WO2016123517A2 - Recurrent gene fusions in cutaneous cd30-positive lymphoproliferative disorders - Google Patents
Recurrent gene fusions in cutaneous cd30-positive lymphoproliferative disorders Download PDFInfo
- Publication number
- WO2016123517A2 WO2016123517A2 PCT/US2016/015714 US2016015714W WO2016123517A2 WO 2016123517 A2 WO2016123517 A2 WO 2016123517A2 US 2016015714 W US2016015714 W US 2016015714W WO 2016123517 A2 WO2016123517 A2 WO 2016123517A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tyk2
- gene
- fusion
- npm1
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- kits, compositions and methods for cancer diagnosis, research and therapy including but not limited to, cancer markers.
- the present invention relates to recurrent gene fusions (e.g., recurrent translocations involving TYK2) as diagnostic markers and clinical targets for cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
- Lymphoproliferative disorders refer to several conditions in which lymphocytes are produced in excessive quantities. They typically occur in patients who have compromised immune systems.
- LPDs include, but are not limited to, follicular lymphoma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, hairy cell leukemia, lymphomas, multiple myeloma, Waldenstrom's macroglobulinemia, Wiskott- Aldrich syndrome, post-transplant lymphoproliferative disorder, autoimmune
- lymphoproliferatieve syndrome APS
- lymphoid interstitial pneumonia a lymphoproliferatieve syndrome
- CD30-positive lymphoproliferative disorders include lymphomatoid papulosis and primary cutaneous anaplastic large cell lymphoma.
- Lymphomatoid papulosis is characterized by multiple papules and nodules, which regress spontaneously. Three histologic subtypes have been described, which represent a spectrum with overlapping features and do not carry prognostic significance.
- Type A lesions have a few tumor cells in a background of inflammatory cells including neutrophils, eosinophils, and histiocytes.
- Type B lesions are characterized by epidermotropic lymphocytes with cerebriform nuclei mimicking mycosis fungoides.
- Type C lesions have sheets of large atypical lymphoid cells with only a few admixed inflammatory cells. The large atypical lymphoid cells are thought to be of T cell origin.
- LYP types A and C the large atypical cells express CD30, CD3, and CD4. CD2 and CD5 are usually expressed. These cells also express the cytotoxic markers TIA-1 and granzyme. The large atypical cells do not express CD8, CD7, or CD56. The cells may lose expression of CD3.
- LYP type B the atypical cells are usually CD30 negative. Five year survival rates for LYP are 100%; however up to 20% of patients develop LYP-associated malignant lymphomas (e.g., mycosis fungoides, Hodgkin lymphoma, systemic or cutaneous CD30+ large T-cell lymphoma), which result in a fatal outcome of 2% of patients.
- LYP-associated malignant lymphomas e.g., mycosis fungoides, Hodgkin lymphoma, systemic or cutaneous CD30+ large T-cell lymphoma
- ACL Primary cutaneous anaplastic large cell lymphoma
- This disease mainly affects adults with a peak in the sixth decade, but cases have been reported in children. It usually presents as a solitary rapidly growing nodule. The skin overlying the lesion may ulcerate. Histologically the cells grow in sheets. Mitotic figures are frequent. Clusters of small reactive lymphocytes are found within and around the tumor cells.
- the malignant cells express CD2, CD3, CD4, CD30, and cytotoxic markers including TIA-1, granzyme, and perforin. Loss of T-cell antigen expression is not infrequent.
- the malignant cells do not express EMA or ALK. Five year survival rates approach 90%. Interestingly, up to 40% of C-ALCL show spontaneous regression similarly to LYP.
- CD30-positive lymphoproliferative disorders e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma
- the cutaneous CD30-positive lymphoproliferative spectrum of disorders includes lymphomatoid papulosis (LYP) and primary cutaneous anaplastic large cell lymphoma (ALCL). Chromosomal translocations targeting tyrosine kinases in CD30-positive LPD have not been described.
- LYP lymphomatoid papulosis
- ACL primary cutaneous anaplastic large cell lymphoma
- Chromosomal translocations targeting tyrosine kinases in CD30-positive LPD have not been described.
- experiments conducted during the course of developing embodiments for the present invention identified a chimeric fusion involving NPM1 (5q35) and TYK2 (19pl3) which encodes an NPM1-TYK2 protein containing the oligomerization domain of NPM1 and an intact catalytic domain in TYK2.
- kits, compositions and methods for cancer diagnosis, research and therapy including but not limited to, cancer markers.
- the present invention relates to recurrent gene fusions (e.g., recurrent translocations involving TYK2) as diagnostic markers and clinical targets for cutaneous CD30-positive
- lymphoproliferative disorders e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma.
- the present invention provides, but is not limited to, methods, compositions, and kits involving gene fusions having a 3' portion from a TYK2 gene and a 5' portion from a TYK2-gene-fusion-partner.
- composition, methods, kits are not limited to a particular portion of a TYK2 gene.
- the portion of the TYK2 gene comprises any portion of TYK2 enabling tyrosine kinase activity upon expression as a polypeptide. In some embodiments, the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises the entire C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises at least a portion of the TYK2 pseudokinase domain.
- the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2 and/or at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the TYK2 pseudokinase domain.
- composition, methods, kits are not limited to a particular
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide capable of having constitutively activated tyrosine kinase activity when expressed in a cell.
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell is capable of constitutively activating downstream targets of TYK2 (e.g., STAT1, STAT3, STAT5) within the cell.
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell results in increased cellular proliferation of that cell.
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide, wherein 1) the polypeptide is capable of having constitutively activated tyrosine kinase activity when expressed in a cell, 2) expression of the polypeptide in a cell results in constitutive activation of downstream targets of TYK2 (e.g., STAT1, STAT3, STAT5), and 3) expression of the polypeptide in a cell results in increased cellular proliferation of the cell.
- TYK2 e.g., STAT1, STAT3, STAT5
- the TYK2-gene-fusion-partner is any portion of NPM1.
- the TYK2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the NPMl oligomerization domain. In some embodiments, the TYK2 -gene-fusion-partner comprises the entire NPM1 oligomerization domain.
- the TYK2 -gene-fusion-partner comprises at least a portion
- the TYK2-gene-fusion-partner comprises the entire NPM1 histone binding domains.
- the TYK2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the distal portion of the NPM1 DNA/RNA binding domains. In some embodiments, the TYK2-gene-fusion-partner comprises the entire distal portion of the NPM1 DNA/RNA binding domains.
- the TYK2-gene-fusion-partner comprises the entire NPM1 oligomerization domain, the entire NPM1 histone binding domain, and the entire distal portion of the NPM1 DNA/RNA binding domain.
- the present invention provides methods for detecting cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., a human patient) comprising, consisting essentially of, or consisting of: providing a sample from the patient; and, detecting the presence or absence in the sample of a gene fusion having a 3' portion from a TYK2 gene and a 5' portion from a TYK2-gene-fusion-partner, wherein the presence in the sample of the gene fusion is indicative of a cutaneous CD30-positive lymphoproliferative disorder (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in the subj ect.
- the sample includes biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells.
- Detecting the presence or absence in the sample of such a gene fusion may comprise detecting chromosomal rearrangements of genomic DNA having a 5' portion from a TYK2- gene-fusion-partner (e.g., NPMl) and a 3' portion from a TYK2 gene.
- a variety of techniques may be used for detecting the chromosomal rearrangements of genomic DNA, including nucleic acid sequencing, nucleic acid hybridization, and nucleic acid amplification.
- Nucleic acid hybridization techniques include in situ hybridization (ISH), microarray, and Southern blot.
- Nucleic acid amplification techniques include polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA).
- PCR polymerase chain reaction
- RT-PCR reverse transcription polymerase chain reaction
- TMA transcription-mediated amplification
- LCR ligase chain reaction
- SDA strand displacement amplification
- NASBA nucleic acid sequence based amplification
- Detecting the presence or absence in the sample of such a gene fusion may alternatively comprise detecting chimeric mRNA transcripts having a 5' portion from a TYK2 -gene-fusion-partner (e.g., NPMl) and a 3' portion from a TYK2 gene.
- a variety of techniques may be used for detecting the chimeric mRNA, including nucleic acid sequencing, nucleic acid hybridization, and, nucleic acid amplification.
- Nucleic acid hybridization techniques include in situ hybridization (ISH) (e.g., Fluorescence in situ hybridization (FISH)), microarray, and Northern blot).
- Nucleic acid amplification techniques include, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand
- SDA SDA
- NASBA nucleic acid sequence based amplification
- Detecting the presence or absence in the sample of a gene fusion may also be used.
- a variety of techniques may be used for detecting the truncated TYK2 protein or chimeric protein: protein sequencing; and, immunoassay. Immunoassay techniques include immunoprecipitation, Western blot, ELISA, immunohistochemistry, immunocytochemistry, flow cytometry, and immuno-PCR.
- the present invention further provides, but is not limited to, compositions and kits for detecting / diagnosing cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., human patient).
- the compositions and kits may comprise: a single labeled probe comprising a sequence that hybridizes to the junction at which a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl) fuses to a 3' portion from a TYK2 gene;
- the first labeled probe comprises a sequence that hybridizes to a TYK2 -gene-fusion-partner (e.g., NPMl) and the second labeled probe comprises a sequence that hybridizes to a TYK2 gene;
- a TYK2 -gene-fusion-partner e.g., NPMl
- oligonucleotide comprises a sequence that hybridizes to a TYK2-gene-fusion-partner (e.g., NPMl) and the second amplification oligonucleotide comprises a sequence that hybridizes to a TYK2 gene;
- a TYK2-gene-fusion-partner e.g., NPMl
- a TYK2 -gene-fusion-partner e.g., NPMl
- a TYK2- gene-fusion-partner e.g., NPMl
- the present invention provides methods for treating cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis;
- a subject e.g., a human patient
- administering an agent that inhibits at least one biological activity of such a gene fusion having a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl) and a 3 ' portion from a TYK2 gene.
- the agent inhibits tyrosine kinase activity resulting from the gene fusion.
- the agent inhibits STAT1, STAT3, and/or STAT5 activity resulting from the gene fusion.
- the agent inhibits increased cellular proliferation resulting from the gene fusion.
- the agent inhibits one or more of tyrosine kinase activity resulting from the gene fusion, STAT1 , STAT3, and/or STAT5 activity resulting from the gene fusion, and increased cellular proliferation resulting from the gene fusion.
- the agent inhibits expression of the gene fusion.
- the agent inhibits any expression and/or activity resulting from the gene fusion.
- the agent may be a small molecule, an siRNA, an antisense nucleic acid, or an antibody.
- the agent is co- administered with an additional agent known to treat cancer (e.g., an agent for treating cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis;
- kits for detecting gene fusions associated with CD30-positive lymphoproliferative disorders e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma
- a subject comprising or consisting essentially of or consisting of detecting the presence of one or more gene fusions involving TYK2.
- kits comprise, consist essentially of, or consist of informative reagents for detecting a gene fusion having or resulting from the fusion of, rearrangement of, or genomic deletion between, a 3' portion from a TYK family member gene and a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl), wherein detecting the presence in a sample (e.g., a sample from a human subject) (e.g., biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells) of the gene fusion between a TYK2 gene and a TYK2-gene-fusion-partner (e.g., NPMl) identifies or characterizes cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
- a sample e.g., a sample from a human subject
- a sample e.g., biopsy
- Such embodiments are not limited to a particular reagent(s).
- a probe that specifically hybridizes to the fusion junction of a TYK2 gene and a TYK2 -gene-fusion-partner e.g., NPMl
- a pair of primers that amplify a fusion junction of a gene fusion between a TYK2 gene and a TYK2-gene-fusion-partner e.g., NPMl
- an antibody that binds to the fusion junction of a fusion polypeptide of TYK2 and a TYK2 -gene-fusion-partner e.g., NPMl
- NPMl e.g., a NPM1-TYK2 fusion polypeptide
- cutaneous CD30-positive lymphoproliferative disorders e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma
- a subject e.g., human subject
- the present invention provides a method for characterizing / detecting / identifying cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., human subject), comprising: (a) contacting a biological sample from a subject (e.g., biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells) with a nucleic acid or polypeptide detection assay comprising at least a first gene fusion informative reagent for identification of a NPMl-TYK2 gene fusion under conditions that the presence of such a gene fusion is detected; and (b) characterizing / detecting / identifying cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in the subject when the NPM1-TYK2 gene fusion is present in
- step (a) comprises detecting chromosomal rearrangements of genomic DNA having a 5' portion from NPMl and a 3' portion from TYK2. In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid sequencing technique. In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid hybridization technique. In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid hybridization technique (e.g., including but not limited to, in situ hybridization (ISH), microarray or Southern blot).
- a nucleic acid hybridization technique e.g., including but not limited to, in situ hybridization (ISH), microarray or Southern blot.
- step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid amplification method (e.g., including but not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), or nucleic acid sequence based amplification (NASBA)).
- a nucleic acid amplification method e.g., including but not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), or nucleic acid sequence based amplification (NASBA)
- PCR polymerase chain reaction
- RT-PCR reverse transcription polymerase chain reaction
- TMA transcription-mediated amplification
- LCR ligase chain reaction
- SDA strand displacement amplification
- NASBA nu
- step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid sequencing technique. In some embodiments, step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid hybridization technique. In some embodiments, step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid hybridization technique (e.g., including but not limited to, in situ hybridization (ISH), microarray or Northern blot).
- ISH in situ hybridization
- microarray microarray or Northern blot
- step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid amplification method (e.g., including but not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT- PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), or nucleic acid sequence based amplification (NASBA)).
- a nucleic acid amplification method e.g., including but not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT- PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), or nucleic acid sequence based amplification (NASBA)).
- PCR polymerase chain reaction
- RT- PCR reverse transcription polymerase chain reaction
- TMA transcription-mediated amplification
- LCR ligase chain reaction
- SDA strand displacement amplification
- NASBA
- the method further comprises the step of collecting the sample from the subject.
- the sample is, for example, biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells.
- the described methods further comprise the step of detecting the level of expression of the gene fusion in the sample, wherein detecting an enhanced level of expression of the gene fusion in the patient sample relative to the level of expression of the gene fusion in a normal sample (e.g., relative to the level in normal cells, increase or decrease in level relative to a prior time point, increase or decrease relative to a pre-established thereshold level, etc.) indicates the presence of neoplastic cells or cells predisposed to the onset of a neoplastic state in the sample.
- the treatment course of action comprises administration of an inhibitor of activity resulting from such a gene fusion (e.g., NPM1 -TYK2) (e.g., tyrosine kinase activity resulting from the gene fusion, STAT1 , STAT3, and/or STAT5 activity resulting from the gene fusion, and increased cellular proliferation resulting from the gene fusion) when the gene fusion is present in the sample.
- an inhibitor of activity resulting from such a gene fusion e.g., NPM1 -TYK2
- the agent inhibits expression of the gene fusion.
- the agent inhibits any expression and/or activity resulting from the gene fusion.
- the agent may be a small molecule, an siRNA, an antisense nucleic acid, or an antibody.
- the present invention provides a method for diagnosing a neoplastic disorder or susceptibility to a neoplastic disorder comprising detecting the presence of a NPM1-TYK2 gene fusion in a sample from a subject (e.g., a human patient), wherein the NPM1 -TYK2 gene fusion is a fusion between chromosome 5, exon 9 of NPM1 and chromosome 19, exon 15 of TYK2 (e.g., N5;T19), and diagnosing the subject as having or being susceptible to a neoplastic disorder when the gene fusion is present.
- the neoplastic disorder is a cutaneous CD30-positive lymphoproliferative disorder (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
- the present invention provides a method of determining the present invention
- NPM1 -TYK2 gene fusion status of a human by: (a) determining the presence or absence of the N5;T19 gene fusion in both alleles of the of the NPM1 -TYK2 fusion gene of the human in a nucleic acid sample obtained from the human, and (b) identifying the human (i) as being homozygous for N5;T19 gene fusion in the NPM1-TYK2 fusion gene when one of the gene fusions is present in both alleles of the NPM1-TYK2 fusion gene, or (ii) as being
- the NPM1-TYK2 gene fusion is N5;T19.
- An NPM1-TYK2 gene fusion may be detected by amplifying any of SEQ ID NOs: 1, 2, 3, or 4, or diagnostic fragments thereof.
- the method includes detecting one or more additional NPM1-TYK2 gene fusions in a sample from the subject.
- the NPM1-TYK2 fusion may be detected by assessing sample nucleic acid by PCR,
- the sample is amplified by reverse transcriptase polymerase chain reaction (RT-PCR).
- RT-PCR reverse transcriptase polymerase chain reaction
- the amplifying employs a detectably labeled primer.
- the detecting is accomplished with electrophoresis.
- the detecting is accomplished using a real-time PCR-based detection system, such as TaqMan®.
- the present invention also provides a method for diagnosing a neoplastic disorder or susceptibility to a neoplastic disorder by detecting the presence or absence of an NPM1- TYK2 fusion protein in a sample from a subject, wherein the NPM1-TYK2 fusion protein is a fusion between exon 9 of NPMl and exon 15 of ALK, and diagnosing the subject has having or being susceptible to a neoplastic disorder when the fusion protein is present.
- kits for detecting aNPMl-TYK2 fusion mutations which include one or more oligonucleotides (e.g., a primer) for amplifying a fragment of a nucleic acid sample which contains the N5;T19 mutation, if present.
- the kit further contains one or more mutation-specific oligonucleotide probes.
- FIG. 1 FISH Results and Clinical Data for Cutaneous CD30-Positive
- FIG. 2A-F Identification of TYK2 translocations in cutaneous T cell lymphoma- derived cell line and primary CD30 positive LPD patient samples.
- A Read support from RNA sequencing illustrating the forward fragment reads spanning the breakpoint between 5' NPMl (NM_002520 c.1016) component and 3 ' TYK2 (NM_003331 c.2554) component and confirmation by Sanger sequencing.
- B Protein domain and exon diagram illustrating the preservation of N-terminal oligomerization and histone and DNA/RNA binding domains of NPMl and the C-terminal kinase domain of TYK2 in the NPM1-TYK2 fusion protein.
- FIG. 3 Summary of RNAseq data for MyLa.
- FIG. 4 SYBR Green- based qRT-PCR validation of NPM1-TYK2 fusion transcript expression in MyLa and other hematological cell lines.
- FIG. 5 Conventional gel based RT-PCR validation of NPM1-TYK2 fusion transcript expression in MyLa and other hematological cell lines.
- FIG. 6 Agarose gel electrophoresis of PCR products for genomic breakpoint mapping from NPMl-TYK2 positive MyLa and the negative control HH.
- the cartoon depicts the location of genomic breakpoint in NPMl and TYK2 genes and their juxtaposition.
- the bottom panel shows the Sanger sequencing of the PCR product which shows the exact genomic fusion point.
- FIG. 7A-F Oncogenic potential of NPM1-TYK2 fusion gene product.
- A Presence of the NPM1-TYK2 fusion protein in MyLa and not in other T-cell lines. Individual NPMl and TYK2 western blot assays show shift in the size of the protein in MyLa as a result of the fusion.
- B Hyperactivation of TYK2 and elevated STAT pathway activation in MyLa cells endogenously expressing NPM1-TYK2 fusion protein as compared with other T-cell lines.
- the Macl cell line that has a JAK2 rearrangement is used as a positive control.
- HUT78 cell line exhibits constitutive STAT5 activation.
- FIG. 8 Immunohistochemical staining for NPMl in primary patient samples. In the absence of NPM1-TYK2, NPMl expression is restricted to the nucleus (left panel). In a patient with NPM1-TYK2 fusion, there is atypical cytoplasmic localization of NPMl (right panel). (Anti-NPMl, 500x magnification).
- FIG. 9 Immunofluorescence staining demonstrates a marked expression of cytoplasmic and nuclear phosphorylated STAT 1/3/5 in NPM-TYK2 positive My La cell line as compared to fusion negative HH cell line.
- FIG. 10 Immunohistochemical staining for pSTAT5 in primary patient samples. In the absence of NPM1-TYK2, there is weak expression of pSTAT5, predominantly limited to the cytoplasm (left panel). In a patient with NPM1-TYK2 fusion, expression of pSTAT5 is stronger and increased nuclear expression is present (right panel). (Anti-pSTAT5, 400x magnification).
- FIG. 11 A-E A) wild type cDNA sequence for TYK2; B) wild type ORF nucleic acid sequence for TYK2; C) wild type amino acid sequence for TYK2; D) wild type nucleic acid sequence for TYK2; and E) TYK2 nucleic acid intron involved in TYK2 translocation.
- FIG. 12A-E A) wild type cDNA sequence for NPMl; B) wild type ORF nucleic acid sequence for NPMl ; C) wild type amino acid sequence for NPMl; D) wild type nucleic acid sequence for NPMl ; and E) NPMl nucleic acid intron involved in NPMl translocation.
- FIG. 13A-D A) cDNA sequence for NPM1-TYK2 gene fusion; B) coding region for NPM1-TYK2 gene fusion; C) amino acid sequence for NPM1-TYK2 gene fusion product; and D) NPM1-TYK2 introns involved in translocation.
- gene fusion refers to a chimeric genomic DNA, a chimeric messenger RNA, a truncated protein or a chimeric protein resulting from the fusion of at least a portion of a first gene to at least a portion of a second gene.
- the gene fusion need not include entire genes or exons of genes.
- sensitivity is defined as a statistical measure of performance of an assay (e.g., method, test), calculated by dividing the number of true positives by the sum of the true positives and the false negatives.
- specificity is defined as a statistical measure of performance of an assay (e.g., method, test), calculated by dividing the number of true negatives by the sum of true negatives and false positives.
- informative or “informativeness” refers to a quality of a marker or panel of markers, and specifically to the likelihood of finding a marker (or panel of markers) in a positive sample.
- TYK2 refers to a member of the Janus Kinase (JAK) family of tyrosine kinases.
- An example of TYK2 polypeptide is the human polypeptide sequence described in Genbank accession number P29597.3.
- An exemplary TYK2 coding sequence is the human sequence described in Genbank accession number X54637.
- TYK2 also includes species homologs, splice variants, polymorphic variants, and conservatively modified variants of TYK2 that retain TYK2 tyrosine kinase activity. Fig.
- 1 1 provides: A) human wild type cDNA sequence for TYK2; B) human wild type ORF nucleic acid sequence for TYK2; C) human wild type amino acid sequence for TYK2; D) human wild type nucleic acid sequence for TYK2; and E) human TYK2 nucleic acid intron involved in TYK2
- NPMl refers to a gene which encodes a phosphoprotein which moves between the nucleus and the cytoplasm. The gene product is thought to be involved in several processes including regulation of the ARF/p53 pathway.
- An exemplary NPMl coding sequence is the human sequence described in Genbank accession number P06748. NPMl also includes species homologs, splice variants, polymorphic variants, and conservatively modified variants of NPMl that retain its wild type activity. Fig.
- NPM1 -TYK2 refers to a chimeric genomic DNA, a chimeric messenger RNA, a truncated protein or a chimeric protein resulting from the fusion of at least a portion of an NPMl gene to at least a portion of a TYK2 gene.
- the gene fusion need not include entire genes or exons of genes.
- Fig. 13 provides: A) cDNA sequence for NPM1 -
- TYK2 gene fusion B) coding region for NPM1-TYK2 gene fusion; C) amino acid sequence for NPM1-TYK2 gene fusion product; and D) NPM1-TYK2 introns involved in
- NPM1/TYK2 informative reagent refers to a reagent or reagents that are informative for identification of gene fusions described herein.
- reagents are primers, probes or antibodies for detection of NPM1 -TYKE2 gene fusions described herein.
- transcriptional regulatory region refers to the non-coding upstream regulatory sequence of a gene, also called the 5 ' untranslated region (5 'UTR).
- detect may describe either the general act of discovering or discerning or the specific observation of a detectably labeled composition.
- the term "inhibits at least one biological activity of a gene fusion” refers to any agent that decreases any activity of a gene fusion of the present invention (e.g., including, but not limited to, the activities described herein), via directly contacting gene fusion protein, contacting gene fusion mRNA or genomic DNA, causing conformational changes of gene fusion polypeptides, decreasing gene fusion protein levels, or interfering with gene fusion interactions with signaling partners, and affecting the expression of gene fusion target genes.
- Inhibitors also include molecules that indirectly regulate gene fusion biological activity by intercepting upstream signaling molecules.
- siRNAs refers to small interfering RNAs.
- siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAs contain from about two to four unpaired nucleotides at the 3' end of each strand.
- At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to, or substantially complementary to, a target RNA molecule.
- the strand complementary to a target RNA molecule is the "antisense strand;" the strand homologous to the target RNA molecule is the "sense strand,” and is also complementary to the siRNA antisense strand.
- siRNAs may also contain additional sequences; non-limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures. siRNAs appear to function as key intermediaries in triggering RNA interference in invertebrates and in vertebrates, and in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants.
- RNA interference refers to the silencing or decreasing of gene expression by siRNAs. It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene.
- the gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not integrated into the genome. The expression of the gene is either completely or partially inhibited.
- RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.
- gene transfer system refers to any means of delivering a composition comprising a nucleic acid sequence to a cell or tissue.
- gene transfer systems include, but are not limited to, vectors (e.g., retroviral, adenoviral, adeno- associated viral, and other nucleic acid-based delivery systems), microinj ection of naked nucleic acid, polymer-based delivery systems (e.g., liposome-based and metallic particle- based systems), biolistic injection, and the like.
- viral gene transfer system refers to gene transfer systems comprising viral elements (e.g., intact viruses, modified viruses and viral components such as nucleic acids or proteins) to facilitate delivery of the sample to a desired cell or tissue.
- adenovirus gene transfer system refers to gene transfer systems comprising intact or altered viruses belonging to the family Adenoviridae.
- site-specific recombination target sequences refers to nucleic acid sequences that provide recognition sequences for recombination factors and the location where recombination takes place.
- nucleic acid molecule refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA.
- the term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to,
- gene refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA).
- the polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment is retained.
- the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full- length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences.
- the term "gene” encompasses both cDNA and genomic forms of a gene.
- a genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns” or “intervening regions” or “intervening sequences.
- Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript.
- mRNA messenger RNA
- heterologous gene refers to a gene that is not in its natural environment.
- a heterologous gene includes a gene from one species introduced into another species.
- a heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc).
- Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically j oined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
- oligonucleotide refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than 200 residues long (e.g., between 15 and 100), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a "24-mer”. Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides.
- Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes.
- the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules.
- the sequence “5'-A-G-T-3'” is complementary to the sequence “3'-T-C-A-5 ⁇
- Complementarity may be "partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids.
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
- a partially complementary sequence is a nucleic acid molecule that at least partially inhibits a completely complementary nucleic acid molecule from hybridizing to a target nucleic acid is "substantially homologous.”
- the inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency.
- a substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous nucleic acid molecule to a target under conditions of low stringency.
- low stringency conditions are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
- the absence of non-specific binding may be tested by the use of a second target that is substantially non-complementary (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.
- substantially homologous refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
- a gene may produce multiple RNA species that are generated by differential splicing of the primary RNA transcript.
- cDNAs that are splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon on both cDNAs) and regions of complete non-identity (for example, representing the presence of exon "A” on cDNA 1 wherein cDNA 2 contains exon "B" instead). Because the two cDNAs contain regions of sequence identity they will both hybridize to a probe derived from the entire gene or portions of the gene containing sequences found on both cDNAs; the two splice variants are therefore substantially homologous to such a probe and to each other.
- substantially homologous refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described above.
- hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T m of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be “self- hybridized.”
- stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted.
- low stringency conditions a nucleic acid sequence of interest will hybridize to its exact complement, sequences with single base mismatches, closely related sequences (e.g., sequences with 90% or greater homology), and sequences having only partial homology (e.g., sequences with 50-90% homology).
- 'medium stringency conditions a nucleic acid sequence of interest will hybridize only to its exact complement, sequences with single base mismatches, and closely relation sequences (e.g., 90% or greater homology).
- a nucleic acid sequence of interest will hybridize only to its exact complement, and (depending on conditions such a temperature) sequences with single base mismatches. In other words, under conditions of high stringency the temperature can be raised so as to exclude hybridization to sequences with single base mismatches.
