WO2016142687A1 - Nucleic acid analysis involving surface-anchored nucleic acid probes - Google Patents

Nucleic acid analysis involving surface-anchored nucleic acid probes Download PDF

Info

Publication number
WO2016142687A1
WO2016142687A1 PCT/GB2016/050617 GB2016050617W WO2016142687A1 WO 2016142687 A1 WO2016142687 A1 WO 2016142687A1 GB 2016050617 W GB2016050617 W GB 2016050617W WO 2016142687 A1 WO2016142687 A1 WO 2016142687A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid probe
length
probe
nucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2016/050617
Other languages
French (fr)
Inventor
Philip Nigel Bartlett
Tom Brown
Evanthia Papadopoulou
Nittaya Gale
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Southampton
Original Assignee
University of Southampton
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Southampton filed Critical University of Southampton
Publication of WO2016142687A1 publication Critical patent/WO2016142687A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/60Detection means characterised by use of a special device
    • C12Q2565/607Detection means characterised by use of a special device being a sensor, e.g. electrode
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/60Detection means characterised by use of a special device
    • C12Q2565/632Detection means characterised by use of a special device being a surface enhanced, e.g. resonance, Raman spectrometer

Definitions

  • the present invention relates to a method of nucleic acid analysis, in particular using surface- anchored nucleic acid probes, and associated uses thereof.
  • nucleic acid arrays on solid surfaces have been extensively used in gene expression profiling and the detection of microorganisms using a range of optical (e.g. fluorescence, surface plasmon resonance (SP ), surface enhanced Raman spectroscopy) 1 and electronic sensing platforms.
  • optical e.g. fluorescence, surface plasmon resonance (SP ), surface enhanced Raman spectroscopy
  • a short single-stranded nucleic acid is immobilised on an assay surface via one end, adopting vertical orientation, to promote target binding.
  • end-tethered DNA doesn't necessarily adopt a fixed and upright orientation at the surface, a variety of triggers such as surface potential, 3,4 temperature, pH, ionic strength, 4 the length of the DNA and the nature of the DNA-end that is tethered 5 can influence the orientation and tilting angles on the surface.
  • the high probe density of end-tethered DNA molecules on the surface can lead to slow hybridization kinetics and low hybridization efficiencies, 6 this problem is more intense when real DNA fragments are used as targets (PCR products are usually >100 base pairs).
  • Optimization of the probe density 7 and the use of hybridization rate accelerators (e.g. dextran sulphate, CTAB) 8,9 have been employed to improve the hybridization efficiencies.
  • an aim of the present invention is to improve nucleic acid analysis requiring the use of a nucleic acid probe.
  • a method of analysing nucleic acid in a sample comprising:
  • nucleic acid probe which is anchored to a substrate surface from a point located in a mid-region of the nucleic acid probe
  • a method of analysing nucleic acid in a sample comprising: -providing a nucleic acid probe, which is anchored to a substrate surface from a nonterminal residue of the nucleic acid probe; and
  • the invention allows the specific immobilization of the nucleic acid in a horizontal orientation relative to the substrate surface.
  • Horizontally-immobilised nucleic acid on the substrate surface has several advantages such that it can lead to inherent lower probe density on the surface with increased hybridization efficiency; it can locate the nucleic acid backbone closer to a sensor surface allowing increased sensitivity; and it can allow the nucleic acid to adopt a more fixed orientation on the surface that is less susceptible to external parameters (i.e. pH, surface potential, temperature).
  • the invention provides a simple, straightforward methodology for specific tethering of DNA probes which can use a single anchor, and wherein the anchor can be placed approximately in the middle of the probe to ensure horizontal orientation of the attached nucleic acid.
  • a successful hybridisation of the nucleic acid probe to the target nucleic acid sequence can indicate the presence of the target nucleic acid in the sample.
  • the failure to hybridise the nucleic acid probe to the target nucleic acid sequence may indicate the absence of the target nucleic acid in the sample, or at least the absence of detectable quantities thereof.
  • the method may further comprise detecting the amount or concentration of the target nucleic acid in the sample.
  • Providing a nucleic acid probe molecule anchored to a substrate may comprise
  • nucleic acid probe may comprise or consist of nucleic acid selected from any one of the group comprising DNA, NA, and a nucleic acid analogue, such as PNA or LNA; or combinations thereof.
  • the nucleic acid probe may comprise or consist of DNA.
  • the nucleic acid probe may comprise or consist of PNA.
  • the nucleic acid probe may be at least about 8 nucleotides in length.
  • the nucleic acid probe may be at least about 10 nucleotides in length.
  • the nucleic acid probe may be at least about 12 nucleotides in length.
  • the nucleic acid probe may be at least about 15 nucleotides in length.
  • the nucleic acid probe may be about 20 nucleotides in length.
  • the nucleic acid probe may be no more than about 15 nucleotides in length.
  • the nucleic acid probe may be no more than about 20 nucleotides in length.
  • the nucleic acid probe may be no more than about 30 nucleotides in length.
  • the nucleic acid probe may be no more than about 40 nucleotides in length.
  • the nucleic acid probe may be no more than about 100 nucleotides in length.
  • the nucleic acid probe may be no more than about 150 nucleotides in length.
  • the nucleic acid probe may be between about 8 and about 150 nucleotides in length.
  • the nucleic acid probe may be between about 8 and about 100 nucleotides in length.
  • the nucleic acid probe may be between about 8 and about 80 nucleotides in length.
  • the nucleic acid probe may be between about 8 and about 50 nucleotides in length.
  • the nucleic acid probe may be between about 8 and about 35 nucleotides in length.
  • the nucleic acid probe may be 30 between about 8 and about 30 nucleotides in length.
  • the nucleic acid probe may be between about 8 and about 25 nucleotides in length.
  • the nucleic acid probe may be about 30 nucleotides in length.
  • a plurality of probe nucleic acid molecules may be provided.
  • the nucleic acid probes in a plurality of probes may vary in length.
  • a plurality of nucleic acid probes may have an average length of about 30 nucleotides.
  • a plurality of nucleic acid probes may have an average length of between about 8 and about 50 nucleotides.
  • a plurality of nucleic acid probes may have an average length of between about 8 and about 60 nucleotides.
  • a plurality of nucleic acid probes may have an average length of between about 8 and about 80 nucleotides.
  • a plurality of nucleic acid probes may have an average length of between about 8 and about 100 nucleotides.
  • a plurality of nucleic acid probes may have an average length of between about 8 and about 150 nucleotides.
  • a plurality of nucleic acid probes may have an average length of between about 8 and about 35 nucleotides.
  • a plurality of nucleic acid probes may have an average length of between about 8 and about 25 nucleotides.
  • the nucleic acid probe may comprise a known/pre-determined sequence.
  • the nucleic acid probe may be complementary to the target nucleic acid sequence.
  • the nucleic acid probe may be 100% complementary to the target nucleic acid sequence.
  • the nucleic acid probe may be at least about 95%, or at least about 90% complementary to the target nucleic acid sequence.
  • the nucleic acid probe may be at least about 80% complementary to the target nucleic acid sequence.
  • the nucleic acid probe may be complementary to the target nucleic acid sequence along the whole length of the probe.
  • the nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 8 consecutive nucleotides of the probe.
  • the nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 10 consecutive nucleotides of the probe.
  • the nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 15 consecutive nucleotides of the probe.
  • the nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 18 consecutive nucleotides of the probe.
  • the nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 25 consecutive nucleotides of the probe.
  • the nucleic acid probe may be sufficiently complementary to the target nucleic acid sequence to be able to selectively hybridise under stringent conditions.
  • the nucleic acid probe may hybridise to target nucleic acid, such as under stringent conditions.
  • the nucleic acid probe may be anchored to a substrate surface only from one or more point(s) located in a mid-region of the nucleic acid probe.
  • the nucleic acid probe may be anchored to a substrate surface only from a point located in a mid-region of the nucleic acid probe.
  • the nucleic acid probe may comprise a single anchor point.
  • the nucleic acid probe may not comprise two or more anchor points.
  • the nucleic acid probe may not comprise three or more anchor points.
  • the nucleic acid probe may not be anchored to the substrate from a hairpin loop region of the nucleic acid probe.
  • the anchor points may be immediately adjacent to each other, e.g. on neighbouring nucleotides or the anchors may be attached within the same nucleotide.
  • the anchor points may be attached no more than 4 nucleotides apart on the same strand.
  • the anchor points may be attached no more than 3 nucleotides apart on the same strand.
  • the anchor points may be attached no more than 2 nucleotides apart on the same strand.
  • the anchor points may be attached no more than 1 nucleotide apart on the same strand.
  • the anchor points may not be separated by a major or minor groove when the nucleic acid is duplexed.
  • the anchor points may all be on the same region of the strand where it faces the anchor surface (i.e. not on another region of the strand that would be a helical turn away in the context of duplexed nucleic acid).
  • the provision of only a single mid-region anchor point (or closely positioned anchor points) when anchoring a nucleic acid to a substrate advantageously allows a double helical structure to form and unwind during hybridisation events and during denaturing-hybridisation events, and other nucleic acid manipulation events.
  • two or more anchor points where provided along the strand of nucleic acid, they may interfere with unwinding and hybridisation if they span across the major or minor grooves when the nucleic acid is duplexed.
  • the second strand would be entangled between the nucleic acid probe, the anchors, and the surface.
  • the mid-region of the nucleic acid probe may not comprise a terminal nucleotide of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may comprise a series of nucleotides that are positioned at, or near, to the middle residue of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least 3 nucleotides away from either end of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least 4 nucleotides away from either end of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least 5 nucleotides away from either end of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may not comprise a hairpin loop (otherwise known as a stem loop).
  • the nucleic acid probe comprises a hairpin loop
  • the hairpin loop may be considered equivalent to a terminal nucleotide in position on the probe, for example because it effectively forms an end of the duplexed nucleic acid. Therefore, in an embodiment wherein the nucleic acid comprises a stem loop, the anchor point may be located in the stem of the stem loop, such as in a mid-region of the stem.
  • the mid-region of a stem loop structured nucleic acid may not comprise part of the loop.
  • terminal nucleotide is understood to be the most 5' nucleotide or the most 3' nucleotide, for example the end nucleotide of any particular nucleic acid strand.
  • near-terminal is understood to include the terminal nucleotide, the immediate upstream/downstream nucleotide from the terminal nucleotide. In some embodiments "near- terminal” may also include nucleotides within 1, 2, 3, or 4 nucleotides of the terminal nucleotide.
  • the mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 10% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 20% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 30% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the mid- region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 40% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 45% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the mid-region of the nucleic acid probe may be at least within 10% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least within 20% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid- region of the nucleic acid probe may be at least within 30% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid- region of the nucleic acid probe may be at least within 40% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid- region of the nucleic acid probe may be at least within 50% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid- region of the nucleic acid probe may be at least within 60% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid- region of the nucleic acid probe may be at least within 70% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid- region of the nucleic acid probe may be at least within 80% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least 5 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the mid-region of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the mid-region of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the mid-region of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the mid-region of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least 7, 8, 9 or 10 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the mid-region of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the mid-region of the nucleic acid probe may be at least 10 nucleotides away from either end of the nucleic acid probe.
  • the mid-region of the nucleic acid probe may be at least 12 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the mid-region of the nucleic acid probe may be at least 13 or 14 nucleotides away from either end of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be located in a series of nucleotides that are positioned at, or near, to the middle residue of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be located 3 nucleotides away from either end of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be located at least 4 nucleotides away from either end of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be located at least 5 nucleotides away from either end of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 10% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 20% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 30% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 40% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 45% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
  • the anchor point of the nucleic acid probe may be at least within 10% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least within 20% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least within 30% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least within 40% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least within 50% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least within 60% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least within 70% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least within 80% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
  • the anchor point may refer to all of the anchor points provided on the nucleic acid probe, for example where multiple anchor points are provided, all of the anchor points are intended to be included in this term. Alternatively, only a single anchor point may be provided, whereby “the anchor point” refers directly to that single anchor point.
  • the anchor point of the nucleic acid probe may be at least 5 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the anchor point of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the anchor point of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the anchor point of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the anchor point of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least 7, 8, 9 or 10 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the anchor point of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the anchor point of the nucleic acid probe may be at least 10 nucleotides away from either end of the nucleic acid probe.
  • the anchor point of the nucleic acid probe may be at least 12 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the anchor point of the nucleic acid probe may be at least 13 or 14 nucleotides away from either end of the nucleic acid probe.
