WO2016154246A1 - Hla-restricted epitopes encoded by somatically mutated genes - Google Patents
Hla-restricted epitopes encoded by somatically mutated genes Download PDFInfo
- Publication number
- WO2016154246A1 WO2016154246A1 PCT/US2016/023673 US2016023673W WO2016154246A1 WO 2016154246 A1 WO2016154246 A1 WO 2016154246A1 US 2016023673 W US2016023673 W US 2016023673W WO 2016154246 A1 WO2016154246 A1 WO 2016154246A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hla
- scfv
- peptide
- variable region
- molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2833—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4746—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used p53
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/005—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/32—Immunoglobulins specific features characterized by aspects of specificity or valency specific for a neo-epitope on a complex, e.g. antibody-antigen or ligand-receptor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/734—Complement-dependent cytotoxicity [CDC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/41—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a Myc-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/7051—T-cell receptor (TcR)-CD3 complex
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70539—MHC-molecules, e.g. HLA-molecules
Definitions
- This invention is related to the area of antibody generation. In particular, it relates to constructs that contain an antibody variable region in a single chain or other types of antibody molecules.
- Cancers are the result of sequential mutations of oncogenes and tumor suppressor genes (1). In theory, somatic mutations are ideal therapeutic targets because they are not found in virtually any normal cell (2). Even though the protein products of these mutations generally only subtly differ from the wild type (wt) form, often by a single amino acid, this difference is sufficient for effective targeting. When the protein is an enzyme, such as that encoded by BRAF, the resulting structural change can provide a pocket for the binding of specific enzymatic inhibitors (3-5). Antibodies are one of the most successful types of modern pharmaceutical agents and have been shown to be able to specifically recognize proteins that differ only by a single amino acid or by the modification of a single amino acid (5-11).
- Intracellular antigens such as viral components
- HLA human leukocyte antigen
- MANAs for Mutation-Associated Neo-Antigens
- T-cells that can bind to such peptide-HLA complexes have been found in patients as well as in experimental animals (13-16).
- T cell responses generated in vivo against MANAs are "private," i.e., directed against mutant epitopes encoded by passenger mutations that are present in cancers of individual patients or mice but are not commonly found in patients and do not drive neoplastic growth (2). Immunologic agents targeting such antigens are only useful for the treatment of the individual patients harboring the particular MANA (16- 20).
- an isolated molecule comprising an antibody variable region.
- the antibody variable region specifically binds to a complex of a human leukocyte antigen (HLA) molecule, a ⁇ -2-microglobulin molecule, and a peptide which is a portion of a protein.
- the peptide comprises a mutant residue which is in an intracellular epitope of the protein.
- the molecule does not specifically bind to the HLA molecule when the HLA molecule is not in the complex.
- the molecule also does not specifically bind to the peptide in its wild-type form.
- the molecule does not specifically bind to the peptide when not presented within an HLA complex.
- the isolated molecules can be used for detecting or monitoring cancer cells or for treating cancers.
- a method for selecting from a nucleic acid library an scFv or Fab or TCR that specifically binds to a complex of (a) a human leukocyte antigen (HLA) molecule, (b) a ⁇ -2-microglobulin molecule, and (c) and a first form of a peptide portion of a protein.
- the first form comprises a mutant residue, and the mutant residue is in an intracellular epitope of the protein.
- the scFv or Fab or TCR does not specifically bind to the HLA molecule when the HLA molecule is not in the complex.
- the scFv or Fab or TCR does not specifically bind to the peptide in its wild-type form.
- the method comprises a step of: positively selecting for scFv or Fab or TCR that bind to said complex in the presence of a competitor complex that comprises (a) a second form of the peptide portion bound to (b) HLA and (c) ⁇ -2-microglobulin.
- the second form is selected from the group consisting of a wild-type form and a peptide with a different mutant residue from the first form.
- amounts of said complex and the competitor complex may be varied so that ratio of competitor complex to relevant complex increases.
- a method for selecting from a nucleic acid library an scFv or Fab or T cell receptor that specifically binds to a first form of a peptide portion of a protein.
- the first form comprises a mutant residue, that is in an intracellular epitope of the protein.
- the scFv or Fab or TCR does not specifically bind to the peptide in its wild-type form.
- the method comprises a step of: positively selecting for scFv or Fab or T cell receptors that bind to the first form in the presence of a competitor second form of the peptide portion, wherein the second form is selected from the group consisting of a wild-type form and a peptide with a different mutant residue than the first form.
- FIG. 1 Generation of MANAbody. The process of MANAbody generation is outlined with the competitive phage selection highlighted at the center.
- Fig. 2A-2E Selective binding of phage and purified scFv to mutant monomers.
- Fig. 3A-3D Selective binding of candidate phage clones or purified D10 scFv to cells displaying mutant peptides on the cell surface.
- T2 or T2A3 cells were pulsed with indicated peptides and then incubated with D10 phage (Fig. 3A), purified D10 scFv (Fig. 3B), or C9 phage (Fig. 3C) before analysis of the stained cells by flow cytometry.
- ELA, LLG negative control peptides; for C9 phage, KRAS(WT) was used as a negative control peptide.
- Fig. 3D scFv-mediated, complement-dependent cell killing.
- CDC assay was performed by incubating T2 cells with 10% rabbit complement and D10 scFv or D10-7 scFv preconjugated to anti-V5 antibody, after T2 cells were pulsed or unpulsed or pulsed with the indicated peptides.
- FIG. 4A-4B Selective affinity of D10 MANAbody.
- Fig. 4A Selective binding of D10 MANAbody to KRAS(G12V)-HLA-A2. Monomers folded with indicated peptides and HLA molecules were incubated with D10 MANAbody at different dilutions, followed by ELISA with anti-human IgG antibody. P ⁇ 0.0001 comparing KRAS G12V HLA-A2 against every other monomer at 1 ⁇ g/mL dilution.
- FIG. 4B Selective binding of D10 MANAbody to cells displaying mutant peptides on the cell surface. T2 cells were unpulsed or pulsed with indicated peptides and then incubated with D10 MANAbody or with an isotype control antibody, before analysis of the stained cells by flow cytometry.
- FIG. 5 Linear presentation of scFv/M13 ⁇ open reading frame in the phagemid. pelB, pelB periplasmic secretion signal; V L and V H , light and heavy chains in scFv; myc, myc tag; TEV, TEV protease cleavage recognition sequence; M13 ⁇ , M13 ⁇ coat protein.
- Fig. 6A-6C Flowchart of competitive selection. The selection process consisted of 10 rounds of selection and amplification, which were divided into three phases: enrichment phase (Fig. 6A; rounds 1-3), competitive phase (Fig. 6B; rounds 4-8), and final selection phase (Fig. 6C; rounds 9- 10). Ratio of mutant (MUT) monomer to wild type (WT) competitive monomer used in each competitive round is shown.
- Fig. 7A-7B Binding of phage after different selection phases. Monomers folded with the indicated peptides and HLA molecules were incubated with phage (en masse) at different dilutions, followed by ELISA with anti-M13 antibody.
- Fig. 7A Binding of phage collected after the enrichment phase.
- Fig. 7B Binding of phage collected after the final selection phase. KRAS(G12V), KRAS peptides with G12V mutations; KRAS(WT), wild type KRAS peptide.
- Fig. 8 Purified D10 scFv does not bind KRAS peptides not complexed with HLA molecules or denatured monomers. Biotinylated KRAS peptides alone, native monomers, or heat denatured monomers were incubated with purified scFv at different dilutions, followed by ELISA with anti-Flag tag antibody. KRAS(G12V), KRAS peptides with G12V mutation; KRAS(WT), wild type KRAS peptide; No Monomer, well coated with streptavidin without monomer attached. [19] Fig. 9. Selective binding of purified D10-7 scFv to different monomers.
- Fig. 10 Flowchart of modified competitive selection yielding the C9 phage.
