WO2016153880A2 - Methods for detection of rnase activity - Google Patents

Methods for detection of rnase activity Download PDF

Info

Publication number
WO2016153880A2
WO2016153880A2 PCT/US2016/022681 US2016022681W WO2016153880A2 WO 2016153880 A2 WO2016153880 A2 WO 2016153880A2 US 2016022681 W US2016022681 W US 2016022681W WO 2016153880 A2 WO2016153880 A2 WO 2016153880A2
Authority
WO
WIPO (PCT)
Prior art keywords
hsa
mir
mioo
mirna
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/022681
Other languages
French (fr)
Other versions
WO2016153880A3 (en
Inventor
Aiming Yu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to US15/558,563 priority Critical patent/US10422003B2/en
Publication of WO2016153880A2 publication Critical patent/WO2016153880A2/en
Publication of WO2016153880A3 publication Critical patent/WO2016153880A3/en
Anticipated expiration legal-status Critical
Priority to US16/577,762 priority patent/US11041201B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/44Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/916Hydrolases (3) acting on ester bonds (3.1), e.g. phosphatases (3.1.3), phospholipases C or phospholipases D (3.1.4)
    • G01N2333/922Ribonucleases (RNAses); Deoxyribonucleases (DNAses)

Definitions

  • compositions and methods for detecting RNase activity are provided.
  • Ribonucleases are a family of nucleases involved in the processing and degradation of RNAs (e.g., mRNAs and noncoding RNAs), which are critical for life cycles and cellular defense against infections. Change in RNase activity may be an indicator of human diseases (e.g., inflammation and cancer) and/or disease status. In addition, determination of RNase contamination is essential for RNA research and discovery.
  • UV-based assays which is less selective and thus unable to provide an accurate quantification.
  • Radioactivity-based assays which requires the production and use of radioactive isotope-labeled RNA substrates.
  • Fluorescence-based assays which requires the production and use of RNA substrates labeled with fluorophores.
  • the traditional Kunitz RNase activity assay is based upon the ultraviolet absorbance of label-free nucleic acids or degraded nucleosides, which is less selective, sensitive and accurate.
  • Recent and current RNase activity assays including those commercially-available kits rely on isotope- or fluorophore-labeled RNAs (or antibodies), and thus offer greater sensitivities to determine very low levels of RNase activities (or indicate RNase protein levels).
  • labeling methods are limited to the access to inexpensive, large quantities of labeled RNA substrates (e.g., micrograms), whereas biological samples such as human sera are comprised of high levels of RNase activities.
  • polynucleotides comprising a tRNA operably linked to a pre- microRNA (pre-miRNA) and an aptamer that binds to a target analyte.
  • pre-miRNA pre- microRNA
  • the tRNA is a methionyl tRNA.
  • the tRNA has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: l .
  • the pre-miRNA is selected from pre-miRNA- 1291, pre-miRNA-34a and pre- miRNA-125-1.
  • the pre-miRNA- 1291 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to the miRBase Accession No.
  • the pre-miRNA-34a comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000268 or SEQ ID NO:2.
  • the pre-miRNA- 125-1 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000446.
  • the pre-miRNA- 1291 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity, to SEQ ID NO: 12.
  • the pre- miRNA-34a comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO:2.
  • the pre-miRNA- 125-1 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 14.
  • sequence identity e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 14.
  • the polynucleotide comprises a methionyl tRNA operably linked to a pre- miRNA-1291. In varying embodiments, the polynucleotide comprises a methionyl tRNA operably linked to a pre-miRNA-34a. In varying embodiments, the polynucleotide comprises a methionyl tRNA operably linked to a pre-miRNA- 125-1.
  • the methionyl tRNA operably linked to the pre-miRNA-1291 has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 13.
  • the methionyl tRNA operably linked to the pre-miRNA-34a has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO:3.
  • the methionyl tRNA operably linked to the pre-miRNA- 125-1 has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 15.
  • the tRNA operably linked to a pre-microRNA comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to a
  • polynucleotide selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 13 and SEQ ID NO: 15.
  • the stem-loop anticodon of the tRNA is replaced with the pre-miRNA.
  • the aptamer binds to a dye selected from the group consisting of malachite green, tetramethylrosamine, sulforhodamine B, and
  • the aptamer binds to malachite green.
  • the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity, to SEQ ID NO:9.
  • the aptamer is inserted or located 5' to the pre-miRNA. In some embodiments, the aptamer is inserted or located 3' to the pre-miRNA.
  • the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity, to SEQ ID NO: 10.
  • the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 11.
  • compositions comprising a polynucleotide as described above and herein, and an analyte bound by the aptamer.
  • the analyte bound by the aptamer elicits a detectable signal, e.g., a fluorescent signal.
  • kits comprising a polynucleotide and/or a composition as described above and herein.
  • kits for detecting RNase activity comprising:
  • the test sample is a biological sample.
  • the biological sample is a fluid sample selected from the group consisting of serum, blood, plasma, saliva, sweat, tears, milk, semen, urine, and vaginal secretions.
  • the biological sample is a biopsy.
  • the RNase is one or more ribonucleases selected from the group consisting of RNAse A (RNase 1), RNase H, RNase III, RNase P, RNase L, RNase Tl, RNase T2, RNase U2, and angiogenin (RNase 5).
  • RNase 1 RNAse A
  • RNase III ribonucleases selected from the group consisting of RNAse A (RNase 1), RNase H, RNase III, RNase P, RNase L, RNase Tl, RNase T2, RNase U2, and angiogenin (RNase 5).
  • RNase 5 angiogenin
  • polynucleotide refers to polymers composed of
  • nucleotide refers to a chemical moiety having a sugar (modified, unmodified, or an analog thereof), a nucleotide base (modified, unmodified, or an analog thereof), and a phosphate group (modified, unmodified, or an analog thereof).
  • Nucleotides include deoxyribonucleotides, ribonucleotides, and modified nucleotide analogs including, for example, locked nucleic acids (“LNAs”), peptide nucleic acids (“PNAs”), L-nucleotides, ethylene-bridged nucleic acids (“EN As”), arabinoside, and nucleotide analogs (including abasic nucleotides).
  • LNAs locked nucleic acids
  • PNAs peptide nucleic acids
  • EN As ethylene-bridged nucleic acids
  • nucleotide analogs including abasic nucleotides.
  • nucleic acid refer to a nucleotide, oligonucleotide, polynucleotide, or any fragment thereof and to naturally occurring or synthetic molecules.
  • RNA may be used in the methods described herein and/or may be converted to cDNA by reverse-transcription and/or RNA for use in the methods described herein.
  • a "microRNA,” “miR,” or “miRNA” refer to the unprocessed or processed RNA transcript from a miRNA gene.
  • the unprocessed miRNA gene transcript is also called a “miRNA precursor,” and typically comprises an RNA transcript of about 70-100 nucleotides in length.
  • the miRNA precursor can be processed by digestion with an RNase (for example, Dicer, Argonaut, or RNase III) into an active 19-25 nucleotide RNA molecule. This active 19-25 nucleotide RNA molecule is also called the "processed" miRNA gene transcript or "mature" miRNA.
  • RNase for example, Dicer, Argonaut, or RNase III
  • pre-microRNA or "pre-miR” or pre-miRNA” interchangeably refer to an RNA hairpin comprising within its polynucleotide sequence at least one mature micro RNA sequence and at least one dicer cleavable site.
  • pre-miRNA-1291 or “hsa-mir-1291” or “HGNC:MIR1291” interchangeable refer to an RNA polynucleotide having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0006353 (www.mirbase.org) or SEQ ID NO:4.
  • pre-miRNA-34a or “hsa-mir-34a” or “HGNC :MIR34A” interchangeable refer to an RNA polynucleotide having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000268 (www.mirbase.org) or SEQ ID NO:2.
  • pre-miRNA-125-1 or “hsa-mir-125b-l” or “HGNC:MIR125B1” interchangeable refer to an RNA polynucleotide having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000446 (www.mirbase.org) or SEQ ID NO:6.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., share at least about 80% identity, for example, at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity over a specified region to a reference sequence, e.g., the tRNA, pre-microRNA and tRNA/microRNA hybrid polynucleotide molecules described herein, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithms (e.g., BLAST, ALIGN, FASTA or any other known alignment algorithm) or by manual alignment and visual inspection.
  • sequence comparison algorithms e.g., BLAST, ALIGN, FASTA or any other known alignment algorithm
  • sequences are then said to be “substantially identical.”
  • This definition also refers to the compliment of a test sequence.
  • the identity exists over a region that is at least about 10, 15, 20, 25, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120 nucleotides in length, or over the full-length of a reference sequence.
  • siRNA refers to any nucleic acid molecule capable of down regulating ⁇ i.e., inhibiting) gene expression in a mammalian cells (preferably a human cell).
  • siRNA includes without limitation nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hai in RNA (shRNA).
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hai in RNA
  • the sense strand of a siRNA molecule may also include additional nucleotides not complementary to the antisense region of the siRNA molecule.
  • antisense region refers to a nucleotide sequence of a siRNA molecule complementary (partially or fully) to a target nucleic acid sequence.
  • the antisense strand of a siRNA molecule may include additional nucleotides not complementary to the sense region of the siRNA molecule.
  • the terms "piRNA” and “Piwi -interacting RNA” are interchangeable and refer to a class of small RNAs involved in gene silencing. PiRNA molecules typically are between 26 and 31 nucleotides in length.
  • snRNA and "small nuclear RNA” are interchangeable and refer to a class of small RNAs involved in a variety of processes including RNA splicing and regulation of transcription factors.
  • the subclass of small nucleolar RNAs (snoRNAs) is also included.
  • the term is also intended to include artificial snRNAs, such as antisense derivatives of snRNAs comprising antisense sequences directed against the ncRNA.
  • operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
  • a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present.
  • Expression is meant to include the transcription of any one or more of transcription of a microRNA, siRNA, piRNA, snRNA, IncRNA, antisense nucleic acid, or mRNA from a DNA or RNA template and can further include translation of a protein from an mRNA template.
  • the promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked" to the coding sequence.
  • homologous region refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region” is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term “homologous, region,” as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule can have two homologous regions which are capable of hybridizing to each other. Thus, the term
  • homologous region includes nucleic acid segments with complementary sequence.
  • Homologous regions may vary in length, but will typically be between 4 and 40 nucleotides (e.g., from about 4 to about 40, from about 5 to about 40, from about 5 to about 35, from about 5 to about 30, from about 5 to about 20, from about 6 to about 30, from about 6 to about 25, from about 6 to about 15, from about 7 to about 18, from about 8 to about 20, from about 8 to about 15, etc.).
  • nucleotides e.g., from about 4 to about 40, from about 5 to about 40, from about 5 to about 35, from about 5 to about 30, from about 5 to about 20, from about 6 to about 30, from about 6 to about 25, from about 6 to about 15, from about 7 to about 18, from about 8 to about 20, from about 8 to about 15, etc.
  • complementary and complementarity are interchangeable and refer to the ability of polynucleotides to form base pairs with one another.
  • Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions.
  • Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G).
  • 100% complementary refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region.
  • Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other and can be expressed as a percentage.
  • a "target site” or “target sequence” is the nucleic acid sequence recognized (i.e., sufficiently complementary for hybridization) by an antisense oligonucleotide or inhibitory RNA molecule.
  • the term "subject” refers to a mammal, such as a human, but can also be another animal such as a domestic animal (e.g., a dog, cat, or the like), a farm animal (e.g., a cow, a sheep, a pig, a horse, or the like) or a laboratory animal (e.g., a monkey, a rat, a mouse, a rabbit, a guinea pig, or the like).
  • the term "patient” refers to a subject who is, or is suspected to be, afflicted with a disease.
  • the terms "effective amount” or “pharmaceutically effective amount” or “therapeutically effective amount” of a composition is a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in, the symptoms associated with a disease that is being treated.
  • the amount of a composition of the invention administered to the subject will depend on the type and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease. The skilled artisan will be able to determine appropriate dosages depending on these and other factors.
  • the compositions of the present invention can also be administered in combination with one or more additional therapeutic
  • Figure 1 illustrates high-yield production of recombinant miRNA/siRNA agents in E. coli using OnRS-based technology
  • (a) Urea-PAGE analysis of total RNAs showed that there was large variability in the expression of chimeric pre-miRNAs in E. coli using the same tRNA scaffold.
  • Total RNAs isolated from untransformed HST08 (WT) E.coli were used as a control.
  • the heat color gradation indicates the base-pairing probability from 0 to 1.
  • the chimeric tRNA/mir-34a robustly expressed in E.
  • OnRS/miR-124 chimeric miRNAs
  • siRNAs e.g., OnRS/GFP-siRNA
  • E. coli e.g., -15-20% of total RNAs
  • miR-124 and GFP siRNA using the tRNA and tRNA/mir-155 scaffold, respectively.
  • FIG. 2A-D illustrate the fate of recombinant ncRNAs in human cells
  • (a and b) Unbiased deep sequencing study revealed that OnRS-carried miR-124 and GFP- siRNA were precisely processed to target small RNAs, leading to 3 orders of magnitude increase in miR-124 in A549 cells and GFP siRNA in ES-2/GFP cells, respectively. Note the presence of miRNA and siRNA isoforms as well as corresponding passenger strands and other small RNAs at much lower levels.
  • FIG. 3 A-E illustrate OnRS-carried miRNA is biologically/
  • RT-qPCR analysis revealed that mature miR-124 levels retained 3 orders of magnitude higher in A549 cells for 4 days since transfection with OnRS/miR-124, as compared with OnRS/Neg.
  • Western blots showed that OnRS/miR- 124 was effective in reducing the protein expression level of miR-124 target gene STAT3 in A549 cells at 72 h post-transfection.
  • Flow cytometric analyses demonstrated that
  • OnRS/miR-124 was effective in inducing apoptosis in A549 cells at 48 h post-transfection.
  • Cells treated with OnRS/Neg were used as controls, (d) MTT assay showed that
  • OnRS/miR-124 significantly suppressed the proliferation of A549 cells at 72 h post- treatment, as compared to OnRS/Neg. (e) Inhibition of A549 cell proliferation by
  • OnRS/miR-124 was also demonstrated when cell growth was monitored using Icelligence Real-Time Cell analyzer.
  • the arrow points to the time point of ncRNA treatment. Values are mean ⁇ SD of triplicated treatments. *P ⁇ 0.01.
  • FIGS 4A-F illustrate OnRS-carried siRNA is effective for RNAi in vitro and in vivo.
  • GFP fluorescence intensity was sharply reduced in ES-2/GFP cells in vitro at 72 h after transfected with OnRS/GFP-siRNA (a), which was associated with (b) 70-80% lower GFP mRNA levels and (c) 1000-fold higher GFP siRNA levels.
  • OnRS/GFP-siRNA a
  • hepatic GFP fluorescence was significantly suppressed in the GFP-transgenic mouse models in vivo, as demonstrated by microscopic examination of (d) non-fixed and (e) fixed liver slices, as well as (f) RT-qPCR analysis of hepatic GFP mRNA levels. Fixed liver slices were stained with DAPI, and GFP
  • FIG. 5 illustrates the basic principle of the herein described RNase assay method using a malachite green aptamer (MGA) sensor.
  • Figures 6A-E illustrate high-yield large-scale production of chimeric MGA sensor that produces strong and selective fluorescence upon binding to MG.
  • MGA may be inserted at the 5 ' or 3' end of the OnRS scaffold to offer OnRS/MGA5 and
  • OnRS/MGA3 respectively.
  • the heat color gradation indicates the base-pairing probability from 0 to 1.
  • (b) A consistent high-level expression of chimeric MGA in E. coli, e.g., over 50% of OnRS/MGA5 and OnRS/MGA3 in total RNAs.
  • (c) Representative FPLC traces of OnRS/MGA5 during FPLC purification. Insert is urea-PAGE analysis of the collected RNA fractions (1, 2 and 3) eluted at 10.6 min.
  • OnRS/MGA3 led to a shift of the wavelength of MG maximum absorbance from 618 to 630 nm. The same shift was observed when FPLC-purified OnRS/MGA and total RNAs isolated from OnRS/MGA-expressing bacteria were used.
  • the SEPHADEXTM-purified aptamer (OnRS/Seph) and corresponding total RNAs were used as additional controls, (e) Strong and selective fluorescence was shown when MG bound to OnRS/MGA5 or
  • OnRS/MGA3 The same results were obtained when using FPLC-purified OnRS/MGA and OnRS/MGA-containing total RNAs.
  • Figures 7A-E illustrate method to determine RNase activity using chimeric MGA sensor,
  • Dose response was obvious for the exposure to human serum RNases and the intensity of OnRS/MGA-bound MG fluorescence, and addition of RNase inhibitor completely blocked the cleavage of OnRS/MGA by serum RNases.
  • OnRS/MGA was much more susceptible to human RNase A (10 min incubation) than angiogenin (RNase 5; 30 min incubation), (e) Human pancreatic cancer patients showed significantly higher serum RNase activities than benign/normal patients, as determined by the decrease in MGA-bound MG fluorescence intensity ( ⁇ . ⁇ ./ ⁇ / ⁇ ). N 10 in each group. OnRS/MGA5 was used in this study.
  • RNA sensor to detect RNase activity in biological samples.
  • This method is based on the strong and specific fluorescence intensity displayed by malachite green (MG) upon binding to malachite green aptamer (MGA), where chimeric MGA was efficiently produced on large scale (tens of milligrams from 1 L bacterial culture) using tRNA/pre-miRNA non-coding RNA (ncRNA) scaffolds (OnRS) described herein and in co-pending and co-owned US Provisional Application No.
  • the present RNase detection methods are different from current RNase activity assays, such as those commercially-available kits that rely on isotope- or fluorophore-labeled RNAs that are only able to offer microgram quantities of labeled RNA agents but unable to offer milligrams quantities.
  • biological samples such as human sera are comprised of high levels of RNase activities
  • direct determination of these RNase activities requires the use of large quantities (e.g., microgram levels) of labeled RNA agents which is costly and impractical with presently available technologies.
  • the extensive dilution (e.g., 1 : 1,000) of serum sample would affect the RNase activity assay including linear range and accuracy.
  • the herein described label-free method is much simpler and provides direct, selective and accurate measurement of RNase activity in human serum samples, etc.
  • Data are provided to demonstrate the utility of this method to detect serum RNase activities, e.g., in pancreatic cancer patients versus healthy /benign subjects, and thereof may be utilized for diagnosis and/or prognosis.
  • the presently described fluorescence-based method uses label-free RNA substrate bearing a malachite green aptamer (MGA), which produces a selective and sensitive fluorescent absorbance upon binding to malachite green MG.
  • MGA malachite green aptamer
  • Chimeric MGA is produced on a large scale using tRNA/pre-miRNA non-coding RNA (ncRNA) scaffolds (OnRS) recombinant RNA technique (e.g., producing multi-milligrams MGA from 1L bacterial culture), thereby allowing the assay of serum RNase activity without dilution.
  • This method is cost-effective, selective and more accurate.
  • the polynucleotides comprise a tRNA operably linked to a pre- microRNA.
  • the anticodon of the tRNA is replaced with a pre- microRNA molecule.
  • the 3 '-terminus and the 5'- terminus of the pre-microRNA are ligated or fused to the 3 '-terminus and the 5 '-terminus of the tRNA that are created when the anticodon is removed.
  • the tRNA molecule and the pre- microRNA molecule can be, but need not be directly ligated or fused to one another to be operably linked.
  • the pre-microRNA can contain one or more dicer cleavable sites to allow for the high level expression and efficient cleavage of an inserted RNA molecule desired to be expressed from the hybrid tRNA/pre-microRNA
  • the hybrid tRNA/pre-microRNA molecules can be produced by standard recombinant methods, or can be synthetically prepared.
  • the polynucleotides can have one or more chemical modifications, including without limitation, e.g., internucleotide linkages, internucleoside linkages, dideoxyribonucleotides, 2 '-sugar modification, 2 '-amino groups, 2'-fluoro groups, 2'-methoxy groups, 2'-alkoxy groups, 2'- alkyl groups, 2'-deoxyribonucleotides, 2'-0-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, universal base nucleotides, acyclic nucleotides, 5-C-methyl nucleotides, biotin groups, terminal glyceryl incorporation, inverted deoxy abasic residue incorporation, ster
  • the hybrid tRNA/pre-microRNA molecules comprise analog ribonucleotide bases.
  • analog defines possible derivatives of the ribonucleotide originating from the activity of tRNA post-transcriptional modification enzymes of the cell in which they are produced.
  • the analogs of the ribonucleotides A, C, G and U which may be found in a tRNA depend on the cell in which that tRNA is produced and on the position of the ribonucleotide in question in the tRNA. A large number of analogs are given in SRocl et al. (1998) "Compilation of tRNA sequences and sequences of tRNA genes”.
  • RNA modification database data (http://medstat.med.utah.edu/RNAmods/).
  • the analogs of A may be selected more particularly from the group constituted by 1-methyl-A, inosine and 2'- O-methyl-A.
  • the analogs of C may be selected more particularly from the group constituted by 5-methyl-C and 2'-0-methyl-C.
  • the analogs of G may be selected more particularly from the group constituted by 7-methyl-G and 2'-0-methyl-G.
  • the analogs of U may be selected more particularly from the group constituted by pseudouridine, ribothymidine, 2'-0-methyl-ribothymidine, dihydrouridine, 4-thiouridine and 3-(3-amino-3- carb oxy propy l)-uri dine .
  • pseudouridine ribothymidine
  • 2'-0-methyl-ribothymidine dihydrouridine
  • 4-thiouridine 3-(3-amino-3- carb oxy propy l)-uri dine .
  • a tRNA is formed of a single ribonucleotide chain which is capable of folding to adopt a characteristic, so-called cloverleaf secondary structure.
  • This characteristic secondary structure comprises:
  • an acceptor stem composed of the first 7 ribonucleotides of the 5' end of the ribonucleotide chain and the 7 ribonucleotides that precede the last 4 ribonucleotides of the 3' end of the ribonucleotide chain, thus forming a double-stranded structure comprising 6 or 7 pairs of ribonucleotides, it being possible for the ribonucleotides constituted by the first ribonucleotide of the 5' end of the ribonucleotide chain and the ribonucleotide that precedes the last 4 ribonucleotides of the 3' end of the ribonucleotide chain not to be paired;
  • a D arm constituted by 4 pairs of ribonucleotides and a D loop constituted by 8 to 10 ribonucleotides, formed by the folding of a part of the ribonucleotide chain that follows the first 7 ribonucleotides of the 5' end of the ribonucleotide chain;
  • variable loop constituted by from 4 to 21 ribonucleotides and formed by a part of the ribonucleotide chain that follows the stem of the anticodon and the loop of the anticodon;
  • a T arm constituted by 5 pairs of ribonucleotides, and a T loop constituted by 8 ribonucleotides, formed by the folding of a part of the ribonucleotide chain that follows the variable loop and precedes the ribonucleotides of the 3' end of the ribonucleotide chain which are involved in the constitution of the acceptor stem.
  • the hybrid tRNA/pre-microRNA polynucleotides can contain any tRNA known in the art, e.g. for encoding any amino acid.
  • the selection of an appropriate tRNA molecule may be, in part, driven by the host cells to be used for expression of the inserted RNA.
  • the tRNA selected can be from a tRNA encoding for codon preferred by the species of host cell rather than from a rare codon in that species of host cell.
  • the tRNA is a methionyl-tRNA.
  • the tRNA is derived from the host cell used for expression.
  • the tRNA is a mammalian tRNA.
  • the tRNA is a human tRNA.
  • the chimeric tRNA defined above does not comprise the substantially intact stem of the anticodon of the tRNA from which it is derived.
  • the stem of the anticodon of the tRNA before modification is no longer present.
  • the hybrid tRNA/pre-microRNA polynucleotides can contain any pre- microRNA molecule known in the art.
  • the pre-microRNA is selected from human pre-miRNA-1291, human pre-miRNA-34a and human pre-miRNA- 125-1.
  • Other pre-microRNA molecules that can be used in the hybrid tRNA/pre-microRNA polynucleotides include pre-microRNA molecules that express in the host cell (e.g., E. coli host cell) at or above the levels of expression of human pre-miRNA-1291, human pre- miRNA-34a and human pre-miRNA- 125-1 in the same host cell (e.g., E. coli host cell).
  • the pre-microRNA molecule is from a mammalian pre-microRNA molecule.
  • the pre-microRNA molecule is from a human pre- microRNA molecule.
  • the pre-microRNA component of the hybrid tRNA/pre-microRNA polynucleotides is from about 80 nucleotides to about 120 nucleotides in length, e.g., from about 80 nucleotides to about 100 nucleotides in length, e.g., about 80, 85, 90, 95, 100, 105, 110, 115 or 120 nucleotides in length.
  • the pre-microRNA is a human pre-microRNA selected from the group consisting of hsa-let-7a-l (miRBase.org accession no. :
  • MI0000060 hsa-let-7a-2 (MI0000061), hsa-let-7a-3 (MI0000062), hsa-let-7b
  • MI0000063 hsa-let-7c (MI0000064), hsa-let-7d (MI0000065), hsa-let-7e (MI0000066), hsa-let-7f-l (MI0000067), hsa-let-7f-2 (MI0000068), hsa-let-7g (MI0000433), hsa-let-7i (MI0000434), hsa-mir-1-1 (MI0000651), hsa-mir-1-2 (MI0000437), hsa-mir-7-1
  • MI0000466 hsa-mir-9-2 (MI0000467), hsa-mir-9-3 (MI0000468), hsa-mir-lOa
  • MI0000266 hsa-mir-lOb (MI0000267), hsa-mir-15a (MI0000069), hsa-mir-15b
  • MI0000071 MI0000071
  • hsa-mir-18a MI0000072
  • hsa-mir-18b MI0001518
  • hsa-mir-19a MI0000073
  • hsa-mir-19b-l MI0000074
  • hsa-mir-19b-2 MI0000075
  • hsa-mir-20a MI0000076
  • hsa-mir-20b MI0001519
  • hsa-mir-21 MI0000077
  • MI0000082 hsa-mir-26a-l
  • MI0000083 hsa-mir-26a-2
  • MI0000750 hsa-mir-26b
  • MI0000084 hsa-mir-27a
  • MI0000440 hsa-mir-28
  • MI0000086 hsa-mir-29a (MI0000087), hsa-mir-29b-l (MI0000105), hsa-mir-29b-2 (MI0000107), hsa-mir-29c (MI0000735), hsa-mir-30a (MI0000088), hsa-mir-30b
  • MI0000441 hsa-mir-30c-l
  • MI0000736 hsa-mir-30c-2
  • MI0000254 hsa-mir-30d
  • MI0000255 hsa-mir-30e
  • MI0000749 hsa-mir-31 (MI0000089)
  • hsa-mir-32 hsa-mir-32
  • MI0000268 hsa-mir-34b (MI0000742), hsa-mir-34c (MI0000743), hsa-mir-92a-l (MI0000093), hsa-mir-92a-2 (MI0000094), hsa-mir-92b (MI0003560), hsa-mir-93
  • MI0000095 hsa-mir-95
  • MI0000097 hsa-mir-96
  • MI0000098 hsa-mir-98
  • MI0000100 hsa-mir-99a
  • MI0000101 hsa-mir-99b
  • MI0000746 hsa-mir-100
  • MI0000102 hsa-mir-101-1 (MI0000103), hsa-mir-101-2 (MI0000739), hsa-mir-103a-l (MI0000109), hsa-mir-103a-2 (MI0000108), hsa-mir-103b-l (MI0007261), hsa-mir-103b-2 (MI0007262), hsa-mir-105-1 (MI0000111), hsa-mir- 105-2 (MI0000112), hsa-mir-106a (MI0000113), hsa-mir-106b (MI0000734), hsa-mir-107 (MI0000114), hsa-mir-122 (MI0000442), hsa-mir- 124-1 (MI0000443), hsa-mir- 124-2 (MI0000444), hsa-mir-124-3 (MI0000445), hsa-mir-125a (MI0000469), hsa-mir- 125b-
  • MI0000458 hsa-mir-143 (MI0000459), hsa-mir-144 (MI0000460), hsa-mir-145
  • MI0000461 hsa-mir- 146a (MI0000477), hsa-mir- 146b (MI0003129), hsa-mir- 147a (MI0000262), hsa-mir-147b (MI0005544), hsa-mir-148a (MI0000253), hsa-mir-148b (MI0000811), hsa-mir-149 (MI0000478), hsa-mir-150 (MI0000479), hsa-mir-151a (MI0000809), hsa-mir-151b (MI0003772), hsa-mir-152 (MI0000462), hsa-mir-153-1 (MI0000463) , hsa- miir-153-2 (MI0000464), hsa-mir-154 (MI0000480), hsa-mir-155
  • MI0000681 hsa- miir-181a-l
  • MI0000289 hsa-mir-181a-2
  • MI0000269 hsa-mir-181b-l
  • MI0000481 hsa- miir-185
  • MI0000483 hsa-mir-186
  • MI0000483 hsa-mir-187
  • MI0000274 hsa- miir-188
  • MI0000484 hsa-mir-190a
  • MI0000486 hsa-mir-190b
  • MI0000487 hsa- miir-193b (MI0003137), hsa-mir-194-1 (MI0000488), hsa-mir-194-2
  • MI0000732 hsa- miir-195 (MI0000489), hsa-mir-196a-l (MI0000238), hsa-mir-196a-2
  • MI0000240 hsa- miir-199a-l
  • MI0000281 hsa-mir-199b
  • MI0000282 hsa- miir-200a (MI0000737), hsa-mir-200b (MI0000342), hsa-mir-200c
  • MI0000650 hsa- miir-202
  • MI0003130 hsa-mir-203a
  • MI0000283 hsa-mir-203b
  • hsa- miir-208a MI0000251
  • hsa-mir-208b MI0005570
  • hsa-mir-210 MI0000490
  • MI0000286 hsa- miir-211
  • MI0000288 hsa-mir-212
  • MI0000288 hsa-mir-214
  • MI0000290 hsa- miir-215
  • MI0000292 hsa-mir-216a
  • MI0000292 hsa-mir-216b
  • MI0000300 hsa- miir-224
  • MI0000301 hsa-mir-296
  • MI0000747 hsa-mir-297
  • MI0000808 hsa- miir-328 (MI0000804), hsa-mir-329-1 (MI0001725), hsa-mir-329-2
  • MI0000816) hsa- miir-337 (MI0000806), hsa-mir-338 (MI0000814), hsa-mir-339
  • MI0000815) hsa- miir-340 (MI0000802), hsa-mir-342 (MI0000805), hsa-mir-345
  • MI0000825) hsa- miir-346 (MI0000826), hsa-mir-361 (MI0000760), hsa-mir-362 (MI0000762) , hsa- mi r-363 (MI000076), hsa-mir-365a (MI0000767), hsa-mir-365b
  • MI0000769 hsa- mi r-367 (MI0000775), hsa-mir-369 (MI0000777), hsa-mir-370
  • MI0000776 hsa- mi r-377
  • MI0000785 hsa-mir-378a
  • MI0000786 hsa-mir-378b
  • MI0021273 hsa- mi r-379
  • MI0000787 hsa-mir-380
  • MI0000788 hsa-mir-381
  • MI0001444 hsa- mi r-423 (MI0001445), hsa-mir-424 (MI0001446), hsa-mir-425
  • hsa- mi r-433 MI0001723
  • hsa-mir-448 MI0001637
  • MI0001652 hsa- mi r-450a-2 (MI0003187), hsa-mir-450b (MI0005531), hsa-mir-451a
  • hsa- mi r-451b MI0017360
  • hsa-mir-452 MI0001733
  • hsa- mi r-455 MI0003513
  • hsa-mir-466 MI0014157
  • hsa- mi r-484 MI0002468
  • hsa-mir-485 MI0002469
  • MI0003132 hsa- mi r-494
  • MI0003135 hsa-mir-495
  • MI0003135 hsa-mir-496
  • MI0003136 hsa- mi r-497 (MI0003138), hsa-mir-498 (MI0003142), hsa-mir-499a
  • MI0003193 hsa- mi r-507
  • MI0003194 hsa-mir-508
  • MI0003195 hsa-mir-509-1
  • MI0003197 hsa- mi r-511 (MI0003127), hsa-mir-512-1 (MI0003140), hsa-mir-512-2
  • MI0003144 hsa- mir- -515-2 (MI0003147), hsa-mir-516a-l (MI0003180), hsa-mir-516a-2
  • MI0003181 hsa- mir- -516b-l
  • MI0003172 hsa-mir-516b-2
  • MI0003167 hsa-mir-517a
  • MI0003161 hsa- mir- -517b (MI0003165), hsa-mir-517c (MI0003174), hsa-mir-518a-l
  • MI0003170 hsa- mir- -518a-2 (MI0003173), hsa-mir-518b (MI0003156), hsa-mir-518c
  • MI0003159 hsa- mir- -518d (MI0003171), hsa-mir-518e (MI0003169), hsa-mir-518f
  • MI0003154 hsa- mir- -519a-l
  • MI0003178 hsa-mir-519a-2
  • MI0003182 hsa-mir-519b
  • MI0003151 hsa- mir- -519c (MI0003148), hsa-mir-519d (MI0003162), hsa-mir-519e
  • MI0003145 hsa- mir- -520a (MI0003149), hsa-mir-520b (MI0003155), hsa-mir-520c
  • MI0003158 hsa- mir- -520d (MI0003164), hsa-mir-520e (MI0003143), hsa-mir-520f
  • MI0003146 hsa- mir- -520g (MI0003166), hsa-mir-520h (MI0003175), hsa-mir-521-1
  • MI0003176 hsa- mir- -521-2 (MI0003163), hsa-mir-522 (MI0003177), hsa-mir-523
  • MI0003153 hsa- mir- -524 (MI0003160), hsa-mir-525 (MI0003152), hsa-mir-526a-l
  • MIOO 16762 hsa- mir- -548ad
  • MIOO 16770 hsa-mir-548ae-l
  • MIOO 16779 hsa-mir-548ae
  • MI0003559 hsa-mir-555 (MI0003561), hsa-mir-556 (MI0003562), hsa-mir-557
  • MI0003563 hsa-mir-558 (MI0003564), hsa-mir-559 (MI0003565), hsa-mir-561
  • MI0003567 hsa-mir-562 (MI0003568), hsa-mir-563 (MI0003569), hsa-mir-564
  • MI0003570 hsa-mir-566 (MI0003572), hsa-mir-567 (MI0003573), hsa-mir-568
  • MI0003574 hsa-mir-569 (MI0003576), hsa-mir-570 (MI0003577), hsa-mir-571
  • MI0003578 hsa-mir-572 (MI0003579), hsa-mir-573 (MI0003580), hsa-mir-574
  • MI0003581 hsa-mir-575 (MI0003582), hsa-mir-576 (MI0003583), hsa-mir-577
  • MI0003584 hsa-mir-578 (MI0003585), hsa-mir-579 (MI0003586), hsa-mir-580
  • MI0003590 hsa-mir-584 (MI0003591), hsa-mir-585 (MI000359), hsa-mir-586
  • MI0003594 hsa-mir-587 (MI0003595), hsa-mir-588 (MI0003597), hsa-mir-589
  • hsa-mir-590 MI0003602
  • hsa-mir-591 MI0003603
  • hsa-mir-592 MI0003599
  • MI0003604 hsa-mir-593 (MI0003605), hsa-mir-595 (MI0003607), hsa-mir-596
  • MI0003608 hsa-mir-597 (MI0003609), hsa-mir-598 (MI0003610 162), hsa-mir-599 (MI0003611), hsa-mir-600 (MI0003613), hsa-mir-601 (MI0003614), hsa-mir-602
  • MI0003615 hsa-mir-603 (MI0003616), hsa-mir-604 (MI0003617), hsa-mir-605
  • MI0003618 hsa-mir-606 (MI0003619), hsa-mir-607 (MI0003620), hsa-mir-608
  • MI0003621 hsa-mir-609 (MI0003622), hsa-mir-610 (MI0003623), hsa-mir-611
  • MI0003624 hsa-mir-612 (MI0003625), hsa-mir-613 (MI0003626), hsa-mir-614
  • MI0003627 hsa-mir-615 (MI0003628), hsa-mir-616 (MI0003629), hsa-mir-617
  • MI0003631 hsa-mir-618 (MI0003632), hsa-mir-619 (MI0003633), hsa-mir-620
  • MI0003634 hsa-mir-621 (MI0003635), hsa-mir-622 (MI0003636), hsa-mir-623
  • MI0003637 hsa-mir-624 (MI0003638), hsa-mir-625 (MI0003639), hsa-mir-626 (MI0003640) hsa- mi r-627 (MI0003641), hsa-mir-628 (MI0003642), hsa-mir-629
  • MI0003643 hsa- mi r-630 (MI000364), hsa-mir-631 (MI0003645), hsa-mir-632
  • MI0003650 hsa- mi r-636 (MI0003651), hsa-mir-637 (MI0003652), hsa-mir-638
  • MI0003653 hsa- mi r-639 (MI0003654), hsa-mir-640 (MI0003655), hsa-mir-641
  • MI0003658 hsa- mi r-644a (MI0003659), hsa-mir-645 (MI0003660), hsa-mir-646
  • MI0003661 hsa- mi r-647 (MI0003662), hsa-mir-648 (MI0003663), hsa-mir-649
  • MI0003664 hsa- mi r-650 (MI0003665), hsa-mir-651 (MI0003666), hsa-mir-652
  • MI0003682 hsa- mi r-659 (MI0003683), hsa-mir-660 (MI0003684), hsa-mir-661
  • MI0003669 hsa- mi r-662 (MI0003670), hsa-mir-663a (MI0003672), hsa-mir-663b
  • MI0005560 hsa- mi r-887 (MI0005562), hsa-mir-888 (MI0005537), hsa-mir-889
  • MI0005762 hsa- mi r-941-1 (MI0005763), hsa-mir-941-2 (MI0005764), hsa-mir-941-3
  • MI0006272 hsa- mi r-1180 (MI0006273), hsa-mir-1181 (MI0006274), hsa-mir-1182 (MI0006275) , hsa- -mir 1183 (MI0006276), hsa-mir-1184-1 (MI0006277), hsa-mir-1184-2
  • MI0020340 hsa- -mir 1200 (MI0006332), hsa-mir-1202 (MI0006334), hsa-mir-1203
  • hsa- -mir 1204 MI0006337
  • hsa-mir- 1205 MI0006338
  • hsa- -mir 1225 MI0006311
  • hsa-mir-1226 MI0006313
  • hsa-mir-1227 MI0003764
  • hsa- -mir 1233-1 MI0006323
  • hsa-mir- 1233 -2 MI0015973
  • hsa- -mir 1236 MI0006326
  • hsa-mir-1237 MI0006327
  • hsa- -mir 1249 MI0006384
  • hsa-mir-1250 MI0006385
  • hsa-mir-1251 MI0006383
  • hsa- -mir 1264 MI0003758
  • hsa-mir- 1265 MI0006401
  • MI0006403 hsa- -mir 1267 (MI0006404), hsa-mir- 1268a (MI0006405), hsa-mir- 1268b
  • MI0006408 hsa- -mir 1273 a (MI0006409), hsa-mir- 1273 c (MIOO 14171), hsa-mir- 1273 d
  • hsa- -mir 1273h MI0025512
  • hsa-mir-1275 MI0006415
  • hsa- -mir 1277 MI0006419
  • hsa-mir- 1278 MI0006425
  • hsa- -mir 1283-2 MI0006430
  • hsa-mir-1284 MI0006431
  • MI0006351 hsa- -mir 1290
  • MI0006353 hsa-mir-1291
  • MI0006353 hsa-mir-1292