  • the nucleic acid probe may be double stranded or single stranded. In one embodiment, the nucleic acid probe is double stranded nucleic acid. In another embodiment, the nucleic acid probe is single stranded nucleic acid. In one embodiment, the nucleic acid may not comprise a hairpin loop (also known as a stem loop). In one embodiment, the nucleic acid may not be capable of forming a hairpin loop structure. In an embodiment, wherein the nucleic acid is double stranded, the sense and anti-sense strand (i.e. the complementary strands) may be separate molecular entities, for example not joined by a hairpin loop.
  • the sense and anti-sense strand i.e. the complementary strands
  • the sense and anti-sense strand may be separate molecular entities, for example not joined by a covalent bond.
  • the anchor point of the nucleic acid probe may be not at an end residue of the nucleic acid probe.
  • the anchor point may not be within 3 nucleotides from end of the nucleic acid probe.
  • the anchor point may not be within 4 nucleotides from end of the nucleic acid probe.
  • the anchor may comprise any compound capable of tethering a nucleic acid to a substrate surface.
  • the anchor may be a small molecule, or a polymer. Any appropriate chemistry may be used to anchor the nucleic acid probe to the substrate surface, for example click-chemistry may be used to anchor the nucleic acid probe to the substrate surface by reaction of a chemical group on the nucleic acid probe with an opposing/complementary reactive group on the substrate.
  • the substrate surface and/or the nucleic acid probe may comprise reactive or charged groups for anchoring the nucleic acid probe to the substrate surface.
  • the anchor may comprise a thiol anchor. In one embodiment a thiol anchor may be attached to a thymine base on the nucleic acid probe.
  • the anchor may comprise a phosphoramidate bond.
  • the anchor may comprise a triazole.
  • the nucleic acid may be anchored by immobilisation of the nucleic acid using a carbodiimide crosslinker, such as EDC (also called EDAC; l-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride, or DCC (dicyclohexyl carbodiimide).
  • EDC also called EDAC; l-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride, or DCC (dicyclohexyl carbodiimide).
  • the nucleic acid may be anchored by immobilisation of the nucleic acid using the carbodiimide linker upon a surface modified with stearic acid or octadecylamine.
  • the nucleic acid may be anchored by immobilisation of the nucleic acid using a carbodiimide crosslinker, such as EDC, upon a surface modified with primary amino groups or aminoethanethiol.
  • the nucleic acid may be anchored through attachment of nucleic acid, such as ssDNA, onto a phosphoric acid-terminated surface.
  • the phosphoric acid may comprise MBPA (mercaptobutylphosphoric acid).
  • the nucleic acid may be anchored through attachment of nucleic acid onto a film of aluminum alkenebisphosphonate on the surface of the substrate.
  • the nucleic acid may be anchored onto a mercaptosilane coating of the surface via the amino groups of the nucleic acid bases.
  • the nucleic acid may be anchored using functionalised polypyrrole.
  • the nucleic acid may be anchored using any one of the covalent cross-linking reactions discussed in Pividori et al., (2000. Biosensors & Bioelectronics 15; pp. 191-303 - incorporated herein by reference), and as illustrated in Figure 8.
  • the nucleic acid probe may comprise a modified nucleotide, comprising a linker or reactive group to form an anchor.
  • the linker group for attachment to the surface may be termed an anchor unit.
  • the nucleic acid probe may comprise a modified thymine for use as an anchor.
  • the anchor may comprise a modified thymine.
  • the modified thymine may comprise a deoxythymidine (dT) modified with a linker.
  • the modified thymine may comprise a deoxythymidine (dT) modified with an anchor unit.
  • the anchor unit may comprise a linker comprising thiol groups, such as dithiols.
  • the linker may comprise at least two or three dithiols as a surface anchor.
  • the linker may comprise a propagylamidopentanol linker attached to the thymine, such as at the C5 position of the thymine.
  • the nucleic acid probe may comprise modified thymine comprising a deoxythymidine (dT) modified with a linker comprising three dithiols as a surface anchor and a propagylamidopentanol linker attached to the C5 position of the thymine.
  • the linker or reactive group to form an anchor may comprise biotin for linking with streptavidin, or comprise streptavidin for linking with biotin.
  • the nucleic acid probe may be anchored to a modified surface by the use of silane coupling agents to introduce functional groups to the surface (such as thiols, amines, or aldehydes) for linking to a nucleic acid probe modified with an appropriate reactive group, which would form an anchoring bond.
  • silane coupling agents to introduce functional groups to the surface (such as thiols, amines, or aldehydes) for linking to a nucleic acid probe modified with an appropriate reactive group, which would form an anchoring bond.
  • the anchor may be between about 0.2nm and about lOOnm in length. In another embodiment, the anchor may be between about 0.2nm and about 50nm in length. In another embodiment, the anchor may be between about 0.2nm and about 15nm in length. In another embodiment, the anchor may be between about 0.2nm and about lOnm in length. Alternatively, the anchor may be between about 0.3nm and about 5nm in length. Alternatively, the anchor may be between about 0.5nm and about 4nm in length. Alternatively, the anchor may be between about 0.5nm and about 3nm in length. Alternatively, the anchor may be between about 0.8nm and about 4nm in length. The anchor may be between about 0.8nm and about 2.3nm in length.
  • the anchor may be between about 0.8nm and about 2.3nm in length, for example when the nucleic acid probe is at least 4.5nm in length.
  • the anchor may be between about 0.2nm and about 2.3nm in length.
  • the anchor may be between about 0.5nm and about 2.3nm in length.
  • the anchor may be between about 0.2nm and about 3nm in length.
  • the anchor may be between about 0.2nm and about 2.5nm in length.
  • the anchor may be between about 0.5nm and about 2.5nm in length.
  • the anchor may be at least 0.2nm in length.
  • the anchor may be at least 0.3nm in length.
  • the anchor may be at least 0.5nm in length.
  • the anchor may be no more than 50nm in length. In another embodiment, the anchor may be no more than 20nm in length. In another embodiment, the anchor may be no more than lOnm in length. Alternatively, the anchor may be no more than 5nm in length.
  • the length of the anchor may be less than 51% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 50% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 49% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 48% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 40% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 30% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 25% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 20% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 15% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 10% of the length of the nucleic acid probe.
  • the length of the anchor may be less than 5% of the length of the nucleic acid probe.
  • the length of the anchor may be more than 5% of the length of the nucleic acid probe.
  • the length of the anchor may be more than 10% of the length of the nucleic acid probe.
  • the length of the anchor may be more than 20% of the length of the nucleic acid probe.
  • the length of the anchor may be between about 10% and 50% of the length of the nucleic acid probe.
  • the length of the anchor may be between about 1% and 49% of the length of the nucleic acid probe.
  • the length of the anchor may be between about 5% and 49% of the length of the nucleic acid probe.
  • the length of the anchor may be between about 1% and 30% of the length of the nucleic acid probe.
  • the length of the anchor may be between about 0.5% and 49% of the length of the nucleic acid probe.
  • the anchor linking the nucleic acid probe to the surface is small enough to hold the hybridized nucleic acid probe in a substantially horizontal orientation (e.g. substantially parallel to the substrate surface) and prevent the hybridized nucleic acid probe from adopting a substantially vertical orientation (e.g. substantially perpendicular relative to the substrate surface).
  • the substrate may comprise a nanoparticle, a nanotube or rod.
  • the substrate may comprise a wafer consisting of, or layered with, a metal.
  • the substrate surface may be porous or roughened, for example by etching.
  • the substrate may comprise a metallic substrate, such as gold.
  • the metallic substrate may comprise or consist of gold, silver, platinum, copper or aluminium.
  • the substrate comprises or consists of a metallic nanoparticle, such as a gold nanoparticle.
  • the substrate may comprise an electrode, for example as discussed in Lucarelli et al. (2004. Biosensors and Bioelectronics 19; pp. 515-530 - incorporated herein by reference).
  • the substrate may comprise a carbon electrode.
  • the substrate may comprise a glass surface or a semiconductor surface.
  • the substrate surface and/or the nucleic acid probe may comprise modifications to enable the nucleic acid probe attachment.
  • the surface may comprise, or may be modified to comprise, any one of the following group comprising polylysine; amine; epoxy diazonium ion; SU-8; unmodified glass; agarose film; membrane, such as nitrocellulose; gold; mercaptosilanes; maleimide; iodoacetyl; aldehyde; isothiocyanate; aminated surfaces; and avidin; or combinations thereof.
  • the surface may comprise, or may be modified to comprise, any one of the following group comprising polylysine; amine; epoxy diazonium ion; SU-8; unmodified glass; agarose film; membrane, such as nitrocellulose; or combinations thereof.
  • the surface may comprise, or may be modified to comprise, unmodified glass.
  • the nucleic acid is thiol modified for attachment, the surface may comprise, or may be modified to comprise, any one of the following group comprising gold; mercaptosilanes; maleimide; and iodoacetyl; or combinations thereof.
  • the surface may comprise, or may be modified to comprise, any one of the following group comprising aldehyde; epoxy; isothiocyanate; active esters; and carboxylic groups or combinations thereof.
  • the surface may comprise, or may be modified to comprise, an aminated surface.
  • the nucleic acid is biotin modified, the surface may comprise, or may be modified to comprise, avidin; or vice versa.
  • the sample may comprise a bodily fluid sample.
  • the sample may comprise a tissue sample.
  • the sample may comprise an environmental sample, such as a water, air, or soil sample.
  • the sample may comprise a food or beverage sample.
  • the sample may comprise a cell culture sample.
  • the sample may comprise a sample of pre-extracted nucleic acid.
  • the sample may consist of nucleic acid and a solute.
  • the sample may be from a mammal.
  • the mammal may be human.
  • the sample may comprise a blood or blood plasma sample.
  • the sample may be selected from any of the group comprising blood; blood plasma; mucous; urine; faeces; cerebrospinal fluid; tissue, such as organ tissue; lung aspirate; or combinations thereof.
  • the target nucleic acid sequence may be varied in length, for example as provided by a restriction enzyme digests of longer nucleic acid strands.
  • the target nucleic acid sequence may be at least 8 nucleotides in length.
  • the target nucleic acid sequence may be at least 12 nucleotides in length.
  • the target nucleic acid sequence may be at least 15 nucleotides in length.
  • the target nucleic acid sequence may be at least 18 nucleotides in length.
  • the target nucleic acid sequence may be at least 25 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 200 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 180 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 150 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 100 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 80 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 60 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 40 nucleotides in length.
  • the target nucleic acid sequence may be no more than about 35 nucleotides in length.
  • the target nucleic acid sequence may be between about 8 and about 200 nucleotides in length.
  • the target nucleic acid sequence may be between about 12 and about 150 nucleotides in length.
  • the target nucleic acid sequence may be between about 18 and about 150 nucleotides in length.
  • the target nucleic acid sequence may be about 30 nucleotides in length.
  • reference to the length of the target nucleic acid may refer to the average length of the target nucleic acid in a pool of nucleic acid.
  • the target nucleic acid sequence may comprise or consist of DNA or RNA.
  • the target nucleic acid sequence may comprise a mixture of DNA and RNA.
  • the target nucleic acid sequence may comprise genomic nucleic acid.
  • the target nucleic acid sequence may comprise viral RNA; mRNA; ncRNA; small RNA; and siRNA; or combinations thereof.
  • the target nucleic acid sequence may comprise mitochondrial nucleic acid.
  • the target nucleic acid sequence may comprise or consist of chromosomal and/or non-chromosomal DNA.
  • the target nucleic acid sequence in the sample may comprise a mixture of mammalian and non-mammalian nucleic acid.
  • the target nucleic acid sequence in the sample may comprise a mixture of mammalian and microbial nucleic acid.
  • the target nucleic acid sequence in the sample may comprise a mixture of mammalian and bacterial and/or viral nucleic acid.
  • the target nucleic acid sequence in the sample may comprise a mixture of mammalian and fungal nucleic acid.
  • the target nucleic acid sequence in the sample may comprise a mixture of mammalian and pathogen nucleic acid.
  • the target nucleic acid sequence the sample may comprise a mixture of species and/or strains.
  • the target nucleic acid sequence may comprise a species and/or strain specific sequence.
  • the target nucleic acid sequence may comprise a pathogen's nucleic acid sequence.
  • the target nucleic acid sequence may comprise microbial nucleic acid sequence.
  • the target nucleic acid sequence may comprise fungal nucleic acid sequence.
  • the target nucleic acid sequence may comprise nucleic acid sequence selected from any of the group comprising bacterial nucleic acid sequence; viral nucleic acid sequence; parasitic nucleic acid sequence; protozoan nucleic acid sequence; and fungal nucleic acid sequence; or combinations thereof.
  • the target nucleic acid sequence may comprise a cell type and/or cell state specific sequence.
  • the target nucleic acid sequence may be extracted from the sample. For example, the target nucleic acid sequence in the sample may be purified or partially purified prior to hybridisation and/or amplification. The extraction of target nucleic acid sequence may be carried out by the skilled person by standard laboratory techniques.
  • the target nucleic acid sequence may be amplified prior to hybridising the nucleic acid probe.
  • the sample may be provided with pre-amplified target nucleic acid sequence.
  • the amplification of target nucleic acid sequence may comprise or consist of polymerase amplification.
  • the amplification of target nucleic acid sequence may comprise or consist of PCR.
  • the PCR may use a pair of primers. One or both primer of the primer pair may be affinity tagged, thereby providing affinity tagged PCR product.
  • the target nucleic acid sequence may be affinity tagged.
  • the affinity tag may comprise biotin.
  • the hybridisation of the nucleic acid probe with the target nucleic acid sequence may be detected by an electrochemical genosensor.
  • the hybridisation of the nucleic acid probe with the target nucleic acid sequence may be detected by surface enhanced resonance Raman scattering (SERRS) or surface enhanced Raman scattering (SERS) assay, for example for detecting dye labelled nucleic acid.
  • the dye may be a Raman-active dye, such as an azo dye.
  • the hybridisation may be detected via an increase in a current signal of an electroactive indicator (e.g. that preferentially binds the double-stranded DNA).
  • the electroactive indicator may be used in conjunction with, or alternatively to, enzyme or redox labels, or from other hybridisation-induced changes in electrochemical parameters.
  • Detecting hybridisation may comprise the use of differential pulse voltammetry (DPV), square wave voltammetry (SWV) and/or potentiometric stripping analysis (PSA).
  • Detecting hybridisation may comprise the use of an intercalative compound/groove binder and/or enzyme label.
  • DPV differential pulse voltammetry
  • SWV square wave voltammetry
  • PSA potentiometric stripping analysis
  • Detecting hybridisation may comprise the use of an intercalative compound/groove binder and/or enzyme label.
  • the probe nucleic acid and/or target nucleic acid may be labelled.
  • the label may comprise an organic dye, organic fluorophore, fluorescent dye, IR absorbing dye, UV absorbing dye, metachromatic dye, photochromic dye, thermochromic dye, or sulphonephthalein dye.
  • the label may comprise an azo-dye.
  • the label may comprise enzyme labels, nanoparticle labels, or radio- labels.
  • the label may comprise fluorescence dye (cyanine dye (Cy3, Cy5), Texas Red, Rhodamine Red, Alexa Dye, Bodipy dye, Atto dye, FAM, TET, HEX, JOE, Cy3, TAM RA, or ROX,).