- the selection process consisted of 9 rounds of selection and amplification, which were divided into three phases: enrichment phase (rounds 1-5), competitive phase (rounds 6-8), and final selection phase (round 9). Ratio of mutant (MUT) monomer to wild type (WT) competitive monomer used in each competitive round is shown.
- Fig. 11A-E Peptide loading efficiency as assessed by W6/32 antibody staining.
- T2 or T2A3 cells were unpulsed or pulsed with indicated peptides and then incubated with the W6/32 antibody, before analysis of the stained cells by flow cytometry.
- ELA control peptide.
- Fig. 11 A KRAS(G12V)
- Fig. 11B KRAS(WT)
- Fig. 11C EGFR(L858R)
- Fig. 11D EGFR(WT)
- Fig. HE ELA control
- Fig. 12 Selective binding of D10 phage to cells displaying mutant peptides on the cell surface.
- T2 cells were pulsed with indicated peptides and then incubated with D10 phage, C9 phage as control, or no phage before analysis of the stained cells by flow cytometry.
- Fig. 13 Selective binding of C9 phage to cells displaying mutant peptides on the cell surface. T2A3 cells were pulsed with indicated peptides and then incubated with C9 phage or no phage before analysis of the stained cells by flow cytometry. EGFR(L858R), EGFR peptide with L858R mutation; EGFR(WT), wild type EGFR peptide; KRAS(WT), wild type KRAS peptide. [24] Fig. 14. W6/32 antibody-mediated, complement-dependent cell killing. CDC assay was performed by incubating T2 cells with the W6/32 antibody and 10% rabbit complement, after T2 cells were pulsed or unpulsed with indicated peptides. CellTiter-Glo® was used to assess the viability of cells.
- Fig. 15 Selective binding of D10 MANAbody to cells displaying mutant peptides on the cell surface. T2 cells were pulsed with indicated peptides and then incubated with or without D10 MANAbody before analysis of the stained cells by flow cytometry. A control antibody (7 A) was also used.
- Fig. 16 shows an Enzyme Linked Immunosorbant Assay using beta catenin S45F specific scFvs presented on bacteriophage.
- CTNNB 1 S45F scFv candidate (E10): Phage ELISA (normalized). Legend indicates dilutions of phage used. Monomers and phage clone used labeled on the X-axis. * indicates identical sequences.
- Both scFvs show significantly more binding to the Mutant epitope (CTNNB 1 S45F) than the WT. Both scFvs show increased binding to the mutant epitope HLA- A3 complex when compared to the wild-type complex. See Example 11.
- FIG. 17 shows results of a flow cytometric assay of E10 CTNNB S45F phage staining.
- Phage clone is specific to CTNNB S45F peptide-pulsed cells.
- scFv is directed against CTNNB 1 (Beta Catenin) S45F mutation.
- W6/32 data shows an increase in antibody binding over b2m (negative control) showing that the mutant and wild-type peptide can be presented on HLA-A3 complexes present on the T2A3 cell line.
- E10 phage staining shows that the scFv binds specifically to S45F epitopes (80,400k MFUs) over control peptides (600-800 MFU).
- Rows labeled 1-5 demonstrate that both the mutant and wild-type beta catenin epitopes can be presented on cell surface HLA-A3 complexes.
- Rows labeled 6-9 show the mean fluorescent intensity (MFI) of the E10 phage bound to T2A3 cells pulsed with the indicated peptide.
- E10 phage recognizes the mutant peptide specifically, and does not bind to cell surface presented complexes pulsed with either the wild-type or control (K3WT) peptide.
- the histogram provides an alternative representation of the specificity of the E10 phage. See Example 11.
- Fig. 18 shows results of a complement dependent cytotoxicity assay (CDC). CDC with CTG (Cell Titer GloTM) on T2A3 Cells with E10 (CTNNB 1 S45F HLA-A3) scFv:anti-V5 Conjugate.
- CDC complement dependent cytotoxicity assay
- Figs. 20 (table) and 21 (histogram) show results of samples labeled 1-7 in the table and demonstrate that both the mutant EGFR T790M epitopes (9-mer and 10-mer) can be presented on cell surface HLA-A2 complexes.
- Rows labeled 8-10 in the table of Fig. 20 show the mean fluorescent intensity (MFI) of the D3E6 phage bound to T2 cells pulsed with the indicated peptide.
- D3E6 phage recognizes the mutant peptide specifically, and does not bind to cell surface presented complexes pulsed with control peptides.
- the histogram (Fig. 21) is an alternative representation showing the specificity of the D3E6 phage.
- Figs. 22-25 (table in Fig. 22 and flow cytometry in Figs. 23-25) provide further confirmation that the D3E6, D2D8, and D2D6 clones recognize the mutant peptides specifically, and do not bind to cell surface presented complexes pulsed with control peptides.
- Fig. 23 EGFR T790M clone 1 ("D3E6") staining of T2 cells; Fig.
- EGFR T790M clone 2 (“D2D8") staining of T2 cells
- Fig. 25 EGFR T790M clone 3 (“D2D6”) staining of T2 cells. See Examples 12 and 13.
- Fig. 26 shows results of an ELISA which tested precipitated phage. High specificity for KRAS G12V in HLA-A2 was observed for the F10 candidate. Legend indicates dilutions of phage used. Monomers used are indicated on the X-axis. See Example 10.
- Fig. 27 provides a histogram of results from a flow cytometry assay showing that F10 affinity matured variants can specifically recognize the mutant KRAS epitope pulsed on T2 cells over the wild-type control. See Example 10.
- intracellular proteins which may be targeted include without limitations EGFR, KRAS, NRAS, HRAS, p53, PIK3CA, ABL1, beta-catenin, and IDH1/2.
- mutations include those in residues EGFR L858, KRAS G12, KRAS G13, HRAS G12, NRAS G12, HRAS Q61, NRAS Q61, IDH1 R132, beta-catenin S45, IDH2 R140, and IDH2 R172.
- Common mutants include EGFR L858R, KRAS G12V, KRAS G12C, KRAS G12D, HRAS Q61P, NRAS Q61P, HRAS Q61R, NRAS Q61R, HRAS Q61K, NRAS Q61K, EGFR T790M, IDH1 R132H, beta-catenin S45F, IDH2 R140Q, and IDH2 R172K.
- a private or personal disease specific mutation coding for an epitope that is intracellular may be the target of an scFv or Fab or T cell receptors.
- Libraries which can be made and screened include any that produce useful specific binding molecules, such as scFv, Fab, and TCR.
- the complexity of the repertoire of binding molecules is preferably very high.
- the libraries may be made in any suitable vector system, including but not limited to M13 phage, ribosomes, and yeast.
- Fab libraries see Lee et al., Mol Biol. "High-affinity human antibodies from phage- displayed synthetic Fab libraries with a single framework scaffold," 2004 Jul 23;340: 1073-93.
- T cell receptor libraries see Kieke et al., “Selection of functional T cell receptor mutants from a yeast surface-display library," Proc Natl Acad Sci U S A. 1999; 96: 5651-5656.
- the rarity of the desired scFv or Fab or TCR in a library is in some part due to the nature of the desired target.
- the desired target comprises a complex of an HLA molecule, a ⁇ -2-microblobulin protein, and a peptide.
- the desired scFv or Fab or TCR will only recognize a particular epitope that contains a mutant residue, most likely a substitution of one amino acid for another. Moreover, it will not specifically recognize the same macromolecular complex in which the residue is wild-type. Because of this extremely narrow focus, a strong selection process is required, in addition to an extraordinary amount of diversity in the library.
- a positive selection step for the desired scFv or Fab or T cell receptors has been devised which is performed in the presence of a competitor complex.
- the competitor complex comprises wild-type form of the peptide bound to HLA and ⁇ -2 microglobulin.
- the competitor complex may comprise a peptide with a highly similar sequence to the mutant peptide, such as a peptide with one or more additional mutant residues or a peptide with an alternate, non-wild-type, residue at the same residue as the mutant peptide.
