WO2016149366A1 - Methods and compositions for treating cancer - Google Patents

Methods and compositions for treating cancer Download PDF

Info

Publication number
WO2016149366A1
WO2016149366A1 PCT/US2016/022641 US2016022641W WO2016149366A1 WO 2016149366 A1 WO2016149366 A1 WO 2016149366A1 US 2016022641 W US2016022641 W US 2016022641W WO 2016149366 A1 WO2016149366 A1 WO 2016149366A1
Authority
WO
WIPO (PCT)
Prior art keywords
erv
cancer
aza
ervfcl
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/022641
Other languages
French (fr)
Inventor
Katherine CHIAPPINELLI
Stephen B. Baylin
Reiner Strick
Pamela STRISSEL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universitaetsklinikum Erlangen
Johns Hopkins University
Original Assignee
Universitaetsklinikum Erlangen
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universitaetsklinikum Erlangen, Johns Hopkins University filed Critical Universitaetsklinikum Erlangen
Publication of WO2016149366A1 publication Critical patent/WO2016149366A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/702Specific hybridization probes for retroviruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to the field of epigenetics. More specifically, the present invention provides methods and compositions useful for predicting response to epigenetic drug therapy.
  • DNMTs non-small cell lung cancer
  • NSCLC non-small cell lung cancer
  • DNA methyltransf erase inhibitors such as 5-azacytidine (Aza) and 5-aza- 2' -deoxy cytidine (Dac) are increasingly being used in therapeutic strategies for cancer. They have been particularly effective in hematologic neoplasms where they are FDA approved for the pre-leukemic disorder, myelodysplasia (MDS). Despite such efficacy, the precise mechanisms accounting for the anti -tumor activities of these drugs are not certain. The major explored mode of action is their function as cytidine analogues which, when incorporated into DNA, serve as suicide inhibitors to block the catalytic actions of DNA methyltransferases (DNMTs) while also triggering degradation of these proteins.
  • DNMTs DNA methyltransf erase inhibitors
  • DNMTis the strongest clinical efficacy of DNMTis has emerged as doses of the drugs have actually been lowered. This may be because such doses avoid toxicities of the drugs that may be largely due to off- target effects such as global DNA damage.
  • transient exposure of cancer cells to nanomolar range levels of DNMTis can avoid early cytotoxicity due to DNA damage and subsequently, after drug withdrawal, allow cells to exhibit apparent reprogramming and blunting of tumorigenicity.
  • Candidate mechanisms for this effect include promoter DNA demethylation and re-expression of many genes, including some tumor suppressors, which are abnormally silenced in cancer. Concomitantly, there is restoration of more normal patterns for many signaling pathways in which abnormalities drive cancer initiation and progression including regulation of apoptosis, reduced cell cycle activity, and decrease in stem cell functions.
  • NSCLC non- small lung cancer
  • ERV epithelial ovarian cancer
  • NSCLC non-small cell lung cancer
  • a major mechanism underlying AZA triggering the above cascade of immune related events, and especially the interferon response is induction of a cytosolic double-stranded RNA (dsRNA) sensing system that serves as a viral defense mechanism for epithelial and other cell types and can induce antitumor responses.
  • dsRNA cytosolic double-stranded RNA
  • AZA activates the interferon response by upregulation of dsRNA.
  • a key contributor to the induction of the dsRNA interferon response is increased sense and antisense transcript expression of multiple DNA hypermethylated human endogenous retroviruses (ERVs).
  • ERPs DNA hypermethylated human endogenous retroviruses
  • ERV-High or “ERV-Low” that differentiates patients with a low immune and high immune signature and is regulated by epigenetic drugs such as demethylating drugs, histone deacetylase inhibitors.
  • epigenetic drugs such as demethylating drugs, histone deacetylase inhibitors.
  • patients with a high immune signature may benefit from epigenetic drugs such as demethylating drugs, histone deacetylase inhibitors.
  • immunotherapies such as anti PD1 or anti PDL1 antibodies or vaccines.
  • immunotherapies such as anti PD1 or anti PDL1 antibodies or vaccines.
  • patients with a low immune signature or low ERV would be patients who would then benefit from treatment with epigenetic drugs and then subsequent
  • Immunotherapy is emerging as one of the most exciting modality in solid tumors with recent identification of use of checkpoint therapy for melanomas, selected lung and renal cancers.
  • most solid cancers do not respond to immunotherapy.
  • common solid cancers such as colorectal, breast and ovarian cancers are not thought to be typically as immune responsive cancers.
  • We have now shown that these cancers can have an immune rich signature and others that are low in immune signal. Cancers that are high in this immune signature termed "ERV-High" would be candidates for immunotherapy.
  • ERV-Low cancers that are low in this immune signature termed “ERV-Low” would benefit from epigenetic drugs especially demethylating drugs, but also histone deacetylase inhibitors in increasing their immune stimulation and then treating with immunotherapy to treat these cancers.
  • epigenetic drugs especially demethylating drugs, but also histone deacetylase inhibitors in increasing their immune stimulation and then treating with immunotherapy to treat these cancers.
  • ERV -High high immune signature
  • ERV- Low a panel of ERV transcripts that identifies patients who have a low immune signature termed "ERV- Low” who would benefit from epigenetic therapy followed by immunotherapy for their cancer.
  • the present invention provides a panel termed "ERV,” a panel based on ERV expression in ovarian cancer. Patients are either low or high in this panel.
  • the baseline ERV panel can be used as a prognostic panel, for example, patients with high ERV expression may have better survival than patients with low ERV expression.
  • the baseline ERV panel can also be used to stratify patients who may benefit from epigenetic therapy. For example, patients with low ERV panel baseline may benefit from epigenetic therapy and/or immunotherapy and/or chemotherapy whereas patients with high ERV panel may do well with immunotherapy alone.
  • patients with a change in ERV panel may be the ones who are responding to therapy.
  • ERV expression scores for 20 patients would be divided into three equal groups, with the lowest in the “low” group, then the “medium” group, then the “high” group. There would be no comparison to the average for this subsetting.
  • a baseline expression for the ERVs can be established and used as an index or standard against which ERV expression data from subsequent patient could be compared.
  • the present invention provides a method for treating a patient having cancer comprising the steps of (a) obtaining a biological sample from the patient; (b) generating ERV expression data from the biological sample; (c) classifying the ERV expression data from the biological sample as ERV high or low based on a comparison to a control or reference; and (d) treating the cancer patient with immunotherapy if the ERV expression data from the biological sample is classified as ERV high or treating the cancer patient with epigenetic therapy followed by immunotherapy if the ERV expression data from the biological sample is classified as ERV low.
  • the epigenetic therapy comprises treatment with a DNA methyltransferase inhibitor (e.g., 5-azacitidine) and/or a histone deactytelase inhibitor (HDACi).
  • a DNA methyltransferase inhibitor e.g., 5-azacitidine
  • HDACi histone deactytelase inhibitor
  • Examples of DNMTi also include 5-aza-2'-deoxycytidine (Dac or decitabine); SGI-110 (Aztex); 5,6-dihydro-5-azacytidine; 5-fluoro-2'-deoxycytidine; zebularine.
  • HDACi examples include, but are not limited to, vorinostat, romidepsin, panobinostat (LBH589), valproic acid, belinostat (PXD101), mocetinostat (MGCD0103), abexinostat (PCI-24781), SB989, entinostat (MS0275), resminostat (4SC-201), givinostat (IF2357), quisinostat (JNJ-26481585), CUDC-101, AR-42, CHR-2845, CHR-3996, 4SC-202,
  • the immunotherapy comprises treatment with anti PD1 (e.g., Nivolumab) or anti PDL1 antibodies or vaccines.
  • Therapies can also include, but are not limited to, anti EGFR antibodies (e.g., Matuzumab), alemtuzumab (Campeth-1H), bevacizumab (Avastin), brentuximab vedotin, cetuximab (Erbitux), gemtuzumab ozogamicin, ibritumomab tiuxetan (Zevalin), ipilimumab (Yervoy), nimotuzumab, ofatumumab, panitumumab (Vectibix), rituximab, tositumomab, and trastuzumab.
  • anti EGFR antibodies e.g., Matuzumab
  • alemtuzumab Campeth-1H
  • bevacizumab Avastin
  • brentuximab vedotin cetuximab
  • a method for treating cancer in a patient comprises the step of administering epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method for treating cancer in a patient comprises the step of administering immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method for treating cancer in a patient comprises the steps of (a) administering epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference; or (b) administering immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method comprises the step of prescribing epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method comprises the step of prescribing immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method comprises the steps of (a) prescribing epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference; or (b) prescribing immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method comprises the steps of (a) ordering a diagnostic test that assays gene expression from a biological sample obtained from a patient and classifies the gene expression data from the biological sample as high or low ERV based on a comparison to a control or reference; and (b) administering or prescribing epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method comprises the steps of (a) ordering a diagnostic test that assays gene expression from a biological sample obtained from a patient and classifies the gene expression data from the biological sample as high or low ERV based on a comparison to a control or reference; and (b) administering or prescribing immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • a method comprises the steps of (a) ordering a diagnostic test that assays gene expression from a biological sample obtained from a patient and classifies the gene expression data from the biological sample as high or low ERV based on a comparison to a control or reference; and (b) administering or prescribing either (i) epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference or (ii) administering or prescribing immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
  • the biological sample is a solid tumor sample.
  • the cancer is ovarian.
  • the cancer is colorectal, breast, melanoma or lung cancer.
  • the lung cancer is non- small cell lung cancer (NSCLC).
  • the cancer is a carcinoma.
  • the ERV expression data is generated using polymerase chain reaction (PCR).
  • the PCR is qRT-PCR.
  • the ERV expression data is generated using one or more primers from Table 1.
  • the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, ERVV-1, ERVV-2, ERVS71-1, ERVPABLB-1, HERV-K74261, HML- 2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVH-1, ERVH-2, ERVH-3, ERVE4-1, ERVFcl, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVMER34-1, ERVH48-1, ERV9-1, ERV-F(XA34), and ERVW-5.
  • the ERV panel comprises one or more of the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV- K102, ERVE4-1, ERVH-1, ERVH-2, ERVH-3, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVW-5, ERVH48-1 and ERV9-1.
  • the ERV panel comprises one or more of ERVW-1, ERVP(b), ERV-3, ERVFcl, ERV-Fbl, and ERV9-1.
  • the present invention provides a method for treating a patient having cancer comprising the steps of (a) obtaining a biological sample from the patient; (b) generating ERV expression data from the biological sample; (c) classifying the ERV expression data from the biological sample as ERV high or low based on a comparison to a control or reference; and (d) treating the cancer patient with immunotherapy if the ERV expression data from the biological sample is classified as ERV high or treating the cancer patient with epigenetic therapy such as a DNA methyltransf erase inhibitor and/or a histone deacetylase inhibitor followed by immunotherapy if the ERV expression data from the biological sample is classified as ERV low.
  • epigenetic therapy such as a DNA methyltransf erase inhibitor and/or a histone deacetylase inhibitor
  • the cancer patient can be treated with chemotherapy if the ERV expression data from the biological sample is classified as ERV high.
  • the present invention provides a method for treating a patient having cancer comprising the steps of (a) obtaining a biological sample from the patient; (b) generating ERV expression data from the biological sample; (c) classifying the ERV expression data from the biological sample as ERV high or low based on a comparison to a control or reference; and (d) treating the cancer patient with immunotherapy such as anti PDl or anti PDLl antibodies or vaccines if the ERV expression data from the biological sample is classified as ERV high or treating the cancer patient with epigenetic therapy followed by immunotherapy such as anti PDl or anti PDLl antibodies or vaccines if the ERV expression data from the biological sample is classified as ERV low.
  • the methods can also comprise generating ERV expression data and indicating or recommending a treatment approach.
  • a low dose of DNMTi can be used, i.e., a lower dose than what it typically prescribed for patient. Lower doses can be more effective and less toxic in cancer. See Issa, J.P., 2 NATURE CLIN. PRACTICE ONCOLOGY S24- 239 (2005).
  • the low dose for Aza is about 10-85 mg/m 2 . In more specific embodiments, the low dose of Aza is about 10-85 mg/m 2 , 15-80 mg/m 2 , 20-80 mg/m 2 , 20-75 mg/m 2 , 25-80 mg/m 2 , 25-75 mg/m 2 , and so forth.
  • the low dose for Dac is about 5-85 mg/m 2 . In more specific embodiments, the low dose of Dac is about 5-80 mg/m 2 , 10-75 mg/m 2 , 10-80 mg/m 2 , 15-80 mg/m 2 , 15-75 mg/m 2 , and so forth.
  • Immunotherapy can be administered at typical levels.
  • doses of anti- CTLA-4 ipilimumab/Y ervoy/BMS
  • doses of anti-PD-1 are as follows: 200 mg, every 3 weeks.
  • patients receiving epigenetic therapy and immunotherapy can be treated as follows: zacitidine 40 mg/m 2 , subcutaneous days 1-6, 8-10 + Entinostat 8 mg Oral Days 3 & 10 for 28 Days times 2 cycles followed by Nivolumab 3 mg/kg every 2 weeks until progression.
  • zacitidine 40 mg/m 2 subcutaneous days 1-6, 8-10 + Entinostat 8 mg Oral Days 3 & 10 for 28 Days times 2 cycles followed by Nivolumab 3 mg/kg every 2 weeks until progression.
  • FIG. 1 DNMT inhibitors upregulate immune genes in ovarian cancer cell lines.
  • A) Levels of immune genes in four EOC cell lines and DKO colon cancer cell line (DNMTI-/-, DNMT3B-/-) relative to its parental HCT116 line. Y-axis log2 Aza/Mock fold change from microarray data. Dotted line denotes twofold change.
  • C-D qRT-PCR validation of interferon response genes in the A2780 (C) and TykNu (D) EOC lines treated with no drug (Mock), 500 nM Aza (Aza), or 100 nM Decitabine (Dac) for 3 days, and rested for 4 (Day 7) or 7 (Day 10) days before assaying.
  • Y-axis fold change over mock.
  • FIG. 2. DNMTis upregulate immune signaling through secreted interferon.
  • Aza induces immune signaling through dsRNA activation of secreted interferon.
  • A) Blocking IFNAR2 (aIFNAR2) or B) IFNP in TykNu cells treated vs. non- treated with Aza as in FIGS. 1C,D; parentheses U/mL of antibody.
  • DNA Cytoplasmic DNA
  • Cyto RNA Cytoplasmic RNA excluding ribosomal RNA.
  • FIG. 4 Aza activates dsRNA sensors to induce interferon signaling.
  • FIG. 5 Aza upregulates sense and antisense ERV transcripts.
  • RNA was isolated from cells at last (Day 3), one (Day 4), three (Day 7) and seven (Day 10) days after Mock or 500 nM Aza (Aza) for 3 days.
  • FIG. 6 Aza upregulates ERV transcripts, but not proteins, through DNA
  • FIG. 7 Aza-upregulated viral defense genes are significantly correlated with ERVs in primary tumors and correlate with sensitivity to immune therapy.
  • the (*) denotes that 8 of 10 high ERV tumors had significantly higher ISG expression compared to the low ERV tumors.
  • the term "antibody” is used in reference to any immunoglobulin molecule that reacts with a specific antigen. It is intended that the term encompass any immunoglobulin (e.g., IgG, IgM, IgA, IgE, IgD, etc.) obtained from any source (e.g., humans, rodents, non-human primates, caprines, bovines, equines, ovines, etc.).
  • antibodies include polyclonal, monoclonal, humanized, chimeric, human, or otherwise-human-suitable antibodies.
  • Antibodies also includes any fragment or derivative of any of the herein described antibodies.
  • the term "antigen” is generally used in reference to any substance that is capable of reacting with an antibody. More specifically, as used herein, the term “antigen” refers to a biomarker described herein. An antigen can also refer to a synthetic peptide, polypeptide, protein or fragment of a polypeptide or protein, or other molecule which elicits an antibody response in a subject, or is recognized and bound by an antibody.
  • biomarker refers to a molecule that is associated either quantitatively or qualitatively with a biological change.
  • biomarkers include polynucleotides, such as a gene product, RNA or RNA fragment; proteins, polypeptides, and fragments of a polypeptide or protein.
  • a biomarker means a molecule/compound that is differentially present (i.e., increased or decreased) in a biological sample as measured/compared against the same marker in another biological sample or control/reference.
  • a biomarker can be differentially present in a biological sample as measured/compared against the other markers in same or another biological sample or control/reference.
  • one or more biomarkers can be differentially present in a biological sample as measured/compared against other markers in the same or another biological sample or control/reference and against the same markers in another biological sample or control/reference.
  • a biomarker can be differentially present in a biological sample from a subj ect or a group of subjects having a first phenotype (e.g., having a disease or condition) as compared to a biological sample from a subject or group of subjects having a second phenotype (e.g., not having the disease or condition or having a less severe version of the disease or condition).
  • the one or more biomarkers can be generally present at a level that is increased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 100%, by at least 110%, by at least 120%, by at least 130%, by at least 140%, by at least 150%, or more; or is generally present at a level that is decreased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%,
  • a biomarker is preferably differentially present at a level that is statistically significant (e.g., a p-value less than 0.05 and/or a q-value of less than 0.10 as determined using, for example, either Welch's T-test or Wilcoxon's rank-sum Test). Biomarker levels can be used in conjunction with other parameters to assess a patient.
  • cancer means a type of hyperproliferative disease that includes a malignancy characterized by deregulated or uncontrolled cell growth. Cancers of virtually every tissue are known. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies.
  • squamous cell cancer e.g., epithelial squamous cell cancer
  • lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung
  • cancer of the peritoneum hepatocellular cancer
  • gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer, uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, thyroid cancer, hepatic carcinoma, as well as head and neck cancer.
  • cancer includes primary malignant cells or tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
  • primary malignant cells or tumors e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor
  • secondary malignant cells or tumors e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor.
  • abnormal cellular proliferation which can also be referred to as "excessive cellular proliferation or "cellular proliferative disease.”
  • diseases associated abnormal cellular proliferation include metastatic tumors, malignant tumors, benign tumors, cancers, precancers, hyperplasias, warts, and polyps, as well as non-cancerous conditions such as benign melanomas, benign chondroma, benign prostatic hyperplasia, moles, dysplastic nevi, dysplasia, hyperplasias, and other cellular growths occurring within the epidermal layers.
  • Classes of precancers include acquired small or microscopic precancers, acquired large lesions with nuclear atypia, precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer, and acquired diffuse hyperplasias and diffuse metaplasias.
  • Examples of small or microscopic precancers include HGSIL (high grade squamous intraepithelial lesion of uterine cervix), AIN (anal intraepithelial neoplasia), dysplasia of vocal cord, aberrant crypts (of colon), PIN (prostatic intraepithelial neoplasia).
  • Examples of acquired large lesions with nuclear atypia include tubular adenoma, AILD
  • angioimmunoblastic lymphadenopathy with dysproteinemia atypical meningioma, gastric polyp, large plaque parapsoriasis, myelodysplasia, papillary transitional cell carcinoma in- situ, refractory anemia with excess blasts, and Schneiderian papilloma. It is understood that the methods and compositions of the present invention are applicable to cancer generally.
  • comparing refers to making an assessment of how the proportion, level or cellular localization of one or more biomarkers in a sample from a patient relates to the proportion, level or cellular localization of the corresponding one or more biomarkers in a standard, reference or control sample.
  • comparing may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, or different from the proportion, level, or cellular localization of the corresponding one or more biomarkers in standard, reference or control sample.
  • the term may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, different from or otherwise corresponds (or not) to the proportion, level, or cellular localization of predefined biomarker levels/ratios that correspond to, for example, high or low ERV level.
  • the term "comparing" refers to assessing whether the level of one or more biomarkers of the present invention in a sample from a patient is the same as, more or less than, different from other otherwise correspond (or not) to levels/ratios of the same biomarkers in a control sample (e.g., predefined levels/ratios that correlate to high or low ERV levels).
  • the term "comparing" refers to making an assessment of how the proportion, level or cellular localization of one or more biomarkers in a sample from a patient relates to the proportion, level or cellular localization of one or more biomarkers in the same sample. For example, a ratio of one biomarker to another (or more) from the same patient sample can be compared. Percentages or ratios of expression or levels of the biomarkers can be compared to other percentages or ratios in the same sample and/or to predefined reference or control percentages or ratios. Such comparison can be made to assess whether the patient's immune signature is ERV -high or ERV -low, which assessment can be used to direct therapy.
  • the ratio can include 1 -fold, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11 -, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-, 21 -, 22-, 23-, 24-, 25-, 26-, 27-, 28-, 29-, 30-, 31 -, 32-, 33-, 34-, 35-, 36-, 37-, 38-, 39-, 40-, 41 -, 42-, 43-, 44-, 45-, 46-, 47-, 48-, 49-, 50-, 51 -, 52-, 53-, 54-, 55-, 56-, 57-, 58-, 59-, 60-, 61 -, 62-, 63-, 64-, 65-, 66-, 67-, 68-, 69-, 70-, 71-, 72-, 73-,
  • the difference can include 0.9-fold, 0.8-fold, 0.7-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, and 0.1 -fold (higher or lower) depending on context.
  • the foregoing can also be expressed in terms of a range (e.g., 1 -5 fold/times higher or lower) or a threshold (e.g., at least 2-fold/times higher or lower).
  • the evaluation of the relationship between one or more biomarkers in a sample can also be expressed in terms of a percentage including, but not limited to, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 6
  • the terms “identifies,” “indicates” or “correlates” (or “identifying,” “indicating” or “correlating,” or “identification,” “indication” or “correlation,” depending on the context) in reference to a parameter, e.g., a modulated proportion, level, or cellular localization in a sample from a patient, may mean that the patient has a particular immune signature, e.g., ERV high or ERV low.
  • the parameter may comprise the level (expression level or protein level) of one or more biomarkers of the present invention.
  • a particular set or pattern of the amounts of one or more biomarkers may identify the patient as having a particular immune signature, e.g., ERV high or ERV low
  • identifying may be by any linear or non-linear method of quantifying the relationship between levels/ratios of biomarkers to other biomarkers and/or standard, control or comparative value for the assessment of an immune signature.
  • patient refers to a mammal, particularly, a human.
  • the patient may have mild, intermediate or severe disease.
  • the patient may be treatment naive, responding to any form of treatment, or refractory.
  • the patient may be an individual in need of treatment or in need of diagnosis based on particular symptoms or family history.
  • the terms may refer to treatment in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; and primates.
  • measuring and determining are used interchangeably throughout, and refer to methods which include obtaining a patient sample and/or detecting the level of a biomarker(s) in a sample. In one embodiment, the terms refer to obtaining a patient sample and detecting the level of one or more biomarkers in the sample. In another embodiment, the terms “measuring” and “determining” mean detecting the level of one or more biomarkers in a patient sample. Measuring can be accomplished by methods known in the art and those further described herein. The terms are also used interchangeably throughout with the term "detecting.”
  • sample encompasses a variety of sample types obtained from a patient, individual, or subject and can be used in a diagnostic or monitoring assay.
  • the patient sample may be obtained from a healthy subject, a diseased patient or a patient having associated symptoms of cancer.
  • a sample obtained from a patient can be divided and only a portion may be used for diagnosis. Further, the sample, or a portion thereof, can be stored under conditions to maintain sample for later analysis.
  • the definition specifically encompasses solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof.
  • sample includes blood and other liquid samples of biological origin (including, but not limited to, peripheral blood, serum, plasma, cerebrospinal fluid, urine, saliva, stool and synovial fluid).
  • a sample comprises a tumor sample.
  • sample also includes samples that have been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations.
  • the terms further encompass a clinical sample, and also include cells in culture, cell supernatants, tissue samples, organs, and the like. Samples may also comprise fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by
  • a sample comprises an optimal cutting temperature (OCT)-embedded frozen tissue sample.
  • OCT optimal cutting temperature
