WO2016138294A1 - Hesperidin-containing compositions and methods for treatment of skin disorders - Google Patents

Hesperidin-containing compositions and methods for treatment of skin disorders Download PDF

Info

Publication number
WO2016138294A1
WO2016138294A1 PCT/US2016/019613 US2016019613W WO2016138294A1 WO 2016138294 A1 WO2016138294 A1 WO 2016138294A1 US 2016019613 W US2016019613 W US 2016019613W WO 2016138294 A1 WO2016138294 A1 WO 2016138294A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
hesperidin
present
skin
total
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/019613
Other languages
French (fr)
Inventor
Peter M. Elias
Mao-Qiang MAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Publication of WO2016138294A1 publication Critical patent/WO2016138294A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/63Steroids; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/72Cosmetics or similar toiletry preparations characterised by the composition containing organic macromolecular compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/34Alcohols
    • A61K8/345Alcohols containing more than one hydroxy group
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/36Carboxylic acids; Salts or anhydrides thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/36Carboxylic acids; Salts or anhydrides thereof
    • A61K8/361Carboxylic acids having more than seven carbon atoms in an unbroken chain; Salts or anhydrides thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/36Carboxylic acids; Salts or anhydrides thereof
    • A61K8/365Hydroxycarboxylic acids; Ketocarboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/40Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
    • A61K8/42Amides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/40Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
    • A61K8/44Aminocarboxylic acids or derivatives thereof, e.g. aminocarboxylic acids containing sulfur; Salts; Esters or N-acylated derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/58Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing atoms other than carbon, hydrogen, halogen, oxygen, nitrogen, sulfur or phosphorus
    • A61K8/585Organosilicon compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60Sugars; Derivatives thereof
    • A61K8/602Glycosides, e.g. rutin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/68Sphingolipids, e.g. ceramides, cerebrosides, gangliosides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/007Preparations for dry skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations

Definitions

  • the presently disclosed subject matter relates to topical compositions containing hesperidin, cholesterol alone or as part of a triple physiologic mixture of stratum comeum lipids, formulated at an acidic pH, and their utility for the treatment of: i) dry or aged skin due to an abnormal epidermal permeability barrier; ii) dry skin with an abnormal permeability barrier due to the use of systemic hypolipidemic drugs; iii) prevent or treat epidermal functional
  • the epidermal permeability barrier resides in the stratum corneum (SC), where hydrophobic lipids are sequestered as multilayered lamellae within the intercellular spaces, which regulate transepidermal water loss, corneocyte cohesion, and percutaneous penetration.
  • SC stratum corneum
  • Applications include treatments for
  • diabetic and GC -treated skin mimics aged skin, including both abnormally dry skin and impaired permeability barrier function.
  • millions of individuals world-wide are receiving oral statins or other hypolipidemic drugs for the treatment of hyperlipidemia, including
  • compositions and methods meet these needs. Because epidermal permeability barrier requirements regulate epidermal proliferation, differentiation, lipid production, as well as cutaneous innate immunity, strategies that improve barrier function by enhancing epidermal proliferation, differentiation and/or lipid production, while also reducing stratum corneum (SC) pH should prove useful for preventing and/or treating functional abnormalities, including the impaired permeability barrier homeostasis in aged skin.
  • SC stratum corneum
  • hesperidin alone or 2) hesperidin combined with A) a triple-lipid barrier mixture that is cholesterol-dominant or with B) cholesterol alone, and formulated at a low pH; can successfully treat dry or inflamed or aged skin, and reverse or prevent the side effects that accompany diabetes or systemic or topical GC treatment, and reverse or prevent the side effects that accompany hypolipodemic drug treatment.
  • epidermal barrier function is compromised due to decreased differentiation, proliferation, impaired lipid secretion, or an elevated skin surface pH.
  • One aspect of the invention is directed to a topical composition providing desirable restorative effects on the epidermal permeability barrier in aged skin, as provided herein.
  • barrier lipids should be cerami de-dominant for diseased skin, with an optimal mole ratio of 1 :3: 1
  • cholesterol:ceramide:free fatty acids for aged skin the combination of barrier lipids instead should be cholesterol-dominant, with an optimal mole ratio of 3: 1 : 1 cholesterol:ceramide:free fatty acids.
  • one aspect of the invention is directed to a topical composition, the composition comprising a) about 1 to about 50 wt% of cholesterol; b) about 0.01 to about 5 wt% of an acidic buffer; and c) about 0.001 to about 50 wt% of hesperidin; where the buffer content is sufficient to maintain the pH of the topical composition at 3 or above, but below 5.5.
  • the lipid weight percent ranges from about 0.01 % to about 5% of the formulation.
  • Another aspect of the invention is directed to a topical composition, the composition comprising a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide or synthetic ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%; b) about 0.1 to about 10 wt% of a skin conditioner; c) about 0.001 to about 5 wt% of a chelating agent; d) about 1 to about 30 wt% of a humectant; e) about 0.5 to about 20 wt% of an emulsifier; f) one or more emollients in a total of about 1 to about 30 wt%; g) one or more preservatives in a total of about 0.1 to about 10 wt%; h) about 0.01 to about 5 wt% of an acid buffer; i) one or more encapsulation aids in a
  • the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Synthetic ceramide; PC- 104) and conjugated linoleic acid (CLA) at a 3: 1 : 1 molar ratio.
  • the skin conditioner comprises dimethicone
  • the chelating agent comprises disodium EDTA
  • the humectant comprises glycerin
  • the acid buffer comprises citric acid.
  • the emulsifier comprises glyceryl stearate PEG- 100.
  • the one or more additional emollients comprise petrolatum and squalane.
  • the one or more preservatives comprise phenoxyethanol and sorbic acid.
  • the one or more encapsulation aids comprise corn syrup solids and euphorbia cerifera (candelilla) wax.
  • the aqueous phase thickener comprises xanthan gum.
  • the pH of the topical composition is > 3 up to 5.5.
  • the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1 : 1.
  • the cholesterol is present in about 0.1 to about 10 wt%.
  • the ceramide or mixture of ceramides is present in about 0.1 to about 10 wt%.
  • the free fatty acid or mixture of free fatty acids is present in about 0.01 to about 6 wt%.
  • One aspect of the invention is directed to a topical composition, the composition consisting of a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids; b) about 0.1 to about 10 wt% of a skin conditioner; c) about 0.001 to about 5 wt% of a chelating agent; d) about 1 to about 30 wt% of a humectant; e) about 0.5 to about 20 wt% of glyceryl stearate PEG- 100 emulsifier; f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane; g) about 0.1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid; h) about 0.01 to about 5 wt% of citric acid; i) about 1 to
  • encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax; j) about 0.01 to about 3 wt% of an aqueous phase thickener; k) about 0.001 to about 50 wt% of hesperidin; and 1) water.
  • compositions comprising a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%; b) about 0.001 to about 50 wt% of hesperidin; c) about 0.01 to about 5 wt% of an acid buffer; and d) about 0.001 to about 5% of at least one topical glucocorticoid (either separately or as the vehicle for the topical steroid).
  • barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%; b) about 0.001 to about 50 wt% of hesperidin; c) about 0.01 to about 5 wt% of an acid buffer; and d) about 0.001 to about 5% of at least one topical glucocorticoid (either
  • One aspect of the invention is directed to a method of treating or preventing inflammation by administering an effective amount of the above anti-inflammatory composition to at least a portion of affected skin in need thereof.
  • a further aspect of the invention is directed to a method of treating aged skin, comprising administering one of the topical compositions described above to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
  • Clinical indication of skin aging can be selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
  • Another aspect of the invention is directed to a method of preventing or reversing epidermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with one of the topical compositions described above, in an amount effective to prevent or reverse an epidermal clinical indication of glucocorticoid side effects.
  • Epidermal clinical indications of glucocorticoid side effects can be selected from the group consisting of inflammation (steroid rosacea and/or peri-oral dermatitis), tachyphylaxis, disease flares, and rebound flares.
  • Yet another aspect of the invention is directed to a method for the treatment of the dry skin or abnormal epidermal barrier function associated with the administration of oral hypolipodemic agents, particularly statins, comprising one of the topical compositions described above to at least a portion of affected skin of a subject, in an amount effective to relieve or reverse clinical indications of hypolipodemic drug treatment.
  • the subject is taking a hypolipodemic agent, such as simvastatin or pravastatin, or is expected to receive such treatment.
  • FIG. 1 shows a chart displaying inherited abnormalities in acidifying mechanisms which activate kallikreins (KLKs), comprising multiple ways by which pH functions in inflammatory dermatoses.
  • FIGS. 2A-2C displays the results of treatment of murine skin with a composition of the invention, as described herein.
  • FIG. 2A displays a chart of changes in basal transepidermal water loss;
  • FIG. 2B displays a chart of the changes in kinetics of barrier recovery rates, and
  • FIG. 2C displays the skin surface pH.
  • FIGS. 3A-3C The ventral (flexor) surface represents chronologically-aged (CA) skin with little photo-aging (PA), while the extensor surface reflects substantial PA, superimposed on CA.
  • the visual results of the topical composition as described herein on both chronologically (CA) and photoaged (PA) skin were striking - signs of both CA and PA, such as xerotic scaling, atrophy (skin thinning) and ecchymoses, largely disappeared in sites treated with the hesperidin- containing, barrier repair formulation.
  • These grossly apparent changes were paralleled by marked improvements in epidermal function, including a striking improvement in stratum corneum hydration (FIG. 3B), as well as moderate benefits for basal barrier function (FIG. 3A; p ⁇ 0.1).
  • FIG. 3C cutaneous resonance running time
  • the permeability barrier in aged epidermis has been largely overlooked, because earlier functional studies described few if any abnormalities in aged skin. Yet, the permeation of a variety of molecules is altered across aged epidermis in vivo. Moreover, aged SC displays a global reduction in lipids, with reduced numbers of extracellular bilayers, indicative of lower reserve barrier capacity. Although an aged permeability barrier might function adequately under basal conditions, when acutely challenged, both barrier integrity and the kinetics of barrier recovery are impaired in both aged human and aged murine skin. The pH of skin tends to rise with age, favoring dermal inflammation and a predilection to infections.
  • the barrier abnormality after acute challenges to the epidermis of aged mice is associated with a paucity of lamellar body material at the stratum granulosum-SC interface, and a delay in the return of stainable lipids to the SC interstices.
  • a global deficiency in the synthesis of all 3 physiologic lipids with a further reduction in cholesterologenesis accounts for the barrier abnormality in aged human epidermis. Such reductions in cholesterol biosynthesis begin at about age 50 in the human population.
  • Epidermal lipid synthesis is required for formation and maintenance of the epidermal permeability barrier. Synthesis of the three key barrier-related lipids, cholesterol, ceramides and free fatty acids, requires their respective rate-limiting enzymes, HMGCoA, SPT1, ACC, and FAS. Basal mRNA levels for all three key lipid synthetic enzymes were observed to be lower in aged epidermis as compared with young epidermis, consistent with the concept that lower lipid synthesis rates in aged epidermis reflect the reduced expression of their synthetic enzymes.
  • a composition of this invention that regulates and improves the conditions of the epidermis, also improves the dermis by enhancing the nourishment of dermal tissues and other cellular components in the deeper layers of the skin.
  • Certain compounds of the present invention can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the present invention. Certain compounds of the present invention may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present invention and are intended to be within the scope of the present invention.
  • salt refers to acid or base salts of the compounds used in the methods of the present invention.
  • acceptable salts are mineral acid (hydrochloric acid, hydrobromic acid, phosphoric acid, and the like) salts, organic acid (acetic acid, propionic acid, glutamic acid, citric acid and the like) salts, quaternary ammonium (methyl iodide, ethyl iodide, and the like) salts.
  • an “effective amount” is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, change enzyme activity, increase enzyme activity, reduce protein function, reduce one or more symptoms of a disease or condition).
  • An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a "therapeutically effective amount.”
  • a “reduction” of a symptom or symptoms means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s).
  • a “prophylactically effective amount" of a drug or prodrug is an amount of a drug or prodrug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms.
  • the full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses.
  • a prophylactically effective amount may be administered in one or more administrations. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g. , Lieberman,
  • a disease e.g. dry skin, aged skin, or abnormal epidermal barrier function
  • a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
  • a causative agent could be a target for treatment of the disease.
  • Control or "control experiment” or “standard control” is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. In some instances, the control is used as a standard of comparison in evaluating experimental effects.
  • Contacting is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including
  • contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be a compound as described herein and a protein or enzyme. In some embodiments contacting includes allowing a compound described herein to interact with a protein.
  • a patient or “subject in need thereof or “subject” refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a compound or pharmaceutical composition or by a method, as provided herein.
  • Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals.
  • a patient is human.
  • a subject is human.
  • "Disease” or “condition” refer to a state of being or health status of a patient or subject capable of being treated with a compound, pharmaceutical composition, or method provided herein.
  • the disease is dry skin.
  • the disease is aged skin.
  • the disease is dry skin, aged skin, or abnormal epidermal barrier function.
  • “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the present invention without causing a significant adverse toxicological effect on the patient.
  • Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethy cellulose, polyvinyl pyrrolidine, and colors, and the like.
  • Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents
  • preparation is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
  • compositions of the present invention can be delivered by transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
  • Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions.
  • the compositions of the present invention may additionally include components to provide sustained release and/or comfort.
  • co-administer it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies (e.g. glucocorticoid treatment, immunomodulator treatment, hypolipodemic agent). Co-administer may also include a composition described herein is administered 10 days prior or 10 days after administration of one or more additional therapies
  • compositions of the invention can be administered alone or can be co-administered to the patient.
  • compositions described herein can also be formulated in combination with one or more additional active ingredients which can include any pharmaceutical agent such immune enhancers, immune suppressants, anti inflammatory agents and the like. Co-administration is meant to include simultaneous or sequential administration of the compound individually or in combination (more than one compound or agent).
  • additional active ingredients can include any pharmaceutical agent such immune enhancers, immune suppressants, anti inflammatory agents and the like. Co-administration is meant to include simultaneous or sequential administration of the compound individually or in combination (more than one compound or agent).
  • Pharmaceutical compositions provided by the present invention include compositions wherein the active ingredient (e.g. compounds described herein, including embodiments or examples) may be contained in a therapeutically effective amount, i.e. , in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, inter alia, on the condition being treated.
  • compositions When administered in methods to treat a disease, such compositions will contain an amount of active ingredient effective to achieve the desired result, e.g., reducing, eliminating, or slowing the progression of disease symptoms. Determination of a therapeutically effective amount of a compound of the invention is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure herein.
  • the dosage and frequency (single or multiple doses) administered to a mammal can vary depending upon a variety of factors, for example, whether the mammal suffers from another disease, and its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems.
  • Other therapeutic regimens or agents can be used in conjunction with the methods and compounds of Applicants' invention. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art.
  • Dosages may be varied depending upon the requirements of the patient and the compound being employed.
  • the dose administered to a patient, in the context of the present invention should be sufficient to affect a beneficial therapeutic response in the patient over time.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.
  • Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particular clinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
  • an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient.
  • This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.
  • an analog and “analogue” are used interchangeably and are used in accordance with their plain ordinary meaning within Chemistry and Biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called “reference” compound (e.g., hesperidin)) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound, including isomers thereof.
  • an analog is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound.
  • an analog has a similar function to the reference compound (e.g., as measured in one or more assays, such as the effect of hesperidin on aged skin).
  • the term "about” means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, about means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to +/- 10% of the specified value. In embodiments, about means the specified value.
  • treating is defined as administration of a composition to a subject with the purpose to cure, alleviate, relieve, remedy, prevent, or ameliorate a disorder, the symptom of the disorder, the disease state secondary to the disorder, or the predisposition toward the disorder.
  • An "effective amount” is an amount of the composition that is capable of producing a medically desirable result, e.g. , as described above, in a treated subject.
  • prevent means that the treated patient either does not develop a clinically observable level of the condition at all, or develops it more slowly and/or to a lesser degree than he/she would have absent the treatment.
  • These terms are not limited solely to a situation in which the patient experiences no aspect of the condition whatsoever.
  • a treatment will be said to have “prevented” the condition if it is given during exposure of a patient to a stimulus that would have been expected to produce a given manifestation of the condition, and results in the patient's experiencing fewer and/or milder symptoms of the condition than otherwise expected.
  • a treatment can "prevent" infection by resulting the patient's displaying only mild overt symptoms of the infection; it does not imply that there must have been no penetration of any cell by the infecting microorganism.
  • the treated patient either does not develop a clinically observable level of the condition at all, or develops it more slowly and/or to a lesser degree than a non-treated patient exposed to same condition- inducing stimulus as the treated patient, where the susceptibility of the non-treated patient to the condition is the same as the treated patient's susceptibility prior to treatment.
  • identifying a subject in need of such treatment can be in the judgment of a subj ect or a health care professional and can be subjective (e.g. opinion) or objective (e.g. measurable by a test or diagnostic method).
  • cholesterol refers to (3P)-choles-5-en-3-ol, or any salt form or isomer thereof.
  • hesperidin refers to the compound (2 ⁇ S)-5-hydroxy-2-(3-hydroxy-4- methoxypheiiyl)-7-[(2S,3R,4S ⁇
  • hesperidin has the structure:
  • Hesperidin may be referred to as a flavanone glycoside including the flavone hesperetin bound to the disaccharide rutinose, and may be found in citrus fruits and other natural sources. Its name is derived from "hesperidium", for fruit produced by citrus trees, and the compound is found in oranges, lemons, limes and pummelo fruits, among others. Peppermint leaves also contain hesperidin. The aglycone form may be referred to as hesperetin; thus an alternative name for hesperidin is hesperetin 7-rutinoside.
  • a hesperidin analog is a compound functionally similar to hesperidin. In embodiments, the hesperidin analog is chemically similar to hesperidin but differing in one or more atoms, wherein the analog includes one or more functions or effects of hesperidin on aged skin.
  • dry skin is used in accordance with its plain ordinary meaning and refers to skin wherein there is a reduced amount of water in the epidermis.
  • dry skin may be associated with greater levels of transepidermal water loss (TEWL).
  • dry skin may have reduced levels of at least one of cholesterol, ceramides, glycerol, filaggrin, and natural moisturizing molecules (e.g., urocanic acid).
  • Dry skin may result from use of systemic hypolipidemic drugs (e.g., statins), glucocorticoid treatment, or immunomodulator treatment. Symptoms associated with dry skin include the visible peeling of the outer skin layer, itching, and skin cracking.
  • abnormal epidermal barrier function is used in accordance with its plain ordinary meaning and refers to aberrant function in the epidermis (e.g., due to decreased differentiation, proliferation, impaired lipid secretion, or an elevated skin surface pH (e.g., pH > 5.5) relative to a healthy control (e.g., population average, skin at another location on the same subj ect as the aged skin)).
  • Abnormal epidermal barrier function may be associated with the use of systemic hypolipidemic drugs (e.g., statins), glucocorticoid treatment, or immunomodulator treatment.
  • Abnormal epidermal barrier function may result in visible or tactile wrinkles or discontinuities in skin associated with skin aging, e.g., visible and/or tactile scaling, wrinkles or discontinuities in skin texture or color.
  • aged skin is used in accordance with its plain ordinary meaning and refers to chronologically- and/or photo- aged skin, typically characterized by abnormal epidermal barrier function or a flawed permeability barrier (e.g., characterized by a thinner epidermis with reduced epidermal proliferation, abnormal differentiation, impaired lipid synthesis and/or an elevated skin surface pH).
  • Aged skin e.g., chronologically- or photo- may display abnormal epidermal barrier function resulting in impaired barrier function, reduced antimicrobial defense, and/or reduced cutaneous wound healing.
  • Aged skin may display abnormal epidermal barrier function such as reduced stratum comeum hydration, reduced stratum comeum cohesion, increased abnormal desquamation, increased skin scaling, increased occurrence of skin infections, increased susceptibility to skin infections, increased susceptibility of inflammatory dermatoses, and increased occurrence of inflammatory dermatoses (e.g., increased relative to normal, average, or healthy skin of a control (e.g., population average, skin at another location on the same subject as the aged skin)).
  • abnormal epidermal barrier function such as reduced stratum comeum hydration, reduced stratum comeum cohesion, increased abnormal desquamation, increased skin scaling, increased occurrence of skin infections, increased susceptibility to skin infections, increased susceptibility of inflammatory dermatoses, and increased occurrence of inflammatory dermatoses (e.g., increased relative to normal, average, or healthy skin of a control (e.g., population average, skin at another location on the same subject as the aged skin)).
  • Clinical indications of aged skin may include eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
  • the term "photo-aged skin” is used in accordance with its plain ordinary meaning and refers to skin displaying abnormal epidermal barrier function as a result of chronic exposure to ultraviolet radiation (e.g., 300-400 nm).
  • the term "barrier lipids” is used in accordance with its plain ordinary meaning and refers to epidermal lipids of both sebaceous and keratinocyte origin. Non-limiting examples include non-polar lipids, mainly triglycerides, wax esters, squalane, fatty acids, free fatty acids, ceramides cholesterol, cholesterol esters and diglycerides. In embodiments, barrier lipids are ceramides, cholesterol, and/or free fatty acids.
  • ceramide is used in accordance with its plain ordinary meaning and refers to sphingosine (e.g. , 2-amino-4-octadecene-l,3-diol) and a fatty acid.
  • the ceramide is a pseudoceramide (i.e., synthetic) as described in Uchida, et al (Journal of
  • Non-limiting examples of a ceramide include myristoyl/palmitoyl oxostearamide/arachamide MEA, myristoyl/palmitoyl oxostearamide/arachamide, N-(Ethyl dihydrogenphosphate)-2-hexyl-3-oxo-decanamide, N-Ethanol-2-mirystyl-3-oxo-staramide, ceramide PC-102 (Hydroxypropyl Bislauramide MEA), ceramide PC-104 (Hydroxypropyl Bispalmitamide MEA), and ceramide PC- 108 (Hydroxypropyl Bisstearamide MEA).
  • the ceramide is a synthetic ceramide.
  • the ceramide is N-(3- hexadecyloxy-2-hydroxypropyl)-N-2-hydroxyethylhexadecanamide (PC-104) or N-(2- hydroxyethyl)-2-pentadecanolylhexadecanamide (Bio391).
  • the ceramide is myristoyl/palmitoyl oxostearamide/arachamide MEA.
  • fatty acid or “free fatty acid is used in accordance with its plain ordinary meaning and refers to a carboxylic acid with a long (e.g., C4-C30) aliphatic chain, which may be saturated or unsaturated, including all positional and geometrical isomers.
  • a fatty acid may be lauric acid, palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidonic acid, or conjugated linoleic acid.
  • skin conditioner is used in accordance with its plain ordinary meaning and refers to a an agent that attracts or retains moisture in the skin (e.g perhaps a silicon-based polymer).
  • a skin conditioner include polydimethylsiloxane (i.e. dimethicone) and dimethicone copolyol.
  • chelating agent is used in accordance with its plain ordinary meaning and refers to chemical compounds that coordinate with metal atoms. Typically a chelating agent forms two or more separate coordinate bonds between a poly dentate ligand and a single central atom (e.g., a metal atom).
  • a chelating agent include disodium ethylenediaminetetraacetic acid (EDTA), tetrasodium EDTA and tetrahydroxypropyl ethylenediamine.
  • humectant is used in accordance with its plain ordinary meaning and refers to a hygroscopic agent which promotes retention of moisture.
  • a humectant include glycerin, urea, aloe vera, honey, and sorbitol, xylitol, maltitol.
  • emulsifier is used in accordance with its plain ordinary meaning and refers to an agent that stabilizes a mixture of two or more compounds that are typically immiscible.
  • Non-limiting examples of an emulsifier includes emulsifying wax, cetearyl alcohol, polysorbate 20, ceteareth 20, glycerl stearate PEG-100 and modified food starches (e.g., com syrup solids).
  • emollient is used in accordance with its plain ordinary meaning and refers to compounds which increase the water content of the epidermis by reducing evaporation.
  • Non- limiting examples include squalane and petrolatum.
  • preservative is used in accordance with its plain ordinary meaning and refers to agents intended to prevent microbial growth and spoiling of a composition described herein.
  • preservatives include sorbic acid, sodium sorbate, potassium sorbate, calcium sorbate, and glycol ethers (e.g., dimethoxyethane, phenoxyethanol, or 2- butoxy ethyl acetate).
  • acid buffer is used in accordance with its plain ordinary meaning and refers to a weak acid and its conjugate base used to control the pH (e.g., wherein the pH is less than 7).
  • Non-limiting examples include citric acid.
  • encapsulation aids is used in accordance with its plain ordinary meaning and refers to agents used control the release of the active substance.
  • Non-limiting examples include modified food starch (e.g., corn syrup solids), aliginate, and euphorbia cerifera
  • aqueous phase thickener is used in accordance with its plain ordinary meaning and refers to a rheology modifier (e.g., an agent capable of modulating (e.g., increasing) the viscosity of a liquid without substantially changing other properties of the liquid).
  • a rheology modifier e.g., an agent capable of modulating (e.g., increasing) the viscosity of a liquid without substantially changing other properties of the liquid.
  • glucocorticoid is used in accordance with its plain ordinary meaning and refers to a corticosteroid (e.g., that binds to the glucocorticoid receptor).
  • a glucocorticoid include clobetasol propionate, betamethasone dipropionate, halobetasol propionate, diflorasone diacetate, fluocinonide, halcinonide, amcinonide, desoximetasone, triamcinolone acetonide, mometasone furoate, fluticasone propionate, halometasone, fluocinolone acetonide, hydrocortisone valerate, hydrocortisone butyrate, flurandrenolide, triamcinolone acetonide, mometasone furoate, fluticasone propionate, desonide, fluocinolone acetonide
  • glyceryl stearate PEG-100 refers to a water soluble ester with and an average of number of ethylene oxide monomers in the polyethylene chain around 100.
  • glyceryl stearate PEG-100 is an off-white, solid ester of polyethylene glycol (a binder and a softener) and stearic acid.
  • glucocorticoid side effects is used in accordance with its plain ordinary meaning and refers to inflammation (e.g., steroid rosacea and/or peri-oral dermatitis), tachyphylaxis, disease flares, or rebound flares caused by glucocorticoid treatment, or other unintended effects of using glucocorticoids.
  • citrus bioflavonoid is used in accordance with its plain ordinary meaning and refers to compounds present in citrus fruits (e.g., lemons, limes, oranges, grapefruits, and tangerines).
  • Citrus bioflavonoids may be bioflavonoids present in citrus plants (e.g., citrus fruit, leaves, roots, etc.).
  • Citrus bioflavonoids include citrus flavanones, which may optionally be glycosylated (e.g., by a disaccharide) to a citrus flavanone glycoside, which is also included in citrus bioflavonoids (e.g., hesperidin).
  • citrus bioflavonoids include apigenin, hesperidin, hesperitin, naringenin, naringin, narirutin, nobiletin, tangeretin, and tangeritin.
  • Citrus bioflavonoids include hesperidin.
  • Citrus bioflavonoids include hesperitin. Citrus bioflavonoids may include eriodictyol, homoeriodictyol, and luteolin, . Citrus bioflavonoids include citrus flavones, citrus flavonol, citrus flavanones, citrus flavanonols, citrus flavans, and citrus flavanols. [0075]
  • the term "immunomodulator" is used in accordance with its plain ordinary meaning and refers to compounds that modulate the immune system. Examples of immunomodulators include pimecrolimus and/or tacrolimus. In embodiments, the immunomodulator is a topical calcineurin inhibitor (e.g., pimecrolimus and/or tacrolimus). Examples of additional topical calcineurin inhibitors can be found in Breuer et al. (Am. J. Clin. Dermatol. 2005; 6(2): 65-77) and is incorporated herein in its entirety.
  • a topical composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof).
  • a topical composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • a topical composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin.
  • the composition is capable of treating aged skin.
  • a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof).
  • a citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin.
  • a topical composition for treating aged skin including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof).
  • a topical composition for treating aged skin including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • the topical composition includes a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin.
  • the topical composition further comprises a skin conditioner.
  • the topical composition further comprises a chelating agent.
  • the topical composition further comprises a humectant.
  • the topical composition further comprises an emulsifier.
  • the topical composition further comprises one or more emollients.
  • the topical composition further comprises one or more preservatives.
  • the topical composition further comprises an acid buffer.
  • the topical composition further comprises one or more encapsulation aids. In embodiments, the topical composition further comprises an aqueous phase thickener. In embodiments, the tropical composition is capable of treating aged skin (e.g., a symptom of aged skin, photo-aged skin, chronologically-aged skin).
  • One aspect of the invention is directed to a composition, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at about 3 to about 5.5.
  • One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition from about 3 to about 5.5.
  • the citrus bioflavonoid is hesperidin.
  • One aspect of the invention is directed to a composition, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at about 3 to about 5.5.
  • One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of hesperidin, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at about 3 to about 5.5.
  • composition including a)
  • 0.1 to 50 wt% of cholesterol preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5.
  • One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) 0.1 to 50 wt% of cholesterol, preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to 50 wt% of a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5.
  • the citrus bioflavonoid is hesperidin.
  • One aspect of the invention is directed to a composition, the composition including a) 0.1 to 50 wt% of cholesterol, preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to 50 wt% of hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5.
  • One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) 0.1 to 50 wt% of cholesterol, preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5.
  • the cholesterol is present in about 0.1 to about 50 wt%. In embodiments, the cholesterol is present in about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2,
  • the cholesterol is present in 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%.
  • the cholesterol is present in about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3,
  • the cholesterol is present in 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %.
  • the cholesterol is present in about 1.0 wt %. In embodiments, the cholesterol is present in about 0.5 to about 1.5 wt%.
  • the cholesterol is present in about 0.8 to about 1.2 wt%. In embodiments, the cholesterol is present in about 0.9 to about 1.1 wt%. In embodiments, the cholesterol is present in 1.0 wt %. In embodiments, the cholesterol is present in 0.5 to 1.5 wt%. In embodiments, the cholesterol is present in 0.8 to 1.2 wt%. In embodiments, the cholesterol is present in 0.9 to 1.1 wt%.
  • the acid buffer is present in about 0.1 to about 50 wt%.
  • the acid buffer is present in about 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 1, 2, 3,
  • the acid buffer is present in about 0.5 wt %. In embodiments, the acid buffer is present in about 0.1 to about 5 wt%. In embodiments, the acid buffer is present in about 0.1 to about 3 wt%. In embodiments, the acid buffer is present in about 0.1 to about 2 wt%. In embodiments, the acid buffer is present in about 0.1 to about 1.2 wt%. In embodiments, the acid buffer is present in about 0.4 to about 1.0 wt%.
  • the acid buffer is present in 0.1 to 50 wt%. In embodiments, the acid buffer is present in 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74,
  • the acid buffer is present in 0.5 wt %. In embodiments, the acid buffer is present in 0.1 to 5 wt%. In embodiments, the acid buffer is present in 0.1 to 3 wt%. In embodiments, the acid buffer is present in 0.1 to 2 wt%. In embodiments, the acid buffer is present in 0.1 to 1.2 wt%. In embodiments, the acid buffer is present in 0.4 to 1.0 wt%.
  • the citrus bioflavonoid e.g., hesperidin, or an analog
  • pharmaceutically acceptable salt, or prodrug thereof is present in about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or about 50 wt%.
  • the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 wt%.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is present in about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %.
  • the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.0 to about 2.8 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.5 to about 2.2 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.8 to about 2.1 wt %.
  • the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.9 to about 2.1 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 0.5 to 3.0 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog,
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is present in 1.5 to 2.2 wt %.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is present in 1.8 to 2.1 wt %.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is present in about 2.0 wt %.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 2 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 10 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 15 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 30 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 35 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 2 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 15 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 25 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 35 wt%.
  • the citrus bioflavonoid e.g., hesperidin, or an analog,
  • the pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof).
  • the citrus bioflavonoid is hesperidin.
  • the hesperidin is present in about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or about 50 wt%.
  • the hesperidin is present in 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 wt%.
  • the hesperidin is present in about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %. In embodiments, the hesperidin is present in 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %. In embodiments, the hesperidin is present in about 0.5 to about 3.0 wt %. In embodiments, the hesperidin is present in about 1.0 to about 2.8 wt %. In embodiments, the hesperidin is present in about 1.5 to about 2.2 wt %. In
  • the hesperidin is present in about 1.8 to about 2.1 wt %. In embodiments, the hesperidin is present in about 1.9 to about 2.1 wt %. In embodiments, the hesperidin is present in 0.5 to 3.0 wt %. In embodiments, the hesperidin is present in 1.0 to 2.8 wt %. In
  • the hesperidin is present in 1.5 to 2.2 wt %. In embodiments, the hesperidin is present in 1.8 to 2.1 wt %. In embodiments, the hesperidin is present in 1.9 to 2.1 wt %. In embodiments, the hesperidin is present in about 2.0 wt %. In embodiments, the hesperidin is present in 2.0 wt%.
  • hesperidin is present in about 5 wt%. In embodiments hesperidin is present in about 10 wt%. In embodiments, hesperidin is present in about 15 wt%. In embodiments, hesperidin is present in about 20 wt%. In embodiments, hesperidin is present in about 25 wt%. In embodiments, hesperidin is present in about 30 wt%. In embodiments, hesperidin is present in about 35 wt%. In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments hesperidin is present in 10 wt%.
  • hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, and an aqueous phase thickener.
  • a skin conditioner e.g., a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, and an aqueous phase thickener.
  • the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, or an aqueous phase thickener.
  • compositions for treating aged skin including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to
  • the citrus bioflavonoid is hesperidin.
  • Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 2 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 10 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 15 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 30 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in about 35 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 2 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 15 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 25 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 35 wt%.
  • the citrus bioflavonoid e.g., hesperidin, or an analog,
  • pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof).
  • active citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to about 20 wt% of an emulsifier,
  • the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one
  • the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one
  • hesperidin is present in about 15 wt%. In embodiments, hesperidin is present in about 20 wt%. In embodiments, hesperidin is present in about 25 wt%. In embodiments, hesperidin is present in about 30 wt%. In embodiments, hesperidin is present in about 35 wt%. In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%.
  • hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • compositions for treating aged skin including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably about 1 to about 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%
  • hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments, hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%.
  • the mixture of barrier lipids is present in about 2 to about 10 total wt%. In embodiments, the mixture of barrier lipids is present in about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26,
  • the mixture of barrier lipids is present in about 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0, 30.0, 31.0, 32.0, 33.0, 34.0, 35.0, 36.0, 37.0, 38.0, 39.0, 40.0, 41.0, 42.0, 43.0, 44.0, 45.0, 46.0, 47.0, 48.0, 49.0, or about 50.0 wt%.
  • the mixture of barrier lipids is present in about 0.5 to about 10 total wt%. In embodiments, the mixture of barrier lipids is present in about 0.5 to about 5 total wt%. In embodiments, the mixture of barrier lipids is present in about 1 to about 5 total wt%. In embodiments, the mixture of barrier lipids is present in about 2 to about 5 total wt%.
  • the mixture of barrier lipids is present in about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79
  • the mixture of barrier lipids is present in about 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65, 2.7, 2.75, 2.8, 2.85, 2.9, 2.95, 3.0, 3.05, 3.1, 3.15, 3.2, 3.25, 3.3, 3.35, 3.4, 3.45, 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05, 4.1,
  • the skin conditioner is present in about 0.1 to about 10 wt%. In embodiments, the skin conditioner is present in about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06,
  • the skin conditioner is present in about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or about 10.0 wt%.
  • the skin conditioner is present in about 0.5 to about 8 wt%.
  • the skin conditioner is present in about 0.5 to about 5 wt%.
  • the skin conditioner is present in about 0.5 to about 3 wt%.
  • the skin conditioner is present in about 0.5 to about 2 wt%.
  • the chelating agent is present in about 0.0001 to about 5.0 wt%. In embodiments, the chelating agent is present in about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71,
  • the chelating agent is present in about 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65,
  • the chelating agent is present in about 0.01 to about 5.0 wt%.
  • the chelating agent is present in about 0.05 to about 3.0 wt%. In embodiments, the chelating agent is present in about 0.05 to about 2.0 wt%. In embodiments, the chelating agent is present in about 0.05 to about 1.0 wt%. In embodiments, the chelating agent is present in about 0.05 to about 0.25 wt%. [0105] In embodiments, the humectant is present in about 1 to about 30 wt%.
  • the humectant is present in about 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or about 30.0 wt %.
  • the humectant is present in about 5 to about 15 wt%.
  • the humectant is present in about 8 to about 13 wt%.
  • the humectant is present in about 9 to about 11 wt%.
  • the emulsifier is present in about 0.5 to about 20 wt%.
  • the emulsifier is present in about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.
  • the emulsifier is present in about 0.5,
  • the emulsifier is present in about 0.5 to about 10 wt%. In embodiments, the emulsifier is present in about 0.5 to about 5 wt%. In embodiments, the emulsifier is present in about 0.5 to about 2 wt%.
  • one or more emollients is present in about 1 to about 30 total wt%. In embodiments, one or more emollients is present in about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or about 30.0 wt%.
  • one or more emollients is present in about 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07,
  • one or more emollients is present in about 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05,
  • one or more emollients is present in about 1 to about 10 wt%. In embodiments, one or more emollients is present in about 1 to about 5 wt%. In embodiments, one or more emollients is present in about 1 to about 3 wt%.
  • one or more preservatives is present in about 0.1 to about 10 total wt%. In embodiments, one or more preservatives is present in about 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01,
  • one or more preservatives is present in about 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0.
  • one or more preservatives is present in about 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or about 10.0 total wt%. In embodiments, one or more preservatives is present in about 0.1 to about 3 wt%. In
  • one or more preservatives is present in about 0.1 to about 2 wt%.
  • one or more preservatives is present in about 0.1 to about 1.0 wt%.
  • one or more encapsulation aids is present in about 1 to about 25 total wt%.
  • one or more encapsulation aids is present in about 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22,
  • one or more encapsulation aids is present in about 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, or about 7.5 wt%.
  • one or more encapsulation aids is present in about 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0 wt %.
  • one or more encapsulation aids is present in about 1 to about 15 total wt%. In embodiments, one or more encapsulation aids is present in about 1 to about 10 total wt%. In embodiments, one or more encapsulation aids is present in about 2 to about 9 total wt%.
  • aqueous phase thickener is present in about 0.01 to about 3 wt%. In embodiments, aqueous phase thickener is present in about 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48
  • aqueous phase thickener is present in about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, to about 0.75 wt %.
  • aqueous phase thickener
  • aqueous phase thickener is present in about 0.10 to about 2 wt%. In embodiments, aqueous phase thickener is present in about 0.5 to about 1.0 wt%.
  • the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
  • the mixture of barrier lipids consists of cholesterol, myristoyl/palmitoyl
  • the mixture of barrier lipids consists of cholesterol, myristoyl/palmitoyl oxostearamide/arachamide and conjugated linoleic acid (CLA).
  • the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA) present in a 3: 1 : 1 molar ratio.
  • the mixture of barrier lipids consists of cholesterol myristoyl/palmitoyl oxostearamide/arachamide MEA and conjugated linoleic acid (CLA) present in a 3: 1 : 1 molar ratio.
  • the mixture of barrier lipids is cholesterol- dominant.
  • the skin conditioner comprises dimethicone
  • the chelating agent comprises disodium EDTA
  • the humectant comprises glycerin
  • the acid buffer comprises citric acid.
  • the emulsifier comprises glyceryl stearate PEG- 100.
  • the one or more emollients comprise petrolatum and squalane.
  • the one or more preservatives comprise phenoxyethanol and sorbic acid.
  • the one or more encapsulation aids comprise corn syrup solids and euphorbia cerifera (candelilla) wax.
  • the aqueous phase thickener comprises xanthan gum.
  • the mixture of barrier lipids includes cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
  • the mixture of barrier lipids includes cholesterol, myristoyl/palmitoyl oxostearamide/arachamide MEA, and conjugated linoleic acid (CLA).
  • the mixture of barrier lipids includes cholesterol, myristoyl/palmitoyl oxostearamide/arachamide, and conjugated linoleic acid (CLA).
  • the mixture of barrier lipids includes cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA) present in a 3: 1 : 1 molar ratio.
  • the mixture of barrier lipids is cholesterol-dominant.
  • the skin conditioner is dimethicone
  • the chelating agent is disodium EDTA
  • the humectant is glycerin
  • the acid buffer is citric acid.
  • the emulsifier is glyceryl stearate PEG-100.
  • the one or more emollients is petrolatum and squalane.
  • the one or more preservatives is phenoxyethanol and sorbic acid.
  • the one or more encapsulation aids is corn syrup solids and euphorbia cerifera (candelilla) wax.
  • the aqueous phase thickener is xanthan gum.
  • the mixture of barrier lipids is as described herein (e.g., the mixture of barrier lipids as described herein, including in examples).
  • the skin conditioner is as described herein (e.g., the skin conditioner as described herein, including in examples)
  • the chelating agent is as described herein (e.g., the chelating agent as described herein, including in examples)
  • the humectant is as described herein (e.g., the humectant as described herein, including in examples)
  • the acid buffer is as described herein (e.g., the acid buffer as described herein, including in examples).
  • the emulsifier is as described herein (e.g., the emulsifier as described herein, including in examples).
  • the one or more emollients is as described herein (e.g., the emollients as described herein, including in examples).
  • the one or more preservatives is as described herein (e.g., the preservatives as described herein, including in examples).
  • the one or more encapsulation aids is as described herein (e.g., the encapsulation aids as described herein, including in examples).
  • the aqueous phase thickener is as described herein (e.g., the aqueous phase thickener as described herein, including in examples).
  • the pH of the topical composition is from about 3 to about 5.5. In embodiments the pH of the topical composition is about 3. In embodiments the pH of the topical composition is about 3.2. In embodiments the pH of the topical composition is about 3.4. In embodiments the pH of the topical composition is about 3.6. In embodiments the pH of the topical composition is about 3.8. In embodiments the pH of the topical composition is about 4. In embodiments the pH of the topical composition is about 4.2. In embodiments the pH of the topical composition is about 4.4. In embodiments the pH of the topical composition is about 4.6. In embodiments the pH of the topical composition is about 4.8. In embodiments the pH of the topical composition is about 5.
  • the pH of the topical composition is about 5.2. In embodiments the pH of the topical composition is about 5.5. In a preferred embodiment the pH of the topical composition is about 3.1 to about 5.0. In a preferred embodiment the pH of the topical composition is about 3.2 to about 4.5. In a preferred embodiment the pH of the topical composition is about 3 to about 4.
  • the pH of the topical composition is 3 to 5.5.
  • the pH of the topical composition is 3. In embodiments the pH of the topical composition is 3.2. In embodiments the pH of the topical composition is 3.4. In embodiments the pH of the topical composition is 3.6. In embodiments the pH of the topical composition is 3.8. In embodiments the pH of the topical composition is 4. In embodiments the pH of the topical composition is 4.2. In embodiments the pH of the topical composition is 4.4. In embodiments the pH of the topical composition is 4.6. In embodiments the pH of the topical composition is 4.8. In embodiments the pH of the topical composition is 5. In embodiments the pH of the topical composition is 5.2. In embodiments the pH of the topical composition is 5.5. In a preferred embodiment the pH of the topical composition is 3.1 to 5.0. In a preferred embodiment the pH of the topical composition is 3.2 to 4.5. In a preferred embodiment the pH of the topical composition is 3 to 4.
  • the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, and an aqueous phase thickener.
  • a skin conditioner e.g., a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, and an aqueous phase thickener.
  • the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, or an aqueous phase thickener.
  • Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 2 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 15 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 25 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 35 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 2 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 15 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 25 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 35 wt%.
  • the citrus bioflavonoid e.g., hesperidin, or an analog,
  • pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof).
  • active citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 2 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 15 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 25 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 35 wt%.
  • compositions for treating aged skin including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more
  • pharmaceutically acceptable salt, or prodrug thereof preferably 1 to 10 wt%, more preferably 2 to 5 wt%.
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 20 wt%.
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 35 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog,
  • pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In embodiments, hesperidin or an analog,
  • the hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • compositions for treating aged skin including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more
  • hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%.
  • hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • An aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more
  • the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 20 wt%.
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 35 wt%.
  • the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one
  • hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments, hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%.
  • the mixture of barrier lipids is present in 2 to 10 total wt%. In embodiments, the mixture of barrier lipids is present in 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28,
  • the mixture of barrier lipids is present in 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0, 30.0, 31.0, 32.0, 33.0, 34.0, 35.0, 36.0, 37.0, 38.0, 39.0, 40.0, 41.0, 42.0, 43.0, 44.0, 45.0, 46.0, 47.0, 48.0, 49.0, or 50.0 wt%.
  • the mixture of barrier lipids is present in 0.5 to 10 total wt%. In embodiments, the mixture of barrier lipids is present in 0.5 to 5 total wt%. In embodiments, the mixture of barrier lipids is present in 1 to 5 total wt%. In embodiments, the mixture of barrier lipids is present in 2 to 5 total wt%.
  • the mixture of barrier lipids is present in 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79,
  • the mixture of barrier lipids is present in 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65,
  • the skin conditioner is present in 0.1 to 10 wt%. In embodiments, the skin conditioner is present in 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76
  • the skin conditioner is present in 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 wt%.
  • the skin conditioner is present in 0.5 to 8 wt%.
  • the skin conditioner is present in 0.5 to 5 wt%.
  • the skin conditioner is present in 0.5 to 3 wt%.
  • the skin conditioner is present in 0.5 to 2 wt%.
  • the chelating agent is present in 0.0001 to 5.0 wt%.
  • the chelating agent is present in 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81,
  • the chelating agent is present in 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65, 2.7, 2.75, 2.8, 2.85, 2.9, 2.95, 3.0, 3.05, 3.1, 3.15, 3.2, 3.25, 3.3, 3.35, 3.4, 3.45, 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05, 4.1, 4.15,
  • the chelating agent is present in 0.01 to 5.0 wt%. In embodiments, the chelating agent is present in 0.05 to 3.0 wt%. In embodiments, the chelating agent is present in 0.05 to 2.0 wt%. In embodiments, the chelating agent is present in 0.01 to 1.0 wt%. In embodiments, the chelating agent is present in 0.05 to 0.25 wt%.
  • the humectant is present in 1 to 30 wt%. In embodiments, the humectant is present in 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 30.0 wt %. In embodiments, the humectant is present in 5 to 15 wt%. In embodiments, the humectant is present in 8 to 13 wt%. In embodiments, the humectant is present in 9 to 11 wt%.
  • the emulsifier is present in 0.5 to 20 wt%. In embodiments, the emulsifier is present in 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74
  • the emulsifier is present in 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, or 20.0 wt %.
  • the emulsifier is present in 0.5 to 10 wt%.
  • the emulsifier is present in 0.5 to 5 wt%.
  • the emulsifier is present in 0.5 to 2 wt%.
  • one or more emollients is present in 1 to 30 total wt%.
  • one or more emollients is present in 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or 30.0 wt%.
  • emollients is present in 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0,
  • one or more emollients is present in 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.
  • one or more emollients is present in 1 to 10 total wt%. In embodiments, one or more emollients is present in 1 to 5 total wt%. In embodiments, one or more emollients is present in 1 to 3 total wt%. [0137] In embodiments, one or more preservatives is present in 0.1 to 10 total wt%. In embodiments, one or more preservatives is present in 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87,
  • one or more preservatives is present in 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0.
  • one or more preservatives is present in 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 total wt%. In embodiments, one or more preservatives is present in 0.1 to 3 wt%. In embodiments, one or more preservatives is present in 0.1 to 2 wt%. In
  • one or more preservatives is present in 0.1 to 1.0 wt%.
  • one or more encapsulation aids is present in 1 to 25 total wt%.
  • one or more encapsulation aids is present in 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26
  • one or more encapsulation aids is present in 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, or 7.5 wt%.
  • one or more encapsulation aids is present in 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 wt %.
  • one or more encapsulation aids is present in 1 to 15 total wt%. In embodiments, one or more encapsulation aids is present in 1 to 10 total wt%. In embodiments, one or more encapsulation aids is present in 2 to 9 total wt%. [0139] In embodiments, aqueous phase thickener is present in 0.01 to 3 wt%.
  • aqueous phase thickener is present in 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72
  • aqueous phase thickener is present in 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, to 0.75 wt %.
  • aqueous phase thickener is present in 0.05 to 3 wt%. In embodiments, aqueous phase thickener is present in 0.10 to 2 wt%. In embodiments, aqueous phase thickener is present in 0.5 to 1.0 wt%.
  • the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1 : 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is about 3: about 1 : about 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 2.9: 1 : 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1.1 : 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1 : 1.1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3.1 : 1 : 1.
  • the molar ratio of cholesterol:ceramide:free fatty acid is (2.8- 3.2):(0.8-1.2):(0.8-1.2).
  • the cholesterol is present in about 0.1 to about 10 wt%, preferably about 1 to about 10 wt%, more preferably about 1 to about 5 wt%.
  • the ceramide or mixture of ceramides is present in about 0.1 to about 10 wt%, preferably about 0.1 to about 5 wt%, more preferably about 0.2 to about 3 wt%.
  • the free fatty acid or mixture of free fatty acids is present in about 0.01 to about 6 wt%, preferably about 0.1 to about 5 wt%, more preferably about 0.2 to about 3 wt%.
  • the cholesterol is present in 0.1 to 10 wt%, preferably 1 to 10 wt%, more preferably 1 to 5 wt%.
  • the ceramide or mixture of ceramides is present in 0.1 to 10 wt%, preferably 0.1 to 5 wt%, more preferably 0.2 to 3 wt%.
  • the free fatty acid or mixture of free fatty acids is present in 0.01 to 6 wt%, preferably 0.1 to 5 wt%, more preferably 0.2 to 3 wt%.
  • One aspect of the invention is directed to a topical composition, the composition consisting of a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to about 20 wt% of glyceryl stearate PEG
  • hesperidin is present in about 2 wt%. In embodiments, hesperidin is present in about 5 wt%. In embodiments, hesperidin is present in about 10 wt%. In
  • hesperidin is present in about 15 wt%. In embodiments, hesperidin is present in about 20 wt%. In embodiments, hesperidin is present in about 25 wt%. In embodiments, hesperidin is present in about 30 wt%. In embodiments, hesperidin is present in about 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • the aqueous phase thickener can be, for example, xanthan gum.
  • One aspect of the invention is directed to a topical composition, the composition including a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to about 20 wt% of glyceryl stearate
  • PEG- 100 emulsifier preferably about 0.5 to about 10 wt%, more preferably about 1 to about 5 wt%; f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably about 2 to about 20 wt%, more preferably about 4 to about 10 wt%; g) about 0.1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably about 0.5 to about 5 wt%, more preferably about 0.8 to about 1.5 wt%; h) about 0.01 to about 5 wt% of citric acid, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; i) about 1 to about 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably about
  • Another aspect of the invention is directed to a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; c) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and d) about 0.001% to about 5% of a topical glucocorticoid.
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • Another aspect of the invention is directed to a composition
  • a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of hesperidin, preferably about 1 to about 10 wt%, more preferably about
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • Another aspect of the invention is directed to an anti-inflammatory composition
  • an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; c) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and d) about 0.001% to about 5% of a
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is hesperidin.
  • Another aspect of the invention is directed to an anti-inflammatory composition