- the positive selection agent comprises HLA, ⁇ - 2-microglobulin, and the "mutant" peptide.
- the competitive selection step will be performed repeatedly. As the step is repeatedly performed, the ratio of competitor complex to positive selection agent can be increased.
- the competitive panning is followed by a negative selection step using the competitor complex.
- the competitive complex and/or the positive selection agent may be displayed or expressed on the surface of a cell for the selection step.
- this type of selection process may be used to pan for binding molecules that recognize a single amino acid difference in a protein or peptide that is not part of an HLA/p-2 microglobulin complex.
- the peptide does not represent an intracellular epitope.
- the HLA molecule which is used to present peptide with a mutant residue may be from any HLA gene (A, B, C, E. F, and G) and allele of those genes. More prevalent genes and alleles, such as HLA-A2, HLA-A3, and HLA-B7, will find wider usage among human patients of some groups.
- HLA genes which may be used are HLA DP, DM, DO A, DOB, DQ, and DR.
- useful molecules When useful molecules are identified that specifically bind to a complex of (1) an HLA molecule, (2) a ⁇ -2-microglobulin, and (3) a peptide comprising a mutant residue (found in an intracellular epitope in the full native protein) they can be used for various purposes and in various derivatives.
- the molecules can be bound or attached to a detectable label. Detectable labels can be any that are known in the art including, without limitation, radionuclides, chromophores, enzymes, and fluorescent molecules. Such molecules can be used, for example, to monitor anti-tumor therapy or to detect cancer cells in a sample, or to diagnose cancer.
- the molecules can alternatively be bound, conjugated, or attached to a therapeutic agent.
- Such therapeutic agents can be specifically targeted to cells expressing the protein by means of the scFv or Fab or T cell receptor identified.
- Another derivative of the identified molecule that may be usefully made is a chimeric antigen receptor (CAR).
- CAR chimeric antigen receptor
- This derivative includes as part of a single protein, the identified molecule comprising an antibody variable region, a hinge region, a transmembrane region, and an intracellular domain. See, e.g., Curran et al., "Chimeric antigen receptors for T cell immunotherapy: current understanding and future directions," J. Gene Med 2012; 14: 405-415.
- the CDR sequences of a useful molecule may be incorporated into an intact antibody, to form a MANAbody, as described in the examples.
- the useful molecule is not a part of an intact antibody molecule.
- the useful molecule may also be included as part of a chimeric protein with another scFv/antibody, such as an anti-CD3 scFv, to form a bispecific targeting agent.
- a chimeric protein may be used to target T cells to the tumor, inducing anti-tumor activity.
- Any diagnostic technique known in the art can be used with the useful molecules. They can be used on samples that are tissue samples or tissue homogenates, for example. They can be used in immunohistochemistry, ELISA, immunoprecipitation, immunoblots, etc. Detection will be dependent on the detectable label that is attached or used to identify immune complexes. Any detection technique can be used.
- Therapeutic administration can be accomplished using any known means suitable for administering an antibody or specific binding molecule. Administration may be by injection or infusion into the peripheral circulatory system, for example, or intratumoral, intraspinal, intracerebellar, intraperitoneal, etc.
- TCRmimics Other antibodies, termed TCRmimics, have been generated against peptide-HLA complexes in the past (48-49).
- a first important aspect of our study is the generation of antibody-based reagents that differentially recognize HLA complexes containing peptides varying only by a single amino acid.
- a second important aspect of our study is that the variant peptides are commonly found in human cancers.
- T2 cells (ATCC, Manassas, VA) were cultured in RPMI-1640 (ATCC) with 10% FBS (GE Hyclone, Logan, Utah, USA), 1% penicillin streptomycin (Life Technologies), and 20 IU/mL recombinant human IL-2 (ProleukinTM, Prometheus Laboratories) at 37°C under 5% C0 2 .
- T2A3 cells (a kind gift from the Eric Lutz and Liz Jaffee, JHU) were grown in the same conditions as T2 cells but also with the addition of 500ug/mL Geneticin (Life Technologies) and lx Non-Essential Amino Acids (Life Technologies).
- a myc epitope tag followed by a TEV protease cleavage recognition sequence was placed immediately downstream of the variable heavy chain, which was followed in frame by the full length M13 ⁇ coat protein sequence.
- Fig. 5 Successful cloning was confirmed by Sanger sequencing 45 random clones obtained from transformation of a small portion of the ligated product. Twenty-four of the clones contained the expected sequences or silent mutations, 4 contained in-frame mutations within the framework regions, and 17 contained deletions of one or more base pairs, indicating a successful synthesis and cloning fraction of 53%. This was later confirmed following library electroporation as discussed below.
- the diluted bacteria were grown to an OD 6 oo of 0.2-0.4, infected with M13K07 Helper phage (NEB, Ipswich, MA or Antibody Design Labs) at an MOI of 1 and allowed to recover at 37°C for 30 min before shaking at 37°C for an additional 30 min.
- the culture was centrifuged and the cells were resuspended in 2xYT medium with carbenicllin (100 ⁇ g/mL) and kanamycin (50 ⁇ g/mL) and grown overnight at 30° C for phage production.
- the bacterial culture was aliquoted into 50 mL Falcon tubes and pelleted twice, first at 3000 g and then at 12000 g, to obtain clarified supernatant.
- the phage-laden supernatant was precipitated on ice for 40 min with a 20% PEG-8000/2.5 M NaCl solution at a 1:4 ratio of PEG/NaCl:supernatent.
- phage from each 50 mL-culture was centrifuged at 12,000 g for 40 minutes and resuspended in a 1 mL vol IX TBS, 2 mM EDTA.
- Phage from multiple tubes were pooled, re-precipitated, and resuspended to an average titer of 1 x 10 13 cfu/mL in 15 % glycerol.
- the total number of transformants obtained was determined to be 5.5 x 10 9 .
- the library was aliquoted and stored in 15% glycerol at - 80° C.
- DNA from the library was amplified using the following primers (Forward: GGATACCGCTGTCTACTACTGTAGCCG, SEQ ID NO: 1 Reverse: CTGCTCACCGTCACCAATGTGCC, SEQ ID NO: 2) which flank the CDR-H3 region. Additional molecular barcode sequences were incorporated at the 5'-ends of these primers to facilitate unambiguous enumeration of distinct phage sequences.
- the protocols for PCR-amplification and sequencing are previously published in (1). Sequences were processed and translated using a custom SQL database and both the nucleotide sequences and amino acid translations were analyzed using Microsoft Excel.
- a wt KRAS peptide (KLVVVGAGGV; SEQ ID NO: 3) predicted to bind to HLA-A2, a mutant KRAS (G12V) peptide (KLVVVGAVGV; SEQ ID NO: 4) predicted to bind to HLA-A2, a mutant KRAS (G12C) peptide (KLVVVGACGV; SEQ ID NO: 5) predicted to bind to HLA-A2, a mutant KRAS (G12D) peptide (KLVVVGADGV; SEQ ID NO: 6) predicted to bind to HLA-A2, a mutant KRAS (G12V) peptide (VVGAVGVGK; SEQ ID NO: 7) predicted to bind to HLA- A3, a mutant KRAS (G12C) peptide (VVGACGVGK; SEQ ID NO: 8) predicted to bind to HLA- A3, a mutant EGFR (L858R) peptide
- HLA-A2 and HLA- A3 monomers were synthesized by refolding recombinant HLA with peptide and beta-2 microglobulin, purified by gel-filtration, and biotinylated (Fred Hutchinson Immune Monitoring Lab, Seattle, WA). Monomers were confirmed to be folded prior to selection by performing an ELISA using W6/32 antibody (BioLegend, San Diego, CA), which recognizes only folded HLA(59).
- a rabbit anti-HLA-A antibody EP1395Y (Abeam, Cambridge, MA), which recognizes both folded and unfolded HLA, was used as a control for binding of unfolded monomers to the ELISA plates.