  • the term "predetermined threshold value" of a biomarker refers to the level of the same biomarker in a corresponding control/normal sample or group of control/normal samples. Further, the term “altered level” of a biomarker in a sample refers to a level that is either below or above the predetermined threshold value for the same biomarker and thus encompasses either high (increased) or low (decreased) levels.
  • binding agent specific for or “binding agent that specifically binds” refers to an agent that binds to a biomarker and does not significantly bind to unrelated compounds.
  • binding agents that can be effectively employed in the disclosed methods include, but are not limited to, lectins, proteins and antibodies, such as monoclonal or polyclonal antibodies, or antigen-binding fragments thereof, aptamers, etc.
  • a binding agent binds a biomarker with an affinity constant of, for example, greater than or equal to about lxl 0 -6 M.
  • a binding agent can also comprise a probe or primer that specifically hybridizes a biomarker nucleic acid.
  • binding refers to that binding which occurs between such paired species as enzyme/substrate, receptor/agonist, antibody/antigen, nucleic acid/complement and lectin/carbohydrate which may be mediated by covalent or non-covalent interactions or a combination of covalent and non-covalent interactions.
  • the binding which occurs is typically electrostatic, hydrogen- bonding, or the result of lipophilic interactions. Accordingly, "specific binding" occurs between a paired species where there is interaction between the two which produces a bound complex having the characteristics of an antibody/antigen or enzyme/substrate interaction.
  • the specific binding is characterized by the binding of one member of a pair to a particular species and to no other species within the family of compounds to which the corresponding member of the binding member belongs.
  • an antibody typically binds to a single epitope and to no other epitope within the family of proteins.
  • specific binding between an antigen and an antibody will have a binding affinity of at least 10 -6 M. In other embodiments, the antigen and antibody will bind with affinities of at least 10 -7 M, 10 -8 M to 10 -9 M, 10 -10 M, 10 -11 M, or 10 -12 M.
  • Various methodologies of the instant invention include a step that involves comparing a value, level, feature, characteristic, property, etc. to a "suitable control,” referred to interchangeably herein as an “appropriate control,” a “control sample” or a “reference.”
  • a “suitable control,” “appropriate control,” “control sample” or a “reference” is any control or standard familiar to one of ordinary skill in the art useful for comparison purposes.
  • a "suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc., determined in a cell, organ, or patient, e.g., a control cell, organ, or patient, exhibiting, for example, a particular immune signature.
  • a "suitable control” or “appropriate control” is a value, level, feature, characteristic, property, ratio, etc. (e.g., biomarker levels that correlate to a particular immune signature) determined prior to performing a therapy (e.g., cancer treatment) on a patient.
  • a therapy e.g., cancer treatment
  • a transcription rate, mRNA level, translation rate, protein level/ratio, biological activity, cellular characteristic or property, genotype, phenotype, etc. can be determined prior to, during, or after administering a therapy into a cell, organ, or patient.
  • a "suitable control,” “appropriate control” or a “reference” is a predefined value, level, feature, characteristic, property, ratio, etc.
  • a "suitable control” can be a profile or pattern of levels/ratios of one or more biomarkers of the present invention that correlates to a particular immune signature, to which a patient sample can be compared. The patient sample can also be compared to a negative control.
  • control or reference levels may also be tailored to specific techniques that are used to measure levels of biomarkers in biological samples (e.g., LC-MS, GC-MS, ELISA, PCR, etc.), where the levels of biomarkers may differ based on the specific technique that is used.
  • a control or reference can be a profile or pattern of levels of one or more biomarkers that correlates to a particular immune signature, e.g., ERV high or ERV low.
  • biomarker nucleic acid is amplified prior to measurement.
  • the level of biomarker nucleic acid is measured during the amplification process.
  • the target nucleic acid is not amplified prior to measurement.
  • nucleic acid polymerization and amplification techniques include reverse transcription (RT), polymerase chain reaction (PCR), real-time PCR (quantitative PCR (q-PCR)), nucleic acid sequence-base amplification (NASBA), ligase chain reaction, multiplex ligatable probe amplification, invader technology (Third Wave), rolling circle amplification, in vitro transcription (IVT), strand displacement amplification, transcription-mediated amplification (TMA), RNA (Eberwine) amplification, and other methods that are known to persons skilled in the art.
  • more than one amplification method is used, such as reverse transcription followed by real time quantitative PCR (qRT-PCR). See, e.g., Chen et al, 33(20) NUCL. ACIDS RES. el 79 (2005).
  • a typical PCR reaction comprises multiple amplification steps or cycles that selectively amplify target nucleic acid species including a denaturing step in which a target nucleic acid is denatured; an annealing step in which a set of PCR primers (forward and reverse primers) anneal to complementary DNA strands; and an extension step in which a thermostable DNA polymerase extends the primers.
  • a DNA fragment is amplified to produce an amplicon, corresponding to the target DNA sequence.
  • Typical PCR reactions include about 20 or more cycles of denaturation, annealing, and extension. In many cases, the annealing and extension steps can be performed concurrently, in which case the cycle contains only two steps.
  • a reverse transcription reaction (which produces a complementary cDNA sequence) may be performed prior to PCR reactions.
  • Reverse transcription reactions include the use of, e.g., a RNA-based DNA polymerase (reverse transcriptase) and a primer.
  • a set of primers is used for each target sequence.
  • the lengths of the primers depends on many factors, including, but not limited to, the desired hybridization temperature between the primers, the target nucleic acid sequence, and the complexity of the different target nucleic acid sequences to be amplified.
  • a primer is about 15 to about 35 nucleotides in length. In other embodiments, a primer is equal to or fewer than about 15, fewer than about 20, fewer than about 25, fewer than about 30, or fewer than about 35 nucleotides in length. In additional embodiments, a primer is at least about 35 nucleotides in length.
  • a forward primer can comprise at least one sequence that anneals to biomarker nucleic acid sequence and alternatively can comprise an additional 5' non-complementary region.
  • a reverse primer can be designed to anneal to the complement of a reverse transcribed mRNA.
  • the reverse primer may be independent of the biomarker nucleic acid sequence, and multiple biomarker nucleic acid sequences may be amplified using the same reverse primer.
  • a reverse primer may be specific for a biomarker nucleic acid.
  • two or more biomarker nucleic acid sequences are amplified in a single reaction volume.
  • One aspect includes multiplex q-PCR, such as qRT-PCR, which enables simultaneous amplification and quantification of at least two biomarker nucleic acid sequences of interest in one reaction volume by using more than one pair of primers and/or more than one probe.
  • the primer pairs comprise at least one amplification primer that uniquely binds each mRNA, and the probes are labeled such that they are distinguishable from one another, thus allowing simultaneous quantification of multiple biomarker nucleic acid sequences.
  • Multiplex qRT-PCR has research and diagnostic uses including, but not limited, to detection of biomarker nucleic acid sequences for diagnostic, prognostic, and therapeutic applications.
  • the qRT-PCR reaction may further be combined with the reverse transcription reaction by including both a reverse transcriptase and a DNA-based thermostable DNA polymerase.
  • a "hot start" approach may be used to maximize assay performance.
  • the components for a reverse transcriptase reaction and a PCR reaction may be sequestered using one or more thermoactivation methods or chemical alteration to improve polymerization efficiency. See U.S. Patents No. 6,403,341 ; No. 5,550,044; and No.
  • labels, dyes, or labeled probes and/or primers are used to detect amplified or unamplified biomarker nucleic acid sequence (mRNA/cDNA).
  • mRNA/cDNA amplified or unamplified biomarker nucleic acid sequence
  • detection methods are appropriate based on the sensitivity of the detection method and the abundance of the target. Depending on the sensitivity of the detection method and the abundance of the target, amplification may or may not be required prior to detection.
  • biomarker nucleic acid sequence amplification is preferred.
  • a probe or primer may include Watson-Crick bases or modified bases.
  • Modified bases include, but are not limited to, the AEGIS bases (from EraGen Biosciences, Inc.
  • bases are joined by a natural
  • phosphodiester bond or a different chemical linkage.
  • Different chemical linkages include, but are not limited to, a peptide bond or a Locked Nucleic Acid (LNA) linkage, which is described, e.g., in U.S. Patent No. 7,060,809.
  • LNA Locked Nucleic Acid
  • oligonucleotide probes or primers present in an amplification reaction are suitable for monitoring the amount of amplification product produced as a function of time.
  • probes having different single stranded versus double stranded character are used to detect the nucleic acid.
  • Probes include, but are not limited to, the 5'-exonuclease assay (e.g., TaqMan®) probes (see U.S. Patent No. 5,538,848), stem-loop molecular beacons (see, e.g., U.S. Patents No. 6,103,476 and No. 5,925,517), stemless or linear beacons (see, e.g., WO 9921881, U.S.
  • Patents No. 6,649,349 and No. 6,485,901 peptide nucleic acid (PNA) Molecular Beacons (see, e.g., U.S. Patents No. 6,593,091 and No. 6,355,421), linear PNA beacons (see, e.g., U.S. Patent No. 6,329,144), non-FRET probes (see, e.g., U.S. Patent No. 6,150,097), Sunrise®/Amplifluor® probes (see, e.g., U.S. Patent No. 6,548,250), stem-loop and duplex ScorpionTM probes (see, e.g., U.S. Patent No.
  • one or more of the primers in an amplification reaction can include a label.
  • different probes or primers comprise detectable labels that are distinguishable from one another.
  • a nucleic acid, such as the probe or primer may be labeled with two or more distinguishable labels.
  • a label is attached to one or more probes and has one or more of the following properties: (i) provides a detectable signal; (ii) interacts with a second label to modify the detectable signal provided by the second label, e.g. , FRET (Fluorescent
  • Biomarker nucleic acid sequences can be detected by direct or indirect methods.
  • a direct detection method one or more biomarker nucleic acid sequences are detected by a detectable label that is linked to a nucleic acid molecule.
  • the biomarker nucleic acid sequences may be labeled prior to binding to the probe. Therefore, binding is detected by screening for the labeled biomarker nucleic acid sequence that is bound to the probe.
  • the probe is optionally linked to a bead in the reaction volume.
  • nucleic acids are detected by direct binding with a labeled probe, and the probe is subsequently detected.
  • the nucleic acids such as amplified mRNA/cDNA
  • xMAP Microspheres Luminex Corp. (Austin, TX) conjugated with probes to capture the desired nucleic acids.
  • Some methods may involve detection with polynucleotide probes modified, for example, with fluorescent labels or branched DNA (bDNA) detection.
  • nucleic acids are detected by indirect detection methods.
  • a biotinylated probe may be combined with a stretavidin-conjugated dye to detect the bound nucleic acid.
  • the streptavidin molecule binds a biotin label on amplified nucleic acid, and the bound nucleic acid is detected by detecting the dye molecule attached to the streptavidin molecule.
  • the streptavi din-conjugated dye molecule comprises Phycolink® Streptavidin R-Phycoerythrin (ProZyme, Inc. (Heward, CA)). Other conjugated dye molecules are known to persons skilled in the art.
  • Labels include, but are not limited to, light-emitting, light-scattering, and light- absorbing compounds which generate or quench a detectable fluorescent, chemiluminescent, or bioluminescent signal. See, e.g., Garman A., Non-Radioactive Labeling, Academic Press (1997) and Kricka, L., Nonisotopic DNA Probe Techniques, Academic Press, San Diego (1992).
  • Fluorescent reporter dyes useful as labels include, but are not limited to, fluoresceins (see, e.g., U.S. Patents No. 6,020,481; No. 6,008,379; and No. 5,188,934), rhodamines (see, e.g., U.S. Patents No.
  • fluorescein dyes include, but are not limited to, 6-carboxyfluorescein; 2',4', 1,4,- tetrachlorofluorescein, and 2',4',5',7',1,4-hexachlorofluorescein.
  • the fluorescent label is selected from SYBR-Green, 6-carboxyfluorescein ("FAM”), TET, ROX, VICTM, and JOE.
  • FAM 6-carboxyfluorescein
  • TET 6-carboxyfluorescein
  • ROX ROX
  • VICTM VICTM
  • JOE JOE
  • labels are different fluorophores capable of emitting light at different, spectrally-resolvable wavelengths (e.g., 4-differently colored fluorophores); certain such labeled probes are known in the art and described above, and in U.S. Patent No.
  • a dual labeled fluorescent probe that includes a reporter fluorophore and a quencher fluorophore is used in some embodiments. It will be appreciated that pairs of fluorophores are chosen that have distinct emission spectra so that they can be easily distinguished.
  • labels are hybridization-stabilizing moieties which serve to enhance, stabilize, or influence hybridization of duplexes, e.g., intercalators and intercalating dyes (including, but not limited to, ethidium bromide and SYBR-Green), minor-groove binders, and cross-linking functional groups (see, e.g., Blackburn et al, eds. "DNA and RNA Structure” in Nucleic Acids in Chemistry and Biology (1996)).
  • intercalators and intercalating dyes including, but not limited to, ethidium bromide and SYBR-Green
  • minor-groove binders include, but not limited to, ethidium bromide and SYBR-Green
  • cross-linking functional groups see, e.g., Blackburn et al, eds. "DNA and RNA Structure” in Nucleic Acids in Chemistry and Biology (1996)).
  • methods relying on hybridization and/or ligation to quantify biomarker nucleic acid may be used including, but not limited to, oligonucleotide ligation (OLA) methods and methods that allow a distinguishable probe that hybridizes to the target nucleic acid sequence to be separated from an unbound probe.
  • OLA oligonucleotide ligation
  • HARP-like probes as disclosed in U. S. Patent Application Publication No. 2006/0078894 may be used to measure the quantity of target nucleic acid.
  • the probe after hybridization between a probe and the targeted nucleic acid, the probe is modified to distinguish the hybridized probe from the unhybridized probe. Thereafter, the probe may be amplified and/or detected.
  • a probe inactivation region comprises a subset of nucleotides within the target hybridization region of the probe.
  • a post-hybridization probe inactivation step is carried out using an agent which is able to distinguish between a HARP probe that is hybridized to its targeted nucleic acid sequence and the corresponding unhybridized HARP probe.
  • the agent is able to inactivate or modify the unhybridized HARP probe such that it cannot be amplified.
  • a probe ligation reaction may be used to quantify target biomarker nucleic acid.
  • a probe ligation reaction may be used to quantify target biomarker nucleic acid.
  • MLPA MLPA
  • pairs of probes which hybridize immediately adjacent to each other on the target nucleic acid are ligated to each other only in the presence of the target nucleic acid.
  • MLPA probes have flanking PCR primer binding sites. MLPA probes can only be amplified if they have been ligated, thus allowing for detection and quantification of biomarkers.
  • a sample may also be analyzed by means of a microarray.
  • Microarrays generally comprise solid substrates and have a generally planar surface, to which a capture reagent (also called an adsorbent or affinity reagent) is attached.
  • a capture reagent also called an adsorbent or affinity reagent
  • the surface of a microarray comprises a plurality of addressable locations, each of which has the capture reagent (e.g., miRNA probes specific for particular biomarkers) bound there.
  • Many microarrays are described in the art. These include, for example, biochips produced by Asuragen,. Inc. (Austin, TX); Affymetrix, Inc. (Santa Clara, CA); GenoSensor Corp. (Tempe, AZ); Invitrogen, Corp. (Carlsbad, CA); and Illumina, Inc. (San Diego, CA).
  • a method comprises the steps of (a) assaying gene expression levels of one or more ERV genes described herein (e.g., including a panel described herein) in a biological sample obtained from a patient; (b) calculating an immune signature value based on the assayed expression levels.
  • the assay step can comprise PCR amplification.
  • the method can further comprise generating a report summarizing the gene expression data and/or the immune signature values.
  • the method may further comprise recommending a particular treatment. For example, an immune signature that is determined to be low in comparison to other biomarkers/control levels indicates that the subject should be treated with epigenetic therapy followed immunotherapy, chemotherapy or some combination of therapy for the particular cancer.
  • an immune signature that is determined to be high in comparison to other biomarkers/control levels indicates that the subject can be treated with immunotherapy (and optionally chemotherapy or some combination of therapy for the particular cancer).
  • immunotherapy and optionally chemotherapy or some combination of therapy for the particular cancer.
  • the methods listed above include all embodiments of the ERV panels described herein.
  • ERV expression can be measured using a microfluidic card (e.g., TaqMan® Array Microfluidic Card (Applied Biosystems).
  • the biomarkers of the present invention can be used in diagnostic tests to assess, determine, and/or qualify (used interchangeably herein) immune signature status in a patient and therefore, direct treatment of the patient.
  • immune signature status includes a high immune signature (ERV high) and a low immune signature (ERV low). Based on this status, further procedures may be indicated, including additional diagnostic tests or therapeutic procedures or regimens.
  • biomarkers are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc., of these biomarkers are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. Thus, if a panel of biomarkers A, B, and C are disclosed as well as a class of biomarkers D, E, and F and an example of a combination panel A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed.
  • any subset or combination of these is also disclosed.
  • the sub-group of A-E, B-F, and C-E would be considered disclosed.
  • This concept applies to all aspects of this application including, but not limited to, steps in methods of using the disclosed biomarkers.
  • steps in methods of using the disclosed biomarkers are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.
  • the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, ERVV-1, ERVV-2, ERVS71-1, ERVPABLB-1, HERV- K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVH-1, ERVH-2, ERVH-3, ERVE4-1, ERVFcl, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVMER34-1, ERVH48-1, ERV9-1, ERV- F(XA34), and ERVW-5.
  • the foregoing includes, for example, combinations of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, and 31 biomarkers.
  • the foregoing combinations are common in any of breast, colorectal and ovarian cancer.
  • the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVE4-1, ERVH-1, ERVH-2, ERVH- 3, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVW-5, ERVH48-1 and ERV9-1.
  • the foregoing includes, for example, combinations of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 and 24 biomarkers.
  • the ERV panel comprises one or more of ERVW-1, ERVP(b), ERV-3, ERV-Fcl, ERV-Fbl, and ERV9-1.
  • the foregoing includes, for example, combinations of at least 2, at least 3, at least 4, at least 5, and 6 biomarkers.
  • expression of all the ERVs can be measured and the expression of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, and 31 of the biomarkers can be used to classify ERV high, ERV intermediate and/or ERV low.
  • the power of a diagnostic test to correctly predict status is commonly measured as the sensitivity of the assay, the specificity of the assay or the area under a receiver operated characteristic ("ROC") curve.
  • Sensitivity is the percentage of true positives that are predicted by a test to be positive, while specificity is the percentage of true negatives that are predicted by a test to be negative.
  • An ROC curve provides the sensitivity of a test as a function of 1- specificity. The greater the area under the ROC curve, the more powerful the predictive value of the test.
  • Other useful measures of the utility of a test are positive predictive value and negative predictive value. Positive predictive value is the percentage of people who test positive that are actually positive. Negative predictive value is the percentage of people who test negative that are actually negative.
  • the biomarker panels of the present invention may show a statistical difference in different immune signature statuses of at least p ⁇ 0.05, p ⁇ 10 -2 , p ⁇ 10- 3 , p ⁇ 10 -4 or p ⁇ 10 -5 . Diagnostic tests that use these biomarkers may show an ROC of at least 0.6, at least about 0.7, at least about 0.8, or at least about 0.9.
  • the biomarkers are measured in a patient sample using the methods described herein and an immune signature status is calculated.
  • the measurement(s) may then be compared with a relevant diagnostic amount(s), cut-off(s), or multivariate model scores that distinguish a high immune signature (ERV high) status from a low immune signature (ERV low) status.
  • the diagnostic amount(s) represents a measured amount of a biomarker(s) above which or below which a patient is classified as having a particular immune signature status.
  • the particular diagnostic cut-off can be determined, for example, by measuring the amount of biomarkers in a statistically significant number of samples from patients with different immune signature statuses, and drawing the cut-off to suit the desired levels of specificity and sensitivity.
  • the values measured for markers of a biomarker panel are mathematically combined and the combined value is correlated to the underlying diagnostic question of high or low ERV immune signature.
  • Biomarker values may be combined by any appropriate state of the art mathematical method.
  • DA discriminant analysis
  • DFA Discriminant Functional Analysis
  • Kernel Methods e.g., SVM
  • Multidimensional Scaling MDS
  • Nonparametric Methods e.g., k-Nearest-Neighbor Classifiers
  • PLS Partial Least Squares
  • Tree-Based Methods e.g., Logic Regression, CART, Random Forest Methods, Boosting/Bagging Methods
  • Generalized Linear Models e.g., Logistic
  • the method used in a correlating a biomarker combination of the present invention is selected from DA (e.g., Linear-, Quadratic-, Regularized Discriminant Analysis), DFA, Kernel Methods (e.g., SVM), MDS, Nonparametric Methods (e.g., k-Nearest-Neighbor Classifiers), PLS (Partial Least Squares), Tree-Based Methods (e.g., Logic Regression, CART, Random Forest Methods, Boosting Methods), or Generalized Linear Models (e.g., Logistic Regression), and Principal Components Analysis. Details relating to these statistical methods are found in the following references: Ruczinski et al.,12 J.
  • data that are generated using samples such as "known samples” can then be used to "train” a classification model.
  • a "known sample” is a sample that has been pre-classified.
  • the data that are used to form the classification model can be referred to as a "training data set.”
  • the training data set that is used to form the classification model may comprise raw data or pre-processed data.
  • the classification model can recognize patterns in data generated using unknown samples.
  • the classification model can then be used to classify the unknown samples into classes. This can be useful, for example, in predicting whether or not a particular biological sample is associated with a certain biological condition.
  • Classification models can be formed using any suitable statistical classification or learning method that attempts to segregate bodies of data into classes based on objective parameters present in the data. Classification methods may be either supervised or unsupervised. Examples of supervised and unsupervised classification processes are described in Jain, "Statistical Pattern Recognition: A Review", IEEE Transactions on Pattem Analysis and Machine Intelligence, Vol. 22, No. 1, January 2000, the teachings of which are incorporated by reference.
  • supervised classification training data containing examples of known categories are presented to a learning mechanism, which learns one or more sets of relationships that define each of the known classes. New data may then be applied to the learning mechanism, which then classifies the new data using the learned relationships.
  • supervised classification processes include linear regression processes (e.g., multiple linear regression (MLR), partial least squares (PLS) regression and principal components regression (PCR)), binary decision trees (e.g., recursive partitioning processes such as CART), artificial neural networks such as back propagation networks, discriminant analyses (e.g., Bayesian classifier or Fischer analysis), logistic classifiers, and support vector classifiers (support vector machines).
  • linear regression processes e.g., multiple linear regression (MLR), partial least squares (PLS) regression and principal components regression (PCR)
  • binary decision trees e.g., recursive partitioning processes such as CART
  • artificial neural networks such as back propagation networks
  • discriminant analyses e.g., Bayesian classifier or Fischer analysis
  • Another supervised classification method is a recursive partitioning process.
  • Recursive partitioning processes use recursive partitioning trees to classify data derived from unknown samples. Further details about recursive partitioning processes are provided in U.S. Patent Application No. 2002 0138208 Al to Paulse et al., "Method for analyzing mass spectra.”
  • the classification models that are created can be formed using unsupervised learning methods.
  • Unsupervised classification attempts to learn classifications based on similarities in the training data set, without pre-classifying the spectra from which the training data set was derived.
  • Unsupervised learning methods include cluster analyses. A cluster analysis attempts to divide the data into "clusters" or groups that ideally should have members that are very similar to each other, and very dissimilar to members of other clusters. Similarity is then measured using some distance metric, which measures the distance between data items, and clusters together data items that are closer to each other.
  • Clustering techniques include the MacQueen's K-means algorithm and the Kohonen's Self-Organizing Map algorithm.
  • the classification models can be formed on and used on any suitable digital computer.
  • Suitable digital computers include micro, mini, or large computers using any standard or specialized operating system, such as a Unix, Windows® or LinuxTM based operating system.