  • hsa- -mir 1293 MI0006355
  • hsa-mir-1294 MI0006356
  • MI0007075 hsa- mir- -1471 (MI0007076), hsa-mir-1537 (MI0007258), hsa-mir-1538
  • MI0007259 hsa- mir- -1539 (MI0007260), hsa-mir-1587 (MIOO 16905), hsa-mir-1825
  • MI0008193 hsa- mir- -1827 (MI0008195), hsa-mir-1908 (MI0008329), hsa-mir-1909
  • MI0008330 hsa- mir- -1910 (MI0008331), hsa-mir-1911 (MI0008332), hsa-mir-1912
  • MI0008333 hsa- mir- -1913 (MI0008334), hsa-mir-1914 (MI0008335), hsa-mir-1915
  • MI0009983 hsa- mir- -1976 (MI0009986), hsa-mir-2052 (MIOO 10486), hsa-mir-2053
  • MI0012063 hsa- mir- -2861 (MI0013006), hsa-mir-2909 (MI0013083), hsa-mir-3064
  • MI0014133 hsa- mir- -3118- 4 (MI0014207), hsa-mir-3118-5 (MI0014243), hsa-mir-3118
  • MI0015981 hsa- mir- -3119- 1 (MI0014134), hsa-mir-3119-2 (MI0014135), hsa-mir-3120
  • MIOO 14136 hsa- mir- -3121 (MIOO 14137), hsa-mir-3122 (MIOO 14138), hsa-mir-3123
  • MIOO 14139 hsa- mir- -3124 (MIOO 14140), hsa-mir-3125 (MIOO 14142), hsa-mir-3126
  • MI0014143 hsa- mir- -3127 (MIOO 14144), hsa-mir-3128 (MIOO 14145), hsa-mir-3129
  • MIOO 14146 hsa- mir- -3130- 1 (MIOO 14147), hsa-mir-3130-2 (MIOO 14148), hsa-mir-3131
  • MI0014151 hsa- mir- -3132 (MI0014152), hsa-mir-3133 (MI0014153), hsa-mir-3134
  • MIOO 14158 hsa- mir- -3137 (MIOO 14160), hsa-mir-3138 (MIOO 14161), hsa-mir-3139 (MI0014162), hsa-mir-3140 (MI0014163), hsa-mir-3141 (MI0014165), hsa-mir-3142 (MI0014166), hsa-mir-3143 (MI0014167), hsa-mir-3144 (MI0014169), hsa-mir-3145 (MI0014170), hsa-mir-3146 (MI0014172), hsa-mir-3147 (MI0014173), hsa-mir-3148 (MI0014175), hsa-mir-3149 (MI0014176), hsa-mir-3150a (MI0014177), hsa-mir-3150b (MI0016426), hsa-mir-3151 (MI0014178), hsa-mir-3152 (MI0014179), hsa-mir
  • MI0015855 hsa- -mi r-4257 (MI0015856) , hsa-mir-4259 (MI0015858), hsa-mir-4260
  • MI0015880 hsa- -mi r-4273 (MI0015881) , hsa-mir-4274 (MI0015884), hsa-mir-4275
  • MI0015883 hsa- -mi r-4276 (MI0015882) , hsa-mir-4277 (MI0015886), hsa-mir-4278
  • MIOO 15898 hsa- -mi r-4290 (MIOO 15899) , hsa-mir-4291 (MIOO 15900), hsa-mir-4292
  • MI0015832 hsa- -mi r-4305 (MIOO 15835) , hsa-mir-4306 (MIOO 15836), hsa-mir-4307
  • MIOO 15840 hsa- -mi r-4311 (MIOO 15841) , hsa-mir-4312 (MIOO 15842), hsa-mir-4313
  • MI0015843 hsa- -mi r-4314 (MIOO 15846) , hsa-mir-4315- 1 (MI0015844), hsa-mir-4315-2
  • MIOO 15847 hsa- -mi r-4319 (MIOO 15848) , hsa-mir-4320 (MI0015849), hsa-mir-4321
  • MI0015852 hsa- -mi r-4322 (MI0015851) , hsa-mir-4323 (MI0015853), hsa-mir-4324
  • MI0015854 hsa- -mi r-4325 (MIOO 15865) , hsa-mir-4326 (MI0015866), hsa-mir-4327
  • MIOO 16766 hsa- -mi r-4428 (MIOO 16767) , hsa-mir-4429 (MIOO 16768), hsa-mir-4430
  • MIOO 17304 hsa- mi r-4674 (MIOO 17305), hsa-mir-4675 (MIOO 17306), hsa-mir-4676
  • MIOO 17307 hsa- mi r-4677 (MIOO 17308), hsa-mir-4678 (MIOO 17309), hsa-mir-4679-1
  • MIOO 17310 hsa- mi r-4679-2 (MIOO 17311), hsa-mir-4680 (MIOO 17312), hsa-mir-4681
  • MIOO 17313 hsa- mi r-4682 (MIOO 17314), hsa-mir-4683 (MIOO 17315), hsa-mir-4684
  • MIOO 17316 hsa- mi r-4685 (MIOO 17317), hsa-mir-4686 (MIOO 17318), hsa-mir-4687
  • MIOO 17326 hsa- mi r-4694 (MIOO 17327), hsa-mir-4695 (MIOO 17328), hsa-mir-4696
  • MI0017332 hsa- mi r-4700 (MI0017333), hsa-mir-4701 (MI0017334), hsa-mir-4703
  • MIOO 17336 hsa- mi r-4704 (MIOO 17337), hsa-mir-4705 (MIOO 17338), hsa-mir-4706
  • MIOO 17349 hsa- mi r-4716 (MIOO 17350), hsa-mir-4717 (MIOO 17352), hsa-mir-4718 (MIOO 17353) hsa- -mi r-4719 (MIOO 17354) , hsa- -m r-4720 (MIOO 17355), hsa-mir-4721
  • MIOO 17356 hsa- -mi r-4722 (MIOO 17357) , hsa- -m r-4723 (MIOO 17359), hsa-mir-4724
  • MIOO 17361 hsa- -mi r-4725 (MIOO 17362) , hsa- -m r-4726 (MI0017363), hsa-mir-4727
  • MIOO 17364 hsa- -mi r-4728 (MIOO 17365) , hsa- -m r-4729 (MIOO 17366), hsa-mir-4730
  • MIOO 17367 hsa- -mi r-4731 (MIOO 17368) , hsa- -m r-4732 (MIOO 17369), hsa-mir-4733
  • MI0017373 hsa- -mi r-4737 (MIOO 17374) , hsa- -m r-4738 (MIOO 17376), hsa-mir-4739
  • MIOO 17377 hsa- -mi r-4740 (MIOO 17378) , hsa- -m r-4741 (MIOO 17379), hsa-mir-4742
  • MIOO 17380 hsa- -mi r-4743 (MIOO 17381) , hsa- -m r-4744 (MIOO 17382), hsa-mir-4745
  • MIOO 17384 hsa- -mi r-4746 (MIOO 17385) , hsa- -m r-4747 (MIOO 17386), hsa-mir-4748
  • MIOO 17387 hsa- -mi r-4749 (MIOO 17388) , hsa- -m r-4750 (MIOO 17389), hsa-mir-4751
  • MIOO 17394 hsa- -mi r-4755 (MIOO 17395) , hsa- -m r-4756 (MIOO 17397), hsa-mir-4757
  • MIOO 17398 hsa- -mi r-4758 (MIOO 17399) , hsa- -m r-4759 (MIOO 17400), hsa-mir-4760
  • MIOO 17404 hsa- -mi r-4764 (MIOO 17405) , hsa- -m r-4765 (MIOO 17406), hsa-mir-4766
  • MIOO 17407 hsa- -mi r-4767 (MIOO 17408) , hsa- -m r-4768 (MIOO 17409), hsa-mir-4769
  • MIOO 17410 hsa- -mi r-4770 (MIOO 17411) , hsa- -m r-4771- 1 (MIOO 17412), hsa-mir-4771-2
  • MIOO 17422 hsa- -mi r-4779 (MIOO 17423) , hsa- -m r-4780 (MIOO 17424), hsa-mir-4781
  • MIOO 17434 hsa- -mi r-4788 (MIOO 17435) , hsa- -m r-4789 (MIOO 17436), hsa-mir-4790
  • MIOO 17978 hsa- mir- -5090 (MIOO 17979), hsa-mir-5091 (MIOO 17980), hsa-mir-5092
  • MIOO 18001 hsa- mir- -5096 (MIOO 18004), hsa-mir-5100 (MI0019116), hsa-mir-5186
  • MI0018165 hsa- mir- -5187
  • MI0018166 hsa-mir-5188
  • MI0018167 hsa-mir-5189
  • MI0018168 hsa- mir- -5190
  • MI0018169 hsa-mir-5191
  • MI0018170 hsa-mir-5192
  • MI0018171 hsa- mir- -5193 (MI0018172), hsa-mir-5194 (MI0018173), hsa-mir-5195
  • MI0019115 hsa- mir- -5572
  • MI0019117 hsa-mir-5579
  • MI0019133 hsa-mir-5580
  • MI0019135 hsa- mir- -5581 (MI0019136), hsa-mir-5582 (MI0019138), hsa-mir-5583-1
  • MI0019139 hsa- mir- -5583-2
  • MI0019140 hsa-mir-5584
  • MI0019141 hsa-mir-5585
  • MIOO 19147 hsa- mir- -5589 (MI0019148), hsa-mir-5590 (MI0019150), hsa-mir-5591
  • MIOO 19293 hsa- mir- -5682 (MIOO 19282), hsa-mir-5683 (MIOO 19284), hsa-mir-5684
  • MIOO 19292 hsa- mir- -5689
  • MIOO 19295 hsa-mir-5690
  • MIOO 19295 MIOO 19295
  • MI0022554 hsa- ⁇ mir- -6720 (MI0022555) hsa- ⁇ mir- -6721 (MI0022556) hsa-mir-6722 (MI0022557 hsa- ⁇ mir- -6723 (MI0022558) hsa- ⁇ mir- -6724 (MI0022559) hsa-mir-6726 (MI0022571 hsa- ⁇ mir- -6727 (MI0022572) hsa- ⁇ mir- -6728 (MI0022573) hsa-mir-6729 (MI0022574 hsa- ⁇ mir- -6730 (MI0022575) hsa- ⁇ mir- -6731 (MI0022576) hsa-mir-6732 (MI0022577 hsa- ⁇ mir- -6733 (MI0022578) hsa- ⁇ mir- -6734 (MI0022579) hsa-
  • MI0022627 hsa- -mi r-6783 (MI0022628) , hsa-mir- -6784 (MI0022629), hsa-mir-6785
  • MI0022630 hsa- -mi r-6786 (MI0022631) , hsa-mir- -6787 (MI0022632), hsa-mir-6788
  • MI0022633 hsa- -mi r-6789 (MI0022634) , hsa-mir- -6790 (MI0022635), hsa-mir-6791
  • MI0022636 hsa- -mi r-6792 (MI0022637) , hsa-mir- -6793 (MI0022638), hsa-mir-6794
  • MI0022639 hsa- -mi r-6795 (MI0022640) , hsa-mir- -6796 (MI0022641), hsa-mir-6797
  • MI0022642 hsa- -mi r-6798 (MI0022643) , hsa-mir- -6799 (MI0022644), hsa-mir-6800
  • MI0022645 hsa- -mi r-6801 (MI0022646) , hsa-mir- -6802 (MI0022647), hsa-mir-6803
  • MI0022648 hsa- -mi r-6804 (MI0022649) , hsa-mir- -6805 (MI0022650), hsa-mir-6806
  • MI0022651 hsa- -mi r-6807 (MI0022652) , hsa-mir- -6808 (MI0022653), hsa-mir-6809
  • MI0022654 hsa- -mi r-6810 (MI0022655) , hsa-mir- -6811 (MI0022656), hsa-mir-6812
  • MI0022657 hsa- -mi r-6813 (MI0022658) , hsa-mir- -6814 (MI0022659), hsa-mir-6815
  • MI0022660 hsa- -mi r-6816 (MI0022661) , hsa-mir- -6817 (MI0022662), hsa-mir-6818
  • MI0022663 hsa- -mi r-6819 (MI0022664) , hsa-mir- -6820 (MI0022665), hsa-mir-6821
  • MI0022666 hsa- -mi r-6822 (MI0022667) , hsa-mir- -6823 (MI0022668), hsa-mir-6824
  • MI0022669 hsa- -mi r-6825 (MI0022670) , hsa-mir- -6826 (MI0022671), hsa-mir-6827
  • MI0022672 hsa- -mi r-6828 (MI0022673) , hsa-mir- -6829 (MI0022674), hsa-mir-6830
  • MI0022675 hsa- -mi r-6831 (MI0022676) , hsa-mir- -6832 (MI0022677), hsa-mir-6833
  • MI0022678 hsa- -mi r-6834 (MI0022679) , hsa-mir- -6835 (MI0022680), hsa-mir-6836
  • MI0022682 hsa- -mi r-6837 (MI0022683) , hsa-mir- -6838 (MI0022684), hsa-mir-6839
  • MI0022685 hsa- -mi r-6840 (MI0022686) , hsa-mir- -6841 (MI0022687), hsa-mir-6842
  • MI0022688 hsa- -mi r-6843 (MI0022689) , hsa-mir- -6844 (MI0022690), hsa-mir-6845
  • MI0022691 hsa- -mi r-6846 (MI0022692) , hsa-mir- -6847 (MI0022693), hsa-mir-6848
  • MI0022694 hsa- -mi r-6849 (MI0022695) , hsa-mir- -6850 (MI0022696), hsa-mir-6851
  • MI0022697 hsa- -mi r-6852 (MI0022698) , hsa-mir- -6853 (MI0022699), hsa-mir-6854
  • MI0022700 hsa- -mi r-6855 (MI0022701) , hsa-mir- -6856 (MI0022702), hsa-mir-6857
  • MI0022703 hsa- -mi r-6858 (MI0022704) , hsa-mir- -6859-1 (MI0022705), hsa-mir-6859-2
  • MI0026420 hsa- -mi r-6859-3 (MI0026421), hsa-mir-6860 (MI0022707), hsa-mir-6861
  • MI0022708 hsa- -mi r-6862-1 (MI0022709), hsa-mir-6862-2 (MI0026415), hsa-mir-6863
  • MI0022710 hsa- -mi r-6864 (MI0022711), hsa-mir- -6865 (MI0022712), hsa-mir-6866
  • MI0022713 hsa- -mi r-6867 (MI0022714), hsa-mir- -6868 (MI0022715), hsa-mir-6869
  • MI0022716 hsa- -mi r-6870 (MI0022717), hsa-mir- -6871 (MI0022718), hsa-mir-6872
  • MI0022719 hsa- -mi r-6873 (MI0022720), hsa-mir- -6874 (MI0022721), hsa-mir-6875
  • MI0022722 hsa- -mi r-6876 (MI0022723), hsa-mir- -6877 (MI0022724), hsa-mir-6878 (MI0022725), hsa-mir-6879 (MI0022726), hsa-mir-6880 (MI0022727), hsa-mir-6881 (MI0022728), hsa-mir-6882 (MI0022729), hsa-mir-6883 (MI0022730), hsa-mir-6884 (MI0022731), hsa-mir-6885 (MI0022732), hsa-mir-6886 (MI0022733), hsa-mir-6887 (MI0022734), hsa-mir-6888 (MI0022735), hsa-mir-6889 (MI0022736), hsa-mir-6890 (MI0022737), hsa-
  • the pre-microRNA is not pre-miRNA-22, pre- miRNA-122, pre-miRNA- 124-2, pre-miRNA-125-2, pre-miRNA-155 or pre-miRNA-221.
  • the hybrid molecules comprise the full-length native pre-micro-RNA.
  • the hybrid molecules comprise fragments or subsequences of the native pre-micro-RNA molecules. Fragments or subsequences of the native pre-micro-RNA molecules that find use will have one or more cleavage sites recognized by and accessible to an endoribonuclease (e.g., Dicer) such that an inserted RNA molecule (e.g., a noncoding RNA (ncRNA), mature microRNA (miRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a Piwi-interacting RNA (piRNA), a small nuclear RNA (snRNA), a small nucleolar RNA (snoRNA), an aptamer) can be cleaved out of or released from the hybrid tRNA/pre-microRNA molecule.
  • ncRNA noncoding RNA
  • miRNA mature microRNA
  • siRNA small interfering RNA
  • the tRNA operably linked to a pre-microRNA comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to a polynucleotide selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 13 and SEQ ID NO: 15.
  • the tRNA operably linked to the pre-microRNA (pre- miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 10.
  • the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 11.
  • the hybrid tRNA/pre-microRNA molecules are further operably linked to an aptamer.
  • the aptamer can be inserted/positioned/located either 5' to the pre-microRNA (as illustrated by SEQ ID NO: 10 - OnRS-2/MGA5) or 3' to the pre- microRNA (as illustrated by SEQ ID NO: 11 - OnRS-2/MGA3).
  • SEQ ID NO: 10 - OnRS-2/MGA5 an aptamer that elicit a detectable signal when bound to their analytes.
  • the aptamer/analyte pairs can elicit the detectable signal while the aptamer is retained as an intact or substantially intact polynucleotide (e.g., sufficient for the aptamer to bind the analyte) within hybrid tRNA/pre- microRNA molecule.
  • the aptamers elicit a fluorescent signal when bound to its analyte.
  • the aptamer binds to a dye selected from the group consisting of malachite green, tetramethylrosamine, sulforhodamine B, and
  • the aptamer binds to malachite green.
  • the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO:9.
  • the test sample is a biological sample.
  • the biological sample is a fluid sample selected from the group consisting of serum, blood, sweat, tears, plasma, saliva, mucous, sputum, milk, semen, urine, and vaginal secretions.
  • the biological sample is a biopsy.
  • the RNase activity is from one or more endoribonucl eases, e.g., RNase A (EC 3.1.27.5), RNase H (EC 3.1.26.4), RNase III (EC 3.1.26.3), RNase L, RNase P (EC 3.1.26.5), RNase PhyM, RNase Tl (EC 3.1.27.3), RNase T2 (EC 3.1.27.1), RNase U2 (EC 3.1.27.4), and RNase V (EC 3.1.27.8).
  • the RNase activity is from one or more exoribonucleases, e.g., Polynucleotide Phosphorylase (PNPase) (EC 2.7.7.8), RNase PH (EC number EC 2.7.7.56), RNase R, RNase D (EC 3.1.13.5), RNase T, Oligoribonuclease (EC 3.1.13.3), Exoribonuclease I (EC 3.1.1 1.1), and Exoribonuclease II (EC 3.1.13.1).
  • PNPase Polynucleotide Phosphorylase
  • RNase PH EC number EC 2.7.7.56
  • RNase R EC 3.1.13.5
  • RNase T Oligoribonuclease
  • Oligoribonuclease EC 3.1.13.3
  • Exoribonuclease I EC 3.1.1 1.1
  • Exoribonuclease II EC 3.1.13.1
  • the RNase activity is from one or more exoribonucleases
  • ribonucleases selected from the group consisting of tRNA nucleotidyltransferase (EC 2.7.7.56), Ribonuclease D (EC 3.1.13.5), Physarum polycephalum ribonuclease (EC 3.1.26.1), Ribonuclease alpha (EC 3.1.26.2), Ribonuclease III (EC 3.1.26.3), Ribonuclease H (EC 3.1.26.4), Ribonuclease P (EC 3.1.26.5), Ribonuclease IV (EC 3.1.26.6),
  • tRNA nucleotidyltransferase EC 2.7.7.56
  • Ribonuclease D EC 3.1.13.5
  • Physarum polycephalum ribonuclease EC 3.1.26.1
  • Ribonuclease alpha EC 3.1.26.2
  • Ribonuclease III EC 3.1.26.3
  • Ribonuclease H EC 3.
  • Ribonuclease P4 (3.1.26.7), Ribonuclease M5 (EC 3.1.26.8), Ribonuclease (poly-(U)- specific) (EC 3.1.26.9), Ribonuclease IX (EC 3.1.26.10), Ribonuclease Z (EC 3.1.26.1 1), Ribonuclease E (EC 3.1.26.12), Retroviral ribonuclease H (EC 3.1.26.13), Ribonuclease T(2) (EC 3.1.27.1), Bacillus subtilis ribonuclease (EC 3.1.27.2), Ribonuclease T(l) (EC 3.1.27.3), Ribonuclease U(2) (EC 3.1.27.4), Pancreatic ribonuclease (EC 3.1.27.5), Enterobacter ribonuclease (EC 3.1.27.6), Ribonuclease F (EC 3.1.27.7), Ribonucleas
  • the test sample suspected of having RNase is contacted with a composition comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte under conditions and for a time sufficient to allow RNase, if present, to degrade the aptamer and disrupt aptamer/analyte binding.
  • the contacting step can be performed under physiological conditions of salinity (e.g., 100 mM KC1, 5 mM MgCl 2 , and 10 mM HEPES), pH (e.g., pH 7.4) and temperature (e.g., 37°C) for a time period of about 5 to 60 minutes.
  • the detecting step can be performed using any appropriate method known in the art, and will depend on the detectable signal elicited by the aptamer/analyte pair.
  • RNase activity is calculated as the change in detectable signal (e.g., fluorescent intensity) over time per volume of sample (e.g., AA.U./min/[iL).
  • a reduction or disappearance in detectable signal (e.g., fluorescent intensity) in a mixture comprising the test sample and the hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte in comparison to detectable signal (e.g., fluorescent intensity) in a control composition comprising the hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte without contacting the test sample indicates that the test sample comprises RNases and RNase activity.
  • a further control can include determining detectable signal (e.g., fluorescent intensity) of the same biological sample from a healthy control subject (e.g., a subject known not to have the disease of interest).
  • a reduced or eliminated detectable signal (e.g., fluorescent intensity) in the test sample versus the control subject sample indicates elevated RNase activity in the test sample compared to the sample from the control subject.
  • an increased detectable signal e.g., fluorescence
  • an increased detectable signal indicates reduced RNase activity in the test sample compared to the sample from the control subject.
  • RNase activity can be detected and quantified at the milligram level without dilution of test sample.
  • compositions comprising the polynucleotides described above and herein, comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte (e.g., a hybrid tRNA/pre-microRNA molecule comprising an aptamer that binds to a dye such as malachite green where the aptamer is bound to malachite green).
  • kits comprising one or more receptacles/containers/vials comprising one or more polynucleotides described above and herein, comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer.
  • kits comprising one or more receptacles/containers/vials comprising one or more compositions described above and herein, comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte.
  • the hybrid tRNA/pre-microRNA molecules can be produced by recombinant expression in a host cell, or can be synthetically prepared. Such recombinant and synthetic methods are well known in the art.
  • the host cell can be eukaryotic or prokaryotic.
  • the host cell is of the same species of cell as that of the tRNA molecule or the pre-microRNA molecule used in the hybrid tRNA/pre-microRNA molecule.
  • a host cell that does not comprise an endoribonuclease that may cleave out the inserted RNA (e.g., Dicer) can be used.
  • the host cell for the recombinant expression of a hybrid tRNA/pre-microRNA molecule is a prokaryotic cell, e.g., a bacterial cell, e.g., an
  • the host cell for the recombinant expression of a hybrid tRNA/pre-microRNA molecule is a eukaryotic cell, e.g., a mammalian cell, a human cell, an insect cell, a plant cell or a yeast cell.
  • Eukaryotic (e.g., mammalian or human) host cells which are deficient for Dicer are known in the art and find use for the high level expression for production of the hybrid tRNA/pre-microRNA molecules in a eukaryotic host cell, e.g., as described in Commins, et al.
  • hybrid tRNA/pre-microRNA scaffolds facilitate stable, consistent and reliable high level expression of a desired inserted RNA molecule in vivo and in vitro, as described herein.
  • high levels of the hybrid tRNA/pre-microRNA scaffolds are produced in vitro by a host cell that does not comprise an endoribonuclease that may cleave out the inserted RNA (e.g., Dicer).
  • at least about 5-100 mg, e.g., at least about 10-50 mg, of hybrid tRNA/pre-microRNA scaffold molecules can be produced in vitro from 1 liter of E. coli culture over 16-48 hours of time.
  • hybrid tRNA/pre-microRNA scaffold molecules can be produced in vitro from 1 liter of yeast cell culture.
  • the tRNA/pre-microRNA molecule produced comprises at least about 5%, e.g., at least about 6%, 7%, 8%, 9%, 10%, 11%, 12%, 15%, 20%, or more, of the total RNA.
  • the hybrid tRNA/pre-microRNA scaffolds are purified as part of the total RNA from the production host cells. Such methods of isolating or purifying total RNA from a host cell are established in the art.
  • the hybrid tRNA/pre-microRNA scaffolds are further substantially isolated or purified from the other RNA molecules and components of the production host cell. This can be done using any method in the art, including, e.g., separation by separation by gel electrophoresis, affinity chromatography, chromatography, FPLC and/or HPLC.
  • the substantially isolated and/or purified hybrid tRNA/pre-microRNA scaffolds can then be transfected or delivered into a eukaryotic cell, which will then process the hybrid tRNA/pre-microRNA scaffolds to cleave or release the inserted RNA.
  • the hybrid tRNA/pre-microRNA scaffolds are contacted with or exposed to an endoribonuclease (e.g., Dicer) in vitro, under conditions sufficient to allow cleave or release of the inserted RNA.
  • an endoribonuclease e.g., Dicer
  • the efficiency of in vitro cleavage or release of the inserted RNA from the hybrid tRNA/pre- microRNA scaffolds can be facilitated by adding a RNase or DNAzyme site to the tRNA- pre-miRNA molecule
  • RNA research and therapy relies primarily on synthetic RNAs.
  • OnRS noncoding RNA scaffold
  • tRNA/mir-34a multi-milligrams of chimeric RNAs
  • OnRS/GFP-siRNA was effective in knocking down GFP mRNA levels and fluorescent intensity in ES-2/GFP cells and GFP-transgenic mice. Furthermore, the OnRS/MGA sensor offered a specific strong fluorescence upon binding MG, which was utilized as label-free substrate to accurately determine serum RNase activities in pancreatic cancer patients.
  • RNA interference (RNAi) technologies have been widely utilized for genome function studies.
  • RNAi -based therapies under clinical trials 1-3
  • an RNA aptamer Pegaptanib
  • U.S. Food and Drug Administration for the treatment of age-related macular degeneration (4).
  • RNAi agents and noncoding RNA (ncRNA) materials used for basic, translational and clinical research such as small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), RNA aptamers, and microRNAs (miRs or miRNAs) are mainly produced through chemical synthesis (5-9), while other virus and non-virus-vector based strategies literally utilize DNA agents.
  • siRNAs small interfering RNAs
  • shRNAs short hairpin RNAs
  • miRs or miRNAs microRNAs
  • organic synthesis of oligonucleotides may be automated, a multi-milligram dose of 22-nt double-stranded siRNA or miRNA agents for in-vivo testing or projected therapy is very costly.
  • RNAi agents on a large scale, a successful example has been reported very recently for the generation of fully-processed siRNAs from pl9-expressing bacteria (12).
  • tRNA (13-15) and rRNA (16) have been employed as scaffolds to produce a number of chimeric RNAs in common strains of bacteria, given the fact that tRNAs and rRNAs are present as stable RNA molecules in the cells.
  • the recombinant RNA chimeras are thus isolated, and the target RNAs may be released in demand by corresponding RNase (13,14), Ribozyme (15) or DNAzyme (16) for structural and biophysical analyses.
  • RNase 13,14
  • Ribozyme Ribozyme
  • DNAzyme (16) DNAzyme
  • RNA secondary structures The secondary structures of chimeric ncRNAs were predicted using the CentroidFold
  • Trna/mir-34a was used as a template for the amplification of target sequences using the oligonucleotides (Table 1), and then the amplicons were inserted into pBSMrnaSeph vector linearized by SacII and Eagl (New England Biolabs) which removed the SEPHADEXTM aptamer from Trna scaffold at the same time. All inserts were confirmed by Sanger sequencing analyses at UC Davis Genome Center. TABLE l
  • the underlined are the sequences of tRNA scaffold.
  • the rest is the hsa-miR-34a precursor with ⁇ 9 nt flanking sequence at each prime.
  • sequence in red indicates the target sequence and the green part is the complementary sequence. Sequence in bold indicates the MGA.
  • tRNA/miR-155/GFP- Fow-AGTAATTTACGTCGACGAGGCTTGCTGAAGGCTGTATGCTGGTTGTACTCCAGCTTGTGCCCGTTTTGGCCACTGACTGACGG siRNA Rev-CGGCCGCAACCATCGACGTCGAGTGCTAGTAACAGGCCTTGTGTCCTGGTTGTACTCCATTGTGCCCGTCAGTGGCCAA
  • RNAs were isolated from E. coli using the Tris-HCl-saturated phenol extraction method, quantitated with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Rockford, IL) and analyzed by denaturing urea (8 M) polyacrylamide (8%) gel electrophoresis (PAGE). All images were acquired with ChemiDoc MP Imaging System (Bio-Rad, Hercules, CA). Intensities of bands were used to provide a rough estimation of relative levels of recombinant ncRNAs present in the total RNAs.
  • Buffer B Buffer A plus 1 M sodium chloride
  • FPLC traces were monitored at 260 nm using a UV/Vis detector. Peak areas were employed to estimate the relative levels of recombinant ncRNAs within the total RNAs, which agrees with those determined by urea-PAGE analyses. After analyzed on a denaturing PAGE gel, the fractions containing pure ncRNAs were pooled. Recombinant ncRNAs were precipitated with ethanol, reconstituted with nuclease-free water, and then desalted and concentrated with Amicon ultra-2 mL centrifugal filters (30 KD; EMD
  • RNAs were isolated using a Direct-zol RNA extraction kit (Zymo Research, Irvine, CA) at 48 h post-transfection, and small RNA libraries were generated using the Illumina TruseqTM Small RNA Preparation kit (Illumina, San Diego, CA) according to the instructions.
  • the purified cDNA library was used for cluster generation on Illumina' s Cluster Station and then sequenced on Illumina GAIIx following vendor's instructions.
  • Raw sequencing reads (40 nt) were obtained using Illumina's Sequencing Control Studio software version 2.8 (SCS v2.8) following real-time sequencing image analysis and base-calling by Illumina's Real-Time Analysis version 1.8.70 (RTA vl .8.70).
  • the extracted sequencing reads were used for the standard sequencing data analysis by following a proprietary pipeline script, ACGTlOl-miR v4.2 (LC Sciences, Houston, TX)(20,21). Cells were treated in triplicate and sequenced separately.
  • RT-qPCR Reverse transcription quantitative real-time PCR
  • Apoptosis assay The apoptosis assay was performed by using a FACS
  • Annexin V assay kit (Trevigen, Inc., Gaithersburg, MD, USA) following the manufacturer s protocol. Briefly, A549 cells were transfected with 100 nM recombinant ncRNAs, harvested at 72 h post-transfection, incubated with Annexin V-FITC conjugate and propidium iodide solution, and then the samples were analyzed on a FACScan flow cytometer (BD Biosciences, San Jose, CA). Data analysis was performed using Flowjo (Ashland, OR). Cells were treated in triplicate and similar results were obtained when the whole experiment was repeated.
  • A549 cells were transfected with 20 or 100 nM chimeric RNAs.
  • ES-2/GFP cells were seeded 8,000 cells/well on a 24-well plate and transfected with 5 or 15 nM FPLC-purified chimeric RNAs at 24 h later. The fluorescence was monitored with an Olympus 1X81 microscope (Olympus, Center Valley, PA) at 24h, 48h and 72h post-transfection. All images were acquired using the same settings at the same time. At the end of the study, total RNAs were isolated from the cells and subject to RT-qPCR evaluation of GFP mRNA and siRNA levels. Cells were treated in triplicate, and similar results were obtained when the whole experiment was repeated.
  • DAPI 6- diamidino-2-phenylindole
  • liver tissues were subject to RNA isolation and RT-qPCR analyses for GFP mRNA and siRNA levels against 18S and U74 was used as control, respectively.
  • Gene specific primers were presented in Table 1.
  • MG Malachite green aptamer binding assays .
  • Serum RNase activity assay Serum specimens from IRB-approved, prospectively-collected UC Davis Pancreas Registry bank were utilized. The serum has been processed uniformly within 4 h of blood collection, aliquoted and stored in a -80 0C freezer till usage with minimal freeze-thaw cycle. A total of 20 patients' serum from 10 pancreatic ductal adenocarcinoma (PDAC) (5 early-stage PDAC (American Joint
  • the PDAC cases consisted of 4 males and 6 females, benign/normal of 5 males and 5 females. Age ranges were 51 to 80
  • 10 ⁇ _, MG to a final 10 ⁇ concentration.
  • 2.08 ⁇ OnRS/MGA5 and 1.0 ⁇ L ⁇ pool human serum were incubated for 0-60 min.
  • RNAi agents An OnRS is developed to achieve high-yield production of recombinant RNAi agents.
  • Figure la A series of plasmids were created and employed to transform E. coli.
  • the levels of recombinant pre-miRNA chimeras expressed/accumulated in HST08 E. coli were largely variable when the same tRNA scaffold was used.
  • OnRS was able to assemble other miRNAs (e.g., 21-nt miR-27b and 22-nt miR-22, etc.; unpublished data) and a 22-nt scrambled RNA sequence (chimeric RNA was named OnRS/Neg and used as a control in the following studies; Table 1), which were all consistently produced in HST08 E. coli at high yields and on a large scale, i.e., >15% of OnRS/miRNAs in total RNAs and >1.5 mg of FPLC-purified OnRS/miRNAs from 0.5 L bacterial culture at all times.
  • OnRS/GFP-siRNA from 0.5 L bacterial culture every time. These results indicate that target miRNA/siRNA agents can be assembled by using OnRS-based platform to offer a consistent high-level production of chimeric ncRNAs in bacteria.
  • Target miRNAs/siRNAs are selectively released from chimeric ncRNAs in human cells while tRNA scaffold is processed to tRNA fragments (tRFs).
  • tRFs tRNA fragments
  • An unbiased deep sequencing study was conducted after the preparation of small RNAs library from human lung carcinoma A549 cells at 48 h post-transfection with OnRS/miR-124 and OnRS (tRNA/mir-34a). The data showed that OnRS/miR-124 was selectively processed to large numbers (5,613 ⁇ 975 reads) of 20-nt miR-124 in A549 cells ( Figure 2a).
  • OnRS/GFP-siRNA and OnRS/Neg The data showed that GFP-siRNA levels were about 1,000-fold higher in ES-2/GFP cells treated with chimeric OnRS/GFP-siRNA than the control OnRS/Neg ( Figure 2b), which was mainly attributable to the increase in 22-, 23- and 21-nt isoforms and accompanied by lower levels of passenger strands. It was also noted that OnRS/Neg was indeed processed to a number of scrambled RNAs at 22-23 nt in length, but at much lower levels, which might be related to a lower stability of the scrambled RNAs or insufficient processing. Nevertheless, there were no or minimal differences in the levels of other cellular miRNAs between OnRS/GFP-siRNA- and OnRS/Neg-treated cells.
  • OnRS/Neg-treated cells ( Figure 2d), despite that overall tRF levels were much lower in ES- 2/GFP cells than A549 cells. Together, these results support the utility of OnRS for "stealth delivery" of target miRNAs and siRNAs into human cells beyond high-yield production of the chimeric ncRNAs in bacteria and the use of OnRS/Neg as a control to assess
  • OnRS-carried miR-124 is biologically /pharmacologically active in controlling target gene expression and cancer cellular processes. Then we evaluated the bioactivities of OnRS-carried miR-124, as miR-124 is known to regulate a number of target genes such as the oncogenic signal transducer and activator of transcription 3 (STAT3), enhance apoptosis, and inhibit cell proliferation (26-28). Consistent with deep sequencing data, selective stem-loop RT-qPCR analyses showed that mature miR-124 levels were around 1000-fold higher in A549 cells from day 1 to 4 after transfection with OnRS/miR- 124, compared with OnRS/Neg (Figure 3a).
  • STAT3 oncogenic signal transducer and activator of transcription 3
  • OnRS-carried GFP siRNA is effective in knocking down GFP expression in vitro and in vivo.
  • OnRS/GFP-siRNA significantly suppressed the GFP fluorescence intensity and mRNA levels at 72 h post-transfection ( Figure 4a-4b), which was associated with 3 orders of magnitude increase in GFP siRNA levels ( Figure 4c).
  • OnRS-carried MGA was further demonstrated by a strong fluorescent intensity at 630/650 nm (excitation/emission) upon binding MG ( Figure 6e).
  • label-free OnRS/MGA itself did not exhibit any fluorescence, and only minimal basal-level MG fluorescent intensity was shown in the absence or presence of non-MGA-containing total RNAs and HPLC-purified OnRS/Seph ( Figure 6e), supporting the specificity of MGA- bound-MG fluorescence.
  • RNase A the major form RNase in human serum
  • RNase 5 angiogenin
  • OnRS/MGA was degraded by 500-fold higher concentration (0.01 ⁇ g/ ⁇ L) of angiogenin in 30 min. Since RNase A is the major form of RNase in human serum (30), this assay would mainly indicate pancreas-derived RNase A activity in human serum. Therefore, we utilized OnRS/MGA to evaluate the RNase activities in a set of serum samples prospectively collected from PDAC and benign/normal patients. The data showed that serum RNase activities (AA.U./min/ L) were significantly (P ⁇ 0.01) higher in PDAC (196 ⁇ 22) than benign/normal (118 ⁇ 8) patients. These results implicate that chimeric MGA sensor produced using the OnRS platform could be useful for determination of RNase activities.
  • a general approach has been established for a consistent, cost-effective production of multiple to tens of milligrams of chimeric ncRNAs in 1 L culture of a common strain of E. coli, bearing various types of small RNAs of interests.
  • the OnRS used in this platform is based upon the tRNA fusion pre-miRNA-34a that is resistant to nucleolytic digestion in bacteria and thus accumulated to significantly high level (e.g., >15% of total RNAs) for an easy purification with the anion-exchange FPLC method.
  • the miR-34a-5p/miR-34a-3p duplex within the OnRS cargo may be replaced by any target double-stranded small RNAs such as siRNA or miRNA/miRNA* duplex ( Figure lb) to achieving high-yield production of corresponding chimeric siRNA or miRNA agents, as exemplified by successful production of >1.5 mg of OnRS/miR-124, OnRS/GFP- siRNA and control OnRS/Neg chimeras from 0.5 L bacterial culture in this report.
  • any target double-stranded small RNAs such as siRNA or miRNA/miRNA* duplex ( Figure lb) to achieving high-yield production of corresponding chimeric siRNA or miRNA agents, as exemplified by successful production of >1.5 mg of OnRS/miR-124, OnRS/GFP- siRNA and control OnRS/Neg chimeras from 0.5 L bacterial culture in this report.
  • RNA aptamers can be sprouting at particular sites on OnRS to offer the aptamer chimeras (Figure 5a), which are nicely demonstrated by the assembling of OnRS/MGA5 and OnRS/MGA3 sensors.
  • OnRS-based platform is also supported by successful production of other target RNA agents (e.g., miR-27b, miR-22, and a vascular endothelial growth factor (VEGF) aptamer, etc.; unpublished data), whereas its application to bioengineer other types of biological RNAs such as catalytic RNAs (ribozymes) for biotransformation and guide RNAs (gRNAs) for genome editing warrants further investigations.
  • ribozymes catalytic RNAs
  • gRNAs guide RNAs
  • RNAi agents into the cells. Indeed they were selectively processed to large numbers of target miRNAs and siRNAs in human cells, as determined by unbiased deep sequencing studies ( Figure 2a-2b). So was the scrambled RNA from OnRS/Neg. The presence of small RNA isoforms differing in 1- or 2-nt at 5' or 3' within chimeric ncRNA- and vehicle-treated human cells may indicate the flexibilities of endoribonucleases in producing small RNAs from pre-miRNAs or shRNAs (31-33). As a result, selective stem- loop RT-qPCR assays revealed a three orders of magnitude increase in miR-124 in A549 cells and GFP siRNA in ES-2/GFP cells, respectively.
  • ES-2/GFP cells levels were much lower than A549 cells, which is presumably due to the differences in generating, degrading, excreting and/or retaining tRFs in different types of cells.
  • target miRNAs/siRNAs, tRFs and other small RNAs derived from chimeric ncRNA agents in human cells were fully elucidated, the roles of specific ribonucleases such as Dicer in the processes remain undefined.
  • RNA aptamers [0102] The utility of OnRS was further extended to consistent high-yield production of RNA aptamers. A priori it is unknown whether aptamer activity would still be present in the tRNA (13-15) and 5S rRNA (16) scaffolds, although ribozyme activity was observed in the context of the tRNA scaffold when Hammerhead ribozyme sequences were inserted together with the target RNA to be produced (15).
  • the OnRS-resembled RNA aptamer MGA sensor indeed interacted with MG to produce a specific strong fluorescence at 630/650 nm (excitation/emission; Figure 5e), as it was originally discovered (9), which was further employed for the determination of serum RNase activities in clinical samples (Figure 7e).
  • the RNase activity assay using label-free MGA sensor developed in this study is different from current methods.
  • the Kunitz RNase activity assay (29,34-36) is based upon the ultraviolet absorbance of label-free nucleic acids at 260 nm or nucleosides at 280 nm, which is relatively less selective and sensitive.
  • Recent and current RNase activity assays including those commercially-available kits rely on isotope- or fluorophore-labeled RNAs or antibodies (37-40), and thus offer greater sensitivities to determine very low levels of RNase activities or indicate RNase protein levels.
  • human serum is comprised of much higher RNase activities.
  • CENTROIDFOLD a web server for RNA secondary structure prediction. Nucleic acids research, 37, W277-280.
  • CentroidHomfold-LAST accurate prediction of RNA secondary structure using
  • Cytomegalovirus microRNA expression is tissue specific and is associated with persistence. Journal of virology, 85, 378-389.
  • N-methylnicotinamide and nicotinamide N- methyltransf erase are associated with microRNA- 1291 -altered pancreatic carcinoma cell metabolome and suppressed tumorigenesis. Carcinogenesis, 35, 2264-2272.
  • tRNA sequences Underlined are tRNA sequences, and the italic are hsa-mir-34a sequences. Italic bold sequences are extended 5' and 3' sequences of hsa-mir-34a . Underlined italic bold represents mutated nucleotides. The boxed are MGA sequences.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Provided are compositions and methods for detecting RNase activity.