- Biotinylated monomers containing HLA and beta-2-microglobulin proteins were conjugated to either MyOne Tl streptavidin magnetic beads (Life Technologies, Carlsbad, CA) or to streptavidin agarose (Novagen, Millipore, Darmstadt, Germany).
- biotinylated monomers were incubated with either 25 ⁇ ⁇ of MyOne Tl beads or 100 ⁇ ⁇ of streptavidin agarose in blocking buffer (PBS, 0.5% BSA, 0.1% Na-azide) for 1 hr at room temperature (RT). After the initial incubation, the complexes were washed 3 times with 1 ml blocking buffer and resuspended in lOOuL blocking buffer.
- blocking buffer PBS, 0.5% BSA, 0.1% Na-azide
- Enrichment phase The enrichment phase of selection consists of rounds 1 to 3. In round one, 1.4 x 10 12 phage (140 uL), representing 250-fold coverage of the library, were incubated for 30 minutes in a mixture of 25ul washed naked MyOne Tl beads and 1 ug (100 uL) heat-denatured HLA-A2 conjugated to MyOne Tl beads. It should be noted that after heat-denaturation, only the biotinylated HLA molecule, but not the peptide or beta-2-microglobulin, will be able to bind the MyOne Tl beads.
- This step is referred to as "negative selection,” necessary to remove any phage recognizing either streptavidin or denatured monomer, present to a small extent in every preparation of biotinylated monomer.
- beads were immobilized with a DynaMag-2 magnet (Life Technologies) and the supernatant containing unbound phage was transferred for positive selection against the mutant KRAS-HLA-A2 monomer. The amount of monomer was decreased from 1 ug in round 1 to 500 ng in round 2 and 250 ng in round 3 and phage were incubated for 30 minutes.
- beads Prior to elution, beads were washed 10 times with 1ml, IX TBS containing 0.05 %, 0.1 %, and 0.25 % Tween-20 in rounds 1 to 3 respectively. Phage were eluted by resuspending the beads in 1 mL of 0.2 M glycine, pH 2.2. After alO-minute incubation, the solution was neutralized by the addition of 150 ⁇ ⁇ of 1 M Tris, pH 9.0. Eluted phage were used to infect 10 mL cultures of mid-log-phase SS320s, with the addition of M13K07 helper phage (MOI of 4) and 2% glucose.
- MOI M13K07 helper phage
- Final selection phase In the final selection phase (rounds 9 -10), 1 ⁇ g each of denatured and native KRAS-(WT)-HLA-A2 monomers was used for negative selection to remove residual wt monomer-binding phage. After negative selection, beads were immobilized with a magnet and the supernatant containing unbound phage was transferred for positive selection with 62.5 ng of mutant KRAS-HLA-A2 monomer, as described for the enrichment phase above.
- Affinity Maturation Affinity maturation of D10 was performed at AxioMx as follows. Briefly, the D10 scFv sequence (SEQ ID NO: 37) was synthesized and used as template for error-prone PCR-based mutagenesis. The resulting mutagenized library underwent three rounds of selection and amplification where the phage was negatively selected against KRAS(WT)-HLA-A2 monomer prior to positive selection against KRAS(G12V)-HLA-A2 monomer and subsequent amplification. Following selection and amplication, potential phage were isolated, sequenced, and tested via ELISA. To identify higher affinity D10 variants.
- the bound phage were incubated with 100 ⁇ ⁇ of rabbit anti-M13 antibody (Pierce, Rockford, IL) diluted 1:2000 in IX TBST for 1 hr at RT, followed by washing an additional 6X times and incubation with 100 ⁇ ⁇ of anti-Rabbit IgG-HRP (Jackson Labs, Bar Harbor, Maine) diluted 1: 10,000 in IX TBST for 45 min at RT. After a final 6 washes with IX TBST, 100 of TMB substrate (Biolegend, San Diego, CA) was added to the well and the reaction was quenched with 1 N HC1 or 2 N sulfuric acid.
- the cells were then infected with 1.6 x 10 M13K07 helper phage (Antibody Design Labs, San Diego, CA) at MOI of 4 in a dep-well 96-well plate and incubated for 30 min at 37°C with no shaking followed by 30 min of shaking.
- the cells were pelleted, resuspended in 300 ⁇ ⁇ of 2xYT medium containing carbenicillin (100 ⁇ g/mL) and kanamycin (50 ⁇ g/mL) and grown overnight at 30°C. Cells were pelleted and the phage-laden supernatant was used for ELISA as described above.
- ELISA with purified scFvs was performed essentially as above, with serial dilutions from a starting concentration of 1 ⁇ g/mL and the use of a 1:2000 diluted anti-Flag-HRP antibody (Abeam) for detection.
- ELISAs with the full-length D10 MANAbody were performed similarly, with serial dilutions from a starting concentration of 1 ⁇ g/mL and a 1:2000 diluted anti-human IgG-HRP antibody as the secondary antibody (Life Technologies).
- Monomer heat denaturation was first performed by diluting monomer into 100 ⁇ ⁇ ddH20 followed by a 5 minute heat block incubation at 100°C.
- BL21 DE3 Gold cells transformed with recombinant plasmids were, grown in 1 liter batches to an OD 6 oo of 1.0 chilled to approximately 20°C and induced with 500 uM IPTG. Protein was expressed overnight at 20°C. The next morning bacteria were pelleted, resuspended in periplasmic extraction buffer (50 mM Tris pH 7.4, 20 % sucrose, 1 mM EDTA, 5 mM MgC12) and incubated on ice for 30 minutes in the presence of 1/10 volume 1 mg/ml lysozyme.
- periplasmic extraction buffer 50 mM Tris pH 7.4, 20 % sucrose, 1 mM EDTA, 5 mM MgC12
- scFv sequences were provided to AxioMx Inc., subcloned into a vector containing a periplasmic localization sequence, and N-terminal Flag and C-terminal His tags. scFv was then purified via nickel chromatography .
- the scFv sequence was grafted on to the trastuzamab (4D5) sequence for recombinant antibody expression. Both heavy and light chain sequences were provided to Geneart. for codon optimization, synthesis, subcloning, and protein production (Geneart, Life Technologies, Carlsbad, CA). An IgG signal sequence was included on each chain for protein expression and antibody secretion using the Expi293TM cell culture system. Following 72 hours of protein expression, antibodies from the one liter culture were purified with column chromatography and eluted in 17 mL PBS aliquoted and shipped at 8.25 mg/mL.
- T2 and T2A3 Cell Staining were washed once in 50 mL PBS and once in 50 mL RPMI-1640 without serum before incubation at 5 x 10 5 cells per mL in serum-free RPMI-1640 containing 50 ⁇ g/mL peptide and 10 ⁇ g/mL human beta-2 microglobulin (ProSpec, East Brunswick, NJ) for 4 hr or overnight at 37°C.
- the pulsed cells were pelleted, washed once in stain buffer (PBS containing 0.5% BSA, 2 mM EDTA, and 0.1% sodium azide) and resuspended in stain buffer.
- Phage staining was performed at 4°C with ⁇ 1 x 10 9 phage for 30 min in 200ul total volume, followed by 3 x 4 mL rinses in stain buffer by centrifugation at 500 g for 5 min at 6°C.
- Cells were resuspended in 200 uL stain buffer and stained with 1 uL of rabbit anti-M13 antibody (Pierce, Rockford, IL) on ice for 30 min, followed by three rinses with 4 mL stain buffer. Cells were then resuspended in 200 uL stain buffer and incubated with luL anti-rabbit-Alexa Fluor 488TM (Life Technologies) on ice for 30 min, and rinsed an additional three times before analysis.
- ScFv staining was performed with 1 ⁇ g of scFv for 30 min on ice in 100 uL stain buffer, followed by three rinses in stain buffer at 4°C.
- Cells were then stained with 1 ⁇ L ⁇ of mouse anti-V5-FITC (Life Technologies, Grand Island, NY) for 30 min on ice, followed by three rinses in stain buffer at 6C.