  • an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; c) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and d) about 0.001% to about 5% of a topical glucocorticoid.
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • the glucocorticoid is present in about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, or about 5 wt%.
  • the glucocorticoid is present in about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.1 1, 1.12, 1. 13, 1.14, 1. 15, 1.16, 1.17, 1.18, 1.
  • One aspect of the invention is directed to a topical composition, the composition consisting of a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is hesperidin.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 5 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 10 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 20 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 25 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • citrus bioflavonoid is present in 30 wt%.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid e.g., hesperidin, or an analog,
  • aqueous phase thickener can be, for example, xanthan gum.
  • One aspect of the invention is directed to a topical composition, the composition including a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the topical composition is capable of treating dry skin.
  • the citrus bioflavonoid is hesperidin.
  • Another aspect of the invention is directed to a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prod
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is hesperidin.
  • Another aspect of the invention is directed to an anti-inflammatory composition
  • an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid.
  • citrus bioflavonoid
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is hesperidin.
  • One aspect of the invention is directed to a topical composition, the composition consisting of a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 20 wt%.
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In
  • hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 35 wt%.
  • the hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • One aspect of the invention is directed to a topical composition, the composition consisting of a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.
  • hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments, hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%.
  • the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • a topical composition the composition including a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.
  • a skin conditioner preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.
  • the topical composition is capable of treating dry skin.
  • Another aspect of the invention is directed to a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid.
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • Another aspect of the invention is directed to an anti-inflammatory composition
  • an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid.
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • Another aspect of the invention is directed to an anti-inflammatory composition
  • an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid.
  • the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin.
  • the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
  • the glucocorticoid is present in 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.
  • the glucocorticoid is present in 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1. 1, 1.11, 1. 12, 1.13, 1.14, 1.15, 1. 16, 1.17, 1.18, 1.
  • the free fatty acid and/or cholesterol components of the above compositions can also include lipid metabolites or naturally-occurring oils enriched in species that are known activators or ligands for the nuclear hormone receptors PPARa, ⁇ / ⁇ and/or LXR.
  • lipid metabolites include, for example, the PPARa activator, gamma-linoleic acid.
  • the free fatty acid can be selected from either essential or non-essential free fatty acids, or can be a combination thereof.
  • the topical compositions of the invention can be adapted for therapeutic applications to treat various skin diseases and disorders, and also can be adapted to cosmetic uses.
  • the topical compositions can contain a wide variety of optional components (e.g., scents); provided that such optional components are physically and chemically compatible with the essential components described herein, and do not unduly impair stability, efficacy, or other use benefits associated with the compositions.
  • Optional components can be dispersed, dissolved, or the like in the carrier of the present compositions.
  • Exemplary optional components include emollients, oil absorbents, antimicrobial agents, binders, additional buffering agents, denaturants, cosmetic astringents, external analgesics, film formers, humectants, opacifying agents, perfumes, pigments, skin soothing and healing agents, preservatives, propellants, skin penetration enhancers, solvents, suspending agents, emulsifiers, cleansing agents, thickening agents, solubilizing agents, waxes, sunscreens, sunless tanning agents, antioxidants and/or radical scavengers, chelating agents, antiacne agents, anti -inflammatory agents, desquamation agents/exfoliants, organic hydroxy acids, vitamins, and natural extracts. Examples of such materials are described in Harry's
  • a composition including citrus bioflavonoid e.g. , hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • a composition including cholesterol and citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof.
  • the citrus bioflavonoid is hesperidin.
  • the composition further includes a ceramide and a free fatty acid.
  • the molar ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 molar.
  • the molar ratio of total cholesteroktotal ceramide: total free fatty acid is 3: 1 : 1 molar.
  • compositions including hesperidin In an aspect is provided a composition including hesperidin. In an aspect is provided a composition including cholesterol and hesperidin. In embodiments, the composition further includes a ceramide and a free fatty acid. In embodiments, the molar ratio of total
  • cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 molar. In embodiments, the molar ratio of total cholesteroktotal ceramide:total free fatty acid is 3: 1 : 1 molar.
  • the composition further includes an acid buffer.
  • the pH of the composition is between about 3 to about 5.5.
  • the composition includes about 1 to about 50 wt% of total cholesterol.
  • the composition includes about 0.1 to about 10 wt% of total cholesterol.
  • the composition includes about 0.1 to about 5 wt% of total cholesterol.
  • the composition includes about 0.001 to about 50 wt% of hesperidin.
  • the composition includes about 0.1 to about 10 wt% of hesperidin.
  • the composition includes about 0.1 to about 5 wt% of hesperidin.
  • the composition includes about 0.1 to about 10 wt% total ceramide.
  • the composition includes about 0.1 to about 5 wt% total ceramide. In embodiments, the composition includes about 0.01 to about 6 wt% total free fatty acid. In embodiments, the composition includes about 0.1 to about 2 wt% total free fatty acid. In embodiments, the composition includes about 0.05 to about 5 wt% of the acid buffer. In embodiments, the composition includes about 0.1 to about 5 wt% of the acid buffer.
  • the composition further includes a skin conditioner. In embodiments, the composition includes about 0.1 to about 10 wt% of the skin conditioner. In embodiments, the composition includes about 0.1 to about 5 wt% of the skin conditioner. In embodiments, the skin conditioner is dimethicone. In embodiments, the composition further includes a chelating agent. In embodiments, the composition includes about 0.001 to about 5 wt% of the chelating agent. In embodiments, the composition includes about 0.01 to about 1 wt% of the chelating agent. In embodiments, the chelating agent is disodium EDTA. In embodiments, the composition further includes a humectant.
  • the composition includes about 1 to about 30 wt% of the humectant. In embodiments, the composition includes about 5 to about 30 wt% of the humectant. In embodiments, the humectant is glycerin. In embodiments, the composition further includes an emulsifier. In embodiments, the composition includes about 0.5 to about 20 wt% of the emulsifier. In embodiments, the composition includes about 0.2 to about 10 wt% of the emulsifier. In embodiments, the emulsifier is glyceryl stearate PEG-100. In embodiments, the composition further includes an emollient.
  • the composition includes about 1 to about 30 wt% of the emollient. In embodiments, the composition includes about 0.2 to about 10 wt% of the emollient. In embodiments, the emollient is petrolatum. In embodiments, the emollient is squalane. In embodiments, the composition further includes a preservative. In embodiments, the composition includes about 0.1 to about 10 wt% of the preservative. In embodiments, the composition includes about 0.01 to about 5 wt% of the preservative. In embodiments, the preservative is phenoxyethanol. In embodiments, the preservative is sorbic acid. In embodiments, the composition further includes an encapsulation aid.
  • the composition includes about 1 to about 25 wt% of the encapsulation aid. In embodiments, the composition includes about 0.01 to about 30 wt% of the encapsulation aid. In embodiments, the encapsulation aid is euphorbia cerifera (candelilla) wax. In embodiments, the encapsulation aid is corn syrup solids. In embodiments, the composition further includes an aqueous phase thickener. In embodiments, the composition includes about 0.01 to about 3 wt% of the aqueous phase thickener. In embodiments, the aqueous phase thickener is xanthan gum. In embodiments, the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC- 104).
  • the free fatty acid is conjugated linoleic acid (CLA).
  • the composition further includes a glucocorticoid. In embodiments, the composition includes about 0.001 to about 5 wt% of the glucocorticoid. In embodiments, the composition is a topical composition.
  • a topical composition including: a) cholesterol (e.g., about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1. 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %); b) an acid buffer (e.g. , 0.10, 0. 11, 0.12, 0.13, 0. 14, 0.15, 0.16, 0.17, 0.
  • a topical composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.
  • a skin conditioner e.g., about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17
  • a chelating agent e.g., about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63
  • emollients e.g., about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0,
  • an aqueous phase thickener e.g., about 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18,
  • a topical composition consisting of: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18
  • emollients consisting of petrolatum and squalane (e.g., about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5
  • citric acid e.g., about 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
  • encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax (e.g., about 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96,
  • a topical composition including: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18,
  • emollients consisting of petrolatum and squalane (e.g., about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5
  • citric acid e.g., about 0. 10, 0.11, 0. 12, 0.13, 0.14, 0.15, 0. 16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or about 1.5 total wt%); h) citric acid (e.g., about 0. 10, 0.11, 0. 12, 0.13, 0.14, 0.15, 0.
  • a composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.
  • the composition further includes an acid buffer.
  • the pH of the composition is from 3 to 5.5.
  • the composition includes 1 to 50 wt% of total cholesterol.
  • the composition includes 0.1 to 10 wt% of total cholesterol.
  • the composition includes 0.1 to 5 wt% of total cholesterol.
  • the composition includes 0.001 to 50 wt% of hesperidin.
  • the composition includes 0. 1 to 10 wt% of hesperidin.
  • the composition includes 0.1 to 5 wt% of hesperidin.
  • the composition includes 0.1 to 10 wt% total ceramide.
  • the composition includes 0.1 to 5 wt% total ceramide. In embodiments, the composition includes 0.01 to 6 wt% total free fatty acid. In embodiments, the composition includes 0. 1 to 2 wt% total free fatty acid. In embodiments, the composition includes 0.05 to 5 wt% of the acid buffer. In embodiments, the composition includes 0.1 to 5 wt% of the acid buffer.
  • the composition further includes a skin conditioner. In embodiments, the composition includes 0. 1 to 10 wt% of the skin conditioner. In embodiments, the composition includes 0. 1 to 5 wt% of the skin conditioner. In embodiments, the skin conditioner is dimethicone. In embodiments, the composition further includes a chelating agent. In embodiments, the composition includes 0.001 to 5 wt% of the chelating agent. In embodiments, the composition includes 0.01 to 1 wt% of the chelating agent. In embodiments, the chelating agent is disodium EDTA. In embodiments, the composition further includes a humectant. In embodiments, the composition includes 1 to 30 wt% of the humectant.
  • the composition includes 5 to 30 wt% of the humectant. In embodiments, the humectant is glycerin. In embodiments, the composition further includes an emulsifier. In embodiments, the composition includes 0.5 to 20 wt% of the emulsifier. In embodiments, the composition includes 0.2 to 10 wt% of the emulsifier. In embodiments, the emulsifier is glyceryl stearate PEG-100. In embodiments, the composition further includes an emollient. In embodiments, the composition includes 1 to 30 wt% of the emollient. In embodiments, the composition includes 0.2 to 10 wt% of the emollient.
  • the emollient is petrolatum. In embodiments, the emollient is squalane. In embodiments, the composition further includes a preservative. In embodiments, the composition includes 0.1 to 10 wt% of the preservative. In embodiments, the composition includes 0.01 to 5 wt% of the preservative. In embodiments, the preservative is phenoxyethanol. In embodiments, the preservative is sorbic acid. In embodiments, the composition further includes an encapsulation aid. In embodiments, the composition includes 1 to 25 wt% of the encapsulation aid. In embodiments, the composition includes 0.01 to 30 wt% of the encapsulation aid.
  • the encapsulation aid is euphorbia cerifera (candelilla) wax. In embodiments, the encapsulation aid is com syrup solids. In embodiments, the composition further includes an aqueous phase thickener. In embodiments, the composition includes 0.01 to 3 wt% of the aqueous phase thickener. In embodiments, the aqueous phase thickener is xanthan gum. In embodiments, the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC- 104). In embodiments, the free fatty acid is conjugated linoleic acid (CLA). In embodiments, the composition further includes a glucocorticoid.
  • the composition includes 0.001 to 5 wt% of the glucocorticoid.
  • the composition is a topical composition.
  • a topical composition the composition including: a) cholesterol (e.g., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2. 1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %); b) an acid buffer (e.g., 0.10, 0.1 1, 0. 12, 0.13, 0.14, 0.15, 0.
  • an acid buffer e.g., 0.10, 0.1 1, 0. 12, 0.13, 0.14, 0.15, 0.
  • a topical composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof (e.g., 1.0, 1.
  • a topical composition consisting of: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g.,
  • a topical composition including: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2
  • a skin conditioner e.g., 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48,
  • a skin conditioner e.g., 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.
  • a chelating agent e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1 1, 0.12, 0.
  • a composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18
  • Any of the methods including administration or use of hesperidin described herein may instead administer or use an analog of hesperidin. Any of the methods including administration or use of hesperidin described herein, may instead administer or use a pharmaceutically acceptable salt of hesperidin. Any of the methods including administration or use of hesperidin described herein, may instead administer or use a prodrug of hesperidin.
  • the topical composition of the present invention is generally prepared by conventional methods such as are known in the art of making topical compositions. Such methods typically involve mixing of the ingredients in one or more steps to a relatively uniform state, with or without heating, cooling, application of vacuum, and the like.
  • the topical composition is useful for regulating or improving skin condition, including regulating visible or tactile wrinkles or discontinuities in skin and those associated with skin aging, e.g., visible and/or tactile scaling, wrinkles or discontinuities in skin texture or color.
  • wrinkles, scale or discontinuities may be induced or caused by internal factors (e.g., chronological aging and other biochemical changes from within the skin) or external factors
  • photo-aging e.g., ultraviolet radiation, environmental pollution, wind, heat, low humidity, harsh surfactants, and abrasives.
  • Regulating skin conditions by improving barrier function, antimicrobial defense, or SC integrity can be carried out prophylactically or therapeutically.
  • Prophylactic regulation includes delaying, minimizing, or preventing the development of visible or tactile wrinkles or discontinuities in skin.
  • Therapeutic regulation includes ameliorating, diminishing, minimizing or effacing such wrinkles, scale, or discontinuities.
  • Regulating skin conditions e.g. treating abnormal barrier function, treating aged skin, treating dry skin
  • a topical composition of this invention can topically apply to the skin a safe and effective amount of the composition.
  • the applied amount, the frequency of application and the period of use vary widely depending upon the active levels of a given composition and the level of regulation desired, e.g., in light of the level of skin ageing present in the subject and the rate of further skin ageing.
  • compositions of the present invention can be employed to provide a skin appearance and/or feel benefit.
  • Quantities of the compositions typically applied per application are from about 0.1 mg/cm 2 to about 10 mg/cm 2 , e.g., 2 mg/cm 2 .
  • a composition can be used once or twice per day.
  • application rates can vary from about once per week up to about three times per day or more.
  • Regulating skin conditions is preferably performed by applying a composition in the form of a skin lotion, cream, cosmetic, or the like which is intended to be left on the skin for an extended period for some aesthetic, prophylactic, therapeutic or other benefit (i.e., a "leave-on" composition).
  • a composition in the form of a skin lotion, cream, cosmetic, or the like which is intended to be left on the skin for an extended period for some aesthetic, prophylactic, therapeutic or other benefit
  • “leave-on” compositions exclude rinse-off skin cleansing products.
  • the leave-on composition is preferably left on the skin for a period of at least about 15 minutes, 30 minutes, 1 hour, or up to about 12 hours.
  • the anti-inflammatory composition described above is largely preventive, since 'fixing' the barrier is anti-inflammatory in either aging or young skin.
  • This composition includes not only the barrier lipids in a barrier-enhancing molar ratio and pH, but also includes topical glucocorticoids or immunomodulators, and together such a combination reduces inflammation and prevents disease flares. It also prevents the emergence of epidermal side effects, such as rebound flares and tachyphylaxis, due to the coadministered glucocorticoids or immunomodulators.
  • these compositions are useful for the treatment of conditions including a) xerosis; b) xerotic eczema; c) winter itch; d) nummular eczema; e) seborrheic dermatitis; f) occupational dermatitis; g) hand eczema; h) stasis dermatitis; and any other eczematous condition occurring in the aging population.
  • Another aspect of the invention is directed to a method of treating inflammation by administering an effective amount of the above anti-inflammatory composition as described herein to at least a portion of affected skin in need thereof.
  • a further aspect of the invention is directed to a method of preventing or treating aged skin, including administering one of the topical compositions described above to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
  • the method is directed to a method of treating aged skin, including administering one of the topical compositions described above to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
  • a clinical indication of skin aging can be selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
  • the method includes treating functional abnormalities in chronologically- and/or photo-aged skin, wherein the functional abnormalities may include reduced stratum corneum hydration, reduced stratum corneum cohesion, increased abnormal desquamation, increased skin scaling, increased occurrence of skin infections, increased susceptibility to skin infections, increased susceptibility of inflammatory dermatoses, and/or increased occurrence of inflammatory dermatoses.
  • the method includes improving (i.e. increasing) stratum corneum hydration, improving (i.e. increasing) stratum corneum cohesion, inhibiting (i.e. reducing) abnormal desquamation, inhibiting (i. e. reducing) excessive scaling), reducing occurrence of skin infections, reducing susceptibility to skin infections, reducing susceptibility of inflammatory dermatoses, and/or reducing occurrence of inflammatory dermatoses.
  • the method includes treating functional
  • the method includes treating functional abnormalities in photo-aged skin.
  • the method includes administering to a patient one of the topical compositions described herein begins when the patient is about 40 years old.
  • the patient is 36 years old.
  • the patient is 37 years old.
  • the patient is 38 years old.
  • the patient is 39 years old.
  • the patient is 40 years old.
  • the patient is 41 years old.
  • the patient is 42 years old.
  • the patient is 43 years old.
  • the patient is 44 years old.
  • Another aspect of the invention is directed to a method of preventing or reversing dermal side effects of systemic or topical glucocorticoid treatment, including treating at least a portion of affected skin with one of the compositions described above, in an amount effective to prevent or reverse a dermal clinical indication of glucocorticoid treatment.
  • a dermal clinical indication of glucocorticoid treatment can be selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
  • a method of preventing or reversing a dermal side effect of topical or systemic immunomodulator treatment including treating at least a portion of affected skin with one of the compositions described above, in an amount effective to prevent or reverse dermal clinical indications of immunomodulators treatment.
  • the compositions described above including treating at least a portion of affected skin with one of the compositions described above, in an amount effective to prevent or reverse dermal clinical indications of immunomodulators treatment.
  • immunomodulator include pimecrolimus and/or tacrolimus.
  • the amino acids immunomodulator include pimecrolimus and/or tacrolimus.
  • immunomodulator is a topical calcineurin inhibitor (e.g., pimecrolimus and/or tacrolimus).
  • glucocorticoid treatment can be selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
  • Yet another aspect of the invention is directed to a method for the treatment of dry skin or abnormal epidermal barrier function associated with oral hypolipodemic agent treatment, for example, statin treatment, including administering one of the topical compositions described above to at least a portion of affected skin of a subject, in an amount effective to relieve or reverse clinical indications of hypolipodemic treatment.
  • the subject has been administered a hypolipodemic agent, such as a statin, or is expected to receive such treatment.
  • the subj ect has been co-administered a hypolipodemic agent.
  • Hypolipodemic agents other than statins include fibrates, niacin, bile acid sequestrants, ezetimibe, lomitapide, phytosterols, orlistat, cholesteryl ester transfer protein inhibitors, and squalane synthase inhibitors.
  • the composition is for use in treating dry skin in a subject in need thereof. In embodiments, the composition is for use in treating abnormal epidermal barrier function in a subject in need thereof. In embodiments, the composition is for use in treating an inflammatory condition in a subject in need thereof. In embodiments, the composition is for use in treating a clinical indication of skin aging in a subj ect in need thereof. In embodiments, the clinical indication of skin aging is eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
  • the composition is for use in treating a dermal clinical indication of glucocorticoid treatment in a subject in need thereof.
  • the dermal clinical indication of glucocorticoid treatment is inflammation, tachyphylaxis, disease flares, or rebound flares.
  • the composition is for use in treating a clinical indication of hypolipodemic treatment in a subject in need thereof.
  • One aspect of the invention is directed to a topical composition comprising citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) in the absence of lipids providing desirable restorative effects on the epidermal permeability barrier in aged skin, as provided herein.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is hesperidin.
  • a further aspect of the invention is directed to a method of treating aged skin, comprising administering one of the topical compositions comprising citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) in the absence of lipids to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
  • citrus bioflavonoid e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof
  • the citrus bioflavonoid is hesperidin.
  • Another aspect of the invention is directed to a method of preventing or reversing an epidermal side effect of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with one of the topical compositions comprising citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) in the absence of lipids, in an amount effective to prevent or reverse epidermal a clinical indication of glucocorticoid side effects.
  • the citrus bioflavonoid is hesperidin.
  • One aspect of the invention is directed to a topical composition comprising hesperidin in the absence of lipids providing desirable restorative effects on the epidermal permeability barrier in aged skin, as provided herein.
  • a further aspect of the invention is directed to a method of treating aged skin, comprising administering one of the topical compositions comprising hesperidin in the absence of lipids to at least a portion of aged skin, in an amount effective to relieve or reverse clinical indications of skin aging.
  • Another aspect of the invention is directed to a method of preventing or reversing epidermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with one of the topical compositions comprising hesperidin in the absence of lipids, in an amount effective to prevent or reverse epidermal clinical indications of glucocorticoid side effects.
  • Citrus bioflavonoids such as orange peel extract, reportedly exhibit beneficial effects for skin pigmentation, inflammation, and ultraviolet (UV) protection, as well as stimulating keratinocyte proliferation.
  • topical hesperidin improves epidermal permeability barrier function in young normal murine skin, and have explored the responsible mechanisms.
  • Topical hesperidin significantly accelerated young murine skin barrier recovery after acute barrier abrogation; which correlated with stimulation of both epidermal proliferation and differentiation, as well as enhanced lamellar body (lipid) secretion.
  • topical hesperidin enhances epidermal permeability barrier homeostasis in normal skin by stimulating epidermal proliferation and differentiation, and by stimulating lamellar body secretion.
  • topical citrus bioflavonoids such as hesperidin for aged skin have not heretofore been disclosed.
  • topical hesperidin treatment significantly increased the mRNA levels of HMGCoA, SPT1 and FAS in aged mouse epidermis, as assessed by Q-PCR.
  • topical applications of hesperidin improve multiple key epidermal functions in aged mouse skin. After 9 days of treatment, the gross appearance of mouse skin treated with vehicle and hesperidin appeared similar.
  • Epidermal lipid synthesis is required for the formation and maintenance of the epidermal permeability barrier.
  • Synthesis of three key barrier-related lipids, cholesterol, ceramides, and fatty acids requires their respective rate-limiting enzymes 3-hydroxy-3-methyl- glutaryl-CoA reductase (HMGCoA), serine palmitoyltransferase 1 (SPT1), and fatty acid synthase (FAS).
  • HMGCoA 3-hydroxy-3-methyl- glutaryl-CoA reductase
  • SPT1 serine palmitoyltransferase 1
  • FAS fatty acid synthase
  • Basal mRNA levels for all three key lipid synthetic enzymes were lower in aged as compared with young epidermis, consistent with the concept that the lower lipid synthesis rates in aged epidermis could reflect the reduced expression of their synthetic enzymes.
  • Topical hesperidin treatment significantly increased the mRNA levels of HMGCoA, SPT1, and FAS in aged
  • Epidermal permeability barrier function depends on newly synthesized epidermal lipids delivered to the SC through the secretion of lamellar bodies from the stratum granulosum.
  • ATP-binding cassette transporter 12 (ABCA12), a trans-membrane glycosylceramide transporter, is required for normal lamellar body assembly, we next evaluated the changes in epidermal mRNA levels of ABCA12 in hesperidin-treated aged epidermis.
  • sPLA2g2f To determine whether the hesperi din-induced acidification of the pH of the SC results from the upregulation of NHEl and/or the parallel acidifying mechanism, sPLA2g2f, we next assessed the changes in epidermal mRNA levels of these two genes in aged epidermis after herperidin treatments by Q-PCR. Topical hesperidin provoked a marked elevation in mRNA levels for both NHEl and sPLA2g2f in aged epidermis. These results suggest that hesperidin-induced acidification of aged epidermis results from stimulation of NHEl and sPLA2g2f, accounting for the lower skin surface pH, and likely improved epidermal permeability barrier homeostasis in hesperi din-treated aged mouse skin.
  • Epidermal permeability barrier and antimicrobial function are co-regulated and independent. Aged humans are predisposed to develop both cutaneous and extracutaneous infections, and expression of the epidermal cathelicidin antimicrobial peptide CAMP/LL37 is reduced in aged skin. To determine whether hesperidin enhances epidermal antimicrobial defense, we next assessed changes in the mRNA levels of mouse beta-defensin 3 (mBD3), a homolog of human beta-defensin 2 (hBD2), following hesperidin treatment. Hesperidin treatment significantly increased epidermal mBD3 mRNA levels.
  • mBD3 mouse beta-defensin 3
  • hBD2 a homolog of human beta-defensin 2
  • topical hesperidin improves a wide spectrum of functional abnormalities in aged epidermis, including abnormalities in epidermal permeability barrier function, epidermal differentiation, lipid production, and SC acidification.
  • the antioxidant property of hesperidin is also beneficial.
  • Aged skin displays lower antioxidant capacity and excessive accumulation of oxidative products, and hesperidin shows high antioxidant capacity.
  • topical hesperidin applications increased epidermal mRNA levels of antioxidant enzymes such as glutathione reductase and superoxide dismutase in murine skin.
  • Pertinent to antioxidant activity nuclear factor (erythroid-derived 2)- like 2 (Nrf2), a transcription factor, regulates epidermal differentiation and antioxidant defense.
  • Nrf2 function is impaired in aged heart, and expression levels were lower in aged epidermis. Hesperidin upregulates Nrf2 in the heart and in the aged epidermis. Hence, hesperidin-induced improvement of epidermal permeability barrier function in aged skin might be mediated via Nrf2.
  • Glucocorticoid Side Effects Systemic and topical glucocorticoids (GC) can cause significant adverse effects not only on the dermis, but also on epidermal structure and function. In epidermis, one striking GC-induced alteration in permeability barrier function occurs that can be attributed to an inhibition of epidermal mitogenesis, differentiation and lipid production, features that mimic aged skin.
  • Hesperidin co-applications unexpectedly also prevented the anticipated GC-induced impairments of epidermal permeability barrier homoeostasis and stratum corneum (SC) integrity and SC acidification. These preventive effects could be attributed to a significant increase in filaggrin expression, enhanced epidermal ⁇ -glucocerebrosidase activity and accelerated lamellar bilayer maturation, the last two likely attributable to a hesperidin- induced reduction in stratum corneum pH. Furthermore, co-applications of hesperidin with GC surprisingly prevented the expected GC-induced inhibition of epidermal proliferation.
  • topical hesperidin also unexpectedly increased epidermal anti-oxidant enzymes, including glutathione reductase and superoxide dismutase, mRNA expression, which could counteract multiple negative effects of GC on epidermal function.
  • epidermal anti-oxidant enzymes including glutathione reductase and superoxide dismutase, mRNA expression
  • the acid mantle refers to the highly acidic film of the SC that acts as a deterrent to the entry of bacteria, viruses and other potential contaminants that might penetrate the skin.
  • exogenous acidic sources such as sebum-derived free fatty acids
  • several endogenous acidifying mechanisms account for up to 2 pH units (a 200-fold increase in protons) of the overall pH of the stratum corneum (SC) (Table 1).
  • the sodium-protein antiporter, type 1 (NHE1) which selectively acidifies extracellular domains at the stratum granulosum (SG)/SC interface, accounts for ca. 4 unit of the bulk pH of the SC.
  • This critically-important site is where sphingomyelin and glucosylceramides are processed by the acidic pH-dependent enzymes, acidic sphingomyelinase (aSMase) and ⁇ - glucocerebrosidase ( ⁇ -GlcCer'ase) into ceramides, thereby generating the permeability barrier.
  • secretory phospholipase releases free fatty acids (FFA) from the sn.2 position of glycerophospholipids (PL). While one subset of sPLA2 releases arachidonic acid that is subsequently converted to eicosanoids, other sPLA2 release FFAs that are required for permeability barrier homeostasis and SC acidification ( « 1 pH unit), but only the PLA2G2F isoform is regulated and required for permeability barrier homeostasis. Notably, Pla2g2f knock out mice display an elevated SC pH, again demonstrating that PL hydrolysis to FFA accounts for ca. l unit of SC pH.
  • V 2 pH unit lower (50-fold more acidic) than the SC of lightly-pi gmented skin, due in part to the persistence and extrusion of melanin granules at the SG-SC interface.
  • the acidic pH of darkly-pigmented skin dictates the superior function in such individuals, because acidification of lightly -pigmented human skin "resets" functions to darkly-pigmented levels. But it is likely that one additional mechanism contributes to SC acidification.
  • Cholesterol sulfate (CS0 4 ) is the most abundant and widely distributed of sulfated sterols, and a critical regulator of epidermal differentiation. The CSO4 content of the epidermis climbs to ca.
  • lipid mass in the SG due to enhanced expression of the gene that encodes SULT2Blb, the enzyme that sulfonates cholesterol.
  • the hydrolytic enzyme, steroid sulfatase (SSase) then hydrolyzes CSO 4 until its levels decline to ca. 1% in the outer SC.
  • CSO 4 levels increase to >10% of lipid mass, and the SC in XLI is more acidic than normal, consistent with the low pKa (3.1) of CSO 4 .
  • glucosylceramides into ceramides is dependent upon aSMase and ⁇ -GlcCer'ase, which display pH optima of ca. 5. Only at the reduced acidity of normal SC can these enzymes generate enough Cer necessary to form lamellar bilayers. Conversely, when the pH of the SC rises with inflammation or under experimental conditions, the activities of these enzymes decline in parallel with a deterioration of permeability barrier function.
  • SC integrity resistance to stripping
  • SC cohesion protein removed per stripping
  • desquamation At the low pH of normal SC, comeodesmosomes (CD) are slowly, but progressively degraded by serine proteases (kallikreins, KLK), and then more avidly by aspartate and thiol proteases that exhibit acidic pH optima.
  • KLK serine proteases
  • elevations in pH activate KLK, which rapidly degrade CD, accelerating desquamation and compromising SC integrity/cohesion.
  • a third pH-linked function is pro-inflammatory cytokine activation.
  • Large pre-formed pools of the 33 kDa precursors of pro-IL-la and pro-IL- ⁇ are stored in the comeocyte cytosol.
  • KLK activity increases, releasing the active 17 kDa forms of IL-la/IL- ⁇ , which in turn, initiate divergent, downstream cytokine cascades.
  • single perturbations instead unleash beneficial, cytokine-initiated, homeostatic responses (e.g., accelerated DNA and lipid synthesis) that help to restore barrier homeostasis.
  • Moderately- aged skin also suffers from a flawed permeability barrier and impaired SC integrity, in parallel with an elevated SC pH, due to decreased NHEl expression. Again, acidifying the SC normalizes both permeability barrier function and SC integrity/cohesion in moderately-aged mice.
  • both the low pH and the free fatty acids in the formulation inhibit the growth of microbial pathogens, such as S. aureus, and repair of the barrier also provides a daunting barrier to the penetration of pathogens.
  • microbial pathogens such as S. aureus
  • epidermal cholesterol biosynthesis has been shown to be essential for maintaining the cutaneous barrier function.
  • One known side effect of oral statin and hypolipodemic agents is dry skin, or acquired ichthyosis resulting from lowered dermal cholesterol concentrations.
  • lovastatin an inhibitor of cholesterol biosynthesis
  • cholesterol synthesis rapidly normalizes, but fatty acid synthesis remains elevated. This indicates that a disturbance in the new fatty acid: cholesterol molar ratio accounts for the perturbed barrier function.
  • the statin-induced alteration of the permeability of the epidermal barrier can manifest as excessive scale, cheilitis, eczemas, or acquired ichthyosis.
  • TEWL transepidermal water loss
  • TEWL was measured using an electrolytic water analyzer (Meeco, Warrington, PA) at 0, 2 and 4 hours after tape stripping (10-fold increase in TEWL), and percent barrier recovery was calculated.
  • Keratinocyte Culture Second-passage keratinocytes isolated from adult human (donor aged 60-65 year old) were cultured in serum-free keratinocyte growth medium containing 0.07 mM calcium (Clonetics, San Diego, California). Cells at 60%-70% confluence were switched to a medium containing 1.2 mM calcium and treated with either 0.02% hesperidin or vehicle alone (0.02% ethanol). After 24 and 48 hrs of treatment, keratinocytes were collected for Q-PCR analysis. [0232] Immunohistochemistry. Immunohistochemical staining for assessing changes in epidermal differentiation was performed as follows.
  • First strand cDNA was synthesized from lug of total RNA with the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA).
  • the real-time PCR contained 20 ng of reversed transcribed total RNA, 450 nM forward and reverse primers, and 10 ⁇ of 2* LightCycler 480 SYBR Green I Master in a final volume of 20 ⁇ in 96-well plates using Mx3000PTM Real-time PCR System (Stratagene, La Jolla, CA). Quantification was performed by the comparative CT method with 36B4 or Cyclophilin A used for normalization.
  • lipid synthetic enzymes such as 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCoA), serine-palmitoyl transferase 1 (SPT1), fatty acid synthase (FAS), lipid transporters (ATP- binding cassette A12 (ABCA12)), mouse beta defensin 3 (mBD3), sodium-hydrogen exchanger 1(NHE1), secretary phospholipase A2g2f (sPLA2g2f), filaggrin, involucrin, loricrin and Cyclophilin A are listed in Primer Table 2. Relative expression of the mRNAs compared to control mRNA was calculated. Data are expressed as percentage of control (as 100%).
  • Electron Microscopy Skin biopsies from both vehicle and hesperidin-treated mice were taken for electron microscopy. Briefly, samples were minced to ⁇ 0.5 mm 3 , fixed in modified Kamovsky's fixative overnight, and post-fixed in either 0.2% ruthenium tetroxide or 1% aqueous osmium tetroxide, containing 1.5% potassium ferrocyanide. After fixation, all samples were dehydrated in a graded ethanol series, and embedded in an Epon-epoxy mixture. Ultrathin sections were examined, with or without further contrasting with lead citrate, in a Zeiss 10A electron microscope (Carl Zeiss, Thomwood, NJ), operated at 60 kV.
  • LB numbers were determined in granular cells two to three layers below the stratum granulosum-stratum corneum(SG-SC) junction as previously described. The number of LBs was counted at 4800 magnification using a calibrated grid. Total 10 random pictures from each biopsy sample were assessed. For quantification of LB secretion, number of LB protrusion at the SG-SC junction were measured at a magnification of 5800 and correlated with the length of the bottom surface of the first SC layer on 10 random images at 5800 magnification. [0236] Statistics. Data are expressed as the mean + SEM.
  • GraphPad Prism 4 software (San Diego, CA, USA) was used for all statistical analyses. Unpaired two-tailed student's /-test with Welch's correction was used to determine the statistical significances when two groups were compared. One-Way ANOVA with Tukey correction was used when three or more groups were compared.
  • Citric Acid >0.5 (to reduce pH to 3-5)
  • the lipids may be diluted to determine whether the impact of hesperidin could be separated out, and whether a potential cost saving could be achieved by lowering the amount of ceramide needed. It was observed that the dilute mixture does very well for improving barrier function (accelerates barrier recovery and lowers basal TEWL levels). It was noted that hesperidin significantly improved (lowered) pH when added to the triple lipid mixture.
  • Example preparation of a topical composition The active ingredients are solubilized in preparation for topical application in organic solvents suitable for dermal application, such as ethanol, aqueous ethanol, acetone, aqueous acetone, or combinations of acetone and ethanol, with or without water. Mixtures of propylene glycol and ethanol or propylene glycol and aqueous ethanol are also suitable. Alternatively, mild detergents, such as MIRANOL®, can be used to solubilize the mixture of active ingredients.
  • the composition includes a cholesterol-dominant lipid mixture plus hesperidin for the use on aged mice: 18-Month old mice were divided into groups of untreated, lipid mixture + vehicle (70% ethanol) treated, and lipid mixture + 2% hesperidin treated. Mice are treated twice daily for 7 days. All measurements are carried out with a MPA5 physiology monitor. Lipid mixture contained cholesterol, fatty acid and ceramide (3: 1 : 1 molar ratio, with cholesterol at 3 moles) at a concentration of 0.74 wt%. Data are normalized to untreated control, setting untreated as 100%.
  • Embodiment PI A topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, said composition comprising: a) about 1 to about 50 wt% of cholesterol;
  • pH of said topical composition is about 3 to about 5.5.
  • Embodiment P2 A topical composition for treating aged skin, said composition comprising: a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
  • Embodiment P3 The composition of Embodiment P2, wherein said mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
  • Embodiment P4 The composition of Embodiment P2 or P3, wherein said skin conditioner comprises dimethicone, said chelating agent comprises disodium EDTA, said humectant comprises glycerin, and said acid buffer comprises citric acid.
  • Embodiment P5 The composition of any one of Embodiments P2 to P4, wherein said emulsifier comprises glyceryl stearate PEG- 100.
  • Embodiment P6 The composition of any one of Embodiments P2 to P5, wherein said one or more emollients comprise petrolatum and squalane.
  • Embodiment P7 The composition of any one of Embodiments P2 to P6, wherein said one or more preservatives comprise phenoxyethanol and sorbic acid.
  • Embodiment P8 The composition of any one of Embodiments P2 to P7, wherein said one or more encapsulation aids comprise com syrup solids and euphorbia cerifera (candelilla) wax.
  • Embodiment P9 The composition of any one of Embodiments P2 to P8, wherein said aqueous phase thickener comprises xanthan gum.
  • Embodiment PIO The composition of any one of Embodiments P2 to P9, wherein the pH of said topical composition is about 3 to about 5.5.
  • Embodiment Pl l The composition of any one of Embodiments P2 to PIO, wherein said molar ratio of cholesterol: ceramide:free fatty acid is 3: 1: 1.
  • Embodiment PI 2 The composition of any one of Embodiments P2 to PI 1, wherein cholesterol is present in about 0.1 to about 10 wt%.
  • Embodiment PI 3 The composition of any one of Embodiments P2 to PI 2, wherein said ceramide is present in about 0.1 to about 10 wt%.
  • Embodiment P14 The composition of any one of Embodiments P2 to P13, wherein said free fatty acid is present in about 0.01 to about 6 wt%.
  • Embodiment P15 The topical composition for treating aged skin of Embodiment P2, said composition consisting of:
  • Embodiment PI 6 An anti -inflammatory composition comprising: a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
  • Embodiment PI 7 A method of treating aged skin, comprising administering said topical composition of any one of Embodiments PI to PI 6 to at least a portion of aged skin, in an amount effective to relieve or reverse clinical indications of skin aging.
  • Embodiment PI 8 The method of Embodiment PI 7, wherein the clinical indications of skin aging are selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
  • Embodiment PI 9 A method of preventing or reversing dermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with said topical composition of any one of Embodiments PI to PI 6, in an amount effective to prevent or reverse dermal clinical indications of glucocorticoid treatment.
  • Embodiment P20 The method of Embodiment PI 9, wherein said dermal clinical indications of glucocorticoid treatment are selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
  • Embodiment P21 A method of treating inflammation comprising administering an effective amount of the anti-inflammatory composition of Embodiment P16 to at least a portion of affected skin in need thereof.
  • Embodiment P22 A method for the treatment of dry skin and/or abnormal epidermal barrier function associated with oral hypolipodemic agent treatment, comprising administering said topical composition of Embodiment PI or Pl l to at least a portion of affected skin of a subject, in an amount effective to relieve or reverse clinical indications of hypolipodemic treatment.
  • Embodiment P23 The method of Embodiment P22, wherein the subject has taken a
  • hypolipodemic agent or is expected to receive such treatment.
  • Embodiment P24 A composition comprising cholesterol and hesperidin, wherein:
  • composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 moles; or
  • Embodiment P25 The composition of Embodiment P24, comprising about 1 to about 50 wt% of total cholesterol.
  • Embodiment P26 The composition of one of Embodiments P24 to P25 comprising about 0.001 to about 50 wt% of hesperidin.
  • Embodiment P27 The composition of one of Embodiments P25 to P26, comprising about 0.1 to about 10 wt% total ceramide.
  • Embodiment 28 The composition of one of Embodiments P25 to P27, comprising about 0.01 to about 6 wt% total free fatty acid.
  • Embodiment P29 The composition of one of Embodiments P24 to P28, comprising about 0.01 to about 5 wt% of acid buffer.
  • Embodiment P30 The composition of one of Embodiments P24 to P29, further comprising a skin conditioner.
  • Embodiment P31 The composition of Embodiment P30, comprising about 0.1 to about 10 wt% of the skin conditioner.
  • Embodiment P32 The composition of one of Embodiments P30 to P31, wherein the skin conditioner is dimethicone.
  • Embodiment P33 The composition of one of Embodiments P24 to P32, further comprising a chelating agent.
  • Embodiment P34 The composition of Embodiment P33, comprising about 0.001 to about 5 wt% of the chelating agent.
  • Embodiment P35 The composition of one of Embodiments P33 to P34, wherein the chelating agent is disodium EDTA.
  • Embodiment P36 The composition of one of Embodiments P24 to P35, further comprising a humectant.
  • Embodiment P37 The composition of Embodiment P36, comprising about 1 to about 30 wt% of the humectant.
  • Embodiment P38 The composition of one of Embodiments P36 to P37, wherein the humectant is glycerin.
  • Embodiment P39 The composition of one of Embodiments P24 to P38, further comprising an emulsifier.
  • Embodiment P40 The composition of Embodiment P39, comprising about 0.5 to about 20 wt% of the emulsifier.
  • Embodiment P41 The composition of one of Embodiments P38 to P39, wherein the emulsifier is glyceryl stearate PEG-100.
  • Embodiment P42 The composition of one of Embodiments P24 to P41, further comprising an emollient.
  • Embodiment P43 The composition of Embodiment P42, comprising about 1 to about 30 wt% of the emollient.
  • Embodiment P44 The composition of one of Embodiments P42 to P43, wherein the emollient is petrolatum.
  • Embodiment P45 The composition of one of Embodiments P42 to P43, wherein the emollient is squalane.
  • Embodiment P46 The composition of one of Embodiments P24 to P45, further comprising a preservative.
  • Embodiment P47 The composition of Embodiment P46, comprising about 0.1 to about 10 wt% of the preservative.
  • Embodiment P48 The composition of one of Embodiments P46 to P47, wherein the preservative is phenoxyethanol.
  • Embodiment P49 The composition of one of Embodiments P46 to P47, wherein the preservative is sorbic acid.
  • Embodiment P50 The composition of one of Embodiments P24 to P49, further comprising an encapsulation aid.
  • Embodiment P51 The composition of Embodiment P50, comprising about 1 to about 25 wt% of the encapsulation aid.
  • Embodiment P52 The composition of one of Embodiments P50 to P51, wherein the
  • encapsulation aid is euphorbia cerifera (candelilla) wax.
  • Embodiment P53 The composition of one of Embodiments P50 to P51, wherein the
  • encapsulation aid is corn syrup solids.
  • Embodiment P54 The composition of one of Embodiments P24 to P53, further comprising an aqueous phase thickener.
  • Embodiment P55 The composition of Embodiment P54, comprising about 0.01 to about 3 wt% of the aqueous phase thickener.
  • Embodiment P56 The composition of one of Embodiments P54 to P55, wherein the aqueous phase thickener is xanthan gum.
  • Embodiment P57 The composition of one of Embodiments P24 to P56, wherein the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC-104).
  • Embodiment P58 The composition of one of Embodiments P24 to P57, wherein the free fatty acid is conjugated linoleic acid (CLA).
  • CLA conjugated linoleic acid
  • Embodiment P59 The composition of one of Embodiments P24 to P58, further comprising a glucocorticoid.
  • Embodiment P60 The composition of Embodiment P59, comprising about 0.001 to about 5 wt% of the glucocorticoid.
  • Embodiment P61 The composition of one of Embodiments P24 to P60, wherein the composition is a topical composition.
  • Embodiment P62 The composition of one of Embodiments P24 to P61 for use in treating dry skin in a subject in need thereof.
  • Embodiment P63 The composition of one of Embodiments P24 to P61 for use in treating abnormal epidermal barrier function in a subject in need thereof.
  • Embodiment P64 The composition of one of Embodiments P24 to P61 for use in treating an inflammatory condition in a subject in need thereof.
  • Embodiment P65 The composition of one of Embodiments P24 to P61 for use in treating a clinical indication of skin aging in a subject in need thereof.
  • Embodiment P66 The composition of Embodiment P65, wherein the clinical indication of skin aging is eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
  • Embodiment P67 The composition of one of Embodiments P24 to P61 for use in treating a dermal clinical indication of glucocorticoid treatment in a subj ect in need thereof.
  • Embodiment P68 The composition of Embodiment P67, wherein the dermal clinical indication of glucocorticoid treatment is inflammation, tachyphylaxis, disease flares, or rebound flares.
  • Embodiment P69 The composition of one of Embodiments P24 to P61 for use in treating a clinical indication of hypolipodemic treatment in a subject in need thereof.
  • Embodiment 1 A topical composition, the composition comprising:
  • Embodiment 2 The composition of Embodiment 1, wherein the composition is capable of treating dry skin or skin suffering an abnormal epidermal barrier function.
  • Embodiment 3 A topical composition, the composition comprising:
  • barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
  • k about 0.001 to about 50 wt% of hesperidin.
  • Embodiment 4 The composition of Embodiment 3, wherein the composition is capable of treating aged skin.
  • Embodiment 5 The composition of one of Embodiment 3 or 4, wherein the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
  • the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
  • Embodiment 6 The composition of any one of Embodiments 3 to 5, wherein the skin conditioner comprises dimethicone, the chelating agent comprises disodium EDTA, the humectant comprises glycerin, and the acid buffer comprises citric acid.
  • Embodiment 7 The composition of any one of Embodiments 3 to 6, wherein the emulsifier comprises glyceryl stearate PEG-100.
  • Embodiment 8 The composition of any one of Embodiments 3 to 7, wherein the one or more emollients comprise petrolatum and squalane.
  • Embodiment 9 The composition of any one of Embodiments 3 to 8, wherein the one or more preservatives comprise phenoxyethanol and sorbic acid.
  • Embodiment 10 The composition of any one of Embodiments 3 to 9, wherein the one or more encapsulation aids comprise com syrup solids and euphorbia cerifera (candelilla) wax.
  • Embodiment 11 The composition of any one of Embodiments 3 to 10, wherein the aqueous phase thickener comprises xanthan gum.
  • Embodiment 12 The composition of any one of Embodiments 3 to 1 1, wherein the pH of the topical composition is from about 3 to about 5.5.
  • Embodiment 13 The composition of any one of Embodiments 3 to 12, wherein the molar ratio of cholesterol: ceramide:free fatty acid is 3: 1 : 1.
  • Embodiment 14 The composition of any one of Embodiments 3 to 13, wherein cholesterol is present in about 0. 1 to about 10 wt%.
  • Embodiment 15 The composition of any one of Embodiments 3 to 14, wherein the ceramide is present in about 0.1 to about 10 wt%.
  • Embodiment 16 The composition of any one of Embodiments 3 to 15, wherein the free fatty acid is present in about 0.01 to about 6 wt%.
  • Embodiment 17 The topical composition of Embodiment 4, the composition consisting of: a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids;
  • Embodiment 18 A composition comprising:
  • barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
  • Embodiment 19 The composition of Embodiment 18, the composition is an antiinflammatory composition.
  • Embodiment 20 A method of treating aged skin, comprising administering the topical composition of any one of Embodiments 1 to 19 to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
  • Embodiment 21 The method of Embodiment 20, wherein the clinical indication of skin aging is selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
  • Embodiment 22 A method of preventing or reversing dermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with the topical composition of any one of Embodiments 1 to 19, in an amount effective to prevent or reverse a dermal clinical indication of glucocorticoid treatment.
  • Embodiment 23 The method of Embodiment 22, wherein the dermal clinical indication of glucocorticoid treatment is selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
  • Embodiment 24 A method of treating inflammation comprising administering an effective amount of the composition of one of Embodiments 1 to 19 to at least a portion of affected skin in need thereof.
  • Embodiment 25 A method for the treatment of dry skin and/or abnormal epidermal barrier function associated with oral hypolipodemic agent treatment, comprising administering the topical composition of Embodiment 1 or 19 to at least a portion of affected skin of a subj ect, in an amount effective to relieve or reverse a clinical indication of hypolipodemic treatment.
  • Embodiment 26 The method of Embodiment 25, wherein the subj ect has been administered a hypolipodemic agent or is co-administered with a hypolipodemic agent.
  • Embodiment 27 A composition comprising cholesterol and hesperidin, wherein:
  • composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 moles; or
  • the pH of the composition is from about 3 to about 5.5.
  • Embodiment 28 The composition of Embodiment 27, wherein:
  • the composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 moles; and (ii) the pH of the composition is from about 3 to about 5.5.
  • Embodiment 29 The composition of Embodiment 27, comprising about 1 to about 50 wt% of total cholesterol.
  • Embodiment 30 The composition of one of Embodiments 27 to 29 comprising about 0.001 to about 50 wt% of hesperidin.
  • Embodiment 31 The composition of one of Embodiments 27 to 30, comprising about 0.1 to about 10 wt% total ceramide.
  • Embodiment 32 The composition of one of Embodiments 27 to 31, comprising about 0.01 to about 6 wt% total free fatty acid.
  • Embodiment 33 The composition of one of Embodiments 27 to 32, comprising about 0.01 to about 5 wt% of the acid buffer.
  • Embodiment 34 The composition of one of Embodiments 27 to 33, further comprising a skin conditioner.
  • Embodiment 35 The composition of Embodiment 34, comprising about 0.1 to about 10 wt% of the skin conditioner.
  • Embodiment 36 The composition of one of Embodiments 34 to 35, wherein the skin conditioner is dimethicone.
  • Embodiment 37 The composition of one of Embodiments 27 to 36, further comprising a chelating agent.
  • Embodiment 38 The composition of Embodiment 37, comprising about 0.001 to about 5 wt% of the chelating agent.
  • Embodiment 39 The composition of one of Embodiments 37 to 38, wherein the chelating agent is disodium ethylenediaminetetraacetic acid (EDTA).
  • EDTA disodium ethylenediaminetetraacetic acid
  • Embodiment 40 The composition of one of Embodiments 27 to 39, further comprising a humectant.
  • Embodiment 41 The composition of Embodiment 40, comprising about 1 to about 30 wt% of the humectant.
  • Embodiment 42 The composition of one of Embodiments 40 to 41, wherein the humectant is glycerin.
  • Embodiment 43 The composition of one of Embodiments 27 to 42, further comprising an emulsifier.
  • Embodiment 44 The composition of Embodiment 43, comprising about 0.5 to about 20 wt% of the emulsifier.
  • Embodiment 45 The composition of one of Embodiments 43 to 44, wherein the emulsifier is glyceryl stearate PEG- 100.
  • Embodiment 46 The composition of one of Embodiments 27 to 45, further comprising an emollient.
  • Embodiment 47 The composition of Embodiment 46, comprising about 1 to about 30 wt% of the emollient.
  • Embodiment 48 The composition of one of Embodiments 46 to 47, wherein the emollient is petrolatum.
  • Embodiment 49 The composition of one of Embodiments 46 to 47, wherein the emollient is squalane.
  • Embodiment 50 The composition of one of Embodiments 27 to 49, further comprising a preservative.
  • Embodiment 51 The composition of Embodiment 50, comprising about 0.1 to about 10 wt% of the preservative.
  • Embodiment 52 The composition of one of Embodiments 50 to 51, wherein the preservative is phenoxyethanol.
  • Embodiment 53 The composition of one of Embodiments 50 to 51, wherein the preservative is sorbic acid.
  • Embodiment 54 The composition of one of Embodiments 27 to 53, further comprising an encapsulation aid.
  • Embodiment 55 The composition of Embodiment 54, comprising about 1 to about 25 wt% of the encapsulation aid.
  • Embodiment 56 The composition of one of Embodiments 54 to 55, wherein the encapsulation aid is euphorbia cerifera (candelilla) wax.
  • the encapsulation aid is euphorbia cerifera (candelilla) wax.
  • Embodiment 57 The composition of one of Embodiments 54 to 55, wherein the encapsulation aid is corn syrup solids.
  • Embodiment 58 The composition of one of Embodiments 27 to 57, further comprising an aqueous phase thickener.
  • Embodiment 59 The composition of Embodiment 58, comprising about 0.01 to about 3 wt% of the aqueous phase thickener.
  • Embodiment 60 The composition of one of Embodiments 58 to 59, wherein the aqueous phase thickener is xanthan gum.
  • Embodiment 61 The composition of one Embodiments 27 to 60, wherein the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC-104).
  • Embodiment 62 The composition of one of Embodiments 27 to 61, wherein the free fatty acid is conjugated linoleic acid (CLA).
  • CLA conjugated linoleic acid
  • Embodiment 63 The compositions of one of Embodiments 27 to 62, further comprising a glucocorticoid.
  • Embodiment 64 The composition of Embodiment 63, comprising about 0.001 to about 5 wt% of the glucocorticoid.
  • Embodiment 65 The composition of one of Embodiments 27 to 64, wherein the composition is a topical composition.
  • Embodiment 66 The composition of one of Embodiments 27 to 65, for use in treating dry skin in a subject in need thereof.
  • Embodiment 67 The composition of one of Embodiments 27 to 65, for use in treating abnormal epidermal barrier function in a subject in need thereof.
  • Embodiment 68 The composition of one of Embodiments 27 to 65, for use in treating an inflammatory condition in a subject in need thereof.
  • Embodiment 69 The composition of one of Embodiments 27 to 65, for use in treating a clinical indication of skin aging in a subject in need thereof.
  • Embodiment 70 The composition of Embodiment 69, wherein the clinical indication of skin aging is eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
  • Embodiment 71 The composition of one of Embodiments 27 to 65, for use in treating a dermal clinical indication of glucocorticoid treatment in a subj ect in need thereof.
  • Embodiment 72 The composition of Embodiment 71, wherein the dermal clinical indication of glucocorticoid treatment is inflammation, tachyphylaxis, disease flares, or rebound flares.
  • Embodiment 73 The composition of one of Embodiments 27 to 65, for use in treating a clinical indication of hypolipodemic treatment in a subject in need thereof.
  • Embodiment 74 The method of Embodiment 20, wherein the aged skin is photo-aged skin.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Emergency Medicine (AREA)
  • Dermatology (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

