WO2016130697A1 - Methods and kits for generating vectors that co-express multiple target molecules - Google Patents

Methods and kits for generating vectors that co-express multiple target molecules Download PDF

Info

Publication number
WO2016130697A1
WO2016130697A1 PCT/US2016/017377 US2016017377W WO2016130697A1 WO 2016130697 A1 WO2016130697 A1 WO 2016130697A1 US 2016017377 W US2016017377 W US 2016017377W WO 2016130697 A1 WO2016130697 A1 WO 2016130697A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
grna
promoter
target
coding sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/017377
Other languages
French (fr)
Inventor
Joana de Campos ALVES VIDIGAL
Andrea Ventura
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Memorial Sloan Kettering Cancer Center
Original Assignee
Memorial Sloan Kettering Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Memorial Sloan Kettering Cancer Center filed Critical Memorial Sloan Kettering Cancer Center
Publication of WO2016130697A1 publication Critical patent/WO2016130697A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present application relates generally to methods and kits for expressing multiple target molecules from a single expression vector and, in particular, to a methods and kits for building CRISPR/Cas9 libraries expressing paired guide RNAs starting from a pool of oligonucleotides.
  • CRISPR-Cas9 site-specific double-stranded DNA breaks are generated by the bacterial Cas9 endonuclease coupled to a single guide RNA (gRNA) molecule containing ⁇ 20nt homology to the desired site.
  • gRNA single guide RNA
  • NHEJ error-prone non-homologous end-joining pathway leading to mutations at the targeted locus.
  • CRIPSR-Cas9 gene disruption using the CRIPSR-Cas9 system has proven highly efficient and can be used for bi-allelic targeting of multiple genes simultaneously.
  • the simplicity of single gRNA cloning makes it suitable for the generation of pooled libraries for loss-of-function screens.
  • the method comprises the steps of: (a) amplifying a target DNA sequence with a pair of primers to produce a double-stranded DNA target fragment, wherein the target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second gRNA coding sequence, a first gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA sequence and the first gRNA sequence, wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence, and (b) ligating the double-stranded DNA target fragment to a linearized donor plasmid to form a circular
  • the method comprises the steps of (a) amplifying a pool of target DNA sequences with a pair of primers to produce a pool of double- stranded DNA target fragments, wherein each target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second target-DNA-specific gRNA coding sequence, a first target-DNA-specific gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA sequence and the first gRNA sequence, wherein at least two of the target DNA sequences comprise different target-DNA-specific gRNA coding sequences, and wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a
  • kits for generating an expression vector capable of expression of multiple target molecules or a pool of such co- expression vectors comprises a donor plasmid comprising a promoter sequence and a gRNA scaffold coding sequence; a forward primer comprising a first anchor sequence that is homologous to at least a portion of the promoter sequence; and a reverse primer comprising a second anchor sequence that is homologous to at least a portion of the gRNA scaffold coding sequence.
  • FIGS 1A-1B A vector for paired-gRNA/Cas9 expression.
  • FIG. 1A Schematic representation of a Cas9 expression vector containing a gRNA pair.
  • FIG. IB Top, northern blot (N.B.) analysis to total RNA from cells transiently transfected with an empty vector (lane 1), vectors expressing single gRNAs (lanes 2 and 3) or a vector expressing an gRNA pair (lane 4); Bottom, PCR analysis to targeted locus showing a -350 bp band corresponding the genomic deletion only in cells transfected with the gRNA pair.
  • Figure 2 A one-step method to clone gRNAs pairs.
  • a 1 lOnt DNA oligo (SEQ ID NO: 1) containing the sequences of two gRNAs is amplified by PCR with a pair of primers (SEQ ID NOS: 2 and 3), to generate a dsDNA molecule (SEQ ID NO: 4) that contains two restriction sites for Bbsl as well as 40bp homologies to the U6 promoter and the gRNA scaffold.
  • SEQ ID NO: 4 A Gibson reaction between the amplicon and a fragment containing a U6 promoter and an gRNA scaffold generates an intermediate circular molecule. This is linearized with Bbsl digestion and cloned into a Cas9 expression plasmid to generate the final construct expressing the gRNA pair.
  • FIG. 3 A is a schematic representation of the pooled cloning strategy. Each color represents a distinct gRNA pair.
  • Fig. 3B shows gel electrophoresis of the fragments used in the Gibson ligation and of the assembled insert after linearization with Bbsl.
  • Fig. 3C shows NotllEcoRl digestion of plasmid DNA showing correct vector assembly in 10/10 bacterial clones.
  • Fig. 3D shows correct cloning of oligo / into a lentiviral vector. (gRNAl (SEQ ID NO: 11); gRNA2 (SEQ ID NO: 12).
  • Fig. 3E is a pie chart showing representation of each gRNA pair in sequenced clones.
  • Figures 4A-4D show lentiviral vectors for paired gRNA expression.
  • Fig. 4A is a schematic representation of the lentiviral vectors.
  • Fig. 4B shows detection of indel formation by SURVEYOR assay.
  • Nuc nuclease.
  • Fig. 4C shows analysis of proviral integrity by PCR to genomic DNA of infected cells. Diagram shows location of primers and expected size upon amplification of each provirus. Black bars indicate primer location.
  • Bottom panel shows PCR assay to uninfected cells (lane 1) and cells infected with either an empty lentiviral vector (lane 2), a lentiviral vector carrying a single gRNA (lane 3), or one of the three lentiviral vectors carrying the gRNA pair (lanes 4-6).
  • Fig. 4D top panel shows PCR analysis to targeted locus showing a band corresponding the genomic deletion only in cells infected with paired-lentiviral vectors.
  • Fig. 4D bottom threenels show northern blot (N.B.) analysis to total RNA from uninfected cells, or cells infected with the indicated lentiviral constructs.
  • Figure 5 is schematic representation of several pDonor plasmids.
  • the first boxes represent gRNA scaffold, the second arrowed boxes represent pol III promoters.
  • the smaller boxes within the arrowed box represent the various regulatory motifs present in the U6 promoters (from 5' to 3' : the Octamer motif, the Proximal sequence element, and the TATA- box).
  • Sequence present in each pDonor plasmid is shown as SEQ ID NO: 43 (pDonor_hU6) SEQ ID NO: 44 (pDonor_mU6); SEQ ID NO: 45 (pDonor_sU6).
  • Figures 6A-6D are pictures of uncropped gels.
  • Fig. 6A shows PCR detection of genomic deletion (related to Fig IB).
  • Fig. 6B shows PCR detection of proviral recombination (related to Fig. 4C).
  • Fig. 6C shows surveyor assay to 5' cut site to genomic DNA of uninfected cells to cells infected with the indicated constructs (related to Fig. 4B, top panel).
  • Fig. 6D shows surveyor assay to 3' cut site to genomic DNA of uninfected cells to cells infected with the indicated constructs (related to Fig. 4B, bottom panel).
  • CRISPR-Cas9 refers to the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Type II system is a bacterial immune system that has been modified for genome engineering.
  • CRISPR consists of two components: a "guide" RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas9).
  • gRNA guide RNA
  • Cas9 non-specific CRISPR-associated endonuclease
  • CRISPR refers to CRISPR associated protein 9, which is an RNA-guided DNA endonuclease enzyme associated with the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive immunity system in Streptococcus pyogenes, among other bacteria.
  • S. pyogenes utilizes Cas9 to memorize and later interrogate and cleave foreign DNA, such as invading bacteriophage DNA or plasmid DNA. Cas9 performs this interrogation by unwinding foreign DNA and checking whether it is homologous to the 20 basepair spacer region of the guide RNA.
  • Cas9 cleaves the invading DNA.
  • the exact amino acid residues within each nuclease domain that are critical for endonuclease activity are known (D10A for HNH and H840A for RuvC in S. pyogenes Cas9) and modified versions of the Cas9 enzyme containing only one active catalytic domain (called "Cas9 nickase") have been generated.
  • Both RuvC- and HNH- nuclease domains can be rendered inactive by point mutations (D10A and H840A in SpCas9), resulting in a nuclease dead Cas9 (dCas9) molecule that cannot cleave target DNA.
  • the dCas9 molecule can be tagged with transcriptional repressors or activators.
  • dCas9-based activators and repressors consist of dCas9 fused directly to a single transcriptional activator, e.g., VP64, or transcriptional repressors, e.g., KRAB.
  • Other activation strategies include: co-expression of epitope-tagged dCas9 and antibody-activator effector proteins (e.g. SunTag system), dCas9 fused to several different activation domains in series (e.g. dCas9-VPR, C) or co-expression of dCas9-VP64 with a "modified scaffold" gRNA and additional RNA-binding "helper activators” (e.g. SAM activators).
  • S. pyogenes Cas9 (SpCas9) is a particular embodiment of CRISPR endonuclease, however, other variants of Cas9 may be used, e.g., Kleinsteiver et al., Nature, 2015 Jul
  • SpCas9 Staphylococcus aureus Cas9
  • AAV adeno-associated virus
  • gRNA refers to a short synthetic RNA composed of a "scaffold” sequence necessary for Cas9-binding and a user-defined “spacer” or “targeting” sequence which defines the genomic target to be modified.
  • the "spacer” or “targeting” sequence of a gRNA typically has a length of about 20 nucleotides (nt).
  • the gRNA scaffold sequence is the sequence within the gRNA that is responsible for Cas9 binding; it does not include the 20bp spacer/targeting sequence that is used to guide Cas9 to target DNA.
  • the genomic target can be any ⁇ 20 nucleotide DNA sequence, provided the sequence is unique compared to the rest of the genome, and that target is present immediately upstream of a Protospacer Adjacent Motif (PAM).
  • PAM Protospacer Adjacent Motif
  • the PAM sequence is absolutely necessary for target binding and the exact sequence is dependent upon the species of Cas9 (5' NGG 3' for Streptococcus pyogenes Cas9).
  • Guide RNA design for CRISPR libraries follows the same general principles as designing a gRNA for a specific target. Target sequences must be unique compared to the rest of the genome and be located just upstream of a PAM sequence.
  • the exact region of the gene to be targeted may vary depending on the specific application (5' constitutively expressed exons for knock-out libraries, or the promoter region for activation and repression libraries).
  • Cas9 or Cas9 derivative
  • Cas9 derivative is included on the gRNA-containing plasmid; for others, they must be delivered to the cells separately.
  • gRNAs The genomic sequence used to design gRNAs will depend upon the target gene and species and the scientific objective.
  • dCas9- activators or dCas9-repressors To activate or repress a target gene using dCas9- activators or dCas9-repressors, gRNAs should be targeted to the promoter driving expression of the gene of interest.
  • gRNAs commonly target 5' constitutively expressed exons, which reduces the chances that the targeted region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since frameshift mutations here will increase the likelihood that a nonfunctional protein product is produced.
  • gRNAs can be designed to target exons that code for known essential protein domains.
  • Cleavage efficiency may increase or decrease depending upon the specific nucleotides within the selected target sequence.
  • gRNA targeting sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than gRNAs containing a C nucleotide at the same position.
  • the ability to semi-automatically design and synthesize gRNAs to mutate, activate, or repress almost any genomic locus makes the CRISPR/Cas9 suitable for large-scale forward genetic screening.