  • Nanoparticles labels may be used to enhance the signal, and may be further modified with DNA or an appropriate dye.
  • the label may comprise electrochemical dyes (e.g. methylene blue, Co(phen)3(CI04)3) or HRP enzyme.
  • the nucleic acid probe may be anchored to, and arranged in, an array (i.e. a microarray).
  • a plurality of different nucleic acid probes may be arranged in an array in order to detect a range of different target nucleic acid sequences.
  • a plurality of the same nucleic acid probes may be anchored in an array for detecting hybridisation with target nucleic acid sequence under varying conditions. Varying conditions could include physical parameters such as temperature, and/or detecting hybridisation in the presence of additional components, such as potential therapeutic molecules, for example, arranged to target a nucleic acid sequence.
  • nucleic acid probe molecule which is anchored to a substrate
  • anchor point is located in a mid-region of the nucleic acid.
  • anchor points may only be located in the mid-region of the nucleic acid probe.
  • nucleic acid probe molecule which is anchored to a substrate
  • anchor point is not located at a terminal residue of the nucleic acid.
  • a plurality of nucleic acid probes may be anchored to the substrate.
  • a nucleic acid probe comprising an anchor group arranged to anchor the nucleic acid to a substrate, wherein the anchor group is located in a mid-region of the nucleic acid probe.
  • the nucleic acid does not comprise terminal or near-terminal anchor groups; or b) the anchor group is the only anchor group arranged to anchor the nucleic acid to a substrate.
  • a nucleic acid probe comprising an anchor group arranged to anchor the nucleic acid to a substrate, wherein the anchor group is not located at a terminal residue of the nucleic acid probe.
  • a plurality of nucleic acid probes may be provided. In one embodiment, a plurality of nucleic acid probes may be between 2 and 100 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 50 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 25 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 10 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 7 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 6 nucleic acid probes.
  • a plurality of nucleic acid probes may be between 3 and 100 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 10 and 100 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be at least 2 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be at least 3 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be at least 4, 5, 10, 20, or 30 nucleic acid probes.
  • a microarray comprising a plurality of nucleic acid probes anchored to a substrate, wherein the anchor point is located in a mid-region of the nucleic acid probe.
  • the anchor points may only be located in the mid-region of the nucleic acid probe.
  • the nucleic acid probes may be separated, for example into groups of the same nucleic acid probe, into compartments in the microarray. Such compartmentalisation may facilitate the testing of different samples and/or conditions.
  • the surface density of the nucleic acid probe (once anchored) may be about 10 12 per cm 2 .
  • the surface density of the nucleic acid probe (once anchored) may be about 4.2 x 10 11 per cm 2 .
  • the surface density of the nucleic acid probe (once anchored) may be between about 4.2 x 10 11 per cm 2 and about 10 12 per cm 2 .
  • the surface density of the nucleic acid probe (once anchored) may be between about 1 x 10 11 per cm 2 and about 10.5 12 per cm 2 .
  • the surface density of the nucleic acid probe (once anchored) may be between about 1 x 10 10 per cm 2 and about 10 13 per cm 2 .
  • the surface density of the nucleic acid probe may be less than about 10 13 per cm 2 . In another embodiment, the surface density of the nucleic acid probe (once anchored) may be less than about 10 12 per cm 2 . In another embodiment, the surface density of the nucleic acid probe (once anchored) may be less than about 5 x 10 11 per cm 2 .
  • the surface density of the nucleic acid probe may be calculated using a chronoamperometric method. The probe may be hybridised to its target prior to anchoring to the substrate surface, or hybridised to its target after anchoring to the substrate surface. A lower density of nucleic acid probe may be provided on the substrate surface by hybridising the nucleic acid probe to its target prior to anchoring.
  • Figure 1 schematic diagram to show A) an end tethering approach where the DNA adopts a vertical orientation, and B) a middle tethering approach where the DNA adopts a horizontal and more fixed orientation.
  • Figure 2 Structure of the dithiol linker attached on the thymine base.
  • Figure 3 (a- b) SE S spectra of the DNA probe-1 (short probe with a thiol linker appox. in the middle) that was immobilised at 40 °C and was hybridised with (a) fully- complementary short target DNA(Target 1) and (b) non-complementary short target DNA (Target 3).
  • the DNA target was labelled with Texas Red and Cy3B at the 5' and 3' ends respectively.
  • Figure 4 SERS spectra of the DNA probe-1 (short probe with a thiol linker approx. in the middle) hybridised with (a) fully-complementary long target DNA (Target 2) and (c) non-complementary long target DNA (Target 4), (b) SERS spectra of DNA probe-4
  • Figure 5 SERS spectra of the long DNA probe (77 bases long, Probe 3) with a thiol in the middle and hybridised (a) to a fully complementary long DNA target (76 bases long, Target 2) and (b) non complementary long DNA target (79 bases long, Target 4).
  • Figure 6 SERS spectra of the DNA probe 2 hybridised to the long complementary target (target 2) and the long non complementary target (target 4).
  • Figure 7 SERS spectra of the (a) DNA probe 1 and (b) DNA probe 2, hybridised to the long complementary target (target 2). The spectra are all displayed with the same intensity but have been offset for clarity.
  • Figure 8 Some common reactions used for the covalent binding of DNA on different electrochemical transducer surfaces, (a) Immobilisation of ssDNA on glassy carbon electrodes (through deoxyguanosine group (dG)n-DNA) using carbodiimide method (EDC: l-3(-dimethylaminopropyl)-3-ethyl-carbodiimide;NHS:N- hydroxysulfosuccinimide).
  • Figure 9 (a) - (b) Structure of dithiol and hexaethylene glycol linker attached at the (a) 3'and (b) 5' end of the DNA probes, (c) Structure of the Cy3B modification at the 3' end and (d) the Texas Red modification at the 5' end.
  • FIG. 10 Binding isotherm for [Ru(NH 3 ) 6 ] + with DNA duplex immobilised horizontally on an Au SSV substrate.
  • the duplex was hybridized in solution and then the duplex strand (0.5 ⁇ of dsDNA in 0.05 M Na 2 S0 4 ) was immobilised on the SSV Au surface overnight. The surface was then passivated with mercaptohexanol (1 mM).
  • a method of the present invention is to specifically immobilize a DNA probe horizontally on the surface. This orientation leads to lower probe density which can increase the hybridization efficiency as well as locating the DNA backbone closer to the sensor surface thereby allowing increased sensitivity.
  • DNA sequences that were aligned horizontally to the surface have been shown to be effective for sensitive electronic 10 and SERS 11 label free detection of DNA.
  • the DNA was physically adsorbed on the surfaces, whereas specific attachment via a linker would be more efficient and more controlled for the design of molecular assays.
  • a recent approach described the specific horizontal immobilization of a 15-mer PNA probe on a silicon dioxide surface via three linker molecules attached at three locations ( ⁇ points) along the PNA backbone.
  • the invention provides a simple, straightforward methodology for specific tethering of DNA probes using a single linker, by placing the linker approximately in the middle of the probe to ensure horizontal orientation of the attached dsDNA.
  • the thiol linker is attached to a thymine base.
  • Previously vertically tethered DNA was used on Au sphere segment void (SSV) surfaces which give large SE S enhancements, 13 14 to develop assays for sensitive DNA discrimination by targeting the detection of single nucleotide polymorphism 15 and tandem repeats.
  • SSV Au sphere segment void
  • 13 14 to develop assays for sensitive DNA discrimination by targeting the detection of single nucleotide polymorphism 15 and tandem repeats.
  • 16 Specifically, a negative potential is applied on the Au SSV surface to melt the DNA and the melting is monitored by recording the SERS signal of the labelled DNA target as a function of applied potential. When the DNA target diffuses away from the surface after dsDNA dissociation, the signal of the SERS label decreases significantly.
  • a modified 30bp oligonucleotide probe ( 5' -h exy n o I - ATATC ATCTTTG GTGT*TTCCTC A TGCTTTA- 3') (SEQ ID NO: 1) was synthesized.
  • the T* indicates a deoxythymidine (dT) modified with a linker consisting of three dithiols as a surface anchor and a propagylamidopentanol linker attached at the C5 position of the thymine, as shown in Figure 2.
  • the modified dT was the 16 th base along the probe starting from the 5' end.
  • the length of the DNA probe is ⁇ 10.2 nm and the length of the linker between the thymine and the Au surface (from propagylamidopentanol, phosphate and the first dithiol) can range from 0.8 nm to 2.3 nm depending on whether the alkyl chain is curled or extended. No spacers have been used between the three dithiol units and thymine base to minimize the bending of the DNA duplex and facilitate a fixed and rigid orientation on the surface. Immobilization of the DNA probe at room temperature prior to hybridization was avoided since the DNA might coil up on the surface in an unsuitable manner.
  • the DNA probe was hybridized to its target in solution to guarantee that the desired rigid duplex was formed before surface immobilization.
  • the Au SSV surface was then incubated in the 0.5 ⁇ DNA solution at room temperature, overnight, following passivation with mercaptohexanol.
  • the DNA probe was first immobilized on the surface at 40 Q C for 6 hours in order to allow the DNA to bind in its uncoiled form. 4
  • the Au surface was then passivated with mercaptohexanol before hybridized to its target DNA at room temperature for 2 hours. It should be noted that in both cases the DNA was immobilized at low ionic strength (0.05 M Na 2 S0 4 ) since there was no need to screen the duplex charge in these inherently low probe density surfaces.
  • Figure 3 (a)-(d) shows SERS spectra of the DNA probe with the thiol linker attached on the thymine base assembled on the gold SSV under both sets of conditions with both the complementary and non-complementary target DNA. Significantly, bands for both Texas Red and Cy3B are visible when the DNA probe with the thiol linker located on the thymine base is hybridized to the complementary target, Figure 3 (a).
  • Texas Red has a stronger resonance contribution (A max , 589 nm) with the 633 nm laser used here than the Cy3B dye (A max , 558 nm).
  • a similar difference in SERS intensity has been observed when two different DNA strands individually labelled with the two dyes were immobilized vertically on the surface.
  • the horizontally tethered dsDNA was denatured either electrochemically (by application of -1.2 V vs Ag/AgCI), or thermally (by heating to 80 °C).
  • the target DNA was labelled with a single Texas Red fluorophore at the 5' end. After DNA denaturation by either method, the Texas Red SERS signal was lost due to the labelled DNA target being released and diffusing away from the surface.
  • the surface density of the DNA was calculated using a chronoamperometric method. The surface coverage was found slightly different, depending on the immobilization methods:
  • This study demonstrates a new simple and effective methodology for the covalent attachment of DNA probes on gold surfaces that promotes horizontal orientation of the dsDNA.
  • the method is sensitive for the discrimination of complementary and non-complementary DNA.
  • the DNA duplexes can also be melted on the surface and their melting profile can be monitored using either a labelled DNA target or unmodified target with an added binding agent specific for double stranded DNA (i.e. methylene blue).
  • This new immobilization strategy can be applied to a wide range of optical or electronic biosensors and has the potential to improve the hybridization efficiency of long DNA targets on the surface as well as the overall sensitivity of the sensors.
  • the same methodology can be applied to successfully induce horizontal orientation of the DNA on surfaces up to the persistence length of dsDNA (> 150 bp).
  • a methodology that allows the specific tethering of dsDNA horizontally on the surface is provided. This can be achieved using a linker on the DNA probe, which will be placed approximately in the middle of the DNA sequence.
  • the DNA probe modified with a surface-linker is first immobilised on a gold nanostructured surface by incubation of the surface in a DNA solution at 40°C for 6 hours in order to allow the DNA to bind in its uncoiled form.
  • the surface is then passivated mercaptohexanol in order to prevent unspecific binding of the DNA to the surface.
  • the surface tethered DNA probe is then hybridised to its target DNA at room temperature for 2 hours. SERS spectroscopy was utilised to show that the DNA was hybridised in a horizontal orientation. To monitor the orientation of the DNA duplex, the target DNA was labelled on each end with different fluorophores: Texas Red at the 5' end and Cy3B or Cy3 at the 3' end.
  • Target -1 Comp-short target 30 bases
  • Target 2 Comp long target 78 bases
  • Target 3 Non Comp-short target 30 bases
  • Target 4 Non Comp-long target 79 bases
  • Target 5 Comp long target 76 bases
  • Figure 3(a) and (b) shows the results where a short probe (30 bases long) that had the surface- linker in the middle and was hybridised with a short complementary target (30 bases long) and a short non-complementary target (30 bases long).
  • Figure 4 shows the results of utilizing a short probe (30 bases long) that had a surface-linker in the middle, hybridised to a longer complementary target (76 bases long) and a longer non- complementary target.
  • the figure shows that when the probe was hybridised to a fully complementary long target the SERS spectrum contains bands associated with both dyes. Therefore the dsDNA has been successfully orientated parallel to the Au surface.
  • the probe was hybridised to a non-complementary long DNA target, no SERS signal is observed. Two different probes have been used to show that the result is reproducible and can be applied to different DNA sequences.
  • Figure 5 shows the results of utilising a long probe (77 bases long), with a surface-linker approx. in the middle, hybridised to a fully complementary long target (76 bases long).
  • the SERS spectrum contains bands associated with mainly Texas Red. Small bands of Cy3 can be observed.
  • the figure also shows that when the probe was hybridised to a non-complementary target, there is an insignificantly small signal of Texas Red demonstrating that the hybridization is specific to the complementary sequence.
  • Figure 6 shows the results of utilising a short probe (25 bases long) that had three linkers, one in the middle and one in each end of the DNA (Probe 2). The figure shows that when the probe was hybridised to a fully complementary short target the SERS spectrum contains bands associated with both dyes. When the probe was hybridised to a non-complementary long DNA target, no SERS signal is observed.
  • Figure 7 shows the spectra of dsDNA when (a) short DNA probe (probe 1, one linker in the middle) was used hybridised with a long DNA target (target 2) and (b) short DNA (probe 2, three linkers across the DNA backbone) was used hybridised with a long DNA target (target 2). It obvious that when there is only one linker on the DNA probe the signal from both of the dyes is significantly stronger, demonstrating that the horizontal immobilisation of the DNA is more successful when the probe has only one thiol in the middle.
  • the distance from base to base in the DNA sequence is 0.34 nm.
  • the length of the linker, for this experiment, between the thymine and the Au surface (from propagylamidopentanol, phosphate and the first dithiol) can range from 0.8 nm to 2.3 nm depending on whether the alkyl chain is curled or extended. Therefore, for this linker, the DNA probe is preferably no smaller than 14 bases (the length of 7 bases will be 2.38 nm). If the DNA sequence is smaller than 14 bases then there is a possibility that the DNA can orientate perpendicular on the surface (when the linker is extended which is not very likely).
  • linker For shorter DNA sequences a shorter linker can be employed.
  • the length of the linker should be optimised with regards to the length of the DNA probe. 3. Methods to immobilise DNA on a surface.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method of analysing nucleic acid in a sample comprising:- providing a nucleic acid probe, which is anchored to a substrate surface only from one or more point(s) located in a mid-region of the nucleic acid probe; and detecting the presence or absence of a target nucleic acid sequence in the sample by hybridisation of the nucleic acid probe with the target nucleic acid sequence if present.