- High stringency conditions when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 P0 4 H 2 0 and 1.85 g/1 EDTA, pH adjusted to 7.4 with 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 P0 4 H 2 0 and 1.85 g/1 EDTA, pH adjusted to 7.4 with
- “Medium stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 P0 4 H 2 0 and 1.85 g/1 EDTA, pH adjusted to 7.4 with 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 P0 4 H 2 0 and 1.85 g/1 EDTA, pH adjusted to 7.4 with
- Low stringency conditions comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 P0 4
- low stringency conditions Numerous equivalent conditions may be employed to comprise low stringency conditions; factors such as the length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of low stringency hybridization different from, but equivalent to, the above listed conditions.
- the conditions that promote hybridization under conditions of high stringency e.g., increasing the temperature of the hybridization and/or wash steps, the use of formamide in the hybridization solution, etc.
- stringency can be utilized.
- amplification oligonucleotide refers to an oligonucleotide that hybridizes to a target nucleic acid, or its complement, and participates in a nucleic acid amplification reaction.
- An example of an amplification oligonucleotide is a "primer” that hybridizes to a template nucleic acid and contains a 3' OH end that is extended by a polymerase in an amplification process.
- oligonucleotide is an oligonucleotide that is not extended by a polymerase (e.g., because it has a 3' blocked end) but participates in or facilitates amplification.
- Amplification oligonucleotides may optionally include modified nucleotides or analogs, or additional nucleotides that participate in an amplification reaction but are not complementary to or contained in the target nucleic acid.
- Amplification oligonucleotides may contain a sequence that is not complementary to the target or template sequence.
- the 5' region of a primer may include a promoter sequence that is non-complementary to the target nucleic acid (referred to as a "promoter-primer").
- an amplification oligonucleotide that functions as a primer may be modified to include a 5' promoter sequence, and thus function as a promoter-primer.
- a promoter-primer may be modified by removal of, or synthesis without, a promoter sequence and still function as a primer.
- a 3' blocked amplification oligonucleotide may provide a promoter sequence and serve as a template for polymerization (referred to as a "promoter-provider").
- the term "primer” refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product that is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH).
- the primer is preferably single stranded for maximum efficiency in amplification, but may altematively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
- the primer is an oligodeoxyribonucleotide.
- the primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.
- probe refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, that is capable of hybridizing to at least a portion of another oligonucleotide of interest.
- a probe may be single-stranded or double-stranded. Probes are useful in the detection, identification and isolation of particular gene sequences.
- any probe used in the present invention will be labeled with any "reporter molecule,” so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
- isolated when used in relation to a nucleic acid, as in “an isolated oligonucleotide” or “isolated polynucleotide” refers to a nucleic acid sequence that is identified and separated from at least one component or contaminant with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids as nucleic acids such as DNA and RNA found in the state they exist in nature.
- a given DNA sequence e.g., a gene
- RNA sequences such as a specific mRNA sequence encoding a specific protein
- isolated nucleic acid encoding a given protein includes, by way of example, such nucleic acid in cells ordinarily expressing the given protein where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature.
- the isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single- stranded or double-stranded form.
- the oligonucleotide or polynucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or
- polynucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded).
- the term "purified” or “to purify” refers to the removal of components (e.g., contaminants) from a sample.
- antibodies are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind to the target molecule.
- the removal of non- immunoglobulin proteins and/or the removal of immunoglobulins that do not bind to the target molecule results in an increase in the percent of target-reactive immunoglobulins in the sample.
- recombinant polypeptides are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.
- Recurrent chromosomal translocations frequently underlie the pathogenesis of several hematopoietic malignancies and often define molecular subtypes with distinct biological behavior (see, e.g., Rowley JD, Nature reviews Cancer 2001 ; 1 :245-50; Mitelman F, et al, Nature reviews Cancer 2007;7:233-45). Frequently, these translocations target tyrosine kinases resulting in constitutive activation and promotion of oncogenesis (see, e.g., Greuber EK, et al., Nature reviews Cancer 2013; 13:559-71).
- Cutaneous CD30-positive LPD represents a clinicopathologic spectrum including lymphomatoid papulosis (LYP) and primary cutaneous anaplastic large cell lymphoma (ALCL) (see, e.g., Swerdlow SH, Campo, E., Harris, N.L., Jaffe, E.S., Pileri, S.A., Stein, H., Thiele, I, Vardiman, J.W, ed. WHO
- FISH studies provided evidence that TYK2 is targeted by translocation partners other than NPM1. Taken together, such results indicate TYK2 as a therapeutic target in the treatment of CD30-positive LPDs.
- kits, compositions and methods for cancer diagnosis, research and therapy including but not limited to, cancer markers.
- the present invention relates to recurrent gene fusions (e.g., recurrent translocations involving
- TYK2 as diagnostic markers and clinical targets for cutaneous CD30-positive
- lymphoproliferative disorders e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma.
- Embodiments of the present invention provide diagnostic, screening, research, and therapeutic methods for detecting, diagnosing and characterizing cancer (e.g., cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma)) based on the presence of gene fusions including TYK2 and a TYK2-gene-fusion-partner in a sample.
- cancer e.g., cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma)
- gene fusion comprises an intact catalytic domain in TYK2, although other regions are specifically encopossed by embodiments of the present invention.
- Such embodiments are not limited to a particular portion of a TYK2 gene.
- the portion of the TYK2 gene comprises any portion of TYK2 enables tyrosine kinase activity upon expression as a polypeptide. In some embodiments, the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises the entire C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises at least a portion of the TYK2 pseudokinase domain.
- the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2 and/or at least a portion (e.g., 1 %, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the TYK2 pseudokinase domain.
- the gene fusion is a NPM1 -TYK2 gene fusion.
- gene fusions comprise the oligomerization domain of NPMl and an intact catalytic domain in TYK2, although other regions are specifically encopossed by
- Such embodiments are not limited to a particular TYK2-gene-fusion-partner.
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide capable of having constitutively activated tyrosine kinase activity when expressed in a cell.
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell is capable of constitutively activating downstream targets of TYK2 (e.g., STAT1 , STAT3, STAT5) within the cell.
- TYK2 e.g., STAT1 , STAT3, STAT5
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell results in increased cellular proliferation of that cell.
- the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide, wherein 1) the polypeptide is capable of having constitutively activated tyrosine kinase activity when expressed in a cell, 2) expression of the polypeptide in a cell results in constitutive activation of downstream targets of TYK2 (e.g., STAT1, STAT3, STAT5), and 3) expression of the polypeptide in a cell results in increased cellular proliferation of the cell.
- TYK2 e.g., STAT1, STAT3, STAT5
- the TYK2-gene-fusion-partner is any portion of NPMl .
- the TYK2-gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the NPMl oligomerization domain. In some embodiments, the TYK2 -gene-fusion-partner comprises the entire NPMl oligomerization domain.
- the TYK2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the NPMl histone binding domains. In some embodiments, the TYK2-gene-fusion-partner comprises the entire NPMl histone binding domains. In some embodiments, the ⁇ 2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the distal portion of the NPMl DNA/RNA binding domains. In some embodiments, the TYK2-gene-fusion-partner comprises the entire distal portion of the NPM1 DNA/RNA binding domains.
- the TYK2-gene-fusion-partner comprises the entire NPM1 oligomerization domain, the entire NPM1 histone binding domain, and the entire distal portion of the NPM1 DNA/RNA binding domain.
- the NPM1-TYK2 gene fusion is a fusion between chromosome 5, exon 9 of NPM1 and chromosome 19, exon 15 of TYK2 (e.g., N5;T19).
- the gene fusion proteins of the present invention may be used as immunogens to produce antibodies having use in the diagnostic, research, and therapeutic methods described below.
- the antibodies may be polyclonal or monoclonal, chimeric, humanized, single chain or Fab fragments.
- Various procedures may be used for the production and labeling of such antibodies and fragments. See, e.g., Burns, ed., Immunochemical Protocols, 3 rd ed., Humana Press (2005); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988); Kozbor et al., Immunology Today 4: 72 (1983); Kohler and Milstein, Nature 256: 495 (1975).
- the present invention provides DNA, RNA and protein based diagnostic methods that either directly or indirectly detect the gene fusions.
- the present invention also provides compositions and kits for diagnostic purposes.
- the diagnostic methods of the present invention may be qualitative or quantitative.
- Quantitative diagnostic methods may be used, for example, to discriminate between indolent and aggressive cancers via a cutoff or threshold level. Where applicable, qualitative or quantitative diagnostic methods may also include amplification of target, signal or intermediary (e.g., a universal primer).
- An initial assay may confirm the presence of a gene fusion but not identify the specific fusion.
- a secondary assay is then performed to determine the identity of the particular fusion, if desired.
- the second assay may use a different detection technology than the initial assay.
- the gene fusions of embodiments of the present invention may be detected along with other markers in a multiplex or panel format. Markers are selected for their predictive value alone or in combination with the gene fusions. Markers for other cancers, diseases, infections, and metabolic conditions are also contemplated for includsion in a multiplex of panel format.
- diagnostic methods of embodiments of the present invention may also be modified with reference to data correlating particular gene fusions with the stage, aggressiveness or progression of the disease or the presence or risk of metastasis.
- the information provided by the methods of the present invention will assist a physician in choosing the best course of treatment for a particular patient.
- the sample may be tissue (e.g., a biopsy sample), blood, or a fraction thereof (e.g., plasma, serum, or cells).
- tissue e.g., a biopsy sample
- blood e.g., blood, or a fraction thereof (e.g., plasma, serum, or cells).
- the patient sample typically requires preliminary processing designed to isolate or enrich the sample for the gene fusions or cells that contain the gene fusions.
- a variety of techniques may be used for this purpose, including but not limited: centrifugation; immunocapture; cell lysis; and, nucleic acid target capture.
- the gene fusions of the present invention may be detected as chromosomal rearrangements of genomic DNA or chimeric mRNA using a variety of nucleic acid techniques, including but not limited to: nucleic acid sequencing; nucleic acid hybridization; and, nucleic acid amplification.
- nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing.
- chain terminator Sanger
- dye terminator sequencing Those of ordinary skill in the art will recognize that because RNA is less stable in the cell and more prone to nuclease attack experimentally RNA is usually reverse transcribed to DNA before sequencing.
- Chain terminator sequencing uses sequence-specific termination of a DNA synthesis reaction using modified nucleotide substrates. Extension is initiated at a specific site on the template DNA by using a short radioactive, fluorescent or other labeled, oligonucleotide primer complementary to the template at that region.
- the oligonucleotide primer is extended using a DNA polymerase, standard four deoxynucleotide bases, and a low concentration of one chain terminating nucleotide, most commonly a di-deoxynucleotide. This reaction is repeated in four separate tubes with each of the bases taking turns as the di-deoxynucleotide.
- the DNA polymerase Limited incorporation of the chain terminating nucleotide by the DNA polymerase results in a series of related DNA fragments that are terminated only at positions where that particular di-deoxynucleotide is used.
- the fragments are size-separated by electrophoresis in a slab polyacrylamide gel or a capillary tube filled with a viscous polymer. The sequence is determined by reading which lane produces a visualized mark from the labeled primer as you scan from the top of the gel to the bottom.
- Dye terminator sequencing alternatively labels the terminators. Complete sequencing can be performed in a single reaction by labeling each of the di-deoxynucleotide chain- terminators with a separate fluorescent dye, which fluoresces at a different wavelength.
- Some embodiments of the present invention utilize next generation or high- throughput sequencing.
- a variety of nucleic acid sequencing methods are contemplated for use in the methods of the present disclosure including, for example, chain terminator (Sanger) sequencing, dye terminator sequencing, and high-throughput sequencing methods.
- chain terminator (Sanger) sequencing e.g., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1997); Maxam et al, Proc. Natl. Acad. Sci. USA 74:560-564 (1977); Drmanac, et al., Nat. Biotechnol. 16:54-58 (1998); Kato, Int. J. Clin. Exp. Med.
- sequencing technology including, but not limited to, pyrosequencing, sequencing-by-ligation, single molecule sequencing, sequence-by-synthesis (SBS), massive parallel clonal, massive parallel single molecule SBS, massive parallel single molecule real-time, massive parallel single molecule real-time nanopore technology, etc.
- SBS sequence-by-synthesis
- massive parallel clonal massive parallel single molecule SBS
- massive parallel single molecule real-time massive parallel single molecule real-time nanopore technology
- a number of DNA sequencing techniques can be used including fluorescence-based sequencing methodologies (See, e.g., Birren et al, Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, N.Y.; herein incorporated by reference in its entirety).
- the technology finds use in automated sequencing techniques understood in that art.
- the present technology finds use in parallel sequencing of partitioned amplicons (PCT Publication No: WO2006084132 to Kevin McKernan et al, herein incorporated by reference in its entirety).
- the technology finds use in DNA sequencing by parallel oligonucleotide extension (See, e.g., U.S. Pat. No.
- NGS Next-generation sequencing
- NGS methods can be broadly divided into those that typically use template amplification and those that do not.
- Amplification-requiring methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform commercialized by Illumina, and the Supported Oligonucleotide Ligation and Detection (SOLiD) platform commercialized by Applied Biosystems.
- Non-amplification approaches also known as single-molecule sequencing, are exemplified by the HeliScope platform commercialized by Helicos Biosciences, and emerging platforms commercialized by VisiGen, Oxford Nanopore Technologies Ltd., Life Technologies/Ion Torrent, and Pacific Biosciences, respectively.
- template DNA is fragmented, end- repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors.
- Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonally amplified using a technique referred to as emulsion PCR.
- the emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent reporter such as luciferase.
- sequencing data are produced in the form of shorter-length reads.
- single- stranded fragmented DNA is end-repaired to generate 5'-phosphorylated blunt ends, followed by Klenow-mediated addition of a single A base to the 3' end of the fragments.
- A-addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with oligonucleotide anchors.
- the anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the "arching over" of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell.
- These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators.
- sequence of incorporated nucleotides is determined by detection of post-incorporation fluorescence, with each fluor and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run. Sequencing nucleic acid molecules using SOLiD technology (Voelkerding et al, Clinical Chem, 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol, 7: 287-296; U.S. Pat. No. 5,912,148; U.S. Pat. No.
- interrogation probes In the SOLiD system, interrogation probes have 16 possible combinations of the two bases at the 3' end of each probe, and one of four fluors at the 5' end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and fluor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output exceeds 4 billion bases per sequencing run.
- the technology finds use in nanopore sequencing (see, e.g., Astier et al, J. Am. Chem. Soc. 2006 Feb 8; 128(5): 1705-10, herein incorporated by reference).
- the theory behind nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore.
- As each base of a nucleic acid passes through the nanopore this causes a change in the magnitude of the current through the nanopore that is distinct for each of the four bases, thereby allowing the sequence of the DNA molecule to be determined.
- the technology finds use in HeliScope by Helicos
- Template DNA is fragmented and polyadenylated at the 3' end, with the final adenosine bearing a fluorescent label.
- Denatured polyadenylated template fragments are ligated to poly(dT) oligonucleotides on the surface of a flow cell.
- Initial physical locations of captured template molecules are recorded by a CCD camera, and then label is cleaved and washed away.
- Sequencing is achieved by addition of polymerase and serial addition of fluorescently-labeled dNTP reagents. Incorporation events result in fluor signal corresponding to the dNTP, and signal is captured by a CCD camera before each round of dNTP addition.
- Sequence read length ranges from 25-50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.
- the Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g., Science 327(5970): 1190 (2010); U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589,
- a microwell contains a template DNA strand to be sequenced. Beneath the layer of microwells is a hypersensitive ISFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry.
- a dNTP is incorporated into the growing complementary strand a hydrogen ion is released, which triggers a hypersensitive ion sensor. If homopolymer repeats are present in the template sequence, multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal.
- the per-base accuracy of the Ion Torrent sequencer is -99.6% for 50 base reads, with -100 Mb generated per run.
- the read-length is 100 base pairs.
- the accuracy for homopolymer repeats of 5 repeats in length is -98%.
- the benefits of ion semiconductor sequencing are rapid sequencing speed and low upfront and operating costs.
- the technology finds use in another nucleic acid sequencing approach developed by
- This sequencing process typically includes providing a daughter strand produced by a template-directed synthesis.
- the daughter strand generally includes a plurality of subunits coupled in a sequence
- the selectively cleavable bond(s) is/are cleaved to yield an Xpandomer of a length longer than the plurality of the subunits of the daughter strand.
- the Xpandomer typically includes the tethers and reporter elements for parsing genetic information in a sequence corresponding to the contiguous nucleotide sequence of all or a portion of the target nucleic acid. Reporter elements of the Xpandomer are then detected.
- capillary electrophoresis is utilized to analyze amplification fragments.
- nucleic acids e.g., the products of a PCR reaction
- High voltage is applied so that the fluorescent DNA fragments are separated by size and are detected by a laser/camera system.
- CE systems from Life Technogies are utilized for fragment sizing (See e.g., US 6706162, US8043493, each of which is herein incorporated by reference in its entirety).
- nucleic acid hybridization techniques include, but are not limited to, in situ hybridization (ISH), microarray, and Southern or Northern blot.
- ISH In situ hybridization
- DNA ISH can be used to determine the structure of chromosomes.
- RNA ISH is used to measure and localize mRNAs and other transcripts within tissue sections or whole mounts. Sample cells and tissues are usually treated to fix the target transcripts in place and to increase access of the probe. The probe hybridizes to the target sequence at elevated temperature, and then the excess probe is washed away.
- ISH can also use two or more probes, labeled with radioactivity or the other non-radioactive labels, to simultaneously detect two or more transcripts.
- fusion sequences are detected using fluorescence in situ hybridization (FISH).
- FISH fluorescence in situ hybridization
- the preferred FISH assays for the present invention utilize bacterial artificial chromosomes (BACs). These have been used extensively in the human genome sequencing project (see Nature 409: 953-958 (2001)) and clones containing specific BACs are available through distributors that can be located through many sources, e.g., NCBI. Each BAC clone from the human genome has been given a reference name that
- the detection assay is a FISH assay utilizing a probe for TYK2and7or a TYK2-gene-fusion- partner (e.g., NPM1).
- DNA microarrays e.g., cDNA microarrays and oligonucleotide microarrays
- protein microarrays e.g., cDNA microarrays and oligonucleotide microarrays
- tissue microarrays e.g., tissue microarrays
- transfection or cell microarrays e.g., cell microarrays
- chemical compound microarrays e.g., antibody microarrays.
- a DNA microarray commonly known as gene chip, DNA chip, or biochip, is a collection of microscopic DNA spots attached to a solid surface (e.g., glass, plastic or silicon chip) forming an array for the purpose of expression profiling or monitoring expression levels for thousands of genes simultaneously.
- the affixed DNA segments are known as probes, thousands of which can be used in a single DNA microarray.
- Microarrays can be used to identify disease genes by comparing gene expression in disease and normal cells.
- Microarrays can be fabricated using a variety of technologies, including but not limiting: printing with fine-pointed pins onto glass slides; photolithography using pre-made masks; photolithography using dynamic micromirror devices; ink-jet printing; or, electrochemistry on microelectrode arrays.
- Southern and Northem blotting is used to detect specific DNA or RNA sequences, respectively.
- DNA or RNA extracted from a sample is fragmented, electrophoretically separated on a matrix gel, and transferred to a membrane filter.
- the filter bound DNA or RNA is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected.
- a variant of the procedure is the reverse Northem blot, in which the substrate nucleic acid that is affixed to the membrane is a collection of isolated DNA fragments and the probe is RNA extracted from a tissue and labeled.
- PCR polymerase chain reaction
- RT-PCR reverse transcription polymerase chain reaction
- TMA transcription- mediated amplification
- LCR ligase chain reaction
- SDA strand displacement amplification
- NASBA nucleic acid sequence based amplification
- RNA be reversed transcribed to DNA prior to amplification e.g., RT-PCR
- other amplification techniques directly amplify RNA (e.g., TMA and NASBA).
- PCR The polymerase chain reaction (U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159 and 4,965,188, each of which is herein incorporated by reference in its entirety), commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of a target nucleic acid sequence.
- RT-PCR reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from mRNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA.
- cDNA complementary DNA
- TMA Transcription mediated amplification
- TMA optionally incorporates the use of blocking moieties, terminating moieties, and other modifying moieties to improve TMA process sensitivity and accuracy.
- the ligase chain reaction (Weiss, R., Science 254: 1292 (1991), herein incorporated by reference in its entirety), commonly referred to as LCR, uses two sets of complementary DNA oligonucleotides that hybridize to adjacent regions of the target nucleic acid. The DNA oligonucleotides are covalently linked by a DNA ligase in repeated cycles of thermal denaturation, hybridization and ligation to produce a detectable double-stranded ligated oligonucleotide product.
- SDA uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTPaS to produce a duplex hemiphosphorothioated primer extension product, endonuclease-mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3' end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product.
- thermophilic SDA uses thermophilic endonucleases and polymerases at higher temperatures in essentially the same method (EP Pat. No. 0 684 315).
- amplification methods include, for example: nucleic acid sequence based amplification (U.S. Pat. No. 5,130,238, herein incorporated by reference in its entirety), commonly referred to as NASBA; one that uses an RNA replicase to amplify the probe molecule itself (Lizardi et al., BioTechnol. 6: 1197 (1988), herein incorporated by reference in its entirety), commonly referred to as replicase; a transcription based amplification method (Kwoh et al, Proc. Natl. Acad. Sci. USA 86: 1173 (1989)); and, self-sustained sequence replication (Guatelli et al, Proc. Natl. Acad. Sci. USA 87: 1874 (1990), each of which is herein incorporated by reference in its entirety).
- amplification methods see Persing, David H., "In Vitro Nucleic Acid Amplification
- Non-amplified or amplified gene fusion nucleic acids can be detected by any means.
- the gene fusions can be detected by hybridization with a detectably labeled probe and measurement of the resulting hybrids.
- Illustrative non-limiting examples of detection methods are described below.
- One illustrative detection method, the Hybridization Protection Assay (HP A) involves hybridizing a chemiluminescent oligonucleotide probe (e.g., an acridinium ester-labeled (AE) probe) to the target sequence, selectively hydrolyzing the chemiluminescent label present on unhybridized probe, and measuring the chemiluminescence produced from the remaining probe in a luminometer.
- a chemiluminescent oligonucleotide probe e.g., an acridinium ester-labeled (AE) probe
- AE acridinium ester-labeled
- Another illustrative detection method provides for quantitative evaluation of the amplification process in real-time.
- Evaluation of an amplification process in "real-time” involves determining the amount of amplicon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined values to calculate the amount of target sequence initially present in the sample.
- a variety of methods for determining the amount of initial target sequence present in a sample based on real-time amplification including methods disclosed in U.S. Pat. Nos. 6,303,305 and 6,541,205, each of which is herein incorporated by reference in its entirety can be used.
- Another method for determining the quantity of target sequence initially present in a sample, but which is not based on a real-time amplification is disclosed in U.S. Pat. No. 5,710,029, herein
- Amplification products may be detected in real-time through the use of various self- hybridizing probes, most of which have a stem-loop structure.
- Such self-hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a target sequence.
- “molecular torches” are a type of self-hybridizing probe that includes distinct regions of self-complementarity (referred to as “the target binding domain” and “the target closing domain") which are connected by a joining region (e.g., non- nucleotide linker) and which hybridize to each other under predetermined hybridization assay conditions.
- molecular torches contain single-stranded base regions in the target binding domain that are from 1 to about 20 bases in length and are accessible for hybridization to a target sequence present in an amplification reaction under strand displacement conditions.
- hybridization of the two complementary regions, which may be fully or partially complementary, of the molecular torch is favored, except in the presence of the target sequence, which will bind to the single- stranded region present in the target binding domain and displace all or a portion of the target closing domain.
- the target binding domain and the target closing domain of a molecular torch include a detectable label or a pair of interacting labels (e.g., luminescent/quencher) positioned so that a different signal is produced when the molecular torch is self-hybridized than when the molecular torch is hybridized to the target sequence, thereby permitting detection of probe:target duplexes in a test sample in the presence of unhybridized molecular torches.
- a detectable label or a pair of interacting labels e.g., luminescent/quencher
- Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS).
- Molecular beacons are disclosed in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.
- probe binding pairs having interacting labels such as those disclosed in U.S. Pat. No. 5,928,862 (herein incorporated by reference in its entirety) might be adapted for use in the present invention.
- Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized in the present invention.
- Additional detection systems include "molecular switches," as disclosed in U.S. Publ. No. 20050042638, herein incorporated by reference in its entirety.
- Other probes, such as those comprising intercalating dyes and/or fluorochromes are also useful for detection of amplification products in the present invention. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).
- the gene fusions of the present invention may be detected as truncated or chimeric proteins using a variety of protein techniques, including but not limited to: protein sequencing; and, immunoassays.
- Illustrative non-limiting examples of protein sequencing techniques include, but are not limited to, mass spectrometry and Edman degradation.
- Mass spectrometry can, in principle, sequence any size protein but becomes computationally more difficult as size increases.
- a protein is digested by an endoprotease, and the resulting solution is passed through a high pressure liquid chromatography column. At the end of this column, the solution is sprayed out of a narrow nozzle charged to a high positive potential into the mass spectrometer. The charge on the droplets causes them to fragment until only single ions remain.
- the peptides are then fragmented and the mass- charge ratios of the fragments measured.
- the mass spectrum is analyzed by computer and often compared against a database of previously sequenced proteins in order to determine the sequences of the fragments. The process is then repeated with a different digestion enzyme, and the overlaps in sequences are used to construct a sequence for the protein.
- the peptide to be sequenced is adsorbed onto a solid surface (e.g., a glass fiber coated with polybrene).
- a solid surface e.g., a glass fiber coated with polybrene.
- phenylisothiocyanate is added to the adsorbed peptide, together with a mildly basic buffer solution of 12% trimethylamine, and reacts with the amine group of the N-terminal amino acid.
- the terminal amino acid derivative can then be selectively detached by the addition of anhydrous acid.
- the derivative isomerizes to give a substituted
- phenylthiohydantoin which can be washed off and identified by chromatography, and the cycle can be repeated.
- the efficiency of each step is about 98%, which allows about 50 amino acids to be reliably determined.
- immunoassays include, but are not limited to: immunoprecipitation; Western blot; ELISA; immunohistochemistry; immunocytochemistry; flow cytometry; and, immuno-PCR.
- Polyclonal or monoclonal antibodies detectably labeled using various techniques e.g., colorimetric, fluorescent, chemiluminescent or radioactive are suitable for use in the immunoassays.
- Immunoprecipitation is the technique of precipitating an antigen out of solution using an antibody specific to that antigen.
- the process can be used to identify protein complexes present in cell extracts by targeting a protein believed to be in the complex.
- the complexes are brought out of solution by insoluble antibody-binding proteins isolated initially from bacteria, such as Protein A and Protein G.
- the antibodies can also be coupled to sepharose beads that can easily be isolated out of solution.
- the precipitate can be analyzed using mass spectrometry, Western blotting, or any number of other methods for identifying constituents in the complex.
- a Western blot, or immunoblot is a method to detect protein in a given sample of tissue homogenate or extract. It uses gel electrophoresis to separate denatured proteins by mass.
- the proteins are then transferred out of the gel and onto a membrane, typically polyvinyldiflroride or nitrocellulose, where they are probed using antibodies specific to the protein of interest.
- a membrane typically polyvinyldiflroride or nitrocellulose
- researchers can examine the amount of protein in a given sample and compare levels between several groups.
- An ELISA short for Enzyme-Linked Immunosorbent Assay, is a biochemical technique to detect the presence of an antibody or an antigen in a sample. It utilizes a minimum of two antibodies, one of which is specific to the antigen and the other of which is coupled to an enzyme. The second antibody will cause a chromogenic or fluorogenic substrate to produce a signal. Variations of ELISA include sandwich ELISA, competitive ELISA, and ELISPOT. Because the ELISA can be performed to evaluate either the presence of antigen or the presence of antibody in a sample, it is a useful tool both for determining serum antibody concentrations and also for detecting the presence of antigen.
- Immunohistochemistry and immunocytochemistry refer to the process of localizing proteins in a tissue section or cell, respectively, via the principle of antigens in tissue or cells binding to their respective antibodies. Visualization is enabled by tagging the antibody with color producing or fluorescent tags.
- color tags include, but are not limited to, horseradish peroxidase and alkaline phosphatase.
