WO2016134485A1 - Acinetobacter o-oligosaccharyltransferases and uses thereof - Google Patents

Acinetobacter o-oligosaccharyltransferases and uses thereof Download PDF

Info

Publication number
WO2016134485A1
WO2016134485A1 PCT/CA2016/050208 CA2016050208W WO2016134485A1 WO 2016134485 A1 WO2016134485 A1 WO 2016134485A1 CA 2016050208 W CA2016050208 W CA 2016050208W WO 2016134485 A1 WO2016134485 A1 WO 2016134485A1
Authority
WO
WIPO (PCT)
Prior art keywords
glycosylation
protein
comp
pila
strain
Prior art date
Application number
PCT/CA2016/050208
Other languages
French (fr)
Inventor
Mario Feldman
Mohamed Adel NASR
Original Assignee
Vaxalta Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vaxalta Inc. filed Critical Vaxalta Inc.
Priority to EP16754717.3A priority Critical patent/EP3262077A4/en
Priority to US15/553,733 priority patent/US10265391B2/en
Priority to AU2016224006A priority patent/AU2016224006B8/en
Priority to BR112017017930A priority patent/BR112017017930A2/en
Priority to JP2017545671A priority patent/JP6764872B2/en
Priority to CA2977561A priority patent/CA2977561C/en
Publication of WO2016134485A1 publication Critical patent/WO2016134485A1/en
Priority to US16/390,833 priority patent/US10869918B2/en
Priority to US17/127,142 priority patent/US11497804B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1081—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/005—Glycopeptides, glycoproteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6087—Polysaccharides; Lipopolysaccharides [LPS]
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present application pertains to the field of molecular microbiology. More particularly, the present application relates to O-oligosaccharyltransferases, particularly the use of PglLcomP O-oligosaccharyltransferase in vaccine applications.
  • Acinetohacter baumannii and A. nosocomialis are clinically relevant members of the Acinetohacter calcoaceticus- A. baumannii (Acb) complex and important opportunistic nosocomial pathogens (Wisplinghoff et al, 2012). These species have emerged as troublesome pathogens due in part to their remarkable resistance to disinfection, desiccation, as well as their ability to acquire multiply drug resistant phenotypes, all of which promote their survivability in the hospital setting. Furthermore, pan-resistant strains within the Acb are continuously being isolated from hospitals worldwide (Arroyo et al, 2009; Gottig et al, 2014).
  • virulence factors include an outer membrane protein A (OmpA), the ability to form biofilms, exopolysaccharide, lipopolysaccharide (LPS), protein glycosylation systems and capsule (Choi et al, 2008; Choi et al, 2009; Gordon et al, 2010; Iwashkiw et al, 2012; Lees-Miller et al, 2013).
  • OmpA outer membrane protein A
  • T6SS type VI secretion system
  • A. baylyi is a non-pathogenic member of the genus Acinetohacter, characterized by its genetic tractability and natural competence. For these properties, A. baylyi is widely used as a model organism for molecular and genetic studies of the genus Acinetohacter
  • OTase oligosaccharyltransferase
  • GT cytoplasmic glycosyltransferases
  • O-OTases An OTase-dependent, ubiquitous O-linked protein glycosylation system has been recently discovered within the genus Acinetobacter . This system was required for biofilm formation and pathogenicity of A. haumannii (Iwashkiw et al, 2012). The glycan structures for several strains of A. haumannii have also been characterized and extensive carbohydrate diversity has been established (Scott et al, 2014). [0005] OTases involved in O-glycosylation (O-OTases) do not share extensive primary amino acid sequence homologies; yet, all O-Otases contain domains from the Wzy C superfamily (Power and Jennings, 2003).
  • Orthologs of PglL general 90 O-Otases and WaaL O-antigen ligases are two of the most well characterized enzymes from the Wzy_C superfamily. It has proven challenging to identify O-OTases based solely on bioinformatic methodologies as O-OTases and WaaL ligases catalyze similar reactions, i.e. the transfer of lipid-linked glycans to acceptor proteins or lipid A respectively (Hug & Feldman, 2011). The two enzymes appear to be evolutionarily and mechanistically related as mutagenesis of topologically similar conserved histidine residues of the E. coli O-antigen ligase (H337) and N.
  • O-OTase meningitidis O-OTase (H349) results in the loss of glycan transfer activities (Perez et al, 2008; Ruan et al, 2012; Musumeci et al, 2014).
  • PglL_A and PglL_B hidden Markov models (HMM) were defined to better resolve orthologs of PglL O-OTases from other enzymes of the Wzy_C superfamily (Power et al, 2006; Schulz et al, 2013).
  • HMM hidden Markov models
  • Tfp type IV pili
  • PilA the major pilin subunit gene is immediately 5' of the cognate OTase gene
  • P. aeruginosa strain 1244 the major pilin, PilA, is glycosylated by PilO (later renamed TfpO), an O-OTase encoded immediately downstream of pilA (Castric, 1995; Kus et al, 2004).
  • glycosylation-deficient mutants showed decreased twitching motility and were out-competed by the wild type in a mouse respiratory infection model (Kus et al, 2004; Smedley et al, 2005).
  • the same genetic arrangement and glycosylation phenotype has also been found in P. syringae (Nguyen et al, 2012).
  • Pilin post-translational modification has also been identified in Acinetobacter species.
  • A. baylyi ADP1 two Wzy_C superfamily domain-containing proteins are encoded in the genome. One gene is found immediately downstream of the gene encoding the pilin-like protein ComP, whereas the other gene is found within a distant glycan biosynthesis gene cluster. Mutation of the predicted OTase encoded downstream of the comP gene affected the electrophoretic mobility of ComP, indicating this gene may encode for a ComP-specific OTase (Porstendorfer et al, 2000; Schulz et al, 2013). Additionally, during the course of a previous study demonstrating the functional production of Tfp by the medically relevant ⁇ .
  • OTases are powerful tool for glycoengineering conjugate vaccines.
  • the enzymatic attachment of glycans to proteins present several advantages compared to the chemical attachment of sugars. Although they exhibit relaxed specificity, OTases known so far present some limitations.
  • glycans containining glucose at the reducing end have not been successivefully transferred by any of the known enzymes, such as PglB and PglL.
  • PglB has been shown to required an acetylated sugar at the reducing end ( Wacker et al , 2006) .
  • PglL was able to transfer sugars with galactose at the reducing end (Faridmoayer et al, 2008), but it has not been shown that sugars containing a glucose at the reducing can be transferred to proteins. This is extremely important for the synthesis of vaccines against Streptococcus. Most capsular polyccharides from Streptococcus contain a glucose residue at the reducing end (Bentley et al, 2006). The licensed vaccines against S. pneumoniae, such as Prevnar 13, contain up to 13 capsular serotypes. Better vaccines, containing more serotypes are needed.
  • An object of the present invention is to provide the use of an O-OTase for the generation of glycoproteins for vaccine applications.
  • a method of synthesizing a glycoprotein comprising glycosylation of ComP using a PglLcomP O- oligosaccharyltransferase can be performed in Gram negative bacteria, such as Acinetobacter (including, for example, A. baylyi, A. baumannii, A. nosocomialis, or A.
  • the glycosylation can use sugars derived from O- glycosylation, N-glycans, O antigens, capsular polysaccharides, etc.
  • the N-glycan is derived from Campylobacter, such as Campylobacter jejuni N- hepatasaccharide, for example.
  • PglLc om p can be employed to efficiently attach capsular polysaccharides containing glucose at the reducing end to a protein carrier. Such capsules are common within the genus Streptococcus.
  • the present application provides the generation of an immune response in mice employing a glycoprotein obtained through the activity of PglLcomP, containing a capsule from S. pneumoniae attached to a suitable carrier.
  • the ComP can be optionally fused to a second protein, an adjuvant or a carrier.
  • PglLcomP for the glycosylation of a protein, such as a protein with a Streptoccocus capsule, in particular wherein the Streptococcus is Streptococcus pneumoniae.
  • an O- oligosaccharyltransferase for glycosylation of ComP.
  • the glycosylation can be recombinantly produced in Gram negative bacteria, such as Acinetobacter (including, for example, ⁇ , baylyi, A. baumannii, A. nosocomialis, or A. calcoaceticus) or E. coli, and the like.
  • the glycosylation can use sugars derived from O-glycosylation, N-glycans, O-antigens, capsular polysaccharides, etc.
  • the N-glycan is derived from Campylobacter, such as Campylobacter jejuni N-hepatasaccharide or a capsular
  • the O-OTase is PglLcomP.
  • the capsular polysaccharide is a Streptococcus capsule, such as Streptococcus pneumoniae.
  • the present application provides a vaccine against Streptococcus, more particularly Streptococcus pneumoniae.
  • a vaccine comprising a glycoprotein synthesized in accordance with the method as described herein.
  • glycoprotein which is a fusion protein comprising ComP or a fragment of ComP carrying a glycosylation site.
  • Figure 1 illustrates genomic and domain organization of putative O-OTases of Acinetobacter spp. encoding two OTase genes.
  • A Genomic context of OTases encoded by the A. nosocomialis strain M2 chromosome.
  • B Wzy_C super family (cl04850) and
  • C Genomic context of OTases encoded by the A. baylyi ADP1 chromosome.
  • D Wzy_C super family (cl04850) and DUF3366 domains present in PglLcomP and PglLADPi. The rectangle below PglLcomP indicates a portion of the DUF3366 domain.
  • FIG. 2 illustrates PilAM2 glycosylation in a TfpO-dependent manner with a tetrasaccharide containing (HexNAc)2, Hexose and N-acetyl-deoxyHexose.
  • A Surface proteins from the indicated strains were prepared by shearing, as described in the materials and methods, followed by separation by SDS-PAGE and western blot analysis of whole cell lysates.
  • PilAM2 from strain M2 was identified employing rabbit anti-PilAM2.
  • Strains M2 pilA+ and M2 tfpO+ were complemented pilA and tfpO mutants, respectively. "Gly” denotes the glycosylated form of the protein.
  • PilAM2 was sheared from the surface of strain M2 and a hyper-piliated mutant, precipitated, separated by SDS-PAGE, and visualized by Coomassie straining.
  • Figure 3 illustrates PilAM2-like glycosylation dependency on a conserved carboxy- terminal serine.
  • P. aeruginosa strain 1244 and selected Acinetobacter strains All Acinetobacter strains encoding tfpO homologs contain a carboxy-terminal serine on their respective PilA proteins.
  • B Westem blot analysis of whole cell extracts probing for PilAM2 expression and electrophoretic mobility. Strain M2 derivatives expressing PilA[S132A] and PilA[S136A] were constructed and extracts chararacterized. Serine 132 was not required for glycosylation while serine 136, the C-terminal serine was required for glycosylation.
  • C Pilin
  • glycosylation in strain M2 is not required for natural transformation. Mutants that were unable to glycosylate PilAM2 were still naturally transformable.
  • FIG. 4 illustrates that the major polysaccharide antigen locus (MPA) was required for pilin glycosylation.
  • MPA major polysaccharide antigen locus
  • A Genetic organization of the strain M2 MPA locus which is located between the conserved flcpA and UdP genes. Adapted from Hu et al, 2013.
  • B Westem blot analysis of whole cell extracts probing for PilAM2 expression and electrophoretic mobility from MPA locus mutants. PilAM2 from the AweeH .km mutant ran at the same
  • PilAM2 electrophoretic mobility as PilAM2 from the ⁇ 0: :kan mutant indicating it was not glycosylated.
  • Deletion of the other three glycosyltransferases yielded PilAM2 proteins with intermediate electrophoretic mobilities.
  • PilA from the wa/Y : :kan mutant migrated closest to the WT PilA mobility, then PilA from the wqfZy.k mutant, followed by PilA from the wagB: :kan mutant. Mutants that were complemented all glycosylated PilAM2.
  • FIG. 5 illustrates that PglLM2 is a general O-OTase and utilizes the same lipid- linked glycan donor as TfpOM2.
  • A Westem blot analysis of whole cell extracts probing for OmpA-His expression and electrophoretic mobility.
  • OmpA-His served as bait protein for glycosylation by strain M2 as well as the isogenic tfpOM2: :k and pglLM2: :km mutants. All strains expressed OmpA-His; however, OmpA-His from the pglLM2: :k mutant ran at an increased electrophoretic mobility indicating the lack of glycosylation.
  • FIG. 6 illustrates activity of O-OTases iriA. haylyi ADPl.
  • A Western blot analysis probing for ComP-His expression in whole cell lysates of A. haylyi ADPl as well as the isogenic ApglLcomP and ApglLmm mutants.
  • FIG. 7 illustrates the heterologous expression of TfpO and PglL OTases in E. coli.
  • Campylobacter oligosaccharide This is seen only when PglLADPi or PglLi9606 were expressed in E. coli CLM24 along with CjLLO and His-tagged DsbAl.
  • Figure 8 provides an O-glycan structure identified using ZIC-HILIC enrichment of A. haylyi ADPl glycoproteins.
  • ITMS-CID fragmentation results in near exclusive glycan fragmentation of A. haylyi ADPl glycopeptides enabling the identification of four unique glycans on multiple protein substrates corresponding to;
  • a and D) a pentasaccharide composed of 286-217-HexNAc3 (1112.41 Da, 92DAAHDAAASVEK 103 of
  • PilAM2 was glycosylated in A. baumannii ATCC 19606 and A. baumannii 27413, both of which encode tfpO homologs. Strains lacking tfpO homologs (A. baumannii ATCC 17978 and A. baylyi ADP1) were unable to glycosylate PilAM2.
  • PilA17978 was glycosylated in its native strain by PglL17978 and in A. baylyi ADP1 by PglLADPi, but not by PglLcomP.
  • Figure 10 illustrates a model of lipid-linked oligosaccharide synthesis, TfpOM2- dependent pilin glycosylation, and PglLM2 general O-glycosylation in A. nosocomialis strain M2.
  • the proteins encoded by the genes from the major polysaccharide antigen locus synthesize the tetrasaccharide (HexNAc)-(Hex)-(deoxy-Hex)-(HexNAc) on an undecaprenyl lipid carrier, which is then transferred to the periplasm.
  • the lipid-linked oligosaccharide can then be transferred to the major pilin protein, PilA, by the pilin-specific OTase TfpO or further processed and transferred to other proteins, such as, OmpA by the general OTase PglLM2.
  • Figure 11 illustrates the structures of the glycans employed in the present application. Structures are modified from Faridmoayer et al, 2008 and van Selm et al, 2003.
  • FIG 12 illustrates PglLcomP transfers C. jejuni LLO and E. coli 07 antigen to ComP.
  • Lane 1 corresponds to unglycosylated ComP, with no OTase coexpressed.
  • ComP and PglLcomP are coexpressed.
  • (A) Lower electrophoretic mobility bands that react to the anti-his and anti-glycan antibodies indicate glycosylation of ComP by the C. jejuni LLO.
  • (B) Lower electrophoretic mobility bands that react to the anti-his indicate glycosylation by E. coli 07 antigen subunits. Glycoprotein signals disappear upon Proteinase K digests (lane 3).
  • FIG. 13 is an illustration that PglLcomP, but not NmPglL or CjPglB, can transfer CPS subunits from S. pneumoniae serotype 14 to ComP.
  • Western blot analyses of (Lane 1) whole cell lysates of E. coli CLM24 expressing his-tagged (A) ComP, (B) DsbA and (C) AcrA.
  • Lane 2 corresponds to Ni-NTA purified proteins from E. coli CLM24 coexpressing the S. pneumoniae serotype 14 CPS synthesis locus and PglLcomP.
  • FIG. 14 is an illustration of visual results of whole cell ELISAs performed on post immune mouse sera obtained after 21 days.
  • ELISAs were done using sera from (A) mice immunized with the unglycosylated protein and probed for with a secondary HRP-conjugated anti-IgM antibody, (B) mice immunized with the glycosylated protein and probed for with a secondary HRP-conjugated anti-IgM antibody, or (C) mice immunized with the
  • Figure 15 is a graphical illustration of sera from mice, when injected with CPS- conjugated ComP, react against S. pneumoniae whole cells.
  • Mouse sera from 10 animals pre immune bleeds and post immune day 21
  • serum from 10 mice injected with unglycosylated protein were tested.
  • Secondary HRP-conjugated antibodies used were against mouse IgG antibodies for mice injected with the unglycosylated protein, or against mouse IgM and mouse IgG antibodies for mice injected with the CPS- conjugated ComP. This was followed by treatment with the chromogenic substrate TMB.
  • Sera from mice probed for with the HRP-conjugated mouse IgG antibody showed an increase in absorbance values at 650 nm compared to mice injected with the unglycosylated protein.
  • Figure 16 provides a graphical representation of immune responses.
  • Panel (A) illustrates the combined data from whole cell ELISAs against mouse sera.
  • Panel (B) illustrates absorbance values at 650 nm of TMB-treated negative control (no primary antibody) or positive control wells (commercially available rabbit antibody against the S. pneumoniae serotype 14 capsular polysaccharide).
  • Figure 17 demonstrates that the IgG immune response observed is directed against CPS from S. pneumoniae serotype 14.
  • Western blot analyses of LPS obtained from E. coli CLM37 probing for expression of S. pneumoniae serotype 14 CPS with the mouse sera followed by a secondary fluorescent mouse anti IgG antibody.
  • Figure 18 provides a summary of the current knowledge of the glycans transferred by CjPglB and NmPglL to their acceptor proteins in comparison with PglLcomP.
  • Figure 19 illustrates quantitative analysis of glycosylation in A. baylyi ADPl WT, A. baylyi ADPlApglLADPi, and A. baylyi ADPlApglL com p using dimethyl labeling. Using dimethyl labeling and ZIC-HILIC, the O-OTase responsible for glycosylation of individual glycopeptides was confirmed. Glycopeptides derived from A. baylyi ADPl WT, labeled with light label and A. baylyi ADPlApglL com p labeled with heavy label, were observed at near 1 : 1 levels; whereas, A.
  • Figure 20 illustrates genomic organization of OTase(s) in (A) A. baumannii ATCC 17978 and (B) A. baumannii ATCC 19606.
  • Figure 21 illustrates quantitative glycopeptides identified in A. baylyi ADP1.
  • a genomic analysis of sequenced genomes of Acinetobacter spp. revealed that, in addition to A. baylyi ADP1, multiple strains within the genus Acinetobacter encode two OTases.
  • A. baylyi ADP1 multiple strains within the genus Acinetobacter encode two OTases.
  • genetic and proteomic techniques to demonstrate that both OTases are functional and that one of these enzymes acted as a pilin-specific OTase, whereas the other OTase was able to glycosylate a wide range of proteins.
  • mass spectrometry the glycan structure of A. nosocomialis strain M2 was characterized and the glycoproteome of A. baylyi defined.
  • glycosylation pathways have been identified in bacteria. Irrespective of the pathway utilized, both N- and O-glycans often decorate cell surface adhesins in both Gram-negative and Gram-positive bacteria. Examples of glycosylated surface-associated proteins include the O-glycosylation of AIDA-I and TibA in E.
  • nosocomialis strain M2AtfpO: :km mutant was equally as transformable as the parental strain (Figure 3C), exhibited the same twitching motility phenotype as the parent strain, and also contained similar levels of surface 428 exposed PilA (data not shown). Furthermore, no condition was found in which A. baylyi ADP1 would attach to abiotic surfaces or form biofilms.
  • Acinetobacter strains encode two OTase homologs, one of which is required for general O-glycosylation and the other that specifically modifies pilin.
  • 76% of A. baumannii isolates with completed genomes encoded a PilA protein containing a carboxy-terminal serine.
  • Acinetobacter spp. the two OTases of the environmental isolated, baylyi ADP1 are distantly separated on the chromosome. Schulz et al. (2013) showed that the OTase homolog pglLcomv, which is encoded adjacent to comP, is responsible for ComP modification.
  • pglL omv is a ComP-specific OTase.
  • PglLADPl is not an O-antigen ligase as previously suggested but rather a general O-OTase glycosylating multiple protein targets.
  • PglLM2 encoded by M215_10475, is able to recognize the same motif that the general O-OTase PglL found in all other A. baumannii strains recognizes, as evidenced by the ability of A. nosocomialis M2 to glycosylate OmpA- His.
  • both PglLM2 and TfpOM2 utilize the same lipid linked tetrasaccharide to modify their target proteins.
  • PglLM2 was able to transfer two subunits of the glycan, whereas TfpOM2 only transferred a single glycan chain.
  • FIG. 10 provides an exemplary model depicting O-glycan synthesis by the MPA cluster and the shared usage of this lipid-linked glycan by TfpOM2 and PglLM2.
  • OTases recognize low complexity regions (LCR), rich in serine, alanine and proline (Vik et al., 2009).
  • the pilin specific TfpO enzymes described here recognize a peptide of about 15 amino acids containing many serine and proline residues.
  • P. aeruginosa TfpO it may be suggested, in accordance with the present application, that the carboxy-terminal serine of PilAM2 may serve as the site of TfpOM2-dependent glycosylation.
  • Bacterial species carrying two functional O-OTases, a PglL-general OTase and a pilin-specific OTase have not previously been identified.
  • TfpO is the only OTase present in Pseudomonas (Smedley et al., 2005; Nguyen et al., 2012), while PglL is the only OTase identified in Neisseria (Faridmoayer et al., 2007), A. baumannii ATCC 17978 (Iwashkiw et al., 2012), B. cenocepacia K56-2 (Lithgow et al, 2014) and R. solanacearum (Elhenawy et al. , submitted). Three possible O-OTases have been identified in V. cholerae, but the activity of only one of these has been shown in E.
  • Acinetobacter strains require two different OTases to glycosylate pilin and other proteins remains unclear as some pathogenic strains of A. baumannii carry only PglL, which is required for optimal biofilm formation and virulence (Iwashkiw et al, 2012). It is important to note that non-pathogenic A. baylyi ADP1 also contains two O-OTases. However there are several differences between the ComP-specific OTase PglLcomP of A. baylyi and the pilin- specific OTases TfpO of the medically relevant Acinetobacter spp.
  • TfpO OTases are hypothesized to be specific for the carboxy-terminal serine present on PilA, as a carboxy-terminal serine to alanine point mutant was unable to produce glycosylated pilin.
  • all Acinetobacter strains encoding a tfpO gene homolog also contained the carboxy-terminal serine on their respective PilA sequences.
  • the present application demonstrates that Acinetobacter TfpO homologs are functionally exchangeable as PilAM2 was modified by each tfpO encoding strain tested (Figure 9A). The variable electrophoretic mobility of PilAM2 is likely due to glycan variability between these strains (Scott, et al , 2014).
  • OTases three different classes of OTases are found to be present in Acinetobacter : the pilin-specific TfpO enzymes that glycosylate pilins containing carboxy-terminal serine residues; the general PglL OTases that recognize LCR in multiple proteins; and PglLcomP, which appears to be exclusively devoted to the glycosylation of ComP.
  • These enzymes have different biochemical characteristics, which provide helpful information for the synthesis of novel glycoconjugates with biotechnological applications. The differentiation between these enzymes is not trivial, and may not be accurately predicted just by the presence of pfam domains.
  • PilO/TfpO from P. aeruginosa strain 1244 contains the pfam04932 domain
  • tfpO from A. nosocomial! s strain M2 contains the pfaml3425 domain.
  • the general PglL OTases of the medically relevant Acinetobacter spp. including strain M2 and A. baumannii ATCC 17978, contain domains from the pfam04932 family and the A. baylyi general PglLADPi OTases contain a pfaml3425 domain.
  • PglLcomP can be employed to efficiently attach capsular polysaccharides containing a glucose residue at the reducing end, to a carrier protein, such as ComP.
  • a carrier protein such as ComP.
  • Such capsules are common within the genus Streptococcus.
  • Expression of PglLcomP in E. coli in presence of plasmids expressing ComP and a capsular polysaccharide from S. pneumoniae resulted in the glycosylation of ComP with said polysaccharide.
  • Injection of this glycoprotein in mice mounted a specific IgG immune response against the capsular polysaccharide, demonstrating the applicability of PglLcomP to generate recombinant conjugate vaccines against
  • Streptococcus .
  • MlAtfpO kanApilT: : strep MlAtfpO '::kan containing a deletion of pilT and replacement
  • MlApilA (pz7A[S136A]+) MlApilA : :kan with a mini-Tn7 element containing an allele
  • MlAwafY :kan Strain M2 containing a deletion of wafY and replacement
  • MlAwafZ :kan Strain M2 containing a deletion of wafZ and replacement
  • M2AwagB ⁇ an Strain M2 containing a deletion of wagB and replacement
  • MlAweeH :kan Strain M2 containing a deletion of weeH and replacement
  • M2ApilA :kan (pilA+)
  • MlApilA :kan with a mini-Tn7 element containing the pilA Harding et al.
  • Ml AwqfZ :kan (wq/Z+)
  • MlAwafZ :kan with a mini-Tn7 element containing the wafY
  • MlAwagB :kan (wagB+)
  • MlAwagB :kan with a mini-Tn7 element containing the
  • MlAweeH :kan (wee,7+)
  • MlApilA : :kan with a mini-Tn7 element containing the pilA
  • the tfpO gene was cloned with the predicted pilA promoter into a mini-Tn7 element as previously described. Briefly, gDNA from the ApilA mutant was used as template with primer set 3 to generate an amplicon containing the predicted pilA promoter, the ATG start codon of the pilA open reading frame, a FLP scar, the last 21bp of pilA, the 53bp intergenic region, and the entire tfpO open reading frame.
  • the pBAV-comP-His plasmid was built by using primer set 32.
  • the sticky-ended amplicon was digested with the respective restriction enzymes and ligated into the vector pBAVmcs in the same sites.
  • the ligation was then electroporated into DH5a- E with transformants being selected for on L-agar plates supplemented with kanamycin.
  • the pEXT-pg/ comP, pEXT- pglLmvi, pEXT-(/ >019606 and pEXT-pglL 19606 plasmids were built using primer sets 33, 34, 35 and 36 respectively.
  • pWH-pilA17978-His construction and western blot analysis The pilA allele from A. baumanii ATCC 17978 was PCR amplified using primer set 37. The PCR product was purified and End-it repaired to phosphorylate the 5' ends.
  • the vector pWH1266 was linearized with EcoRI, End-it repaired, and then treated with alkaline phosphatase.
  • the linearized pWH1266 and the PCR purified pilA allele were ligated, transformed into DH5a, and transormants were selected on L-agar supplemented with ampicillin.
  • the pWH- pilA17978 plasmid was sequenced verified and used as template for an inverse PCR to add a C-terminal hexa-histidine tag using primer set 38.
  • the PCR product was purified, Dpnl treated, End-it repaired, and ligated.
  • the ligation was electroporated into DH5 and transformants were selected on L-agar supplemented with ampicillin.
  • the pWH-pilA17978- His electroporated into A. baumannii strains as previously described and naturally transformed into A.
  • nosocomialis strain M2 the plasmid pCCl-Apgl: :kan was linearized and transformed via natural transformation. Transformants were selected on L- agar supplemented with kanamycin. The M2ApglL: :k region in the mutant was verified by sequencing.
  • the upstream and downstream flanking DNA regions around weeH were PCR amplified with primer sets 9 and 10 respectively.
  • the Tn5 kanamycin cassette and pGEM vector were PCR amplified with 15bp overhangs homologous to the DNA in which they were to be recombined using primer sets 11 and 12 respectively.
  • the PCR amplicons were gel extracted and ethanol precipitated.
  • One hundred nanograms of each product was added to the In-fusion EcoDry cloning tube according to the manufacturer's protocol and incubated at 37°C for 15 mins then at 50°C for 15 mins.
  • the newly generated vector was transformed into chemically competent Stellar cells (Clontech) according to the manufacturer's protocol. Transformants were selected for on
  • pRSM4063 Construction of pRSM4063.
  • an empty mini-Tn7 element was first introduced into strain M2 via a four-parental mating strategy previously described. Transposition of the empty mini-Tn7 element into the atfln7 was sequence verified generating the strain M2attTn7::MCS_Empty. Genomic DNA was purified from this strain and used as a template in a PCR using primer set 13. The forward primer of primer set 13 is approximately 2kb upstream of the mini-Tn7 element and the reverse primer of primer set 13 is approximately 2kb downstream of the mini-Tn7 element. The ensuing PCR product was ligated into the pSMART-LCKan vector, sequence verified, and designated pRSM4063.
  • the upstream wxy promoter was selected to drive expression of each of the three genes.
  • Each glycosyl-transferase mutant was complemented by returning the deleted gene driven off the predicted wxy promoter to the chromosome using the mini-Tn7 system. Briefly, the glycosyl-transferase locus was PCR amplified using primer set 23, End-It repaired (Epicentre) and ligated into pCCl (Epicentre). Transformants were selected on chloramphenicol and the pCCl-GT plasmid was verified by restriction digest. The pCCl-GT plasmid contained the predicted promoter of the wxy gene (329 bp upstream), wxy, wafY, wafZ, wagA, gnaB, and wagB.
  • an inverse PCR strategy was employed to remove the wxy gene and join the wxy promoter to the ATG start codon of the wafY gene using primer set 24 and pCCl-GT as template.
  • the subsequent PCR product was End-It repaired (Epicentre) and ligated to itself generating the pCCl-wxyP-wafY construct.
  • the wxyV-wafY DNA fragment was PCR amplified using primer set 27, which contained Xmal and Kpnl restriction overhangs.
  • the PCR product was digested and ligated to predigested pRSM3510 then transformed into ECIOOD cells.
  • Transformants were selected for on L-agar supplemented with kanamycin.
  • the mini-Tn7 element containing wxyVwafY was introduced into the M2Avra y : :kan mutant using a four-parental mating strategy previously described.
  • the same process was used to generate pRSM3510- wxy?-wafY except primer set 25 and primer set 28 were used.
  • the mini-Tn7 element containing wxy?-wafl was introduced to the M2 wafl: :kan mutant via a four-parental mating strategy.
  • the wxy?-wagB fragment was generated using primer set 26 and primer set 29, but was cloned into pRSM4063.
  • the pRSM4063- wxyV-wagB vector was linearized with Xhol and introduced into M2Awag5::kan via natural transformation as previously described.
  • A1S 1193 open reading frame along with its predicted promoter was PCR amplified to include a C-terminal 5X His tag using primer set 30, which also contained Xmal and Kpnl restriction overhangs.
  • the PCR product was digested and ligated to pre-digested pRSM4063.
  • the pRSM4063-Al S_l 193-5X vector was linearized with Xhol and introduced to
  • Acinetobacter strains via natural transformation as previously described.
  • a truncated His-tagged recombinant, soluble derivative of pilA (rsPilAM2) was amplified using gDNA from A. nosocomialis strain M2 as template with primer set 31 deleting the first 28 amino acids of the PilA protein.
  • This PCR product was then used as template for a second PCR where the forward primer of primer set 15 contained an Ndel site and the reverse contained a BamHI site to aid in directional cloning into pET-15b.
  • the amplicon was digested with Ndel and BamHI then ligated into the expression vector pET-15b, which was digested with Ndel and BamHI generating a first codon fusion driven off of the T7 promoter with an N-terminal His tag followed by a thrombin cleavage site.