Description

METHODS FOR DETECTION OF RNASE ACTIVITY
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. § 119(e) of U.S.
Provisional Application No. 62/137,201, filed on March 23, 2015, which is hereby incorporated herein by reference in its entirety.
STATEMENT OF GOVERNMENTAL SUPPORT
[0002] This invention was made with government support under Grant No.
1U01CA175315 awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD
[0003] Provided are compositions and methods for detecting RNase activity.
BACKGROUND
[0004] Ribonucleases (RNases) are a family of nucleases involved in the processing and degradation of RNAs (e.g., mRNAs and noncoding RNAs), which are critical for life cycles and cellular defense against infections. Change in RNase activity may be an indicator of human diseases (e.g., inflammation and cancer) and/or disease status. In addition, determination of RNase contamination is essential for RNA research and discovery.
[0005] Existing methods for detecting RNase activity include:
1. UV-based assays, which is less selective and thus unable to provide an accurate quantification.
2. Radioactivity-based assays, which requires the production and use of radioactive isotope-labeled RNA substrates.
3. Fluorescence-based assays, which requires the production and use of RNA substrates labeled with fluorophores.
[0006] The traditional Kunitz RNase activity assay is based upon the ultraviolet absorbance of label-free nucleic acids or degraded nucleosides, which is less selective, sensitive and accurate. Recent and current RNase activity assays including those commercially-available kits rely on isotope- or fluorophore-labeled RNAs (or antibodies), and thus offer greater sensitivities to determine very low levels of RNase activities (or indicate RNase protein levels). However, labeling methods are limited to the access to inexpensive, large quantities of labeled RNA substrates (e.g., micrograms), whereas biological samples such as human sera are comprised of high levels of RNase activities. Without extensive dilutions (e.g., 1 : 1,000) of the serum sample that would inevitably affect the RNase activity assay including linear range and accuracy, larger quantities (e.g., >10 μg) of labeled synthetic RNA agents are needed for a direct detection of serum RNase activity using labeling methods. Therefore, direct quantification of RNase activity in serum and other biological samples using labeling assays is costly and a more efficient method is warranted.
SUMMARY
[0007] Provided are polynucleotides comprising a tRNA operably linked to a pre- microRNA (pre-miRNA) and an aptamer that binds to a target analyte. In varying embodiments, the tRNA is a methionyl tRNA. In varying embodiments, the tRNA has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: l . In varying embodiments, the pre-miRNA is selected from pre-miRNA- 1291, pre-miRNA-34a and pre- miRNA-125-1. In varying embodiments, the pre-miRNA- 1291 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to the miRBase Accession No.
MI0006353. In varying embodiments, the pre-miRNA-34a comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000268 or SEQ ID NO:2. In varying embodiments, the pre-miRNA- 125-1 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000446. In varying embodiments, the pre-miRNA- 1291 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity, to SEQ ID NO: 12. In varying embodiments, the pre- miRNA-34a comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO:2. In varying embodiments, the pre-miRNA- 125-1 comprises a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 14. In varying
embodiments, the polynucleotide comprises a methionyl tRNA operably linked to a pre- miRNA-1291. In varying embodiments, the polynucleotide comprises a methionyl tRNA operably linked to a pre-miRNA-34a. In varying embodiments, the polynucleotide comprises a methionyl tRNA operably linked to a pre-miRNA- 125-1. In varying embodiments, the methionyl tRNA operably linked to the pre-miRNA-1291 has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 13. In varying embodiments, the methionyl tRNA operably linked to the pre-miRNA-34a has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO:3. In varying embodiments, the methionyl tRNA operably linked to the pre-miRNA- 125-1 has a nucleic acid sequence having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 15. In varying embodiments, the tRNA operably linked to a pre-microRNA (pre-miRNA) comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to a
polynucleotide selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 13 and SEQ ID NO: 15.
In varying embodiments, all or part of the stem-loop anticodon of the tRNA is replaced with the pre-miRNA. In some embodiments, the aptamer binds to a dye selected from the group consisting of malachite green, tetramethylrosamine, sulforhodamine B, and
triphenylmethane dyes. In some embodiments, the aptamer binds to malachite green. In some embodiments, the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity, to SEQ ID NO:9. In some embodiments, the aptamer is inserted or located 5' to the pre-miRNA. In some embodiments, the aptamer is inserted or located 3' to the pre-miRNA. In some embodiments, the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity, to SEQ ID NO: 10. In some embodiments, the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 11.
[0008] In a further aspect, provided are compositions comprising a polynucleotide as described above and herein, and an analyte bound by the aptamer. In varying
embodiments, the analyte bound by the aptamer elicits a detectable signal, e.g., a fluorescent signal.
[0009] In a further aspect, provided are kits comprising a polynucleotide and/or a composition as described above and herein.
[0010] In another aspect, provided are methods of detecting RNase activity. In some embodiments, the methods comprise:
a) contacting a test sample suspected of having RNase with a composition as described above and herein to form a mixture, wherein the analyte bound by the aptamer elicits a detectable signal;
b) determining the presence and amount of detectable signal in the mixture in comparison to the presence and amount of detectable signal in a control composition that has not been contacted with the sample, wherein reduced or eliminated levels of detectable signal indicate the presence of RNase activity. In some embodiments, the test sample is a biological sample. In some embodiments, the biological sample is a fluid sample selected from the group consisting of serum, blood, plasma, saliva, sweat, tears, milk, semen, urine, and vaginal secretions. In some embodiments, the biological sample is a biopsy. In some embodiments, the RNase is one or more ribonucleases selected from the group consisting of RNAse A (RNase 1), RNase H, RNase III, RNase P, RNase L, RNase Tl, RNase T2, RNase U2, and angiogenin (RNase 5). In some embodiments, the RNase activity can be detected and quantified at the milligram level without prior dilution of test sample. DEFINITIONS
[0011] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art. Standard techniques are used for nucleic acid and peptide synthesis. Generally, enzymatic reactions and purification steps are performed according to the manufacturer's specifications. The techniques and procedures are generally performed according to conventional methods in the art and various general references (see generally, Sambrook et al. Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012) and Ausubel, ed., Current Protocols in Molecular Biology, John Wiley Interscience, (1990-2014)), which are provided throughout this document. The nomenclature used herein and the laboratory procedures in analytical chemistry, and organic synthetic described below are those well-known and commonly employed in the art. Standard techniques, or modifications thereof, are used for chemical syntheses and chemical analyses. [0012] The term "polynucleotide" refers to polymers composed of
deoxyribonucleotides, ribonucleotides or any combination thereof.
[0013] As used herein, the term "nucleotide" refers to a chemical moiety having a sugar (modified, unmodified, or an analog thereof), a nucleotide base (modified, unmodified, or an analog thereof), and a phosphate group (modified, unmodified, or an analog thereof). Nucleotides include deoxyribonucleotides, ribonucleotides, and modified nucleotide analogs including, for example, locked nucleic acids ("LNAs"), peptide nucleic acids ("PNAs"), L-nucleotides, ethylene-bridged nucleic acids ("EN As"), arabinoside, and nucleotide analogs (including abasic nucleotides). Similarly, "nucleic acid," "nucleotide sequence," or "nucleic acid sequence" refer to a nucleotide, oligonucleotide, polynucleotide, or any fragment thereof and to naturally occurring or synthetic molecules. These phrases also refer to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent the sense or the antisense strand, or to any DNA-like or RNA-like material. RNA may be used in the methods described herein and/or may be converted to cDNA by reverse-transcription and/or RNA for use in the methods described herein.
[0014] As used herein interchangeably, a "microRNA," "miR," or "miRNA" refer to the unprocessed or processed RNA transcript from a miRNA gene. The unprocessed miRNA gene transcript is also called a "miRNA precursor," and typically comprises an RNA transcript of about 70-100 nucleotides in length. The miRNA precursor can be processed by digestion with an RNase (for example, Dicer, Argonaut, or RNase III) into an active 19-25 nucleotide RNA molecule. This active 19-25 nucleotide RNA molecule is also called the "processed" miRNA gene transcript or "mature" miRNA. [0015] The terms "pre-microRNA" or "pre-miR" or pre-miRNA" interchangeably refer to an RNA hairpin comprising within its polynucleotide sequence at least one mature micro RNA sequence and at least one dicer cleavable site.
[0016] The terms "pre-miRNA-1291" or "hsa-mir-1291" or "HGNC:MIR1291" interchangeable refer to an RNA polynucleotide having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0006353 (www.mirbase.org) or SEQ ID NO:4.
[0017] The terms "pre-miRNA-34a" or "hsa-mir-34a" or "HGNC :MIR34A" interchangeable refer to an RNA polynucleotide having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000268 (www.mirbase.org) or SEQ ID NO:2.
[0018] The terms "pre-miRNA-125-1" or "hsa-mir-125b-l" or "HGNC:MIR125B1" interchangeable refer to an RNA polynucleotide having at least 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to miRBase Accession No. MI0000446 (www.mirbase.org) or SEQ ID NO:6.
[0019] The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., share at least about 80% identity, for example, at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity over a specified region to a reference sequence, e.g., the tRNA, pre-microRNA and tRNA/microRNA hybrid polynucleotide molecules described herein, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithms (e.g., BLAST, ALIGN, FASTA or any other known alignment algorithm) or by manual alignment and visual inspection. Such sequences are then said to be "substantially identical." This definition also refers to the compliment of a test sequence. Preferably, the identity exists over a region that is at least about 10, 15, 20, 25, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120 nucleotides in length, or over the full-length of a reference sequence.
[0020] As used herein, the term "short interfering nucleic acid" or "siRNA" refers to any nucleic acid molecule capable of down regulating {i.e., inhibiting) gene expression in a mammalian cells (preferably a human cell). siRNA includes without limitation nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hai in RNA (shRNA). Likewise, the term "sense region" refers to a nucleotide sequence of a siRNA molecule complementary (partially or fully) to an antisense region of the siRNA molecule. Optionally, the sense strand of a siRNA molecule may also include additional nucleotides not complementary to the antisense region of the siRNA molecule. Conversely, as used herein, the term "antisense region" refers to a nucleotide sequence of a siRNA molecule complementary (partially or fully) to a target nucleic acid sequence.
Optionally, the antisense strand of a siRNA molecule may include additional nucleotides not complementary to the sense region of the siRNA molecule. [0021] The terms "piRNA" and "Piwi -interacting RNA" are interchangeable and refer to a class of small RNAs involved in gene silencing. PiRNA molecules typically are between 26 and 31 nucleotides in length.
[0022] The terms "snRNA" and "small nuclear RNA" are interchangeable and refer to a class of small RNAs involved in a variety of processes including RNA splicing and regulation of transcription factors. The subclass of small nucleolar RNAs (snoRNAs) is also included. The term is also intended to include artificial snRNAs, such as antisense derivatives of snRNAs comprising antisense sequences directed against the ncRNA.
[0023] "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present. Expression is meant to include the transcription of any one or more of transcription of a microRNA, siRNA, piRNA, snRNA, IncRNA, antisense nucleic acid, or mRNA from a DNA or RNA template and can further include translation of a protein from an mRNA template. The promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
[0024] The term "homologous region" refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region" is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term "homologous, region," as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule can have two homologous regions which are capable of hybridizing to each other. Thus, the term
"homologous region" includes nucleic acid segments with complementary sequence.
Homologous regions may vary in length, but will typically be between 4 and 40 nucleotides (e.g., from about 4 to about 40, from about 5 to about 40, from about 5 to about 35, from about 5 to about 30, from about 5 to about 20, from about 6 to about 30, from about 6 to about 25, from about 6 to about 15, from about 7 to about 18, from about 8 to about 20, from about 8 to about 15, etc.).
[0025] The term "complementary" and "complementarity" are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). 100% complementary refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region. Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other and can be expressed as a percentage.
[0026] A "target site" or "target sequence" is the nucleic acid sequence recognized (i.e., sufficiently complementary for hybridization) by an antisense oligonucleotide or inhibitory RNA molecule.
[0027] As used herein, the term "subject" refers to a mammal, such as a human, but can also be another animal such as a domestic animal (e.g., a dog, cat, or the like), a farm animal (e.g., a cow, a sheep, a pig, a horse, or the like) or a laboratory animal (e.g., a monkey, a rat, a mouse, a rabbit, a guinea pig, or the like). The term "patient" refers to a subject who is, or is suspected to be, afflicted with a disease.
[0028] As used herein, the terms "effective amount" or "pharmaceutically effective amount" or "therapeutically effective amount" of a composition, is a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in, the symptoms associated with a disease that is being treated. The amount of a composition of the invention administered to the subject will depend on the type and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions of the present invention can also be administered in combination with one or more additional therapeutic
compounds. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 illustrates high-yield production of recombinant miRNA/siRNA agents in E. coli using OnRS-based technology, (a) Urea-PAGE analysis of total RNAs showed that there was large variability in the expression of chimeric pre-miRNAs in E. coli using the same tRNA scaffold. Total RNAs isolated from untransformed HST08 (WT) E.coli were used as a control. The heat color gradation indicates the base-pairing probability from 0 to 1. (b) The chimeric tRNA/mir-34a robustly expressed in E. coli was developed as an OnRS that offered a consistent high-level expression of chimeric miRNAs (e.g., OnRS/miR-124) and siRNAs (e.g., OnRS/GFP-siRNA) in E. coli (e.g., -15-20% of total RNAs). In contrast, there was no or minimal expression of miR-124 and GFP siRNA using the tRNA and tRNA/mir-155 scaffold, respectively, (c and d) Representative FPLC traces during the purification of OnRS/miR-124 and OnRS/GFP-siRNA, respectively.
Inserts are corresponding urea-PAGE analyses of collected fractions (1, 2, 3, and 4) eluted at 8.3 and 8.7 min, respectively, which confirmed the purity of isolated recombinant ncRNAs. [0030] Figures 2A-D illustrate the fate of recombinant ncRNAs in human cells, (a and b) Unbiased deep sequencing study revealed that OnRS-carried miR-124 and GFP- siRNA were precisely processed to target small RNAs, leading to 3 orders of magnitude increase in miR-124 in A549 cells and GFP siRNA in ES-2/GFP cells, respectively. Note the presence of miRNA and siRNA isoforms as well as corresponding passenger strands and other small RNAs at much lower levels. In contrast, the levels of other cellular miRNAs showed no or minor changes. Values are mean ± SD of triplicated treatments that were sequenced separately, (c and d) Mapping major cellular tRFs derived from OnRS/miR-124 versus OnRS (tRNA/mir-34a) in A549 cells and OnRS/GFP-siRNA versus OnRS/Neg in ES-2/GFP cells, respectively. Shown are the mean numbers of reads of triplicated treatments. 3,000 reads was used as a cut off.
[0031] Figures 3 A-E illustrate OnRS-carried miRNA is biologically/
pharmacologically active in regulating target gene expression and controlling cellular processes in human cells, (a) RT-qPCR analysis revealed that mature miR-124 levels retained 3 orders of magnitude higher in A549 cells for 4 days since transfection with OnRS/miR-124, as compared with OnRS/Neg. (b) Western blots showed that OnRS/miR- 124 was effective in reducing the protein expression level of miR-124 target gene STAT3 in A549 cells at 72 h post-transfection. (c) Flow cytometric analyses demonstrated that
OnRS/miR-124 was effective in inducing apoptosis in A549 cells at 48 h post-transfection. Cells treated with OnRS/Neg were used as controls, (d) MTT assay showed that
OnRS/miR-124 significantly suppressed the proliferation of A549 cells at 72 h post- treatment, as compared to OnRS/Neg. (e) Inhibition of A549 cell proliferation by
OnRS/miR-124 was also demonstrated when cell growth was monitored using Icelligence Real-Time Cell analyzer. The arrow points to the time point of ncRNA treatment. Values are mean ± SD of triplicated treatments. *P < 0.01.
[0032] Figures 4A-F illustrate OnRS-carried siRNA is effective for RNAi in vitro and in vivo. GFP fluorescence intensity was sharply reduced in ES-2/GFP cells in vitro at 72 h after transfected with OnRS/GFP-siRNA (a), which was associated with (b) 70-80% lower GFP mRNA levels and (c) 1000-fold higher GFP siRNA levels. Following i.v.
administration of OnRS/GFP-siRNA, hepatic GFP fluorescence was significantly suppressed in the GFP-transgenic mouse models in vivo, as demonstrated by microscopic examination of (d) non-fixed and (e) fixed liver slices, as well as (f) RT-qPCR analysis of hepatic GFP mRNA levels. Fixed liver slices were stained with DAPI, and GFP
fluorescence and DAPI-stained nuclei (blue) images were merged together (e). Control RS- 2/GFP cells (N = 3 per group) or GFP-transgenic mice (N = 3-4 per group) were treated with the same doses of OnRS/Neg. Values are mean ± SD. *P < 0.01, compared with OnRS/Neg treatment. [0033] Figure 5 illustrates the basic principle of the herein described RNase assay method using a malachite green aptamer (MGA) sensor.
[0034] Figures 6A-E illustrate high-yield large-scale production of chimeric MGA sensor that produces strong and selective fluorescence upon binding to MG. (a) MGA may be inserted at the 5 ' or 3' end of the OnRS scaffold to offer OnRS/MGA5 and
OnRS/MGA3, respectively. The heat color gradation indicates the base-pairing probability from 0 to 1. (b) A consistent high-level expression of chimeric MGA in E. coli, e.g., over 50% of OnRS/MGA5 and OnRS/MGA3 in total RNAs. (c) Representative FPLC traces of OnRS/MGA5 during FPLC purification. Insert is urea-PAGE analysis of the collected RNA fractions (1, 2 and 3) eluted at 10.6 min. (d) Binding to OnRS/MGA5 and
OnRS/MGA3 led to a shift of the wavelength of MG maximum absorbance from 618 to 630 nm. The same shift was observed when FPLC-purified OnRS/MGA and total RNAs isolated from OnRS/MGA-expressing bacteria were used. The SEPHADEX™-purified aptamer (OnRS/Seph) and corresponding total RNAs were used as additional controls, (e) Strong and selective fluorescence was shown when MG bound to OnRS/MGA5 or
OnRS/MGA3. The same results were obtained when using FPLC-purified OnRS/MGA and OnRS/MGA-containing total RNAs.
[0035] Figures 7A-E illustrate method to determine RNase activity using chimeric MGA sensor, (a) Change in MGA-bound-MG fluorescent intensity with the increase in MG and MGA concentrations. Corresponding MGA and MG concentrations were fixed at 1.6 μg/mL and 10 μΜ, respectively, (b) The fluorescent intensity was decreased over time when incubated with human serum, and in v/'vo-jetPEI formulated OnRS/MGA was protected from cleavage by serum RNases. (c) Dose response was obvious for the exposure to human serum RNases and the intensity of OnRS/MGA-bound MG fluorescence, and addition of RNase inhibitor completely blocked the cleavage of OnRS/MGA by serum RNases. (d) OnRS/MGA was much more susceptible to human RNase A (10 min incubation) than angiogenin (RNase 5; 30 min incubation), (e) Human pancreatic cancer patients showed significantly higher serum RNase activities than benign/normal patients, as determined by the decrease in MGA-bound MG fluorescence intensity (ΔΑ.υ./πήη/μΕ). N = 10 in each group. OnRS/MGA5 was used in this study.
DETAILED DESCRIPTION
1. Introduction
[0036] Provided are methods and kits based in part on the discover, design and development of simple methods for producing and using an RNA sensor to detect RNase activity in biological samples. This method is based on the strong and specific fluorescence intensity displayed by malachite green (MG) upon binding to malachite green aptamer (MGA), where chimeric MGA was efficiently produced on large scale (tens of milligrams from 1 L bacterial culture) using tRNA/pre-miRNA non-coding RNA (ncRNA) scaffolds (OnRS) described herein and in co-pending and co-owned US Provisional Application No. 62/003,806, filed on March 28, 2014, also published in Chen, et al., Nucleic Acids Research (2015) l :doi: 10.1093/nar/gkv228. Both documents are hereby incorporated herein by reference in their entireties for all purposes.
[0037] The present RNase detection methods are different from current RNase activity assays, such as those commercially-available kits that rely on isotope- or fluorophore-labeled RNAs that are only able to offer microgram quantities of labeled RNA agents but unable to offer milligrams quantities. Because biological samples such as human sera are comprised of high levels of RNase activities, direct determination of these RNase activities requires the use of large quantities (e.g., microgram levels) of labeled RNA agents which is costly and impractical with presently available technologies. Furthermore, the extensive dilution (e.g., 1 : 1,000) of serum sample would affect the RNase activity assay including linear range and accuracy. Therefore, the herein described label-free method is much simpler and provides direct, selective and accurate measurement of RNase activity in human serum samples, etc. Data are provided to demonstrate the utility of this method to detect serum RNase activities, e.g., in pancreatic cancer patients versus healthy /benign subjects, and thereof may be utilized for diagnosis and/or prognosis.
[0038] The presently described fluorescence-based method uses label-free RNA substrate bearing a malachite green aptamer (MGA), which produces a selective and sensitive fluorescent absorbance upon binding to malachite green MG. Chimeric MGA is produced on a large scale using tRNA/pre-miRNA non-coding RNA (ncRNA) scaffolds (OnRS) recombinant RNA technique (e.g., producing multi-milligrams MGA from 1L bacterial culture), thereby allowing the assay of serum RNase activity without dilution. This method is cost-effective, selective and more accurate.
2. Polynucleotides - tRNA/pre-microRNA scaffolds
[0039] Generally, the polynucleotides comprise a tRNA operably linked to a pre- microRNA. In varying embodiments, the anticodon of the tRNA is replaced with a pre- microRNA molecule. For example, in some embodiments, the 3 '-terminus and the 5'- terminus of the pre-microRNA are ligated or fused to the 3 '-terminus and the 5 '-terminus of the tRNA that are created when the anticodon is removed. The tRNA molecule and the pre- microRNA molecule can be, but need not be directly ligated or fused to one another to be operably linked. In varying embodiments, the pre-microRNA can contain one or more dicer cleavable sites to allow for the high level expression and efficient cleavage of an inserted RNA molecule desired to be expressed from the hybrid tRNA/pre-microRNA
polynucleotide. [0040] The hybrid tRNA/pre-microRNA molecules can be produced by standard recombinant methods, or can be synthetically prepared. In varying embodiments, the polynucleotides can have one or more chemical modifications, including without limitation, e.g., internucleotide linkages, internucleoside linkages, dideoxyribonucleotides, 2 '-sugar modification, 2 '-amino groups, 2'-fluoro groups, 2'-methoxy groups, 2'-alkoxy groups, 2'- alkyl groups, 2'-deoxyribonucleotides, 2'-0-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, universal base nucleotides, acyclic nucleotides, 5-C-methyl nucleotides, biotin groups, terminal glyceryl incorporation, inverted deoxy abasic residue incorporation, sterically hindered molecules, 3'-deoxyadenosine (cordycepin), 3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxyinosine (ddl), 2',3'-dideoxy-3'-thiacytidine (3TC), 2',3'-didehydro-2',3'- di deoxy thy mi di-ne (d4T), monophosphate nucleotide modification (MNM) of 3'-azido-3'- deoxythymidine (AZT), MNM-2',3'-dideoxy-3'-thiacytidine (3TC), MNM- 2',3'-didehydro- 2',3'-dide-oxythymidine (d4T), capping moieties, L-nucleotides locked nucleic acid (LNA) nucleotides, 2'-methoxyethoxy (MOE) nucleotides, 2'-methyl-thio-ethyl, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-chloro nucleotides, 2'-azido nucleotides, 2'-0-methyl, cholesterol groups, 2'-0-methyl groups, phosphorothioate groups, 2'-fluoro groups, 2'-0-methyoxyethyl groups, boranophosphate groups, 4'-thioribose groups, bile acid, lipids, and bridges connecting the 2'-oxygen and 4'-carbon.
[0041] In varying embodiments, the hybrid tRNA/pre-microRNA molecules comprise analog ribonucleotide bases. As used herein, the term "analog" defines possible derivatives of the ribonucleotide originating from the activity of tRNA post-transcriptional modification enzymes of the cell in which they are produced. The analogs of the ribonucleotides A, C, G and U which may be found in a tRNA depend on the cell in which that tRNA is produced and on the position of the ribonucleotide in question in the tRNA. A large number of analogs are given in Sprinzl et al. (1998) "Compilation of tRNA sequences and sequences of tRNA genes". Nucleic Acids Res., 26, 148-153 and on the basis of "RNA modification database" data (http://medstat.med.utah.edu/RNAmods/). The analogs of A may be selected more particularly from the group constituted by 1-methyl-A, inosine and 2'- O-methyl-A. The analogs of C may be selected more particularly from the group constituted by 5-methyl-C and 2'-0-methyl-C. The analogs of G may be selected more particularly from the group constituted by 7-methyl-G and 2'-0-methyl-G. The analogs of U may be selected more particularly from the group constituted by pseudouridine, ribothymidine, 2'-0-methyl-ribothymidine, dihydrouridine, 4-thiouridine and 3-(3-amino-3- carb oxy propy l)-uri dine . a. tRNA
[0042] The general characteristics of a tRNA are well-known to the person skilled in the art. In some embodiments, a tRNA is formed of a single ribonucleotide chain which is capable of folding to adopt a characteristic, so-called cloverleaf secondary structure. This characteristic secondary structure comprises:
(i) an acceptor stem composed of the first 7 ribonucleotides of the 5' end of the ribonucleotide chain and the 7 ribonucleotides that precede the last 4 ribonucleotides of the 3' end of the ribonucleotide chain, thus forming a double-stranded structure comprising 6 or 7 pairs of ribonucleotides, it being possible for the ribonucleotides constituted by the first ribonucleotide of the 5' end of the ribonucleotide chain and the ribonucleotide that precedes the last 4 ribonucleotides of the 3' end of the ribonucleotide chain not to be paired;
(ii) a D arm constituted by 4 pairs of ribonucleotides and a D loop constituted by 8 to 10 ribonucleotides, formed by the folding of a part of the ribonucleotide chain that follows the first 7 ribonucleotides of the 5' end of the ribonucleotide chain;
(iii) a stem of the anticodon constituted by 5 pairs of ribonucleotides, and a loop of the anticodon constituted by 7 ribonucleotides (stem-loop of the anticodon), formed by the folding of a part of the ribonucleotide chain that follows the D arm and the D loop;
(iv) a variable loop constituted by from 4 to 21 ribonucleotides and formed by a part of the ribonucleotide chain that follows the stem of the anticodon and the loop of the anticodon;
(v) a T arm constituted by 5 pairs of ribonucleotides, and a T loop constituted by 8 ribonucleotides, formed by the folding of a part of the ribonucleotide chain that follows the variable loop and precedes the ribonucleotides of the 3' end of the ribonucleotide chain which are involved in the constitution of the acceptor stem.