- fluorophore tags include, but are not limited to, fluorescein isothiocyanate (FITC) or phycoerythrin (PE).
- Flow cytometry is a technique for counting, examining and sorting microscopic particles suspended in a stream of fluid. It allows simultaneous multiparametric analysis of the physical and/or chemical characteristics of single cells flowing through an
- a beam of light (e.g., a laser) of a single frequency or color is directed onto a hydrodynamically focused stream of fluid.
- a number of detectors are aimed at the point where the stream passes through the light beam; one in line with the light beam (Forward Scatter or FSC) and several perpendicular to it (Side Scatter (SSC) and one or more fluorescent detectors).
- FSC Forward Scatter
- SSC Segment Scatter
- Each suspended particle passing through the beam scatters the light in some way, and fluorescent chemicals in the particle may be excited into emitting light at a lower frequency than the light source.
- FSC correlates with the cell volume and SSC correlates with the density or inner complexity of the particle (e.g., shape of the nucleus, the amount and type of cytoplasmic granules or the membrane roughness).
- Immuno-polymerase chain reaction utilizes nucleic acid amplification techniques to increase signal generation in antibody-based immunoassays. Because no protein equivalence of PCR exists, that is, proteins cannot be replicated in the same manner that nucleic acid is replicated during PCR, the only way to increase detection sensitivity is by signal amplification.
- the target proteins are bound to antibodies which are directly or indirectly conjugated to oligonucleotides. Unbound antibodies are washed away and the remaining bound antibodies have their oligonucleotides amplified. Protein detection occurs via detection of amplified oligonucleotides using standard nucleic acid detection methods, including real-time methods.
- a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of a given marker or markers) into data of predictive value for a clinician.
- the clinician can access the predictive data using any suitable means.
- the present invention provides the further benefit that the clinician, who is not likely to be trained in genetics or molecular biology, need not understand the raw data.
- the data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject.
- the present invention contemplates any method capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information provides, medical personal, and subjects.
- a sample e.g., a biopsy or a serum sample
- a profiling service e.g., clinical lab at a medical facility, genomic profiling business, etc.
- any part of the world e.g., in a country different than the country where the subject resides or where the information is ultimately used
- the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves and directly send it to a profiling center.
- the sample comprises previously determined biological information
- the information may be directly sent to the profiling service by the subject (e.g., an information card containing the information may be scanned by a computer and the data transmitted to a computer of the profiling center using an electronic communication systems).
- the profiling service Once received by the profiling service, the sample is processed and a profile is produced (i.e., expression data), specific for the diagnostic or prognostic information desired for the subject.
- the profile data is then prepared in a format suitable for interpretation by a treating clinician.
- the prepared format may represent a diagnosis or risk assessment (e.g., likelihood of cancer being present) for the subject, along with recommendations for particular treatment options.
- the data may be displayed to the clinician by any suitable method.
- the profiling service generates a report that can be printed for the clinician (e.g., at the point of care) or displayed to the clinician on a computer monitor.
- the information is first analyzed at the point of care or at a regional facility.
- the raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient.
- the central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis.
- the central processing facility can then control the fate of the data following treatment of the subject. For example, using an electronic communication system, the central facility can provide data to the clinician, the subject, or researchers.
- the subject is able to directly access the data using the electronic communication system.
- the subject may chose further intervention or counseling based on the results.
- the data is used for research use.
- the data may be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease.
- the gene fusions of the present invention may also be detected using in vivo imaging techniques, including but not limited to: radionuclide imaging; positron emission tomography (PET); computerized axial tomography, X-ray or magnetic resonance imaging method, fluorescence detection, and chemiluminescent detection.
- in vivo imaging techniques are used to visualize the presence of or expression of cancer markers in an animal (e.g., a human or non-human mammal).
- cancer marker mRNA or protein is labeled using a labeled antibody specific for the cancer marker.
- a specifically bound and labeled antibody can be detected in an individual using an in vivo imaging method, including, but not limited to, radionuclide imaging, positron emission tomography, computerized axial tomography, X-ray or magnetic resonance imaging method, fluorescence detection, and chemiluminescent detection.
- an in vivo imaging method including, but not limited to, radionuclide imaging, positron emission tomography, computerized axial tomography, X-ray or magnetic resonance imaging method, fluorescence detection, and chemiluminescent detection.
- the in vivo imaging methods of the present invention are useful in the diagnosis of cancers that express the cancer markers of the present invention.
- In vivo imaging is used to visualize the presence of a marker indicative of the cancer. Such techniques allow for diagnosis without the use of an unpleasant biopsy.
- the in vivo imaging methods of the present invention are also useful for providing prognoses to cancer patients. For example, the presence of a marker indicative of cancers likely to metastasize can be detected.
- the in vivo imaging methods of the present invention can further be used to detect metastatic cancers in other parts of the body.
- reagents e.g., antibodies
- specific for the cancer markers of the present invention are fluorescently labeled.
- the labeled antibodies are introduced into a subject (e.g., orally or parenterally). Fluorescently labeled antibodies are detected using any suitable method (e.g., using the apparatus described in U.S. Pat. No. 6,198,107, herein incorporated by reference).
- antibodies are radioactively labeled.
- Sumerdon et al. (Nucl. Med. Biol 17:247-254 [1990] have described an optimized antibody-chelator for the radioimmunoscintographic imaging of tumors using Indium- 111 as the label.
- Griffin et al (J Clin One 9:631-640 [1991]) have described the use of this agent in detecting tumors in patients suspected of having recurrent colorectal cancer.
- Agents with paramagnetic ions as labels for magnetic resonance imaging can be utilized (Lauffer, Magnetic Resonance in Medicine 22:339-342 [1991]). The label used will depend on the imaging modality chosen.
- Radioactive labels such as Indium-I l l, Technetium-99m, or Iodine-131 can be used for planar scans or single photon emission computed tomography (SPECT).
- Positron emitting labels such as Fluorine- 19 can also be used for positron emission tomography (PET).
- PET positron emission tomography
- paramagnetic ions such as Gadolinium (III) or Manganese (II) can be used.
- Radioactive metals with half-lives ranging from 1 hour to 3.5 days are available for conjugation to antibodies, such as scandium-47 (3.5 days) gallium-67 (2.8 days), gallium-68 (68 minutes), technetiium-99m (6 hours), and indium-111 (3.2 days), of which gallium-67, technetium-99m, and indium-111 are preferable for gamma camera imaging, gallium-68 is preferable for positron emission tomography.
- a useful method of labeling antibodies with such radiometals is by means of a bifunctional chelating agent, such as diethylenetriaminepentaacetic acid (DTP A), as described, for example, by Khaw et al. (Science 209:295 [1980]) for In-I l l and Tc-99m, and by Scheinberg et al. (Science 215: 1511 [1982]).
- DTP A diethylenetriaminepentaacetic acid
- Other chelating agents may also be used, but the l-(p-carboxymethoxybenzyl)EDTA and the carboxy carbonic anhydride of DTP A are advantageous because their use permits conjugation without affecting the antibody's immunoreactivity substantially.
- Another method for coupling DPTA to proteins is by use of the cyclic anhydride of DTP A, as described by Hnatowich et al. (Int. J. Appl. Radiat. Isot. 33:327 [1982]) for labeling of albumin with In-111, but which can be adapted for labeling of antibodies.
- a suitable method of labeling antibodies with Tc-99m which does not use chelation with DPTA is the pretinning method of Crockford et al., (U.S. Pat. No. 4,323,546, herein incorporated by reference).
- a preferred method of labeling immunoglobulins with Tc-99m is that described by Wong et al. (Int. J. Appl. Radiat. Isot., 29:251 [1978]) for plasma protein, and recently applied successfully by Wong et al. (J. Nucl. Med., 23:229 [1981]) for labeling antibodies.
- radiometals conjugated to the specific antibody it is likewise desirable to introduce as high a proportion of the radiolabel as possible into the antibody molecule without destroying its immunospecificity.
- a further improvement may be achieved by effecting radiolabeling in the presence of the specific cancer marker of the present invention, to insure that the antigen binding site on the antibody will be protected. The antigen is separated after labeling.
- in vivo biophotonic imaging (Xenogen, Almeda, CA) is utilized for in vivo imaging.
- This real-time in vivo imaging utilizes luciferase.
- the luciferase gene is incorporated into cells, microorganisms, and animals (e.g., as a fusion protein with a cancer marker of the present invention). When active, it leads to a reaction that emits light.
- a CCD camera and software is used to capture the image and analyze it.
- compositions for use in the diagnostic methods of the present invention include, but are not limited to, probes, amplification oligonucleotides, and antibodies. Particularly preferred compositions detect a product only when a gene fusion of TYK2 and a TYK2-gene- fusion-partner (e.g., NPMl) is present in a sample (e.g., NPM1-TYK2).
- a gene fusion of TYK2 and a TYK2-gene- fusion-partner e.g., NPMl
- a sample e.g., NPM1-TYK2
- the compositions include a single labeled probe comprising a sequence that hybridizes to the junction at which a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl) fuses to a 3' portion from a TYK2 gene (i.e., spans the gene fusion junction).
- the compositions include a pair of amplification oligonucleotides wherein the first amplification oligonucleotide comprises a sequence that hybridizes to a TYK2-gene- fusion-partner (e.g., NPM1) and the second amplification oligonucleotide comprises a sequence that hybridizes to TYK2 gene.
- the compositions include an antibody to a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1).
- compositions include: a pair of labeled probes wherein the first labeled probe comprises a sequence that hybridizes to a TYK2-gene-fusion-partner (e.g., NPM1) and a second labeled probe comprises a sequence that hybridizes to an TYK2 gene.
- a TYK2-gene-fusion-partner e.g., NPM1
- a second labeled probe comprises a sequence that hybridizes to an TYK2 gene.
- compositions alone or in combination with other compositions of the present invention, may be provided in the form of a kit.
- the single labeled probe and pair of amplification oligonucleotides may be provided in a kit for the
- Kits may further comprise appropriate controls and/or detection reagents.
- the probe and antibody compositions of the present invention may also be provided in the form of an array.
- the present invention provides drug screening assays (e.g., to screen for anticancer drugs).
- the screening methods of the present invention utilize cancer markers identified using the methods of the present invention (e.g., including but not limited to gene fusions between TYK2 and a TYK2-gene-fusion-partner (e.g., NPM1)).
- the present invention provides methods of screening for compounds that alter (e.g., decrease) the expression of cancer marker genes.
- the compounds or agents may interfere with transcription, by interacting, for example, with the promoter region.
- the compounds or agents may interfere with mRNA produced from the fusion (e.g., by RNA interference, antisense technologies, etc.).
- candidate compounds may interfere with pathways that are upstream or downstream of the biological activity of the fusion.
- candidate compounds are antisense or interfering RNA agents (e.g., oligonucleotides) directed against cancer markers.
- candidate compounds are antibodies or small molecules that specifically bind to a cancer marker regulator or expression products of the present invention and inhibit its biological function.
- candidate compounds are evaluated for their ability to alter cancer marker expression by contacting a compound with a cell expressing a cancer marker and then assaying for the effect of the candidate compounds on expression.
- the effect of candidate compounds on expression of a cancer marker gene is assayed for by detecting the level of cancer marker mRNA expressed by the cell. mRNA expression can be detected by any suitable method.
- the effect of candidate compounds on expression of cancer marker genes is assayed by measuring the level of polypeptide encoded by the cancer markers. The level of polypeptide expressed can be measured using any suitable method, including but not limited to, those disclosed herein.
- the present invention provides screening methods for identifying modulators, i.e., candidate or test compounds or agents (e.g., proteins, peptides,
- peptidomimetics, peptoids, small molecules or other drugs which bind to cancer markers of the present invention, have an inhibitory (or stimulatory) effect on, for example, cancer marker expression or cancer marker activity, or have a stimulatory or inhibitory effect on, for example, the expression or activity of a cancer marker substrate.
- Compounds thus identified can be used to modulate the activity of target gene products (e.g., cancer marker genes) either directly or indirectly in a therapeutic protocol, to elaborate the biological function of the target gene product, or to identify compounds that disrupt normal target gene interactions.
- cancer markers that inhibit the activity or expression of cancer markers are useful in the treatment of proliferative disorders, e.g., cancer, particularly cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
- proliferative disorders e.g., cancer, particularly cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
- the invention provides assays for screening candidate or test compounds that are substrates of a cancer marker protein or polypeptide or a biologically active portion thereof. In another embodiment, the invention provides assays for screening candidate or test compounds that bind to or modulate the activity of a cancer marker protein or polypeptide or a biologically active portion thereof.
- test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods, including biological libraries;
- peptoid libraries libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone, which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckennann et al, J. Med. Chem. 37: 2678-85
- the present invention provides therapies for cancer (e.g., cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma)).
- therapies directly or indirectly target cancer markers (e.g., including but not limited to, gene fusions between TYK2 and a TYK2-gene-fusion-partner (e.g., NPM1).
- the present invention targets the expression of cancer markers.
- the present invention employs compositions comprising oligomeric antisense or RNAi compounds, particularly oligonucleotides (e.g., those identified in the drug screening methods described above), for use in modulating the function of nucleic acid molecules encoding cancer markers of the present invention, ultimately modulating the amount of cancer marker expressed.
- oligomeric antisense or RNAi compounds particularly oligonucleotides (e.g., those identified in the drug screening methods described above)
- oligonucleotides e.g., those identified in the drug screening methods described above
- RNA Interference RNA Interference
- RNAi is utilized to inhibit fusion protein function.
- RNAi represents an evolutionary conserved cellular defense for controlling the expression of foreign genes in most eukaryotes, including humans.
- RNAi is typically triggered by double- stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of single-stranded target RNAs homologous in response to dsRNA.
- the mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), which are normally produced from long dsRNA by enzymatic cleavage in the cell.
- siRNAs are generally approximately twenty-one nucleotides in length (e.g.
- RNAi oligonucleotides are designed to target the junction region of fusion proteins.
- siRNAs Chemically synthesized siRNAs have become powerful reagents for genome-wide analysis of mammalian gene function in cultured somatic cells. Beyond their value for validation of gene function, siRNAs also hold great potential as gene-specific therapeutic agents (Tuschl and Borkhardt, Molecular Intervent. 2002; 2(3): 158-67, herein incorporated by reference).
- siRNAs are extraordinarily effective at lowering the amounts of targeted RNA, and by extension proteins, frequently to undetectable levels.
- the silencing effect can last several months, and is extraordinarily specific, because one nucleotide mismatch between the target RNA and the central region of the siRNA is frequently sufficient to prevent silencing (Brummelkamp et al, Science 2002; 296:550-3; and Holen et al, Nucleic Acids Res. 2002; 30: 1757-66, both of which are herein incorporated by reference).
- siRNAs An important factor in the design of siRNAs is the presence of accessible sites for siRNA binding.
- Bahoia et al (J. Biol. Chem, 2003; 278: 15991-15997; herein incorporated by reference) describe the use of a type of DNA array called a scanning array to find accessible sites in mRNAs for designing effective siRNAs.
- These arrays comprise oligonucleotides ranging in size from monomers to a certain maximum, usually Comers, synthesized using a physical barrier (mask) by stepwise addition of each base in the sequence. Thus the arrays represent a full oligonucleotide complement of a region of the target gene.
- Hybridization of the target mRNA to these arrays provides an exhaustive accessibility profile of this region of the target mRNA. Such data are useful in the design of antisense oligonucleotides (ranging from 7mers to 25mers), where it is important to achieve a compromise between
- oligonucleotide length and binding affinity to retain efficacy and target specificity (Sohail et al, Nucleic Acids Res., 2001 ; 29(10): 2041- 2045). Additional methods and concerns for selecting siRNAs are described for example, in WO 05054270, WO05038054A1,
- fusion protein expression is modulated using antisense compounds that specifically hybridize with one or more nucleic acids encoding cancer markers of the present invention.
- the specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds that specifically hybridize to it is generally referred to as "antisense.”
- the functions of DNA to be interfered with include replication and transcription.
- RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity that may be engaged in or facilitated by the RNA.
- the overall effect of such interference with target nucleic acid function is modulation of the expression of cancer markers of the present invention.
- modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. For example, expression may be inhibited to potentially prevent tumor proliferation.
- Targeting an antisense compound to a particular nucleic acid is a multistep process.
- the process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
- the target is a nucleic acid molecule encoding a cancer marker of the present invention.
- the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
- Chimeric antisense compounds of the present invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above.
- the present invention also includes pharmaceutical compositions and formulations that include the antisense compounds of the present invention as described below.
- the present invention contemplates the use of any genetic manipulation for use in modulating the expression of cancer markers of the present invention.
- genetic manipulation include, but are not limited to, gene knockout (e.g., removing the fusion gene from the chromosome using, for example, recombination), expression of antisense constructs with or without inducible promoters, and the like.
- Delivery of nucleic acid construct to cells in vitro or in vivo may be conducted using any suitable method.
- a suitable method is one that introduces the nucleic acid construct into the cell such that the desired event occurs (e.g., expression of an antisense construct).
- Genetic therapy may also be used to deliver siRNA or other interfering molecules that are expressed in vivo (e.g., upon stimulation by an inducible promoter).
- Plasmids carrying genetic information into cells are achieved by any of various methods including, but not limited to, directed injection of naked DNA constructs, bombardment with gold particles loaded with said constructs, and macromolecule mediated gene transfer using, for example, liposomes, biopolymers, and the like.
- Preferred methods use gene delivery vehicles derived from viruses, including, but not limited to, adenoviruses, retroviruses, vaccinia viruses, and adeno-associated viruses. Because of the higher efficiency as compared to retroviruses, vectors derived from adenoviruses are the preferred gene delivery vehicles for transferring nucleic acid molecules into host cells in vivo.
- Adenoviral vectors have been shown to provide very efficient in vivo gene transfer into a variety of solid tumors in animal models and into human solid tumor xenografts in immune-deficient mice. Examples of adenoviral vectors and methods for gene transfer are described in PCT publications WO 00/12738 and WO 00/09675 and U.S. Pat. Appl. Nos. 6,033,908, 6,019,978, 6,001,557, 5,994,132, 5,994,128, 5,994,106, 5,981,225, 5,885,808, 5,872,154, 5,830,730, and 5,824,544, each of which is herein incorporated by reference in its entirety.
- Vectors may be administered to subject in a variety of ways.
- vectors are administered into tumors or tissue associated with tumors using direct injection.
- administration is via the blood or lymphatic circulation (See e.g., PCT publication 99/02685 herein incorporated by reference in its entirety).
- Exemplary dose levels of adenoviral vector are preferably 10 s to 10 11 vector particles added to the perfusate.
- the present invention provides antibodies that target cells that express a cancer marker of the present invention (e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1)).
- a cancer marker of the present invention e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1).
- Any suitable antibody e.g., monoclonal, polyclonal, or synthetic
- the antibodies used for cancer therapy are humanized antibodies. Methods for humanizing antibodies can be utilized (See e.g., U.S. Pat. Nos. 6,180,370, 5,585,089, 6,054,297, and 5,565,332; each of which is herein incorporated by reference).
- the therapeutic antibodies comprise an antibody generated against a cancer marker of the present invention (e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1)), wherein the antibody is conjugated to a cytotoxic agent.
- a cancer marker of the present invention e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1)
- a tumor specific therapeutic agent is generated that does not target normal cells, thus reducing many of the detrimental side effects of traditional chemotherapy.
- the therapeutic agents will be pharmacologic agents that will serve as useful agents for attachment to antibodies, particularly cytotoxic or otherwise anticellular agents having the ability to kill or suppress the growth or cell division of endothelial cells.
- the present invention contemplates the use of any pharmacologic agent that can be conjugated to an antibody, and delivered in active form.
- exemplary anticellular agents include chemotherapeutic agents, radioisotopes, and cytotoxins.
- the therapeutic antibodies of the present invention may include a variety of cytotoxic moieties, including but not limited to, radioactive isotopes (e.g., iodine-131, iodine- 123, technicium-99m, indium-I l l, rhenium-188, rhenium-186, gallium-67, copper-67, yttrium-90, iodine-125 or astatine-211), hormones such as a steroid, antimetabolites such as cytosines (e.g., arabinoside, fluorouracil, methotrexate or aminopterin; an anthracycline; mitomycin C), vinca alkaloids (e.g., demecolcine; etop
- agents such as a coagulant, a cytokine, growth factor, bacterial endotoxin or the lipid A moiety of bacterial endotoxin.
- therapeutic agents will include plant-, fungus- or bacteria-derived toxin, such as an A chain toxins, a ribosome inactivating protein, a-sarcin, aspergillin, restrictocin, a ribonuclease, diphtheria toxin or pseudomonas exotoxin, to mention just a few examples.
- deglycosylated ricin A chain is utilized.
- agents such as these may, if desired, be successfully conjugated to an antibody, in a manner that will allow their targeting, internalization, release or presentation to blood components at the site of the targeted tumor cells as required using conjugation technology (See, e.g., Ghose et al, Methods Enzymol., 93:280 [1983]).
- the present invention provides immunotoxins targeted to a cancer marker of the present invention (e.g., a gene fusion between TYK2 and a TYK2-gene-fusion-partner (e.g., NPM1)).
- Immunotoxins are conjugates of a specific targeting agent typically a tumor-directed antibody or fragment, with a cytotoxic agent, such as a toxin moiety.
- the targeting agent directs the toxin to, and thereby selectively kills, cells carrying the targeted antigen.
- therapeutic antibodies employ crosslinkers that provide high in vivo stability (Thorpe et al, Cancer Res., 48:6396 [1988]).
- antibodies are designed to have a cytotoxic or otherwise anticellular effect against the tumor vasculature, by suppressing the growth or cell division of the vascular endothelial cells. This attack is intended to lead to a tumor-localized vascular collapse, depriving the tumor cells, particularly those tumor cells distal of the vasculature, of oxygen and nutrients, ultimately leading to cell death and tumor necrosis.
- antibody based therapeutics are formulated as pharmaceutical compositions as described below.
- administration of an antibody composition of the present invention results in a measurable decrease in cancer (e.g., decrease or elimination of tumor).
- the present invention further provides pharmaceutical compositions (e.g., comprising pharmaceutical agents that modulate the expression or activity of gene fusions of the present invention (e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g.,
- compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets.
- Thickeners flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
- compositions of the present invention may be prepared according to techniques such as, for example, bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s).
- the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- the pharmaceutical compositions may be formulated and used as foams.
- Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
- cationic lipids such as lipofectin (U. S. Pat. No. 5,705, 188), cationic glycerol derivatives, and poly cationic molecules, such as polylysine (WO 97/30731), also enhance the cellular uptake of oligonucleotides.
- compositions of the present invention may additionally contain other adjunct components found in pharmaceutical compositions.
- the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the
- compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
- compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents that function by a non-antisense mechanism.
- chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan,
- cyclophosphamide 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES).
- Anti-inflammatory drugs including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids
- antiviral drugs including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention.
- Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
- Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved.
- Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. The administering physician can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50S found to be effective in in vitro and in vivo animal models or based on the examples described herein.
- dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly.
- the treating physician can estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
- This example describes the methods for Examples 2 and 3.
- RNAseq RNA was isolated from the MyLa cell lines using RNeasy kit from Qiagen (Valencia, CA, USA) and quantitated using the Agilent 2100 bio-analyzer (Agilent Biotechnologies, Santa Clara, CA, USA). Samples with RNA integrity score (RIN) >6 were used for preparing cDNA libraries for transcriptome sequencing. Paired-end libraries for sequencing with Illumina Genome Analyzer II were prepared according to the protocol provided by Illumina, with minor modifications, with the mRNA-seq sample prep kit (Illumina). Sequence analysis was carried out using a combination of custom designed bioinformatics tools and Chimerascan (see, e.g., Iyer MK, Bioinformatics 2011 ;27:2903-4).
- Clinical information was available for four of the seven patients demonstrating TYK2 translocations, including 1 patient with NPMl-TYK2 fusion (Fig. 1).
- the patient with NPM1-TYK2 fusion presented at the age of 71 with localized disease diagnosed as LYP.
- Phototherapy resulted in 6 years of remission.
- the patient's disease recurred and was controlled with methotrexate.
- Another patient presented at the age of 40 with localized disease diagnosed as LYP.
- Her disease was currently controlled with methotrexate.
- the fourth patient was diagnosed with LYP at the age of 31 which progressed to cutaneous ALCL.
- the patient received radiation and methotrexate with stable disease.
- no difference in clinical behavior or presentation was discernable between cases with and without a TYK2 rearrangement.
- Fluorescence in situ hybridization (FISH) Interphase FISH was performed to assess for TYK2 rearrangements and for specific NPM1-TYK2 fusions. Fluorescently labeled BAC clones were purchased from Empire Genomics, Buffalo, NY, USA. Tissue microarrays containing clinical samples were sectioned at 4 ⁇ and deparaffinized. The deparaffinized tissue microarray and cytospin slides of MyLa cells were hybridized with the probes overnight and assessed by fluorescent microscopy.
- BAC clones used for FISH included TYK2 probes: RP11-177J4 labeled with ROX (5' of TYK2), RP11-347E20, labeled with fluorescein (3' of TYK2) and NPMl probe RP11-1072120, labeled with ROX (5' of NPM1).
- Quantitative real time polymerase chain reaction (qRT-PCR) validation Reverse transcription ⁇ g of total RNA was used for preparation of cDNA using Superscript II reverse transcription kit (Life Technologies, Grand Island, NY, USA). The final product was diluted to ⁇ in nuclease free water. ⁇ of this diluted cDNA was used for quantitative real-time polymerase chain reaction (qRT-PCR) analyses. SYBR green assay. qRT-PCR was performed using Power SYBR Green Mastermix
- NPM-TYK2 Q Fl 5'ACTCAAAACCATCATCAACACCA3' (SEQ ID NO: 1)
- NPM-TYK2 Q Rl 5 ' GTTCCGGCC AC AC AC ATTAC3 ' (SEQ ID NO: 2)
- NPM1-TYK2 fusion chimera was amplified from MyLa T-cell line using two different primer sets for NPM1 and TYK2.
- the primers were designed to amplify across the fusion chimera generating two different amplicons (175 bp and 468 bp) using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA) followed by conventional Sanger sequencing technology using BigDye version 3.1 chemistry run on an Applied Biosystems 3730x1 DNA Sequencer.
- the PCR products were separated on a 1% agarose gel, bands excised and purified for Sanger sequencing.
- Genomic PCR for genomic breakpoint mapping To identify the genomic break point in the index NPM1-TYK2 fusion event, a series of forward primers were designed that spanned from last exon of NPM1 present in NPM1-TYK2 fusion to the end of the following intron. Similarly, reverse primers were designed to span the region between the first exon of TYK2 in NPM1-TYK2 through the entire intron proximal to the exon. Genomic DNA was isolated from MyLa and HH cells using QIAamp DNA extraction kit (Valencia, CA, USA). 40ng of genomic DNA was used as template for performing genomic PCR using High Fidelity Phusion DNA Polymerase.
- NPM1-TYK2 full length fusion gene was amplified from MyLa cell line using high fidelity Phusion DNA polymerase.
- the amplified gene product was then cloned into pLentilox IRES GFP mammalian expression Lenti virus vector (University of Michigan Vector Core, MI, USA) between Xhol and Xbal restriction sites.
- FLAG sequences were artificially introduced at the N-terminal end of the gene by PCR.
- NPM1- TYK2 K462R kinase dead mutant (see, e.g., Gauzzi MC, et al, The Journal of biological chemistry 1996;271 :20494-500was generated by performing site directed mutagenesis PCR using mutant primers and wild type NPM1-TYK2 gene as template. Sequence verified clones were transfected into HEK293FT cells and checked for expression of fusion protein after 48hrs post transfection using Poly Jet (SignaGen, Rockville, MD, USA). Cell culture The hematological cell lines used for such experiments were stocked and
- HEK293FT cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). T-cell derived cell lines were maintained in RPMI-1640 medium supplemented with 20% FBS, L-glutamine and penicillin/streptomycin (Thermo Scientific, Waltham, MA, USA). HEK293FT cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10%FBS, glutamine and penicillin/streptomycin. Stable TYK2 knockdown MyLa cell lines were generated by transducing the lentivirus supernatant containing shRNAs for TYK2 and selecting them with puromycin ( ⁇ g/mL) for 48hrs post transduction.