Compositions and methods for treating aged skin or skin otherwise suffering from abnormal epidermal barrier function are disclosed, where the compositions include hesperidin.

Description

HESPERIDIN-CONTAINING COMPOSITIONS AND METHODS FOR TREATMENT
OF SKIN DISORDERS
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No. 62/120,682, filed February 25, 2015 which is incorporated herein by reference in its entirety and for all purposes.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER
PROGRAM LISTING APPENDIX SUBMITTED AS AN ASCII FILE
[0002] The Sequence Listing written in file 48536-558001WO_ST25.TXT, created February 18, 2016, 7,435 bytes, machine format IBM-PC, MS-Windows operating system, is hereby incorporated by reference.
FIELD OF THE DISCLOSED SUBJECT MATTER
[0003] The presently disclosed subject matter relates to topical compositions containing hesperidin, cholesterol alone or as part of a triple physiologic mixture of stratum comeum lipids, formulated at an acidic pH, and their utility for the treatment of: i) dry or aged skin due to an abnormal epidermal permeability barrier; ii) dry skin with an abnormal permeability barrier due to the use of systemic hypolipidemic drugs; iii) prevent or treat epidermal functional
abnormalities that accompany therapy with immunomodulator treatment; and iii) prevent or treat epidermal functional abnormalities that accompany therapy with glucocorticoid treatment.
BACKGROUND
[0004] One of the main functions of mammalian skin is to serve as a barrier to the systemic uptake of potentially harmful compounds and pathogens. This barrier also serves to conserve water, allowing life in a terrestrial environment. The epidermal permeability barrier resides in the stratum corneum (SC), where hydrophobic lipids are sequestered as multilayered lamellae within the intercellular spaces, which regulate transepidermal water loss, corneocyte cohesion, and percutaneous penetration. Three main lipids form the permeability barrier in the epidermis. These barrier lipids include cholesterol, ceramides and free fatty acids, in an approximately equal molar ratio. [0005] As skin ages, there are negative effects on the dermis (the deeper skin layers) which are evidenced predominantly as cosmetic symptoms, such as wrinkling and sagging. There are also negative effects of aging on the epidermis, particularly on the permeability barrier, where these negative effects favor dermal inflammation and a predilection to infections (as a result of both reduced lipid production and the higher pH of aged skin), resulting in suboptimal permeability and antimicrobial barriers.
[0006] As skin ages, the epidermis becomes thinner with reduced epidermal proliferation, abnormal differentiation, impaired lipid synthesis and an elevated skin surface pH. These alterations have profound consequences for barrier function, skin cohesion, antimicrobial defense, inflammatory thresholds, and cutaneous wound healing. These abnormalities have been linked, in part, to reduced epidermal IL-l a expression, reduced epidermal expression of CD44 and its ligand, hyaluronic acid, and reduced epidermal lipid synthesis, as well as reduced expression of the sodium-hydrogen antiporter, type 1 (NHE1). Among these many changes, much attention has been paid to the epidermal permeability barrier, because of its dominant role in regulating these metabolic responses.
[0007] Further, there tends to be dryness and itching as the epidermal barrier function deteriorates with aging, especially in winter, due to a steeper gradient of transepidermal water loss (TEWL), among other factors. An additional cause of dry skin as the population ages results from the side effects of widely-prescribed, orally-administered hypolipodemic drugs (e.g., statins), which may result in epidermal cholesterol deficiency and a barrier abnormality.
[0008] In view of the aging world population, there continues to be an unmet need for ameliorating the multiple negative effects of skin aging, particularly by restoring and
maintaining the epidermal permeability barrier. Applications include treatments for
chronologically- and photo-aged skin, diabetic skin, dry skin in aged and non-aged skin, 'winter itch,' inflamed skin in aged and non-aged skin, and glucocorticoid (GC)-treated skin. Notably, diabetic and GC -treated skin mimics aged skin, including both abnormally dry skin and impaired permeability barrier function. In addition, millions of individuals world-wide are receiving oral statins or other hypolipidemic drugs for the treatment of hyperlipidemia, including
hyperlipidemia in aged humans. These drugs can aggravate pre-existing skin conditions of the aged, and provoke all of the problems of aged skin in otherwise normal skin. Disclosed herein, inter alia, are solutions to these and other problems in the art. BRIEF SUMMARY OF THE INVENTION
[0009] The present compositions and methods meet these needs. Because epidermal permeability barrier requirements regulate epidermal proliferation, differentiation, lipid production, as well as cutaneous innate immunity, strategies that improve barrier function by enhancing epidermal proliferation, differentiation and/or lipid production, while also reducing stratum corneum (SC) pH should prove useful for preventing and/or treating functional abnormalities, including the impaired permeability barrier homeostasis in aged skin.
[0010] We have now discovered that 1) hesperidin alone or 2) hesperidin combined with A) a triple-lipid barrier mixture that is cholesterol-dominant or with B) cholesterol alone, and formulated at a low pH; can successfully treat dry or inflamed or aged skin, and reverse or prevent the side effects that accompany diabetes or systemic or topical GC treatment, and reverse or prevent the side effects that accompany hypolipodemic drug treatment. In all of these situations, epidermal barrier function is compromised due to decreased differentiation, proliferation, impaired lipid secretion, or an elevated skin surface pH. [0011] One aspect of the invention is directed to a topical composition providing desirable restorative effects on the epidermal permeability barrier in aged skin, as provided herein.
[0012] It has now been discovered that, although the combination of barrier lipids should be cerami de-dominant for diseased skin, with an optimal mole ratio of 1 :3: 1
cholesterol:ceramide:free fatty acids, for aged skin the combination of barrier lipids instead should be cholesterol-dominant, with an optimal mole ratio of 3: 1 : 1 cholesterol:ceramide:free fatty acids.
[0013] Further, it has now been discovered that the pH of the applied composition should be acidic (i.e. pH < 7), within an appropriate pH range that corrects the pH abnormality in aged skin, without causing irritation. [0014] Thus, one aspect of the invention is directed to a topical composition, the composition comprising a) about 1 to about 50 wt% of cholesterol; b) about 0.01 to about 5 wt% of an acidic buffer; and c) about 0.001 to about 50 wt% of hesperidin; where the buffer content is sufficient to maintain the pH of the topical composition at 3 or above, but below 5.5. The lipid weight percent ranges from about 0.01 % to about 5% of the formulation. [0015] Another aspect of the invention is directed to a topical composition, the composition comprising a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide or synthetic ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%; b) about 0.1 to about 10 wt% of a skin conditioner; c) about 0.001 to about 5 wt% of a chelating agent; d) about 1 to about 30 wt% of a humectant; e) about 0.5 to about 20 wt% of an emulsifier; f) one or more emollients in a total of about 1 to about 30 wt%; g) one or more preservatives in a total of about 0.1 to about 10 wt%; h) about 0.01 to about 5 wt% of an acid buffer; i) one or more encapsulation aids in a total of about 1 to about 25 wt%; j) about 0.01 to about 3 wt% of an aqueous phase thickener; and k) between 0.001 to about 50 wt% of hesperidin. In embodiments, the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Synthetic ceramide; PC- 104) and conjugated linoleic acid (CLA) at a 3: 1 : 1 molar ratio. In embodiments, the skin conditioner comprises dimethicone, the chelating agent comprises disodium EDTA, the humectant comprises glycerin, and the acid buffer comprises citric acid. In embodiments, the emulsifier comprises glyceryl stearate PEG- 100. In embodiments, the one or more additional emollients comprise petrolatum and squalane. In embodiments, the one or more preservatives comprise phenoxyethanol and sorbic acid. In embodiments, the one or more encapsulation aids comprise corn syrup solids and euphorbia cerifera (candelilla) wax. In embodiments, the aqueous phase thickener comprises xanthan gum. In a preferred embodiment the pH of the topical composition is > 3 up to 5.5. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1 : 1. In embodiments, the cholesterol is present in about 0.1 to about 10 wt%. In embodiments, the ceramide or mixture of ceramides is present in about 0.1 to about 10 wt%. In embodiments, the free fatty acid or mixture of free fatty acids is present in about 0.01 to about 6 wt%.
[0016] One aspect of the invention is directed to a topical composition, the composition consisting of a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids; b) about 0.1 to about 10 wt% of a skin conditioner; c) about 0.001 to about 5 wt% of a chelating agent; d) about 1 to about 30 wt% of a humectant; e) about 0.5 to about 20 wt% of glyceryl stearate PEG- 100 emulsifier; f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane; g) about 0.1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid; h) about 0.01 to about 5 wt% of citric acid; i) about 1 to about 25 wt% of a mixture of
encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax; j) about 0.01 to about 3 wt% of an aqueous phase thickener; k) about 0.001 to about 50 wt% of hesperidin; and 1) water. [0017] Another aspect of the invention is directed to composition comprising a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%; b) about 0.001 to about 50 wt% of hesperidin; c) about 0.01 to about 5 wt% of an acid buffer; and d) about 0.001 to about 5% of at least one topical glucocorticoid (either separately or as the vehicle for the topical steroid).
[0018] One aspect of the invention is directed to a method of treating or preventing inflammation by administering an effective amount of the above anti-inflammatory composition to at least a portion of affected skin in need thereof. [0019] A further aspect of the invention is directed to a method of treating aged skin, comprising administering one of the topical compositions described above to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
Clinical indication of skin aging can be selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
[0020] Another aspect of the invention is directed to a method of preventing or reversing epidermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with one of the topical compositions described above, in an amount effective to prevent or reverse an epidermal clinical indication of glucocorticoid side effects. Epidermal clinical indications of glucocorticoid side effects can be selected from the group consisting of inflammation (steroid rosacea and/or peri-oral dermatitis), tachyphylaxis, disease flares, and rebound flares.
[0021] Yet another aspect of the invention is directed to a method for the treatment of the dry skin or abnormal epidermal barrier function associated with the administration of oral hypolipodemic agents, particularly statins, comprising one of the topical compositions described above to at least a portion of affected skin of a subject, in an amount effective to relieve or reverse clinical indications of hypolipodemic drug treatment. In embodiments, the subject is taking a hypolipodemic agent, such as simvastatin or pravastatin, or is expected to receive such treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 shows a chart displaying inherited abnormalities in acidifying mechanisms which activate kallikreins (KLKs), comprising multiple ways by which pH functions in inflammatory dermatoses. [0023] FIGS. 2A-2C displays the results of treatment of murine skin with a composition of the invention, as described herein. FIG. 2A displays a chart of changes in basal transepidermal water loss; FIG. 2B displays a chart of the changes in kinetics of barrier recovery rates, and FIG. 2C displays the skin surface pH.
[0024] FIGS. 3A-3C. The ventral (flexor) surface represents chronologically-aged (CA) skin with little photo-aging (PA), while the extensor surface reflects substantial PA, superimposed on CA. The visual results of the topical composition as described herein on both chronologically (CA) and photoaged (PA) skin were striking - signs of both CA and PA, such as xerotic scaling, atrophy (skin thinning) and ecchymoses, largely disappeared in sites treated with the hesperidin- containing, barrier repair formulation. These grossly apparent changes were paralleled by marked improvements in epidermal function, including a striking improvement in stratum corneum hydration (FIG. 3B), as well as moderate benefits for basal barrier function (FIG. 3A; p<0.1). But most striking were the benefits for PA skin, reflected by changes in cutaneous resonance running time (CRRT) (FIG. 3C; p<0.02).
DETAILED DESCRIPTION
[0025] The permeability barrier in aged epidermis has been largely overlooked, because earlier functional studies described few if any abnormalities in aged skin. Yet, the permeation of a variety of molecules is altered across aged epidermis in vivo. Moreover, aged SC displays a global reduction in lipids, with reduced numbers of extracellular bilayers, indicative of lower reserve barrier capacity. Although an aged permeability barrier might function adequately under basal conditions, when acutely challenged, both barrier integrity and the kinetics of barrier recovery are impaired in both aged human and aged murine skin. The pH of skin tends to rise with age, favoring dermal inflammation and a predilection to infections. Further, the barrier abnormality after acute challenges to the epidermis of aged mice is associated with a paucity of lamellar body material at the stratum granulosum-SC interface, and a delay in the return of stainable lipids to the SC interstices. A global deficiency in the synthesis of all 3 physiologic lipids with a further reduction in cholesterologenesis accounts for the barrier abnormality in aged human epidermis. Such reductions in cholesterol biosynthesis begin at about age 50 in the human population.
[0026] Epidermal lipid synthesis is required for formation and maintenance of the epidermal permeability barrier. Synthesis of the three key barrier-related lipids, cholesterol, ceramides and free fatty acids, requires their respective rate-limiting enzymes, HMGCoA, SPT1, ACC, and FAS. Basal mRNA levels for all three key lipid synthetic enzymes were observed to be lower in aged epidermis as compared with young epidermis, consistent with the concept that lower lipid synthesis rates in aged epidermis reflect the reduced expression of their synthetic enzymes.
[0027] Although it was anticipated that topical applications of any one of the barrier lipids to aged skin would assist in the regeneration of the epidermal barrier layer, it has now been discovered that application to aged skin of the individual barrier lipids, rather than a combination of all 3 barrier lipids, actually compromises epidermal permeability barrier function. A combination of all three barrier lipids together, in an optimized ratio, is required to optimally improve barrier function. [0028] This invention is based, at least in part, on the unexpected discovery that a topical composition containing hesperidin in combination with the cholesterol-dominant, triple-lipid mixture, formulated at an acidic pH, regulates and improves aging skin conditions. As mentioned above, the principal processes of skin aging take place both in the upper layers of skin (i.e., the epidermis) and in the dermis. A composition of this invention that regulates and improves the conditions of the epidermis, also improves the dermis by enhancing the nourishment of dermal tissues and other cellular components in the deeper layers of the skin.
I. Definitions
[0029] While various embodiments and aspects of the present invention are shown and described herein, it will be obvious to those skilled in the art that such embodiments and aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention.
[0030] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in the application including, without limitation, patents, patent applications, articles, books, manuals, and treatises are hereby expressly incorporated by reference in their entirety for any purpose.
[0031] Certain compounds of the present invention can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the present invention. Certain compounds of the present invention may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present invention and are intended to be within the scope of the present invention.
[0032] As used herein, the term "salt" refers to acid or base salts of the compounds used in the methods of the present invention. Illustrative examples of acceptable salts are mineral acid (hydrochloric acid, hydrobromic acid, phosphoric acid, and the like) salts, organic acid (acetic acid, propionic acid, glutamic acid, citric acid and the like) salts, quaternary ammonium (methyl iodide, ethyl iodide, and the like) salts.
[0033] An "effective amount" is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, change enzyme activity, increase enzyme activity, reduce protein function, reduce one or more symptoms of a disease or condition). An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a "therapeutically effective amount." A "reduction" of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A "prophylactically effective amount" of a drug or prodrug is an amount of a drug or prodrug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g. , Lieberman,
Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of
Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
[0034] The term "associated" or "associated with" in the context of a substance or substance activity or function associated with a disease (e.g. dry skin, aged skin, or abnormal epidermal barrier function) means that the disease is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function. As used herein, what is described as being associated with a disease (e.g, dry skin, aged skin, or abnormal epidermal barrier function) if a causative agent, could be a target for treatment of the disease.
[0035] "Control" or "control experiment" or "standard control" is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. In some instances, the control is used as a standard of comparison in evaluating experimental effects. [0036] "Contacting" is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including
biomolecules, or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated, however, that the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture. The term "contacting" may include allowing two species to react, interact, or physically touch, wherein the two species may be a compound as described herein and a protein or enzyme. In some embodiments contacting includes allowing a compound described herein to interact with a protein.
[0037] "Patient" or "subject in need thereof or "subject" refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a compound or pharmaceutical composition or by a method, as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals. In some embodiments, a patient is human. In some embodiments, a subject is human. [0038] "Disease" or "condition" refer to a state of being or health status of a patient or subject capable of being treated with a compound, pharmaceutical composition, or method provided herein. In embodiments, the disease is dry skin. In embodiments, the disease is aged skin. In embodiments, the disease is dry skin, aged skin, or abnormal epidermal barrier function.
[0039] "Pharmaceutically acceptable excipient" and "pharmaceutically acceptable carrier" refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the present invention without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethy cellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present invention.
[0040] The term "preparation" is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
[0041] As used herein, the term "administering" means topical contact or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject. The compositions of the present invention can be delivered by transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols. Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions. The compositions of the present invention may additionally include components to provide sustained release and/or comfort. By "co-administer" it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies (e.g. glucocorticoid treatment, immunomodulator treatment, hypolipodemic agent). Co-administer may also include a composition described herein is administered 10 days prior or 10 days after administration of one or more additional therapies
(e.g. glucocorticoid treatment, immunomodulator treatment, hypolipodemic agent. The compositions of the invention can be administered alone or can be co-administered to the patient.
The compositions described herein can also be formulated in combination with one or more additional active ingredients which can include any pharmaceutical agent such immune enhancers, immune suppressants, anti inflammatory agents and the like. Co-administration is meant to include simultaneous or sequential administration of the compound individually or in combination (more than one compound or agent). [0042] Pharmaceutical compositions provided by the present invention include compositions wherein the active ingredient (e.g. compounds described herein, including embodiments or examples) may be contained in a therapeutically effective amount, i.e. , in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, inter alia, on the condition being treated. When administered in methods to treat a disease, such compositions will contain an amount of active ingredient effective to achieve the desired result, e.g., reducing, eliminating, or slowing the progression of disease symptoms. Determination of a therapeutically effective amount of a compound of the invention is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure herein. [0043] The dosage and frequency (single or multiple doses) administered to a mammal can vary depending upon a variety of factors, for example, whether the mammal suffers from another disease, and its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems. Other therapeutic regimens or agents can be used in conjunction with the methods and compounds of Applicants' invention. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art.
[0044] Dosages may be varied depending upon the requirements of the patient and the compound being employed. The dose administered to a patient, in the context of the present invention should be sufficient to affect a beneficial therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.
[0045] Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particular clinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
[0046] Utilizing the teachings provided herein, an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.
[0047] "Analog" and "analogue" are used interchangeably and are used in accordance with their plain ordinary meaning within Chemistry and Biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called "reference" compound (e.g., hesperidin)) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound, including isomers thereof. Accordingly, an analog is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound. In embodiments, an analog has a similar function to the reference compound (e.g., as measured in one or more assays, such as the effect of hesperidin on aged skin). [0048] As used herein, the term "about" means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, about means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to +/- 10% of the specified value. In embodiments, about means the specified value. [0049] As used herein the term "treating" is defined as administration of a composition to a subject with the purpose to cure, alleviate, relieve, remedy, prevent, or ameliorate a disorder, the symptom of the disorder, the disease state secondary to the disorder, or the predisposition toward the disorder. An "effective amount" is an amount of the composition that is capable of producing a medically desirable result, e.g. , as described above, in a treated subject. [0050] When the terms "prevent", "preventing", and "prevention" are used herein in connection with a given treatment for a given condition, they mean that the treated patient either does not develop a clinically observable level of the condition at all, or develops it more slowly and/or to a lesser degree than he/she would have absent the treatment. These terms are not limited solely to a situation in which the patient experiences no aspect of the condition whatsoever. For example, a treatment will be said to have "prevented" the condition if it is given during exposure of a patient to a stimulus that would have been expected to produce a given manifestation of the condition, and results in the patient's experiencing fewer and/or milder symptoms of the condition than otherwise expected. A treatment can "prevent" infection by resulting the patient's displaying only mild overt symptoms of the infection; it does not imply that there must have been no penetration of any cell by the infecting microorganism. The treated patient either does not develop a clinically observable level of the condition at all, or develops it more slowly and/or to a lesser degree than a non-treated patient exposed to same condition- inducing stimulus as the treated patient, where the susceptibility of the non-treated patient to the condition is the same as the treated patient's susceptibility prior to treatment.
[0051] As used herein, "identifying" a subject in need of such treatment can be in the judgment of a subj ect or a health care professional and can be subjective (e.g. opinion) or objective (e.g. measurable by a test or diagnostic method).
[0052] The term "cholesterol" refers to (3P)-choles-5-en-3-ol, or any salt form or isomer thereof.
[0053] The term "hesperidin" refers to the compound (2<S)-5-hydroxy-2-(3-hydroxy-4- methoxypheiiyl)-7-[(2S,3R,4S^
methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2,3-dihydrochromen-4-one, or any salt, isomer, or salt thereof. In embodiments, hesperidin has the structure:
Figure imgf000014_0001
Formula (I). Hesperidin may be referred to as a flavanone glycoside including the flavone hesperetin bound to the disaccharide rutinose, and may be found in citrus fruits and other natural sources. Its name is derived from "hesperidium", for fruit produced by citrus trees, and the compound is found in oranges, lemons, limes and pummelo fruits, among others. Peppermint leaves also contain hesperidin. The aglycone form may be referred to as hesperetin; thus an alternative name for hesperidin is hesperetin 7-rutinoside. A hesperidin analog is a compound functionally similar to hesperidin. In embodiments, the hesperidin analog is chemically similar to hesperidin but differing in one or more atoms, wherein the analog includes one or more functions or effects of hesperidin on aged skin.
[0054] The term "dry skin" is used in accordance with its plain ordinary meaning and refers to skin wherein there is a reduced amount of water in the epidermis. For example, dry skin may be associated with greater levels of transepidermal water loss (TEWL). Additionally, dry skin may have reduced levels of at least one of cholesterol, ceramides, glycerol, filaggrin, and natural moisturizing molecules (e.g., urocanic acid). Dry skin may result from use of systemic hypolipidemic drugs (e.g., statins), glucocorticoid treatment, or immunomodulator treatment. Symptoms associated with dry skin include the visible peeling of the outer skin layer, itching, and skin cracking. [0055] The term "abnormal epidermal barrier function" is used in accordance with its plain ordinary meaning and refers to aberrant function in the epidermis (e.g., due to decreased differentiation, proliferation, impaired lipid secretion, or an elevated skin surface pH (e.g., pH > 5.5) relative to a healthy control (e.g., population average, skin at another location on the same subj ect as the aged skin)). Abnormal epidermal barrier function may be associated with the use of systemic hypolipidemic drugs (e.g., statins), glucocorticoid treatment, or immunomodulator treatment. Abnormal epidermal barrier function may result in visible or tactile wrinkles or discontinuities in skin associated with skin aging, e.g., visible and/or tactile scaling, wrinkles or discontinuities in skin texture or color.
[0056] The term "aged skin" is used in accordance with its plain ordinary meaning and refers to chronologically- and/or photo- aged skin, typically characterized by abnormal epidermal barrier function or a flawed permeability barrier (e.g., characterized by a thinner epidermis with reduced epidermal proliferation, abnormal differentiation, impaired lipid synthesis and/or an elevated skin surface pH). Aged skin (e.g., chronologically- or photo-) may display abnormal epidermal barrier function resulting in impaired barrier function, reduced antimicrobial defense, and/or reduced cutaneous wound healing. Aged skin (e.g., chronologically- or photo-), may display abnormal epidermal barrier function such as reduced stratum comeum hydration, reduced stratum comeum cohesion, increased abnormal desquamation, increased skin scaling, increased occurrence of skin infections, increased susceptibility to skin infections, increased susceptibility of inflammatory dermatoses, and increased occurrence of inflammatory dermatoses (e.g., increased relative to normal, average, or healthy skin of a control (e.g., population average, skin at another location on the same subject as the aged skin)). Clinical indications of aged skin may include eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
[0057] The term "photo-aged skin" is used in accordance with its plain ordinary meaning and refers to skin displaying abnormal epidermal barrier function as a result of chronic exposure to ultraviolet radiation (e.g., 300-400 nm). [0058] The term "barrier lipids" is used in accordance with its plain ordinary meaning and refers to epidermal lipids of both sebaceous and keratinocyte origin. Non-limiting examples include non-polar lipids, mainly triglycerides, wax esters, squalane, fatty acids, free fatty acids, ceramides cholesterol, cholesterol esters and diglycerides. In embodiments, barrier lipids are ceramides, cholesterol, and/or free fatty acids. [0059] The term "ceramide" is used in accordance with its plain ordinary meaning and refers to sphingosine (e.g. , 2-amino-4-octadecene-l,3-diol) and a fatty acid. In embodiments, the ceramide is a pseudoceramide (i.e., synthetic) as described in Uchida, et al (Journal of
Dermatological Science, Volume 51, 37-43) hereby expressly incorporated by reference in its entirety for any purpose. Non-limiting examples of a ceramide include myristoyl/palmitoyl oxostearamide/arachamide MEA, myristoyl/palmitoyl oxostearamide/arachamide, N-(Ethyl dihydrogenphosphate)-2-hexyl-3-oxo-decanamide, N-Ethanol-2-mirystyl-3-oxo-staramide, ceramide PC-102 (Hydroxypropyl Bislauramide MEA), ceramide PC-104 (Hydroxypropyl Bispalmitamide MEA), and ceramide PC- 108 (Hydroxypropyl Bisstearamide MEA). In embodiments, the ceramide is a synthetic ceramide. In embodiments, the ceramide is N-(3- hexadecyloxy-2-hydroxypropyl)-N-2-hydroxyethylhexadecanamide (PC-104) or N-(2- hydroxyethyl)-2-pentadecanolylhexadecanamide (Bio391). In embodiments, the ceramide is myristoyl/palmitoyl oxostearamide/arachamide MEA.
[0060] The term "fatty acid" or "free fatty acid is used in accordance with its plain ordinary meaning and refers to a carboxylic acid with a long (e.g., C4-C30) aliphatic chain, which may be saturated or unsaturated, including all positional and geometrical isomers. For example, a fatty acid may be lauric acid, palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidonic acid, or conjugated linoleic acid. [0061] The term "skin conditioner" is used in accordance with its plain ordinary meaning and refers to a an agent that attracts or retains moisture in the skin (e.g„ a silicon-based polymer). Non-limiting examples of a skin conditioner include polydimethylsiloxane (i.e. dimethicone) and dimethicone copolyol. [0062] The term "chelating agent" is used in accordance with its plain ordinary meaning and refers to chemical compounds that coordinate with metal atoms. Typically a chelating agent forms two or more separate coordinate bonds between a poly dentate ligand and a single central atom (e.g., a metal atom). Non-limiting examples of a chelating agent include disodium ethylenediaminetetraacetic acid (EDTA), tetrasodium EDTA and tetrahydroxypropyl ethylenediamine.
[0063] The term "humectant" is used in accordance with its plain ordinary meaning and refers to a hygroscopic agent which promotes retention of moisture. Non-limiting examples of a humectant include glycerin, urea, aloe vera, honey, and sorbitol, xylitol, maltitol.
[0064] The term "emulsifier" is used in accordance with its plain ordinary meaning and refers to an agent that stabilizes a mixture of two or more compounds that are typically immiscible. Non-limiting examples of an emulsifier includes emulsifying wax, cetearyl alcohol, polysorbate 20, ceteareth 20, glycerl stearate PEG-100 and modified food starches (e.g., com syrup solids).
[0065] The term "emollient" is used in accordance with its plain ordinary meaning and refers to compounds which increase the water content of the epidermis by reducing evaporation. Non- limiting examples include squalane and petrolatum.
[0066] The term "preservative" is used in accordance with its plain ordinary meaning and refers to agents intended to prevent microbial growth and spoiling of a composition described herein. Non-limiting examples of preservatives include sorbic acid, sodium sorbate, potassium sorbate, calcium sorbate, and glycol ethers (e.g., dimethoxyethane, phenoxyethanol, or 2- butoxy ethyl acetate).
[0067] The term "acid buffer" is used in accordance with its plain ordinary meaning and refers to a weak acid and its conjugate base used to control the pH (e.g., wherein the pH is less than 7). Non-limiting examples include citric acid.
[0068] The term "encapsulation aids" is used in accordance with its plain ordinary meaning and refers to agents used control the release of the active substance. Non-limiting examples include modified food starch (e.g., corn syrup solids), aliginate, and euphorbia cerifera
(candelilla) wax.
[0069] The term "aqueous phase thickener" is used in accordance with its plain ordinary meaning and refers to a rheology modifier (e.g., an agent capable of modulating (e.g., increasing) the viscosity of a liquid without substantially changing other properties of the liquid).
[0070] The term "glucocorticoid" is used in accordance with its plain ordinary meaning and refers to a corticosteroid (e.g., that binds to the glucocorticoid receptor). Non-limiting examples of a glucocorticoid include clobetasol propionate, betamethasone dipropionate, halobetasol propionate, diflorasone diacetate, fluocinonide, halcinonide, amcinonide, desoximetasone, triamcinolone acetonide, mometasone furoate, fluticasone propionate, halometasone, fluocinolone acetonide, hydrocortisone valerate, hydrocortisone butyrate, flurandrenolide, triamcinolone acetonide, mometasone furoate, fluticasone propionate, desonide, fluocinolone acetonide, hydrocortisone valerate, alclometasone dipropionate, Triamcinolone acetonide, fluocinolone acetonide, desonide, and hydrocortisone. [0071] Examples of skin conditioner, chelating agent, emollient, humectant, emulsifier, preservative, acid buffer, encapsulation aids, aqueous phase thickener are described in Harry's Cosmeticology, 7th Ed., Harry & Wilkinson (Hill Publishers, London 1982); in Pharmaceutical Dosage Forms— Disperse Systems; Lieberman, Rieger & Banker, Vols. 1 (1988) & 2 (1989); Marcel Decker, Inc. ; in The Chemistry and Manufacture of Cosmetics, 2nd. Ed., deNavarre (Van Nostrand 1962-1965); and in The Handbook of Cosmetic Science and Technology, 1st Ed. Knowlton & Pearce (Elsevier 1993) can also be used in the present invention.
[0072] The term "glyceryl stearate PEG-100" refers to a water soluble ester with and an average of number of ethylene oxide monomers in the polyethylene chain around 100. For example, glyceryl stearate PEG-100 is an off-white, solid ester of polyethylene glycol (a binder and a softener) and stearic acid.
[0073] The term "glucocorticoid side effects" is used in accordance with its plain ordinary meaning and refers to inflammation (e.g., steroid rosacea and/or peri-oral dermatitis), tachyphylaxis, disease flares, or rebound flares caused by glucocorticoid treatment, or other unintended effects of using glucocorticoids. [0074] The term "citrus bioflavonoid" is used in accordance with its plain ordinary meaning and refers to compounds present in citrus fruits (e.g., lemons, limes, oranges, grapefruits, and tangerines). Citrus bioflavonoids may be bioflavonoids present in citrus plants (e.g., citrus fruit, leaves, roots, etc.). Citrus bioflavonoids include citrus flavanones, which may optionally be glycosylated (e.g., by a disaccharide) to a citrus flavanone glycoside, which is also included in citrus bioflavonoids (e.g., hesperidin). Examples of citrus bioflavonoids include apigenin, hesperidin, hesperitin, naringenin, naringin, narirutin, nobiletin, tangeretin, and tangeritin. Citrus bioflavonoids include hesperidin. Citrus bioflavonoids include hesperitin. Citrus bioflavonoids may include eriodictyol, homoeriodictyol, and luteolin, . Citrus bioflavonoids include citrus flavones, citrus flavonol, citrus flavanones, citrus flavanonols, citrus flavans, and citrus flavanols. [0075] The term "immunomodulator" is used in accordance with its plain ordinary meaning and refers to compounds that modulate the immune system. Examples of immunomodulators include pimecrolimus and/or tacrolimus. In embodiments, the immunomodulator is a topical calcineurin inhibitor (e.g., pimecrolimus and/or tacrolimus). Examples of additional topical calcineurin inhibitors can be found in Breuer et al. (Am. J. Clin. Dermatol. 2005; 6(2): 65-77) and is incorporated herein in its entirety.
II. Compositions
[0076] In an aspect is provided a topical composition, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments is provided a topical composition, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof. In embodiments is provided a topical composition, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin. In embodiments, the composition is capable of treating aged skin.
[0077] In an aspect is provided a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments is provided a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof. In embodiments is provided a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin.
[0078] In an aspect is provided a topical composition for treating aged skin, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments is provided a topical composition for treating aged skin, the composition including a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof. In embodiments, the topical composition includes a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof and hesperidin. [0079] In embodiments, the topical composition further comprises a skin conditioner. In embodiments, the topical composition further comprises a chelating agent. In embodiments, the topical composition further comprises a humectant. In embodiments, the topical composition further comprises an emulsifier. In embodiments, the topical composition further comprises one or more emollients. In embodiments, the topical composition further comprises one or more preservatives. In embodiments, the topical composition further comprises an acid buffer. In embodiments, the topical composition further comprises one or more encapsulation aids. In embodiments, the topical composition further comprises an aqueous phase thickener. In embodiments, the tropical composition is capable of treating aged skin (e.g., a symptom of aged skin, photo-aged skin, chronologically-aged skin). [0080] One aspect of the invention is directed to a composition, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at about 3 to about 5.5. One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition from about 3 to about 5.5. In embodiments, the citrus bioflavonoid is hesperidin.
[0081] One aspect of the invention is directed to a composition, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at about 3 to about 5.5. One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) about 0.1 to about 50 wt% of cholesterol, preferably about 1 to about 20 wt%, more preferably about 2 to about 5 wt%; b) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and c) about 0.001 to about 50 wt% of hesperidin, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at about 3 to about 5.5.
[0082] One aspect of the invention is directed to a composition, the composition including a)
0.1 to 50 wt% of cholesterol, preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to
50 wt% of hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5. One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) 0.1 to 50 wt% of cholesterol, preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to 50 wt% of a citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5. In embodiments, the citrus bioflavonoid is hesperidin.
[0083] One aspect of the invention is directed to a composition, the composition including a) 0.1 to 50 wt% of cholesterol, preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to 50 wt% of hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5. One aspect of the invention is directed to a topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, the composition including a) 0.1 to 50 wt% of cholesterol, preferably 1 to 20 wt%, more preferably 2 to 5 wt%; b) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and c) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; where the buffer content is sufficient to maintain the pH of the topical composition at 3 to 5.5.
[0084] In embodiments, the cholesterol is present in about 0.1 to about 50 wt%. In embodiments, the cholesterol is present in about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2,
1.3, 1.4, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 wt%. In embodiments, the cholesterol is present in 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%. In embodiments, the cholesterol is present in about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3,
1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %. In embodiments, the cholesterol is present in 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %. In embodiments, the cholesterol is present in about 1.0 wt %. In embodiments, the cholesterol is present in about 0.5 to about 1.5 wt%. In embodiments, the cholesterol is present in about 0.8 to about 1.2 wt%. In embodiments, the cholesterol is present in about 0.9 to about 1.1 wt%. In embodiments, the cholesterol is present in 1.0 wt %. In embodiments, the cholesterol is present in 0.5 to 1.5 wt%. In embodiments, the cholesterol is present in 0.8 to 1.2 wt%. In embodiments, the cholesterol is present in 0.9 to 1.1 wt%.
[0085] In embodiments, the acid buffer is present in about 0.1 to about 50 wt%. In
embodiments, the acid buffer is present in about 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 wt%. In embodiments, the acid buffer is present in about 0.5 wt %. In embodiments, the acid buffer is present in about 0.1 to about 5 wt%. In embodiments, the acid buffer is present in about 0.1 to about 3 wt%. In embodiments, the acid buffer is present in about 0.1 to about 2 wt%. In embodiments, the acid buffer is present in about 0.1 to about 1.2 wt%. In embodiments, the acid buffer is present in about 0.4 to about 1.0 wt%.
[0086] In embodiments, the acid buffer is present in 0.1 to 50 wt%. In embodiments, the acid buffer is present in 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74,
0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%. In embodiments, the acid buffer is present in 0.5 wt %. In embodiments, the acid buffer is present in 0.1 to 5 wt%. In embodiments, the acid buffer is present in 0.1 to 3 wt%. In embodiments, the acid buffer is present in 0.1 to 2 wt%. In embodiments, the acid buffer is present in 0.1 to 1.2 wt%. In embodiments, the acid buffer is present in 0.4 to 1.0 wt%.
[0087] In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) is present in about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or about 50 wt%. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 wt%. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 0.5 to about 3.0 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.0 to about 2.8 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.5 to about 2.2 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.8 to about 2.1 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 1.9 to about 2.1 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 0.5 to 3.0 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) is present in 1.0 to 2.8 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 1.5 to 2.2 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 1.8 to 2.1 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 1.9 to 2.1 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 2.0 wt %. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 2.0 wt%.
[0088] In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 5 wt%. In embodiments citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 10 wt%. In
embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 35 wt%. In
embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 5 wt%. In embodiments citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 10 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 35 wt%. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments, the citrus bioflavonoid is hesperidin.
