exosomes or other extracellular vesicles in the PF, wherein a change in exosome or other extracellular vesicle concentration or the composition of the molecular cargo of the exosomes or other extracellular vesicles compared to normal patient values indicates said patient is at increased risk of developing postsurgical complications.
7. A method according to claim 6, wherein the concentration of exosomes or other extracellular vesicles in the PF is increased compared to normal patient values.
8. A method according to claim 6, wherein the concentration of exosomes or other extracellular vesicles in the PF is decreased compared to normal patient values.
9. A method for making a prognosis of post-surgical complications following cardiac surgery, the method comprising analysing a sample obtained from a patient before, during or after surgery and measuring the concentration of exosomes or other extracellular vesicles in the sample, wherein a change in exosome or other extracellular vesicle concentration compared to normal patient values indicates said patient is at increased risk of developing post-surgical complications.
10. A method according to claim 9, wherein the concentration of exosomes or other extracellular vesicles in the sample is increased compared to normal patient values.
11. A method according to claim 9 or 10, wherein the sample is obtained from the patient within 2 hours of surgery.
12. A method according to any of claims 9 to 11, wherein the sample is a whole blood, plasma, serum, urine, biopsy or surgery leftover sample.
13. A pharmaceutical composition comprising pericardial fluid (PF) exosomes and one or more pharmaceutically acceptable carriers or excipients.
14. A pharmaceutical composition according to claim 13 wherein the PF exosomes are autologous, allogenic or xenogenic.
15. A pharmaceutical composition according to claim 13 wherein the PF exosomes are artificial.
16. A pharmaceutical composition according to any of claims 13 to 15, wherein the PF exosomes further comprise one or more therapeutic agents.
17. A pharmaceutical composition according any of claims 13 to 16, wherein the PF exosomes comprise one or more microRNAs selected from 21-5p, 23a-3p, 24-3p, 27a-3p, 29a-3p, 29a-5p, 29b-3p, 126-3p, 126-5p, 143-3p, 199-5p, 374a-5p.
18. A pharmaceutical composition according to claim 17, wherein the relative expression of 21-5p is about 2.5xl0"2, 23a-3p is about 4xl0"4, 24-3p is about 3.5x10"2, 27a-3p is about 4xl0"3, 29a-3p is about 0.5X10"1, 29a-5p is about 5xl0"5, 29b-3p is about 3xl0"4, 126-3p is about 0.5xl0"3, 126-5p is about 2xl0"4, 143-3p is about 0.6xl0"3, 199-5p is about 1.5xl0"5 or 374a-5p is about 0.6xl0"3, relative to expression of cel-miR-39.
19. A pharmaceutical composition according to claim 17, wherein the ratio of PF exosome microRNAs to plasma exosome microRNAs is at least 2: 1 for microRNAs 21-5p, 23a-3p, 24-3p, 27a-3p, 29a-3p, 29a-5p, 29b-3p, 126-3p, 126-5p, 143-3p, 199- 5p, 374a-5p.
20. A pharmaceutical composition according to any of claims 13 to 19, wherein at least 50% of the PF exosomes have a particle size of about 30nm to about 120nm.
21. A pharmaceutical composition according to any of claims 13 to 20 for use in therapy.
22. A pharmaceutical composition for use according to claim 21, wherein the composition is for use in the prevention or treatment of cardiovascular disease, kidney disease, ischaemic disease in different organs and tissues, neuropathies or dementia associated with vascular defects.
23. A pharmaceutical composition for use according to claim 21, wherein the composition is for use in protecting an organ from surgery-induced damage or to promote wound healing.
24. A pharmaceutical composition for use according to claim 23, wherein the organ is the heart.
25. A method for cardiac surgery, the method comprising delivering PF or PF extracellular vesicles during or after surgery.
26. A method according to claim 25, comprising absorbing PF exosomes on a matrix and placing the matrix into contact with a patient's heart or great vessels.
27. A method according to claim 26, wherein the PF exosomes are autologous, allogenic or xenogenic.
28. A method according to claim 26, wherein the exosomes are artificial.
29. A method according to any of claims 25 to 28, wherein PF extracellular vesicles are delivered in a cardioplegia solution, or via an intravascular access or by direct injection into the heart wall.
30. A method for the treatment or prevention of cardiovascular disease, kidney disease or ischemic disease, the method comprising providing PF exosomes to a diseased area of a patient.
31. A method according to claim 30, comprising absorbing PF exosomes on a matrix and placing the matrix into contact with the diseased area of the patient.
32. A method according to claim 30 or 31, wherein the PF exosomes are autologous, allogenic or xenogenic.
33. A method according to claim 30 or 31, wherein the exosomes are artificial.
34. A method according to any of claims 30 or 32 to 33, wherein PF exosomes are delivered in a solution, or via an intravascular access or by direct injection into the diseased area.
35. A method for diagnosing acute complications after surgery, the method comprising analysing a sample obtained from a patient and measuring the concentration of exosomes in the sample, wherein an increase in exosome concentration compared to normal patient values indicates said patient has an increased probability of having an acute complication after surgery.
36. A method according to any of claim 35, wherein the sample is a whole blood, plasma, serum, urine, biopsy or surgery leftover sample.
37. A method according to claims 35 or 36, wherein the exosomes comprise one or more microRNAs selected from miR-1, miR-24, miR-133a, miR-133b, miR-208a, miR-208b and miR-210.
38. A method according to any of claims 35 to 37, wherein the acute complication is acute kidney injury, perioperative bleeding or other acute complication.
39. A method for making a prognosis of post-surgical complications following cardiac surgery, the method comprising analysing a sample of pericardial fluid (PF) obtained from a patient during the surgery and measuring the expression of microRNAs in the PF, wherein a change in microRNA expression compared to normal patient values indicates said patient is at increased risk of developing postsurgical complications.
40. A method according to claim 39, wherein the expression of microRNAs in the PF is increased compared to normal patient values.
41. A method according to claim 40, wherein the microRNAs include one or more of let-7b-5p, miR-21-5p, miR23a-3p, miR-24-3p, miR29a-3p, miR-29c-3p and miR- 451a.
42. A method according to claim 39, wherein the expression of microRNAs in the PF is decreased compared to normal patient values.
PCT/GB2016/050923 2015-04-02 2016-04-01 Exosomes Ceased WO2016156865A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1505747.4A GB201505747D0 (en) 2015-04-02 2015-04-02 Exosomes
GB1505747.4 2015-04-02