  • Ligation products were electroporated into DH5a-E (Invitrogen), transformants were subcloned and verified to contain the vector with insert by restriction digestion and sequencing.
  • a correct clone was transformed into E.coli strain Origami B (DE3) (Novagen) for expression of the recombinant protein.
  • rsPilAM2 purification Origami B(DE3) (Millipore) containing pET15b-rsPilAM2 was inoculated into 100 mL of LB broth to an A600nm optical density of 0.05 and grown at 37°C with 180 rpm to mid-log phase at which point rsPilAM2 expression was induced with IPTG at a final concentration of 500 ⁇ . Cells were transitioned to 19°C with 180 rpm and grown for 18 h. Cells were harvested by centrifugation into two equal pellets and resolved in 4 mL each of IX Ni-NTA Bind Buffer (Novagen) with protease inhibitors (Roche).
  • His-tag rsPilAM2 was eluted from the resin with three washes of Ni-NTA elution buffer and dialyzed overnight in phosphate buffered saline.
  • the N-terminal His tag on rsPilAM2 was thrombin cleaved with 0.04 units ⁇ L of biotinylated- thrombin (Novagen) for 2 hours at room temperature.
  • the biotinylated-thrombin was captured with streptavidin-agarose beads for 30 minutes and the rsPilAM2 was collected with a centrifugation in a spin filter at 500 x g for 5 minutes.
  • Transformation efficiency assays Natural transformation was assayed as described previously (Harding et al., 2013). Transformation efficiency was calculated by dividing the CFU of transformants by the total CFU. Experiments were conducted on at least three separate occasions.
  • ADPI samples were labeled with light formaldehyde (CH2O) and light sodium cyanoborohyride (NaBFbCN), ADPlA/?g/ZADPi samples with medium formaldehyde (CD2O) and light sodium cyanoborohyride, and ADP1A pglL omP with heavy formaldehyde ( 13 CD20) and heavy sodium cyanoborodeuteride
  • Pili shear preparations were prepared as previously described with the following modifications. Briefly, bacterial lawns were removed from the agar surface and resuspended in 5 mL of ice cold DPBS supplemented with IX protease inhibitors (Roche). The bacterial suspensions were normalized to an optical density at A600nm equal to 70. To shear surface exposed proteins, bacterial suspensions were vortexed on high for 1 minute. Bacteria were pelleted at 10,000 x g for 10 minutes at 4 ° C. The supernatants were collected and again centrifuged at 10,000 x g for 10 minutes at 4 ° C.
  • the supernatants were collected and further clarified by centrifugation at 20,000 x g for 5 mins at 4 ° C.
  • the sheared surface proteins were precipitated with ammonium sulfate at a final concentration of 30%.
  • Precipitated proteins were pelleted by centrifugation at 20,000 x g for 10 minutes at 4 ° C.
  • the supernatants were discarded and the pellets were resuspended in 100 of IX Laemmli buffer. Preparations were boiled for 10 minutes, run on SDS-PAGE, coomassie-stained, and bands were excised and prepared for mass spectrometric analysis according to Shevchenko et al. (2006).
  • Trifluoroacetic acid and desalted with a C18 ZipTip (Millipore, USA). 60% ACN was used to elute the peptides, which were dried in a speedvac and resuspended with 0.1% Formic
  • LPS extraction and silver staining [0085] LPS from A. baylyi and R. solanacearum was extracted from overnight cultures by the TRI-reagent method as described previously (Yi & hackett, 2000). Equal amounts of LPS were loaded on 12.5% SDS-PAGE gels for LPS separation followed by silver staining as previously described (Tsai & Frasch, 1982).
  • E. coli CLM24 cells were co-transformed with three plasmids: one plasmid encoding the C. jejuni glycosylation locus, another plasmid encoding a single O-OTase gene, and the last plasmid, pAMF22, encoding dsbA 1 -His. Ampicillin (100 ⁇ g/ml), trimethoprim (50 ⁇ g/ml) and chloramphenicol (10 ⁇ g/ml) were added as required for plasmid selection.
  • Peptide lysates for glycopeptide enrichment and quantitative analysis were prepared according to Lithgow et al. (2014) with minor modifications. Briefly, 2 mg of dried membrane enriched protein samples were solubilized in 6 M urea, 2 M thiourea, 40 mM NH4HC03 and reduced with lOmM Dithiothreitol (DTT). Reduced, solubilized peptides were alkylated with 25mM iodoacetamide (IAA) for one hour in the absence of light.
  • DITT Dithiothreitol
  • the resulting alkylated protein mixture was digested with Lys-C (1/100 w/w) for 4 hours at 25°C, diluted 1 :5 in 40 mM NH4HC03, then digested with trypsin (1/50 w/w) overnight at 25°C. Digestion was terminated with the addition of 1 % trifluoroacetic acid (TFA). Peptide digests were purified using the CI 8 empore (Sigma- Aldrich, St. Louis MO) STop And Go Extraction (STAGE) tips (Rappsilber et al., 2007) to remove primary amide and salts. [0090] Enrichment of A. baylyi ADP1 glycopeptides using ZIC-HILIC purification
  • ZIC-HILIC enrichment was performed according to (Scott et al, 2011) with minor modifications.
  • Micro-columns composed of 10 ⁇ ZIC-HILIC resin (Sequant, Umea, Sweden) packed into plO tips containing a 1 mm 2 excised C8 EmporeTM disc (Sigma) were packed to a bed length of 0.5 cm. Prior to use, the columns were washed with ultra pure water, followed by 95% acetonitrile (ACN), and then equilibrated with 80% ACN and 5% formic acid (FA). Samples were resuspended in 80% ACN and 5% FA and insoluble material was removed by centrifugation at 16,100 x g for 5 min at 4°C.
  • HCD scan events containing the 204.08 oxonium were manual inspected to identify potential deglycosylated peptides ions.
  • MS features m/z, charge and intensity
  • the resulting numerical values of the detected MS features were scripted into mgf files and the peptide mass set to that of the deglycosylated peptide mass.
  • the resulting mgf files were then searched using the MASCOT setting described above. All spectra were searched with the decoy option enabled and no matches to this database were detected; the false discovery rate (FDR) was 0%.
  • A. baylyi ADP1 encodes two proteins containing domains from the Wzy_C superfamily (Schulz et al., 2013).
  • ORFs open reading frames
  • M215_10480 and M215_10475 contain the pfaml3425 and the pfam04932 domains, respectively ( Figure 1, panels A and B).
  • Figure 1, panels A and B the same genetic arrangement was found in 12 of the 17 completed genomes for A. baumannii strains, 7 of 8 A. nosocomialis genomes, and 3 of 5 A. pittii genomes demonstrating the conservation of this locus amongst medically relevant members of the Acb complex (Data not shown).
  • ORF the gene encoding the pfaml3425 domain containing protein
  • M215_10480 as the putative glycosylase A (pgyA) (Harding et al., 2013). Given that the gene encoding M215_10480 is immediately downstream of pilA, together with the functional data provided herein which demonstrates that this protein is a pilin glycosylase, we have renamed the gene encoding ORF M215_10480 as a type four pilin specific O- Oligosaccharyltransferase gene itfpO).
  • the second ORF, M215_10475 encodes a predicted protein that contains a domain from the pfam04932 family, a domain that has been found in all previously characterized PglL orthologs as well as in O-antigen ligases.
  • the PglL A and the PglL B domains were also identified in M215_10475. It appears that this protein is an ortholog of the PglL general OTases; thus, we have designated ORF M215_10475 as pglLMl ( Figure 1, panels A and B).
  • pglLMl Downstream of the tfpOMl gene is the pglLMl gene. Since the genes encoding both OTases are in close proximity and use the same lipid-linked oligosaccharide as a substrate, it was speculated that these genes would be cotranscribed. There does appear to be some transcriptional read through but transcript levels for the pglLMl gene are markedly higher than the tfpOMl levels, suggesting that the intergenic region between tfpOMl and pglLMl contains a promoter, which also drives transcription of pglLMl.
  • ACIAD3337 encoding a pfam04932-containing OTase-like protein, which was designated pglL by Schulz et al, (2013). This has been designated ACIAD3337 as pglLcomP due to its proximity to comP ( Figure 1, panels C and D) and the previously reported evidence demonstrating its requirement for post-translational modification of ComP (Schulz et al, 2013).
  • a second pfaml3425 domain containing ORF predicted to encode a WaaL ligase ortholog was also identified.
  • ACIAD0103 was not located near the pilin gene homolog, but instead was found within a glycan biosynthetic locus. This is herein designated ACIAD0103 as the pglLmm ( Figure 1, panels C and D).
  • A. baylyi was the only strain containing two genes encoding proteins with domains from the Wzy_C superfamily that were not encoded by adjacent genes.
  • Figure 2A shows Western blot analysis of whole cell lysates from strain M2, the isogenic pilA mutant, and the complemented pilA mutant strain confirmed our previous findings that PilA existed in two molecular forms differing by apparent molecular weight. The more abundant, higher molecular weight form of PilA was likely a post-translationally modified species of PilA while the lower molecular weight form of PilA was an unmodified species. To determine the effects of TfpO on PilA post-translational modification, we constructed an isogenic tfpO mutant and probed for PilA expression. PilA from the strain lacking tfpO existed only in the lower molecular weight form ( Figure 2A).
  • PilA from the complemented tfpO mutant strain existed primarily in the higher molecular weight form confirming that TfpO was required for post-translational modification of PilA.
  • pglLMl Immediately downstream of tfpO in strain M2 is pglLMl, which encodes a homolog of the general O-OTases responsible for glycosylation of many membrane associated proteins in Neisseria gonorrhoeae and N. meningiditis (Vik et al, 2009; Borud et al, 2011).
  • PHAM2 was glycosylated in a TfpOM2-dependent manner with a tetrasaccharide containing ( ⁇ , Hexose and N-acetyl-deoxyHexose.
  • TfpO tetrasaccharide containing ( ⁇ , Hexose and N-acetyl-deoxyHexose.
  • PilA was purified from surface shear preparations from strain M2, a hyper-piliated MlApilL mutant, and a hyper- piliated MlAtfpO: :kmApilL: : strep mutant.
  • the pilT gene encodes for the predicted retraction ATPase; therefore, mutants lacking pilL have a hyper-piliated phenotype, which results in an abundance of surface exposed PilA. Proteins in the shear preparations were separated by SDS-PAGE, coomassie-stained, excised and subjected to mass spectrometric analysis.
  • Figure B shows MS/MS analysis of PilA from both strains M2 and MlApilL identified the presence of a tetrasaccharide, comprised of two HexNAc residues, a Hexose and N- acetyldeoxyHexose, on PilA.
  • MS/MS analysis revealed that the tetrasaccharide was present on the carboxy-terminal tryptic 119NSGTDTPVELLPQSFVAS136 peptide.
  • PilA from the M2AtfpO: :kanApilT:: strep mutant was unmodified confirming that TfpO was required for PilA glycosylation (data not shown).
  • the M2(£3 ⁇ 4 ' L4[S136A])+ strain was generated.
  • a strain with an in-frame deletion of the pilA gene was generated so as to not affect the transcription of the downstream tfpO gene.
  • Figure 3B shows Western blot analysis of whole cell lysates from the
  • M2(£3 ⁇ 4 ' L4[S136A])+ strain demonstrated that PilA only existed in the unmodified, lower molecular weight form indicating that the carboxy-terminal serine was required for PilA post- translational modification). Another highly conserved serine was found at position 132.
  • Western blot analysis of whole cell lysates from the M2(/3 ⁇ 4 ' L4[S132A])+ strain demonstrated that PilA existed in the modified form indicating that serine 132 was not required for glycosylation (Figure 3B).
  • MP A The Major Polysaccharide Antigen Locus is required for post- translational modification of PHAM2.
  • Hu et al. recently developed a molecular serotyping scheme for Acinetobacter spp. containing a major polysaccharide antigen (MP A) locus.
  • the MPA locus found between the conserved flcpA and UdP genes, was identified in all sequenced Acinetobacter strains included in their study and was also present in A. nosocomialis strain M2 (Hu et al., 2013, Carruthers et al., 2013).
  • the MPA locus from ⁇ 4.
  • nosocomialis strain M2 contains three predicted glycosyl-transferases (designated wqfY, wafZ, and wagB) and one predicted initiating glycosyl-transferase (designated weeH or pglC) ( Figure 4A). To determine if the MPA locus was required for post-translational modification of PilAM2, individual isogenic mutants lacking each of the predicted glycosyltransferases were constructed.
  • Figure 4B shows Western blot analysis of whole cell lysates from the strain lacking weeH demonstrated that PilA existed in the lower molecular weight form indicating that WeeH is required for glycosylation of PilA.
  • PilA proteins with intermediate electrophoretic mobilities.
  • PilA from the wafYv.kwv mutant migrated closest to the WT PilA mobility, then PilA from the wafZv.km mutant, followed by PilA from the wagB: :kan mutant ( Figure 4B).
  • both partially modified and unmodified forms of PilA were identified from the wafZv.km and wagB .km mutant backgrounds. All mutant strains were successfully complemented, indicating that the products of wqfY, wafZ, wagB, and weeH genes were all required to produce fully modified PilA.
  • pglLMl encodes a PglL-like O-OTase in A. nosocomialis strain M2 and uses the same tetrasaccharide precursor as a donor for general protein glycosylation.
  • pglLMl the second ORF containing the Wzy_C domain, was shown to not be required for pilin glycosylation. It is thought that pglLMl may be a general O-OTase that, like the previously characterized PglL in A. baumannii ATCC 17978, could glycosylate non-pilin target proteins.
  • Al S_l 193-His encoding for the protein OmpA, could serve as a bait acceptor protein in order to isolate and identify Acinetobacter strain specific glycans, as it is recognized by PglLs from different strains (Scott et al., 2014).
  • OmpA-His containing a carboxy terminal His-tag, in strains M2, M2AtfpO: ⁇ m, M2ApglL: :kan, and M2AweeH: ⁇ .
  • Figure 5A provides Western blot analysis which demonstrates that all four strains expressed OmpA-His; however, OmpA-His from the M2ApglL: :kan and the
  • M215_10475 is a general O-OTase providing functional evidence for the PglLM2 designation.
  • this branched tetrasaccharide was the same tetrasaccharide found on PilA, indicating that TfpOM2 and PglLM2 both utilize the same lipid-linked glycan precursor as the substrate for protein glycosylation (Figure 5B). This observation was expected given that WeeH was required for both PilA and OmpA- Hispost-translational modification, indicating a common glycan precursor pathway.
  • ACIAD0103 is not a WaaL O-antigen ligase and is not required for ComP modification.
  • ACIAD3337 is located adjacent to comP. Schulz et al. (2013) determined, and we independently confirmed, that pglL omv (ACIAD3337) is required for ComP modification ( Figure 6A). Furthermore, western blot analysis probing for ComP -His expression from an isogenic pglLmm (ACIAD0103) mutant strain demonstrated that PglLADPi is not required for ComP post-translational modification ( Figure 6A).
  • ACIAD0103 encodes the general O-OTase, PglLADPi, in A. baylyi ADP1
  • PglLADPi was tested to determine if it is able to glycosylate DsbAl from N. meningitidis and OmpA ⁇ ⁇ . baumannii ATCC 17978, which are also modified by general O-OTases in their respective strains, and were previously employed as models to study glycosylation (Vik et al, 2009; Iwashkiw et al, 2012; Gebhart et al, 2012; Lithgow et al, 2014). These two proteins were independently expressed in wild-type, ApglLcomP and ApglLmvi A. baylyi strains.
  • E. coli CLM24 a strain lacking the WaaL O-antigen ligase, which leads to the accumulation of lipid-linked glycan precursors that then are able to serve as substrates for heterologous O-OTase activity (Feldman et al, 2005).
  • coli CLM24 was transformed with plasmids encoding an acceptor protein (DsbAl), a glycan donor (the Campylobacter jejuni lipid-linked oligosaccharide (CjLLO)), and one OTase, as previously described (Faridmoayer et al, 2007; Ielmini & Feldman, 2011).
  • DsbAl acceptor protein
  • CjLLO Campylobacter jejuni lipid-linked oligosaccharide
  • OTase OTase
  • glycosylation we compared the glycoproteome of A. baylyi ADP1 to either the
  • ADPlA/?g/ZcomP mutant or the APDlA/?g/ZADPi mutant were identified 360 within A. baylyi ADP1.
  • baylyi ADP1 generated unique glycans with glycopeptides decorated with one of four pentasaccharide glycoforms composed of 286-217-HexNAc3 (1112.41 Da, Figure 8A and 8D), 286-217-245-HexNAc2 (1154.41 Da, Figure 8B and 8F), 286-217-HexNAc-245- HexNAc (1154.41 Da, Figure 8B and 8G) and 286-217-2452-HexNAc (1196.41 Da, Figure 8C and 8E).
  • Glycopeptide analysis of membrane proteins from A. baylyi ADPlA/?g/ZcomP enabled the identification of identical glycopeptides suggesting the glycoproteome was unaffected by the loss of this gene.
  • Figure 19 shows quantitative analysis of glycosylation in A. baylyi ADPl WT, A. baylyi ADPlApglLADPi, and A. baylyi ADPlApglLcomP using dimethyl labeling.
  • Quantitative dimethylation labeling enabled comparison of all three strains simultaneously providing an intemal positive control for glycopeptide enrichment and led to the detection of seven glycopeptides (Table 2).
  • isotopologues confirm the absent of ADPlApglLADPiderived glycopeptides and the 1 : 1 : 1 ratio of non-glycosylated peptides.
  • ADPlApglLcomP HCD fragmentation confirming the identification of the medium isotopologues of the non-glycosylated peptide 166AQSVANYLSGQGVSSSR182, confirming its origins from ADP lApglLADPi.
  • Table 2 shows dimethylated glycopeptides identified in A. baylyi ADPl .
  • Figure 21 illustrates quantitative glycopeptides identified in A. baylyi ADPl. Dimethylated glycopeptides identified in A. baylyi ADPl wild type (light) and OTase mutant (heavy). Identifications are grouped according to the corresponding Uniprot number. The protein name, parent m/z, charge state, glycan mass, peptide mass, glycan composition, peptide sequence and mascot ion score are provided for each identified glycopeptide.
  • PilAM2 expressed in A. baumannii ATCC 19606 ran with the slowest electrophoretic mobility indicative of a larger glycan associated with PilAM2 (Scott et al, 2014).
  • Acinetobacter spp. it was found that it was glycosylated only in A. baylyi ADP1. Strains encoding tfpO homologs were unable to modify ComP -His, with the exception of A.
  • PglLcomP was analyzed to determined if it is able to modify A. baumannii ATCC 17978 pilin, which does not carry a terminal serine residue.
  • PilA17978 was not glycosylated by PglLcomP, but was glycosylated by both its cognate PglL17978 and the PglLADPi general O-OTases. These results distinguish PglLcomP from the other pilin-specific TfpO OTases that recognize terminal serine residues, and from the general PglL O-OTases.
  • PglLcomP is more similar to PglL-like OTases but, unexpectedly, its activity is specific for ComP, which is a pilin-like protein that does not have a terminal serine residue. PglLcomP appears to belong to a new class of O-OTases.
  • O-oligosaccharyltransferases enzymes that transfer the glycan from a lipid carrier to target proteins.
  • O-OTases are difficult to identify due to similarities with the WaaL ligases that catalyze the last step in LPS synthesis.
  • a bioinformatics analysis revealed the presence of two genes encoding putative O-OTases or WaaL ligases in most of the strains within the genus Acinetobacter .
  • the present application provides that these genes encode two O-OTases, one devoted uniquely to type IV pilin, and the other one responsible for glycosylation of multiple proteins.
  • the pilin-specific OTases in. Acinetobacter resemble the TfpO/PilO O-Otase from Pseudomonas aeruginosa.
  • the two O-OTases are closely related to PglL, the general O-OTase first discovered in Neisseria. However, one of them is exclusively dedicated to the glycosylation of the pilin-like protein ComP.
  • Plasmid pMNl was constructed by subcloning ComP from pBAV-ComP-his into BamHI and Sail sites of pEXT20. Plasmid pMN2 was constructed by subcloning pglLcomp with its upstream region from the Sail and Pstl sites of pMN8 to pMNl .
  • Electrocompetent E. coli CLM24, CLM37 or SDB1 were prepared as per the protocol described by Dower and colleagues (Dower et al, 1988). Cells were transformed with plasmids encoding the glycan synthesis loci, acceptor protein and OTase. For plasmid selection, ampicillin (100 ⁇ g/ml), tetracycline (20 ⁇ g /ml), trimethoprim (50 ⁇ g /ml), chloramphenicol (12.5 ⁇ g /ml), kanamycin (20 ⁇ g /ml) and spectinomycin (80 ⁇ g /ml) were added as needed.
  • the pellet was resuspended in a buffer containing 0.1% Triton xlOO or 1% n-dodecyl ⁇ -D-maltoside (DDM) in 10 ml PBS and membrane proteins were solubilized by tumbling overnight.
  • An equal volume of PBS was added to the suspension to reduce detergent concentration and the suspension was ultracentrifuged at 100000 G for 60 minutes.
  • Supematants which correspond to solubilized membrane proteins, were loaded on columns for nickel affinity protein purifications.
  • Hexa-histidine-tagged proteins were purified from solubilized total membranes by nickel affinity chromatography. Briefly, total membranes were loaded on nickel-nitrilotriacetic acid (Ni-NTA) agarose columns (Qiagen) previously equilibrated with a buffer containing 20 mM imidazole. To remove unbound proteins, the column was washed four times each with buffers containing 20 mM and 30 mM imidazole. His-tagged proteins bound to the column were eluted over six fractions with an elution buffer containing 250 mM imidazole.
  • Ni-NTA nickel-nitrilotriacetic acid
  • AKTA purifier (Amersham Biosciences, Sweden) was employed for protein purifications. Solubilized membrane proteins were first filtered through 0.45 ⁇ and 0.22 ⁇ filters, and then loaded on a His-Trap HP column (GE Healthcare) previously equilibrated with a buffer containing 20 mM imidazole. Unbound proteins were removed by washing the column ten times each with buffers containing 20 mM and 30 mM imidazole. To elute proteins bound to the column, gradient elutions with an incremental increase in imidazole concentration of the elution buffer were used.
  • Imidazole was removed by an overnight round of dialysis followed by 2 2- hour rounds in a dialysis buffer composed of 250 ml PBS containing 0.25% DDM. Proteins were quantified using a DC kit (biorad) after which the samples were diluted to
  • mice approximately 6 ⁇ g/ml and 0.6 ⁇ g injected per mouse.
  • Two groups of 10 mice were injected either unglycosylated ComP or CPS-conjugated ComP. Sera from the mice were obtained before immunization, 7 and 21 days post immunization. A booster dose was given on the 14 th day.
  • S. pneumoniae serotype 14 (Statens Serum Institut, Denmark) was grown overnight in BHI broth at 37°C with 5% C02 aerobic conditions. Cells were washed in lx PBS and OD was adjusted to 0.6. Cells were then heat inactivated by incubation at 60°C for 2 h followed by immobilizing on Coming high binding 96 well plates (50 ⁇ ⁇ ). Plates were incubated overnight at 4°C. The following day, wells were washed three times with lx PBS (100 ⁇ ⁇ ) before blocking with 5% skimmed milk for 2 h. The wells were washed three times with PBS.
  • Antibodies employed were the anti mouse IgM (1 : 10000), anti mouse IgG (1 : 10000) and anti rabbit (1 :5000) HRP-conjugated antibodies diluted in 2.5% skimmed milk in PBST. After incubation, the wells were washed three times with PBS and 100 of the chromogenic substrate TMB (Cell Signaling Technology) was added to each well and the plate was incubated at room temperature for 5 minutes after which the absorbance at 650 nm was measured using a BioTekTM plate reader.
  • TMB Cell Signaling Technology
  • Bacterial surface glycans such as capsular polysaccharides (CPS) and O antigens are good vaccine candidates as they were demonstrated to provide glycan-specific protection. Said glycans when used alone elicit T cell-independent immune responses, with no memory cells being formed, and subsequent booster doses are required to sustain protection. As a result, the efficacy of glycan-only vaccines has been well documented in adults under 55 years. However, children ⁇ 5 respond poorly, if at all, to these vaccines, which has been attributed to the low expression of CD21 on the surface of B cells in the spleen and blood at this age.
  • CPS capsular polysaccharides
  • O antigens are good vaccine candidates as they were demonstrated to provide glycan-specific protection. Said glycans when used alone elicit T cell-independent immune responses, with no memory cells being formed, and subsequent booster doses are required to sustain protection.
  • the efficacy of glycan-only vaccines has been well
  • polysaccharide vaccines are less effective due to the physiological age-associated atrophy of haematopoietic tissue and primary lymphoid organs, causing a decreased production of B and T cells (Griffioen et al , 1991 ; Simell et al , 2008) (Reviewed by Pace, 2013).
  • Conjugate vaccines where surface glycans are linked to immunogenic proteins, have greatly reduced incidence of diseases, compared to glycan-only vaccines.
  • surface glycans are conjugated to immunogenic proteins, and this elicits T cell-dependent immune responses, which are stronger immune responses that are also associated with the development of memory cells for subsequent infections.
  • the efficacy of conjugate vaccines was demonstrated in children ⁇ 5 years, which could be attributed to the fact that infant T cells show adult immunophenotypes and mount equally robust immune responses to conjugate vaccine antigens (Timens et al , 1989). For these reasons, conjugate vaccines are gaining momentum in the vaccine market (reviewed by Pace, 2013).
  • the best-characterized OTases for producing conjugate vaccines are the Campylobacter N-OTase PglB (CjPglB) and the O-OTases TfpO/PilO from Pseudomonas aeruginosa and NmPglL from Neisseria meningitidis.
  • the mentioned OTases were found be specific towards the glycans transferred and the range of acceptor proteins they glycosylate.
  • CjPglB transfers glycans to Asn residues of acceptor proteins that lie in the sequon D/EX1NX2S/T, with X being any amino acid except proline, and the residue in the -2 position being acidic, namely glutamic acid (D) or aspartic acid (E) (Kowarik et al, 2006).
  • D glutamic acid
  • E aspartic acid
  • a DQNAT sequon was identified to be the optimal sequon for glycosylation by CjPglB (Chen et al, 2007). Insertion of this sequon, termed "glycotag", at N or C termini of unglycosylated proteins such as E. coli maltose-binding protein MalE induced glycosylation by CjPglB (Fisher et al, 2010).
  • CjPglB requires an acetamido group at C-2 of the reducing end for glycan transfer to acceptor proteins. Furthermore, CjPglB was shown to only transfer glycans with N-acetylated sugar residues at the reducing end of the glycan such as FucNAc, GalNAc, GlcNAc and Bac (Feldman et al, 2005; Wacker et al , 2006). Additionally, CjPglB was demonstrated to transfer Burkholderia. pseudomallei O
  • polysaccharide II the equivalent of O antigen.
  • This glycan is a polymer of disaccharide repeating subunits composed of glucose and O-acetyl deoxytalose (Garcia-Quintanilla et al, 2014).
  • TfpO/PilO was demonstrated to transfer multiple Pseudomonas O antigens, all of which are either tri or tetrasaccharides with FucNAc at the reducing end, to PilA. TfpO also transferred the E. coli 0157 antigen, a tetrasaccharide with GalNAc at the reducing end (DiGiandomenico et al , 2002; Horzempa et al , 2006). Furthermore, TfpO was demonstrated to only transfer short chain oligosaccharides of the E.
  • NmPglL on the other hand displayed a more relaxed glycan specificity than TfpO, and was demonstrated to transfer sugars with N-acetylated glycans at the reducing end as well as glycans with Gal residues at the reducing end, characteristic of the Salmonella enterica S. Typhimurium O antigen (which could not be transferred by CjPglB).
  • the O-OTases NmPglL and TfpO are sequentially and phylogenetically distinct, which suggests that they comprise two distinct classes of O-OTases.
  • PglL-like OTases appear to be far more superior and with more potential in glycoengineering than TfpO-like OTases, given their ability to transfer longer oligosaccharides and their more relaxed glycan specificity.
  • a limitation of all characterized OTases to date is that none of them are able to transfer glycans with glucose residues at the reducing end. Such glycans are characteristic of the capsular polysacharides of members of the genus Streptococcus, an example of which being S. pneumoniae.
  • Streptococcus pneumoniae or the Pneumococcus, is one of the leading causes of bacterial meningitis in infants and children. Children under 5, the elderly and
  • Pneumococcus infections predicted 14.5 million cases. Pneumococcus-associated mortalities in children under 5 years are estimated to be 826000 annually, accounting for approximately 11% of mortalities in children under 5 (O'Brien et al , 2009). More than 90 serotypes have been identified for the Pneumococcus, each possessing a structurally and immunogenically distinct polysaccharide capsule that is the basis of pneumococcus vaccines (Lund, 1970; Kadioglu et al , 2008).
  • Pneumococcus conjugate vaccines available in the market are produced by chemical conjugations of CPS to the modified diphtheria toxin CRM197, which, despite its exceptional efficacy, is significantly more expensive than polysaccharide-only vaccines according to the CDC vaccine price list. This has led the slow implementation of Pneumococcus vaccine programs by low-income countries without external aid (Wenger, 2001 ; Weinberger et al. , 2011 ).
  • Streptococcus CPS to acceptor proteins would revolutionize immunization against this organism, leading to significantly cheaper vaccines and ultimately leading to a reduction in disease burden and child deaths especially in low- income countries.
  • O-OTase that appears to constitute a novel class of O-OTases.
  • the OTase is called PglLc om p and was identified in the non- pathogenic strain Acinetobacter baylyi (Harding et al, 2015). This OTase is phylogenetically and sequentially similar to PglL-like OTases and transfers similar glycans (Figure 12).
  • a booster dose of the glycoprotein was administered on day 14 and pre immune sera and post immune sera (day 7 and day 21) were collected.
  • pre immune sera and post immune sera day 7 and day 21 were collected.
  • Acinetobacter baumannii Utilizes a Type VI Secretion System for Bacterial Competition.
  • pilO a gene required for glycosylation of Pseudomonas aeruginosa 1244 pilin.
  • the pgaABCD locus of Acinetobacter baumannii encodes the production of poly -beta- 1-6-N- acetylglucosamine, which is critical for biofilm formation. Journal of Bacteriology 191(19): 5953-63. [00189] Choi, C. H., Hyun, S. H., Lee, J. Y., Lee, J. S., Lee, Y. S., Kim, S. A., ... Lee,
  • Escherichia coli TibA self-associating autotransporter influences the conformation and the functionality of the protein.
  • Type IV pilin is glycosylated in Pseudomonas syringae pv. tabaci 6605 and is required for surface motility and virulence. Molecular Plant Pathology 13(7): 764-74.
  • Acinetobacter baumannii utilizes a type VI secretion system for bacterial competition.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present application provides methods and uses of O-oligosaccharyltransferase (O-OTases) for generating vaccines. In particular, the present application provides a method of synthesizing a glycoprotein comprising glycosylation of pilin-like protein ComP using a Pg1LComP O-OTase. Uses of glycoproteins synthesized by glycosylating Com P using Pg1LComP O-OTase, particularly for the preparation of vaccines and the like, including a vaccine to Streptococcus, is also provided.