  • ligation refers to the joining of two nucleic acid fragments through the action of an enzyme.
  • ligation involves the use of restriction enzymes to generate a wide variety of ends in DNA digested by the restriction enzyme.
  • a Type II restriction enzyme is used.
  • the restriction enzyme used is Bbsl.
  • restriction enzymes such as EcoRI, Smal or EcoRV, may be used to digest DNA prior to ligation.
  • topoisomerase-mediate ligation may be performed.
  • the Gateway cloning system may be used.
  • a Gibson ligation may be used.
  • any homology -based ligation technique may be used and that the ligation technique is not limiting on the application.
  • promoter is to be taken in its broadest context and includes transcriptional regulatory elements (TREs) from genomic genes or chimeric TREs therefrom, including the TATA box or initiator element for accurate transcription initiation, with or without additional TREs (i.e., upstream activating sequences, transcription factor binding sites, enhancers, and silencers) which regulate activation or repression of genes operably linked thereto in response to developmental and/or external stimuli, and trans-acting regulatory proteins or nucleic acids.
  • a promoter may contain a genomic fragment or it may contain a chimera of one or more TREs combined together.
  • RNA pol III promoters are used.
  • a human U6 promoter is used.
  • an HI promoter is used.
  • both U6 and HI promoters are used.
  • pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41 :521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the ⁇ -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter.
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • PGK phosphoglycerol kinase
  • a vector comprises one or more pol III promoter ⁇ e.g., 1, 2, 3, 4, 5, or more pol I promoters), one or more pol II promoters ⁇ e.g., 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters ⁇ e.g., 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof.
  • a nucleic acid sequence is "operably linked" to another nucleic acid sequence when the former is placed into a functional relationship with the latter.
  • a DNA for a presequence or signal peptide is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences being linked are contiguous and, in the case of a signal peptide, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers may be used in accordance with conventional practice.
  • downstream refers to a nucleotide sequence that is located 3' to reference nucleotide sequence.
  • downstream nucleotide sequences generally relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.
  • upstream refers to a nucleotide sequence that is located 5' to reference nucleotide sequence.
  • upstream nucleotide sequences generally relate to sequences that are located on the 5' side of a coding sequence or starting point of transcription. For example, most promoters are located upstream of the start site of transcription.
  • restriction endonuclease and “restriction enzyme,” as used herein, refer to an enzyme that binds and cuts within a specific nucleotide sequence within double stranded DNA.
  • the term “pool” as used throughout the specification is to be understood to mean a collection of two or more different molecules.
  • DNA amplification refers to an artificial increase in the number of copies of a particular DNA fragment through replication of the fragment.
  • DNA amplification is performed using the polymerase chain reaction.
  • DNA amplification technique is not limiting on the application.
  • expression vector refers to any genetic expression systems.
  • recombinant expression vectors can comprise a nucleic acid in a form suitable for expression of the nucleic acid in a host cell, as well as one or more regulatory elements, which are operatively-linked to the nucleic acid sequence to be expressed, e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell.
  • regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences).
  • a tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas), or particular cell types (e.g., lymphocytes).
  • Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc.
  • a vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).
  • CRISPR clustered regularly interspersed short palindromic repeats
  • viral cloning vectors refers to vectors that can be used to generate recombinant viruses.
  • a viral cloning vector typically contains certain sequences from the corresponding virus.
  • Viral cloning vectors include vectors created from: retroviruses;
  • adenoviruses adenoviral/retroviral chimeras; adeno- associated viruses; herpes simplex virus I or II; parvovirus; reticuloendotheliosis virus; poliovirus, papillomavirus, vaccinia virus, lentivirus, as well as hybrid or chimeric vectors incorporating favorable aspects of two or more viruses.
  • Cas9 vector refers to an expression vector that is capable of expression a Cas9 gene.
  • the Cas9 vector comprises a Cas9 gene operably linked to a promoter.
  • the promoter can be constitutive (CMV, EF1 alpha, CBh) or inducible (e.g., Tet-on or Tet-off).
  • One aspect of the present application relates to a method for generating a pool of co-expression vectors capable of expression of two or more different target molecules from each co-expression vector.
  • the method comprises the steps of (a) amplifying a pool of target DNA sequences with a pair of primers to produce a pool of double-stranded DNA target fragments, wherein each target DNA sequence comprises from the 5' end to the 3 ' end, a first anchor region, a second target molecule coding sequence, a first target molecule coding sequence, a second anchor region, and one or more restriction enzyme sites between the second target molecule coding sequence and the first target molecule coding sequence, wherein at least two of the target DNA sequences in the pool of target DNA sequences comprise different target molecule coding sequences, and wherein the pair of primers consists of a forward primer comprising a forward anchor sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence
  • the second anchoring sequence is homologous to a different portion of the donor plasmid sequence that does not overlap with the first promoter sequence.
  • the target molecules are gRNAs. In other embodiments, the target molecules are shRNAs, or any other short non-polyadenylated RNA molecule.
  • the pDonor sequence will be selected based on the type of target molecules.
  • the pool of target DNA sequences may be generated using methods well known in the art.
  • the pool of target DNA sequences are generated by PCR amplification of single stranded DNA oligonucleotides either synthesized individually and mixed prior to PCR or synthesized in a pool as done in on-chip oligonucleotide synthesis and analogous methods.
  • the target DNA sequences are generated as double stranded DNA molecules synthesized individually or in a pool.
  • a pooled library may be obtained by ordering a gene fragment library, which consists of synthetically generated nucleotides varying in length that contain defined regions of consecutive variable bases ⁇ See, e.g., Gibson D, Young L, et al.
  • DNA oligo pools may be ordered that are a mixture of large numbers of different oligos in fmole to nmole range. These DNA oligo pools can be synthesized according to desired specifications.
  • each target DNA sequence further comprises a spacer sequence between the second target molecule coding sequence and the first target molecule coding sequence.
  • the one or more restriction sites are located within the spacer sequence.
  • the spacer sequence has a length of 1-100 nt, 5-60 nt, 10-50 nt, 20-40 nt or 20-30 nt.
  • each of the first anchor region and the second anchor region has a length of 10-100 nt, 10-60 nt, 10-50 nt, 10-40 nt, 10-30 nt, 20-40 nt or 20-30 nt.
  • the expression vector is a Cas9 vector comprising a Cas9 gene under the control of a third promoter
  • the target molecules are gRNAs
  • the donor plasmid further comprises a first gRNA scaffold coding sequence
  • the expression plasmid further comprises a second gRNA scaffold coding sequence.
  • the target molecules are gRNAs and the target molecule coding sequences in the target DNA sequence comprise the "spacer” or “targeting" sequence of the gRNAs, or a portion of the "spacer” or “targeting” sequence of the gRNAs.
  • the target molecule coding sequences in the target DNA sequence consist of the "spacer” or “targeting” sequence of the gRNAs, or a portion of the "spacer” or “targeting” sequence of the gRNAs.
  • the expression vector is a viral cloning vector that allows for the production of a recombinant virus derived from an adeno-associated virus (AAV), adenovirus, herpesvirus, vaccinia virus, poliovirus, poxvirus, a retrovirus (including a lentivirus, such as HIV-1 and HIV-2), Sindbis and other RNA viruses, alphavirus, astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, togaviruses and the like.
  • AAV adeno-associated virus
  • adenovirus herpesvirus
  • vaccinia virus vaccinia virus
  • poliovirus poxvirus
  • a retrovirus including a lentivirus, such as HIV-1 and HIV-2
  • Sindbis and other RNA viruses alphavirus, astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus,
  • Cas9 and gRNA can be present in a single lentiviral transfer vector or separate transfer vectors.
  • Packaging and envelope plasmids provide the necessary components to make lentiviral particles.
  • CRISPR elements are inserted into an AAV transfer vector and used to generate AAV particles.
  • the method further comprises the step of (e) generating an expression library from the a pool of co-expression vectors in step (d).
  • step (e) generating an expression library from the a pool of co-expression vectors in step (d).
  • the one or more restriction sites can be the recognition site of any restriction endonucleases. In some embodiments, the one or more restriction sites comprising one or two Bbs I sites.
  • the first promoter and the second promoter can be any promoter capable of controlling expression of the operably linker target molecule coding sequence.
  • the first promoter and the second promoter are promoters for RNA polymerases, such as U6 and HI promoters.
  • the first promoter is different from the second promoter.
  • the first promoter is the same as the second promoter.
  • the first promoter and/or the second promoter is an inducible promoter. Examples of inducible promoters include, but are not limited to, promoters that are specifically activated either by light, temperature or specific chemical inducing agents. In some
  • inducible expression systems regulated by administration of tetracycline or dexamethasone may be used
  • the method comprises the steps of (a) amplifying a target DNA sequence with a pair of primers to produce a double-stranded DNA target fragment, wherein the target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second gRNA coding sequence, a first gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA coding sequence and the first gRNA coding sequence, wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence, and (b) ligating the double-stranded DNA target fragment to a linearized donor plasmid to form a circular intermediate, wherein the linearized donor plasmid comprises a first promoter sequence and a first gRNA scaffold
  • the first and second gRNA coding sequences each encodes the "spacer" or “targeting" sequence of a gRNA molecule.
  • the method comprises the steps of (a) amplifying a pool of target DNA sequences with a pair of primers to produce a pool of double-stranded DNA target fragments, wherein each target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second target-DNA-specific gRNA coding sequence, a first target-DNA- specific gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA sequence and the first gRNA sequence, wherein at least two of the target DNA sequences comprise different target-DNA-specific gRNA coding sequences, and wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence; (b) ligating the double-stranded DNA target fragments to
  • the pool of double-stranded DNA donor fragments are generated by PCR amplification of single stranded DNA oligonucleotides either synthesized individually and mixed prior to PCR or synthesized in a pool as done in on-chip oligonucleotide synthesis and analogous methods.
