WO2016118090A1 - Cancer specific antigen-binding proteins - Google Patents

Cancer specific antigen-binding proteins Download PDF

Info

Publication number
WO2016118090A1
WO2016118090A1 PCT/SG2016/050032 SG2016050032W WO2016118090A1 WO 2016118090 A1 WO2016118090 A1 WO 2016118090A1 SG 2016050032 W SG2016050032 W SG 2016050032W WO 2016118090 A1 WO2016118090 A1 WO 2016118090A1
Authority
WO
WIPO (PCT)
Prior art keywords
antigen
binding
binding protein
binding fragment
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SG2016/050032
Other languages
French (fr)
Inventor
Boon Hwa Andre Choo
Tien Sze Louisa LUK
Robert Brown
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ip2ipo Innovations Ltd
Agency for Science Technology and Research Singapore
Original Assignee
Imperial Innovations Ltd
Agency for Science Technology and Research Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Imperial Innovations Ltd, Agency for Science Technology and Research Singapore filed Critical Imperial Innovations Ltd
Publication of WO2016118090A1 publication Critical patent/WO2016118090A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • G01N33/57585Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds identifiable in body fluids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069Reproductive system, e.g. ovaria, uterus, testes, prostate
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57515Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57525Immunoassay; Biospecific binding assay; Materials therefor for cancer of the liver or pancreas
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57545Immunoassay; Biospecific binding assay; Materials therefor for cancer of the ovaries
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/734Complement-dependent cytotoxicity [CDC]

Definitions

  • the present invention relates to antigen -binding proteins and fragments thereof as well as antibodies that bind to cancer cells. Specifically, the present invention relates to antigen -binding proteins and fragments thereof that bind to clathrin heavy chain 1 (CHC1) on the surface of cancer stem cells.
  • CHC1 clathrin heavy chain 1
  • Cancer stem cells are hypothesized to be a rare population of tumor cells possessing embryonic stem cell-like characteristics and are resistant to conventional chemotherapy treatments.
  • mAbs monoclonal antibodies developed against several growth factor receptors have been shown to exert therapeutic efficacy in the treatment of solid tumors, such as ovarian cancer.
  • solid tumors such as ovarian cancer.
  • bevacizumab a potent angiogenesis inhibitor
  • mAbs do not target CSC markers and therefore fail to demonstrate clinically significant effects on overall survival in cancer.
  • an antigen-binding protein or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GFSLSRYGVY; a VHCDR2 having the amino acid sequence VIW A VGS TN YNS ALMS , and a VHCDR3 having the amino acid sequence DREYGYGLAY; and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence SASSSVSYIH, a VLCDR2 having the amino acid sequence DTSNLAS, and a VLCDR3 having the amino acid sequence FQGSGYPLT.
  • an antigen-binding protein or an antigen-binding fragment thereof, or an antigen-binding fragment thereof, that competes with the antigen binding protein as described herein for binding to clathrin heavy chain 1 (CHC1).
  • CHC1 clathrin heavy chain 1
  • an antigen-binding protein or an antigen-binding fragment thereof, as described herein, comprising a radioisotope or a cytotoxin conjugated thereto.
  • composition comprising a physiologically acceptable carrier and a therapeutically effective amount of the antigen-binding protein, or an antigen-binding fragment thereof as described herein.
  • an antigen-binding protein, or an antigen-binding fragment thereof as described herein in the manufacture of a medicament for treating cancer.
  • a method for detecting cancer in a subject comprising: contacting a sample obtained from the subject with an antigen-binding protein, or an antigen-binding fragment thereof as described herein in vitro; detecting the binding of the antigen-binding protein, or an antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample is indicative of cancer.
  • a method for treating cancer in a subject comprising administering a therapeutically effective amount of an antigen-binding protein, or an antigen-binding fragment thereof as described herein to a subject in need thereof.
  • kits when used in the method as described herein, comprising an antigen-binding protein, or an antigen-binding fragment thereof as described herein, together with instructions for use.
  • FIG. 1 Identification of stem cell-like subpopulations in ovarian cancer cell lines.
  • A flow cytometry analysis displaying a representative diagram of the SP in IGROV1, following staining with Hoechst 33342 dye (right). Effect of the transporter blocker, verapamil, on the SP subset (left). Hoechst "blue” represents the 450 BP filter, the standard analysis wavelength for Hoechst 33342 analysis for DNA content. Hoechst "red” was detected at 675 nm.
  • B flow cytometry analysis displaying a representative diagram of Aldefluor-positive cells in IGROV1 when cells were incubated with the Aldefluor substrate, BAAA (right). The specific inhibitor of ALDH, DEAB, was used to establish the baseline fluorescence of the cells (left).
  • Fig. 2 Characterization of stem cell-like subpopulations in the IGROV1 ovarian cancer cell line.
  • A RT-qPCR analysis. Mean mRNA expression levels of stem cell markers in SP ( ⁇ ) in relation to NSP (;3 ⁇ 4 «).
  • FIG. 3 Identification of mAbs which fulfilled the selection criteria.
  • A representative flow cytometry analyses displaying reactivity of a positive antibody clone, TAG-OCS l. MAbs were screened against IGROVl Aldefluor-positive cells and positive antibody clones were then tested against five cell lines - IGROVl, PEA1, hESC, IMR90 and HEK293. (:3 ⁇ 4) represent the control samples while ( ⁇ ) represent samples incubated with the TAG-OCS l.
  • B representative immunocytochemistry data showing binding of TAG-OCS l to subpopulations of cells in the IGROVl cell line. Scale bar: 20 ⁇ .
  • FIG. 4 Reactivity of TAG-OCS l towards cell populations.
  • A flow cytometry analysis of IGROVl cells which were co-stained with TAG-OCS l and Hoechst dye.
  • B flow cytometry analyses displaying reactivity of TAG-OCS l to hESC and hESC-derived EBs.
  • C immunocytochemistry images showing binding of TAG-OCS l to hESCs. HESCs stained with Oct4 served as controls. Scale bar: 200 ⁇ .