- Antibody staining was performed by resuspending cells in lOOuL stain buffer, and blocking with 1 ug goat anti-human antibody (Life Technologies) on ice 30 min, followed by three rinses at 4°C.
- scFvs were conjugated to an anti-V5 mouse monoclonal antibody (Life Technologies, Grand Island, NY) at a 2: 1 molar ratio overnight at 4°C. Conjuaged scFvs or control anti-HLA antibody W6/32 (Bio-X- Cell) were serially diluted in serum-free RPMI-1640 on ice. Baby rabbit complement (Cedarlane), resuspended with ice cold ddH 2 0, was added to the serially diluted antibody conjugates before transferring 60 ⁇ ⁇ to a 96-well plate.
- Cell Death (%) 100 - (100 x Luciferase Signal / Luciferase Signal M ax)
- CDR-L3 which contained a mixture of serines and tyrosines, two amino acids previously shown to facilitate a minimalist approach to library design (26, 27).
- CDRs in the heavy chain have been shown to play a more significant role in antigen-binding diversity (28-30), and we therefore introduced more degeneracy in the heavy chain CDRs than in the light chain CDRs.
- the synthesized oligonucleotide library was cloned into a phagemid vector for scFv expression.
- This scFv carried a myc tag and was fused to the bacteriophage M13 ⁇ coat protein through a tobacco etch virus (TEV) cleavage site (Fig. 5).
- TEV tobacco etch virus
- This design facilitated purification of scFvs from the phage particles and provided an alternative elution method, accomplished via TEV cleavage, during the subsequent phage- selection process.
- 45 clones were sequenced by the Sanger method. The sequencing showed a library success rate of 53%, as defined by the absence of mutations within the framework region and the presence of the expected amino acids within the CDRs.
- Target selection and competitive strategy for identifying selectively reactive phage clones We chose MANAbody targets based on the frequency of particular mutations and the strength of their predicted binding to HLA alleles.
- KRAS is one of the most commonly mutated genes in human cancers, with mutations particularly prevalent in pancreatic, colorectal, and lung adenocarcinomas.
- G12V mutation was one of the most commonly mutated genes in human cancers, with mutations particularly prevalent in pancreatic, colorectal, and lung adenocarcinomas.
- G12V mutation was the target because a relevant peptide containing it was predicted to bind with high affinity to the HLA-A2, which is the most common HLA allele in many ethnic groups (32). This in silico prediction was made using the NetMHC v3.4 algorithm (33-35).
- the critical mutant residue (V at codon 12) was expected to be exposed on the surface of the HLA protein based on structural studies of other peptide HLA- complexes (36).
- mutant peptides Peptides corresponding to the product of a mutant allele will henceforth be termed "mutant peptides," while peptides representing the product of a wt allele will be referred to as “wt peptides.”
- the mutant KRAS peptide was then folded into a complex (monomer) of HLA-A2 and beta-2- microglobulin [KRAS(G12V)-HLA-A2].
- Two peptides corresponding to wt KRAS sequences were also synthesized and folded with HLA-A2 or HLA-A3 to form KRAS(WT)-HLA-A2 and KRAS(WT)-HLA-A3 monomers, respectively.
- Additional mutant KRAS monomers corresponding to other codon 12 mutations were also assembled. In most cases, monomers were biotinylated to facilitate purification and subsequent experimentation (see Materials and Methods).
- the phage display selection process consisted of 10 rounds of selection and amplification, which were divided into three distinct phases: an enrichment phase (rounds 1-3), a competitive phase (rounds 4-8), and a final selection phase (rounds 9- 10) (Fig. 6).
- the overall objective of these phases was to maximize recovery of clones that bound KRAS(G12V)-HLA-A2 better than KRAS (WT) -HLA- A2 or HLA alone.
- negative selection with heat-denatured biotinylated HLA-A2 monomers was followed by positive selection with KRAS(G12V)-HLA-A2 (Fig. 6A and Materials and Methods).
- the amount of KRAS(G12V)-HLA-A2 monomer was reduced to enrich for stronger binders.
- the novel competitive phase described in this study was intended to enrich for the rare mutant KRAS-(G12V)-HLA-A2 binders over KRAS (WT) -HLA- A2 binders and the much more frequent pan-HLA binders that we expected to be present in the library following the enrichment phase.
- Each round of the competitive phase began with negative selection using denatured HLA-A2 and native HLA-A3 monomers (Fig. 6B). Then, the phage were simultaneously incubated with KRAS (G 12V) -HLA- A2 bound to streptavidin magnetic beads and KRAS(WT)-HLA-A2 bound to streptavidin agarose beads.
- KRAS(WT)-HLA-A2 served as a competitor, as phage bound to it would not be recovered in the magnetic bead trapping step (Fig. 6B).
- decreasing amounts of KRAS(G12V)-HLA-A2 but the same amount of KRAS(WT)-HLA-A2 were employed in an attempt to enrich for high affinity binders.
- each round started with stringent negative selection using a vast excess of denatured and native KRAS (WT) -HLA- A2 monomer and proceeded with positive selection with KRAS (G 12V) -HLA- A2 monomer (Fig. 6 ).
- DIO scFv did not show any binding above background to KRAS(WT)-HLA-A2, KRAS(WT)-HLA-A3, or to other KRAS mutants (KRAS G12C or KRAS G12D) bound to HLA-A2. Additionally, DIO scFv did not bind to KRAS peptides when not complexed with HLA proteins (Fig. 8). These results demonstrate successful selection for scFv bound to peptides in the context of HLA.
- a peptide (KITDFGRAK; SEQ ID NO: 9) containing this mutation was predicted to bind at high-affinity to the HLA- A3 allele when analyzed by the NetMHC v3.4 algorithm.
- IPTG Isopropyl ⁇ -D-l-thiogalactopyranoside
- a phage clone (C9; SEQ ID NO: 39) that showed selective binding to mutant EGFR peptide complexed to HLA- A3 [EGFR(L858R)-HLA- A3 ] , compared to a variety of control monomers, including wt EGFR bound to HLA- A3 (Fig. 2D).
- the C9 scFv generated from this clone showed similar selective binding to EGFR(L858R)-HLA-A3 (Fig. 2E).
- T2 cell line was derived from an Epstein-Barr virus-transformed human lymphoblast line defective in presentation of endogenous HLA-associated peptide antigens due to a deletion that involves genes for TAP1 and TAP2 peptide transporters (41).
- T2A3 is a modified version of T2 with stable expression of the HLA-A3 transgene (42, 43).
- T2 and T2A3 cells express low levels of HLA that can be stabilized by addition of exogenous HLA- binding peptides, and thus can serve as a platform for assaying interactions with specific HLA-binding peptides (44, 45).
- KRAS(G12V), KRAS(WT), or a negative control peptide To assess loading efficiency, we used the W6/32 antibody that targets HLA molecules stabilized by any HLA-binding peptides. The efficiency of peptide loading between wild type and mutant peptides were comparable as suggested by anti-W6/32 staining (Fig. 11).
- T2 cells pulsed with the mutant KRAS(G12V) peptide could be targeted by D10 scFv and killed in a Complement-Dependent Cytotoxicity (CDC) assay.
- CDC Complement-Dependent Cytotoxicity
- the antibody killed peptide-pulsed T2 cells efficiently in the presence of complement (Fig. 14).
- Both scFvs killed the KRAS(G12V)- pulsed T2 cells in a dose-dependent fashion and the affinity-matured D10-7 scFv showed a remarkable improvement in killing efficiency (EC50 of 0.79 nM for D10-7 vs. EC50 of 11.2 nM for DIO, Fig. 3D).
- cells pulsed with KRAS(WT) or not pulsed with exogenous peptides showed only marginal cell death.
- the DIO MANAbody interacted with KRAS(G12V)-HLA-A2, as assessed by ELISA (Fig. 4A). No binding was observed to the KRAS(WT)-HLA-A2 monomer or to any other monomer tested.