[0043] The hybrid tRNA/pre-microRNA polynucleotides can contain any tRNA known in the art, e.g. for encoding any amino acid. The selection of an appropriate tRNA molecule may be, in part, driven by the host cells to be used for expression of the inserted RNA. For example, when seeking to produce high expression levels of a desired inserted RNA molecule, the tRNA selected can be from a tRNA encoding for codon preferred by the species of host cell rather than from a rare codon in that species of host cell. In varying embodiments, the tRNA is a methionyl-tRNA. In varying embodiments, the tRNA is derived from the host cell used for expression. In varying embodiments, the tRNA is a mammalian tRNA. In varying embodiments, the tRNA is a human tRNA.
[0044] In some embodiments, the chimeric tRNA defined above does not comprise the substantially intact stem of the anticodon of the tRNA from which it is derived. For example, in the chimeric tRNA, between the ribonucleotide that precedes the stem-loop of the anticodon in the tRNA before modification and the ribonucleotide that follows the stem- loop of the anticodon in the tRNA before modification, the stem of the anticodon of the tRNA before modification is no longer present. b. pre-microRNA [0045] The hybrid tRNA/pre-microRNA polynucleotides can contain any pre- microRNA molecule known in the art. In varying embodiments the pre-microRNA is selected from human pre-miRNA-1291, human pre-miRNA-34a and human pre-miRNA- 125-1. Other pre-microRNA molecules that can be used in the hybrid tRNA/pre-microRNA polynucleotides include pre-microRNA molecules that express in the host cell (e.g., E. coli host cell) at or above the levels of expression of human pre-miRNA-1291, human pre- miRNA-34a and human pre-miRNA- 125-1 in the same host cell (e.g., E. coli host cell). In varying embodiments, the pre-microRNA molecule is from a mammalian pre-microRNA molecule. In varying embodiments, the pre-microRNA molecule is from a human pre- microRNA molecule. In varying embodiments, the pre-microRNA component of the hybrid tRNA/pre-microRNA polynucleotides is from about 80 nucleotides to about 120 nucleotides in length, e.g., from about 80 nucleotides to about 100 nucleotides in length, e.g., about 80, 85, 90, 95, 100, 105, 110, 115 or 120 nucleotides in length.
[0046] In varying embodiments, the pre-microRNA is a human pre-microRNA selected from the group consisting of hsa-let-7a-l (miRBase.org accession no. :
MI0000060), hsa-let-7a-2 (MI0000061), hsa-let-7a-3 (MI0000062), hsa-let-7b
(MI0000063), hsa-let-7c (MI0000064), hsa-let-7d (MI0000065), hsa-let-7e (MI0000066), hsa-let-7f-l (MI0000067), hsa-let-7f-2 (MI0000068), hsa-let-7g (MI0000433), hsa-let-7i (MI0000434), hsa-mir-1-1 (MI0000651), hsa-mir-1-2 (MI0000437), hsa-mir-7-1
(MI0000263), hsa-mir-7-2 (MI0000264), hsa-mir-7-3 (MI0000265), hsa-mir-9-1
(MI0000466), hsa-mir-9-2 (MI0000467), hsa-mir-9-3 (MI0000468), hsa-mir-lOa
(MI0000266), hsa-mir-lOb (MI0000267), hsa-mir-15a (MI0000069), hsa-mir-15b
(MI0000438), hsa-mir-16-1 (MI0000070), hsa-mir-16-2 (MI0000115), hsa-mir-17
(MI0000071), hsa-mir-18a (MI0000072), hsa-mir-18b (MI0001518), hsa-mir-19a (MI0000073), hsa-mir-19b-l (MI0000074), hsa-mir-19b-2 (MI0000075), hsa-mir-20a (MI0000076), hsa-mir-20b (MI0001519), hsa-mir-21 (MI0000077), hsa-mir-22
(MI0000078), hsa-mir-23a (MI0000079), hsa-mir-23b (MI0000439), hsa-mir-23c
(MI0016010), hsa-mir-24-1 (MI0000080), hsa-mir-24-2 (MI0000081), hsa-mir-25
(MI0000082), hsa-mir-26a-l (MI0000083), hsa-mir-26a-2 (MI0000750), hsa-mir-26b (MI0000084), hsa-mir-27a (MI0000085), hsa-mir-27b (MI0000440), hsa-mir-28
(MI0000086), hsa-mir-29a (MI0000087), hsa-mir-29b-l (MI0000105), hsa-mir-29b-2 (MI0000107), hsa-mir-29c (MI0000735), hsa-mir-30a (MI0000088), hsa-mir-30b
(MI0000441), hsa-mir-30c-l (MI0000736), hsa-mir-30c-2 (MI0000254), hsa-mir-30d (MI0000255), hsa-mir-30e (MI0000749), hsa-mir-31 (MI0000089), hsa-mir-32
(MI0000090), hsa-mir-33a (MI0000091), hsa-mir-33b (MI0003646), hsa-mir-34a
(MI0000268), hsa-mir-34b (MI0000742), hsa-mir-34c (MI0000743), hsa-mir-92a-l (MI0000093), hsa-mir-92a-2 (MI0000094), hsa-mir-92b (MI0003560), hsa-mir-93
(MI0000095), hsa-mir-95 (MI0000097), hsa-mir-96 (MI0000098), hsa-mir-98
(MI0000100), hsa-mir-99a (MI0000101), hsa-mir-99b (MI0000746), hsa-mir-100
(MI0000102), hsa-mir-101-1 (MI0000103), hsa-mir-101-2 (MI0000739), hsa-mir-103a-l (MI0000109), hsa-mir-103a-2 (MI0000108), hsa-mir-103b-l (MI0007261), hsa-mir-103b-2 (MI0007262), hsa-mir-105-1 (MI0000111), hsa-mir- 105-2 (MI0000112), hsa-mir-106a (MI0000113), hsa-mir-106b (MI0000734), hsa-mir-107 (MI0000114), hsa-mir-122 (MI0000442), hsa-mir- 124-1 (MI0000443), hsa-mir- 124-2 (MI0000444), hsa-mir-124-3 (MI0000445), hsa-mir-125a (MI0000469), hsa-mir- 125b- 1 (MI0000446), hsa-mir- 125b-2 (MI0000470), hsa-mir- 126 (MI0000471), hsa-mir- 127 (MI0000472), hsa-mir- 128-1 (MI0000447), hsa-mir- 128-2 (MI0000727), hsa-mir- 129-1 (MI0000252), hsa-mir- 129-2 (MI0000473), hsa-mir-130a (MI0000448), hsa-mir-130b (MI0000748), hsa-mir-132 (MI0000449), hsa-mir- 133a-l (MI000045), hsa-mir- 133a-2 (MI0000451), hsa-mir- 133b (MI0000822), hsa-mir- 134 (MI0000474), hsa-mir- 135a- 1 (MI0000452), hsa-mir- 135a-2 (MI0000453), hsa-mir-135b (MI0000810), hsa-mir-136 (MI0000475), hsa-mir-137 (MI0000454), hsa-mir- 138-1 (MI0000476), hsa-mir- 138-2 (MI0000455), hsa-mir- 139 (MI0000261), hsa-mir-140 (MI0000456), hsa-mir-141 (MI0000457), hsa-mir-142
(MI0000458), hsa-mir-143 (MI0000459), hsa-mir-144 (MI0000460), hsa-mir-145
(MI0000461), hsa-mir- 146a (MI0000477), hsa-mir- 146b (MI0003129), hsa-mir- 147a (MI0000262), hsa-mir-147b (MI0005544), hsa-mir-148a (MI0000253), hsa-mir-148b (MI0000811), hsa-mir-149 (MI0000478), hsa-mir-150 (MI0000479), hsa-mir-151a (MI0000809), hsa-mir-151b (MI0003772), hsa-mir-152 (MI0000462), hsa-mir-153-1 (MI0000463) , hsa- miir-153-2 (MI0000464), hsa-mir-154 (MI0000480), hsa-mir-155
(MI0000681) , hsa- miir-181a-l (MI0000289), hsa-mir-181a-2 (MI0000269), hsa-mir-181b-l
(MI0000270) , hsa- miir-181b-2 (MI0000683), hsa-mir-181c (MI0000271), hsa-mir-181d
(MI0003139) , hsa- miir-182 (MI0000272), hsa-mir-183 (MI0000273), hsa-mir-184
(MI0000481) , hsa- miir-185 (MI0000482), hsa-mir-186 (MI0000483), hsa-mir-187
(MI0000274) , hsa- miir-188 (MI0000484), hsa-mir-190a (MI0000486), hsa-mir-190b
(MI0005545) , hsa- miir-191 (MI0000465), hsa-mir-192 (MI0000234), hsa-mir-193a
(MI0000487) , hsa- miir-193b (MI0003137), hsa-mir-194-1 (MI0000488), hsa-mir-194-2
(MI0000732) , hsa- miir-195 (MI0000489), hsa-mir-196a-l (MI0000238), hsa-mir-196a-2
(MI0000279) , hsa- miir-196b (MI0001150), hsa-mir-197 (MI0000239), hsa-mir-198
(MI0000240) , hsa- miir-199a-l (MI0000242), hsa-mir-199a-2 (MI0000281), hsa-mir-199b
(MI0000282) , hsa- miir-200a (MI0000737), hsa-mir-200b (MI0000342), hsa-mir-200c
(MI0000650) , hsa- miir-202 (MI0003130), hsa-mir-203a (MI0000283), hsa-mir-203b
(MI0017343) , hsa- miir-204 (MI0000284), hsa-mir-205 (MI0000285), hsa-mir-206
(MI0000490) , hsa- miir-208a (MI0000251), hsa-mir-208b (MI0005570), hsa-mir-210
(MI0000286) , hsa- miir-211 (MI0000287), hsa-mir-212 (MI0000288), hsa-mir-214
(MI0000290) , hsa- miir-215 (MI0000291), hsa-mir-216a (MI0000292), hsa-mir-216b
(MI0005569) , hsa- miir-217 (MI0000293), hsa-mir-218-1 (MI0000294), hsa-mir-218-2
(MI0000295) , hsa- miir-219a-l (MI0000296), hsa-mir-219a-2 (MI0000740), hsa-mir-219b
(MIOO 17299) , hsa- miir-221 (MI0000298), hsa-mir-222 (MI0000299), hsa-mir-223
(MI0000300) , hsa- miir-224 (MI0000301), hsa-mir-296 (MI0000747), hsa-mir-297
(MI0005775) , hsa- miir-298 (MI0005523), hsa-mir-299 (MI0000744), hsa-mir-300
(MI0005525) , hsa- miir-301a (MI0000745), hsa-mir-301b (MI0005568), hsa-mir-302a
(MI0000738) , hsa- miir-302b (MI0000772), hsa-mir-302c (MI0000773), hsa-mir-302d
(MI0000774) , hsa- miir-302e (MI0006417), hsa-mir-302f (MI0006418), hsa-mir-320a
(MI0000542) , hsa- miir-320b-l (MI0003776), hsa-mir-320b-2 (MI0003839), hsa-mir-320c-l
(MI0003778) , hsa- miir-320c-2 (MI0008191), hsa-mir-320d-l (MI0008190), hsa-mir-320d-2
(MI0008192) , hsa- miir-320e (MI0014234), hsa-mir-323a (MI0000807), hsa-mir-323b
(MIOO 1420), hhssaa--mmiirr--324 (MI0000813), hsa-mir-325 (MI0000824), hsa-mir-326
(MI0000808) , hsa- miir-328 (MI0000804), hsa-mir-329-1 (MI0001725), hsa-mir-329-2
(MI0001726) , hsa- miir-330 (MI0000803), hsa-mir-331 (MI0000812), hsa-mir-335
(MI0000816) , hsa- miir-337 (MI0000806), hsa-mir-338 (MI0000814), hsa-mir-339
(MI0000815) , hsa- miir-340 (MI0000802), hsa-mir-342 (MI0000805), hsa-mir-345
(MI0000825) , hsa- miir-346 (MI0000826), hsa-mir-361 (MI0000760), hsa-mir-362 (MI0000762) , hsa- mi r-363 (MI000076), hsa-mir-365a (MI0000767), hsa-mir-365b
(MI0000769) , hsa- mi r-367 (MI0000775), hsa-mir-369 (MI0000777), hsa-mir-370
(MI0000778) , hsa- mi r-371a (MI0000779), hsa-mir-371b (MI0017393), hsa-mir-372
(MI0000780) , hsa- mi r-373 (MI0000781), hsa-mir-374a (MI0000782), hsa-mir-374b
(MI0005566) , hsa- mi r-374c (MI0016684), hsa-mir-375 (MI0000783), hsa-mir-376a-l
(MI0000784) , hsa- mi r-376a-2 (MI0003529), hsa-mir-376b (MI0002466), hsa-mir-376c
(MI0000776) , hsa- mi r-377 (MI0000785), hsa-mir-378a (MI0000786), hsa-mir-378b
(MIOO 14154) , hsa- mi r-378c (MIOO 15825), hsa-mir-378d-l (MIOO 16749), hsa-mir-378d-2
(MI0003840) , hsa- mi r-378e (MI0016750), hsa-mir-378f (MI0016756), hsa-mir-378g
(MIOO 16761) , hsa- mi r-378h (MI0016808 803), hsa-mir-378i (MI0016902), hsa-mir-378j
(MI0021273) , hsa- mi r-379 (MI0000787), hsa-mir-380 (MI0000788), hsa-mir-381
(MI0000789) , hsa- mi r-382 (MI0000790), hsa-mir-383 (MI0000791), hsa-mir-384
(MI0001145) , hsa- mi r-409 (MI0001735), hsa-mir-410 (MI0002465), hsa-mir-411
(MI0003675) , hsa- mi r-412 (MI0002464), hsa-mir-421 (MI0003685), hsa-mir-422a
(MI0001444) , hsa- mi r-423 (MI0001445), hsa-mir-424 (MI0001446), hsa-mir-425
(MI0001448) , hsa- mi r-429 (MI0001641), hsa-mir-431 (MI0001721), hsa-mir-432
(MI0003133) , hsa- mi r-433 (MI0001723), hsa-mir-448 (MI0001637), hsa-mir-449a
(MI0001648) , hsa- mi r-449b (MI0003673), hsa-mir-449c (MI0003823), hsa-mir-450a-l
(MI0001652) , hsa- mi r-450a-2 (MI0003187), hsa-mir-450b (MI0005531), hsa-mir-451a
(MI0001729) , hsa- mi r-451b (MI0017360), hsa-mir-452 (MI0001733), hsa-mir-454
(MI0003820) , hsa- mi r-455 (MI0003513), hsa-mir-466 (MI0014157), hsa-mir-483
(MI0002467) , hsa- mi r-484 (MI0002468), hsa-mir-485 (MI0002469), hsa-mir-486
(MI0002470) , hsa- mi r-486-2 (MI0023622), hsa-mir-487a (MI0002471), hsa-mir-487b
(MI0003530) , hsa- mi r-488 (MI0003123), hsa-mir-489 (MI0003124), hsa-mir-490
(MI0003125) , hsa- mi r-491 (MI0003126), hsa-mir-492 (MI0003131), hsa-mir-493
(MI0003132) , hsa- mi r-494 (MI0003134), hsa-mir-495 (MI0003135), hsa-mir-496
(MI0003136) , hsa- mi r-497 (MI0003138), hsa-mir-498 (MI0003142), hsa-mir-499a
(MI0003183) , hsa- mi r-499b (MI0017396), hsa-mir-500a (MI0003184), hsa-mir-500b
(MIOO 15903) , hsa- mi r-501 (MI0003185), hsa-mir-502 (MI0003186), hsa-mir-503
(MI0003188) , hsa- mi r-504 (MI0003189), hsa-mir-505 (MI0003190), hsa-mir-506
(MI0003193) , hsa- mi r-507 (MI0003194), hsa-mir-508 (MI0003195), hsa-mir-509-1
(MI0003196) , hsa- mi r-509-2 (MI0005530), hsa-mir-509-3 (MI0005717), hsa-mir-510
(MI0003197) , hsa- mi r-511 (MI0003127), hsa-mir-512-1 (MI0003140), hsa-mir-512-2
(MI0003141) , hsa- mi r-513a-l (MI0003191), hsa-mir-513a-2 (MI0003192), hsa-mir-513b (MI0006648) , hsa- mir- -513c (MI0006649), hsa-mir-514a-l (MI0003198), hsa-mir-514a-2
(MI0003199) , hsa- mir- -514a-3 (MI0003200), hsa-mir-514b (MI0014251), hsa-mir-515-1
(MI0003144) , hsa- mir- -515-2 (MI0003147), hsa-mir-516a-l (MI0003180), hsa-mir-516a-2
(MI0003181) , hsa- mir- -516b-l (MI0003172), hsa-mir-516b-2 (MI0003167), hsa-mir-517a
(MI0003161) , hsa- mir- -517b (MI0003165), hsa-mir-517c (MI0003174), hsa-mir-518a-l
(MI0003170) , hsa- mir- -518a-2 (MI0003173), hsa-mir-518b (MI0003156), hsa-mir-518c
(MI0003159) , hsa- mir- -518d (MI0003171), hsa-mir-518e (MI0003169), hsa-mir-518f
(MI0003154) , hsa- mir- -519a-l (MI0003178), hsa-mir-519a-2 (MI0003182), hsa-mir-519b
(MI0003151) , hsa- mir- -519c (MI0003148), hsa-mir-519d (MI0003162), hsa-mir-519e
(MI0003145) , hsa- mir- -520a (MI0003149), hsa-mir-520b (MI0003155), hsa-mir-520c
(MI0003158) , hsa- mir- -520d (MI0003164), hsa-mir-520e (MI0003143), hsa-mir-520f
(MI0003146) , hsa- mir- -520g (MI0003166), hsa-mir-520h (MI0003175), hsa-mir-521-1
(MI0003176) , hsa- mir- -521-2 (MI0003163), hsa-mir-522 (MI0003177), hsa-mir-523
(MI0003153) , hsa- mir- -524 (MI0003160), hsa-mir-525 (MI0003152), hsa-mir-526a-l
(MI0003157) , hsa- mir- -526a-2 (MI0003168), hsa-mir-526b (MI0003150), hsa-mir-527
(MI0003179) , hsa- mir- -532 (MI0003205), hsa-mir-539 (MI0003514), hsa-mir-541
(MI0005539) , hsa- mir- -542 (MI0003686), hsa-mir-543 (MI0005565), hsa-mir-544a
(MI0003515) , hsa- mir- -544b (MI0014159), hsa-mir-545 (MI0003516), hsa-mir-548a-l
(MI0003593. hsa- mir- 548a-2 (MI000359), hsa-mir-548a-3 (MI0003612), hsa-mir-548aa-l
(MI0016689) , hsa- mir- -548aa-2 (MIOO 16690), hsa-mir-548ab (MIOO 16752), hsa-mir-548ac
(MIOO 16762) , hsa- mir- -548ad (MIOO 16770), hsa-mir-548ae-l (MIOO 16779), hsa-mir-548ae
2 (MIOO 16780), hsa-mir-548ag-l (MIOO 16793), hsa-mir-548ag-2 (MIOO 16794), hsa-mir- 548ah (MI0016796), hsa-mir-548ai (MI0016813), hsa-mir-548aj-l (MI0016814), hsa-mir- 548aj-2 (MI0016815), hsa-mir-548ak (MI0016840), hsa-mir-548al (MI0016851), hsa-mir- 548am (MIOO 16904), hsa-mir-548an (MIOO 16907), hsa-mir-548ao (MIOO 17871), hsa-mir- 548ap (MIOO 17875), hsa-mir-548aq (MI0019130), hsa-mir-548ar (MI0019131), hsa-mir- 548as (MI0019132), hsa-mir-548at (MI0019137), hsa-mir-548au (MI0019145), hsa-mir- 548av (MI0019152), hsa-mir-548aw (MIOO 19283), hsa-mir-548ax (MIOO 19286), hsa-mir- 548ay (MI0022210), hsa-mir-548az (MI0022212), hsa-mir-548b (MI0003596), hsa-mir- 548ba (MI0025747), hsa-mir-548c (MI0003630), hsa-mir-548d-l (MI0003668), hsa-mir- 548d-2 (MI0003671), hsa-mir-548e (MI0006344), hsa-mir-548f-l (MI0006374), hsa-mir- 548f-2 (MI0006375), hsa-mir-548f-3 (MI0006376), hsa-mir-548f-4 (MI0006377), hsa-mir- 548f-5 (MI0006378), hsa-mir-548g (MI0006395), hsa-mir-548h-l (MI0006411), hsa-mir- 548h-2 (MI0006412), hsa-mir-548h-3 (MI0006413), hsa-mir-548h-4 (MI0006414), hsa- mir-548h-5 (MI0016751), hsa-mir-548i-l (MI0006421), hsa-mir-548i-2 (MI0006422), hsa- mir-548i-3 (MI0006423), hsa-mir-548i-4 (MI0006424), hsa-mir-548j (MI0006345), hsa- mir-548k (MI0006354), hsa-mir-5481 (MI0006361), hsa-mir-548m (MI0006400), hsa-mir- 548n (MI0006399), hsa-mir-548o (MI0006402), hsa-mir-548o-2 (MIOO 16746), hsa-mir- 548p (MI0006420), hsa-mir-548q (MI0010637), hsa-mir-548s (MI0014141), hsa-mir-548t (MIOO 14164), hsa-mir-548u (MIOO 14168), hsa-mir-548v (MIOO 14174), hsa-mir-548w (MI0014222), hsa-mir-548x (MI0014244), hsa-mir-548x-2 (MI0016833), hsa-mir-548y (MI0016595), hsa-mir-548z (MI0016688), hsa-mir-549a (MI0003679), hsa-mir-550a-l (MI0003600), hsa-mir-550a-2 (MI0003601), hsa-mir-550a-3 (MI0003762), hsa-mir-550b-l (MI0016686), hsa-mir-550b-2 (MI0016687), hsa-mir-551a (MI0003556), hsa-mir-551b (MI0003575), hsa-mir-552 (MI0003557), hsa-mir-553 (MI0003558), hsa-mir-554
(MI0003559), hsa-mir-555 (MI0003561), hsa-mir-556 (MI0003562), hsa-mir-557
(MI0003563), hsa-mir-558 (MI0003564), hsa-mir-559 (MI0003565), hsa-mir-561
(MI0003567), hsa-mir-562 (MI0003568), hsa-mir-563 (MI0003569), hsa-mir-564
(MI0003570), hsa-mir-566 (MI0003572), hsa-mir-567 (MI0003573), hsa-mir-568
(MI0003574), hsa-mir-569 (MI0003576), hsa-mir-570 (MI0003577), hsa-mir-571
(MI0003578), hsa-mir-572 (MI0003579), hsa-mir-573 (MI0003580), hsa-mir-574
(MI0003581), hsa-mir-575 (MI0003582), hsa-mir-576 (MI0003583), hsa-mir-577
(MI0003584), hsa-mir-578 (MI0003585), hsa-mir-579 (MI0003586), hsa-mir-580
(MI0003587), hsa-mir-581 (MI0003588), hsa-mir-582 (MI0003589), hsa-mir-583
(MI0003590), hsa-mir-584 (MI0003591), hsa-mir-585 (MI000359), hsa-mir-586
(MI0003594), hsa-mir-587 (MI0003595), hsa-mir-588 (MI0003597), hsa-mir-589
(MI0003599), hsa-mir-590 (MI0003602), hsa-mir-591 (MI0003603), hsa-mir-592
(MI0003604), hsa-mir-593 (MI0003605), hsa-mir-595 (MI0003607), hsa-mir-596
(MI0003608), hsa-mir-597 (MI0003609), hsa-mir-598 (MI0003610 162), hsa-mir-599 (MI0003611), hsa-mir-600 (MI0003613), hsa-mir-601 (MI0003614), hsa-mir-602
(MI0003615), hsa-mir-603 (MI0003616), hsa-mir-604 (MI0003617), hsa-mir-605
(MI0003618), hsa-mir-606 (MI0003619), hsa-mir-607 (MI0003620), hsa-mir-608
(MI0003621), hsa-mir-609 (MI0003622), hsa-mir-610 (MI0003623), hsa-mir-611
(MI0003624), hsa-mir-612 (MI0003625), hsa-mir-613 (MI0003626), hsa-mir-614
(MI0003627), hsa-mir-615 (MI0003628), hsa-mir-616 (MI0003629), hsa-mir-617
(MI0003631), hsa-mir-618 (MI0003632), hsa-mir-619 (MI0003633), hsa-mir-620
(MI0003634), hsa-mir-621 (MI0003635), hsa-mir-622 (MI0003636), hsa-mir-623
(MI0003637), hsa-mir-624 (MI0003638), hsa-mir-625 (MI0003639), hsa-mir-626 (MI0003640) hsa- mi r-627 (MI0003641), hsa-mir-628 (MI0003642), hsa-mir-629
(MI0003643) hsa- mi r-630 (MI000364), hsa-mir-631 (MI0003645), hsa-mir-632
(MI0003647) hsa- mi r-633 (MI0003648), hsa-mir-634 (MI0003649), hsa-mir-635
(MI0003650) hsa- mi r-636 (MI0003651), hsa-mir-637 (MI0003652), hsa-mir-638
(MI0003653) hsa- mi r-639 (MI0003654), hsa-mir-640 (MI0003655), hsa-mir-641
(MI0003656) hsa- mi r-642a (MI0003657), hsa-mir-642b (MI0016685), hsa-mir-643
(MI0003658) hsa- mi r-644a (MI0003659), hsa-mir-645 (MI0003660), hsa-mir-646
(MI0003661) hsa- mi r-647 (MI0003662), hsa-mir-648 (MI0003663), hsa-mir-649
(MI0003664) hsa- mi r-650 (MI0003665), hsa-mir-651 (MI0003666), hsa-mir-652
(MI0003667) hsa- mi r-653 (MI0003674), hsa-mir-654 (MI0003676), hsa-mir-655
(MI0003677) hsa- mi r-656 (MI0003678), hsa-mir-657 (MI0003681), hsa-mir-658
(MI0003682) hsa- mi r-659 (MI0003683), hsa-mir-660 (MI0003684), hsa-mir-661
(MI0003669) hsa- mi r-662 (MI0003670), hsa-mir-663a (MI0003672), hsa-mir-663b
(MI0006336) hsa- mi r-664a (MI0006442), hsa-mir-664b (MI0019134), hsa-mir-665
(MI0005563) hsa- mi r-668 (MI0003761), hsa-mir-670 (MI0003933), hsa-mir-671
(MI0003760) hsa- mi r-675 (MI0005416), hsa-mir-676 (MI0016436), hsa-mir-708
(MI0005543) hsa- mi r-711 (MI0012488), hsa-mir-718 (MI0012489), hsa-mir-744
(MI0005559) hsa- mi r-758 (MI0003757), hsa-mir-759 (MI0004065), hsa-mir-760
(MI0005567) hsa- mi r-761 (MI0003941), hsa-mir-762 (MI0003892), hsa-mir-764
(MI0003944) hsa- mi r-765 (MI0005116), hsa-mir-766 (MI0003836), hsa-mir-767
(MI0003763) hsa- mi r-769 (MI0003834), hsa-mir-770 (MI0005118), hsa-mir-802
(MI0003906) hsa- mi r-873 (MI0005564), hsa-mir-874 (MI0005532), hsa-mir-875
(MI0005541) hsa- mi r-876 (MI0005542), hsa-mir-877 (MI0005561), hsa-mir-885
(MI0005560) hsa- mi r-887 (MI0005562), hsa-mir-888 (MI0005537), hsa-mir-889
(MI0005540) hsa- mi r-890 (MI0005533), hsa-mir-891a (MI0005524), hsa-mir-891b
(MI0005534) hsa- mi r-892a (MI0005528), hsa-mir-892b (MI0005538), hsa-mir-892c
(MI0022560) hsa- mi r-920 (MI0005712), hsa-mir-921 (MI0005713), hsa-mir-922
(MI0005714) hsa- mi r-924 (MI0005716), hsa-mir-933 (MI0005755), hsa-mir-934
(MI0005756) hsa- mi r-935 (MI0005757), hsa-mir-936 (MI0005758), hsa-mir-937
(MI0005759) hsa- mi r-938 (MI0005760), hsa-mir-939 (MI0005761), hsa-mir-940
(MI0005762) hsa- mi r-941-1 (MI0005763), hsa-mir-941-2 (MI0005764), hsa-mir-941-3
(MI0005765) hsa- mi r-941-4 (MI0005766), hsa-mir-942 (MI0005767), hsa-mir-943
(MI0005768) hsa- mi r-944 (MI0005769), hsa-mir-1178 (MI0006271), hsa-mir-1179
(MI0006272) hsa- mi r-1180 (MI0006273), hsa-mir-1181 (MI0006274), hsa-mir-1182 (MI0006275) , hsa- -mir 1183 (MI0006276), hsa-mir-1184-1 (MI0006277), hsa-mir-1184-2
(MI0015971) , hsa- -mir 1184-3 (MI0015972), hsa-mir-1 185-1 (MI0003844), hsa-mir-1185-2
(MI0003821) , hsa- -mir 1193 (MI0014205), hsa-mir-1197 (MI0006656), hsa-mir-1199
(MI0020340) , hsa- -mir 1200 (MI0006332), hsa-mir-1202 (MI0006334), hsa-mir-1203
(MI0006335) , hsa- -mir 1204 (MI0006337), hsa-mir- 1205 (MI0006338), hsa-mir- 1206
(MI0006339) , hsa- -mir 1207 (MI0006340), hsa-mir-1208 (MI0006341), hsa-mir-1224
(MI0003764) , hsa- -mir 1225 (MI0006311), hsa-mir-1226 (MI0006313), hsa-mir-1227
(MI0006316) , hsa- -mir 1228 (MI0006318), hsa-mir- 1229 (MI0006319), hsa-mir- 1231
(MI0006321) , hsa- -mir 1233-1 (MI0006323), hsa-mir- 1233 -2 (MI0015973), hsa-mir-1234
(MI0006324) , hsa- -mir 1236 (MI0006326), hsa-mir-1237 (MI0006327), hsa-mir-1238
(MI0006328) , hsa- -mir 1243 (MI0006373), hsa-mir- 1244-1 (MI0006379), hsa-mir- 1244-2
(MI0015974) , hsa- -mir 1244-3 (MI0015975), hsa-mir-1245a (MI0006380), hsa-mir-1245b
(MIOO 17431) , hsa- -mir 1246 (MI0006381), hsa-mir- 1247 (MI0006382), hsa-mir- 1248
(MI0006383) , hsa- -mir 1249 (MI0006384), hsa-mir-1250 (MI0006385), hsa-mir-1251
(MI0006386) , hsa- -mir 1252 (MI0006434), hsa-mir-1253 (MI0006387), hsa-mir- 1254-1
(MI000638), hsa-mir--1254-2 (MI0016747), hsa-mir-1255a (MI0006389), hsa-mir- 1255b- 1
(MI0006435) , hsa- -mir 1255b-2 (MI0006436), hsa-mir-1256 (MI0006390), hsa-mir-1257
(MI0006391) , hsa- -mir 1258 (MI0006392), hsa-mir- 1260a (MI0006394), hsa-mir- 1260b
(MIOO 14197) , hsa- -mir 1261 (MI0006396), hsa-mir- 1262 (MI0006397), hsa-mir- 1263
(MI0006398) , hsa- -mir 1264 (MI0003758), hsa-mir- 1265 (MI0006401), hsa-mir- 1266
(MI0006403) , hsa- -mir 1267 (MI0006404), hsa-mir- 1268a (MI0006405), hsa-mir- 1268b
(MIOO 16748) , hsa- -mir 1269a (MI0006406), hsa-mir-1269b (MI0016888), hsa-mir- 1270-1
(MI0006407) , hsa- -mir 1270-2 (MI0015976), hsa-mir-1271 (MI0003814), hsa-mir-1272
(MI0006408) , hsa- -mir 1273 a (MI0006409), hsa-mir- 1273 c (MIOO 14171), hsa-mir- 1273 d
(MIOO 14254) , hsa- -mir 1273e (MI0016059), hsa-mir-1273f (MI0018002), hsa-mir-1273g
(MIOO 18003) , hsa- -mir 1273h (MI0025512), hsa-mir-1275 (MI0006415), hsa-mir-1276
(MI0006416) , hsa- -mir 1277 (MI0006419), hsa-mir- 1278 (MI0006425), hsa-mir- 1279
(MI0006426) , hsa- -mir 1281 (MI0006428), hsa-mir- 1282 (MI0006429), hsa-mir- 1283-1
(MI0003832) , hsa- -mir 1283-2 (MI0006430), hsa-mir-1284 (MI0006431), hsa-mir-1285-1
(MI0006346) , hsa- -mir 1285-2 (MI0006347), hsa-mir-1286 (MI0006348), hsa-mir-1287
(MI0006349) , hsa- -mir 1288 (MI0006432), hsa-mir- 1289-1 (MI0006350), hsa-mir- 1289-2
(MI0006351) , hsa- -mir 1290 (MI0006352), hsa-mir-1291 (MI0006353), hsa-mir-1292
(MI0006433) , hsa- -mir 1293 (MI0006355), hsa-mir-1294 (MI0006356), hsa-mir-1295a
(MI0006357) , hsa- -mir 1295b (MIOO 19146), hsa-mir- 1296 (MI0003780), hsa-mir- 1297 (MI0006358), hsa-mir-1298 (MI0003938), hsa-mir-1299 (MI0006359), hsa-mir-1301 (MI0003815), hsa-mir-1302-1 (MI0006362), hsa-mir-1302- 10 (MI0015979), hsa-mir-1302- 11 (MI0015980), hsa-mir-1302-2 (MI0006363), hsa-mir-1302-3 (MI0006364), hsa-mir- 1302-4 (MI0006365), hsa-mir-1302-5 (MI0006366), hsa-mir-1302-6 (MI0006367), hsa- mir-1302-7 (MI0006368), hsa-mir-1302-8 (MI0006369), hsa-mir-1302-9 (MI0015978), hsa-mir-1303 (MI0006370), hsa-mir-1304 (MI0006371), hsa-mir-1305 (MI0006372), hsa- mir-1306 (MI0006443), hsa-mir-1307 (MI0006444), hsa-mir-1321 (MI0006652), hsa-mir-
1322 (MI0006653), hsa-mir- 323 (MI0003786), hsa-mir-1324 (MI0006657), hsa-mir-1343
(MIOO 17320) hsa- mir- -1468 (MI0003782), hsa-mir-1469 (MI0007074), hsa-mir-1470
(MI0007075) hsa- mir- -1471 (MI0007076), hsa-mir-1537 (MI0007258), hsa-mir-1538
(MI0007259) hsa- mir- -1539 (MI0007260), hsa-mir-1587 (MIOO 16905), hsa-mir-1825
(MI0008193) hsa- mir- -1827 (MI0008195), hsa-mir-1908 (MI0008329), hsa-mir-1909
(MI0008330) hsa- mir- -1910 (MI0008331), hsa-mir-1911 (MI0008332), hsa-mir-1912
(MI0008333) hsa- mir- -1913 (MI0008334), hsa-mir-1914 (MI0008335), hsa-mir-1915
(MI0008336) hsa- mir- -1972- 1 (MI0009982), hsa-mir- 1972-2 (MI0015977), hsa-mir-1973
(MI0009983) hsa- mir- -1976 (MI0009986), hsa-mir-2052 (MIOO 10486), hsa-mir-2053
(MIOO 10487) hsa- mir- -2054 (MI0010488), hsa-mir-2110 (MI0010629), hsa-mir-2113
(MI0003939) hsa- mir- -2114 (MI0010633), hsa-mir-2115 (MI0010634), hsa-mir-2116
(MIOO 10635) hsa- mir- -2117 (MI0010636), hsa-mir-2276 (MI0011282), hsa-mir-2277
(MIOO 11284) hsa- mir- -2278 (MI0011285), hsa-mir-2355 (MI0015873), hsa-mir-2392
(MIOO 16870) hsa- mir- -2467 (MI0017432), hsa-mir-2681 (MI0012062), hsa-mir-2682
(MI0012063) hsa- mir- -2861 (MI0013006), hsa-mir-2909 (MI0013083), hsa-mir-3064
(MIOO 17375) hsa- mir- -3065 (MIOO 14228), hsa-mir-3074 (MIOO 14181), hsa-mir-3115
(MIOO 14127) hsa- mir- -3116- 1 (MIOO 14128), hsa-mir-3116-2 (MIOO 14129), hsa-mir-3117
(MIOO 14130) hsa- mir- -3118- 1 (MI0014131), hsa-mir-3118-2 (MI0014132), hsa-mir-3118
(MI0014133) hsa- mir- -3118- 4 (MI0014207), hsa-mir-3118-5 (MI0014243), hsa-mir-3118
(MI0015981) hsa- mir- -3119- 1 (MI0014134), hsa-mir-3119-2 (MI0014135), hsa-mir-3120
(MIOO 14136) hsa- mir- -3121 (MIOO 14137), hsa-mir-3122 (MIOO 14138), hsa-mir-3123
(MIOO 14139) hsa- mir- -3124 (MIOO 14140), hsa-mir-3125 (MIOO 14142), hsa-mir-3126
(MI0014143) hsa- mir- -3127 (MIOO 14144), hsa-mir-3128 (MIOO 14145), hsa-mir-3129
(MIOO 14146) hsa- mir- -3130- 1 (MIOO 14147), hsa-mir-3130-2 (MIOO 14148), hsa-mir-3131
(MI0014151) hsa- mir- -3132 (MI0014152), hsa-mir-3133 (MI0014153), hsa-mir-3134
(MIOO 14155) hsa- mir- -3135a (MI0014156), hsa-mir-3135b (MI0016809), hsa-mir-3136
(MIOO 14158) hsa- mir- -3137 (MIOO 14160), hsa-mir-3138 (MIOO 14161), hsa-mir-3139 (MI0014162), hsa-mir-3140 (MI0014163), hsa-mir-3141 (MI0014165), hsa-mir-3142 (MI0014166), hsa-mir-3143 (MI0014167), hsa-mir-3144 (MI0014169), hsa-mir-3145 (MI0014170), hsa-mir-3146 (MI0014172), hsa-mir-3147 (MI0014173), hsa-mir-3148 (MI0014175), hsa-mir-3149 (MI0014176), hsa-mir-3150a (MI0014177), hsa-mir-3150b (MI0016426), hsa-mir-3151 (MI0014178), hsa-mir-3152 (MI0014179), hsa-mir-3153 (MI0014180), hsa-mir-3154 (MI0014182), hsa-mir-3155a (MI0014183), hsa-mir-3155b (MI0016839), hsa-mir-3156-1 (MI0014184), hsa-mir-3156-2 (MI0014230), hsa-mir-3156-3 (MI0014242), hsa-mir-3157 (MI0014185), hsa-mir-3158-1 (MI0014186), hsa-mir-3158-2 (MI0014187), hsa-mir-3159 (MI0014188), hsa-mir-3160-1 (MI0014189), hsa-mir-3160-2 (MI0014190), hsa-mir-3161 (MI0014191), hsa-mir-3162 (MI0014192), hsa-mir-3163 (MI0014193), hsa-mir-3164 (MI0014194), hsa-mir-3165 (MI0014195), hsa-mir-3166 (MI0014196), hsa-mir-3167 (MI0014198), hsa-mir-3168 (MI0014199), hsa-mir-3169 (MI0014200), hsa-mir-3170 (MIOO 14201), hsa-mir-3171 (MIOO 14202), hsa-mir-3173 (MI0014204), hsa-mir-3174 (MI0014208), hsa-mir-3175 (MI0014209), hsa-mir-3176 (MIOO 14210), hsa-mir-3177 (MIOO 14211), hsa-mir-3178 (MIOO 14212), hsa-mir-3179-1 (MI0014213), hsa-mir-3179-2 (MI0014216; hsa-mir-3179-3 (MI0014221), hsa-mir-3180-1 (MIOO 14214), hsa-mir-3180-2 (MIOO 14215; hsa-mir-3180-3 (MIOO 14217), hsa-mir-3180-4 (MI0016408), hsa-mir-3180-5 (MI0016409), hsa-mir-3181 (MI0014223), hsa-mir-3182 (MI0014224), hsa-mir-3183 (MI0014225), hsa-mir-3184 (MI0014226), hsa-mir-3185 (MI0014227), hsa-mir-3186 (MI0014229), hsa-mir-3187 (MI0014231), hsa-mir-3188 (MI0014232), hsa-mir-3189 (MI0014233), hsa-mir-3190 (MI0014235), hsa-mir-3191 (MIOO 14236), hsa-mir-3192 (MIOO 14237), hsa-mir-3193 (MIOO 14238), hsa-mir-3194 (MIOO 14239), hsa-mir-3195 (MIOO 14240), hsa-mir-3196 (MIOO 14241), hsa-mir-3197 (MIOO 14245), hsa-mir-3198-1 (MIOO 14246), hsa-mir-3198-2 (MIOO 17335), hsa-mir-3199-1 (MI0014247), hsa-mir-3199-2 (MI0014248), hsa-mir-3200 (MI0014249), hsa-mir-3201 (MI0014250), hsa-mir-3202-1 (MI0014252), hsa-mir-3202-2 (MI0014253), hsa-mir-3529 (MI0017351), hsa-mir-3591 (MI0017383), hsa-mir-3605 (MI0015995), hsa-mir-3606 (MI0015996), hsa-mir-3607 (MI0015997), hsa-mir-3609 (MI0015999), hsa-mir-3610 (MIOO 16000), hsa-mir-3611 (MIOO 16001), hsa-mir-3612 (MIOO 16002), hsa-mir-3613 (MI0016003), hsa-mir-3614 (MI0016004), hsa-mir-3615 (MI0016005), hsa-mir-3616 (MIOO 16006), hsa-mir-3617 (MIOO 16007), hsa-mir-3618 (MIOO 16008), hsa-mir-3619 (MIOO 16009), hsa-mir-3620 (MIOO 16011), hsa-mir-3621 (MIOO 16012), hsa-mir-3622a (MI0016013), hsa-mir-3622b (MI0016014), hsa-mir-3646 (MI0016046), hsa-mir-3648 (MI0016048), hsa-mir-3649 (MI0016049), hsa-mir-3650 (MI0016050), hsa-mir-3651 (MI0016051), hsa-mir-3652 (MI0016052), hsa-mir-3653 (MI0016053), hsa-mir-3654 (MI0016054), hsa-mir-3655 (MI0016055), hsa-mir-3656 (MI0016056), hsa-mir-3657 (MI0016057), hsa-mir-3658 (MI0016058), hsa-mir-3659 (MI0016060), hsa-mir-3660 (MIOO 16061), hsa-mir-3661 (MI0016062), hsa-mir-3662 (MI0016063), hsa-mir-3663 (MIOO 16064), hsa-mir-3664 (MIOO 16065), hsa-mir-3665 (MIOO 16066), hsa-mir-3666 (MIOO 16067), hsa-mir-3667 (MIOO 16068), hsa-mir-3668 (MIOO 16069), hsa-mir-3669 (MIOO 16070), hsa-mir-3670-1 (MIOO 16071), hsa-mir-3670-2 (MI0019112), hsa-mir-3671 (MI0016072), hsa-mir-3672 (MI0016073), hsa-mir-3673 (MI0016074), hsa-mir-3674 (MIOO 16075), hsa-mir-3675 (MIOO 16076), hsa-mir-3677 (MIOO 16078), hsa-mir-3678 (MIOO 16079), hsa-mir-3679 (MIOO 16080), hsa-mir-3680-1 (MIOO 16081), hsa-mir-3680-2 (MI0019113), hsa-mir-3681 (MI0016082), hsa-mir-3682 (MI0016083), hsa-mir-3683 (MI0016084), hsa-mir-3684 (MI0016085), hsa-mir-3685 (MI0016086), hsa-mir-3686 (MI0016087), hsa-mir-3687 (MI0016088), hsa-mir-3688-1 (MI0016089), hsa-mir-3688-2 (MI0017447), hsa-mir-3689a (MIOO 16090), hsa-mir-3689b (MI0016411), hsa-mir-3689c (MI0016832), hsa-mir-3689d-l (MI0016834), hsa-mir-3689d-2 (MI0016835), hsa-mir- 3689e (MIOO 16836), hsa-mir-3689f (MIOO 16837), hsa-mir-3690-1 (MIOO 16091), hsa-mir- 3690-2 (MI0023561), hsa-mir-3691 (MI0016092), hsa-mir-3692 (MI0016093), hsa-mir- 3713 (MI0016134), hsa-mir-3714 (MI0016135), hsa-mir-3907 (MI0016410), hsa-mir-3908 (MI0016412), hsa-mir-3909 (MI0016413), hsa-mir-3910-1 (MI0016414), hsa-mir-3910-2 (MIOO 16431), hsa-mir-3911 (MIOO 16415), hsa-mir-3912 (MIOO 16416), hsa-mir-3913-1 (MIOO 16417), hsa-mir-3913-2 (MIOO 16418), hsa-mir-3914-1 (MIOO 16419), hsa-mir-3914-2 (MIOO 16421), hsa-mir-3915 (MIOO 16420), hsa-mir-3916 (MIOO 16422), hsa-mir-3917 (MI0016423), hsa-mir-3918 (MI0016424), hsa-mir-3919 (MI0016425), hsa-mir-3920 (MIOO 16427), hsa-mir-3921 (MIOO 16428), hsa-mir-3922 (MIOO 16429), hsa-mir-3923 (MI0016430), hsa-mir-3924 (MI0016432), hsa-mir-3925 (MI0016433), hsa-mir-3926-1 (MI0016434), hsa-mir-3926-2 (MI0016437), hsa-mir-3927 (MI0016435), hsa-mir-3928 (MI0016438), hsa-mir-3929 (MI0016439), hsa-mir-3934 (MI0016590), hsa-mir-3935 (MI0016591), hsa-mir-3936 (MI0016592), hsa-mir-3937 (MI0016593), hsa-mir-3938 (MI0016594), hsa-mir-3939 (MI0016596), hsa-mir-3940 (MI0016597), hsa-mir-3941 (MI0016598), hsa-mir-3942 (MI0016599), hsa-mir-3943 (MI0016600), hsa-mir-3944 (MIOO 16601), hsa-mir-3945 (MIOO 16602), hsa-mir-3960 (MIOO 16964), hsa-mir-3972 (MIOO 16990), hsa-mir-3973 (MIOO 16991), hsa-mir-3974 (MIOO 16992), hsa-mir-3975 (MI0016993), hsa-mir-3976 (MI0016994), hsa-mir-3977 (MI0016995), hsa-mir-3978 (MI0016996), hsa-mir-4251 (MI0015861), hsa-mir-4252 (MI0015864), hsa-mir-4253 (MIOO 15860) hsa- -mi r-4254 (MIOO 15862) , hsa-mir-4255 (MI0015863), hsa-mir-4256