[0089] In embodiments, the hesperidin is present in about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or about 50 wt%. In embodiments, the hesperidin is present in 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 wt%. In embodiments, the hesperidin is present in about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %. In embodiments, the hesperidin is present in 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %. In embodiments, the hesperidin is present in about 0.5 to about 3.0 wt %. In embodiments, the hesperidin is present in about 1.0 to about 2.8 wt %. In embodiments, the hesperidin is present in about 1.5 to about 2.2 wt %. In
embodiments, the hesperidin is present in about 1.8 to about 2.1 wt %. In embodiments, the hesperidin is present in about 1.9 to about 2.1 wt %. In embodiments, the hesperidin is present in 0.5 to 3.0 wt %. In embodiments, the hesperidin is present in 1.0 to 2.8 wt %. In
embodiments, the hesperidin is present in 1.5 to 2.2 wt %. In embodiments, the hesperidin is present in 1.8 to 2.1 wt %. In embodiments, the hesperidin is present in 1.9 to 2.1 wt %. In embodiments, the hesperidin is present in about 2.0 wt %. In embodiments, the hesperidin is present in 2.0 wt%.
[0090] In embodiments, hesperidin is present in about 5 wt%. In embodiments hesperidin is present in about 10 wt%. In embodiments, hesperidin is present in about 15 wt%. In embodiments, hesperidin is present in about 20 wt%. In embodiments, hesperidin is present in about 25 wt%. In embodiments, hesperidin is present in about 30 wt%. In embodiments, hesperidin is present in about 35 wt%. In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin. [0091] In embodiments, the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, and an aqueous phase thickener. In
embodiments, the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, or an aqueous phase thickener.
[0092] Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to about 20 wt% of an emulsifier, preferably about 0.5 to about 10 wt%, more preferably about 1 to about 5 wt%; f) one or more emollients in a total of about 1 to about 30 wt%, preferably about 2 to about 20 wt%, more preferably about 4 to about 10 wt%; g) one or more preservatives in a total of about 0.1 to about 10 wt%, preferably about 0.5 to about 5 wt%, more preferably about 0.8 to about 1.5 wt%; h) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; i) one or more encapsulation aids in a total of about 1 to about 25 wt%, preferably about 5 to about 15 wt%, more preferably about 8 to about 10 wt%; j) about 0.01 to about 3 wt% of an aqueous phase thickener, preferably about 0.1 to about 2 wt%, more preferably about 0.2 to about 1 wt%; and k) about 0.001 to about 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%. In embodiments, the citrus bioflavonoid is hesperidin. [0093] Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%. In embodiments, the citrus bioflavonoid is hesperidin.
[0094] In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 5 wt%. In embodiments citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 10 wt%. In
embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in about 35 wt%.
[0095] In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 5 wt%. In embodiments citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 10 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 35 wt%. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). [0096] In embodiments, the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to about 20 wt% of an emulsifier, preferably about 0.5 to about 10 wt%, more preferably about 1 to about 5 wt%; f) one or more emollients in a total of about 1 to about 30 wt%, preferably about 2 to about 20 wt%, more preferably about 4 to about 10 wt%; g) one or more preservatives in a total of about 0.1 to about 10 wt%, preferably about 0.5 to about 5 wt%, more preferably about 0.8 to about 1.5 wt%; h) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; i) one or more encapsulation aids in a total of about 1 to about 25 wt%, preferably about 5 to about 15 wt%, more preferably about 8 to about 10 wt%; j) about 0.01 to about 3 wt% of an aqueous phase thickener, preferably about 0.1 to about 2 wt%, more preferably about 0.2 to about 1 wt%; and k) about 0.001 to about 50 wt% hesperidin, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%.
[0097] In embodiments, the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%. [0098] In embodiments, the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%. [0099] In embodiments, hesperidin is present in about 2 wt%. In embodiments, hesperidin is present in about 5 wt%. In embodiments hesperidin is present in about 10 wt%. In
embodiments, hesperidin is present in about 15 wt%. In embodiments, hesperidin is present in about 20 wt%. In embodiments, hesperidin is present in about 25 wt%. In embodiments, hesperidin is present in about 30 wt%. In embodiments, hesperidin is present in about 35 wt%. In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
[0100] Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably about 1 to about 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%. In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments, hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%.
[0101] In embodiments, the mixture of barrier lipids is present in about 2 to about 10 total wt%. In embodiments, the mixture of barrier lipids is present in about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26,
2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4A4, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10 total wt%. In embodiments, the mixture of barrier lipids is present in about 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0, 30.0, 31.0, 32.0, 33.0, 34.0, 35.0, 36.0, 37.0, 38.0, 39.0, 40.0, 41.0, 42.0, 43.0, 44.0, 45.0, 46.0, 47.0, 48.0, 49.0, or about 50.0 wt%. In embodiments, the mixture of barrier lipids is present in about 0.5 to about 10 total wt%. In embodiments, the mixture of barrier lipids is present in about 0.5 to about 5 total wt%. In embodiments, the mixture of barrier lipids is present in about 1 to about 5 total wt%. In embodiments, the mixture of barrier lipids is present in about 2 to about 5 total wt%.
[0102] In embodiments, the mixture of barrier lipids is present in about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0 wt %. In embodiments, the mixture of barrier lipids is present in about 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65, 2.7, 2.75, 2.8, 2.85, 2.9, 2.95, 3.0, 3.05, 3.1, 3.15, 3.2, 3.25, 3.3, 3.35, 3.4, 3.45, 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05, 4.1, 4.15, 4.2, 4.25, 4.3, 4.35, 4.4, 4.45, 4.5, 4.55, 4.6, 4.65, 4.7, 4.75, 4.8, 4.85, 4.9, 4.95, or about 5.0 wt %.
[0103] In embodiments, the skin conditioner is present in about 0.1 to about 10 wt%. In embodiments, the skin conditioner is present in about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06,
1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23,
1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57,
1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74,
1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91,
1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59,
2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93,
2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %. In embodiments, the skin conditioner is present in about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or about 10.0 wt%. In embodiments, the skin conditioner is present in about 0.5 to about 8 wt%. In embodiments, the skin conditioner is present in about 0.5 to about 5 wt%. In embodiments, the skin conditioner is present in about 0.5 to about 3 wt%. In embodiments, the skin conditioner is present in about 0.5 to about 2 wt%.
[0104] In embodiments, the chelating agent is present in about 0.0001 to about 5.0 wt%. In embodiments, the chelating agent is present in about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0 wt %. In embodiments, the chelating agent is present in about 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65,
2.7, 2.75, 2.8, 2.85, 2.9, 2.95, 3.0, 3.05, 3.1, 3.15, 3.2, 3.25, 3.3, 3.35, 3.4, 3.45, 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05, 4.1, 4.15, 4.2, 4.25, 4.3, 4.35, 4.4, 4.45, 4.5, 4.55, 4.6, 4.65, 4.7, 4.75, 4.8, 4.85, 4.9, 4.95, or about 5.0 wt %. In embodiments, the chelating agent is present in about 0.01 to about 5.0 wt%. In embodiments, the chelating agent is present in about 0.05 to about 3.0 wt%. In embodiments, the chelating agent is present in about 0.05 to about 2.0 wt%. In embodiments, the chelating agent is present in about 0.05 to about 1.0 wt%. In embodiments, the chelating agent is present in about 0.05 to about 0.25 wt%. [0105] In embodiments, the humectant is present in about 1 to about 30 wt%. In embodiments, the humectant is present in about 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or about 30.0 wt %. In embodiments, the humectant is present in about 5 to about 15 wt%. In embodiments, the humectant is present in about 8 to about 13 wt%. In embodiments, the humectant is present in about 9 to about 11 wt%.
[0106] In embodiments, the emulsifier is present in about 0.5 to about 20 wt%. In
embodiments, the emulsifier is present in about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95,
2.96, 2.97, 2.98, 2.99, or about 3.0 wt %. In embodiments, the emulsifier is present in about 0.5,
I.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0,
I I.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, or about 20.0 wt %. In embodiments, the emulsifier is present in about 0.5 to about 10 wt%. In embodiments, the emulsifier is present in about 0.5 to about 5 wt%. In embodiments, the emulsifier is present in about 0.5 to about 2 wt%.
[0107] In embodiments, one or more emollients is present in about 1 to about 30 total wt%. In embodiments, one or more emollients is present in about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or about 30.0 wt%. In embodiments, one or more emollients is present in about 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07,
2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24,
2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41,
2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, or about 2.5 total wt %. In embodiments, one or more emollients is present in about 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05,
4.1, 4.15, 4.2, 4.25, 4.3, 4.35, 4.4, 4.45, 4.5, 4.55, 4.6, 4.65, 4.7, 4.75, 4.8, 4.85, 4.9, 4.95, or about 5.0 total wt %. In embodiments, one or more emollients is present in about 1 to about 10 wt%. In embodiments, one or more emollients is present in about 1 to about 5 wt%. In embodiments, one or more emollients is present in about 1 to about 3 wt%.
[0108] In embodiments, one or more preservatives is present in about 0.1 to about 10 total wt%. In embodiments, one or more preservatives is present in about 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01,
1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35,
1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or about 1.5 wt%. In embodiments, one or more preservatives is present in about 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0. In embodiments, one or more preservatives is present in about 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or about 10.0 total wt%. In embodiments, one or more preservatives is present in about 0.1 to about 3 wt%. In
embodiments, one or more preservatives is present in about 0.1 to about 2 wt%. In
embodiments, one or more preservatives is present in about 0.1 to about 1.0 wt%. [0109] In embodiments, one or more encapsulation aids is present in about 1 to about 25 total wt%. In embodiments, one or more encapsulation aids is present in about 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10.0 total wt%. In embodiments, one or more encapsulation aids is present in about 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, or about 7.5 wt%. In embodiments, one or more encapsulation aids is present in about 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0 wt %. In embodiments, one or more encapsulation aids is present in about 1 to about 15 total wt%. In embodiments, one or more encapsulation aids is present in about 1 to about 10 total wt%. In embodiments, one or more encapsulation aids is present in about 2 to about 9 total wt%.
[0110] In embodiments, aqueous phase thickener is present in about 0.01 to about 3 wt%. In embodiments, aqueous phase thickener is present in about 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or about 2.0 wt%. In embodiments, aqueous phase thickener is present in about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, to about 0.75 wt %. In embodiments, aqueous phase thickener is present in about
0.05 to about 3 wt%. In embodiments, aqueous phase thickener is present in about 0.10 to about 2 wt%. In embodiments, aqueous phase thickener is present in about 0.5 to about 1.0 wt%.
[0111] In embodiments, the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA). In embodiments, the mixture of barrier lipids consists of cholesterol, myristoyl/palmitoyl
oxostearamide/arachamide MEA and conjugated linoleic acid (CLA). In embodiments, the mixture of barrier lipids consists of cholesterol, myristoyl/palmitoyl oxostearamide/arachamide and conjugated linoleic acid (CLA). In embodiments, the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA) present in a 3: 1 : 1 molar ratio. In embodiments, the mixture of barrier lipids consists of cholesterol myristoyl/palmitoyl oxostearamide/arachamide MEA and conjugated linoleic acid (CLA) present in a 3: 1 : 1 molar ratio. In embodiments, the mixture of barrier lipids is cholesterol- dominant. In embodiments, the skin conditioner comprises dimethicone, the chelating agent comprises disodium EDTA, the humectant comprises glycerin, and the acid buffer comprises citric acid. In embodiments, the emulsifier comprises glyceryl stearate PEG- 100. In embodiments, the one or more emollients comprise petrolatum and squalane. In embodiments, the one or more preservatives comprise phenoxyethanol and sorbic acid. In embodiments, the one or more encapsulation aids comprise corn syrup solids and euphorbia cerifera (candelilla) wax. In embodiments, the aqueous phase thickener comprises xanthan gum.
[0112] In embodiments, the mixture of barrier lipids includes cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA). In embodiments, the mixture of barrier lipids includes cholesterol, myristoyl/palmitoyl oxostearamide/arachamide MEA, and conjugated linoleic acid (CLA). In embodiments, the mixture of barrier lipids includes cholesterol, myristoyl/palmitoyl oxostearamide/arachamide, and conjugated linoleic acid (CLA). In embodiments, the mixture of barrier lipids includes cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA) present in a 3: 1 : 1 molar ratio. In embodiments, the mixture of barrier lipids is cholesterol-dominant. In embodiments, the skin conditioner is dimethicone, the chelating agent is disodium EDTA, the humectant is glycerin, and the acid buffer is citric acid. In embodiments, the emulsifier is glyceryl stearate PEG-100. In embodiments, the one or more emollients is petrolatum and squalane. In embodiments, the one or more preservatives is phenoxyethanol and sorbic acid. In embodiments, the one or more encapsulation aids is corn syrup solids and euphorbia cerifera (candelilla) wax. In embodiments, the aqueous phase thickener is xanthan gum.
[0113] In embodiments, the mixture of barrier lipids is as described herein (e.g., the mixture of barrier lipids as described herein, including in examples). In embodiments, the skin conditioner is as described herein (e.g., the skin conditioner as described herein, including in examples), the chelating agent is as described herein (e.g., the chelating agent as described herein, including in examples), the humectant is as described herein (e.g., the humectant as described herein, including in examples), and the acid buffer is as described herein (e.g., the acid buffer as described herein, including in examples). In embodiments, the emulsifier is as described herein (e.g., the emulsifier as described herein, including in examples). In embodiments, the one or more emollients is as described herein (e.g., the emollients as described herein, including in examples). In embodiments, the one or more preservatives is as described herein (e.g., the preservatives as described herein, including in examples). In embodiments, the one or more encapsulation aids is as described herein (e.g., the encapsulation aids as described herein, including in examples). In embodiments, the aqueous phase thickener is as described herein (e.g., the aqueous phase thickener as described herein, including in examples).
[0114] In a preferred embodiment the pH of the topical composition is from about 3 to about 5.5. In embodiments the pH of the topical composition is about 3. In embodiments the pH of the topical composition is about 3.2. In embodiments the pH of the topical composition is about 3.4. In embodiments the pH of the topical composition is about 3.6. In embodiments the pH of the topical composition is about 3.8. In embodiments the pH of the topical composition is about 4. In embodiments the pH of the topical composition is about 4.2. In embodiments the pH of the topical composition is about 4.4. In embodiments the pH of the topical composition is about 4.6. In embodiments the pH of the topical composition is about 4.8. In embodiments the pH of the topical composition is about 5. In embodiments the pH of the topical composition is about 5.2. In embodiments the pH of the topical composition is about 5.5. In a preferred embodiment the pH of the topical composition is about 3.1 to about 5.0. In a preferred embodiment the pH of the topical composition is about 3.2 to about 4.5. In a preferred embodiment the pH of the topical composition is about 3 to about 4.
[0115] In a preferred embodiment the pH of the topical composition is 3 to 5.5. In
embodiments the pH of the topical composition is 3. In embodiments the pH of the topical composition is 3.2. In embodiments the pH of the topical composition is 3.4. In embodiments the pH of the topical composition is 3.6. In embodiments the pH of the topical composition is 3.8. In embodiments the pH of the topical composition is 4. In embodiments the pH of the topical composition is 4.2. In embodiments the pH of the topical composition is 4.4. In embodiments the pH of the topical composition is 4.6. In embodiments the pH of the topical composition is 4.8. In embodiments the pH of the topical composition is 5. In embodiments the pH of the topical composition is 5.2. In embodiments the pH of the topical composition is 5.5. In a preferred embodiment the pH of the topical composition is 3.1 to 5.0. In a preferred embodiment the pH of the topical composition is 3.2 to 4.5. In a preferred embodiment the pH of the topical composition is 3 to 4.
[0116] In embodiments, the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, and an aqueous phase thickener. In
embodiments, the topical composition further comprises a skin conditioner, a chelating agent, a humectant, an emulsifier, one or more emollients, one or more preservatives, an acid buffer, one or more encapsulation aids, or an aqueous phase thickener.
[0117] Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%. In embodiments, the citrus bioflavonoid is hesperidin.
[0118] In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 5 wt%. In embodiments citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 10 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 35 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 5 wt%. In embodiments citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 10 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 35 wt%. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). [0119] Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%. In embodiments, the citrus bioflavonoid is hesperidin.
[0120] In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 5 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 10 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 35 wt%.
[0121] Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of hesperidin or an analog,
pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%.
[0122] In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 20 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In
embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 35 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog,
pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In
embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In embodiments, hesperidin or an analog,
pharmaceutically acceptable salt, or prodrug thereof is present in 35 wt%. In embodiments, the hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
[0123] Another aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%. [0124] In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
[0125] An aspect of the invention is directed to a topical composition for treating aged skin, the composition including a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%. In embodiments, the citrus bioflavonoid is hesperidin.
[0126] In embodiments, the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%. [0127] In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 20 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In
embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 35 wt%.
[0128] In embodiments, the composition includes a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0.1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of an emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) one or more emollients in a total of 1 to 30 wt%, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) one or more preservatives in a total of 0.1 to 10 wt%, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) one or more encapsulation aids in a total of 1 to 25 wt%, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0.1 to 2 wt%, more preferably 0.2 to 1 wt%; and k) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%.
[0129] In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments, hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%.
[0130] In embodiments, the mixture of barrier lipids is present in 2 to 10 total wt%. In embodiments, the mixture of barrier lipids is present in 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52,
9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88,
9.9, 9.92, 9.94, 9.96, 9.98, or 10 total wt%. In embodiments, the mixture of barrier lipids is present in 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0, 30.0, 31.0, 32.0, 33.0, 34.0, 35.0, 36.0, 37.0, 38.0, 39.0, 40.0, 41.0, 42.0, 43.0, 44.0, 45.0, 46.0, 47.0, 48.0, 49.0, or 50.0 wt%. In embodiments, the mixture of barrier lipids is present in 0.5 to 10 total wt%. In embodiments, the mixture of barrier lipids is present in 0.5 to 5 total wt%. In embodiments, the mixture of barrier lipids is present in 1 to 5 total wt%. In embodiments, the mixture of barrier lipids is present in 2 to 5 total wt%.
[0131] In embodiments, the mixture of barrier lipids is present in 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 wt %. In embodiments, the mixture of barrier lipids is present in 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65,
1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65, 2.7, 2.75, 2.8, 2.85, 2.9, 2.95, 3.0, 3.05, 3.1, 3.15, 3.2, 3.25, 3.3, 3.35, 3.4, 3.45, 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05, 4.1, 4.15, 4.2, 4.25, 4.3, 4.35, 4.4, 4.45, 4.5, 4.55, 4.6, 4.65, 4.7, 4.75, 4.8, 4.85, 4.9, 4.95, or 5.0 wt %. [0132] In embodiments, the skin conditioner is present in 0.1 to 10 wt%. In embodiments, the skin conditioner is present in 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79,
1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64,
2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81,
2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98,
2.99, or 3.0 wt %. In embodiments, the skin conditioner is present in 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 wt%. In embodiments, the skin conditioner is present in 0.5 to 8 wt%. In embodiments, the skin conditioner is present in 0.5 to 5 wt%. In embodiments, the skin conditioner is present in 0.5 to 3 wt%. In embodiments, the skin conditioner is present in 0.5 to 2 wt%. [0133] In embodiments, the chelating agent is present in 0.0001 to 5.0 wt%. In embodiments, the chelating agent is present in 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 wt %. In embodiments, the chelating agent is present in 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, 1.8, 1.85, 1.9, 1.95, 2.0, 2.05, 2.1, 2.15, 2.2, 2.25, 2.3, 2.35, 2.4, 2.45, 2.5, 2.55, 2.6, 2.65, 2.7, 2.75, 2.8, 2.85, 2.9, 2.95, 3.0, 3.05, 3.1, 3.15, 3.2, 3.25, 3.3, 3.35, 3.4, 3.45, 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05, 4.1, 4.15, 4.2, 4.25, 4.3, 4.35, 4.4, 4.45, 4.5, 4.55, 4.6, 4.65, 4.7, 4.75, 4.8, 4.85, 4.9, 4.95, or 5.0 wt %. In embodiments, the chelating agent is present in 0.01 to 5.0 wt%. In embodiments, the chelating agent is present in 0.05 to 3.0 wt%. In embodiments, the chelating agent is present in 0.05 to 2.0 wt%. In embodiments, the chelating agent is present in 0.01 to 1.0 wt%. In embodiments, the chelating agent is present in 0.05 to 0.25 wt%.
[0134] In embodiments, the humectant is present in 1 to 30 wt%. In embodiments, the humectant is present in 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 30.0 wt %. In embodiments, the humectant is present in 5 to 15 wt%. In embodiments, the humectant is present in 8 to 13 wt%. In embodiments, the humectant is present in 9 to 11 wt%.
[0135] In embodiments, the emulsifier is present in 0.5 to 20 wt%. In embodiments, the emulsifier is present in 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %. In embodiments, the emulsifier is present in 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, or 20.0 wt %. In embodiments, the emulsifier is present in 0.5 to 10 wt%. In embodiments, the emulsifier is present in 0.5 to 5 wt%. In embodiments, the emulsifier is present in 0.5 to 2 wt%.
[0136] In embodiments, one or more emollients is present in 1 to 30 total wt%. In
embodiments, one or more emollients is present in 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or 30.0 wt%. In
embodiments, one or more emollients is present in 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, or 2.5 total wt %. In embodiments, one or more emollients is present in 3.5, 3.55, 3.6, 3.65, 3.7, 3.75, 3.8, 3.85, 3.9, 3.95, 4.0, 4.05, 4.1, 4.15,
4.2, 4.25, 4.3, 4.35, 4.4, 4.45, 4.5, 4.55, 4.6, 4.65, 4.7, 4.75, 4.8, 4.85, 4.9, 4.95, or 5.0 total wt %. In embodiments, one or more emollients is present in 1 to 10 total wt%. In embodiments, one or more emollients is present in 1 to 5 total wt%. In embodiments, one or more emollients is present in 1 to 3 total wt%. [0137] In embodiments, one or more preservatives is present in 0.1 to 10 total wt%. In embodiments, one or more preservatives is present in 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87,
0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01, 1.02, 1.03, 1.04,
1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or 1.5 wt%. In embodiments, one or more preservatives is present in 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0. In embodiments, one or more preservatives is present in 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 total wt%. In embodiments, one or more preservatives is present in 0.1 to 3 wt%. In embodiments, one or more preservatives is present in 0.1 to 2 wt%. In
embodiments, one or more preservatives is present in 0.1 to 1.0 wt%. [0138] In embodiments, one or more encapsulation aids is present in 1 to 25 total wt%. In embodiments, one or more encapsulation aids is present in 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10.0 total wt%. In embodiments, one or more encapsulation aids is present in 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, or 7.5 wt%. In embodiments, one or more encapsulation aids is present in 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 wt %. In embodiments, one or more encapsulation aids is present in 1 to 15 total wt%. In embodiments, one or more encapsulation aids is present in 1 to 10 total wt%. In embodiments, one or more encapsulation aids is present in 2 to 9 total wt%. [0139] In embodiments, aqueous phase thickener is present in 0.01 to 3 wt%. In embodiments, aqueous phase thickener is present in 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or 2.0 wt%. In embodiments, aqueous phase thickener is present in 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, to 0.75 wt %. In embodiments, aqueous phase thickener is present in 0.05 to 3 wt%. In embodiments, aqueous phase thickener is present in 0.10 to 2 wt%. In embodiments, aqueous phase thickener is present in 0.5 to 1.0 wt%.
[0140] In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1 : 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is about 3: about 1 : about 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 2.9: 1 : 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1.1 : 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1 : 1.1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is 3.1 : 1 : 1. In a preferred embodiment the molar ratio of cholesterol:ceramide:free fatty acid is (2.8- 3.2):(0.8-1.2):(0.8-1.2). In embodiments, the cholesterol is present in about 0.1 to about 10 wt%, preferably about 1 to about 10 wt%, more preferably about 1 to about 5 wt%. In embodiments, the ceramide or mixture of ceramides is present in about 0.1 to about 10 wt%, preferably about 0.1 to about 5 wt%, more preferably about 0.2 to about 3 wt%. In embodiments, the free fatty acid or mixture of free fatty acids is present in about 0.01 to about 6 wt%, preferably about 0.1 to about 5 wt%, more preferably about 0.2 to about 3 wt%. In embodiments, the cholesterol is present in 0.1 to 10 wt%, preferably 1 to 10 wt%, more preferably 1 to 5 wt%. In embodiments, the ceramide or mixture of ceramides is present in 0.1 to 10 wt%, preferably 0.1 to 5 wt%, more preferably 0.2 to 3 wt%. In embodiments, the free fatty acid or mixture of free fatty acids is present in 0.01 to 6 wt%, preferably 0.1 to 5 wt%, more preferably 0.2 to 3 wt%.
[0141] One aspect of the invention is directed to a topical composition, the composition consisting of a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to about 20 wt% of glyceryl stearate PEG- 100 emulsifier, preferably about 0.5 to about 10 wt%, more preferably about 1 to about 5 wt%; f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably about 2 to about 20 wt%, more preferably about 4 to about 10 wt%; g) about 0.1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably about 0.5 to about 5 wt%, more preferably about 0.8 to about 1.5 wt%; h) about 0.01 to about 5 wt% of citric acid, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; i) about 1 to about 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably about 5 to about 15 wt%, more preferably about 8 to about 10 wt%; j) about 0.01 to about 3 wt% of an aqueous phase thickener, preferably about 0.1 to about 2 wt%, more preferably about 0.2 to about 1 wt%; k) about 0.001 to about 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; and 1) water.
[0142] In embodiments, hesperidin is present in about 2 wt%. In embodiments, hesperidin is present in about 5 wt%. In embodiments, hesperidin is present in about 10 wt%. In
embodiments, hesperidin is present in about 15 wt%. In embodiments, hesperidin is present in about 20 wt%. In embodiments, hesperidin is present in about 25 wt%. In embodiments, hesperidin is present in about 30 wt%. In embodiments, hesperidin is present in about 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin. The aqueous phase thickener can be, for example, xanthan gum.
[0143] One aspect of the invention is directed to a topical composition, the composition including a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.1 to about 10 wt% of a skin conditioner, preferably about 1 to about 5 wt%, more preferably about 2 to about 4 wt%; c) about 0.001 to about 5 wt% of a chelating agent, preferably about 0.01 to about 2 wt%, more preferably about 0.1 to about 1 wt%; d) about 1 to about 30 wt% of a humectant, preferably about 3 to about 20 wt%, more preferably about 5 to about 10 wt%; e) about 0.5 to about 20 wt% of glyceryl stearate
PEG- 100 emulsifier, preferably about 0.5 to about 10 wt%, more preferably about 1 to about 5 wt%; f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably about 2 to about 20 wt%, more preferably about 4 to about 10 wt%; g) about 0.1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably about 0.5 to about 5 wt%, more preferably about 0.8 to about 1.5 wt%; h) about 0.01 to about 5 wt% of citric acid, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; i) about 1 to about 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably about 5 to about 15 wt%, more preferably about 8 to about 10 wt%; j) about 0.01 to about 3 wt% of an aqueous phase thickener, preferably about 0.1 to about 2 wt%, more preferably about 0.2 to about 1 wt%; k) about 0.001 to about 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; and 1) water. In embodiments, the topical composition is capable of treating dry skin.
[0144] Another aspect of the invention is directed to a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; c) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and d) about 0.001% to about 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof).
[0145] Another aspect of the invention is directed to a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of hesperidin, preferably about 1 to about 10 wt%, more preferably about
2 to about 5 wt%; c) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about
3 wt%, more preferably about 0.5 to about 2 wt%; and d) about 0.001% to about 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin. [0146] Another aspect of the invention is directed to an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; c) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and d) about 0.001% to about 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments, the citrus bioflavonoid is hesperidin.
[0147] Another aspect of the invention is directed to an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%, preferably about 1 to about 20 wt%, more preferably about 2 to about 10 wt%; b) about 0.001 to about 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably about 1 to about 10 wt%, more preferably about 2 to about 5 wt%; c) about 0.01 to about 5 wt% of an acid buffer, preferably about 0.25 to about 3 wt%, more preferably about 0.5 to about 2 wt%; and d) about 0.001% to about 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin. [0148] In embodiments, the glucocorticoid is present in about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, or about 5 wt%. In embodiments, the glucocorticoid is present in about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.1 1, 1.12, 1. 13, 1.14, 1. 15, 1.16, 1.17, 1.18, 1. 19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2. 1, 2.11, 2. 12, 2.13, 2.14, 2.15, 2.16, 2. 17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71 , 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %.
[0149] One aspect of the invention is directed to a topical composition, the composition consisting of a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0. 1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of glyceryl stearate PEG- 100 emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) 1 to 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) 0.1 to 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of citric acid, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) 1 to 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0. 1 to 2 wt%, more preferably 0.2 to 1 wt%; k) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%; and 1) water. In embodiments, the citrus bioflavonoid is hesperidin. [0150] In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 2 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 5 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 10 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 15 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 20 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 25 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 30 wt%. In embodiments, citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) is present in 35 wt%. In embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog,
pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). The aqueous phase thickener can be, for example, xanthan gum.
[0151] One aspect of the invention is directed to a topical composition, the composition including a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0. 1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of glyceryl stearate PEG- 100 emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) 1 to 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) 0.1 to 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of citric acid, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) 1 to 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0. 1 to 2 wt%, more preferably 0.2 to 1 wt%; k) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%; and 1) water. In embodiments, the topical composition is capable of treating dry skin. In embodiments, the citrus bioflavonoid is hesperidin.
[0152] Another aspect of the invention is directed to a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof), preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments, the citrus bioflavonoid is hesperidin.
[0153] Another aspect of the invention is directed to an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments, the citrus bioflavonoid is hesperidin. [0154] One aspect of the invention is directed to a topical composition, the composition consisting of a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0. 1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of glyceryl stearate PEG- 100 emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) 1 to 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) 0.1 to 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of citric acid, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) 1 to 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0. 1 to 2 wt%, more preferably 0.2 to 1 wt%; k) 0.001 to 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; and 1) water.
[0155] In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 2 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 5 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 10 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 15 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 20 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 25 wt%. In embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 30 wt%. In
embodiments, hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof is present in 35 wt%. In embodiments, the hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
[0156] One aspect of the invention is directed to a topical composition, the composition consisting of a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0. 1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of glyceryl stearate PEG- 100 emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) 1 to 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) 0.1 to 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of citric acid, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) 1 to 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0. 1 to 2 wt%, more preferably 0.2 to 1 wt%; k) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; and 1) water.
[0157] In embodiments, hesperidin is present in 2 wt%. In embodiments, hesperidin is present in 5 wt%. In embodiments, hesperidin is present in 10 wt%. In embodiments, hesperidin is present in 15 wt%. In embodiments, hesperidin is present in 20 wt%. In embodiments, hesperidin is present in 25 wt%. In embodiments, hesperidin is present in 30 wt%. In embodiments, hesperidin is present in 35 wt%. In embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin. [0158] One aspect of the invention is directed to a topical composition, the composition including a) 1 to 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0. 1 to 10 wt% of a skin conditioner, preferably 1 to 5 wt%, more preferably 2 to 4 wt%; c) 0.001 to 5 wt% of a chelating agent, preferably 0.01 to 2 wt%, more preferably 0. 1 to 1 wt%; d) 1 to 30 wt% of a humectant, preferably 3 to 20 wt%, more preferably 5 to 10 wt%; e) 0.5 to 20 wt% of glyceryl stearate PEG- 100 emulsifier, preferably 0.5 to 10 wt%, more preferably 1 to 5 wt%; f) 1 to 30 wt% of a mixture of emollients consisting of petrolatum and squalane, preferably 2 to 20 wt%, more preferably 4 to 10 wt%; g) 0.1 to 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid, preferably 0.5 to 5 wt%, more preferably 0.8 to 1.5 wt%; h) 0.01 to 5 wt% of citric acid, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; i) 1 to 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax, preferably 5 to 15 wt%, more preferably 8 to 10 wt%; j) 0.01 to 3 wt% of an aqueous phase thickener, preferably 0. 1 to 2 wt%, more preferably 0.2 to 1 wt%; k) 0.001 to 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; and 1) water. In embodiments, the topical composition is capable of treating dry skin.
[0159] Another aspect of the invention is directed to a composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin.
[0160] Another aspect of the invention is directed to an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin or an analog, pharmaceutically acceptable salt, or prodrug thereof.
[0161] Another aspect of the invention is directed to an anti-inflammatory composition including a) a mixture of optimized molar ratio of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of 1 to 50 wt%, preferably 1 to 20 wt%, more preferably 2 to 10 wt%; b) 0.001 to 50 wt% of hesperidin, preferably 1 to 10 wt%, more preferably 2 to 5 wt%; c) 0.01 to 5 wt% of an acid buffer, preferably 0.25 to 3 wt%, more preferably 0.5 to 2 wt%; and d) 0.001% to 5% of a topical glucocorticoid. In some embodiments, the glucocorticoid is selected from the group consisting of potent fluorinated agents that are most likely to provoke changes that mimic aged skin. In some embodiments, the hesperidin can be contained within its natural source, such as orange rind or peppermint oil, in an amount sufficient to provide the required wt% of the active hesperidin. [0162] In embodiments, the glucocorticoid is present in 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0. 1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, or 5 wt%. In embodiments, the glucocorticoid is present in 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1. 1, 1.11, 1. 12, 1.13, 1.14, 1.15, 1. 16, 1.17, 1.18, 1. 19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.1 1, 2.12, 2.13, 2. 14, 2.15, 2.16, 2.17, 2. 18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41 , 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %. [0163] The free fatty acid and/or cholesterol components of the above compositions can also include lipid metabolites or naturally-occurring oils enriched in species that are known activators or ligands for the nuclear hormone receptors PPARa, ΡΡΑΡ /δ and/or LXR. Such lipid metabolites include, for example, the PPARa activator, gamma-linoleic acid. The free fatty acid can be selected from either essential or non-essential free fatty acids, or can be a combination thereof.
[0164] The topical compositions of the invention can be adapted for therapeutic applications to treat various skin diseases and disorders, and also can be adapted to cosmetic uses. The topical compositions can contain a wide variety of optional components (e.g., scents); provided that such optional components are physically and chemically compatible with the essential components described herein, and do not unduly impair stability, efficacy, or other use benefits associated with the compositions. Optional components can be dispersed, dissolved, or the like in the carrier of the present compositions. [0165] Exemplary optional components include emollients, oil absorbents, antimicrobial agents, binders, additional buffering agents, denaturants, cosmetic astringents, external analgesics, film formers, humectants, opacifying agents, perfumes, pigments, skin soothing and healing agents, preservatives, propellants, skin penetration enhancers, solvents, suspending agents, emulsifiers, cleansing agents, thickening agents, solubilizing agents, waxes, sunscreens, sunless tanning agents, antioxidants and/or radical scavengers, chelating agents, antiacne agents, anti -inflammatory agents, desquamation agents/exfoliants, organic hydroxy acids, vitamins, and natural extracts. Examples of such materials are described in Harry's
Cosmeticology, 7th Ed., Harry & Wilkinson (Hill Publishers, London 1982); in Pharmaceutical Dosage Forms— Disperse Systems; Lieberman, Rieger & Banker, Vols. 1 (1988) & 2 (1989);
Marcel Decker, Inc. ; in The Chemistry and Manufacture of Cosmetics, 2nd. Ed., deNavarre (Van Nostrand 1962-1965); and in The Handbook of Cosmetic Science and Technology, 1st Ed. Knowlton & Pearce (Elsevier 1993) can also be used in the present invention.
[0166] In an aspect is provided a composition including citrus bioflavonoid (e.g. , hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In an aspect is provided a composition including cholesterol and citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof). In embodiments, the citrus bioflavonoid is hesperidin.In embodiments, the composition further includes a ceramide and a free fatty acid. In embodiments, the molar ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 molar. In embodiments, the molar ratio of total cholesteroktotal ceramide: total free fatty acid is 3: 1 : 1 molar.
[0167] In an aspect is provided a composition including hesperidin. In an aspect is provided a composition including cholesterol and hesperidin. In embodiments, the composition further includes a ceramide and a free fatty acid. In embodiments, the molar ratio of total
cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 molar. In embodiments, the molar ratio of total cholesteroktotal ceramide:total free fatty acid is 3: 1 : 1 molar.