  • the digital computer that is used may be physically separate from the mass spectrometer that is used to create the spectra of interest, or it may be coupled to the mass spectrometer.
  • the training data set and the classification models according to embodiments of the invention can be embodied by computer code that is executed or used by a digital computer.
  • the computer code can be stored on any suitable computer readable media including optical or magnetic disks, sticks, tapes, etc., and can be written in any suitable computer
  • the learning algorithms described above are useful both for developing classification algorithms for the biomarkers already discovered, and for finding new biomarker biomarkers.
  • the classification algorithms form the base for diagnostic tests by providing diagnostic values (e.g., cut-off points) for biomarkers used singly or in combination.
  • kits for qualifying immune signature status which kits are used to detect the biomarkers described herein.
  • the kit is provided as a PCR kit comprising primers that specifically bind to one or more of the biomarkers described herein.
  • primers the specifically bind and amplify the target biomarkers can further comprise substrates and other reagents necessary for conducting PCR (e.g., quantitative real-time PCR).
  • the kit can be configured to conduct singleplex or multiplex PCR.
  • the kit can further comprise instructions for carrying out the PCR reaction(s).
  • the biological sample obtained from a subject may be manipulated to extract nucleic acid.
  • the nucleic acids are contacted with primers that specifically bind the target biomarkers to form a primer: biomarker complex.
  • the complexes can then be amplified and detected/quantified/measured to determine the levels of one or more biomarkers.
  • the subject can then be identified as having a particular immune signature (e.g., ERV high or ERV low) based on a comparison of the measured levels of one or more biomarkers to one or more reference controls and/or a comparison of one set of biomarkers to another set of biomarkers.
  • a particular immune signature e.g., ERV high or ERV low
  • the kit comprises primers/probes for
  • ERVW-1 amplifying/detecting/measuring one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, ERVV-1, ERVV-2, ERVS71-1, ERVPABLB-1, HERV-K74261, HML-2.HOM/K108, ERV- K17833 CI 9, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVH-1, ERVH-2, ERVH-3, ERVE4-1, ERVFcl, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVMER34-1, ERVH48-1, ERV9-1, ERV-F(XA34) and ERVW-5, and combinations of all of the foregoing.
  • the kit comprises primers/probes for amplifying/detecting/measuring one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV- K115, ERV-K102, ERVE4-1, ERVH-1, ERVH-2, ERVH-3, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVW-5, ERVH48-1 and ERV9-1, and combinations of all of the foregoing.
  • the kit comprises primers/probes for amplifying/detecting/measuring one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML
  • kits comprises the primers encoded by SEQ ID NOS: 1-62.
  • the kit comprises the primers encoded by SEQ ID NOS: l-8, 17-52, 55-58 and 61-62.
  • the kits comprise the primers encoded by SEQ ID NOS: 1-2, 5-6, 7-8, 39-40, and 55-58.
  • the kits can further comprise reagents and instructions for performing PCR.
  • the PCR is qRT- PCR.
  • DNA methyltransf erase inhibitors such as 5-azacytidine (Aza) and 5-aza- 2'-deoxycytidine (Dac) are effective cancer therapies in hematologic neoplasms (Tsai et al, 2012) (Matei et al, 2012) and are FDA approved for the pre-leukemic disorder
  • MDS myelodysplasia
  • DNMTs DNA methyltransferases
  • tumorigenicity (Tsai et al, 2012).
  • Mechanisms can include reversal of abnormal promoter DNA methylation, re-expression of silenced genes including tumor suppressors (Baylin and Jones, 2011), and changes to cancer signaling pathways including apoptosis, cell cycle activity, and stem cell functions (Tsai et al, 2012).
  • a long recognized activity of DNMTis described by others (Karpf et al, 2004; Karpf et al, 1999), and our group (Li et al, 2014; Wrangle et al, 2013), is induction of immune responses in cancer cells.
  • NSCLC non-small cell lung cancer
  • Aza induces interferon signaling and concordant upregulation of surface antigens and their assembly proteins, viral defense pathways, and transcript and surface protein levels of PD- Ll, the key checkpoint ligand targeted in the above immunotherapy (Li et al, 2014; Wrangle et al, 2013).
  • Aza- Induced iMmune genes AIM (Li et al, 2014) for which activation is greatest for epithelial ovarian cancer (EOC) and NSCLC (Li et al, 2014).
  • dsRNA cytosolic double-stranded RNA
  • TCGA Cancer Genome Atlas
  • the viral defense gene expression separates primary EOC and other cancers into high and low expression and high tumor expression strongly associates with clinical benefit in a trial of immune checkpoint therapy for advanced melanoma.
  • Aza sensitizes to immune checkpoint blockade in a pre-clinical model of melanoma.
  • Cell lines were treated with 500 nM Aza, 100 nM Dac, or 500 nM- 3 ⁇ carboplatin (Sigma, St. Louis, Missouri) for 72 hours, and DNA and RNA were isolated using standard methods at 1, 3, or 7 days following removal of drug.
  • 2 ⁇ ruxolitinib Invivogen #tlrl-rux
  • 0.625- 5 U/mL of anti-IFNAR2 antibody PBL Interferon Source #21385-1
  • 0.625-2.5 U/mL of anti- IFNB antibody PBL Interferon Source #31400- 1
  • 1.25-5 U/mL of anti-ILlORB antibody Abeam # ab89884 were added during DNMTi treatment.
  • Ribosomal RNA was depleted using the Ribominus kit (Invitrogen), and PolyA+ and Poly A- RNA were isolated using the Oligotex Direct mRNA Mini Kit (Invitrogen). Nucleic acids were treated with 1 U ⁇ g of RNase III (Ambion), 10 U ⁇ g of RNaseH (Invitrogen), or 3 U/ 1 ⁇ g calf intestine alkaline phosphatase (New England Biolabs) according to manufacturer's instructions and 400 ng of each nucleic acid was transfected into HT29 cells.
  • DNA Methylation Analysis DNA was bisulfite converted and subjected to
  • Methylation-Specific PCR (Herman et al, 1996) for IRF7 and Fc2, and COBRA (Xiong and Laird, 1997) for the Fc2 locus on chromosome 1 1.
  • Western blot analyses employed antibodies against ERV-3 (1 : 1000, Everest), B-Actin (1 :5000, Sigma), MDA5 (1 : 1000, Cell Signaling #5321), PARP (#9542, 1 : 1000; Cell Signaling Technology, Inc.), RIG-I (1 : 1000, Cell Signaling #4200), STING (1 : 1000, Abeam #ab82960), Syncytin-1 (1 :350, Dr. Herve Perron, Geneuro, Geneva
  • IFN ⁇ ELISA utilized the Verikine- HSTM Human Interferon Beta Serum ELISA kit (PBL Interferon Source) and IFNL ELISA the DuoSet ELISA for Human IL-29/IL28-B (IFNL 1/3) kit (R & D Systems).
  • Syncytin-1, ERV-3 and ERV-W2 env, ER, and E-GFP vectors and siRNAs targeting Syncytin-1 , ERV-3, or a scrambled control were transfected using the JetPei or Hyperfect transfection reagents, respectively.
  • TLR3, MAVS, and STING shRNA were performed according to established methods (Stewart et al, 2003).
  • RNAseq Expression Analysis o f Tumors from Anti-CTLA-4-Treated Patients . Patients were described previously (Snyder et al, 2014) and samples were obtained with written informed consent per approved institutional review board (IRB) protocols. Expression data were obtained using RNASeq with all data deposited at GEO (accession number pending).
  • mice were subcutaneously injected with 1x105 B16-F10 tumor cells. On days 4, 8, 1 1 , 14, 18, mice were treated
  • mice received two cycles of intraperitoneal injection of 0.1 to 0.75 mg/kg Aza in PBS for 5 consecutive days followed by 7 days off treatment, starting at day 8 after developing palpable tumors, with control groups receiving corresponding doses of non-specific isotype antibody control and PBS intraperitoneally.
  • Tumor surface was measured with a caliper using the ellipse surface formula (Length*Width*n)/400.
  • Consensus hierarchical clustering was performed with the ConsensusClusterPlus R-package (Wilkerson and Hayes, 2010) and data analyzed by the Fisher exact p value test for association between clusters (p ⁇ 0.05 *; p ⁇ 0.0l **;p ⁇ 0.001 ***).
  • Colorectal cell lines HCT116 and HT29 were obtained from the American Type Tissue Collection and were cultured under recommended conditions.
  • Ovarian cancer cell lines were obtained from the laboratory of Dr. Dennis Slamon and included A2780 Hey, Kuramochi, and TykNu. These cell lines were cultured according to ATCC recommended conditions.
  • Cell lines were treated with 500 nM of Aza, 100 nM of Dac, or 500 nM- 3 ⁇ of carboplatin (Sigma; St. Louis, Missouri) for 72 hours while in log-growth phase, changing the media and drug every 24 hours for drug treatment.
  • carboplatin Sigma; St. Louis, Missouri
  • ruxolitinib (Invivogen #tlrlrux), 0.625-5 U/mL of anti-IFNAR2 antibody (PBL Interferon Source #21385-1), 0.625-2.5 U/mL of anti-IFNB antibody (PBL Interferon Source #31400- 1), or 1.25-5 U/mL of anti-ILlORB antibody (Abeam # ab89884) were added during DNMTi treatment.
  • Cells were harvested at 1, 3, or 7 days following initial application of drug. DNA and RNA were obtained using standard protocols (Tsai et al, 2012) RNA from cell lines was sent for the Agilent 44K Expression Array (Li et al., 2014).
  • DNA bisulfite conversion was performed using a commercially available kit (EZ DNA Methylation GoldTM Kit, Zymo Research, Orange, CA).
  • Methylation-Specific PCR was performed as previously described (Herman et al, 1996) for the IRF7 and Fc2 genes. Primers are listed in Table 6.
  • COBRA Combined Bisulfite Restriction Analysis
  • Primers are listed in Table 6. Bands and restriction fragments were resolved on 2% agarose gels, stained with ethidium bromide, and photoimaged with a UV camera.
  • RNAseq Expression Analysis of Tumors from Anti-CTLA-4- Treated Patients RNAseq Expression Analysis of Tumors from Anti-CTLA-4- Treated Patients .
  • RNA Sequencing was performed at New York Genome Center.
  • Raw reads in the fastq format were aligned to Human Genome HG19 using RNA-seq STAR aligner (Dobin et al, 2013).
  • Mapped reads for each sample were counted for each gene in annotation files in GTF format (gencode.vl9.annotation.gtf available for download from GENECODE website
  • qRT-PCR results are expressed as mean +/- SEM, with p values ⁇ 0.05 considered statistically significant using the program IBM SPSS version 21. Different groups were compared by Mann-Whitney U test or Student /-test as appropriate, and 2-tailed p values are reported. Normalized, level 3 Agilent gene expression array data for high-grade serous ovarian cancer was downloaded from The Cancer Genome Atlas (TCGA) data portal.
  • TCGA Cancer Genome Atlas
  • RNA concentration was determined using the Nanodrop machine and software (Thermo Fisher Scientific, Rockville, Maryland). 1 ⁇ g total RNA was used to generate cDNA with the QuantiTect Reverse Transcription Kit (Qiagen, Venlo, The Netherlands).
  • Quantitative reverse transcription PCR of DDX41, DDX58, IFI16, IFI27, IFI44, IFI44L, IFI6, IFNB1, IFNL1, IFNL2, IFNL3, IFNLR1, IL-1B, IL-10RB, IL-15, IRF7, MAGEB2, MAYS, MB21D1, MX1, OASL, STAT1, and TMEM173 mRNA was performed using TaqMan assays or Custom Taqman Gene Expression Array Cards (Life Technologies, Carlsbad, California) and the Applied Biosystems 7500 Fast real-time PCR system and software. TBP and GAPDH were used as reference genes. The AACT method was used to calculate relative expression levels. All qRT-PCR assays were carried out in triplicate and then repeated with new cDNA synthesis. Reverse transcriptase negative cDNA synthesis reactions were performed for at least one sample per plate.
  • Protein was isolated from cell lines and measured by BCA (Pierce Biotechnology. Protein extracts were subjected to polyacrylamide gel electrophoresis using the 4%-12% NuPAGE gel system (Invitrogen), transferred to PVDF (Millipore) membranes, and immunoblotted using antibodies that specifically recognize ERV-3, MDA5, cleaved PARP, RIG-I, STING (TMEM173), Syncytin-1, and TLR3. ⁇ -actin (Sigma #5441, 1 :5000) was used as a loading control.
  • Antibodies used were as follows: polyclonal goat anti-ERV-3 (1 : 1000, Everest), mouse anti- ⁇ -Actin (1:5000, Sigma), goat anti-mouse IgG-HRP (sc-2005, 1:5,000; Santa Cruz Biotechnology, Inc.), rabbit anti-MDA5 (1: 1000, Cell Signaling #5321), rabbit anti-PARP (#9542, 1: 1000; Cell Signaling Technology, Inc.), rabbit anti -RIG-I (1 : 1000, Cell Signaling #4200), rabbit anti-STING (TMEM173) (ab92605, 1: 1000, Abeam), Syncytin-1 monoclonal mouse antibody 14A5 against the SU (1:350) (kind gift from Dr.
  • Cytoplasmic RNA was depleted of ribosomal RNA using the Ribominus kit (Invitrogen), according to the manufacturer's instructions. PolyA+ and Poly A- RNA were isolated using the Oligotex Direct mRNA Mini Kit (Invitrogen), according to the manufacturer's instructions. Nucleic acids were treated with 1 U ⁇ g of RNase III (Ambion), 10 U ⁇ g of RNaseH (Invitrogen) or 3 U ⁇ g calf intestine alkaline phosphatase (New England Biolabs) according to the
  • RNA concentration was measured with aNanodrop, and 400 ng of each nucleic acid or 1 ⁇ g/mL PolyLC (Invivogen) was transfected into HT29 recipient cells.
  • IFNB ELISA was performed with the Verikine-HSTM Human Interferon Beta Serum ELISA kit (PBL Interferon Source) and IFNL ELISA was performed with the DuoSet ELISA for Human IL- 29/IL28-B (IFNL 1/3) kit (R & D Systems).
  • TLR3, MAVS, STING and GFP knockdowns were created in A2780, Hey, and TykNu cell lines. Virus production and infections were carried out according to established methods (Stewart et al, 2003).
  • the short hairpin sequences used were:
  • PCR cDNA amplification was performed and fragments cloned into TopoTA vectors (Invitrogen) for all new ERV genes not previously analyzed as stated above (Strissel et al, 2012) (Tables 3 and 4).
  • qPCR analyses of all cloned env and other ERV genes with a known copy number was used as an external standard to generate a standard curve with a cycle threshold (CT) value against the log of amount of standard. Importantly, a similar PCR efficiency (over 97 %) between all env genes was needed for comparison. Similar standard curves of all env genes were obtained for the SYBR-Green based qPCR with the following slopes and calculations (Strissel et al, 2012) and Tables 3 and 4).
  • ERV env genes were amplified by qPCR from 40 ng of cell line cDNA with SYBR- green technology and analyzed with an ABI7300 (ABI, Darmstadt, Germany) according to Strissel et al, 2012). Expression values were calculated as molecules (mol) per ng total RNA using a standard curve of each cloned env gene determined by real time PCR and calculated as mean +/- standard deviation of the mean (S.E.M.) according to (Ruebner et al, 2013) (Ruebner et al, 2012).
  • ERV-W1 URE/ 5'LTR without the U5 region (URE-U3-R) (-613 to +133 nt) on chromosome 7q21.2 was amplified with PCR from human control placenta and cloned via Kpnl and Hind III into pGL3-basic (Promega) (Ruebner et al. 2013).
  • the new pGL3-LTR vector was incubated with Nco I and Xba 1 deleting the luciferase gene and Syncytin-1 (1617 bp) was cloned into the Nco I and Xba 1 sites of pGL3-basic without luciferase and sequenced (5' LTR-Syn-l-pGL3).
  • the vector of ERV-W2 env (phCMV-Xq22.3 env FL) was a kind gift from Dr. K. Ruprecht, Charite, University Medicine, Berlin and represents the env-W2 cDNA but only has a partial codogenic env due to a stop codon (Table 2) (Roebke et al, 2010).
  • the p3Xfiag-CMV-14 vector contains the ERV-3 env full length cDNA and was contributed by Dr. Neal Rote, Case Western University.
  • the pEGFPNl vector was purchased (CloneTech Laboratories, Inc.).
  • a pCMV-Tag vector (Stratagene) contains the human wild type ERa cDNA and is called HEGO-CMV-ERa and was a kind gift from Dr. R.X. Song, University of Virginia, USA. Following transfection of HEGO-CMV-ERa into an ER minus carcinoma cell line an ERa full length 66 KD protein was observed (Strissel et al Oncotarget, 2012).
  • ERV siRNA Knockdown Experiments. A2780, Hey and TykNu ovarian cancer cell lines were treated with 500 nM of Aza (Sigma; St. Louis, Missouri) for 72 hours while in log- growth phase, changing the media and drug every 24 hours. The next day (Day 4) following Aza treatment, the cells were transfected using Hyperfect reagent (Qiagen) according to manufacturer's instructions with siAlexa scrambled (80nM) (Allstars Neg siRNA AF488, Qiagen) to achieve transfection efficiency above 85% and also to represent a negative mock control.
  • Hyperfect reagent Qiagen
  • siAlexa scrambled 80nM
  • Allstars Neg siRNA AF488, Qiagen Allstars Neg siRNA AF488, Qiagen
  • RNA was used for ⁇ -actin with all cell lines; Syncytin-1 (400ng for A2780, Hey, TykNu, HCT116 and 200ng for DKO) and env-Fc2, [A2780 (200ng), Hey and TykNu (400ng), HCT116 (200ng), DKO (100ng)].
  • ⁇ ⁇ of a gene specific primer ligated to a TAG- sequence not specific for the human genome (GSP sense/antisense (RT) TAG was implemented in the reaction. RNA and primers were preheated at 65°C for 5min.
  • the GSP-TAG, 0.5mM dNTP, 5mM MgC12, lOmM DTT, 40U RNaseOUT, 100U SuperScriptlll® RT (life technologies, Germany) and 240ng Actinomycin D (Sigma, Germany) were added with the RNA for a 20 ⁇ 1 reaction. Synthesis was performed at 50°C for 50 min and terminated at 85°C for 5 min. RT with extremely low intrinsic RNase H activity (for cleavage of RNA from RNA/DNA duplexes) and Actinomycin D was added to prevent second strand cDNA RT resulting in antisense artifacts (PMID 17897965).
  • 20-50mg of tissue was demembranated and the RNA isolated and cDNA synthesized according to (Strissel et al, 2012). All cDNAs were quantified for 22 ERV env genes to determine molecules / ng RNA (identical env genes as in FIG. 5 but not including gag-W5, env-MER34, ERV-FXA34 and ERV9-1).
  • mice Bl 6-F10 Melanoma Mouse Model. All mouse procedures were performed in accordance with the institutional protocol guidelines at the Memorial Sloan Kettering Cancer Center (MSKCC; New York, NY). C57BL/6J mice (6-8- week-old females) were obtained from The Jackson Laboratory. C57BL/6J mice were subcutaneously injected with 1x105 B16-F10 tumor cells. On days 4, 8, 11, 14, 18, the mice were treated intraperitoneally with anti-ctla-4 (100 ⁇ g in 100 ⁇ ). For Aza treatment, mice received two cycles of
  • DNMTis trigger viral defense and type I interferon signaling.
  • Induction of AIM in a previous study of 23 EOC cell lines included, in addition to previously reported DNA hypermethylated cancer testis antigens (MAGEA4, MAGEA9, NY-ESO-1) (James et al, 2013; Karpf et al., 2009; Karpf et al, 2004; Odunsi et al, 2014), interferon/viral defense, antigen processing and presentation, and host immune cell attraction genes (FIG. la).
  • TMEM173/STING TMEM173/STING
  • RNA DDX41 and DDX58
  • FIG. 1C D, FIG. SI A, B
  • IFNL1 IL28A
  • IFNL3 IL29
  • IFN III receptor IFNLR1 IFN III receptor IFNLR1
  • RNA sensing proteins include TLR3 on the endosomal membrane and MDA5, PKR, and RIG-I in the cytoplasm (FIG. 2A). These induce IRF3, IRF7, and NF-KB to translocate to the nucleus and activate transcription of IFN ⁇ 1 (Ivashkiv and Donlin, 2014). IRF7 is frequently promoter DNA hypermethylated in cancer and the associated low basal expression can be reversed by Aza in squamous NSCLC (Wrangle et al, 2013). Among 23 EOC lines examined, IRF7 was hypermethylated in only one, A2780 (Li et al, 2014) (FIG.
  • Type III IFN signaling can be activated by viral infection (Robek et al, 2005) (Ding and Robek, 2014). However, even though we observed upregulation of Type III ligand transcripts IFNL1 (IL28A) and IFNL3 (IL29) (FIG. SIC), secreted Type III interferon proteins are undetectable by ELISA (FIG. S2B).
  • IFN ⁇ binding to IFNAR2 also may contribute to late, Aza induced apoptosis that peaks at 4-7 days after Aza withdrawal, since anti-IFNAR2 leads to a lower ratio of cleaved/total PARP (FIG. 3A,C). (FIGS. 3C, S2F).
  • DNMTis trigger viral defense through induction ofdsRNA.
  • Aza-induced viral defense genes and IFN ⁇ 1 are not generally DNA methylated at promoter regions (Li et al, 2014), thus Aza may activate the pathway upstream of these genes.
  • Aza-induced human endogenous retrovirus (ERV) transcripts can activate viral de fense responses in EOC.
  • the above data suggests Aza might activate endogenous retroviral sequences (ERVs) that constitute more than 8% of the human genome, can activate cytosolic RNA sensors, and are silenced in normal somatic cells by promoter DNA methylation (Bannert and Kurth, 2004) (Tristem, 2000) (Hurst and Magiorkinis, 2014) (Mankan et al, 2014).
  • Aza can induce specific ERV transcripts in melanoma, choriocarcinoma, and endometrial cancer cells (Laska et al, 2013; Ruebner et al, 2013; Stengel et al, 2010) (Strissel et al., 2012). Indeed, in initial testing, the ERVK subfamily (Wang-Johanning et al, 2003) transcripts increased 2.5-fold in the A2780 cell line upon Aza treatment (data not shown).
  • Upregulation of individual ERVs (22 full length env, 6 partial coding env, one full length gag, and two partial coding poh) (Tables Sl- S2), in PCR assays for non-repeat sequences, occur especially, at Day 7, coinciding with ISG expression, in three EOC lines following Aza and Dac treatment (FIG. 5A,B, FIG. S5A,B,C).
  • ERV env genes like Syncytin-1, ERVS, env-K and env-H (Blond et al, 1999; Lower et al, 1993; Mi et al, 2000; Rote et al, 2004) and at especially high levels, env-Fc2, a less well characterized gene (Benit et al, 2003).
  • DKO as well as Aza treated A2780 and TykNu cells, loss of env-Fc2 promoter methylation correlates with increased Fc2 expression (FIGS. 5B, 6A-C, S6A) but not in Hey cells (FIG. S6A).
  • bidirectional transcription producing sense and anti-sense transcripts occurred for Syncytin-1 and five env- Fc2 gene loci, but not ⁇ -actin, in three EOC lines and HCT 116 and DKO cells (FIG. 5C, Tables 3 and 4), analyzed by the TAG-aided sense/antisense transcript detection (TASA-TD) technique (Henke et al, 2015).
  • TASA-TD TAG-aided sense/antisense transcript detection
  • ERV transcripts seem directly involved in the Aza responses in that, first, although druginduced upregulation of ERV transcripts begins early after Aza, both ERVs and viral defense gene increases generally peak by day 7 (FIGS. 5, S5). Second, ERV env proteins such as Synl and ERV-3 are not increased after Aza treatment, supporting a dominant role for viral defense signaling via RNA transcripts (FIG. 6D, FIG. S6B, and C). Third, overexpression of ERVS, EnvW2, and Syncytin-1 in TykNu (FIG. 6e-j), A2780 (FIG. S6S), and Hey cells (FIG.
  • ER V transcripts a driving role for ER V transcripts in triggering Aza-induced viral defense gene responses is evidenced by a high correlation of basal levels of both in 19 primary EOC.
  • Viral defense gene levels divide human tumors into high and low expression groups that track with responses to immune checkpoint therapy.
  • Human cancers can evolve immune evasion to become less responsive to immune modulation (Drake et al, 2006) (Schreiber et al., 2011).
  • basal transcript levels for the Aza-induced viral defense genes group primary EOC, breast, colon, and lung cancers, and melanoma from The Cancer Genome Atlas (TCGA) studies into high and low groups (FIG. 7B, FIG. S7C-F).
  • TCGA Cancer Genome Atlas
  • this basal expression divides tumors into high, medium, and low expression groups and the former two encompass virtually all of the TCGA (Verhaak et al 2013) immune reactive (IMR), good prognosis tumors.
  • the Low group encompasses the PRO (high proliferative), poor prognosis subtype (p ⁇ 0.001 to .0001 -FIGS. 7B, S7B)).
  • CIMP DNA hypermethylation frequency phenotype
  • Aza treatment potentiates immune checkpoint therapy in a mouse model of melanoma.
  • multiple combinations of low dose Aza directly enhance tumor responses to anti-CTLA4 immune checkpoint therapy (FIGS. 7E,F, S7G).
  • B16 cells treated in vitro with Aza, then injected into mice and treated with anti- CTLA-4, are even cleared completely (data not shown).
  • DNMTis can potentiate the anti -tumor effects of immune checkpoint inhibitors.
  • DNMTis induce a complex set of immune pathway responses in tumor cells (Li et al., 2014; Wrangle et al, 2013).
  • DNMTis trigger cytoplasmic dsRNA sensing, central to cellular viral defense responses, and activate interferon in EOC and colon cancer cells by disrupting DNMTs. This activation could induce tumor attraction of lymphocytes (Ivashkiv and Donlin, 2014).
  • ERVs A major trigger of the Aza-induced viral defense response appears to be bidirectional transcription of ERVs that are known to fold into dsRNA secondary structures.
  • ERVs representing more than 8% of the human genome (Bannert and Kurth, 2004; Tristem, 2000), integrated into the genome of mammals between 0.1 and 40 million years ago via exogenous retroviral infections of germ cells (Egan et al, 2004; Turner et al, 2001).
  • ERV genes are non-functional due to DNA recombination, mutations and deletions, but some produce functional proteins including group-specific antigen (gag), polymerase (pol) with reverse transcriptase (RT) and the envelope (env) surface unit (SU) with a transmembrane immunosuppressive-like peptide (Mi et al, 2000) (Blaise et al, 2005; de Parseval et al, 2003; Villesen et al, 2004).
  • the env gene of ERVW-1 chromosome 7q21.2
  • Syncytin- 1 has an essential role in placentogenesis (Blond et al, 1999; Mi et al, 2000).
  • Syncytin-1 is epigenetically regulated throughout placentogenesis (Matouskova et al, 2006).
  • Some tumors have ERV demethylation and increased expression such as the ERV-K (HML- 2) 5'LTR-UTR in melanoma (Stengel et al, 2010) and the 5'-LTR region of several ERVs in testicular cancer (Gimenez et al., 2010).
  • HML- 2 HML- 2
  • 5'LTR-UTR in melanoma
  • Gimenez et al., 2010 A 20% overall mean demethylation of single CpGs in the ERVW-1 5' LTR regulating Syncytin-1 correlates with increased expression in endometrial cancer (Strissel et al, 2012).
  • ERVs can be targeted as tumor-associated antigens on melanoma cells (Cooper et al, 2015).
  • individual ERVs can maintain full or partial promoter DNA methylation and low expression and DNMTis can induce ERV demethylation and viral defense signaling in human embryonic stem cells (Grow et al., 2015).
  • Noncoding RNAs could contribute to the Aza-induced immune response, such as repetitive Alu elements (Tarallo et al, 2012). UV light can damage small nucleolar RNA and activate an interferon response via TLR3 (Bernard et al.,
  • Dac can induce an interferon response, apoptosis, increased ERVs and repetitive satellite RNAs in p53-null mouse fibroblasts (Leonova et al,
  • ERV-K env proteins have been shown to increase immunotherapeutic potential of melanoma, breast, and ovarian cancer patients (Rycaj et al, 2014; Wang-Johanning et al, 2012) (Cooper et al, 2015).
  • our hypotheses that drugs like Aza might sensitize patients with multiple cancer types to immune checkpoint blockade and other immunotherapies are further strengthened by the data in our pre-clinical melanoma model.
  • immune checkpoint therapy in addition to the functional significance of our data, a potential biomarker strategy is suggested by our findings in a melanoma trial.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to the field of epigenetics. More specifically, the present invention provides methods and compositions useful for predicting response to epigenetic drug therapy. As described herein, we have identified a unique signature termed EVR that differentiates patients with a low immune and high immune signature and is regulated by epigenetic drugs such as demethylating drugs, histone deacetylase inhibitors. In certain embodiments, patients with a high immune signature may benefit from immunotherapies such as anti PD1 or anti PDL1 antibodies or vaccines. In other embodiments, patients with a low immune signature or low ERV would be patients who would then benefit from treatment with epigenetic drugs and then subsequent immunotherapy.