Publications (1)

Publication Number Publication Date
WO2016156865A1 true WO2016156865A1 (en) 2016-10-06

Family

ID=53190139

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2016/050923 Ceased WO2016156865A1 (en) 2015-04-02 2016-04-01 Exosomes

Country Status (2)

Country Link
GB (1) GB201505747D0 (en)
WO (1) WO2016156865A1 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107287199A (en) * 2017-06-29 2017-10-24 中山大学附属第医院 Application of MicroRNA 29a-5p in preparation of medicine for treating acute cerebral ischemia and cerebral ischemia-reperfusion injury
EP3308795A1 (en) * 2016-10-12 2018-04-18 Unicyte EV AG A composition of extracellular vesicles (evs) and medical uses thereof
CN109694909A (en) * 2017-10-23 2019-04-30 长庚医疗财团法人林口长庚纪念医院 The method for developing the risk of acute kidney injury for predicting the human individual with acute myocardial infarction
WO2020142769A1 (en) * 2019-01-04 2020-07-09 Kenneth Allen Pettine Isolation and use of autogenous platelet derived exosomes
WO2020188433A1 (en) * 2019-03-15 2020-09-24 Unicyte Ev Ag Method for predicting proangiogenic potential of extracellular vesicles (evs)
CN113574179A (en) * 2019-03-15 2021-10-29 联合细胞Ev股份公司 A method for predicting the proangiogenic potential of extracellular vesicles (EVs)
WO2022170000A1 (en) * 2021-02-03 2022-08-11 Nanosomix, Inc. Methods, assays and compositions for measuring brain damage or harm during surgery
US12213995B2 (en) 2019-07-18 2025-02-04 Direct Biologics, Llc Preparations comprising mesenchymal stem cells and cannabinoids and methods of their use
US12453743B2 (en) 2018-05-30 2025-10-28 Direct Biologics, Llc Mesenchymal stem cell (MSC) growth factor and extracellular vesicle preparation in frozen or powdered form and methods of use
US12502407B2 (en) 2024-04-25 2025-12-23 Direct Biologics, Llc Treatment of fistula with bone marrow mesenchymal stem cell derived extracellular vesicles
US12569517B2 (en) 2019-02-07 2026-03-10 Direct Biologics, Llc Method for treating osteoarthritis with mesenchymal stem cell exosomes
US12570980B2 (en) 2020-04-22 2026-03-10 Direct Biologics, Llc Methods and compositions for treating inflammatory conditions associated with infectious disease