[0168] In embodiments, the composition further includes an acid buffer. In embodiments, the pH of the composition is between about 3 to about 5.5. In embodiments, the composition includes about 1 to about 50 wt% of total cholesterol. In embodiments, the composition includes about 0.1 to about 10 wt% of total cholesterol. In embodiments, the composition includes about 0.1 to about 5 wt% of total cholesterol. In embodiments, the composition includes about 0.001 to about 50 wt% of hesperidin. In embodiments, the composition includes about 0.1 to about 10 wt% of hesperidin. In embodiments, the composition includes about 0.1 to about 5 wt% of hesperidin. In embodiments, the composition includes about 0.1 to about 10 wt% total ceramide. In embodiments, the composition includes about 0.1 to about 5 wt% total ceramide. In embodiments, the composition includes about 0.01 to about 6 wt% total free fatty acid. In embodiments, the composition includes about 0.1 to about 2 wt% total free fatty acid. In embodiments, the composition includes about 0.05 to about 5 wt% of the acid buffer. In embodiments, the composition includes about 0.1 to about 5 wt% of the acid buffer.
[0169] In embodiments, the composition further includes a skin conditioner. In embodiments, the composition includes about 0.1 to about 10 wt% of the skin conditioner. In embodiments, the composition includes about 0.1 to about 5 wt% of the skin conditioner. In embodiments, the skin conditioner is dimethicone. In embodiments, the composition further includes a chelating agent. In embodiments, the composition includes about 0.001 to about 5 wt% of the chelating agent. In embodiments, the composition includes about 0.01 to about 1 wt% of the chelating agent. In embodiments, the chelating agent is disodium EDTA. In embodiments, the composition further includes a humectant. In embodiments, the composition includes about 1 to about 30 wt% of the humectant. In embodiments, the composition includes about 5 to about 30 wt% of the humectant. In embodiments, the humectant is glycerin. In embodiments, the composition further includes an emulsifier. In embodiments, the composition includes about 0.5 to about 20 wt% of the emulsifier. In embodiments, the composition includes about 0.2 to about 10 wt% of the emulsifier. In embodiments, the emulsifier is glyceryl stearate PEG-100. In embodiments, the composition further includes an emollient. In embodiments, the composition includes about 1 to about 30 wt% of the emollient. In embodiments, the composition includes about 0.2 to about 10 wt% of the emollient. In embodiments, the emollient is petrolatum. In embodiments, the emollient is squalane. In embodiments, the composition further includes a preservative. In embodiments, the composition includes about 0.1 to about 10 wt% of the preservative. In embodiments, the composition includes about 0.01 to about 5 wt% of the preservative. In embodiments, the preservative is phenoxyethanol. In embodiments, the preservative is sorbic acid. In embodiments, the composition further includes an encapsulation aid. In embodiments, the composition includes about 1 to about 25 wt% of the encapsulation aid. In embodiments, the composition includes about 0.01 to about 30 wt% of the encapsulation aid. In embodiments, the encapsulation aid is euphorbia cerifera (candelilla) wax. In embodiments, the encapsulation aid is corn syrup solids. In embodiments, the composition further includes an aqueous phase thickener. In embodiments, the composition includes about 0.01 to about 3 wt% of the aqueous phase thickener. In embodiments, the aqueous phase thickener is xanthan gum. In embodiments, the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC- 104). In embodiments, the free fatty acid is conjugated linoleic acid (CLA). In embodiments, the composition further includes a glucocorticoid. In embodiments, the composition includes about 0.001 to about 5 wt% of the glucocorticoid. In embodiments, the composition is a topical composition.
[0170] In embodiments is provided a topical composition, the composition including: a) cholesterol (e.g., about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1. 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %); b) an acid buffer (e.g. , 0.10, 0. 11, 0.12, 0.13, 0. 14, 0.15, 0.16, 0.17, 0. 18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 wt%); and c) hesperidin (e.g., about 1.0, 1. 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %); wherein the pH of the topical composition is about 3 to about 5.5.
[0171] In embodiments is provided a topical composition, the composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2. 12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3. 18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4. 1, 4.12, 4. 14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4A4, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5. 1, 5.12, 5. 14, 5.16, 5. 18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86,
5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6. 18, 6.2, 6.22,
6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58,
6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3,
7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02,
8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74,
8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10 total wt%); b) a skin conditioner (e.g., about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32,
1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49,
1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85,
2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt%); c) a chelating agent (e.g., about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0 wt %); d) a humectant (e.g., about 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or about 30.0 wt %); e) an emulsifier (about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9,
2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %); f) one or more emollients (e.g., about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0,
10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or about 30.0 wt%); g) one or more preservatives (e.g., about 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or about total 1.5 wt%); h) an acid buffer (e.g., about 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 wt%); i) one or more encapsulation aids (e.g., about 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54,
9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9,
9.92, 9.94, 9.96, 9.98, or about 10.0 total wt%; j) an aqueous phase thickener (e.g., about 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18,
1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or about 2.0 wt%); and k) hesperidin (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5,
1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %).
[0172] In embodiments is provided a topical composition consisting of: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68,
4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28,
8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10 total wt%); b) a skin conditioner (e.g., about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45,
1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62,
1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01 , 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.1 1, 2.12, 2.13,
2.14, 2. 15, 2.16, 2.17, 2.18, 2. 19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3,
2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47,
2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %); c) a chelating agent (e.g., about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0. 11, 0.12, 0.13, 0.14, 0. 15, 0.16, 0.17, 0.18, 0. 19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0 wt %); d) humectant (e.g., about 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 1 1.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or about 30.0 wt %); e) glyceryl stearate PEG- 100 emulsifier (e.g., about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.1 1, 1.12, 1.13, 1. 14, 1.15, 1.16, 1.17, 1. 18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46,
1.47, 1.48, 1.49, 1.5, 1.51 , 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63,
1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97,
1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2. 11, 2.12, 2.13, 2.14,
2.15, 2. 16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31,
2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48,
2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82,
2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %); f) a mixture of emollients consisting of petrolatum and squalane (e.g., about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or about 30.0 wt%); g) a mixture of preservatives consisting of phenoxyethanol and sorbic acid (e.g., about 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42,
I.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or about 1.5 total wt%); h) citric acid (e.g., about 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 wt%); i) a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax (e.g., about 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10.0 total wt%); j) an aqueous phase thickener (e.g., about 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or about 2.0 wt%); k) hesperidin (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %); and 1) water.
[0173] In embodiments is provided a topical composition including: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68,
4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10 total wt%); b) a skin conditioner (e.g., about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79,
1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %); c) a chelating agent (e.g., about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0. 11, 0.12, 0.13, 0.14, 0. 15, 0.16, 0.17, 0.18, 0. 19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or about 1.0 wt %); d) humectant (e.g., about 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 1 1.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or about 30.0 wt %); e) glyceryl stearate PEG- 100 emulsifier (e.g., about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.1 1, 1.12, 1.13, 1. 14, 1.15, 1.16, 1.17, 1. 18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51 , 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2. 11, 2.12, 2.13, 2.14, 2.15, 2. 16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82,
2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %); f) a mixture of emollients consisting of petrolatum and squalane (e.g., about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or about 30.0 wt%); g) a mixture of preservatives consisting of phenoxyethanol and sorbic acid (e.g., about 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1. 1, 1.11, 1. 12, 1.13, 1.14, 1.15, 1. 16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or about 1.5 total wt%); h) citric acid (e.g., about 0. 10, 0.11, 0. 12, 0.13, 0.14, 0.15, 0. 16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 wt%); i) a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax (e.g., about 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10.0 total wt%); j) an aqueous phase thickener (e.g., about 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or about 2.0 wt%); k) hesperidin (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %); and 1) water.
[0174] In embodiments is provided a composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1,
7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18,
8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9,
8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or about 10 total wt%) b) hesperidin (e.g., about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0 wt %); c) an acid buffer (e.g., about 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 wt%); and d) at least one glucocorticoid (e.g., about 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12,
1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29,
1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or about 3.0 wt %). [0175] In embodiments, the composition further includes an acid buffer. In embodiments, the pH of the composition is from 3 to 5.5. In embodiments, the composition includes 1 to 50 wt% of total cholesterol. In embodiments, the composition includes 0.1 to 10 wt% of total cholesterol. In embodiments, the composition includes 0.1 to 5 wt% of total cholesterol. In embodiments, the composition includes 0.001 to 50 wt% of hesperidin. In embodiments, the composition includes 0. 1 to 10 wt% of hesperidin. In embodiments, the composition includes 0.1 to 5 wt% of hesperidin. In embodiments, the composition includes 0.1 to 10 wt% total ceramide. In embodiments, the composition includes 0.1 to 5 wt% total ceramide. In embodiments, the composition includes 0.01 to 6 wt% total free fatty acid. In embodiments, the composition includes 0. 1 to 2 wt% total free fatty acid. In embodiments, the composition includes 0.05 to 5 wt% of the acid buffer. In embodiments, the composition includes 0.1 to 5 wt% of the acid buffer.
[0176] In embodiments, the composition further includes a skin conditioner. In embodiments, the composition includes 0. 1 to 10 wt% of the skin conditioner. In embodiments, the composition includes 0. 1 to 5 wt% of the skin conditioner. In embodiments, the skin conditioner is dimethicone. In embodiments, the composition further includes a chelating agent. In embodiments, the composition includes 0.001 to 5 wt% of the chelating agent. In embodiments, the composition includes 0.01 to 1 wt% of the chelating agent. In embodiments, the chelating agent is disodium EDTA. In embodiments, the composition further includes a humectant. In embodiments, the composition includes 1 to 30 wt% of the humectant. In embodiments, the composition includes 5 to 30 wt% of the humectant. In embodiments, the humectant is glycerin. In embodiments, the composition further includes an emulsifier. In embodiments, the composition includes 0.5 to 20 wt% of the emulsifier. In embodiments, the composition includes 0.2 to 10 wt% of the emulsifier. In embodiments, the emulsifier is glyceryl stearate PEG-100. In embodiments, the composition further includes an emollient. In embodiments, the composition includes 1 to 30 wt% of the emollient. In embodiments, the composition includes 0.2 to 10 wt% of the emollient. In embodiments, the emollient is petrolatum. In embodiments, the emollient is squalane. In embodiments, the composition further includes a preservative. In embodiments, the composition includes 0.1 to 10 wt% of the preservative. In embodiments, the composition includes 0.01 to 5 wt% of the preservative. In embodiments, the preservative is phenoxyethanol. In embodiments, the preservative is sorbic acid. In embodiments, the composition further includes an encapsulation aid. In embodiments, the composition includes 1 to 25 wt% of the encapsulation aid. In embodiments, the composition includes 0.01 to 30 wt% of the encapsulation aid. In embodiments, the encapsulation aid is euphorbia cerifera (candelilla) wax. In embodiments, the encapsulation aid is com syrup solids. In embodiments, the composition further includes an aqueous phase thickener. In embodiments, the composition includes 0.01 to 3 wt% of the aqueous phase thickener. In embodiments, the aqueous phase thickener is xanthan gum. In embodiments, the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC- 104). In embodiments, the free fatty acid is conjugated linoleic acid (CLA). In embodiments, the composition further includes a glucocorticoid. In embodiments, the composition includes 0.001 to 5 wt% of the glucocorticoid. In embodiments, the composition is a topical composition. [0177] In embodiments is provided a topical composition, the composition including: a) cholesterol (e.g., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2. 1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %); b) an acid buffer (e.g., 0.10, 0.1 1, 0. 12, 0.13, 0.14, 0.15, 0. 16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%); and c) hesperidin (e.g., 1.0, 1. 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2. 1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %); wherein the pH of the topical composition is 3 to 5.5. [0178] In embodiments is provided a topical composition, the composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof (e.g., 1.0, 1. 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2. 18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3. 18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4. 1, 4.12, 4. 14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5. 1, 5.12, 5. 14, 5.16, 5. 18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66,
7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10 total wt%); b) a skin conditioner (e.g., 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68,
1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt%); c) a chelating agent (e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 wt %); d) a humectant (e.g., 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 30.0 wt %); e) an emulsifier (1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %); f) one or more emollients (e.g., 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0,
7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or 30.0 wt%); g) one or more preservatives (e.g., 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or total 1.5 wt%); h) an acid buffer (e.g., 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%); i) one or more encapsulation aids (e.g., 7.0, 7.02, 7.04,
7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10.0 total wt%; j) an aqueous phase thickener (e.g., 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or 2.0 wt%); and k) hesperidin (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %).
[0179] In embodiments is provided a topical composition consisting of: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g.,
1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10 total wt%); b) a skin conditioner (e.g., 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1 , 1.11, 1. 12, 1.13, 1.14, 1. 15, 1.16, 1.17, 1.18, 1. 19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2. 1, 2.11, 2. 12, 2.13, 2.14, 2.15, 2.16, 2. 17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71 , 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %); c) a chelating agent (e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1 1, 0.12, 0. 13, 0.14, 0.15, 0.16, 0. 17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 wt %); d) humectant (e.g., 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 30.0 wt %); e) glyceryl stearate PEG-100 emulsifier (e.g., 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1. 11, 1.12, 1.13, 1.14, 1. 15, 1.16, 1.17, 1.18, 1. 19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1 , 2.1 1, 2.12, 2. 13, 2.14, 2.15, 2.16, 2. 17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61 , 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %); f) a mixture of emollients consisting of petrolatum and squalane (e.g., 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or 30.0 wt%); g) a mixture of preservatives consisting of phenoxyethanol and sorbic acid (e.g., 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or 1.5 total wt%); h) citric acid (e.g., 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%); i) a mixture of encapsulation aids consisting of corn syrup solids and euphorbia cerifera (candelilla) wax
(e.g., 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10.0 total wt%); j) an aqueous phase thickener (e.g., 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or 2.0 wt%); k) hesperidin (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %); and 1) water.
[0180] In embodiments is provided a topical composition including: a) a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62,
3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06, 6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3,
8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02,
9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38,
9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10 total wt%); b) a skin conditioner (e.g., 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64,
1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32,
2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49,
2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71 , 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %); c) a chelating agent (e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.1 1, 0.12, 0. 13, 0.14, 0.15, 0.16, 0. 17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 wt %); d) humectant (e.g., 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0, 19.0, 20.0, 21.0, 22.0, 23.0, 24.0, 25.0, 26.0, 27.0, 28.0, 29.0 or 30.0 wt %); e) glyceryl stearate PEG-100 emulsifier (e.g., 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1. 11, 1.12, 1.13, 1.14, 1. 15, 1.16, 1.17, 1.18, 1. 19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1 , 2.1 1, 2.12, 2. 13, 2.14, 2.15, 2.16, 2. 17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61 , 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %); f) a mixture of emollients consisting of petrolatum and squalane (e.g., 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 1 1.5, 12.0, 12.5, 13.0, 13.5, 14.0, 14.5, 15.0, 15.5, 16.0, 16.5, 17.0, 17.5, 18.0, 18.5, 19.0, 19.5, 20.0, 20.5, 21.0, 21.5, 22.0, 22.5, 23.0, 23.5, 24.0, 24.5, 25.0, 25.5, 26.0, 26.5, 27.0, 27.5, 28.0, 28.5, 29.0, 29.5, or 30.0 wt%); g) a mixture of preservatives consisting of phenoxyethanol and sorbic acid (e.g., 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.1 1, 1.12, 1.13, 1. 14, 1.15, 1.16, 1.17, 1. 18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41 , 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, or 1.5 total wt%); h) citric acid (e.g., 0.10, 0.11 , 0.12, 0. 13, 0.14, 0.15, 0.16, 0. 17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%); i) a mixture of encapsulation aids consisting of corn syrup solids and euphorbia cerifera (candelilla) wax (e.g., 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10.0 total wt%); j) an aqueous phase thickener (e.g., 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.24, 0.26, 0.28, 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, 0.5, 0.52, 0.54, 0.56, 0.58, 0.6, 0.62, 0.64, 0.66, 0.68, 0.7, 0.72, 0.74, 0.76, 0.78, 0.8, 0.82, 0.84, 0.86, 0.88, 0.9, 0.92, 0.94, 0.96, 0.98, 1.0, 1.02, 1.04, 1.06, 1.08, 1.1, 1.12, 1.14, 1.16, 1.18, 1.2, 1.22, 1.24, 1.26, 1.28, 1.3, 1.32, 1.34, 1.36, 1.38, 1.4, 1.42, 1.44, 1.46, 1.48, 1.5, 1.52, 1.54, 1.56, 1.58, 1.6, 1.62, 1.64, 1.66, 1.68, 1.7, 1.72, 1.74, 1.76, 1.78, 1.8, 1.82, 1.84, 1.86, 1.88, 1.9, 1.92, 1.94, 1.96, 1.98, or 2.0 wt%); k) hesperidin (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %); and 1) water.
[0181] In embodiments is provided a composition including: a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.02, 2.04, 2.06, 2.08, 2.1, 2.12, 2.14, 2.16, 2.18, 2.2, 2.22, 2.24, 2.26, 2.28, 2.3, 2.32, 2.34, 2.36, 2.38, 2.4, 2.42, 2.44, 2.46, 2.48, 2.5, 2.52, 2.54, 2.56, 2.58, 2.6, 2.62, 2.64, 2.66, 2.68, 2.7, 2.72, 2.74, 2.76, 2.78, 2.8, 2.82, 2.84, 2.86, 2.88, 2.9, 2.92, 2.94, 2.96, 2.98, 3.0, 3.02, 3.04, 3.06, 3.08, 3.1, 3.12, 3.14, 3.16, 3.18, 3.2, 3.22, 3.24, 3.26, 3.28, 3.3, 3.32, 3.34, 3.36, 3.38, 3.4, 3.42, 3.44, 3.46, 3.48, 3.5, 3.52, 3.54, 3.56, 3.58, 3.6, 3.62, 3.64, 3.66, 3.68, 3.7, 3.72, 3.74, 3.76, 3.78, 3.8, 3.82, 3.84, 3.86, 3.88, 3.9, 3.92, 3.94, 3.96, 3.98, 4.0, 4.02, 4.04, 4.06, 4.08, 4.1, 4.12, 4.14, 4.16, 4.18, 4.2, 4.22, 4.24, 4.26, 4.28, 4.3, 4.32, 4.34, 4.36, 4.38, 4.4, 4.42, 4.44, 4.46, 4.48, 4.5, 4.52, 4.54, 4.56, 4.58, 4.6, 4.62, 4.64, 4.66, 4.68, 4.7, 4.72, 4.74, 4.76, 4.78, 4.8, 4.82, 4.84, 4.86, 4.88, 4.9, 4.92, 4.94, 4.96, 4.98, 5.0, 5.02, 5.04, 5.06, 5.08, 5.1, 5.12, 5.14, 5.16, 5.18, 5.2, 5.22, 5.24, 5.26, 5.28, 5.3, 5.32, 5.34, 5.36, 5.38, 5.4, 5.42, 5.44, 5.46, 5.48, 5.5, 5.52, 5.54, 5.56, 5.58, 5.6, 5.62, 5.64, 5.66, 5.68, 5.7, 5.72, 5.74, 5.76, 5.78, 5.8, 5.82, 5.84, 5.86, 5.88, 5.9, 5.92, 5.94, 5.96, 5.98, 6.0, 6.02, 6.04, 6.06,
6.08, 6.1, 6.12, 6.14, 6.16, 6.18, 6.2, 6.22, 6.24, 6.26, 6.28, 6.3, 6.32, 6.34, 6.36, 6.38, 6.4, 6.42, 6.44, 6.46, 6.48, 6.5, 6.52, 6.54, 6.56, 6.58, 6.6, 6.62, 6.64, 6.66, 6.68, 6.7, 6.72, 6.74, 6.76, 6.78, 6.8, 6.82, 6.84, 6.86, 6.88, 6.9, 6.92, 6.94, 6.96, 6.98, 7.0, 7.02, 7.04, 7.06, 7.08, 7.1, 7.12, 7.14, 7.16, 7.18, 7.2, 7.22, 7.24, 7.26, 7.28, 7.3, 7.32, 7.34, 7.36, 7.38, 7.4, 7.42, 7.44, 7.46, 7.48, 7.5, 7.52, 7.54, 7.56, 7.58, 7.6, 7.62, 7.64, 7.66, 7.68, 7.7, 7.72, 7.74, 7.76, 7.78, 7.8, 7.82, 7.84, 7.86, 7.88, 7.9, 7.92, 7.94, 7.96, 7.98, 8.0, 8.02, 8.04, 8.06, 8.08, 8.1, 8.12, 8.14, 8.16, 8.18, 8.2, 8.22, 8.24, 8.26, 8.28, 8.3, 8.32, 8.34, 8.36, 8.38, 8.4, 8.42, 8.44, 8.46, 8.48, 8.5, 8.52, 8.54, 8.56, 8.58, 8.6, 8.62, 8.64, 8.66, 8.68, 8.7, 8.72, 8.74, 8.76, 8.78, 8.8, 8.82, 8.84, 8.86, 8.88, 8.9, 8.92, 8.94, 8.96, 8.98, 9.0, 9.02, 9.04, 9.06, 9.08, 9.1, 9.12, 9.14, 9.16, 9.18, 9.2, 9.22, 9.24, 9.26, 9.28, 9.3, 9.32, 9.34, 9.36, 9.38, 9.4, 9.42, 9.44, 9.46, 9.48, 9.5, 9.52, 9.54, 9.56, 9.58, 9.6, 9.62, 9.64, 9.66, 9.68, 9.7, 9.72, 9.74, 9.76, 9.78, 9.8, 9.82, 9.84, 9.86, 9.88, 9.9, 9.92, 9.94, 9.96, 9.98, or 10 total wt%) b) hesperidin (e.g., 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 wt %); c) an acid buffer (e.g., 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21,0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 wt%); and d) at least one glucocorticoid (e.g., 1.0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.1, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.2, 1.21, 1.22, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.3, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.4, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1.5, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.6, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.7, 1.71, 1.72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.8, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89,
1.9, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2.0, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.1, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.5, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.6, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.7, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.8, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.9, 2.91, 2.92, 2.93, 2.94, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.0 wt %). [0182] Any of the methods including administration or use of hesperidin described herein, may instead administer or use an analog of hesperidin. Any of the methods including administration or use of hesperidin described herein, may instead administer or use a pharmaceutically acceptable salt of hesperidin. Any of the methods including administration or use of hesperidin described herein, may instead administer or use a prodrug of hesperidin.
III. Methods of use
[0183] The topical composition of the present invention is generally prepared by conventional methods such as are known in the art of making topical compositions. Such methods typically involve mixing of the ingredients in one or more steps to a relatively uniform state, with or without heating, cooling, application of vacuum, and the like.
[0184] The topical composition is useful for regulating or improving skin condition, including regulating visible or tactile wrinkles or discontinuities in skin and those associated with skin aging, e.g., visible and/or tactile scaling, wrinkles or discontinuities in skin texture or color. Such wrinkles, scale or discontinuities may be induced or caused by internal factors (e.g., chronological aging and other biochemical changes from within the skin) or external factors
(e.g., photo-aging) (e.g., ultraviolet radiation, environmental pollution, wind, heat, low humidity, harsh surfactants, and abrasives).
[0185] Regulating skin conditions by improving barrier function, antimicrobial defense, or SC integrity can be carried out prophylactically or therapeutically. Prophylactic regulation includes delaying, minimizing, or preventing the development of visible or tactile wrinkles or discontinuities in skin. Therapeutic regulation, on the other hand, includes ameliorating, diminishing, minimizing or effacing such wrinkles, scale, or discontinuities. Regulating skin conditions (e.g. treating abnormal barrier function, treating aged skin, treating dry skin) involves improving skin appearance and feel, by providing a smoother, more even appearance, or feel and reducing signs of aging.
[0186] To use a topical composition of this invention, one can topically apply to the skin a safe and effective amount of the composition. The applied amount, the frequency of application and the period of use vary widely depending upon the active levels of a given composition and the level of regulation desired, e.g., in light of the level of skin ageing present in the subject and the rate of further skin ageing.
[0187] A wide range of quantities of the compositions of the present invention can be employed to provide a skin appearance and/or feel benefit. Quantities of the compositions typically applied per application are from about 0.1 mg/cm2 to about 10 mg/cm2, e.g., 2 mg/cm2. Typically, a composition can be used once or twice per day. However, application rates can vary from about once per week up to about three times per day or more.
[0188] Regulating skin conditions is preferably performed by applying a composition in the form of a skin lotion, cream, cosmetic, or the like which is intended to be left on the skin for an extended period for some aesthetic, prophylactic, therapeutic or other benefit (i.e., a "leave-on" composition). As used herein, "leave-on" compositions exclude rinse-off skin cleansing products. After applying the composition to the skin, the leave-on composition is preferably left on the skin for a period of at least about 15 minutes, 30 minutes, 1 hour, or up to about 12 hours. [0189] With regard to the epidermal barrier function, the anti-inflammatory composition described above is largely preventive, since 'fixing' the barrier is anti-inflammatory in either aging or young skin. This composition includes not only the barrier lipids in a barrier-enhancing molar ratio and pH, but also includes topical glucocorticoids or immunomodulators, and together such a combination reduces inflammation and prevents disease flares. It also prevents the emergence of epidermal side effects, such as rebound flares and tachyphylaxis, due to the coadministered glucocorticoids or immunomodulators. With regard to inflammatory diseases that are attributable, at least in part, to epidermal intrinsic/chronologic aging, these compositions are useful for the treatment of conditions including a) xerosis; b) xerotic eczema; c) winter itch; d) nummular eczema; e) seborrheic dermatitis; f) occupational dermatitis; g) hand eczema; h) stasis dermatitis; and any other eczematous condition occurring in the aging population.
[0190] Another aspect of the invention is directed to a method of treating inflammation by administering an effective amount of the above anti-inflammatory composition as described herein to at least a portion of affected skin in need thereof.
[0191] A further aspect of the invention is directed to a method of preventing or treating aged skin, including administering one of the topical compositions described above to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging. In embodiments, the method is directed to a method of treating aged skin, including administering one of the topical compositions described above to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging. A clinical indication of skin aging can be selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis. In embodiments, the method includes treating functional abnormalities in chronologically- and/or photo-aged skin, wherein the functional abnormalities may include reduced stratum corneum hydration, reduced stratum corneum cohesion, increased abnormal desquamation, increased skin scaling, increased occurrence of skin infections, increased susceptibility to skin infections, increased susceptibility of inflammatory dermatoses, and/or increased occurrence of inflammatory dermatoses. In embodiments, the method includes improving (i.e. increasing) stratum corneum hydration, improving (i.e. increasing) stratum corneum cohesion, inhibiting (i.e. reducing) abnormal desquamation, inhibiting (i. e. reducing) excessive scaling), reducing occurrence of skin infections, reducing susceptibility to skin infections, reducing susceptibility of inflammatory dermatoses, and/or reducing occurrence of inflammatory dermatoses. In embodiments, the method includes treating functional
abnormalities in chronologically -aged skin. In embodiments, the method includes treating functional abnormalities in photo-aged skin.
[0192] In embodiments, the method includes administering to a patient one of the topical compositions described herein begins when the patient is about 40 years old. In embodiments, the patient is 36 years old. In embodiments, the patient is 37 years old. In embodiments, the patient is 38 years old. In embodiments, the patient is 39 years old. In embodiments, the patient is 40 years old. In embodiments, the patient is 41 years old. In embodiments, the patient is 42 years old. In embodiments, the patient is 43 years old. In embodiments, the patient is 44 years old. [0193] Another aspect of the invention is directed to a method of preventing or reversing dermal side effects of systemic or topical glucocorticoid treatment, including treating at least a portion of affected skin with one of the compositions described above, in an amount effective to prevent or reverse a dermal clinical indication of glucocorticoid treatment. A dermal clinical indication of glucocorticoid treatment can be selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
[0194] In an aspect is provided a method of preventing or reversing a dermal side effect of topical or systemic immunomodulator treatment, including treating at least a portion of affected skin with one of the compositions described above, in an amount effective to prevent or reverse dermal clinical indications of immunomodulators treatment. In embodiments, the
immunomodulator include pimecrolimus and/or tacrolimus. In embodiments, the
immunomodulator is a topical calcineurin inhibitor (e.g., pimecrolimus and/or tacrolimus).
Examples of additional topical calcineurin inhibitors can be found in Breuer et al. (Am. J. Clin. Dermatol. 2005; 6(2):65-77) and is incorporated herein in its entirety. Dermal clinical indications of glucocorticoid treatment can be selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
[0195] Yet another aspect of the invention is directed to a method for the treatment of dry skin or abnormal epidermal barrier function associated with oral hypolipodemic agent treatment, for example, statin treatment, including administering one of the topical compositions described above to at least a portion of affected skin of a subject, in an amount effective to relieve or reverse clinical indications of hypolipodemic treatment. In embodiments, the subject has been administered a hypolipodemic agent, such as a statin, or is expected to receive such treatment. In embodiments, the subj ect has been co-administered a hypolipodemic agent. Hypolipodemic agents other than statins include fibrates, niacin, bile acid sequestrants, ezetimibe, lomitapide, phytosterols, orlistat, cholesteryl ester transfer protein inhibitors, and squalane synthase inhibitors.
[0196] In embodiments, the composition is for use in treating dry skin in a subject in need thereof. In embodiments, the composition is for use in treating abnormal epidermal barrier function in a subject in need thereof. In embodiments, the composition is for use in treating an inflammatory condition in a subject in need thereof. In embodiments, the composition is for use in treating a clinical indication of skin aging in a subj ect in need thereof. In embodiments, the clinical indication of skin aging is eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis. In embodiments, the composition is for use in treating a dermal clinical indication of glucocorticoid treatment in a subject in need thereof. In embodiments, the dermal clinical indication of glucocorticoid treatment is inflammation, tachyphylaxis, disease flares, or rebound flares. In embodiments, the composition is for use in treating a clinical indication of hypolipodemic treatment in a subject in need thereof.
[0197] One aspect of the invention is directed to a topical composition comprising citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) in the absence of lipids providing desirable restorative effects on the epidermal permeability barrier in aged skin, as provided herein. In embodiments, the citrus bioflavonoid is hesperidin. [0198] A further aspect of the invention is directed to a method of treating aged skin, comprising administering one of the topical compositions comprising citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) in the absence of lipids to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging. In embodiments, the citrus bioflavonoid is hesperidin.
[0199] Another aspect of the invention is directed to a method of preventing or reversing an epidermal side effect of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with one of the topical compositions comprising citrus bioflavonoid (e.g., hesperidin, or an analog, pharmaceutically acceptable salt, or prodrug thereof) in the absence of lipids, in an amount effective to prevent or reverse epidermal a clinical indication of glucocorticoid side effects. In embodiments, the citrus bioflavonoid is hesperidin.
[0200] One aspect of the invention is directed to a topical composition comprising hesperidin in the absence of lipids providing desirable restorative effects on the epidermal permeability barrier in aged skin, as provided herein.
[0201] A further aspect of the invention is directed to a method of treating aged skin, comprising administering one of the topical compositions comprising hesperidin in the absence of lipids to at least a portion of aged skin, in an amount effective to relieve or reverse clinical indications of skin aging.
[0202] Another aspect of the invention is directed to a method of preventing or reversing epidermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with one of the topical compositions comprising hesperidin in the absence of lipids, in an amount effective to prevent or reverse epidermal clinical indications of glucocorticoid side effects.
[0203] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
EXAMPLES
[0204] Citrus bioflavonoids, such as orange peel extract, reportedly exhibit beneficial effects for skin pigmentation, inflammation, and ultraviolet (UV) protection, as well as stimulating keratinocyte proliferation. We have recently demonstrated that topical hesperidin improves epidermal permeability barrier function in young normal murine skin, and have explored the responsible mechanisms. Topical hesperidin significantly accelerated young murine skin barrier recovery after acute barrier abrogation; which correlated with stimulation of both epidermal proliferation and differentiation, as well as enhanced lamellar body (lipid) secretion. These results indicated that topical hesperidin enhances epidermal permeability barrier homeostasis in normal skin by stimulating epidermal proliferation and differentiation, and by stimulating lamellar body secretion. However, the benefits of topical citrus bioflavonoids such as hesperidin for aged skin have not heretofore been disclosed.
[0205] As noted in the Background section, synthesis of the three key barrier-related lipids, cholesterol, ceramides (including pseudo-ceramides), and free fatty acids, requires their respective rate-limiting enzymes, HMGCoA, SPT1, and FAS. Basal mRNA levels for all three key lipid synthetic enzymes, and particularly HMGCoA reductase, were observed to be lower in aged epidermis as compared with young epidermis, consistent with concept that the lower lipid synthesis rates in aged epidermis reflect the reduced expression of their synthetic enzymes. Surprisingly, we have now demonstrated that topical hesperidin treatment significantly increased the mRNA levels of HMGCoA, SPT1 and FAS in aged mouse epidermis, as assessed by Q-PCR. [0206] Thus, topical applications of hesperidin improve multiple key epidermal functions in aged mouse skin. After 9 days of treatment, the gross appearance of mouse skin treated with vehicle and hesperidin appeared similar. Histological analysis showed that aged epidermis was thinner than young epidermis; whereas proliferating cell nuclear antigen (PCNA) staining indicated that aged epidermis displayed less robust proliferative activity as compared with young epidermis; hesperidin treatment did not stimulate epidermal proliferation in aged skin, as indicated by PCNA-positive cells per cm epidermal length (2.70±0.10 vs. 2.45± 0.13 for vehicle- treated vs. hesperidin-treated skin, NS; 3.46±0.17 for young skin; young vs. vehicle- or hesperidin-treated aged skin, P<0.001). These results indicate that topical hesperidin does not stimulate epidermal proliferation in aged mice. [0207] After 9 days of topical hesperidin treatment, baseline SC hydration in hesperidin- treated mice also was no different from that in vehicle-treated mice (60.77±1.32 for vehicle- treated vs. 58.80±2.27 for hesperidin-treated). However, skin surface pH significantly declined in hesperidin-treated skin compared with vehicle-treated skin. Although basal transepidermal water loss rates increased slightly in hesperidin-treated skin as compared with vehicle-treated skin, these levels still fell well within the normal range of young skin. Consistent with previous findings in young mice, topical hesperidin significantly accelerated barrier recovery at both 2 and 4 hours after acute barrier disruption of aged skin. These results demonstrate that topical hesperidin improves epidermal permeability barrier homeostasis, while also lowering skin surface pH in aged murine skin.
[0208] We next examined the basis for improved barrier function and acidification in aged epidermis. Our previous studies demonstrated that topical hesperidin stimulates epidermal differentiation, accounting in part for improved epidermal permeability barrier homeostasis in young mice. Hence, we next assessed whether topical hesperidin also stimulates epidermal differentiation in aged epidermis. Topical hesperidin significantly increased the mRNA levels of filaggrin and loricrin in aged mouse epidermis, consistent with the results of immunostaining. Consistently, hesperidin also increased the mRNA levels of filaggrin, involucrin, and loricrin in adult keratinocyte cultures. These results indicate that hesperidin stimulates epidermal differentiation, providing one potential mechanism whereby hesperidin improves barrier function in aged skin.
[0209] Epidermal lipid synthesis is required for the formation and maintenance of the epidermal permeability barrier. Synthesis of three key barrier-related lipids, cholesterol, ceramides, and fatty acids requires their respective rate-limiting enzymes 3-hydroxy-3-methyl- glutaryl-CoA reductase (HMGCoA), serine palmitoyltransferase 1 (SPT1), and fatty acid synthase (FAS). Basal mRNA levels for all three key lipid synthetic enzymes were lower in aged as compared with young epidermis, consistent with the concept that the lower lipid synthesis rates in aged epidermis could reflect the reduced expression of their synthetic enzymes. Topical hesperidin treatment significantly increased the mRNA levels of HMGCoA, SPT1, and FAS in aged mouse epidermis, as assessed by quantitative reverse transcriptase in real time (Q-PCR).
[0210] Epidermal permeability barrier function depends on newly synthesized epidermal lipids delivered to the SC through the secretion of lamellar bodies from the stratum granulosum.
Therefore, we next assessed whether topical hesperidin stimulates lamellar body formation and/or secretion. As ATP-binding cassette transporter 12 (ABCA12), a trans-membrane glycosylceramide transporter, is required for normal lamellar body assembly, we next evaluated the changes in epidermal mRNA levels of ABCA12 in hesperidin-treated aged epidermis.
Although untreated aged epidermis displayed lower levels of ABCA12 mRNA in comparison with young mice, topical hesperidin induced a marked increase in ABCA12 mRNA expression in aged mouse epidermis and adult keratinocyte cultures. Although the density of lamellar bodies did not increase in aged epidermis after hesperidin treatment, quantitative analyses revealed that the extent of lamellar body secretion was enhanced by topical hesperidin treatment. In comparison with young epidermis, the increased number of lamellar bodies in aged epidermis is likely because of the retardation of secretion. Together, these results suggest that hesperidin induced an increase in ABCA12 mRNA expression that results in an apparent acceleration in the delivery of newly synthesized lipids to the SC. [0211] Both epidermal sodium/hydrogen exchanger 1 (NHE1) and secretory phospholipase A2 (sPLA2; in particular SPLAg2f) are key factors that selectively influence the pH of the SC. Previous studies from our group have shown that aged skin exhibits higher pH, at least partly owing to reduced NHEl expression. To determine whether the hesperi din-induced acidification of the pH of the SC results from the upregulation of NHEl and/or the parallel acidifying mechanism, sPLA2g2f, we next assessed the changes in epidermal mRNA levels of these two genes in aged epidermis after herperidin treatments by Q-PCR. Topical hesperidin provoked a marked elevation in mRNA levels for both NHEl and sPLA2g2f in aged epidermis. These results suggest that hesperidin-induced acidification of aged epidermis results from stimulation of NHEl and sPLA2g2f, accounting for the lower skin surface pH, and likely improved epidermal permeability barrier homeostasis in hesperi din-treated aged mouse skin.