  • D flow cytometry analyses displaying reactivity of TAG-OCS l towards cells from the normal ovarian cell lines, OSEC2 and IOSE21.
  • Fig. 5 Characterization of ovarian tumour subpopulations detected by TAG- OCS l.
  • A mean mRNA expression levels by RT-qPCR of stem cell markers in IGROVl TAG-OCS l -positive populations ( ⁇ ) in relation to TAG-OCS l -negative populations (3 ⁇ 43 ⁇ 43 ⁇ 4).
  • Fig. 6 Validating the target antigen of TAG-OCS l.
  • A validation of mass spectrometry results by immunoprecipitation and subsequent Western blotting. Immunoprecipitated eluate (IP) and membrane protein extracts (Lysate) using TAG-OCS l were subjected to Western blot and probed with rnAb to human CHC1 (mAb-CHCl, left). To confirm this result, immunoprecipitated eluate using human CHC1 was subjected to Western blot and probed with TAG-OCS l (right). Human CHC1 antibody and TAG-OCS l served as negative controls.
  • B RT-qPCR analysis.
  • D & E show staining of clinical samples by TAG-OCS l.
  • D immunofluorescence staining showing EpCam-positive patient ovarian ascites stained positively by TAG-OCS l and patient ovarian tumour sections were positively-stained by TAG-OCS l.
  • E immunohistochemistry showing patient ovarian tumour sections stained positively by TAG-OCS l.
  • F differential staining in normal and ovarian patient tumour microarray (TMA) sections. Patient TMA sections stained positively by TAG-OCS l while normal ovary sections did not exhibit any staining by TAG-OCS l.
  • FIG. 7 Effect of TAG-OCS l on cells in vitro.
  • A left, Alamar Blue assay measuring viability of IGROV1 ovarian cancer cells after addition of TAG-OCS l compared to the buffer control.
  • Right xCELLigence experiment measuring cell indexes of IGROV1 ovarian cancer cells after addition of TAG-OCS l ( ⁇ ) compared to the buffer control (;;3 ⁇ 43 ⁇ 4).
  • B left, microscopic images of IGROV1 cells after a 72 hours incubation period with buffer.
  • Right microscopic images of IGROV1 cells after a 72 hours incubation period with TAG- OCS l.
  • Scale bar 500 ⁇ .
  • the mAb also binds to 87.5% of 786-0 cells (kidney cancer cell line) and 92.1% of MCF7 cells (breast cancer cell line). Furthermore, TAG-OCS l confers cytotoxicity towards MCF7 cells.
  • F CDC assay showing percentage cytotoxicity of IGROV1 cells after incubation with complement or inactivated complement.
  • G CDC assay showing percentage cytotoxicity of 786-0 (kidney cancer) cells after incubation with complement or inactivated complement.
  • H CDC assay showing percentage cytotoxicity of MCF7 (breast cancer) cells after incubation with complement or inactivated complement.
  • I ADC assay showing luminescence levels of viable cells after IGROV1 cells were incubated with buffer, ZAP, mAb controls or mAb- ZAP.
  • J ADC assay showing luminescence levels of viable cells after MCF7 cells were incubated with buffer, ZAP, mAb controls or mAb-ZAP.
  • TAG-OCS 1 -positive cells formed increased sizes and numbers of colonies when compared to their counterparts as well as to unseparated cells.
  • TAG-OCS 1 mediates CDC activity and is successful as an ADC in PEA1 cells.
  • Fig. 11 TAG-OCS 1 heavy and light chain amino acid sequence alignment to the encoding nucleic acid sequence.
  • FIG. 12 A and B, flow cytometry experiments show that chimeric TAG-OCS 1 successfully binds to 786-0 kidney cancer cell line (A) and the MCF7 breast cancer cell line (B) at a level which is comparable to the original IgM molecule. Chimeric TAG-OCS 1 also convers cytotoxicity towards MCF7 cells.
  • C ADC assay showing luminescence levels of viable cells after IGROV1 cells were incubated with buffer, ZAP, mAb controls or mAb- ZAP.
  • D ADC assay showing luminescence levels of viable cells after PEA1 cells were incubated with buffer, ZAP, mAb controls or mAb-ZAP.
  • the present invention relates to antigen-binding proteins, or an antigen-binding fragments thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GFSLSRYGVY; a VHCDR2 having the amino acid sequence VIWAVGSTNYNSALMS, and a VHCDR3 having the amino acid sequence DREYGYGLAY; and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence SASSSVSYIH, a VLCDR2 having the amino acid sequence DTSNLAS, and a VLCDR3 having the amino acid sequence FQGSGYPLT.
  • antigen binding protein refers to antibodies, antibody fragments and other protein constructs, such as domains, which are capable of binding to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term "antigen-binding fragment" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab') 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment, which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab') 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
  • a Fd fragment consisting of the
  • fragment includes a reference to a nucleic acid or polypeptide molecule that encodes a constituent or is a constituent of a particular polypeptide / nucleic acid or variant thereof.
  • the fragment possesses qualitative biological activity in common with the polypeptide in question.
  • fragments of a nucleic acid sequence do not necessarily need to encode polypeptides which retain biological activity, for example, hybridisation probes or PCR primers.
  • a fragment of a nucleic acid sequence encodes a polypeptide which retains qualitative biological activity of the polypeptide.
  • the fragment may be physically derived from the full- length polypeptide / nucleic acid or alternatively may be synthesised by some other means, for example chemical synthesis.
  • antibody is used herein in the broadest sense to refer to molecules with an immunoglobulin-like domain and includes monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, diabodies, TandabsTM.
  • an antibody refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, or an antigen-binding portion thereof.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
  • Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region.
  • the light chain constant region is comprised of one domain, CL.
  • the VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity determining regions
  • FR framework regions
  • Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • CDRs are defined as the complementarity determining region amino acid sequences of an antigen binding protein. These are the hypervariable regions of immunoglobulin heavy and light chains. There are three heavy chains and three light chain CDRs (or CDR regions) in the variable portion of an immunoglobulin. Thus, “CDRs” as used herein refers to all three heavy chain CDRs, all three light chain CDRs, all heavy and light chain CDRs, or at least two CDRs.