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009105044A1 (en) * 2008-02-22 2009-08-27 Agency For Science, Technology And Research (A*Star) Mesenchymal stem cell particles
WO2012110099A1 (en) * 2011-02-18 2012-08-23 Cavadis B.V. Determination of exosomal biomarkers for predicting cardiovascular events

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009105044A1 (en) * 2008-02-22 2009-08-27 Agency For Science, Technology And Research (A*Star) Mesenchymal stem cell particles
WO2012110099A1 (en) * 2011-02-18 2012-08-23 Cavadis B.V. Determination of exosomal biomarkers for predicting cardiovascular events

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BERNAL-MIZRACHI LEON ET AL: "High levels of circulating endothelial microparticles in patients with acute coronary syndromes", AMERICAN HEART JOURNAL, MOSBY- YEAR BOOK INC, US, vol. 145, no. 6, 1 June 2003 (2003-06-01), pages 962 - 970, XP002455907, ISSN: 0002-8703, DOI: 10.1016/S0002-8703(03)00103-0 *
CHUANWEI LI ET AL: "Circulating microRNAs as novel and sensitive biomarkers of acute myocardial Infarction", CLINICAL BIOCHEMISTRY, ELSEVIER INC, US, CA, vol. 45, no. 10, 9 April 2012 (2012-04-09), pages 727 - 732, XP028494366, ISSN: 0009-9120, [retrieved on 20120426], DOI: 10.1016/J.CLINBIOCHEM.2012.04.013 *
JIN LIN ET AL: "Exosomes: Novel Biomarkers for Clinical Diagnosis", THE SCIENTIFIC WORLD JOURNAL, vol. 105, no. 30, 1 January 2015 (2015-01-01), pages 10513 - 8, XP055284066, ISSN: 2356-6140, DOI: 10.1111/j.1462-5822.2010.01537.x *
P.-E. RAUTOU ET AL: "Microparticles, Vascular Function, and Atherothrombosis", CIRCULATION RESEARCH., vol. 109, no. 5, 19 August 2011 (2011-08-19), US, pages 593 - 606, XP055283716, ISSN: 0009-7330, DOI: 10.1161/CIRCRESAHA.110.233163 *
YASUHIDE KUWABARA ET AL: "Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damage", vol. 4, no. 4, 1 August 2011 (2011-08-01), pages 446 - 454, XP002732481, ISSN: 1942-325X, Retrieved from the Internet <URL:http://circgenetics.ahajournals.org/content/4/4/446> [retrieved on 20110602], DOI: 10.1161/CIRCGENETICS.110.958975 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12208120B2 (en) 2016-10-12 2025-01-28 Unicyte Ev Ag Composition of extracellular vesicles (EVS) and medical uses thereof
EP3308795A1 (en) * 2016-10-12 2018-04-18 Unicyte EV AG A composition of extracellular vesicles (evs) and medical uses thereof
US11464799B2 (en) 2016-10-12 2022-10-11 Usicyte Ev Ag Composition of extracellular vesicles (EVS) and medical uses thereof
CN107287199A (en) * 2017-06-29 2017-10-24 中山大学附属第医院 Application of MicroRNA 29a-5p in preparation of medicine for treating acute cerebral ischemia and cerebral ischemia-reperfusion injury
CN109694909A (en) * 2017-10-23 2019-04-30 长庚医疗财团法人林口长庚纪念医院 The method for developing the risk of acute kidney injury for predicting the human individual with acute myocardial infarction
CN109694909B (en) * 2017-10-23 2022-04-26 长庚医疗财团法人林口长庚纪念医院 Products for predicting the risk of developing acute kidney injury in human subjects with acute myocardial infarction and uses thereof
US12453743B2 (en) 2018-05-30 2025-10-28 Direct Biologics, Llc Mesenchymal stem cell (MSC) growth factor and extracellular vesicle preparation in frozen or powdered form and methods of use
WO2020142769A1 (en) * 2019-01-04 2020-07-09 Kenneth Allen Pettine Isolation and use of autogenous platelet derived exosomes
US12569517B2 (en) 2019-02-07 2026-03-10 Direct Biologics, Llc Method for treating osteoarthritis with mesenchymal stem cell exosomes
WO2020188433A1 (en) * 2019-03-15 2020-09-24 Unicyte Ev Ag Method for predicting proangiogenic potential of extracellular vesicles (evs)
CN113574179A (en) * 2019-03-15 2021-10-29 联合细胞Ev股份公司 A method for predicting the proangiogenic potential of extracellular vesicles (EVs)
US12213995B2 (en) 2019-07-18 2025-02-04 Direct Biologics, Llc Preparations comprising mesenchymal stem cells and cannabinoids and methods of their use
US12570980B2 (en) 2020-04-22 2026-03-10 Direct Biologics, Llc Methods and compositions for treating inflammatory conditions associated with infectious disease
US12590310B2 (en) 2020-04-22 2026-03-31 Direct Biologics, Llc Methods and compositions for treating inflammatory conditions associated with infectious disease
WO2022170000A1 (en) * 2021-02-03 2022-08-11 Nanosomix, Inc. Methods, assays and compositions for measuring brain damage or harm during surgery
US12502407B2 (en) 2024-04-25 2025-12-23 Direct Biologics, Llc Treatment of fistula with bone marrow mesenchymal stem cell derived extracellular vesicles