[0212] Epidermal permeability barrier and antimicrobial function are co-regulated and independent. Aged humans are predisposed to develop both cutaneous and extracutaneous infections, and expression of the epidermal cathelicidin antimicrobial peptide CAMP/LL37 is reduced in aged skin. To determine whether hesperidin enhances epidermal antimicrobial defense, we next assessed changes in the mRNA levels of mouse beta-defensin 3 (mBD3), a homolog of human beta-defensin 2 (hBD2), following hesperidin treatment. Hesperidin treatment significantly increased epidermal mBD3 mRNA levels. To further validate these in vivo results, the effects of hesperidin on antimicrobial mRNA expression were evaluated in cultured keratinocytes from aged human skin. Although no changes in constitutive hBD2 mRNA expression were observed, the addition of hesperidin to aged human keratinocyte cultures markedly upregulated not only hBD3 mRNA but also CAMP/LL37 expression. These results demonstrate that hesperidin stimulates antimicrobial peptide mRNA expression in aged keratinocytes.
[0213] Thus, we have demonstrated that topical hesperidin improves a wide spectrum of functional abnormalities in aged epidermis, including abnormalities in epidermal permeability barrier function, epidermal differentiation, lipid production, and SC acidification. The antioxidant property of hesperidin is also beneficial. Aged skin displays lower antioxidant capacity and excessive accumulation of oxidative products, and hesperidin shows high antioxidant capacity. We have demonstrated that topical hesperidin applications increased epidermal mRNA levels of antioxidant enzymes such as glutathione reductase and superoxide dismutase in murine skin. Pertinent to antioxidant activity, nuclear factor (erythroid-derived 2)- like 2 (Nrf2), a transcription factor, regulates epidermal differentiation and antioxidant defense. Nrf2 function is impaired in aged heart, and expression levels were lower in aged epidermis. Hesperidin upregulates Nrf2 in the heart and in the aged epidermis. Hence, hesperidin-induced improvement of epidermal permeability barrier function in aged skin might be mediated via Nrf2. [0214] Glucocorticoid Side Effects. Systemic and topical glucocorticoids (GC) can cause significant adverse effects not only on the dermis, but also on epidermal structure and function. In epidermis, one striking GC-induced alteration in permeability barrier function occurs that can be attributed to an inhibition of epidermal mitogenesis, differentiation and lipid production, features that mimic aged skin. Hesperidin co-applications unexpectedly also prevented the anticipated GC-induced impairments of epidermal permeability barrier homoeostasis and stratum corneum (SC) integrity and SC acidification. These preventive effects could be attributed to a significant increase in filaggrin expression, enhanced epidermal β-glucocerebrosidase activity and accelerated lamellar bilayer maturation, the last two likely attributable to a hesperidin- induced reduction in stratum corneum pH. Furthermore, co-applications of hesperidin with GC surprisingly prevented the expected GC-induced inhibition of epidermal proliferation. Finally, topical hesperidin also unexpectedly increased epidermal anti-oxidant enzymes, including glutathione reductase and superoxide dismutase, mRNA expression, which could counteract multiple negative effects of GC on epidermal function. Together, these results show that, surprisingly, topical hesperidin prevents GC-induced epidermal side effects by divergent mechanisms.
[0215] A notable unexpected finding that emerged was that topical hesperidin prevented the topical GC-induced changes in skin surface pH. Not only does an acidic pH accelerate epidermal permeability barrier recovery in adult and neonatal barrier maturation, but it also prevents the development of atopic dermatitis in a murine model. To date, hesperidin is the only known agent shown to prevent the GC-induced abnormality in skin surface pH. Although the underlying mechanism(s) remains unknown, the resultant improvement in SC pH could significantly impact epidermal function by acidification-induced increase in β- glucocerebrosidase and sphingomyelinase activity, which also correlated with accelerated maturation of SC extracellular lamellar bilayers. Thus, a reduced SC pH likely represents another mechanism by which hesperidin prevents the emergence of GC -induced permeability barrier abnormalities.
[0216] pH and Stratum Corneum Acidification and Sources of the Acid Mantle. The acid mantle refers to the highly acidic film of the SC that acts as a deterrent to the entry of bacteria, viruses and other potential contaminants that might penetrate the skin. Although the acid mantle initially was assumed to result from exogenous acidic sources, such as sebum-derived free fatty acids, instead it has now been unexpectedly observed that several endogenous acidifying mechanisms account for up to 2 pH units (a 200-fold increase in protons) of the overall pH of the stratum corneum (SC) (Table 1).
[0217] Table 1. Impact of Endogenous Acidifying Mechanisms on SC Acidification & Epidermal Functions. Abbreviations: Choi, cholesterol; CS04, cholesterol sulfate; FFA, free fatty acid; FLG, filaggrin; NHE1, Na+/H+ antiporter 1 ; PCA, polycarboxylic acid ; PL, phospholipids; S04, sulfate; t-UCA, trans-urocanic acid.
Figure imgf000093_0001
[0218] The sodium-protein antiporter, type 1 (NHE1), which selectively acidifies extracellular domains at the stratum granulosum (SG)/SC interface, accounts for ca. 4 unit of the bulk pH of the SC. This critically-important site is where sphingomyelin and glucosylceramides are processed by the acidic pH-dependent enzymes, acidic sphingomyelinase (aSMase) and β- glucocerebrosidase (β-GlcCer'ase) into ceramides, thereby generating the permeability barrier.
[0219] Further, secretory phospholipase (sPLA2) releases free fatty acids (FFA) from the sn.2 position of glycerophospholipids (PL). While one subset of sPLA2 releases arachidonic acid that is subsequently converted to eicosanoids, other sPLA2 release FFAs that are required for permeability barrier homeostasis and SC acidification (« 1 pH unit), but only the PLA2G2F isoform is regulated and required for permeability barrier homeostasis. Notably, Pla2g2f knock out mice display an elevated SC pH, again demonstrating that PL hydrolysis to FFA accounts for ca. l unit of SC pH.
[0220] Deimination of amino acid constituents of filaggrin (FLG) generates abundant polycarboxylic acids (PCA) that contribute to SC pH, demonstrated by the ca. V2 pH unit increase in pH in FLG-deficient (non-inflammatory) ichthyosis vulgaris. Within the FLG→ PCA mechanism, the generation of trans-urocanic acid (tUCA) from histidine, which comprises about 10% of FLG, is a major contributor to pH. However, histidase-deficient (Peruvian) mice do not display a defect in SC acidity, because they upregulate NHE1 in a compensatory fashion. Finally, the pH of darkly-pigmented human epidermis is ca. V2 pH unit lower (50-fold more acidic) than the SC of lightly-pi gmented skin, due in part to the persistence and extrusion of melanin granules at the SG-SC interface. The acidic pH of darkly-pigmented skin dictates the superior function in such individuals, because acidification of lightly -pigmented human skin "resets" functions to darkly-pigmented levels. But it is likely that one additional mechanism contributes to SC acidification. Cholesterol sulfate (CS04) is the most abundant and widely distributed of sulfated sterols, and a critical regulator of epidermal differentiation. The CSO4 content of the epidermis climbs to ca. 5% of lipid mass in the SG, due to enhanced expression of the gene that encodes SULT2Blb, the enzyme that sulfonates cholesterol. The hydrolytic enzyme, steroid sulfatase (SSase), then hydrolyzes CSO4 until its levels decline to ca. 1% in the outer SC. In X-linked ichthyosis (XLI), CSO4 levels increase to >10% of lipid mass, and the SC in XLI is more acidic than normal, consistent with the low pKa (3.1) of CSO4. While CSO4 ionization would generate H2SO4 in situ, the ongoing hydrolysis of CSO4 to Choi + S04~ across normal SC could also form H2SO4 in aqueous compartments, perhaps contributing to the selective reduction of pH that persists within extracellular domains at all levels of SC.
[0221] Functions of the Acid Mantle. In addition to antimicrobial defense, pH regulates at \ least three key additional functions of normal skin (Table 1). First, it is critical for epidermal permeability barrier homeostasis, because the hydrolysis of sphingomyelin and
glucosylceramides into ceramides is dependent upon aSMase and β-GlcCer'ase, which display pH optima of ca. 5. Only at the reduced acidity of normal SC can these enzymes generate enough Cer necessary to form lamellar bilayers. Conversely, when the pH of the SC rises with inflammation or under experimental conditions, the activities of these enzymes decline in parallel with a deterioration of permeability barrier function.
[0222] A second cohort of pH-linked functions includes SC integrity (= resistance to stripping), SC cohesion (= protein removed per stripping), and desquamation. At the low pH of normal SC, comeodesmosomes (CD) are slowly, but progressively degraded by serine proteases (kallikreins, KLK), and then more avidly by aspartate and thiol proteases that exhibit acidic pH optima. Conversely, elevations in pH activate KLK, which rapidly degrade CD, accelerating desquamation and compromising SC integrity/cohesion.
[0223] A third pH-linked function is pro-inflammatory cytokine activation. Large pre-formed pools of the 33 kDa precursors of pro-IL-la and pro-IL-Ιβ are stored in the comeocyte cytosol. As the pH of the SC rises with barrier perturbations and in inflammation, KLK activity increases, releasing the active 17 kDa forms of IL-la/IL-Ιβ, which in turn, initiate divergent, downstream cytokine cascades. While repeated insults lead to inflammation, single perturbations instead unleash beneficial, cytokine-initiated, homeostatic responses (e.g., accelerated DNA and lipid synthesis) that help to restore barrier homeostasis.
[0224] Developmental Variations in pH. Full-term neonatal skin exhibits a near-neutral surface pH, with a permeability barrier which, though sufficient for terrestrial life under basal conditions, recovers more slowly than adult skin from acute perturbations. Moreover, adjustment of SC with acidic buffers normalizes barrier function in neonatal rats, and topical PPARa, ΡΡΑί /δ or LXR activators normalize SC pH and epidermal function by increasing sPLA2 activity. Neonatal skin also displays a well-known propensity to blister, likely due to poor SC cohesion, and impaired antimicrobial defense (both pH-dependent functions). Moderately- aged skin (>55 yrs) also suffers from a flawed permeability barrier and impaired SC integrity, in parallel with an elevated SC pH, due to decreased NHEl expression. Again, acidifying the SC normalizes both permeability barrier function and SC integrity/cohesion in moderately-aged mice.
[0225] Pathophysiology of SC pH - Inflammatory Dermatoses. The surface pH of inflamed skin inevitably climbs towards neutrality, an increase which has direct consequences for the pathogenesis of atopic dermatitis (AD) through increased kallikreins (KLK) activity (FIG. 1). It has been shown that repeated topical applications of the universal hapten, oxazolone, produces an AD-like dermatoses (Ox-AD) in hairless mice in parallel with emergence of an elevated SC pH and a progressive barrier abnormality. It has also been shown that additional topical and aerosol applications of dust mite antigens further aggravate the Ox-AD dermatoses, ultimately yielding the next temporal component of the atopic diathesis; i.e., asthma.
Importantly, maintenance of an acidic SC pH not only prevents the emergence of AD, but also the later, asthmatic component of the 'atopic march.' Notably, these studies teach us that AD and the atopic march can develop with repeated insults that compromise barrier function, even against a normal genetic background. It seems highly likely that pH plays a key role in the pathogenesis not only of AD, but likely also in other inflammatory dermatoses.
[0226] With regard to the antimicrobial characteristics of the inventive compositions, both the low pH and the free fatty acids in the formulation inhibit the growth of microbial pathogens, such as S. aureus, and repair of the barrier also provides a formidable barrier to the penetration of pathogens. We have also shown that applications of the triple lipid mixture enhance the production and secretion of antimicrobial peptides, such as the cathelicidin, LL-37, and human beta-defensin 2.
[0227] As discussed above, epidermal cholesterol biosynthesis has been shown to be essential for maintaining the cutaneous barrier function. One known side effect of oral statin and hypolipodemic agents is dry skin, or acquired ichthyosis resulting from lowered dermal cholesterol concentrations. For example, lovastatin, an inhibitor of cholesterol biosynthesis, produces a barrier defect when applied to normal epidermis. After lovastatin is applied, cholesterol synthesis rapidly normalizes, but fatty acid synthesis remains elevated. This indicates that a disturbance in the new fatty acid: cholesterol molar ratio accounts for the perturbed barrier function. The statin-induced alteration of the permeability of the epidermal barrier can manifest as excessive scale, cheilitis, eczemas, or acquired ichthyosis.
[0228] Additionally we treated skin of the left ventral and dorsal forearms of 5 normal, moderately-aged human subjects twice-daily with 2% hesperidin formulation (plus a 1.5% cholesterol-dominant version of the UC patent-protected barrier repair technology) in a standard oil-in-water vehicle. The ventral (flexor) surface represents chronologically-aged (CA) skin with little photoaging (PA), while the extensor surface reflects substantial PA, superimposed on CA. All 5 of the normal subjects exhibited pigment type II skin (Fitzpatrick scale of I [= redheads, always burn] to VI [= very darkly -pigmented skin, never burns, comparable to Bushmen of Sub- Saharan Africa]).
[0229] The visual results, as reported in FIGS. 3A-3C, on both chronologically (CA) and photoaged (PA) skin were striking - signs of both CA and PA, such as xerotic scaling, atrophy (skin thinning) and ecchymoses, largely disappeared in sites treated with the hesperidin- containing, barrier repair formulation. These grossly apparent changes were paralleled by marked improvements in epidermal function, including a striking improvement in stratum corneum hydration (FIG. 3B), as well as moderate benefits for basal barrier function (FIG. 3A; p<0.1). But most striking were the benefits for PA skin, reflected by changes in cutaneous resonance running time (CRRT) (FIG. 3C; p<0.02). These last results strongly suggest that the hesperidin-containing formulation penetrates through the epidermis, improving the organization of collagen fibers and other structural elements in PA human skin.
[0230] Experimental protocols and functional studies. All animal procedures were approved by the Animal Studies Subcommittee (IACUC) of the San Francisco Veterans Administration Medical Center and performed in accordance with their guidelines. Since hesperidin is not soluble in 100% ethanol, 70% ethanol was used as vehicle. Since the tumover time for hairless is about 9.5 days in normal young mice, we chose to treat aged mice for 9 days. Both flanks of 12- 15 month old mice were treated topically with 60 μΐ of 2% hesperidin or 70% ethanol twice daily for 9 days. Basal epidermal permeability barrier function was assessed by measuring
transepidermal water loss (TEWL) using TM300 connected to MPA5 (C&K, Cologne,
Germany). For barrier recovery, TEWL was measured using an electrolytic water analyzer (Meeco, Warrington, PA) at 0, 2 and 4 hours after tape stripping (10-fold increase in TEWL), and percent barrier recovery was calculated.
[0231] Keratinocyte Culture. Second-passage keratinocytes isolated from adult human (donor aged 60-65 year old) were cultured in serum-free keratinocyte growth medium containing 0.07 mM calcium (Clonetics, San Diego, California). Cells at 60%-70% confluence were switched to a medium containing 1.2 mM calcium and treated with either 0.02% hesperidin or vehicle alone (0.02% ethanol). After 24 and 48 hrs of treatment, keratinocytes were collected for Q-PCR analysis. [0232] Immunohistochemistry. Immunohistochemical staining for assessing changes in epidermal differentiation was performed as follows. Briefly, 5 μιτι paraffin sections were incubated with the primary antibodies (Covance, Emeryville, CA) overnight at 4°C. After washes χ3, sections were incubated with the secondary antibody for 30 minutes. Staining was detected with ABC-peroxidase kit from Vector Lab (Burlingame, CA). Sections were examined with a Zeiss fluorescence microscope (Jena, Germany) and digital images were captured with AxioVision software (Carl Zeiss Vision, Munich, Germany). [0233] Q-PCR for mRNA expression. Total RNA was isolated from cultured human keratinocytes using TRI Reagent (Sigma). First strand cDNA was synthesized from lug of total RNA with the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). The real-time PCR contained 20 ng of reversed transcribed total RNA, 450 nM forward and reverse primers, and 10 μΐ of 2* LightCycler 480 SYBR Green I Master in a final volume of 20 μΐ in 96-well plates using Mx3000PTM Real-time PCR System (Stratagene, La Jolla, CA). Quantification was performed by the comparative CT method with 36B4 or Cyclophilin A used for normalization. The primers for lipid synthetic enzymes such as 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCoA), serine-palmitoyl transferase 1 (SPT1), fatty acid synthase (FAS), lipid transporters (ATP- binding cassette A12 (ABCA12)), mouse beta defensin 3 (mBD3), sodium-hydrogen exchanger 1(NHE1), secretary phospholipase A2g2f (sPLA2g2f), filaggrin, involucrin, loricrin and Cyclophilin A are listed in Primer Table 2. Relative expression of the mRNAs compared to control mRNA was calculated. Data are expressed as percentage of control (as 100%).
[0234] Electron Microscopy. Skin biopsies from both vehicle and hesperidin-treated mice were taken for electron microscopy. Briefly, samples were minced to <0.5 mm3, fixed in modified Kamovsky's fixative overnight, and post-fixed in either 0.2% ruthenium tetroxide or 1% aqueous osmium tetroxide, containing 1.5% potassium ferrocyanide. After fixation, all samples were dehydrated in a graded ethanol series, and embedded in an Epon-epoxy mixture. Ultrathin sections were examined, with or without further contrasting with lead citrate, in a Zeiss 10A electron microscope (Carl Zeiss, Thomwood, NJ), operated at 60 kV. [0235] Measurement of Lamellar Body Density and Secretion. LB numbers were determined in granular cells two to three layers below the stratum granulosum-stratum corneum(SG-SC) junction as previously described. The number of LBs was counted at 4800 magnification using a calibrated grid. Total 10 random pictures from each biopsy sample were assessed. For quantification of LB secretion, number of LB protrusion at the SG-SC junction were measured at a magnification of 5800 and correlated with the length of the bottom surface of the first SC layer on 10 random images at 5800 magnification. [0236] Statistics. Data are expressed as the mean + SEM. GraphPad Prism 4 software (San Diego, CA, USA) was used for all statistical analyses. Unpaired two-tailed student's /-test with Welch's correction was used to determine the statistical significances when two groups were compared. One-Way ANOVA with Tukey correction was used when three or more groups were compared.
[0237] Primer Table 2.
Forward 5' GCCGTGAACTGGGTCGA 3 ' SEQ ID NOT
Mouse HMGCoA Reverse 5' GCATATATAGCAATGTCTCCTGC 3' SEQ ID NO:2
Forward 5' AGGGTTCTATGGCACATTTGATGT 3' SEQ ID NO:3
Mouse SPT1 Reverse 5' TGGCTTCTTCGGTCTTCATAAAC 3' SEQ ID NO:4
Forward 5 ' GCTGCGGAAACTTC AGGAAAT3 ' SEQ ID NO:5
Mouse FAS Reverse 5 'AGAGACGTGTCACTCCTGGACTT3 ' SEQ ID NO:6
Forward 5' ACAGGAATGGCCTTCATCAC 3' SEQ ID NO:7 h/m ABCA12 Reverse 5' AACATGGTGCCCTGAGAAAC 3' SEQ ID NO:8
Forward 5 ' CCATCATGGATCTGCGTGG 3 ' SEQ ID NO:9
Human Filaggrin Reverse 5' CACGAGAGGAAGTCTCTGCGT 3' SEQ ID NO: 10
Forward 5' TGACAGCCAAGTCC ATTCTG 3 ' SEQ ID NO: 11
Mouse Filaggrin Reverse 5' TATCCTCCCTGACCACTTGC 3' SEQ ID NO: 12
Forward 5' CTGCCTGAGCAAGAATGTGA 3 ' SEQ ID NO: 13
Human Involucrin Reverse 5' TGCTCTGGGTTTTCTGCTTT 3' SEQ ID NO: 14
Forward 5' AAGGGCTTTCCC AAAC ATGA 3 ' SEQ ID NO: 15
Mouse Involucrin Reverse 5' TGCTGGTGCTCACACTTTTGA 3 ' SEQ ID NO: 16
Forward 5' GTGGAAAGACCTCTGGTGGA 3' SEQ ID NO: 17
Mouse Loricrin Reverse 5' TGGAACC ACCTCC AT AGGAA 3 ' SEQ ID NO: 18
Forward 5' CCTAGCAGCTATGAGGATCCAT 3' SEQ ID NO: 19
Human BD3 Reverse 5' CTTCGGCAGCATTTTCG 3' SEQ ID NO:20
Forward 5' TCTGTTTGCATTTCTCCTGGT 3' SEQ ID NO:21
Mouse BD3 Reverse 5' GGAACTCCACAACTGCCAAT 3' SEQ ID NO:22
Forward 5' GCTAACCTCTACCGCCTCCT 3' SEQ ID NO:23
Human CAMP Reverse 5' GGTCACTGTCCCCATACACC 3' SEQ ID NO:24
Forward 5' TGAGCCCCAAGGGGACGAGG 3' SEQ ID NO:25
Mouse CAMP Reverse 5' GCCGGGTTCAGGGTGACTGC 3' SEQ ID NO:26
Forward 5' TCTCCTTTGAGCTGTTTGCAG 3' SEQ ID NO:27
Human CycloA Reverse 5' CACCACATGCTTGCCATC 3' SEQ ID NO:28
Forward 5' GCGACCTGGAAGTCCAACTAC 3' SEQ ID NO:29 h/m 36B4 Reverse 5' ATCTGCTGCATCTGCTTGG 3 ' SEQ ID NO:30
Forward 5'- TTTCCCCGATTTCCTTCTCT - 3' SEQ ID NO:31
Mouse NHE1 Reverse 5'- GCGTGTAAGACCTGGGACAT - 3' SEQ ID NO:32
Forward 5'- CCCCATCCAGTCCTTAGTCA -3' SEQ ID NO:33
Mouse sPLA2g2f Reverse 5'- ACTTCTGGGCAGGAGTCAGA -3' SEQ ID NO:34 Forward 5 'CGAGTCAACGGATTTGGTCGTA3 ' SEQ ID NO:35
Human GAPDH Reverse 5 ' GC AAC AAT ATCC ACTTT ACC AGAGTT AA3 ' SEQ ID NO:36
Example of a topical composition
Raw Material % Range By Weight Injji edieiU 1- unction
Cholesterol 1.0
Barrier Lipid
Dimethicone 1.83
Skin Conditioner
Disodium EDTA 0.10
Chelating Agent
Glycerin 10%
Humectant
Hydroxypropyl Bispalmitamic
ie 1.0
MEA (Ceramide PC-104)
Barrier Lipid
Conjugated Linoleic Acid 0.25
Barrier Lipid
Glyceryl Stearate PEG-100 1.59
Emulsifier
Petrolatum 2.00
Emollient
Phenoxyethanol 0.70
Preservative
Squalane 2.5
Emollient
Citric Acid >0.5 (to reduce pH to 3-5)
Buffer
Sorbic Acid 0.10
Preservative
Corn Syrup Solids (A blend c
3f 7.02
HI-CAP 10 and HI-CAP 20)
Encapsulation Aid
Euphorbia Cerifera (Candelil
la) 0.78
Wax
Encapsulation Aid
Xanthan Gum 0.22
Aqueous phase thickener
Purified USO Grade Water QS to 100
Diluent
Hesperidin 2.0
Anti- aging
[0238] The lipids may be diluted to determine whether the impact of hesperidin could be separated out, and whether a potential cost saving could be achieved by lowering the amount of ceramide needed. It was observed that the dilute mixture does very well for improving barrier function (accelerates barrier recovery and lowers basal TEWL levels). It was noted that hesperidin significantly improved (lowered) pH when added to the triple lipid mixture.
[0239] Example preparation of a topical composition: The active ingredients are solubilized in preparation for topical application in organic solvents suitable for dermal application, such as ethanol, aqueous ethanol, acetone, aqueous acetone, or combinations of acetone and ethanol, with or without water. Mixtures of propylene glycol and ethanol or propylene glycol and aqueous ethanol are also suitable. Alternatively, mild detergents, such as MIRANOL®, can be used to solubilize the mixture of active ingredients.
[0240] The composition includes a cholesterol-dominant lipid mixture plus hesperidin for the use on aged mice: 18-Month old mice were divided into groups of untreated, lipid mixture + vehicle (70% ethanol) treated, and lipid mixture + 2% hesperidin treated. Mice are treated twice daily for 7 days. All measurements are carried out with a MPA5 physiology monitor. Lipid mixture contained cholesterol, fatty acid and ceramide (3: 1 : 1 molar ratio, with cholesterol at 3 moles) at a concentration of 0.74 wt%. Data are normalized to untreated control, setting untreated as 100%.
[0241] The specific examples disclosed above are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. Without further elaboration, it is believed that one skilled in the art can, based on the description herein, utilize the present invention to its fullest extent. [0242] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0243] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the scope of the present claims.
[0244] All publications cited herein are hereby incorporated by reference in their entirety.
Embodiments
Embodiment PI. A topical composition for treating dry skin or skin suffering an abnormal epidermal barrier function, said composition comprising: a) about 1 to about 50 wt% of cholesterol;
b) about 0.01 to about 5 wt% of an acid buffer; and
c) about 0.001 to about 50 wt% of hesperidin;
wherein the pH of said topical composition is about 3 to about 5.5.
Embodiment P2. A topical composition for treating aged skin, said composition comprising: a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
b) about 0. 1 to about 10 wt% of a skin conditioner;
c) about 0.001 to about 5 wt% of a chelating agent;
d) about 1 to about 30 wt% of a humectant;
e) about 0.5 to about 20 wt% of an emulsifier;
f) one or more emollients in a total of about 1 to about 30 wt%;
g) one or more preservatives in a total of about 0.1 to about 10 wt%;
h) about 0.01 to about 5 wt% of an acid buffer;
i) one or more encapsulation aids in a total of about 1 to about 25 wt%;
j) about 0.01 to about 3 wt% of an aqueous phase thickener; and
k) about 0.001 to about 50 wt% of hesperidin. Embodiment P3. The composition of Embodiment P2, wherein said mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
Embodiment P4. The composition of Embodiment P2 or P3, wherein said skin conditioner comprises dimethicone, said chelating agent comprises disodium EDTA, said humectant comprises glycerin, and said acid buffer comprises citric acid.
Embodiment P5. The composition of any one of Embodiments P2 to P4, wherein said emulsifier comprises glyceryl stearate PEG- 100.
Embodiment P6. The composition of any one of Embodiments P2 to P5, wherein said one or more emollients comprise petrolatum and squalane. Embodiment P7. The composition of any one of Embodiments P2 to P6, wherein said one or more preservatives comprise phenoxyethanol and sorbic acid. Embodiment P8. The composition of any one of Embodiments P2 to P7, wherein said one or more encapsulation aids comprise com syrup solids and euphorbia cerifera (candelilla) wax. Embodiment P9. The composition of any one of Embodiments P2 to P8, wherein said aqueous phase thickener comprises xanthan gum.
Embodiment PIO. The composition of any one of Embodiments P2 to P9, wherein the pH of said topical composition is about 3 to about 5.5.
Embodiment Pl l. The composition of any one of Embodiments P2 to PIO, wherein said molar ratio of cholesterol: ceramide:free fatty acid is 3: 1: 1.
Embodiment PI 2. The composition of any one of Embodiments P2 to PI 1, wherein cholesterol is present in about 0.1 to about 10 wt%.
Embodiment PI 3. The composition of any one of Embodiments P2 to PI 2, wherein said ceramide is present in about 0.1 to about 10 wt%.
Embodiment P14. The composition of any one of Embodiments P2 to P13, wherein said free fatty acid is present in about 0.01 to about 6 wt%.
Embodiment P15. The topical composition for treating aged skin of Embodiment P2, said composition consisting of:
a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids;
b) about 0.1 to about 10 wt% of a skin conditioner;
c) about 0.001 to about 5 wt% of a chelating agent;
d) about 1 to about 30 wt% of a humectant;
e) about 0.5 to about 20 wt% of glyceryl stearate PEG- 100 emulsifier;
f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane;
g) about 0.1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid;
h) about 0.01 to about 5 wt% of citric acid;
i) about 1 to about 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax;
j) about 0.01 to about 3 wt% of an aqueous phase thickener;
k) about 0.001 to about 50 wt% of hesperidin; and
1) water.
Embodiment PI 6. An anti -inflammatory composition comprising: a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
b) about 0.001 to about 50 wt% of hesperidin;
c) about 0.01 to about 5 wt% of an acid buffer; and
d) about 0.001 to about 5% of at least one glucocorticoid.
Embodiment PI 7. A method of treating aged skin, comprising administering said topical composition of any one of Embodiments PI to PI 6 to at least a portion of aged skin, in an amount effective to relieve or reverse clinical indications of skin aging.
Embodiment PI 8. The method of Embodiment PI 7, wherein the clinical indications of skin aging are selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
Embodiment PI 9. A method of preventing or reversing dermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with said topical composition of any one of Embodiments PI to PI 6, in an amount effective to prevent or reverse dermal clinical indications of glucocorticoid treatment.
Embodiment P20. The method of Embodiment PI 9, wherein said dermal clinical indications of glucocorticoid treatment are selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
Embodiment P21. A method of treating inflammation comprising administering an effective amount of the anti-inflammatory composition of Embodiment P16 to at least a portion of affected skin in need thereof.
Embodiment P22. A method for the treatment of dry skin and/or abnormal epidermal barrier function associated with oral hypolipodemic agent treatment, comprising administering said topical composition of Embodiment PI or Pl l to at least a portion of affected skin of a subject, in an amount effective to relieve or reverse clinical indications of hypolipodemic treatment.
Embodiment P23. The method of Embodiment P22, wherein the subject has taken a
hypolipodemic agent or is expected to receive such treatment.
Embodiment P24. A composition comprising cholesterol and hesperidin, wherein:
(i) said composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 moles; or
(ii) the pH of the composition is between about 3 to about 5.5. Embodiment P25. The composition of Embodiment P24, comprising about 1 to about 50 wt% of total cholesterol.
Embodiment P26. The composition of one of Embodiments P24 to P25 comprising about 0.001 to about 50 wt% of hesperidin.
Embodiment P27. The composition of one of Embodiments P25 to P26, comprising about 0.1 to about 10 wt% total ceramide.
Embodiment 28. The composition of one of Embodiments P25 to P27, comprising about 0.01 to about 6 wt% total free fatty acid.
Embodiment P29. The composition of one of Embodiments P24 to P28, comprising about 0.01 to about 5 wt% of acid buffer.
Embodiment P30. The composition of one of Embodiments P24 to P29, further comprising a skin conditioner.
Embodiment P31. The composition of Embodiment P30, comprising about 0.1 to about 10 wt% of the skin conditioner.
Embodiment P32. The composition of one of Embodiments P30 to P31, wherein the skin conditioner is dimethicone.
Embodiment P33. The composition of one of Embodiments P24 to P32, further comprising a chelating agent.
Embodiment P34. The composition of Embodiment P33, comprising about 0.001 to about 5 wt% of the chelating agent.
Embodiment P35. The composition of one of Embodiments P33 to P34, wherein the chelating agent is disodium EDTA.
Embodiment P36. The composition of one of Embodiments P24 to P35, further comprising a humectant.
Embodiment P37. The composition of Embodiment P36, comprising about 1 to about 30 wt% of the humectant.
Embodiment P38. The composition of one of Embodiments P36 to P37, wherein the humectant is glycerin.
Embodiment P39. The composition of one of Embodiments P24 to P38, further comprising an emulsifier.
Embodiment P40. The composition of Embodiment P39, comprising about 0.5 to about 20 wt% of the emulsifier. Embodiment P41. The composition of one of Embodiments P38 to P39, wherein the emulsifier is glyceryl stearate PEG-100.
Embodiment P42. The composition of one of Embodiments P24 to P41, further comprising an emollient.
Embodiment P43. The composition of Embodiment P42, comprising about 1 to about 30 wt% of the emollient.
Embodiment P44. The composition of one of Embodiments P42 to P43, wherein the emollient is petrolatum.
Embodiment P45. The composition of one of Embodiments P42 to P43, wherein the emollient is squalane.
Embodiment P46. The composition of one of Embodiments P24 to P45, further comprising a preservative.
Embodiment P47. The composition of Embodiment P46, comprising about 0.1 to about 10 wt% of the preservative.
Embodiment P48. The composition of one of Embodiments P46 to P47, wherein the preservative is phenoxyethanol.
Embodiment P49. The composition of one of Embodiments P46 to P47, wherein the preservative is sorbic acid.
Embodiment P50. The composition of one of Embodiments P24 to P49, further comprising an encapsulation aid.
Embodiment P51. The composition of Embodiment P50, comprising about 1 to about 25 wt% of the encapsulation aid.
Embodiment P52. The composition of one of Embodiments P50 to P51, wherein the
encapsulation aid is euphorbia cerifera (candelilla) wax.
Embodiment P53. The composition of one of Embodiments P50 to P51, wherein the
encapsulation aid is corn syrup solids.
Embodiment P54. The composition of one of Embodiments P24 to P53, further comprising an aqueous phase thickener.
Embodiment P55. The composition of Embodiment P54, comprising about 0.01 to about 3 wt% of the aqueous phase thickener.
Embodiment P56. The composition of one of Embodiments P54 to P55, wherein the aqueous phase thickener is xanthan gum. Embodiment P57. The composition of one of Embodiments P24 to P56, wherein the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC-104).
Embodiment P58. The composition of one of Embodiments P24 to P57, wherein the free fatty acid is conjugated linoleic acid (CLA).
Embodiment P59. The composition of one of Embodiments P24 to P58, further comprising a glucocorticoid.
Embodiment P60. The composition of Embodiment P59, comprising about 0.001 to about 5 wt% of the glucocorticoid.
Embodiment P61. The composition of one of Embodiments P24 to P60, wherein the composition is a topical composition.
Embodiment P62. The composition of one of Embodiments P24 to P61 for use in treating dry skin in a subject in need thereof.
Embodiment P63. The composition of one of Embodiments P24 to P61 for use in treating abnormal epidermal barrier function in a subject in need thereof.
Embodiment P64. The composition of one of Embodiments P24 to P61 for use in treating an inflammatory condition in a subject in need thereof.
Embodiment P65. The composition of one of Embodiments P24 to P61 for use in treating a clinical indication of skin aging in a subject in need thereof.
Embodiment P66. The composition of Embodiment P65, wherein the clinical indication of skin aging is eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
Embodiment P67. The composition of one of Embodiments P24 to P61 for use in treating a dermal clinical indication of glucocorticoid treatment in a subj ect in need thereof.
Embodiment P68. The composition of Embodiment P67, wherein the dermal clinical indication of glucocorticoid treatment is inflammation, tachyphylaxis, disease flares, or rebound flares. Embodiment P69. The composition of one of Embodiments P24 to P61 for use in treating a clinical indication of hypolipodemic treatment in a subject in need thereof.
ADDITIONAL EMBODIMENTS
Embodiment 1. A topical composition, the composition comprising:
a) about 1 to about 50 wt% of cholesterol;
b) about 0.01 to about 5 wt% of an acid buffer; and
c) about 0.001 to about 50 wt% of hesperidin;
wherein the pH of the topical composition is from about 3 to about 5.5. Embodiment 2. The composition of Embodiment 1, wherein the composition is capable of treating dry skin or skin suffering an abnormal epidermal barrier function.
Embodiment 3. A topical composition, the composition comprising:
a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
b) about 0. 1 to about 10 wt% of a skin conditioner;
c) about 0.001 to about 5 wt% of a chelating agent;
d) about 1 to about 30 wt% of a humectant;
e) about 0.5 to about 20 wt% of an emulsifier;
f) one or more emollients in a total of about 1 to about 30 wt%;
g) one or more preservatives in a total of about 0.1 to about 10 wt%;
h) about 0.01 to about 5 wt% of an acid buffer;
i) one or more encapsulation aids in a total of about 1 to about 25 wt%;
j) about 0.01 to about 3 wt% of an aqueous phase thickener; and
k) about 0.001 to about 50 wt% of hesperidin.
Embodiment 4. The composition of Embodiment 3, wherein the composition is capable of treating aged skin.
Embodiment 5. The composition of one of Embodiment 3 or 4, wherein the mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
Embodiment 6. The composition of any one of Embodiments 3 to 5, wherein the skin conditioner comprises dimethicone, the chelating agent comprises disodium EDTA, the humectant comprises glycerin, and the acid buffer comprises citric acid.
Embodiment 7. The composition of any one of Embodiments 3 to 6, wherein the emulsifier comprises glyceryl stearate PEG-100.
Embodiment 8. The composition of any one of Embodiments 3 to 7, wherein the one or more emollients comprise petrolatum and squalane.
Embodiment 9. The composition of any one of Embodiments 3 to 8, wherein the one or more preservatives comprise phenoxyethanol and sorbic acid.
Embodiment 10. The composition of any one of Embodiments 3 to 9, wherein the one or more encapsulation aids comprise com syrup solids and euphorbia cerifera (candelilla) wax. Embodiment 11. The composition of any one of Embodiments 3 to 10, wherein the aqueous phase thickener comprises xanthan gum.
Embodiment 12. The composition of any one of Embodiments 3 to 1 1, wherein the pH of the topical composition is from about 3 to about 5.5.
Embodiment 13. The composition of any one of Embodiments 3 to 12, wherein the molar ratio of cholesterol: ceramide:free fatty acid is 3: 1 : 1.
Embodiment 14. The composition of any one of Embodiments 3 to 13, wherein cholesterol is present in about 0. 1 to about 10 wt%.
Embodiment 15. The composition of any one of Embodiments 3 to 14, wherein the ceramide is present in about 0.1 to about 10 wt%.
Embodiment 16. The composition of any one of Embodiments 3 to 15, wherein the free fatty acid is present in about 0.01 to about 6 wt%.
Embodiment 17. The topical composition of Embodiment 4, the composition consisting of: a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids;
b) about 0. 1 to about 10 wt% of a skin conditioner;
c) about 0.001 to about 5 wt% of a chelating agent;
d) about 1 to about 30 wt% of a humectant;
e) about 0.5 to about 20 wt% of glyceryl stearate PEG- 100 emulsifier;
f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane; g) about 0. 1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid;
h) about 0.01 to about 5 wt% of citric acid;
i) about 1 to about 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax;
j) about 0.01 to about 3 wt% of an aqueous phase thickener;
k) about 0.001 to about 50 wt% of hesperidin; and
1) water.
Embodiment 18. A composition comprising:
a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
b) about 0.001 to about 50 wt% of hesperidin;
c) about 0.01 to about 5 wt% of an acid buffer; and d) about 0.001 to about 5% of at least one glucocorticoid.
Embodiment 19. The composition of Embodiment 18, the composition is an antiinflammatory composition.
Embodiment 20. A method of treating aged skin, comprising administering the topical composition of any one of Embodiments 1 to 19 to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
Embodiment 21. The method of Embodiment 20, wherein the clinical indication of skin aging is selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
Embodiment 22. A method of preventing or reversing dermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with the topical composition of any one of Embodiments 1 to 19, in an amount effective to prevent or reverse a dermal clinical indication of glucocorticoid treatment.
Embodiment 23. The method of Embodiment 22, wherein the dermal clinical indication of glucocorticoid treatment is selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
Embodiment 24. A method of treating inflammation comprising administering an effective amount of the composition of one of Embodiments 1 to 19 to at least a portion of affected skin in need thereof.
Embodiment 25. A method for the treatment of dry skin and/or abnormal epidermal barrier function associated with oral hypolipodemic agent treatment, comprising administering the topical composition of Embodiment 1 or 19 to at least a portion of affected skin of a subj ect, in an amount effective to relieve or reverse a clinical indication of hypolipodemic treatment.
Embodiment 26. The method of Embodiment 25, wherein the subj ect has been administered a hypolipodemic agent or is co-administered with a hypolipodemic agent.
Embodiment 27. A composition comprising cholesterol and hesperidin, wherein:
(i) the composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 moles; or
(ii) the pH of the composition is from about 3 to about 5.5.
Embodiment 28. The composition of Embodiment 27, wherein:
(i) the composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesteroktotal ceramide:total free fatty acid is about 3: 1 : 1 moles; and (ii) the pH of the composition is from about 3 to about 5.5.
Embodiment 29. The composition of Embodiment 27, comprising about 1 to about 50 wt% of total cholesterol.
Embodiment 30. The composition of one of Embodiments 27 to 29 comprising about 0.001 to about 50 wt% of hesperidin.
Embodiment 31. The composition of one of Embodiments 27 to 30, comprising about 0.1 to about 10 wt% total ceramide.
Embodiment 32. The composition of one of Embodiments 27 to 31, comprising about 0.01 to about 6 wt% total free fatty acid.
Embodiment 33. The composition of one of Embodiments 27 to 32, comprising about 0.01 to about 5 wt% of the acid buffer.
Embodiment 34. The composition of one of Embodiments 27 to 33, further comprising a skin conditioner.
Embodiment 35. The composition of Embodiment 34, comprising about 0.1 to about 10 wt% of the skin conditioner.
Embodiment 36. The composition of one of Embodiments 34 to 35, wherein the skin conditioner is dimethicone.
Embodiment 37. The composition of one of Embodiments 27 to 36, further comprising a chelating agent.
Embodiment 38. The composition of Embodiment 37, comprising about 0.001 to about 5 wt% of the chelating agent.
Embodiment 39. The composition of one of Embodiments 37 to 38, wherein the chelating agent is disodium ethylenediaminetetraacetic acid (EDTA).
Embodiment 40. The composition of one of Embodiments 27 to 39, further comprising a humectant.
Embodiment 41. The composition of Embodiment 40, comprising about 1 to about 30 wt% of the humectant.
Embodiment 42. The composition of one of Embodiments 40 to 41, wherein the humectant is glycerin.
Embodiment 43. The composition of one of Embodiments 27 to 42, further comprising an emulsifier.
Embodiment 44. The composition of Embodiment 43, comprising about 0.5 to about 20 wt% of the emulsifier. Embodiment 45. The composition of one of Embodiments 43 to 44, wherein the emulsifier is glyceryl stearate PEG- 100.
Embodiment 46. The composition of one of Embodiments 27 to 45, further comprising an emollient.
Embodiment 47. The composition of Embodiment 46, comprising about 1 to about 30 wt% of the emollient.
Embodiment 48. The composition of one of Embodiments 46 to 47, wherein the emollient is petrolatum.
Embodiment 49. The composition of one of Embodiments 46 to 47, wherein the emollient is squalane.
Embodiment 50. The composition of one of Embodiments 27 to 49, further comprising a preservative.
Embodiment 51. The composition of Embodiment 50, comprising about 0.1 to about 10 wt% of the preservative.
Embodiment 52. The composition of one of Embodiments 50 to 51, wherein the preservative is phenoxyethanol.
Embodiment 53. The composition of one of Embodiments 50 to 51, wherein the preservative is sorbic acid.
Embodiment 54. The composition of one of Embodiments 27 to 53, further comprising an encapsulation aid.
Embodiment 55. The composition of Embodiment 54, comprising about 1 to about 25 wt% of the encapsulation aid.
Embodiment 56. The composition of one of Embodiments 54 to 55, wherein the encapsulation aid is euphorbia cerifera (candelilla) wax.
Embodiment 57. The composition of one of Embodiments 54 to 55, wherein the encapsulation aid is corn syrup solids.
Embodiment 58. The composition of one of Embodiments 27 to 57, further comprising an aqueous phase thickener.
Embodiment 59. The composition of Embodiment 58, comprising about 0.01 to about 3 wt% of the aqueous phase thickener.
Embodiment 60. The composition of one of Embodiments 58 to 59, wherein the aqueous phase thickener is xanthan gum.
I l l Embodiment 61. The composition of one Embodiments 27 to 60, wherein the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC-104).
Embodiment 62. The composition of one of Embodiments 27 to 61, wherein the free fatty acid is conjugated linoleic acid (CLA).
Embodiment 63. The compositions of one of Embodiments 27 to 62, further comprising a glucocorticoid.
Embodiment 64. The composition of Embodiment 63, comprising about 0.001 to about 5 wt% of the glucocorticoid.
Embodiment 65. The composition of one of Embodiments 27 to 64, wherein the composition is a topical composition.
Embodiment 66. The composition of one of Embodiments 27 to 65, for use in treating dry skin in a subject in need thereof.
Embodiment 67. The composition of one of Embodiments 27 to 65, for use in treating abnormal epidermal barrier function in a subject in need thereof.
Embodiment 68. The composition of one of Embodiments 27 to 65, for use in treating an inflammatory condition in a subject in need thereof.
Embodiment 69. The composition of one of Embodiments 27 to 65, for use in treating a clinical indication of skin aging in a subject in need thereof.
Embodiment 70. The composition of Embodiment 69, wherein the clinical indication of skin aging is eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
Embodiment 71. The composition of one of Embodiments 27 to 65, for use in treating a dermal clinical indication of glucocorticoid treatment in a subj ect in need thereof.
Embodiment 72. The composition of Embodiment 71, wherein the dermal clinical indication of glucocorticoid treatment is inflammation, tachyphylaxis, disease flares, or rebound flares.
Embodiment 73. The composition of one of Embodiments 27 to 65, for use in treating a clinical indication of hypolipodemic treatment in a subject in need thereof.
Embodiment 74. The method of Embodiment 20, wherein the aged skin is photo-aged skin.