  • the target DNA sequences are generated as double stranded DNA molecules synthesized individually or in a pool.
  • a single pair of primers is used to amplify the pool of target DNA sequences.
  • the target-DNA-specific gRNA coding sequences in the target DNA sequence comprise the "spacer” or “targeting” sequence of the gRNAs, or a portion of the "spacer” or “targeting” sequence of the gRNAs. In some embodiments, the target-DNA- specific gRNA coding sequence in the target DNA sequence consist of the "spacer" or
  • targeting sequence of the gRNAs or a portion of the “spacer” or “targeting” sequence of the gRNAs.
  • the expression vector is a viral cloning vector that allows for the production of a recombinant virus derived from an adeno-associated virus (AAV), adenovirus, herpesvirus, vaccinia virus, poliovirus, poxvirus, a retrovirus (including a lentivirus, such as HIV-1 and HIV-2), Sindbis and other RNA viruses, alphavirus, astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, togaviruses and the like.
  • AAV adeno-associated virus
  • adenovirus herpesvirus
  • vaccinia virus vaccinia virus
  • poliovirus poxvirus
  • a retrovirus including a lentivirus, such as HIV-1 and HIV-2
  • Sindbis and other RNA viruses alphavirus, astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus,
  • the pool of co-expression vectors produced in Step (d) are plasmids and are used in in vitro transcription reactions to generate mature Cas9 mRNA and gRNA, then delivered to target cells ⁇ i.e. microinjection or electroporation).
  • purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA complex and delivered to cells using cationic lipids.
  • the expression vector further comprises a reporter gene ⁇ e.g., GFP) to identify and enrich positive cells, or selection marker to generate stable cell lines.
  • the linearized expression vector can be any expression vector that carries a pol III promoter.
  • the linearized expression vector is a virus vector.
  • the linearized expression vector is a CRISPR-Cas9 expression vector.
  • the library comprises a pool of CRISPR-Cas9 vectors each expressing a pair of sgRNA.
  • kits for generating an expression vector capable of expression of multiple target molecules or a pool of such co- expression vectors comprises a donor plasmid comprising a promoter sequence; a forward primer comprising a first anchor sequence that is homologous to at least a portion of the promoter sequence; and a reverse primer comprising a second anchor sequence that is homologous to a portion of the donor plasmid sequence that does not overlap with the portion of the promoter sequence that is homologous to the first anchor sequence.
  • the second anchor sequence is homologous to a portion of the donor plasmid sequence that does not overlap promoter sequence.
  • the kit comprises a donor plasmid comprising a promoter sequence and a gRNA scaffold coding sequence; a forward primer comprising a first anchor sequence that is homologous to at least a portion of the promoter sequence; and a reverse primer comprising a second anchor sequence that is homologous to at least a portion of the gRNA scaffold coding sequence.
  • the kit may also comprise a set of instructions, listing of ingredients and other informational materials related to the conduct of the method.
  • the kit comprising a forward primer that has homology to a DNA transcription promoter sequence, a reverse primer that has homology to a gRNA scaffold sequence, reagents for performance of a PCR amplification using the forward and reverse primers, restriction enzymes for digestion of DNA, and reagents for performance of ligation.
  • the kit comprises reagents for performance of a Gibson ligation.
  • the pDonor plasmid was generated by cloning a 435 bp fragment containing two Bbsl restriction sites flanking an sgRNA-scaffold sequence and a U6 promoter into an EcoRV- digested pBluescript KS+ vector (SEQ ID NO: 31).
  • pDonor plasmids were generated by cloning the Donor fragments into either an EcoRV-digested pBluescript KS+ vector (pDonor_hU6) or into the Topo Blunt II plasmid (Invitrogen) (Fig. 5).
  • the sU6 promoter was generated by replacing the regulatory elements of mU6 for those of hU6 (i.e., the Octamer motif, the Proximal sequence element, and the TATA-box) (Fig. 5A).
  • the sequences contained in each of the pDonors are provided in Fig. 5, along with the sequence of the DNA oligos used for cloning gRNA pairs under the various promoters.
  • Oligonucleotides were mixed at equimolar concentrations and amplified with phusion polymerase (New England Biolabs) using primers that add homology regions to the 3' region of the U6 promoter (forward primer,
  • GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 3).
  • the gel- purified 148 bp amplicon was ligated to the 415 bp Donor fragment— generated by Bbsl digestion of the pDonor plasmid— in a 3 : 1 molar ratio, using the Gibson Assembly Master Mix (New England Biolabs; lh at 50°C).
  • the Gibson reaction was treated with Plasmid Safe exonuclease (Epicenter) for lh at 37°C to remove unligated fragments, column purified (QIAquick PCR purification kit; Qiagen) and digested with Bbsl at 37°C for 3h.
  • the linearized 461 bp fragment was gel purified and cloned into BsmBI-digested lentiCRISPR vector4 (Addgene plasmid 49535). For 10 bacterial clones, correct assembly was confirmed by digestion of plasmid DNA with Notl and EcoRI enzymes. Sequencing of vectors was done using forward (GGCAAGTTTGTGGAATTGGT (SEQ ID NO: 5) and reverse
  • Donor fragment is prepared by digesting lOug of pDonor_sU6 with Bbsl. Gel extraction is performed to obtain a 415bp band.
  • the Gibson reaction is performed by incubating at 50°C for lh. If a pooled library is being created a nuclease digestion is then added to each Gibson reaction as follows:
  • the nuclease digestion occurs at 37°C for lh.
  • PCR clean up and digestion reactions may be carried out with Qiagen' s PCR clean up kit.
  • a digestion with Bbsl is carried out as follows:
  • digest 5-10ug of your vector of choice e.g.,
  • lentiCRISPR_v2 addgene #52961 ; BsmBI); px330 (addgene # 42230 ; Bbsl).
  • Gel extraction is performed on the top band, which corresponds to vector backbone.
  • set up ligations containing 50ng of vector and 6-7 ng of insert include a control ligation with water.
  • Transform bacteria with 2.5ul of ligation and select. Pick colonies the next day and check for positive clones by digestion (e.g., Notl/Xhol digestion for lentiCRISPR, which yields 1.8kb in positive clones. Double check if the enzymes cut within the sgRNAs). Sequence with forward (e.g., lentiCRISPR fwd; GGCAAGTTTGTGGAATTGGT (SEQ ID NO: 5) and reverse primers (e.g., lentiCRISPR rev; TCTCTAGGCACCGGTTCAAT (SEQ ID NO: 6).
  • forward e.g., lentiCRISPR fwd; GGCAAGTTTGTGGAATTGGT (SEQ ID NO: 5
  • reverse primers e.g., lentiCRISPR rev; TCTCTAGGCACCGGTTCAAT (SEQ ID NO: 6).
  • NIH3T3 cells were cultured at 37°C (5% C0 2 ) in DME-HG supplemented with 10% FCS, L-glutamine (2mM), penicillin (lOOU/ml) and streptomycin (lOOug/ml).
  • DME-HG DME-HG supplemented with 10% FCS, L-glutamine (2mM), penicillin (lOOU/ml) and streptomycin (lOOug/ml).
  • lOOU/ml penicillin
  • streptomycin lOOug/ml
  • 293T cells (ATCC; # CRL-3216) were transfected with lentiviral constructs together with ecotropic packaging plasmids using the protocol described above. Media containing viruses were collected 48h after transfection and used to infect NIH3T3 cells. Infected cells were selected with puromycin (2 ⁇ g/ml) for 3 days and then collected for further analysis. Analysis of proviral integrity was done by PCR using primers F2 and R2 (Fig. 6B). In cells displaying detectable levels of proviral recombination the amplicon corresponding to the recombined viral genome was cloned into Topo Blunt II (Invitrogen) and 6 clones of the resulting bacterial clones sequenced.
  • Topo Blunt II Invitrogen
  • RNA samples were collected in TRIZOL (Invitrogen) and total RNA isolated according to manufacturers' protocols. For each sample, 10 ⁇ g of RNA were resolved in a 15% Urea-PAGE gel and blotted onto a Hybond-N+ nylon membrane (GE Healthcare). Membranes were UV-cross-linked and hybridized overnight with 32P -labeled probes against the 5' region of each sgRNA (sgRNAl probe,
  • TTGGACGCCCTCGCAGTGGC SEQ ID NO: 7
  • sgRNA2 probe SEQ ID NO: 7
  • genomic deletions For detection of genomic deletions, cells were collected in lysis buffer (100 mM Tris-HCl pH8.5, 200 mM NaCl, 5 mM EDTA, 0.2% SDS and 100 ng/ml proteinase K) and incubated at 55°C for 4h. Genomic DNA was extracted with phenol-chloroform followed by ethanol precipitation and amplified by PCR with Phusion polymerase (New England Biolabs) using primers that flank the sgRNA target sites (forward primer,
  • AAGTTCGAGGCCATCTCTGA (SEQ ID NO: 9); reverse primer,
  • Example 3 A one-step cloning method for paired-gRNA vectors
  • the two sgRNA sequences were cloned sequentially in the recipient vector, a strategy that is incompatible with the generation of medium or large pooled libraries.
  • a method was devised to simultaneously clone two guide RNAs from a short (110 nt) DNA oligonucleotide (Fig. 2).
  • the DNA oligo contains the sequences corresponding to the sgRNAs separated by a short spacer harboring two Bbsl sites. At the 5' and 3' ends of the oligo are short sequences with homology to the U6 promoter and the sgRNA scaffold, respectively.
  • Amplification of the oligo by PCR using primers that bind to these regions generates a 148 bp dsDNA molecule that contains 40 bp homologies to the 3' end of the U6 promoter and to the 5' end of the sgRNA scaffold (Fig.2).
  • pDonor a plasmid
  • SEQ ID NO: 30 contains Bbsl sites located at nucleotide positions 716-721 and 1145-1150; sgRNA-scaffold sequence at nucleotide positions 724-805; U6 promoter sequence at nucleotide positions 890-1138.
  • the pool was amplified in a single PCR reaction and ligated the resulting product to the U6:sgRNA-scaffold fragment using Gibson reaction (Fig. 3A).
  • Linearization of the Gibson product with Bbsl resulted in the expected 461 bp band (Fig. 3B), which was gel purified and cloned into a linearized lentiviral vector (Shalem, O et al, Science, 2014, 343 :80- 84) containing a U6 promoter and a gRNA scaffold (Fig. 3A).
  • Digestion of DNA from individual bacterial colonies released the expected 1.6 kb band in 10/10 clones (Fig. 3C).
  • Example 5 Paired-gRNA lentiviral vectors for stable transduction of cells
  • lentiviral vectors harboring direct repeats are unstable, the presence of two identical human U6 (hU6) promoters in the same vector might lead to viral recombination, loss of gRNA expression, and consequently lower genome editing efficiency.
  • hU6 human U6
  • reduced editing efficiency at the 3' cut site targeting by the proximal gRNA; gRNA2 in cells transduced with a lentivirus expressing the two gRNAs from identical hU6 promoters is observed (Fig. 4B; lanes 9 and 10).
  • Genomic PCR analysis confirmed that this was due to loss of the proximal hU6-gRNA2 sequence in the proviral genome (Fig. 4C).
  • pDonor vectors were generated carrying the murine U6 (mU6) promoter, or a synthetic mouse U6 (sU6) promoter harboring regulatory sequence elements from hU6. These pDonor vectors were used to clone the gRNA pair into a recipient lentivirus containing the hU6 promoter, thus producing two new lentiviral constructs (Fig. 4A). In contrast to cells infected with lentiviruses carrying two hU6 promoters, cells infected with lentiviruses expressing gRNAs from two different promoters displayed largely intact proviruses (Fig. 4B). Accordingly editing efficiency at the two cut sites was comparable to what observed when each gRNA was individually expressed (Fig.
  • Fig. 4D shows the expression levels of the gRNAs.
  • Fig. 4D shows the desired genomic deletion.
  • Fig. 5 shows the some of the vector structure.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A method to build expression libraries expressing paired gRNAs is described. This method may be used to expand the potential applications of CRISPR-technology for functional genomics in vitro and in vivo.