Description

ACINETOBACTER O-OLIGOSACCHARYLTRANSFERASES AND USES
THEREOF
FIELD
[0001] The present application pertains to the field of molecular microbiology. More particularly, the present application relates to O-oligosaccharyltransferases, particularly the use of PglLcomP O-oligosaccharyltransferase in vaccine applications.
BACKGROUND
[0002] Acinetohacter baumannii and A. nosocomialis are clinically relevant members of the Acinetohacter calcoaceticus- A. baumannii (Acb) complex and important opportunistic nosocomial pathogens (Wisplinghoff et al, 2012). These species have emerged as troublesome pathogens due in part to their remarkable resistance to disinfection, desiccation, as well as their ability to acquire multiply drug resistant phenotypes, all of which promote their survivability in the hospital setting. Furthermore, pan-resistant strains within the Acb are continuously being isolated from hospitals worldwide (Arroyo et al, 2009; Gottig et al, 2014). While the mechanisms of antibiotic resistance of Acb members has been intensively studied (Gordon et al, 2010), our understanding of their virulence mechanisms is unclear. Identified virulence factors include an outer membrane protein A (OmpA), the ability to form biofilms, exopolysaccharide, lipopolysaccharide (LPS), protein glycosylation systems and capsule (Choi et al, 2008; Choi et al, 2009; Gordon et al, 2010; Iwashkiw et al, 2012; Lees-Miller et al, 2013). A type VI secretion system (T6SS) has been also identified, although a role in pathogenesis has not been demonstrated (Carruthers et al, 2013; Weber et al, 2013).
[0003] A. baylyi is a non-pathogenic member of the genus Acinetohacter, characterized by its genetic tractability and natural competence. For these properties, A. baylyi is widely used as a model organism for molecular and genetic studies of the genus Acinetohacter
(Vaneechoutte et al, 2006; de Berardinis et al, 2008; Brzoska et al, 2013) and is also utilized in bioremediation (Abd-El-Haleem et al, 2002; Mara et al, 2012). All members of the Acinetohacter genus, independent of their pathogenicity, carry a protein glycosylation system (Iwashkiw et al., 2012). [0004] Protein glycosylation, the covalent attachment of carbohydrate moieties to protein substrates, is the most abundant post-translational modification of proteins (Varki, 1993) and occurs in all domains of life (Neuberger, 1938; Sleytr, 1975; Mescher & Strominger, 1976). The major types of protein glycosylation are N- and O-glycosylation. Both processes can be classified as oligosaccharyltransferase (OTase)-dependent and OTase independent (Nothaft & Szymanski, 2010; Iwashkiw et al, 2013). OTases are enzymes that catalyze the transfer of a glycan, previously assembled by cytoplasmic glycosyltransferases (GT) onto an undecaprenyl pyrophosphate lipid carrier, to target proteins. The development of sensitive analytical techniques has led to the identification of OTase-dependent protein glycosylation in numerous bacterial species. These include members of the genera Campylobacter, Neisseria, Pseudomonas, Francisella, Vibrio, Burkholderia and Bacteroides (Szymanski et al, 1999; Faridmoayer et al, 2007; Egge-Jacobsen et al, 2011; Balonova et al, 2012; Gebhart et al, 2012; Coyne et al, 2013; Lithgow et al, 2014). Glycosylation frequently affects protein stability, bacterial adhesion, flagellar filament assembly, biofilm formation, and virulence in general (Logan, 2006; Iwashkiw et al, 2013). An OTase-dependent, ubiquitous O-linked protein glycosylation system has been recently discovered within the genus Acinetobacter . This system was required for biofilm formation and pathogenicity of A. haumannii (Iwashkiw et al, 2012). The glycan structures for several strains of A. haumannii have also been characterized and extensive carbohydrate diversity has been established (Scott et al, 2014). [0005] OTases involved in O-glycosylation (O-OTases) do not share extensive primary amino acid sequence homologies; yet, all O-Otases contain domains from the Wzy C superfamily (Power and Jennings, 2003). Orthologs of PglL general 90 O-Otases and WaaL O-antigen ligases are two of the most well characterized enzymes from the Wzy_C superfamily. It has proven challenging to identify O-OTases based solely on bioinformatic methodologies as O-OTases and WaaL ligases catalyze similar reactions, i.e. the transfer of lipid-linked glycans to acceptor proteins or lipid A respectively (Hug & Feldman, 2011). The two enzymes appear to be evolutionarily and mechanistically related as mutagenesis of topologically similar conserved histidine residues of the E. coli O-antigen ligase (H337) and N. meningitidis O-OTase (H349) results in the loss of glycan transfer activities (Perez et al, 2008; Ruan et al, 2012; Musumeci et al, 2014). Recently, the PglL_A and PglL_B hidden Markov models (HMM) were defined to better resolve orthologs of PglL O-OTases from other enzymes of the Wzy_C superfamily (Power et al, 2006; Schulz et al, 2013). [0006] O-OTases are often encoded downstream of their cognate target protein. This genetic arrangement is often found in Gram-negative organisms encoding type IV pili (Tfp) systems, where the major pilin subunit gene is immediately 5' of the cognate OTase gene (Schulz et al, 2013). For example, in P. aeruginosa strain 1244 the major pilin, PilA, is glycosylated by PilO (later renamed TfpO), an O-OTase encoded immediately downstream of pilA (Castric, 1995; Kus et al, 2004). This modification is believed to play a role in virulence as glycosylation-deficient mutants showed decreased twitching motility and were out-competed by the wild type in a mouse respiratory infection model (Kus et al, 2004; Smedley et al, 2005). The same genetic arrangement and glycosylation phenotype has also been found in P. syringae (Nguyen et al, 2012).
[0007] Pilin post-translational modification has also been identified in Acinetobacter species. In A. baylyi ADP1, two Wzy_C superfamily domain-containing proteins are encoded in the genome. One gene is found immediately downstream of the gene encoding the pilin-like protein ComP, whereas the other gene is found within a distant glycan biosynthesis gene cluster. Mutation of the predicted OTase encoded downstream of the comP gene affected the electrophoretic mobility of ComP, indicating this gene may encode for a ComP-specific OTase (Porstendorfer et al, 2000; Schulz et al, 2013). Additionally, during the course of a previous study demonstrating the functional production of Tfp by the medically relevant^. nosocomialis strain M2, we also identified two molecular forms of PilA differing by apparent molecular weight leading to the hypothesis that the pilins of Acb members may also be post- translationally modified (Harding et al, 2013; Carruthers et al, 2013).
[0008] OTases are powerful tool for glycoengineering conjugate vaccines. The enzymatic attachment of glycans to proteins present several advantages compared to the chemical attachment of sugars. Although they exhibit relaxed specificity, OTases known so far present some limitations. For example, glycans containining glucose at the reducing end have not been succesfully transferred by any of the known enzymes, such as PglB and PglL. PglB has been shown to required an acetylated sugar at the reducing end ( Wacker et al , 2006) . PglL was able to transfer sugars with galactose at the reducing end (Faridmoayer et al, 2008), but it has not been shown that sugars containing a glucose at the reducing can be transferred to proteins. This is extremely important for the synthesis of vaccines against Streptococcus. Most capsular polyccharides from Streptococcus contain a glucose residue at the reducing end (Bentley et al, 2006). The licensed vaccines against S. pneumoniae, such as Prevnar 13, contain up to 13 capsular serotypes. Better vaccines, containing more serotypes are needed. The current OTases have not been useful in generating conjugates containing capsule from these bacteria containing glucose at the reducing end, and therefore they have little applications for production of vaccines against Streptococcus. [0009] This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.
SUMMARY [0010] An object of the present invention is to provide the use of an O-OTase for the generation of glycoproteins for vaccine applications.
[0011] In accordance with one aspect of the present invention, there is provided a method of synthesizing a glycoprotein comprising glycosylation of ComP using a PglLcomP O- oligosaccharyltransferase. The method can be performed in Gram negative bacteria, such as Acinetobacter (including, for example, A. baylyi, A. baumannii, A. nosocomialis, or A.
calcoaceticus) or E. coli, and the like. The glycosylation can use sugars derived from O- glycosylation, N-glycans, O antigens, capsular polysaccharides, etc. In one particular embodiment, the N-glycan is derived from Campylobacter, such as Campylobacter jejuni N- hepatasaccharide, for example. Unlike previously known OTases, PglLcomp can be employed to efficiently attach capsular polysaccharides containing glucose at the reducing end to a protein carrier. Such capsules are common within the genus Streptococcus. The present application provides the generation of an immune response in mice employing a glycoprotein obtained through the activity of PglLcomP, containing a capsule from S. pneumoniae attached to a suitable carrier. In another embodiment, the ComP can be optionally fused to a second protein, an adjuvant or a carrier. In another aspect of the present invention there is provided a use of PglLcomP for the glycosylation of a protein, such as a protein with a Streptoccocus capsule, in particular wherein the Streptococcus is Streptococcus pneumoniae.
[0012] In accordance with another aspect of the present invention there is provided an O- oligosaccharyltransferase (O-OTase) for glycosylation of ComP. The glycosylation can be recombinantly produced in Gram negative bacteria, such as Acinetobacter (including, for example, ^, baylyi, A. baumannii, A. nosocomialis, or A. calcoaceticus) or E. coli, and the like. The glycosylation can use sugars derived from O-glycosylation, N-glycans, O-antigens, capsular polysaccharides, etc. In one particular embodiment, the N-glycan is derived from Campylobacter, such as Campylobacter jejuni N-hepatasaccharide or a capsular
polysaccharide from Streptococcus, for example. In one particular embodiment, the O-OTase is PglLcomP. In another emboidment, the capsular polysaccharide is a Streptococcus capsule, such as Streptococcus pneumoniae. Thus, the present application provides a vaccine against Streptococcus, more particularly Streptococcus pneumoniae.
[0013] In accordance with a further aspect of the present invention, there is provided a vaccine comprising a glycoprotein synthesized in accordance with the method as described herein.
[0014] In accordance with yet a further aspect of the present invention, there is provided a glycoprotein which is a fusion protein comprising ComP or a fragment of ComP carrying a glycosylation site. BRIEF DESCRIPTION OF THE FIGURES
[0015] For a better understanding of the present invention, as well as other aspects and further features thereof, reference is made to the following description which is to be used in conjunction with the accompanying drawings, where:
[0016] Figure 1 illustrates genomic and domain organization of putative O-OTases of Acinetobacter spp. encoding two OTase genes. (A) Genomic context of OTases encoded by the A. nosocomialis strain M2 chromosome. (B) Wzy_C super family (cl04850) and
DUF3366 domains present in TfpOM2 and PglLM2. (C) Genomic context of OTases encoded by the A. baylyi ADP1 chromosome. (D) Wzy_C super family (cl04850) and DUF3366 domains present in PglLcomP and PglLADPi. The rectangle below PglLcomP indicates a portion of the DUF3366 domain.
[0017] Figure 2 illustrates PilAM2 glycosylation in a TfpO-dependent manner with a tetrasaccharide containing (HexNAc)2, Hexose and N-acetyl-deoxyHexose. (A) Surface proteins from the indicated strains were prepared by shearing, as described in the materials and methods, followed by separation by SDS-PAGE and western blot analysis of whole cell lysates. PilAM2 from strain M2 was identified employing rabbit anti-PilAM2. PilAM2 from the M2AtfpO: :kan mutant existed only as a lower molecular form indicating TfpO was required for Pil AM2 post-translational modification. Strains M2 pilA+ and M2 tfpO+ were complemented pilA and tfpO mutants, respectively. "Gly" denotes the glycosylated form of the protein. (B) PilAM2 was sheared from the surface of strain M2 and a hyper-piliated mutant, precipitated, separated by SDS-PAGE, and visualized by Coomassie straining.
Bands associated with PilAM2 were excised and tryptically digested for MS/MS analysis.
[0018] Figure 3 illustrates PilAM2-like glycosylation dependency on a conserved carboxy- terminal serine. (A) Alignment of the carboxy terminal region of PilA proteins from
P. aeruginosa strain 1244 and selected Acinetobacter strains. All Acinetobacter strains encoding tfpO homologs contain a carboxy-terminal serine on their respective PilA proteins. (B) Westem blot analysis of whole cell extracts probing for PilAM2 expression and electrophoretic mobility. Strain M2 derivatives expressing PilA[S132A] and PilA[S136A] were constructed and extracts chararacterized. Serine 132 was not required for glycosylation while serine 136, the C-terminal serine was required for glycosylation. (C) Pilin
glycosylation in strain M2 is not required for natural transformation. Mutants that were unable to glycosylate PilAM2 were still naturally transformable.
[0019] Figure 4 illustrates that the major polysaccharide antigen locus (MPA) was required for pilin glycosylation. (A) Genetic organization of the strain M2 MPA locus which is located between the conserved flcpA and UdP genes. Adapted from Hu et al, 2013. (B) Westem blot analysis of whole cell extracts probing for PilAM2 expression and electrophoretic mobility from MPA locus mutants. PilAM2 from the AweeH .km mutant ran at the same
electrophoretic mobility as PilAM2 from the ^0: :kan mutant indicating it was not glycosylated. Deletion of the other three glycosyltransferases yielded PilAM2 proteins with intermediate electrophoretic mobilities. PilA from the wa/Y : :kan mutant migrated closest to the WT PilA mobility, then PilA from the wqfZy.k mutant, followed by PilA from the wagB: :kan mutant. Mutants that were complemented all glycosylated PilAM2.
[0020] Figure 5 illustrates that PglLM2 is a general O-OTase and utilizes the same lipid- linked glycan donor as TfpOM2. (A) Westem blot analysis of whole cell extracts probing for OmpA-His expression and electrophoretic mobility. OmpA-His served as bait protein for glycosylation by strain M2 as well as the isogenic tfpOM2: :k and pglLM2: :km mutants. All strains expressed OmpA-His; however, OmpA-His from the pglLM2: :k mutant ran at an increased electrophoretic mobility indicating the lack of glycosylation. (B) Glycosylated OmpA-His was purified from solubilized membranes using nickel affinity chromatography, separated by SDS-PAGE, and visualized by Coomassie staining. OmpA-His was excised from the gel and characterized by MS/MS analysis. [0021] Figure 6 illustrates activity of O-OTases iriA. haylyi ADPl. (A) Western blot analysis probing for ComP-His expression in whole cell lysates of A. haylyi ADPl as well as the isogenic ApglLcomP and ApglLmm mutants. The increase in ComP-His electrophoretic mobility seen in the ApglLcomP mutant indicates the absence of pilin glycosylation in this strain. (B) Silver stain of LPS obtained from A. haylyi ADPl, the isogenic ApglLcomP, and Apgl∑ADPi mutants as well as Ralstonia solanacearum. A. haylyi lacks O-antigen, as seen by the lack of laddering observed with ?. solanacearum LPS. (C, D) Western blot analysis of whole cell lysates from A. haylyi ADPl, the isogenic ApglLcomP and ApglLmvi mutants recombinantly expressing his-tagged proteins Dsbal (C) or OmpA-His (D). The increases in the relative mobility of the His-tagged proteins produced in the ApglLmvi background indicate that expression of PglLADPi was required for glycosylation of these proteins.
[0022] Figure 7 illustrates the heterologous expression of TfpO and PglL OTases in E. coli. Western blot analysis of whole cell lysates of E. coli CLM24 expressing, as indicated, the C. jejuni lipid linked oligosaccharide (CjLLO) and His-tagged DsbAl together with an A. haylyi or A. haumannii ATCC 19606 OTase. His-tagged DsbAl was detected using the polyclonal anti-his antibody (green) and CjLLO was detected using the hR6 antibody (red). Co- localization of both signals, seen in yellow, indicates glycosylation of DsbAl by the
Campylobacter oligosaccharide. This is seen only when PglLADPi or PglLi9606 were expressed in E. coli CLM24 along with CjLLO and His-tagged DsbAl.
[0023] Figure 8 provides an O-glycan structure identified using ZIC-HILIC enrichment of A. haylyi ADPl glycoproteins. ITMS-CID fragmentation results in near exclusive glycan fragmentation of A. haylyi ADPl glycopeptides enabling the identification of four unique glycans on multiple protein substrates corresponding to; A and D) a pentasaccharide composed of 286-217-HexNAc3 (1112.41 Da, 92DAAHDAAASVEK 103 of
Q6FCV1_ACIAD); B, F and G) two isobaric glycoforms composed of 286-217-245- HexNAc2 and 286-217-HexNAc-245-HexNAc (1154.41 Da, 344NTAASSVAATHKK356 of Q6F814_ ACIAD) and C and E) a pentasaccharide composed of 286-217-2452- HexNAc (1196.41 Da, 344NT AAS S V AATHKK356 of Q6F814 ACIAD). [0024] Figure 9 illustrates that PglLcomP, but not TfpOM2, is specific for its cognate pilin protein. (A) Western blot analysis of whole cell extracts probing for heterologous PilAM2 expression and electrophoretic mobility. PilAM2 was glycosylated in A. baumannii ATCC 19606 and A. baumannii 27413, both of which encode tfpO homologs. Strains lacking tfpO homologs (A. baumannii ATCC 17978 and A. baylyi ADP1) were unable to glycosylate PilAM2. (B) Western blot analysis probing for heterologous ComP -His expression and electrophoretic mobility. ComP -His was only modified in A. baylyi ADP1 indicating that PglLcomP is specific for ComP. (C) Western blot analysis probing for heterologous PilA17978 expression and electrophoretic mobility. PilA17978 was glycosylated in its native strain by PglL17978 and in A. baylyi ADP1 by PglLADPi, but not by PglLcomP.
[0025] Figure 10 illustrates a model of lipid-linked oligosaccharide synthesis, TfpOM2- dependent pilin glycosylation, and PglLM2 general O-glycosylation in A. nosocomialis strain M2. The proteins encoded by the genes from the major polysaccharide antigen locus synthesize the tetrasaccharide (HexNAc)-(Hex)-(deoxy-Hex)-(HexNAc) on an undecaprenyl lipid carrier, which is then transferred to the periplasm. The lipid-linked oligosaccharide can then be transferred to the major pilin protein, PilA, by the pilin-specific OTase TfpO or further processed and transferred to other proteins, such as, OmpA by the general OTase PglLM2.
[0026] Figure 11 illustrates the structures of the glycans employed in the present application. Structures are modified from Faridmoayer et al, 2008 and van Selm et al, 2003.
[0027] Figure 12 illustrates PglLcomP transfers C. jejuni LLO and E. coli 07 antigen to ComP. Western blot analyses on E. coli CLM24 whole cell lysates expressing ComP with or without PglLcomP coexpressed with (A) C. jejuni LLO and (B) E. coli 07 antigen. Lane 1 corresponds to unglycosylated ComP, with no OTase coexpressed. In lane 2, ComP and PglLcomP are coexpressed. (A) Lower electrophoretic mobility bands that react to the anti-his and anti-glycan antibodies indicate glycosylation of ComP by the C. jejuni LLO. (B) Lower electrophoretic mobility bands that react to the anti-his indicate glycosylation by E. coli 07 antigen subunits. Glycoprotein signals disappear upon Proteinase K digests (lane 3).
Expression was probed for with a monoclonal anti-his antibody. [0028] Figure 13 is an illustration that PglLcomP, but not NmPglL or CjPglB, can transfer CPS subunits from S. pneumoniae serotype 14 to ComP. Western blot analyses of (Lane 1) whole cell lysates of E. coli CLM24 expressing his-tagged (A) ComP, (B) DsbA and (C) AcrA. Lane 2 corresponds to Ni-NTA purified proteins from E. coli CLM24 coexpressing the S. pneumoniae serotype 14 CPS synthesis locus and PglLcomP. Lower electrophoretic mobility bands in panel A that react to both Anti-His and Anti-Glycan antibodies in lane 2 relative to lane 1 indicate glycosylation of ComP by CPS subunits in a PglLcomP-dependent manner. Lane 2 in panels B and C shows no lower electrophoretic mobility bands compared to lane 1, indicating the inability of NmPglL and CjPglB to transfer CPS subunits to DsbAl and AcrA respectively. Expression was probed for with a monoclonal anti-his antibody and a polyclonal anti-glycan antibody. [0029] Figure 14 is an illustration of visual results of whole cell ELISAs performed on post immune mouse sera obtained after 21 days. ELISAs were done using sera from (A) mice immunized with the unglycosylated protein and probed for with a secondary HRP-conjugated anti-IgM antibody, (B) mice immunized with the glycosylated protein and probed for with a secondary HRP-conjugated anti-IgM antibody, or (C) mice immunized with the
unglycosylated protein and probed for with a secondary HRP-conjugated anti-IgG antibody.
[0030] Figure 15 is a graphical illustration of sera from mice, when injected with CPS- conjugated ComP, react against S. pneumoniae whole cells. Mouse sera from 10 animals (pre immune bleeds and post immune day 21) were incubated in wells of 96 well plates containing immobilized heat-killed whole cell S. pneumoniae serotype 14. As a negative control, sera from 10 mice injected with unglycosylated protein were tested. Secondary HRP-conjugated antibodies used were against mouse IgG antibodies for mice injected with the unglycosylated protein, or against mouse IgM and mouse IgG antibodies for mice injected with the CPS- conjugated ComP. This was followed by treatment with the chromogenic substrate TMB. Sera from mice probed for with the HRP-conjugated mouse IgG antibody showed an increase in absorbance values at 650 nm compared to mice injected with the unglycosylated protein.
[0031] Figure 16 provides a graphical representation of immune responses. Panel (A) illustrates the combined data from whole cell ELISAs against mouse sera. Panel (B) illustrates absorbance values at 650 nm of TMB-treated negative control (no primary antibody) or positive control wells (commercially available rabbit antibody against the S. pneumoniae serotype 14 capsular polysaccharide). [0032] Figure 17 demonstrates that the IgG immune response observed is directed against CPS from S. pneumoniae serotype 14. Western blot analyses of LPS obtained from E. coli CLM37 probing for expression of S. pneumoniae serotype 14 CPS with the mouse sera followed by a secondary fluorescent mouse anti IgG antibody. (A) Sera from the negative control mice injected with the unglycosylated protein did not react to CPS. (B) Sera obtained from a mouse immunized with the CPS -conjugated ComP that reacted in the ELISA plates reacted to CPS in the Western blots. A commercial anti-CPS rabbit antibody was used as a positive control.
[0033] Figure 18 provides a summary of the current knowledge of the glycans transferred by CjPglB and NmPglL to their acceptor proteins in comparison with PglLcomP.
[0034] Figure 19 illustrates quantitative analysis of glycosylation in A. baylyi ADPl WT, A. baylyi ADPlApglLADPi, and A. baylyi ADPlApglLcomp using dimethyl labeling. Using dimethyl labeling and ZIC-HILIC, the O-OTase responsible for glycosylation of individual glycopeptides was confirmed. Glycopeptides derived from A. baylyi ADPl WT, labeled with light label and A. baylyi ADPlApglLcomp labeled with heavy label, were observed at near 1 : 1 levels; whereas, A. baylyi ADPlApglLADPi, labeled with medium label, was undetectable within samples. Conversely non-glycosylated peptides were observed at a near 1 : 1 : 1 level between all three strains. A and D) The MS spectra of the light, medium and heavy isotopologues of the glycopeptide 113KLAEP AAS AVADQNSPLS AQQQLEQK138 (Q6F825_ACIAD) and non-glycosylated peptide 166AQSVANYLSGQGVSSSR182 (Q6FDR2 ACIAD) enabled the comparison of glycosylation across all three strains. No glycopeptides were observed within ADPlApglLADPiwhile non-glycosylated peptides were observed a near 1 : 1 : 1 ratio. B and E) Comparison of the extracted ion chromatograms of the light, medium and heavy isotopologues confirm the absent of ADPlApglLADPi derived glycopeptides and the 1 : 1 : 1 ratio of non-glycosylated peptides. C) HCD fragmentation confirming the identification of the heavy isotopologues of the glycopeptide
113KLAEP AAS AVADQNSPLS AQQQLEQK138, confirming its origins from
ADPlApglLcomp. F) HCD fragmentation confirming the identification of the medium isotopologues of the non-glycosylated peptide 166AQSVANYLSGQGVSSSR182, confirming its origins from ADPlApglLADPi.
[0035] Figure 20 illustrates genomic organization of OTase(s) in (A) A. baumannii ATCC 17978 and (B) A. baumannii ATCC 19606. [0036] Figure 21 illustrates quantitative glycopeptides identified in A. baylyi ADP1.
DETAILED DESCRIPTION
[0037] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0038] As used in the specification and claims, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise.
[0039] The term "comprising" as used herein will be understood to mean that the list following is non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) and/or ingredient(s) as appropriate.
[0040] A genomic analysis of sequenced genomes of Acinetobacter spp. revealed that, in addition to A. baylyi ADP1, multiple strains within the genus Acinetobacter encode two OTases. In accordance with the present application there are provided genetic and proteomic techniques to demonstrate that both OTases are functional and that one of these enzymes acted as a pilin-specific OTase, whereas the other OTase was able to glycosylate a wide range of proteins. In addition, using mass spectrometry, the glycan structure of A. nosocomialis strain M2 was characterized and the glycoproteome of A. baylyi defined.
[0041] In recent years, a panoply of glycosylation pathways have been identified in bacteria. Irrespective of the pathway utilized, both N- and O-glycans often decorate cell surface adhesins in both Gram-negative and Gram-positive bacteria. Examples of glycosylated surface-associated proteins include the O-glycosylation of AIDA-I and TibA in E. coli (Charbonneau et al., 2007; Cote et al., 2013), the type IV pilins of Pseudomonas, Neisseria, Dichelobacter nodosus, and Fransicella tularensis (Castric et al, 1995, Aas et al, 2006; Faridmoayer et al, 2007, Voisin et al. 2007, Cagatay et al, 2008, Egge-Jacobsen et al, 2011), the flagellins in multiple bacterial species (Nothaft & Szymanski, 2010; Iwashkiw et al, 2013), the serine rich adhesins in Streptococcus spp. (Zhou & Wu, 2009), and the N- glycosylation of HMWG in Haemophilus (Gross et al, 2008) and Aggregatibacter actinomycetemcomitans (Tang & Mintz, 2010). Medically relevant Acb members are not the exception and the present application, as well as previous work, show that pilin and multiple outer membrane proteins are 0-glycosylated, which could provide an adherence advantage either to host cells, in bacterial communities, or to abiotic surfaces. However, as of yet, the biological role for glycosylation of Acinetobacter pilin subunits has not been elucidated. Specifically, the A. nosocomialis strain M2AtfpO: :km mutant was equally as transformable as the parental strain (Figure 3C), exhibited the same twitching motility phenotype as the parent strain, and also contained similar levels of surface 428 exposed PilA (data not shown). Furthermore, no condition was found in which A. baylyi ADP1 would attach to abiotic surfaces or form biofilms.
[0042] As mentioned previously, pilin glycosylation in P. aeruginosa and P. syringae, mediated by PilO and TfpO, respectively, was essential for motility, biofilm formation and virulence (Smedley et al, 2005; Nguyen et al, 2012). Pilin glycosylation had no effect on natural competence in A. baylyi (Porstendorfer et al, 2000) or A. nosocomialis (Figure 3C). Nevertheless, the ubiquitous nature of O-linked protein glycosylation within the genus Acinetobacter suggests a key, still unknown role for this post-translational modification.
[0043] As described herein, some Acinetobacter strains encode two OTase homologs, one of which is required for general O-glycosylation and the other that specifically modifies pilin. The majority of the medically relevant Acinetobacter strains, including^, nosocomialis strain M2, encode two contiguous OTases, which are located immediately downstream of a type IVa major pilin subunit gene. At the time of the present application, 76% of A. baumannii isolates with completed genomes encoded a PilA protein containing a carboxy-terminal serine. All isolates containing a gene encoding a PilA protein with a carboxy-terminal serine also encode for a tfpO homolog found immediately downstream of pilA. This finding is congruous with findings reported for the group I pilins (PilAI) found in P. aeruginosa (Kus et al, 2004). Thus there appear to be multiple lineages of pilin genes, specifically, a lineage that contains an allele that encodes for a PilA with a carboxy-terminal serine and the downstream accessory gene tfpO and lineages that are not glycosylated by a TfpO-like activity. All isolates lacking a carboxy-terminal serine on the major pilin protein, including ATCC 17978, do not encode for a tfpO homolog consistent with the separate evolution of Acinetobacter pilin lineages. [0044] In contrast to the contiguous organization of OTases in the medically relevant
Acinetobacter spp., the two OTases of the environmental isolated, baylyi ADP1 are distantly separated on the chromosome. Schulz et al. (2013) showed that the OTase homolog pglLcomv, which is encoded adjacent to comP, is responsible for ComP modification.
Mutational analysis coupled with an in vivo glycosylation assay as well as the