- DMEM Dulbecco's modified Eagle's medium
- Stable TYK2 knockdown MyLa cell lines were generated by transducing the lentivirus supernatant containing shRNAs for TYK2 and selecting them with puromycin ( ⁇ g/mL
- the levels of pSTATl, pSTAT3, pSTAT5 and pTYK2 were analysed in cell lines after treating them with ImM activated Na3V04 for lhr prior harvesting.
- the lysates used in the immunoblotting experiments were prepared from the cell lines using RIPA buffer containing 50mM Tris HC1, pH 7.4; 1% NP-40; 0.25% Na- deoxycholate; 150mM NaCl; ImM PMSF; ImM EDTA; lmM Na 3 V0 4 ; lmM NaF; and 0.1% SDS.
- the samples were incubated on ice for 30 min followed by centrifugation at 10,000x for 15 min.
- the protein content of the supematants was estimated using a protein BCA assay kit (Pierce protein research products, Rockford, IL, USA). 20 ⁇ g of protein extract was separated on a high resolution SDS PAGE using MES SDS running buffer, and analyzed for expression of proteins by immunoblotting using antibodies specific for monoclonal ANTI- FLAG M2 (clone M2) antibody (Sigma, St. Louis, MO, USA).
- pSTATl (Y701), STAT1, pSTAT3 (Y705), STAT3, pSTAT5 (Y694), STAT5, pTYK2 (Y1054/55) and TYK2 antibodies were purchased from Cell Signaling Technologies (Beverly, MA, USA) and used in our study.
- Stable knockdown of TYK2 expression in MyLa Lenti-viral mediated gene transduction was performed as described earlier (see, e.g., Sahasrabuddhe AA, et al, Oncogene 2014). Briefly, 293FT cells were co-transfected with lentiviral construct and packaging vectors (Invitrogen). Virus-producing supernatant was harvested 48 h after transfection and supplemented with polybrene and used to infect MyLa cells.
- Lentiviral mission shRNA constructs targeting different region of TYK2 (TRCN0000003123- 5 ' CGTGAGCCTAACCATGATCTT3 ' (SEQ ID NO: 5) and TRCN0000320620- 5 ' GAGTGCCTGAAGGAGTATAAG3 ' (SEQ ID NO: 6)) and Vector control (SHC201) were purchased from Sigma (St.Louis, MO, USA).
- Cell proliferation assay was performed using water soluble tetrazolium-1 (WST-1) procured from Roche Applied Sciences, Indianapolis, IN, USA, based on manufacturer's protocol (see, e.g., McDonnell SR, et al., Oncogene 2011). Briefly, equal numbers of cells were plated in 96-well plates with growth media and ⁇ of WST-1 reagent was added at different time intervals (0, 12, 36, 48 hours). After addition of WST-1 reagent, the plates were incubated at 37 ° C in an incubator with 5% CO2 for 2 hours.
- WST-1 water soluble tetrazolium-1
- the intensities of the color developed in each well was determined by measuring the absorbance at 440nm. The assay was performed in triplicate for all the samples at each time point.
- Genomic DNA was extracted using both the QIAGEN BioRobot EZ1 and QIAamp FFPE DNA extraction kits (QIAGEN).
- QIAGEN QIAGEN BioRobot EZ1 and QIAamp FFPE DNA extraction kits
- PCR amplification was performed using Phusion DNA polymerase (New England Biolabs) followed by conventional Sanger sequencing technology using BigDye version 3.1 chemistry run on an Applied Biosystems 3730x1 DNA Sequencer at the University of Michigan DNA sequencing Core. All sequencing reactions were performed using nested sequencing primers. Sequencing trace analysis was performed using Mutation Surveyor software. All mutations were verified in at least two independent PCR amplification and sequencing reactions.
- Y701 phospho-STATl clone 58D6, rabbit monoclonal IgG
- Y705 phospho-SATA3 mouse monoclonal IgGl, clone M9C6
- Y694/Y 699 phospho-STAT5 monoclonal antibody goat anti-mouse IgG
- the secondary antibodies were Alexa-conjugated donkey anti-rabbit IgG or Alexa- conjugated goat anti-mouse IgG (Alexa594, Life Technologies).
- Coverslips were mounted on standard slides with mounting media supplemented with 4', 6'-diamidino-2-phenylindole (DAPI). The images were captured and recorded using an Olympus BX-51 upright light microscope equipped with an Olympus DP-70 camera.
- DAPI 6'-diamidino-2-phenylindole
- FISH Hybridization
- RNA sequencing analysis of MyLa revealed 803 total fragments representing a chimeric fusion between the N-terminal region of NPMl and the C-terminal region of TYK2 (Fig. 2A, upper panel; Fig. 3).
- RT-PCR analysis confirmed high levels and exclusive expression of the NPM1-TYK2 RNA chimera in MyLa, but not in 11 other hematological cell lines (Fig. 4; Fig. 5).
- the fusion occurred at NPMl NM_002520 c.1016 (exon 9) and TYK2 NM_003331 c.2554 (exon 16) and was confirmed by Sanger sequencing (Fig. 2 A, lower panel).
- the fusion gene was predicted to yield a product comprising the entire oligomerization, histone binding domains and the distal portion of the DNA/RNA binding domains of NPMl and a small portion of the TYK2 pseudokinase domain and the entire C-terminal kinase domain (Fig. 2B).
- chrl9 10,469,817 in the TYK2 gene (Fig. 1C; Fig. ID; Fig. 6).
- TYK2 break-apart and NPM1-TYK2 fusion FISH assays confirmed the presence of the NPM1-TYK2 rearrangement in MyLa (Fig. 2E).
- the pTYK2 (Y1054/1055) levels in the NPMl -TYK2 -positive My La cell line and in other T-cell lines were evaluated, and confirmed high levels of pTYK2 in only MyLa indicating constitutive activation of TYK2 kinase (Fig. 7A).
- western blot analysis for NPMl and total TYK2 demonstrates the presence of a fusion protein (81kD) supporting the expression of the NPM1-TYK2 fusion protein.
- immunostaining for NPMl in NPM1-TYK2 fusion positive cases revealed cytoplasmic reactivity and mislocalization of NPMl, a predominantly nuclear protein, indicating abnormal subcellular localization (Fig. 8).
- NPM1-TYK2 and NPM1-TYK2 (K462R) kinase-defective mutant proteins were ectopically expressed in HEK293FT cells.
- Expression of NPM1-TYK2 protein demonstrated constitutive TYK2 autophosphorylation whereas the kinase-defective NPM1- TYK2 (K462R) mutant completely abolished its phosphorylation (Fig. 7C).
- pSTATl, pSTAT3 and pSTAT5 were induced by the kinase-active NPM1-TYK2 while the kinase-defective NPM1-TYK2 (K462R) mutant completely abrogated their phosphorylation.
- NPM1-TYK2 The oncogenic potential of NPM1-TYK2 was further assessed by examining the effect of TYK2 knockdown on STATl/3/5 activation and cell proliferation.
- Lentivirus-based shRNA-mediated knockdown of TYK2 in MyLa resulted in decreased pSTATl, pSTAT3 and pSTAT5 without affecting their total protein levels (Fig. 7E).
- a significant decrease (2.2 fold) in cell proliferation was observed compared to vector control (P ⁇ 0.01) (Fig. 7F).
- the following primers are used for cloning in pCAGGS:
- the following primers are used for cloning in plentilox IRES
- NPM1 xhol flag F AActcgagATGGACTACAAGGACGACGATGACAAGGAAGATTCGATGGACATGGAC ATGAGCCC (SEQ ID NO: 9)
- the following PCR primers are used for PCR amplification for sequencing a NPM1-TYK2 gene fusion:
- the following primers are used for NPM1-TYK2 Q-PCR: NPM-TYK2 Q Fl
- GCCAGGATCACTCAGCTTGA SEQ ID NO: 16
- NPM1-TYK2 Q-PCR yields the following sequencing result:
- the NPM1-TYK2 gene fusion break point on sequending is provided: Gtgagtaaagttatcttaaaaaaactttgtctcccctcaaattgcacgt
- primers are provided:
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Provided herein are kits, compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to recurrent gene fusions (e.g., recurrent translocations involving TYK2) as diagnostic markers and clinical targets for cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
Description
RECURRENT GENE FUSIONS IN CUTANEOUS CD30-POSITTVE
LYMPHOPROLIFERATIVE DISORDERS
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims the priority benefit of U.S. Provisional Patent
Application 62/110,034, filed January 30, 2015, which is incorporated by reference in its entirety.
FIELD OF THE INVENTION
Provided herein are kits, compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to recurrent gene fusions (e.g., recurrent translocations involving TYK2) as diagnostic markers and clinical targets for cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
BACKGROUND OF THE INVENTION
Lymphoproliferative disorders (LPDs) refer to several conditions in which lymphocytes are produced in excessive quantities. They typically occur in patients who have compromised immune systems. Examples of LPDs include, but are not limited to, follicular lymphoma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, hairy cell leukemia, lymphomas, multiple myeloma, Waldenstrom's macroglobulinemia, Wiskott- Aldrich syndrome, post-transplant lymphoproliferative disorder, autoimmune
lymphoproliferatieve syndrome (ALPS), lymphoid interstitial pneumonia, and CD30-positive lymphoproliferative disorders. Examples of CD30-positive lymphoproliferative disorders include lymphomatoid papulosis and primary cutaneous anaplastic large cell lymphoma.
Lymphomatoid papulosis (LYP) is characterized by multiple papules and nodules, which regress spontaneously. Three histologic subtypes have been described, which represent a spectrum with overlapping features and do not carry prognostic significance. Type A lesions have a few tumor cells in a background of inflammatory cells including neutrophils, eosinophils, and histiocytes. Type B lesions are characterized by epidermotropic lymphocytes with cerebriform nuclei mimicking mycosis fungoides. Type C lesions have sheets of large atypical lymphoid cells with only a few admixed inflammatory cells. The large atypical lymphoid cells are thought to be of T cell origin. Various histologic types may be present in individual patients at the same time. In LYP types A and C the large atypical cells express CD30, CD3, and CD4. CD2 and CD5 are usually expressed. These cells also express the
cytotoxic markers TIA-1 and granzyme. The large atypical cells do not express CD8, CD7, or CD56. The cells may lose expression of CD3. In LYP type B the atypical cells are usually CD30 negative. Five year survival rates for LYP are 100%; however up to 20% of patients develop LYP-associated malignant lymphomas (e.g., mycosis fungoides, Hodgkin lymphoma, systemic or cutaneous CD30+ large T-cell lymphoma), which result in a fatal outcome of 2% of patients.
Primary cutaneous anaplastic large cell lymphoma (ALCL) is composed of large atypical to anaplastic appearing lymphoid cells. This disease mainly affects adults with a peak in the sixth decade, but cases have been reported in children. It usually presents as a solitary rapidly growing nodule. The skin overlying the lesion may ulcerate. Histologically the cells grow in sheets. Mitotic figures are frequent. Clusters of small reactive lymphocytes are found within and around the tumor cells. The malignant cells express CD2, CD3, CD4, CD30, and cytotoxic markers including TIA-1, granzyme, and perforin. Loss of T-cell antigen expression is not infrequent. The malignant cells do not express EMA or ALK. Five year survival rates approach 90%. Interestingly, up to 40% of C-ALCL show spontaneous regression similarly to LYP.
Improved methods for detecting, investigating, and treating CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) are needed.
SUMMARY OF THE INVENTION
The cutaneous CD30-positive lymphoproliferative spectrum of disorders (LPD) includes lymphomatoid papulosis (LYP) and primary cutaneous anaplastic large cell lymphoma (ALCL). Chromosomal translocations targeting tyrosine kinases in CD30-positive LPD have not been described. Using whole transcriptome sequencing, experiments conducted during the course of developing embodiments for the present invention identified a chimeric fusion involving NPM1 (5q35) and TYK2 (19pl3) which encodes an NPM1-TYK2 protein containing the oligomerization domain of NPM1 and an intact catalytic domain in TYK2. Fluorescence in situ hybridization revealed NPM1-TYK2 fusions in 2 of 47 (4%) primary cases of CD30-positive LPDs and was absent in other mature T-cell neoplasms (n = 151). Functionally, NPM1-TYK2 induced constitutive TYK2, STAT1, STAT3 and STAT5 activation. Conversely, a kinase-defective NPMl-TYK2 mutant abrogated STAT1/3/5 signaling. In addition, shRNA-mediated silencing of TYK2 abrogated lymphoma cell growth. Moroever, it was demonstrated that TYK2 is targeted by multiple different translocation
partners in CD30-positive LPD. Such experiments indicate recurrent translocations involving TYK2 and highlights therapeutic opportunities in the treatment of CD30-positive LPDs with TYK2 translocations.
Accordingly, provided herein are kits, compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to recurrent gene fusions (e.g., recurrent translocations involving TYK2) as diagnostic markers and clinical targets for cutaneous CD30-positive
lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
In certain embodiments, the present invention provides, but is not limited to, methods, compositions, and kits involving gene fusions having a 3' portion from a TYK2 gene and a 5' portion from a TYK2-gene-fusion-partner.
Such embodiments (e.g., composition, methods, kits) are not limited to a particular portion of a TYK2 gene.
In some embodiments, the portion of the TYK2 gene comprises any portion of TYK2 enabling tyrosine kinase activity upon expression as a polypeptide. In some embodiments, the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises the entire C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises at least a portion of the TYK2 pseudokinase domain. In some embodiments, the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2 and/or at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the TYK2 pseudokinase domain.
Such embodiments (e.g., composition, methods, kits) are not limited to a particular
TYK2 -gene-fusion-partner.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide capable of having constitutively activated tyrosine kinase activity when expressed in a cell.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell is capable of constitutively activating downstream targets of TYK2 (e.g., STAT1, STAT3, STAT5) within the cell.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell results in increased cellular proliferation of that cell.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide, wherein 1) the polypeptide is capable of having constitutively activated tyrosine kinase activity when expressed in a cell, 2) expression of the polypeptide in a cell results in constitutive activation of downstream targets of TYK2 (e.g., STAT1, STAT3, STAT5), and 3) expression of the polypeptide in a cell results in increased cellular proliferation of the cell.
In some embodiments, the TYK2-gene-fusion-partner is any portion of NPM1.
In some embodiments, the TYK2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the NPMl oligomerization domain. In some embodiments, the TYK2 -gene-fusion-partner comprises the entire NPM1 oligomerization domain.
In some embodiments, the TYK2 -gene-fusion-partner comprises at least a portion
(e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the NPMl histone binding domains. In some embodiments, the TYK2-gene-fusion-partner comprises the entire NPM1 histone binding domains.
In some embodiments, the TYK2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the distal portion of the NPM1 DNA/RNA binding domains. In some embodiments, the TYK2-gene-fusion-partner comprises the entire distal portion of the NPM1 DNA/RNA binding domains.
In some embodiments, the TYK2-gene-fusion-partner comprises the entire NPM1 oligomerization domain, the entire NPM1 histone binding domain, and the entire distal portion of the NPM1 DNA/RNA binding domain.
In certain embodiments, the present invention provides methods for detecting cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., a human patient) comprising, consisting essentially of, or consisting of: providing a sample from the patient; and, detecting the presence or absence in the sample of a gene fusion having a 3' portion from a TYK2 gene and a 5' portion from a TYK2-gene-fusion-partner, wherein the presence in the sample of the gene fusion is indicative of a cutaneous CD30-positive lymphoproliferative disorder (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in the subj ect.
In some embodiments, the sample includes biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells.
Detecting the presence or absence in the sample of such a gene fusion may comprise detecting chromosomal rearrangements of genomic DNA having a 5' portion from a TYK2- gene-fusion-partner (e.g., NPMl) and a 3' portion from a TYK2 gene. A variety of techniques may be used for detecting the chromosomal rearrangements of genomic DNA, including nucleic acid sequencing, nucleic acid hybridization, and nucleic acid amplification. Nucleic acid hybridization techniques include in situ hybridization (ISH), microarray, and Southern blot. Nucleic acid amplification techniques include polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA).
Detecting the presence or absence in the sample of such a gene fusion may alternatively comprise detecting chimeric mRNA transcripts having a 5' portion from a TYK2 -gene-fusion-partner (e.g., NPMl) and a 3' portion from a TYK2 gene. A variety of techniques may be used for detecting the chimeric mRNA, including nucleic acid sequencing, nucleic acid hybridization, and, nucleic acid amplification. Nucleic acid hybridization techniques include in situ hybridization (ISH) (e.g., Fluorescence in situ hybridization (FISH)), microarray, and Northern blot). Nucleic acid amplification techniques include, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand
displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA).
Detecting the presence or absence in the sample of a gene fusion may also
alternatively comprise detecting an amino-terminally truncated TYK2 protein resulting from a fusion of a TYK2-gene-fusion-partner (e.g., NPMl) to a TYK2 gene, or detecting a chimeric protein having an amino-terminal portion from a a TYK2-gene-fusion-partner (e.g., NPMl) and a carboxy -terminal portion from an TYK2 gene. A variety of techniques may be used for detecting the truncated TYK2 protein or chimeric protein: protein sequencing; and, immunoassay. Immunoassay techniques include immunoprecipitation, Western blot, ELISA, immunohistochemistry, immunocytochemistry, flow cytometry, and immuno-PCR.
The present invention further provides, but is not limited to, compositions and kits for detecting / diagnosing cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., human patient). The compositions and kits may comprise:
a single labeled probe comprising a sequence that hybridizes to the junction at which a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl) fuses to a 3' portion from a TYK2 gene;
a pair of labeled probes wherein the first labeled probe comprises a sequence that hybridizes to a TYK2 -gene-fusion-partner (e.g., NPMl) and the second labeled probe comprises a sequence that hybridizes to a TYK2 gene;
a pair of amplification oligonucleotides wherein the first amplification
oligonucleotide comprises a sequence that hybridizes to a TYK2-gene-fusion-partner (e.g., NPMl) and the second amplification oligonucleotide comprises a sequence that hybridizes to a TYK2 gene;
an antibody to an amino-terminally truncated TYK2 protein resulting from a fusion of a TYK2 -gene-fusion-partner (e.g., NPMl) to a TYK2 gene; and/or,
an antibody to a chimeric protein having an amino-terminal portion from a TYK2- gene-fusion-partner (e.g., NPMl) and a carboxy-terminal portion from a TYK2 gene.
In certain embodiments, the present invention provides methods for treating cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis;
primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., a human patient) comprising: administering to the patient an agent that inhibits at least one biological activity of such a gene fusion having a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl) and a 3 ' portion from a TYK2 gene. In some embodiments, the agent inhibits tyrosine kinase activity resulting from the gene fusion. In some embodiments, the agent inhibits STAT1, STAT3, and/or STAT5 activity resulting from the gene fusion. In some embodiments, the agent inhibits increased cellular proliferation resulting from the gene fusion. In some embodiments, the agent inhibits one or more of tyrosine kinase activity resulting from the gene fusion, STAT1 , STAT3, and/or STAT5 activity resulting from the gene fusion, and increased cellular proliferation resulting from the gene fusion. In some embodiments, the agent inhibits expression of the gene fusion. In some embodiments, the agent inhibits any expression and/or activity resulting from the gene fusion. The agent may be a small molecule, an siRNA, an antisense nucleic acid, or an antibody. In some embodiments, the agent is co- administered with an additional agent known to treat cancer (e.g., an agent for treating cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis;
primary cutaneous anaplastic large cell lymphoma)).
In certain embodiments, the present invention provides kits for detecting gene fusions associated with CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis;
primary cutaneous anaplastic large cell lymphoma) in a subject, comprising or consisting essentially of or consisting of detecting the presence of one or more gene fusions involving TYK2. In some embodiments, such kits comprise, consist essentially of, or consist of informative reagents for detecting a gene fusion having or resulting from the fusion of, rearrangement of, or genomic deletion between, a 3' portion from a TYK family member gene and a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl), wherein detecting the presence in a sample (e.g., a sample from a human subject) (e.g., biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells) of the gene fusion between a TYK2 gene and a TYK2-gene-fusion-partner (e.g., NPMl) identifies or characterizes cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
Such embodiments are not limited to a particular reagent(s). Examples include but are not limited to, a probe that specifically hybridizes to the fusion junction of a TYK2 gene and a TYK2 -gene-fusion-partner (e.g., NPMl), a pair of primers that amplify a fusion junction of a gene fusion between a TYK2 gene and a TYK2-gene-fusion-partner (e.g., NPMl) (e.g., a first primer that hybridizes to a TYK2 nucleic acid and second primer that hybridizes to nucliec acid from a TYK2-gene-fusion-partner (e.g., NPMl)), an antibody that binds to the fusion junction of a fusion polypeptide of TYK2 and a TYK2 -gene-fusion-partner (e.g., NPMl) (e.g., a NPM1-TYK2 fusion polypeptide), a sequencing primer that binds to a fusion between TYK2 and a TYK2-gene-fusion-partner (e.g., NPMl) (e.g., a NPMl -TYK2 fusion polypeptide) and generates an extension product that spans the fusion junction of said gene fusion between TYK2 and a TYK2-gene-fusion-partner (e.g., NPMl) (e.g., a NPMl-TYK2 fusion polypeptide), or a pair of probes wherein the first probe hybridizes to TYK2 gene and the second probe hybridizes to a TYK2-gene-fusion-partner (e.g., NPMl).
Further embodiments of the present invention provide uses and methods for characterizing / detecting / identifying cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., human subject) using the aforementioned kits or other components.
For example, in some embodiments, the present invention provides a method for characterizing / detecting / identifying cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in a subject (e.g., human subject), comprising: (a) contacting a biological sample from a subject (e.g., biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells) with a nucleic acid or polypeptide detection assay comprising at least a first gene fusion informative
reagent for identification of a NPMl-TYK2 gene fusion under conditions that the presence of such a gene fusion is detected; and (b) characterizing / detecting / identifying cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma) in the subject when the NPM1-TYK2 gene fusion is present in the sample.
In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA having a 5' portion from NPMl and a 3' portion from TYK2. In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid sequencing technique. In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid hybridization technique. In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid hybridization technique (e.g., including but not limited to, in situ hybridization (ISH), microarray or Southern blot). In some embodiments, step (a) comprises detecting chromosomal rearrangements of genomic DNA using a nucleic acid amplification method (e.g., including but not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), or nucleic acid sequence based amplification (NASBA)). In some embodiments, step (a) comprises detecting chimeric mRNA transcripts having 5' portion from NPM1 and a 3' portion from TYK2.
In some embodiments, step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid sequencing technique. In some embodiments, step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid hybridization technique. In some embodiments, step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid hybridization technique (e.g., including but not limited to, in situ hybridization (ISH), microarray or Northern blot). In some embodiments, step (a) comprises detecting chimeric mRNA transcripts using a nucleic acid amplification method (e.g., including but not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT- PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), or nucleic acid sequence based amplification (NASBA)).
In some embodiments, the method further comprises the step of collecting the sample from the subject. In some embodiments, the sample is, for example, biopsy tissue, tissue, blood, plasma, serum, urine, stool, and/or cells.
In some embodiments, the described methods further comprise the step of detecting the level of expression of the gene fusion in the sample, wherein detecting an enhanced level of expression of the gene fusion in the patient sample relative to the level of expression of the gene fusion in a normal sample (e.g., relative to the level in normal cells, increase or decrease in level relative to a prior time point, increase or decrease relative to a pre-established thereshold level, etc.) indicates the presence of neoplastic cells or cells predisposed to the onset of a neoplastic state in the sample.
Further embodiments provide the step of determining a treatment course of action based on the presence or absence of the gene fusion. For example, in some embodiments, the treatment course of action comprises administration of an inhibitor of activity resulting from such a gene fusion (e.g., NPM1 -TYK2) (e.g., tyrosine kinase activity resulting from the gene fusion, STAT1 , STAT3, and/or STAT5 activity resulting from the gene fusion, and increased cellular proliferation resulting from the gene fusion) when the gene fusion is present in the sample. In some embodiments, the agent inhibits expression of the gene fusion. In some embodiments, the agent inhibits any expression and/or activity resulting from the gene fusion. The agent may be a small molecule, an siRNA, an antisense nucleic acid, or an antibody.
In certain embodiments, the present invention provides a method for diagnosing a neoplastic disorder or susceptibility to a neoplastic disorder comprising detecting the presence of a NPM1-TYK2 gene fusion in a sample from a subject (e.g., a human patient), wherein the NPM1 -TYK2 gene fusion is a fusion between chromosome 5, exon 9 of NPM1 and chromosome 19, exon 15 of TYK2 (e.g., N5;T19), and diagnosing the subject as having or being susceptible to a neoplastic disorder when the gene fusion is present. In some embodiments, the neoplastic disorder is a cutaneous CD30-positive lymphoproliferative disorder (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
In certain embodiments, the present invention provides a method of determining the
NPM1 -TYK2 gene fusion status of a human by: (a) determining the presence or absence of the N5;T19 gene fusion in both alleles of the of the NPM1 -TYK2 fusion gene of the human in a nucleic acid sample obtained from the human, and (b) identifying the human (i) as being homozygous for N5;T19 gene fusion in the NPM1-TYK2 fusion gene when one of the gene fusions is present in both alleles of the NPM1-TYK2 fusion gene, or (ii) as being
heterozygous for the N5;T19 gene fusion in the NPM1-TYK2 fusion gene when one of the gene fusions is present in one of the alleles of the NPM1-TYK2 fusion gene, or (iii) as having no alteration in the NPM1-TYK2 fusion gene caused by the N5;T19 gene fusion when each of the gene fusions is absent from both alleles of the NPM1-TYK2 fusion gene.
In some embodiments, the NPM1-TYK2 gene fusion is N5;T19. An NPM1-TYK2 gene fusion may be detected by amplifying any of SEQ ID NOs: 1, 2, 3, or 4, or diagnostic fragments thereof. In one embodiment, the method includes detecting one or more additional NPM1-TYK2 gene fusions in a sample from the subject.
The NPM1-TYK2 fusion may be detected by assessing sample nucleic acid by PCR,
RT-PCR, and/or nucleic acid hybridization. In one embodiment, the sample is amplified by reverse transcriptase polymerase chain reaction (RT-PCR). In one embodiment, the amplifying employs a detectably labeled primer. In one embodiment, the detecting is accomplished with electrophoresis. In one embodiment, the detecting is accomplished using a real-time PCR-based detection system, such as TaqMan®.
The present invention also provides a method for diagnosing a neoplastic disorder or susceptibility to a neoplastic disorder by detecting the presence or absence of an NPM1- TYK2 fusion protein in a sample from a subject, wherein the NPM1-TYK2 fusion protein is a fusion between exon 9 of NPMl and exon 15 of ALK, and diagnosing the subject has having or being susceptible to a neoplastic disorder when the fusion protein is present.
The invention also provides kits for detecting aNPMl-TYK2 fusion mutations which include one or more oligonucleotides (e.g., a primer) for amplifying a fragment of a nucleic acid sample which contains the N5;T19 mutation, if present. Optionally, the kit further contains one or more mutation-specific oligonucleotide probes.
Additional embodiments of the present invention are provided in the description and examples below.
DESCRIPTION OF THE FIGURES FIG. 1 : FISH Results and Clinical Data for Cutaneous CD30-Positive
Lymphoproliferative Disorders.
FIG. 2A-F: Identification of TYK2 translocations in cutaneous T cell lymphoma- derived cell line and primary CD30 positive LPD patient samples. (A) Read support from RNA sequencing illustrating the forward fragment reads spanning the breakpoint between 5' NPMl (NM_002520 c.1016) component and 3 ' TYK2 (NM_003331 c.2554) component and confirmation by Sanger sequencing. (B) Protein domain and exon diagram illustrating the preservation of N-terminal oligomerization and histone and DNA/RNA binding domains of NPMl and the C-terminal kinase domain of TYK2 in the NPM1-TYK2 fusion protein. (C) Cloning of the genomic breakpoint of the t(5;19) fusion event at chr5: 170,832,813 and
chrl9: 10,469,815 and confirmation by Sanger sequencing. (D) The NPM1-TYK2 fusion joins the positive strand of the NPMl locus up to and including exon 9, with the inverted negative strand of the TYK2 locus between exons 15 and 16. (E) FISH studies. A TYK2 break-apart assay shows a TYK2 rearrangement in the MyLa cell line and in a primary cutaneous CD30-positive LPD (upper panel). NPM1-TYK2 fusion FISH reveals that NPMl is the partner gene in both. A case that is negative for TYK2 translocation is also illustrated (lower panel). (F) NPM1-TYK2 fusion probe FISH assay shows the occurrence of t(5; 19) translocation in a cutaneous ALCL primary sample.