Description

TITLE
METHODS AND KITS FOR GENERATING VECTORS THAT CO-EXPRESS
MULTIPLE TARGET MOLECULES
[0001] The present application claims priority to U.S. Provisional Application No.
62/114,957, filed February 11, 2015. The entirety of the aforementioned applications is incorporated herein by reference.
FIELD
[0002] The present application relates generally to methods and kits for expressing multiple target molecules from a single expression vector and, in particular, to a methods and kits for building CRISPR/Cas9 libraries expressing paired guide RNAs starting from a pool of oligonucleotides.
BACKGROUND
[0003] In the CRISPR-Cas9 system, site-specific double-stranded DNA breaks are generated by the bacterial Cas9 endonuclease coupled to a single guide RNA (gRNA) molecule containing ~20nt homology to the desired site. In eukaryotic genomes, these breaks are primarily repaired through the error-prone non-homologous end-joining (NHEJ) pathway leading to mutations at the targeted locus. Gene disruption using the CRIPSR-Cas9 system has proven highly efficient and can be used for bi-allelic targeting of multiple genes simultaneously. In addition, the simplicity of single gRNA cloning makes it suitable for the generation of pooled libraries for loss-of-function screens.
[0004] The concomitant expression of Cas9 and two gRNAs allows for a wider range of genome manipulations including the generation of chromosomal rearrangements and large genomic deletions. In addition, when combined with Cas9, the coexpression of two guides can be used to generate double-stranded breaks at target sites while minimizing damage at off-target loci. The ability to generate pooled libraries of CRISPR-Cas9 vectors expressing paired gRNA would thus greatly expand the potential applications of this technology for functional genomic screens.
SUMMARY
[0005] One aspect of the present application relates to a method for generating an expression vector capable of expression of two or more different target molecules. In some embodiments, the method comprises the steps of: (a) amplifying a target DNA sequence with a pair of primers to produce a double-stranded DNA target fragment, wherein the target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second gRNA coding sequence, a first gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA sequence and the first gRNA sequence, wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence, and (b) ligating the double-stranded DNA target fragment to a linearized donor plasmid to form a circular intermediate, wherein the linearized donor plasmid comprises a first promoter sequence and a first gRNA scaffold coding sequence, wherein the first anchoring sequence is homologous to a portion of the first promoter sequence and wherein the second anchoring sequence is homologous to a portion of the first gRNA scaffold coding sequence, wherein the double-stranded DNA target fragment is located downstream of the first promoter in the circular intermediate, and wherein the a first gRNA coding sequence is operably linked to the first gRNA scaffold coding sequence in the circular intermediate; (c) linearizing the circular intermediate at the one or more restriction enzyme sites to produce a linearized intermediate, wherein the first promoter is downstream of the first gRNA scaffold and is operably linked to the coding sequence of the second gRNA in the linearized intermediate; and (d) introducing the linearized intermediate into an expression vector comprising a second promoter and a second gRNA scaffold sequences downstream of the second promoter to form a co-expression vector comprising an expression cassette comprising (1) the first gRNA sequence operably linked to the first gRNA scaffold and is under the control of the second promoter, and (2) the second gRNA coding sequence operably linked to the second gRNA scaffold and is under the control of the first promoter.
[0006] Another aspect of the present application relates to a method for generating a pool of co-expression vectors capable of expression of two or more different RNA molecules from each co-expression vector. In some embodiments, the method comprises the steps of (a) amplifying a pool of target DNA sequences with a pair of primers to produce a pool of double- stranded DNA target fragments, wherein each target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second target-DNA-specific gRNA coding sequence, a first target-DNA-specific gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA sequence and the first gRNA sequence, wherein at least two of the target DNA sequences comprise different target-DNA-specific gRNA coding sequences, and wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence; (b) ligating the double-stranded DNA target fragments to a linearized donor plasmid to form a pool of circular intermediates, wherein the linearized donor plasmid comprises a first promoter sequence and a first gRNA scaffold coding sequence, wherein the first anchoring sequence is homologous to a portion of the first promoter sequence and wherein the second anchoring sequence is
homologous to a portion of the first gRNA scaffold coding sequence, wherein the double- stranded DNA target fragment is located downstream of the first promoter in each circular intermediate, and wherein the a first target-DNA-specific gRNA coding sequence is operably linked to the first gRNA scaffold coding sequence in each circular intermediate; (c) linearizing the pool of circular intermediates at the one or more restriction enzyme sites to produce a pool of linearized intermediates, wherein the first promoter is downstream of the first target-DNA- specific gRNA scaffold and is operably linked to the coding sequence of the second gRNA in each linearized intermediate; and (d) introducing the pool of linearized intermediates into an expression vector comprising a second promoter and a second gRNA scaffold sequences downstream of the second promoter to form a pool of co-expression vectors each comprising a co-expression cassette comprising (1) the first target-DNA-specific gRNA sequence operably linked to the first gRNA scaffold and is under the control of the second promoter, and (2) the second target-DNA-specific gRNA coding sequence operably linked to the second gRNA scaffold and is under the control of the first promoter.
[0007] Another aspect of the present invention relates to a kit for generating an expression vector capable of expression of multiple target molecules or a pool of such co- expression vectors. In some embodiments, the kit comprises a donor plasmid comprising a promoter sequence and a gRNA scaffold coding sequence; a forward primer comprising a first anchor sequence that is homologous to at least a portion of the promoter sequence; and a reverse primer comprising a second anchor sequence that is homologous to at least a portion of the gRNA scaffold coding sequence.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] The above and other objects and advantages of the application will be apparent upon consideration of the following detailed description, taken in conjunction with the accompanying figures.
[0009] Figures 1A-1B: A vector for paired-gRNA/Cas9 expression. (Fig. 1A) Schematic representation of a Cas9 expression vector containing a gRNA pair. (Fig. IB) Top, northern blot (N.B.) analysis to total RNA from cells transiently transfected with an empty vector (lane 1), vectors expressing single gRNAs (lanes 2 and 3) or a vector expressing an gRNA pair (lane 4); Bottom, PCR analysis to targeted locus showing a -350 bp band corresponding the genomic deletion only in cells transfected with the gRNA pair. [0010] Figure 2: A one-step method to clone gRNAs pairs. Overview of the paired- gRNA cloning strategy. Briefly, a 1 lOnt DNA oligo (SEQ ID NO: 1) containing the sequences of two gRNAs is amplified by PCR with a pair of primers (SEQ ID NOS: 2 and 3), to generate a dsDNA molecule (SEQ ID NO: 4) that contains two restriction sites for Bbsl as well as 40bp homologies to the U6 promoter and the gRNA scaffold. A Gibson reaction between the amplicon and a fragment containing a U6 promoter and an gRNA scaffold generates an intermediate circular molecule. This is linearized with Bbsl digestion and cloned into a Cas9 expression plasmid to generate the final construct expressing the gRNA pair.
[0011] Figures 3A-3E: Pooled cloning of gRNA pairs. Fig. 3 A is a schematic representation of the pooled cloning strategy. Each color represents a distinct gRNA pair. Fig. 3B shows gel electrophoresis of the fragments used in the Gibson ligation and of the assembled insert after linearization with Bbsl. Fig. 3C shows NotllEcoRl digestion of plasmid DNA showing correct vector assembly in 10/10 bacterial clones. Fig. 3D shows correct cloning of oligo / into a lentiviral vector. (gRNAl (SEQ ID NO: 11); gRNA2 (SEQ ID NO: 12). Fig. 3E is a pie chart showing representation of each gRNA pair in sequenced clones.
[0012] Figures 4A-4D show lentiviral vectors for paired gRNA expression. Fig. 4A is a schematic representation of the lentiviral vectors. Fig. 4B shows detection of indel formation by SURVEYOR assay. Nuc, nuclease. Fig. 4C shows analysis of proviral integrity by PCR to genomic DNA of infected cells. Diagram shows location of primers and expected size upon amplification of each provirus. Black bars indicate primer location. Bottom panel shows PCR assay to uninfected cells (lane 1) and cells infected with either an empty lentiviral vector (lane 2), a lentiviral vector carrying a single gRNA (lane 3), or one of the three lentiviral vectors carrying the gRNA pair (lanes 4-6). Fig. 4D top panel shows PCR analysis to targeted locus showing a band corresponding the genomic deletion only in cells infected with paired-lentiviral vectors. Fig. 4D bottom threenels show northern blot (N.B.) analysis to total RNA from uninfected cells, or cells infected with the indicated lentiviral constructs.
[0013] Figure 5 is schematic representation of several pDonor plasmids. The first boxes represent gRNA scaffold, the second arrowed boxes represent pol III promoters. The smaller boxes within the arrowed box represent the various regulatory motifs present in the U6 promoters (from 5' to 3' : the Octamer motif, the Proximal sequence element, and the TATA- box). Sequence present in each pDonor plasmid is shown as SEQ ID NO: 43 (pDonor_hU6) SEQ ID NO: 44 (pDonor_mU6); SEQ ID NO: 45 (pDonor_sU6). Generic sequences of the oligos encoding the gRNA pairs are shown as SEQ ID NO: 46 (01igo_hU6) and SEQ ID NO: 47 (01igo_s/mU6). [0014] Figures 6A-6D are pictures of uncropped gels. Fig. 6A shows PCR detection of genomic deletion (related to Fig IB). Fig. 6B shows PCR detection of proviral recombination (related to Fig. 4C). Fig. 6C shows surveyor assay to 5' cut site to genomic DNA of uninfected cells to cells infected with the indicated constructs (related to Fig. 4B, top panel). Fig. 6D shows surveyor assay to 3' cut site to genomic DNA of uninfected cells to cells infected with the indicated constructs (related to Fig. 4B, bottom panel).
DETAILED DESCRIPTION
[0015] One mode for carrying out the application is presented in terms of its exemplary embodiment, discussed herein. However, the application is not limited to the described embodiment and a person skilled in the art will appreciate that many other embodiments of the application are possible without deviating from the basic concept of the application, and that any such work around will also fall under scope of this application. It is envisioned that other styles and configurations of the present application can be easily incorporated into the teachings of the present application, and only one particular configuration shall be shown and described for purposes of clarity and disclosure and not by way of limitation of scope.
[0016] Headings used herein are for organizational purposes only and are not meant to be used to limit the scope of the description or the claims. As used throughout this application, the word "may" is used in a permissive sense (i.e., meaning having the potential to), rather than the mandatory sense (i.e., meaning must). The terms "a" and "an" herein do not denote a limitation of quantity, but rather denote the presence of at least one of the referenced items. Definitions
[0017] The term "CRISPR-Cas9" refers to the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Type II system is a bacterial immune system that has been modified for genome engineering. CRISPR consists of two components: a "guide" RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas9). One can change the genomic target of Cas9 by simply changing the targeting sequence present in the gRNA.
[0018] The term "Cas9" refers to CRISPR associated protein 9, which is an RNA-guided DNA endonuclease enzyme associated with the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive immunity system in Streptococcus pyogenes, among other bacteria. S. pyogenes utilizes Cas9 to memorize and later interrogate and cleave foreign DNA, such as invading bacteriophage DNA or plasmid DNA. Cas9 performs this interrogation by unwinding foreign DNA and checking whether it is homologous to the 20 basepair spacer region of the guide RNA. If the DNA substrate is homologous to the guide RNA, Cas9 cleaves the invading DNA. The exact amino acid residues within each nuclease domain that are critical for endonuclease activity are known (D10A for HNH and H840A for RuvC in S. pyogenes Cas9) and modified versions of the Cas9 enzyme containing only one active catalytic domain (called "Cas9 nickase") have been generated. Both RuvC- and HNH- nuclease domains can be rendered inactive by point mutations (D10A and H840A in SpCas9), resulting in a nuclease dead Cas9 (dCas9) molecule that cannot cleave target DNA. The dCas9 molecule can be tagged with transcriptional repressors or activators. In some embodiments, dCas9-based activators and repressors consist of dCas9 fused directly to a single transcriptional activator, e.g., VP64, or transcriptional repressors, e.g., KRAB. Other activation strategies include: co-expression of epitope-tagged dCas9 and antibody-activator effector proteins (e.g. SunTag system), dCas9 fused to several different activation domains in series (e.g. dCas9-VPR, C) or co-expression of dCas9-VP64 with a "modified scaffold" gRNA and additional RNA-binding "helper activators" (e.g. SAM activators).