characterization of the glycoproteome demonstrated that pglL omv is a ComP-specific OTase. On the other hand, the second OTase, PglLADPl, is not an O-antigen ligase as previously suggested but rather a general O-OTase glycosylating multiple protein targets.
[0045] The present application provides that PglLM2, encoded by M215_10475, is able to recognize the same motif that the general O-OTase PglL found in all other A. baumannii strains recognizes, as evidenced by the ability of A. nosocomialis M2 to glycosylate OmpA- His. In A. nosocomialis strain M2, both PglLM2 and TfpOM2 utilize the same lipid linked tetrasaccharide to modify their target proteins. The present application provides that PglLM2 was able to transfer two subunits of the glycan, whereas TfpOM2 only transferred a single glycan chain. Previous studies have shown two subunits of the glycans being transferred by general OTases (Scott et al., 2014); and that TfpO is unable to transfer long sugar chains to P. aeruginosa pilin (Faridmoayer et al., 2007). Furthermore, the MP A locus was identified as the source of the genes encoding the proteins responsible for the synthesis of the shared lipid- linked tetrasaccharide. Figure 10 provides an exemplary model depicting O-glycan synthesis by the MPA cluster and the shared usage of this lipid-linked glycan by TfpOM2 and PglLM2.
[0046] Although many protein glycosylation systems have been identified, how O-OTases, such as the ones from A. baumannii, Neisseria spp. and Burkholderia spp., recognize the acceptor sequences in their protein targets is still not clear. It has been established that
OTases recognize low complexity regions (LCR), rich in serine, alanine and proline (Vik et al., 2009). The pilin specific TfpO enzymes described here recognize a peptide of about 15 amino acids containing many serine and proline residues. Similarly to P. aeruginosa TfpO, it may be suggested, in accordance with the present application, that the carboxy-terminal serine of PilAM2 may serve as the site of TfpOM2-dependent glycosylation. Bacterial species carrying two functional O-OTases, a PglL-general OTase and a pilin-specific OTase have not previously been identified. TfpO is the only OTase present in Pseudomonas (Smedley et al., 2005; Nguyen et al., 2012), while PglL is the only OTase identified in Neisseria (Faridmoayer et al., 2007), A. baumannii ATCC 17978 (Iwashkiw et al., 2012), B. cenocepacia K56-2 (Lithgow et al, 2014) and R. solanacearum (Elhenawy et al. , submitted). Three possible O-OTases have been identified in V. cholerae, but the activity of only one of these has been shown in E. coli (Gebhart et al., 2012), and no glycoproteins have been identified in V. cholerae. In N. meningitidis and N. gonorrhoeae, the OTase PglL is able to glycosylate pilin and several other proteins (Aas et al, 2006; Faridmoayer et al, 2007). Although PglL can recognize three glycosylation sites in pilin when the system is reconstituted in E. coli, none of them contain the typical LCR domain found in the remaining Neisseria glycoproteins, indicating that PglL can recognize more than one motif (Musumeci et al, 2014).
[0047] In Francisella spp. the OTase is closely related to PilO/TfpO and it appears to be responsible for both pilin and general glycosylation (Balonova et al, 2012). Why
Acinetobacter strains require two different OTases to glycosylate pilin and other proteins remains unclear as some pathogenic strains of A. baumannii carry only PglL, which is required for optimal biofilm formation and virulence (Iwashkiw et al, 2012). It is important to note that non-pathogenic A. baylyi ADP1 also contains two O-OTases. However there are several differences between the ComP-specific OTase PglLcomP of A. baylyi and the pilin- specific OTases TfpO of the medically relevant Acinetobacter spp. Although both OTases are encoded immediately downstream of their cognate protein acceptors (Figure 1 panels A and C), TfpO OTases are hypothesized to be specific for the carboxy-terminal serine present on PilA, as a carboxy-terminal serine to alanine point mutant was unable to produce glycosylated pilin. Interestingly, all Acinetobacter strains encoding a tfpO gene homolog also contained the carboxy-terminal serine on their respective PilA sequences. Furthermore, the present application demonstrates that Acinetobacter TfpO homologs are functionally exchangeable as PilAM2 was modified by each tfpO encoding strain tested (Figure 9A). The variable electrophoretic mobility of PilAM2 is likely due to glycan variability between these strains (Scott, et al , 2014).
[0048] Although the site of ComP glycosylation has not been identified, it is predicted to be at an internal residue as ComP does not contain a carboxy terminal serine or any carboxy terminal residue associated with post-translational modification. BLAST analysis of the ComP-specific OTase also demonstrated that PglLcomp is more closely related to the general OTase PglLM2 than to TfpO. Although the pilin-specific TfpO OTase could cross glycosylate different pilins containing carboxy-terminal serines, PglLcomP was unable to glycosylate the pilins recognized by TfpO.
[0049] In accordance with the present application, three different classes of OTases are found to be present in Acinetobacter : the pilin-specific TfpO enzymes that glycosylate pilins containing carboxy-terminal serine residues; the general PglL OTases that recognize LCR in multiple proteins; and PglLcomP, which appears to be exclusively devoted to the glycosylation of ComP. These enzymes have different biochemical characteristics, which provide helpful information for the synthesis of novel glycoconjugates with biotechnological applications. The differentiation between these enzymes is not trivial, and may not be accurately predicted just by the presence of pfam domains. For example, despite having the highest degree of sequence similarity and being functionally homologous, PilO/TfpO from P. aeruginosa strain 1244 contains the pfam04932 domain, whereas tfpO from A. nosocomial! s strain M2 contains the pfaml3425 domain. Moreover, the general PglL OTases of the medically relevant Acinetobacter spp., including strain M2 and A. baumannii ATCC 17978, contain domains from the pfam04932 family and the A. baylyi general PglLADPi OTases contain a pfaml3425 domain. Adding to the complexity is the fact that the general PglL OTases from medically relevant Acinetobacter spp. and the A. baylyi ComP-specific PglLcomP contain the same pfam04932 domains yet recognize different sequons. In addition, this pfam domain is present in the WaaL O-antigen ligases. While bioinformatic analyses can be powerful tools to initially locate and identify ORFs encoding proteins predicted to be involved in glycan transfer events, the present application reinforces the concept that the activity of
bioinformatically identified O-OTases must be experimentally determined and reveals a complex and fascinating evolutionary pathway for bacterial O-OTases. [0050] In accordance with the present application, and unlike previously known OTases,
PglLcomP can be employed to efficiently attach capsular polysaccharides containing a glucose residue at the reducing end, to a carrier protein, such as ComP. Such capsules are common within the genus Streptococcus. Expression of PglLcomP in E. coli in presence of plasmids expressing ComP and a capsular polysaccharide from S. pneumoniae resulted in the glycosylation of ComP with said polysaccharide. Injection of this glycoprotein in mice mounted a specific IgG immune response against the capsular polysaccharide, demonstrating the applicability of PglLcomP to generate recombinant conjugate vaccines against
Streptococcus .
[0051] To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way. [0052] Example 1;
[0053] Materials and Methods
[0054] Strains, plasmids, and growth conditions.
[0055] A list of bacterial strains and plasmids used herein are as follows:
TABLE 1: Plasmids and bacterial strains used herein
Figure imgf000017_0001
PLASMIDS
pFLP2 Encodes FLP recombinase Kumar et al.,
(2010) pKD13 Contains kanamycin resistance gene from Tn5 flanked by Datsenko &
FRT sites Wanner,
(2000) pRSM3542 pKD13 containing kan-sacB Carruthers et
a/., (2013) pGEM-T-Ez General cloning plasmid Promega pCCl Single copy, general cloning plasmid Epicentre pSMART-LCKAN Low copy blunt cloning vector Lucigen yGEM-pilA pGEM containing pilA with 1 kb flanking DNA Harding et al.
(2013) pGEM-pilA : .kan-sacB pGEM-pilA containing pilA: :kan This study pCCl-pilA-tfpO-pglL pCCl containing the pilA-tfpO-pglL locus with
This study approximately 1 kb of flanking DNA
pKNOCK derivative with a mini-Tn7 element containing a Harding et al. pRSM3510
multiple cloning site (2013) pRSM3510 containing pilA with expression driven from the Harding et al. pRSM3510-^X
predicted pilA promoter (2013) pRSM3510-/>i'Z 4 with a carboxy terminal serine to alanine
pRSM3510-^X [SI 36 A] This study
point mutation
pRSM3510-^X4[S132A] pRSM3510-/>;Z 4 with a serine 132 to alanine point mutation This study
pRSM3510 containing the predicted pilA promoter, the ATG
pRSM3510-^X p-/ pO of pilA, a FLP scar, the last 21 bp of pilA, and the tfpO gene This study
including the 48bp intergenic region between pilA and tfpO
pCCl-/¾ L: :kan pCCl-pilA-tfpO-pglL containing pglLwkan This study pGEM-weeH: :kan pGEM-T-Ez containing weeH .kan This study pSMART-LCKan containing an the empty mini-Tn7 element
pRSM4063 from pRSM3510 along with 2kb of flanking DNA up and This study downstream of the αίίΤη7 from strain M2
pRSM4063 containing the weeH gene with its predicted
pRSM4063-wee# This study promoter
Hunger et al., pWH1266 E. coli - Acinetobacter shuttle vector
(1990) pGEM-wo 7: :kan pGEM-T-Ez containing waJY : :kan This study pGEM-wo/Z: :kan pGEM-T-Ez containing wafZ: :kan This study pGEM-wagB: :kan pGEM-T-Ez containing wagBwkan This study pCCl containing the predicted promoter of the wxy gene
pCCl-GT This study
(329 bp upstream), wxy, wq/Y, wafZ, wagA, gnaB, and wagB
pCCl -wxy? -wq/Y pCCl-GT lacking the wxy open reading frame This study pCC 1 -wxyv-wqfZ pCCl-GT lacking the wxy and waJY open reading frames This study pCCl-GT lacking the wxy, wq/Y, wagA, and gnaB open
pCC 1 -wxyp-wagB This study reading frames
Figure imgf000018_0001
IPTG inducible.
Ampr pEXT20 expressing C-IOX His-tagged pglLigeoe from
A. baumannii ATCC 19606 inserted at BamHI and Sail, This Study IPTG inducible.
Faridmoayer
Tpr C-IOX His-tagged dsbAl from N. meningitidis MC58 A. and pAMF22
cloned into pMLBAD, Arabinose inducible. Feldman MF.
(unpublished)
C-6X His-tagged dsbAl subcloned into pBAVMCS, Km1, at
pBAV-dsbAl-Ris This Study
BamHI and Hindlll. Constitutively expressing.
Cm1 pACYC184-based plasmid encoding the C. jejuni
Wacker et al., pACYCp^ZB protein glycosylation locus cluster with mutations W458A
(2002) and D459A in PglB, IPTG inducible.
pBAVMCS- Km1 pBAVMCS constitutively expressing C-IOX hist- Scott et al., A1 S 1193Hisl0X tagged Al S_l 193 inserted at BamHI and Sail. (2014)
STRAINS
Acinetobacter nosocomialis Metro Health Systems Clinical Isolate Niu et al., strain M2 (2008)
M2Apz'£4: :kan Strain M2 containing a deletion of pilA and replacement with Harding et al.
a kanamycin resistance cassette (2013)
MlApilA : ±an-sacB Strain M2 containing a deletion of pilA and replacement with
This study a kan-sacB cassette
M2ApM Strain M2 containing an unmarked, in-frame deletion of pilA This study
MlApilT Strain M2 containing an unmarked, in-frame deletion of pilA Harding et al.
(2013)
M2AtfpO:±an Strain M2 containing a deletion of tfpO and replacement
This study with a kanamycin resistance cassette
MlAtfpO : kanApilT: : strep MlAtfpO '::kan containing a deletion of pilT and replacement
This study with a streptomycin resistance cassette
M2ApglL: ±an Strain M2 containing a deletion of pglL and replacement This study with a kanamycin cassette
MlApilA (pz7A[S136A]+) MlApilA : :kan with a mini-Tn7 element containing an allele
of pilA with a carboxy-terminal serine to alanine point This study mutation
MlAwafY: :kan Strain M2 containing a deletion of wafY and replacement
This study with a kanamycin resistance cassette
MlAwafZ: :kan Strain M2 containing a deletion of wafZ and replacement
This study with a kanamycin resistance cassette
M2AwagB: ±an Strain M2 containing a deletion of wagB and replacement
This study with a kanamycin resistance cassette
MlAweeH: :kan Strain M2 containing a deletion of weeH and replacement
This study with a kanamycin resistance cassette
M2ApilA: :kan (pilA+) MlApilA : :kan with a mini-Tn7 element containing the pilA Harding et al.
gene transcribed from its predicted promoter (2013)
MlAtfpO::kan (tfpO+) MlAtfpO::kan with a mini-Tn7 element containing the tfpO
This study gene transcribed from the pilA predicted promoter
M2AwqfY: :kan (wq/Y+) MlAwafY : :kan with a mini-Tn7 element containing the wafY
This study gene under control of the predicted wxy promoter
Ml AwqfZ: :kan (wq/Z+) MlAwafZ: :kan with a mini-Tn7 element containing the wafY
This study gene under control of the predicted wxy promoter
MlAwagB: :kan (wagB+) MlAwagB: :kan with a mini-Tn7 element containing the
This study wafY gene under control of the predicted wxy promoter
MlAweeH: :kan (wee,7+) MlApilA : :kan with a mini-Tn7 element containing the pilA
gene fused to a FLAG tag transcribed from its predicted This study promoter
M2 (Al S_1193-his+) Strain M2 with a mini-Tn7 element containing Al S_l 193-
This study his transcribed from its predicted promoter
MlAtfpO: :kan (Al S_l 193- MlAtfpO::kan with a mini-Tn7 element containing
This study his+) Al S_l 193-his transcribed from its predicted promoter
MlApglL: :kan (Al S_l 193- MlApglL: :kan with a mini-Tn7 element containing
This study his+) Al S_l 193-his transcribed from its predicted promoter
A baumannii ATCC 17978 Reference A baumannii strain ATCC
A baumannii ATCC 19606 Reference A baumannii strain ATCC
A. baumannii 11413 A baumannii clinical isolate isolated at Nationwide
NCH
Children's Hospital (NCH) from body fluid
A tayfyz ADP1 Environmental isolate de Berardinis et al, (2008)
A baylyi A >g Lc0mp: :kan Strain ADP1 with pglLCOmv deleted and replaced with a de Berardinis kanamycin resistance casette et al. (2008)
A baylyi
Figure imgf000019_0001
deleted and replaced with a de Berardinis kanamycin resistance casette et al. (2008)
E. co/z DH5a General cloning strain Invitrogen
E. coli ECIOOD pir+ General cloning strain, pir+ Epicentre
E. co/z DY380 Recombineering strain Lee et al.,
(2001)
E. co/z DH5a(pFLP2) Carries FLP recombinase gene under temperature control Kumar et al.
(2010)
£. co/z HB101 (pRK2013) Conjugation helper strain Figurski &
Helinski, (1979)
E. co/z EC100D(pTNS2) Carries transposase genes for mini-Tn7 transposition Choi et al.,
(2005)
E. coli Origami 2(DE3) K-12 derivative containing mutations in trxB and gor genes
Novagen and a host lysogen of DE3
E. coli Stellar chemically HST08 strain derivative for high transformation efficiencies
Clontech competent cells
E. coli CLM24 Constructed from E. coli W3110 (IN(rrnD-rrnE)l rph-1). Feldman et waaL mutant al., (2005) [0056] All bacteria were grown on L-agar or in LB-broth at 37°C unless otherwise noted. When appropriate, antibiotics were added to the A. nosocomialis or A. baumannii cultures at the following concentrations except when noted otherwise: 100 μg ampicillin/mL, 20 μg kanamycin/mL, or 12.5 μg chloramphenicol/mL. When appropriate, E. coli cultures were supplemented with antibiotics at the following concentrations: 50 μg ampicillin/mL for E. coli strains containing plasmids other than pGEM derivatives, 100 μg ampicillin/mL for ?. coli strains containing pGEM derivatives, or 20 μg kanamycin/mL. R. solanacearum was grown at 30°C in BG media (Boucher et al, 1985).
[0057] Bioinformatic analysis of Acinetobacter OTases. [0058] Protein sequences for Acinetobacter specific OTases were analyzed using NCBFs Basic Local Alignment Search Tool (BLAST) and protein domains identified using the Conserved Domain Database for the annotation of proteins (Marchler-Bauer et al, 2004, Marchler-Bauer et al, 2009, Marchler-Bauer et al, 2011).
[0059] Generation of a strain with an in-frame deletion of pilA. The ApilA mutant was constructed, generating an in-frame deletion of pilA, according to the methodology published previously by our group (Harding et al, 2013). Primer sets 1 and 2 were used and can be found in the primer table in the supplemental materials.
[0060] Construction of the tfpOy.ksai mutant. The tfpO: :km mutant was constructed previously (Harding et al, 2013); however, at that time the gene was designated as the pgyA gene, not the tfpO gene.
[0061] Complementation of the AtfpOiiksm mutant. To complement the AtfpO .km mutant, the tfpO gene was cloned with the predicted pilA promoter into a mini-Tn7 element as previously described. Briefly, gDNA from the ApilA mutant was used as template with primer set 3 to generate an amplicon containing the predicted pilA promoter, the ATG start codon of the pilA open reading frame, a FLP scar, the last 21bp of pilA, the 53bp intergenic region, and the entire tfpO open reading frame. A four-parental mating strategy was used to introduce the mini-Tn7 element containing tfpO driven off the predicted pilA promoter into the AtfpO: :km mutant as previously described (Harding et al, 2013). A correct clone was verified by sequencing and designated as the tfpO+ complement. [0062] Plasmid construction and transfer into E. coli. The pilA gene from strain M2 was PCR amplified from gDNA using primer set 4 and cloned into the EcoRV site of pWH1266. A correct clone containing the pWH-pilAM2 plasmid was verified by restriction digestion and sequencing. pWH-pilAM2 was purified from E. coli harboring the plasmid, then electroporated into Acinetohacter isolates. Acinetohacter isolates were made
electrocompetent according to the methods previously described (Aranda et al, 2010). The pBAV-comP-His plasmid was built by using primer set 32. The sticky-ended amplicon was digested with the respective restriction enzymes and ligated into the vector pBAVmcs in the same sites. The ligation was then electroporated into DH5a- E with transformants being selected for on L-agar plates supplemented with kanamycin. The pEXT-pg/ comP, pEXT- pglLmvi, pEXT-(/ >019606 and pEXT-pglL 19606 plasmids were built using primer sets 33, 34, 35 and 36 respectively. The resulting amplicons were digested with BamHI and Sail and inserted in the same sites of pEXT20. Ligations were electroplated into DH5a-E and transformants were selected for on L-agar plates supplemented with ampicillin. [0063] pWH-pilA17978-His construction and western blot analysis. The pilA allele from A. baumanii ATCC 17978 was PCR amplified using primer set 37. The PCR product was purified and End-it repaired to phosphorylate the 5' ends. The vector pWH1266 was linearized with EcoRI, End-it repaired, and then treated with alkaline phosphatase. The linearized pWH1266 and the PCR purified pilA allele were ligated, transformed into DH5a, and transormants were selected on L-agar supplemented with ampicillin. The pWH- pilA17978 plasmid was sequenced verified and used as template for an inverse PCR to add a C-terminal hexa-histidine tag using primer set 38. The PCR product was purified, Dpnl treated, End-it repaired, and ligated. The ligation was electroporated into DH5 and transformants were selected on L-agar supplemented with ampicillin. The pWH-pilA17978- His electroporated into A. baumannii strains as previously described and naturally transformed into A. baylyi strains according to our previously described methods for transforming A. nosocomialis strain M2. Acinetohacter transformants were selected on L-agar supplemented with ampicillin. Western blot analysis on whole cell lysates was conducted as described above with the following exceptions. Strains were grown in LB broth without NaCl and were normalized to an OD600 = 2.0.
[0064] Construction of a strain M2 ApglL::kan mutant. The entire pilA-tfpO-pglL locus along with lkb of flanking DNA from A. nosocomialis strain M2 was amplified using primer set 6. The PCR product was ligated to pCCl (Epicentre) and transformed into E. coli EPI300. A correct clone containing the pCCl -pi lA-tfpO-pglL vector was verified by restriction digestion and sequencing. To replace the pglL gene with a kanamycin cassette, a modified recombineering protocol was used as previously described (Harding et al, 2013). To introduce the mutation into A. nosocomialis strain M2, the plasmid pCCl-Apgl: :kan was linearized and transformed via natural transformation. Transformants were selected on L- agar supplemented with kanamycin. The M2ApglL: :k region in the mutant was verified by sequencing.
[0065] Generation of strains containing point mutations in pilA in strain M2. To generate a strain with a carboxy-terminal serine to alanine point mutation in the pilA gene of strain M2, the MlApilA mutant was complemented with a mini-Tn7 element containing a variant of the pilA allele, where the carboxy-terminal serine was mutated to an alanine (pRSM3510-/wX4[S136A]). The pRSM3510-/¾L4[S136A] plasmid was constructed using the
Quikchange Site Directed Mutagenesis Kit (Stratagene) according to the manufacturer's protocol using primer set 8. A correct clone carrying the pRSM3510-/¾'L4[S136A] plasmid was verified by restriction digest and sequencing. The mini-Tn7 construct containing the /¾'L4[S136A] allele was transposed into the atflnl of strain M2 via a four-parental mating strategy previously described above. The same protocol was used to generate the
/¾'L4[S132A] except primer set 39 was used. [0066] Construction of glycosyl-transferase mutants in the strain M2 background. In order to replace each glycosyl-transferase gene with a kanamycin resistance cassette, an In- Fusion HD EcoDry cloning kit was used according to the manufacturers protocol (ClonTech). The following protocol describing the construction of the M2AweeH::kan mutation was used for each glycosyl-transferase mutant, except the 15bp overhangs were added to the primers which amplified the 5' and 3' flanking regions of each respective gene. Briefly, the upstream and downstream flanking DNA regions around weeH were PCR amplified with primer sets 9 and 10 respectively. The Tn5 kanamycin cassette and pGEM vector were PCR amplified with 15bp overhangs homologous to the DNA in which they were to be recombined using primer sets 11 and 12 respectively. The PCR amplicons were gel extracted and ethanol precipitated. One hundred nanograms of each product was added to the In-fusion EcoDry cloning tube according to the manufacturer's protocol and incubated at 37°C for 15 mins then at 50°C for 15 mins. The newly generated vector was transformed into chemically competent Stellar cells (Clontech) according to the manufacturer's protocol. Transformants were selected for on
L-agar plates supplemented with kanamycin. A correct clone containing the pGEM- weeH::k plasmid was sequence verified. The weeHv.kwv cassette was PCR amplified using the forward primer of primer set 9 with reverse primer of primer set 10. The amplicon was Dpnl treated, ethanol precipitated, then transformed into strain M2 according to previously published methodologies. A correct clone designated M2AweeH::kan was sequence verified.
[0067] The upstream and downstream regions of wafY were amplified using primer sets 17 and 18, linearized pGEM was amplified using primer set 15, and the kanamycin cassette was amplified with primer set 16. The above protocol was used to In-Fuse all four PCR products. pGEM-wa/y::kan was linearized with EcoRI and introduced into A. nosocomialis strain M2 via natural transformation as previously described. A correct clone designated M2 wafY : :kan was sequence verified.
[0068] The upstream and downstream regions of wafZ were amplified using primer sets 19 and 20 and the upstream and downstream regions of wagB were amplified using primer sets 21 and 22. Mutants were then constructed as described for the wafY mutant. Clones designated Μ2Δ wafZv.kwv and M2 wagB: :kan were identified and sequence verified.
[0069] Construction of pRSM4063. To generate the pRSM4063 vector, an empty mini-Tn7 element was first introduced into strain M2 via a four-parental mating strategy previously described. Transposition of the empty mini-Tn7 element into the atfln7 was sequence verified generating the strain M2attTn7::MCS_Empty. Genomic DNA was purified from this strain and used as a template in a PCR using primer set 13. The forward primer of primer set 13 is approximately 2kb upstream of the mini-Tn7 element and the reverse primer of primer set 13 is approximately 2kb downstream of the mini-Tn7 element. The ensuing PCR product was ligated into the pSMART-LCKan vector, sequence verified, and designated pRSM4063.
[0070] Construction of the weeH complemented mutant. To complement the weeH.. km mutant, weeH plus 375bp of upstream DNA was PCR amplified using primer set 14. The amplicon was digested with Xmal and Kpnl, cloned into pRSM4063 and electroporated into DH5a. To complement the AweeH.km mutant, pRSM4063-weeH was linearized with Ndel and introduced into M2 AweeH.km via natural transformation according to a previously published procedure (Harding et al, 2013). [0071] Construction of the wafY, wafZ, and wagB complemented mutants. Given the lack of an obvious promoter driving expression of each of the glycosyl-transferase genes and the over-lapping nature of the open reading frames, the upstream wxy promoter was selected to drive expression of each of the three genes. Each glycosyl-transferase mutant was complemented by returning the deleted gene driven off the predicted wxy promoter to the chromosome using the mini-Tn7 system. Briefly, the glycosyl-transferase locus was PCR amplified using primer set 23, End-It repaired (Epicentre) and ligated into pCCl (Epicentre). Transformants were selected on chloramphenicol and the pCCl-GT plasmid was verified by restriction digest. The pCCl-GT plasmid contained the predicted promoter of the wxy gene (329 bp upstream), wxy, wafY, wafZ, wagA, gnaB, and wagB.
[0072] To generate the wxy promoter-wa/y construct, an inverse PCR strategy was employed to remove the wxy gene and join the wxy promoter to the ATG start codon of the wafY gene using primer set 24 and pCCl-GT as template. The subsequent PCR product was End-It repaired (Epicentre) and ligated to itself generating the pCCl-wxyP-wafY construct. The wxyV-wafY DNA fragment was PCR amplified using primer set 27, which contained Xmal and Kpnl restriction overhangs. The PCR product was digested and ligated to predigested pRSM3510 then transformed into ECIOOD cells. Transformants were selected for on L-agar supplemented with kanamycin. The mini-Tn7 element containing wxyVwafY was introduced into the M2Avra y : :kan mutant using a four-parental mating strategy previously described. [0073] The same process was used to generate pRSM3510- wxy?-wafY except primer set 25 and primer set 28 were used. The mini-Tn7 element containing wxy?-wafl was introduced to the M2 wafl: :kan mutant via a four-parental mating strategy. The wxy?-wagB fragment was generated using primer set 26 and primer set 29, but was cloned into pRSM4063. The pRSM4063- wxyV-wagB vector was linearized with Xhol and introduced into M2Awag5::kan via natural transformation as previously described.
[0074] Construction and transfer of p4063-AlS_1193-5X into Acinetobacter strains. The
A1S 1193 open reading frame along with its predicted promoter was PCR amplified to include a C-terminal 5X His tag using primer set 30, which also contained Xmal and Kpnl restriction overhangs. The PCR product was digested and ligated to pre-digested pRSM4063. The pRSM4063-Al S_l 193-5X vector was linearized with Xhol and introduced to
Acinetobacter strains via natural transformation as previously described. [0075] Construction of pET-15b-rsPilAM2. A truncated His-tagged recombinant, soluble derivative of pilA (rsPilAM2) was amplified using gDNA from A. nosocomialis strain M2 as template with primer set 31 deleting the first 28 amino acids of the PilA protein. This PCR product was then used as template for a second PCR where the forward primer of primer set 15 contained an Ndel site and the reverse contained a BamHI site to aid in directional cloning into pET-15b. The amplicon was digested with Ndel and BamHI then ligated into the expression vector pET-15b, which was digested with Ndel and BamHI generating a first codon fusion driven off of the T7 promoter with an N-terminal His tag followed by a thrombin cleavage site. Ligation products were electroporated into DH5a-E (Invitrogen), transformants were subcloned and verified to contain the vector with insert by restriction digestion and sequencing. A correct clone was transformed into E.coli strain Origami B (DE3) (Novagen) for expression of the recombinant protein.
[0076] rsPilAM2 purification. Origami B(DE3) (Millipore) containing pET15b-rsPilAM2 was inoculated into 100 mL of LB broth to an A600nm optical density of 0.05 and grown at 37°C with 180 rpm to mid-log phase at which point rsPilAM2 expression was induced with IPTG at a final concentration of 500 μΜ. Cells were transitioned to 19°C with 180 rpm and grown for 18 h. Cells were harvested by centrifugation into two equal pellets and resolved in 4 mL each of IX Ni-NTA Bind Buffer (Novagen) with protease inhibitors (Roche).
Resuspended pellets were added to 15 mL TeenPrep Lysing matrix B tubes (MP
Biomedicals) and lysed in a Fast Prep 24 homogenizer (MP Biomedicals) with two rounds at 6.0 m/s for 40 seconds with a 5 minute incubation on ice between each round. Supernatants were separated from the unlysed bacteria and the lysing matrix by centrifugation at 4000 rpm for 10 mins at 4°C. Supernatants were further clarified with 1 hour of ultracentrifugation at 100,000 x g for 1 hour at 4°C Clarified supernatants were incubated with 1 mL of Ni-NTA His bind resin (Novagen) for 2 hours at 4°C with gentle rocking followed by two 4 mL washes with IX Ni-NTA wash buffer. His-tag rsPilAM2 was eluted from the resin with three washes of Ni-NTA elution buffer and dialyzed overnight in phosphate buffered saline. The N-terminal His tag on rsPilAM2 was thrombin cleaved with 0.04 units^L of biotinylated- thrombin (Novagen) for 2 hours at room temperature. The biotinylated-thrombin was captured with streptavidin-agarose beads for 30 minutes and the rsPilAM2 was collected with a centrifugation in a spin filter at 500 x g for 5 minutes. To remove any small peptides containing the cleaved His-tag or uncleaved His-tag rsPilAM2, the filtrate was run over Ni- NTA bind resin and the flow through was collected as pure, cleaved rsPilAM2. The pure protein was dialyzed in phosphate buffer saline with 50% glycerol then normalized to 1 mg/mL using a BCA total protein assay kit (Pierce).