  • An antigen binding fragment may be provided by means of arrangement of one or more CDRs on non-antibody protein scaffolds such as a domain.
  • the domain may be a domain antibody or may be a domain which is a derivative of a scaffold selected from the group consisting of CTLA-4, lipocalin, SpA, an Affibody, an avimer, GroEl, transferrin, GroES and fibronectin/adnectin, which has been subjected to protein engineering in order to obtain binding to an antigen, other than the natural ligand.
  • An antigen binding fragment or an immunologically effective fragment may comprise partial heavy or light chain variable sequences. Fragments are at least 5, 6, 8 or 10 amino acids in length. Alternatively the fragments are at least 15, at least 20, at least 50, at least 75, or at least 100 amino acids in length.
  • single variable domain refers to an antigen binding protein variable domain (for example, V H , V HH , V L ) that specifically binds an antigen or epitope independently of a different variable region or domain.
  • a “domain antibody” or “dAb” may be considered the same as a “single variable domain” which is capable of binding to an antigen.
  • a single variable domain may be a human antibody variable domain, but also includes single antibody variable domains from other species such as rodent, nurse shark and Camelid V HH dAbs.
  • Camelid V HH are immunoglobulin single variable domain polypeptides that are derived from species including camel, llama, alpaca, dromedary, and guanaco, which produce heavy chain antibodies naturally devoid of light chains. Such V HH domains may be humanised according to standard techniques available in the art, and such domains are considered to be "domain antibodies”. As used herein V H includes camelid V HH domains.
  • domain refers to a folded protein structure which has tertiary structure independent of the rest of the protein. Generally, domains are responsible for discrete functional properties of proteins, and in many cases may be added, removed or transferred to other proteins without loss of function of the remainder of the protein and/or of the domain.
  • a "single variable domain” is a folded polypeptide domain comprising sequences characteristic of antibody variable domains. It therefore includes complete antibody variable domains and modified variable domains, for example, in which one or more loops have been replaced by sequences which are not characteristic of antibody variable domains, or antibody variable domains which have been truncated or comprise N- or C-terminal extensions, as well as folded fragments of variable domains which retain at least the binding activity and specificity of the full-length domain.
  • a domain can bind an antigen or epitope independently of a different variable region or domain.
  • antigen binding protein binds to its antigen, for example, clathrin or clathrin heavy chain 1 (CHC1) with no or insignificant binding to other proteins.
  • CHC1 clathrin heavy chain 1
  • the antigen binding proteins described herein may bind to its antigen with at least 2, 5, 10, 50, 100, or 1000 fold greater affinity than they bind to closely related molecules.
  • the antigen-binding proteins or antigen-binding fragments thereof of the invention are characterized by particular functional features or properties.
  • the antibodies bind specifically to clathrin (e.g., bind to human clathrin and may cross-react with clathrin from other species, such as cynomolgus monkey).
  • an antibody of the invention binds to clathrin with high affinity, for example with a K D of 1x10 " M or less.
  • Standard assays to evaluate the binding ability of the antigen-binding proteins or antigen -binding fragments toward the antigen of interest e.g.
  • CHC1 are known in the art, including for example, ELISAs, Western blots and RIAs.
  • the binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis. Suitable assays for evaluating any of the above-described characteristics are described in detail in the Examples.
  • the heavy chain variable region comprises the amino acid sequence set forth in SEQ ID NO: l.
  • the light chain variable region comprises the amino acid sequence set forth in SEQ ID NO:2
  • amino acid sequences disclosed in the present invention are encoded by nucleic acid sequences. It will also be understood to one of skill in the art that nucleic acid codons encoding each amino acid are degenerate. Accordingly, there may be more than one nucleic acid sequence for a given amino acid sequence and the alternative sequences may be determined by one of skill in the art.
  • SEQ ID NO: 1 and SEQ ID NO: 2 are provided in Table 1.
  • SEQ ID NO: 3 is one possible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 1.
  • SEQ ID NO: 4 is one possible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2.
  • Table 1 Amino acid and nucleic acid sequences of the antigen-binding proteins of the invention.
  • an antigen-binding protein, or antigen-binding fragment thereof of the present invention may comprise heavy and light chain variable regions comprising amino acid sequences that are homologous to the amino acid sequences of the preferred antibodies described herein, and wherein the antibodies retain the desired functional properties of the antigen-binding protein, or antigen-binding fragment of the invention.
  • the antigen-binding protein comprises heavy and light chain CDR regions that are about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65% and 60% identical to the heavy and light chain CDR regions of (i) and (ii).
  • the antigen-binding protein, or an antigen-binding fragment thereof comprises heavy and light chain CDR regions that are about 80% identical to the heavy and light chain CDR regions of (i) and (ii).
  • the antigen-binding protein, or an antigen-binding fragment thereof comprises a heavy chain variable region which comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: l.
  • the antigen-binding protein, or an antigen-binding fragment thereof comprises a light chain variable region which comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO:2.
  • the percent homology between two amino acid sequences is equivalent to the percent identity between the two sequences.
  • the antigen-binding protein, or an antigen-binding fragment thereof is a monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, a single chain antibody, a univalent antibody lacking a hinge region, a minibody, diabodies, and TandabsTM.
  • monoclonal antibody or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • polyclonal antibody or “polyclonal antibody composition” as used herein refer to a preparation of a collection of antibody molecules, each identifying a different epitope of a specific antigen.
  • a polyclonal antibody composition displays a single binding specificity and affinity for different epitopes.
  • humanized antibody is intended to refer to antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences. Additional framework region modifications may be made within the human framework sequences.
  • chimeric antibody is intended to refer to antibodies in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as an antibody in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody.
  • recombinant antibody refers to antibodies or fragments which have been produced using recombinant DNA techniques.
  • antibodies having an antigen binding site at least part of which is derived from a different antibody such as those in which hypervariable or complementarity determining regions of one antibody have been grafted into variable framework regions of a second, different, and preferably human, antibody; recombinant antibodies or fragments wherein non-Fv sequences have been substituted by non-Fv sequences from other, different antibodies; or recombinant antibodies or fragments possessing substantially the structure of a natural immunoglobulin but wherein the hinge region has a different number of cysteine residues from that found in the natural immunoglobulin, or wherein one or more cysteine residues in a surface pocket of the recombinant antibody of fragment is in the place of another amino acid residue present in the natural immunoglobulin.