Description

NUCLEIC ACID ANALYSIS INVOLVINGSURFACE-ANCHORED NUCLEIC ACID
PROBES
The present invention relates to a method of nucleic acid analysis, in particular using surface- anchored nucleic acid probes, and associated uses thereof.
The detection of specific nucleic acid sequences is important in areas such as clinical diagnostics, forensic applications, drug discovery and archaeology. Nucleic acid arrays on solid surfaces have been extensively used in gene expression profiling and the detection of microorganisms using a range of optical (e.g. fluorescence, surface plasmon resonance (SP ), surface enhanced Raman spectroscopy)1 and electronic sensing platforms.2 Typically, a short single-stranded nucleic acid is immobilised on an assay surface via one end, adopting vertical orientation, to promote target binding. However, end-tethered DNA doesn't necessarily adopt a fixed and upright orientation at the surface, a variety of triggers such as surface potential,3,4 temperature, pH, ionic strength,4 the length of the DNA and the nature of the DNA-end that is tethered5 can influence the orientation and tilting angles on the surface. The high probe density of end-tethered DNA molecules on the surface can lead to slow hybridization kinetics and low hybridization efficiencies,6 this problem is more intense when real DNA fragments are used as targets (PCR products are usually >100 base pairs). Optimization of the probe density7 and the use of hybridization rate accelerators (e.g. dextran sulphate, CTAB)8,9 have been employed to improve the hybridization efficiencies.
Therefore, an aim of the present invention is to improve nucleic acid analysis requiring the use of a nucleic acid probe. According to a first aspect of the present invention, there is provided a method of analysing nucleic acid in a sample comprising:
-providing a nucleic acid probe, which is anchored to a substrate surface from a point located in a mid-region of the nucleic acid probe; and
-detecting the presence or absence of a target nucleic acid sequence in the sample by hybridisation of the nucleic acid probe with the target nucleic acid sequence if present.
According to another aspect of the present invention, there is provided a method of analysing nucleic acid in a sample comprising: -providing a nucleic acid probe, which is anchored to a substrate surface from a nonterminal residue of the nucleic acid probe; and
-detecting the presence or absence of a target nucleic acid sequence in the sample by hybridisation of the nucleic acid probe with the target nucleic acid sequence if present.
Advantageously, the invention allows the specific immobilization of the nucleic acid in a horizontal orientation relative to the substrate surface. Horizontally-immobilised nucleic acid on the substrate surface has several advantages such that it can lead to inherent lower probe density on the surface with increased hybridization efficiency; it can locate the nucleic acid backbone closer to a sensor surface allowing increased sensitivity; and it can allow the nucleic acid to adopt a more fixed orientation on the surface that is less susceptible to external parameters (i.e. pH, surface potential, temperature). The invention provides a simple, straightforward methodology for specific tethering of DNA probes which can use a single anchor, and wherein the anchor can be placed approximately in the middle of the probe to ensure horizontal orientation of the attached nucleic acid.
A successful hybridisation of the nucleic acid probe to the target nucleic acid sequence can indicate the presence of the target nucleic acid in the sample. The failure to hybridise the nucleic acid probe to the target nucleic acid sequence may indicate the absence of the target nucleic acid in the sample, or at least the absence of detectable quantities thereof.
The method may further comprise detecting the amount or concentration of the target nucleic acid in the sample. Providing a nucleic acid probe molecule anchored to a substrate may comprise
-providing a modified nucleic acid molecule comprising an anchor group arranged to anchor the modified nucleic acid to a substrate;
-providing a substrate; and
-reacting the anchor group of the modified nucleic acid with the substrate to form nucleic acid probe, which is anchored to the substrate. The anchor group may be located in a mid-region of the nucleic acid probe, such that the probe is anchored to the substrate surface from the point located in a mid-region of the nucleic acid probe. The nucleic acid probe may comprise or consist of nucleic acid selected from any one of the group comprising DNA, NA, and a nucleic acid analogue, such as PNA or LNA; or combinations thereof. The nucleic acid probe may comprise or consist of DNA. The nucleic acid probe may comprise or consist of PNA. The nucleic acid probe may be at least about 8 nucleotides in length. The nucleic acid probe may be at least about 10 nucleotides in length. The nucleic acid probe may be at least about 12 nucleotides in length. The nucleic acid probe may be at least about 15 nucleotides in length. The nucleic acid probe may be about 20 nucleotides in length. The nucleic acid probe may be no more than about 15 nucleotides in length. The nucleic acid probe may be no more than about 20 nucleotides in length. The nucleic acid probe may be no more than about 30 nucleotides in length. The nucleic acid probe may be no more than about 40 nucleotides in length. The nucleic acid probe may be no more than about 100 nucleotides in length. The nucleic acid probe may be no more than about 150 nucleotides in length. The nucleic acid probe may be between about 8 and about 150 nucleotides in length. The nucleic acid probe may be between about 8 and about 100 nucleotides in length. The nucleic acid probe may be between about 8 and about 80 nucleotides in length. The nucleic acid probe may be between about 8 and about 50 nucleotides in length. The nucleic acid probe may be between about 8 and about 35 nucleotides in length. The nucleic acid probe may be 30 between about 8 and about 30 nucleotides in length. The nucleic acid probe may be between about 8 and about 25 nucleotides in length. The nucleic acid probe may be about 30 nucleotides in length.
A plurality of probe nucleic acid molecules may be provided. The nucleic acid probes in a plurality of probes may vary in length. A plurality of nucleic acid probes may have an average length of about 30 nucleotides. A plurality of nucleic acid probes may have an average length of between about 8 and about 50 nucleotides. A plurality of nucleic acid probes may have an average length of between about 8 and about 60 nucleotides. A plurality of nucleic acid probes may have an average length of between about 8 and about 80 nucleotides. A plurality of nucleic acid probes may have an average length of between about 8 and about 100 nucleotides. A plurality of nucleic acid probes may have an average length of between about 8 and about 150 nucleotides. A plurality of nucleic acid probes may have an average length of between about 8 and about 35 nucleotides. A plurality of nucleic acid probes may have an average length of between about 8 and about 25 nucleotides.
The nucleic acid probe may comprise a known/pre-determined sequence. The nucleic acid probe may be complementary to the target nucleic acid sequence. The nucleic acid probe may be 100% complementary to the target nucleic acid sequence. The nucleic acid probe may be at least about 95%, or at least about 90% complementary to the target nucleic acid sequence. The nucleic acid probe may be at least about 80% complementary to the target nucleic acid sequence. The nucleic acid probe may be complementary to the target nucleic acid sequence along the whole length of the probe. The nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 8 consecutive nucleotides of the probe. The nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 10 consecutive nucleotides of the probe. The nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 15 consecutive nucleotides of the probe. The nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 18 consecutive nucleotides of the probe. The nucleic acid probe may be complementary to the target nucleic acid sequence along a length of at least about 25 consecutive nucleotides of the probe. The nucleic acid probe may be sufficiently complementary to the target nucleic acid sequence to be able to selectively hybridise under stringent conditions. The nucleic acid probe may hybridise to target nucleic acid, such as under stringent conditions. The nucleic acid probe may be anchored to a substrate surface only from one or more point(s) located in a mid-region of the nucleic acid probe. The nucleic acid probe may be anchored to a substrate surface only from a point located in a mid-region of the nucleic acid probe. The nucleic acid probe may comprise a single anchor point. The nucleic acid probe may not comprise two or more anchor points. The nucleic acid probe may not comprise three or more anchor points. In one embodiment, the nucleic acid probe may not be anchored to the substrate from a hairpin loop region of the nucleic acid probe. In an embodiment, wherein there are two or more anchor points, the anchor points may be immediately adjacent to each other, e.g. on neighbouring nucleotides or the anchors may be attached within the same nucleotide. In an embodiment, wherein there are two or more anchor points, the anchor points may be attached no more than 4 nucleotides apart on the same strand. Alternatively, the anchor points may be attached no more than 3 nucleotides apart on the same strand. Alternatively, the anchor points may be attached no more than 2 nucleotides apart on the same strand. Alternatively, the anchor points may be attached no more than 1 nucleotide apart on the same strand. In an embodiment, wherein there are two or more anchor points, the anchor points may not be separated by a major or minor groove when the nucleic acid is duplexed. For example, the anchor points may all be on the same region of the strand where it faces the anchor surface (i.e. not on another region of the strand that would be a helical turn away in the context of duplexed nucleic acid).
The provision of only a single mid-region anchor point (or closely positioned anchor points) when anchoring a nucleic acid to a substrate advantageously allows a double helical structure to form and unwind during hybridisation events and during denaturing-hybridisation events, and other nucleic acid manipulation events. For example, if two or more anchor points where provided along the strand of nucleic acid, they may interfere with unwinding and hybridisation if they span across the major or minor grooves when the nucleic acid is duplexed. For example, the second strand would be entangled between the nucleic acid probe, the anchors, and the surface.
The mid-region of the nucleic acid probe may not comprise a terminal nucleotide of the nucleic acid probe. The mid-region of the nucleic acid probe may comprise a series of nucleotides that are positioned at, or near, to the middle residue of the nucleic acid probe. The mid-region of the nucleic acid probe may be at least 3 nucleotides away from either end of the nucleic acid probe. The mid-region of the nucleic acid probe may be at least 4 nucleotides away from either end of the nucleic acid probe. The mid-region of the nucleic acid probe may be at least 5 nucleotides away from either end of the nucleic acid probe. The mid-region of the nucleic acid probe may not comprise a hairpin loop (otherwise known as a stem loop). In an embodiment, wherein the nucleic acid probe comprises a hairpin loop, the skilled person will understand that the hairpin loop may be considered equivalent to a terminal nucleotide in position on the probe, for example because it effectively forms an end of the duplexed nucleic acid. Therefore, in an embodiment wherein the nucleic acid comprises a stem loop, the anchor point may be located in the stem of the stem loop, such as in a mid-region of the stem. The mid-region of a stem loop structured nucleic acid may not comprise part of the loop. The term "terminal nucleotide" is understood to be the most 5' nucleotide or the most 3' nucleotide, for example the end nucleotide of any particular nucleic acid strand. The term "near-terminal" is understood to include the terminal nucleotide, the immediate upstream/downstream nucleotide from the terminal nucleotide. In some embodiments "near- terminal" may also include nucleotides within 1, 2, 3, or 4 nucleotides of the terminal nucleotide.
The mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 10% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 20% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 30% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the mid- region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 40% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the mid-region of the nucleic acid probe may comprise a series of nucleotides that are distanced at least 45% from either of the terminal nucleotides relative to the entire nucleic acid probe length. The mid-region of the nucleic acid probe may be at least within 10% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The mid-region of the nucleic acid probe may be at least within 20% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The mid- region of the nucleic acid probe may be at least within 30% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The mid- region of the nucleic acid probe may be at least within 40% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The mid- region of the nucleic acid probe may be at least within 50% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The mid- region of the nucleic acid probe may be at least within 60% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The mid- region of the nucleic acid probe may be at least within 70% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The mid- region of the nucleic acid probe may be at least within 80% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the mid-region of the nucleic acid probe may be at least 5 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the mid-region of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the mid-region of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the mid-region of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the mid-region of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the mid-region of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the mid-region of the nucleic acid probe may be at least 7, 8, 9 or 10 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the mid-region of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the mid-region of the nucleic acid probe may be at least 10 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the mid-region of the nucleic acid probe may be at least 12 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the mid-region of the nucleic acid probe may be at least 13 or 14 nucleotides away from either end of the nucleic acid probe. The anchor point of the nucleic acid probe may be located in a series of nucleotides that are positioned at, or near, to the middle residue of the nucleic acid probe. The anchor point of the nucleic acid probe may be located 3 nucleotides away from either end of the nucleic acid probe. The anchor point of the nucleic acid probe may be located at least 4 nucleotides away from either end of the nucleic acid probe. The anchor point of the nucleic acid probe may be located at least 5 nucleotides away from either end of the nucleic acid probe.
The anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 10% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 20% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 30% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 40% from either of the terminal nucleotides relative to the entire nucleic acid probe length. Alternatively, the anchor point of the nucleic acid probe may be located at a nucleotide that is distanced at least 45% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