[0077] Generation of polyclonal antiserum against rsPilAM2. Polyclonal antiserum against rsPilAM2 was raised following our previously described methods (Actis et al., 1985). Briefly, 100 μg of purified rsPilAM2 emulsified in one milliliter of Freund's complete adjuvant was injected using a 23 gauge needle at ten intracutaneous sites into the haunch of a 6-month old female New Zealand white rabbit (Charles River Laboratories International, Inc.,
Wilmington, MA). Injections consisting of 100 μg rsPilAM2 emulsified in Freund's incomplete adjuvant were subsequently delivered at 15-day intervals, and serum was collected at 10-day intervals following the initial injection. The specificity and reactivity of the anti-rsPilAM2 antibodies were confirmed by immunoblotting rsPilAM2 and A. nosocomialis strain M2 whole- cell lysates after proteins were size-fractionated by SDS-PAGE.
[0078] Transformation efficiency assays. Natural transformation was assayed as described previously (Harding et al., 2013). Transformation efficiency was calculated by dividing the CFU of transformants by the total CFU. Experiments were conducted on at least three separate occasions.
[0079] Quantitative dimethylation of A. baylyi ADP1 membrane extracts. Quantitative dimethylation of lysates from A. baylyi ADP1, the ADPlA/?g/ZcomP mutant, and the ADP1 pglL ADPi mutant was performed as outlined previously (Boersema et al., 2009). Briefly, 1 mg of peptide lysate from each strain was resuspended in 30 μΐ of 100 mM tetraethylammonium bromide and mixed with the following combinations of 200 mM formaldehyde (30 μΐ) and 1M sodium cyanoborohyride (3 μΐ) isotopologues: ADPI samples were labeled with light formaldehyde (CH2O) and light sodium cyanoborohyride (NaBFbCN), ADPlA/?g/ZADPi samples with medium formaldehyde (CD2O) and light sodium cyanoborohyride, and ADP1A pglL omP with heavy formaldehyde (13CD20) and heavy sodium cyanoborodeuteride
(NaBDsCN). Reagents were mixed and samples incubated at room temperature for 1 h. Dimethylation reactions were repeated twice to ensure complete labeling of all amine groups. Dimethylation reactions were terminated by the addition of 30 μΐ of 1M NH4CI for 20 minutes at room temperature. Samples were acidified by addition of 5% (v/v) acetic acid and allowed to equilibrate in the dark for 1 h before pooling the three samples at 1 : 1 : 1 ratio. Pooled samples were then STAGE tip purified, lyophilized, and stored at -20°C. [0080] Western blot analyses.
[0081] Western blot analyses were preformed according to previously described
methodologies (Harding et al, 2013). Primary antibodies used were Anti-rsPilAM2 or Penta- His Antibody (Qiagen). Secondary antibodies used were Goat anti-rabbit IgG (H+L), alkaline phosphatase antibody (Molecular Probes) and Goat-anti mouse IgG (H+L), alkaline phosphatase antibody (Molecular Probes). Membranes were developed with the BCIP/NBT Liquid Substrate System (Sigma).
[0082] Pili Shear Preparations.
[0083] Pili shear preparations were prepared as previously described with the following modifications. Briefly, bacterial lawns were removed from the agar surface and resuspended in 5 mL of ice cold DPBS supplemented with IX protease inhibitors (Roche). The bacterial suspensions were normalized to an optical density at A600nm equal to 70. To shear surface exposed proteins, bacterial suspensions were vortexed on high for 1 minute. Bacteria were pelleted at 10,000 x g for 10 minutes at 4°C. The supernatants were collected and again centrifuged at 10,000 x g for 10 minutes at 4°C. The supernatants were collected and further clarified by centrifugation at 20,000 x g for 5 mins at 4°C. The sheared surface proteins were precipitated with ammonium sulfate at a final concentration of 30%. Precipitated proteins were pelleted by centrifugation at 20,000 x g for 10 minutes at 4°C. The supernatants were discarded and the pellets were resuspended in 100 of IX Laemmli buffer. Preparations were boiled for 10 minutes, run on SDS-PAGE, coomassie-stained, and bands were excised and prepared for mass spectrometric analysis according to Shevchenko et al. (2006). Briefly, bands were washed with water and dehydrated with acetonitrile (ACN) repeatedly. Disulfide bonds were reduced with lOmM DTT in 50mM NH4HC03 for 60 minutes at 37°C followed by alkylation of cysteine thiol groups with 50mM iodoacetamide in 50mM NH4HC03 for 60 minutes in the dark at room temperature. Gel pieces were then washed with 50mM
NH4HC03, dehydrated with 100% ACN and dried. Pilin was digested with 0.02mg/mL trypsin in 50mM NH4HC03 (Promega) at 37°C for 16 hours. Peptides were eluted with 100% ACN and water and lyophilized. Tryptic peptides were resuspended in 0.1%
Trifluoroacetic acid and desalted with a C18 ZipTip (Millipore, USA). 60% ACN was used to elute the peptides, which were dried in a speedvac and resuspended with 0.1% Formic
Acid. The analysis was done using a Q-TOF Premier (Waters, Manchester, UK) coupled to a nanoACQUITY (Waters) ultra-performance liquid chromatography system as previously described (Wang et al, 2007). MassLynx, v. 4.1 (Waters) was used to analyze the data. OmpA-His was purified from strain M2 and prepared for ESI-QTOF MS/MS analysis as described above.
[0084] LPS extraction and silver staining [0085] LPS from A. baylyi and R. solanacearum was extracted from overnight cultures by the TRI-reagent method as described previously (Yi & Hackett, 2000). Equal amounts of LPS were loaded on 12.5% SDS-PAGE gels for LPS separation followed by silver staining as previously described (Tsai & Frasch, 1982).
[0086] DsbAl glycosylation in E. coli [0087] E. coli CLM24 cells were co-transformed with three plasmids: one plasmid encoding the C. jejuni glycosylation locus, another plasmid encoding a single O-OTase gene, and the last plasmid, pAMF22, encoding dsbA 1 -His. Ampicillin (100 μg/ml), trimethoprim (50 μg/ml) and chloramphenicol (10 μg/ml) were added as required for plasmid selection. Cells were grown at 37°C to an OD600 of 0.4-0.6 and then were induced with 0.1 mM IPTG and/or 0.2% arabinose. Cultures requiring arabinose induction were given a second dose of induction after 4 hours. Whole cell lysates were obtained at stationary phases and western blot analyses were employed to determine DsbAl modification.
[0088] Digestion of membrane enriched samples of baylyi ADP1
[0089] Peptide lysates for glycopeptide enrichment and quantitative analysis were prepared according to Lithgow et al. (2014) with minor modifications. Briefly, 2 mg of dried membrane enriched protein samples were solubilized in 6 M urea, 2 M thiourea, 40 mM NH4HC03 and reduced with lOmM Dithiothreitol (DTT). Reduced, solubilized peptides were alkylated with 25mM iodoacetamide (IAA) for one hour in the absence of light. The resulting alkylated protein mixture was digested with Lys-C (1/100 w/w) for 4 hours at 25°C, diluted 1 :5 in 40 mM NH4HC03, then digested with trypsin (1/50 w/w) overnight at 25°C. Digestion was terminated with the addition of 1 % trifluoroacetic acid (TFA). Peptide digests were purified using the CI 8 empore (Sigma- Aldrich, St. Louis MO) STop And Go Extraction (STAGE) tips (Rappsilber et al., 2007) to remove primary amide and salts. [0090] Enrichment of A. baylyi ADP1 glycopeptides using ZIC-HILIC purification
[0091] ZIC-HILIC enrichment was performed according to (Scott et al, 2011) with minor modifications. Micro-columns composed of 10 μηι ZIC-HILIC resin (Sequant, Umea, Sweden) packed into plO tips containing a 1 mm2 excised C8 Empore™ disc (Sigma) were packed to a bed length of 0.5 cm. Prior to use, the columns were washed with ultra pure water, followed by 95% acetonitrile (ACN), and then equilibrated with 80% ACN and 5% formic acid (FA). Samples were resuspended in 80% ACN and 5% FA and insoluble material was removed by centrifugation at 16,100 x g for 5 min at 4°C. Samples were adjusted to a concentration of 3 μg/μL and 150 μg of peptide material was loaded onto a column and washed with 10 load volumes of 80% ACN, 5% FA. Unbound fractions were collected, pooled, and dried by vacuum centrifugation. ZIC-HILIC bound peptides were eluted with 3 load volumes of ultra-pure water and concentrated using vacuum centrifugation. Biological replicates were subjected to ZIC-HILIC enrichment independently using freshly prepared reagents. [0092] Identification of glycopeptides using reversed-phase LC-MS, CID MS-MS and HCD MS-MS
[0093] Purified glycopeptides/peptides were resuspended in Buffer A (0.5% acetic acid) and separated using reversed-phase chromatography on either an Agilent 1290 Series HPLC (Agilent Technologies, Mississauga, ON) coupled to LTQ-Orbitrap Velos (Thermo
Scientific, San Jose CA) for qualitative analysis of glycopeptides or an EASY-nLClOOO system coupled to a Q-exactive for quantitative studies. For qualitative analysis of A. baylyi ADP1 glycopeptides, a packed in-house 20 cm, 75 μηι inner diameter, 360 μηι outer diameter, ReproSil - Pur C18 AQ 1.9 μηι (Dr. Maisch, Ammerbuch- Entringen, Germany) column was used. For quantitative studies a house packaged 45 cm, 50 μηι inner diameter, 360 μηι outer diameter, ReproSil - Pur C18 AQ 1.9 μηι column was used. In both systems, samples were loaded onto a trap column, an in-house packed 2 cm, 100 μηι inner diameter, 360 μηι outer diameter column containing Aqua 5 μηι C18 (Phenomenex, Torrance, CA), at 5 μί/ηιίη prior to gradient separation and infused for mass spectrometry. A 180 min gradient was run from 0% buffer B (80% ACN, 0.5% acetic acid) to 32% B over 140 min, next from 32% B to 40% B in the next 5 min, then increased to 100% B over 2.5 min period, held at 100% B for 2.5 min, and then dropped to 0% B for another 20 min. Unbound fractions from ZIC-HILIC glycopeptide enrichment were subjected to analysis using the same instrumental set up as qualitative analysis of glycopeptides. Both instruments were operated using Xcalibur v2.2 (Thermo Scientific) with a capillary temperature of 275°C in a data-dependent mode automatically switching between MS, CID MS -MS and HCD MS -MS for qualitative analysis as previously described (Scott et al., 2011) and using a top 10 data-dependent approach switching between MS (resolution 70k, AGC target of lxl 06), and HCD MS -MS events (resolution 17.5k AGC target of lxlO6 with a maximum injection time of 60ms, NCE 28 with 20% stepping) for quantitative studies.
[0094] Identification of baylyi ADP1 glycopeptides
[0095] Raw files for qualitative glycosylation analysis were processed as previously described (Scott et al., 2011, 2012). Briefly, Proteome Discoverer v. 1.2 (Thermo Scientific) was used to search the resulting glycopeptide data using MASCOT v2.4 against the A. baylyi ADP1 database (obtained from UNIPROT, http://www.uniprot.org/, 681 2014-06-10, Taxon identifier: 62977 containing 3263 protein sequences). Mascot searches were performed using the following parameters: peptide mass accuracy 20 ppm; fragment mass accuracy 0.02 Da; no enzyme specificity, fixed modifications - carbamidomethyl, variable modifications - methionine oxidation and deamidated N, Q. The instrument setting of MALDI-QUAD-TOF was chosen as previous studies show quadrupole-like fragmentation within HCD spectra (Olsen et al., 2007). Scan events that did not result in peptide identifications from MASCOT searches were exported to Microsoft Excel (Microsoft, Redmond WA). To identify possible glycopeptides within exported non match scans, the MS-MS module of GPMAW 8.2 called 'mgf graph'was used to identify HCD scan events that contained the 204.08 m/z oxonium of HexNAc. All scan events containing the oxonium 204.08 m/z ion were manually inspected to identify possible glycopeptides. To facilitate glycopeptide assignments HCD scan events containing the 204.08 oxonium were manual inspected to identify potential deglycosylated peptides ions. Within these HCD scans the MS features (m/z, charge and intensity), which corresponded to masses below that of the deglycosylated peptide were extracted using the Spectrum list function of Xcalibur v2.2. The resulting numerical values of the detected MS features were scripted into mgf files and the peptide mass set to that of the deglycosylated peptide mass. The resulting mgf files were then searched using the MASCOT setting described above. All spectra were searched with the decoy option enabled and no matches to this database were detected; the false discovery rate (FDR) was 0%. [0096] Quantitative analysis of dimethylated A. baylyi ADP1 and mutant glycopeptides was performed as previously reported (Lithgow et al., 2014). Briefly, dimethylated A. baylyi ADP1 glycopeptides were identified as above and quantified by manually extracting the area under the curve of the monoisotopic peak using Xcalibur v2.2. Triplex(wild type ADP1 vs ADP 1 ApglLcomP vs ADP 1 ApglLmm).
[0097] Results
[0098] The two OTase homologs encoded by Acinetobacter contain different pfani domains
[0099] It was previously reported that A. baylyi ADP1 encodes two proteins containing domains from the Wzy_C superfamily (Schulz et al., 2013). Through bioinformatic analyses we identified several Acinetobacter spp. with two open reading frames (ORFs) immediately downstream of the major type IVa pilin subunit pilA (Figure 1, panel A) that are predicted to encode proteins that contain evolutionarily related domains from the Wzy C superfamily.
[00100] In A. nosocomialis strain M2, the pilA gene is immediately upstream of two genes, M215_10480 and M215_10475, both of which encode members of the Wzy_C superfamily. M215_10480 and M215_10475 contain the pfaml3425 and the pfam04932 domains, respectively (Figure 1, panels A and B). At the time of this study, the same genetic arrangement was found in 12 of the 17 completed genomes for A. baumannii strains, 7 of 8 A. nosocomialis genomes, and 3 of 5 A. pittii genomes demonstrating the conservation of this locus amongst medically relevant members of the Acb complex (Data not shown). Previously we designated the gene encoding the pfaml3425 domain containing protein (ORF
M215_10480) as the putative glycosylase A (pgyA) (Harding et al., 2013). Given that the gene encoding M215_10480 is immediately downstream of pilA, together with the functional data provided herein which demonstrates that this protein is a pilin glycosylase, we have renamed the gene encoding ORF M215_10480 as a type four pilin specific O- Oligosaccharyltransferase gene itfpO).
[00101] The second ORF, M215_10475, encodes a predicted protein that contains a domain from the pfam04932 family, a domain that has been found in all previously characterized PglL orthologs as well as in O-antigen ligases. The PglL A and the PglL B domains were also identified in M215_10475. It appears that this protein is an ortholog of the PglL general OTases; thus, we have designated ORF M215_10475 as pglLMl (Figure 1, panels A and B).
[00102] Transcriptome analysis was performed on mid log phase M2 cells using RNA- seq (data not shown). PilAMl transcription was readily observed; tfpOMl transcription was also observed but the levels dropped precipitously beginning at the intergenic region between pilAMl and tfpOMl. A predicted Rho-independent terminator is located immediately upstream of the ATG start codon of tfpOMl. It is likely that pilAMl and tfpOMl are in an operon separated by a leaky transcriptional terminator. These findings are consistent with transcriptional studies of pilA and pilO (tfpO) of P. aeruginosa 1244 (Castric, 1995).
Downstream of the tfpOMl gene is the pglLMl gene. Since the genes encoding both OTases are in close proximity and use the same lipid-linked oligosaccharide as a substrate, it was speculated that these genes would be cotranscribed. There does appear to be some transcriptional read through but transcript levels for the pglLMl gene are markedly higher than the tfpOMl levels, suggesting that the intergenic region between tfpOMl and pglLMl contains a promoter, which also drives transcription of pglLMl.
[00103] In the A. baylyi ADP1 genome, the comP gene, encoding a pilin-like protein, is followed by ACIAD3337 encoding a pfam04932-containing OTase-like protein, which was designated pglL by Schulz et al, (2013). This has been designated ACIAD3337 as pglLcomP due to its proximity to comP (Figure 1, panels C and D) and the previously reported evidence demonstrating its requirement for post-translational modification of ComP (Schulz et al, 2013).
[00104] A second pfaml3425 domain containing ORF (ACIAD0103) predicted to encode a WaaL ligase ortholog was also identified. ACIAD0103 was not located near the pilin gene homolog, but instead was found within a glycan biosynthetic locus. This is herein designated ACIAD0103 as the pglLmm (Figure 1, panels C and D). A. baylyi was the only strain containing two genes encoding proteins with domains from the Wzy_C superfamily that were not encoded by adjacent genes.
[00105] \n A. baumannii ATCC 17978, a well-studied strain with respect to its glycosylation, only one general O-OTase was identified, which was previously designated PglL (Iwashkiw et al, 2012; Lees-Miller et al, 2013). [00106] TfpO is required for post-translational modification of pilin in A.
nosocomialis strain M2.
[00107] Figure 2A shows Western blot analysis of whole cell lysates from strain M2, the isogenic pilA mutant, and the complemented pilA mutant strain confirmed our previous findings that PilA existed in two molecular forms differing by apparent molecular weight. The more abundant, higher molecular weight form of PilA was likely a post-translationally modified species of PilA while the lower molecular weight form of PilA was an unmodified species. To determine the effects of TfpO on PilA post-translational modification, we constructed an isogenic tfpO mutant and probed for PilA expression. PilA from the strain lacking tfpO existed only in the lower molecular weight form (Figure 2A). The increase in PilA's electrophoretic mobility is consistent with the loss of a post-translational modification. Furthermore, PilA from the complemented tfpO mutant strain existed primarily in the higher molecular weight form confirming that TfpO was required for post-translational modification of PilA. [00108] Immediately downstream of tfpO in strain M2 is pglLMl, which encodes a homolog of the general O-OTases responsible for glycosylation of many membrane associated proteins in Neisseria gonorrhoeae and N. meningiditis (Vik et al, 2009; Borud et al, 2011). To determine if PglLM2 also played a role in post-translational modification of PilA, an isogenic mutant strain lacking pglLMl was generated. Western blot analysis of whole cell lysates from the pglLMl mutant demonstrated that PilA existed primarily in the modified form, indicating that PglLM2 is not required for the post-translational modification of PilA as observed (Figure 2A).
[00109] PHAM2 was glycosylated in a TfpOM2-dependent manner with a tetrasaccharide containing (ΗβχΝΑ , Hexose and N-acetyl-deoxyHexose. [00110] To confirm that PilA was glycosylated by TfpO, PilA was purified from surface shear preparations from strain M2, a hyper-piliated MlApilL mutant, and a hyper- piliated MlAtfpO: :kmApilL: : strep mutant. The pilT gene encodes for the predicted retraction ATPase; therefore, mutants lacking pilL have a hyper-piliated phenotype, which results in an abundance of surface exposed PilA. Proteins in the shear preparations were separated by SDS-PAGE, coomassie-stained, excised and subjected to mass spectrometric analysis.
Figure B shows MS/MS analysis of PilA from both strains M2 and MlApilL identified the presence of a tetrasaccharide, comprised of two HexNAc residues, a Hexose and N- acetyldeoxyHexose, on PilA. MS/MS analysis revealed that the tetrasaccharide was present on the carboxy-terminal tryptic 119NSGTDTPVELLPQSFVAS136 peptide. PilA from the M2AtfpO: :kanApilT:: strep mutant was unmodified confirming that TfpO was required for PilA glycosylation (data not shown).
[00111] The carboxy-terminal serinel36 of ΡΠΑΜ2 was required for pilin modification.
[00112] In P. aeruginosa 1244 the pilin protein PilA is glycosylated in a TfpO- dependent manner (Castric, 1995). The glycosylation site was later determined to be at the carboxy terminal serine 148 (Comer et al, 2002). Amino acid sequences of PilA proteins from Acinetobacter spp., including^, nosocomialis M2, were compared to the P. aeruginosa 1244 PilA. Although the sequences share limited homology, strain M2's PilA sequence also contains a C-terminal serine, which was included in the glycopeptide identified by MS (Figure 2B). [00113] Figure 3A shows that, in fact, all Acinetobacter spp. containing two consecutive genes encoding O-OTase homologs contain a carboxy-terminal serine in their respective PilA amino acid sequences.
[00114] In order to determine if the carboxy-terminal serinel36 was required for PilA post-translational modification, the M2(£¾'L4[S136A])+ strain was generated. First, a strain with an in-frame deletion of the pilA gene was generated so as to not affect the transcription of the downstream tfpO gene. We then complemented the M2ApilA strain with an allele of pilA where the carboxy-terminal serine was mutated to an alanine residue generating an M2(/^L4[S136A])+ strain.
[00115] Figure 3B shows Western blot analysis of whole cell lysates from the
M2(£¾'L4[S136A])+ strain demonstrated that PilA only existed in the unmodified, lower molecular weight form indicating that the carboxy-terminal serine was required for PilA post- translational modification). Another highly conserved serine was found at position 132. We constructed the M2(£¾'L4[S132A])+ strain in order to determine if this site was also required for glycosylation. Western blot analysis of whole cell lysates from the M2(/¾'L4[S132A])+ strain demonstrated that PilA existed in the modified form indicating that serine 132 was not required for glycosylation (Figure 3B). The carboxy terminal serine to alanine point mutation did not affect Tfp functionality as the M2(/¾'L4[S136A])+ strain was naturally transformable (Figure 3C) and exhibited twitching motility similar to the parental strain (Data not shown).
[00116] The Major Polysaccharide Antigen (MP A) Locus is required for post- translational modification of PHAM2. [00117] Hu et al. recently developed a molecular serotyping scheme for Acinetobacter spp. containing a major polysaccharide antigen (MP A) locus. The MPA locus, found between the conserved flcpA and UdP genes, was identified in all sequenced Acinetobacter strains included in their study and was also present in A. nosocomialis strain M2 (Hu et al., 2013, Carruthers et al., 2013). The MPA locus from^4. nosocomialis strain M2 contains three predicted glycosyl-transferases (designated wqfY, wafZ, and wagB) and one predicted initiating glycosyl-transferase (designated weeH or pglC) (Figure 4A). To determine if the MPA locus was required for post-translational modification of PilAM2, individual isogenic mutants lacking each of the predicted glycosyltransferases were constructed. Figure 4B shows Western blot analysis of whole cell lysates from the strain lacking weeH demonstrated that PilA existed in the lower molecular weight form indicating that WeeH is required for glycosylation of PilA. Deletion of the other three glycosyltransferases yielded PilA proteins with intermediate electrophoretic mobilities. PilA from the wafYv.kwv mutant migrated closest to the WT PilA mobility, then PilA from the wafZv.km mutant, followed by PilA from the wagB: :kan mutant (Figure 4B). Interestingly, both partially modified and unmodified forms of PilA were identified from the wafZv.km and wagB .km mutant backgrounds. All mutant strains were successfully complemented, indicating that the products of wqfY, wafZ, wagB, and weeH genes were all required to produce fully modified PilA.
[00118] pglLMl encodes a PglL-like O-OTase in A. nosocomialis strain M2 and uses the same tetrasaccharide precursor as a donor for general protein glycosylation. [00119] In Figure 2 A, pglLMl, the second ORF containing the Wzy_C domain, was shown to not be required for pilin glycosylation. It is thought that pglLMl may be a general O-OTase that, like the previously characterized PglL in A. baumannii ATCC 17978, could glycosylate non-pilin target proteins. We recently demonstrated that Al S_l 193-His, encoding for the protein OmpA, could serve as a bait acceptor protein in order to isolate and identify Acinetobacter strain specific glycans, as it is recognized by PglLs from different strains (Scott et al., 2014). We expressed OmpA-His, containing a carboxy terminal His-tag, in strains M2, M2AtfpO: ±m, M2ApglL: :kan, and M2AweeH: ± .
[00120] Figure 5A provides Western blot analysis which demonstrates that all four strains expressed OmpA-His; however, OmpA-His from the M2ApglL: :kan and the
M2AweeH: :kan backgrounds migrated at an increased electrophoretic mobility, consistent with the lack of a post-translational modification. ESI-TOF-MS/MS analysis of OmpA-His purified from strain M2 revealed glycosylation with two subunits of a branched
tetrasaccharide. These results suggest that M215_10475 is a general O-OTase providing functional evidence for the PglLM2 designation. Furthermore, this branched tetrasaccharide was the same tetrasaccharide found on PilA, indicating that TfpOM2 and PglLM2 both utilize the same lipid-linked glycan precursor as the substrate for protein glycosylation (Figure 5B). This observation was expected given that WeeH was required for both PilA and OmpA- Hispost-translational modification, indicating a common glycan precursor pathway.
[00121] ACIAD0103 is not a WaaL O-antigen ligase and is not required for ComP modification.
[00122] As noted above, two OTase-like proteins containing domains from the Wzy_C superfamily are encoded in the A. baylyi ADP1 genome. One of these, pglLcomP
(ACIAD3337), is located adjacent to comP. Schulz et al. (2013) determined, and we independently confirmed, that pglL omv (ACIAD3337) is required for ComP modification (Figure 6A). Furthermore, western blot analysis probing for ComP -His expression from an isogenic pglLmm (ACIAD0103) mutant strain demonstrated that PglLADPi is not required for ComP post-translational modification (Figure 6A).
[00123] Schulz et al. (2013) speculated that the other Wzy_C superfamily domain- containing protein, PglLADPi (ACIAD0103), encoded a WaaL O-antigen ligase. For LPS biosynthesis, the O-antigen repeat unit is sequentially assembled on the same lipid carrier as the O-glycan on the cytoplasmic side of the inner membrane, flipped to the periplasm, polymerized to form the O-antigen chain and transferred to the lipid A-core polysaccharide by the O-antigen ligase (Hug & Feldman, 2011). Differences in the number of O-antigen subunit repeats in LPS molecules appear as a ladder-like banding pattem in LPS silver stains (Whitfield, 1995). In order to determine if pglLmvi was acting as an O-antigen ligase, we purified LPS iromA. baylyi ADP1, the ADPlA/?g/Zcomp: :kan, and ADPlA/?g/ZADPi: :kan mutants and silver stained the SDS PAGE-separated preparation.
[00124] As illustrated in Figure 6B, LPS silver stained SDS polyacrylamide gels showed identical banding patterns, with no O-antigen subunits observed in the LOS compared to 0-antigen-containing LPS obtained from the plant pathogen Ralstonia solanacearum. Given that PglLADPi was not acting as an O-antigen ligase, it is possible that PglLADPi could encode a second O-OTase.
[00125] ACIAD0103 encodes the general O-OTase, PglLADPi, in A. baylyi ADP1
[00126] PglLADPi was tested to determine if it is able to glycosylate DsbAl from N. meningitidis and OmpA ΪΪΟΏ\ Α. baumannii ATCC 17978, which are also modified by general O-OTases in their respective strains, and were previously employed as models to study glycosylation (Vik et al, 2009; Iwashkiw et al, 2012; Gebhart et al, 2012; Lithgow et al, 2014). These two proteins were independently expressed in wild-type, ApglLcomP and ApglLmvi A. baylyi strains. DsbAl -His (Figure 6C) and OmpA-His (Figure 6D) displayed an increased electrophoretic mobility in the ApglLmvi background relative to wild-type and ApglLcomP backgrounds. These experiments support the role of PglLADPi as a general O- OTase.
[00127] In vivo glycosylation assays in E. coli were performed to further confirm the OTase activity of PglLADPi (Gebhart et al, 2012). We employed E. coli CLM24, a strain lacking the WaaL O-antigen ligase, which leads to the accumulation of lipid-linked glycan precursors that then are able to serve as substrates for heterologous O-OTase activity (Feldman et al, 2005). E. coli CLM24 was transformed with plasmids encoding an acceptor protein (DsbAl), a glycan donor (the Campylobacter jejuni lipid-linked oligosaccharide (CjLLO)), and one OTase, as previously described (Faridmoayer et al, 2007; Ielmini & Feldman, 2011). We also included PglLComP and employed TfpO 19606 and PglL 19606, encoding the pilin-specific and the general O-OTase from A. baumannii ATCC 19606, as controls. DsbAl -His was detected with an anti-histidine antibody and glycosylation was detected employing the hR6 antibody, which is reactive against the C. jejuni heptasaccharide.
[00128] As illustrated in Figure 7, a band reacting with both antibodies, corresponding to DsbAl - His modified by the C. jejuni heptasaccharide, was only present in E.coli co- expressing DsbAl-His, the CjLLO and either PglLADPi or the general O-OTase PglL19606. Together this data suggests a role of PglLADPi as a general O-OTase.