Description

METHODS AND COMPOSITIONS FOR TREATING CANCER
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 62/190,426, filed July 9, 2015, and U.S. Provisional Application No. 62/133,713, filed March 16, 2015, both of which are incorporated herein by reference in their entireties.
STATEMENT OF GOVERNMENTAL INTEREST
This invention was made with government support under grant nos. CA058184, and CA183214, awarded by the National Institutes of Health, and grant no. BC031272, awarded by the Department of Defense. The government has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates to the field of epigenetics. More specifically, the present invention provides methods and compositions useful for predicting response to epigenetic drug therapy.
BACKGROUND OF THE INVENTION
Cancers are now recognized as being driven by widespread changes in the epigenome including changes in DNA methylation and chromatin packaging. Changes in DNA methylation include global loss of methylation and focal gain of methylation at promoter regions of tumor suppressor genes leading to transcriptional silencing. DNA methylation, the covalent modification of DNA, is mediated by a family of DNA methyltransferases
(DNMTs). In recent years, inhibitors of DNMTs (DNMTis) have emerged as therapeutic targets for treatment of myeloid malignancies as well as cutaneous T cell lymphoma. In 2004, the FDA approved the DNMT inhibitor 5-azacitidine (AZA) for treatment of myelodysplastic syndrome. Several groups, including the present inventors, have focused on the therapeutic potential of DNMT inhibitors in the treatment of solid tumors with exciting early possibilities seen in non-small cell lung cancer (NSCLC) and to reverse chemotherapy resistance in ovarian cancers.
SUMMARY OF THE INVENTION
DNA methyltransf erase inhibitors (DNMTis), such as 5-azacytidine (Aza) and 5-aza- 2' -deoxy cytidine (Dac) are increasingly being used in therapeutic strategies for cancer. They have been particularly effective in hematologic neoplasms where they are FDA approved for the pre-leukemic disorder, myelodysplasia (MDS). Despite such efficacy, the precise mechanisms accounting for the anti -tumor activities of these drugs are not certain. The major explored mode of action is their function as cytidine analogues which, when incorporated into DNA, serve as suicide inhibitors to block the catalytic actions of DNA methyltransferases (DNMTs) while also triggering degradation of these proteins. In this regard, the strongest clinical efficacy of DNMTis has emerged as doses of the drugs have actually been lowered. This may be because such doses avoid toxicities of the drugs that may be largely due to off- target effects such as global DNA damage. In fact, we have shown in pre-clinical studies that transient exposure of cancer cells to nanomolar range levels of DNMTis can avoid early cytotoxicity due to DNA damage and subsequently, after drug withdrawal, allow cells to exhibit apparent reprogramming and blunting of tumorigenicity. Candidate mechanisms for this effect include promoter DNA demethylation and re-expression of many genes, including some tumor suppressors, which are abnormally silenced in cancer. Concomitantly, there is restoration of more normal patterns for many signaling pathways in which abnormalities drive cancer initiation and progression including regulation of apoptosis, reduced cell cycle activity, and decrease in stem cell functions.
One long recognized activity of DNMTis, which we have recently extended, is induction of a complex series of coordinated signaling events that activate the innate immune response in tumor cells. This may be of particular translational importance with respect to recent clinical trials wherein low dose AZA is emerging as a potentially useful drug for non- small lung cancer (NSCLC). A small number of NSCLC patients who received AZA subsequently had remarkably robust and durable responses to the exciting new
immunotherapy approach employing immune tolerance checkpoint inhibitors. These latter approaches also have activity alone against NCSLC and a larger trial has now been initiated to determine if AZA can actually prime patients for sensitization to such checkpoint inhibition. The potential of such priming led us to a series of laboratory studies, employing the transient low-dose AZA protocol mentioned above, Tsai et al, 21 CANCER CELL 430-446 (2012), to outline mechanisms that might account for this important possibility. We have found that for NSCLC, AZA induces the interferon signaling pathway in concordance with upregulation of surface antigens and their assembly proteins, multiple proinflammatory genes, a viral defense pathway, and, at the transcript and surface protein level, the key checkpoint ligand targeted in the above immunotherapy, PD-L1. We extended
characterization of these events to three other common solid tumor types by defining a gene expression signature, encompassing some 300 transcripts that we termed AZA-Induced iMmune genes or AIM. Notably, the frequency for AIM activation was greatest for epithelial ovarian cancer and then non-small cell lung cancer (NSCLC) cells. Importantly, in genomewide expression patterns for primary tumor samples, ERV separates epithelial ovarian cancer (EOC), NSCLC, and other cancers into "high" and "low" expression groups. These results point to a broad immune stimulatory role for DNA demethylating drugs in multiple cancers.
In one aspect of the present invention, we show that a major mechanism underlying AZA triggering the above cascade of immune related events, and especially the interferon response, is induction of a cytosolic double-stranded RNA (dsRNA) sensing system that serves as a viral defense mechanism for epithelial and other cell types and can induce antitumor responses. We show that AZA activates the interferon response by upregulation of dsRNA. Moreover, a key contributor to the induction of the dsRNA interferon response is increased sense and antisense transcript expression of multiple DNA hypermethylated human endogenous retroviruses (ERVs). We thus define a key way in which AZA and related epigenetic therapy agents may sensitize cancer cells to various immunotherapies and be part of a tumor suppressor-like response.
In certain embodiments, we demonstrate that patients with low expression of ERVs would benefit from epigenetic therapy when combined with immunotherapy.
As described herein, we have identified a unique signature termed "ERV-High" or "ERV-Low" that differentiates patients with a low immune and high immune signature and is regulated by epigenetic drugs such as demethylating drugs, histone deacetylase inhibitors. In certain embodiments, patients with a high immune signature may benefit from
immunotherapies such as anti PD1 or anti PDL1 antibodies or vaccines. In other
embodiments, patients with a low immune signature or low ERV would be patients who would then benefit from treatment with epigenetic drugs and then subsequent
immunotherapy.
Immunotherapy is emerging as one of the most exciting modality in solid tumors with recent identification of use of checkpoint therapy for melanomas, selected lung and renal cancers. However, most solid cancers do not respond to immunotherapy. At present, common solid cancers such as colorectal, breast and ovarian cancers are not thought to be typically as immune responsive cancers. We have now shown that these cancers can have an immune rich signature and others that are low in immune signal. Cancers that are high in this immune signature termed "ERV-High" would be candidates for immunotherapy. In addition, we have shown that cancers that are low in this immune signature termed "ERV-Low" would benefit from epigenetic drugs especially demethylating drugs, but also histone deacetylase inhibitors in increasing their immune stimulation and then treating with immunotherapy to treat these cancers. Currently there is little knowledge of immune signatures specific to cancers. Our work is novel in that it identifies epithelial cancer cells are involved in immune signaling, and this immune signature is regulated by epigenetic drugs. Provided herein is a panel of ERV transcripts that identifies patients who have a high immune signature termed "ERV -High" who would benefit from immunotherapy for their cancers. Also provided herein is a panel of ERV transcripts that identifies patients who have a low immune signature termed "ERV- Low" who would benefit from epigenetic therapy followed by immunotherapy for their cancer.
The present invention provides a panel termed "ERV," a panel based on ERV expression in ovarian cancer. Patients are either low or high in this panel. Thus, in certain embodiments, the baseline ERV panel can be used as a prognostic panel, for example, patients with high ERV expression may have better survival than patients with low ERV expression. In other embodiments, the baseline ERV panel can also be used to stratify patients who may benefit from epigenetic therapy. For example, patients with low ERV panel baseline may benefit from epigenetic therapy and/or immunotherapy and/or chemotherapy whereas patients with high ERV panel may do well with immunotherapy alone. In further embodiments, patients with a change in ERV panel may be the ones who are responding to therapy.
One skilled in the art can readily classify expression as high, intermediate or low using the disclosure described herein. For example, after measuring the expression levels by qRT-PCR of a panel of 10 ERVs in a group of patients, for example 20 patients, we could have a matrix of gene expression; 20 patients with expression information on 10 ERVs each. We could then add up the ERV expression for each patient (combining all 10 genes). Then, we would add up this score for all 20 patients and divide it by 20 to create an "average ERV expression score" for this patient group. To define "high" versus "low" ERV scores, we would divide the score for each patient by the average; those above the average would be in the "high" group and those below the average would be in the "low" group. To further define three different subsets, such as "low", "medium", and "high", ERV expression scores for 20 patients would be divided into three equal groups, with the lowest in the "low" group, then the "medium" group, then the "high" group. There would be no comparison to the average for this subsetting. In other embodiments, after compiling expression data on ERVs from patient studies (those who benefited from epigenetic therapy plus immunotherapy, etc.), a baseline expression for the ERVs can be established and used as an index or standard against which ERV expression data from subsequent patient could be compared. Accordingly, in one embodiment, the present invention provides a method for treating a patient having cancer comprising the steps of (a) obtaining a biological sample from the patient; (b) generating ERV expression data from the biological sample; (c) classifying the ERV expression data from the biological sample as ERV high or low based on a comparison to a control or reference; and (d) treating the cancer patient with immunotherapy if the ERV expression data from the biological sample is classified as ERV high or treating the cancer patient with epigenetic therapy followed by immunotherapy if the ERV expression data from the biological sample is classified as ERV low.
In certain embodiments, the epigenetic therapy comprises treatment with a DNA methyltransferase inhibitor (e.g., 5-azacitidine) and/or a histone deactytelase inhibitor (HDACi). Examples of DNMTi also include 5-aza-2'-deoxycytidine (Dac or decitabine); SGI-110 (Aztex); 5,6-dihydro-5-azacytidine; 5-fluoro-2'-deoxycytidine; zebularine.
Examples of HDACi include, but are not limited to, vorinostat, romidepsin, panobinostat (LBH589), valproic acid, belinostat (PXD101), mocetinostat (MGCD0103), abexinostat (PCI-24781), SB989, entinostat (MS0275), resminostat (4SC-201), givinostat (IF2357), quisinostat (JNJ-26481585), CUDC-101, AR-42, CHR-2845, CHR-3996, 4SC-202,
CG200745, ACY-1215, ME-344, sulforaphane, and kevetrin. In other embodiments, the immunotherapy comprises treatment with anti PD1 (e.g., Nivolumab) or anti PDL1 antibodies or vaccines. Therapies can also include, but are not limited to, anti EGFR antibodies (e.g., Matuzumab), alemtuzumab (Campeth-1H), bevacizumab (Avastin), brentuximab vedotin, cetuximab (Erbitux), gemtuzumab ozogamicin, ibritumomab tiuxetan (Zevalin), ipilimumab (Yervoy), nimotuzumab, ofatumumab, panitumumab (Vectibix), rituximab, tositumomab, and trastuzumab.
In a specific embodiment, a method for treating cancer in a patient comprises the step of administering epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference. In another embodiment, a method for treating cancer in a patient comprises the step of administering immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference. In a further embodiment, a method for treating cancer in a patient comprises the steps of (a) administering epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference; or (b) administering immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
In one embodiment, a method comprises the step of prescribing epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference. In another embodiment, a method comprises the step of prescribing immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference. In a further embodiment, a method comprises the steps of (a) prescribing epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference; or (b) prescribing immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
In yet another embodiment, a method comprises the steps of (a) ordering a diagnostic test that assays gene expression from a biological sample obtained from a patient and classifies the gene expression data from the biological sample as high or low ERV based on a comparison to a control or reference; and (b) administering or prescribing epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference. In an alternative embodiment, a method comprises the steps of (a) ordering a diagnostic test that assays gene expression from a biological sample obtained from a patient and classifies the gene expression data from the biological sample as high or low ERV based on a comparison to a control or reference; and (b) administering or prescribing immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference. In a further embodiment, a method comprises the steps of (a) ordering a diagnostic test that assays gene expression from a biological sample obtained from a patient and classifies the gene expression data from the biological sample as high or low ERV based on a comparison to a control or reference; and (b) administering or prescribing either (i) epigenetic therapy followed by immunotherapy to a patient classified as having a low ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference or (ii) administering or prescribing immunotherapy to a patient classified as having a high ERV signature based on a comparison of gene expression data generated from a biological sample obtained from the patient to a control or reference.
In a specific embodiment, the biological sample is a solid tumor sample. In another embodiment, the cancer is ovarian. In yet another embodiment, the cancer is colorectal, breast, melanoma or lung cancer. In a more specific embodiment, the lung cancer is non- small cell lung cancer (NSCLC). In particular embodiments, the cancer is a carcinoma. In certain embodiments, the ERV expression data is generated using polymerase chain reaction (PCR). In a specific embodiment, the PCR is qRT-PCR. In certain embodiments, the ERV expression data is generated using one or more primers from Table 1.
In one embodiment, the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, ERVV-1, ERVV-2, ERVS71-1, ERVPABLB-1, HERV-K74261, HML- 2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVH-1, ERVH-2, ERVH-3, ERVE4-1, ERVFcl, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVMER34-1, ERVH48-1, ERV9-1, ERV-F(XA34), and ERVW-5. In another embodiment, the ERV panel comprises one or more of the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV- K102, ERVE4-1, ERVH-1, ERVH-2, ERVH-3, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVW-5, ERVH48-1 and ERV9-1. In a further embodiment, the ERV panel comprises one or more of ERVW-1, ERVP(b), ERV-3, ERVFcl, ERV-Fbl, and ERV9-1.
In a further embodiment, the present invention provides a method for treating a patient having cancer comprising the steps of (a) obtaining a biological sample from the patient; (b) generating ERV expression data from the biological sample; (c) classifying the ERV expression data from the biological sample as ERV high or low based on a comparison to a control or reference; and (d) treating the cancer patient with immunotherapy if the ERV expression data from the biological sample is classified as ERV high or treating the cancer patient with epigenetic therapy such as a DNA methyltransf erase inhibitor and/or a histone deacetylase inhibitor followed by immunotherapy if the ERV expression data from the biological sample is classified as ERV low. In other embodiments, the cancer patient can be treated with chemotherapy if the ERV expression data from the biological sample is classified as ERV high. In another embodiment, the present invention provides a method for treating a patient having cancer comprising the steps of (a) obtaining a biological sample from the patient; (b) generating ERV expression data from the biological sample; (c) classifying the ERV expression data from the biological sample as ERV high or low based on a comparison to a control or reference; and (d) treating the cancer patient with immunotherapy such as anti PDl or anti PDLl antibodies or vaccines if the ERV expression data from the biological sample is classified as ERV high or treating the cancer patient with epigenetic therapy followed by immunotherapy such as anti PDl or anti PDLl antibodies or vaccines if the ERV expression data from the biological sample is classified as ERV low. The methods can also comprise generating ERV expression data and indicating or recommending a treatment approach.
In the treatment methods of the present invention, a low dose of DNMTi can be used, i.e., a lower dose than what it typically prescribed for patient. Lower doses can be more effective and less toxic in cancer. See Issa, J.P., 2 NATURE CLIN. PRACTICE ONCOLOGY S24- 239 (2005). In particular embodiments, the low dose for Aza is about 10-85 mg/m2. In more specific embodiments, the low dose of Aza is about 10-85 mg/m2, 15-80 mg/m2, 20-80 mg/m2, 20-75 mg/m2, 25-80 mg/m2, 25-75 mg/m2, and so forth. In other embodiments, the low dose for Dac is about 5-85 mg/m2. In more specific embodiments, the low dose of Dac is about 5-80 mg/m2, 10-75 mg/m2, 10-80 mg/m2, 15-80 mg/m2, 15-75 mg/m2, and so forth.
Immunotherapy can be administered at typical levels. For example, doses of anti- CTLA-4 (ipilimumab/Y ervoy/BMS) are as follows: 1 mg/kg by vein every 6 weeks. Doses of anti-PD-1 (pembrolizumab/MK3475) are as follows: 200 mg, every 3 weeks. In a specific embodiment, patients receiving epigenetic therapy and immunotherapy can be treated as follows: zacitidine 40 mg/m2, subcutaneous days 1-6, 8-10 + Entinostat 8 mg Oral Days 3 & 10 for 28 Days times 2 cycles followed by Nivolumab 3 mg/kg every 2 weeks until progression. One of ordinary skill in the art can adjust to achieve optimal effectiveness.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1. DNMT inhibitors upregulate immune genes in ovarian cancer cell lines. A) Levels of immune genes in four EOC cell lines and DKO colon cancer cell line (DNMTI-/-, DNMT3B-/-) relative to its parental HCT116 line. Y-axis=log2 Aza/Mock fold change from microarray data. Dotted line denotes twofold change. B) qRT-PCR validation of immune genes in EOC cells treated for 72 hours: Mock, 500 nM Aza, or 500 nM- 3 μΜ carboplatin and rested for 7 days before assaying (Day 10). IC50s: A2780 (Aza=848 nM, Carb=457 nM), Hey (Aza=4.1 μΜ, Carb=12.2 μΜ), TykNu (Aza=491 nM, Carb=986.2 nM). C-D) qRT-PCR validation of interferon response genes in the A2780 (C) and TykNu (D) EOC lines treated with no drug (Mock), 500 nM Aza (Aza), or 100 nM Decitabine (Dac) for 3 days, and rested for 4 (Day 7) or 7 (Day 10) days before assaying. Y-axis=fold change over mock. Data in B-D are represented as mean +/- S.E.M of 3 biological replicates. *=p<0.05. See also FIG. SI .
FIG. 2. DNMTis upregulate immune signaling through secreted interferon. A) Schematic of interferon pathway. Protein symbols outlined in text. B) Treatment of recipient A2780 or TykNu cells with media from cells treated with Mock or Aza, +/- addition of anti- IFNp. Y-axis=qRT-PCR fold Aza/Mock of ISGs. *=p<0.05 and Λ=p<0.05, respectively, for Mock or Aza media with versus without anti-IFNp versus Mock or Aza media plus anti-IFNp ; C) ELISA of IFNpin media from TykNu cells at Day 10 from studies in B. D) Treatment of EOC cells with Aza as in FIG. 1C,D, but in the presence of 2 μΜ Ruxolitinib (Rux). qRT- PCR fold changes for ISGs. *=p<0.05 for fold Aza over Mock and Λ=ρ<0.05, Mock or Aza versus Mock + Rux or Aza + Rux. Data=mean +/- S.E.M. of three (B, D) or four (C) biological replicates. See also FIG. S2.
FIG. 3. Aza induces immune signaling through dsRNA activation of secreted interferon. A) Blocking IFNAR2 (aIFNAR2) or B) IFNP in TykNu cells treated vs. non- treated with Aza as in FIGS. 1C,D; parentheses=U/mL of antibody. Y-axis=qRT-PCR for ISGs. *=p<0.05 for A), Mock or Aza - anti-IFNAR2 versus + anti-IFNAR2, B) Mock or Aza with no anti-IFNp versus with anti-IFNp. C) Immunoblotting for cleaved PARP with β-actin loading control. Fold change shown for cleaved/total PARP ratio, normalized to β-actin for each dose of anti-IFNAR2 (triangles=0- 1.25 U/mL). Aza compared to Mock=l . D,E) Indicated nucleic acids from the cytoplasm of A2780 or TykNu treated cells with no drug (Mock) or 500 nM Aza (Aza) for 3 days and rested without drug for 4 days before transfection into recipient HT29 cells. Y-axis=fold change, Aza/Mock, for ΙΡΝβΙ transcript (D) or ISG transcripts (E) induced in HT29s. No Tx=no transfection, Cyto
DNA=Cytoplasmic DNA, Cyto RNA=Cytoplasmic RNA excluding ribosomal RNA.
*=p<0.05 for D) fold change Aza vs Mock, E) Aza / Mock. Data in A,B,D,E is mean +/- S.E.M. of three biological replicates. See also FIG. S3.
FIG. 4. Aza activates dsRNA sensors to induce interferon signaling. A) Effects on ΙΕΝβΙ transcripts, at 24 hours, in HT29 recipient cells transfected with nucleic acid fractions, treated with RNaselll, from A2780 as in FIG. 3d,e. IFNβ1 transcripts were measured at 24 hours. *=p<0.05 for fold change over untreated; Λ=ρ<0.05 for Mock or Aza + versus - RNAselll. B) Westem blots for MDA5, RIG-I, and TLR3 in A2780 cells at four (Day 7) and seven (Day 10) days after Mock vs 500 nM Aza (Aza) for 3 days. C) Knockdown upon lentiviral infection, with puromycin selection, of A2780 and TykNu with shGFP, shTLR3, and shSTING hairpins. Immunoblotting with anti-TLR3, anti-STING and anti-β-actin.
Densitometry fold change, normalized to mock or shGFP, shown at the bottom of the gels. D) q-RT-PCR for ISGs from B and C. *=p<0.05 Aza over Mock; Λ=ρ<0.05 shGFP versus each shRNA sensor with mean fold change +/- S.E.M. of three biological replicates. See also FIG. S4.
FIG. 5. Aza upregulates sense and antisense ERV transcripts. RNA was isolated from cells at last (Day 3), one (Day 4), three (Day 7) and seven (Day 10) days after Mock or 500 nM Aza (Aza) for 3 days. A) Total number of molecules for all ERV genes; error bars=S.E.M for 4 independent experiments. Numbers above bars=significant data for indicated days. Gray=Mock, Black=Aza. B) qRT-PCR of ERV genes in A2780 cells for 4 independent experiments. Y-axis= fold increases for Aza/Mock +/- S.E.M and normalized to Mock=l. White bars=nonsignificant and colored bars=significant ERV gene induction (p<0.05). C) TASA-TD PCR amplified sense and antisense transcripts of the env-Fc2 (731 bp) and Syncytin-1 (202 bp) genes from first strand cDNA. Aza treated A2780, Hey, and TykNu, and HCT116 and DKO cells are indicated. Ratios of sense (s) and antisense (as) determined by ImageJ. PCR primers=gene specific (GS); TAG. β-actin sense 399 bp amplification product=negative control for as transcripts (Chen et al., 2004). See also FIG. S5.
FIG. 6. Aza upregulates ERV transcripts, but not proteins, through DNA
demethylation. A) env-Fc2 and erv-9-1 ERV gene total number of molecules, assayed by qRT-PCR, for DKO (DNMT1-/-, DNMT3B-/-) and parental HCT116 cells. Y-axis=mean +/- SEM for n=6 biological replicates. *=p<0.05 for DKO versus HCT116. B) DNA
methylation changes in ERVs in A2780 cells treated with Mock or 500 nM Aza for 3 days at post-treatment day 4 (Day 7), or 7 (Day 10). Bisulfite treated DNA was amplified and digested with the Acil enzyme producing 155 and 44 bp fragments of methylated DNA while unmethylated DNA does not digest (189 bp fragment). "U"=unmethylated band,
"M"=methylated band. C) DNA from B) was subjected to Methylationspecific PCR for Fc2 family members on chromosomes 7 and 11. U"=unmethylated, "M"=methylated. IVD=z>? vitro methylated DNA. D) Syncytin-1 and ERV-3 protein levels in EOC cells treated as in B). Fold change for densitometry by ImageJ for Aza vs Mock cells normalized to β-actin protein levels E) Transfection of full-length env genes from EnvW2, ERV-3, or Syncytin-1 or EGFP and ER controls in TykNu cells. qRT-PCR was performed for ISGs 7 days after transfection. Dotted black line indicates 1. Y-axis=mean +/- S.E.M fold change of three biological replicates for overexpression/ Mock. *=p<0.05. See also FIG. S6.
FIG. 7. Aza-upregulated viral defense genes are significantly correlated with ERVs in primary tumors and correlate with sensitivity to immune therapy. A) Heatmap comparing basal levels of viral defense genes and ERVs in primary EOC. The cut-off for lower or higher ERVs was the mean control tissue value of 237.57 +/- 83.05 molecules/ng RNA. Mean ISGs of the high ERV ovarian tumor (T) cohort (n=10) is 12.65-fold higher than the mean of ISGs of the low ERV cohort (n=9). The (*) denotes that 8 of 10 high ERV tumors had significantly higher ISG expression compared to the low ERV tumors. ISG expression is organized according to low and high ERV expression cohorts in arbitrary units; color code from blue to red shows increasing ISG expression. For clusters (k=6), differences are significant between the high ERV expression (2.5 +/- 0.37) and the low ERV expression cohort (5.33 +/- 0.28). B) Interferon stimulated, viral defense genes upregulated at least twofold by Aza in EOC cell lines (right y-axis) were used to cluster EOC tumors for RNA- Seq data (blue=low; red=high) from The Cancer Genome Atlas (TCGA). EOC TCGA subtypes are shown: DIF (differentiated), IMR (immune reactive), MES (mesenchymal), and PRO (proliferative) C), D) Viral defense gene signature is upregulated in tumors from anti- CTLA-4 treated metastatic melanoma patients who derived durable clinical benefit (complete response, partial response, or progression free-survival > 6 months as previously described (Snyder et al, 2014)) compared to those without benefit. Tumors collected pre-CTLA-4 treatment and shortly post-treatment are shown. E), F) Tumor responses of mice injected with B16-F10 cells and treated with either PBS, anti-CTLA-4, Aza, or both anti-CTLA-4 and Aza. Data represent results from one of two independent experiments with identical results, each with n=10 per arm.
DETAILED DESCRIPTION OF THE INVENTION
It is understood that the present invention is not limited to the particular methods and components, etc., described herein, as these may vary. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a "protein" is a reference to one or more proteins, and includes equivalents thereof known to those skilled in the art and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Specific methods, devices, and materials are described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
All publications cited herein are hereby incorporated by reference including all journal articles, books, manuals, published patent applications, and issued patents. In addition, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided. The definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention.
I. Definitions
As used herein, the term "antibody" is used in reference to any immunoglobulin molecule that reacts with a specific antigen. It is intended that the term encompass any immunoglobulin (e.g., IgG, IgM, IgA, IgE, IgD, etc.) obtained from any source (e.g., humans, rodents, non-human primates, caprines, bovines, equines, ovines, etc.). Specific
types/examples of antibodies include polyclonal, monoclonal, humanized, chimeric, human, or otherwise-human-suitable antibodies. "Antibodies" also includes any fragment or derivative of any of the herein described antibodies.
As used herein, the term "antigen" is generally used in reference to any substance that is capable of reacting with an antibody. More specifically, as used herein, the term "antigen" refers to a biomarker described herein. An antigen can also refer to a synthetic peptide, polypeptide, protein or fragment of a polypeptide or protein, or other molecule which elicits an antibody response in a subject, or is recognized and bound by an antibody.
As used herein, the term "biomarker" refers to a molecule that is associated either quantitatively or qualitatively with a biological change. Examples of biomarkers include polynucleotides, such as a gene product, RNA or RNA fragment; proteins, polypeptides, and fragments of a polypeptide or protein. In certain embodiments, a "biomarker" means a molecule/compound that is differentially present (i.e., increased or decreased) in a biological sample as measured/compared against the same marker in another biological sample or control/reference. In other embodiments, a biomarker can be differentially present in a biological sample as measured/compared against the other markers in same or another biological sample or control/reference. In further embodiments, one or more biomarkers can be differentially present in a biological sample as measured/compared against other markers in the same or another biological sample or control/reference and against the same markers in another biological sample or control/reference. In yet another embodiment, a biomarker can be differentially present in a biological sample from a subj ect or a group of subjects having a first phenotype (e.g., having a disease or condition) as compared to a biological sample from a subject or group of subjects having a second phenotype (e.g., not having the disease or condition or having a less severe version of the disease or condition).
In general, the one or more biomarkers can be generally present at a level that is increased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 100%, by at least 110%, by at least 120%, by at least 130%, by at least 140%, by at least 150%, or more; or is generally present at a level that is decreased by at least 5%, by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, or by 100% (i.e., absent). A biomarker is preferably differentially present at a level that is statistically significant (e.g., a p-value less than 0.05 and/or a q-value of less than 0.10 as determined using, for example, either Welch's T-test or Wilcoxon's rank-sum Test). Biomarker levels can be used in conjunction with other parameters to assess a patient.