The anchor point of the nucleic acid probe may be at least within 10% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The anchor point of the nucleic acid probe may be at least within 20% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The anchor point of the nucleic acid probe may be at least within 30% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The anchor point of the nucleic acid probe may be at least within 40% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The anchor point of the nucleic acid probe may be at least within 50% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The anchor point of the nucleic acid probe may be at least within 60% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The anchor point of the nucleic acid probe may be at least within 70% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe. The anchor point of the nucleic acid probe may be at least within 80% of the total nucleic acid length away from the central residue or central pair of residues of the nucleic acid probe.
Reference to "the anchor point" may refer to all of the anchor points provided on the nucleic acid probe, for example where multiple anchor points are provided, all of the anchor points are intended to be included in this term. Alternatively, only a single anchor point may be provided, whereby "the anchor point" refers directly to that single anchor point.
In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the anchor point of the nucleic acid probe may be at least 5 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the anchor point of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the anchor point of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, the anchor point of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the anchor point of the nucleic acid probe may be at least 7 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the anchor point of the nucleic acid probe may be at least 6 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 20 and about 35 nucleotides in length, the anchor point of the nucleic acid probe may be at least 7, 8, 9 or 10 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the anchor point of the nucleic acid probe may be at least 8 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the anchor point of the nucleic acid probe may be at least 10 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the anchor point of the nucleic acid probe may be at least 12 nucleotides away from either end of the nucleic acid probe. In an embodiment wherein the nucleic acid probe is between about 30 and about 40 nucleotides in length, the anchor point of the nucleic acid probe may be at least 13 or 14 nucleotides away from either end of the nucleic acid probe.
The nucleic acid probe may be double stranded or single stranded. In one embodiment, the nucleic acid probe is double stranded nucleic acid. In another embodiment, the nucleic acid probe is single stranded nucleic acid. In one embodiment, the nucleic acid may not comprise a hairpin loop (also known as a stem loop). In one embodiment, the nucleic acid may not be capable of forming a hairpin loop structure. In an embodiment, wherein the nucleic acid is double stranded, the sense and anti-sense strand (i.e. the complementary strands) may be separate molecular entities, for example not joined by a hairpin loop. In an embodiment, wherein the nucleic acid is double stranded, the sense and anti-sense strand (i.e. the complementary strands) may be separate molecular entities, for example not joined by a covalent bond. The anchor point of the nucleic acid probe may be not at an end residue of the nucleic acid probe. The anchor point may not be within 3 nucleotides from end of the nucleic acid probe. The anchor point may not be within 4 nucleotides from end of the nucleic acid probe.
The anchor may comprise any compound capable of tethering a nucleic acid to a substrate surface. The anchor may be a small molecule, or a polymer. Any appropriate chemistry may be used to anchor the nucleic acid probe to the substrate surface, for example click-chemistry may be used to anchor the nucleic acid probe to the substrate surface by reaction of a chemical group on the nucleic acid probe with an opposing/complementary reactive group on the substrate. The substrate surface and/or the nucleic acid probe may comprise reactive or charged groups for anchoring the nucleic acid probe to the substrate surface. The anchor may comprise a thiol anchor. In one embodiment a thiol anchor may be attached to a thymine base on the nucleic acid probe. The anchor may comprise a phosphoramidate bond. Alternatively, the anchor may comprise a triazole. The nucleic acid may be anchored by immobilisation of the nucleic acid using a carbodiimide crosslinker, such as EDC (also called EDAC; l-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride, or DCC (dicyclohexyl carbodiimide). For example, the nucleic acid may be anchored by immobilisation of the nucleic acid using the carbodiimide linker upon a surface modified with stearic acid or octadecylamine. In another embodiment, the nucleic acid may be anchored by immobilisation of the nucleic acid using a carbodiimide crosslinker, such as EDC, upon a surface modified with primary amino groups or aminoethanethiol. In another embodiment, the nucleic acid may be anchored through attachment of nucleic acid, such as ssDNA, onto a phosphoric acid-terminated surface. The phosphoric acid may comprise MBPA (mercaptobutylphosphoric acid). In another embodiment, the nucleic acid may be anchored through attachment of nucleic acid onto a film of aluminum alkenebisphosphonate on the surface of the substrate. In another embodiment, the nucleic acid may be anchored onto a mercaptosilane coating of the surface via the amino groups of the nucleic acid bases. In another embodiment, the nucleic acid may be anchored using functionalised polypyrrole.
The nucleic acid may be anchored using any one of the covalent cross-linking reactions discussed in Pividori et al., (2000. Biosensors & Bioelectronics 15; pp. 191-303 - incorporated herein by reference), and as illustrated in Figure 8.
The nucleic acid probe may comprise a modified nucleotide, comprising a linker or reactive group to form an anchor. The linker group for attachment to the surface may be termed an anchor unit. The nucleic acid probe may comprise a modified thymine for use as an anchor. The anchor may comprise a modified thymine. The modified thymine may comprise a deoxythymidine (dT) modified with a linker. The modified thymine may comprise a deoxythymidine (dT) modified with an anchor unit. The anchor unit may comprise a linker comprising thiol groups, such as dithiols. The linker may comprise at least two or three dithiols as a surface anchor. The linker may comprise a propagylamidopentanol linker attached to the thymine, such as at the C5 position of the thymine. In one embodiment, the nucleic acid probe may comprise modified thymine comprising a deoxythymidine (dT) modified with a linker comprising three dithiols as a surface anchor and a propagylamidopentanol linker attached to the C5 position of the thymine. The linker or reactive group to form an anchor may comprise biotin for linking with streptavidin, or comprise streptavidin for linking with biotin. The nucleic acid probe may be anchored to a modified surface by the use of silane coupling agents to introduce functional groups to the surface (such as thiols, amines, or aldehydes) for linking to a nucleic acid probe modified with an appropriate reactive group, which would form an anchoring bond.
The anchor may be between about 0.2nm and about lOOnm in length. In another embodiment, the anchor may be between about 0.2nm and about 50nm in length. In another embodiment, the anchor may be between about 0.2nm and about 15nm in length. In another embodiment, the anchor may be between about 0.2nm and about lOnm in length. Alternatively, the anchor may be between about 0.3nm and about 5nm in length. Alternatively, the anchor may be between about 0.5nm and about 4nm in length. Alternatively, the anchor may be between about 0.5nm and about 3nm in length. Alternatively, the anchor may be between about 0.8nm and about 4nm in length. The anchor may be between about 0.8nm and about 2.3nm in length. The anchor may be between about 0.8nm and about 2.3nm in length, for example when the nucleic acid probe is at least 4.5nm in length. The anchor may be between about 0.2nm and about 2.3nm in length. The anchor may be between about 0.5nm and about 2.3nm in length. The anchor may be between about 0.2nm and about 3nm in length. The anchor may be between about 0.2nm and about 2.5nm in length. The anchor may be between about 0.5nm and about 2.5nm in length. In one embodiment, the anchor may be at least 0.2nm in length. In another embodiment, the anchor may be at least 0.3nm in length. In another embodiment, the anchor may be at least 0.5nm in length. In one embodiment, the anchor may be no more than 50nm in length. In another embodiment, the anchor may be no more than 20nm in length. In another embodiment, the anchor may be no more than lOnm in length. Alternatively, the anchor may be no more than 5nm in length.
The length of the anchor may be less than 51% of the length of the nucleic acid probe. The length of the anchor may be less than 50% of the length of the nucleic acid probe. The length of the anchor may be less than 49% of the length of the nucleic acid probe. The length of the anchor may be less than 48% of the length of the nucleic acid probe. The length of the anchor may be less than 40% of the length of the nucleic acid probe. The length of the anchor may be less than 30% of the length of the nucleic acid probe. The length of the anchor may be less than 25% of the length of the nucleic acid probe. The length of the anchor may be less than 20% of the length of the nucleic acid probe. The length of the anchor may be less than 15% of the length of the nucleic acid probe. The length of the anchor may be less than 10% of the length of the nucleic acid probe. The length of the anchor may be less than 5% of the length of the nucleic acid probe. The length of the anchor may be more than 5% of the length of the nucleic acid probe. The length of the anchor may be more than 10% of the length of the nucleic acid probe. The length of the anchor may be more than 20% of the length of the nucleic acid probe. The length of the anchor may be between about 10% and 50% of the length of the nucleic acid probe. In another embodiment, the length of the anchor may be between about 1% and 49% of the length of the nucleic acid probe. In another embodiment, the length of the anchor may be between about 5% and 49% of the length of the nucleic acid probe. In another embodiment, the length of the anchor may be between about 1% and 30% of the length of the nucleic acid probe. In another embodiment, the length of the anchor may be between about 0.5% and 49% of the length of the nucleic acid probe.
Advantageously, the anchor linking the nucleic acid probe to the surface is small enough to hold the hybridized nucleic acid probe in a substantially horizontal orientation (e.g. substantially parallel to the substrate surface) and prevent the hybridized nucleic acid probe from adopting a substantially vertical orientation (e.g. substantially perpendicular relative to the substrate surface).
The substrate may comprise a nanoparticle, a nanotube or rod. The substrate may comprise a wafer consisting of, or layered with, a metal. The substrate surface may be porous or roughened, for example by etching. The substrate may comprise a metallic substrate, such as gold. The metallic substrate may comprise or consist of gold, silver, platinum, copper or aluminium. In one embodiment, the substrate comprises or consists of a metallic nanoparticle, such as a gold nanoparticle. The substrate may comprise an electrode, for example as discussed in Lucarelli et al. (2004. Biosensors and Bioelectronics 19; pp. 515-530 - incorporated herein by reference). The substrate may comprise a carbon electrode. The substrate may comprise a glass surface or a semiconductor surface.
The substrate surface and/or the nucleic acid probe may comprise modifications to enable the nucleic acid probe attachment. For example, the surface may comprise, or may be modified to comprise, any one of the following group comprising polylysine; amine; epoxy diazonium ion; SU-8; unmodified glass; agarose film; membrane, such as nitrocellulose; gold; mercaptosilanes; maleimide; iodoacetyl; aldehyde; isothiocyanate; aminated surfaces; and avidin; or combinations thereof. In an embodiment where the nucleic acid itself is not modified for attachment, the surface may comprise, or may be modified to comprise, any one of the following group comprising polylysine; amine; epoxy diazonium ion; SU-8; unmodified glass; agarose film; membrane, such as nitrocellulose; or combinations thereof. In an embodiment where the nucleic acid is silane modified, the surface may comprise, or may be modified to comprise, unmodified glass. In an embodiment where the nucleic acid is thiol modified for attachment, the surface may comprise, or may be modified to comprise, any one of the following group comprising gold; mercaptosilanes; maleimide; and iodoacetyl; or combinations thereof. In an embodiment where the nucleic acid is amine modified for attachment, the surface may comprise, or may be modified to comprise, any one of the following group comprising aldehyde; epoxy; isothiocyanate; active esters; and carboxylic groups or combinations thereof. In an embodiment where the nucleic acid is phosphate modified, the surface may comprise, or may be modified to comprise, an aminated surface. In an embodiment where the nucleic acid is biotin modified, the surface may comprise, or may be modified to comprise, avidin; or vice versa. The sample may comprise a bodily fluid sample. The sample may comprise a tissue sample. In another embodiment, the sample may comprise an environmental sample, such as a water, air, or soil sample. The sample may comprise a food or beverage sample. The sample may comprise a cell culture sample. The sample may comprise a sample of pre-extracted nucleic acid. The sample may consist of nucleic acid and a solute. Where the sample is a bodily fluid sample, it may be from a mammal. The mammal may be human. The sample may comprise a blood or blood plasma sample. The sample may be selected from any of the group comprising blood; blood plasma; mucous; urine; faeces; cerebrospinal fluid; tissue, such as organ tissue; lung aspirate; or combinations thereof. The target nucleic acid sequence may be varied in length, for example as provided by a restriction enzyme digests of longer nucleic acid strands. The target nucleic acid sequence may be at least 8 nucleotides in length. The target nucleic acid sequence may be at least 12 nucleotides in length. The target nucleic acid sequence may be at least 15 nucleotides in length. The target nucleic acid sequence may be at least 18 nucleotides in length. The target nucleic acid sequence may be at least 25 nucleotides in length. The target nucleic acid sequence may be no more than about 200 nucleotides in length. The target nucleic acid sequence may be no more than about 180 nucleotides in length. The target nucleic acid sequence may be no more than about 150 nucleotides in length. The target nucleic acid sequence may be no more than about 100 nucleotides in length. The target nucleic acid sequence may be no more than about 80 nucleotides in length. The target nucleic acid sequence may be no more than about 60 nucleotides in length. The target nucleic acid sequence may be no more than about 40 nucleotides in length. The target nucleic acid sequence may be no more than about 35 nucleotides in length. The target nucleic acid sequence may be between about 8 and about 200 nucleotides in length. The target nucleic acid sequence may be between about 12 and about 150 nucleotides in length. The target nucleic acid sequence may be between about 18 and about 150 nucleotides in length. The target nucleic acid sequence may be about 30 nucleotides in length. In some embodiments, reference to the length of the target nucleic acid may refer to the average length of the target nucleic acid in a pool of nucleic acid.