[0019] S. pyogenes Cas9 (SpCas9) is a particular embodiment of CRISPR endonuclease, however, other variants of Cas9 may be used, e.g., Kleinsteiver et al., Nature, 2015 Jul
23;523(7561):481-5, have generated synthetic SpCas9-derived variants with non-NGG PAM sequences. Additional Cas9 orthologs from various species have been identified and these "non- SpCas9s" bind a variety of PAM sequences. The coding sequence for Staphylococcus aureus Cas9 (SaCas9) is— 1 kilobase shorter than SpCas9 (which is ~4kb coding sequence), allowing it to be efficiently packaged into adeno-associated virus (AAV). Similar to SpCas9, the SaCas9 endonuclease is capable of modifying target genes in vitro and in vivo. Zetsche et al, Cell, 2015 Oct 22; 163(3):759-71, describes two RNA-guided endonucleases from the Cpfl family that display cleavage activity in mammalian cells. Other species with Cas9 variants include
Treponema denticola, Streptococcus thermophiles, and Neisseria meningitides.
[0020] The term "gRNA" refers to a short synthetic RNA composed of a "scaffold" sequence necessary for Cas9-binding and a user-defined "spacer" or "targeting" sequence which defines the genomic target to be modified. The "spacer" or "targeting" sequence of a gRNA typically has a length of about 20 nucleotides (nt). The gRNA scaffold sequence is the sequence within the gRNA that is responsible for Cas9 binding; it does not include the 20bp spacer/targeting sequence that is used to guide Cas9 to target DNA. The genomic target can be any ~20 nucleotide DNA sequence, provided the sequence is unique compared to the rest of the genome, and that target is present immediately upstream of a Protospacer Adjacent Motif (PAM). The PAM sequence is absolutely necessary for target binding and the exact sequence is dependent upon the species of Cas9 (5' NGG 3' for Streptococcus pyogenes Cas9). Guide RNA design for CRISPR libraries follows the same general principles as designing a gRNA for a specific target. Target sequences must be unique compared to the rest of the genome and be located just upstream of a PAM sequence. Obviously, the exact region of the gene to be targeted may vary depending on the specific application (5' constitutively expressed exons for knock-out libraries, or the promoter region for activation and repression libraries). For some libraries, Cas9 (or Cas9 derivative) is included on the gRNA-containing plasmid; for others, they must be delivered to the cells separately.
[0021] The genomic sequence used to design gRNAs will depend upon the target gene and species and the scientific objective. To activate or repress a target gene using dCas9- activators or dCas9-repressors, gRNAs should be targeted to the promoter driving expression of the gene of interest. For genetic knock-outs, gRNAs commonly target 5' constitutively expressed exons, which reduces the chances that the targeted region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since frameshift mutations here will increase the likelihood that a nonfunctional protein product is produced. Alternatively, gRNAs can be designed to target exons that code for known essential protein domains. For gene editing experiments using homology directed repair, it is essential that the target sequence be close to the location of the desired edit. Cleavage efficiency may increase or decrease depending upon the specific nucleotides within the selected target sequence. For example, gRNA targeting sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than gRNAs containing a C nucleotide at the same position. The ability to semi-automatically design and synthesize gRNAs to mutate, activate, or repress almost any genomic locus makes the CRISPR/Cas9 suitable for large-scale forward genetic screening.
[0022] The term "ligation" refers to the joining of two nucleic acid fragments through the action of an enzyme. In some embodiments, ligation involves the use of restriction enzymes to generate a wide variety of ends in DNA digested by the restriction enzyme. In certain embodiments, a Type II restriction enzyme is used. In a particular embodiment, the restriction enzyme used is Bbsl. One of ordinary skill will understand that other restriction enzymes, such as EcoRI, Smal or EcoRV, may be used to digest DNA prior to ligation. In certain
embodiments, topoisomerase-mediate ligation may be performed. In other embodiments, the Gateway cloning system may be used. In a preferred embodiment, a Gibson ligation may be used. One of ordinary skill will understand that any homology -based ligation technique may be used and that the ligation technique is not limiting on the application.
[0023] As used herein, the term "promoter" is to be taken in its broadest context and includes transcriptional regulatory elements (TREs) from genomic genes or chimeric TREs therefrom, including the TATA box or initiator element for accurate transcription initiation, with or without additional TREs (i.e., upstream activating sequences, transcription factor binding sites, enhancers, and silencers) which regulate activation or repression of genes operably linked thereto in response to developmental and/or external stimuli, and trans-acting regulatory proteins or nucleic acids. A promoter may contain a genomic fragment or it may contain a chimera of one or more TREs combined together. In certain embodiments, RNA pol III promoters are used. In certain embodiments, a human U6 promoter is used. In other embodiments, an HI promoter is used. In some embodiments, both U6 and HI promoters are used. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41 :521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter. In some embodiments, a vector comprises one or more pol III promoter {e.g., 1, 2, 3, 4, 5, or more pol I promoters), one or more pol II promoters {e.g., 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters {e.g., 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof.
[0024] A nucleic acid sequence is "operably linked" to another nucleic acid sequence when the former is placed into a functional relationship with the latter. For example, a DNA for a presequence or signal peptide is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a signal peptide, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers may be used in accordance with conventional practice.
[0025] The term "downstream," as used herein, refers to a nucleotide sequence that is located 3' to reference nucleotide sequence. In particular, downstream nucleotide sequences generally relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.
[0026] The term "upstream," as used herein, refers to a nucleotide sequence that is located 5' to reference nucleotide sequence. In particular, upstream nucleotide sequences generally relate to sequences that are located on the 5' side of a coding sequence or starting point of transcription. For example, most promoters are located upstream of the start site of transcription.
[0027] The terms "restriction endonuclease" and "restriction enzyme," as used herein, refer to an enzyme that binds and cuts within a specific nucleotide sequence within double stranded DNA. [0028] The term "pool" as used throughout the specification is to be understood to mean a collection of two or more different molecules.
[0029] The term "DNA amplification" refers to an artificial increase in the number of copies of a particular DNA fragment through replication of the fragment. In a preferred embodiment, DNA amplification is performed using the polymerase chain reaction. One of ordinary skill will understand that the choice of DNA amplification technique is not limiting on the application.
[0030] The term "expression vector" refers to any genetic expression systems. For example, recombinant expression vectors can comprise a nucleic acid in a form suitable for expression of the nucleic acid in a host cell, as well as one or more regulatory elements, which are operatively-linked to the nucleic acid sequence to be expressed, e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell. Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas), or particular cell types (e.g., lymphocytes).
Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc. A vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).
[0031] The term "viral cloning vectors" refers to vectors that can be used to generate recombinant viruses. A viral cloning vector typically contains certain sequences from the corresponding virus. Viral cloning vectors include vectors created from: retroviruses;
adenoviruses; adenoviral/retroviral chimeras; adeno- associated viruses; herpes simplex virus I or II; parvovirus; reticuloendotheliosis virus; poliovirus, papillomavirus, vaccinia virus, lentivirus, as well as hybrid or chimeric vectors incorporating favorable aspects of two or more viruses.
[0032] The term "Cas9 vector," as used herein, refers to an expression vector that is capable of expression a Cas9 gene. In some embodiments , the Cas9 vector comprises a Cas9 gene operably linked to a promoter. The promoter can be constitutive (CMV, EF1 alpha, CBh) or inducible (e.g., Tet-on or Tet-off).
Method of Generating a Co-expression Vector or a Pool of Co-expression Vectors
[0033] One aspect of the present application relates to a method for generating a pool of co-expression vectors capable of expression of two or more different target molecules from each co-expression vector. In some embodiments, the method comprises the steps of (a) amplifying a pool of target DNA sequences with a pair of primers to produce a pool of double-stranded DNA target fragments, wherein each target DNA sequence comprises from the 5' end to the 3 ' end, a first anchor region, a second target molecule coding sequence, a first target molecule coding sequence, a second anchor region, and one or more restriction enzyme sites between the second target molecule coding sequence and the first target molecule coding sequence, wherein at least two of the target DNA sequences in the pool of target DNA sequences comprise different target molecule coding sequences, and wherein the pair of primers consists of a forward primer comprising a forward anchor sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence; (b) ligating the pool of double-stranded DNA target fragments to a linearized donor plasmid to form a pool of circular intermediates, wherein the linearized donor plasmid comprises a first promoter sequence, wherein the first anchoring sequence has homology to a portion of the first promoter sequence and wherein the second anchoring sequence is homologous to a different portion of the donor plasmid sequence that does not overlap with the portion of the first promoter sequence that is homologous to the first anchoring sequence, wherein the double-stranded DNA target fragment is located downstream of the first promoter in each circular intermediate; (c) linearizing the pool of circular intermediates at the one or more restriction enzyme sites to produce a pool of linearized intermediates, wherein the first promoter is operably linked to the coding sequence of the second target molecule in each linearized intermediate; and (d) introducing the pool of linearized intermediates into an expression vector comprising a second promoter to form a pool of co-expression vectors each comprising a co- expression cassette comprising (1) the first target molecule coding sequence operably linked to the second promoter, and (2) the second target molecule coding sequence operably linked to the first promoter. In some embodiments, the second anchoring sequence is homologous to a different portion of the donor plasmid sequence that does not overlap with the first promoter sequence. [0034] The method provides simple and inexpensive procedure that allows rapid and efficient cloning of two or more target sequences into an expression vector. The pool of target DNA sequences is amplified with a single pair of primers.
[0035] In some embodiments, the target molecules are gRNAs. In other embodiments, the target molecules are shRNAs, or any other short non-polyadenylated RNA molecule. One of ordinary skill will understand that the pDonor sequence will be selected based on the type of target molecules.
[0036] The pool of target DNA sequences may be generated using methods well known in the art. In some embodiments, the pool of target DNA sequences are generated by PCR amplification of single stranded DNA oligonucleotides either synthesized individually and mixed prior to PCR or synthesized in a pool as done in on-chip oligonucleotide synthesis and analogous methods. In other embodiments, the target DNA sequences are generated as double stranded DNA molecules synthesized individually or in a pool.
[0037] In particular embodiments, a pooled library may be obtained by ordering a gene fragment library, which consists of synthetically generated nucleotides varying in length that contain defined regions of consecutive variable bases {See, e.g., Gibson D, Young L, et al.
(2009) Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature
Methods, 6(5):343-345). In other particular embodiments, DNA oligo pools may be ordered that are a mixture of large numbers of different oligos in fmole to nmole range. These DNA oligo pools can be synthesized according to desired specifications.
[0038] In some embodiments, each target DNA sequence further comprises a spacer sequence between the second target molecule coding sequence and the first target molecule coding sequence. In some embodiments, the one or more restriction sites are located within the spacer sequence. In some embodiments, the spacer sequence has a length of 1-100 nt, 5-60 nt, 10-50 nt, 20-40 nt or 20-30 nt.
[0039] In some embodiments, each of the first anchor region and the second anchor region has a length of 10-100 nt, 10-60 nt, 10-50 nt, 10-40 nt, 10-30 nt, 20-40 nt or 20-30 nt.
[0040] In some embodiments, the expression vector is a Cas9 vector comprising a Cas9 gene under the control of a third promoter