FIG. 3: Summary of RNAseq data for MyLa.
FIG. 4: SYBR Green- based qRT-PCR validation of NPM1-TYK2 fusion transcript expression in MyLa and other hematological cell lines.
FIG. 5: Conventional gel based RT-PCR validation of NPM1-TYK2 fusion transcript expression in MyLa and other hematological cell lines.
FIG. 6: Agarose gel electrophoresis of PCR products for genomic breakpoint mapping from NPMl-TYK2 positive MyLa and the negative control HH. The cartoon depicts the location of genomic breakpoint in NPMl and TYK2 genes and their juxtaposition. The bottom panel shows the Sanger sequencing of the PCR product which shows the exact genomic fusion point.
FIG. 7A-F: Oncogenic potential of NPM1-TYK2 fusion gene product. (A) Presence of the NPM1-TYK2 fusion protein in MyLa and not in other T-cell lines. Individual NPMl and TYK2 western blot assays show shift in the size of the protein in MyLa as a result of the fusion. (B) Hyperactivation of TYK2 and elevated STAT pathway activation in MyLa cells endogenously expressing NPM1-TYK2 fusion protein as compared with other T-cell lines. The Macl cell line that has a JAK2 rearrangement is used as a positive control. HUT78 cell line exhibits constitutive STAT5 activation. (C) Ectopic expression of NPM1-TYK2 fusion protein in HEK293T cells reveals activation of STAT proteins in Western blot assays. Note the significantly reduced levels of STAT activation in cells expressing NPM1-TYK2 kinase- defective mutant K462R. (D) Exogenously expressed NPM1-TYK2 fusion protein in HEK293FT cells leads to transcriptional activation of STAT1/3/5. Cells expressing kinase- defective mutant K462R NPM1-TYK2 fusion protein show reduced levels of STAT activation indicating a specific effect of TYK2 kinase activity on downstream STAT activation. (E) Diminished STAT pathway activation following knockdown of TYK2 protein in MyLa cell line by shRNA knockdown. (F) ShRNA-mediated silencing of TYK2 reduces proliferation of MyLa cells demonstrating oncogenic potential of NPM1-TYK2.
FIG. 8: Immunohistochemical staining for NPMl in primary patient samples. In the absence of NPM1-TYK2, NPMl expression is restricted to the nucleus (left panel). In a patient with NPM1-TYK2 fusion, there is atypical cytoplasmic localization of NPMl (right panel). (Anti-NPMl, 500x magnification).
FIG. 9: Immunofluorescence staining demonstrates a marked expression of cytoplasmic and nuclear phosphorylated STAT 1/3/5 in NPM-TYK2 positive My La cell line as compared to fusion negative HH cell line.
FIG. 10: Immunohistochemical staining for pSTAT5 in primary patient samples. In the absence of NPM1-TYK2, there is weak expression of pSTAT5, predominantly limited to the cytoplasm (left panel). In a patient with NPM1-TYK2 fusion, expression of pSTAT5 is stronger and increased nuclear expression is present (right panel). (Anti-pSTAT5, 400x magnification).
FIG. 11 A-E: A) wild type cDNA sequence for TYK2; B) wild type ORF nucleic acid sequence for TYK2; C) wild type amino acid sequence for TYK2; D) wild type nucleic acid sequence for TYK2; and E) TYK2 nucleic acid intron involved in TYK2 translocation.
FIG. 12A-E: A) wild type cDNA sequence for NPMl; B) wild type ORF nucleic acid sequence for NPMl ; C) wild type amino acid sequence for NPMl; D) wild type nucleic acid sequence for NPMl ; and E) NPMl nucleic acid intron involved in NPMl translocation.
FIG. 13A-D: A) cDNA sequence for NPM1-TYK2 gene fusion; B) coding region for NPM1-TYK2 gene fusion; C) amino acid sequence for NPM1-TYK2 gene fusion product; and D) NPM1-TYK2 introns involved in translocation.
DEFINITIONS
To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
As used herein, the term "gene fusion" refers to a chimeric genomic DNA, a chimeric messenger RNA, a truncated protein or a chimeric protein resulting from the fusion of at least a portion of a first gene to at least a portion of a second gene. The gene fusion need not include entire genes or exons of genes.
As used herein, the term "sensitivity" is defined as a statistical measure of performance of an assay (e.g., method, test), calculated by dividing the number of true positives by the sum of the true positives and the false negatives.
As used herein, the term "specificity" is defined as a statistical measure of performance of an assay (e.g., method, test), calculated by dividing the number of true negatives by the sum of true negatives and false positives.
As used herein, the term "informative" or "informativeness" refers to a quality of a marker or panel of markers, and specifically to the likelihood of finding a marker (or panel of markers) in a positive sample.
As used herein, "TYK2" refers to a member of the Janus Kinase (JAK) family of tyrosine kinases. An example of TYK2 polypeptide is the human polypeptide sequence described in Genbank accession number P29597.3. An exemplary TYK2 coding sequence is the human sequence described in Genbank accession number X54637. TYK2 also includes species homologs, splice variants, polymorphic variants, and conservatively modified variants of TYK2 that retain TYK2 tyrosine kinase activity. Fig. 1 1 provides: A) human wild type cDNA sequence for TYK2; B) human wild type ORF nucleic acid sequence for TYK2; C) human wild type amino acid sequence for TYK2; D) human wild type nucleic acid sequence for TYK2; and E) human TYK2 nucleic acid intron involved in TYK2
translocation.
As used herein, "NPMl " refers to a gene which encodes a phosphoprotein which moves between the nucleus and the cytoplasm. The gene product is thought to be involved in several processes including regulation of the ARF/p53 pathway. An exemplary NPMl coding sequence is the human sequence described in Genbank accession number P06748. NPMl also includes species homologs, splice variants, polymorphic variants, and conservatively modified variants of NPMl that retain its wild type activity. Fig. 12 provides: A) human wild type cDNA sequence for NPMl ; B) human wild type ORF nucleic acid sequence for NPMl ; C) human wild type amino acid sequence for NPMl ; D) human wild type nucleic acid sequence for NPMl ; and E) human NPMl nucleic acid intron involved in NPMl
translocation.
As used herein, "NPM1 -TYK2" refers to a chimeric genomic DNA, a chimeric messenger RNA, a truncated protein or a chimeric protein resulting from the fusion of at least a portion of an NPMl gene to at least a portion of a TYK2 gene. The gene fusion need not include entire genes or exons of genes. Fig. 13 provides: A) cDNA sequence for NPM1 -
TYK2 gene fusion; B) coding region for NPM1-TYK2 gene fusion; C) amino acid sequence for NPM1-TYK2 gene fusion product; and D) NPM1-TYK2 introns involved in
translocation.
As used herein, the terms "NPM1/TYK2 informative reagent" refers to a reagent or reagents that are informative for identification of gene fusions described herein. In some embodiments, reagents are primers, probes or antibodies for detection of NPM1 -TYKE2 gene fusions described herein.
As used herein, the term "transcriptional regulatory region" refers to the non-coding upstream regulatory sequence of a gene, also called the 5 ' untranslated region (5 'UTR).
As used herein, the terms "detect", "detecting", or "detection" may describe either the general act of discovering or discerning or the specific observation of a detectably labeled composition.
As used herein, the term "inhibits at least one biological activity of a gene fusion" refers to any agent that decreases any activity of a gene fusion of the present invention (e.g., including, but not limited to, the activities described herein), via directly contacting gene fusion protein, contacting gene fusion mRNA or genomic DNA, causing conformational changes of gene fusion polypeptides, decreasing gene fusion protein levels, or interfering with gene fusion interactions with signaling partners, and affecting the expression of gene fusion target genes. Inhibitors also include molecules that indirectly regulate gene fusion biological activity by intercepting upstream signaling molecules.
As used herein, the term "siRNAs" refers to small interfering RNAs. In some embodiments, siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAs contain from about two to four unpaired nucleotides at the 3' end of each strand. At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to, or substantially complementary to, a target RNA molecule. The strand complementary to a target RNA molecule is the "antisense strand;" the strand homologous to the target RNA molecule is the "sense strand," and is also complementary to the siRNA antisense strand. siRNAs may also contain additional sequences; non-limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures. siRNAs appear to function as key intermediaries in triggering RNA interference in invertebrates and in vertebrates, and in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants.
The term "RNA interference" or "RNAi" refers to the silencing or decreasing of gene expression by siRNAs. It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene. The gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not
integrated into the genome. The expression of the gene is either completely or partially inhibited. RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.
As used herein, the term "gene transfer system" refers to any means of delivering a composition comprising a nucleic acid sequence to a cell or tissue. For example, gene transfer systems include, but are not limited to, vectors (e.g., retroviral, adenoviral, adeno- associated viral, and other nucleic acid-based delivery systems), microinj ection of naked nucleic acid, polymer-based delivery systems (e.g., liposome-based and metallic particle- based systems), biolistic injection, and the like. As used herein, the term "viral gene transfer system" refers to gene transfer systems comprising viral elements (e.g., intact viruses, modified viruses and viral components such as nucleic acids or proteins) to facilitate delivery of the sample to a desired cell or tissue. As used herein, the term "adenovirus gene transfer system" refers to gene transfer systems comprising intact or altered viruses belonging to the family Adenoviridae.
As used herein, the term "site-specific recombination target sequences" refers to nucleic acid sequences that provide recognition sequences for recombination factors and the location where recombination takes place.
As used herein, the term "nucleic acid molecule" refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to,
4- acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine,
5- (carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1 -methylpseudouracil, 1 -methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine,
5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N- uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2- thiocytosine, and 2,6-diaminopurine.
The term "gene" refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA,
tRNA). The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragment is retained. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full- length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences. " Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
As used herein, the term "heterologous gene" refers to a gene that is not in its natural environment. For example, a heterologous gene includes a gene from one species introduced into another species. A heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc). Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically j oined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
As used herein, the term "oligonucleotide," refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than 200 residues long (e.g., between 15 and 100), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a "24-mer". Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, cruciforms, bends, and triplexes.
As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence "5'-A-G-T-3'," is complementary to the sequence "3'-T-C-A-5\ " Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
The term "homology" refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). A partially complementary sequence is a nucleic acid molecule that at least partially inhibits a completely complementary nucleic acid molecule from hybridizing to a target nucleic acid is "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous nucleic acid molecule to a target under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target that is substantially non-complementary (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.
When used in reference to a double-stranded nucleic acid sequence such as a cDNA or genomic clone, the term "substantially homologous" refers to any probe that can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described above.
A gene may produce multiple RNA species that are generated by differential splicing of the primary RNA transcript. cDNAs that are splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon on both cDNAs) and regions of complete non-identity (for example, representing the presence of exon "A" on cDNA 1 wherein cDNA 2 contains exon "B" instead). Because the two cDNAs contain regions of sequence identity they will both
hybridize to a probe derived from the entire gene or portions of the gene containing sequences found on both cDNAs; the two splice variants are therefore substantially homologous to such a probe and to each other.
When used in reference to a single-stranded nucleic acid sequence, the term
"substantially homologous" refers to any probe that can hybridize (i.e., it is the complement of) the single-stranded nucleic acid sequence under conditions of low stringency as described above.
As used herein, the term "hybridization" is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the Tm of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be "self- hybridized."
As used herein the term "stringency" is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. Under "low stringency conditions" a nucleic acid sequence of interest will hybridize to its exact complement, sequences with single base mismatches, closely related sequences (e.g., sequences with 90% or greater homology), and sequences having only partial homology (e.g., sequences with 50-90% homology). Under 'medium stringency conditions," a nucleic acid sequence of interest will hybridize only to its exact complement, sequences with single base mismatches, and closely relation sequences (e.g., 90% or greater homology). Under "high stringency conditions," a nucleic acid sequence of interest will hybridize only to its exact complement, and (depending on conditions such a temperature) sequences with single base mismatches. In other words, under conditions of high stringency the temperature can be raised so as to exclude hybridization to sequences with single base mismatches.
"High stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH2P04 H20 and 1.85 g/1 EDTA, pH adjusted to 7.4 with
NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
"Medium stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH2P04 H20 and 1.85 g/1 EDTA, pH adjusted to 7.4 with
NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0X SSPE, 1.0% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
"Low stringency conditions" comprise conditions equivalent to binding or hybridization at 42°C in a solution consisting of 5X SSPE (43.8 g/1 NaCl, 6.9 g/1 NaH2P04
H20 and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5X Denhardt's reagent [50X Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 5X SSPE, 0.1% SDS at 42°C when a probe of about 500 nucleotides in length is employed.
Numerous equivalent conditions may be employed to comprise low stringency conditions; factors such as the length and nature (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of low stringency hybridization different from, but equivalent to, the above listed conditions. In addition, the conditions that promote hybridization under conditions of high stringency (e.g., increasing the temperature of the hybridization and/or wash steps, the use of formamide in the hybridization solution, etc.) (see definition above for "stringency") can be utilized.
As used herein, the term "amplification oligonucleotide" refers to an oligonucleotide that hybridizes to a target nucleic acid, or its complement, and participates in a nucleic acid amplification reaction. An example of an amplification oligonucleotide is a "primer" that hybridizes to a template nucleic acid and contains a 3' OH end that is extended by a polymerase in an amplification process. Another example of an amplification
oligonucleotide is an oligonucleotide that is not extended by a polymerase (e.g., because it has a 3' blocked end) but participates in or facilitates amplification. Amplification oligonucleotides may optionally include modified nucleotides or analogs, or additional nucleotides that participate in an amplification reaction but are not complementary to or contained in the target nucleic acid. Amplification oligonucleotides may contain a sequence
that is not complementary to the target or template sequence. For example, the 5' region of a primer may include a promoter sequence that is non-complementary to the target nucleic acid (referred to as a "promoter-primer"). Those skilled in the art will understand that an amplification oligonucleotide that functions as a primer may be modified to include a 5' promoter sequence, and thus function as a promoter-primer. Similarly, a promoter-primer may be modified by removal of, or synthesis without, a promoter sequence and still function as a primer. A 3' blocked amplification oligonucleotide may provide a promoter sequence and serve as a template for polymerization (referred to as a "promoter-provider").
As used herein, the term "primer" refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product that is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may altematively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.
As used herein, the term "probe" refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, that is capable of hybridizing to at least a portion of another oligonucleotide of interest. A probe may be single-stranded or double-stranded. Probes are useful in the detection, identification and isolation of particular gene sequences. It is contemplated that any probe used in the present invention will be labeled with any "reporter molecule," so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
The term "isolated" when used in relation to a nucleic acid, as in "an isolated oligonucleotide" or "isolated polynucleotide" refers to a nucleic acid sequence that is identified and separated from at least one component or contaminant with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or
setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids as nucleic acids such as DNA and RNA found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins. However, isolated nucleic acid encoding a given protein includes, by way of example, such nucleic acid in cells ordinarily expressing the given protein where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single- stranded or double-stranded form. When an isolated nucleic acid, oligonucleotide or polynucleotide is to be utilized to express a protein, the oligonucleotide or polynucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or
polynucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded).
As used herein, the term "purified" or "to purify" refers to the removal of components (e.g., contaminants) from a sample. For example, antibodies are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind to the target molecule. The removal of non- immunoglobulin proteins and/or the removal of immunoglobulins that do not bind to the target molecule results in an increase in the percent of target-reactive immunoglobulins in the sample. In another example, recombinant polypeptides are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.
DETAILED DESCRIPTION OF THE INVENTION
Recurrent chromosomal translocations frequently underlie the pathogenesis of several hematopoietic malignancies and often define molecular subtypes with distinct biological behavior (see, e.g., Rowley JD, Nature reviews Cancer 2001 ; 1 :245-50; Mitelman F, et al, Nature reviews Cancer 2007;7:233-45). Frequently, these translocations target tyrosine kinases resulting in constitutive activation and promotion of oncogenesis (see, e.g., Greuber EK, et al., Nature reviews Cancer 2013; 13:559-71). Cutaneous CD30-positive LPD represents a clinicopathologic spectrum including lymphomatoid papulosis (LYP) and primary cutaneous anaplastic large cell lymphoma (ALCL) (see, e.g., Swerdlow SH, Campo,
E., Harris, N.L., Jaffe, E.S., Pileri, S.A., Stein, H., Thiele, I, Vardiman, J.W, ed. WHO
Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon: IARC; 2008).
Gene fusions targeting tyrosine kinases underlying the pathogenesis of CD30-positive LPD have not been described.
Experiments conducted during the course of developing embodiments for the present invention identified a novel recurrent NPM1-TYK2 gene fusion in CD30-positive LPD.
Functional support for NPM1-TYK2 in mediating activation of STAT1/3/5 signaling to promote cell proliferation was provided. Functional inactivation of TYK2 was shown to significantly diminish proliferation indicating TYK2 as an oncogenic driver kinase.
Additionally, FISH studies provided evidence that TYK2 is targeted by translocation partners other than NPM1. Taken together, such results indicate TYK2 as a therapeutic target in the treatment of CD30-positive LPDs.
Accordingly, provided herein are kits, compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to recurrent gene fusions (e.g., recurrent translocations involving
TYK2) as diagnostic markers and clinical targets for cutaneous CD30-positive
lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma). I. Gene Fusions
Embodiments of the present invention provide diagnostic, screening, research, and therapeutic methods for detecting, diagnosing and characterizing cancer (e.g., cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma)) based on the presence of gene fusions including TYK2 and a TYK2-gene-fusion-partner in a sample. In some embodiments, the gene fusion comprises an intact catalytic domain in TYK2, although other regions are specifically encopossed by embodiments of the present invention.
Such embodiments are not limited to a particular portion of a TYK2 gene.
In some embodiments, the portion of the TYK2 gene comprises any portion of TYK2 enables tyrosine kinase activity upon expression as a polypeptide. In some embodiments, the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises the entire C-terminal kinase domain of TYK2. In some embodiments, the portion of the TYK2 gene comprises at least a portion of the TYK2
pseudokinase domain. In some embodiments, the portion of the TYK2 gene comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the C-terminal kinase domain of TYK2 and/or at least a portion (e.g., 1 %, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the TYK2 pseudokinase domain.
In some embodiments, the gene fusion is a NPM1 -TYK2 gene fusion. In some embodiments, gene fusions comprise the oligomerization domain of NPMl and an intact catalytic domain in TYK2, although other regions are specifically encopossed by
embodiments of the present invention.
Such embodiments are not limited to a particular TYK2-gene-fusion-partner.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide capable of having constitutively activated tyrosine kinase activity when expressed in a cell.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell is capable of constitutively activating downstream targets of TYK2 (e.g., STAT1 , STAT3, STAT5) within the cell.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide that when expressed in a cell results in increased cellular proliferation of that cell.
In some embodiments, the TYK2 -gene-fusion-partner is any gene such that upon fusion with TYK2 the resulting gene fusion encodes a polypeptide, wherein 1) the polypeptide is capable of having constitutively activated tyrosine kinase activity when expressed in a cell, 2) expression of the polypeptide in a cell results in constitutive activation of downstream targets of TYK2 (e.g., STAT1, STAT3, STAT5), and 3) expression of the polypeptide in a cell results in increased cellular proliferation of the cell.
In some embodiments, the TYK2-gene-fusion-partner is any portion of NPMl .
In some embodiments, the TYK2-gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the NPMl oligomerization domain. In some embodiments, the TYK2 -gene-fusion-partner comprises the entire NPMl oligomerization domain.
In some embodiments, the TYK2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the NPMl histone binding domains. In some embodiments, the TYK2-gene-fusion-partner comprises the entire NPMl histone binding domains.
In some embodiments, the ΤΎΚ2 -gene-fusion-partner comprises at least a portion (e.g., 1%, 10%, 25%, 50%, 75%, 80%, 95%, 99%, 100%) of the distal portion of the NPMl DNA/RNA binding domains. In some embodiments, the TYK2-gene-fusion-partner comprises the entire distal portion of the NPM1 DNA/RNA binding domains.
In some embodiments, the TYK2-gene-fusion-partner comprises the entire NPM1 oligomerization domain, the entire NPM1 histone binding domain, and the entire distal portion of the NPM1 DNA/RNA binding domain.
In some embodiments, the NPM1-TYK2 gene fusion is a fusion between chromosome 5, exon 9 of NPM1 and chromosome 19, exon 15 of TYK2 (e.g., N5;T19).
II. Antibodies
The gene fusion proteins of the present invention, including fragments, derivatives and analogs thereof, may be used as immunogens to produce antibodies having use in the diagnostic, research, and therapeutic methods described below. The antibodies may be polyclonal or monoclonal, chimeric, humanized, single chain or Fab fragments. Various procedures may be used for the production and labeling of such antibodies and fragments. See, e.g., Burns, ed., Immunochemical Protocols, 3rd ed., Humana Press (2005); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988); Kozbor et al., Immunology Today 4: 72 (1983); Kohler and Milstein, Nature 256: 495 (1975).
III. Diagnostic Applications
The present invention provides DNA, RNA and protein based diagnostic methods that either directly or indirectly detect the gene fusions. The present invention also provides compositions and kits for diagnostic purposes.
The diagnostic methods of the present invention may be qualitative or quantitative.
Quantitative diagnostic methods may be used, for example, to discriminate between indolent and aggressive cancers via a cutoff or threshold level. Where applicable, qualitative or quantitative diagnostic methods may also include amplification of target, signal or intermediary (e.g., a universal primer).
An initial assay may confirm the presence of a gene fusion but not identify the specific fusion. A secondary assay is then performed to determine the identity of the particular fusion, if desired. The second assay may use a different detection technology than the initial assay.
The gene fusions of embodiments of the present invention may be detected along with other markers in a multiplex or panel format. Markers are selected for their predictive value alone or in combination with the gene fusions. Markers for other cancers, diseases, infections, and metabolic conditions are also contemplated for includsion in a multiplex of panel format.
The diagnostic methods of embodiments of the present invention may also be modified with reference to data correlating particular gene fusions with the stage, aggressiveness or progression of the disease or the presence or risk of metastasis. Ultimately, the information provided by the methods of the present invention will assist a physician in choosing the best course of treatment for a particular patient.
A. Sample
Any patient sample suspected of containing the gene fusions may be tested according to the methods of the present invention. By way of non-limiting examples, the sample may be tissue (e.g., a biopsy sample), blood, or a fraction thereof (e.g., plasma, serum, or cells).
In some embodiments, the patient sample typically requires preliminary processing designed to isolate or enrich the sample for the gene fusions or cells that contain the gene fusions. A variety of techniques may be used for this purpose, including but not limited: centrifugation; immunocapture; cell lysis; and, nucleic acid target capture.
B. DNA and RNA Detection
The gene fusions of the present invention may be detected as chromosomal rearrangements of genomic DNA or chimeric mRNA using a variety of nucleic acid techniques, including but not limited to: nucleic acid sequencing; nucleic acid hybridization; and, nucleic acid amplification.
1. Sequencing
Illustrative non-limiting examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Those of ordinary skill in the art will recognize that because RNA is less stable in the cell and more prone to nuclease attack experimentally RNA is usually reverse transcribed to DNA before sequencing.
Chain terminator sequencing uses sequence-specific termination of a DNA synthesis reaction using modified nucleotide substrates. Extension is initiated at a specific site on the
template DNA by using a short radioactive, fluorescent or other labeled, oligonucleotide primer complementary to the template at that region. The oligonucleotide primer is extended using a DNA polymerase, standard four deoxynucleotide bases, and a low concentration of one chain terminating nucleotide, most commonly a di-deoxynucleotide. This reaction is repeated in four separate tubes with each of the bases taking turns as the di-deoxynucleotide. Limited incorporation of the chain terminating nucleotide by the DNA polymerase results in a series of related DNA fragments that are terminated only at positions where that particular di-deoxynucleotide is used. For each reaction tube, the fragments are size-separated by electrophoresis in a slab polyacrylamide gel or a capillary tube filled with a viscous polymer. The sequence is determined by reading which lane produces a visualized mark from the labeled primer as you scan from the top of the gel to the bottom.
Dye terminator sequencing alternatively labels the terminators. Complete sequencing can be performed in a single reaction by labeling each of the di-deoxynucleotide chain- terminators with a separate fluorescent dye, which fluoresces at a different wavelength.
Some embodiments of the present invention utilize next generation or high- throughput sequencing. A variety of nucleic acid sequencing methods are contemplated for use in the methods of the present disclosure including, for example, chain terminator (Sanger) sequencing, dye terminator sequencing, and high-throughput sequencing methods. See, e.g., Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1997); Maxam et al, Proc. Natl. Acad. Sci. USA 74:560-564 (1977); Drmanac, et al., Nat. Biotechnol. 16:54-58 (1998); Kato, Int. J. Clin. Exp. Med. 2: 193-202 (2009); Ronaghi et al., Anal. Biochem. 242:84-89 (1996); Margulies et al., Nature 437:376-380 (2005); Ruparel et al, Proc. Natl. Acad. Sci. USA 102:5932-5937 (2005), and Harris et al, Science 320: 106-109 (2008); Levene et al., Science 299:682-686 (2003); Korlach et al, Proc. Natl. Acad. Sci. USA 105: 1176-1181 (2008); Branton et al, Nat. Biotechnol. 26(10): 1146-53 (2008); Eid et al, Science 323: 133-138 (2009); each of which is herein incorporated by reference in its entirety.
In some embodiments, sequencing technology including, but not limited to, pyrosequencing, sequencing-by-ligation, single molecule sequencing, sequence-by-synthesis (SBS), massive parallel clonal, massive parallel single molecule SBS, massive parallel single molecule real-time, massive parallel single molecule real-time nanopore technology, etc. Morozova and Marra provide a review of some such technologies in Genomics, 92: 255 (2008), herein incorporated by reference in its entirety. Those of ordinary skill in the art will recognize that because RNA is less stable in the cell and more prone to nuclease attack experimentally RNA is usually reverse transcribed to DNA before sequencing.
A number of DNA sequencing techniques can be used including fluorescence-based sequencing methodologies (See, e.g., Birren et al, Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, N.Y.; herein incorporated by reference in its entirety). In some embodiments, the technology finds use in automated sequencing techniques understood in that art. In some embodiments, the present technology finds use in parallel sequencing of partitioned amplicons (PCT Publication No: WO2006084132 to Kevin McKernan et al, herein incorporated by reference in its entirety). In some embodiments, the technology finds use in DNA sequencing by parallel oligonucleotide extension (See, e.g., U.S. Pat. No.
5,750,341 to Macevicz et al, and U.S. Pat. No. 6,306,597 to Macevicz et al, both of which are herein incorporated by reference in their entireties). Additional examples of sequencing techniques in which the technology finds use include the Church polony technology (Mitra et al., 2003, Analytical Biochemistry 320, 55-65; Shendure et al, 2005 Science 309, 1728-1732; U.S. Pat. No. 6,432,360, U.S. Pat. No. 6,485,944, U.S. Pat. No. 6,511,803; herein
incorporated by reference in their entireties), the 454 picotiter pyrosequencing technology (Margulies et al, 2005 Nature 437, 376-380; US 20050130173; herein incorporated by reference in their entireties), the Solexa single base addition technology (Bennett et al, 2005, Pharmacogenomics, 6, 373-382; U.S. Pat. No. 6,787,308; U.S. Pat. No. 6,833,246; herein incorporated by reference in their entireties), the Lynx massively parallel signature sequencing technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634; U.S. Pat. No. 5,695,934; U.S. Pat. No. 5,714,330; herein incorporated by reference in their entireties), and the Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87; WO 00018957; herein incorporated by reference in its entirety).
Next-generation sequencing (NGS) methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, e.g., Voelkerding et al, Clinical Chem, 55: 641-658, 2009;
MacLean et al., Nature Rev. Microbiol, 7: 287-296; each herein incorporated by reference in their entirety). NGS methods can be broadly divided into those that typically use template amplification and those that do not. Amplification-requiring methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform commercialized by Illumina, and the Supported Oligonucleotide Ligation and Detection (SOLiD) platform commercialized by Applied Biosystems. Non-amplification approaches, also known as single-molecule sequencing, are exemplified by the HeliScope platform commercialized by Helicos Biosciences, and emerging platforms commercialized
by VisiGen, Oxford Nanopore Technologies Ltd., Life Technologies/Ion Torrent, and Pacific Biosciences, respectively.