The target nucleic acid sequence may comprise or consist of DNA or RNA. The target nucleic acid sequence may comprise a mixture of DNA and RNA. The target nucleic acid sequence may comprise genomic nucleic acid. The target nucleic acid sequence may comprise viral RNA; mRNA; ncRNA; small RNA; and siRNA; or combinations thereof. The target nucleic acid sequence may comprise mitochondrial nucleic acid. The target nucleic acid sequence may comprise or consist of chromosomal and/or non-chromosomal DNA. The target nucleic acid sequence in the sample may comprise a mixture of mammalian and non-mammalian nucleic acid. The target nucleic acid sequence in the sample may comprise a mixture of mammalian and microbial nucleic acid. The target nucleic acid sequence in the sample may comprise a mixture of mammalian and bacterial and/or viral nucleic acid. The target nucleic acid sequence in the sample may comprise a mixture of mammalian and fungal nucleic acid. The target nucleic acid sequence in the sample may comprise a mixture of mammalian and pathogen nucleic acid. The target nucleic acid sequence the sample may comprise a mixture of species and/or strains. The target nucleic acid sequence may comprise a species and/or strain specific sequence. The target nucleic acid sequence may comprise a pathogen's nucleic acid sequence. The target nucleic acid sequence may comprise microbial nucleic acid sequence. The target nucleic acid sequence may comprise fungal nucleic acid sequence. The target nucleic acid sequence may comprise nucleic acid sequence selected from any of the group comprising bacterial nucleic acid sequence; viral nucleic acid sequence; parasitic nucleic acid sequence; protozoan nucleic acid sequence; and fungal nucleic acid sequence; or combinations thereof. The target nucleic acid sequence may comprise a cell type and/or cell state specific sequence. The target nucleic acid sequence may be extracted from the sample. For example, the target nucleic acid sequence in the sample may be purified or partially purified prior to hybridisation and/or amplification. The extraction of target nucleic acid sequence may be carried out by the skilled person by standard laboratory techniques.
The target nucleic acid sequence may be amplified prior to hybridising the nucleic acid probe. The sample may be provided with pre-amplified target nucleic acid sequence. The amplification of target nucleic acid sequence may comprise or consist of polymerase amplification. The amplification of target nucleic acid sequence may comprise or consist of PCR. The PCR may use a pair of primers. One or both primer of the primer pair may be affinity tagged, thereby providing affinity tagged PCR product. The target nucleic acid sequence may be affinity tagged. The affinity tag may comprise biotin. The hybridisation of the nucleic acid probe with the target nucleic acid sequence may be detected by an electrochemical genosensor. The hybridisation of the nucleic acid probe with the target nucleic acid sequence may be detected by surface enhanced resonance Raman scattering (SERRS) or surface enhanced Raman scattering (SERS) assay, for example for detecting dye labelled nucleic acid. The dye may be a Raman-active dye, such as an azo dye.
The hybridisation may be detected via an increase in a current signal of an electroactive indicator (e.g. that preferentially binds the double-stranded DNA). The electroactive indicator may be used in conjunction with, or alternatively to, enzyme or redox labels, or from other hybridisation-induced changes in electrochemical parameters. Detecting hybridisation may comprise the use of differential pulse voltammetry (DPV), square wave voltammetry (SWV) and/or potentiometric stripping analysis (PSA). Detecting hybridisation may comprise the use of an intercalative compound/groove binder and/or enzyme label. For detection of hybridisation, handling of nucleic acid, and analysis, the probe nucleic acid and/or target nucleic acid may be labelled. For example, the label may comprise an organic dye, organic fluorophore, fluorescent dye, IR absorbing dye, UV absorbing dye, metachromatic dye, photochromic dye, thermochromic dye, or sulphonephthalein dye. The label may comprise an azo-dye. The label may comprise enzyme labels, nanoparticle labels, or radio- labels. The label may comprise fluorescence dye (cyanine dye (Cy3, Cy5), Texas Red, Rhodamine Red, Alexa Dye, Bodipy dye, Atto dye, FAM, TET, HEX, JOE, Cy3, TAM RA, or ROX,). Nanoparticles labels may be used to enhance the signal, and may be further modified with DNA or an appropriate dye. The label may comprise electrochemical dyes (e.g. methylene blue, Co(phen)3(CI04)3) or HRP enzyme.
The nucleic acid probe may be anchored to, and arranged in, an array (i.e. a microarray). A plurality of different nucleic acid probes may be arranged in an array in order to detect a range of different target nucleic acid sequences. Additionally or alternatively, a plurality of the same nucleic acid probes may be anchored in an array for detecting hybridisation with target nucleic acid sequence under varying conditions. Varying conditions could include physical parameters such as temperature, and/or detecting hybridisation in the presence of additional components, such as potential therapeutic molecules, for example, arranged to target a nucleic acid sequence.
According to another aspect of the invention, there is provided a nucleic acid probe molecule, which is anchored to a substrate,
wherein the anchor point is located in a mid-region of the nucleic acid. In an embodiment wherein multiple anchor points are provided the anchor points may only be located in the mid-region of the nucleic acid probe.
According to another aspect of the invention, there is provided a nucleic acid probe molecule, which is anchored to a substrate,
wherein the anchor point is not located at a terminal residue of the nucleic acid.
A plurality of nucleic acid probes may be anchored to the substrate. According to another aspect of the invention, there is provided a nucleic acid probe comprising an anchor group arranged to anchor the nucleic acid to a substrate, wherein the anchor group is located in a mid-region of the nucleic acid probe. The nucleic acid probe according to the invention, wherein
a) the nucleic acid does not comprise terminal or near-terminal anchor groups; or b) the anchor group is the only anchor group arranged to anchor the nucleic acid to a substrate. The nucleic acid probe according to the invention, wherein anchor group is not located in a loop region of a stem loop structure.
According to another aspect of the invention, there is provided a nucleic acid probe comprising an anchor group arranged to anchor the nucleic acid to a substrate, wherein the anchor group is not located at a terminal residue of the nucleic acid probe.
A plurality of nucleic acid probes may be provided. In one embodiment, a plurality of nucleic acid probes may be between 2 and 100 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 50 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 25 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 10 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 7 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 2 and 6 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 3 and 100 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be between 10 and 100 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be at least 2 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be at least 3 nucleic acid probes. In another embodiment, a plurality of nucleic acid probes may be at least 4, 5, 10, 20, or 30 nucleic acid probes. According to another aspect of the invention, there is provided a microarray comprising a plurality of nucleic acid probes anchored to a substrate, wherein the anchor point is located in a mid-region of the nucleic acid probe. In an embodiment wherein multiple anchor points are provided the anchor points may only be located in the mid-region of the nucleic acid probe.
The nucleic acid probes may be separated, for example into groups of the same nucleic acid probe, into compartments in the microarray. Such compartmentalisation may facilitate the testing of different samples and/or conditions.
The surface density of the nucleic acid probe (once anchored) may be about 1012 per cm2. The surface density of the nucleic acid probe (once anchored) may be about 4.2 x 1011 per cm2. The surface density of the nucleic acid probe (once anchored) may be between about 4.2 x 1011 per cm2 and about 1012 per cm2. The surface density of the nucleic acid probe (once anchored) may be between about 1 x 1011 per cm2 and about 10.512 per cm2. The surface density of the nucleic acid probe (once anchored) may be between about 1 x 1010 per cm2 and about 1013 per cm2. In one embodiment, the surface density of the nucleic acid probe (once anchored) may be less than about 1013 per cm2. In another embodiment, the surface density of the nucleic acid probe (once anchored) may be less than about 1012 per cm2. In another embodiment, the surface density of the nucleic acid probe (once anchored) may be less than about 5 x 1011 per cm2. The surface density of the nucleic acid probe may be calculated using a chronoamperometric method. The probe may be hybridised to its target prior to anchoring to the substrate surface, or hybridised to its target after anchoring to the substrate surface. A lower density of nucleic acid probe may be provided on the substrate surface by hybridising the nucleic acid probe to its target prior to anchoring. The skilled person will understand that optional features of one embodiment or aspect of the invention may be applicable, where appropriate, to other embodiments or aspects of the invention. Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings.
Figure 1: schematic diagram to show A) an end tethering approach where the DNA adopts a vertical orientation, and B) a middle tethering approach where the DNA adopts a horizontal and more fixed orientation.
Figure 2: Structure of the dithiol linker attached on the thymine base. Figure 3: (a- b) SE S spectra of the DNA probe-1 (short probe with a thiol linker appox. in the middle) that was immobilised at 40 °C and was hybridised with (a) fully- complementary short target DNA(Target 1) and (b) non-complementary short target DNA (Target 3). (c-d) SERS spectra of DNA probe with the dithiol at the (c) 5' end (Probe 5) and (d) 3' end (Probe 6), hybridized to a complementary short DNA target (Target-1). The DNA target was labelled with Texas Red and Cy3B at the 5' and 3' ends respectively.
Figure 4: SERS spectra of the DNA probe-1 (short probe with a thiol linker approx. in the middle) hybridised with (a) fully-complementary long target DNA (Target 2) and (c) non-complementary long target DNA (Target 4), (b) SERS spectra of DNA probe-4
(short probe with a thiol linker appox. in the middle) hybridised with a fully complementary long target (Target 5).
Figure 5: SERS spectra of the long DNA probe (77 bases long, Probe 3) with a thiol in the middle and hybridised (a) to a fully complementary long DNA target (76 bases long, Target 2) and (b) non complementary long DNA target (79 bases long, Target 4).
Figure 6: SERS spectra of the DNA probe 2 hybridised to the long complementary target (target 2) and the long non complementary target (target 4).
Figure 7: SERS spectra of the (a) DNA probe 1 and (b) DNA probe 2, hybridised to the long complementary target (target 2). The spectra are all displayed with the same intensity but have been offset for clarity. Figure 8: Some common reactions used for the covalent binding of DNA on different electrochemical transducer surfaces, (a) Immobilisation of ssDNA on glassy carbon electrodes (through deoxyguanosine group (dG)n-DNA) using carbodiimide method (EDC: l-3(-dimethylaminopropyl)-3-ethyl-carbodiimide;NHS:N- hydroxysulfosuccinimide). (b) Carbodiimide method upon carbon paste bulk modified by stearic acid, (c) Carbodiimide method upon a graphite electrode modified with amino groups (APTES: 3-aminopropyltriethoxysilane). Attachment through 5% phosphate group of ssDNA, (P)ssDNA. (d) Attachment through 5' phosphate group of ssDNA onto aminoethanethiol modified gold electrode, (e) Attachment of ssDNA onto phosphoric acid-terminated surface of a gold electrode (MBPA: mercaptobutylphosphoric acid), (f) DNA immobilisation onto a mercaptosilane coating of a platinum surface via the amino groups of the bases, (NH2)ssDNA (TMSPT: 3- trimethoxysilyl-l-propanethiol; CDI: N-cyclohexyl-N%-[2-(N-methylmorpholino)-ethyl]- carbodiimide-4-toluene sulfonate), (g) Immobilisation using functionalised polypyrrole (Py: 3-acetic acid pyrrole; Py-polymer: 3-N-hydroxyphthalimide pyrrole; (NH2..DNA): an amino-substituted oligonucleotide). Figure 8 is adopted from: Pividori et al, Biosens. Bioelectron., 2000, 15, 291-303.
Figure 9: (a) - (b) Structure of dithiol and hexaethylene glycol linker attached at the (a) 3'and (b) 5' end of the DNA probes, (c) Structure of the Cy3B modification at the 3' end and (d) the Texas Red modification at the 5' end.
Figure 10: Binding isotherm for [Ru(NH3)6] + with DNA duplex immobilised horizontally on an Au SSV substrate. For this experiment, the duplex was hybridized in solution and then the duplex strand (0.5 μΜ of dsDNA in 0.05 M Na2S04) was immobilised on the SSV Au surface overnight. The surface was then passivated with mercaptohexanol (1 mM).
A method of the present invention is to specifically immobilize a DNA probe horizontally on the surface. This orientation leads to lower probe density which can increase the hybridization efficiency as well as locating the DNA backbone closer to the sensor surface thereby allowing increased sensitivity. For example, DNA sequences that were aligned horizontally to the surface have been shown to be effective for sensitive electronic10 and SERS11 label free detection of DNA. However, in these reports the DNA was physically adsorbed on the surfaces, whereas specific attachment via a linker would be more efficient and more controlled for the design of molecular assays. A recent approach described the specific horizontal immobilization of a 15-mer PNA probe on a silicon dioxide surface via three linker molecules attached at three locations (γ points) along the PNA backbone.12 This approach, although promising, used linkers at both ends of the probe, leaving open the possibility for the DNA to bind on the surface via only one end. Herein, the invention provides a simple, straightforward methodology for specific tethering of DNA probes using a single linker, by placing the linker approximately in the middle of the probe to ensure horizontal orientation of the attached dsDNA. The thiol linker is attached to a thymine base.
Previously vertically tethered DNA was used on Au sphere segment void (SSV) surfaces which give large SE S enhancements,13 14 to develop assays for sensitive DNA discrimination by targeting the detection of single nucleotide polymorphism15 and tandem repeats.16 Specifically, a negative potential is applied on the Au SSV surface to melt the DNA and the melting is monitored by recording the SERS signal of the labelled DNA target as a function of applied potential. When the DNA target diffuses away from the surface after dsDNA dissociation, the signal of the SERS label decreases significantly. Importantly, it was shown that it is possible to monitor the electrochemical melting of the duplexes on the Au SSV surface utilizing the SERS signal of a binding agent (methylene blue) that can specifically interact with the double helix instead of using a label that is covalently attached to the DNA.17 Here, the same methodology can be applied using horizontally tethered DNA, utilizing both a covalently attached dye and methylene blue as a binding agent specific for dsDNA to monitor the DNA melting. Results and Discussion