- the DIO MANAbody also showed relatively stronger staining of T2 cells pulsed with the mutant KRAS(G12V) peptide, compared to those pulsed with KRAS (WT) or a negative control peptide (Fig. 4B, Fig. 15).
- the observed half-life of the full- length DIO MANAbody was similar to that of its scFv derivative when assessed for its monovalent dissassociation.
- DIO MANAbody retained the high specificity and low dissociation rate constant observed with the DIO scFv.
- CTNNB 1 is the gene name coding for protein beta-catenin. These names are used interchangeably in this document.
- the first change is the inclusion of cells from cell lines that express the particular HLA allele that is being screened for. However, these cells that do not contain the relevant mutation of interest.
- We add these cells to the negative selection step that occurs at the beginning of each round the same step where we interrogate the phage against denatured HLA and naked streptavidin beads).
- the cells can be added to this step for the first two rounds or for the duration of screening.
- the purpose of this step is to remove any phage that bind to similar HLA-epitope sequences as our mutant epitope.
- KRAS G12V-HLA-A2 clone FIO Phage selection for the FIO clone was carried out as described for C9 phage selection, with the exception that mutant [KRAS(G12V)- HLA-A2] and wild type [KRAS(WT)-HLA-A2] monomers were used. This demonstrates that multiple scFv candidates can be identified for a given HLA complex.
- KRAS(wt)-HLA-A2 signal remains near background, as does the F10 scFv (this is due to the inclusion of an N-terminal epitope tag).
- F10 affinity matured variants display remarkable binding (as much as a 131-fold increase in mean fluorescence intensity).
- CTNNBl (S45F)-HLA-A3 oncogenic mutation (TTAPFLSGK; SEQ ID NO: 27).
- Phage clone E10 is specific to CTNNB S45F peptide-pulsed cells.
- EGFR T790M The EGFR T790M mutation is the second most frequent EGFR mutation (after L858R). This is a significant mutation because it appears frequently in response to anti-EGFR therapies as a resistance mutation. Additionally evidence in the literature suggests that the T790M mutation is endogenously processed and presented on tumor cells by HLA-A2 complexes (as both 9 and 10 amino acid epitopes).
- Phage Selection Phage selection was done as described above. Potential candidates (with different scFv sequences) from two and three and four days of competitive selection (followed by two days of negative selection) were identified. These candidates are referred to as D2D6, D3E6, D2D8. D3E6 looked the most promising among this cohort. [110] The D3E6 scFv sequence is:
- TP53 is the most commonly mutated gene in cancer. We have obtained scFVs capable of binding to the p53 R248W mutation. We are currently testing their specificity, but demonstrate that antibodies against this epitope may be obtained.
- Another common mutation p53 R248Q which is identical in sequence except for the W to Q change, binds in a similar fashion to HLA-A2.
- ABLl E255K mutation (KVYEGVWKK; SEQ ID NO: 26 ).
- ABLl is mutated in -30% of all CMLs.
- E255K mutation confers drug resistance to imatinab and nilotinab.
- the mutation is predicted to reside at position 1 within the epitope. This makes it very difficult for an antibody or TCR to distinguish between mutant and wild type.
- the predicted affinity of HLA-A3 for the mutant epitope is 10-fold higher than the predicted wild type affinity (29 nM vs. 228 nM).
- proteolytic processing of epitopes with different N-terminal amino acids may results in different cleavage products, thus affecting endogenous presentation. This suggests that scFv recognition of both mutant and wild type epitopes (with mutations at position 1) may not hinder in vivo mutant epitope specificity.
- thermostabilization and affinity maturation of an antibody Protein engineering, design & selection : PEDS 26(2): 151-164.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Virology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Hospice & Palliative Care (AREA)
Abstract
Description
Claims
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2016235251A AU2016235251B2 (en) | 2015-03-23 | 2016-03-23 | HLA-restricted epitopes encoded by somatically mutated genes |
| CN202211294036.6A CN115873129A (en) | 2015-03-23 | 2016-03-23 | HLA-restricted epitopes encoded by somatic mutant genes |
| CN201680028347.4A CN108137685B (en) | 2015-03-23 | 2016-03-23 | HLA-restricted epitopes encoded by somatic mutation genes |
| JP2017549815A JP6944877B2 (en) | 2015-03-23 | 2016-03-23 | HLA restrictive epitope encoded by a somatic mutation gene |
| EP16769561.8A EP3286222A4 (en) | 2015-03-23 | 2016-03-23 | Hla-restricted epitopes encoded by somatically mutated genes |
| US15/560,241 US20180086832A1 (en) | 2015-03-23 | 2016-03-23 | Hla-restricted epitopes encoded by somatically mutated genes |
| CA2980292A CA2980292A1 (en) | 2015-03-23 | 2016-03-23 | Hla-restricted epitopes encoded by somatically mutated genes |
| AU2022201421A AU2022201421A1 (en) | 2015-03-23 | 2022-03-02 | HLA-restricted epitopes encoded by somatically mutated genes |
| US18/351,087 US20240166751A1 (en) | 2015-03-23 | 2023-07-12 | Hla-restricted epitopes encoded by somatically mutated genes |
| AU2025202102A AU2025202102A1 (en) | 2015-03-23 | 2025-03-24 | HLA-restricted epitopes encoded by somatically mutated genes |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562136843P | 2015-03-23 | 2015-03-23 | |
| US62/136,843 | 2015-03-23 | ||
| US201562186455P | 2015-06-30 | 2015-06-30 | |
| US62/186,455 | 2015-06-30 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/560,241 A-371-Of-International US20180086832A1 (en) | 2015-03-23 | 2016-03-23 | Hla-restricted epitopes encoded by somatically mutated genes |
| US18/351,087 Division US20240166751A1 (en) | 2015-03-23 | 2023-07-12 | Hla-restricted epitopes encoded by somatically mutated genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016154246A1 true WO2016154246A1 (en) | 2016-09-29 |
Family
ID=56977729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/023673 Ceased WO2016154246A1 (en) | 2015-03-23 | 2016-03-23 | Hla-restricted epitopes encoded by somatically mutated genes |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US20180086832A1 (en) |
| EP (1) | EP3286222A4 (en) |
| JP (3) | JP6944877B2 (en) |
| CN (2) | CN115873129A (en) |
| AU (3) | AU2016235251B2 (en) |
| CA (1) | CA2980292A1 (en) |
| WO (1) | WO2016154246A1 (en) |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018164637A1 (en) * | 2017-03-08 | 2018-09-13 | Agency For Science, Technology And Research | T cell receptor like antibodies that bind to p53-mhc class i complex |
| WO2018213467A1 (en) * | 2017-05-16 | 2018-11-22 | The Johns Hopkins University | Manabodies and methods of using |
| WO2020172332A1 (en) * | 2019-02-20 | 2020-08-27 | Fred Hutchinson Cancer Research Center | Binding proteins specific for ras neoantigens and uses thereof |
| US11504421B2 (en) | 2017-05-08 | 2022-11-22 | Gritstone Bio, Inc. | Alphavirus neoantigen vectors |