In pyrosequencing (Voelkerding et al., Clinical Chem, 55: 641-658, 2009; MacLean et al, Nature Rev. Microbiol, 7: 287-296; U.S. Pat. No. 6,210,891; U.S. Pat. No. 6,258,568; each herein incorporated by reference in its entirety), template DNA is fragmented, end- repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors. Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonally amplified using a technique referred to as emulsion PCR. The emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent reporter such as luciferase. In the event that an appropriate dNTP is added to the 3' end of the sequencing primer, the resulting production of ATP causes a burst of luminescence within the well, which is recorded using a CCD camera. It is possible to achieve read lengths greater than or equal to 400 bases, and 106 sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of sequence.
In the Solexa/Illumina platform (Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al, Nature Rev. Microbiol, 7: 287-296; U.S. Pat. No. 6,833,246; U.S. Pat. No. 7,115,400; U.S. Pat. No. 6,969,488; each herein incorporated by reference in its entirety), sequencing data are produced in the form of shorter-length reads. In this method, single- stranded fragmented DNA is end-repaired to generate 5'-phosphorylated blunt ends, followed by Klenow-mediated addition of a single A base to the 3' end of the fragments. A-addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with oligonucleotide anchors. The anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the "arching over" of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell. These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators. The sequence of incorporated nucleotides is determined by detection of post-incorporation fluorescence, with each fluor and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.
Sequencing nucleic acid molecules using SOLiD technology (Voelkerding et al, Clinical Chem, 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol, 7: 287-296; U.S. Pat. No. 5,912,148; U.S. Pat. No. 6,130,073; each herein incorporated by reference in their entirety) also involves fragmentation of the template, ligation to oligonucleotide adaptors, attachment to beads, and clonal amplification by emulsion PCR. Following this, beads bearing template are immobilized on a derivatized surface of a glass flow-cell, and a primer complementary to the adaptor oligonucleotide is annealed. However, rather than utilizing this primer for 3' extension, it is instead used to provide a 5' phosphate group for ligation to interrogation probes containing two probe-specific bases followed by 6 degenerate bases and one of four fluorescent labels. In the SOLiD system, interrogation probes have 16 possible combinations of the two bases at the 3' end of each probe, and one of four fluors at the 5' end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and fluor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output exceeds 4 billion bases per sequencing run.
In certain embodiments, the technology finds use in nanopore sequencing (see, e.g., Astier et al, J. Am. Chem. Soc. 2006 Feb 8; 128(5): 1705-10, herein incorporated by reference). The theory behind nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore. As each base of a nucleic acid passes through the nanopore, this causes a change in the magnitude of the current through the nanopore that is distinct for each of the four bases, thereby allowing the sequence of the DNA molecule to be determined.
In certain embodiments, the technology finds use in HeliScope by Helicos
Biosciences (Voelkerding et al, Clinical Chem., 55: 641-658, 2009; MacLean et al, Nature Rev. Microbiol, 7: 287-296; U.S. Pat. No. 7,169,560; U.S. Pat. No. 7,282,337; U.S. Pat. No. 7,482,120; U.S. Pat. No. 7,501,245; U.S. Pat. No. 6,818,395; U.S. Pat. No. 6,911,345; U.S. Pat. No. 7,501,245; each herein incorporated by reference in their entirety). Template DNA is fragmented and polyadenylated at the 3' end, with the final adenosine bearing a fluorescent label. Denatured polyadenylated template fragments are ligated to poly(dT) oligonucleotides
on the surface of a flow cell. Initial physical locations of captured template molecules are recorded by a CCD camera, and then label is cleaved and washed away. Sequencing is achieved by addition of polymerase and serial addition of fluorescently-labeled dNTP reagents. Incorporation events result in fluor signal corresponding to the dNTP, and signal is captured by a CCD camera before each round of dNTP addition. Sequence read length ranges from 25-50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.
The Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g., Science 327(5970): 1190 (2010); U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589,
20100301398, 20100197507, 20100188073, and 20100137143, incorporated by reference in their entireties for all purposes). A microwell contains a template DNA strand to be sequenced. Beneath the layer of microwells is a hypersensitive ISFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry. When a dNTP is incorporated into the growing complementary strand a hydrogen ion is released, which triggers a hypersensitive ion sensor. If homopolymer repeats are present in the template sequence, multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal. This technology differs from other sequencing technologies in that no modified nucleotides or optics are used. The per-base accuracy of the Ion Torrent sequencer is -99.6% for 50 base reads, with -100 Mb generated per run. The read-length is 100 base pairs. The accuracy for homopolymer repeats of 5 repeats in length is -98%. The benefits of ion semiconductor sequencing are rapid sequencing speed and low upfront and operating costs.
The technology finds use in another nucleic acid sequencing approach developed by
Stratos Genomics, Inc. and involves the use of Xpandomers. This sequencing process typically includes providing a daughter strand produced by a template-directed synthesis. The daughter strand generally includes a plurality of subunits coupled in a sequence
corresponding to a contiguous nucleotide sequence of all or a portion of a target nucleic acid in which the individual subunits comprise a tether, at least one probe or nucleobase residue, and at least one selectively cleavable bond. The selectively cleavable bond(s) is/are cleaved to yield an Xpandomer of a length longer than the plurality of the subunits of the daughter strand. The Xpandomer typically includes the tethers and reporter elements for parsing genetic information in a sequence corresponding to the contiguous nucleotide sequence of all
or a portion of the target nucleic acid. Reporter elements of the Xpandomer are then detected. Additional details relating to Xpandomer-based approaches are described in, for example, U.S. Pat. Pub No. 20090035777, entitled "High Throughput Nucleic Acid Sequencing by Expansion," filed June 19, 2008, which is incorporated herein in its entirety.
Other emerging single molecule sequencing methods include real-time sequencing by synthesis using a VisiGen platform (Voelkerding et al, Clinical Chem, 55: 641-58, 2009; U.S. Pat. No. 7,329,492; U.S. Pat. App. Ser. No. 11/671956; U.S. Pat. App. Ser. No.
11/781166; each herein incorporated by reference in their entirety) in which immobilized, primed DNA template is subjected to strand extension using a fluorescently-modified polymerase and florescent acceptor molecules, resulting in detectible fluorescence resonance energy transfer (FRET) upon nucleotide addition.
In some embodiments, capillary electrophoresis (CE) is utilized to analyze amplification fragments. During capillary electrophoresis, nucleic acids (e.g., the products of a PCR reaction) are injected electrokinetically into capillaries filled with polymer. High voltage is applied so that the fluorescent DNA fragments are separated by size and are detected by a laser/camera system. In some embodiments, CE systems from Life Technogies (Grand Island, NY) are utilized for fragment sizing (See e.g., US 6706162, US8043493, each of which is herein incorporated by reference in its entirety). 2. Hybridization
Illustrative non-limiting examples of nucleic acid hybridization techniques include, but are not limited to, in situ hybridization (ISH), microarray, and Southern or Northern blot.
In situ hybridization (ISH) is a type of hybridization that uses a labeled
complementary DNA or RNA strand as a probe to localize a specific DNA or RNA sequence in a portion or section of tissue (in situ), or, if the tissue is small enough, the entire tissue (whole mount ISH). DNA ISH can be used to determine the structure of chromosomes. RNA ISH is used to measure and localize mRNAs and other transcripts within tissue sections or whole mounts. Sample cells and tissues are usually treated to fix the target transcripts in place and to increase access of the probe. The probe hybridizes to the target sequence at elevated temperature, and then the excess probe is washed away. The probe that was labeled with either radio-, fluorescent- or antigen-labeled bases is localized and quantitated in the tissue using either autoradiography, fluorescence microscopy or immunohistochemistry, respectively. ISH can also use two or more probes, labeled with radioactivity or the other non-radioactive labels, to simultaneously detect two or more transcripts.
2.1 FISH
In some embodiments, fusion sequences are detected using fluorescence in situ hybridization (FISH). The preferred FISH assays for the present invention utilize bacterial artificial chromosomes (BACs). These have been used extensively in the human genome sequencing project (see Nature 409: 953-958 (2001)) and clones containing specific BACs are available through distributors that can be located through many sources, e.g., NCBI. Each BAC clone from the human genome has been given a reference name that
unambiguously identifies it. These names can be used to find a corresponding GenBank sequence and to order copies of the clone from a distributor. In some embodiments, the detection assay is a FISH assay utilizing a probe for TYK2and7or a TYK2-gene-fusion- partner (e.g., NPM1).
2.2 Microarrays
Different kinds of biological assays are called microarrays including, but not limited to: DNA microarrays (e.g., cDNA microarrays and oligonucleotide microarrays); protein microarrays; tissue microarrays; transfection or cell microarrays; chemical compound microarrays; and, antibody microarrays. A DNA microarray, commonly known as gene chip, DNA chip, or biochip, is a collection of microscopic DNA spots attached to a solid surface (e.g., glass, plastic or silicon chip) forming an array for the purpose of expression profiling or monitoring expression levels for thousands of genes simultaneously. The affixed DNA segments are known as probes, thousands of which can be used in a single DNA microarray. Microarrays can be used to identify disease genes by comparing gene expression in disease and normal cells. Microarrays can be fabricated using a variety of technologies, including but not limiting: printing with fine-pointed pins onto glass slides; photolithography using pre-made masks; photolithography using dynamic micromirror devices; ink-jet printing; or, electrochemistry on microelectrode arrays.
Southern and Northem blotting is used to detect specific DNA or RNA sequences, respectively. DNA or RNA extracted from a sample is fragmented, electrophoretically separated on a matrix gel, and transferred to a membrane filter. The filter bound DNA or RNA is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected. A variant of the procedure is the reverse Northem blot, in which the substrate nucleic acid that is affixed to the membrane is a
collection of isolated DNA fragments and the probe is RNA extracted from a tissue and labeled.
3. Amplification
Chromosomal rearrangements of genomic DNA and chimeric mRNA may be amplified prior to or simultaneous with detection. Illustrative non-limiting examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription- mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA). Those of ordinary skill in the art will recognize that certain amplification techniques (e.g., PCR) require that RNA be reversed transcribed to DNA prior to amplification (e.g., RT-PCR), whereas other amplification techniques directly amplify RNA (e.g., TMA and NASBA).
The polymerase chain reaction (U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159 and 4,965,188, each of which is herein incorporated by reference in its entirety), commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of a target nucleic acid sequence. In a variation called RT-PCR, reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from mRNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA. For other various permutations of PCR see, e.g., U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159; Mullis et al, Meth. Enzymol. 155: 335 (1987); and, Murakawa et al, DNA 7: 287 (1988), each of which is herein incorporated by reference in its entirety.
Transcription mediated amplification (U.S. Pat. Nos. 5,480,784 and 5,399,491, each of which is herein incorporated by reference in its entirety), commonly referred to as TMA, synthesizes multiple copies of a target nucleic acid sequence autocatalytically under conditions of substantially constant temperature, ionic strength, and pH in which multiple RNA copies of the target sequence autocatalytically generate additional copies. See, e.g., U.S. Pat. Nos. 5,399,491 and 5,824,518, each of which is herein incorporated by reference in its entirety. In a variation described in U.S. Publ. No. 20060046265 (herein incorporated by reference in its entirety), TMA optionally incorporates the use of blocking moieties, terminating moieties, and other modifying moieties to improve TMA process sensitivity and accuracy.
The ligase chain reaction (Weiss, R., Science 254: 1292 (1991), herein incorporated by reference in its entirety), commonly referred to as LCR, uses two sets of complementary DNA oligonucleotides that hybridize to adjacent regions of the target nucleic acid. The DNA oligonucleotides are covalently linked by a DNA ligase in repeated cycles of thermal denaturation, hybridization and ligation to produce a detectable double-stranded ligated oligonucleotide product.
Strand displacement amplification (Walker, G. et al, Proc. Natl. Acad. Sci. USA 89: 392-396 (1992); U.S. Pat. Nos. 5,270,184 and 5,455,166, each of which is herein
incorporated by reference in its entirety), commonly referred to as SDA, uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTPaS to produce a duplex hemiphosphorothioated primer extension product, endonuclease-mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3' end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product.
Thermophilic SDA (tSDA) uses thermophilic endonucleases and polymerases at higher temperatures in essentially the same method (EP Pat. No. 0 684 315).
Other amplification methods include, for example: nucleic acid sequence based amplification (U.S. Pat. No. 5,130,238, herein incorporated by reference in its entirety), commonly referred to as NASBA; one that uses an RNA replicase to amplify the probe molecule itself (Lizardi et al., BioTechnol. 6: 1197 (1988), herein incorporated by reference in its entirety), commonly referred to as replicase; a transcription based amplification method (Kwoh et al, Proc. Natl. Acad. Sci. USA 86: 1173 (1989)); and, self-sustained sequence replication (Guatelli et al, Proc. Natl. Acad. Sci. USA 87: 1874 (1990), each of which is herein incorporated by reference in its entirety). For further discussion of amplification methods see Persing, David H., "In Vitro Nucleic Acid Amplification
Techniques" in Diagnostic Medical Microbiology: Principles and Applications (Persing et al, Eds.), pp. 51-87 (American Society for Microbiology, Washington, DC (1993)). 4. Detection Methods
Non-amplified or amplified gene fusion nucleic acids can be detected by any means. For example, the gene fusions can be detected by hybridization with a detectably labeled probe and measurement of the resulting hybrids. Illustrative non-limiting examples of detection methods are described below.
One illustrative detection method, the Hybridization Protection Assay (HP A) involves hybridizing a chemiluminescent oligonucleotide probe (e.g., an acridinium ester-labeled (AE) probe) to the target sequence, selectively hydrolyzing the chemiluminescent label present on unhybridized probe, and measuring the chemiluminescence produced from the remaining probe in a luminometer. See, e.g., U.S. Pat. No. 5,283,174 and Norman C. Nelson et al,
Nonisotopic Probing, Blotting, and Sequencing, ch. 17 (Larry J. Kricka ed., 2d ed. 1995, each of which is herein incorporated by reference in its entirety).
Another illustrative detection method provides for quantitative evaluation of the amplification process in real-time. Evaluation of an amplification process in "real-time" involves determining the amount of amplicon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined values to calculate the amount of target sequence initially present in the sample. A variety of methods for determining the amount of initial target sequence present in a sample based on real-time amplification including methods disclosed in U.S. Pat. Nos. 6,303,305 and 6,541,205, each of which is herein incorporated by reference in its entirety can be used. Another method for determining the quantity of target sequence initially present in a sample, but which is not based on a real-time amplification, is disclosed in U.S. Pat. No. 5,710,029, herein
incorporated by reference in its entirety.
Amplification products may be detected in real-time through the use of various self- hybridizing probes, most of which have a stem-loop structure. Such self-hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a target sequence. By way of non-limiting example, "molecular torches" are a type of self-hybridizing probe that includes distinct regions of self-complementarity (referred to as "the target binding domain" and "the target closing domain") which are connected by a joining region (e.g., non- nucleotide linker) and which hybridize to each other under predetermined hybridization assay conditions. In a preferred embodiment, molecular torches contain single-stranded base regions in the target binding domain that are from 1 to about 20 bases in length and are accessible for hybridization to a target sequence present in an amplification reaction under strand displacement conditions. Under strand displacement conditions, hybridization of the two complementary regions, which may be fully or partially complementary, of the molecular torch is favored, except in the presence of the target sequence, which will bind to the single- stranded region present in the target binding domain and displace all or a portion of the target closing domain. The target binding domain and the target closing domain of a molecular
torch include a detectable label or a pair of interacting labels (e.g., luminescent/quencher) positioned so that a different signal is produced when the molecular torch is self-hybridized than when the molecular torch is hybridized to the target sequence, thereby permitting detection of probe:target duplexes in a test sample in the presence of unhybridized molecular torches. Molecular torches and a variety of types of interacting label pairs are disclosed in U.S. Pat. No. 6,534,274, herein incorporated by reference in its entirety.
Another example of a detection probe having self-complementarity is a "molecular beacon." Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Molecular beacons are disclosed in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.
Other self-hybridizing are, for example, probe binding pairs having interacting labels, such as those disclosed in U.S. Pat. No. 5,928,862 (herein incorporated by reference in its entirety) might be adapted for use in the present invention. Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized in the present invention. Additional detection systems include "molecular switches," as disclosed in U.S. Publ. No. 20050042638, herein incorporated by reference in its entirety. Other probes, such as those comprising intercalating dyes and/or fluorochromes, are also useful for detection of amplification products in the present invention. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).
C. Protein Detection
The gene fusions of the present invention may be detected as truncated or chimeric proteins using a variety of protein techniques, including but not limited to: protein sequencing; and, immunoassays.
1. Sequencing
Illustrative non-limiting examples of protein sequencing techniques include, but are not limited to, mass spectrometry and Edman degradation.
Mass spectrometry can, in principle, sequence any size protein but becomes computationally more difficult as size increases. A protein is digested by an endoprotease, and the resulting solution is passed through a high pressure liquid chromatography column. At the end of this column, the solution is sprayed out of a narrow nozzle charged to a high positive potential into the mass spectrometer. The charge on the droplets causes them to fragment until only single ions remain. The peptides are then fragmented and the mass- charge ratios of the fragments measured. The mass spectrum is analyzed by computer and often compared against a database of previously sequenced proteins in order to determine the sequences of the fragments. The process is then repeated with a different digestion enzyme, and the overlaps in sequences are used to construct a sequence for the protein.
In the Edman degradation reaction, the peptide to be sequenced is adsorbed onto a solid surface (e.g., a glass fiber coated with polybrene). The Edman reagent,
phenylisothiocyanate (PTC), is added to the adsorbed peptide, together with a mildly basic buffer solution of 12% trimethylamine, and reacts with the amine group of the N-terminal amino acid. The terminal amino acid derivative can then be selectively detached by the addition of anhydrous acid. The derivative isomerizes to give a substituted
phenylthiohydantoin, which can be washed off and identified by chromatography, and the cycle can be repeated. The efficiency of each step is about 98%, which allows about 50 amino acids to be reliably determined.
2. Immunoassays
Illustrative non-limiting examples of immunoassays include, but are not limited to: immunoprecipitation; Western blot; ELISA; immunohistochemistry; immunocytochemistry; flow cytometry; and, immuno-PCR. Polyclonal or monoclonal antibodies detectably labeled using various techniques (e.g., colorimetric, fluorescent, chemiluminescent or radioactive) are suitable for use in the immunoassays.
Immunoprecipitation is the technique of precipitating an antigen out of solution using an antibody specific to that antigen. The process can be used to identify protein complexes present in cell extracts by targeting a protein believed to be in the complex. The complexes are brought out of solution by insoluble antibody-binding proteins isolated initially from bacteria, such as Protein A and Protein G. The antibodies can also be coupled to sepharose beads that can easily be isolated out of solution. After washing, the precipitate can be analyzed using mass spectrometry, Western blotting, or any number of other methods for identifying constituents in the complex.
A Western blot, or immunoblot, is a method to detect protein in a given sample of tissue homogenate or extract. It uses gel electrophoresis to separate denatured proteins by mass. The proteins are then transferred out of the gel and onto a membrane, typically polyvinyldiflroride or nitrocellulose, where they are probed using antibodies specific to the protein of interest. As a result, researchers can examine the amount of protein in a given sample and compare levels between several groups.
An ELISA, short for Enzyme-Linked Immunosorbent Assay, is a biochemical technique to detect the presence of an antibody or an antigen in a sample. It utilizes a minimum of two antibodies, one of which is specific to the antigen and the other of which is coupled to an enzyme. The second antibody will cause a chromogenic or fluorogenic substrate to produce a signal. Variations of ELISA include sandwich ELISA, competitive ELISA, and ELISPOT. Because the ELISA can be performed to evaluate either the presence of antigen or the presence of antibody in a sample, it is a useful tool both for determining serum antibody concentrations and also for detecting the presence of antigen.
Immunohistochemistry and immunocytochemistry refer to the process of localizing proteins in a tissue section or cell, respectively, via the principle of antigens in tissue or cells binding to their respective antibodies. Visualization is enabled by tagging the antibody with color producing or fluorescent tags. Typical examples of color tags include, but are not limited to, horseradish peroxidase and alkaline phosphatase. Typical examples of fluorophore tags include, but are not limited to, fluorescein isothiocyanate (FITC) or phycoerythrin (PE).
Flow cytometry is a technique for counting, examining and sorting microscopic particles suspended in a stream of fluid. It allows simultaneous multiparametric analysis of the physical and/or chemical characteristics of single cells flowing through an
optical/electronic detection apparatus. A beam of light (e.g., a laser) of a single frequency or color is directed onto a hydrodynamically focused stream of fluid. A number of detectors are aimed at the point where the stream passes through the light beam; one in line with the light beam (Forward Scatter or FSC) and several perpendicular to it (Side Scatter (SSC) and one or more fluorescent detectors). Each suspended particle passing through the beam scatters the light in some way, and fluorescent chemicals in the particle may be excited into emitting light at a lower frequency than the light source. The combination of scattered and fluorescent light is picked up by the detectors, and by analyzing fluctuations in brightness at each detector, one for each fluorescent emission peak, it is possible to deduce various facts about the physical and chemical structure of each individual particle. FSC correlates with the cell volume and
SSC correlates with the density or inner complexity of the particle (e.g., shape of the nucleus, the amount and type of cytoplasmic granules or the membrane roughness).
Immuno-polymerase chain reaction (IPCR) utilizes nucleic acid amplification techniques to increase signal generation in antibody-based immunoassays. Because no protein equivalence of PCR exists, that is, proteins cannot be replicated in the same manner that nucleic acid is replicated during PCR, the only way to increase detection sensitivity is by signal amplification. The target proteins are bound to antibodies which are directly or indirectly conjugated to oligonucleotides. Unbound antibodies are washed away and the remaining bound antibodies have their oligonucleotides amplified. Protein detection occurs via detection of amplified oligonucleotides using standard nucleic acid detection methods, including real-time methods.
D. Data Analysis
In some embodiments, a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of a given marker or markers) into data of predictive value for a clinician. The clinician can access the predictive data using any suitable means. Thus, in some preferred embodiments, the present invention provides the further benefit that the clinician, who is not likely to be trained in genetics or molecular biology, need not understand the raw data. The data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject.
The present invention contemplates any method capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information provides, medical personal, and subjects. For example, in some embodiments of the present invention, a sample (e.g., a biopsy or a serum sample) is obtained from a subject and submitted to a profiling service (e.g., clinical lab at a medical facility, genomic profiling business, etc.), located in any part of the world (e.g., in a country different than the country where the subject resides or where the information is ultimately used) to generate raw data. Where the sample comprises a tissue or other biological sample, the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves and directly send it to a profiling center. Where the sample comprises previously determined biological information, the information may be directly sent to the profiling service by the subject (e.g., an information card containing the information may be scanned by a computer and the data transmitted to a computer of the profiling center
using an electronic communication systems). Once received by the profiling service, the sample is processed and a profile is produced (i.e., expression data), specific for the diagnostic or prognostic information desired for the subject.
The profile data is then prepared in a format suitable for interpretation by a treating clinician. For example, rather than providing raw expression data, the prepared format may represent a diagnosis or risk assessment (e.g., likelihood of cancer being present) for the subject, along with recommendations for particular treatment options. The data may be displayed to the clinician by any suitable method. For example, in some embodiments, the profiling service generates a report that can be printed for the clinician (e.g., at the point of care) or displayed to the clinician on a computer monitor.
In some embodiments, the information is first analyzed at the point of care or at a regional facility. The raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient. The central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis. The central processing facility can then control the fate of the data following treatment of the subject. For example, using an electronic communication system, the central facility can provide data to the clinician, the subject, or researchers.
In some embodiments, the subject is able to directly access the data using the electronic communication system. The subject may chose further intervention or counseling based on the results. In some embodiments, the data is used for research use. For example, the data may be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease. E. In vivo Imaging
The gene fusions of the present invention may also be detected using in vivo imaging techniques, including but not limited to: radionuclide imaging; positron emission tomography (PET); computerized axial tomography, X-ray or magnetic resonance imaging method, fluorescence detection, and chemiluminescent detection. In some embodiments, in vivo imaging techniques are used to visualize the presence of or expression of cancer markers in an animal (e.g., a human or non-human mammal). For example, in some embodiments, cancer marker mRNA or protein is labeled using a labeled antibody specific for the cancer marker. A specifically bound and labeled antibody can be detected in an individual using an in vivo imaging method, including, but not limited to, radionuclide imaging, positron
emission tomography, computerized axial tomography, X-ray or magnetic resonance imaging method, fluorescence detection, and chemiluminescent detection. Methods for generating antibodies to the cancer markers of the present invention are described below.
The in vivo imaging methods of the present invention are useful in the diagnosis of cancers that express the cancer markers of the present invention. In vivo imaging is used to visualize the presence of a marker indicative of the cancer. Such techniques allow for diagnosis without the use of an unpleasant biopsy. The in vivo imaging methods of the present invention are also useful for providing prognoses to cancer patients. For example, the presence of a marker indicative of cancers likely to metastasize can be detected. The in vivo imaging methods of the present invention can further be used to detect metastatic cancers in other parts of the body.
In some embodiments, reagents (e.g., antibodies) specific for the cancer markers of the present invention are fluorescently labeled. The labeled antibodies are introduced into a subject (e.g., orally or parenterally). Fluorescently labeled antibodies are detected using any suitable method (e.g., using the apparatus described in U.S. Pat. No. 6,198,107, herein incorporated by reference).
In other embodiments, antibodies are radioactively labeled. Sumerdon et al., (Nucl. Med. Biol 17:247-254 [1990] have described an optimized antibody-chelator for the radioimmunoscintographic imaging of tumors using Indium- 111 as the label. Griffin et al, (J Clin One 9:631-640 [1991]) have described the use of this agent in detecting tumors in patients suspected of having recurrent colorectal cancer. Agents with paramagnetic ions as labels for magnetic resonance imaging can be utilized (Lauffer, Magnetic Resonance in Medicine 22:339-342 [1991]). The label used will depend on the imaging modality chosen. Radioactive labels such as Indium-I l l, Technetium-99m, or Iodine-131 can be used for planar scans or single photon emission computed tomography (SPECT). Positron emitting labels such as Fluorine- 19 can also be used for positron emission tomography (PET). For MRI, paramagnetic ions such as Gadolinium (III) or Manganese (II) can be used.
Radioactive metals with half-lives ranging from 1 hour to 3.5 days are available for conjugation to antibodies, such as scandium-47 (3.5 days) gallium-67 (2.8 days), gallium-68 (68 minutes), technetiium-99m (6 hours), and indium-111 (3.2 days), of which gallium-67, technetium-99m, and indium-111 are preferable for gamma camera imaging, gallium-68 is preferable for positron emission tomography.
A useful method of labeling antibodies with such radiometals is by means of a bifunctional chelating agent, such as diethylenetriaminepentaacetic acid (DTP A), as
described, for example, by Khaw et al. (Science 209:295 [1980]) for In-I l l and Tc-99m, and by Scheinberg et al. (Science 215: 1511 [1982]). Other chelating agents may also be used, but the l-(p-carboxymethoxybenzyl)EDTA and the carboxy carbonic anhydride of DTP A are advantageous because their use permits conjugation without affecting the antibody's immunoreactivity substantially.
Another method for coupling DPTA to proteins is by use of the cyclic anhydride of DTP A, as described by Hnatowich et al. (Int. J. Appl. Radiat. Isot. 33:327 [1982]) for labeling of albumin with In-111, but which can be adapted for labeling of antibodies. A suitable method of labeling antibodies with Tc-99m which does not use chelation with DPTA is the pretinning method of Crockford et al., (U.S. Pat. No. 4,323,546, herein incorporated by reference).
A preferred method of labeling immunoglobulins with Tc-99m is that described by Wong et al. (Int. J. Appl. Radiat. Isot., 29:251 [1978]) for plasma protein, and recently applied successfully by Wong et al. (J. Nucl. Med., 23:229 [1981]) for labeling antibodies.