Claims

WHAT IS CLAIMED IS: 1. A topical composition, said composition comprising:
a) about 1 to about 50 wt% of cholesterol;
b) about 0.01 to about 5 wt% of an acid buffer; and c) about 0.001 to about 50 wt% of hesperidin;
wherein the pH of said topical composition is from about 3 to about 5.5.
2. The composition of claim 1, wherein the composition is capable of treating dry skin or skin suffering an abnormal epidermal barrier function.
3. A topical composition, said composition comprising:
a) a mixture of barrier lipids selected from the group consisting of cholesterol, at least one ceramide, at least one free fatty acid, and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
b) about 0.1 to about 10 wt% of a skin conditioner;
c) about 0.001 to about 5 wt% of a chelating agent;
d) about 1 to about 30 wt% of a humectant;
e) about 0.5 to about 20 wt% of an emulsifier;
f) one or more emollients in a total of about 1 to about 30 wt%;
g) one or more preservatives in a total of about 0.1 to about 10 wt%; h) about 0.01 to about 5 wt% of an acid buffer;
i) one or more encapsulation aids in a total of about 1 to about 25 wt%; j) about 0.01 to about 3 wt% of an aqueous phase thickener; and k) about 0.001 to about 50 wt% of hesperidin.
4. The composition of claim 3, wherein the composition is capable of treating aged skin.
5. The composition of claim 3, wherein said mixture of barrier lipids consists of cholesterol, hydroxypropyl bispalmitamide MEA (Ceramide PC-104) and conjugated linoleic acid (CLA).
6. The composition of claim 3, wherein said skin conditioner comprises dimethicone, said chelating agent comprises disodium EDTA, said humectant comprises glycerin, and said acid buffer comprises citric acid.
7. The composition of claim 3, wherein said emulsifier comprises glyceryl stearate PEG- 100.
8. The composition of claim 3, wherein said one or more emollients comprise petrolatum and squalane.
9. The composition of claim 3, wherein said one or more preservatives comprise phenoxyethanol and sorbic acid.
10. The composition of claim 3, wherein said one or more encapsulation aids comprise corn syrup solids and euphorbia cerifera (candelilla) wax.
11. The composition of claim 3, wherein said aqueous phase thickener comprises xanthan gum.
12. The composition of claim 3, wherein the pH of said topical composition is from about 3 to about 5.5.
13. The composition of claim 3, wherein the molar ratio of cholesterol:ceramide:free fatty acid is 3: 1 : 1.
14. The composition of claim 3, wherein cholesterol is present in about 0.1 to about 10 wt%.
15. The composition of claim 3, wherein said ceramide is present in about 0.1 to about 10 wt%.
16. The composition of claim 3, wherein said free fatty acid is present in about 0.01 to about 6 wt%.
17. The topical composition of claim 2, said composition consisting of:
a) about 1 to about 50 wt% of a mixture of barrier lipids consisting of cholesterol, one or more ceramides, and one or more free fatty acids;
b) about 0.1 to about 10 wt% of a skin conditioner;
c) about 0.001 to about 5 wt% of a chelating agent;
d) about 1 to about 30 wt% of a humectant;
e) about 0.5 to about 20 wt% of glyceryl stearate PEG- 100 emulsifier; f) about 1 to about 30 wt% of a mixture of emollients consisting of petrolatum and squalane;
g) about 0.1 to about 10 wt% of a mixture of preservatives consisting of phenoxyethanol and sorbic acid;
h) about 0.01 to about 5 wt% of citric acid;
i) about 1 to about 25 wt% of a mixture of encapsulation aids consisting of com syrup solids and euphorbia cerifera (candelilla) wax;
j) about 0.01 to about 3 wt% of an aqueous phase thickener;
k) about 0.001 to about 50 wt% of hesperidin; and
1) water.
18. A composition comprising:
a) a mixture of barrier lipids selected from the group consisting of cholesterol, ceramides, free fatty acids and mixtures of two or more thereof, in a total of about 1 to about 50 wt%;
b) about 0.001 to about 50 wt% of hesperidin;
c) about 0.01 to about 5 wt% of an acid buffer; and d) about 0.001 to about 5% of at least one glucocorticoid.
19. The composition of claim 18, wherein the composition is an anti-inflammatory composition.
20. A method of treating aged skin, comprising administering the topical composition of any one of claims 1 to 19 to at least a portion of aged skin, in an amount effective to relieve or reverse a clinical indication of skin aging.
21. The method of claim 20, wherein said clinical indication of skin aging is selected from the group consisting of eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, and stasis dermatitis.
22. The method of claim 20, wherein the aged skin is photo-aged skin.
23. A method of preventing or reversing dermal side effects of systemic or topical glucocorticoid treatment, comprising treating at least a portion of affected skin with the topical composition of any one of claims 1 to 19, in an amount effective to prevent or reverse a dermal clinical indication of glucocorticoid treatment.
24. The method of claim 23, wherein said dermal clinical indication of glucocorticoid treatment is selected from the group consisting of inflammation, tachyphylaxis, disease flares, and rebound flares.
25. A method of treating inflammation comprising administering an effective amount of the composition of any one of claims 1 to 19 to at least a portion of affected skin of a patient in need thereof.
26. A method of treating dry skin or abnormal epidermal barrier function associated with oral hypolipodemic agent treatment, comprising administering the topical composition of any one of claims 1 to 19 to at least a portion of affected skin of a subj ect, in an amount effective to relieve or reverse a clinical indication of hypolipodemic treatment.
27. The method of claim 26, wherein the subject has been administered a
hypolipodemic agent or is co-administered with a hypolipodemic agent.
28. A composition comprising cholesterol and hesperidin, wherein:
(i) said composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesterol: total ceramide:total free fatty acid is about 3: 1 : 1 moles; or
(ii) the pH of the composition is from about 3 to about 5.5.
29. The composition of claim 28, wherein:
(i) said composition further comprises a ceramide and a free fatty acid wherein the mole ratio of total cholesterol: total ceramide:total free fatty acid is about 3: 1 : 1 moles; and
(ii) the pH of the composition is from about 3 to about 5.5.
30. The composition of claim 28, comprising about 1 to about 50 wt% of total cholesterol.
31. The composition of claim 28 comprising about 0.001 to about 50 wt% of hesperidin.
32. The composition of claim 28, comprising about 0.1 to about 10 wt% total ceramide.
33. The composition of claim 28, comprising about 0.01 to about 6 wt% total free fatty acid.
34. The composition of claim 28, further comprising an acid buffer.
35. The composition of claim 34, comprising about 0.01 to about 5 wt% of the acid buffer.
36. The composition of claim 28, further comprising a skin conditioner.
37. The composition of claim 36, comprising about 0.1 to about 10 wt% of the skin conditioner.
38. The composition of one of claims 36 to 37, wherein the skin conditioner is dimethicone.
39. The composition of claim 28, further comprising a chelating agent.
40. The composition of claim 39, comprising about 0.001 to about 5 wt% of the chelating agent.
41. The composition of one of claims 39 to 40, wherein the chelating agent is disodium ethylenediaminetetraacetic acid (EDTA).
42. The composition of claim 28, further comprising a humectant.
43. The composition of claim 42, comprising about 1 to about 30 wt% of the humectant.
44. The composition of one of claims 42 to 43, wherein the humectant is glycerin.
45. The composition of claim 28, further comprising an emulsifier.
46. The composition of claim 45, comprising about 0.5 to about 20 wt% of the emulsifier.
47. The composition of one of claims 45 to 46, wherein the emulsifier is glyceryl stearate PEG- 100.
48. The composition of claim 28, further comprising an emollient.
49. The composition of claim 48, comprising about 1 to about 30 wt% of the emollient.
50. The composition of one of claims 48 to 49, wherein the emollient is petrolatum.
51. The composition of one of claims 48 to 49, wherein the emollient is squalane.
52. The composition of claim 28, further comprising a preservative.
53. The composition of claim 52, comprising about 0.1 to about 10 wt% of the preservative.
54. The composition of one of claims 52 to 53, wherein the preservative is phenoxyethanol.
55. The composition of one of claims 52 to 53, wherein the preservative is sorbic acid.
56. The composition of claim 28, further comprising an encapsulation aid.
57. The composition of claim 56, comprising about 1 to about 25 wt% of the encapsulation aid.
58. The composition of one of claims 56 to 57, wherein the encapsulation aid is euphorbia cerifera (candelilla) wax.
59. The composition of one of claims 56 to 57, wherein the encapsulation aid is corn syrup solids.
60. The composition of claim 28, further comprising an aqueous phase thickener.
61. The composition of claim 60, comprising about 0.01 to about 3 wt% of the aqueous phase thickener.
62. The composition of one of claims 60 to 61, wherein the aqueous phase thickener is xanthan gum.
63. The composition of claim 28, wherein the ceramide is hydroxypropyl bispalmitamide MEA (Ceramide PC-104).
64. The composition of claim 28, wherein the free fatty acid is conjugated linoleic acid (CLA).
65. The composition of claim 28, further comprising a glucocorticoid.
66. The composition of claim 65, comprising about 0.001 to about 5 wt% of the glucocorticoid.
67. The composition of claim 28, wherein the composition is a topical composition.
68. The composition of claim 28, for use in treating dry skin in a subject in need thereof.
69. The composition of claim 28, for use in treating abnormal epidermal barrier function in a subject in need thereof.
70. The composition of claim 28, for use in treating an inflammatory condition in a subj ect in need thereof.
71. The composition of claim 28, for use in treating a clinical indication of skin aging in a subject in need thereof.
72. The composition of claim 71, wherein said clinical indication of skin aging is eczema, xerosis, xerotic eczema, winter itch, nummular eczema, seborrheic dermatitis, occupational dermatitis, hand eczema, or stasis dermatitis.
73. The composition of claim 28, for use in treating a dermal clinical indication of glucocorticoid treatment in a subject in need thereof.
74. The composition of claim 73, wherein said dermal clinical indication of glucocorticoid treatment is inflammation, tachyphylaxis, disease flares, or rebound flares.
75. The composition of claim 28, for use in treating a clinical indication of hypolipodemic treatment in a subj ect in need thereof.
PCT/US2016/019613 2015-02-25 2016-02-25 Hesperidin-containing compositions and methods for treatment of skin disorders Ceased WO2016138294A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562120682P 2015-02-25 2015-02-25
US62/120,682 2015-02-25

Publications (1)

Publication Number Publication Date
WO2016138294A1 true WO2016138294A1 (en) 2016-09-01

Family

ID=56789181

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/019613 Ceased WO2016138294A1 (en) 2015-02-25 2016-02-25 Hesperidin-containing compositions and methods for treatment of skin disorders

Country Status (2)

Country Link
US (1) US20170020798A1 (en)
WO (1) WO2016138294A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPWO2022168846A1 (en) * 2021-02-03 2022-08-11

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7285504B2 (en) * 2021-10-14 2023-06-02 国立大学法人東海国立大学機構 Scalp condition improving agent and cosmetic containing the same
WO2025122472A1 (en) * 2023-12-04 2025-06-12 Primus Pharmaceuticals, Inc. Emollient compositions comprising linoleic acid and conjugated linoleic acid and methods of use

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040219177A1 (en) * 2003-04-29 2004-11-04 Jacobs Randy J. Depleted skin barrier replenishing skin creams composition and method of application
US20120121737A1 (en) * 2009-04-09 2012-05-17 Symrise Ag Compositions comprising trans-tert-butyl cyclohexanol as skin irritation-reducing agent
US20140120141A1 (en) * 2011-03-25 2014-05-01 Lipotec S.A. Peptides useful in the treatment and care of the skin and mucous membranes and their use in cosmetic or pharmaceutical compositions
US20140378547A1 (en) * 2011-09-30 2014-12-25 Perio Sciences, Llc Antioxidant compositions for treatment of inflammation or oxidative damage

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2920301B1 (en) * 2007-09-04 2009-12-04 Oreal USE OF AN ASSOCIATION HESPERIDINE AND MICROORGANISM FOR THE TREATMENT OF DROUGHT KERATINIC MATERIAL.

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040219177A1 (en) * 2003-04-29 2004-11-04 Jacobs Randy J. Depleted skin barrier replenishing skin creams composition and method of application
US20120121737A1 (en) * 2009-04-09 2012-05-17 Symrise Ag Compositions comprising trans-tert-butyl cyclohexanol as skin irritation-reducing agent
US20140120141A1 (en) * 2011-03-25 2014-05-01 Lipotec S.A. Peptides useful in the treatment and care of the skin and mucous membranes and their use in cosmetic or pharmaceutical compositions
US20140378547A1 (en) * 2011-09-30 2014-12-25 Perio Sciences, Llc Antioxidant compositions for treatment of inflammation or oxidative damage

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FEINGOLD ET AL.: "Cholesterol Synthesis Is Required for Cutaneous Barrier Function in Mice", JOURNAL OF CLINICAL INVESTIGATION, vol. 86, 1990, pages 1738 - 1745 *
MAN ET AL.: "Topical hesperidin prevents glucocorticoid-induced abnormalities in epidermal barrier function in murine skin", EXPERIMENTAL DERMATOLOGY, vol. 23, no. 9, 2014, pages 645 - 651 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPWO2022168846A1 (en) * 2021-02-03 2022-08-11

Also Published As

Publication number Publication date
US20170020798A1 (en) 2017-01-26

Similar Documents

Publication Publication Date Title
JP5010775B2 (en) Use of ellagic acid and its derivatives in cosmetics and dermatology
US10131717B2 (en) Topically administered, skin-penetrating glycosaminoglycan formulations suitable for use in cosmetic and pharmaceutical applications
WO2001078706A2 (en) Treatment of hyperproliferative, inflammatory and related mucocutaneous disorders using inhibitors of mevalonate synthesis and metabolism
US20100080768A1 (en) Compositions and Methods for the Treatment of Inflammatory Dermatosis and Other Pathological Conditions of the Skin
TW457094B (en) Topical composition for enhancing lipid barrier synthesis
CN112118856A (en) Topical skin care composition containing selected triterpenes of Centella asiatica
WO2002072082A1 (en) Therapeutic composition for broad spectrum dermal disease
US20230065900A1 (en) Compositions and methods for modulating inflammation and wound healing
US20160120792A1 (en) Formulations and methods for improving skin conditions
EP1958639A1 (en) Use of chitosans for the treatment of nail inflammatory diseases
US20220226280A1 (en) Compositions and methods for increased glucose uptake and fat metabolism
CN1622796A (en) Topical anti-inflammatory compositions and methods of reducing inflammation
US20170020798A1 (en) Hesperidin-containing compositions and methods for treatment of skin disorders
CN1607932A (en) Methods for improving the aesthetic appearance of skin
KR20190024594A (en) A composition for preventing or treating for atopic dermatitis
US12274729B2 (en) Formulations and methods for skin care or hyaluronic acid synthesis
US7306810B1 (en) Skin cream
JP6096964B2 (en) Food and drink for ceramide synthesis promotion
ES2744173T3 (en) Combination of vitamin C and hyaluronic acid for the treatment of the effects of skin aging
US10786441B2 (en) Skin barrier repair and maintenance composition
US9566262B2 (en) Itch suppression by fucoxanthin
US20250000767A1 (en) Formulations and methods for skin regeneration
US20250195352A1 (en) Lipid formulations containing bioactive fatty acids and other bioactive agents
US20240299423A1 (en) Compositions for treatment of diabetic symptoms
WO2008035982A1 (en) COMBINATION OF A GLUCOCORTICOID AND A β-CYCLODEXTRIN CONJUGATED VITAMIN A DERIVATE COMPLEX

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16756384

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16756384

Country of ref document: EP

Kind code of ref document: A1