As used herein, the term "cancer" means a type of hyperproliferative disease that includes a malignancy characterized by deregulated or uncontrolled cell growth. Cancers of virtually every tissue are known. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers are noted below and include squamous cell cancer (e.g., epithelial squamous cell cancer), lung cancer (including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung), cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer, uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, thyroid cancer, hepatic carcinoma, as well as head and neck cancer. The term "cancer" includes primary malignant cells or tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
The term "cancer," is encompassed within the scope of the broader term "abnormal cellular proliferation, which can also be referred to as "excessive cellular proliferation or "cellular proliferative disease." Examples of diseases associated abnormal cellular proliferation include metastatic tumors, malignant tumors, benign tumors, cancers, precancers, hyperplasias, warts, and polyps, as well as non-cancerous conditions such as benign melanomas, benign chondroma, benign prostatic hyperplasia, moles, dysplastic nevi, dysplasia, hyperplasias, and other cellular growths occurring within the epidermal layers. Classes of precancers include acquired small or microscopic precancers, acquired large lesions with nuclear atypia, precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer, and acquired diffuse hyperplasias and diffuse metaplasias. Examples of small or microscopic precancers include HGSIL (high grade squamous intraepithelial lesion of uterine cervix), AIN (anal intraepithelial neoplasia), dysplasia of vocal cord, aberrant crypts (of colon), PIN (prostatic intraepithelial neoplasia). Examples of acquired large lesions with nuclear atypia include tubular adenoma, AILD
(angioimmunoblastic lymphadenopathy with dysproteinemia), atypical meningioma, gastric polyp, large plaque parapsoriasis, myelodysplasia, papillary transitional cell carcinoma in- situ, refractory anemia with excess blasts, and Schneiderian papilloma. It is understood that the methods and compositions of the present invention are applicable to cancer generally.
As used herein, the term "comparing" refers to making an assessment of how the proportion, level or cellular localization of one or more biomarkers in a sample from a patient relates to the proportion, level or cellular localization of the corresponding one or more biomarkers in a standard, reference or control sample. For example, "comparing" may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, or different from the proportion, level, or cellular localization of the corresponding one or more biomarkers in standard, reference or control sample. In particular embodiments, the term may refer to assessing whether the proportion, level, or cellular localization of one or more biomarkers in a sample from a patient is the same as, more or less than, different from or otherwise corresponds (or not) to the proportion, level, or cellular localization of predefined biomarker levels/ratios that correspond to, for example, high or low ERV level. In another specific embodiment, the term "comparing" refers to assessing whether the level of one or more biomarkers of the present invention in a sample from a patient is the same as, more or less than, different from other otherwise correspond (or not) to levels/ratios of the same biomarkers in a control sample (e.g., predefined levels/ratios that correlate to high or low ERV levels).
In another embodiment, the term "comparing" refers to making an assessment of how the proportion, level or cellular localization of one or more biomarkers in a sample from a patient relates to the proportion, level or cellular localization of one or more biomarkers in the same sample. For example, a ratio of one biomarker to another (or more) from the same patient sample can be compared. Percentages or ratios of expression or levels of the biomarkers can be compared to other percentages or ratios in the same sample and/or to predefined reference or control percentages or ratios. Such comparison can be made to assess whether the patient's immune signature is ERV -high or ERV -low, which assessment can be used to direct therapy.
In embodiments in which the relationship of the biomarkers are described in terms of a ratio, the ratio can include 1 -fold, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11 -, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-, 21 -, 22-, 23-, 24-, 25-, 26-, 27-, 28-, 29-, 30-, 31 -, 32-, 33-, 34-, 35-, 36-, 37-, 38-, 39-, 40-, 41 -, 42-, 43-, 44-, 45-, 46-, 47-, 48-, 49-, 50-, 51 -, 52-, 53-, 54-, 55-, 56-, 57-, 58-, 59-, 60-, 61 -, 62-, 63-, 64-, 65-, 66-, 67-, 68-, 69-, 70-, 71-, 72-, 73-, 74-, 75-, 76-, 77-, 78-, 79-, 80-, 81 -, 82-, 83-, 84-, 85-, 86-, 87-, 88-, 89-, 90-, 91 -, 92-, 93-, 94-, 95-, 96-, 97-, 98-, 99-, 100-fold or more difference (higher or lower). Alternatively, the difference can include 0.9-fold, 0.8-fold, 0.7-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, and 0.1 -fold (higher or lower) depending on context. The foregoing can also be expressed in terms of a range (e.g., 1 -5 fold/times higher or lower) or a threshold (e.g., at least 2-fold/times higher or lower).
The evaluation of the relationship between one or more biomarkers in a sample (e.g., one or more biomarkers compared to one or more other biomarkers (perhaps in combination with internal standards expression or levels (e.g., actin)) can also be expressed in terms of a percentage including, but not limited to, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 150%, 200% or more (higher or lower) difference. The foregoing can also be expressed in terms of a range (e.g., 50-100% higher or lower) or a threshold (e.g., at least 50% higher or lower) As used herein, the terms "identifies," "indicates" or "correlates" (or "identifying," "indicating" or "correlating," or "identification," "indication" or "correlation," depending on the context) in reference to a parameter, e.g., a modulated proportion, level, or cellular localization in a sample from a patient, may mean that the patient has a particular immune signature, e.g., ERV high or ERV low. In specific embodiments, the parameter may comprise the level (expression level or protein level) of one or more biomarkers of the present invention. A particular set or pattern of the amounts of one or more biomarkers may identify the patient as having a particular immune signature, e.g., ERV high or ERV low
In certain embodiments, "identifying," "indicating," or "correlating," as used according to the present invention, may be by any linear or non-linear method of quantifying the relationship between levels/ratios of biomarkers to other biomarkers and/or standard, control or comparative value for the assessment of an immune signature.
The terms "patient," "individual," or "subject" are used interchangeably herein, and refer to a mammal, particularly, a human. The patient may have mild, intermediate or severe disease. The patient may be treatment naive, responding to any form of treatment, or refractory. The patient may be an individual in need of treatment or in need of diagnosis based on particular symptoms or family history. In some cases, the terms may refer to treatment in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; and primates.
The terms "measuring" and "determining" are used interchangeably throughout, and refer to methods which include obtaining a patient sample and/or detecting the level of a biomarker(s) in a sample. In one embodiment, the terms refer to obtaining a patient sample and detecting the level of one or more biomarkers in the sample. In another embodiment, the terms "measuring" and "determining" mean detecting the level of one or more biomarkers in a patient sample. Measuring can be accomplished by methods known in the art and those further described herein. The terms are also used interchangeably throughout with the term "detecting."
The terms "sample," "patient sample," "biological sample," and the like, encompass a variety of sample types obtained from a patient, individual, or subject and can be used in a diagnostic or monitoring assay. The patient sample may be obtained from a healthy subject, a diseased patient or a patient having associated symptoms of cancer. Moreover, a sample obtained from a patient can be divided and only a portion may be used for diagnosis. Further, the sample, or a portion thereof, can be stored under conditions to maintain sample for later analysis. The definition specifically encompasses solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. In other embodiments, the term sample includes blood and other liquid samples of biological origin (including, but not limited to, peripheral blood, serum, plasma, cerebrospinal fluid, urine, saliva, stool and synovial fluid). In a specific embodiment, a sample comprises a tumor sample.
The definition of "sample" also includes samples that have been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations. The terms further encompass a clinical sample, and also include cells in culture, cell supernatants, tissue samples, organs, and the like. Samples may also comprise fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by
immunohistochemistry. In certain embodiments, a sample comprises an optimal cutting temperature (OCT)-embedded frozen tissue sample.
As used herein, the term "predetermined threshold value" of a biomarker refers to the level of the same biomarker in a corresponding control/normal sample or group of control/normal samples. Further, the term "altered level" of a biomarker in a sample refers to a level that is either below or above the predetermined threshold value for the same biomarker and thus encompasses either high (increased) or low (decreased) levels.
As used herein, the terms "binding agent specific for" or "binding agent that specifically binds" refers to an agent that binds to a biomarker and does not significantly bind to unrelated compounds. Examples of binding agents that can be effectively employed in the disclosed methods include, but are not limited to, lectins, proteins and antibodies, such as monoclonal or polyclonal antibodies, or antigen-binding fragments thereof, aptamers, etc. In certain embodiments, a binding agent binds a biomarker with an affinity constant of, for example, greater than or equal to about lxl 0-6 M. A binding agent can also comprise a probe or primer that specifically hybridizes a biomarker nucleic acid.
The terms "specifically binds to," "specific for," and related grammatical variants refer to that binding which occurs between such paired species as enzyme/substrate, receptor/agonist, antibody/antigen, nucleic acid/complement and lectin/carbohydrate which may be mediated by covalent or non-covalent interactions or a combination of covalent and non-covalent interactions. When the interaction of the two species produces a non-covalently bound complex, the binding which occurs is typically electrostatic, hydrogen- bonding, or the result of lipophilic interactions. Accordingly, "specific binding" occurs between a paired species where there is interaction between the two which produces a bound complex having the characteristics of an antibody/antigen or enzyme/substrate interaction. In particular, the specific binding is characterized by the binding of one member of a pair to a particular species and to no other species within the family of compounds to which the corresponding member of the binding member belongs. Thus, for example, an antibody typically binds to a single epitope and to no other epitope within the family of proteins.
In some embodiments, specific binding between an antigen and an antibody will have a binding affinity of at least 10-6 M. In other embodiments, the antigen and antibody will bind with affinities of at least 10-7 M, 10-8 M to 10-9 M, 10-10 M, 10-11 M, or 10-12 M.
Various methodologies of the instant invention include a step that involves comparing a value, level, feature, characteristic, property, etc. to a "suitable control," referred to interchangeably herein as an "appropriate control," a "control sample" or a "reference." A "suitable control," "appropriate control," "control sample" or a "reference" is any control or standard familiar to one of ordinary skill in the art useful for comparison purposes. In one embodiment, a "suitable control" or "appropriate control" is a value, level, feature, characteristic, property, etc., determined in a cell, organ, or patient, e.g., a control cell, organ, or patient, exhibiting, for example, a particular immune signature. In another embodiment, a "suitable control" or "appropriate control" is a value, level, feature, characteristic, property, ratio, etc. (e.g., biomarker levels that correlate to a particular immune signature) determined prior to performing a therapy (e.g., cancer treatment) on a patient. In yet another
embodiment, a transcription rate, mRNA level, translation rate, protein level/ratio, biological activity, cellular characteristic or property, genotype, phenotype, etc., can be determined prior to, during, or after administering a therapy into a cell, organ, or patient. In a further embodiment, a "suitable control," "appropriate control" or a "reference" is a predefined value, level, feature, characteristic, property, ratio, etc. A "suitable control" can be a profile or pattern of levels/ratios of one or more biomarkers of the present invention that correlates to a particular immune signature, to which a patient sample can be compared. The patient sample can also be compared to a negative control. Such reference levels may also be tailored to specific techniques that are used to measure levels of biomarkers in biological samples (e.g., LC-MS, GC-MS, ELISA, PCR, etc.), where the levels of biomarkers may differ based on the specific technique that is used. In particular embodiments, a control or reference can be a profile or pattern of levels of one or more biomarkers that correlates to a particular immune signature, e.g., ERV high or ERV low. II. Methods to Measure the Level of Target Biomarker Nucleic Acids
Many methods of measuring the levels or amounts of biomarker nucleic acid expression are contemplated. Any reliable, sensitive, and specific method can be used. In particular embodiments, biomarker nucleic acid is amplified prior to measurement. In other embodiments, the level of biomarker nucleic acid is measured during the amplification process. In still other methods, the target nucleic acid is not amplified prior to measurement.
A. Amplification Reactions
Many methods exist for amplifying nucleic acid sequences. Suitable nucleic acid polymerization and amplification techniques include reverse transcription (RT), polymerase chain reaction (PCR), real-time PCR (quantitative PCR (q-PCR)), nucleic acid sequence-base amplification (NASBA), ligase chain reaction, multiplex ligatable probe amplification, invader technology (Third Wave), rolling circle amplification, in vitro transcription (IVT), strand displacement amplification, transcription-mediated amplification (TMA), RNA (Eberwine) amplification, and other methods that are known to persons skilled in the art. In certain embodiments, more than one amplification method is used, such as reverse transcription followed by real time quantitative PCR (qRT-PCR). See, e.g., Chen et al, 33(20) NUCL. ACIDS RES. el 79 (2005).
A typical PCR reaction comprises multiple amplification steps or cycles that selectively amplify target nucleic acid species including a denaturing step in which a target nucleic acid is denatured; an annealing step in which a set of PCR primers (forward and reverse primers) anneal to complementary DNA strands; and an extension step in which a thermostable DNA polymerase extends the primers. By repeating these steps multiple times, a DNA fragment is amplified to produce an amplicon, corresponding to the target DNA sequence. Typical PCR reactions include about 20 or more cycles of denaturation, annealing, and extension. In many cases, the annealing and extension steps can be performed concurrently, in which case the cycle contains only two steps. Because mature mRNA are single-stranded, a reverse transcription reaction (which produces a complementary cDNA sequence) may be performed prior to PCR reactions. Reverse transcription reactions include the use of, e.g., a RNA-based DNA polymerase (reverse transcriptase) and a primer.
In PCR and q-PCR methods, for example, a set of primers is used for each target sequence. In certain embodiments, the lengths of the primers depends on many factors, including, but not limited to, the desired hybridization temperature between the primers, the target nucleic acid sequence, and the complexity of the different target nucleic acid sequences to be amplified. In certain embodiments, a primer is about 15 to about 35 nucleotides in length. In other embodiments, a primer is equal to or fewer than about 15, fewer than about 20, fewer than about 25, fewer than about 30, or fewer than about 35 nucleotides in length. In additional embodiments, a primer is at least about 35 nucleotides in length.
In a further embodiment, a forward primer can comprise at least one sequence that anneals to biomarker nucleic acid sequence and alternatively can comprise an additional 5' non-complementary region. In another embodiment, a reverse primer can be designed to anneal to the complement of a reverse transcribed mRNA. The reverse primer may be independent of the biomarker nucleic acid sequence, and multiple biomarker nucleic acid sequences may be amplified using the same reverse primer. Alternatively, a reverse primer may be specific for a biomarker nucleic acid.
In some embodiments, two or more biomarker nucleic acid sequences are amplified in a single reaction volume. One aspect includes multiplex q-PCR, such as qRT-PCR, which enables simultaneous amplification and quantification of at least two biomarker nucleic acid sequences of interest in one reaction volume by using more than one pair of primers and/or more than one probe. The primer pairs comprise at least one amplification primer that uniquely binds each mRNA, and the probes are labeled such that they are distinguishable from one another, thus allowing simultaneous quantification of multiple biomarker nucleic acid sequences. Multiplex qRT-PCR has research and diagnostic uses including, but not limited, to detection of biomarker nucleic acid sequences for diagnostic, prognostic, and therapeutic applications.
The qRT-PCR reaction may further be combined with the reverse transcription reaction by including both a reverse transcriptase and a DNA-based thermostable DNA polymerase. When two polymerases are used, a "hot start" approach may be used to maximize assay performance. See U.S. Patents No. 5,985,619 and No. 5,411,876. For example, the components for a reverse transcriptase reaction and a PCR reaction may be sequestered using one or more thermoactivation methods or chemical alteration to improve polymerization efficiency. See U.S. Patents No. 6,403,341 ; No. 5,550,044; and No.
5,413,924.
B. Detection of Target Biomarker Nucleic Acids
In certain embodiments, labels, dyes, or labeled probes and/or primers are used to detect amplified or unamplified biomarker nucleic acid sequence (mRNA/cDNA). One of ordinary skill in the art will recognize which detection methods are appropriate based on the sensitivity of the detection method and the abundance of the target. Depending on the sensitivity of the detection method and the abundance of the target, amplification may or may not be required prior to detection. One skilled in the art will recognize the detection methods where biomarker nucleic acid sequence amplification is preferred.
A probe or primer may include Watson-Crick bases or modified bases. Modified bases include, but are not limited to, the AEGIS bases (from EraGen Biosciences, Inc.
(Madison, WI)), which have been described, e.g., in U.S. Patents. No. 6,001,983; No.
5,965,364; and No. 5,432,272. In certain aspects, bases are joined by a natural
phosphodiester bond or a different chemical linkage. Different chemical linkages include, but are not limited to, a peptide bond or a Locked Nucleic Acid (LNA) linkage, which is described, e.g., in U.S. Patent No. 7,060,809.
In a further aspect, oligonucleotide probes or primers present in an amplification reaction are suitable for monitoring the amount of amplification product produced as a function of time. In certain aspects, probes having different single stranded versus double stranded character are used to detect the nucleic acid. Probes include, but are not limited to, the 5'-exonuclease assay (e.g., TaqMan®) probes (see U.S. Patent No. 5,538,848), stem-loop molecular beacons (see, e.g., U.S. Patents No. 6,103,476 and No. 5,925,517), stemless or linear beacons (see, e.g., WO 9921881, U.S. Patents No. 6,649,349 and No. 6,485,901), peptide nucleic acid (PNA) Molecular Beacons (see, e.g., U.S. Patents No. 6,593,091 and No. 6,355,421), linear PNA beacons (see, e.g., U.S. Patent No. 6,329,144), non-FRET probes (see, e.g., U.S. Patent No. 6,150,097), Sunrise®/Amplifluor® probes (see, e.g., U.S. Patent No. 6,548,250), stem-loop and duplex Scorpion™ probes (see, e.g., U.S. Patent No.
6,589,743), bulge loop probes (see, e.g., U.S. Patent No. 6,590,091), pseudo knot probes (see, e.g., U.S. Patent No. 6,548,250), cyclicons (see, e.g., U.S. Patent No. 6,383,752), MGB Eclipse® probe (Sigma-Aldrich Corp. (St. Louis, MO)), hairpin probes (see, e.g., U.S. Patent No. 6,596,490), PNA light-up probes, antiprimer quench probes (Li et al, 53 CLIN. CHEM. 624-33 (2006)), self-assembled nanoparticle probes, and ferrocene-modified probes described, for example, in U.S. Patent No. 6,485,901.
In certain embodiments, one or more of the primers in an amplification reaction can include a label. In yet further embodiments, different probes or primers comprise detectable labels that are distinguishable from one another. In some embodiments a nucleic acid, such as the probe or primer, may be labeled with two or more distinguishable labels.
In some aspects, a label is attached to one or more probes and has one or more of the following properties: (i) provides a detectable signal; (ii) interacts with a second label to modify the detectable signal provided by the second label, e.g. , FRET (Fluorescent
Resonance Energy Transfer); (iii) stabilizes hybridization, e.g. , duplex formation; and (iv) provides a member of a binding complex or affinity set, e.g. , affinity, antibody-antigen, ionic complexes, hapten-ligand (e.g. , biotin-avidin). In still other aspects, use of labels can be accomplished using any one of a large number of known techniques employing known labels, linkages, linking groups, reagents, reaction conditions, and analysis and purification methods.
Biomarker nucleic acid sequences can be detected by direct or indirect methods. In a direct detection method, one or more biomarker nucleic acid sequences are detected by a detectable label that is linked to a nucleic acid molecule. In such methods, the biomarker nucleic acid sequences may be labeled prior to binding to the probe. Therefore, binding is detected by screening for the labeled biomarker nucleic acid sequence that is bound to the probe. The probe is optionally linked to a bead in the reaction volume.
In certain embodiments, nucleic acids are detected by direct binding with a labeled probe, and the probe is subsequently detected. In one embodiment of the invention, the nucleic acids, such as amplified mRNA/cDNA, are detected using xMAP Microspheres (Luminex Corp. (Austin, TX)) conjugated with probes to capture the desired nucleic acids. Some methods may involve detection with polynucleotide probes modified, for example, with fluorescent labels or branched DNA (bDNA) detection.
In other embodiments, nucleic acids are detected by indirect detection methods. For example, a biotinylated probe may be combined with a stretavidin-conjugated dye to detect the bound nucleic acid. The streptavidin molecule binds a biotin label on amplified nucleic acid, and the bound nucleic acid is detected by detecting the dye molecule attached to the streptavidin molecule. In one embodiment, the streptavi din-conjugated dye molecule comprises Phycolink® Streptavidin R-Phycoerythrin (ProZyme, Inc. (Heward, CA)). Other conjugated dye molecules are known to persons skilled in the art.
Labels include, but are not limited to, light-emitting, light-scattering, and light- absorbing compounds which generate or quench a detectable fluorescent, chemiluminescent, or bioluminescent signal. See, e.g., Garman A., Non-Radioactive Labeling, Academic Press (1997) and Kricka, L., Nonisotopic DNA Probe Techniques, Academic Press, San Diego (1992). Fluorescent reporter dyes useful as labels include, but are not limited to, fluoresceins (see, e.g., U.S. Patents No. 6,020,481; No. 6,008,379; and No. 5,188,934), rhodamines (see, e.g., U.S. Patents No. 6,191,278; No. 6,051,719; No. 5,936,087; No. 5,847,162; and No. 5,366,860), benzophenoxazines (see, e.g., U.S. Patent No. 6,140,500), energy-transfer fluorescent dyes, comprising pairs of donors and acceptors (see, e.g., U.S. Patents No.
5,945,526; No. 5,863,727; and 5,800,996; and), and cyanines (see, e.g., WO 9745539), lissamine, phycoerythrin, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham Biosciences, Inc. (Piscataway, NJ)), Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY -TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6- JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, Tetramethylrhodamine, and/or Texas Red, as well as any other fluorescent moiety capable of generating a detectable signal. Examples of fluorescein dyes include, but are not limited to, 6-carboxyfluorescein; 2',4', 1,4,- tetrachlorofluorescein, and 2',4',5',7',1,4-hexachlorofluorescein. In certain aspects, the fluorescent label is selected from SYBR-Green, 6-carboxyfluorescein ("FAM"), TET, ROX, VICTM, and JOE. For example, in certain embodiments, labels are different fluorophores capable of emitting light at different, spectrally-resolvable wavelengths (e.g., 4-differently colored fluorophores); certain such labeled probes are known in the art and described above, and in U.S. Patent No. 6,140,054. A dual labeled fluorescent probe that includes a reporter fluorophore and a quencher fluorophore is used in some embodiments. It will be appreciated that pairs of fluorophores are chosen that have distinct emission spectra so that they can be easily distinguished.
In further embodiments, labels are hybridization-stabilizing moieties which serve to enhance, stabilize, or influence hybridization of duplexes, e.g., intercalators and intercalating dyes (including, but not limited to, ethidium bromide and SYBR-Green), minor-groove binders, and cross-linking functional groups (see, e.g., Blackburn et al, eds. "DNA and RNA Structure" in Nucleic Acids in Chemistry and Biology (1996)).
In further aspects, methods relying on hybridization and/or ligation to quantify biomarker nucleic acid may be used including, but not limited to, oligonucleotide ligation (OLA) methods and methods that allow a distinguishable probe that hybridizes to the target nucleic acid sequence to be separated from an unbound probe. For example, HARP-like probes, as disclosed in U. S. Patent Application Publication No. 2006/0078894 may be used to measure the quantity of target nucleic acid. In such methods, after hybridization between a probe and the targeted nucleic acid, the probe is modified to distinguish the hybridized probe from the unhybridized probe. Thereafter, the probe may be amplified and/or detected. In general, a probe inactivation region comprises a subset of nucleotides within the target hybridization region of the probe. To reduce or prevent amplification or detection of a HARP probe that is not hybridized to its target nucleic acid, and thus allow detection of the target nucleic acid, a post-hybridization probe inactivation step is carried out using an agent which is able to distinguish between a HARP probe that is hybridized to its targeted nucleic acid sequence and the corresponding unhybridized HARP probe. The agent is able to inactivate or modify the unhybridized HARP probe such that it cannot be amplified.
In an additional embodiment of the method, a probe ligation reaction may be used to quantify target biomarker nucleic acid. In a Multiplex Ligation-dependent Probe
Amplification (MLPA) technique, pairs of probes which hybridize immediately adjacent to each other on the target nucleic acid are ligated to each other only in the presence of the target nucleic acid. See Schouten et al, 30 NuCL. ACIDS RES. e57 (2002). In some aspects, MLPA probes have flanking PCR primer binding sites. MLPA probes can only be amplified if they have been ligated, thus allowing for detection and quantification of biomarkers.
Furthermore, a sample may also be analyzed by means of a microarray. Microarrays generally comprise solid substrates and have a generally planar surface, to which a capture reagent (also called an adsorbent or affinity reagent) is attached. Frequently, the surface of a microarray comprises a plurality of addressable locations, each of which has the capture reagent (e.g., miRNA probes specific for particular biomarkers) bound there. Many microarrays are described in the art. These include, for example, biochips produced by Asuragen,. Inc. (Austin, TX); Affymetrix, Inc. (Santa Clara, CA); GenoSensor Corp. (Tempe, AZ); Invitrogen, Corp. (Carlsbad, CA); and Illumina, Inc. (San Diego, CA).
In particular embodiments, a method comprises the steps of (a) assaying gene expression levels of one or more ERV genes described herein (e.g., including a panel described herein) in a biological sample obtained from a patient; (b) calculating an immune signature value based on the assayed expression levels. In a specific embodiment, the assay step can comprise PCR amplification. In other embodiments, the method can further comprise generating a report summarizing the gene expression data and/or the immune signature values. In other embodiments, the method may further comprise recommending a particular treatment. For example, an immune signature that is determined to be low in comparison to other biomarkers/control levels indicates that the subject should be treated with epigenetic therapy followed immunotherapy, chemotherapy or some combination of therapy for the particular cancer. Alternatively, an immune signature that is determined to be high in comparison to other biomarkers/control levels indicates that the subject can be treated with immunotherapy (and optionally chemotherapy or some combination of therapy for the particular cancer). The methods listed above include all embodiments of the ERV panels described herein. In specific embodiments, ERV expression can be measured using a microfluidic card (e.g., TaqMan® Array Microfluidic Card (Applied Biosystems).