In the case of the radiometals conjugated to the specific antibody, it is likewise desirable to introduce as high a proportion of the radiolabel as possible into the antibody molecule without destroying its immunospecificity. A further improvement may be achieved by effecting radiolabeling in the presence of the specific cancer marker of the present invention, to insure that the antigen binding site on the antibody will be protected. The antigen is separated after labeling.
In still further embodiments, in vivo biophotonic imaging (Xenogen, Almeda, CA) is utilized for in vivo imaging. This real-time in vivo imaging utilizes luciferase. The luciferase gene is incorporated into cells, microorganisms, and animals (e.g., as a fusion protein with a cancer marker of the present invention). When active, it leads to a reaction that emits light. A CCD camera and software is used to capture the image and analyze it.
F. Compositions & Kits
Compositions for use in the diagnostic methods of the present invention include, but are not limited to, probes, amplification oligonucleotides, and antibodies. Particularly preferred compositions detect a product only when a gene fusion of TYK2 and a TYK2-gene- fusion-partner (e.g., NPMl) is present in a sample (e.g., NPM1-TYK2). In some
embodiments, the compositions include a single labeled probe comprising a sequence that hybridizes to the junction at which a 5' portion from a TYK2-gene-fusion-partner (e.g., NPMl) fuses to a 3' portion from a TYK2 gene (i.e., spans the gene fusion junction). In some
embodiments, the compositions include a pair of amplification oligonucleotides wherein the first amplification oligonucleotide comprises a sequence that hybridizes to a TYK2-gene- fusion-partner (e.g., NPM1) and the second amplification oligonucleotide comprises a sequence that hybridizes to TYK2 gene. In some embodiments, the compositions include an antibody to a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1).
Other useful compositions, however, include: a pair of labeled probes wherein the first labeled probe comprises a sequence that hybridizes to a TYK2-gene-fusion-partner (e.g., NPM1) and a second labeled probe comprises a sequence that hybridizes to an TYK2 gene.
Any of these compositions, alone or in combination with other compositions of the present invention, may be provided in the form of a kit. For example, the single labeled probe and pair of amplification oligonucleotides may be provided in a kit for the
amplification and detection of gene fusions of the present invention. Kits may further comprise appropriate controls and/or detection reagents.
The probe and antibody compositions of the present invention may also be provided in the form of an array.
IV. Drug Screening Applications
In some embodiments, the present invention provides drug screening assays (e.g., to screen for anticancer drugs). The screening methods of the present invention utilize cancer markers identified using the methods of the present invention (e.g., including but not limited to gene fusions between TYK2 and a TYK2-gene-fusion-partner (e.g., NPM1)). For example, in some embodiments, the present invention provides methods of screening for compounds that alter (e.g., decrease) the expression of cancer marker genes. The compounds or agents may interfere with transcription, by interacting, for example, with the promoter region. The compounds or agents may interfere with mRNA produced from the fusion (e.g., by RNA interference, antisense technologies, etc.). The compounds or agents may interfere with pathways that are upstream or downstream of the biological activity of the fusion. In some embodiments, candidate compounds are antisense or interfering RNA agents (e.g., oligonucleotides) directed against cancer markers. In other embodiments, candidate compounds are antibodies or small molecules that specifically bind to a cancer marker regulator or expression products of the present invention and inhibit its biological function.
In one screening method, candidate compounds are evaluated for their ability to alter cancer marker expression by contacting a compound with a cell expressing a cancer marker and then assaying for the effect of the candidate compounds on expression. In some
embodiments, the effect of candidate compounds on expression of a cancer marker gene is assayed for by detecting the level of cancer marker mRNA expressed by the cell. mRNA expression can be detected by any suitable method. In other embodiments, the effect of candidate compounds on expression of cancer marker genes is assayed by measuring the level of polypeptide encoded by the cancer markers. The level of polypeptide expressed can be measured using any suitable method, including but not limited to, those disclosed herein.
Specifically, the present invention provides screening methods for identifying modulators, i.e., candidate or test compounds or agents (e.g., proteins, peptides,
peptidomimetics, peptoids, small molecules or other drugs) which bind to cancer markers of the present invention, have an inhibitory (or stimulatory) effect on, for example, cancer marker expression or cancer marker activity, or have a stimulatory or inhibitory effect on, for example, the expression or activity of a cancer marker substrate. Compounds thus identified can be used to modulate the activity of target gene products (e.g., cancer marker genes) either directly or indirectly in a therapeutic protocol, to elaborate the biological function of the target gene product, or to identify compounds that disrupt normal target gene interactions. Compounds that inhibit the activity or expression of cancer markers are useful in the treatment of proliferative disorders, e.g., cancer, particularly cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma).
In one embodiment, the invention provides assays for screening candidate or test compounds that are substrates of a cancer marker protein or polypeptide or a biologically active portion thereof. In another embodiment, the invention provides assays for screening candidate or test compounds that bind to or modulate the activity of a cancer marker protein or polypeptide or a biologically active portion thereof.
The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods, including biological libraries;
peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone, which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckennann et al, J. Med. Chem. 37: 2678-85
[1994]); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the One-bead one-compound' library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are preferred for use with peptide libraries, while the other four
approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145).
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90:6909 [1993]; Erb et al, Proc. Nad. Acad. Sci. USA 91 : 11422 [1994]; Zuckermann et al., J. Med. Chem. 37:2678 [1994];
Cho et al, Science 261 : 1303 [1993]; Carrell et al., Angew. Chem. Int. Ed. Engl. 33.2059
[1994]; Carell et al, Angew. Chem. Int. Ed. Engl. 33:2061 [1994]; and Gallop et al, J. Med.
Chem. 37: 1233 [1994].
Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13:412-421 [1992]), or on beads (Lam, Nature 354:82-84 [1991]), chips (Fodor, Nature
364:555-556 [1993]), bacteria or spores (U.S. Pat. No. 5,223,409; herein incorporated by reference), plasmids (Cull et al, Proc. Nad. Acad. Sci. USA 89: 18651869 [1992]) or on phage (Scott and Smith, Science 249:386-390 [1990]; Devlin Science 249:404-406 [1990];
Cwirla et al, Proc. Natl. Acad. Sci. 87:6378-6382 [1990]; Felici, J. Mol. Biol. 222:301
[1991]).
VI. Therapeutic Applications
In some embodiments, the present invention provides therapies for cancer (e.g., cutaneous CD30-positive lymphoproliferative disorders (e.g., lymphomatoid papulosis; primary cutaneous anaplastic large cell lymphoma)). In some embodiments, therapies directly or indirectly target cancer markers (e.g., including but not limited to, gene fusions between TYK2 and a TYK2-gene-fusion-partner (e.g., NPM1).
A. RNA Interference and Antisense Therapies
In some embodiments, the present invention targets the expression of cancer markers.
For example, in some embodiments, the present invention employs compositions comprising oligomeric antisense or RNAi compounds, particularly oligonucleotides (e.g., those identified in the drug screening methods described above), for use in modulating the function of nucleic acid molecules encoding cancer markers of the present invention, ultimately modulating the amount of cancer marker expressed.
1. RNA Interference (RNAi)
In some embodiments, RNAi is utilized to inhibit fusion protein function. RNAi represents an evolutionary conserved cellular defense for controlling the expression of
foreign genes in most eukaryotes, including humans. RNAi is typically triggered by double- stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of single-stranded target RNAs homologous in response to dsRNA. The mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), which are normally produced from long dsRNA by enzymatic cleavage in the cell. siRNAs are generally approximately twenty-one nucleotides in length (e.g. 21-23 nucleotides in length), and have a base-paired structure characterized by two nucleotide 3'-overhangs. Following the introduction of a small RNA, or RNAi, into the cell, it is believed the sequence is delivered to an enzyme complex called RISC (RNA-induced silencing complex). RISC recognizes the target and cleaves it with an endonuclease. It is noted that if larger RNA sequences are delivered to a cell, RNase III enzyme (Dicer) converts longer dsRNA into 21-23 nt ds siRNA fragments. In some embodiments, RNAi oligonucleotides are designed to target the junction region of fusion proteins.
Chemically synthesized siRNAs have become powerful reagents for genome-wide analysis of mammalian gene function in cultured somatic cells. Beyond their value for validation of gene function, siRNAs also hold great potential as gene-specific therapeutic agents (Tuschl and Borkhardt, Molecular Intervent. 2002; 2(3): 158-67, herein incorporated by reference).
The transfection of siRNAs into animal cells results in the potent, long-lasting post- transcriptional silencing of specific genes (Caplen et al, Proc Natl Acad Sci U.S.A. 2001; 98: 9742-7; Elbashir et al., Nature. 2001; 411 :494-8; Elbashir et al, Genes Dev. 2001;15: 188- 200; and Elbashir et al., EMBO J. 2001; 20: 6877-88, all of which are herein incorporated by reference). Methods and compositions for performing RNAi with siRNAs are described, for example, in U.S. Pat. 6,506,559, herein incorporated by reference.
siRNAs are extraordinarily effective at lowering the amounts of targeted RNA, and by extension proteins, frequently to undetectable levels. The silencing effect can last several months, and is extraordinarily specific, because one nucleotide mismatch between the target RNA and the central region of the siRNA is frequently sufficient to prevent silencing (Brummelkamp et al, Science 2002; 296:550-3; and Holen et al, Nucleic Acids Res. 2002; 30: 1757-66, both of which are herein incorporated by reference).
An important factor in the design of siRNAs is the presence of accessible sites for siRNA binding. Bahoia et al, (J. Biol. Chem, 2003; 278: 15991-15997; herein incorporated by reference) describe the use of a type of DNA array called a scanning array to find accessible sites in mRNAs for designing effective siRNAs. These arrays comprise oligonucleotides
ranging in size from monomers to a certain maximum, usually Comers, synthesized using a physical barrier (mask) by stepwise addition of each base in the sequence. Thus the arrays represent a full oligonucleotide complement of a region of the target gene. Hybridization of the target mRNA to these arrays provides an exhaustive accessibility profile of this region of the target mRNA. Such data are useful in the design of antisense oligonucleotides (ranging from 7mers to 25mers), where it is important to achieve a compromise between
oligonucleotide length and binding affinity, to retain efficacy and target specificity (Sohail et al, Nucleic Acids Res., 2001 ; 29(10): 2041- 2045). Additional methods and concerns for selecting siRNAs are described for example, in WO 05054270, WO05038054A1,
WO03070966 A2, J Mol Biol. 2005 May 13;348(4): 883-93, J Mol Biol. 2005 May
13;348(4):871-81, and Nucleic Acids Res. 2003 Aug l;31(15):4417-24, each of which is herein incorporated by reference in its entirety. In addition, software (e.g., the MWG online siMAX siRNA design tool) is commercially or publicly available for use in the selection of siRNAs.
2. Antisense
In other embodiments, fusion protein expression is modulated using antisense compounds that specifically hybridize with one or more nucleic acids encoding cancer markers of the present invention. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds that specifically hybridize to it is generally referred to as "antisense." The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity that may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the expression of cancer markers of the present invention. In the context of the present invention,
"modulation" means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. For example, expression may be inhibited to potentially prevent tumor proliferation.
It is preferred to target specific nucleic acids for antisense. "Targeting" an antisense compound to a particular nucleic acid, in the context of the present invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose
function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding a cancer marker of the present invention. The targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
Chimeric antisense compounds of the present invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above.
The present invention also includes pharmaceutical compositions and formulations that include the antisense compounds of the present invention as described below.
B. Gene Therapy
The present invention contemplates the use of any genetic manipulation for use in modulating the expression of cancer markers of the present invention. Examples of genetic manipulation include, but are not limited to, gene knockout (e.g., removing the fusion gene from the chromosome using, for example, recombination), expression of antisense constructs with or without inducible promoters, and the like. Delivery of nucleic acid construct to cells in vitro or in vivo may be conducted using any suitable method. A suitable method is one that introduces the nucleic acid construct into the cell such that the desired event occurs (e.g., expression of an antisense construct). Genetic therapy may also be used to deliver siRNA or other interfering molecules that are expressed in vivo (e.g., upon stimulation by an inducible promoter).
Introduction of molecules carrying genetic information into cells is achieved by any of various methods including, but not limited to, directed injection of naked DNA constructs, bombardment with gold particles loaded with said constructs, and macromolecule mediated gene transfer using, for example, liposomes, biopolymers, and the like. Preferred methods use gene delivery vehicles derived from viruses, including, but not limited to, adenoviruses, retroviruses, vaccinia viruses, and adeno-associated viruses. Because of the higher efficiency as compared to retroviruses, vectors derived from adenoviruses are the preferred gene delivery vehicles for transferring nucleic acid molecules into host cells in vivo. Adenoviral vectors have been shown to provide very efficient in vivo gene transfer into a variety of solid tumors in animal models and into human solid tumor xenografts in immune-deficient mice.
Examples of adenoviral vectors and methods for gene transfer are described in PCT publications WO 00/12738 and WO 00/09675 and U.S. Pat. Appl. Nos. 6,033,908, 6,019,978, 6,001,557, 5,994,132, 5,994,128, 5,994,106, 5,981,225, 5,885,808, 5,872,154, 5,830,730, and 5,824,544, each of which is herein incorporated by reference in its entirety.
Vectors may be administered to subject in a variety of ways. For example, in some embodiments of the present invention, vectors are administered into tumors or tissue associated with tumors using direct injection. In other embodiments, administration is via the blood or lymphatic circulation (See e.g., PCT publication 99/02685 herein incorporated by reference in its entirety). Exemplary dose levels of adenoviral vector are preferably 10s to 1011 vector particles added to the perfusate.
C. Antibody Therapy
In some embodiments, the present invention provides antibodies that target cells that express a cancer marker of the present invention (e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1)). Any suitable antibody (e.g., monoclonal, polyclonal, or synthetic) may be utilized in the therapeutic methods disclosed herein. In preferred embodiments, the antibodies used for cancer therapy are humanized antibodies. Methods for humanizing antibodies can be utilized (See e.g., U.S. Pat. Nos. 6,180,370, 5,585,089, 6,054,297, and 5,565,332; each of which is herein incorporated by reference).
In some embodiments, the therapeutic antibodies comprise an antibody generated against a cancer marker of the present invention (e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g., NPM1)), wherein the antibody is conjugated to a cytotoxic agent. In such embodiments, a tumor specific therapeutic agent is generated that does not target normal cells, thus reducing many of the detrimental side effects of traditional chemotherapy. For certain applications, it is envisioned that the therapeutic agents will be pharmacologic agents that will serve as useful agents for attachment to antibodies, particularly cytotoxic or otherwise anticellular agents having the ability to kill or suppress the growth or cell division of endothelial cells. The present invention contemplates the use of any pharmacologic agent that can be conjugated to an antibody, and delivered in active form. Exemplary anticellular agents include chemotherapeutic agents, radioisotopes, and cytotoxins. The therapeutic antibodies of the present invention may include a variety of cytotoxic moieties, including but not limited to, radioactive isotopes (e.g., iodine-131, iodine- 123, technicium-99m, indium-I l l, rhenium-188, rhenium-186, gallium-67, copper-67, yttrium-90, iodine-125 or astatine-211), hormones such as a steroid, antimetabolites such as
cytosines (e.g., arabinoside, fluorouracil, methotrexate or aminopterin; an anthracycline; mitomycin C), vinca alkaloids (e.g., demecolcine; etoposide; mithramycin), and antitumor alkylating agent such as chlorambucil or melphalan. Other embodiments may include agents such as a coagulant, a cytokine, growth factor, bacterial endotoxin or the lipid A moiety of bacterial endotoxin. For example, in some embodiments, therapeutic agents will include plant-, fungus- or bacteria-derived toxin, such as an A chain toxins, a ribosome inactivating protein, a-sarcin, aspergillin, restrictocin, a ribonuclease, diphtheria toxin or pseudomonas exotoxin, to mention just a few examples. In some preferred embodiments, deglycosylated ricin A chain is utilized.
In any event, it is proposed that agents such as these may, if desired, be successfully conjugated to an antibody, in a manner that will allow their targeting, internalization, release or presentation to blood components at the site of the targeted tumor cells as required using conjugation technology (See, e.g., Ghose et al, Methods Enzymol., 93:280 [1983]).
For example, in some embodiments the present invention provides immunotoxins targeted to a cancer marker of the present invention (e.g., a gene fusion between TYK2 and a TYK2-gene-fusion-partner (e.g., NPM1)). Immunotoxins are conjugates of a specific targeting agent typically a tumor-directed antibody or fragment, with a cytotoxic agent, such as a toxin moiety. The targeting agent directs the toxin to, and thereby selectively kills, cells carrying the targeted antigen. In some embodiments, therapeutic antibodies employ crosslinkers that provide high in vivo stability (Thorpe et al, Cancer Res., 48:6396 [1988]).
In other embodiments, particularly those involving treatment of solid tumors, antibodies are designed to have a cytotoxic or otherwise anticellular effect against the tumor vasculature, by suppressing the growth or cell division of the vascular endothelial cells. This attack is intended to lead to a tumor-localized vascular collapse, depriving the tumor cells, particularly those tumor cells distal of the vasculature, of oxygen and nutrients, ultimately leading to cell death and tumor necrosis.
In preferred embodiments, antibody based therapeutics are formulated as pharmaceutical compositions as described below. In preferred embodiments, administration of an antibody composition of the present invention results in a measurable decrease in cancer (e.g., decrease or elimination of tumor).
D. Pharmaceutical Compositions
The present invention further provides pharmaceutical compositions (e.g., comprising pharmaceutical agents that modulate the expression or activity of gene fusions of the present
invention (e.g., a gene fusion between TYK2 and a TYK2 -gene-fusion-partner (e.g.,
NPM1))). The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets.
Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to techniques such as, for example, bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be
formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (U. S. Pat. No. 5,705, 188), cationic glycerol derivatives, and poly cationic molecules, such as polylysine (WO 97/30731), also enhance the cellular uptake of oligonucleotides.
The compositions of the present invention may additionally contain other adjunct components found in pharmaceutical compositions. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the
compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents that function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES). Anti-inflammatory drugs, including but not
limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. The administering physician can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50S found to be effective in in vitro and in vivo animal models or based on the examples described herein. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly. The treating physician can estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the subject undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years.
EXPERIMENTAL
The following examples are illustrative, but not limiting, of the compounds, compositions, and methods of the present invention. Other suitable modifications and adaptations of the variety of conditions and parameters normally encountered in clinical therapy and which are obvious to those skilled in the art are within the spirit and scope of the invention.
Example 1.
This example describes the methods for Examples 2 and 3.
RNAseq RNA was isolated from the MyLa cell lines using RNeasy kit from Qiagen (Valencia, CA, USA) and quantitated using the Agilent 2100 bio-analyzer (Agilent
Biotechnologies, Santa Clara, CA, USA). Samples with RNA integrity score (RIN) >6 were used for preparing cDNA libraries for transcriptome sequencing. Paired-end libraries for sequencing with Illumina Genome Analyzer II were prepared according to the protocol provided by Illumina, with minor modifications, with the mRNA-seq sample prep kit (Illumina). Sequence analysis was carried out using a combination of custom designed bioinformatics tools and Chimerascan (see, e.g., Iyer MK, Bioinformatics 2011 ;27:2903-4).
Clinical samples Clinical samples of primary cutaneous CD30-positive T-cell lymphoproliferative disorders (n = 47); mycosis fungoides (n = 44); systemic ALK-negative anaplastic large cell lymphoma (n = 44); ALK-positive anaplastic large cell lymphoma (n = 22); peripheral T-cell lymphoma, not otherwise specified (n = 24); angioimmunoblastic T- cell lymphoma (n = 7); extranodal NK/T-cell lymphoma (n = 5); enteropathy-associated T- cell lymphoma (n = 3); hepatosplenic T-cell lymphoma (n =1); cutaneous gamma/delta T-cell lymphoma (n = 1) were obtained with IRB approval from the pathology archives of the University of Michigan, the University of Texas MD Anderson Cancer Center, Henry Ford Health System, and Seoul National University Hospital. Diagnoses were established by using 2008 World Health Organization criteria (see, e.g., Swerdlow SH, et al, WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon: IARC; 2008). Patients with CD30-positive T-cell lymphoproliferative disorders were further subclassified as having either lymphomatoid papulosis or primary cutaneous anaplastic large cell lymphoma based on the combination of histologic and clinical features (see, e.g., Bekkenk MW, et al, Blood 2000;95:3653-61). 1mm diameter cores were taken in triplicate from tumor-rich areas of each formalin-fixed, paraffin-embedded specimen for tissue microarray construction and subsequent immunohistochemical and fluorescence in situ hybridization analysis.
Clinical information Clinical information was available for four of the seven patients demonstrating TYK2 translocations, including 1 patient with NPMl-TYK2 fusion (Fig. 1). The patient with NPM1-TYK2 fusion presented at the age of 71 with localized disease diagnosed as LYP. Phototherapy resulted in 6 years of remission. The patient's disease recurred and was controlled with methotrexate. Another patient presented at the age of 40 with localized disease diagnosed as LYP. After initial treatment with radiation therapy, he developed more widespread involvement that was currently controlled with methotrexate and topical steroids. A third patient presented at the age of 49 with disease diagnosed as LYP. Her disease was currently controlled with methotrexate. The fourth patient was diagnosed
with LYP at the age of 31 which progressed to cutaneous ALCL. The patient received radiation and methotrexate with stable disease. Of note, no difference in clinical behavior or presentation was discernable between cases with and without a TYK2 rearrangement. Fluorescence in situ hybridization (FISH) Interphase FISH was performed to assess for TYK2 rearrangements and for specific NPM1-TYK2 fusions. Fluorescently labeled BAC clones were purchased from Empire Genomics, Buffalo, NY, USA. Tissue microarrays containing clinical samples were sectioned at 4μιη and deparaffinized. The deparaffinized tissue microarray and cytospin slides of MyLa cells were hybridized with the probes overnight and assessed by fluorescent microscopy. BAC clones used for FISH included TYK2 probes: RP11-177J4 labeled with ROX (5' of TYK2), RP11-347E20, labeled with fluorescein (3' of TYK2) and NPMl probe RP11-1072120, labeled with ROX (5' of NPM1).
Quantitative real time polymerase chain reaction (qRT-PCR) validation Reverse transcription, ^g of total RNA was used for preparation of cDNA using Superscript II reverse transcription kit (Life Technologies, Grand Island, NY, USA). The final product was diluted to ΙΟΟμΙ in nuclease free water. Ιμΐ of this diluted cDNA was used for quantitative real-time polymerase chain reaction (qRT-PCR) analyses. SYBR green assay. qRT-PCR was performed using Power SYBR Green Mastermix
(Applied Biosystems, Carlsbad, CA, USA) on an Applied Biosystems StepOne Plus Real- Time PCR System. All oligonucleotide primers were obtained from Integrated DNA
Technologies (Coralville, IA). Control primers were used to amplify the GAPDH
housekeeping gene. All assays were performed and repeated twice and results were plotted as average fold change relative to GAPDH.
Primers used for validation of NPM1-TYK2 fusion transcripts in cell lines by SYBR green assay:
NPM-TYK2 Q Fl 5'ACTCAAAACCATCATCAACACCA3' (SEQ ID NO: 1) NPM-TYK2 Q Rl 5 ' GTTCCGGCC AC AC AC ATTAC3 ' (SEQ ID NO: 2)
Sanger sequencing of NPM1-TYK2 fusion chimera NPM1-TYK2 fusion chimera was amplified from MyLa T-cell line using two different primer sets for NPM1 and TYK2. The primers were designed to amplify across the fusion chimera generating two different amplicons (175 bp and 468 bp) using Phusion DNA polymerase (New England Biolabs,
Ipswich, MA, USA) followed by conventional Sanger sequencing technology using BigDye version 3.1 chemistry run on an Applied Biosystems 3730x1 DNA Sequencer. The PCR products were separated on a 1% agarose gel, bands excised and purified for Sanger sequencing.
Genomic PCR for genomic breakpoint mapping To identify the genomic break point in the index NPM1-TYK2 fusion event, a series of forward primers were designed that spanned from last exon of NPM1 present in NPM1-TYK2 fusion to the end of the following intron. Similarly, reverse primers were designed to span the region between the first exon of TYK2 in NPM1-TYK2 through the entire intron proximal to the exon. Genomic DNA was isolated from MyLa and HH cells using QIAamp DNA extraction kit (Valencia, CA, USA). 40ng of genomic DNA was used as template for performing genomic PCR using High Fidelity Phusion DNA Polymerase.
Primers used for amplifying across the juxtaposed NPM1 and TYK2 introns:
NPMg F 5 ' AC AGAGGGCGTATGAGACTTC3 ' (SEQ ID NO: 3)
TYK2g R 5 ' CC ATAGGGAC AGCC AATGTGAAAA3 ' (SEQ ID NO: 4)
Molecular cloning of NPM1-TYK2 full length fusion gene and transient expression in HEK293FT cells The full length wild-type NPM1-TYK2 fusion gene was amplified from MyLa cell line using high fidelity Phusion DNA polymerase. The amplified gene product was then cloned into pLentilox IRES GFP mammalian expression Lenti virus vector (University of Michigan Vector Core, MI, USA) between Xhol and Xbal restriction sites. FLAG sequences were artificially introduced at the N-terminal end of the gene by PCR. NPM1- TYK2 K462R kinase dead mutant (see, e.g., Gauzzi MC, et al, The Journal of biological chemistry 1996;271 :20494-500was generated by performing site directed mutagenesis PCR using mutant primers and wild type NPM1-TYK2 gene as template. Sequence verified clones were transfected into HEK293FT cells and checked for expression of fusion protein after 48hrs post transfection using Poly Jet (SignaGen, Rockville, MD, USA). Cell culture The hematological cell lines used for such experiments were stocked and
HEK293FT cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). T-cell derived cell lines were maintained in RPMI-1640 medium supplemented with 20% FBS, L-glutamine and penicillin/streptomycin (Thermo Scientific, Waltham, MA, USA). HEK293FT cells were maintained in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10%FBS, glutamine and penicillin/streptomycin. Stable TYK2 knockdown MyLa cell lines were generated by transducing the lentivirus supernatant containing shRNAs for TYK2 and selecting them with puromycin (^g/mL) for 48hrs post transduction.
Immunoblotting The levels of pSTATl, pSTAT3, pSTAT5 and pTYK2 were analysed in cell lines after treating them with ImM activated Na3V04 for lhr prior harvesting. The lysates used in the immunoblotting experiments were prepared from the cell lines using RIPA buffer containing 50mM Tris HC1, pH 7.4; 1% NP-40; 0.25% Na- deoxycholate; 150mM NaCl; ImM PMSF; ImM EDTA; lmM Na3V04; lmM NaF; and 0.1% SDS. The samples were incubated on ice for 30 min followed by centrifugation at 10,000x for 15 min. The protein content of the supematants was estimated using a protein BCA assay kit (Pierce protein research products, Rockford, IL, USA). 20μg of protein extract was separated on a high resolution SDS PAGE using MES SDS running buffer, and analyzed for expression of proteins by immunoblotting using antibodies specific for monoclonal ANTI- FLAG M2 (clone M2) antibody (Sigma, St. Louis, MO, USA). pSTATl (Y701), STAT1, pSTAT3 (Y705), STAT3, pSTAT5 (Y694), STAT5, pTYK2 (Y1054/55) and TYK2 antibodies were purchased from Cell Signaling Technologies (Beverly, MA, USA) and used in our study.
Transcriptional activation assay DNA constructs containing vector and NPM1-TYK2 wild type and K462R mutant were co-transfected along with luciferase reporter system plasmids sensitive to appropriate STAT proteins (pGL4.52 luc2P/STAT5RE; pGL4.45 luc2P/ISRE; Promega; Madison, WI, Cignal STAT3 reporter, SA Biosciences, Valencia, CA) to HEK293FT cells. After 48hrs post transfection, the cells were lysed and transcriptional activity of STAT proteins were measured by using the Dual Luciferase kit (Promega) and a specially configured luminometer (Berthold Technologies; Germany). Western blotting was performed using the extracts to ensure equal expression of different constructs (data not shown).