(MI0015855) hsa- -mi r-4257 (MI0015856) , hsa-mir-4259 (MI0015858), hsa-mir-4260
(MI0015859) hsa- -mi r-4261 (MIOO 15868) , hsa-mir-4262 (MIOO 15872), hsa-mir-4263
(MIOO 15876) hsa- -mi r-4264 (MIOO 15877) , hsa-mir-4265 (MIOO 15869), hsa-mir-4266
(MIOO 15870) hsa- -mi r-4267 (MIOO 15871) , hsa-mir-4268 (MIOO 15874), hsa-mir-4269
(MIOO 15875) hsa- -mi r-4270 (MIOO 15878) , hsa-mir-4271 (MIOO 15879), hsa-mir-4272
(MI0015880) hsa- -mi r-4273 (MI0015881) , hsa-mir-4274 (MI0015884), hsa-mir-4275
(MI0015883) hsa- -mi r-4276 (MI0015882) , hsa-mir-4277 (MI0015886), hsa-mir-4278
(MI0015888) hsa- -mi r-4279 (MI0015887) , hsa-mir-4280 (MI0015889), hsa-mir-4281
(MI0015885) hsa- -mi r-4282 (MIOO 15890) , hsa-mir-4283- 1 (MIOO 15892), hsa-mir-4283-2
(MIOO 15982) hsa- -mi r-4284 (MI0015893) , hsa-mir-4285 (MIOO 15891), hsa-mir-4286
(MIOO 15894) hsa- -mi r-4287 (MIOO 15895) , hsa-mir-4288 (MIOO 15896), hsa-mir-4289
(MIOO 15898) hsa- -mi r-4290 (MIOO 15899) , hsa-mir-4291 (MIOO 15900), hsa-mir-4292
(MIOO 15897) hsa- -mi r-4293 (MIOO 15826) , hsa-mir-4294 (MIOO 15827), hsa-mir-4295
(MIOO 15822) hsa- -mi r-4296 (MI0015823) , hsa-mir-4297 (MIOO 15824), hsa-mir-4298
(MIOO 15830) hsa- -mi r-4299 (MIOO 15829) , hsa-mir-4300 (MIOO 15831), hsa-mir-4301
(MIOO 15828) hsa- -mi r-4302 (MI0015833) , hsa-mir-4303 (MI0015834), hsa-mir-4304
(MI0015832) hsa- -mi r-4305 (MIOO 15835) , hsa-mir-4306 (MIOO 15836), hsa-mir-4307
(MIOO 15838) hsa- -mi r-4308 (MIOO 15839) , hsa-mir-4309 (MIOO 15837), hsa-mir-4310
(MIOO 15840) hsa- -mi r-4311 (MIOO 15841) , hsa-mir-4312 (MIOO 15842), hsa-mir-4313
(MI0015843) hsa- -mi r-4314 (MIOO 15846) , hsa-mir-4315- 1 (MI0015844), hsa-mir-4315-2
(MIOO 15983) hsa- -mi r-4316 (MIOO 15845) , hsa-mir-4317 (MI0015850), hsa-mir-4318
(MIOO 15847) hsa- -mi r-4319 (MIOO 15848) , hsa-mir-4320 (MI0015849), hsa-mir-4321
(MI0015852) hsa- -mi r-4322 (MI0015851) , hsa-mir-4323 (MI0015853), hsa-mir-4324
(MI0015854) hsa- -mi r-4325 (MIOO 15865) , hsa-mir-4326 (MI0015866), hsa-mir-4327
(MIOO 15867) hsa- -mi r-4328 (MIOO 15904) , hsa-mir-4329 (MI0015901), hsa-mir-4330
(MIOO 15902) hsa- -mi r-4417 (MIOO 16753) , hsa-mir-4418 (MIOO 16754), hsa-mir-4419a
(MIOO 16755) hsa- -mi r-4419b (MI0016861), hsa-mir-4420 (MI0016757), hsa-mir-4421
(MIOO 16758) hsa- -mi r-4422 (MIOO 16759) , hsa-mir-4423 (MIOO 16760), hsa-mir-4424
(MIOO 16763) hsa- -mi r-4425 (MIOO 16764) , hsa-mir-4426 (MIOO 16765), hsa-mir-4427
(MIOO 16766) hsa- -mi r-4428 (MIOO 16767) , hsa-mir-4429 (MIOO 16768), hsa-mir-4430
(MIOO 16769) hsa- -mi r-4431 (MIOO 16771) , hsa-mir-4432 (MIOO 16772), hsa-mir-4433
(MIOO 16773) hsa- -mi r-4433b (MI0025511), hsa-mir-4434 (MI0016774), hsa-mir-4435-1
(MIOO 16775) hsa- -mi r-4435-2 (MI0016777), hsa-mir-4436a (MI0016776), hsa-mir-4436b (MI0017425), hsa-mir-4436b-2 (MI0019110), hsa-mir-4437 (MI0016778), hsa-mir-4438 (MI0016781), hsa-mir-4439 (MI0016782), hsa-mir-4440 (MI0016783), hsa-mir-4441 (MIOO 16784), hsa-mir-4442 (MIOO 16785), hsa-mir-4443 (MIOO 16786), hsa-mir-4444-1 (MI0016787), hsa-mir-4444-2 (MI0019111), hsa-mir-4445 (MI0016788), hsa-mir-4446 (MIOO 16789), hsa-mir-4447 (MIOO 16790), hsa-mir-4448 (MIOO 16791), hsa-mir-4449 (MIOO 16792), hsa-mir-4450 (MIOO 16795), hsa-mir-4451 (MIOO 16797), hsa-mir-4452 (MI0016798), hsa-mir-4453 (MI0016799), hsa-mir-4454 (MI0016800), hsa-mir-4455 (MI0016801), hsa-mir-4456 (MI0016802), hsa-mir-4457 (MI0016803), hsa-mir-4458 (MIOO 16804), hsa-mir-4459 (MIOO 16805), hsa-mir-4460 (MIOO 16806), hsa-mir-4461 (MI0016807), hsa-mir-4462 (MI0016810), hsa-mir-4463 (MI0016811), hsa-mir-4464 (MIOO 16812), hsa-mir-4465 (MIOO 16816), hsa-mir-4466 (MIOO 16817), hsa-mir-4467 (MIOO 16818), hsa-mir-4468 (MIOO 16819), hsa-mir-4469 (MIOO 16820), hsa-mir-4470 (MI0016821), hsa-mir-4471 (MI0016822), hsa-mir-4472-1 (MI0016823), hsa-mir-4472-2 (MIOO 16824), hsa-mir-4473 (MIOO 16825), hsa-mir-4474 (MIOO 16826), hsa-mir-4475 (MIOO 16827), hsa-mir-4476 (MIOO 16828), hsa-mir-4477a (MIOO 16829), hsa-mir-4477b (MI0016830), hsa-mir-4478 (MI0016831), hsa-mir-4479 (MI0016838), hsa-mir-4480 (MI0016841), hsa-mir-4481 (MI0016842), hsa-mir-4482 (MI0016843), hsa-mir-4483 (MIOO 16844), hsa-mir-4484 (MIOO 16845), hsa-mir-4485 (MIOO 16846), hsa-mir-4486 (MIOO 16847), hsa-mir-4487 (MIOO 16848), hsa-mir-4488 (MIOO 16849), hsa-mir-4489 (MIOO 16850), hsa-mir-4490 (MIOO 16852), hsa-mir-4491 (MIOO 16853), hsa-mir-4492 (MI0016854), hsa-mir-4493 (MI0016855), hsa-mir-4494 (MI0016856), hsa-mir-4495 (MI0016857), hsa-mir-4496 (MI0016858), hsa-mir-4497 (MI0016859), hsa-mir-4498 (MIOO 16860), hsa-mir-4499 (MIOO 16862), hsa-mir-4500 (MIOO 16863), hsa-mir-4501 (MIOO 16864), hsa-mir-4502 (MIOO 16865), hsa-mir-4503 (MIOO 16866), hsa-mir-4504 (MIOO 16867), hsa-mir-4505 (MIOO 16868), hsa-mir-4506 (MIOO 16869), hsa-mir-4507 (MI0016871), hsa-mir-4508 (MI0016872), hsa-mir-4509-1 (MI0016873), hsa-mir-4509-2 (MI0016874), hsa-mir-4509-3 (MI0016875), hsa-mir-4510 (MI0016876), hsa-mir-4511 (MIOO 16877), hsa-mir-4512 (MIOO 16878), hsa-mir-4513 (MIOO 16879), hsa-mir-4514 (MI0016880), hsa-mir-4515 (MI0016881), hsa-mir-4516 (MI0016882), hsa-mir-4517 (MIOO 16883), hsa-mir-4518 (MIOO 16884), hsa-mir-4519 (MIOO 16885), hsa-mir-4520a (MI0016886), hsa-mir-4520b (MI0017358), hsa-mir-4521 (MI0016887), hsa-mir-4522 (MI0016889), hsa-mir-4523 (MI0016890), hsa-mir-4524a (MI0016891), hsa-mir-4524b (MI0019114), hsa-mir-4525 (MI0016892), hsa-mir-4526 (MI0016893), hsa-mir-4527 (MI0016894), hsa-mir-4528 (MI0016895), hsa-mir-4529 (MI0016896), hsa-mir-4530 (MIOO 16897) hsa- mi r-4531 (MI0016898), hsa-mir-4532 (MI0016899), hsa-mir-4533
(MIOO 16900) hsa- mi r-4534 (MIOO 16901), hsa-mir-4535 (MI0016903), hsa-mir-4536-1
(MIOO 16906) hsa- mi r-4536-2 (MI0019149), hsa-mir-4537 (MI0016908), hsa-mir-4538
(MIOO 16909) hsa- mi r-4539 (MI0016910), hsa-mir-4540 (MI0016911), hsa-mir-4632
(MIOO 17259) hsa- mi r-4633 (MI0017260), hsa-mir-4634 (MI0017261), hsa-mir-4635
(MIOO 17262) hsa- mi r-4636 (MI0017263), hsa-mir-4637 (MI0017264), hsa-mir-4638
(MIOO 17265) hsa- mi r-4639 (MIOO 17266), hsa-mir-4640 (MIOO 17267), hsa-mir-4641
(MIOO 17268) hsa- mi r-4642 (MIOO 17269), hsa-mir-4643 (MIOO 17270), hsa-mir-4644
(MIOO 17271) hsa- mi r-4645 (MIOO 17272), hsa-mir-4646 (MIOO 17273), hsa-mir-4647
(MIOO 17274) hsa- mi r-4648 (MIOO 17275), hsa-mir-4649 (MIOO 17276), hsa-mir-4650-1
(MIOO 17277) hsa- mi r-4650-2 (MIOO 17278), hsa-mir-4651 (MIOO 17279), hsa-mir-4652
(MIOO 17280) hsa- mi r-4653 (MI0017281), hsa-mir-4654 (MI0017282), hsa-mir-4655
(MIOO 17283) hsa- mi r-4656 (MI0017284), hsa-mir-4657 (MI0017285), hsa-mir-4658
(MIOO 17286) hsa- mi r-4659a (MI0017287), hsa-mir-4659b (MI0017291), hsa-mir-4660
(MIOO 17288) hsa- mi r-4661 (MIOO 17289), hsa-mir-4662a (MIOO 17290), hsa-mir-4662b
(MIOO 17293) hsa- mi r-4663 (MIOO 17292), hsa-mir-4664 (MIOO 1729), hsa-mir-4665
(MIOO 17295) hsa- mi r-4666a (MIOO 17296), hsa-mir-4666b (MIOO 19299), hsa-mir-4667
(MIOO 17297) hsa- mi r-4668 (MIOO 17298), hsa-mir-4669 (MIOO 17300), hsa-mir-4670
(MIOO 17301) hsa- mi r-4671 (MI0017302), hsa-mir-4672 (MI0017303), hsa-mir-4673
(MIOO 17304) hsa- mi r-4674 (MIOO 17305), hsa-mir-4675 (MIOO 17306), hsa-mir-4676
(MIOO 17307) hsa- mi r-4677 (MIOO 17308), hsa-mir-4678 (MIOO 17309), hsa-mir-4679-1
(MIOO 17310) hsa- mi r-4679-2 (MIOO 17311), hsa-mir-4680 (MIOO 17312), hsa-mir-4681
(MIOO 17313) hsa- mi r-4682 (MIOO 17314), hsa-mir-4683 (MIOO 17315), hsa-mir-4684
(MIOO 17316) hsa- mi r-4685 (MIOO 17317), hsa-mir-4686 (MIOO 17318), hsa-mir-4687
(MIOO 17319) hsa- mi r-4688 (MI0017321), hsa-mir-4689 (MI0017322), hsa-mir-4690
(MIOO 17323) hsa- mi r-4691 (MIOO 17324), hsa-mir-4692 (MIOO 17325), hsa-mir-4693
(MIOO 17326) hsa- mi r-4694 (MIOO 17327), hsa-mir-4695 (MIOO 17328), hsa-mir-4696
(MIOO 17329) hsa- mi r-4697 (MI0017330), hsa-mir-4698 (MI0017331), hsa-mir-4699
(MI0017332) hsa- mi r-4700 (MI0017333), hsa-mir-4701 (MI0017334), hsa-mir-4703
(MIOO 17336) hsa- mi r-4704 (MIOO 17337), hsa-mir-4705 (MIOO 17338), hsa-mir-4706
(MIOO 17339) hsa- mi r-4707 (MI0017340), hsa-mir-4708 (MI0017341), hsa-mir-4709
(MIOO 17342) hsa- mi r-4710 (MI0017344), hsa-mir-4711 (MI0017345), hsa-mir-4712
(MIOO 17346) hsa- mi r-4713 (MI0017347), hsa-mir-4714 (MI0017348), hsa-mir-4715
(MIOO 17349) hsa- mi r-4716 (MIOO 17350), hsa-mir-4717 (MIOO 17352), hsa-mir-4718 (MIOO 17353) hsa- -mi r-4719 (MIOO 17354) , hsa- -m r-4720 (MIOO 17355), hsa-mir-4721
(MIOO 17356) hsa- -mi r-4722 (MIOO 17357) , hsa- -m r-4723 (MIOO 17359), hsa-mir-4724
(MIOO 17361) hsa- -mi r-4725 (MIOO 17362) , hsa- -m r-4726 (MI0017363), hsa-mir-4727
(MIOO 17364) hsa- -mi r-4728 (MIOO 17365) , hsa- -m r-4729 (MIOO 17366), hsa-mir-4730
(MIOO 17367) hsa- -mi r-4731 (MIOO 17368) , hsa- -m r-4732 (MIOO 17369), hsa-mir-4733
(MIOO 17370) hsa- -mi r-4734 (MIOO 17371) , hsa- -m r-4735 (MIOO 17372), hsa-mir-4736
(MI0017373) hsa- -mi r-4737 (MIOO 17374) , hsa- -m r-4738 (MIOO 17376), hsa-mir-4739
(MIOO 17377) hsa- -mi r-4740 (MIOO 17378) , hsa- -m r-4741 (MIOO 17379), hsa-mir-4742
(MIOO 17380) hsa- -mi r-4743 (MIOO 17381) , hsa- -m r-4744 (MIOO 17382), hsa-mir-4745
(MIOO 17384) hsa- -mi r-4746 (MIOO 17385) , hsa- -m r-4747 (MIOO 17386), hsa-mir-4748
(MIOO 17387) hsa- -mi r-4749 (MIOO 17388) , hsa- -m r-4750 (MIOO 17389), hsa-mir-4751
(MIOO 17390) hsa- -mi r-4752 (MIOO 17391) , hsa- -m r-4753 (MIOO 17392), hsa-mir-4754
(MIOO 17394) hsa- -mi r-4755 (MIOO 17395) , hsa- -m r-4756 (MIOO 17397), hsa-mir-4757
(MIOO 17398) hsa- -mi r-4758 (MIOO 17399) , hsa- -m r-4759 (MIOO 17400), hsa-mir-4760
(MIOO 17401) hsa- -mi r-4761 (MIOO 17402) , hsa- -m r-4762 (MIOO 17403), hsa-mir-4763
(MIOO 17404) hsa- -mi r-4764 (MIOO 17405) , hsa- -m r-4765 (MIOO 17406), hsa-mir-4766
(MIOO 17407) hsa- -mi r-4767 (MIOO 17408) , hsa- -m r-4768 (MIOO 17409), hsa-mir-4769
(MIOO 17410) hsa- -mi r-4770 (MIOO 17411) , hsa- -m r-4771- 1 (MIOO 17412), hsa-mir-4771-2
(MIOO 17413) hsa- -mi r-4772 (MIOO 17414) , hsa- -m r-4773- 1 (MIOO 17415), hsa-mir-4773-2
(MIOO 17416) hsa- -mi r-4774 (MIOO 17417) , hsa- -m r-4775 (MIOO 17418), hsa-mir-4776-1
(MIOO 17419) hsa- -mi r-4776- 2 (MIOO 17420), hsa- mir-4777 (MIOO 17421), hsa-mir-4778
(MIOO 17422) hsa- -mi r-4779 (MIOO 17423) , hsa- -m r-4780 (MIOO 17424), hsa-mir-4781
(MIOO 17426) hsa- -mi r-4782 (MIOO 17427) , hsa- -m r-4783 (MIOO 17428), hsa-mir-4784
(MIOO 17429) hsa- -mi r-4785 (MIOO 17430) , hsa- -m r-4786 (MI0017433), hsa-mir-4787
(MIOO 17434) hsa- -mi r-4788 (MIOO 17435) , hsa- -m r-4789 (MIOO 17436), hsa-mir-4790
(MIOO 17437) hsa- -mi r-4791 (MIOO 17438) , hsa- -m r-4792 (MIOO 17439), hsa-mir-4793
(MIOO 17440) hsa- -mi r-4794 (MIOO 17441) , hsa- -m r-4795 (MIOO 17442), hsa-mir-4796
(MIOO 17443) hsa- -mi r-4797 (MIOO 17444) , hsa- -m r-4798 (MIOO 17445), hsa-mir-4799
(MIOO 17446) hsa- -mi r-4800 (MIOO 17448) , hsa- -m r-4801 (MIOO 17449), hsa-mir-4802
(MIOO 17450) hsa- -mi r-4803 (MIOO 17451) , hsa- -m r-4804 (MIOO 17452), hsa-mir-4999
(MIOO 17865) hsa- -mi r-5000 (MIOO 17866) , hsa- -m r-5001 (MIOO 17867), hsa-mir-5002
(MIOO 17868) hsa- -mi r-5003 (MIOO 17869) , hsa- -m r-5004 (MIOO 17870), hsa-mir-5006
(MIOO 17873) hsa- -mi r-5007 (MIOO 17874) , hsa- -m r-5008 (MIOO 17876), hsa-mir-5009
(MIOO 17877) hsa- -mi r-5010 (MIOO 17878) , hsa- -m r-5011 (MIOO 17879), hsa-mir-5047 (MI0017932) , hsa- mir- -5087 (MIOO 17976), hsa-mir-5088 (MIOO 17977), hsa-mir-5089
(MIOO 17978) , hsa- mir- -5090 (MIOO 17979), hsa-mir-5091 (MIOO 17980), hsa-mir-5092
(MIOO 17981) , hsa- mir- -5093 (MIOO 17982), hsa-mir-5094 (MIOO 17983), hsa-mir-5095
(MIOO 18001) , hsa- mir- -5096 (MIOO 18004), hsa-mir-5100 (MI0019116), hsa-mir-5186
(MI0018165) , hsa- mir- -5187 (MI0018166), hsa-mir-5188 (MI0018167), hsa-mir-5189
(MI0018168) , hsa- mir- -5190 (MI0018169), hsa-mir-5191 (MI0018170), hsa-mir-5192
(MI0018171) , hsa- mir- -5193 (MI0018172), hsa-mir-5194 (MI0018173), hsa-mir-5195
(MI0018174) , hsa- mir- -5196 (MI0018175), hsa-mir-5197 (MI0018176), hsa-mir-5571
(MI0019115) , hsa- mir- -5572 (MI0019117), hsa-mir-5579 (MI0019133), hsa-mir-5580
(MI0019135) , hsa- mir- -5581 (MI0019136), hsa-mir-5582 (MI0019138), hsa-mir-5583-1
(MI0019139) , hsa- mir- -5583-2 (MI0019140), hsa-mir-5584 (MI0019141), hsa-mir-5585
(MIOO 19142) , hsa- mir- -5586 (MI0019143), hsa-mir-5587 (MI0019144), hsa-mir-5588
(MIOO 19147) , hsa- mir- -5589 (MI0019148), hsa-mir-5590 (MI0019150), hsa-mir-5591
(MI0019151) , hsa- mir- -5680 (MI0019280), hsa-mir-5681a (MI0019281), hsa-mir-5681b
(MIOO 19293) , hsa- mir- -5682 (MIOO 19282), hsa-mir-5683 (MIOO 19284), hsa-mir-5684
(MIOO 19285) , hsa- mir- -5685 (MI0019287), hsa-mir-5687 (MI0019291), hsa-mir-5688
(MIOO 19292) , hsa- mir- -5689 (MIOO 19294), hsa-mir-5690 (MIOO 19295), hsa-mir-5691
(MIOO 19296) , hsa- mir- -5692a-l (MI0019297), hsa-mir-5692a-2 (MI0019298), hsa-mir-
5692b (MI0019311), hsa-mir-5692c-l (MI0019288), hsa-mir-5692c-2 (MI0019289), hsa- mir-5693 (MI0019300), hsa-mir-5694 (MI0019301), hsa-mir-5695 (MI0019302), hsa-mir- 5696 (MI0019303), hsa-mir-5697 (MI0019304), hsa-mir-5698 (MI0019305), hsa-mir-5699 (MI0019306), hsa-mir-5700 (MI0019307), hsa-mir-5701-1 (MI0019308), hsa-mir-5701-2 (MI0019593), hsa-mir-5702 (MI0019309), hsa-mir-5703 (MI0019310), hsa-mir-5704 (MI0019312), hsa-mir-5705 (MI0019313), hsa-mir-5706 (MI0019314), hsa-mir-5707 (MI0019315), hsa-mir-5708 (MI0019316), hsa-mir-5739 (MI0019412), hsa-mir-5787 (MIOO 19797), hsa-mir-6068 (MI0020345), hsa-mir-6069 (MI0020346), hsa-mir-6070 (MI0020347), hsa-mir-6071 (MI0020348), hsa-mir-6072 (MI0020349), hsa-mir-6073 (MI0020350), hsa-mir-6074 (MI0020351), hsa-mir-6075 (MI0020352), hsa-mir-6076 (MI0020353), hsa-mir-6077-1 (MI0020354), hsa-mir-6077-2 (MI0023562), hsa-mir-6078 (MI0020355), hsa-mir-6079 (MI0020356), hsa-mir-6080 (MI0020357), hsa-mir-6081 (MI0020358), hsa-mir-6082 (MI0020359), hsa-mir-6083 (MI0020360), hsa-mir-6084 (MI0020361), hsa-mir-6085 (MI0020362), hsa-mir-6086 (MI0020363), hsa-mir-6087 (MI0020364), hsa-mir-6088 (MI0020365), hsa-mir-6089-1 (MI0020366), hsa-mir-6089-2 (MI0023563), hsa-mir-6090 (MI0020367), hsa-mir-6124 (MI0021258), hsa-mir-6125 (MI0021259), hsa-mir-6126 (MI0021260), hsa-mir-6127 (MI0021271), hsa-mir-6128 (MI0021272), hsa-mir-6129 (MI0021274), hsa-mir-6130 (MI0021275), hsa-mir-6131 (MI0021276), hsa-mir-6132 (MI0021277), hsa-mir-6133 (MI0021278), hsa-mir-6134 (MI0021279), hsa-mir-6165 (MI0021472), hsa-mir-6499 (MI0022209), hsa-mir-6500 (MI0022211), hsa-mir-6501 (MI0022213), hsa-mir-6502 (MI0022214), hsa-mir-6503 (MI0022215), hsa-mir-6504 (MI0022216), hsa-mir-6505 (MI0022217), hsa-mir-6506 (MI0022218), hsa-mir-6507 (MI0022219), hsa-mir-6508 (MI0022220), hsa-mir-6509 (MI0022221), hsa-mir-6510 (MI0022222), hsa-mir-651 la- 1 (MI0022223), hsa-mir-651 la-2 (MI0023564), hsa-mir-651 la-3 (MI0023565), hsa-mir-651 la-4 (MI0023566), hsa-mir- 651 lb-1 (MI0022552), hsa-mir-651 lb-2 (MI0023431), hsa-mir-6512 (MI0022224), hsa- mir-6513 (MI0022225), hsa-mir-6514 (MI0022226), hsa-mir-6515 (MI0022227), hsa-mir- 6516 (MI0025513), hsa-mir-6715a (MI0022548), hsa-mir-6715b (MI0022549), hsa-mir- 6716 (MI0022550), hsa-mir-6717 (MI0022551), hsa-mir-6718 (MI0022553), hsa-mir-6719
(MI0022554 hsa- ■mir- -6720 (MI0022555) hsa- ■mir- -6721 (MI0022556) hsa-mir-6722 (MI0022557 hsa- ■mir- -6723 (MI0022558) hsa- ■mir- -6724 (MI0022559) hsa-mir-6726 (MI0022571 hsa- ■mir- -6727 (MI0022572) hsa- ■mir- -6728 (MI0022573) hsa-mir-6729 (MI0022574 hsa- ■mir- -6730 (MI0022575) hsa- ■mir- -6731 (MI0022576) hsa-mir-6732 (MI0022577 hsa- ■mir- -6733 (MI0022578) hsa- ■mir- -6734 (MI0022579) hsa-mir-6735 (MI0022580 hsa- ■mir- -6736 (MI0022581) hsa- ■mir- -6737 (MI0022582) hsa-mir-6738 (MI0022583 hsa- ■mir- -6739 (MI0022584) hsa- ■mir- -6740 (MI0022585) hsa-mir-6741 (MI0022586 hsa- ■mir- -6742 (MI0022587) hsa- ■mir- -6743 (MI0022588) hsa-mir-6744 (MI0022589 hsa- ■mir- -6745 (MI0022590) hsa- ■mir- -6746 (MI0022591) hsa-mir-6747 (MI0022592 hsa- ■mir- -6748 (MI0022593) hsa- ■mir- -6749 (MI0022594) hsa-mir-6750 (MI0022595 hsa- ■mir- -6751 (MI0022596) hsa- ■mir- -6752 (MI0022597) hsa-mir-6753 (MI0022598 hsa- ■mir- -6754 (MI0022599) hsa- ■mir- -6755 (MI0022600) hsa-mir-6756 (MI0022601 hsa- ■mir- -6757 (MI0022602) hsa- ■mir- -6758 (MI0022603) hsa-mir-6759 (MI0022604 hsa- ■mir- -6760 (MI0022605) hsa- ■mir- -6761 (MI0022606) hsa-mir-6762 (MI0022607 hsa- ■mir- -6763 (MI0022608) hsa- ■mir- -6764 (MI0022609) hsa-mir-6765 (MI0022610 hsa- ■mir- -6766 (MI0022611) hsa-mir-6767 (MI0022612), hsa-mir-6768 (MI0022613 hsa-mir-6769a (MI0022614), hsa-mir-6769b (MI0022706), hsa-mir-6770-1 (MI0022615 hsa-mir-6770-2 (MI0026418), hsa-mir-6770-3 (MI0026419), hsa-mir-6771 (MI0022616 hsa-mir-6772 (MI0022617), hsa-mir-6773 (MI0022618), hsa-mir-6774 (MI0022619 hsa-mir-6775 (MI0022620), hsa-mir-6776 (MI0022621), hsa-mir-6777 (MI0022622 hsa-mir-6778 (MI0022623), hsa-mir-6779 (MI0022624), hsa-mir-6780a (MI0022625) hsa- -mi r-6780b (MI0022681), hsa-mir-6781 (MI0022626), hsa-mir-6782
(MI0022627) hsa- -mi r-6783 (MI0022628) , hsa-mir- -6784 (MI0022629), hsa-mir-6785
(MI0022630) hsa- -mi r-6786 (MI0022631) , hsa-mir- -6787 (MI0022632), hsa-mir-6788
(MI0022633) hsa- -mi r-6789 (MI0022634) , hsa-mir- -6790 (MI0022635), hsa-mir-6791
(MI0022636) hsa- -mi r-6792 (MI0022637) , hsa-mir- -6793 (MI0022638), hsa-mir-6794
(MI0022639) hsa- -mi r-6795 (MI0022640) , hsa-mir- -6796 (MI0022641), hsa-mir-6797
(MI0022642) hsa- -mi r-6798 (MI0022643) , hsa-mir- -6799 (MI0022644), hsa-mir-6800
(MI0022645) hsa- -mi r-6801 (MI0022646) , hsa-mir- -6802 (MI0022647), hsa-mir-6803
(MI0022648) hsa- -mi r-6804 (MI0022649) , hsa-mir- -6805 (MI0022650), hsa-mir-6806
(MI0022651) hsa- -mi r-6807 (MI0022652) , hsa-mir- -6808 (MI0022653), hsa-mir-6809
(MI0022654) hsa- -mi r-6810 (MI0022655) , hsa-mir- -6811 (MI0022656), hsa-mir-6812
(MI0022657) hsa- -mi r-6813 (MI0022658) , hsa-mir- -6814 (MI0022659), hsa-mir-6815
(MI0022660) hsa- -mi r-6816 (MI0022661) , hsa-mir- -6817 (MI0022662), hsa-mir-6818
(MI0022663) hsa- -mi r-6819 (MI0022664) , hsa-mir- -6820 (MI0022665), hsa-mir-6821
(MI0022666) hsa- -mi r-6822 (MI0022667) , hsa-mir- -6823 (MI0022668), hsa-mir-6824
(MI0022669) hsa- -mi r-6825 (MI0022670) , hsa-mir- -6826 (MI0022671), hsa-mir-6827
(MI0022672) hsa- -mi r-6828 (MI0022673) , hsa-mir- -6829 (MI0022674), hsa-mir-6830
(MI0022675) hsa- -mi r-6831 (MI0022676) , hsa-mir- -6832 (MI0022677), hsa-mir-6833
(MI0022678) hsa- -mi r-6834 (MI0022679) , hsa-mir- -6835 (MI0022680), hsa-mir-6836
(MI0022682) hsa- -mi r-6837 (MI0022683) , hsa-mir- -6838 (MI0022684), hsa-mir-6839
(MI0022685) hsa- -mi r-6840 (MI0022686) , hsa-mir- -6841 (MI0022687), hsa-mir-6842
(MI0022688) hsa- -mi r-6843 (MI0022689) , hsa-mir- -6844 (MI0022690), hsa-mir-6845
(MI0022691) hsa- -mi r-6846 (MI0022692) , hsa-mir- -6847 (MI0022693), hsa-mir-6848
(MI0022694) hsa- -mi r-6849 (MI0022695) , hsa-mir- -6850 (MI0022696), hsa-mir-6851
(MI0022697) hsa- -mi r-6852 (MI0022698) , hsa-mir- -6853 (MI0022699), hsa-mir-6854
(MI0022700) hsa- -mi r-6855 (MI0022701) , hsa-mir- -6856 (MI0022702), hsa-mir-6857
(MI0022703) hsa- -mi r-6858 (MI0022704) , hsa-mir- -6859-1 (MI0022705), hsa-mir-6859-2
(MI0026420) hsa- -mi r-6859-3 (MI0026421), hsa-mir-6860 (MI0022707), hsa-mir-6861
(MI0022708) hsa- -mi r-6862-1 (MI0022709), hsa-mir-6862-2 (MI0026415), hsa-mir-6863
(MI0022710) hsa- -mi r-6864 (MI0022711), hsa-mir- -6865 (MI0022712), hsa-mir-6866
(MI0022713) hsa- -mi r-6867 (MI0022714), hsa-mir- -6868 (MI0022715), hsa-mir-6869
(MI0022716) hsa- -mi r-6870 (MI0022717), hsa-mir- -6871 (MI0022718), hsa-mir-6872
(MI0022719) hsa- -mi r-6873 (MI0022720), hsa-mir- -6874 (MI0022721), hsa-mir-6875
(MI0022722) hsa- -mi r-6876 (MI0022723), hsa-mir- -6877 (MI0022724), hsa-mir-6878 (MI0022725), hsa-mir-6879 (MI0022726), hsa-mir-6880 (MI0022727), hsa-mir-6881 (MI0022728), hsa-mir-6882 (MI0022729), hsa-mir-6883 (MI0022730), hsa-mir-6884 (MI0022731), hsa-mir-6885 (MI0022732), hsa-mir-6886 (MI0022733), hsa-mir-6887 (MI0022734), hsa-mir-6888 (MI0022735), hsa-mir-6889 (MI0022736), hsa-mir-6890 (MI0022737), hsa-mir-6891 (MI0022738), hsa-mir-6892 (MI0022739), hsa-mir-6893 (MI0022740), hsa-mir-6894 (MI0022741), hsa-mir-6895 (MI0022742), hsa-mir-7106 (MI0022957), hsa-mir-7107 (MI0022958), hsa-mir-7108 (MI0022959), hsa-mir-7109 (MI0022960), hsa-mir-7110 (MI0022961), hsa-mir-7111 (MI0022962), hsa-mir-7112-1 (MI0022963), hsa-mir-7112-2 (MI0026414), hsa-mir-7113 (MI0022964), hsa-mir-7114 (MI0022965), hsa-mir-7150 (MI0023610), hsa-mir-7151 (MI0023611), hsa-mir-7152 (MI0023612), hsa-mir-7153 (MI0023613), hsa-mir-7154 (MI0023614), hsa-mir-7155 (MI0023615), hsa-mir-7156 (MI0023616), hsa-mir-7157 (MI0023617), hsa-mir-7158 (MI0023618), hsa-mir-7159 (MI0023620), hsa-mir-7160 (MI0023621), hsa-mir-7161 (MI0023619), hsa-mir-7162 (MI0023623), hsa-mir-7515 (MI0024354), hsa-mir-7641-1 (MI0024975), hsa-mir-7641 -2 (MI0024976), hsa-mir-7702 (MI0025238), hsa-mir-7703 (MI0025239), hsa-mir-7704 (MI0025240), hsa-mir-7705 (MI0025241), hsa-mir-7706 (MI0025242), hsa-mir-7843 (MI0025510), hsa-mir-7844 (MI0025514), hsa-mir-7845 (MI0025515), hsa-mir-7846 (MI0025516), hsa-mir-7847 (MI0025517), hsa-mir-7848 (MI0025518), hsa-mir-7849 (MI0025519), hsa-mir-7850 (MI0025520), hsa-mir-7851 (MI0025521), hsa-mir-7852 (MI0025522), hsa-mir-7853 (MI0025523), hsa-mir-7854 (MI0025524), hsa-mir-7855 (MI0025525), hsa-mir-7856 (MI0025526), hsa-mir-7973-1 (MI0025748), hsa-mir-7973-2 (MI0025749), hsa-mir-7974 (MI0025750), hsa-mir-7975 (MI0025751), hsa-mir-7976 (MI0025752), hsa-mir-7977 (MI0025753), hsa-mir-7978 (MI0025754), hsa-mir-8052 (MI0025888), hsa-mir-8053 (MI0025889), hsa-mir-8054 (MI0025890), hsa-mir-8055 (MI0025891), hsa-mir-8056 (MI0025892), hsa-mir-8057 (MI0025893), hsa-mir-8058 (MI0025894), hsa-mir-8059 (MI0025895), hsa-mir-8060 (MI0025896), hsa-mir-8061 (MI0025897), hsa-mir-8062 (MI0025898), hsa-mir-8063 (MI0025899), hsa-mir-8064 (MI0025900), hsa-mir-8065 (MI0025901), hsa-mir-8066 (MI0025902), hsa-mir-8067 (MI0025903), hsa-mir-8068 (MI0025904), hsa-mir-8069 (MI0025905), hsa-mir-8070 (MI0025906), hsa-mir-8071-1 (MI0025907), hsa-mir-8071-2 (MI0026417), hsa-mir-8072 (MI0025908), hsa-mir-8073 (MI0025909), hsa-mir-8074 (MI0025910), hsa-mir-8075 (MI0025911), hsa-mir-8076 (MI0025912), hsa-mir-8077 (MI0025913), hsa-mir-8078 (MI0025914), hsa-mir-8079 (MI0025915), hsa-mir-8080 (MI0025916), hsa-mir-8081 (MI0025917), hsa-mir-8082 (MI0025918), hsa-mir-8083 (MI0025919), hsa-mir-8084 (MI0025920), hsa-mir-8085 (MI0025921), hsa-mir-8086 (MI0025922), hsa-mir-8087 (MI0025923), hsa-mir-8088 (MI0025924), hsa-mir-8089 (MI0025925). See, e.g., pre-microRNAs listed on miRBase.org
[0047] In varying embodiments, the pre-microRNA is not pre-miRNA-22, pre- miRNA-122, pre-miRNA- 124-2, pre-miRNA-125-2, pre-miRNA-155 or pre-miRNA-221.
[0048] In varying embodiments, the hybrid molecules comprise the full-length native pre-micro-RNA. In some embodiments, the hybrid molecules comprise fragments or subsequences of the native pre-micro-RNA molecules. Fragments or subsequences of the native pre-micro-RNA molecules that find use will have one or more cleavage sites recognized by and accessible to an endoribonuclease (e.g., Dicer) such that an inserted RNA molecule (e.g., a noncoding RNA (ncRNA), mature microRNA (miRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a Piwi-interacting RNA (piRNA), a small nuclear RNA (snRNA), a small nucleolar RNA (snoRNA), an aptamer) can be cleaved out of or released from the hybrid tRNA/pre-microRNA molecule. [0049] In varying embodiments, the tRNA operably linked to a pre-microRNA (pre- miRNA) comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to a polynucleotide selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 13 and SEQ ID NO: 15. In some embodiments, the tRNA operably linked to the pre-microRNA (pre- miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 10. In some embodiments, the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO: 11. c. Aptamer
[0050] The hybrid tRNA/pre-microRNA molecules are further operably linked to an aptamer. In varying embodiments, the aptamer can be inserted/positioned/located either 5' to the pre-microRNA (as illustrated by SEQ ID NO: 10 - OnRS-2/MGA5) or 3' to the pre- microRNA (as illustrated by SEQ ID NO: 11 - OnRS-2/MGA3). Of interest are aptamers that elicit a detectable signal when bound to their analytes. The aptamer/analyte pairs can elicit the detectable signal while the aptamer is retained as an intact or substantially intact polynucleotide (e.g., sufficient for the aptamer to bind the analyte) within hybrid tRNA/pre- microRNA molecule. In varying embodiments, the aptamers elicit a fluorescent signal when bound to its analyte. [0051] In some embodiments, the aptamer binds to a dye selected from the group consisting of malachite green, tetramethylrosamine, sulforhodamine B, and
triphenylmethane dyes. In varying embodiments, the aptamer binds to malachite green. In varying embodiments, the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQ ID NO:9.
3. Methods of Detection RNase Activity
[0052] Further provided are methods of detecting RNase activity. In varying embodiments, the methods entail:
a) contacting a test sample suspected of having RNase with a composition comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer and the analyte that binds to the aptamer, thereby forming a mixture, wherein the analyte bound by the aptamer elicits a detectable signal;
b) determining the presence and amount of detectable signal in the mixture in comparison to the presence and amount of detectable signal in a control composition that has not been contacted with the sample, wherein reduced or eliminated levels of detectable signal indicate the presence of RNase activity. Samples that have RNases and RNase activity will degrade the hybrid tRNA/pre-microRNA molecule comprising the aptamer such that the aptamer no longer binds to the analyte.
[0053] In varying embodiments, the test sample is a biological sample. In varying embodiments, the biological sample is a fluid sample selected from the group consisting of serum, blood, sweat, tears, plasma, saliva, mucous, sputum, milk, semen, urine, and vaginal secretions. In varying embodiments, the biological sample is a biopsy. In varying embodiments, the RNase activity is from one or more endoribonucl eases, e.g., RNase A (EC 3.1.27.5), RNase H (EC 3.1.26.4), RNase III (EC 3.1.26.3), RNase L, RNase P (EC 3.1.26.5), RNase PhyM, RNase Tl (EC 3.1.27.3), RNase T2 (EC 3.1.27.1), RNase U2 (EC 3.1.27.4), and RNase V (EC 3.1.27.8). In varying embodiments, the RNase activity is from one or more exoribonucleases, e.g., Polynucleotide Phosphorylase (PNPase) (EC 2.7.7.8), RNase PH (EC number EC 2.7.7.56), RNase R, RNase D (EC 3.1.13.5), RNase T, Oligoribonuclease (EC 3.1.13.3), Exoribonuclease I (EC 3.1.1 1.1), and Exoribonuclease II (EC 3.1.13.1). In varying embodiments, the RNase activity is from one or more
ribonucleases selected from the group consisting of tRNA nucleotidyltransferase (EC 2.7.7.56), Ribonuclease D (EC 3.1.13.5), Physarum polycephalum ribonuclease (EC 3.1.26.1), Ribonuclease alpha (EC 3.1.26.2), Ribonuclease III (EC 3.1.26.3), Ribonuclease H (EC 3.1.26.4), Ribonuclease P (EC 3.1.26.5), Ribonuclease IV (EC 3.1.26.6),
Ribonuclease P4 (3.1.26.7), Ribonuclease M5 (EC 3.1.26.8), Ribonuclease (poly-(U)- specific) (EC 3.1.26.9), Ribonuclease IX (EC 3.1.26.10), Ribonuclease Z (EC 3.1.26.1 1), Ribonuclease E (EC 3.1.26.12), Retroviral ribonuclease H (EC 3.1.26.13), Ribonuclease T(2) (EC 3.1.27.1), Bacillus subtilis ribonuclease (EC 3.1.27.2), Ribonuclease T(l) (EC 3.1.27.3), Ribonuclease U(2) (EC 3.1.27.4), Pancreatic ribonuclease (EC 3.1.27.5), Enterobacter ribonuclease (EC 3.1.27.6), Ribonuclease F (EC 3.1.27.7), Ribonuclease V (EC 3.1.27.8), Exoribonuclease II (EC 3.1.13.1), Exoribonuclease H (3.1.13.2), Poly(A)- specific ribonuclease (3.1.13.4), Ribonuclease D (EC 3.1.13.5), and Yeast ribonuclease (EC 3.1.14.1).
[0054] The test sample suspected of having RNase is contacted with a composition comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte under conditions and for a time sufficient to allow RNase, if present, to degrade the aptamer and disrupt aptamer/analyte binding. In varying embodiments, the contacting step can be performed under physiological conditions of salinity (e.g., 100 mM KC1, 5 mM MgCl2, and 10 mM HEPES), pH (e.g., pH 7.4) and temperature (e.g., 37°C) for a time period of about 5 to 60 minutes.
[0055] The detecting step can be performed using any appropriate method known in the art, and will depend on the detectable signal elicited by the aptamer/analyte pair. RNase activity is calculated as the change in detectable signal (e.g., fluorescent intensity) over time per volume of sample (e.g., AA.U./min/[iL). A reduction or disappearance in detectable signal (e.g., fluorescent intensity) in a mixture comprising the test sample and the hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte in comparison to detectable signal (e.g., fluorescent intensity) in a control composition comprising the hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte without contacting the test sample indicates that the test sample comprises RNases and RNase activity. A further control can include determining detectable signal (e.g., fluorescent intensity) of the same biological sample from a healthy control subject (e.g., a subject known not to have the disease of interest). A reduced or eliminated detectable signal (e.g., fluorescent intensity) in the test sample versus the control subject sample indicates elevated RNase activity in the test sample compared to the sample from the control subject.
Similarly, an increased detectable signal (e.g., fluorescence) in the test sample versus the control subject sample indicates reduced RNase activity in the test sample compared to the sample from the control subject.
[0056] In varying embodiments RNase activity can be detected and quantified at the milligram level without dilution of test sample.