III. Determination of a Patient's Immune Signature Status A. Biomarker Panels
The biomarkers of the present invention can be used in diagnostic tests to assess, determine, and/or qualify (used interchangeably herein) immune signature status in a patient and therefore, direct treatment of the patient. The phrase "immune signature status" includes a high immune signature (ERV high) and a low immune signature (ERV low). Based on this status, further procedures may be indicated, including additional diagnostic tests or therapeutic procedures or regimens.
These and other biomarkers are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc., of these biomarkers are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. Thus, if a panel of biomarkers A, B, and C are disclosed as well as a class of biomarkers D, E, and F and an example of a combination panel A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of using the disclosed biomarkers. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.
Accordingly, in one embodiment, the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, ERVV-1, ERVV-2, ERVS71-1, ERVPABLB-1, HERV- K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVH-1, ERVH-2, ERVH-3, ERVE4-1, ERVFcl, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVMER34-1, ERVH48-1, ERV9-1, ERV- F(XA34), and ERVW-5. The foregoing includes, for example, combinations of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, and 31 biomarkers. In particular embodiments, the foregoing combinations are common in any of breast, colorectal and ovarian cancer.
In a further embodiment, the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVE4-1, ERVH-1, ERVH-2, ERVH- 3, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVW-5, ERVH48-1 and ERV9-1. The foregoing includes, for example, combinations of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 and 24 biomarkers.
In a further embodiment, the ERV panel comprises one or more of ERVW-1, ERVP(b), ERV-3, ERV-Fcl, ERV-Fbl, and ERV9-1. The foregoing includes, for example, combinations of at least 2, at least 3, at least 4, at least 5, and 6 biomarkers.
In yet further embodiments, expression of all the ERVs can be measured and the expression of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, and 31 of the biomarkers can be used to classify ERV high, ERV intermediate and/or ERV low.
The power of a diagnostic test to correctly predict status is commonly measured as the sensitivity of the assay, the specificity of the assay or the area under a receiver operated characteristic ("ROC") curve. Sensitivity is the percentage of true positives that are predicted by a test to be positive, while specificity is the percentage of true negatives that are predicted by a test to be negative. An ROC curve provides the sensitivity of a test as a function of 1- specificity. The greater the area under the ROC curve, the more powerful the predictive value of the test. Other useful measures of the utility of a test are positive predictive value and negative predictive value. Positive predictive value is the percentage of people who test positive that are actually positive. Negative predictive value is the percentage of people who test negative that are actually negative.
In particular embodiments, the biomarker panels of the present invention may show a statistical difference in different immune signature statuses of at least p<0.05, p<10-2, p<10- 3, p<10-4 or p<10-5. Diagnostic tests that use these biomarkers may show an ROC of at least 0.6, at least about 0.7, at least about 0.8, or at least about 0.9.
In certain embodiments, the biomarkers are measured in a patient sample using the methods described herein and an immune signature status is calculated. In particular embodiments, the measurement(s) may then be compared with a relevant diagnostic amount(s), cut-off(s), or multivariate model scores that distinguish a high immune signature (ERV high) status from a low immune signature (ERV low) status. The diagnostic amount(s) represents a measured amount of a biomarker(s) above which or below which a patient is classified as having a particular immune signature status. As is well understood in the art, by adjusting the particular diagnostic cut-off(s) used in an assay, one can increase sensitivity or specificity of the diagnostic assay depending on the preference of the diagnostician. In particular embodiments, the particular diagnostic cut-off can be determined, for example, by measuring the amount of biomarkers in a statistically significant number of samples from patients with different immune signature statuses, and drawing the cut-off to suit the desired levels of specificity and sensitivity.
Furthermore, in certain embodiments, the values measured for markers of a biomarker panel are mathematically combined and the combined value is correlated to the underlying diagnostic question of high or low ERV immune signature. Biomarker values may be combined by any appropriate state of the art mathematical method. Well-known
mathematical methods for correlating a marker combination to a disease status employ methods like discriminant analysis (DA) (e.g., linear-, quadratic-, regularized-DA),
Discriminant Functional Analysis (DFA), Kernel Methods (e.g., SVM), Multidimensional Scaling (MDS), Nonparametric Methods (e.g., k-Nearest-Neighbor Classifiers), PLS (Partial Least Squares), Tree-Based Methods (e.g., Logic Regression, CART, Random Forest Methods, Boosting/Bagging Methods), Generalized Linear Models (e.g., Logistic
Regression), Principal Components based Methods (e.g., SIMCA), Generalized Additive Models, Fuzzy Logic based Methods, Neural Networks and Genetic Algorithms based Methods. The skilled artisan will have no problem in selecting an appropriate method to evaluate a biomarker combination of the present invention. In one embodiment, the method used in a correlating a biomarker combination of the present invention is selected from DA (e.g., Linear-, Quadratic-, Regularized Discriminant Analysis), DFA, Kernel Methods (e.g., SVM), MDS, Nonparametric Methods (e.g., k-Nearest-Neighbor Classifiers), PLS (Partial Least Squares), Tree-Based Methods (e.g., Logic Regression, CART, Random Forest Methods, Boosting Methods), or Generalized Linear Models (e.g., Logistic Regression), and Principal Components Analysis. Details relating to these statistical methods are found in the following references: Ruczinski et al.,12 J. OF COMPUTATIONAL AND GRAPHICAL STATISTICS 475-511 (2003); Friedman, J. H., 84 J. OF THE AMERICAN STATISTICAL ASSOCIATION 165-75 (1989); Hastie, Trevor, Tibshirani, Robert, Friedman, Jerome, The Elements of Statistical Learning, Springer Series in Statistics (2001); Breiman, L., Friedman, J. H., Olshen, R. A., Stone, C. J. Classification and regression trees, California: Wadsworth (1984); Breiman, L., 45 MACHINE LEARNING 5-32 (2001); Pepe, M. S., The Statistical Evaluation of Medical Tests for Classification and Prediction, Oxford Statistical Science Series, 28 (2003); and Duda, R. O., Hart, P. E., Stork, D. G., Pattern Classification, Wiley Interscience, 2nd Edition (2001).
B. Generation of Classification Algorithms for Qualifying Immune
Signature Status
In some embodiments, data that are generated using samples such as "known samples" can then be used to "train" a classification model. A "known sample" is a sample that has been pre-classified. The data that are used to form the classification model can be referred to as a "training data set." The training data set that is used to form the classification model may comprise raw data or pre-processed data. Once trained, the classification model can recognize patterns in data generated using unknown samples. The classification model can then be used to classify the unknown samples into classes. This can be useful, for example, in predicting whether or not a particular biological sample is associated with a certain biological condition.
Classification models can be formed using any suitable statistical classification or learning method that attempts to segregate bodies of data into classes based on objective parameters present in the data. Classification methods may be either supervised or unsupervised. Examples of supervised and unsupervised classification processes are described in Jain, "Statistical Pattern Recognition: A Review", IEEE Transactions on Pattem Analysis and Machine Intelligence, Vol. 22, No. 1, January 2000, the teachings of which are incorporated by reference.
In supervised classification, training data containing examples of known categories are presented to a learning mechanism, which learns one or more sets of relationships that define each of the known classes. New data may then be applied to the learning mechanism, which then classifies the new data using the learned relationships. Examples of supervised classification processes include linear regression processes (e.g., multiple linear regression (MLR), partial least squares (PLS) regression and principal components regression (PCR)), binary decision trees (e.g., recursive partitioning processes such as CART), artificial neural networks such as back propagation networks, discriminant analyses (e.g., Bayesian classifier or Fischer analysis), logistic classifiers, and support vector classifiers (support vector machines).
Another supervised classification method is a recursive partitioning process.
Recursive partitioning processes use recursive partitioning trees to classify data derived from unknown samples. Further details about recursive partitioning processes are provided in U.S. Patent Application No. 2002 0138208 Al to Paulse et al., "Method for analyzing mass spectra."
In other embodiments, the classification models that are created can be formed using unsupervised learning methods. Unsupervised classification attempts to learn classifications based on similarities in the training data set, without pre-classifying the spectra from which the training data set was derived. Unsupervised learning methods include cluster analyses. A cluster analysis attempts to divide the data into "clusters" or groups that ideally should have members that are very similar to each other, and very dissimilar to members of other clusters. Similarity is then measured using some distance metric, which measures the distance between data items, and clusters together data items that are closer to each other. Clustering techniques include the MacQueen's K-means algorithm and the Kohonen's Self-Organizing Map algorithm.
Learning algorithms asserted for use in classifying biological information are described, for example, in PCT International Publication No. WO 01/31580 (Bamhill et al, "Methods and devices for identifying patterns in biological systems and methods of use thereof), U.S. Patent Application Publication No. 2002/0193950 (Gavin et al. "Method or analyzing mass spectra"), U.S. Patent Application Publication No. 2003/0004402 (Hitt et al, "Process for discriminating between biological states based on hidden patterns from biological data"), and U.S. Patent Application Publication No. 2003/0055615 (Zhang and Zhang, "Systems and methods for processing biological expression data").
The classification models can be formed on and used on any suitable digital computer. Suitable digital computers include micro, mini, or large computers using any standard or specialized operating system, such as a Unix, Windows® or Linux™ based operating system. In embodiments utilizing a mass spectrometer, the digital computer that is used may be physically separate from the mass spectrometer that is used to create the spectra of interest, or it may be coupled to the mass spectrometer.
The training data set and the classification models according to embodiments of the invention can be embodied by computer code that is executed or used by a digital computer. The computer code can be stored on any suitable computer readable media including optical or magnetic disks, sticks, tapes, etc., and can be written in any suitable computer
programming language including R, C, C++, visual basic, etc.
The learning algorithms described above are useful both for developing classification algorithms for the biomarkers already discovered, and for finding new biomarker biomarkers. The classification algorithms, in turn, form the base for diagnostic tests by providing diagnostic values (e.g., cut-off points) for biomarkers used singly or in combination.
IV. Kits for the Detection of Immune Signature Biomarkers
In another aspect, the present invention provides kits for qualifying immune signature status, which kits are used to detect the biomarkers described herein. In a specific embodiment, the kit is provided as a PCR kit comprising primers that specifically bind to one or more of the biomarkers described herein. One of ordinary skill in the art can design primers the specifically bind and amplify the target biomarkers. The kit can further comprise substrates and other reagents necessary for conducting PCR (e.g., quantitative real-time PCR). The kit can be configured to conduct singleplex or multiplex PCR. The kit can further comprise instructions for carrying out the PCR reaction(s). In specific embodiments, the biological sample obtained from a subject may be manipulated to extract nucleic acid. In a further embodiment, the nucleic acids are contacted with primers that specifically bind the target biomarkers to form a primer: biomarker complex. The complexes can then be amplified and detected/quantified/measured to determine the levels of one or more biomarkers. The subject can then be identified as having a particular immune signature (e.g., ERV high or ERV low) based on a comparison of the measured levels of one or more biomarkers to one or more reference controls and/or a comparison of one set of biomarkers to another set of biomarkers.
In specific embodiments, the kit comprises primers/probes for
amplifying/detecting/measuring one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, ERVV-1, ERVV-2, ERVS71-1, ERVPABLB-1, HERV-K74261, HML-2.HOM/K108, ERV- K17833 CI 9, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVH-1, ERVH-2, ERVH-3, ERVE4-1, ERVFcl, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVMER34-1, ERVH48-1, ERV9-1, ERV-F(XA34) and ERVW-5, and combinations of all of the foregoing. In other embodiments, the kit comprises primers/probes for amplifying/detecting/measuring one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV- K115, ERV-K102, ERVE4-1, ERVH-1, ERVH-2, ERVH-3, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVW-5, ERVH48-1 and ERV9-1, and combinations of all of the foregoing. In certain embodiments, the kit comprises
primers/probes for amplifying/detecting/measuring one or more of ERVW-1, ERVP(b), ERV-3, ERV-Fcl, ERV-Fbl, and ERV9-1, and combinations of all of the foregoing. Thus, in certain embodiments, a kit comprises the primers encoded by SEQ ID NOS: 1-62. In another embodiment, the kit comprises the primers encoded by SEQ ID NOS: l-8, 17-52, 55-58 and 61-62. In yet another embodiment, the kits comprise the primers encoded by SEQ ID NOS: 1-2, 5-6, 7-8, 39-40, and 55-58. The kits can further comprise reagents and instructions for performing PCR. In a specific embodiment, the PCR is qRT- PCR.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and/or methods described and claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for herein. Unless indicated otherwise, parts are parts by weight, temperature is in degrees Celsius or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component
concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.
DNA methyltransf erase inhibitors (DNMTis), such as 5-azacytidine (Aza) and 5-aza- 2'-deoxycytidine (Dac) are effective cancer therapies in hematologic neoplasms (Tsai et al, 2012) (Matei et al, 2012) and are FDA approved for the pre-leukemic disorder
myelodysplasia (MDS) (Kaminskas et al, 2005). These cytidine analogues incorporate into DNA, block catalytic actions of DNA methyltransferases (DNMTs), and trigger their degradation (Stresemann et al, 2006). Preclinically, low doses avoid early cytotoxicity and DNA damage, allowing cells to exhibit apparent reprogramming and blunting of
tumorigenicity (Tsai et al, 2012). Mechanisms can include reversal of abnormal promoter DNA methylation, re-expression of silenced genes including tumor suppressors (Baylin and Jones, 2011), and changes to cancer signaling pathways including apoptosis, cell cycle activity, and stem cell functions (Tsai et al, 2012). A long recognized activity of DNMTis described by others (Karpf et al, 2004; Karpf et al, 1999), and our group (Li et al, 2014; Wrangle et al, 2013), is induction of immune responses in cancer cells. In recent clinical trials for non-small cell lung cancer (NSCLC) (Juergens et al, 2011; Wrangle et al, 2013) a small number of patients had remarkably robust and durable responses to immune checkpoint blockade therapy after first receiving Aza (Wrangle et al, 2013). This immune therapy alone also has activity against NSCLC (Brahmer et al, 2010; Brahmer et al., 2012; Topalian et al., 2012). A larger trial is now ongoing to determine if Aza can indeed prime patients for sensitization to checkpoint inhibition (Brahmer, 2015). For NSCLC and other tumor types, Aza induces interferon signaling and concordant upregulation of surface antigens and their assembly proteins, viral defense pathways, and transcript and surface protein levels of PD- Ll, the key checkpoint ligand targeted in the above immunotherapy (Li et al, 2014; Wrangle et al, 2013). Indeed, we have defined a 300 gene expression signature we termed Aza- Induced iMmune genes or AIM (Li et al, 2014) for which activation is greatest for epithelial ovarian cancer (EOC) and NSCLC (Li et al, 2014). Genome-wide expression of AIM separates primary EOC, NSCLC, and other cancers into high and low expression groups (Li et al, 2014). We hypothesize the low group may represent an "immune evasion/ immune editing" pattern (Drake et al, 2006) (Schreiber et al, 2011) that Aza could reverse to sensitize patients to subsequent immune therapy (Li et al, 2014).
We now show that a major mechanism underlying the Aza-triggered immune response is induction of a cytosolic double-stranded RNA (dsRNA) sensing pathway used by epithelial and other cell types as a viral defense mechanism that triggers a Type I interferon response (Kulaeva et al, 2003; Sistigu et al, 2014). A key contributor is induction of increased expression of multiple DNA hypermethylated endogenous retroviruses (ERVs). In The Cancer Genome Atlas (TCGA), the viral defense gene expression separates primary EOC and other cancers into high and low expression and high tumor expression strongly associates with clinical benefit in a trial of immune checkpoint therapy for advanced melanoma. Aza sensitizes to immune checkpoint blockade in a pre-clinical model of melanoma. We thus define a potential approach in which an epigenetic therapy may sensitize cancer cells to various immunotherapies.
Materials and Methods
Cell Line Treatments. Cell lines were treated with 500 nM Aza, 100 nM Dac, or 500 nM- 3 μΜ carboplatin (Sigma, St. Louis, Missouri) for 72 hours, and DNA and RNA were isolated using standard methods at 1, 3, or 7 days following removal of drug. 2 μΜ ruxolitinib (Invivogen #tlrl-rux), 0.625- 5 U/mL of anti-IFNAR2 antibody (PBL Interferon Source #21385-1), 0.625-2.5 U/mL of anti- IFNB antibody (PBL Interferon Source #31400- 1), or 1.25-5 U/mL of anti-ILlORB antibody (Abeam # ab89884) were added during DNMTi treatment. Preparation of nuclear and cytoplasmic fractions of cultured cells was performed as described (O'Hagan et al, 201 1). Ribosomal RNA was depleted using the Ribominus kit (Invitrogen), and PolyA+ and Poly A- RNA were isolated using the Oligotex Direct mRNA Mini Kit (Invitrogen). Nucleic acids were treated with 1 U^g of RNase III (Ambion), 10 U^g of RNaseH (Invitrogen), or 3 U/ 1 μg calf intestine alkaline phosphatase (New England Biolabs) according to manufacturer's instructions and 400 ng of each nucleic acid was transfected into HT29 cells.
DNA Methylation Analysis. DNA was bisulfite converted and subjected to
Methylation-Specific PCR (Herman et al, 1996) for IRF7 and Fc2, and COBRA (Xiong and Laird, 1997) for the Fc2 locus on chromosome 1 1.
Transcript Abundance. Real-time RT-PCR was performed with an Applied
Biosy stems 7500 Fast Real-Time PCR machine by the 2-AACT method and TASA-TD strand-specific PCR by the method of (Henke et al., 2015).
Protein Analysis. Western blot analyses employed antibodies against ERV-3 (1 : 1000, Everest), B-Actin (1 :5000, Sigma), MDA5 (1 : 1000, Cell Signaling #5321), PARP (#9542, 1 : 1000; Cell Signaling Technology, Inc.), RIG-I (1 : 1000, Cell Signaling #4200), STING (1 : 1000, Abeam #ab82960), Syncytin-1 (1 :350, Dr. Herve Perron, Geneuro, Geneva
Switzerland), and TLR3 (1 : 1000, Cell Signaling #6961). IFNβ ELISA utilized the Verikine- HS™ Human Interferon Beta Serum ELISA kit (PBL Interferon Source) and IFNL ELISA the DuoSet ELISA for Human IL-29/IL28-B (IFNL 1/3) kit (R & D Systems).
Knockdown and Over expression Experiments. Syncytin-1, ERV-3 and ERV-W2 env, ER, and E-GFP vectors and siRNAs targeting Syncytin-1 , ERV-3, or a scrambled control were transfected using the JetPei or Hyperfect transfection reagents, respectively. TLR3, MAVS, and STING shRNA were performed according to established methods (Stewart et al, 2003).
RNAseq Expression Analysis o f Tumors from Anti-CTLA-4-Treated Patients . Patients were described previously (Snyder et al, 2014) and samples were obtained with written informed consent per approved institutional review board (IRB) protocols. Expression data were obtained using RNASeq with all data deposited at GEO (accession number pending).
Bl 6-F10 Melanoma Mouse Model. C57BL/6J mice were subcutaneously injected with 1x105 B16-F10 tumor cells. On days 4, 8, 1 1 , 14, 18, mice were treated
intraperitoneally with 100 μg anti-ctla-4. Mice received two cycles of intraperitoneal injection of 0.1 to 0.75 mg/kg Aza in PBS for 5 consecutive days followed by 7 days off treatment, starting at day 8 after developing palpable tumors, with control groups receiving corresponding doses of non-specific isotype antibody control and PBS intraperitoneally. Tumor surface was measured with a caliper using the ellipse surface formula (Length*Width*n)/400.
Statistical Analysis. Mean +/- SEM qRT-PCR results were considered statistically significant with p values < 0.05 by Mann-Whitney U test or Student /-tests and 2-tailed p values are reported. Tumor growth was assessed by two way ANOVA between each of the mouse treatment groups with p values adjusted by the Dunnett multiple comparison test (df=512). Normalized, level 3 Agilent expression data were obtained from The Cancer Genome Atlas data portal (https://tcga-data.nci.nih.gov/tcga/) and analyzed by R statistical software (www.r-project.org) with existing packages and customized routines. Consensus hierarchical clustering was performed with the ConsensusClusterPlus R-package (Wilkerson and Hayes, 2010) and data analyzed by the Fisher exact p value test for association between clusters (p<0.05 *; p<0.0l **;p< 0.001 ***).
Supplemental Experimental Procedures
Cell Line Treatments. Colorectal cell lines HCT116 and HT29 were obtained from the American Type Tissue Collection and were cultured under recommended conditions. Ovarian cancer cell lines were obtained from the laboratory of Dr. Dennis Slamon and included A2780 Hey, Kuramochi, and TykNu. These cell lines were cultured according to ATCC recommended conditions.
Cell lines were treated with 500 nM of Aza, 100 nM of Dac, or 500 nM- 3 μΜ of carboplatin (Sigma; St. Louis, Missouri) for 72 hours while in log-growth phase, changing the media and drug every 24 hours for drug treatment. To select an appropriate
chemotherapy control, the carboplatin dose that had a similar growth inhibitory effect to 500 nM Aza after 10 days was used to treat the cells (IC50s: A2780 (Aza=848 nM, Carb=457 nM), Hey (Aza=4.1 μΜ, Carb=12.2 μΜ), TykNu (Aza=491 nM, Carb=986.2 nM). 2 μΜ ruxolitinib (Invivogen #tlrlrux), 0.625-5 U/mL of anti-IFNAR2 antibody (PBL Interferon Source #21385-1), 0.625-2.5 U/mL of anti-IFNB antibody (PBL Interferon Source #31400- 1), or 1.25-5 U/mL of anti-ILlORB antibody (Abeam # ab89884) were added during DNMTi treatment. Cells were harvested at 1, 3, or 7 days following initial application of drug. DNA and RNA were obtained using standard protocols (Tsai et al, 2012) RNA from cell lines was sent for the Agilent 44K Expression Array (Li et al., 2014).
Bisulfite conversion. DNA bisulfite conversion was performed using a commercially available kit (EZ DNA Methylation Gold™ Kit, Zymo Research, Orange, CA).
DNA Methylation Analysis. Methylation-Specific PCR was performed as previously described (Herman et al, 1996) for the IRF7 and Fc2 genes. Primers are listed in Table 6. COBRA (Combined Bisulfite Restriction Analysis) was performed as previously described (Xiong and Laird, 1997) at the Fc2 ERV located on chromosome 11. Primers are listed in Table 6. Bands and restriction fragments were resolved on 2% agarose gels, stained with ethidium bromide, and photoimaged with a UV camera.
RNAseq Expression Analysis of Tumors from Anti-CTLA-4- Treated Patients .
Patients were described previously (Snyder et al., 2014) and samples were obtained with written informed consent per approved institutional review board (IRB) protocols.
Expression data were obtained using RNASeq. RNA Sequencing was performed at New York Genome Center. Raw reads in the fastq format were aligned to Human Genome HG19 using RNA-seq STAR aligner (Dobin et al, 2013). Mapped reads for each sample were counted for each gene in annotation files in GTF format (gencode.vl9.annotation.gtf available for download from GENECODE website
(http://www.gencodegenes.org/releases/19.html)) using the FeatureCounts read
summarization program(Liao et al, 2014). Individual count files were merged to the Matrix by an in-house R script. All expression data is deposited at GEO (accession number pending).
Statistical Analysis. qRT-PCR results are expressed as mean +/- SEM, with p values < 0.05 considered statistically significant using the program IBM SPSS version 21. Different groups were compared by Mann-Whitney U test or Student /-test as appropriate, and 2-tailed p values are reported. Normalized, level 3 Agilent gene expression array data for high-grade serous ovarian cancer was downloaded from The Cancer Genome Atlas (TCGA) data portal. A total of 489 ovarian tumors, which, in previous TCGA (Verhaak et al, 2013) have been classified into 4 subtypes (immunoreactive (IMR), proliferative (PRO), mesenchymal (MES), and differentiated (DIF)) by gene expression, were used for the analysis with our defined Viral Defense gene panel. All analyses were performed with the R statistical software suite and programing environment (www.r-project.org), using existing packages and customized routines. Consensus hierarchical clustering, as implemented in the ConsensusClusterPlus R- package (Wilkerson and Hayes, 2010) was used to identify stable clusters. Settings included Ward's method for innerLinkage and finalLinkage, Euclidean distance and 80% resampling. Solutions having anywhere from k=2 to 6 clusters were considered, and evaluated using consensus matrices to assess cluster stability, and cumulative distribution plots to measure the incremental value associated with adding additional clusters. Similar approaches were used to evaluate the gene expression pattern in other solid tumor types (FIG. S7) and the anti- CTLA-4 treated metastatic melanoma dataset. Fisher exact p value test was used to test for association between clusters defined in this way using our Viral Defense panel and subtypes (IMR, PRO, MES, DIF) defined previously by TCGA (p<0.05 *; p<0.01 **; p<0.001 ***). Tumor surface measurements were imported in Graphpad Prism 6 and a two way ANNOVA was used to compare tumor growth between each of the group with anti-ctla4 monotherapy. Reported p values were adjusted using after Dunnett multiple comparison test (df=512).
For statistical analyses of primary ovarian tumors the fold ratio of ISGs of the low ERV tumor group and high ERV tumor (T) cohort was determined. Using the results from real time PCR for ERVs (molecules/ng RNA) and ISGs (2-DDcT) a ratio in AU was calculated as: ISG 2-DDcT T(M9) x ERV molecules T(1-19) / mean ERV molecules of controls (n=9). T DDcT T(1-19) equaled R, which was the relative expression ratio of each ISG gene normalized to the two reference genes TBP and GAPDH and the ISG expression of the control ovarian tissues (n=9). Subsequently, all ISG/ERV ratios were transformed into a color code (blue to red) for each tumor and ISG for display and number code (0 to >10.1) for statistical calculations. Using the number code a hierarchical cluster analysis using the Ward-Method cluster method and Interval Euclidian distance was performed with a maximum of 6 clusters (k=6). Using the different cluster results from the low ERV and high ERV expression cohorts a Fisher's exact test was executed.
IFN response gene validations (qRT-PCR). After total cellular RNA was extracted using the Trizol method (Life Technologies, Carlsbad, California), RNA concentration was determined using the Nanodrop machine and software (Thermo Fisher Scientific, Rockville, Maryland). 1 μg total RNA was used to generate cDNA with the QuantiTect Reverse Transcription Kit (Qiagen, Venlo, The Netherlands). Quantitative reverse transcription PCR (q-RT-PCR) of DDX41, DDX58, IFI16, IFI27, IFI44, IFI44L, IFI6, IFNB1, IFNL1, IFNL2, IFNL3, IFNLR1, IL-1B, IL-10RB, IL-15, IRF7, MAGEB2, MAYS, MB21D1, MX1, OASL, STAT1, and TMEM173 mRNA was performed using TaqMan assays or Custom Taqman Gene Expression Array Cards (Life Technologies, Carlsbad, California) and the Applied Biosystems 7500 Fast real-time PCR system and software. TBP and GAPDH were used as reference genes. The AACT method was used to calculate relative expression levels. All qRT-PCR assays were carried out in triplicate and then repeated with new cDNA synthesis. Reverse transcriptase negative cDNA synthesis reactions were performed for at least one sample per plate.
Immunoblotting. Protein was isolated from cell lines and measured by BCA (Pierce Biotechnology. Protein extracts were subjected to polyacrylamide gel electrophoresis using the 4%-12% NuPAGE gel system (Invitrogen), transferred to PVDF (Millipore) membranes, and immunoblotted using antibodies that specifically recognize ERV-3, MDA5, cleaved PARP, RIG-I, STING (TMEM173), Syncytin-1, and TLR3. β-actin (Sigma #5441, 1 :5000) was used as a loading control. Antibodies used were as follows: polyclonal goat anti-ERV-3 (1 : 1000, Everest), mouse anti-β-Actin (1:5000, Sigma), goat anti-mouse IgG-HRP (sc-2005, 1:5,000; Santa Cruz Biotechnology, Inc.), rabbit anti-MDA5 (1: 1000, Cell Signaling #5321), rabbit anti-PARP (#9542, 1: 1000; Cell Signaling Technology, Inc.), rabbit anti -RIG-I (1 : 1000, Cell Signaling #4200), rabbit anti-STING (TMEM173) (ab92605, 1: 1000, Abeam), Syncytin-1 monoclonal mouse antibody 14A5 against the SU (1:350) (kind gift from Dr. Herve Perron, Geneuro, Geneva Switzerland), rabbit anti-TLR3 (#6961, 1: 1000, Cell Signaling Technology, Inc.), sheep anti-mouse IgG-HRP (1:5000, NA931V, GE Healthcare Life Sciences, Inc.), and donkey anti-rabbit IgG-HRP (1 : 1000, NA934V, GE Healthcare Life Sciences, Inc.). Band intensities of Tiff images were quantified using the program ImageJ.