Stable knockdown of TYK2 expression in MyLa Lenti-viral mediated gene transduction was performed as described earlier (see, e.g., Sahasrabuddhe AA, et al, Oncogene 2014). Briefly, 293FT cells were co-transfected with lentiviral construct and packaging vectors (Invitrogen). Virus-producing supernatant was harvested 48 h after
transfection and supplemented with polybrene and used to infect MyLa cells. Lentiviral mission shRNA constructs targeting different region of TYK2 (TRCN0000003123- 5 ' CGTGAGCCTAACCATGATCTT3 ' (SEQ ID NO: 5) and TRCN0000320620- 5 ' GAGTGCCTGAAGGAGTATAAG3 ' (SEQ ID NO: 6)) and Vector control (SHC201) were purchased from Sigma (St.Louis, MO, USA).
Cell proliferation assay Cell proliferation assay was performed using water soluble tetrazolium-1 (WST-1) procured from Roche Applied Sciences, Indianapolis, IN, USA, based on manufacturer's protocol (see, e.g., McDonnell SR, et al., Oncogene 2011). Briefly, equal numbers of cells were plated in 96-well plates with growth media and ΙΟμΙ of WST-1 reagent was added at different time intervals (0, 12, 36, 48 hours). After addition of WST-1 reagent, the plates were incubated at 37°C in an incubator with 5% CO2 for 2 hours. Based on the cleavage of the tetrazolium salt WST-1 by mitochondrial dehydrogenases in viable cells, the intensities of the color developed in each well was determined by measuring the absorbance at 440nm. The assay was performed in triplicate for all the samples at each time point.
Screening for somatic mutations in TYK2 by Sanger resequencing PCR fragments targeting exon 14 to 16 and 20 to 23, were amplified from genomic DNA of CD30 positive LPD samples (n=25). Genomic DNA was extracted using both the QIAGEN BioRobot EZ1 and QIAamp FFPE DNA extraction kits (QIAGEN). For all Sanger sequencing reactions, PCR amplification was performed using Phusion DNA polymerase (New England Biolabs) followed by conventional Sanger sequencing technology using BigDye version 3.1 chemistry run on an Applied Biosystems 3730x1 DNA Sequencer at the University of Michigan DNA sequencing Core. All sequencing reactions were performed using nested sequencing primers. Sequencing trace analysis was performed using Mutation Surveyor software. All mutations were verified in at least two independent PCR amplification and sequencing reactions.
Immunostaining for NPM1 and pSTAT5 Immunohistochemical staining was performed on formalin-fixed, paraffin-embedded tissue microarrays containing patient samples using an automated immunostainer (Autostainer Link, Dako, Carpinteria, CA).
Following deparafinization and heat-induced epitope retrieval, the slides were incubated with either anti-NPMl (1 :800 dilution, clone EP1848Y, Abeam, Cambridge, MA) or anti-pSTAT5 (1 :400 dilution, clone AX1, Advantex BioReagents LLC, Houston, TX) for 60 min. Staining was visualized with Dako Envision detection system and diaminobenzadine chromagen.
Immunofluorescence analysis Cultured suspension cells from HH and My La cell lines were deposited onto glass slides by cytocentrifugation. Cells were fixed and permeabilized with methanol/glacial acetic acid (3: 1). After fixation, cells were first incubated with the following primary antibodies (Cell Signaling Technology): Y701 phospho-STATl (clone 58D6, rabbit monoclonal IgG), Y705 phospho-SATA3 (mouse monoclonal IgGl, clone M9C6) or Y694/Y 699 phospho-STAT5 monoclonal antibody (rabbit monoclonal IgG, clone D47E7). The secondary antibodies were Alexa-conjugated donkey anti-rabbit IgG or Alexa- conjugated goat anti-mouse IgG (Alexa594, Life Technologies). Coverslips were mounted on standard slides with mounting media supplemented with 4', 6'-diamidino-2-phenylindole (DAPI). The images were captured and recorded using an Olympus BX-51 upright light microscope equipped with an Olympus DP-70 camera.
Example 2.
Patient biopsy samples were obtained with institutional review board approval. RNA was subjected to chimera analysis by producing paired end libraries sequenced on the Illumina Genome Analyzer II. Sequencing data was analyzed using custom bioinformatics tools and Chimerascan software (see, e.g., Iyer MK, et al., Bioinformatics 2011;27:2903-4). Sequencing confirmation of NPM1-TYK2 fusion transcripts was achieved using SYBR Green- based quantitative real-time polymerase chain reaction (qRT-PCR) assays and Sanger sequencing of amplicons by reverse transcription (RT)-PCR. Fluorescence In Situ
Hybridization (FISH) was performed on tissue microarrays of primary patient samples using standard methods. TYK2 break-apart FISH and NPM1-TYK2 fusion FISH assays were designed to detect TYK2 rearrangements and NPM1-TYK2 fusions, respectively.
Immunohistochemistry for pSTAT5 (AX1, Advantex BioReagents LLC, Houston, TX) and NPM1 (EP1848Y, Abeam, Cambridge, MA) was performed on primary patient samples. Mutations in TYK2 were assessed by targeted Sanger sequencing of the genomic DNA. The NPM1-TYK2 fusion gene was amplified from MyLa cells and cloned into a mammalian expression vector for functional studies. Stable MyLa cell lines depleted of TYK2 were generated using lenti-viral mediated gene transduction (see, e.g., Sahasrabuddhe AA, et al, Oncogene 2014) of shRNAs and used in cell proliferation assays.
Example 3.
To discover novel gene fusions that may be involved in the pathogenesis of cutaneous T-cell lymphoproliferative disorders, RNAseq was performed on the cutaneous T-cell lymphoma-derived cell line MyLa. Interestingly, RNA sequencing analysis of MyLa revealed 803 total fragments representing a chimeric fusion between the N-terminal region of NPMl and the C-terminal region of TYK2 (Fig. 2A, upper panel; Fig. 3). RT-PCR analysis confirmed high levels and exclusive expression of the NPM1-TYK2 RNA chimera in MyLa, but not in 11 other hematological cell lines (Fig. 4; Fig. 5). The fusion occurred at NPMl NM_002520 c.1016 (exon 9) and TYK2 NM_003331 c.2554 (exon 16) and was confirmed by Sanger sequencing (Fig. 2 A, lower panel). The fusion gene was predicted to yield a product comprising the entire oligomerization, histone binding domains and the distal portion of the DNA/RNA binding domains of NPMl and a small portion of the TYK2 pseudokinase domain and the entire C-terminal kinase domain (Fig. 2B).
To precisely map the genomic breakpoints, a conventional PCR-based assay using a series of forward primers starting from the C-terminal part of exon 9 through intron 10 of NPMl (positive strand) and reverse primers located from exon 16 through intron 16 of TYK2 (negative strand) was designed. Bi-directional Sanger sequencing of the PCR product revealed break points at position chr5: 170,832,813 within the NPMl gene and
chrl9: 10,469,817 in the TYK2 gene (Fig. 1C; Fig. ID; Fig. 6). TYK2 break-apart and NPM1-TYK2 fusion FISH assays confirmed the presence of the NPM1-TYK2 rearrangement in MyLa (Fig. 2E).
Next the TYK2 break-apart FISH assay was employed to screen for TYK2 gene rearrangements in a large cohort of primary mature T-cell LPD/lymphomas (n=198). TYK2 rearrangements were identified in 7/47 (15%) primary CD30-positive LPD including 3/15 (20.0%) cases of LYP and 4/32 (12.5%) cases of primary cutaneous ALCL. Each of the 7 cases that were identified by TYK2 break-apart FISH was also evaluated with the NPM1- TYK2 fusion FISH assay. Two cases (1 LYP, 1 cutaneous ALCL) harbored the NPM1- TYK2 rearrangement (Fig. 2E; Fig. 2F). These results indicate that TYK2 is targeted by multiple different translocation partners in CD30-positive LPD. This is not unexpected since other prominent oncogenes are known to utilize multiple translocation partners (see, e.g., Mitelman F, et al, Nature reviews Cancer 2007;7:233-45; Chen YW, et al, Blood
2003; 102: 1931-2; author reply 2; Harper DP, et al, Cancer research 2008;68: 10024-7;
Chiarle R, et al., Nature reviews Cancer 2008;8: 11-23). Of note, TYK2 translocations were absent in all (n = 151) cases of other mature T-cell lymphomas including mycosis fungoides (n = 44); systemic ALK-negative ALCL (n = 44) systemic ALK-positive ALCL (n = 22);
peripheral T-cell lymphoma, not otherwise specified (n = 24); angioimmunoblastic T-cell lymphoma (n = 7); extranodal NK/T-cell lymphoma (n = 5); enteropathy-associated T-cell lymphoma (n = 3); hepatosplenic T-cell lymphoma (n = 1) and cutaneous gamma/delta T-cell lymphoma (n = 1). To investigate whether point mutations may represent a mechanism for activation of TYK2, targeted sequencing of TYK2 pseudokinase and kinase domains including previously reported mutations in T-lymphoblastic lymphoma cell lines was performed (see, e.g., Sanda T, et al., Cancer discovery 2013;3:564-77). No mutations were identified in TYK2 in 25 cases of CD30-positive LPD.
In the NPM1-TYK2 fusion reported herein, the 5' partner of the fusion protein NPMl retained the oligomerization domain (Fig. 2B) which was hypothesized to lead to constitutive activation of TYK2 through a mechanism similar to that observed with NPM1-ALK (see, e.g., Pearson JD, et al, Journal of signal transduction 2012;2012: 123253; Bischof D, et al., Molecular and cellular biology 1997;17:2312-25). The pTYK2 (Y1054/1055) levels in the NPMl -TYK2 -positive My La cell line and in other T-cell lines were evaluated, and confirmed high levels of pTYK2 in only MyLa indicating constitutive activation of TYK2 kinase (Fig. 7A). Notably, western blot analysis for NPMl and total TYK2 demonstrates the presence of a fusion protein (81kD) supporting the expression of the NPM1-TYK2 fusion protein. Further, immunostaining for NPMl in NPM1-TYK2 fusion positive cases revealed cytoplasmic reactivity and mislocalization of NPMl, a predominantly nuclear protein, indicating abnormal subcellular localization (Fig. 8). To investigate whether the NPM1-TYK2 fusion conferred constitutive activation of STAT signaling, western blot analysis and
immunofluorescence microscopy was performed which revealed that STAT-family members (pSTATl, pSTAT3 and pSTAT5) downstream of TYK2 are constitutively activated in the MyLa cell line (Fig. 7B; Fig. 9). Importantly, constitutively activated STAT signaling was confirmed in primary NPM1-TYK2 fusion positive CD30 positive LPD tissue samples (n= 2), where nuclear expression of pSTAT5 was observed compared to TYK2 negative cases (Fig. 10).
FL AG-tagged NPM1-TYK2 and NPM1-TYK2 (K462R) kinase-defective mutant proteins were ectopically expressed in HEK293FT cells. Expression of NPM1-TYK2 protein demonstrated constitutive TYK2 autophosphorylation whereas the kinase-defective NPM1- TYK2 (K462R) mutant completely abolished its phosphorylation (Fig. 7C). Similarly, pSTATl, pSTAT3 and pSTAT5 were induced by the kinase-active NPM1-TYK2 while the kinase-defective NPM1-TYK2 (K462R) mutant completely abrogated their phosphorylation. Activation of STAT1/3/5 specifically by NPM1-TYK2 was further corroborated by
transcriptional activation (reporter) assays (Fig. 7D). Altogether, these results indicate that expression of the NPM1-TYK2 fusion protein results in constitutive activation of the STAT signaling pathway.
The oncogenic potential of NPM1-TYK2 was further assessed by examining the effect of TYK2 knockdown on STATl/3/5 activation and cell proliferation. Lentivirus-based shRNA-mediated knockdown of TYK2 in MyLa resulted in decreased pSTATl, pSTAT3 and pSTAT5 without affecting their total protein levels (Fig. 7E). Importantly, a significant decrease (2.2 fold) in cell proliferation was observed compared to vector control (P<0.01) (Fig. 7F).
Example 4.
In some embodiments, the following primers are used for cloning in pCAGGS:
NPM 1 exon 1 ecorl F
AAgaattcAGAAAGGAGTGGGGTTGAAAAGCGCTTG (SEQ ID NO: 7) TYK2 exon 23 xhol R
AActcgagTCCAGCAGAGAAAACATGAGTTTATTACCAGATGG (SEQ ID NO: 8).
In some embodiments, the following primers are used for cloning in plentilox IRES
GFP:
NPM1 xhol flag F AActcgagATGGACTACAAGGACGACGATGACAAGGAAGATTCGATGGACATGGAC ATGAGCCC (SEQ ID NO: 9)
TYK2 xbal stop R
AAtctagaTCAGCACACGCTGAACACTGAAGGGGC (SEQ ID NO: 10).
In some embodiments, the following PCR primers are used for PCR amplification for sequencing a NPM1-TYK2 gene fusion:
NPM1 PCR
AAGCGCCAGTGAAGAAATCT (SEQ ID NO: 11)
TYK2 PCR
CCTCTCCGTCAAAGCAGATC (SEQ ID NO: 12).
In some embodiments, the following primers are used for NPM1-TYK2 Q-PCR: NPM-TYK2 Q Fl
ACTCAAAACCATCATCAACACCA (SEQ ID NO: 1)
NPM-TYK2 Q Rl
GTTCCGGCCACACACATTAC (SEQ ID NO: 2)
NPM-TYK2 Q F2
CACCAAAAGGACCTAGTTCTGT (SEQ ID NO: 13)
NPM-TYK2 Q R2
CTCAGCTTGATGAAGGGGCT (SEQ ID NO: 14)
NPM-TYK2 Q F3
ACCATCATCAACACCAAGATCA (SEQ ID NO: 15)
NPM-TYK2 Q R3
GCCAGGATCACTCAGCTTGA (SEQ ID NO: 16).
In some embodiments, NPM1-TYK2 Q-PCR yields the following sequencing result:
GCTGGAAAGTAGATGCTGGCTGTTGCTTGGTATTATAGGGAGGGCCAGGAGCCC
AGGAGTTCGAGACCAGCCTGGGCAACAGGGCGAGACCCCATCTTTTTTGTTTGTT
TTGTTTTAGGTGGAGTTTCGCCCTGTCACCCAGGCTGGAGTGCAATGGCATGATC TCGGCTCACTGCAACCTTCGCCTCCCGGGTTCAAATGATTCTCCCGCCTCAGCCTC CCAAGTAGCTGGGATTATAGGCTCCTGCCATCACGCCCAGCTAATTTTTGTATTTT TAGTAGAGATGGGGTTTCACCATGTTGGTCAGGCTGGTCTCGAACTTCTGACCTC GTGATCCATCCGCCTCAGCCTCCCAAAGTGCTGGGATTCCAGGCGTGAGCCACCA CGCCCAGCTGGCCCCATCTTTTAAAAATAAACAAATAGCCAGGTGTGGTGGCTCA TACCTGTAATCCCAGCAGTTTGGGAGGCCAAGGCGGGTGGATCACCTGAGGTCA GGAGTTTGAGACCAGCCTGGCCAGTATGGCAAAACCTTGCCTCTACTAAAAATAC AAAAAAAATTAGCCAATGTGGTAACTTGCACCTGTAGGCCGAGGTACTCAGGAA GTTGAGGTGGGAGGATCACCTGAGCTCAGGAATTTGAGGCCGTAGTAAGCTATG ATCACACCACTGCACCCCAGCCTGGGCAGCAGCATAGCTAGACCCCATCTCCACC AAAAATTTAAGAATC AGCTAGGCTGTGGTGATGTGC ACCTGTAATTCTCGCTACT TGGAAGGCTTGAGCCCAGGAGTTTGAAGCTGCAGTGAGCTATGTTCGTGCCACTA TACTCCAACCTGAAAGACAGAGTGAGACCCTGTCTT (SEQ ID NO: 17).
In some embodiments, the NPM1-TYK2 gene fusion break point on sequending is provided:
Gtgagtaaagttatcttaaaaaaactttgtctcccccctcaaattgcacgt
ggtttaatatacttgcctggttcgtggtatgaattttttcaaaaatttcttataaaacatttataatcgtgtctgtggtgatt^
ttaaatatgccttattttccattatgcaaggaacgtagtgcactggttgcaagataacattctgaccttccatgttaaaatagatcagtgaaa accctttgcctattctggttgtaagatatgctagagaaccaacagagggcgtatgagacttcattaaaattacaaacagctggaaaagta gatgctggctgttgcttggtattatagggagggccaggagcccaggagttcgagaccagcctgggcaacagggcgagaccccatctt ttttgtttgttttgttttaggtggagtttcgccctgtcacccaggctggagtgcaatggcatgatctcggctcactgcaaccttcgcct ggttcaaatgattctcccgcctcagcctcccaagtagctgggattataggctcctgccatcacgcccagctaatttttgtatttttagtagag atggggtttcaccatgttggtcaggctggtctcgaacttctgacctcgtgatccatccgcctcagcctcccaaagtgctgggattccagg cgtgagccaccacgcccagctggccccatcttttaaaaataaacaaatagccaggtgtggtggctcatacctgtaatcccagcagtttg ggaggccaaggcgggtggatcacctgaggtcaggagtttgagaccagcctggccagtatggcaaaaccttgcctctactaaaaatac aaaaaaaattagccaatgtggtaacttgcacctgtaggccgaggtactcaggaagttgaggtgggaggatcacctgagctcaggaatt tgaggccgtagtaagctatgatcacaccactgcaccccagcctgggcagcagcatagctagaccccatctccaccaaaaatttaagaa tcagctaggctgtggtgatgtgcacctgtaattctcgctacttggaaggcttgagcccaggagtttgaagctgcagtgagctatgttcgtg ccactatactccaacctgagagacagagtgagaccctgtcttaaaaaaaaaaaaaaaaaaaaaaaacaagaaaaaaataacccccca aaaaacaaaacagaaagaaacccagtgatagtcacagttgtccttttcacattggctgtccctatggggaccaggtttggggttggcgtc tgtgcctctcctgagtggccacaccccctctcctgcccacctcag (SEQ ID NO: 18).
In some embodiments, the following primers are provided:
NPMg Fl exonic primer
CACCAAAAGGACCTAGTTCTGT (SEQ ID NO: 13)
NPMg F2
cttgcctggttcgtggtatg (SEQ ID NO: 19)
NPMg F3
aaccaacagagggcgtatga (SEQ ID NO: 20)
NPMg F4
tctcatctgcttgactgggg (SEQ ID NO : 21 )
NPMg F5
gcaaatgtggggtggtgaaa (SEQ ID NO: 22)
NPMg F6
ttttagatgcccctcccctc (SEQ ID NO: 23)
NPMg F7
ttctgatttgccacccatgc (SEQ ID NO: 24)
NPMg F8
ttctgccaaagtcccttgga (SEQ ID NO: 25)
NPMg F9
accgagttgccatgtttgtt (SEQ ID NO: 26)
NPMg FlO
tctaaaggtatctctctcggtgt (SEQ ID NO: 27)
TYK2g Rl
ggatggatcacgaggtcaga (SEQ ID NO: 28)
TYK2g exonic R2
GTTCCGGCCACACACATTAC (SEQ ID NO: 2)
ACTGGCGAGATGGTGGCGGTGAGAGCCCTCAAGGCAGACTGCGGC (SEQ ID NO: 31)
TYK2 K930R R
GCCGCAGTCTGCCTTGAGGGCTCTCACCGCCACCATCTCGCCAGT (SEQ ID NO: 32)
TYK2 Y1054Fe F
GCCGTGCCCGAAGGCCACGAGTTCTACCGCGTGCGCGAGGATGGGG (SEQ ID NO: 33)
TYK2 Y1054Fe R
CCCCATCCTCGCGCACGCGGTAGAACTCGTGGCCTTCGGGCACGGC (SEQ ID NO: 34)
TYK2 Y1054/55Fe F
GCCGTGCCCGAAGGCCACGAGTTCTTCCGCGTGCGCGAGGATGGGG (SEQ ID NO: 35)
TYK2 Y1054/55Fe R
CCCCATCCTCGCGCACGCGGAAGAACTCGTGGCCTTCGGGCACGGC (SEQ ID NO: 36).
All publications, patents, patent applications and accession numbers mentioned in the above specification are herein incorporated by reference in their entirety. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications and variations of the described compositions and methods of the invention will be apparent to those of ordinary skill in the art and are intended to be within the scope of the following claims.
Claims
1. A method for diagnosing a neoplastic disorder or susceptibility to a neoplastic disorder comprising detecting the presence of a gene fusion between TYK2 and a TYK2- gene-fusion-partner in a nucleic acid sample from a subject, and diagnosing the subject as having or being susceptible to a neoplastic disorder when the gene fusion is present.
2. The method of Claim 1, wherein the neoplastic disorder is a cutaneous CD30-positive lymphoproliferative disorder.
3. The method of Claim 2, wherein the cutaneous CD30-positive lymphoproliferative disorder is lymphomatoid papulosis.
4. The method of Claim 2, wherein the cutaneous CD30-positive lymphoproliferative disorder is primary cutaneous anaplastic large cell lymphoma.
5. The method of Claim 1, wherein the gene fusion comprises as least of a portion of the C-terminal kinase domain of TYK2.
6. The method of Claim 1, wherein the wherein the TYK2 -gene-fusion-partner is NPM1.
7. The method of Claim 6, wherein the gene fusion is an NPM1-TYK2 gene fusion.
8. The method of Claim 7, wherein the NPM1-TYK2 gene fusion is a fusion between at least a portion of exon 9 of NPM1 and at least a portion of exon 15 of TYK2.
9. The method of Claim 7, wherein the NPM1-TYK2 gene fusion comprises the oligomerization domain of NPM1.
10. The method of Claim 7, wherein the NPM1-TYK2 gene fusion comprises the histone binding domain of NPM1.
11. The method of Claim 7, wherein the NPM1-TYK2 gene fusion comprises the DNA/RNA binding domain of NPMl.
12. The method of Claim 7, wherein the NPM1-TYK2 gene fusion comprises the pseudokinase domain of TYK2.
13. The method of Claim 7, wherein the NPM1-TYK2 gene fusion comprises the kinase domain of TYK2.
14. The method of Claim 7, wherein the NPM1-TYK2 gene fusion comprises one or more of the following domains: the oligomerization domain of NPMl, the histone binding domain of NPMl, the DNA/RNA binding domain of NPMl, the the pseudokinase domain of TYK2, and the kinase domain of TYK2.
15. The method of Claim 7, wherein the NPM1-TYK2 gene fusion is N5;T19.
16. The method of Claim 1, wherein the sample is selected from the group consisting of: plasma, serum, and tissue.
17. The method of claim 1, wherein the detecting comprises amplifying SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and/or a fragment thereof.
18. The method of claim 1, wherein the detecting comprises PCR, RT-PCR, or nucleic acid hybridization.
19. The method of claim 1, wherein the detecting comprises reverse transcriptase PCR.
20. The method of claim 1, wherein the RT-PCR employs a detectably labeled primer.
21. The method of claim 1, wherein the detecting is accomplished with electrophoresis.
22. The method of claim 1, wherein the detecting is accomplished using a real-time PCR detection system.
23. A kit for detecting a NPMl -TYK2 gene fusion in a sample comprising at least one oligonucleotide comprising the sequence of SEQ ID NOs: 1 , 2, 3, 4, or complements thereof.
24. An antibody that specifically binds to the polypeptide encoded by a NPM1 -TYK2 gene fusion.
25. A kit for detecting gene fusions associated with cutaneous CD30-positive lymphoproliferative disorders in a subject, comprising: at least a first gene fusion informative reagent for identification of a gene fusion between TYK2 and a TYK2 -gene-fusion-partner.
26. The kit of claim 25, wherein said reagent is a probe that specifically hybridizes to the fusion junction of a gene fusion involving TYK2 and a TYK2-gene-fusion-partner.
27. The kit of claim 25, wherein said reagent is a pair of primers that amplify a fusion junction of a gene fusion between TYK2 and a TYK2 -gene-fusion-partner.
28. The kit of claim 27, wherein said pair of primers comprise a first primer that hybridizes to a TYK2 nucleic acid and second primer that hybridizes to nucliec acid from the TYK2 -gene-fusion-partner.
29. The kit of claim 25, wherein said reagent is an antibody that binds to the fusion junction of a fusion polypeptide encoded by a gene fusion between TYK2 and a TYK2-gene- fusion-partner.
30. The kit of claim 25, wherein the reagent is a sequencing primer that binds to a gene fusion between TYK2 and a TYK2-gene-fusion-partner and generates an extension product that spans the fusion junction of said gene fusion.
31. The kit of Claim 30, wherein the gene fusion is NPM1 -TYK2.
32. The kit of claim 31, wherein said regent comprises a pair of probes wherein said first probe hybridizes to NPM1 and said second probe hybridizes to TYK2.
33. The kit of claim 32, wherein the first probe comprises SEQ ID NO: 1 or a fragment thereof, and the second probe comprises SEQ ID NO: 2, or a fragment thereof.
34. The kit of claim 32, wherein the first probe comprises SEQ ID NO: 3 or a fragment thereof, and the second proble comprises SEQ ID NO: 4, or a fragment thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/547,325 US10590488B2 (en) | 2015-01-30 | 2016-01-29 | Recurrent gene fusions in cutaneous CD30-positive lymphoproliferative disorders |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562110034P | 2015-01-30 | 2015-01-30 | |
| US62/110,034 | 2015-01-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2016123517A2 true WO2016123517A2 (en) | 2016-08-04 |
| WO2016123517A3 WO2016123517A3 (en) | 2016-10-13 |
Family
ID=56544536
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/015714 Ceased WO2016123517A2 (en) | 2015-01-30 | 2016-01-29 | Recurrent gene fusions in cutaneous cd30-positive lymphoproliferative disorders |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10590488B2 (en) |
| WO (1) | WO2016123517A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110669840A (en) * | 2019-10-30 | 2020-01-10 | 宁波胤瑞生物医学仪器有限责任公司 | NPM1 mutation detection kit |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002006326A2 (en) * | 2000-07-14 | 2002-01-24 | Millennium Pharmaceuticals, Inc. | 62088, a human nucleoside phosphatase family member and uses thereof |
| WO2002088309A2 (en) * | 2001-04-27 | 2002-11-07 | St. Jude Children's Research Hospital | Fusion genes associated with acute megakaryoblastic leukemias |
| EP3019628A4 (en) * | 2013-07-12 | 2017-05-10 | The Regents Of The University Of Michigan | Recurrent gene fusions in cancer |
-
2016
- 2016-01-29 US US15/547,325 patent/US10590488B2/en active Active
- 2016-01-29 WO PCT/US2016/015714 patent/WO2016123517A2/en not_active Ceased
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110669840A (en) * | 2019-10-30 | 2020-01-10 | 宁波胤瑞生物医学仪器有限责任公司 | NPM1 mutation detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016123517A3 (en) | 2016-10-13 |
| US20180010196A1 (en) | 2018-01-11 |
| US10590488B2 (en) | 2020-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11390923B2 (en) | ncRNA and uses thereof | |
| JP5512125B2 (en) | Recurrent gene fusion in prostate cancer | |
| AU2010203517B2 (en) | Recurrent gene fusions in cancer | |
| US9783853B2 (en) | Recurrent gene fusions in cancer | |
| EP2591363B1 (en) | Diagnosis and treatment of breast cancer | |
| JP2018019720A (en) | Recurrent gene fusions in prostate cancer | |
| EP2761300A2 (en) | Recurrent gene fusions in breast cancer | |
| EP2094866B1 (en) | Diagnosis and treatment of breast cancer | |
| EP2167689A2 (en) | Recurrent gene fusions in prostate cancer | |
| WO2009061890A1 (en) | Methods and compositions for the diagnosis, prognosis and treatment of chronic myeloid leukemia and acute lymphoblastic leukemia | |
| WO2018127786A1 (en) | Compositions and methods for determining a treatment course of action | |
| US9476096B2 (en) | Recurrent gene fusions in hemangiopericytoma | |
| US9657350B2 (en) | RNA chimeras in human leukemia and lymphoma | |
| KR20150085459A (en) | Novel NTRK1 fusion gene as colon cancer marker and the uses thereof | |
| US11015224B2 (en) | RAF gene fusions | |
| US10590488B2 (en) | Recurrent gene fusions in cutaneous CD30-positive lymphoproliferative disorders | |
| EP2795333A1 (en) | Pseudogenes and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16744201 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15547325 Country of ref document: US |
|
| NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16744201 Country of ref document: EP Kind code of ref document: A2 |