Also Published As

Publication number Publication date
GB201505747D0 (en) 2015-05-20

Similar Documents

Publication Publication Date Title
WO2016156865A1 (en) Exosomes
Franczyk et al. miRNA biomarkers in renal disease
JP6912538B2 (en) Methods and Assays for Blood Circulating Tumor Cells
van Empel et al. Circulating miRNAs: reflecting or affecting cardiovascular disease?
Yan et al. MicroRNA‐126 regulates EPCs function: Implications for a role of miR‐126 in preeclampsia
Ke et al. Exosomal miR‐218‐5p/miR‐363‐3p from Endothelial Progenitor Cells Ameliorate Myocardial Infarction by Targeting the p53/JMY Signaling Pathway
Alique et al. Microvesicles from indoxyl sulfate-treated endothelial cells induce vascular calcification in vitro
Strub et al. Endothelial and circulating C19MC microRNAs are biomarkers of infantile hemangioma
Zietzer et al. MicroRNA-mediated vascular intercellular communication is altered in chronic kidney disease
Zhou et al. Circulating exosomal microRNAs as emerging non‐invasive clinical biomarkers in heart failure: mega bio‐roles of a nano bio‐particle
JP2012525144A (en) Means and methods for neutralizing, preventing and / or determining heart failure or risk of heart failure
US20250123297A1 (en) Supermere Nanoparticles and Methods of Isolation and Use Thereof
US20120034612A1 (en) Methods and Kits for miRNA Isolation and Quantitation
KR20210098431A (en) Compositions comprising cell-derived vesicles and uses thereof
US20170183658A1 (en) USE OF miR-199a-5p, TARGETS AND/OR INHIBITORS THEREOF FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF FIBROPROLIFERATIVE DISORDERS
Alexandru et al. Extracellular vesicles—Incorporated microRNA signature as biomarker and diagnosis of prediabetes state and its complications
US20210108275A1 (en) Materials and methods for bladder cancer detection
Li et al. Exosomal miR-552-3p isolated from BALF of patients with silicosis induces fibroblast activation
Dziedzic et al. Role of circulating microRNA in hemodialyzed patients
EP3937954B1 (en) Method for predicting proangiogenic potential of extracellular vesicles (evs)
Veitch Cellular and Molecular Mechanisms of Endothelial Dysfunction in Diabetic Cardiomyopathy
Just et al. Combined high-throughput library screening and next generation RNA updates sequencing uncover microRNAs controlling human cardiac fibroblast biology
Trevelyan Regulation of human cardiac fibroblast function by specific microRNAs
Charla Investigating extracellular vesicle release from human coronary artery vascular smooth muscle cells in atherosclerosis
TWI539954B (en) Use of mirna let-7g

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16715068

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16715068

Country of ref document: EP

Kind code of ref document: A1