[0041] In some embodiments, the target molecules are gRNAs, the donor plasmid further comprises a first gRNA scaffold coding sequence, and the expression plasmid further comprises a second gRNA scaffold coding sequence. In some embodiments, the target molecules are gRNAs and the target molecule coding sequences in the target DNA sequence comprise the "spacer" or "targeting" sequence of the gRNAs, or a portion of the "spacer" or "targeting" sequence of the gRNAs. In some embodiments, the target molecule coding sequences in the target DNA sequence consist of the "spacer" or "targeting" sequence of the gRNAs, or a portion of the "spacer" or "targeting" sequence of the gRNAs.
[0042] In some embodiments, the expression vector is a viral cloning vector that allows for the production of a recombinant virus derived from an adeno-associated virus (AAV), adenovirus, herpesvirus, vaccinia virus, poliovirus, poxvirus, a retrovirus (including a lentivirus, such as HIV-1 and HIV-2), Sindbis and other RNA viruses, alphavirus, astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, togaviruses and the like. Methods for generating recombinant viruses using the co-expression vector of the present application is well known in the art. For lentiviral transduction vectors, Cas9 and gRNA can be present in a single lentiviral transfer vector or separate transfer vectors. Packaging and envelope plasmids provide the necessary components to make lentiviral particles. For AAV transduction vectors, CRISPR elements are inserted into an AAV transfer vector and used to generate AAV particles.
[0043] In other embodiments, the method further comprises the step of (e) generating an expression library from the a pool of co-expression vectors in step (d). One of ordinary skill will understand that the particular form of expression library is not limiting.
[0044] The one or more restriction sites can be the recognition site of any restriction endonucleases. In some embodiments, the one or more restriction sites comprising one or two Bbs I sites.
[0045] The first promoter and the second promoter can be any promoter capable of controlling expression of the operably linker target molecule coding sequence. In some embodiments, the first promoter and the second promoter are promoters for RNA polymerases, such as U6 and HI promoters. In some embodiments, the first promoter is different from the second promoter. In some embodiments, the first promoter is the same as the second promoter. In some embodiments, the first promoter and/or the second promoter is an inducible promoter. Examples of inducible promoters include, but are not limited to, promoters that are specifically activated either by light, temperature or specific chemical inducing agents. In some
embodiments, inducible expression systems regulated by administration of tetracycline or dexamethasone, for example, may be used
[0046] In some embodiment, the method comprises the steps of (a) amplifying a target DNA sequence with a pair of primers to produce a double-stranded DNA target fragment, wherein the target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second gRNA coding sequence, a first gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA coding sequence and the first gRNA coding sequence, wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence, and (b) ligating the double-stranded DNA target fragment to a linearized donor plasmid to form a circular intermediate, wherein the linearized donor plasmid comprises a first promoter sequence and a first gRNA scaffold coding sequence, wherein the first anchoring sequence is homologous to a portion of the first promoter sequence and wherein the second anchoring sequence is homologous to a portion of the first gRNA scaffold coding sequence, wherein the double- stranded DNA target fragment is located downstream of the first promoter in the circular intermediate, and wherein the a first gRNA coding sequence is operably linked to the first gRNA scaffold coding sequence in the circular intermediate; (c) linearizing the circular intermediate at the one or more restriction enzyme sites to produce a linearized intermediate, wherein the first promoter is downstream of the first gRNA scaffold coding sequence and is operably linked to the second gRNA coding sequence in the linearized intermediate; and (d) introducing the linearized intermediate into an expression vector comprising a second promoter and a second gRNA scaffold sequences downstream of the second promoter to form a co- expression vector comprising an expression cassette comprising (1) the first gRNA coding sequence operably linked to the first gRNA scaffold and is under the control of the second promoter, and (2) the second gRNA coding sequence operably linked to the second gRNA scaffold coding sequence and is under the control of the first promoter
[0047] In some embodiments, the first and second gRNA coding sequences each encodes the "spacer" or "targeting" sequence of a gRNA molecule.
[0048] In other embodiments, the method comprises the steps of (a) amplifying a pool of target DNA sequences with a pair of primers to produce a pool of double-stranded DNA target fragments, wherein each target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second target-DNA-specific gRNA coding sequence, a first target-DNA- specific gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA sequence and the first gRNA sequence, wherein at least two of the target DNA sequences comprise different target-DNA-specific gRNA coding sequences, and wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence; (b) ligating the double-stranded DNA target fragments to a linearized donor plasmid to form a pool of circular intermediates, wherein the linearized donor plasmid comprises a first promoter sequence and a first gRNA scaffold coding sequence, wherein the first anchoring sequence is homologous to a portion of the first promoter sequence and wherein the second anchoring sequence is homologous to a portion of the first gRNA scaffold coding sequence, wherein the double-stranded DNA target fragment is located downstream of the first promoter in each circular intermediate, and wherein the a first target-DNA-specific gRNA coding sequence is operably linked to the first gRNA scaffold coding sequence in each circular intermediate; (c) linearizing the pool of circular intermediates at the one or more restriction enzyme sites to produce a pool of linearized intermediates, wherein the first promoter is downstream of the first target-DNA-specific gRNA scaffold and is operably linked to the coding sequence of the second gRNA in each linearized intermediate; and (d) introducing the pool of linearized intermediates into an expression vector comprising a second promoter and a second gRNA scaffold sequences downstream of the second promoter to form a pool of co-expression vectors each comprising a co-expression cassette comprising (1) the first target-DNA-specific gRNA sequence operably linked to the first gRNA scaffold and is under the control of the second promoter, and (2) the second target-DNA-specific gRNA coding sequence operably linked to the second gRNA scaffold and is under the control of the first promoter.
[0049] In some embodiments, the pool of double-stranded DNA donor fragments are generated by PCR amplification of single stranded DNA oligonucleotides either synthesized individually and mixed prior to PCR or synthesized in a pool as done in on-chip oligonucleotide synthesis and analogous methods. In other embodiments the target DNA sequences are generated as double stranded DNA molecules synthesized individually or in a pool. In some embodiment, a single pair of primers is used to amplify the pool of target DNA sequences.
[0050] In some embodiments, the target-DNA-specific gRNA coding sequences in the target DNA sequence comprise the "spacer" or "targeting" sequence of the gRNAs, or a portion of the "spacer" or "targeting" sequence of the gRNAs. In some embodiments, the target-DNA- specific gRNA coding sequence in the target DNA sequence consist of the "spacer" or
"targeting" sequence of the gRNAs, or a portion of the "spacer" or "targeting" sequence of the gRNAs.
[0051] In some embodiments, the expression vector is a viral cloning vector that allows for the production of a recombinant virus derived from an adeno-associated virus (AAV), adenovirus, herpesvirus, vaccinia virus, poliovirus, poxvirus, a retrovirus (including a lentivirus, such as HIV-1 and HIV-2), Sindbis and other RNA viruses, alphavirus, astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, togaviruses and the like. For lentiviral transduction vectors, Cas9 and gRNA can be present in a single lentiviral transfer vector or separate transfer vectors. Packaging and envelope plasmids provide the necessary components to make lentiviral particles. For AAV transduction vectors, CRISPR elements are inserted into an AAV transfer vector and used to generate AAV particles.
[0052] In some embodiments, the pool of co-expression vectors produced in Step (d) are plasmids and are used in in vitro transcription reactions to generate mature Cas9 mRNA and gRNA, then delivered to target cells {i.e. microinjection or electroporation). In some embodiments, purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA complex and delivered to cells using cationic lipids. In some embodiments, the expression vector further comprises a reporter gene {e.g., GFP) to identify and enrich positive cells, or selection marker to generate stable cell lines.
[0053] The linearized expression vector can be any expression vector that carries a pol III promoter. In some embodiments, the linearized expression vector is a virus vector. In some embodiments, the linearized expression vector is a CRISPR-Cas9 expression vector.
[0054] Another aspect of the present application relates to a pooled expression library generated with the method described above. In some embodiments, the library comprises a pool of CRISPR-Cas9 vectors each expressing a pair of sgRNA.
Kit
[0055] Another aspect of the present application relates to a kit for generating an expression vector capable of expression of multiple target molecules or a pool of such co- expression vectors. In some embodiments, the kit comprises a donor plasmid comprising a promoter sequence; a forward primer comprising a first anchor sequence that is homologous to at least a portion of the promoter sequence; and a reverse primer comprising a second anchor sequence that is homologous to a portion of the donor plasmid sequence that does not overlap with the portion of the promoter sequence that is homologous to the first anchor sequence. In some embodiments, the second anchor sequence is homologous to a portion of the donor plasmid sequence that does not overlap promoter sequence.
[0056] In some embodiments, the kit comprises a donor plasmid comprising a promoter sequence and a gRNA scaffold coding sequence; a forward primer comprising a first anchor sequence that is homologous to at least a portion of the promoter sequence; and a reverse primer comprising a second anchor sequence that is homologous to at least a portion of the gRNA scaffold coding sequence. The kit may also comprise a set of instructions, listing of ingredients and other informational materials related to the conduct of the method.
[0057] In certain embodiments, the kit comprising a forward primer that has homology to a DNA transcription promoter sequence, a reverse primer that has homology to a gRNA scaffold sequence, reagents for performance of a PCR amplification using the forward and reverse primers, restriction enzymes for digestion of DNA, and reagents for performance of ligation. In a particular embodiment, the kit comprises reagents for performance of a Gibson ligation.
[0058] The following examples are intended to be illustrative of a preferred embodiment of the present application, and are not intended to be limiting in any way. The examples describe certain embodiments in which a step-by-step protocol for the cloning of paired gRNA vectors is performed. This protocol can be used with a variety of CRISPR/Cas9 vectors, provided their linearization generates ends compatible with those in the final insert. The choice of pol III promoter under which to express the distal gRNA will depend on the user and the final vector of choice. This will determine the choice of oligo, PCR amplification primers and pDonor vector.
EXAMPLES
Example 1: Methods and materials
DNA Constructs
[0059] The pDonor plasmid was generated by cloning a 435 bp fragment containing two Bbsl restriction sites flanking an sgRNA-scaffold sequence and a U6 promoter into an EcoRV- digested pBluescript KS+ vector (SEQ ID NO: 31).
[0060] Other pDonor plasmids were generated by cloning the Donor fragments into either an EcoRV-digested pBluescript KS+ vector (pDonor_hU6) or into the Topo Blunt II plasmid (Invitrogen) (Fig. 5). The sU6 promoter was generated by replacing the regulatory elements of mU6 for those of hU6 (i.e., the Octamer motif, the Proximal sequence element, and the TATA-box) (Fig. 5A). The sequences contained in each of the pDonors are provided in Fig. 5, along with the sequence of the DNA oligos used for cloning gRNA pairs under the various promoters.
Paired sgRNA cloning
[0061] Oligonucleotides were mixed at equimolar concentrations and amplified with phusion polymerase (New England Biolabs) using primers that add homology regions to the 3' region of the U6 promoter (forward primer,
TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAAC (SEQ ID NO: 2) and to the 5' region of the sgRNA scaffold (reverse primer,
GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (SEQ ID NO: 3). The gel- purified 148 bp amplicon was ligated to the 415 bp Donor fragment— generated by Bbsl digestion of the pDonor plasmid— in a 3 : 1 molar ratio, using the Gibson Assembly Master Mix (New England Biolabs; lh at 50°C). The Gibson reaction was treated with Plasmid Safe exonuclease (Epicenter) for lh at 37°C to remove unligated fragments, column purified (QIAquick PCR purification kit; Qiagen) and digested with Bbsl at 37°C for 3h. The linearized 461 bp fragment was gel purified and cloned into BsmBI-digested lentiCRISPR vector4 (Addgene plasmid 49535). For 10 bacterial clones, correct assembly was confirmed by digestion of plasmid DNA with Notl and EcoRI enzymes. Sequencing of vectors was done using forward (GGCAAGTTTGTGGAATTGGT (SEQ ID NO: 5) and reverse
(TCTCTAGGCACCGGTTCAAT (SEQ ID NO: 6) primers.
[0062] For each oligo, prepare the following PCR reaction in triplicate:
Figure imgf000018_0001
[0063] Prepare an additional reaction with water as a control. PCR conditions are annealing at 68°C with extension for 30 seconds at 72°C for 25 cycles. PCR reactions are then run after completion on 2.5% gel and bands are gel extracted (approx. 148 bp).
[0064] Donor fragment is prepared by digesting lOug of pDonor_sU6 with Bbsl. Gel extraction is performed to obtain a 415bp band.
[0065] For insert assembly, a Gibson reaction is set up for each oligo as follows:
Donor fragment 405ng
Oligo amplicon 432ng
2xGibson MM 30 ul
H20 to 60 ul
[0066] The Gibson reaction is performed by incubating at 50°C for lh. If a pooled library is being created a nuclease digestion is then added to each Gibson reaction as follows:
1 Ox Plasmid Safe Buffer 9 ul
ATP (25mM) 9 ul
Plasmid Safe nuclease 3 ul
H20 9 ul
[0067] The nuclease digestion occurs at 37°C for lh.
[0068] For PCR clean up and digestion reactions may be carried out with Qiagen' s PCR clean up kit. A digestion with Bbsl is carried out as follows:
DNA 50ul
10x BSA (lmg/ml) lOul
1 Ox Buffer lOul
Bbsl 3ul
H20 27ul [0069] The Bbsl digestion occurs at 37°C for 3h. Digestions are then run after completion on 2.5% gel and bands are gel extracted (approx. 480 bp). After gel extraction the insert may then be visualized by running on another gel.
[0070] For vector preparation, digest 5-10ug of your vector of choice, e.g.,
lentiCRISPR_v2 (addgene #52961 ; BsmBI); px330 (addgene # 42230 ; Bbsl). Add l-2ul TSAP for lh to reduce background from partially digested molecules. Gel extraction is performed on the top band, which corresponds to vector backbone. For cloning, set up ligations containing 50ng of vector and 6-7 ng of insert (molar ratio 1 :3), include a control ligation with water.
Transform bacteria with 2.5ul of ligation and select. Pick colonies the next day and check for positive clones by digestion (e.g., Notl/Xhol digestion for lentiCRISPR, which yields 1.8kb in positive clones. Double check if the enzymes cut within the sgRNAs). Sequence with forward (e.g., lentiCRISPR fwd; GGCAAGTTTGTGGAATTGGT (SEQ ID NO: 5) and reverse primers (e.g., lentiCRISPR rev; TCTCTAGGCACCGGTTCAAT (SEQ ID NO: 6).
[0071] Cloning of the paired lentivirus vectors carrying distinct pol III promoters was done as described above, but we used modified oligos and primers (Fig. 5B and Table 1). A list of all primer sequences and primer pairs (including corresponding amplicon sizes) used throughout this study is provided in Tables 1 and 2, respectively.
Table 1
Figure imgf000020_0001
Table 2
Figure imgf000020_0002
Cell Culture
[0072] After NIH3T3 cells were cultured at 37°C (5% C02) in DME-HG supplemented with 10% FCS, L-glutamine (2mM), penicillin (lOOU/ml) and streptomycin (lOOug/ml). One day after seeding (1 x 106 cells/well; 6-well-plate), cells were transfected with 4 μg of plasmid DNA, using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. Cells were collected either 48h or five days after transfection to detect the expression of the sgRNAs or the generation of genomic deletions respectively.
[0073] Cells were cultured at 37°C (5% C02) in DME-HG supplemented with 10% FCS, L-glutamine (2mM), penicillin (lOOU/ml), and streptomycin (100 μ^ηύ). One day after seeding (1 x 106 cells per /well; 6-well-plate), cells were transfected with 4 μg of plasmid DNA using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. NIH3T3 cells (ATCC; #CRL-1658) were collected either 48h or five days after transfection to detect the expression of the gRNAs or the generation of genomic editing, respectively. For cell infection, 293T cells (ATCC; # CRL-3216) were transfected with lentiviral constructs together with ecotropic packaging plasmids using the protocol described above. Media containing viruses were collected 48h after transfection and used to infect NIH3T3 cells. Infected cells were selected with puromycin (2 μg/ml) for 3 days and then collected for further analysis. Analysis of proviral integrity was done by PCR using primers F2 and R2 (Fig. 6B). In cells displaying detectable levels of proviral recombination the amplicon corresponding to the recombined viral genome was cloned into Topo Blunt II (Invitrogen) and 6 clones of the resulting bacterial clones sequenced.
Northern blot analysis and detection of genomic deletions
[0074] To detect sgRNA expression, transfected cells were collected in TRIZOL (Invitrogen) and total RNA isolated according to manufacturers' protocols. For each sample, 10 μg of RNA were resolved in a 15% Urea-PAGE gel and blotted onto a Hybond-N+ nylon membrane (GE Healthcare). Membranes were UV-cross-linked and hybridized overnight with 32P -labeled probes against the 5' region of each sgRNA (sgRNAl probe,
TTGGACGCCCTCGCAGTGGC (SEQ ID NO: 7); sgRNA2 probe,
CCTGTTCGGCACACCTGCTG (SEQ ID NO: 8)) and against mU6 as a loading control (GCAGGGGCCATGCTAATCTTCTCTGTATCG) (SEQ ID NO: 42).
[0075] For detection of genomic deletions, cells were collected in lysis buffer (100 mM Tris-HCl pH8.5, 200 mM NaCl, 5 mM EDTA, 0.2% SDS and 100 ng/ml proteinase K) and incubated at 55°C for 4h. Genomic DNA was extracted with phenol-chloroform followed by ethanol precipitation and amplified by PCR with Phusion polymerase (New England Biolabs) using primers that flank the sgRNA target sites (forward primer,
AAGTTCGAGGCCATCTCTGA (SEQ ID NO: 9); reverse primer,
CAGGTGAAGTCGCTCCCTAC (SEQ ID NO: 10), which leads to the amplification of a ~lkb band in cells carrying a wild-type locus, and a 340 bp band in cells carrying the deletion (Fig. 6A). Sequencing of the genomic deletion was done after cloning the corresponding amplicon into Topo Blunt II vector (Invitrogen). For the detection of indel formation DNA was amplified with primers that flank the cut sites (5 'cut with primers F3/R4; 3' cut with primers F4/R3) followed by generation of DNA heteroduplexes and DNA digestion with the mismatch-sensitive SURVEYOR nuclease (Transgenomic) according to manufacturer's instructions. Digestion fragments were resolved on a 2.5% agarose gel (Figs. 6C, 6D). Example 2: A single vector for co-delivery of Cas9 and paired gRNAs
[0076] Pooled cloning of gRNA pairs would require both guides to be cloned into a single vector. A Cas9 expression plasmid containing two distinct U6 promoters followed by unique cloning sites and a gRNA-scaffold sequence 18 for its ability to efficiently edit an eukaryotic genome was used. Two guide RNAs targeting two sites 760 bp apart on the mouse genome were designed and cloned downstream of the two separate U6 promoters (Fig. 1A). Northern blot analysis showed that this p211asmid configuration leads to expression of the two guides at approximately equimolar ratios (Fig. IB). In addition, genomic deletion in cells transfected with the gRNA pair was detected, but not in cells transfected with individual gRNAs (Fig. IB). These data, show that tandem gRNA expression from a single vector can be used to engineer chromosomal rearrangements in vitro and in vivo (Maddalo D et al, In vivo
engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system, Nature. (2014) 516 (7531):423-7), demonstrate that a single plasmid expressing Cas9 and two guide RNAs can be used for genome editing.
Example 3: A one-step cloning method for paired-gRNA vectors
[0077] For the initial tests described above, the two sgRNA sequences were cloned sequentially in the recipient vector, a strategy that is incompatible with the generation of medium or large pooled libraries. To overcome this limitation, a method was devised to simultaneously clone two guide RNAs from a short (110 nt) DNA oligonucleotide (Fig. 2). The DNA oligo contains the sequences corresponding to the sgRNAs separated by a short spacer harboring two Bbsl sites. At the 5' and 3' ends of the oligo are short sequences with homology to the U6 promoter and the sgRNA scaffold, respectively. Amplification of the oligo by PCR using primers that bind to these regions generates a 148 bp dsDNA molecule that contains 40 bp homologies to the 3' end of the U6 promoter and to the 5' end of the sgRNA scaffold (Fig.2).
[0078] In addition, a plasmid (pDonor) was generated whose digestion with Bbsl yields a 415 bp fragment consisting of an sgRNA scaffold and a U6 promoter (Fig.2; Fig. 5). The complete sequence of pDonor is shown in SEQ ID NO: 30, which contains Bbsl sites located at nucleotide positions 716-721 and 1145-1150; sgRNA-scaffold sequence at nucleotide positions 724-805; U6 promoter sequence at nucleotide positions 890-1138. The presence of overlapping sequences at both ends of the Donor fragment and of the PCR product allows for their assembly into an intermediate circular molecule using the Gibson reaction (Gibson DG et al., Nature methods, 2009, 6:343-345). Digestion of this circular intermediate with Bbsl produces a linear fragment with two distinct 5' overhangs allowing for directional cloning into a variety of Cas9 expression vectors, such as those described in Shalem, O et al, Science, 2014, 343 :80-84; Cong, L et al, Science, 2013, 339:819-823; Ran, FA et al, Nature protocols, 2013, 8:2281-2308; and Sanjana NE et al., Nature methods, 2014, 11 :783-784. This generates a final plasmid in which two distinct sgRNAs are cloned downstream of separate U6 promoters (Fig.lA; Fig. 2).
Example 4: Pooled cloning of gRNA pairs
[0079] To test whether this strategy was suitable for cloning pools of sgRNA pairs nine DNA oligos were designed encoding 18 different guides (A-I; see Table 3 (DNA oligos used for the pooled cloning of paired-gRNA vectors) and pooled them together at equimolar
concentrations. The pool was amplified in a single PCR reaction and ligated the resulting product to the U6:sgRNA-scaffold fragment using Gibson reaction (Fig. 3A). Linearization of the Gibson product with Bbsl resulted in the expected 461 bp band (Fig. 3B), which was gel purified and cloned into a linearized lentiviral vector (Shalem, O et al, Science, 2014, 343 :80- 84) containing a U6 promoter and a gRNA scaffold (Fig. 3A). Digestion of DNA from individual bacterial colonies released the expected 1.6 kb band in 10/10 clones (Fig. 3C). To determine the frequency at which individual oligos were correctly cloned, plasmid DNA was sequenced from 90 bacterial colonies. Although 10% of clones contained chimeric inserts, probably generated at the Gibson step (data not shown), each of the remaining clones contained one of the nine gRNA pairs correctly assembled (Fig. 3D). Importantly, each pair was represented at approximately equal frequency (min=5, max=13, average=8.8; Fig. 3E). These results show that the method described here can be used for pooled cloning of multiple gRNA pairs.
Table 3
Figure imgf000024_0001
[0080] These results show that the method described here can be used for pooled cloning of multiple sgRNA pairs. The small size of the oligos makes them compatible with On-chip' oligonucleotide synthesis (Cleary, MA et al., Nature methods, 2004, 1 :241-248), enabling the generation of large pooled libraries in a fast and cost-effective manner. In addition to providing a simple method to generate Cas9 nickase-based pooled libraries, the ability to assemble large pools of plasmids expressing two distinct guides extends the use of CosP-based screenings to a wider range of biological questions. It allows for instance the generation of deletion libraries against long-noncoding RNA genes, whose function is unlikely to be compromised by the short insertions/deletions introduced by conventional single guide CRISPR libraries. It also allows the generation of pooled libraries to systematically delete chromosomal regions recurrently lost in human cancers to query their functional relevance.
Example 5: Paired-gRNA lentiviral vectors for stable transduction of cells
[0081] Since lentiviral vectors harboring direct repeats are unstable, the presence of two identical human U6 (hU6) promoters in the same vector might lead to viral recombination, loss of gRNA expression, and consequently lower genome editing efficiency. For example, reduced editing efficiency at the 3' cut site (targeted by the proximal gRNA; gRNA2) in cells transduced with a lentivirus expressing the two gRNAs from identical hU6 promoters is observed (Fig. 4B; lanes 9 and 10). Genomic PCR analysis confirmed that this was due to loss of the proximal hU6-gRNA2 sequence in the proviral genome (Fig. 4C).
[0082] Therefore, two additional pDonor vectors were generated carrying the murine U6 (mU6) promoter, or a synthetic mouse U6 (sU6) promoter harboring regulatory sequence elements from hU6. These pDonor vectors were used to clone the gRNA pair into a recipient lentivirus containing the hU6 promoter, thus producing two new lentiviral constructs (Fig. 4A). In contrast to cells infected with lentiviruses carrying two hU6 promoters, cells infected with lentiviruses expressing gRNAs from two different promoters displayed largely intact proviruses (Fig. 4B). Accordingly editing efficiency at the two cut sites was comparable to what observed when each gRNA was individually expressed (Fig. 4B), as were the expression levels of the gRNAs (Fig. 4D). Finally, the desired genomic deletion was readily detectable in these cells (Fig. 4D and Fig. 6A-6D). Fig. 5 shows the some of the vector structure. These results demonstrate that the use of two different promoters prevents lentiviral recombination and allows simultaneous editing at two sites. The series of pDonor plasmids generated according to the method of the present application can therefore be used to rapidly build paired gRNA libraries in a variety of currently available vectors.
[0083] The foregoing descriptions of specific embodiments of the present application have been presented for purposes of illustration and description. They are not intended to be exhaustive or to limit the application and method of use to the precise forms disclosed.
Obviously many modifications and variations are possible in light of the above teaching. It is understood that various omissions or substitutions of equivalents are contemplated as circumstance may suggest or render expedient, but is intended to cover the application or implementation without departing from the spirit or scope of the claims of the present application. All the references cited herein are incorporated in their entirety by reference.