Fractionation Experiments. Preparation of nuclear and cytoplasmic fractions of cultured cells was performed as previously described (O'Hagan et al, 2011). Cytoplasmic RNA was depleted of ribosomal RNA using the Ribominus kit (Invitrogen), according to the manufacturer's instructions. PolyA+ and Poly A- RNA were isolated using the Oligotex Direct mRNA Mini Kit (Invitrogen), according to the manufacturer's instructions. Nucleic acids were treated with 1 U^g of RNase III (Ambion), 10 U^g of RNaseH (Invitrogen) or 3 U^g calf intestine alkaline phosphatase (New England Biolabs) according to the
manufacturer's instructions. Subsequent to treatment, RNA concentration was measured with aNanodrop, and 400 ng of each nucleic acid or 1 μg/mL PolyLC (Invivogen) was transfected into HT29 recipient cells.
ELLS A. IFNB ELISA was performed with the Verikine-HS™ Human Interferon Beta Serum ELISA kit (PBL Interferon Source) and IFNL ELISA was performed with the DuoSet ELISA for Human IL- 29/IL28-B (IFNL 1/3) kit (R & D Systems).
Lentiviral transduction to create stable knockdowns. TLR3, MAVS, STING and GFP knockdowns were created in A2780, Hey, and TykNu cell lines. Virus production and infections were carried out according to established methods (Stewart et al, 2003).
The short hairpin sequences used were:
shTLR3A 5'-CCTTACACATACTCAACCT-3' (SEQ ID NO: 104)
shTLR3D 5'-CCTCTTCGTAACTTGACCA-3' (SEQ ID NO: 105)
shGFP 5'- GCAAGCTGACCCTGAAGTTCAT3-3' (SEQ ID NO: 106)
shMAVS 5' -GCATCTCTTCAATACCCTT-3' (SEQ ID NO: 107)
shSTINGC 5'- GCATGGTCATATTAC ATCG-3 ' (SEQ ID NO: 108) shSTINGD 5 ' -GTCC AGGACTTGAC ATCTTAA-3 ' (SEQ ID NO: 109)
ERV absolute quantitative real time PCR fqPCR). PCR cDNA amplification was performed and fragments cloned into TopoTA vectors (Invitrogen) for all new ERV genes not previously analyzed as stated above (Strissel et al, 2012) (Tables 3 and 4). qPCR analyses of all cloned env and other ERV genes with a known copy number was used as an external standard to generate a standard curve with a cycle threshold (CT) value against the log of amount of standard. Importantly, a similar PCR efficiency (over 97 %) between all env genes was needed for comparison. Similar standard curves of all env genes were obtained for the SYBR-Green based qPCR with the following slopes and calculations (Strissel et al, 2012) and Tables 3 and 4).
ERV env genes were amplified by qPCR from 40 ng of cell line cDNA with SYBR- green technology and analyzed with an ABI7300 (ABI, Darmstadt, Germany) according to Strissel et al, 2012). Expression values were calculated as molecules (mol) per ng total RNA using a standard curve of each cloned env gene determined by real time PCR and calculated as mean +/- standard deviation of the mean (S.E.M.) according to (Ruebner et al, 2013) (Ruebner et al, 2012). qPCR analyses of all cloned env and other ERV genes with a known copy number was used as an external standard to generate a standard curve with a cycle threshold (CT) value against the log of amount of standard. Importantly, a similar PCR efficiency (over 97 %) between all env genes was needed for comparison. Similar standard curves of all env genes were obtained for the SYBR-green based qPCR with the following slopes and calculations (Strissel et al., 2012) and Tables 3 and 4).
Transfection and Over expression of ERV-env vectors. For transfections (per 35mm dish and 2 ml media) 3μg of each vector in 100 μΐ 150 mM NaCl in a ratio with 6μ1 JetPEI in 100 μΐ 150 mM NaCl was used according to manufacturer's instructions (JetPEI, PeqLab). Syncytin-1 on 7q21.2 (NM_014590.3) was amplified from human control placenta (1617 bp) and cloned via Eco Rl into pcDNA3.1/myc-HisB (Invitrogen) with an N-terminal CMV- promoter and C-terminal myc and 6x-His epitopes. The ERV-W1 URE/ 5'LTR without the U5 region (URE-U3-R) (-613 to +133 nt) on chromosome 7q21.2 was amplified with PCR from human control placenta and cloned via Kpnl and Hind III into pGL3-basic (Promega) (Ruebner et al. 2013). The new pGL3-LTR vector was incubated with Nco I and Xba 1 deleting the luciferase gene and Syncytin-1 (1617 bp) was cloned into the Nco I and Xba 1 sites of pGL3-basic without luciferase and sequenced (5' LTR-Syn-l-pGL3). The vector of ERV-W2 env (phCMV-Xq22.3 env FL) was a kind gift from Dr. K. Ruprecht, Charite, University Medicine, Berlin and represents the env-W2 cDNA but only has a partial codogenic env due to a stop codon (Table 2) (Roebke et al, 2010). The p3Xfiag-CMV-14 vector contains the ERV-3 env full length cDNA and was contributed by Dr. Neal Rote, Case Western University. The pEGFPNl vector was purchased (CloneTech Laboratories, Inc.). A pCMV-Tag vector (Stratagene) contains the human wild type ERa cDNA and is called HEGO-CMV-ERa and was a kind gift from Dr. R.X. Song, University of Virginia, USA. Following transfection of HEGO-CMV-ERa into an ER minus carcinoma cell line an ERa full length 66 KD protein was observed (Strissel et al Oncotarget, 2012).
ERV siRNA Knockdown Experiments. A2780, Hey and TykNu ovarian cancer cell lines were treated with 500 nM of Aza (Sigma; St. Louis, Missouri) for 72 hours while in log- growth phase, changing the media and drug every 24 hours. The next day (Day 4) following Aza treatment, the cells were transfected using Hyperfect reagent (Qiagen) according to manufacturer's instructions with siAlexa scrambled (80nM) (Allstars Neg siRNA AF488, Qiagen) to achieve transfection efficiency above 85% and also to represent a negative mock control. Cells were also transfected with two 21bp siRNAs targeting Syncytin-1 (each 40nM) (Ambion, Life Technologies, IDs26922; IDs26920) or two siRNAs targeting ERV-3 (40nM) (Ambion, Life Technologies, IDs4817; IDs4818) or one siRNA combined together from each gene (each 40nM). RNA was isolated at 72 hours post transfection to ensure gene knockdown and at Day 10 from initial Aza treatment to address the expression of genes in the interferon response.
First strand cDNA synthesis and strand specific PCR for detection of sense and antisense ERV transcripts using TASA-TD methodology. Components from the Superscript III First-Strand Synthesis System for RT-PCR (Life technologies, Germany) were adapted to perform reverse transcription with RNA from ovarian cancer lines A2780, Hey, TykNu the colon cancer cell line DKO and its parental cell line HCT116. For first strand cDNA synthesis 50ng RNA was used for β-actin with all cell lines; Syncytin-1 (400ng for A2780, Hey, TykNu, HCT116 and 200ng for DKO) and env-Fc2, [A2780 (200ng), Hey and TykNu (400ng), HCT116 (200ng), DKO (100ng)]. Ι μΜ of a gene specific primer ligated to a TAG- sequence not specific for the human genome (GSP sense/antisense (RT) TAG) was implemented in the reaction. RNA and primers were preheated at 65°C for 5min. For the total reaction: the GSP-TAG, 0.5mM dNTP, 5mM MgC12, lOmM DTT, 40U RNaseOUT, 100U SuperScriptlll® RT (life technologies, Germany) and 240ng Actinomycin D (Sigma, Germany) were added with the RNA for a 20μ1 reaction. Synthesis was performed at 50°C for 50 min and terminated at 85°C for 5 min. RT with extremely low intrinsic RNase H activity (for cleavage of RNA from RNA/DNA duplexes) and Actinomycin D was added to prevent second strand cDNA RT resulting in antisense artifacts (PMID 17897965). After cDNA synthesis 2U recombinant RNase H (life technologies) was added to each reaction and incubated 20 min at 37°C. Finally the first strand cDNA mix was ethanol precipitated and resuspended in 10 μΐ sterile water. Afterwards gene and strand specific PCR was performed. PCR reactions were implemented with the Fast-Start Taq- Polymerase Kit (Roche) as described above (PCR analysis). To amplify sense cDNA and antisense cDNA a TAG- primer and GSP sense (PCR) and a TAG-primer and GSP antisense (PCR) were used, respectively. We performed sense and antisense specific PCR using both sense and antisense cDNA of β-actin as an internal negative control that was previously demonstrated to have no antisense transcript (PMID 15356298). All cDNA products were electrophoresed on 1% agarose gels, visualized using ethidium bromide and then Tif-images quantified using Image!
Primary ovarian serous carcinomas Following dissection of primary serous ovarian carcinoma tissues (n=19) and healthy control ovarian tissues (n=9) (performed by a pathologist at the Institute of Pathology, Erlangen), all tissues were flash frozen in liquid nitrogen and then stored at -80°C. Please note that Tumor 12 was not represented. Clinical data for the primary serous ovarian carcinomas include mean age (55.1 years) and tumor stage and grading (IIB/G2 n=l; IIC/G2 n=l; IIIC Gl n=l; IIIC/G2 n=3; IIIC/G3 n=8; IV/G2 n=l; IV/G3 n=4). Clinical data for healthy control ovarian tissues include mean age (53.7 years) where healthy tissues were dissected from ovaries with ovarian cysts (n=4), uterine leiomyoma (n=l); dermoid (n=l); and patient matched n=l and non-patient matched normal ovarian tissues from ovarian carcinomas. For experiments, 20-50mg of tissue was demembranated and the RNA isolated and cDNA synthesized according to (Strissel et al, 2012). All cDNAs were quantified for 22 ERV env genes to determine molecules / ng RNA (identical env genes as in FIG. 5 but not including gag-W5, env-MER34, ERV-FXA34 and ERV9-1).
Bl 6-F10 Melanoma Mouse Model. All mouse procedures were performed in accordance with the institutional protocol guidelines at the Memorial Sloan Kettering Cancer Center (MSKCC; New York, NY). C57BL/6J mice (6-8- week-old females) were obtained from The Jackson Laboratory. C57BL/6J mice were subcutaneously injected with 1x105 B16-F10 tumor cells. On days 4, 8, 11, 14, 18, the mice were treated intraperitoneally with anti-ctla-4 (100 μg in 100 μΕ). For Aza treatment, mice received two cycles of
intraperitoneal injection of 0.1 to 0.75 mg/kg Aza in PBS for 5 consecutive days followed by 7 days off treatment, starting at day 8. Control groups received a corresponding dose of non- specific isotype antibody control and PBS intraperitoneally. Mice with no palpable tumors on day 8 were eliminated from our study and tumor surface was measured with a caliper using the ellipse surface formula (Length*Width*n)/400. Tumor surface measurements were imported in Graphpad Prism 6 and a two way ANNOVA was used to compare tumor growth between each of the group with anti-ctla4 monotherapy. Reported p values were adjusted using after Dunnett multiple comparison test (df=512).
Table 1. ERV Primers.
Figure imgf000042_0001
Figure imgf000043_0001
THE REMAINDER OF THIS PAGE IS INTENTIONALLY LEFT BLANK
Figure imgf000044_0001
Figure imgf000045_0001
Results
DNMTis trigger viral defense and type I interferon signaling. Induction of AIM in a previous study of 23 EOC cell lines (Li et al, 2014) included, in addition to previously reported DNA hypermethylated cancer testis antigens (MAGEA4, MAGEA9, NY-ESO-1) (James et al, 2013; Karpf et al., 2009; Karpf et al, 2004; Odunsi et al, 2014), interferon/viral defense, antigen processing and presentation, and host immune cell attraction genes (FIG. la). Direct Aza targeting of DNMTs for these changes is suggested by similar findings in DKO colon cancer cells genetically disrupted for two major DNMTs (DNMT1- /-, DNMT3B - /-) versus parental, wild type HCT116 cells (FIG. 1 A). The induced responses may not be a general stress phenomenon as they do not occur with carboplatin, a cytotoxic agent commonly used in EOC treatment (FIG. IB). Aza and Dac incorporate into DNA, inhibiting 3 DNA methyltransf erases (Schaefer et al, 2009), but Aza also incorporates into RNA, inhibiting the RNA methyltransferase DNMT2. Aza thus can demethylate RNA, and unmethylated RNA may activate TLR3 and the interferon response (Kariko et al, 2005). However, Dac and Aza both mimic the DKO cell line results (FIG. 1A, C, D; SI A, B) strongly suggesting that the drugs directly target DNA methylation to trigger the interferon response.
Aza and Dac similarly trigger an interferon response that includes interferon beta (ΙΡΝβΙ) and a panel of Interferon Stimulated Genes (ISGs; IFI16, IFI27, IFI44, IFI44L, MXl, OASL) (FIG. 1C,D, FIG. SI A, B). Each ISG functions predominantly in anti-viral and anti-proliferative signaling (FIG. 2A). In four EOC cell lines, key upstream genes in the Type I Interferon pathway (ΙΡΝβ, IRF7, and STAT1) were generally upregulated at the 4th day following the end of Aza treatment ("Day 7") and further increased by Day 10 (FIG. 1C, D, SlA,b). Importantly, cytosolic sensors for DNA (MB21D1/CGAS and
TMEM173/STING) and RNA (DDX41 and DDX58) were also variably upregulated (FIG. 1C, D, FIG. SI A, B). In A2780 and TykNu, but not Hey or Kuramochi, cell lines, variable increases occured in Type III interferon signaling genes, also involved in response to viruses (Ding and Robek, 2014). These included IFNL1 (IL28A) and IFNL3 (IL29) ligands (FIG. SIC) and especially the IFN III receptor IFNLR1 (FIG. SIC), known to be methylated and activated by epigenetic therapy (Ding et al, 2014).
Key viral RNA sensing proteins include TLR3 on the endosomal membrane and MDA5, PKR, and RIG-I in the cytoplasm (FIG. 2A). These induce IRF3, IRF7, and NF-KB to translocate to the nucleus and activate transcription of IFNβ1 (Ivashkiv and Donlin, 2014). IRF7 is frequently promoter DNA hypermethylated in cancer and the associated low basal expression can be reversed by Aza in squamous NSCLC (Wrangle et al, 2013). Among 23 EOC lines examined, IRF7 was hypermethylated in only one, A2780 (Li et al, 2014) (FIG. S3A), potentially not a classic high-grade EOC (Anglesio et al, 2013; Domcke et al, 2013). Aza induces partial IRF7 demethylation and increased expression in this cell line at Days 7 and 10 while carboplatin did not (FIGS. S3A, 1B,C) and IRF7 knockdown significantly reduced the Aza interferon response (FIG. S3B,C). Such IRF7 induction does not occur in two EOC lines or the HCT116 colon cancer cell line where the gene is not hypermethylated (FIGS. ID, S1A,B, S3A).
When IRF7 is not silenced, other mechanisms must then be operative for Aza to trigger viral defense signaling. Secreted IFNβ is critical to this signaling and, through interaction with surface receptors IFNARl/2, activates JAK/STAT signaling, transcription of ISGs, and resultant translation inhibition and apoptosis (Platanias, 2005) (Ivashkiv and Donlin, 2014) (FIG. 2 A). Indeed, media transferred to untreated cells from Aza-treated cells 7 days after drug withdrawal causes an interferon response with increased expression of ISGs IFI27, IFI44, and IFI44L (FIG. 2B). Moreover, Aza treatment induced secreted IFNβ in media (FIG. 2C, FIG. S2a) and an IFNβ blocking antibody significantly blocked the Aza induced ISG media response (FIG. 2B). Like Type I IFN signaling, Type III IFN signaling can be activated by viral infection (Robek et al, 2005) (Ding and Robek, 2014). However, even though we observed upregulation of Type III ligand transcripts IFNL1 (IL28A) and IFNL3 (IL29) (FIG. SIC), secreted Type III interferon proteins are undetectable by ELISA (FIG. S2B).
Aza appears to activate Type I, IFNβ mediated signaling through JAK/STAT, as the JAK/STAT inhibitor ruxolitinib strongly reduces ISG responses (FIG. 2D, S2C). Further, antibody blocking of IFNAR2, the IFNβ receptor, abrogates Aza induction of IFI27, IFI44L, and IFI6 transcription (FIG. 3A, S2D), as does inhibition of IFNβ itself (FIG. 3B, S2E). In contrast, blocking the Type III interferon, ILIORB receptor, gives only a modest block of IFI27 increase (FIG. S2F). IFNβ binding to IFNAR2 also may contribute to late, Aza induced apoptosis that peaks at 4-7 days after Aza withdrawal, since anti-IFNAR2 leads to a lower ratio of cleaved/total PARP (FIG. 3A,C). (FIGS. 3C, S2F).
DNMTis trigger viral defense through induction ofdsRNA. Aza-induced viral defense genes and IFNβ1 are not generally DNA methylated at promoter regions (Li et al, 2014), thus Aza may activate the pathway upstream of these genes. We considered increases in dsRNA, viral ssRNA, and unmethylated CpG DNA that might trigger cytosolic sensors (Sun et al, 2013). Indeed, 3 days after ending Aza treatment of A2780 and TykNu ovarian cancer cells and subsequent transfection into HT29 colon cancer cells, known to have a robust interferon response (Chiappinelli et al, 2012), cytoplasmic total RNA (without rRNA) and PolyA+ RNA, but not Poly A- RNA or DNA, increased IIFNβ1 transcripts (FIG. 3d). Further, RNaselll treatment of the cytosolic nucleic acids, which specifically digests dsRNA, eliminated the IFNβ1 upregulation (FIG. 4A), but this was not seen with RNaseH treatment that digests DNA-RNA hybrids (FIG. S4A).
If dsRNA is required for the above Aza effects, then the key cytosolic sensors, TLR3, MDA5 (IFIH1) and RIG-I (DDX58), the latter two signaling through the mitochondrial protein, MAVS, should be involved in subsequent IFNβ1 induction (FIG. 2A). Aza increased transcript (FIG. la) and protein levels for these (FIG. 4B). However, RIG-I, which requires a 5' triphosphate group on RNA for activation, is likely not a key player since alkaline phosphatase treatment of cytosolic nucleic acid fractions did not abolish IFNβ1 upregulation (FIG. S4d). In contrast, knockdown of TLR3 and MAVS in A2780 cells (FIG. 2a) decreased by twofold Aza upregulation of interferon genes IFNB1, IFI44, IFI44L and IFI27 as did MAVS knockdown (FIGS. 4C,D; S4B,C). In TykNu, knockdown of TLR3 and MAVS significantly blunted Aza induction of these gene responses (FIG. S4B,C). Importantly, knockdown of STING, the cytosolic DNA sensor (Mankan et al, 2014) did not blunt Aza induced interferon signaling (FIG. 4C,D). A previous report had implicated STING in viral cytosolic sensing in B cells, but this was dependent upon viral reverse transcriptase activity, likely to be low in our cells (Mankan et al, 2014). We thus conclude that MAVS and TLR3 are centrally involved in Aza triggering cytosolic sensors to induce an interferon response.
Aza-induced human endogenous retrovirus (ERV) transcripts can activate viral de fense responses in EOC. The above data suggests Aza might activate endogenous retroviral sequences (ERVs) that constitute more than 8% of the human genome, can activate cytosolic RNA sensors, and are silenced in normal somatic cells by promoter DNA methylation (Bannert and Kurth, 2004) (Tristem, 2000) (Hurst and Magiorkinis, 2014) (Mankan et al, 2014). Some cancers lose ERV DNA methylation and aberrantly overexpress ERVs (Chen et al, 2004; Cohen et al, 1988; Larsen et al, 2009; Larsson et al, 2007; Rycaj et al, 2014; Strick et al, 2007; Strissel et al, 2012; Wang-Johanning et al, 2001 ; Wang- Johanning et al, 2007) while others maintain silencing. Aza can induce specific ERV transcripts in melanoma, choriocarcinoma, and endometrial cancer cells (Laska et al, 2013; Ruebner et al, 2013; Stengel et al, 2010) (Strissel et al., 2012). Indeed, in initial testing, the ERVK subfamily (Wang-Johanning et al, 2003) transcripts increased 2.5-fold in the A2780 cell line upon Aza treatment (data not shown). Upregulation of individual ERVs (22 full length env, 6 partial coding env, one full length gag, and two partial coding poh) (Tables Sl- S2), in PCR assays for non-repeat sequences, occur especially, at Day 7, coinciding with ISG expression, in three EOC lines following Aza and Dac treatment (FIG. 5A,B, FIG. S5A,B,C). These include several known ERV env genes like Syncytin-1, ERVS, env-K and env-H (Blond et al, 1999; Lower et al, 1993; Mi et al, 2000; Rote et al, 2004) and at especially high levels, env-Fc2, a less well characterized gene (Benit et al, 2003). Finally, in DKO as well as Aza treated A2780 and TykNu cells, loss of env-Fc2 promoter methylation correlates with increased Fc2 expression (FIGS. 5B, 6A-C, S6A) but not in Hey cells (FIG. S6A).
Further linking ERVs with a dsRNA-triggered IFN response, bidirectional transcription producing sense and anti-sense transcripts occurred for Syncytin-1 and five env- Fc2 gene loci, but not β-actin, in three EOC lines and HCT 116 and DKO cells (FIG. 5C, Tables 3 and 4), analyzed by the TAG-aided sense/antisense transcript detection (TASA-TD) technique (Henke et al, 2015). Such sense and antisense transcripts can form dsRNA (Faghihi et al, 2008; Su et al, 2012). Interestingly for TykNu there was a 6.69-fold increase of env-Fc2 antisense transcript levels compared to the sense transcript (FIG. 5C) but substantially lower antisense transcripts were seen in both HCT116 and DKO cells (FIGS. 5C, 6A). Disrupting DNMTs seems integral to the above ERV upregulation since increases of env-Fc2 and erv9-l occurred in DKO versus wild type HCT 116 cells (FIG. 6 A).
ERV transcripts seem directly involved in the Aza responses in that, first, although druginduced upregulation of ERV transcripts begins early after Aza, both ERVs and viral defense gene increases generally peak by day 7 (FIGS. 5, S5). Second, ERV env proteins such as Synl and ERV-3 are not increased after Aza treatment, supporting a dominant role for viral defense signaling via RNA transcripts (FIG. 6D, FIG. S6B, and C). Third, overexpression of ERVS, EnvW2, and Syncytin-1 in TykNu (FIG. 6e-j), A2780 (FIG. S6S), and Hey cells (FIG. S6E), as compared to control genes, increase, at the transcript but not the protein levels, the same interferon genes induced by Aza (ΙΕΝβΙ, IFI27, and IFI44L). The increases often exceeded that for the drug likely because total ERV RNA molecules are higher in the overexpression experiments (FIG. S6F-I). Finally, although siRNA knockdown of individual ERVs (Syncytin-1, ERV-3) during Aza treatment produced more complex results, targeting two ERVs significantly blunts the Aza induced gene expression of IFI27, IFI44L, and IFI6 in TykNu cells, but not A2780 or Hey cells (FIG. S7A).
Importantly, a driving role for ER V transcripts in triggering Aza-induced viral defense gene responses is evidenced by a high correlation of basal levels of both in 19 primary EOC. Total molecules of 22 ERV env genes queried are increased (p<0.05) in tumor versus normal (n=9) and divide tumors into lower (n=9) and higher ERV (n=10) expression groups as compared to normal controls. High ERV tumors have significantly higher viral defense response gene expression (p=0.000141) (FIG. 7 A).
Viral defense gene levels divide human tumors into high and low expression groups that track with responses to immune checkpoint therapy. Human cancers can evolve immune evasion to become less responsive to immune modulation (Drake et al, 2006) (Schreiber et al., 2011). In this regard, basal transcript levels for the Aza-induced viral defense genes group primary EOC, breast, colon, and lung cancers, and melanoma from The Cancer Genome Atlas (TCGA) studies into high and low groups (FIG. 7B, FIG. S7C-F). For EOC, this basal expression divides tumors into high, medium, and low expression groups and the former two encompass virtually all of the TCGA (Verhaak et al 2013) immune reactive (IMR), good prognosis tumors. The Low group encompasses the PRO (high proliferative), poor prognosis subtype (p<0.001 to .0001 -FIGS. 7B, S7B)). Interestingly, virtually all of the right sided colon cancers with a high DNA hypermethylation frequency phenotype (p< 002), termed CIMP, which have a high burden of DNA mutations and respond robustly to immune checkpoint therapy (Le et al, 2015), are in the High and Intermediate groups (FIG. S7C). High mutation burden has recently been defined as a key correlate to response to immune checkpoint therapy (Rizvi et al, 2015) (Snyder et al, 2014). Similar sharp high versus low clustering is seen for subgroups of breast and lung cancers and melanoma (Guan et al, 2015) (FIG. S7D-F), the last being very responsive to immune checkpoint therapy (Topalian et al, 2015) (Hodi et al, 2010) (Weber et al, 2015).
Could the levels of viral defense pathway signaling correlate with improved responses to immune checkpoint therapy? Indeed, for RNASeq trans criptomes of melanoma patients treated with anti-CTLA-4, high levels of the viral defense signature expression in tumor samples correlate with long term benefit (disease control [stable disease or better] >6mo as measured radiographically) in patients treated with anti-CTLA-4 therapy (Snyder et al, 2014) (FIG. 7C,D; Tables S5, S6). Importantly, high viral defense signature again correlates with high mutational burden (FIG. 7c).
Aza treatment potentiates immune checkpoint therapy in a mouse model of melanoma. In the B16-F10 mouse melanoma model, multiple combinations of low dose Aza directly enhance tumor responses to anti-CTLA4 immune checkpoint therapy (FIGS. 7E,F, S7G). Further, B16 cells treated in vitro with Aza, then injected into mice and treated with anti- CTLA-4, are even cleared completely (data not shown). Thus DNMTis can potentiate the anti -tumor effects of immune checkpoint inhibitors.
Discussion
Our present data now provide functional context for our earlier reports that DNMTis induce a complex set of immune pathway responses in tumor cells (Li et al., 2014; Wrangle et al, 2013). DNMTis trigger cytoplasmic dsRNA sensing, central to cellular viral defense responses, and activate interferon in EOC and colon cancer cells by disrupting DNMTs. This activation could induce tumor attraction of lymphocytes (Ivashkiv and Donlin, 2014). There are some important implications for one of the most exciting new developments in cancer treatment, immune checkpoint therapy (Brahmer et al., 2012) (Berger et al, 2008; Brahmer et al., 2010; Leach et al, 1996; Topalian et al, 2015) (Hodi et al., 2010) (Weber et al, 2015) and for underlying mechanisms inherent to both tumor and host cells for reversal of immune tolerance in tumor infiltrating T-lymphocytes (Pardoll, 2012). Indeed, our basal levels of viral defense gene transcripts divide EOC, and other major cancer types in TCGA, into low and high expression subgroups. Perhaps most intriguingly, such high basal expression in tumors tracks with favorable patient responses in a trial of immune checkpoint therapy for advanced melanoma, and strong Aza sensitization to immune checkpoint therapy is seen in a pre-clinical mouse melanoma model.
A major trigger of the Aza-induced viral defense response appears to be bidirectional transcription of ERVs that are known to fold into dsRNA secondary structures. ERVs, representing more than 8% of the human genome (Bannert and Kurth, 2004; Tristem, 2000), integrated into the genome of mammals between 0.1 and 40 million years ago via exogenous retroviral infections of germ cells (Egan et al, 2004; Turner et al, 2001). Most ERV genes are non-functional due to DNA recombination, mutations and deletions, but some produce functional proteins including group-specific antigen (gag), polymerase (pol) with reverse transcriptase (RT) and the envelope (env) surface unit (SU) with a transmembrane immunosuppressive-like peptide (Mi et al, 2000) (Blaise et al, 2005; de Parseval et al, 2003; Villesen et al, 2004). The env gene of ERVW-1 (chromosome 7q21.2) called Syncytin- 1 has an essential role in placentogenesis (Blond et al, 1999; Mi et al, 2000).
Importantly, and key to our findings, a major function of DNA methylation in humans is silencing of ERVs and other viral sequences in the human genome; up to 90% of methylated CpGs are located in 45% of the human genome harboring repetitive elements like ERVs (Walsh et al, 1998) (Bestor and Tycko, 1996). However, ERV genes are
unmethylated and expressed in embryonic stem cells (Santoni et al, 2012) and especially Syncytin-1 is epigenetically regulated throughout placentogenesis (Matouskova et al, 2006). Some tumors have ERV demethylation and increased expression such as the ERV-K (HML- 2) 5'LTR-UTR in melanoma (Stengel et al, 2010) and the 5'-LTR region of several ERVs in testicular cancer (Gimenez et al., 2010). A 20% overall mean demethylation of single CpGs in the ERVW-1 5' LTR regulating Syncytin-1 correlates with increased expression in endometrial cancer (Strissel et al, 2012). Indeed, ERVs can be targeted as tumor-associated antigens on melanoma cells (Cooper et al, 2015). In contrast, as in our present data, and those of others (Maksakova et al, 2008), in some cancers, individual ERVs can maintain full or partial promoter DNA methylation and low expression and DNMTis can induce ERV demethylation and viral defense signaling in human embryonic stem cells (Grow et al., 2015).
In addition to ERVs, other noncoding RNAs could contribute to the Aza-induced immune response, such as repetitive Alu elements (Tarallo et al, 2012). UV light can damage small nucleolar RNA and activate an interferon response via TLR3 (Bernard et al.,
2012) and very high dose (10 μΜ) Dac can induce an interferon response, apoptosis, increased ERVs and repetitive satellite RNAs in p53-null mouse fibroblasts (Leonova et al,
2013) . We suspect, however, that such high Dac doses induce DNA damage rather than simply epigenetic effects. Half of the ovarian cancer lines we studied (Li et al, 2014) have wild-type P53 but we see no differences in Aza interferon response between these and those with mutant P53.
The high translational connotations of our findings, including the small number of patients in clinical trials for NSCLC who may have been sensitized by epigenetic priming to immune therapy (Wrangle et al., 2013), remain to be validated in larger clinical trials. These are ongoing for NSCLC (Brahmer, 2015) and planned for advanced ovarian cancer.
Moreover, ERV-K env proteins have been shown to increase immunotherapeutic potential of melanoma, breast, and ovarian cancer patients (Rycaj et al, 2014; Wang-Johanning et al, 2012) (Cooper et al, 2015). Also, our hypotheses that drugs like Aza might sensitize patients with multiple cancer types to immune checkpoint blockade and other immunotherapies are further strengthened by the data in our pre-clinical melanoma model. For immune checkpoint therapy, in addition to the functional significance of our data, a potential biomarker strategy is suggested by our findings in a melanoma trial. The high correlation of viral defense signaling with mutational burden suggests that genetic changes, increases in ERVs, and viral defense genes could predict response to immune checkpoint and other immunomodulatory approaches. Finally, our drug approach to upregulate viral defense signaling might be compared to the use of oncolytic viruses to induce inflammatory immune infiltrates at tumor sites to sensitize to immunomodulation (Zamarin et al, 2014).
THE REMAINDER OF THIS PAGE IS INTENTIONALLY LEFT BLANK
Table 3. Primers used to amplify ERVs.
Figure imgf000053_0001
Table 4. ERV absolute quantification.
Figure imgf000053_0002
ERV env genes and calculation bases for the absolute quantification: γ, t, and R2 representing the values of each standard curve, with γ= slope; t= intercept and R2=correlation coefficient (efficiency). Table 5. Primers used for TASA-TD method.
Figure imgf000054_0001
Table 6. Primers used for MSP and COBRA.
Figure imgf000054_0002
Figure imgf000055_0001
Figure imgf000056_0001