[00129] Comparative proteomic analysis of A. baylyi ADP1 wild-type, ApglLcomP and ApglLADPi strains. [00130] To determine a role of both putative O-OTases in A. baylyi ADP1
glycosylation, we compared the glycoproteome of A. baylyi ADP1 to either the
ADPlA/?g/ZcomP mutant or the APDlA/?g/ZADPi mutant. Using ZIC-HILIC for glycopeptide enrichment (Iwashkiw et al, 2012; Nothaft et al, 2012; Scott et al, 2014; Lithgow et al, 2014) and multiple MS/MS fragmentation approaches (Scott et al., 2011), 21 unique glycopeptides from eight protein substrates were identified 360 within A. baylyi ADP1.
Similar to the diversity observed within other Acinetobacter spp. (Scott et al, 2014), A.
baylyi ADP1 generated unique glycans with glycopeptides decorated with one of four pentasaccharide glycoforms composed of 286-217-HexNAc3 (1112.41 Da, Figure 8A and 8D), 286-217-245-HexNAc2 (1154.41 Da, Figure 8B and 8F), 286-217-HexNAc-245- HexNAc (1154.41 Da, Figure 8B and 8G) and 286-217-2452-HexNAc (1196.41 Da, Figure 8C and 8E). Glycopeptide analysis of membrane proteins from A. baylyi ADPlA/?g/ZcomP enabled the identification of identical glycopeptides suggesting the glycoproteome was unaffected by the loss of this gene. In contrast none of 21 glycopeptides observed within wild type A. baylyi ADPl could be detected within extracts of A. baylyi ADPlA/?g/ZADPi (data not shown), suggesting that pglLmm was responsible for general protein glycosylation within A. baylyi ADPl.
[00131] Glycopeptide quantitative labeling
[00132] Figure 19 shows quantitative analysis of glycosylation in A. baylyi ADPl WT, A. baylyi ADPlApglLADPi, and A. baylyi ADPlApglLcomP using dimethyl labeling. [00133] Quantitative dimethylation labeling enabled comparison of all three strains simultaneously providing an intemal positive control for glycopeptide enrichment and led to the detection of seven glycopeptides (Table 2). Consistent with the requirement of PglLADPi for glycosylation, no glycopeptides derived from the ApglLADPi mutant (Figure 19 A-C) could be detected, while non-glycosylated peptides within the samples were observed at a -1 : 1 : 1 ratio (Figure 19 D-E, Table 2). Glycosylation was observed at near 1 : 1 ratio in
ApglLcomP compared to wild type (ranging from 46% to 170%, Figure 21) with MS/MS identifications enabling the confirmation of glycopeptides originated from strain ApglLcomP (Figure 19C). Taken together these data suggests PglLADPi is a general O-linked OTase while PglLcomP is responsible for glycosylation of a specific subset of the glycoproteome, which was not detectable given the sensitivity of the method employed. [00134] Using dimethyl labeling and ZIC-HILIC, the O-OTase responsible for glycosylation of individual glycopeptides was confirmed. Glycopeptides derived from A. baylyi ADPl WT, labeled with light label and A. baylyi ADPlApglLcomP labeled with heavy label, were observed at near 1 : 1 levels; whereas, A. baylyi ADPlApglLADPi, labeled with medium label, was undetectable within samples. Conversely non-glycosylated peptides were observed at a near 1 : 1 : 1 level between all three strains. A and D) The MS spectra of the light, medium and heavy isotopologues of the glycopeptide
1 13KLAEPAASAVADQNSPLSAQQQLEQK138 (Q6F825 ACIAD) and non-glycosylated peptide 166AQS VANYLSGQGVS SSR182 (Q6FDR2 ACIAD) enabled the comparison of glycosylation across all three strains. No glycopeptides were observed within
ADPlApglLADPi while non-glycosylated peptides were observed a near 1 : 1 : 1 ratio. B and E) Comparison of the extracted ion chromatograms of the light, medium and heavy
isotopologues confirm the absent of ADPlApglLADPiderived glycopeptides and the 1 : 1 : 1 ratio of non-glycosylated peptides. C) HCD fragmentation confirming the identification of the heavy isotopologues of the glycopeptide
1 13KLAEP AAS AV ADQNSPLS AQQQLEQK138, confirming its origins from
ADPlApglLcomP. F) HCD fragmentation confirming the identification of the medium isotopologues of the non-glycosylated peptide 166AQSVANYLSGQGVSSSR182, confirming its origins from ADP lApglLADPi.
[00135] Table 2 shows dimethylated glycopeptides identified in A. baylyi ADPl . Dimethylated Glycopeptides identified in A. baylyi ADPl wild type (light) and OTase mutant (heavy). Identifications are grouped according to the corresponding Uniprot number. The protein name, parent m/z, charge state, glycan mass, peptide mass, glycan composition, peptide sequence and mascot ion score are provided for each identified glycopeptide. For each identified peptide the dimethylation observed is denoted to aid read distinguish glycopeptide observed from wild type (containing dimethyl N-term and K) and the complement (containing dimethyl N-term 2H(6)13C(2) and K2H(6)13C(2)). Table 2: Dimethylated glycopeptides identified in Acinetobacter baylvi ADPl
Figure imgf000040_0001
(SEQ ID NOs: 79-82)
[00136] Figure 21 (SEQ ID NOs: 79-82) illustrates quantitative glycopeptides identified in A. baylyi ADPl. Dimethylated glycopeptides identified in A. baylyi ADPl wild type (light) and OTase mutant (heavy). Identifications are grouped according to the corresponding Uniprot number. The protein name, parent m/z, charge state, glycan mass, peptide mass, glycan composition, peptide sequence and mascot ion score are provided for each identified glycopeptide. For each identified peptide the dimethylation observed is denoted to aid read distinguish glycopeptide observed from wild type (containing dimethyl N-term and K) and the mutant (containing dimethyl N-term 2H(6)13C(2) and K2H(6)13C(2). [00137] PglLcomP acceptor protein specificity distinguishes it from TfpO and general O-OTases
[00138] Given the strong genetic linkage between the major type IVa pilin genes and downstream O-OTase genes on Acinetobacter chromosomes, we sought to determine whether these O-OTases were specific for their cognate pilin protein. A plasmid expressing PilAM2 iro A. nosocomialis strain M2 was expressed into different Acinetobacter spp., and then conducted western blot analysis probing for the expression and electrophoretic mobility of the pilin protein. PilAM2 was modified by A. baumannii ATCC 19606 and the clinical isolate d, baumannii 27413, both of which encode tfpO homologs and pilins containing terminal serine residues, as evidenced by the presence of both the higher molecular weight and lower molecular forms of PilAM2 (Figure 9A). The glycan associated with A. baumannii ATCC 19606 was demonstrated to be identical to the pentasaccharide identified in A.
baumannii ATCC 17978. PilAM2 expressed in A. baumannii ATCC 19606 ran with the slowest electrophoretic mobility indicative of a larger glycan associated with PilAM2 (Scott et al, 2014). Bot A. baumannii ATCC 17978 and^. baylyi ADP1, which lack a tfpO homolog, were unable to glycosylate PilAM2.
[00139] On the contrary, when ComP -His was heterologously expressed in different
Acinetobacter spp., it was found that it was glycosylated only in A. baylyi ADP1. Strains encoding tfpO homologs were unable to modify ComP -His, with the exception of A.
baumannii ATCC 19606, which appeared to have a marginal capacity to modify ComP -His (Figure 9B). PglLcomP was analyzed to determined if it is able to modify A. baumannii ATCC 17978 pilin, which does not carry a terminal serine residue. PilA17978 was not glycosylated by PglLcomP, but was glycosylated by both its cognate PglL17978 and the PglLADPi general O-OTases. These results distinguish PglLcomP from the other pilin-specific TfpO OTases that recognize terminal serine residues, and from the general PglL O-OTases. The sequence of PglLcomP is more similar to PglL-like OTases but, unexpectedly, its activity is specific for ComP, which is a pilin-like protein that does not have a terminal serine residue. PglLcomP appears to belong to a new class of O-OTases.
[00140] Multiple species within the Acinetobacter genus are nosocomial opportunistic pathogens of increasing relevance worldwide. Among the virulence factors utilized by these bacteria are the type IV pili and a protein O-glycosylation system. Glycosylation is mediated by O-oligosaccharyltransferases (O-OTases), enzymes that transfer the glycan from a lipid carrier to target proteins. O-OTases are difficult to identify due to similarities with the WaaL ligases that catalyze the last step in LPS synthesis. A bioinformatics analysis revealed the presence of two genes encoding putative O-OTases or WaaL ligases in most of the strains within the genus Acinetobacter . Employing^, nosocomialis M2 and A. baylyi ADPl as model systems, the present application provides that these genes encode two O-OTases, one devoted uniquely to type IV pilin, and the other one responsible for glycosylation of multiple proteins. With the exception of ADPl, the pilin-specific OTases in. Acinetobacter resemble the TfpO/PilO O-Otase from Pseudomonas aeruginosa. In ADPl instead, the two O-OTases are closely related to PglL, the general O-OTase first discovered in Neisseria. However, one of them is exclusively dedicated to the glycosylation of the pilin-like protein ComP.
[00141] Glycopeptides identified in Acinetobacter baylyi ADPl wild type are shown in
Table 3. Identifications are grouped according to the corresponding Uniprot number. The protein name, parent m/z, charge state, glycan mass, peptide mass, glycan composition, peptide sequence and mascot ion score are provided for each identified glycopeptide.
[00142] Table 3: Glvcopeptides identified in A. baylvi ADPl (SEP ID NOs: 79-88)
Table 3: gycopeptides identifiedin Acinetobacter baylvi ADPl
Figure imgf000043_0001
[00143] Example 2
[00144] Materials and Methods:
[00145] Strains and plasmids
[00146] A list of the bacterial strains and plasmids used in this study is found in Table 4. A. baylyi genomic DNA was isolated using the DNeasy blood and tissue kit (Qiagen). For amplifying the gene aciad3337 (pglLcomp) with its upstream non-coding region, primers igrF (ACTGGTCGACTAGTAGTACTATATGGCTTTAAA; SEQ ID NO: 89) and igrR
(ACTGCTGCAGTTAATATTCTATTGAACAAAATTTTAAC; SEQ ID NO: 90) were used. The resulting PCR product was digested with Sail and Pstl and inserted in the same sites of pEXT20, creating pMN8. Plasmid pMNl was constructed by subcloning ComP from pBAV-ComP-his into BamHI and Sail sites of pEXT20. Plasmid pMN2 was constructed by subcloning pglLcomp with its upstream region from the Sail and Pstl sites of pMN8 to pMNl .
Table 4; Bacterial Strains and plasmids used in this study
Reference
I
Strain/Plasmid Description Source
Strains
E. coli CLM24 W3110, Awaa ligase Feldman et al. (2005)
E. coli CLM37 W3110, AwecA glycosyltransf erase Linton et al. (2005)
E. coli SDB1 W3110, i waa ligase, AwecA glycosyltransferase Garcia- Quintanilla et al. (2014)
E. coli DH5a General cloning strain Invitrogen
Plasmids
pEXT20 Cloning vector, AmpR, IPTG inducible Dykxhoorn et al. , (1996) pBAV-ComP-his C-6X His-tagged ComP cloned in BamHI and Sail sites Harding et of pBAVmcs, KanR, constitutive expression al, (2015) pMNl C-6X His-tagged ComP cloned in BamHI and Sail sites
This work of pEXT20, AmpR, IPTG inducible
pMN2 Non-coding region and PglLcomp cloned in Sail and Pstl
This work sites of pMNl, AmpR, IPTG inducible
pMN3 ComP S69A in pMN2 background This work pMN4 PglLcomp H325A in pMN2 background This work pMN8 Non-coding region and PglLcomp cloned in Sail and Pstl This work sites of pEXT20, AmpR, IPTG inducible
pMAFlO HA-tagged PglB cloned in pMLBAD, TpR, Arabinose Feldman et inducible al. (2005) pAMFlO C-lOx His-tagged NmPglL cloned inyo pEXT20, Faridmoay
AmpR, IPTG inducible er et al. ,
(2008) pIH18 C-6X His-tagged AcrA from C. cloned into pEXT21, Hug et al,
SpR, IPTG inducible 2010 pAMF22 C-6X His-tagged dsbAl from N. meningitidis MC58 Faridmoay cloned into pMLBAD, TpR Arabinose inducible er et al. ,
(unpublishe d) pACYCpglBmut pACYC184-based plasmid encoding the C. jejuni pgl
Wacker et locus with mutations W458A and D459A in PglB. CmR,
al, (2002) IPTG inducible.
pEXT20 expressing C-6X His-tagged /?g/IADPl from
A. baylyi inserted at BamHI and Sail, AmpR, IPTG Harding et pEXT20-pglLADPi
inducible al, (2015) pLPS2 P. aeruginosa Oi l antigen synthesis cluster, TetR Goldberg et al. , (1992) pJHCV32 E. coli 07 antigen synthesis cluster, TetR Feldman et al, (1999)
Price et al, pNLP80 S. pneumoniae CPS14 cluster on pWSK129, KanR
unpublished
Posch et al, pOSH59 S. pneumoniae CPS15b cluster on pACT3, CmR
unpublishe d
S. enterica serovar Typhimurium 0 antigen synthesis Neal et al, pPR1347
cluster, KanR (1993)
[00147] Glycosylation in E. coli
[00148] Electrocompetent E. coli CLM24, CLM37 or SDB1 were prepared as per the protocol described by Dower and colleagues (Dower et al, 1988). Cells were transformed with plasmids encoding the glycan synthesis loci, acceptor protein and OTase. For plasmid selection, ampicillin (100 μg/ml), tetracycline (20 μg /ml), trimethoprim (50 μg /ml), chloramphenicol (12.5 μg /ml), kanamycin (20 μg /ml) and spectinomycin (80 μg /ml) were added as needed. Cells were grown at 37°C in LB broth to an OD600 of 0.4-0.6, induced with 0.05 mM or 0.1 mM IPTG or 0.2% arabinose as required and left overnight at 37°C. Cultures requiring arabinose induction received a second dose of arabinose after 4 hours. Whole cell lysates were obtained at stationary phases, of which 0.1 OD were loaded on 12.5% SDS- PAGE gels, which were then transferred to nitrocellulose membranes. Westem blot analysis was employed to determine protein modification and antibodies used are outlined in Table 5. Nitrocellulose membranes were visualized using the Odyssey Infrared Imaging System
(LiCor Biosciences, USA).
Table 5; Antibodies used in the present application
Reference/
Antibody Description Source
Anti His Poly Rabbit polyclonal, 1:4000 Rockland
Anti His Mono Mouse monoclonal, 1.5000 Abeam
Anti CPS14 Rabbit polyclonal, 1: 1000 Statens
Anti CPS 15b Rabbit polyclonal, 1: 1000 Statens
Anti Pseudomonas Oi l Rabbit polyclonal, 1:500 Lam lab, antigen University of Guelph
Anti Salmonella LT2 0 Rabbit polyclonal, 1: 1000
Statens antigen
hR6 Rabbit polyclonal, 1:200000 Aebi lab
Goat Anti rabbit IR680 1: 15000 Li-Cor
Goat Anti mouse IR800 1: 15000 Li-Cor
HRP-conjugated IgM Mouse monoclonal 1 : 10000 Rockland
HRP-conjugated IgG Mouse monoclonal 1 : 10000 Rockland
HRP-conjugated Rabbit polyclonal 1:5000 Rockland
[00149] Total membrane preparations
[00150] Cells grown overnight at 37°C in Terrific broth were washed with phosphate buffered saline (PBS) buffer and resuspended in the same buffer. Cells were lysed by two rounds of cell disruption using a French press at 20 kpsi followed by the addition of a protease inhibitor cocktail (Roche). Lysates were centrifuged for 30 minutes at 10000 x g to get rid of cell debris and supematants were then ultracentrifuged at 100000 x g for 60 minutes to pellet total membranes. The pellet was resuspended in a buffer containing 0.1% Triton xlOO or 1% n-dodecyl^-D-maltoside (DDM) in 10 ml PBS and membrane proteins were solubilized by tumbling overnight. An equal volume of PBS was added to the suspension to reduce detergent concentration and the suspension was ultracentrifuged at 100000 G for 60 minutes. Supematants, which correspond to solubilized membrane proteins, were loaded on columns for nickel affinity protein purifications. [00151] Nickel affinity protein purifications
[00152] Hexa-histidine-tagged proteins were purified from solubilized total membranes by nickel affinity chromatography. Briefly, total membranes were loaded on nickel-nitrilotriacetic acid (Ni-NTA) agarose columns (Qiagen) previously equilibrated with a buffer containing 20 mM imidazole. To remove unbound proteins, the column was washed four times each with buffers containing 20 mM and 30 mM imidazole. His-tagged proteins bound to the column were eluted over six fractions with an elution buffer containing 250 mM imidazole.
[00153] Alternatively, AKTA purifier (Amersham Biosciences, Sweden) was employed for protein purifications. Solubilized membrane proteins were first filtered through 0.45 μηι and 0.22 μηι filters, and then loaded on a His-Trap HP column (GE Healthcare) previously equilibrated with a buffer containing 20 mM imidazole. Unbound proteins were removed by washing the column ten times each with buffers containing 20 mM and 30 mM imidazole. To elute proteins bound to the column, gradient elutions with an incremental increase in imidazole concentration of the elution buffer were used.
[00154] Mouse immunizations:
[00155] Imidazole was removed by an overnight round of dialysis followed by 2 2- hour rounds in a dialysis buffer composed of 250 ml PBS containing 0.25% DDM. Proteins were quantified using a DC kit (biorad) after which the samples were diluted to
approximately 6 μg/ml and 0.6 μg injected per mouse. Two groups of 10 mice were injected either unglycosylated ComP or CPS-conjugated ComP. Sera from the mice were obtained before immunization, 7 and 21 days post immunization. A booster dose was given on the 14th day.
[00156] Whole cell ELISAs. [00157] S. pneumoniae serotype 14 (Statens Serum Institut, Denmark) was grown overnight in BHI broth at 37°C with 5% C02 aerobic conditions. Cells were washed in lx PBS and OD was adjusted to 0.6. Cells were then heat inactivated by incubation at 60°C for 2 h followed by immobilizing on Coming high binding 96 well plates (50 μΕΛ βΙΙ). Plates were incubated overnight at 4°C. The following day, wells were washed three times with lx PBS (100 μΐ ννβΐΐ) before blocking with 5% skimmed milk for 2 h. The wells were washed three times with PBS. Plates were then incubated for an hour at room temperature with mouse sera (100 μΐ ννβΐΐ) at a 1 :500 dilution in 2.5% skimmed milk in PBST. For the positive control, a commercial rabbit polyclonal antibody against CPS of serotype 14 was used (Statens serum institute). Negative control wells were treated with skimmed milk instead of the primary antibody. After incubation with the primary antibody, wells were washed three times with PBS. This was followed by a 1-hour incubation with secondary HRP-conjugated antibodies (100 μΐ ννβΐΐ). Antibodies employed were the anti mouse IgM (1 : 10000), anti mouse IgG (1 : 10000) and anti rabbit (1 :5000) HRP-conjugated antibodies diluted in 2.5% skimmed milk in PBST. After incubation, the wells were washed three times with PBS and 100 of the chromogenic substrate TMB (Cell Signaling Technology) was added to each well and the plate was incubated at room temperature for 5 minutes after which the absorbance at 650 nm was measured using a BioTek™ plate reader.
[00158] Bacterial surface glycans such as capsular polysaccharides (CPS) and O antigens are good vaccine candidates as they were demonstrated to provide glycan-specific protection. Said glycans when used alone elicit T cell-independent immune responses, with no memory cells being formed, and subsequent booster doses are required to sustain protection. As a result, the efficacy of glycan-only vaccines has been well documented in adults under 55 years. However, children <5 respond poorly, if at all, to these vaccines, which has been attributed to the low expression of CD21 on the surface of B cells in the spleen and blood at this age. In the elderly, polysaccharide vaccines are less effective due to the physiological age-associated atrophy of haematopoietic tissue and primary lymphoid organs, causing a decreased production of B and T cells (Griffioen et al , 1991 ; Simell et al , 2008) (Reviewed by Pace, 2013).
[00159] Conjugate vaccines, where surface glycans are linked to immunogenic proteins, have greatly reduced incidence of diseases, compared to glycan-only vaccines. In conjugate vaccines, surface glycans are conjugated to immunogenic proteins, and this elicits T cell-dependent immune responses, which are stronger immune responses that are also associated with the development of memory cells for subsequent infections. The efficacy of conjugate vaccines was demonstrated in children <5 years, which could be attributed to the fact that infant T cells show adult immunophenotypes and mount equally robust immune responses to conjugate vaccine antigens (Timens et al , 1989). For these reasons, conjugate vaccines are gaining momentum in the vaccine market (reviewed by Pace, 2013). [00160] Most conjugate vaccines in the market today are synthesized by chemically conjugating glycans to proteins, which is an expensive process with numerous drawbacks (Dick and Beurret, 1989; Peeters et al, 2003; Lees et al, 2006). Exploiting OTases to perform this conjugation in bacteria has been suggested as a method for cutting vaccine manufacturing costs and improving the efficiency of the process (Terra et al , 2012). OTases heterologously expressed in a bacterial expression system (usually engineered Escherichia coli strains) transfer lipid-linked glycans to acceptor proteins, after which the glycoprotein is subsequently purified. Examples of OTase-conjugated vaccines include, but are not limited to, those against Pseudomonas aeruginosa, Francisella tularensis, Burkholderia
pseudomallei, Shigella flexneri and Shigella dysenteriae (Horzempa et al, 2008; Cuccui et al, 2013; Garcia-Quintanilla et al, 2014; Kampf et al, 2015; Ravenscroft et al, 2015).
[00161] To date, the best-characterized OTases for producing conjugate vaccines are the Campylobacter N-OTase PglB (CjPglB) and the O-OTases TfpO/PilO from Pseudomonas aeruginosa and NmPglL from Neisseria meningitidis. The mentioned OTases were found be specific towards the glycans transferred and the range of acceptor proteins they glycosylate.
[00162] Regarding acceptor proteins, CjPglB transfers glycans to Asn residues of acceptor proteins that lie in the sequon D/EX1NX2S/T, with X being any amino acid except proline, and the residue in the -2 position being acidic, namely glutamic acid (D) or aspartic acid (E) (Kowarik et al, 2006). A DQNAT sequon was identified to be the optimal sequon for glycosylation by CjPglB (Chen et al, 2007). Insertion of this sequon, termed "glycotag", at N or C termini of unglycosylated proteins such as E. coli maltose-binding protein MalE induced glycosylation by CjPglB (Fisher et al, 2010).
[00163] No consensus sequence has been identified for the glycosylation site of O- OTases to date. Instead, the glycosylated residues identified were in low complexity regions, with an abundance of serine, proline and alanine residues (Vik et al, 2009). This means that acceptor proteins are limited to the natural substrates of O-OTases, which in case of TfpO is the P. aeruginosa strain 1244 Type IV pilin PilA and in case of NmPglL is a wide range of proteins. However, a similar idea to the N-glycosylation glycotags has been employed in P. aeruginosa, where TfpO was able to glycosylate other proteins with the C terminal 15 residues of PilA (where the glycosylation site lies) fused to their C terminal (Qutyan et al, 2010). [00164] With regards to glycan specificity, CjPglB requires an acetamido group at C-2 of the reducing end for glycan transfer to acceptor proteins. Furthermore, CjPglB was shown to only transfer glycans with N-acetylated sugar residues at the reducing end of the glycan such as FucNAc, GalNAc, GlcNAc and Bac (Feldman et al, 2005; Wacker et al , 2006). Additionally, CjPglB was demonstrated to transfer Burkholderia. pseudomallei O
polysaccharide II, the equivalent of O antigen. This glycan is a polymer of disaccharide repeating subunits composed of glucose and O-acetyl deoxytalose (Garcia-Quintanilla et al, 2014).
[00165] TfpO/PilO was demonstrated to transfer multiple Pseudomonas O antigens, all of which are either tri or tetrasaccharides with FucNAc at the reducing end, to PilA. TfpO also transferred the E. coli 0157 antigen, a tetrasaccharide with GalNAc at the reducing end (DiGiandomenico et al , 2002; Horzempa et al , 2006). Furthermore, TfpO was demonstrated to only transfer short chain oligosaccharides of the E. coli 07 antigen, a pentasaccharide with GlcNAc at the reducing end, greatly limiting its potential for the conjugate vaccine industry apart from Pseudomonas conjugate vaccines (Faridmoayer et al, 2007).
[00166] NmPglL on the other hand displayed a more relaxed glycan specificity than TfpO, and was demonstrated to transfer sugars with N-acetylated glycans at the reducing end as well as glycans with Gal residues at the reducing end, characteristic of the Salmonella enterica S. Typhimurium O antigen (which could not be transferred by CjPglB). In addition to having different glycan and protein specificities, the O-OTases NmPglL and TfpO are sequentially and phylogenetically distinct, which suggests that they comprise two distinct classes of O-OTases. PglL-like OTases appear to be far more superior and with more potential in glycoengineering than TfpO-like OTases, given their ability to transfer longer oligosaccharides and their more relaxed glycan specificity. [00167] A limitation of all characterized OTases to date is that none of them are able to transfer glycans with glucose residues at the reducing end. Such glycans are characteristic of the capsular polysacharides of members of the genus Streptococcus, an example of which being S. pneumoniae.
[00168] Streptococcus pneumoniae, or the Pneumococcus, is one of the leading causes of bacterial meningitis in infants and children. Children under 5, the elderly and
immunocompromised are at a particular high risk of community-acquired pneumococcal infections (Reviewed by Watson et al , 1993). In 2000, conservative estimates of
Pneumococcus infections predicted 14.5 million cases. Pneumococcus-associated mortalities in children under 5 years are estimated to be 826000 annually, accounting for approximately 11% of mortalities in children under 5 (O'Brien et al , 2009). More than 90 serotypes have been identified for the Pneumococcus, each possessing a structurally and immunogenically distinct polysaccharide capsule that is the basis of pneumococcus vaccines (Lund, 1970; Kadioglu et al , 2008). Pneumococcus conjugate vaccines available in the market are produced by chemical conjugations of CPS to the modified diphtheria toxin CRM197, which, despite its exceptional efficacy, is significantly more expensive than polysaccharide-only vaccines according to the CDC vaccine price list. This has led the slow implementation of Pneumococcus vaccine programs by low-income countries without external aid (Wenger, 2001 ; Weinberger et al. , 2011 ).
[00169] As a result of this, an OTase capable of biologically conjugating the
Streptococcus CPS to acceptor proteins, such as that of the Pneumococcus, would revolutionize immunization against this organism, leading to significantly cheaper vaccines and ultimately leading to a reduction in disease burden and child deaths especially in low- income countries.
[00170] In the present example there is provided an O-OTase that appears to constitute a novel class of O-OTases. The OTase is called PglLcomp and was identified in the non- pathogenic strain Acinetobacter baylyi (Harding et al, 2015). This OTase is phylogenetically and sequentially similar to PglL-like OTases and transfers similar glycans (Figure 12).
However, it only has one acceptor protein, the type IV pilin ComP, a feature similar to the TfpO-like OTases. The present example demonstrates that PglLcomp has the ability to transfer CPS from S. pneumoniae serotype 14 -which has a glucose residue at the reducing end- to ComP, whereas all previously identified OTases are unable to transfer sugars containing glucose at the reducing end (Figure 13). This finding opens the door to a wide range of applications of PglLcomP in manufacturing Streptococcus conjugate vaccines, including but not limited to S. pneumoniae but to other Streptococci, such as the swine pathogen S. suis and the Bovine pathogen S. uberis. [00171] Example 3
[00172] In the present example there is provided evidence that injection of CPS14- conjugated to ComP via PglLcomp in E. coli mounts an IgG immune response againtst S. pneumoniae serotype 14 capsule. [00173] In this example, it was sought to determine whether ComP conjugated with the S. pneumoniae serotype 14 capsular polysaccharide would generate an immunogenic response in a murine model. Overexpressed his-tagged ComP either conjugated to CPS or in its unglycosylated form were purified by Nickel affinity chromatography from ?. coli SDB1 detergent-solubilized total membranes. For immunization, 60 ng of CPS -conjugated ComP were used per mouse (n=10) and as a control group, mice were immunized with 60 ng of unglycosylated ComP each (n=10). A booster dose of the glycoprotein was administered on day 14 and pre immune sera and post immune sera (day 7 and day 21) were collected. To determine if there was an immunogenic response, we performed whole cell ELISAs by immobilizing heat-killed S. pneumoniae serotype 14 on 96 well plates. Pre immune and post- immune sera from day 7 did not produce and immune response to the whole cells. Post immune sera from day 21 of the mice injected with CPS -conjugated ComP demonstrated marginal IgM and significant IgG based immune responses against this serotype. An IgG immune response was not seen with the negative control mice injected with the glycosylated ComP (Figures 14, 15, 16A). No reactivity was seen in the negative control wells (not treated with a primary antibody) whereas strong reactivity was seen in wells treated with a commercially available anti CPS 14 antibody (SSI Denmark) (Figure 16B). Similar results were seen in Western blots, where S. pneumoniae CPS expression from ?. coli CLM37 was probed for with mice sera (Figure 17).
Table 6: Primers used in the present application
Primer
Set Sequence
F AGAATACTTGCATAGTGACAGGTTACAG (SEQ ID NO: 1)
1
R GTTATGGCGGCGGTGGAGGTC (SEQ ID NO: 2)
CAAAAAGCTTATATAAAAACATACATACAATCTTTGGGGAAAAGGCTATGATTCCGGG
F GATCCGTCGACC (SEQ ID NO: 3)
2
GGATTGACCTCTCTTTTTTATTTCTAAAATTACGATGCTACAAATGATTGTGTAGGCTG
R GAGCTGCTTCG (SEQ ID NO: 4)
F GCGGGATCCGCAAATTGGTGATGTGATGTCTCG (SEQ ID NO: 5)
3
R GCGGGTACCGCTGCGAGGAATAAAAAGAATACT (SEQ ID NO: 6)
F GCGGGATCCGCAAATTGGTGATGTGATGTCTCG (SEQ ID NO: 7)
4
R GCGGGTACCTCGTATTGTGAACTAGACCATCCT (SEQ ID NO: 8)
F GCGGGATCCGCAAATTGGTGATGTGATGTCTCG (SEQ ID NO: 9)
5
R GCGGGTACCGCTGCGAGGAATAAAAAGAATACT (SEQ ID NO: 10) F AGAATACTTGCATAGTGACAGGTTACAG (SEQ ID NO: 11)
■
R CGCATTTATATTTGGGGATTACTC (SEQ ID NO: 12)