  • bispecific antibody refers to antibodies or fragments thereof that can bind with at least two different antigens.
  • Bispecific antibodies may be mono-, tetra- or multivalent. Methods of generating bispecific antibodies are known in the art. For example, chemical reassociation of monovalent L and H fragments, hybrid hybridoma, or engineering knobs-into-holes complementarity into both H-chains. Tetravalent bispecific antibodies can be created by chemical crosslinking of two monoclonal antibodies (Bs(lgG)2). Using F(ab)' fragments as building blocks, multivalent bispecific antibodies can also be created by chemical crosslinking of two or more Fab' molecules (Bs(Fab')2). A genetically controlled heterodimerization of a Bs(Fab')2 molecule was previously described, where the F(ab')- molecules were fused to a fos and a jun heterodimerization domain.
  • heteroconjugate antibody refers to an antibody or fragment thereof comprising two or more covalently linked monoclonal antibodies or fragments thereof with different specificities.
  • single chain antibody or “single chain variable fragment (scFv)” refers to antibodies or fragments thereof wherein the heavy chain variable domain and light chain variable domain of an antigen binding protein or antigen binding fragment thereof are linked to form a single chain. Linkage may be by a linker peptide. Single chain antibodies or single chain Fvs may be linked to form bivalent scFvs or dimerized to form diabodies.
  • diabody refers to bivalent and bispecific antibodies or fragments thereof which comprise a heavy chain variable domain connected to a light chain variable domain by a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain to create two antigen-binding sites.
  • univalent antibody refers to antibodies or fragments thereof that have one antigen-binding site. Accordingly, the term “univalent antibody lacking a hinge region” refers to antibodies or fragments thereof that have one antigen-binding site and that lack the hinge region between the CHI and DH2 domains.
  • minibody refers to antibodies or fragments thereof comprising the variable heavy and variable light chain domains of an antigen binding protein or antigen binding fragment thereof fused to the hinge region and to the CH3 domain of the immunoglobulin molecule.
  • the antigen-binding protein, or an antigen-binding fragment thereof is a monoclonal antibody.
  • the monoclonal antibody is TAG-OCS 1.
  • the monoclonal antibody is humanised.
  • the present invention features an antigen-binding fragment thereof, or antigen-binding protein that binds to clathrin.
  • Clathrin plays a major role in the formation of coated vesicles and is involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules.
  • Clathrin protein is composed of three heavy chains and three light chains. There are two forms of clathrin heavy chains, denoted clathrin heavy chain 1 (CHCl) and clathrin heavy chain 2 (CHC2), while there are two forms of clathrin light chains, denoted clathrin light chain A and clathrin light chain B.
  • the antigen-binding fragment thereof, or antigen- binding protein binds to clathrin heavy chain 1 (CHCl).
  • the present invention features an antigen-binding fragment thereof, or antigen-binding protein that competes with the antigen binding protein or fragment thereof as disclosed herein for binding to CHCl.
  • the term "competes with” in reference to binding of an antigen- binding fragment thereof, or antigen-binding protein refers to an antigen-binding fragment thereof, or antigen-binding protein that has a similar or higher binding affinity to an antigen than the antigen-binding fragments thereof, or antigen-binding proteins of the present invention. Binding of the antigen-binding fragment thereof, or antigen-binding protein to the target antigen inhibits binding of the antigen by the antigen-binding protein or fragments thereof of the present invention.
  • the present invention features antigen-binding protein or antigen- binding fragment thereof, for example an antigen-binding protein or fragment thereof that binds to clathrin, conjugated to a therapeutic moiety, such as a cytotoxin, a drug (e.g., an immunosuppressant) or a radioisotope.
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to (e.g., kills) cells.
  • Examples include saporin, mertansine (DM1), monomethyl auristatin E (MMAE), taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1- dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • DM1 mertansine
  • MMAE monomethyl auristatin E
  • taxol examples include saporin, mertansine (DM1), monomethyl auristatin E (MMAE), taxol, cytochalasin B, gramicidin D,
  • Therapeutic agents also include, for example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vin
  • cytotoxins examples include saporin, mertansine (DM1) and monomethyl auristatin E (MMAE).
  • Cytoxins can be conjugated to antibodies of the invention using linker technology available in the art.
  • linker types that have been used to conjugate a cytotoxin to an antibody include, but are not limited to, hydrazones, thioethers, esters, disulfides and peptide-containing linkers.
  • Antibodies of the present invention also can be conjugated to a radioactive isotope, or radioisotope to generate cytotoxic radiopharmaceuticals, also referred to as radioimmunoconjugates.
  • radioactive isotopes that can be conjugated to antibodies for use diagnostically or therapeutically include, but are not limited to, iodine 131 , indium 111 , yttrium 90 and lutetium 177 .
  • Methods for preparing radioimmunconjugates are established in the art. Examples of radioimmunoconjugates are commercially available, including ZevalinTM (IDEC Pharmaceuticals) and BexxarTM (Corixa Pharmaceuticals), and similar methods can be used to prepare radioimmunoconjugates using the antibodies of the invention.
  • the radioisotope is yttrium 90 .
  • the antibody conjugates of the invention can be used to modify a given biological response, and the drug moiety is not to be construed as limited to classical chemical therapeutic agents.
  • the drug moiety may be a protein or polypeptide possessing a desired biological activity.
  • proteins may include, for example, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor or interferon-.
  • gamma gamma.
  • biological response modifiers such as, for example, lymphokines, interleukin-1 (“IL-1 "), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”), granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony stimulating factor (“G-CSF”), or other growth factors.
  • IL-1 interleukin-1
  • IL-2 interleukin-2
  • IL-6 interleukin-6
  • GM-CSF granulocyte macrophage colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • the present invention provides a composition, e.g., a pharmaceutical composition, comprising a physiologically acceptable carrier and a therapeutically effect amount of the antigen-binding protein, or antigen-binding fragment thereof of the present invention.