A modified 30bp oligonucleotide probe ( 5' -h exy n o I - ATATC ATCTTTG GTGT*TTCCTC A TGCTTTA- 3') (SEQ ID NO: 1) was synthesized. The T* indicates a deoxythymidine (dT) modified with a linker consisting of three dithiols as a surface anchor and a propagylamidopentanol linker attached at the C5 position of the thymine, as shown in Figure 2. The modified dT was the 16th base along the probe starting from the 5' end. The length of the DNA probe is ~10.2 nm and the length of the linker between the thymine and the Au surface (from propagylamidopentanol, phosphate and the first dithiol) can range from 0.8 nm to 2.3 nm depending on whether the alkyl chain is curled or extended. No spacers have been used between the three dithiol units and thymine base to minimize the bending of the DNA duplex and facilitate a fixed and rigid orientation on the surface. Immobilization of the DNA probe at room temperature prior to hybridization was avoided since the DNA might coil up on the surface in an unsuitable manner. Instead, two different methods were used: (i) the DNA probe was hybridized to its target in solution to guarantee that the desired rigid duplex was formed before surface immobilization. The Au SSV surface was then incubated in the 0.5 μΜ DNA solution at room temperature, overnight, following passivation with mercaptohexanol. (ii) the DNA probe was first immobilized on the surface at 40 QC for 6 hours in order to allow the DNA to bind in its uncoiled form.4 The Au surface was then passivated with mercaptohexanol before hybridized to its target DNA at room temperature for 2 hours. It should be noted that in both cases the DNA was immobilized at low ionic strength (0.05 M Na2S04) since there was no need to screen the duplex charge in these inherently low probe density surfaces.
To monitor the orientation of the DNA duplex, the target DNA was labelled on each end with a different fluorophore;, Texas Red at the 5' end and Cy3B at the 3' end. For comparison purposes, two additional probes that had the thiol linker attached on the 5' and 3' end respectively were synthesized (Table 1). Figure 3 (a)-(d) shows SERS spectra of the DNA probe with the thiol linker attached on the thymine base assembled on the gold SSV under both sets of conditions with both the complementary and non-complementary target DNA. Significantly, bands for both Texas Red and Cy3B are visible when the DNA probe with the thiol linker located on the thymine base is hybridized to the complementary target, Figure 3 (a). The presence of bands associated with both dyes in the SERS spectra, demonstrates that the DNA backbone has been successfully orientated horizontal to the Au surface under both sets of surface immobilization conditions. No SERS signal is observed with the non-complementary sequence in either case (Figure 3 (b)). For the complementary DNA (Figure 3 (a)) even though the two dyes have exactly the same surface concentration, the Texas Red bands are stronger than those of Cy3B. Different linkers were used to attach each dye on the DNA (Figure 9), and it is possible that Texas Red adopts a more favored orientation on the surface compare to Cy3B. In addition Texas Red has a stronger resonance contribution (Amax, 589 nm) with the 633 nm laser used here than the Cy3B dye (Amax, 558 nm). A similar difference in SERS intensity has been observed when two different DNA strands individually labelled with the two dyes were immobilized vertically on the surface. In contrast, for the DNA probe attached through the 3' or 5' end, in Figure 3 (c) where the Texas Red is close to the surface and Cy3B is ~10 nm from the surface, the Texas Red bands dominate the spectrum and the Cy3B bands are not visible; whereas in Figure 3 (d), when Texas Red is positioned at the opposite end from the attachment point (~10 nm from the surface), the fluorescence is not quenched and the SERS bands are almost completely masked.
To further verify the robustness and practicality of the use of the thiol linker attached on the thymine base, the horizontally tethered dsDNA was denatured either electrochemically (by application of -1.2 V vs Ag/AgCI), or thermally (by heating to 80 °C). For these experiments the target DNA was labelled with a single Texas Red fluorophore at the 5' end. After DNA denaturation by either method, the Texas Red SERS signal was lost due to the labelled DNA target being released and diffusing away from the surface. In both cases, the SERS signal was recovered when the immobilized probes were re-hybridized clearly demonstrating that the probe horizontally oriented through the thiol linker attached on the thymine remained on the surface and could undergo hybridization so that the functionalized substrates could be reused. The slight reduction in the SERS signals after electrochemical denaturation, compare Fig 2b (i) and (ii), probably reflects some reductive electrochemical desorption of the thiol linked DNA probe from the Au surface at -1.2 V. The surface density of DNA probes at a gold electrode was estimated using the chronoamperometric method of Steel et al.18 Previously, we found the surface coverage of dsDNA immobilized through the three dithiol linker at the 3' or 5' end to be ~1.6 x 1012 molecules per cm2 (on average the DNA molecules are 8.5 nm apart). We found the surface coverage of the dsDNA immobilized horizontally through the thiol linker attached on the thymine base to be 4.2 x 1011 per cm2 (on average of the DNA molecules are 15 nm apart), demonstrating the lower density of the DNA on the surface using this new approach (Figure 10).
The surface density of the DNA was calculated using a chronoamperometric method. The surface coverage was found slightly different, depending on the immobilization methods:
(a) The DNA probe was hybridised to its target in solution and then was immobilised on the surface / as dsDNA. In that case the surface density was found to be 4.2 x 1011 per cm2. (b) The DNA probe was first immobilised on the surface at 40 °C for 6 hours and then was hybridised. In the case the surface density was found to be ~1012 per cm2 (this is close to the surface density we get when the DNA is immobilised). Conclusions
This study demonstrates a new simple and effective methodology for the covalent attachment of DNA probes on gold surfaces that promotes horizontal orientation of the dsDNA. The method is sensitive for the discrimination of complementary and non-complementary DNA. The DNA duplexes can also be melted on the surface and their melting profile can be monitored using either a labelled DNA target or unmodified target with an added binding agent specific for double stranded DNA (i.e. methylene blue). This new immobilization strategy can be applied to a wide range of optical or electronic biosensors and has the potential to improve the hybridization efficiency of long DNA targets on the surface as well as the overall sensitivity of the sensors. The same methodology can be applied to successfully induce horizontal orientation of the DNA on surfaces up to the persistence length of dsDNA (> 150 bp).
Additional Experiments
A methodology that allows the specific tethering of dsDNA horizontally on the surface is provided. This can be achieved using a linker on the DNA probe, which will be placed approximately in the middle of the DNA sequence.
The methodology to achieve the horizontal orientation is as follows:
1. The DNA probe modified with a surface-linker is first immobilised on a gold nanostructured surface by incubation of the surface in a DNA solution at 40°C for 6 hours in order to allow the DNA to bind in its uncoiled form.
2. The surface is then passivated mercaptohexanol in order to prevent unspecific binding of the DNA to the surface.
3. The surface tethered DNA probe is then hybridised to its target DNA at room temperature for 2 hours. SERS spectroscopy was utilised to show that the DNA was hybridised in a horizontal orientation. To monitor the orientation of the DNA duplex, the target DNA was labelled on each end with different fluorophores: Texas Red at the 5' end and Cy3B or Cy3 at the 3' end.
Table 1: DNA probes used in this study
Figure imgf000027_0001
Table 2. DNA targets used in this study"
Name DNA sequences (5'-3') Length of
the DNA sequence
DNA complementary to probes 1, 2, 3, 5 and 6
Target -1 Comp-short target 30 bases
Texas Red * -
TAAAGCATGAGGAAACACCAAAGATGATAT-Cy3B*
(SEQ ID NO: 7)
Target 2 Comp long target 78 bases
Texas Red*- TAAAGACGTTGTTAAATATTAATCCTAAAGCATGAGG
AAACACCAAAGATGATATCGACACACAAACAGGGCT TAATG -Cy3 (SEQ ID NO: 8)
Non-complementary
Target 3 Non Comp-short target 30 bases
Texas Red*-
G G CT ACC AGTCG C AG GT AGTTG GTG ATAGTC (SEQ
ID NO: 9)
Target 4 Non Comp-long target 79 bases
Texas Red*-
TAAAGACGTTGTTAAATATTAATCCGGCTACCAGTCG CAGGTAGTTGGTGATAGTCCGACACACAAACAGGGC TTAATG (SEQ ID NO: 10)
Complementary target for probe 4
Target 5 Comp long target 76 bases
Texas Red *-
TGTAAAGACGGCCAGTGCATTCGAGCATCCTACCACA AAACTCACTGTCAGTGTCTGACACACACAAAATGCAC GA - Cy3 (SEQ ID NO: 11)
" T *= 5-Octadiynyl-dU+amino C6 + Texas Red, Cy3b*= modified Cy3b
Results
Figure 3(a) and (b) shows the results where a short probe (30 bases long) that had the surface- linker in the middle and was hybridised with a short complementary target (30 bases long) and a short non-complementary target (30 bases long).
Figure 4 shows the results of utilizing a short probe (30 bases long) that had a surface-linker in the middle, hybridised to a longer complementary target (76 bases long) and a longer non- complementary target. The figure shows that when the probe was hybridised to a fully complementary long target the SERS spectrum contains bands associated with both dyes. Therefore the dsDNA has been successfully orientated parallel to the Au surface. When the probe was hybridised to a non-complementary long DNA target, no SERS signal is observed. Two different probes have been used to show that the result is reproducible and can be applied to different DNA sequences.
Figure 5 shows the results of utilising a long probe (77 bases long), with a surface-linker approx. in the middle, hybridised to a fully complementary long target (76 bases long). The SERS spectrum contains bands associated with mainly Texas Red. Small bands of Cy3 can be observed. The figure also shows that when the probe was hybridised to a non-complementary target, there is an insignificantly small signal of Texas Red demonstrating that the hybridization is specific to the complementary sequence.
Figure 6 shows the results of utilising a short probe (25 bases long) that had three linkers, one in the middle and one in each end of the DNA (Probe 2). The figure shows that when the probe was hybridised to a fully complementary short target the SERS spectrum contains bands associated with both dyes. When the probe was hybridised to a non-complementary long DNA target, no SERS signal is observed. Figure 7 shows the spectra of dsDNA when (a) short DNA probe (probe 1, one linker in the middle) was used hybridised with a long DNA target (target 2) and (b) short DNA (probe 2, three linkers across the DNA backbone) was used hybridised with a long DNA target (target 2). It obvious that when there is only one linker on the DNA probe the signal from both of the dyes is significantly stronger, demonstrating that the horizontal immobilisation of the DNA is more successful when the probe has only one thiol in the middle.
2. Length of the DNA sequence:
The same methodology can be applied to successfully induce horizontal orientation of the DNA on surfaces up to the persistence length of dsDNA (> 150 bp). The experiments show that when a short probe is used (~ 30 bases) hybridised to a longer target (~ 77 bases) the methods works very well. When the probe is longer (~ 77 bases), the method still works, however the signal from both of the dyes is not as intense as with a shorter probe.
The distance from base to base in the DNA sequence is 0.34 nm. The length of the linker, for this experiment, between the thymine and the Au surface (from propagylamidopentanol, phosphate and the first dithiol) can range from 0.8 nm to 2.3 nm depending on whether the alkyl chain is curled or extended. Therefore, for this linker, the DNA probe is preferably no smaller than 14 bases (the length of 7 bases will be 2.38 nm). If the DNA sequence is smaller than 14 bases then there is a possibility that the DNA can orientate perpendicular on the surface (when the linker is extended which is not very likely).
For shorter DNA sequences a shorter linker can be employed. The length of the linker should be optimised with regards to the length of the DNA probe. 3. Methods to immobilise DNA on a surface.
1. Adsorption via the DNA backbone
Surfaces: nitrocellulose, polysterene, metal oxide surfaces, metal surfaces
2. DNA immobilisation utilising avidin-biotin complexation. The electrodes are immersed in a solution of avidin. Then they are immersed in a stirred solution containing biotinylated oligonucleotide. Avidin complexes with biotin and the resulting complex is very stable.
Surfaces: graphene electrode surfaces
3. DNA immobilisation by covalent attachment to a surface though a linker (Figure 11). This method allows control of spacing, loading density and orientation of the oligonucleotide probe.
Table 2. Surface modification to bind modified and unmodified DNA. Adopted from Martin Dufva, Biomolecular Engineering, 2005, 22, 173-184
DNA modification Substrate modification
None Polylysine
Amine
Epoxy
Diazonium ion
SU-8
Unmodified glass
Agarose film
Membrane
Silanes Unmodified glass
Thiols Gold
Mercaptosilanes
Maleimide
lodoacetyl
Amines (-NH2) Aldehydes
Epoxy
Isothiocyanate
Phosphates (P03) Aminated surfaces
Biotin Avidin REFERENCES
(1) Bantz, K. C; Meyer, A. F.; Wittenberg, N. J.; Im, H.; Kurtulus, O.; Lee, S. H.; Lindquist, N. C; Oh, S.-H.; Haynes, C. L. Phys. Chem. Chem. Phys.2011, 13, 11551.
(2) Noor, M . O.; Krull, U. J. Anal. Chim. Acta 2014, 825, 1.
(3) Josephs, E. A.; Ye, T. J. Am. Chem. Soc.2012, 134, 10021.
(4) Kaiser, W.; Rant, U. J. Am. Chem. Soc.2010, 132, 7935.
(5) Farjami, E.; Campos, R.; Ferapontova, E. E. Langmuir 2012, 28, 16218.
(6) Burden, C. J.; Pittelkow, Y.; Wilson, S. R. J. Phys. Condens. Matter 2006, 18, 5545.
(7) Halperin, A.; Buhot, A.; Zhulina, E. B. J. Phys. Condens. Matter 2006, 18, S463.
(8) Ku, W. C; Lau, W. K.; Tseng, Y. T.; Tzeng, C. M .; Chiu, S. K. Biochem. Biophys. Res. Commun.2004, 315, 30.
(9) Pontius, B. W.; Berg, P. Proc. Natl. Acad. Sci. U. S. A.1991, 88, 8237.
(10) Fritz, J.; Cooper, E. B.; Gaudet, S.; Sorger, P. K.; Manalis, S. R. Proc. Natl. Acad. Sci. U. S. A.2002, 99, 14142.
(11) Papadopoulou, E.; Bell, S. E. J. Angew. Chem. Int. Ed.2011, 50, 9058.
(12) De, A.; Souchelnytskyi, S.; van den Berg, A.; Carlen, E. T. ACS Appl. Mater. Interfaces 2013, 5, 4607.
(13) Cintra, S.; Abdelsalam, M. E.; Bartlett, P. N.; Baumberg, J. J.; Keif, T. A.; Sugawara, Y.; Russell, A. E. Faraday Discuss.2006, 132, 191.
(14) Cole, R. M.; Baumberg, J. J.; Garcia de Abajo, F. J.; Mahajan, S.; Abdelsalam, M.; Bartlett, P. N. Nano Lett.2007, 7, 2094.
(15) Mahajan, S.; Richardson, J.; Brown, T.; Bartlett, P. N. J. Am. Chem. Soc.2008, 130, 15589.
(16) Corrigan, D. K.; Gale, N.; Brown, T.; Bartlett, P. N. Angew. Chem. Int. Ed.2010, 49, 5917.
(17) Johnson, R. P.; Richardson, J. A.; Brown, T.; Bartlett, P. N. J. Am. Chem. Soc.2012, 134, 14099.
(18) Steel, A. B.; Heme, T. M.; Tarlov, M. J. Anal. Chem.1998, 70, 4670.
(19) Johnson, R. P.; Gale, N.; Richardson, J. A.; Brown, T.; Bartlett, P. N. Chem. Sci.2013, 4, 1625.
(20) Rohs, R.; Bloch, I.; Sklenar, H.; Shakked, Z. Nucleic Acids Res.2005, 33, 7048.
(21) Moskovits, M.; Suh, J. S. J. Phys. Chem.1984, 88, 5526.