CTTCCATGTATAATTCTTCTCAAGTTTTTGGTCTGTAACCTGTCACTATGATTCCGGGG
F ATCCGTCGACC (SEQ ID NO: 13)
■
AAAATCCCCTTGAAAACAAGGGGATTTTTTTATTTATCTTTTAATAATTGTGTAGGCTG
R GAGCTGCTTCG (SEQ ID NO: 14)
F CTTCCTCAATCATTTGTAGCAGCGTAATTTTAGAAATAAAAAAG (SEQ ID NO: 15)
R CTTTTTTATTTCTAAAATTACGCTGCTACAAATGATTGAGGAAG (SEQ ID NO: 16)
F ATGAAAAAACTTGAGCACCTTGC (SEQ ID NO: 17)
■
R TGTTTGCTCTTATTTCTACTG (SEQ ID NO: 18)
F TTGTCATTTATAAAGTTAGTCAC (SEQ ID NO: 19)
■
R TGTACACCTGATTTTAATATTCTA (SEQ ID NO: 20)
F GAAATAAGAGCAAACAATTCCGGGGATCCGTCGACC (SEQ ID NO: 21)
■
R CTTTATAAATGACAATGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 22)
F CTCAAGTTTTTTCATCGCCATGGCGGCCGGGAGCATG (SEQ ID NO: 23)
■
R AAAATCAGGTGTACAACTAGTGAATTCGCGGCCGCCTGCA (SEQ ID NO: 24)
F CGTCCCCAAAAGCGTGAA (SEQ ID NO: 25)
■
R TTAGGCAAATTTCGAAGCGTGAT (SEQ ID NO: 26)
F GCGCCCGGGATAAGTGCTCAATTGATGG (SEQ ID NO: 27)
■
R GGTACCGAGATCCCAAACCAGCAAC (SEQ ID NO: 28)
F ACTAGTGAATTCGCGGCCGCCTGCA (SEQ ID NO: 29)
■
R CGCCATGGCGGCCGGGAGCATG (SEQ ID NO: 30)
F ATTCCGGGG ATCCGTCGACC (SEQ ID NO: 31)
■
R TGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 32)
F CCGGCCGCCATGGCGATGACGATTGGTTTAATTTTTTC (SEQ ID NO: 33)
R ACGGATCCCCGGAATCATACTTGTAAAAAAAAAAGTATTT (SEQ ID NO: 34)
F CAGCTCCAGCCTACAATGGAAGAAAATTCTTTATTAATTT (SEQ ID NO: 35) ■
R CGCGAATTCACTAGTTTAAACATATTTTTCCCATTTC (SEQ ID NO: 36)
F CCGGCCGCCATGGCGATGACTCCTGCCGGAGG (SEQ ID NO: 37)
■
R ACGGATCCCCGGAATTTAATAAAGAATTTTCTTCCATTTAC (SEQ ID NO: 38)
F CAGCTCCAGCCTACAATAGTAGGACTAAAAAAATGATTTCG (SEQ ID NO: 39)
R CGCGAATTCACTAGTTTATTTATATAACCCTTTTTCTTTC (SEQ ID NO: 40)
F CGGCCGCCATGGCGATGTTTAAAAATGTATTAATTACTGG (SEQ ID NO: 41) ■
R ACGGATCCCCGGAATCATTTATTTATATAACCCTTTTTCT (SEQ ID NO: 42)
F CAGCTCCAGCCTACAATAAATTTAAAATATTCATAAATCT (SEQ ID NO: 43) ■
R CGCGAATTCACTAGTTTATAATTTAAGTTCTTGAATCAAC (SEQ ID NO: 44)
F CTACATTGTTTATTTTTACCAGAA (SEQ ID NO: 45)
■
R GAAGCTTGAAGTTATCCACGAA (SEQ ID NO: 46)
F CATCAAAAATACCAGCCTAAATTATC (SEQ ID NO: 47)
■
R CCATTGTTTGAAATTATTTAGGG (SEQ ID NO: 48)
F CATCAAAAATACCAGCCTAAATTATC (SEQ ID NO: 49)
■
R GAAGAAAATTCTTTATTAATTTCTG (SEQ ID NO: 50)
F CATCAAAAATACCAGCCTAAATTATC (SEQ ID NO: 51)
■
R GAAAAAGGGTTATATAAATAAATG (SEQ ID NO: 52)
F GCGCCCGGGCTACATTGTTTATTTTTACCAGAA (SEQ ID NO: 53)
■
R GCGGGTACCACCATCATTGACTACTAAGACCTC (SEQ ID NO: 54)
F GCGCCCGGGCTACATTGTTTATTTTTACCAGAA (SEQ ID NO: 55)
■
R GCGGGTACCTTCTACATCCAATACCAGTCGT (SEQ ID NO: 56) F GCGCCCGGGCTACATTGTTTATTTTTACCAGAA (SEQ ID NO: 57)
29 ■
R GCGGGTACCGAAGCTTGAAGTTATCCACGAA (SEQ ID NO: 58)
F GCGCCCGGGCCGAAGCAGGGTGGGTGTTAGT (SEQ ID NO: 59)
30 GCGGGTACCTTAGTGGTGGTGGTGGTGTTGAGCTACTGAAAACTCAATAC (SEQ ID NO:
R
60)
F GCCATATGGCTTATCAAAACTATATTGCTAAATCTC (SEQ ID NO: 61)
31 ■
R GCGGATCCCTCTTTTTTATTTCTAAAATTACGATGCT (SEQ ID NO: 62)
F ATAGGATCCATGAATGCACAAAAGGGTTTTACC (SEQ ID NO: 63)
32 TATGTCGACTCAGTGGTGGTGGTGGTGGTGACCACGACATTCTGATGG (SEQ ID NO:
R
64)
F ATATGGATCCGTGGTTGATAGTAGTACTATATGG (SEQ ID NO: 65)
33 ATATGTCGACTCAGTGGTGGTGGTGGTGGTGATATTCTATTGAACAAAATTTTAACTTA
R GG (SEQ ID NO: 66)
F ATATGGATCCGTGGCTGGTTCCCCGCGTGTGTATAATAGC (SEQ ID NO: 67)
34 ATATGTCGACTTAGTGGTGGTGGTGGTGGTGCTTGGATGACTCTACAGCAGAAGC
R
(SEQ ID NO: 68)
F ACTGGGATCCATGTTAAAAAAAATTATTCTATTTC (SEQ ID NO: 69)
35 ACTGGTCGACTAAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGAGGAATTTTTGAGGT
R TGGTAC (SEQ ID NO: 70)
F ACTGGGATCCATGCAAGTATTCTTTCTGTTC (SEQ ID NO: 71)
36 ACTGGTCGACTAAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGTTTATTTTTTAACAA
R CTCTGCC (SEQ ID NO: 72)
F GGT GG ACGT GG AGG AG (SEQ ID NO: 73)
37 ■
R CTTGCTTGGGTTACATCAGTGCT (SEQ ID NO: 74)
F AATTATTGTACAGCCTTTTG (SEQ ID NO: 75)
38 ■
R CATCATCATCATCATCACTAATATTAAAAATGTATAAAAAACACC (SEQ ID NO: 76)
F CCAGTTGAATTACTTCCTCAAGCATTTGTAGCATCGTAAT (SEQ ID NO: 77)
39 ■
R ATTACGATGCTACAAATGCTTGAGGAAGTAATTCAACTGG (SEQ ID NO: 78)
[00174] References
[00175] Aas, F. E., Egge-Jacobsen, W., Winther-Larsen, H. C, Lovold, C, Hitchen, P. G., Dell, A., & Koomey, M. (2006). Neisseria gonorrhoeae type IV pili undergo multisite, hierarchical modifications with phosphoethanolamine and phosphocholine requiring an enzyme structurally related to lipopolysaccharide phosphoethanolamine transferases. The Journal of Biological Chemistry 281(38): 27712-23.
[00176] Abd-El-Haleem, D., Moawad, H., Zaki, E. A., & Zaki, S. (2002). Molecular characterization of phenol-degrading bacteria isolated from different Egyptian ecosystems. Microbial Ecology 43(2): 217-24.
[00177] Arroyo, L. A, Mateos, I., Gonzalez, V., & Aznar, J. (2009). In vitro activities of tigecycline, minocycline, and colistin-tigecycline combination against multi- and pandrug- resistant clinical isolates of Acinetobacter baumannii group. Antimicrobial Agents and Chemotherapy 53(3): 1295-6.
[00178] Balonova, L., Mann, B. F., Cerveny, L., Alley, W. R., Chovancova, E., Forslund, A.-L., ... Stulik, J. (2012). Characterization of protein glycosylation in Francisella tularensis subsp. holarctica: identification of a novel glycosylated lipoprotein required for virulence. Molecular & Cellular Proteomics : MCP 11 (7): Mi l l.015016.
[00179] Bentley, S.D., Aanensen, D.M., Mavroidi, A., Saunders, D., Rabbinowitsch,
E. , Collins, M., et al. (2006) Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet 2: e31. [00180] Borud, B., Viburiene, R., Hartley, M. D., Paulsen, B. S., Egge- Jacobs en, W.,
Imperiali, B., & Koomey, M. (2011). Genetic and molecular analyses reveal an evolutionary trajectory for glycan synthesis in a bacterial protein glycosylation system. Proceedings of the National Academy of Sciences of the United States of America 108(23): 9643-8.
[00181] Boucher, C. A., Barberis, P. A., & Demery, D. A. (1985). Transposon
Mutagenesis of Pseudomonas solanacearum: Isolation of Tn5 -Induced Avirulent Mutants. Microbiology 131(9): 2449-2457.
[00182] Brzoska, A. J., Hassan, K. A., de Leon, E. J., Paulsen, I. T., & Lewis, P. J. (2013). Single step selection of drug resistant Acinetobacter baylyi ADP1 mutants reveals a functional redundancy in the recruitment of multidrug efflux systems. PloS One 8(2): e56090. [00183] Cagatay, T. I., & Hickford, J. G. H. (2008). Glycosylation of type-IV fimbriae of Dichelobacter nodosus. Veterinary Microbiology 126(1-3): 160-7.
[00184] Carruthers, M. D., Nicholson, P. A., Tracy, E. N., & Munson, R. S. (2013).
Acinetobacter baumannii Utilizes a Type VI Secretion System for Bacterial Competition. PLoS One 8(12): e59388. [00185] Castric, P. (1995). pilO, a gene required for glycosylation of Pseudomonas aeruginosa 1244 pilin. Microbiology 141 : 1247-54.
[00186] Charbonneau, M.-E., Girard, V., Nikolakakis, A., Campos, M., Berthiaume,
F. , Dumas,F., ... Mourez, M. (2007). O-linked glycosylation ensures the normal conformation of the autotransporter adhesin involved in diffuse adherence. Journal of Bacteriology 189(24): 8880-9.
[00187] Chen, M.M., Glover, K.J., and Imperiali, B. (2007) From peptide to protein: comparative analysis of the substrate specificity of N-linked glycosylation in C. jejuni.
Biochemistry 46: 5579-85.
[00188] Choi, A. H. K., Slamti, L., Avci, F. Y., Pier, G. B., & Maira-Litran, T. (2009).
The pgaABCD locus of Acinetobacter baumannii encodes the production of poly -beta- 1-6-N- acetylglucosamine, which is critical for biofilm formation. Journal of Bacteriology 191(19): 5953-63. [00189] Choi, C. H., Hyun, S. H., Lee, J. Y., Lee, J. S., Lee, Y. S., Kim, S. A., ... Lee,
J. C. (2008). Acinetobacter baumannii outer membrane protein A targets the nucleus and induces cytotoxicity. Cellular Microbiology 10(2): 309-19.
[00190] Comer, J. E., Marshall, M. A., Blanch, V. J., Deal, C. D., & Castric, P. (2002).
Identification of the Pseudomonas aeruginosa 1244 pilin glycosylation site. Infection and Immunity 70(6): 2837-45.
[00191] Cote, J.-P., Charbonneau, M.-E., & Mourez, M. (2013). Glycosylation of the
Escherichia coli TibA self-associating autotransporter influences the conformation and the functionality of the protein. PloS One 8(11): e80739.
[00192] Coyne, M. J., Fletcher, C. M., Chatzidaki-Livanis, M., Posch, G, Schaffer, C, & Comstock, L. E. (2013). Phylum- wide general protein O-glycosylation system of the Bacteroidetes. Molecular Microbiology 88(4): 772-83.
[00193] Cuccui, J., Thomas, R.M., Moule, M.G, D'Elia, R. V, Laws, T.R., Mills,
D.C., et al. (2013) Exploitation of bacterial N-linked glycosylation to develop a novel recombinant glycoconjugate vaccine against Francisella tularensis. Open Biol 3: 130002. [00194] De Berardinis, V., Vallenet, D., Castelli, V., Besnard, M., Pinet, A., Cruaud, C, ... Weissenbach, J. (2008). A complete collection of single-gene deletion mutants of
Acinetobacter baylyi ADP1. Molecular Systems Biology 4: 174. [00195] Dick, W.E., and Beurret, M. (1989) Glycoconjugates of bacterial carbohydrate antigens. A survey and consideration of design and preparation factors. Contrib Microbiol Immunol 10: 48-114.
[00196] DiGiandomenico, A., Matewish, M.J., Bisaillon, A, Stehle, J.R., Lam, J.S., and Castric, P. (2002) Glycosylation of Pseudomonas aeruginosa 1244 pilin: glycan substrate specificity. Mol Microbiol 46: 519-30.
[00197] Egge-Jacobsen, W., Salomonsson, E. N., Aas, F. E., Forslund, A.-L., Winther- Larsen, H. C, Maier, J., ... Koomey, M. (2011). O-linked glycosylation of the PilA pilin protein of Francisella tularensis identification of the endogenous protein-targeting oligosaccharyltransferase and characterization of the native oligosaccharide. Journal of Bacteriology 193(19): 5487-97.
[00198] Faridmoayer, A., Fentabil, M. A, Mills, D. C, Klassen, J. S., & Feldman, M. F. (2007). Functional characterization of bacterial oligosaccharyltransferases involved in O linked protein glycosylation. Journal of Bacteriology 189(22): 8088-98. [00199] Feldman, M. F., Wacker, M., Hernandez, M., Hitchen, P. G, Marolda, C. L., Kowarik, M., ... Aebi, M. (2005). Engineering N-linked protein glycosylation with diverse O antigen lipopolysaccharide structures in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 102(8): 3016-21.
[00200] Fisher, A.C., Haitjema, C.H., Guarino, C, Celik, E., Endicott, C.E., Reading, C.A., et al. (2010) Production of Secretory and Extracellular N-Linked Glycoproteins in Escherichia coli. Appl Environ Microbiol 77: 871-881.
[00201] Garcia-Quintanilla, F., Iwashkiw, J.A., Price, N.L., Stratilo, C, and Feldman,
M.F. (2014) Production of a recombinant vaccine candidate against Burkholderia pseudomallei exploiting the bacterial N-glycosylation machinery. Front Microbiol 5: 381. [00202] Gebhart, C, Ielmini, M. V., Reiz, B., Price, N. L., Aas, F. E., Koomey, M., &
Feldman, M. F. (2012). Characterization of exogenous bacterial oligosaccharyltransferases in Escherichia coli reveals the potential for O-linked protein glycosylation in Vibrio cholerae and Burkholderia thailandensis . Glycobiology 22(7): 962-74. [00203] Gordon, N. C, & Wareham, D. W. (2010). Multidrug-resist t Acinetohacter baumannii: mechanisms of virulence and resistance. International Journal of Antimicrobial Agents 35(3): 219-26.
[00204] Gottig, S., Gruber, T. M., Higgins, P. G, Wachsmuth, M., Seifert, H., & Kempf, V. A. J. (2014). Detection of pan drug-resistant Acinetohacter baumannii in Germany. The Journal of Antimicrobial Chemotherapy 69(9): 2578-9.
[00205] Griffioen, A.W., Rijkers, G.T., Janssens-Korpela, P., and Zegers, B.J. (1991)
Pneumococcal polysaccharides complexed with C3d bind to human B lymphocytes via complement receptor type 2. Infect Immun 59: 1839-45. [00206] Gross, J., Grass, S., Davis, A. E., Gilmore-Erdmann, P., Townsend, R. R, &
St Geme, J. W. (2008). The Haemophilus influenzae HMW1 adhesin is a glycoprotein with an unusual N-linked carbohydrate modification. The Journal of Biological Chemistry 283(38): 26010-5.
[00207] Harding, C. M., Tracy, E. Ν., Carruthers, M. D., Rather, P. Ν., Actis, L. A., & Munson, R. S. (2013). Acinetohacter baumannii strain M2 produces type IV pili which play a role in natural transformation and twitching motility but not surface-associated motility. mBio 4(4): e00360-13.
[00208] Harding, CM., Nasr, M.A., Kinsella, R.L., Scott, N.E., Foster, L.J., Weber, B.S., et al. (2015) Acinetohacter strains carry two functional oligosaccharyltransferases, one devoted exclusively to type IV pilin, and the other one dedicated to O-glycosylation of multiple proteins. Mol Microbiol .
[00209] Horzempa, I, Dean, C.R., Goldberg, J.B., and Castric, P. (2006) Pseudomonas aeruginosa 1244 pilin glycosylation: glycan substrate recognition. J Bacteriol 188: 4244-52.
[00210] Horzempa, I, Held, T.K., Cross, A.S., Furst, D., Qutyan, M., Neely, A.N., and Castric, P. (2008) Immunization with a Pseudomonas aeruginosa 1244 pilin provides O- antigen-specific protection. Clin Vaccine Immunol 15: 590-7.
[00211] Hu, D., Liu, B., Dijkshoom, L., Wang, L., & Reeves, P. R. (2013). Diversity in the major polysaccharide antigen of Acinetohacter baumannii assessed by DNA sequencing, and development of a molecular serotyping scheme. PloS One 8(7): e70329. [00212] Hug, I., & Feldman, M. F. (2011). Analogies and homologies in
lipopolysaccharide and glycoprotein biosynthesis in bacteria. Glycobiology 21(2): 138-51.
[00213] Ielmini, M. V, & Feldman, M. F. (2011). Desulfovibrio desulfuricans PglB homolog possesses oligosaccharyltransferase activity with relaxed glycan specificity and distinct protein acceptor sequence requirements. Glycobiology 21(6): 734-42.
[00214] Iwashkiw, J. A., Seper, A., Weber, B. S., Scott, N. E., Vinogradov, E., Stratilo, C, ... Feldman, M. F. (2012). Identification of a General O-linked Protein Glycosylation System in Acinetobacter baumannii and Its Role in Virulence and Biofilm Formation. PLoS Pathogens 8(6): el002758. [00215] Iwashkiw, J. A., Vozza, N. F., Kinsella, R. L., & Feldman, M. F. (2013). Pour some sugar on it: the expanding world of bacterial protein O-linked glycosylation. Molecular Microbiology 89(1): 14-28.
[00216] Kadioglu, A., Weiser, J.N., Paton, J.C., and Andrew, P.W. (2008) The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nat Rev Microbiol 6: 288-301.
[00217] Kampf, M.M., Braun, M., Sirena, D., Ihssen, J., Thony-Meyer, L., and Ren, Q. (2015) In vivo production of a novel glycoconjugate vaccine against Shigella flexneri 2a in recombinant Escherichia coli: identification of stimulating factors for in vivo glycosylation. Microb Cell Fact 14: 12. [00218] Kowarik, M., Young, N.M., Numao, S., Schulz, B.L., Hug, I., Callewaert, N., et al. (2006) Definition of the bacterial N-glycosylation site consensus sequence. EMBO J 25 : 1957-66.
[00219] Kus, J. V, Tullis, E., Cvitkovitch, D. G, & Burrows, L. L. (2004). Significant differences in type IV pilin allele distribution among Pseudomonas aeruginosa isolates from cystic fibrosis (CF) versus non-CF patients. Microbiology 150: 1315-26.
[00220] Lees, A., Sen, G, and LopezAcosta, A. (2006) Versatile and efficient synthesis of protein-poly saccharide conjugate vaccines using aminooxy reagents and oxime chemistry. Vaccine 24: 716-729. [00221] Lees-Miller, R. G., Iwashkiw, J. A., Scott, N. E., Seper, A, Vinogradov, E., Schild, S., & Feldman, M. F. (2013). A common pathway for O-linked protein-glycosylation and synthesis of capsule in Acinetobacter baumannii. Molecular Microbiology 89(5): 816— 30. [00222] Lithgow, K. V., Scott, N. E., Iwashkiw, J. A., Thomson, E. L. S., Foster, L. I, Feldman, M. F., & Dennis, J. J. (2014). A general protein O-glycosylation system within the Burkholderia cepacia complex is involved in motility and virulence. Molecular Microbiology 92(1): 116-137.
[00223] Logan, S. M. (2006). Flagellar glycosylation - a new component of the motility repertoire? Mi crobiology 152: 1249-62.
[00224] Lund, E. (1970) On the nomenclature of the pneumococcal types. IntJ Syst Bacteriol 20: 321-323.
[00225] Mara, K., Decorosi, F., Viti, C, Giovannetti, L., Papaleo, M. C, Maida, I., ... Fani, R. (2012). Molecular and phenotypic characterization of Acinetobacter strains able to degrade diesel fuel. Research in Microbiology 163(3): 161-72.
[00226] Marchler-Bauer A., Bryant SH. (2004). CD-Search: protein domain annotations on the fly. Nucleic Acids Research 32(W): 327-331.
[00227] Marchler-Bauer A. et al. (2009). CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Research 37(D): 205-10. [00228] Marchler-Bauer A. et al. (2011). CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Research 39(D): 225-9.
[00229] Mescher, M. F., & Strominger, J. L. (1976). Structural (shape-maintaining) role of the cell surface glycoprotein of Halobacterium salinarium. Proceedings of the National Academy of Sciences of the United States of America 73(8): 2687-91. [00230] Musumeci, M. A., Faridmoayer, A., Watanabe, Y., & Feldman, M. F. (2014). Evaluating the role of conserved amino acids in bacterial O-oligosaccharyltransferases by in vivo, in vitro and limited proteolysis assays. Glycobiology 24(1): 39-50. [00231] Neuberger, A. (1938). Carbohydrates in protein: The carbohydrate component of crystalline egg albumin. The Biochemical Journal 32(9): 1435-51.
[00232] Nguyen, L. C, Taguchi, F., Tran, Q. M., Naito, K., Yamamoto, M., Ohnishi- Kameyama, M., ... Ichinose, Y. (2012). Type IV pilin is glycosylated in Pseudomonas syringae pv. tabaci 6605 and is required for surface motility and virulence. Molecular Plant Pathology 13(7): 764-74.
[00233] Nothaft, H., Scott, N. E., Vinogradov, E., Liu, X., Hu, R, Beadle, B., ... Szymanski, C. M. (2012). Diversity in the protein N-glycosylation pathways within the Campylobacter genus. Molecular & Cellular Proteomics : MCP 11(11): 1203-19. [00234] Nothaft, H., & Szymanski, C. M. (2010). Protein glycosylation in bacteria: sweeter than ever. Nature Reviews. Microbiology 8(11): 765-78.
[00235] O'Brien, K.L., Wolfson, L.J., Watt, J.P., Henkle, E., Deloria-Knoll, M.,
McCall, N., et al. (2009) Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374: 893-902. [00236] Olsen, J. V, Macek, B., Lange, O., Makarov, A., Horning, S., & Mann, M.
(2007). Higher-energy C-trap dissociation for peptide modification analysis. Nature Methods 4(9): 709-12.
[00237] Pace, D. (2013) Glycoconjugate vaccines. Expert Opin Biol Ther 13: 11-33.
[00238] Peeters, C.C.A.M., Lagerman, P.R., Weers, O. de, Oomen, L.A., Hoogerhout, P., Beurret, M., et al. (2003) Preparation of polysaccharide-conjugate vaccines. Methods Mol Med 87: 153-74.
[00239] Perez, J. M., McGarry, M. A., Marolda, C. L., & Valvano, M. A. (2008). Functional analysis of the large periplasmic loop of the Escherichia coli K-12 WaaL O- antigen ligase. Molecular Microbiology 70(6): 1424-40. [00240] Porstendorfer, D., Gohl, O., Mayer, F., & Averhoff, B. (2000). ComP, a Pilin- Like Protein Essential for Natural Competence in Acinetobacter sp. Strain BD413:
Regulation, Modification, and Cellular Localization. Journal of Bacteriology 182(13): 3673- 3680. [00241] Power, P., & Jennings, M. (2003). The genetics of glycosylation in Gram- negative bacteria. FEMS Microbiology Letters 218(2): 211-222.
[00242] Power, P. M., Seib, K. L., & Jennings, M. P. (2006). Pilin glycosylation in Neisseria meningitidis occurs by a similar pathway to wzy-dependent O-antigen biosynthesis in Escherichia coli. Biochemical and Biophysical Research Communications 347(4):904-8.
[00243] Qutyan, M., Henkel, M., Horzempa, J., Quinn, M., and Castric, P. (2010)
Glycosylation of Pilin and Nonpilin Protein Constructs by Pseudomonas aeruginosa 1244. J Bacteriol 192: 5972-5981.
[00244] Rappsilber, J., Mann, M., & Ishihama, Y. (2007). Protocol for micro- purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nature Protocols 2(8): 1896-906.
[00245] Ravenscroft, N., Haeuptle, M.A., Kowarik, M., Fernandez, F.S., Carranza, P., Brunner, A., et al. (2015) Purification and characterization of a Shigella conjugate vaccine, produced by glycoengineering Escherichia coli. Glycobiology cwv077- [00246] Ruan, X., Loyola, D. E., Marolda, C. L., Perez-Donoso, J. M., & Valvano, M. A. (2012). The WaaL O-antigen lipopolysaccharide ligase has features in common with metal ion-independent inverting glycosyltransferases. Glycobiology 22(2): 288-99.
[00247] Schulz, B. L., Jen, F. E. C, Power, P. M., Jones, C. E., Fox, K. L., Ku, S. C,
... Jennings, M. P. (2013). Identification of bacterial protein O oligosaccharyltransferases and their glycoprotein substrates. PloS One 8(5):e62768.
[00248] Scott, N. E., Kinsella, R. L., Edwards, A. V. G, Larsen, M. R., Dutta, S.,
Saba, J., ... Feldman, M. F. (2014). Diversity Within the O-linked Protein Glycosylation Systems of Acinetobacter Species. Molecular & Cellular Proteomics : MCP 13(9):2354-70.
[00249] Scott, N. E., Nothaft, H., Edwards, A. V. G, Labbate, M., Djordjevic, S. P., Larsen, M.R., ... Cordwell, S. J. (2012). Modification of the Campylobacter jejuni N-linked glycan by EptC protein-mediated addition of phosphoethanolamine. The Journal of
Biological Chemistry 287(35): 29384-96. [00250] Scott, N. E., Parker, B. L., Connolly, A. M., Paulech, J., Edwards, A. V. G.,
Crossett, B., ... Cordwell, S. J. (2011). Simultaneous glycan-peptide characterization using hydrophilic interaction chromatography and parallel fragmentation by CID, higher energy collisional dissociation, and electron transfer dissociation MS applied to theN-linked glycoproteome of Campylobacter jejuni. Molecular & Cellular Proteomics : MCP 10(2): M000031-MCP201.
[00251] Simell, B., Lahdenkari, M., Reunanen, A., Kayhty, H., and Vakevainen, M.
(2008) Effects of Ageing and Gender on Naturally Acquired Antibodies to Pneumococcal Capsular Polysaccharides and Virulence-Associated Proteins. Clin Vaccine Immunol 15: 1391-1397.
[00252] Sleytr, U. B. (1975). Heterologous reattachment of regular arrays of glycoproteins on bacterial surfaces. Nature 257(5525): 400-402.
[00253] Smedley, J. G, Jewell, E., Roguskie, J., Horzempa, J., Syboldt, A., Stolz, D.
B., & Castric, P. (2005). Influence of pilin glycosylation on Pseudomonas aeruginosa 1244 pilus function. Infection and Immunity 73(12): 7922-31.
[00254] Szymanski, C. M., Yao, R., Ewing, C. P., Trust, T. J., & Guerry, P. (1999).
Evidence for a system of general protein glycosylation in Campylobacter jejuni. Molecular Microbiology 32(5): 1022-1030.
[00255] Tang, G, & Mintz, K. P. (2010). Glycosylation of the collagen adhesin EmaA of Aggregatibacter actinomycetemcomitans is dependent upon the lipopolysaccharide biosynthetic pathway. Journal of Bacteriology 192(5): 1395-404.
[00256] Terra, V.S., Mills, D.C., Yates, L.E., Abouelhadid, S., Cuccui, J., and Wren, B. W. (2012) Recent developments in bacterial protein glycan coupling technology and glycoconjugate vaccine design. J Med Microbiol 61 : 919-926. [00257] Timens, W., Boes, A., Rozeboom-Uiterwijk, T., and Poppema, S. (1989) Immaturity of the human splenic marginal zone in infancy. Possible contribution to the deficient infant immune response. J Immunol 143: 3200-6.
[00258] Tsai, C. M., & Frasch, C. E. (1982). A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Analytical Biochemistry 119(1): 115-9. [00259] van Selm, S., van Cann, L.M., Kolkman, M.A.B., van der Zeijst, B.A.M., and Putten, J.P.M. van (2003) Genetic basis for the structural difference between Streptococcus pneumoniae serotype 15B and 15C capsular polysaccharides. Infect Immun 71 : 6192-8.
[00260] Vaneechoutte, M., Young, D. M., Omston, L. N., De Baere, T., Nemec, A., Van Der Reijden, T., ... Dijkshoom, L. (2006). Naturally Transformable Acinetobacter sp. Strain ADP1 Belongs to the Newly Described Species Acinetobacter baylyi. Applied and Environmental Microbiology 72(1): 932-936.
[00261] Varki, A. (1993). Biological roles of oligosaccharides: all of the theories are correct. Glycobiology 3(2): 97-130. [00262] Vik, A., Aas, F. E., Anonsen, J. H., Bilsborough, S., Schneider, A., Egge- Jacobsen, W., & Koomey, M. (2009). Broad spectrum O-linked protein glycosylation in the human pathogen Neisseria gonorrhoeae. Proceedings of the National Academy of Sciences of the United States of America 106(11): 4447-52.
[00263] Voisin, S., Kus, J. V, Houliston, S., St-Michael, F., Watson, D., Cvitkovitch, D. G., ... Burrows, L. L. (2007). Glycosylation of Pseudomonas aeruginosa strain Pa5196 type IV pilins with Mycobacterium-like alpha- 1,5 -linked d-Ara/ oligosaccharides. Journal of Bacteriology 189(1): 151-9.
[00264] Wacker, M., Feldman, M.F., Callewaert, N., Kowarik, M., Clarke, B.R., Pohl, N.L., et al. (2006) Substrate specificity of bacterial oligosaccharyltransferase suggests a common transfer mechanism for the bacterial and eukaryotic systems. Proc Natl Acad Sci U SA 103: 7088-93.
[00265] Wang, N., Mackenzie, L., De Souza, A. G, Zhong, H., Goss, G, & Li, L. (2007). Proteome profile of cytosolic component of zebrafish liver generated by LC-ESI MS/MS combined with trypsin digestion and microwave-assisted acid hydrolysis. Journal of Proteome Research 6(1): 263-72.
[00266] Watson, D.A., Musher, D.M., Jacobson, J.W., and Verhoef, J. (1993) A Brief History of the Pneumococcus in Biomedical Research: A Panoply of Scientific Discovery. Clin Infect Dis 17: 913-924. [00267] Weber, B. S., Miyata, S. T., Iwashkiw, J. A., Mortensen, B. L., Skaar, E. P., Pukatzki, S., & Feldman, M. F. (2013). Genomic and functional analysis of the type VI secretion system in Acinetobacter PloS One 8(1): e55142.
[00268] Weinberger, D.M., Malley, R, and Lipsitch, M. (2011) Serotype replacement in disease after pneumococcal vaccination. Lancet (London, England) 378: 1962-73.
[00269] Wenger, J. (2001) Vaccines for the developing world: current status and future directions. Vaccine 19: 1588-1591.
[00270] Whitfield, C. (1995). Biosynthesis of lipopolysaccharide O antigens. Trends in Microbiology 3(5): 178-185. [00271] Wisplinghoff, H., Paulus, T., Lugenheim, M., Stefanik, D., Higgins, P. G, Edmond, M. B., ... Seifert, H. (2012). Nosocomial bloodstream infections due to
Acinetobacter baumannii, Acinetobacter pittii and Acinetobacter nosocomialis in the United States. Journal of Infection 64(3): 282-290.
[00272] Yi, E. C, & Hackett, M. (2000). Rapid isolation method for
lipopolysaccharide and lipid A from Gram-negative bacteria. The Analyst 125(4): 651-656.
[00273] Zhou, M., & Wu, H. (2009). Glycosylation and biogenesis of a family of serine-rich bacterial adhesins. Microbiology 155: 317-27.
[00274] Actis, L. A., Potter, S. A., & Crosa, J. H. (1985). Iron-regulated outer membrane protein OM2 of Vibrio anguillarum is encoded by virulence plasmid pJMl .
Journal of Bacteriology, 161(2), 736-42.
[00275] Aranda, J., Poza, M., Pardo, B. G, Rumbo, S., Rumbo, C, Parreira, J. R, ... Bou, G. (2010). A rapid and simple method for constructing stable mutants of Acinetobacter baumannii. BMC Microbiology, 10(1), 279. [00276] Boersema, P. J., Raijmakers, R, Lemeer, S., Mohammed, S., & Heck, A. J. R. (2009). Multiplex peptide stable isotope dimethyl labeling for quantitative proteomics. Nature Protocols, 4(4), 484-94. [00277] Carruthers, M. D., Nicholson, P. A., Tracy, E. N., & Munson, R. S. (2013).
Acinetobacter baumannii utilizes a type VI secretion system for bacterial competition. PloS One, 8(3), e59388.
[00278] Choi, K.-H., Gaynor, J. B., White, K. G., Lopez, C, Bosio, C. M., Karkhoff- Schweizer, R. R., & Schweizer, H. P. (2005). A Tn7-based broad-range bacterial cloning and expression system. Nature Methods, 2(6), 443-8.
[00279] Datsenko, K. A, & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America, 97(12), 6640-5. [00280] De Berardinis, V., Vallenet, D., Castelli, V., Besnard, M., Pinet, A., Cruaud, C, ... Weissenbach, J. (2008). A complete collection of single-gene deletion mutants of Acinetobacter bay lyi ADP1. Molecular Systems Biology, 4, 174.
[00281] Dykxhoorn, D. M., St. Pierre, R, & Linn, T. (1996). A set of compatible tac promoter expression vectors. Gene, 177(1-2), 133-136. [00282] Feldman, M. F., Wacker, M., Hernandez, M., Hitchen, P. G, Marolda, C. L., Kowarik, M., ... Aebi, M. (2005). Engineering N-linked protein glycosylation with diverse O antigen lipopolysaccharide structures in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 102(8), 3016-21.
[00283] Figurski, D. H., & Helinski, D. R. (1979). Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proceedings of the National Academy of Sciences, 76(4), 1648-1652.
[00284] Harding, C. M., Tracy, E. N., Carruthers, M. D., Rather, P. N., Actis, L. A., & Munson, R. S. (2013). Acinetobacter baumannii strain M2 produces type IV pili which play a role in natural transformation and twitching motility but not surface-associated motility. mBio, 4(4), e00360-13.
[00285] Hunger, M., Schmucker, R., Kishan, V., & Hillen, W. (1990). Analysis and nucleotide sequence of an origin of an origin of DNA replication in Acinetobacter calcoaceticus and its use for Escherichia coli shuttle plasmids. Gene, 87(1), 45-51. [00286] Kumar, A., Dalton, C, Cortez-Cordova, J., & Schweizer, H. P. (2010). Mini- Tn7 vectors as genetic tools for single copy gene cloning in Acinetobacter baumannii. Journal of Microbiological Methods, 82(3), 296-300.
[00287] Lee, E. C, Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., ... Copeland, N. G. (2001). A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics, 73(1), 56-65.
[00288] Nakar, D., & Gutnick, D. L. (2001). Analysis of the wee gene cluster responsible for the biosynthesis of the polymeric bioemulsifier from the oil-degrading strain Acinetobacter lwoffii RAG-1. Microbiology, 147(7), 1937-1946.
[00289] Niu, C, Clemmer, K. M., Bonomo, R. A, & Rather, P. N. (2008). Isolation and characterization of an autoinducer synthase from Acinetobacter baumannii. Journal of Bacteriology, 190(9), 3386-92.
[00290] Scott, N. E., Kinsella, R. L., Edwards, A. V. G, Larsen, M. R., Dutta, S., Saba, J., ... Feldman, M. F. (2014). Diversity Within the O-linked Protein Glycosylation
Systems of Acinetobacter Species. Molecular & Cellular Proteomics : MCP, 13(9), 2354-70.
[00291] Wacker, M., Linton, D., Hitchen, P. G, Nita-Lazar, M., Haslam, S. M., North, S. J. Aebi, M. (2002). N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science (New York, N.Y.), 298(5599), 1790-3. [00292] All publications, patents and patent applications mentioned in this
Specification are indicative of the level of skill of those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent applications was specifically and individually indicated to be incorporated by reference. [00293] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.