4. Compositions and Kits [0057] Further provided are compositions comprising the polynucleotides described above and herein, comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte (e.g., a hybrid tRNA/pre-microRNA molecule comprising an aptamer that binds to a dye such as malachite green where the aptamer is bound to malachite green). [0058] Further provided are kits comprising one or more receptacles/containers/vials comprising one or more polynucleotides described above and herein, comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer. Also provided are kits comprising one or more receptacles/containers/vials comprising one or more compositions described above and herein, comprising a hybrid tRNA/pre-microRNA molecule comprising an aptamer bound to its analyte.
5. High Level Production of Hybrid tRNA/pre-microRNA Molecules in vitro
[0059] The hybrid tRNA/pre-microRNA molecules can be produced by recombinant expression in a host cell, or can be synthetically prepared. Such recombinant and synthetic methods are well known in the art. When produced by recombinant expression in a host cell, the host cell can be eukaryotic or prokaryotic. In varying embodiments, the host cell is of the same species of cell as that of the tRNA molecule or the pre-microRNA molecule used in the hybrid tRNA/pre-microRNA molecule. When producing a hybrid tRNA/pre- microRNA molecule comprising an inserted RNA sequence, a host cell that does not comprise an endoribonuclease that may cleave out the inserted RNA (e.g., Dicer) can be used. In varying embodiments, the host cell for the recombinant expression of a hybrid tRNA/pre-microRNA molecule is a prokaryotic cell, e.g., a bacterial cell, e.g., an
Escherichia coli cell. In varying embodiments, the host cell for the recombinant expression of a hybrid tRNA/pre-microRNA molecule is a eukaryotic cell, e.g., a mammalian cell, a human cell, an insect cell, a plant cell or a yeast cell. Eukaryotic (e.g., mammalian or human) host cells which are deficient for Dicer are known in the art and find use for the high level expression for production of the hybrid tRNA/pre-microRNA molecules in a eukaryotic host cell, e.g., as described in Commins, et al. Proc Natl Acad Sci USA, (2006) 103(10):3687-3692; Murchison, et al., Proc Natl Acad Sci USA, (2005) 102(34): 12135- 12140; and Kanellopoulou, et al., Genes Dev., (2005) 19:489-501.
[0060] The hybrid tRNA/pre-microRNA scaffolds facilitate stable, consistent and reliable high level expression of a desired inserted RNA molecule in vivo and in vitro, as described herein. In varying embodiments, high levels of the hybrid tRNA/pre-microRNA scaffolds are produced in vitro by a host cell that does not comprise an endoribonuclease that may cleave out the inserted RNA (e.g., Dicer). In varying embodiments, at least about 5-100 mg, e.g., at least about 10-50 mg, of hybrid tRNA/pre-microRNA scaffold molecules can be produced in vitro from 1 liter of E. coli culture over 16-48 hours of time. In varying embodiments, at least about 5-100 mg, e.g., at least about 10-50 mg, of hybrid tRNA/pre- microRNA scaffold molecules can be produced in vitro from 1 liter of yeast cell culture. In some embodiments, the tRNA/pre-microRNA molecule produced comprises at least about 5%, e.g., at least about 6%, 7%, 8%, 9%, 10%, 11%, 12%, 15%, 20%, or more, of the total RNA. [0061] In varying embodiments, the hybrid tRNA/pre-microRNA scaffolds are purified as part of the total RNA from the production host cells. Such methods of isolating or purifying total RNA from a host cell are established in the art. In some embodiments, the hybrid tRNA/pre-microRNA scaffolds are further substantially isolated or purified from the other RNA molecules and components of the production host cell. This can be done using any method in the art, including, e.g., separation by separation by gel electrophoresis, affinity chromatography, chromatography, FPLC and/or HPLC. The substantially isolated and/or purified hybrid tRNA/pre-microRNA scaffolds can then be transfected or delivered into a eukaryotic cell, which will then process the hybrid tRNA/pre-microRNA scaffolds to cleave or release the inserted RNA. [0062] In varying embodiments, the hybrid tRNA/pre-microRNA scaffolds are contacted with or exposed to an endoribonuclease (e.g., Dicer) in vitro, under conditions sufficient to allow cleave or release of the inserted RNA. In varying embodiments, the efficiency of in vitro cleavage or release of the inserted RNA from the hybrid tRNA/pre- microRNA scaffolds can be facilitated by adding a RNase or DNAzyme site to the tRNA- pre-miRNA molecule
EXAMPLES
[0063] The following examples are offered to illustrate, but not to limit the claimed invention.
Example 1
A general approach to high-yield biosynthesis of chimeric RNAs bearing various types of functional small RNAs for broad applications
[0064] RNA research and therapy relies primarily on synthetic RNAs. We employed recombinant RNA technology towards large-scale production of pre-miRNA agents in bacteria, but found the majority of target RNAs were not or negligibly expressed. We thus developed a novel strategy to achieve consistent high-yield biosynthesis of chimeric RNAs carrying various small RNAs (e.g., miRNAs, siRNAs and RNA aptamers), which was based upon an optimal noncoding RNA scaffold (OnRS) derived from tRNA fusion pre-miR-34a (tRNA/mir-34a). Multi-milligrams of chimeric RNAs (e.g.,
OnRS/miR-124, OnRS/GFP-siRNA, OnRS/Neg (scrambled RNA) and OnRS/MGA
(malachite green aptamer)) were readily obtained from 1 L bacterial culture. Deep sequencing analyses revealed that mature miR-124 and target GFP-siRNA were selectively released from chimeric RNAs in human cells. Consequently, OnRS/miR-124 was active in suppressing miR-124 target gene expression and controlling cellular processes, and
OnRS/GFP-siRNA was effective in knocking down GFP mRNA levels and fluorescent intensity in ES-2/GFP cells and GFP-transgenic mice. Furthermore, the OnRS/MGA sensor offered a specific strong fluorescence upon binding MG, which was utilized as label-free substrate to accurately determine serum RNase activities in pancreatic cancer patients. These results demonstrate that OnRS-based bioengineering is a common, robust and versatile strategy to assemble various types of small RNAs for broad applications.
INTRODUCTION
[0065] RNA interference (RNAi) technologies have been widely utilized for genome function studies. There are also a number of RNAi -based therapies under clinical trials (1-3) in addition to an RNA aptamer (Pegaptanib) being approved by the U.S. Food and Drug Administration for the treatment of age-related macular degeneration (4).
Currently RNAi agents and noncoding RNA (ncRNA) materials used for basic, translational and clinical research such as small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), RNA aptamers, and microRNAs (miRs or miRNAs) are mainly produced through chemical synthesis (5-9), while other virus and non-virus-vector based strategies literally utilize DNA agents. Although organic synthesis of oligonucleotides may be automated, a multi-milligram dose of 22-nt double-stranded siRNA or miRNA agents for in-vivo testing or projected therapy is very costly. It is also unclear to what extent chemical modifications would alter the structures, biological activities and safety profiles of these ncRNAs, despite that synthetic ncRNAs exhibit some favorable pharmacokinetic properties such as a longer half-life. In vitro transcription (10,11) is another way to produce RNA agents in variable lengths. However, in vitro transcription generally produces RNA molecules in a test tube on micrograms scale, thus the production of larger quantities of RNAs requires considerably more of the costly RNA polymerases.
[0066] With an interest in developing new strategies to bioengineer ready-to-use
RNAi agents on a large scale, a successful example has been reported very recently for the generation of fully-processed siRNAs from pl9-expressing bacteria (12). On the other hand, tRNA (13-15) and rRNA (16) have been employed as scaffolds to produce a number of chimeric RNAs in common strains of bacteria, given the fact that tRNAs and rRNAs are present as stable RNA molecules in the cells. The recombinant RNA chimeras are thus isolated, and the target RNAs may be released in demand by corresponding RNase (13,14), Ribozyme (15) or DNAzyme (16) for structural and biophysical analyses. These recombinant RNA technologies provide a novel way for a cost-effective and fast production of large quantities of recombinant RNAs (e.g., milligrams of RNA chimeras from 1 L bacteria culture).
[0067] We had taken the initiative to produce pre-miRNA chimeras (Figure la) in common strains of E. coli using tRNA scaffold (17). We hypothesized that fusion tRNA/pre-miRNA isolated from bacteria might act as a "prodrug" where pre-miRNA could be selectively processed to mature miRNA in human cells, and tRNA scaffold would be degraded to tRNA fragments (tRFs). In the present study, we demonstrated that the majority of tRNA/pre-miRNA chimeras did not accumulate in bacteria or only at a negligible level, thus we developed a novel optimal ncRNA scaffold (OnRS)-based strategy to achieve a consistent high-yield production of chimeric RNAs in E. coli that offers the versatility to carry various types of functional small RNAs of interests such as miRNAs, siRNAs and RNA aptamers (Figure lb). This approach is proven robust and shall have broad applications to engineering of target chimeric RNAi agents and RNA sensors that may be utilized as research tools and further developed as therapeutic agents and diagnostic tools.
MATERIALS AND METHODS [0068] Bacterial culture . AW E. coli stains were cultured at 37°C in LB broth supplemented with 100 μg/mL ampicillin. DH5a (Life Technologies, Grand Island, NY) was used for cloning and HST08 (Clontech Laboratories, Mountain View, CA) was employed for the production of multi-milligrams of chimeric RNAs. Other strains such as DH5a, Top 10 (Life Technologies, Grand Island, NY) and BL21 (Sigma- Aldrich, St.
Louis, MO) were also used to evaluate ncRNA expression/accumulation.
[0069] Human cell culture. The human carcinoma cell line A549 was purchased from American Type Culture Collection (Manassas, VA), and ES-2/GFP was from Cell Biolabs (San Diego, CA). Both cell lines were maintained in RPMI 1640 with 10% fetal bovine serum at 37°C in a humidified atmosphere with 5% C02 and 95% air. [0070] Prediction of RNA secondary structures. The secondary structures of chimeric ncRNAs were predicted using the CentroidFold
(http://www.ncrna.org/centroidfold) (18) and CentroidHomfold
(http ://www. ncrna. org/ centroidhomfold) (19).
[0071] Construction ofplasmids. Individual tRNA/pre-miRNA expression plasmids were cloned as we reported (17), following PCR amplification of target sequences from human genomic DNA using gene specific primers (IDT, San Diego, CA). See, Table 1. To create OnRS/miR-124, OnRS/Neg, OnRS/GFP-siRNA and Trna-miR- 155/GFP-siRN A expression plasmids, the oligonucleotides (Table 1) were annealed and amplified, then the amplicons were cloned into the vector pBSMrnaSeph (14) (kindly provided by Dr. Luc Ponchon, France) linearized by endonucleases Sall-HF® and Aatll (New England Biolabs, Ipswich, MA). To construct OnRS/MGA5 and OnRS/MGA3 expression plasmids, Trna/mir-34a was used as a template for the amplification of target sequences using the oligonucleotides (Table 1), and then the amplicons were inserted into pBSMrnaSeph vector linearized by SacII and Eagl (New England Biolabs) which removed the SEPHADEX™ aptamer from Trna scaffold at the same time. All inserts were confirmed by Sanger sequencing analyses at UC Davis Genome Center. TABLE l
(a) Sequences of OnRS-based chimeric RNAs
Targ
et
RNA
s Sequences ( 5'→ 3' )
OnR
S GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGACGUGGACCGGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUG
(tRN UUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCCAAGAGGGAAGATGACGUCGAUGGUUGCGGCCG
A/mir- CGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA
34a)
°nR GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGACCCGUGGACCGGCCAGCUGUGAGUGUUUCUUUAAGGCACGCGGUGAAUGCC mi UGUGAGCAAUAGUAAGGAAGGCAUUCACGCUGUGCCUUCUAGAAGUGCUGCACGUUGUGGGGCCCAAGAGGGAAGACGUCGAUGGUUGCGGCCGCGGGUC
^24 ACAGGUUCGAAUCCCGUCGUAGCCACCA
OnR GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGACCCGUGGACCGGCCAGCUGUGAGUGUUUCUUCACCUAUAACAACGGUAGUU
S/Ne UUUGUGAGCAAUAGUAAGGAAGAAACUACCUUGUUUAUAGGUCUAGAAGUGCUGCACGUUGUGGGGCCCAAGAGGGAAGACGUCGAUGGUUGCGGCCGCG g GGUCACAGGUUCGAAUCCCGUCGUAGCCACCA
OnR
S/GF GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGACCCGUGGACCGGCCAGCUGUGAGUGUUUCUUAGUUGUACUCCAGCUUGUGC
P- CCUGUGAGCAAUAGUAAGGAAGGGCACAAGUGGUAGUACAACCUAGAAGUGCUGCACGUUGUGGGGCCCAAGAGGGAAGACGUCGAUGGUUGCGGCCGCG siRN GGUCACAGGUUCGAAUCCCGUCGUAGCCACCA
A
OnR GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCCGUGGACCGGCCAGCUGUGAGUGUUUCU
S/ G UUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCCGGUCCACCCG
A5 CGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA
OnR GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGUGGACCGGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAA
S/MG GGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCCGGUCCACGGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCCCC
A3 GCGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA
The underlined are the sequences of tRNA scaffold.
The rest is the hsa-miR-34a precursor with ~9 nt flanking sequence at each prime.
The sequence in red indicates the target sequence and the green part is the complementary sequence. Sequence in bold indicates the MGA.
TABLE lb
(b) Oligonucleotides used for plasmid construction and qPCR analysis
Plasmids Primer sequences ( 5'→ 3' )
Fow-ACGCGTCGACCCAGCGATGACCTCTCTAAC
1RNA/mir-27b
Rev-CATCGACGTCCTTAACTGTCCCCATCTCACC
Fow-AGTAATTTACGTCGACGTGGACCGGCCAGCTGTGAGTGTT
lRNA/mir-34a
Rev-CGGCCGCAACCATCGACGTCATCTTCCCTCTTGGGCCCCACAACG
Fow-AGTAATTTACGTCGAC TTCGTGGCTACAGAGTTTCCTTAGCAG
tRNA/mir-122
Rev- CGGCCGCAACCATCGACGTCCAAGACATTTATCGAGGGAAGGATTGC
Fow- AGTAATTTACGTCGACCTCCTTTCCTTCCTCAGGAG
tRNA/mir-124-1
Rev- CGGCCGCAACCATCGACGTCCGCCGACCCACGGTGCTCA
Fow-AGTAATTTACGTCGACTACTTTCCGGATCAAGATTAG
1RNA/mir-124-2
Rev- CGGCCGCAACCATCGACGTCTTGGTGTCCTTCAAGTGCAG
Fow- AGTAATTTACGTCGACAGAAAACATTGTTGCGCTCCTCTC
tRNA/mir-125-1
Rev- CGGCCGCAACCATCGACGTCAGGATGCAAAAGCACGACTCGC
Fow- AGTAATTTACGTCGACTCTACCGCATCAAACCAGACTTTTCC
tRNA/mir-125-2
Rev-CGGCCGCAACCATCGACGTCCTGCTGGTTCCCCTCCGCC
Fow- AGTAATTTACGTCGACAGGCTTGCTGTAGGCTGTATGCTG
tRNA/mir-155
Rev-CGGCCGCAACCATCGACGTC AATGCTAGTAACAGGCATCATACACTGTTA
Fow-AGTAATTTACGTCGACCTTGCAAGCTGAACATCCAGGTCTG
tRNA/mir-221
Rev-CGGCCGCAACCATCGACGTCCAGCCAATGGAGAACATGTTTCCA
Fow-ACGCGTCGACGAGTTCTGTCCGTGAGCCTTGG
tRNA/mir-1291
Rev-CATCGACGTCACAGCCAACAGACCACAGGAAG
Fow-AGTAATTTACGTCGACACCCTGGATGTTCTCTTCAC
tRNA/let7a
Rev-CGGCCGCAACCATCGACGTCGATGCAGACTTTTCTATCACG
Fow-AGTAATTTACGTCGACCCGTGGACCGGCCAGCTGTGAGTGTTTCTTTAAGGCACGCGGTGAATGCCTGTGAGCAATAGTAAGGAAGGC
OnRS/miR-124-20 Rev-
CGGCCGCAACCATCGACGTCTTCCCTCTTGGGCCCCACAACGTGCAGCACTTCTAGAAGGCACAGCGTGAATGCCTTCCTTACTATTGC
Fow-
AGTAATTTACGTCGACCCGTGGACCGGCCAGCTGTGAGTGTTTCTTCACCTATAACAACGGTAGTTTTTGTGAGCAATAGTAAGGAAGAA
OnRS/Neg
Rev-
CGGCCGCAACCATCGACGTCTTCCCTCTTGGGCCCCACAACGTGCAGCACTTCTAGACCTATAAACAAGGTAGTTTCTTCCTTACTATTG
OnRS/GFP-siRNA Fow-
(b) Oligonucleotides used for plasmid construction and qPCR analysis
Plasmids Primer sequences ( 5'→ 3' )
AGTAATTTACGTCGACCCGTGGACCGGCCAGCTGTGAGTGTTTCTTAGTTGTACTCCAGCTTGTGCCCTGTGAGCAATAGTAAGGAAGGG
Rev-CGGCCGCAACCATCGACGTCTTCCCTCTTGGGCCCCACAACGTGCAGCACTTCTAGGTTGTACTACCACTTGTGCC
CTTCCTTACTATTG
tRNA/miR-155/GFP- Fow-AGTAATTTACGTCGACGAGGCTTGCTGAAGGCTGTATGCTGGTTGTACTCCAGCTTGTGCCCGTTTTGGCCACTGACTGACGG siRNA Rev-CGGCCGCAACCATCGACGTCGAGTGCTAGTAACAGGCCTTGTGTCCTGGTTGTACTCCATTGTGCCCGTCAGTCAGTGGCCAA
Fow-GTTAGAGCAGCGGCCGGGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCCGTGGACCGGCCAGCTGTGAG
OnRS/MGA5
Rev- GAACCTGTGACCCGCGGGTGGACCGGGCCCCACAACGTGCAGCA
Fow- GTTAGAGCAGCGGCCGGTGGACCGGCCAGCTGTGAG
OnRS/MGA3
Rev-GAACCTGTGACCCGCGGGGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCGTGGACCGGGCCCCACAACGTGCAGCA
(c) Primers used for RT-qPCR experiments
Utility Primer sequences ( 5'→ 3' )
Universal rev GCGCTAAGGCACGCGGTG
RT-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAATTGT
U74
Fow-CCTGTGGAGTTGATCCTAGTCTGGGTG
RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATT
miR-124
Fow-GCGCTAAGGCACGCGGTG
RT- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC GGGCAC
GFP-siRNA
Fow-GCGCGCAGTTGTACTCCAGCTT
Fow-ACGTAAACGGCCACAAGTTC
GFP mRNA
Rev-AAGTCGTGCTGCTTCATGTG
Fow-CCTAAAGCATACGGGTCCTG
PPIA
Rev-TTTCACTTTGCCAAACACCA
Fow-GTAACCCGTTGAACCCCATT
18s
Rev-CCATCCAATCGGTAGTAGCG
[0072] Expression of chimeric RNAs in E. coli. Chimeric RNAs were expressed in
HST08 on a large scale as described (13, 14,17). Total RNAs were isolated from E. coli using the Tris-HCl-saturated phenol extraction method, quantitated with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Rockford, IL) and analyzed by denaturing urea (8 M) polyacrylamide (8%) gel electrophoresis (PAGE). All images were acquired with ChemiDoc MP Imaging System (Bio-Rad, Hercules, CA). Intensities of bands were used to provide a rough estimation of relative levels of recombinant ncRNAs present in the total RNAs.
[0073] Purification of recombinant ncRNAs. Purification of recombinant ncRNAs was conducted with a NGC QUEST 10PLUS CHROM fast protein liquid chromatography (FPLC) System (Bio-Rad). Separation of recombinant ncRNAs from total RNAs was achieved on a UNO Q6 anion-exchange column (Bio-Rad), which was first equilibrated with Buffer A (10 mM sodium phosphate, pH = 7.0) at a flow rate 5.0 mL/min for 0.5 min, followed by a gradient elution at the same flow rate, 0-56% Buffer B (Buffer A plus 1 M sodium chloride) in 0.5 min, 56% Buffer B for 2 min, 56-65% Buffer B in 10 min, and then 100% Buffer B for 2 min, 100-0% Buffer B in 0.5 min and 100% Buffer A for 5 min.
FPLC traces were monitored at 260 nm using a UV/Vis detector. Peak areas were employed to estimate the relative levels of recombinant ncRNAs within the total RNAs, which agrees with those determined by urea-PAGE analyses. After analyzed on a denaturing PAGE gel, the fractions containing pure ncRNAs were pooled. Recombinant ncRNAs were precipitated with ethanol, reconstituted with nuclease-free water, and then desalted and concentrated with Amicon ultra-2 mL centrifugal filters (30 KD; EMD
Millipore, Billerica, MA). The only exception was OnRS/MGA that was reconstituted with 10 mM HEPES (pH = 7.4) buffer. The quantity of purified ncRNAs was determined using NanoDrop and the quality was validated by PAGE analysis before other experiments.
[0074] Deep sequencing of small RNAs and data analysis. A549 cells were transfected with 50 nM FPLC-purified OnRS/miR-124 and tRNA/mir-34a (OnRS), and ES- 2/GFP cells were transfected with OnRS/Neg and OnRS/GFP-siRNA using Lipofectamine 2000 (Life Technologies). Total RNAs were isolated using a Direct-zol RNA extraction kit (Zymo Research, Irvine, CA) at 48 h post-transfection, and small RNA libraries were generated using the Illumina Truseq™ Small RNA Preparation kit (Illumina, San Diego, CA) according to the instructions. The purified cDNA library was used for cluster generation on Illumina' s Cluster Station and then sequenced on Illumina GAIIx following vendor's instructions. Raw sequencing reads (40 nt) were obtained using Illumina's Sequencing Control Studio software version 2.8 (SCS v2.8) following real-time sequencing image analysis and base-calling by Illumina's Real-Time Analysis version 1.8.70 (RTA vl .8.70). The extracted sequencing reads were used for the standard sequencing data analysis by following a proprietary pipeline script, ACGTlOl-miR v4.2 (LC Sciences, Houston, TX)(20,21). Cells were treated in triplicate and sequenced separately.
[0075] Reverse transcription quantitative real-time PCR (RT-qPCR) . Cells were transfected with various doses of recombinant ncRNAs and harvested at particular time points. Total RNAs were isolated using Direct-zol RNA isolation kit (Zymo Research), and RNA concentrations were determined using NanoDrop 2000 spectrophotometer. RT was conducted with NxGen M-MuLV reverse transcriptase (Lucigen, Middleton, WI), and qPCR analysis was carried out on a CFX96 Touch real-time PCR system (Bio-Rad) using quantitative RT-PCR Master mix (New England Biolabs), as described(17,22). Levels of miRNAs were normalized to U74, and mRNA levels were normalized to PPIA. Gene specific primers were shown in Table 1. Each experiment was conducted in triplicate and each sample was measured 2-3 times. Similar results were obtained when the study was repeated.
[0076] Western blots. A549 cells were transfected with 100 nM OnRS/miR-124 or
OnRS/Neg and harvested after 48 h. Cell lysates were prepared with RIPA lysis buffer (Rockland Immunochemical Inc., Limerick, PA) consisting of complete protease inhibitor cocktail (Roche, Nutley, NJ). Protein concentrations were determined using the BCA Protein Assay Kit (Thermo Fisher Scientific). Whole-cell proteins (40 μg per lane) were separated on 10% SDS-PAGE gel, and electrophoretically transferred onto PVDF membranes (Bio-Rad). Membranes were then incubated with selective antibody against P- STAT-3, STAT-3 (Cell Signaling Technology, Danvers, MA) or GAPDH (Santa Cruz Biotech Inc., Texas, TX), and subsequently with peroxidase anti-rabbit (Jackson
ImmunoResearch Inc., West Grove, PA) or anti-mouse IgG (Cell Signaling). The membranes were then incubated with ECL substrates (Bio-Rad), and images were acquired with ChemiDoc MP Imaging System (Bio-Rad). Cells were treated in triplicate and the same results were obtained when the whole study was repeated.
[0077] Apoptosis assay. The apoptosis assay was performed by using a FACS
Annexin V assay kit (Trevigen, Inc., Gaithersburg, MD, USA) following the manufacturer s protocol. Briefly, A549 cells were transfected with 100 nM recombinant ncRNAs, harvested at 72 h post-transfection, incubated with Annexin V-FITC conjugate and propidium iodide solution, and then the samples were analyzed on a FACScan flow cytometer (BD Biosciences, San Jose, CA). Data analysis was performed using Flowjo (Ashland, OR). Cells were treated in triplicate and similar results were obtained when the whole experiment was repeated.
[0078] MTT assay. A549 cells were transfected with 20 or 100 nM chimeric RNAs.
At 72 h post-transfection, cell viability was determined using MTT as we described previously (23). Cells were treated in triplicate and similar results were obtained when the whole study was repeated.
[0079] Real-time cell growth analysis. A549 cells were seeded 40,000/well on an 8- well E-Plate and treated with 20 or 100 nM recombinant ncRNA 24 h later. Cell growth was monitored using an iCELLigence system (ACEA Biosciences, San Diego, CA).
Similar results were obtained when the whole experiment was repeated for three times.
[0080] In vitro knockdown of GFP. ES-2/GFP cells were seeded 8,000 cells/well on a 24-well plate and transfected with 5 or 15 nM FPLC-purified chimeric RNAs at 24 h later. The fluorescence was monitored with an Olympus 1X81 microscope (Olympus, Center Valley, PA) at 24h, 48h and 72h post-transfection. All images were acquired using the same settings at the same time. At the end of the study, total RNAs were isolated from the cells and subject to RT-qPCR evaluation of GFP mRNA and siRNA levels. Cells were treated in triplicate, and similar results were obtained when the whole experiment was repeated.
[0081] In vivo knockdown of GFP. All animal procedures were approved by the
Institutional Animal Care and Use Committee at UC Davis. Six- to seven-week-old male GFP-transgenic (C57BL/6-Tg(CAG-EGFP)10sb/J) mice (24) (The Jackson Laboratory, Bar Harbor, ME) were injected i.v. with 75 μg FPLC-purified OnRS/Neg (N = 3) or
OnRS/GFP-siRNA (N = 4) after formulated with in vivo-jetPEI (Polyplus-transfection Inc., New York, NY) each day for consecutive 3 days. Three days after the last injection, mice were sacrificed and liver tissues were collected. Frozen sections (8 μπι) were prepared after embedded in Tissue-Tek O.C.T. (Sakura Finetek, Torrance, CA) and examined directly using a Zeiss Axio Observer.zl Microscope coupled to a Zeiss LSM 710 Scanning Device (Zeiss, Oberkochen, Germany). Different batches of sections (8 μπι) were fixed with 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO) and stained with 1 μg/mL 4', 6- diamidino-2-phenylindole (DAPI; Sigma-Aldrich). GFP fluorescence and DAPI-stained nuclei images were recorded with confocal microscope sequentially and then merged together.
[0082] In addition, liver tissues were subject to RNA isolation and RT-qPCR analyses for GFP mRNA and siRNA levels against 18S and U74 was used as control, respectively. Gene specific primers were presented in Table 1.
[0083] Malachite green (MG) aptamer binding assays . Absorbance scanning was performed from 550 nm to 700 nm using a SpectraMax Microplate Reader (Molecular Devices, Sunnyvale, CA) after 32 μg purified ncRNAs or 80 μg total RNAs were incubated with 10 μΜ MG in 100 mM KC1, 5 mM MgCl2, and 10 mM HEPES (pH = 7.4) buffer in a total volume of 100 iL. Fluorescent intensity was determined at 630/650 nm
(excitation/emission) with the same SpectraMax Microplate Reader for purified ncRNAs (32 μg) or total RNAs (80 μg) in the absence and presence of MG (10 μΜ). To establish the linearity of MGA-bound MG fluorescent intensity vis-a-vis MG and MGA concentrations, the intensities of fluorescence were examined when 2.08 μΜ OnRS/MGA5 was exposed to 0-10 μΜ MG and 10 μΜ was incubated with 0-5.2 μΜ OnRS/MGA5, respectively, in 10 mM HEPES (pH = 7.4) buffer in a total volume of 100 μΐ^. Each assay was carried out in triplicate, and all experiments were repeated at least once that showed similar results.
[0084] Serum RNase activity assay. Serum specimens from IRB-approved, prospectively-collected UC Davis Pancreas Registry bank were utilized. The serum has been processed uniformly within 4 h of blood collection, aliquoted and stored in a -80 0C freezer till usage with minimal freeze-thaw cycle. A total of 20 patients' serum from 10 pancreatic ductal adenocarcinoma (PDAC) (5 early-stage PDAC (American Joint
Committee of Cancer, Stages 1 & 2)) and 10 benign/normal pancreas cases (5 chronic pancreatitis and 5 normal pancreases) were selected. The PDAC cases consisted of 4 males and 6 females, benign/normal of 5 males and 5 females. Age ranges were 51 to 80
(mean=67 y/o) in the PDAC and 37 to 85 (mean=60 y/o) in benign/normal groups. A normal pooled human serum sample (Fisher Scientific Inc., Waltham, MA), human recombinant RNase A (Novoprotein, Summit, NJ) and human recombinant angiogenin (R&D Systems, Minneapolis, MN) were used for method development.
[0085] To evaluate the change in MGA-bound MG fluorescent intensity in relationship to incubation time (0-30 min) after exposure to human serum, 2.08 μΜ
OnRS/MGA5 was incubated with 0.4 or 2.0 μΙ_, normal pooled human serum in 10 mM HEPES (pH = 7.4) buffer in a total volume of 90 μΐ., and then fluorescence was determined after the addition of 10 μΙ_, MG to a final 10 μΜ concentration. To assess the protection of MGA by in vivo-jetPEI, 2.08 μΜ OnRS/MGA5 and 1.0 μL· pool human serum were incubated for 0-60 min. To determine the dose response, various volumes of the pooled human serum (0.01-10 pL) or concentrations of recombinant human RNase A (0-10"4 μ /μί) and angiogenin (0-10"2 μg/μL) were incubated with 2.08 μΜ OnRS/MGA5 for 10 min. To define the influence of RNase inhibitor, the pooled human serum (0, 1, 2 and 5 pL) was incubated with 2.08 μΜ OnRS/MGA5 for 10 min, with or without 0.4 U/pL RNase inhibitor (Lucigen, Middleton, WI). Each incubation reaction was carried out in triplicate, and all experiments were repeated at least once that offered consistent findings.
[0086] Based upon the linearity of fluorescent intensity over MG and MGA concentrations, incubation time and quantity of human sera, 0.4 μΙ_, patient serum sample was incubated with 2.08 uM OnRS/MGA5 in 10 mM HEPES (pH = 7.4) buffer in a total volume of 90 μΐ^ at 37°C for 5 min and then 10 μΐ^ MG was added to give 10 μΜ final concentration for the determination of fluorescence at 630/650 nm (excitation/emission). Serum RNase activity was calculated as the change in fluorescent intensity over time and quantity of serum sample, i.e., ΔΑ.υ./πήη/μΕ. Each patient sample was assayed twice with <10% variations.
[0087] Statistical analysis. Values were expressed as mean ± SD. According to the number of groups and variances, data were analyzed with unpaired Student's t-test, or oneway or two-way ANOVA (GraphPad Prism, San Diego, CA). Difference was considered as significant for P-value less than 0.05 (P < 0.05).
RESULTS
[0088] An OnRS is developed to achieve high-yield production of recombinant RNAi agents. We intended to bioengineer tRNA fusion pre-miRNA (tRNA/mir) agents in common strains of bacteria (Figure la) on a large scale, i.e., milligrams of recombinant ncRNAs from 1 L bacterial culture. A series of plasmids were created and employed to transform E. coli. Surprisingly, we found that the levels of recombinant pre-miRNA chimeras expressed/accumulated in HST08 E. coli were largely variable when the same tRNA scaffold was used. The majority of tRNA/pre-miRNA chimeras were unfortunately not accumulated or at a negligible level (Figure la). Use of other E. coli strains still offered no or even lower levels of target ncRNA chimeras (data not shown). Nevertheless, given the findings that tRNA/mir-34a was accumulated to a high level in bacteria (e.g., -15- 20% of total RNAs) and chimeric tRNA/mir-34a was stable and selectively processed to mature hsa-miR-34a in various types of human carcinoma cells, we hypothesized that tRNA/mir-34a might be developed as an OnRS over the tRNA scaffold towards a consistent high-level production of target miRNAs (Figure lb).
[0089] We thus took up the challenge to assemble miR-124 using the OnRS