Claims

1. A method of analysing nucleic acid in a sample comprising:
-providing a nucleic acid probe, which is anchored to a substrate surface only from one or more point(s) located in a mid-region of the nucleic acid probe; and
-detecting the presence or absence of a target nucleic acid sequence in the sample by hybridisation of the nucleic acid probe with the target nucleic acid sequence if present.
2. The method of claim 1, wherein a successful hybridisation of the nucleic acid probe to the target nucleic acid sequence indicates the presence of the target nucleic acid in the sample; and optionally wherein the failure to hybridise the nucleic acid probe to the target nucleic acid sequence indicates the absence of detectable quantities of the target nucleic acid in the sample. 2. The method according to claim 1 or 2, further comprising detecting the amount or concentration of the target nucleic acid in the sample.
3. The method according to any preceding claim, wherein providing a nucleic acid probe molecule anchored to a substrate comprises
-providing a modified nucleic acid molecule comprising an anchor group arranged to anchor the modified nucleic acid to a substrate;
-providing a substrate; and
-reacting the anchor group of the modified nucleic acid with the substrate to form nucleic acid probe, which is anchored to the substrate.
4. The method according to any preceding claim, wherein the nucleic acid probe is between about 8 and about 150 nucleotides in length.
5. The method according to any preceding claim, wherein the nucleic acid probe is between about 8 and about 35 nucleotides in length.
6. The method according to any preceding claim, comprising a plurality of nucleic acid probes having an average length of between about 8 and about 100 nucleotides.
7. The method according to any preceding claim, wherein the nucleic acid probe comprises a single anchor point.
8. The method according to any preceding claim, wherein the mid-region of the nucleic acid probe is at least 3 nucleotides away from either end of the nucleic acid probe.
9. The method according to any preceding claim, wherein the mid-region of the nucleic acid probe comprises a series of nucleotides that are distanced at least 10% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
10. The method according to any preceding claim, wherein the mid-region of the nucleic acid probe comprises a series of nucleotides that are distanced at least 30% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
11. The method according to any preceding claim, wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, and the mid-region of the nucleic acid probe is at least 5 nucleotides away from either end of the nucleic acid probe.
12. The method according to any preceding claim, wherein the nucleic acid probe is single stranded nucleic acid.
13. The method according to any preceding claim, wherein the nucleic acid probe comprises a modified nucleotide, comprising a linker or reactive group to form an anchor.
14. The method according to any preceding claim, wherein the anchor is between about 0.3nm and about 5nm in length.
15. The method according to any preceding claim, wherein the length of the anchor is less than 51% of the length of the nucleic acid probe.
16. The method according to any preceding claim, wherein the probe nucleic acid and/or target nucleic acid are labelled.
17. The method according to any preceding claim, wherein a plurality of the nucleic acid probes are anchored to, and arranged in, an array.
18. A nucleic acid probe, which is anchored to a substrate,
wherein the anchor point(s) is located only in a mid-region of the nucleic acid.
19. A nucleic acid probe comprising an anchor group arranged to anchor the nucleic acid to a substrate, wherein the anchor group is located in a mid-region of the nucleic acid probe, and wherein
a) the nucleic acid does not comprise terminal or near-terminal anchor groups; or b) the anchor group is the only anchor group arranged to anchor the nucleic acid to a substrate.
20. A microarray comprising a plurality of nucleic acid probes anchored to a substrate, wherein the anchor point(s) is located only in a mid-region of the nucleic acid probe.
21. The nucleic acid probe according to claim 18 or 19, or micro array according to claim 20, wherein the nucleic acid probe is between about 8 and about 150 nucleotides in length.
22. The nucleic acid probe according to claim 18 or 19, or micro array according to claim 20, wherein the nucleic acid probe is between about 8 and about 35 nucleotides in length.
23. The nucleic acid probe according to claim 18 or 19, or micro array according to claim 20, comprising a plurality of nucleic acid probes having an average length of between about 8 and about 100 nucleotides.
24. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 23, wherein the nucleic acid probe comprises a single anchor point.
25. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 24, wherein the mid-region of the nucleic acid probe is at least 3 nucleotides away from either end of the nucleic acid probe.
26. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 25, wherein the mid-region of the nucleic acid probe comprises a series of nucleotides that are distanced at least 10% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
27. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 26, wherein the mid-region of the nucleic acid probe comprises a series of nucleotides that are distanced at least 30% from either of the terminal nucleotides relative to the entire nucleic acid probe length.
28. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 27, wherein the nucleic acid probe is between about 18 and about 25 nucleotides in length, and the mid-region of the nucleic acid probe is at least 5 nucleotides away from either end of the nucleic acid probe.
29. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 28, wherein the anchor is between about 0.3nm and about 5nm in length.
30. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 29, wherein the length of the anchor is less than 51% of the length of the nucleic acid probe.
31. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 30, wherein the probe nucleic acid and/or target nucleic acid are labelled.
32. The nucleic acid probe according to claim, or micro array according to any of claim 18 to 31, wherein the nucleic acid probe is single stranded nucleic acid.
33. A nucleic acid probe, microarray, or method substantially as described herein, optionally with reference to the accompanying figures.
PCT/GB2016/050617 2015-03-06 2016-03-07 Nucleic acid analysis involving surface-anchored nucleic acid probes Ceased WO2016142687A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1503845.8 2015-03-06
GB201503845A GB201503845D0 (en) 2015-03-06 2015-03-06 Nucleic acid analysis

Publications (1)

Publication Number Publication Date
WO2016142687A1 true WO2016142687A1 (en) 2016-09-15

Family

ID=52998527

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2016/050617 Ceased WO2016142687A1 (en) 2015-03-06 2016-03-07 Nucleic acid analysis involving surface-anchored nucleic acid probes

Country Status (2)

Country Link
GB (1) GB201503845D0 (en)
WO (1) WO2016142687A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005047301A1 (en) * 2003-11-07 2005-05-26 Solexa Limited Improvements in or relating to polynucleotide arrays

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005047301A1 (en) * 2003-11-07 2005-05-26 Solexa Limited Improvements in or relating to polynucleotide arrays

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ARPITA DE ET AL: "Peptide Nucleic Acid (PNA)-DNA Duplexes: Comparison of Hybridization Affinity between Vertically and Horizontally Tethered PNA Probes", ACS APPLIED MATERIALS AND INTERFACES, vol. 5, no. 11, 12 June 2013 (2013-06-12), US, pages 4607 - 4612, XP055275501, ISSN: 1944-8244, DOI: 10.1021/am4011429 *
BROUDE N E ET AL: "DNA microarrays with stem-loop DNA probes: preparation and applications", NUCLEIC ACIDS RESEARCH, INFORMATION RETRIEVAL LTD, GB, vol. 29, no. 19, 1 January 2001 (2001-01-01), pages E92, XP002993367, ISSN: 0305-1048 *
E. PAPADOPOULOU ET AL: "Specifically horizontally tethered DNA probes on Au surfaces allow labelled and label-free DNA detection using SERS and electrochemically driven melting", CHEMICAL SCIENCE, vol. 7, no. 1, 8 October 2015 (2015-10-08), United Kingdom, pages 386 - 393, XP055275499, ISSN: 2041-6520, DOI: 10.1039/C5SC03185K *
RICCELLI P V ET AL: "Hybridization of single-stranded DNA targets to immobilized complementary DNA probes: comparison of hairpin versus linear capture probes", NUCLEIC ACIDS RESEARCH, INFORMATION RETRIEVAL LTD, GB, vol. 29, no. 4, 15 February 2001 (2001-02-15), pages 996 - 1004, XP002282478, ISSN: 0305-1048, DOI: 10.1093/NAR/29.4.996 *
ZHAO XIAODONG ET AL: "Immobilization of oligodeoxyribonucleotides with multiple anchors to microchips", NUCLEIC ACIDS RESEARCH, INFORMATION RETRIEVAL LTD, GB, vol. 29, no. 4, 15 February 2001 (2001-02-15), pages 955 - 959, XP002175040, ISSN: 0305-1048, DOI: 10.1093/NAR/29.4.955 *

Also Published As

Publication number Publication date
GB201503845D0 (en) 2015-04-22

Similar Documents

Publication Publication Date Title
Xiao et al. Rationally engineered nucleic acid architectures for biosensing applications
Samanta et al. Nucleic‐acid structures as intracellular probes for live cells
Zaid et al. PNA biosensor based on reduced graphene oxide/water soluble quantum dots for the detection of Mycobacterium tuberculosis
Wang et al. Surface plasmon resonance biosensor for enzyme-free amplified microRNA detection based on gold nanoparticles and DNA supersandwich
Hamidi-Asl et al. A review on the electrochemical biosensors for determination of microRNAs
Ji et al. Binding-induced DNA walker for signal amplification in highly selective electrochemical detection of protein
Lu et al. Electrogenerated chemiluminescence biosensor with a tripod probe for the highly sensitive detection of microrna
Zhang et al. Polarity control for nonthiolated DNA adsorption onto gold nanoparticles
Tosar et al. Electrochemical DNA hybridization sensors applied to real and complex biological samples
Lv et al. G-quadruplex as signal transducer for biorecognition events
Chai et al. A novel electrochemiluminescence strategy for ultrasensitive DNA assay using luminol functionalized gold nanoparticles multi-labeling and amplification of gold nanoparticles and biotin–streptavidin system
CN111175365B (en) Electrochemical sensor for detecting exosome miRNA (micro ribonucleic acid), and preparation and application thereof
Liang et al. Electrochemical biosensor for microRNA detection based on cascade hybridization chain reaction
Tao et al. Double-loop hairpin probe and doxorubicin-loaded gold nanoparticles for the ultrasensitive electrochemical sensing of microRNA
Yaman et al. One-pot synthesized gold nanoparticle-peptide nanotube modified disposable sensor for impedimetric recognition of miRNA 410
Zhang et al. DNA triangular prism nanostructure and CRISPR/Cas12a empowered electrochemical biosensor for dual detection of alpha-fetoprotein and microRNA 122
Djebbi et al. Highly sensitive fluorescence assay for miRNA detection: Investigation of the DNA spacer effect on the DSN enzyme activity toward magnetic-bead-tethered probes
Zhai et al. A label-free genetic biosensor for diabetes based on AuNPs decorated ITO with electrochemiluminescent signaling
Hasanzadeh et al. (Nano)-materials and methods of signal enhancement for genosensing of p53 tumor suppressor protein: Novel research overview
Wan et al. Nanoprobe-initiated enzymatic polymerization for highly sensitive electrochemical DNA detection
Fan et al. A label-free ultrasensitive assay of 8-hydroxy-2′-deoxyguanosine in human serum and urine samples via polyaniline deposition and tetrahedral DNA nanostructure
Liu et al. Nonenzymatic multiamplified electrochemical detection of medulloblastoma-relevant microRNAs from cerebrospinal fluid
Lee et al. Electrochemical detection of leukemia oncogenes using enzyme-loaded carbon nanotube labels
Trifonov et al. Application of the hybridization chain reaction on electrodes for the amplified and parallel electrochemical analysis of DNA
Li et al. Highly sensitive electrochemical detection of human telomerase activity based on bio-barcode method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16709549

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16709549

Country of ref document: EP

Kind code of ref document: A1