Claims

1. A method for generating a co-expression vector capable of expression of two or more different RNA molecules, comprising:
(a) amplifying a target DNA sequence with a pair of primers to produce a double- stranded DNA target fragment,
wherein the target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second gRNA coding sequence, a first gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second gRNA coding sequence and the first gRNA coding sequence,
wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence, and
(b) ligating the double-stranded DNA target fragment to a linearized donor plasmid to form a circular intermediate,
wherein the linearized donor plasmid comprises a first promoter sequence and a first gRNA scaffold coding sequence,
wherein the first anchoring sequence is homologous to a portion of the first promoter sequence and wherein the second anchoring sequence is homologous to a portion of the first gRNA scaffold coding sequence,
wherein the double-stranded DNA target fragment is located downstream of the first promoter in the circular intermediate, and
wherein the a first gRNA coding sequence is operably linked to the first gRNA scaffold coding sequence in the circular intermediate;
(c) linearizing the circular intermediate at the one or more restriction enzyme sites to produce a linearized intermediate, wherein the first promoter is downstream of the first gRNA scaffold coding sequence and is operably linked to the second gRNA coding sequence in the linearized intermediate; and
(d) introducing the linearized intermediate into an expression vector comprising a second promoter and a second gRNA scaffold sequences downstream of the second promoter to form a co-expression vector comprising an expression cassette comprising (1) the first gRNA coding sequence operably linked to the first gRNA scaffold and is under the control of the second promoter, and (2) the second gRNA coding sequence operably linked to the second gRNA scaffold coding sequence and is under the control of the first promoter.
2. The method of Claim 1, wherein the target DNA sequence further comprises a spacer sequence between the second gRNA coding sequence and the first gRNA coding sequence and wherein the one or more restriction enzyme sites are located within the spacer sequence.
3. The method of Claim 1, wherein the expression vector further comprises a Cas9 gene under the control of a third promoter.
4. The method of Claim 1, further comprising the step of:
(e) generating a recombinant virus comprising the co-expression cassette.
5. The method of Claim 4, wherein the recombinant virus is selected from the group consisting of recombinant retroviruses, recombinant lentiviruses, recombinant adenoviruses, recombinant adeno-associated viruses, recombinant herpes viruses, and recombinant vaccinia viruses.
6. The method of Claim 1, wherein the double-stranded DNA target fragment contains a 20-40 base pair overlap on each end with the linearized donor plasmid and is ligated to the linearized donor plasmid by Gibson ligation and wherein the first promoter is U6 promoter.
7. A method for generating a pool of co-expression vectors capable of expression of two or more different RNA molecules from each co-expression vector, comprising:
(a) amplifying a pool of target DNA sequences with a pair of primers to produce a pool of double-stranded DNA target fragments,
wherein each target DNA sequence comprises from the 5' end to the 3' end, a first anchor region, a second target-DNA-specific gRNA coding sequence, a first target-DNA- specific gRNA coding sequence, a second anchor region, and one or more restriction enzyme sites between the second target-DNA-specific gRNA coding sequence and the first target-DNA- specific gRNA coding sequence, wherein at least two of the target DNA sequences comprise different target-DNA-specific gRNA coding sequences, and
wherein the pair of primers consists of a forward primer comprising a forward sequence that is homologous to at least a portion of the first anchor region of the target DNA sequence, and a reverse primer comprising a reverse anchor sequence that is homologous to at least a portion of the second anchor region of the target DNA sequence, and
(b) ligating the double-stranded DNA target fragments to a linearized donor plasmid to form a pool of circular intermediates,
wherein the linearized donor plasmid comprises a first promoter sequence and a first gRNA scaffold coding sequence,
wherein the first anchoring sequence is homologous to a portion of the first promoter sequence and wherein the second anchoring sequence is homologous to a portion of the first gRNA scaffold coding sequence, wherein the double-stranded DNA target fragment is located downstream of the first promoter in each circular intermediate, and
wherein the a first target-DNA-specific gRNA coding sequence is operably linked to the first gRNA scaffold coding sequence in each circular intermediate;
(c) linearizing the pool of circular intermediates at the one or more restriction enzyme sites to produce a pool of linearized intermediates, wherein the first promoter is downstream of the first target-DNA-specific gRNA scaffold coding sequence and is operably linked to the coding sequence of the second gRNA coding sequence in each linearized intermediate; and
(d) introducing the pool of linearized intermediates into an expression vector comprising a second promoter and a second gRNA scaffold coding sequences downstream of the second promoter to form a pool of co-expression vectors each comprising a co-expression cassette comprising (1) the first target-DNA-specific gRNA coding sequence operably linked to the first gRNA scaffold coding sequence and is under the control of the second promoter, and (2) the second target-DNA-specific gRNA coding sequence operably linked to the second gRNA scaffold coding sequence and is under the control of the first promoter.
8. The method of Claim 7, wherein each target DNA sequence further comprises a spacer sequence between the second target-DNA-specific gRNA coding sequence and the first target-DNA-specific gRNA coding sequence and wherein the one or more restriction enzyme sites are located within the spacer sequence.
9. The method of Claim 7, wherein the expression vector further comprises a Cas9 gene under the control of a third promoter.
10. The method of Claim 7, further comprising the step of:
(e) generating an expression library with the pool of co-expression vectors.
11. The method of Claim 7, further comprising the step of:
(e) generating a pool of recombinant viruses with the pool of co-expression vectors.
12. The method of Claim 7, wherein each double-stranded DNA target fragment contains a 20-40 base pair overlap on each end with the linearized donor plasmid and is ligated to the linearized donor plasmid by Gibson ligation, and wherein the first promoter is U6 promoter.
13. An expression library comprising the pool of co-expression vectors of Claim 7.
14. A kit for generating a co-expression vector or a pool of co-expression vectors, comprising :
a donor plasmid comprising a promoter sequence and a gRNA scaffold coding sequence, a forward primer comprising a first anchor sequence that is homologous to at least a portion of the promoter sequence; and a reverse primer comprising a second anchor sequence that is homologous to at least a portion of the gRNA scaffold coding sequence.
15. The kit of Claim 15, further comprising an expression vector comprising a promoter and a gRNA scaffold coding sequence.
PCT/US2016/017377 2015-02-11 2016-02-10 Methods and kits for generating vectors that co-express multiple target molecules Ceased WO2016130697A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562114957P 2015-02-11 2015-02-11
US62/114,957 2015-02-11

Publications (1)

Publication Number Publication Date
WO2016130697A1 true WO2016130697A1 (en) 2016-08-18

Family

ID=56615576

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/017377 Ceased WO2016130697A1 (en) 2015-02-11 2016-02-10 Methods and kits for generating vectors that co-express multiple target molecules

Country Status (1)

Country Link
WO (1) WO2016130697A1 (en)

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9580715B2 (en) 2014-06-23 2017-02-28 Regeneron Pharmaceuticals, Inc. Nuclease-mediated DNA assembly
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10208317B2 (en) 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
WO2019023291A3 (en) * 2017-07-25 2019-04-25 Dana-Farber Cancer Institute, Inc. Compositions and methods for making and decoding paired-guide rna libraries and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
CN110249049A (en) * 2016-12-29 2019-09-17 法兰克福大学 The method for generating high-order genome editor library
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
CN110835635A (en) * 2018-08-16 2020-02-25 深圳华大生命科学研究院 Plasmid construction method for the expression of multiple tandem sgRNAs with different promoters
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
CN111349616A (en) * 2018-12-24 2020-06-30 中国农业大学 Method for screening target virus-related host factors and application
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
EP3635114A4 (en) * 2017-06-07 2021-03-17 Arc Bio, LLC CREATION AND USE OF GUIDED NUCLEIC ACIDS
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11111504B2 (en) 2019-04-04 2021-09-07 Regeneron Pharmaceuticals, Inc. Methods for scarless introduction of targeted modifications into targeting vectors
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11718847B2 (en) 2018-08-29 2023-08-08 Agilent Technologies, Inc. Amplifying oligonucleotides and producing libraries of dual guide constructs
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12342801B2 (en) 2016-05-20 2025-07-01 Regeneron Pharmaceuticals, Inc. Methods for producing antigen-binding proteins against foreign antigens
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014204724A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014204724A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"CRISPR Fly Design. Applications of pCFD plasmids", 8 January 2015 (2015-01-08), Retrieved from the Internet <URL:https://web.archive.org/web/20150108022012/http://www.crisprflydesign.org/plasmids> [retrieved on 20160413] *
ADDGENE.: "Zhang Lab CRISPR Plasmids Available from Addgene", 8 February 2015 (2015-02-08), Retrieved from the Internet <URL:https://web.archive.org/web/20150208030038/http://www.addgene.org/crispr/zhang> [retrieved on 20160511] *
KABADI ET AL., MULTIPLEX CRISPR/CAS9-BASED GENOME ENGINEERING FROM A SINGLE LENTIVIRAL VECTOR., vol. 42, no. 19, 29 October 2014 (2014-10-29), pages 1 - 11 *
MADDALO ET AL.: "In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system.", NATURE, vol. 516, no. 7531, 18 December 2014 (2014-12-18), pages 423 - 427 *

Cited By (91)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12037596B2 (en) 2013-04-16 2024-07-16 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10975390B2 (en) 2013-04-16 2021-04-13 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10711280B2 (en) 2013-12-11 2020-07-14 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse ES cell genome
US10208317B2 (en) 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
US11820997B2 (en) 2013-12-11 2023-11-21 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10626402B2 (en) 2014-06-23 2020-04-21 Regeneron Pharmaceuticals, Inc. Nuclease-mediated DNA assembly
US11932859B2 (en) 2014-06-23 2024-03-19 Regeneron Pharmaceuticals, Inc. Nuclease-mediated DNA assembly
US9580715B2 (en) 2014-06-23 2017-02-28 Regeneron Pharmaceuticals, Inc. Nuclease-mediated DNA assembly
US10273488B2 (en) 2014-06-23 2019-04-30 Regeneron Pharmaceuticals, Inc. Nuclease-mediated DNA assembly
US9738897B2 (en) 2014-06-23 2017-08-22 Regeneron Pharmaceuticals, Inc. Nuclease-mediated DNA assembly
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US11697828B2 (en) 2014-11-21 2023-07-11 Regeneran Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12342801B2 (en) 2016-05-20 2025-07-01 Regeneron Pharmaceuticals, Inc. Methods for producing antigen-binding proteins against foreign antigens
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
CN110249049A (en) * 2016-12-29 2019-09-17 法兰克福大学 The method for generating high-order genome editor library
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
EP3635114A4 (en) * 2017-06-07 2021-03-17 Arc Bio, LLC CREATION AND USE OF GUIDED NUCLEIC ACIDS
WO2019023291A3 (en) * 2017-07-25 2019-04-25 Dana-Farber Cancer Institute, Inc. Compositions and methods for making and decoding paired-guide rna libraries and uses thereof
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
CN110835635A (en) * 2018-08-16 2020-02-25 深圳华大生命科学研究院 Plasmid construction method for the expression of multiple tandem sgRNAs with different promoters
CN110835635B (en) * 2018-08-16 2024-01-09 深圳华大生命科学研究院 Plasmid construction method for promoting expression of multiple tandem sgRNAs by different promoters
US11718847B2 (en) 2018-08-29 2023-08-08 Agilent Technologies, Inc. Amplifying oligonucleotides and producing libraries of dual guide constructs
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
CN111349616A (en) * 2018-12-24 2020-06-30 中国农业大学 Method for screening target virus-related host factors and application
CN111349616B (en) * 2018-12-24 2022-11-08 北京复昇生物科技有限公司 Method for screening target virus-related host factors and application
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12624354B2 (en) 2019-03-19 2026-05-12 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12624353B2 (en) 2019-03-19 2026-05-12 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11111504B2 (en) 2019-04-04 2021-09-07 Regeneron Pharmaceuticals, Inc. Methods for scarless introduction of targeted modifications into targeting vectors
US11499164B2 (en) 2019-04-04 2022-11-15 Regeneran Pharmaceuticals, Inc. Methods for scarless introduction of targeted modifications into targeting vectors
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Similar Documents

Publication Publication Date Title
AU2025287334B2 (en) Systems, methods, and compositions for site-specific genetic engineering using Programmable Addition via Site-Specific Targeting Elements (PASTE)
WO2022261150A2 (en) Particle delivery systems
EP3688159A1 (en) Crispr/cas system and method for genome editing and modulating transcription
AU2019281034B2 (en) Method for generating a gene editing vector with fixed guide RNA pairs
KR20220081988A (en) Modified bacterial retrofactors to enhance DNA production
JP2004121248A (en) Method for preparation and application of multi-gene recombinant vector construct
US20240301374A1 (en) Systems and methods for transposing cargo nucleotide sequences
Bode et al. Transcription-promoting genomic sites in mammalia: their elucidation and architectural principles
CN108431226A (en) Gene modification assay
EP4222272A1 (en) Rescue of recombinant adenoviruses by crispr/cas-mediated in vivo terminal resolution
US20100285464A1 (en) A conserved region of the hiv-1 genome and uses thereof
US20230193322A1 (en) CAS9 Fusion Proteins and Related Methods
Sgourou et al. Physiological levels of HBB transgene expression from S/MAR element-based replicating episomal vectors
JP2024543216A (en) CRISPR-associated transposases and methods of use thereof
US20250354177A1 (en) System and methods for duplicating target fragments
WO2020117992A9 (en) Improved vector systems for cas protein and sgrna delivery, and uses therefor
WO2024047587A1 (en) Cas-phi compositions and methods of use
WO2013191950A2 (en) Unique modular vector design
JP2008529533A (en) Method for cutting off both ends of a large DNA fragment

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16749815

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16749815

Country of ref document: EP

Kind code of ref document: A1