(tRNA/mir-34a) platform, noticing that miR-124 differs much from miR-34a in size (20 vs. 22 nt) and arm of origin (3' vs. 5'). We replaced the 22-nt miR-34a-5p with 20-nt miR- 124-3p and substituted their complementary sequences accordingly (Table 1), which indeed offered a high-level expression of OnRS/miR-124 chimera in HST08 E. coli (Fig. lb). Recombinant OnRS/miR-124 was then readily purified to a high degree of homogeneity (> 99%) using the ani on-exchange FPLC method (Figure lc). Likewise, the OnRS was able to assemble other miRNAs (e.g., 21-nt miR-27b and 22-nt miR-22, etc.; unpublished data) and a 22-nt scrambled RNA sequence (chimeric RNA was named OnRS/Neg and used as a control in the following studies; Table 1), which were all consistently produced in HST08 E. coli at high yields and on a large scale, i.e., >15% of OnRS/miRNAs in total RNAs and >1.5 mg of FPLC-purified OnRS/miRNAs from 0.5 L bacterial culture at all times.
[0090] We further evaluated if we could utilize this OnRS-based approach to produce milligrams of functional siRNA agents in 1 L E. coli culture. A 22-nt GFP siRNA (25) was chosen as a model siRNA to assemble chimeric OnRS/GFP-siRNA (Table 1). In contrast to a minimal level of accumulation in bacteria when tRNA/mir-155 was utilized as a carrier, the use of OnRS (tRNA/mir-34a) provided a consistent high-level expression of OnRS/GFP-siRNA (Figure lb) and facilitated the FPLC purification of recombinant ncRNAs (Figure Id). As a result, we were able to produce 1.5-2.0 mg, >98% pure
OnRS/GFP-siRNA from 0.5 L bacterial culture every time. These results indicate that target miRNA/siRNA agents can be assembled by using OnRS-based platform to offer a consistent high-level production of chimeric ncRNAs in bacteria.
[0091] Target miRNAs/siRNAs are selectively released from chimeric ncRNAs in human cells while tRNA scaffold is processed to tRNA fragments (tRFs). Next we assessed if mature miR-124 could be selectively produced from OnRS/miR-124 in human cells. An unbiased deep sequencing study was conducted after the preparation of small RNAs library from human lung carcinoma A549 cells at 48 h post-transfection with OnRS/miR-124 and OnRS (tRNA/mir-34a). The data showed that OnRS/miR-124 was selectively processed to large numbers (5,613 ± 975 reads) of 20-nt miR-124 in A549 cells (Figure 2a). In contrast, there was 0 ± 1 reads of mature miR-124 identified in A549 cells treated with tRNA/mir- 34a (OnRS) that actually offered 22-nt miR-34a. Other miR-124 isoforms including those of 21 nt in length, as well as some passenger strands, were also noted whereas at much lower levels. In addition, OnRS/miR-124 had no or relatively much smaller influence on other cellular miRNAs including the hsa-mir-34a-p3 fragment (Figure 2a), while the tRNA scaffold was degraded to tRFs that actually exhibited similar patterns between OnRS/miR- 124- and tRNA/mir-34a-treated cells (Figure 2c).
[0092] Likewise, we conducted the unbiased deep sequencing analyses of cellular small RNAs in human ES-2/GFP cells at 48 h post-transfection with FPLC-purified
OnRS/GFP-siRNA and OnRS/Neg. The data showed that GFP-siRNA levels were about 1,000-fold higher in ES-2/GFP cells treated with chimeric OnRS/GFP-siRNA than the control OnRS/Neg (Figure 2b), which was mainly attributable to the increase in 22-, 23- and 21-nt isoforms and accompanied by lower levels of passenger strands. It was also noted that OnRS/Neg was indeed processed to a number of scrambled RNAs at 22-23 nt in length, but at much lower levels, which might be related to a lower stability of the scrambled RNAs or insufficient processing. Nevertheless, there were no or minimal differences in the levels of other cellular miRNAs between OnRS/GFP-siRNA- and OnRS/Neg-treated cells.
Furthermore, the tRF patterns were also similar between OnRS/GFP-siRNA and
OnRS/Neg-treated cells (Figure 2d), despite that overall tRF levels were much lower in ES- 2/GFP cells than A549 cells. Together, these results support the utility of OnRS for "stealth delivery" of target miRNAs and siRNAs into human cells beyond high-yield production of the chimeric ncRNAs in bacteria and the use of OnRS/Neg as a control to assess
OnRS/siRNA activities.
[0093] OnRS-carried miR-124 is biologically /pharmacologically active in controlling target gene expression and cancer cellular processes. Then we evaluated the bioactivities of OnRS-carried miR-124, as miR-124 is known to regulate a number of target genes such as the oncogenic signal transducer and activator of transcription 3 (STAT3), enhance apoptosis, and inhibit cell proliferation (26-28). Consistent with deep sequencing data, selective stem-loop RT-qPCR analyses showed that mature miR-124 levels were around 1000-fold higher in A549 cells from day 1 to 4 after transfection with OnRS/miR- 124, compared with OnRS/Neg (Figure 3a). Increase in miR-124 in OnRS/miR-124-treated A549 cells led to a 60% reduction of STAT3 protein levels (Figure 3b), and 1- to 2-fold greater degrees of early and late apoptosis as well as necrosis (Figure 3c). Consequently, OnRS/miR-124 exhibited significantly greater antiproliferative activity than OnRS/Neg, as demonstrated by MTT assay and using a Real-Time Cell Analyzer (Figure 3d-3e). These results demonstrate that chimeric OnRS/miR-124 is biologically/pharmacological active in regulating miR-124 target gene expression and controlling cancer cell growth after being processed to mature miR-124 in the cells.
[0094] OnRS-carried GFP siRNA is effective in knocking down GFP expression in vitro and in vivo. We also assessed the effectiveness of OnRS-carried GFP siRNA using GFP-expressing ES-2 cells and GFP-transgenic mouse models. In ES-2/GFP cells, OnRS/GFP-siRNA significantly suppressed the GFP fluorescence intensity and mRNA levels at 72 h post-transfection (Figure 4a-4b), which was associated with 3 orders of magnitude increase in GFP siRNA levels (Figure 4c). We then treated GFP-transgenic mice (24) with in vivo-jetPEI-formulated OnRS/GFP-siRNA. Compared to the GFP-transgenic mice treated with the same doses of in vivo-jetPEI-formulated OnRS/Neg, there was a remarkable reduction of hepatic GFP fluorescence intensity (Figure 4d-4e) and mRNA levels (Figure 4f) in GFP-transgenic mice treated with OnRS/GFP-siRNA, which was linked to an over 3,000-fold increase in GFP siRNA levels. These data indicate that chimeric GFP-siRNAs produced on large scale using the OnRS cargo are effective agents for in vitro and in vivo RNAi applications.
[0095] Utility of OnRS for high-level production of active RNA aptamer chimeras in bacteria. Encouraged by these findings, we further challenged the potential applications of OnRS to the production of functional RNA aptamers. A malachite green aptamer (MGA) (9) was chosen as a model aptamer and inserted at the 5' and 3' of miR-34a to offer OnRS/MGA5 and OnRS/MGA3, respectively (Figure 6a). Both chimeras were revealed to be expressed at surprisingly high levels in bacteria, i.e., over 50% of OnRS/MGA in total RNAs (Figure 6b). Thus we could use FPLC (Figure 6c) to easily purify 5-6 mg
OnRS/MGA from 15-20 mg total RNAs isolated from 0.5 L bacterial culture at all times.
[0096] Consistent with the reported property of MGA (9), we found that the wavelength of MG maximum absorbance was shifted from 618 to 630 nm upon binding the label-free, chimeric OnRS/MGA sensor (Figure 6d). Interestingly, the use of FPLC- purified OnRS/MGA or total RNAs isolated from OnRS/MGA-expressing bacteria gave the same shift in wavelength, whereas a SEPHADEX™ aptamer (OnRS/Seph) and
corresponding total RNAs did not, indicating the selectivity of MGA-MG interactions. The function of OnRS-carried MGA was further demonstrated by a strong fluorescent intensity at 630/650 nm (excitation/emission) upon binding MG (Figure 6e). In contrast, label-free OnRS/MGA itself did not exhibit any fluorescence, and only minimal basal-level MG fluorescent intensity was shown in the absence or presence of non-MGA-containing total RNAs and HPLC-purified OnRS/Seph (Figure 6e), supporting the specificity of MGA- bound-MG fluorescence. These results demonstrate that OnRS is also powerful for high- yield production of functional RNA aptamers of interests.
[0097] Application of label-free, OnRS-carried malachite green aptamer sensor to determine serum RNase activities among human pancreatic cancer patients. Given the unique property of MGA-bound MG in exhibiting the fluorescence, we further developed an OnRS/MGA-based RNase activity assay and employed the label-free chimeric OnRS/MGA to investigate and compare serum RNase activities between human PDAC and benign (including chronic pancreatitis)/normal patients because pancreatic cancer patients were shown to have much higher serum RNase activities (29). The intensity of the fluorescence increased with MG concentrations and nearly plateaued at 10 μΜ MG when OnRS/MGA concentration was fixed at 2.08 μΜ (or 0.16 μg/μL), while a good linear range was shown for 0.04-5.2 μΜ OnRS/MGA when MG concentration was fixed at 10 μΜ (Figure 7a). As expected, the intensity of OnRS/MGA-bound MG fluorescence was decreased over time (Figure 7b) when OnRS-carried MGA was cleaved by the RNases in a normal pooled human serum sample, and the response was dependent upon the doses of human sera (Figure 7c) while sera themselves did not have any significant fluorescence. Indeed, use of in vivo-jetPEI provided good protection against the decrease in fluorescent intensity over time, and addition of RNase inhibitor completely blocked the cleavage of OnRS/MGA by serum RNases. These data indicate that OnRS/MGA may be utilized to directly determine RNase activities.
[0098] To define the role of RNase A (the major form RNase in human serum) in the cleavage of chimeric ncRNAs, we directly compared the susceptibility of OnRS-carried MGA to cDNA-expressed RNase A and angiogenin (RNase 5). As manifested by the degrees of change in the intensity of MGA-bound MG fluorescence, 2.08 μΜ OnRS/MGA was completely cleaved by 5.0 x 10"5 μg/μL RNase A in 10 min, whereas only 40%
OnRS/MGA was degraded by 500-fold higher concentration (0.01 μg/μL) of angiogenin in 30 min. Since RNase A is the major form of RNase in human serum (30), this assay would mainly indicate pancreas-derived RNase A activity in human serum. Therefore, we utilized OnRS/MGA to evaluate the RNase activities in a set of serum samples prospectively collected from PDAC and benign/normal patients. The data showed that serum RNase activities (AA.U./min/ L) were significantly (P < 0.01) higher in PDAC (196 ± 22) than benign/normal (118 ± 8) patients. These results implicate that chimeric MGA sensor produced using the OnRS platform could be useful for determination of RNase activities.
DISCUSSION
[0099] A general approach has been established for a consistent, cost-effective production of multiple to tens of milligrams of chimeric ncRNAs in 1 L culture of a common strain of E. coli, bearing various types of small RNAs of interests. The OnRS used in this platform is based upon the tRNA fusion pre-miRNA-34a that is resistant to nucleolytic digestion in bacteria and thus accumulated to significantly high level (e.g., >15% of total RNAs) for an easy purification with the anion-exchange FPLC method. The miR-34a-5p/miR-34a-3p duplex within the OnRS cargo may be replaced by any target double-stranded small RNAs such as siRNA or miRNA/miRNA* duplex (Figure lb) to achieving high-yield production of corresponding chimeric siRNA or miRNA agents, as exemplified by successful production of >1.5 mg of OnRS/miR-124, OnRS/GFP- siRNA and control OnRS/Neg chimeras from 0.5 L bacterial culture in this report. In addition, single-stranded small RNAs such as RNA aptamers can be sprouting at particular sites on OnRS to offer the aptamer chimeras (Figure 5a), which are nicely demonstrated by the assembling of OnRS/MGA5 and OnRS/MGA3 sensors. The robustness and versatility of OnRS-based platform is also supported by successful production of other target RNA agents (e.g., miR-27b, miR-22, and a vascular endothelial growth factor (VEGF) aptamer, etc.; unpublished data), whereas its application to bioengineer other types of biological RNAs such as catalytic RNAs (ribozymes) for biotransformation and guide RNAs (gRNAs) for genome editing warrants further investigations.
[0100] Chimeric OnRS/miRNAs and OnRS/siRNAs can act as "pro-drugs" for the
"delivery" of target RNAi agents into the cells. Indeed they were selectively processed to large numbers of target miRNAs and siRNAs in human cells, as determined by unbiased deep sequencing studies (Figure 2a-2b). So was the scrambled RNA from OnRS/Neg. The presence of small RNA isoforms differing in 1- or 2-nt at 5' or 3' within chimeric ncRNA- and vehicle-treated human cells may indicate the flexibilities of endoribonucleases in producing small RNAs from pre-miRNAs or shRNAs (31-33). As a result, selective stem- loop RT-qPCR assays revealed a three orders of magnitude increase in miR-124 in A549 cells and GFP siRNA in ES-2/GFP cells, respectively. The results are also in good agreement with our findings on the stability of tRNA/mir-34a chimera in human cells (unpublished data), i.e., the increases in target small RNAs levels were associated with higher levels of OnRS chimeras lasting as long as 4 days post-treatment, which highlights a favorable stability of OnRS chimeras within human cells. On the other hand, there were no or diminutive changes in the levels of other cellular miRNAs, and the tRNA-derived tRFs exhibited similar patterns in the same human cell lines (Figure 2c-2d). Nevertheless, the levels of individual or total tRFs identified in ES-2/GFP cells were much lower than A549 cells, which is presumably due to the differences in generating, degrading, excreting and/or retaining tRFs in different types of cells. In addition, while the target miRNAs/siRNAs, tRFs and other small RNAs derived from chimeric ncRNA agents in human cells were fully elucidated, the roles of specific ribonucleases such as Dicer in the processes remain undefined.
[0101] The bioactivities of miRNAs (Figure 3) and siRNAs (Figure 4) released from the OnRS cargo are clearly demonstrated by the selective suppression of corresponding target gene expression in vitro and in vivo, using the OnRS/Neg as a control. The transcription factor STAT3, a known miR-124 target gene (27,28), plays an important role in many cellular processes such as cell proliferation and apoptosis. Reduction of STAT3 protein expression levels by miR-124 may at least partially provide an explanation for the enhanced apoptosis and repressed proliferation of A549 cells (Figure 3). On the other hand, the suppression of GFP mRNA expression levels in GFP-expressing ES-2/GFP cells and GFP-transgenic mouse liver tissues by OnRS-delivered GFP siRNA explains the lower GFP fluorescent intensities (Figure 4). While the advantages and disadvantages of using recombinant DNA agents, synthetic and recombinant RNAs to achieve RNAi are undoubtedly subjects of debate, the OnRS-based technology offers a new opportunity to readily and cost-effectively produce multi-milligrams of chimeric miRNA and siRNA agents in a research laboratory setting and allows one to utilize biological RNAs to perform RNA actions in vitro and in vivo. Nevertheless, the relative selectivity, efficiency and safety of OnRS-carried RNAi agents, as compared to existing agents or methods, await more extensive evaluation.
[0102] The utility of OnRS was further extended to consistent high-yield production of RNA aptamers. A priori it is unknown whether aptamer activity would still be present in the tRNA (13-15) and 5S rRNA (16) scaffolds, although ribozyme activity was observed in the context of the tRNA scaffold when Hammerhead ribozyme sequences were inserted together with the target RNA to be produced (15). The OnRS-resembled RNA aptamer MGA sensor indeed interacted with MG to produce a specific strong fluorescence at 630/650 nm (excitation/emission; Figure 5e), as it was originally discovered (9), which was further employed for the determination of serum RNase activities in clinical samples (Figure 7e). The RNase activity assay using label-free MGA sensor developed in this study is different from current methods. The Kunitz RNase activity assay (29,34-36) is based upon the ultraviolet absorbance of label-free nucleic acids at 260 nm or nucleosides at 280 nm, which is relatively less selective and sensitive. Recent and current RNase activity assays including those commercially-available kits rely on isotope- or fluorophore-labeled RNAs or antibodies (37-40), and thus offer greater sensitivities to determine very low levels of RNase activities or indicate RNase protein levels. However, human serum is comprised of much higher RNase activities. Without extensive dilutions (e.g., 1 : 1,000) of the serum sample that might affect the RNase activity assay including linear range, larger quantities (e.g., >10 μg) of labeled synthetic RNA agents are needed, and thus the assays become costly. After careful examination of the linearity in relation to MG and OnRS/MGA concentrations as well as the quantity of human serum and incubation time, we were able to establish a fluorescence-based RNase assay using label-free OnRS/MGA sensor. Consistent with previous findings (29,36,38), our assays revealed a significantly higher serum RNase activity in PDAC patients which may be attributable to the major form RNase A released from the cancerous pancreases.
[0103] In summary, we presented a novel OnRS-based general approach for a consistent high-yield production of chimeric RNAs in common E. coli strains that carry functional small RNAs of interests such as miRNAs, siRNAs and RNA aptamers. This approach is proven robust and versatile and shall have broad applications to engineer chimeric ncRNAs, which may be utilized as in vitro and in vivo research tools and further developed as diagnostic and therapeutic agents.
REFERENCES
1. Dykxhoorn, D.M. and Lieberman, J. (2006) Knocking down disease with siRNAs. Cell, 126, 231-235.
2. Burnett, J. C. and Rossi, J. J. (2012) RNA-based therapeutics: current progress and future prospects. Chemistry & biology, 19, 60-71.
3. Kole, R., Krainer, A.R. and Altman, S. (2012) RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nature reviews. Drug discovery, 11, 125-140. 4. Ulrich, H., Trujillo, C.A., Nery, A.A., Alves, J.M., Majumder, P., Resende, R.R. and Martins, A.H. (2006) DNA and RNA aptamers: from tools for basic research towards therapeutic applications. Combinatorial chemistry & high throughput screening, 9, 619-632.
5. Kelnar, K., Peltier, H.J., Leatherbury, N., Stoudemire, J. and Bader, A.G. (2014) Quantification of therapeutic miRNA mimics in whole blood from non-human primates. Analytical chemistry, 86, 1534-1542.
6. Ling, H., Fabbri, M. and Calin, G.A. (2013) MicroRNAs and other non- coding RNAs as targets for anticancer drug development. Nature reviews. Drug discovery, 12, 847-865.
7. Takahashi, M., Yamada, N., Hatakeyama, H., Murata, M., Sato, Y.,
Minakawa, N., Harashima, H. and Matsuda, A. (2013) In vitro optimization of 2'-OMe-4'- thioribonucleoside-modified anti-microRNA oligonucleotides and its targeting delivery to mouse liver using a liposomal nanoparticle. Nucleic acids research, 41, 10659-10667.
8. Gebert, L.F., Rebhan, M.A., Crivelli, S.E., Denzler, R., Stoffel, M. and Hall, J. (2014) Miravirsen (SPC3649) can inhibit the biogenesis of miR-122. Nucleic acids research, 42, 609-621.
9. Babendure, J.R., Adams, S.R. and Tsien, R.Y. (2003) Aptamers switch on fluorescence of triphenylmethane dyes. Journal of the American Chemical Society, 125, 14716-14717.
10. Beckert, B. and Masquida, B. (2011) Synthesis of RNA by in vitro transcription. Methods in molecular biology, 703, 29-41.
11. Huang, F., He, J., Zhang, Y. and Guo, Y. (2008) Synthesis of biotin- AMP conjugate for 5' biotin labeling of RNA through one-step in vitro transcription. Nature protocols, 3, 1848-1861.
12. Huang, L., Jin, J., Deighan, P., Kiner, E., McReynolds, L. and Lieberman, J. (2013) Efficient and specific gene knockdown by small interfering RNAs produced in bacteria. Nature biotechnology, 31, 350-356.
13. Ponchon, L. and Dardel, F. (2007) Recombinant RNA technology: the tRNA scaffold. Nature methods, 4, 571-576.
14. Ponchon, L., Beauvais, G., Nonin-Lecomte, S. and Dardel, F. (2009) A generic protocol for the expression and purification of recombinant RNA in Escherichia coli using a tRNA scaffold. Nature protocols, 4, 947-959.
15. Nelissen, F.H., Leunissen, E.H., van de Laar, L., Tessari, M., Heus, H.A. and Wijmenga, S.S. (2012) Fast production of homogeneous recombinant RNA— towards large-scale production of RNA. Nucleic acids research, 40, el02.
16. Liu, Y., Stepanov, V.G., Strych, U., Willson, R.C., Jackson, G.W. and Fox, G.E. (2010) DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA- derived chimera expressed in Escherichia coli. BMC biotechnology, 10, 85. 17. Li, M.M., Wang, W.P., Wu, W.J., Huang, M. and Yu, A.M. (2014) Rapid Production of Novel Pre-MicroRNA Agent hsa-mir-27b in Escherichia coli Using
Recombinant RNA Technology for Functional Studies in Mammalian Cells. Drug metabolism and disposition: the biological fate of chemicals, 42, 1791-1795.
18. Sato, K., Hamada, M., Asai, K. and Mituyama, T. (2009)
CENTROIDFOLD: a web server for RNA secondary structure prediction. Nucleic acids research, 37, W277-280.
19. Hamada, M., Yamada, K., Sato, K., Frith, M.C. and Asai, K. (2011) CentroidHomfold-LAST: accurate prediction of RNA secondary structure using
automatically collected homologous sequences. Nucleic acids research, 39, W100-106.
20. Meyer, C, Grey, F., Kreklywich, C.N., Andoh, T.F., Tirabassi, R.S., Orloff, S.L. and Streblow, D.N. (2011) Cytomegalovirus microRNA expression is tissue specific and is associated with persistence. Journal of virology, 85, 378-389.
21. Wei, Z., Liu, X., Feng, T. and Chang, Y. (2011) Novel and conserved micrornas in Dalian purple urchin (Strongylocentrotus nudus) identified by next generation sequencing. International journal of biological sciences, 7, 180-192.
22. Bi, H.C., Pan, Y.Z., Qiu, J.X., Krausz, K.W., Li, F., Johnson, C.H., Jiang, C.T., Gonzalez, F.J. and Yu, A.M. (2014) N-methylnicotinamide and nicotinamide N- methyltransf erase are associated with microRNA- 1291 -altered pancreatic carcinoma cell metabolome and suppressed tumorigenesis. Carcinogenesis, 35, 2264-2272.
23. Pan, Y.Z., Zhou, A., Hu, Z. and Yu, A.M. (2013) Small nucleolar RNA- derived microRNA hsa-miR-1291 modulates cellular drug disposition through direct targeting of ABC transporter ABCCl . Drug metabolism and disposition: the biological fate of chemicals, 41, 1744-1751.
24. Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T. and Nishimune, Y. (1997) 'Green mice' as a source of ubiquitous green cells. FEBS letters, 407, 313-319.
25. Boudreau, R.L. and Davidson, B.L. (2012) Generation of hairpin-based RNAi vectors for biological and therapeutic application. Methods in enzymology, 507, 275-296.
26. Cao, X., Pfaff, S.L. and Gage, F.H. (2007) A functional study of miR-124 in the developing neural tube. Genes & development, 21, 531-536.
27. Cai, B., Li, J., Wang, J., Luo, X., Ai, J., Liu, Y., Wang, N., Liang, H., Zhang, M., Chen, N. et al. (2012) microRNA- 124 regulates cardiomyocyte differentiation of bone marrow-derived mesenchymal stem cells via targeting STAT3 signaling. Stem cells, 30, 1746-1755.
28. Hatziapostolou, M., Polytarchou, C, Aggelidou, E., Drakaki, A., Poultsides, G.A., Jaeger, S.A., Ogata, H., Karin, M., Struhl, K., Hadzopoulou-Cladaras, M. et al.
(2011) An HNF4alpha-miRNA inflammatory feedback circuit regulates hepatocellular oncogenesis. Cell, 147, 1233-1247. 29. Reddi, K.K. and Holland, J.F. (1976) Elevated serum ribonuclease in patients with pancreatic cancer. Proceedings of the National Academy of Sciences of the United States of America, 73, 2308-2310.
30. Akagi, K., Murai, K., Hirao, N. and Yamanaka, M. (1976) Purification and properties of alkaline ribonuclease from human serum. Biochimica et biophysica acta, 442, 368-378.
31. Gu, S., Jin, L., Zhang, Y., Huang, Y., Zhang, F., Valdmanis, P.N. and Kay, M.A. (2012) The loop position of shRNAs and pre-miRNAs is critical for the accuracy of dicer processing in vivo. Cell, 151, 900-911.
32. Castellano, L. and Stebbing, J. (2013) Deep sequencing of small RNAs identifies canonical and non-canonical miRNA and endogenous siRNAs in mammalian somatic tissues. Nucleic acids research, 41, 3339-3351.
33. Dueck, A., Ziegler, C, Eichner, A., Berezikov, E. and Meister, G. (2012) microRNAs associated with the different human Argonaute proteins. Nucleic acids research, 40, 9850-9862.
34. Kunitz, M. (1950) Crystalline desoxyribonuclease; isolation and general properties; spectrophotometric method for the measurement of desoxyribonuclease activity. The Journal of general physiology, 33, 349-362.
35. Crook, E.M., Mathias, A.P. and Rabin, B R. (1960) Spectrophotometric assay of bovine pancreatic ribonuclease by the use of cytidine 2': 3 '-phosphate. The
Biochemical journal, 74, 234-238.
36. Peterson, L.M. (1979) Serum RNase in the diagnosis of pancreatic carcinoma. Proceedings of the National Academy of Sciences of the United States of America, 76, 2630-2634.
37. Potenza, N., Salvatore, V., Migliozzi, A., Martone, V., Nobile, V. and Russo, A. (2006) Hybridase activity of human ribonuclease- 1 revealed by a real-time fluorometric assay. Nucleic acids research, 34, 2906-2913.
38. Kottel, R.H., Hoch, S.O., Parsons, R.G. and Hoch, J.A. (1978) Serum ribonuclease activity in cancer patients. British journal of cancer, 38, 280-286.
39. Vlassov, A., Florentz, C, Helm, M., Naumov, V., Buneva, V., Nevinsky, G. and Giege, R. (1998) Characterization and selectivity of catalytic antibodies from human serum with RNase activity. Nucleic acids research, 26, 5243-5250.
40. Nakata, D. (2014) Increased N-glycosylation of Asn(8)(8) in serum pancreatic ribonuclease 1 is a novel diagnostic marker for pancreatic cancer. Scientific reports, 4, 6715. [0104] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
INFORMAL SEQUENCE LISTING
Underlined are tRNA sequences, and the italic are hsa-mir-34a sequences. Italic bold sequences are extended 5' and 3' sequences of hsa-mir-34a . Underlined italic bold represents mutated nucleotides. The boxed are MGA sequences.
SEQ ID NO:l - tR A/MSA (107 nt) :
5' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGACGG
UGACGUCGAUGGUUGCGGCCGCGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
SEQ ID NO: 2 - Human Pre-miR-34a (hsa-mir-34a ; MI0000268)
5 ' -GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGC
AAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC-
3'
SEQ ID NO: 3 - OnRS-1 or tRNA/mir-34a (233 nt) :
5' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGAC
GUGGACCGGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGU UGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGC UGCACGUUGUGGGGCCCAAGAGGGAAGAUGACGUCGAOGGUOGCGGCCGC GGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
SEQ ID NO: - OnRS-2 (195 nt) :
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGt7GGACCGGCCAGC[7G
UGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAG GAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCC CGGt7CCACCCGCGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3
SEQ ID NO: 5 - OnRS-3 (199 nt) :
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGGCCAGC[7G[7GAG[7G[7
UUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAA UCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCCGACGUC GAUGGUUGCGGCCGCGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
SEQ ID NO: 6 - OnRS-4a (182 nt) :
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGGCCAGC[7G[7GAG[7G[7
UUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAA UCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCCCCGCGG GUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
SEQ ID NO:7 - OnRS-4b (181 nt) :
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGGCCAGC[7G[7GAG[7G[7
UUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAA UCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUUGGCCCCCGCGG GUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
SEQ ID NO:8 - OnRS-5 (182 nt) :
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGGCCCCGCL/GL/GAGL/G
UUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCA AUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCCCGCG GGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
SEQ ID NO: 9 - Malachite Green Aptamer (MGA) (38 nt)
5' GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC -3'
SEQ ID NO: 10 - OnRS-2/MGA5 (233 nt)
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGGAUCCCGACUGGCGA
GAGCCAGGUAACGAAUGGAUCC GUGGACCGGCCAGCUGUGAGUGUUUCUU
UGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGC AAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCCGGUCCACCCGC GGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
SEQ ID NO:ll - OnRS-2/MGA3 (233 nt) :
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGGt7GGACCGGCCAGC[7G
UGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAG GAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCC
CGGZJCCAuGGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCCCCGC
GGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 ' Sequence ID No: 12 - Pre-miR-1291 (121 nt)
5 ' -AGUUCUGUCCGUGAGCCUUGGGUAGAAUUCCAGUGGCCCUGACUGAAGACCAGCAGUU GUACUGUGGCUGUUGGUUUCAAGCAGAGGCCUAAAGGACUGUCUUCCUGUGGUCUGUUGGC UG-3'
Sequence ID No: 13 - tRNA/mir-1291 chimera (227 nt)
5 ' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGACGAGUUCUG UCCGUGAGCCUUGGGUAGAAUUCCAGUGGCCCUGACUGAAGACCAGCAGUUGUACUGUGGC UGUUGGUUUCAAGCAGAGGCCUAAAGGACUGUCUUCCUGUGGUCUGUUGGCUGUGACGUCG AUGGUUGCGGCCGCGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '
Sequence ID No: 14 - Pre-miR-125-1 (110 nt)
5 ' -AGAAAACAUUGUUGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGU UUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCUUUUGCAUCCU-3 ' Sequence ID No: 15 - tRNA/mir-125-1 chimera (216 nt)
5' -GGCUACGUAGCUCAGUUGGUUAGAGCAGCGGCCGAGUAAUUUACGUCGACGAGAAAAC AUUGUUGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCAC GGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCUUUUGCAUCCUUGACGUCGAUGGUUGCGGC CGCGGGUCACAGGUUCGAAUCCCGUCGUAGCCACCA-3 '