  • a composition may include one or a combination of (e.g., two or more different) antigen-binding proteins or antigen-binding fragments thereof of the invention.
  • a pharmaceutical composition of the invention can comprise a combination of antibodies that bind to different epitopes on the target antigen or that have complementary activities.
  • compositions of the invention also can be administered in combination therapy, i.e., combined with other agents or pharmaceutical ingredients.
  • the combination therapy can include an antigen-binding protein or antigen-binding fragment of the present invention (e.g., TAG-OCS 1) combined with at least one other chemo therapeutic, antiinflammatory or immunosuppressant agent.
  • therapeutic agents that can be used in combination therapy include but are not limited to infliximab, bevacizumab, trastuzumab, carboplatin, cisplatin, oxaliplatin and paclitaxel.
  • compositions of the invention are administered in combination with one or more of bevacizumab, carboplatin or paclitaxel.
  • compositions of the invention are administered together with another pharmaceutical agent
  • the other pharmaceutical agent may be administered separately, simultaneously or sequentially.
  • a “therapeutically effective amount” or “therapeutically effective dosage” include within its meaning a non-toxic but sufficient amount of an agent or compound to provide the desired therapeutic effect, such as, a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction.
  • a “therapeutically effective dosage” preferably inhibits cell growth or tumor growth by at least about 20%, more preferably by at least about 40%, even more preferably by at least about 60%, and still more preferably by at least about 80% relative to untreated subjects.
  • the ability of a compound to inhibit tumor growth can be evaluated in an animal model system predictive of efficacy in human tumors.
  • composition can be evaluated by examining the ability of the compound to inhibit, such inhibition in vitro by assays known to the skilled practitioner.
  • a therapeutically effective amount of a therapeutic compound can decrease tumor size, or otherwise ameliorate symptoms in a subject. Accordingly, the exact amount required will vary from subject to subject depending on factors such as the species being treated, the age and general condition of the subject, the severity of the condition being treated, the particular agent being administered and the mode of administration and so forth. Thus, it is not possible to specify an exact "effective amount”.
  • pharmaceutically acceptable carrier or “physiologically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).
  • the active compound i.e., antigen-binding fragment, antigen-binding protein or antibody may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
  • the pharmaceutical compounds of the invention may include one or more pharmaceutically acceptable salts.
  • a "pharmaceutically acceptable salt” refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include acid addition salts and base addition salts.
  • Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like.
  • nontoxic inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like
  • nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like.
  • Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as ⁇ , ⁇ '-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.
  • a pharmaceutical composition of the invention also may include a pharmaceutically acceptable anti-oxidant.
  • pharmaceutically acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil- soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil- soluble antioxidants such as ascorbyl palmitate, butyl
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.01 percent to about ninety-nine percent of active ingredient, preferably from about 0.1 percent to about 70 percent, most preferably from about 1 percent to about 30 percent of active ingredient in combination with a pharmaceutically acceptable carrier.
  • Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response).
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
  • the dosage ranges from about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg, of the host body weight.
  • dosages can be 0.3 mg/kg body weight, 1 mg/kg body weight, 3 mg/kg body weight, 5 mg/kg body weight or 10 mg/kg body weight or within the range of 1-10 mg/kg.
  • An exemplary treatment regime entails administration once per week, once every two weeks, once every three weeks, once every four weeks, once a month, once every 3 months or once every three to 6 months.
  • Preferred dosage regimens for an antibody of the invention e.g.
  • TAG-OCS 1 include 1 mg/kg body weight or 3 mg/kg body weight via intravenous administration, with the antibody being given using one of the following dosing schedules: (i) every four weeks for six dosages, then every three months; (ii) every three weeks; (iii) 3 mg/kg body weight once followed by 1 mg/kg body weight every three weeks.
  • the antigen-binding protein, fragment thereof or antibody can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the antibody in the patient. In general, human antibodies show the longest half -life, followed by humanized antibodies, chimeric antibodies, and nonhuman antibodies. The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, a relatively low dosage is administered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and preferably until the patient shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.
  • compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
  • the selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • the antigen-binding proteins, fragments thereof, antibodies, antibody compositions and methods of the present invention have numerous in vitro and in vivo utilities involving, for example, binding to CHClor detecting CHC1 on the surface of CSCs, such as ovarian CSCs.
  • these molecules can be administered to cells in culture, in vitro or ex vivo, or to human subjects, e.g., in vivo, to enhance immunity in a variety of situations.
  • the invention provides a use of an antigen-binding protein, or fragment thereof of the present invention in the manufacture of a medicament for treating cancer.
  • Preferred cancers which may be treated using the antibodies of the invention include cancers typically responsive to immunotherapy.
  • preferred cancers for treatment include melanoma (e.g., metastatic malignant melanoma), renal cancer (e.g. clear cell carcinoma), prostate cancer (e.g. hormone refractory prostate adenocarcinoma), breast cancer, colon cancer, liver cancer (e.g. hepatocellular carcinoma, cholangiocarcinoma, fibrolamellar carcinoma, angiosarcoma and hepatoblastoma) and lung cancer (e.g. non-small cell lung cancer).
  • the invention includes refractory or recurrent malignancies whose growth may be inhibited using the antibodies of the invention.
  • Examples of other cancers that may be treated using the methods of the invention include bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin's lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemias including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic le
  • compositions or medicaments of the present invention can be administered via one or more routes of administration using one or more of a variety of methods known in the art.
  • routes and/or mode of administration will vary depending upon the desired results.
  • Preferred routes of administration for antibodies of the invention include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal or other parenteral routes of administration, for example by injection or infusion.
  • parenteral administration means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
  • an antigen-binding protein, fragment thereof or antibody of the invention can be administered via a non-parenteral route, such as a topical, epidermal or mucosal route of administration, for example, intranasally, orally, vaginally, rectally, sublingually or topically.
  • a non-parenteral route such as a topical, epidermal or mucosal route of administration, for example, intranasally, orally, vaginally, rectally, sublingually or topically.