Claims

We claim:
1. A method for treating a patient having cancer comprising the steps of:
a. generating endogenous retrovirus (ERV) expression data from a biological sample obtain from the patient;
b. classifying the ERV expression data from the biological sample as ERV high or low based on a comparison to a control or reference; and
c. treating the cancer patient with immunotherapy if the ERV expression data from the biological sample is classified as ERV high or treating the cancer patient with epigenetic therapy followed by immunotherapy if the ERV expression data from the biological sample is classified as ERV low.
2. The method of claim 1, wherein the biological sample is a solid tumor sample.
3. The method of claim 1, wherein the cancer is ovarian.
4. The method of claim 1, wherein the cancer is melanoma, colorectal, breast or lung cancer.
5. The method of claim 4, wherein the lung cancer is non-small cell lung cancer (NSCLC).
6. The method of claim 5, wherein the cancer is a carcinoma.
7. The method of claim 1, wherein ERV expression data is generated using polymerase chain reaction (PCR).
8. The method of claim 1 , wherein the PCR is qRT-PCR.
9. The method of claim 1, wherein the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, ERVV-1, ERVV-2, ERVS71-1, ERVPABLB-1, HERV- K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVH-1, ERVH-2, ERVH-3, ERVE4-1, ERVFcl, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVMER34-1, ERVH48-1, ERV9-1, ERV- F(XA34), and ERVW-5.
10. The method of claim 1, wherein the ERV panel comprises one or more of ERVW-1, ERVFRD-1, ERVP(b), ERVR, HERV-K74261, HML-2.HOM/K108, ERV-K17833 C19, HML-2 (K109), ERV-K113, ERV-K115, ERV-K102, ERVE4-1, ERVH-1, ERVH-2, ERVH- 3, ERVFCl-1, ERVFCl-2, ERVFCl-3, ERVFCl-4, ERVFCl-5, ERVW-2, ERVW-5, ERVH48-1 and ERV9-1.
11. The method of claim 1, wherein the ERV panel comprises one or more of ERVW-1, ERVP(b), ERV-3, ERV-Fcl, ERV-Fbl, and ERV9-1.
12. The method of claim 1, wherein the ERV expression data is generated using one or more primers from Table 1.
13. The method of claim 1, wherein the ERV expression data is generated using a microarray.
14. The method of claim 1, wherein the epigenetic therapy comprises treatment with a DNA methyltransf erase inhibitor (DNMTi) and/or a histone deacetylase inhibitor (HDACi).
15. The method of claim 14, wherein the DNMTi is 5-azacytidine or 5-aza-2'- deoxycytidine.
16. The method of claim 1, wherein the immunotherapy comprises treatment with anti PD1 or anti PDL1 antibodies or vaccines.
17. A kit comprising the primers encoded by SEQ ID NOS: 1-62.
18. A kit comprising the primers encoded by SEQ ID NOS: 1-8, 17-52, 55-58 and 61-62.
19. A kit comprising the primers encoded by SEQ ID NOS: 1-2, 5-6, 7-8, 39-40, and 55- 58.
20. The kit of any one of claims 17-19, further comprising reagents and instructions for performing PCR.
21. The kit of claim 20, wherein the PCR is qRT-PCR.
PCT/US2016/022641 2015-03-16 2016-03-16 Methods and compositions for treating cancer Ceased WO2016149366A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562133713P 2015-03-16 2015-03-16
US62/133,713 2015-03-16
US201562190426P 2015-07-09 2015-07-09
US62/190,426 2015-07-09

Publications (1)

Publication Number Publication Date
WO2016149366A1 true WO2016149366A1 (en) 2016-09-22

Family

ID=56919464

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/022641 Ceased WO2016149366A1 (en) 2015-03-16 2016-03-16 Methods and compositions for treating cancer

Country Status (1)

Country Link
WO (1) WO2016149366A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10287353B2 (en) 2016-05-11 2019-05-14 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US10385131B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors
WO2019173456A1 (en) * 2018-03-06 2019-09-12 Board Of Regents, The University Of Texas System Replication stress response biomarkers for immunotherapy response
US20190365836A1 (en) * 2017-01-13 2019-12-05 Mayo Foundation For Medical Education And Research Materials and methods for treating cancer
WO2023069943A1 (en) * 2021-10-18 2023-04-27 Dana-Farber Cancer Institute, Inc. Combination decitabine and mps1 inhibitor therapy to prime cancer immunogenicity
CN116773814A (en) * 2023-06-25 2023-09-19 复旦大学附属肿瘤医院 Breast cancer treatment sensitivity prediction marker
CN118641759A (en) * 2024-06-21 2024-09-13 杭州师范大学 SUPYN use as tumor markers
US12187758B2 (en) 2022-03-15 2025-01-07 Rome Therapeutics, Inc. Compounds and methods for treating disease

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120321637A1 (en) * 2011-06-20 2012-12-20 The Board Of Regents Of The University Of Texas System Combination cancer therapy with herv inhibition

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120321637A1 (en) * 2011-06-20 2012-12-20 The Board Of Regents Of The University Of Texas System Combination cancer therapy with herv inhibition

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANDERSSON ET AL.: "ERV3 and related sequences in humans: structure and RNA expression", JOURNAL OF VIROLOGY, vol. 79, no. 14, 2005, pages 9270 - 9284, XP055311165 *
RUEBNER ET AL.: "Reduced syncyt in-1 expression levels in placental syndromes correlates with epigenetic hypermethylation of the ERVW-1 promoter region", PLOS ONE, vol. 8, no. Issue No.2, 2013, pages 1 - 10, XP055311168 *
STRISSEL ET AL.: "Reactivation of codogenic endogenous retroviral (ERV) envelope genes in human endometrial carcinoma and prestages: Emergence of new molecular targets", ONCOTARGET, vol. 3, no. 10, 2012, pages 1204 - 1219, XP055311160 *
TRISTEM: "Identification and characterization of novel human endogenous retrovirus families by phylogenetic screening of the human genome mapping project database", JOURNAL OF VIROLOGY, vol. 74, no. 8, 2000, pages 3715 - 3730, XP002996133 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10385130B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US10385131B2 (en) 2016-05-11 2019-08-20 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors
US10287353B2 (en) 2016-05-11 2019-05-14 Huya Bioscience International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US11535670B2 (en) 2016-05-11 2022-12-27 Huyabio International, Llc Combination therapies of HDAC inhibitors and PD-L1 inhibitors
US12122833B2 (en) 2016-05-11 2024-10-22 Huyabio International, Llc Combination therapies of HDAC inhibitors and PD-1 inhibitors
US11865150B2 (en) * 2017-01-13 2024-01-09 Mayo Foundation For Medical Education And Research Materials and methods for treating cancer
US20190365836A1 (en) * 2017-01-13 2019-12-05 Mayo Foundation For Medical Education And Research Materials and methods for treating cancer
US12414974B2 (en) 2017-01-13 2025-09-16 Mayo Foundation For Medical Education And Research Materials and methods for treating cancer
WO2019173456A1 (en) * 2018-03-06 2019-09-12 Board Of Regents, The University Of Texas System Replication stress response biomarkers for immunotherapy response
US11851712B2 (en) 2018-03-06 2023-12-26 Board Of Regents, The University Of Texas System Replication stress response biomarkers for immunotherapy response
WO2023069943A1 (en) * 2021-10-18 2023-04-27 Dana-Farber Cancer Institute, Inc. Combination decitabine and mps1 inhibitor therapy to prime cancer immunogenicity
US12187758B2 (en) 2022-03-15 2025-01-07 Rome Therapeutics, Inc. Compounds and methods for treating disease
CN116773814A (en) * 2023-06-25 2023-09-19 复旦大学附属肿瘤医院 Breast cancer treatment sensitivity prediction marker
CN118641759A (en) * 2024-06-21 2024-09-13 杭州师范大学 SUPYN use as tumor markers

Similar Documents

Publication Publication Date Title
WO2016149366A1 (en) Methods and compositions for treating cancer
Strati et al. Prognostic significance of PD-L1 expression on circulating tumor cells in patients with head and neck squamous cell carcinoma
Lim et al. Thioredoxin and thioredoxin-interacting protein as prognostic markers for gastric cancer recurrence
US9315869B2 (en) Marker for predicting gastric cancer prognosis and method for predicting gastric cancer prognosis using the same
US10619210B2 (en) Predicting response to epigenetic drug therapy
AU2014364520B2 (en) Methods and assays relating to circulating tumor cells
Zhong et al. LncRNA AC099850. 3 promotes hepatocellular carcinoma proliferation and invasion through PRR11/PI3K/AKT axis and is associated with patients prognosis
Patnaik et al. MiR-205 and MiR-375 microRNA assays to distinguish squamous cell carcinoma from adenocarcinoma in lung cancer biopsies
US20140302042A1 (en) Methods of predicting prognosis in cancer
Zhang et al. Identification of long non-coding RNA expression profiles and co-expression genes in thyroid carcinoma based on the cancer genome atlas (TCGA) database
US10648035B2 (en) Methods and compositions for diagnosing and treating gastric cancer
US20130331281A1 (en) Molecular markers for prognostically predicting prostate cancer, method and kit thereof
US20190085401A1 (en) Method for the quantification of pd-l1 expression
US20110071032A1 (en) Novel tumor marker determination
CA2920062A1 (en) Signature of cycling hypoxia and use thereof for the prognosis of cancer
Kloth et al. Elevated expression of SerpinA1 and SerpinA3 in HLA‐positive cervical carcinoma
KR20230025895A (en) Multimodal analysis of circulating tumor nucleic acid molecules
CN110225984A (en) Identify the method and therapeutic choice of risk of cancer
WO2020175903A1 (en) Dna methylation marker for predicting recurrence of liver cancer, and use thereof
Sun et al. Hedgehog interacting protein 1 is a prognostic marker and suppresses cell metastasis in gastric cancer
JP2025540676A (en) Cell-free DNA methylation testing for breast cancer
Long et al. Prognostic value of JAK3 promoter methylation and mRNA expression in clear cell renal cell carcinoma
Cao et al. Integrating bulk, single-cell, and spatial transcriptomics to identify and functionally validate novel targets to enhance immunotherapy in NSCLC
WO2018183603A1 (en) Method and kit for diagnosing early stage pancreatic cancer
Li et al. The Prognostic and Immune Significance of BZW2 in Pan-Cancer and its Relationship with Proliferation and Apoptosis of Cervical Cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16765654

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16765654

Country of ref document: EP

Kind code of ref document: A1