Claims

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE PROPERTY OR PRIVILEGE IS CLAFMED ARE DEFINED AS FOLLOWS:
1. A method of synthesizing a glycoprotein comprising glycosylation of ComP using a Pg 1 LcomP O-oligosacchaiyl transferase .
2. The method of claim 1, wherein the ComP is optionally fused to a second protein, an adjuvant or a carrier.
3. The method of claim 1 or 2, which is performed in Gram negative bacteria.
4. The method of claim 3, wherein the bacteria is Acinetobacter or E. coli.
5. The method of any one of claims 1 to 4, wherein the glycosylation uses sugars derived from O-glycosylation, N-glycan, O-antigens, or a capsular polysaccharide.
6. The method of claim 5, wherein the capsular polysaccharide is a Streptococcus capsule.
7. The method of claim 6, wherein the Streptococcus is Streptococcus pneumoniae.
8. The method of claim 5, wherein the N-glycan is derived from Campylobacter .
9. The method of claim 8, wherein the N-glycan is a Campylobacter jejuni N- heptasaccharide.
10. The method of claim 4, wherein the Acinetobacter is A. baylyi, A. baumannii, A.
nosocomialis, or A. calcoaceticus.
11. An O-oligosaccharyltransferase for glycosylation of ComP.
12. The O-oligosaccharyltransferase of claim 11, wherein the glycosylation is recombinantly produced in Gram negative bacteria.
13. The O-oligosaccharyltransferase of claim 12, wherein the bacteria is Acinetobacter or E. coli.
14. The O-oligosaccharyltransferase of any one of claims 11 to 13, wherein the glycosylation uses sugars derived from O- glycosylation, N-glycan, O-antigens, or capsular polysaccharide.
15. The O-oligosaccharyltransferase of claim 14, wherein the capsular polysaccharide is from Streptococcus.
16. The O-oligosaccharyltransferase of claim 15, wherein the Streptococcus is Streptococcus pneumoniae.
17. The O-oligosaccharyltransferase of claim 14, wherein the N-glycan is derived from Campylobacter .
18. The O-oligosaccharyltransferase of claim 17, wherein the N-glycan is Campylobacter jejuni N-heptasaccharide.
19. The O-oligosaccharyltransferase of any one of claims 13 to 18, which is PglL ComP.
20. A vaccine comprising a glycoprotein synthesized in accordance with the method of any one of claims 1 to 10.
21. The vaccine of claim 20, which is a Streptococcus vaccine.
22. The vaccine of claim 21, wherein the Streptococcus is Streptococcus pneumoniae.
23. A glycoprotein which is a fusion protein comprising ComP or a fragment of ComP carrying a glycosylation site. Use of PglLcomP for the glycosylation of a protein.
Use of claim 24, for the glycosylation of a protein with a Streptoccocus capsule
Use of claim 25, wherein the Streptococcus is Streptococcus pneumoniae.
PCT/CA2016/050208 2015-02-26 2016-02-26 Acinetobacter o-oligosaccharyltransferases and uses thereof WO2016134485A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP16754717.3A EP3262077A4 (en) 2015-02-26 2016-02-26 Acinetobacter o-oligosaccharyltransferases and uses thereof
US15/553,733 US10265391B2 (en) 2015-02-26 2016-02-26 Acinetobacter O-oligosaccharyltransferases and uses thereof
AU2016224006A AU2016224006B8 (en) 2015-02-26 2016-02-26 Acinetobacter O-oligosaccharyltransferases and uses thereof
BR112017017930A BR112017017930A2 (en) 2015-02-26 2016-02-26 acinetobacter o-oligosaccharyl transferases and uses thereof
JP2017545671A JP6764872B2 (en) 2015-02-26 2016-02-26 Acinetobacter O-oligosaccharide transferase and its use
CA2977561A CA2977561C (en) 2015-02-26 2016-02-26 Acinetobacter o-oligosaccharyltransferases and uses thereof
US16/390,833 US10869918B2 (en) 2015-02-26 2019-04-22 Acinetobacter o-oligosaccharyltransferases and uses thereof
US17/127,142 US11497804B2 (en) 2015-02-26 2020-12-18 Acinetobacter O-oligosaccharyltransferases and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562121439P 2015-02-26 2015-02-26
US62/121,439 2015-02-26

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/553,733 A-371-Of-International US10265391B2 (en) 2015-02-26 2016-02-26 Acinetobacter O-oligosaccharyltransferases and uses thereof
US16/390,833 Continuation US10869918B2 (en) 2015-02-26 2019-04-22 Acinetobacter o-oligosaccharyltransferases and uses thereof

Publications (1)

Publication Number Publication Date
WO2016134485A1 true WO2016134485A1 (en) 2016-09-01

Family

ID=56787925

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2016/050208 WO2016134485A1 (en) 2015-02-26 2016-02-26 Acinetobacter o-oligosaccharyltransferases and uses thereof

Country Status (7)

Country Link
US (3) US10265391B2 (en)
EP (1) EP3262077A4 (en)
JP (1) JP6764872B2 (en)
AU (1) AU2016224006B8 (en)
BR (1) BR112017017930A2 (en)
CA (1) CA2977561C (en)
WO (1) WO2016134485A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017062558A1 (en) * 2015-10-07 2017-04-13 Boehringer Ingelheim Vetmedica, Inc. Streptococcus suis polysaccharide-protein conjugate composition
WO2019241672A3 (en) * 2018-06-16 2020-02-06 Vaxnewmo Llc Glycosylated comp pilin variants, methods of making and uses thereof
US11497804B2 (en) 2015-02-26 2022-11-15 Vaxnewmo Llc Acinetobacter O-oligosaccharyltransferases and uses thereof

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10729763B2 (en) 2017-06-10 2020-08-04 Inventprise, Llc Mixtures of polysaccharide-protein pegylated compounds
WO2020131236A1 (en) * 2018-12-21 2020-06-25 Vaxnewmo Llc O-linked glycosylation recognition motifs
WO2021217037A2 (en) * 2020-04-23 2021-10-28 Cornell University Bacterial system for producing human o-glycoproteins
WO2024030212A1 (en) * 2022-06-30 2024-02-08 Mechanobiologics, Inc. Reversal of cellular senescence by treatment with low frequency ultrasound

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1059354A2 (en) * 1999-06-10 2000-12-13 Ceres Incorporated Sequence-determined DNA fragments and corresponding polypeptides encoded thereby
ES2652416T3 (en) * 2006-12-13 2018-02-02 The Governors Of The University Of Alberta  Methods and systems for protein O-glycosylation
US20130196410A1 (en) 2010-03-05 2013-08-01 Alnylam Pharmaceuticals, Inc Compositions and methods for modifying the glycosylation pattern of a polypeptide
WO2013067523A1 (en) 2011-11-04 2013-05-10 Cornell University A prokaryote-based cell-free system for the synthesis of glycoproteins
WO2014057109A1 (en) * 2012-10-12 2014-04-17 Glycovaxyn Ag Methods of host cell modification
CA2889767C (en) * 2012-11-07 2021-09-21 Glycovaxyn Ag Production of recombinant vaccine in e. coli by enzymatic conjugation
WO2014151878A2 (en) 2013-03-14 2014-09-25 Abbvie Inc. Methods for modulating protein glycosylation profiles of recombinant protein therapeutics using monosaccharides and oligosacharides
EP3193918A4 (en) 2014-09-18 2018-06-20 University of Maryland, Baltimore Broad spectrum conjugate vaccine to prevent klebsiella pneumoniae and pseudomonas aeruginosa infections
WO2016107818A1 (en) 2014-12-30 2016-07-07 Glycovaxyn Ag Compositions and methods for protein glycosylation
AU2016224006B8 (en) 2015-02-26 2020-03-19 Vaxnewmo Llc Acinetobacter O-oligosaccharyltransferases and uses thereof
JP2021528059A (en) 2018-06-16 2021-10-21 ヴァックスニューモ エルエルシーＶａｘｎｅｗｍｏ Ｌｌｃ Glycosylated ComP pilin variant, manufacturing method and its use
WO2020131236A1 (en) 2018-12-21 2020-06-25 Vaxnewmo Llc O-linked glycosylation recognition motifs

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
PORSTENDÖRFER D. ET AL.: "ComP, a pilin-like protein essential for natural competence in Acinetobacter sp. Strain BD 413 : regulation, modification, and cellular localization''.", J BACTERIOL., vol. 182, no. 13, July 2000 (2000-07-01), pages 3673 - 80, ISSN: 0021-9193 *
SCHULZ B.L. ET AL.: "Identification of bacterial protein O-oligosaccharyltransferases and their glycoprotein substrates''.", PLOS ONE, vol. 8, no. 5, 3 May 2013 (2013-05-03), pages e62768, XP055307413, ISSN: 1932-6203, Retrieved from the Internet <URL:www.plosone.org> *
See also references of EP3262077A4 *
TERRA V. S. ET AL.: "Recent developments in bacterial protein glycan coupling technology and glycoconjugate vaccine design''.", J MED MICROBIOL., vol. 61, no. 7, July 2012 (2012-07-01), pages 919 - 26, XP055107688, ISSN: 1473-5644, DOI: doi:10.1099/jmm.0.039438-0 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11497804B2 (en) 2015-02-26 2022-11-15 Vaxnewmo Llc Acinetobacter O-oligosaccharyltransferases and uses thereof
WO2017062558A1 (en) * 2015-10-07 2017-04-13 Boehringer Ingelheim Vetmedica, Inc. Streptococcus suis polysaccharide-protein conjugate composition
WO2019241672A3 (en) * 2018-06-16 2020-02-06 Vaxnewmo Llc Glycosylated comp pilin variants, methods of making and uses thereof
US11932670B2 (en) * 2018-06-16 2024-03-19 Vaxnewmo Llc Glycosylated ComP pilin variants, methods of making and uses thereof

Also Published As

Publication number Publication date
US20190343945A1 (en) 2019-11-14
JP2018507693A (en) 2018-03-22
JP6764872B2 (en) 2020-10-07
AU2016224006A1 (en) 2017-09-28
CA2977561C (en) 2022-09-06
EP3262077A4 (en) 2018-11-14
US11497804B2 (en) 2022-11-15
US20210220460A1 (en) 2021-07-22
US20180050101A1 (en) 2018-02-22
AU2016224006B8 (en) 2020-03-19
AU2016224006B2 (en) 2020-02-27
US10265391B2 (en) 2019-04-23
CA2977561A1 (en) 2016-09-01
US10869918B2 (en) 2020-12-22
EP3262077A1 (en) 2018-01-03
BR112017017930A2 (en) 2018-04-10

Similar Documents

Publication Publication Date Title
US11497804B2 (en) Acinetobacter O-oligosaccharyltransferases and uses thereof
Harding et al. A cinetobacter strains carry two functional oligosaccharyltransferases, one devoted exclusively to type IV pilin, and the other one dedicated to O‐glycosylation of multiple proteins
Harding et al. A platform for glycoengineering a polyvalent pneumococcal bioconjugate vaccine using E. coli as a host
EP3131577B1 (en) Modified host cells and uses thereof
EP2142660B1 (en) Methods and systems for o-glycosylating proteins
KR20150054800A (en) Bioconjugates comprising modified antigens and uses thereof
KR20100123730A (en) Bioconjugates made from recombinant n-glycosylated proteins from procaryotic cells
US20220088211A1 (en) O-linked glycosylation recognition motifs
Duke et al. Development and immunogenicity of a prototype multivalent group B Streptococcus bioconjugate vaccine
Knoot et al. Discovery and characterization of a new class of O-linking oligosaccharyltransferases from the Moraxellaceae family
US20220054632A1 (en) Modified carrier proteins for o-linked glycosylation
Cain et al. Exploiting pglB oligosaccharyltransferase-positive and-negative Campylobacter jejuni and a multiprotease digestion strategy to identify novel sites modified by N-linked protein glycosylation
BR122024013855A2 (en) METHOD OF GLYCOSYLATION OF A PROTEIN IN A BACTERIAL CELL, CONJUGATE VACCINES, GLYCOSYLATED FUSION PROTEIN, AND USE OF A GLYCOSYLATED COMP FUSION PROTEIN
Nasr Exploiting novel Acinetobacter Oligosaccharyltransferases for the development of glycoconjugate vaccines against the Pneumococcus
WO2024077205A2 (en) Moraxellaceae o-linking oligosaccharyltransferases, glycosylation fragments, and uses thereof
US20240207383A1 (en) Minimal Sequons Sufficient for O-Linking Glycosylation
WO2024182291A2 (en) Compositions and methods for producing glycoconjugate polypeptides having isopeptide bonds with a second polypeptide partner and uses thereof
Mayer et al. A platform for glycoengineering a polyvalent pneumococcal bioconjugate vaccine using E. coli as a host
Harding Discovery and demonstration of functional type IV pili production and post-translational modification by a medically relevant Acinetobacter species
Yogendirarajah Elucidating the Importance of HopE and its Potential Lewis Glycosylation in Helicobacter pylori
Barre Characterization of the bacterial oligosaccharyltransferase for N-linked protein glycosylation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16754717

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2977561

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2017545671

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15553733

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017017930

Country of ref document: BR

REEP Request for entry into the european phase

Ref document number: 2016754717

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016224006

Country of ref document: AU

Date of ref document: 20160226

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112017017930

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20170822