  • the active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • a controlled release formulation including implants, transdermal patches, and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art.
  • compositions can be administered with medical devices known in the art.
  • the present invention also provides a method for detecting cancer in a subject, the method comprising: contacting a sample obtained from the subject with an antigen-binding protein, or an antigen-binding fragment thereof of the present invention in vitro; detecting the binding of the antigen-binding protein, or an antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample is indicative of cancer.
  • the terms “detecting” or “detection” refer to the determination of the presence or absence of binding of the antigen-binding protein or antigen-binding fragments thereof of the present invention to the target antigen in a sample.
  • the terms “detecting” or “detection” may also refer to the measurement of relative levels of binding of the antigen-binding protein or antigen-binding fragments thereof of the present invention to a target antigen in a sample relative to another sample or control sample.
  • control sample is from the same subject. In another embodiment, the control sample is from a different subject.
  • the control sample may from the same type of sample, or from a different type of sample.
  • sample refers to a biological sample obtained from a subject and includes but is not limited to blood, blood plasma, serum, buccal smear, amniotic fluid, prenatal tissue, sweat, nasal swab or urine, organs, tissues, fractions, and cells isolated from mammals including humans.
  • a sample may also include sections of the biological sample including tissues (for example, sectional portions of an organ or tissue), extracts from a biological sample, for example, an antigen from a biological fluid (for example, blood or urine).
  • the term "subject” is intended to include human and non-human animals.
  • Non-human animals includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles, although mammals are preferred, such as non-human primates, sheep, dogs, cats, cows and horses.
  • the terms "patient” or “subject” are used interchangeably.
  • Preferred subjects include human patients in need of cancer treatment.
  • the antigen -binding protein, or antigen -binding fragment thereof comprises a detectable label.
  • Detectable labels include fluorescent, chemiluminescent, bioluminescent, radioisotopes and enzyme labels. Non-limiting examples include FITC, TRITC, GFP, phycobilliproteins, luciferase ds Red, alkaline phosphatase, horseradish peroxidase, glucose oxidase, PE, Cy Dyes, biotin-strepavidin and Qdots®.
  • the detectable label is biotin, alkaline phosphatase, horseradish peroxidase, FITC, PE or Cy Dyes.
  • Detection of the detectable label may be achieved by conventional means in the art.
  • the detectable label may be detected using flow cytometry, immunohistochemistry and in tissue sections.
  • the instant disclosure provides a kit of parts comprising an antigen-binding protein or antigen-binding fragment thereof as described herein.
  • the kit may also further comprise instructions for use.
  • the antigen-binding protein or antigen-binding fragment thereof is packaged in unit dosage form.
  • the side population was defined as described in Goodell et al. (15). After which, cells were resuspended in phosphate -buffered saline (PBS) and maintained at 4°C until analysis/sorting.
  • PBS phosphate -buffered saline
  • the Aldefluor kit (STEMCELL Technologies Inc., #01700) was used to isolate CSC populations with a high aldehyde enzymatic activity according to the manufacturer's instructions.
  • IGROV1 cells were fixed in 4% paraformaldehyde for 30 minutes at room temperature and thereafter incubated with TAG-OCS 1 culture supernatant or commercial CHC1 antibody (1: 1000 dilution; Lifespan Biosciences, #LS-C22246-100) overnight at 4°C. Binding of the antibody to the cell surface was then visualized using goat a-mouse antibody conjugated with phycoerythrin (PE; 1:500 dilution; DAKO, #R0480). Finally, mounting media (Vector Laboratories, #H1200) containing DAPI was used to counterstain cell nuclei. The same procedure was performed on hESCs with an additional permeabilisation step using Triton X- 100 for the detection of intracellular antigens.
  • Detected subpopulations were separated by sorting as described. Each subpopulation was then subjected to an invasion assay (Chemicon, #ECM554) according to the manufacturer's instructions.
  • IGROV1, HEYA8, PEA1 The ovarian cancer cell lines, IGROV1, HEYA8, PEA1, and the normal immortalized ovarian cell lines, OSEC2 and IOSE21, were all maintained in RPMI 1640 medium (Invitrogen, #11875-093) containing 10% fetal bovine serum (FBS).
  • IGROV1, PEA1 and OSEC2 were obtained from Ovarian Cancer Action, Imperial College, London, UK, while IOSE21 was obtained from Professor Frances Balkwill, Institute of Cancer, Centre for Cancer and Inflammation, Barts and The London School of Medicine and Dentistry, London.
  • HEYA8 was obtained from Professor Jean Paul Thiery, Institute of Molecular and Cell Biology, A*STAR, Singapore.
  • HES-3 human embryonic stem cell line
  • ES Cell International ESI, Singapore
  • matrigel coated organ culture dishes supplemented with conditioned medium from mouse feeders. Differentiation of hESC in vitro was induced as previously described.
  • the human embryonic kidney cell line (HEK293) and lung fibroblast cell line (IMR90) were obtained from the American Type Culture Collection (ATCC; Rockville, USA) and maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin and 2 mmol/L L-glutamine.
  • mAb clones For characterization of mAb clones, cells were incubated for 30 minutes with each mAb clone (150 ⁇ ⁇ culture supernatant or 5 ⁇ g purified mAb in 200 1% BS A/PBS) or with mAb against human clathrin (CHCl; BD Transduction Laboratories, #610499). Cells were then further incubated for 15 minutes with a 1:500 dilution of goat a-mouse antibody fluorescein isothiocyanate (FITC)-conjugated (DAKO, #F0479). 1.25 mg/mL propidium iodide (PI) was added 5 minutes before analysis/sorting.
  • FITC goat a-mouse antibody fluorescein isothiocyanate
  • Table 3 Gene expression assays for the TaqMan system. The gene expression assays were selected from the Applied Biosystems website (http ://www . appliedbiosy stems .com. sg/) .
  • IGROV1 membrane protein extracts were obtained using the ProteoJET Membrane Protein Extraction Kit (Fermentas Inc., #K0321) according to the manufacturer's instructions and thereafter used for immunoprecipitation (IP). Briefly, rabbit antibody conjugated with biotin was captured onto a Streptavidin Phytip column (5 ⁇ . of resin beads). The column was functionalized with either TAG-OCS 1 or the commercially-available CHC1 antibody (BD Transduction Laboratories, #610499). Clarified membrane protein extracts were then passed through the column.