| US11578427B2 (en) | 2019-12-11 | 2023-02-14 | Molecular Partners Ag | Designed ankyrin repeat domains with altered surface residues |
| JP2023507729A (en) * | 2019-12-17 | 2023-02-27 | ザ・ジョンズ・ホプキンス・ユニバーシティー | MANA Bodies Targeting Tumor Antigens and Methods of Use |
| US11591619B2 (en) | 2019-05-30 | 2023-02-28 | Gritstone Bio, Inc. | Modified adenoviruses |
| US11771747B2 (en) | 2020-08-06 | 2023-10-03 | Gritstone Bio, Inc. | Multiepitope vaccine cassettes |
| EP4223771A4 (en) * | 2020-09-29 | 2024-12-11 | Institute Of Microbiology, Chinese Academy Of Sciences | SCREENING AND ANTITUMOR USE OF THE T CELL RECEPTOR SPECIFIC TO A KRAS MUTATION |
| US12257311B2 (en) | 2020-05-12 | 2025-03-25 | Cue Biopharma, Inc. | Multimeric T-cell modulatory polypeptides and methods of use thereof |
| US12331097B2 (en) | 2018-08-16 | 2025-06-17 | Biontech Us Inc. | T cell receptor constructs and uses thereof |
| US12421287B2 (en) | 2016-12-22 | 2025-09-23 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
| WO2025217204A1 (en) * | 2024-04-08 | 2025-10-16 | The Johns Hopkins University | Methods and materials for treating p53+ cancers |
| US12630637B2 (en) | 2025-07-29 | 2026-05-19 | Gritstone Bio, Inc. | Antigen-binding proteins and related methods of use |
Families Citing this family (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016154047A2 (en) * | 2015-03-20 | 2016-09-29 | Memorial Sloan-Kettering Cancer Center | Monoclonal antigen-binding proteins to intracellular oncogene products |
| US11851471B2 (en) | 2017-01-09 | 2023-12-26 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
| IL269000B2 (en) | 2017-03-15 | 2024-06-01 | Cue Biopharma Inc | Methods for modulating an immune response |
| TW201920249A (en) | 2017-09-07 | 2019-06-01 | 美商信號生物製藥公司 | T cell regulatory multimeric polypeptide having binding site and method of use thereof |
| CN111886241A (en) | 2018-01-09 | 2020-11-03 | 库尔生物制药有限公司 | Multimeric T cell modulating polypeptides and methods of use thereof |
| CN111116754A (en) * | 2018-10-30 | 2020-05-08 | 天津亨佳生物科技发展有限公司 | Specific TCR aiming at EGFR L858R gene mutation and application thereof |
| CN111116732A (en) * | 2018-10-30 | 2020-05-08 | 天津亨佳生物科技发展有限公司 | Specific TCR aiming at EGFR L858R gene mutation and application thereof |
| CN111748026A (en) * | 2019-03-29 | 2020-10-09 | 天津亨佳生物科技发展有限公司 | Specific T cell receptor aiming at EGFR L858R gene mutation and application thereof |
| CN111777678A (en) * | 2019-04-04 | 2020-10-16 | 天津亨佳生物科技发展有限公司 | EGFR L858R new antigen epitope peptide and application thereof in treating tumors |
| CN111848781A (en) * | 2019-04-25 | 2020-10-30 | 天津亨佳生物科技发展有限公司 | Specific T cell receptor aiming at EGFR L858R gene mutation and application thereof |
| CN110172089B (en) * | 2019-06-11 | 2020-01-07 | 北京鼎成肽源生物技术有限公司 | KRAS mutant multi-antigen combination, targeting KRAS mutant tumor CTL and application thereof |
| WO2021055594A1 (en) * | 2019-09-20 | 2021-03-25 | Cue Biopharma, Inc. | T-cell modulatory polypeptides and methods of use thereof |
| US20220378890A1 (en) * | 2019-09-26 | 2022-12-01 | Board Of Regents, The University Of Texas System | Immunogenic egfr peptide compositions and their use in the treatment of cancer |
| WO2021087840A1 (en) * | 2019-11-07 | 2021-05-14 | 武汉华大吉诺因生物科技有限公司 | Tumor immunotherapy polypeptide and application thereof |
| JP2023502625A (en) * | 2019-11-15 | 2023-01-25 | グリットストーン バイオ インコーポレイテッド | Antigen-binding proteins that target shared neoantigens |
| EP4211149A4 (en) | 2020-09-09 | 2024-10-09 | Cue Biopharma, Inc. | MHC CLASS II T-CELL MODULATING MULTIMER POLYPEPTIDES FOR THE TREATMENT OF TYPE 1 DIABETES MELLITUS (T1D) AND METHODS OF USE THEREOF |
| WO2022099157A1 (en) * | 2020-11-06 | 2022-05-12 | Cue Biopharma, Inc. | Antigen presenting polypeptide complexes and methods of use thereof |
| CA3209741A1 (en) | 2021-02-26 | 2022-09-01 | Shohei Koide | Compositions and methods comprising antibodies that bind to covalent peptide conjugates |
| CN114085281A (en) * | 2021-10-15 | 2022-02-25 | 北京臻知医学科技有限责任公司 | Tumor antigen epitope peptide, polymer and application thereof |
| WO2026062579A1 (en) | 2024-09-19 | 2026-03-26 | Comed Therapeutics Ltd. | Compositions and methods for protein delivery to cells |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030022244A1 (en) * | 2000-03-16 | 2003-01-30 | Ramot University Authority For Applied Research & Industrial Development Ltd. | Single chain antibody against mutant P53 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1485075A4 (en) * | 2002-02-20 | 2006-04-26 | Dyax Corp | Mhc-peptide complex binding ligands |
| JP3738308B2 (en) * | 2002-11-29 | 2006-01-25 | 篤 村口 | Cloning method of antigen-specific lymphocyte antigen receptor gene |
| US7736644B2 (en) * | 2003-06-27 | 2010-06-15 | Amgen Fremont Inc. | Antibodies directed to the deletion mutants of epidermal growth factor receptor and uses thereof |
| AU2005247950B2 (en) * | 2004-05-27 | 2012-02-02 | Receptor Logic, Inc. | Antibodies as T cell receptor mimics, methods of production and uses thereof |
| CN101228187A (en) * | 2005-03-25 | 2008-07-23 | 特拉维夫大学拉莫特有限公司 | Human synthetic single-chain antibody against common epitope of mutant p53 and use thereof |
| US8039594B2 (en) * | 2005-03-25 | 2011-10-18 | Ramot At Tel-Aviv University Ltd. | Human synthetic single-chain antibodies directed against the common epitope of mutant P53 and their uses |
| KR101944557B1 (en) * | 2011-02-11 | 2019-01-30 | 메모리얼 슬로안 케터링 캔서 센터 | Hlarestricted, peptidespecific antigen binding proteins |
-
2016
- 2016-03-23 EP EP16769561.8A patent/EP3286222A4/en active Pending
- 2016-03-23 CN CN202211294036.6A patent/CN115873129A/en active Pending
- 2016-03-23 CA CA2980292A patent/CA2980292A1/en active Pending
- 2016-03-23 US US15/560,241 patent/US20180086832A1/en not_active Abandoned
- 2016-03-23 JP JP2017549815A patent/JP6944877B2/en active Active
- 2016-03-23 CN CN201680028347.4A patent/CN108137685B/en active Active
- 2016-03-23 AU AU2016235251A patent/AU2016235251B2/en active Active
- 2016-03-23 WO PCT/US2016/023673 patent/WO2016154246A1/en not_active Ceased
-
2021
- 2021-04-23 JP JP2021072976A patent/JP7304911B2/en active Active
-
2022
- 2022-03-02 AU AU2022201421A patent/AU2022201421A1/en not_active Abandoned
-
2023
- 2023-04-11 JP JP2023063966A patent/JP2023085528A/en active Pending
- 2023-07-12 US US18/351,087 patent/US20240166751A1/en active Pending
-
2025
- 2025-03-24 AU AU2025202102A patent/AU2025202102A1/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030022244A1 (en) * | 2000-03-16 | 2003-01-30 | Ramot University Authority For Applied Research & Industrial Development Ltd. | Single chain antibody against mutant P53 |
Non-Patent Citations (6)
Cited By (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12421287B2 (en) | 2016-12-22 | 2025-09-23 | Cue Biopharma, Inc. | T-cell modulatory multimeric polypeptides and methods of use thereof |
| EP3592776A4 (en) * | 2017-03-08 | 2021-01-06 | Agency for Science, Technology and Research | T-LYMPHOCYTE RECEPTOR-TYPE ANTIBODIES BINDING TO A CLASS I P53-MHC COMPLEX |