Claims

CLAIMS What is claimed is:
1. A polynucleotide comprising a tRNA operably linked to a pre- microRNA (pre-miRNA) and an aptamer that binds to a target analyte.
2. The polynucleotide of claim 1, wherein the tRNA is a methionyl tRNA.
3. The polynucleotide of claim 2, wherein the tRNA has a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 1.
4. The polynucleotide of any one of claims 1 to 3, wherein the pre- miRNA is selected from pre-miRNA- 1291, pre-miRNA-34a and pre-miRNA-125-1
5. The polynucleotide of claim 4, wherein:
a) the pre-miRNA- 1291 comprises a nucleic acid sequence having at least 90% sequence identity to the miRBase Accession No. MI0006353;
b) the pre-miRNA-34a comprises a nucleic acid sequence having at least 90% sequence identity to miRBase Accession No. MI0000268 or SEQ ID NO:2; and/or c) the pre-miRNA- 125-1 comprises a nucleic acid sequence having at least 90%) sequence identity to miRBase Accession No. MI0000446.
6. The polynucleotide of any one of claims 4 to 5, wherein:
a) the pre-miRNA- 1291 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 12;
b) the pre-miRNA-34a comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:2; and/or
c) the pre-miRNA- 125-1 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 14.
7. The polynucleotide of any one of claims 1 to 6, compri a) a methionyl tRNA operably linked to a pre-miRNA- 1291; b) a methionyl tRNA operably linked to a pre-miRNA-34a; or c) a methionyl tRNA operably linked to a pre-miRNA-125-1.
8. The polynucleotide of claim 7, wherein:
a) the methionyl tRNA operably linked to the pre-miRNA-1291 has a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 13;
b) the methionyl tRNA operably linked to the pre-miRNA-34a has a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:3; and/or
c) the methionyl tRNA operably linked to the pre-miRNA- 125-1 has a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 15.
9. The polynucleotide of claim 1, wherein the tRNA operably linked to a pre-microRNA (pre-miRNA) comprises a polynucleotide sequence having at least about 90% sequence identity to a polynucleotide selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 13 and SEQ ID NO: 15.
10. The polynucleotide of any one of claims 1 to 9, wherein all or part of the stem-loop anticodon of the tRNA is replaced with the pre-miRNA.
11. The polynucleotide of any one of claims 1 to 10, wherein the aptamer binds to a dye selected from the group consisting of malachite green, tetramethylrosamine, sulforhodamine B, and triphenylmethane dyes.
12. The polynucleotide of any one of claims 1 to 10, wherein the aptamer binds to malachite green.
13. The polynucleotide of any one of claims 1 to 12, wherein the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity to SEQ ID NO:9.
14. The polynucleotide of any one of claims 1 to 13, wherein the aptamer is inserted 5' to the pre-miRNA.
15. The polynucleotide of any one of claims 1 to 13, wherein the aptamer is inserted 3' to the pre-miRNA.
16. The polynucleotide of any one of claims 1 to 15, wherein the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity to SEQ ID NO: 10.
17. The polynucleotide of any one of claims 1 to 15, wherein the tRNA operably linked to the pre-microRNA (pre-miRNA) and the aptamer comprises a polynucleotide sequence having at least about 90% sequence identity to SEQ ID NO: 11.
18. A composition comprising a polynucleotide of any one of claims 1 to 17 and an analyte bound by the aptamer.
19. A kit comprising a polynucleotide of any one of claims 1 to 17 or a composition of claim 18.
20. A method of detecting RNase activity comprising:
a) contacting a test sample suspected of having RNase with a composition of claim 18 to form a mixture, wherein the analyte bound by the aptamer elicits a detectable signal;
b) determining the presence and amount of detectable signal in the mixture in comparison to the presence and amount of detectable signal in a control composition that has not been contacted with the sample, wherein reduced or eliminated levels of detectable signal indicate the presence of RNase activity.
21. The method of claim 20, wherein the test sample is a biological sample.
22. The method of claim 21, wherein the biological sample is a fluid sample selected from the group consisting of serum, blood, plasma, saliva, sweat, tears, milk, semen, urine, and vaginal secretions.
23. The method of claim 21, wherein the biological sample is a biopsy.
24. The method of any one of claims 20 to 23, wherein the RNase is one or more ribonucleases selected from the group consisting of RNAse A (RNase 1), RNase H, RNase III, RNase P, RNase L, RNase Tl, RNase T2, RNase U2, and angiogenin (RNase 5).
25. The method of any one of claims 20 to 24, wherein RNase activity can be detected and quantified at the milligram level without dilution of test sample.
PCT/US2016/022681 2015-03-23 2016-03-16 Methods for detection of rnase activity Ceased WO2016153880A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/558,563 US10422003B2 (en) 2015-03-23 2016-03-16 Methods for detection of RNase activity
US16/577,762 US11041201B2 (en) 2015-03-23 2019-09-20 Methods for detection of RNase activity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562137201P 2015-03-23 2015-03-23
US62/137,201 2015-03-23

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/558,563 A-371-Of-International US10422003B2 (en) 2015-03-23 2016-03-16 Methods for detection of RNase activity
US16/577,762 Division US11041201B2 (en) 2015-03-23 2019-09-20 Methods for detection of RNase activity

Publications (2)

Publication Number Publication Date
WO2016153880A2 true WO2016153880A2 (en) 2016-09-29
WO2016153880A3 WO2016153880A3 (en) 2016-11-24

Family

ID=56979106

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/022681 Ceased WO2016153880A2 (en) 2015-03-23 2016-03-16 Methods for detection of rnase activity

Country Status (2)

Country Link
US (2) US10422003B2 (en)
WO (1) WO2016153880A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10422003B2 (en) 2015-03-23 2019-09-24 The Regents Of The University Of California Methods for detection of RNase activity
US10619156B2 (en) 2014-05-28 2020-04-14 The Regents Of The University Of California Hybrid tRNA/pre-miRNA molecules and methods of use
CN113046446A (en) * 2021-04-29 2021-06-29 大连海洋大学 DNA molecular marker for identifying sex of living body of echinococcus phototropis and identification method
EP3781684A4 (en) * 2018-04-20 2022-04-20 The Regents Of The University Of California TRNA/PRE-MIRNA COMPOSITIONS AND METHODS OF TREATMENT OF LIVER CELL CARCINOMA
EP3796920A4 (en) * 2018-05-22 2023-03-01 The Regents Of The University Of California ARNT/PRE-MIARN COMPOSITIONS AND THEIR USE IN THE TREATMENT OF CANCER

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2794401T3 (en) * 2008-10-15 2020-11-18 Axolabs Gmbh Oligonucleotide detection method

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU3647799A (en) * 1998-04-03 1999-10-25 Salk Institute For Biological Studies, The Ribozyme-mediated control of gene expression
US8106180B2 (en) 2003-08-07 2012-01-31 Whitehead Institute For Biomedical Research Methods and products for expression of micro RNAs
EP2290073A3 (en) * 2004-05-28 2011-08-31 Asuragen, Inc. Methods and compositions involving microRNA
WO2007002528A1 (en) * 2005-06-23 2007-01-04 Yale University Anti-aging micrornas
US7892734B2 (en) * 2005-08-11 2011-02-22 The Board Of Trustees Of The University Of Illinois Aptamer based colorimetric sensor systems
FR2902439A1 (en) 2006-06-14 2007-12-21 Univ Rene Descartes Paris V Et CHIMERIC TRANSFER RNA AND USE THEREOF FOR THE PRODUCTION OF RNA BY A CELL
WO2008039937A2 (en) 2006-09-27 2008-04-03 Novarx Blocking of gene expression in eukaryotic cells
US20100087336A1 (en) * 2007-03-08 2010-04-08 Biotex, Inc. Functional nucleic acids and methods
AU2008235260B2 (en) * 2007-04-05 2013-08-29 Australian Centre For Plant Functional Genomics Pty Ltd Methods for detecting a target nucleotide sequence in a sample utilising a nuclease-aptamer complex
US20090004668A1 (en) 2007-06-22 2009-01-01 The Board Of Trustees Of The Leland Stanford Junior University Pre-miRNA loop-modulated target regulation
CA2698362C (en) * 2007-09-04 2013-03-26 Sanofi-Aventis Identifying molecules that modulate protein- protein interactions using protease activated reporters
CN103096925A (en) 2010-05-03 2013-05-08 Atyr医药公司 Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of arginyl-tRNA synthetases
US10378016B2 (en) 2010-12-06 2019-08-13 Children's Medical Center Corporation Composition and method for oligonucleotide delivery
WO2013106766A2 (en) 2012-01-13 2013-07-18 The Research Foundation Of State University Of New York THERAPEUTIC INDICATIONS OF miR-1291
WO2013170365A1 (en) 2012-05-18 2013-11-21 The University Of British Columbia Compositions of sparc polypeptide and grp78, and methods and uses thereof for sensitizing cancer cells
WO2015183667A1 (en) * 2014-05-28 2015-12-03 The Regents Of The University Of California HYBRID tRNA/pre-miRNA MOLECULES AND METHODS OF USE
US10422003B2 (en) * 2015-03-23 2019-09-24 The Regents Of The University Of California Methods for detection of RNase activity

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10619156B2 (en) 2014-05-28 2020-04-14 The Regents Of The University Of California Hybrid tRNA/pre-miRNA molecules and methods of use
US10422003B2 (en) 2015-03-23 2019-09-24 The Regents Of The University Of California Methods for detection of RNase activity
US11041201B2 (en) 2015-03-23 2021-06-22 The Regents Of The University Of California Methods for detection of RNase activity
EP3781684A4 (en) * 2018-04-20 2022-04-20 The Regents Of The University Of California TRNA/PRE-MIRNA COMPOSITIONS AND METHODS OF TREATMENT OF LIVER CELL CARCINOMA
US11702657B2 (en) 2018-04-20 2023-07-18 The Regents Of The University Of California TRNA/pre-miRNA compositions and methods for treating hepatocellular carcinoma
EP3796920A4 (en) * 2018-05-22 2023-03-01 The Regents Of The University Of California ARNT/PRE-MIARN COMPOSITIONS AND THEIR USE IN THE TREATMENT OF CANCER
US11946049B2 (en) 2018-05-22 2024-04-02 The Regents Of The University Of California tRNA/pre-miRNA compositions and use in treating cancer
CN113046446A (en) * 2021-04-29 2021-06-29 大连海洋大学 DNA molecular marker for identifying sex of living body of echinococcus phototropis and identification method
CN113046446B (en) * 2021-04-29 2023-05-23 大连海洋大学 DNA molecular marker for sex identification of echinococci and identification method

Also Published As

Publication number Publication date
US20200056236A1 (en) 2020-02-20
US11041201B2 (en) 2021-06-22
WO2016153880A3 (en) 2016-11-24
US20180245152A1 (en) 2018-08-30
US10422003B2 (en) 2019-09-24

Similar Documents

Publication Publication Date Title
EP3160980B1 (en) HYBRID tRNA/pre-miRNA MOLECULES AND METHODS OF USE
US11041201B2 (en) Methods for detection of RNase activity
KR101960067B1 (en) Pharmaceutical composition for treating cancer comprising miRNA
AU2008256886B2 (en) Micro-RNA scaffolds and non-naturally occurring micro-RNAs
US11946049B2 (en) tRNA/pre-miRNA compositions and use in treating cancer
EP2208499A1 (en) Nucleic acid capable of regulating the proliferation of cell
CA2827533A1 (en) Enhanced biodistribution of oligomers
EP2298359A1 (en) Nucleic acid capable of controlling degranulation of mast cell
CA2857880A1 (en) Methods and compositions involving mirna and mirna inhibitor molecules

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16769353

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 15558563

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16769353

Country of ref document: EP

Kind code of ref document: A2