  • SDS-PAGE and Western blotting were performed by the methods of Laemmli and Towbin respectively.
  • the membrane was immunoblotted overnight at 4°C with TAG-OCS 1 culture supernatant or mouse mAb to human CHC1 followed by horseradish peroxidase- conjugated goat anti-mouse antibodies (1:10000 dilution, DAKO).
  • Binding of HRP- conjugated secondary antibodies was visualized by Immobilon Western Chemiluminescent HRP Substrate (Millipore, #WBKLS0500).
  • Silver staining was performed using SilverQuest silver staining kit (Life technologies, #LC6070) according to the manufacturer's instructions and the protein band corresponding to the band on the Western Blot was manually excised for mass spectrometry (MS) analysis.
  • MS mass spectrometry
  • AlamarBlue® dye (Invitrogen, #DAL1025) was purchased commercially and the assay was performed according to the manufacturer's instructions (9,10). Briefly, 5000 cells were seeded in each well of a 96-well plate in their appropriate growth culture medium as described earlier and allowed to attach overnight. 30 of purified mAb at a final concentration of 200 ⁇ g was then added to each well. At the end of 72 hours, 10 ⁇ ⁇ of alamarBlue® was added to each well. The plate was further incubated at 37°C for 30 minutes and subsequently analyzed using a fluorescence plate reader (TECAN Infinite M200; Tecan Group Ltd.) at an excitation wavelength of 545nm and emission wavelength of 590nm.
  • TECAN Infinite M200 Tecan Group Ltd.
  • CDC experiments [00150] 5000 cells in 90 ⁇ ⁇ of non -phenol red culture media per well were plated onto a 96-well plate. Thereafter, increasing concentrations of TAG-OCS 1 were added to wells which contained either active or heat-inactivated human serum (Quidel, #A100). 100 ⁇ ⁇ of culture media served as background control for this experiment. Thereafter, lactate dehydrogenase (LDH) activity in all the wells was measured to determine cell viability using a CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, #G1780), according to the manufacturer's instructions. All conditions were performed in triplicates.
  • 5000 cells in 90 of culture media per well were plated onto opaque-walled 96- well plates and allowed to attach to the wells overnight. Thereafter, 0.1 of TAG-OCS 1 (1 mg/mL) and anti-M-ZAP (0.27 mg/mL) (Cat No. IT-30 Advanced Targeting Systems, San Diego, USA) were added to the test wells. The plate was then incubated for 72 hours before cytotoxicity assays were performed using the Cell Titer-Glo Luminescent Cell Viability Assay (Promega, #G757) according to the manufacturer's instructions. Controls for this experiment were buffer only, anti-M-ZAP only, and TAG-OCS 1 only. All conditions were performed in triplicates.
  • the Aldefluor activity assay yielded Aldefluor-positive populations which showed up distinctively on flow cytometry plots.
  • Incubation of cells with BAAA in the absence of the enzyme inhibitor, DEAB induced a shift in BAAA fluorescence, defining the Aldefluor-positive population (Fig. IB, right), while addition of DEAB abolished this effect (Fig. IB, left).
  • mRNA expression of stem cell markers were upregulated in Aldefluor-positive populations, with CD133 showing the highest extent of upregulation (5-fold increase) in its expression level (Fig. 2B).
  • Anchorage-independent colony forming spheroid assays showed increased numbers and sizes of spheroid in the SP (Fig. 2C) and Aldefluor-positive populations (Fig. 2D) when compared to their respective counterparts. It was further observed that the largest colonies (>64 cells) were more abundantly formed in the SP and Aldefluor- positive populations.
  • SP cells demonstrated a 7-fold increase in invasiveness when compared to NSP (Fig.
  • IGROV1 ovarian CSCs were chosen for isolation using the Aldefluor activity assay for the generation of mAbs. Isolated populations of Aldefluor-positive ovarian tumor IGROV1 cells were first injected into female BALB/c mice. Subsequently, a two-step screening process was carried out to select for mAbs which showed reactivity towards subpopulations of cells in the ovarian cancer and hESC cell lines but not towards the differentiated IMR90 and HEK293 cell lines.
  • TAG-OCS l This strong reactivity of TAG-OCS l towards hESCs was further confirmed by immunocytochemistry experiments (Fig. 4C), which suggests that the antibody may be targeting pluripotent cell types. Furthermore, TAG-OCS l did not react with cells from the normal ovarian cell lines, OSEC2 and IOSE21 (Fig. 4D). Together, the data showed that TAG-OCS l recognizes a CSC subpopulation and we sought to further characterize TAG-OCS l and the subpopulation of cells detected by TAG-OCS l in ovarian tumor cells. [00166] EXAMPLE 3
  • TAG-OCSl detects subpopulations which exhibit tumor stem cell-like characteristics
  • TAG-OCS l -positive cells exert a drug- resistance mechanism which may in part be mediated by expression of various ATP-binding cassette (ABC) transporters.
  • the CD133 marker had previously been found to be present on cells which possess cancer-initiating cell characteristics in ovarian tissues. CD133 expression in ovarian cancer has also been found to be directly regulated by epigenetic modifications. Furthermore, methylation of the CD 133 promoter may be representative of epigenetic repression of other pluripotency-associated genes.
  • TAG-OCS l -positive cells demonstrated a 3.9-fold increase in invasiveness compared to the TAG-OCS l -negative cells from the IGROVl ovarian cancer cell line (Fig. 5D).
  • This increased invasiveness of CSCs possibly relates to aggressiveness in tumors, as suggested by a previous study where putative ovarian CSCs were found to form more aggressive tumor xenografts at a lower inoculum compared to their non CSC-progeny.
  • Target antigen of TAG-OCSl is determined as clathrin heavy chain
  • IP Immunoprecipitation
  • IP eluates of the commercial CHC1 antibody were resolved by SDS-PAGE and then probed with TAG-OCS l.