| WO2018164637A1 (en) * | 2017-03-08 | 2018-09-13 | Agency For Science, Technology And Research | T cell receptor like antibodies that bind to p53-mhc class i complex |
| EP3778646A1 (en) * | 2017-03-08 | 2021-02-17 | Agency for Science, Technology and Research | T cell receptor like antibodies that bind to p53-mhc class i complex |
| US11504421B2 (en) | 2017-05-08 | 2022-11-22 | Gritstone Bio, Inc. | Alphavirus neoantigen vectors |
| US11510973B2 (en) | 2017-05-08 | 2022-11-29 | Gritstone Bio, Inc. | Alphavirus antigen vectors |
| US12109257B2 (en) | 2017-05-08 | 2024-10-08 | Gritstone Bio, Inc. | Alphavirus neoantigen vectors |
| JP2020520920A (en) * | 2017-05-16 | 2020-07-16 | ザ・ジョンズ・ホプキンス・ユニバーシティ | MANA body and usage |
| JP7701079B2 (en) | 2017-05-16 | 2025-07-01 | ザ・ジョンズ・ホプキンス・ユニバーシティ | MANA BODY AND METHODS OF USE |
| WO2018213467A1 (en) * | 2017-05-16 | 2018-11-22 | The Johns Hopkins University | Manabodies and methods of using |
| AU2018269370B2 (en) * | 2017-05-16 | 2025-06-05 | The Johns Hopkins University | Manabodies and methods of using |
| US11807662B2 (en) | 2017-05-16 | 2023-11-07 | The Johns Hopkins University | MANAbodies and methods of using |
| JP2024023228A (en) * | 2017-05-16 | 2024-02-21 | ザ・ジョンズ・ホプキンス・ユニバーシティ | MANA body and usage |
| JP7381345B2 (en) | 2017-05-16 | 2023-11-15 | ザ・ジョンズ・ホプキンス・ユニバーシティ | MANA body and usage |
| US12331097B2 (en) | 2018-08-16 | 2025-06-17 | Biontech Us Inc. | T cell receptor constructs and uses thereof |
| US11458191B2 (en) | 2019-02-20 | 2022-10-04 | Fred Hutchinson Cancer Center | Binding proteins specific for RAS neoantigens and uses thereof |
| GB2596461B (en) * | 2019-02-20 | 2023-09-27 | Fred Hutchinson Cancer Center | Binding proteins specific for RAS neoantigens and uses thereof |
| WO2020172332A1 (en) * | 2019-02-20 | 2020-08-27 | Fred Hutchinson Cancer Research Center | Binding proteins specific for ras neoantigens and uses thereof |
| GB2596461A (en) * | 2019-02-20 | 2021-12-29 | Hutchinson Fred Cancer Res | Binding proteins specific for Ras neoantigens and uses thereof |
| US11382954B2 (en) | 2019-02-20 | 2022-07-12 | Fred Hutchinson Cancer Center | Binding proteins specific for RAS neoantigens and uses thereof |
| US12098383B2 (en) | 2019-05-30 | 2024-09-24 | Gritstone Bio, Inc. | Modified adenoviruses |
| US11591619B2 (en) | 2019-05-30 | 2023-02-28 | Gritstone Bio, Inc. | Modified adenoviruses |
| US11578427B2 (en) | 2019-12-11 | 2023-02-14 | Molecular Partners Ag | Designed ankyrin repeat domains with altered surface residues |
| US12435445B2 (en) | 2019-12-11 | 2025-10-07 | Molecular Partners Ag | Designed ankyrin repeat domains with altered surface residues |
| JP2023507729A (en) * | 2019-12-17 | 2023-02-27 | ザ・ジョンズ・ホプキンス・ユニバーシティー | MANA Bodies Targeting Tumor Antigens and Methods of Use |
| US12257311B2 (en) | 2020-05-12 | 2025-03-25 | Cue Biopharma, Inc. | Multimeric T-cell modulatory polypeptides and methods of use thereof |
| US12485183B2 (en) | 2020-05-12 | 2025-12-02 | Cue Biopharma, Inc. | Multimeric T-cell modulatory polypeptides and methods of use thereof |
| US12485184B2 (en) | 2020-05-12 | 2025-12-02 | Cue Biopharma, Inc. | Multimeric T-cell modulatory polypeptides and methods of use thereof |
| US11771747B2 (en) | 2020-08-06 | 2023-10-03 | Gritstone Bio, Inc. | Multiepitope vaccine cassettes |
| EP4223771A4 (en) * | 2020-09-29 | 2024-12-11 | Institute Of Microbiology, Chinese Academy Of Sciences | SCREENING AND ANTITUMOR USE OF THE T CELL RECEPTOR SPECIFIC TO A KRAS MUTATION |
| WO2025217204A1 (en) * | 2024-04-08 | 2025-10-16 | The Johns Hopkins University | Methods and materials for treating p53+ cancers |
| US12630637B2 (en) | 2025-07-29 | 2026-05-19 | Gritstone Bio, Inc. | Antigen-binding proteins and related methods of use |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2018513135A (en) | 2018-05-24 |
| AU2016235251B2 (en) | 2022-03-17 |
| CN108137685B (en) | 2022-11-11 |
| EP3286222A4 (en) | 2018-08-08 |
| CN115873129A (en) | 2023-03-31 |
| EP3286222A1 (en) | 2018-02-28 |
| AU2025202102A1 (en) | 2025-04-10 |
| JP6944877B2 (en) | 2021-10-06 |
| AU2022201421A1 (en) | 2022-03-24 |
| AU2016235251A1 (en) | 2017-10-12 |
| JP2023085528A (en) | 2023-06-20 |
| US20240166751A1 (en) | 2024-05-23 |
| JP2021121190A (en) | 2021-08-26 |
| JP7304911B2 (en) | 2023-07-07 |
| US20180086832A1 (en) | 2018-03-29 |
| CA2980292A1 (en) | 2016-09-29 |
| CN108137685A (en) | 2018-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240166751A1 (en) | Hla-restricted epitopes encoded by somatically mutated genes | |
| JP7303750B2 (en) | Methods and compositions for targeting complexes containing non-classical HLA-I and neoantigens in cancer - Patents.com | |
| JP7324789B2 (en) | Humanized anti-MUC1* antibody | |
| JP7091447B2 (en) | A novel scFv amino acid sequence, a chimeric antigen receptor containing it, and its use. | |
| JP7430924B2 (en) | competitive antigen binding protein | |
| JP2021520209A (en) | Diagnostic Assay for Detecting Tumor Antigens in Cancer Patients | |
| US20200291128A1 (en) | Antibodies and methods of use thereof | |
| US20230074705A1 (en) | Target antigen discovery, phenotypic screens and use thereof for identification of target cell specific target epitopes | |
| EP3655026A2 (en) | Antigen binding regions against fibronectin type iii domains and methods of using the same | |
| HK40091002A (en) | Hla-restricted epitopes encoded by somatically mutated genes | |
| US20200165602A1 (en) | Methods and compositions for generation of binding agents against cell surface antigens | |
| Skoraa et al. | Generation of MANAbodies against KRAS G12V-A2 and EGFR L858R-A3 | |
| Liddy | Molecular engineering of high affinity T-cell receptors for bispecific therapeutics | |
| HK40045824A (en) | Methods and compositions for generation of binding agents against cell surface antigens | |
| HK40040607A (en) | Target antigen discovery, phenotypic screens and use thereof for identification of target cell specific target epitopes | |
| HK40040607B (en) | Target antigen discovery, phenotypic screens and use thereof for identification of target cell specific target epitopes | |
| Memic et al. | Generation of recombinant guinea pig antibody fragments to the human GABAC receptor | |
| HK1226140B (en) | Methods and compositions for generation of binding agents against cell surface antigens | |
| HK1218779B (en) | Target antigen discovery, phenotypic screens and use thereof for identification of target cell specific target epitopes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16769561 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2980292 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15560241 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2017549815 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2016235251 Country of ref document: AU Date of ref document: 20160323 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2016769561 Country of ref document: EP |