  • target antigen bands of identical sizes ⁇ 180kDa
  • TAG-OCS l target antigen bands of identical sizes
  • mAb-CHCl commercially-available mAb-CHCl
  • CHC1 was upregulated by 6.9-fold and 2.9-fold in the IGROVl and HEYA8 TAG-OCS l -positive subpopulations respectively, compared to their TAG-OCS 1- negative counterparts.
  • TAG-OCS l detects a novel epitope of CHC1 which is expressed on the cell surface of ovarian CSCs.
  • CHC1 is an essential component of the clathrin molecule which mediates a major endocytosis pathway.
  • endocytic mechanisms are exhibited by both tumor- initiating and metastasizing cells where vesicular trafficking and subsequent degradation or re-assembly takes place after the disassembly of signaling and adhesion complexes.
  • factors involved in endocytosis possibly represent crucial targets of the processes driving tumor initiation and progression.
  • TAG-OCS l could potentially be useful in distinguishing early ovarian cancer from benign tumors as well as enable the early diagnosis of ovarian cancer for improved prognosis. This was confirmed by staining of ovarian clinical samples by TAG-OCS l ( Figure 6D to 6F). EpCAM-positive patient ascites and patient ovarian tumour sections showed positive staining by TAG-OCS l ( Figure 6D and 6E).
  • TMA patient tumour microarray
  • the IMR90 lung fibroblast cell line which TAG-OCS l did not bind to in FACS experiments was used as a negative control.
  • viability of IMR90 cells was not affected by the addition of TAG-OCS l.
  • Data obtained showed that incubation of cells with TAG-OCS l did not result in a decrease in cell viability of CHI ovarian cancer cells in both the Alamar Blue and xCELLigence experiments (Fig. 7C).
  • Data obtained from flow cytometry experiments revealed that TAG-OCS l binds and kills MCF7 breast cancer cells (Fig.
  • TAG-OCS l binds to 15% of the IGROVl ovarian cancer cell line, 87.5% of 786-0 cells (kidney cancer cell line) and 92.1% of MCF7 cells (breast cancer cell line). Furthermore, TAG-OCS l confers cytotoxicity towards MCF7 cells (Fig. 7E).
  • TAG-OCSl mediates CDC and functions as an ADC
  • TAG-OCS l when used as a vehicle for the specific delivery of toxins, such as the ribosome-inactivating protein, saporin, to CHC1 -expressing ovarian cancer cells was determined.
  • the mAb-ZAP complex exhibited specific cytotoxicity towards IGROV1 and PEA1 ovarian tumor cells (Fig. 7F, 71, Fig. 10), as well as towards 786-0 kidney cancer cells (Fig. 7G) and MCF7 breast cancer cells (Fig. 7H, 7J).
  • TAG-OCS 1 possesses independent cytotoxic effects in vitro, but only at concentrations higher than those used in this assay.
  • developing TAG-OCS 1 into a cytotoxic antibody-drug conjugate (ADC) in future may result in the elimination of cells which express CHC1 on the surface while sparing normal cells which express intracellular CHC1.
  • ADC cytotoxic antibody-drug conjugate
  • a baseline level of target antigen expression in normal tissues may be tolerable and resultant potential toxicities may depend on the relative ratio between tumor and normal expression levels.
  • the monoclonal antibody TAG-OCS 1 described thus far is an IgM antibody.
  • a chimeric TAG-OCS 1 (IgG) antibody was also generated using general methods known in the art and analysed. Briefly, the variable region of the antibody was cloned from the mouse hybridoma, then cloned into a construct (protein expression vector) with the constant region of a human IgGl. The chimeric TAG-OCS 1 was then expressed in a CHO cell line (in house) and purified.
  • Flow cytometry experiments show that chimeric TAG-OCS 1 successfully binds to the 786-0 kidney cancer cell line and MCF7 breast cancer cell line at a level which is comparable to the original IgM molecule (Fig. 12A and 12B). Chimeric TAG-OCS 1 also confers cytotoxicity towards MCF7 cells. [00189] Through the antibody-drug conjugate (ADC) assay, chimeric TAG-OCS 1 (at levels of lOOng/well and 200ng/well) is shown to exhibit ADC cytotoxicity towards IGROV1 (Fig. 12C) and PEA1 (Fig. 12D) ovarian cancer cells, after an incubation time of 72 hrs.
  • ADC antibody-drug conjugate
  • TAG-OCS 1 may be used to directly detect CHC1, either alone or in combination with other cancer markers, thereby allowing for the screening of early stage ovarian cancer at mass level.
  • MAb also mediates CDC in vitro and further development of TAG-OCS 1 as an ADC could prove to be highly valuable for immunotherapy of recurrent, chemoresistant disease.
  • TAG-OCS 1 represents a novel diagnostic and possible therapeutic agent with enhanced specificity against CSCs in ovarian cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Gynecology & Obstetrics (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Reproductive Health (AREA)
  • Pregnancy & Childbirth (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to antigen-binding proteins, and antigen-binding fragments thereof that binds to clathrin heavy chain 1 (CHC1) on the surface of cancer stem cells. The present invention also relates to compositions comprising the antigen-binding protein, and antigen-binding fragments thereof and use of these antigen-binding protein, and antigen-5 binding fragments thereof as well as methods for detecting cancer in a subject comprising the step of contacting a sample with the antigen-binding protein, and antigen-binding fragments thereof of the invention. Methods of treating cancer and kits for use in the methods of the invention are also described.

Description

CANCER SPECIFIC ANTIGEN-BINDING PROTEINS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of Singapore application No. 1020150057 IP, filed 23 January 2015, the contents of it being hereby incorporated by reference in its entirety for all purposes.
FIELD OF THE INVENTION
[0002] The present invention relates to antigen -binding proteins and fragments thereof as well as antibodies that bind to cancer cells. Specifically, the present invention relates to antigen -binding proteins and fragments thereof that bind to clathrin heavy chain 1 (CHC1) on the surface of cancer stem cells.
BACKGROUND OF THE INVENTION
[0003] Cancer stem cells (CSCs) are hypothesized to be a rare population of tumor cells possessing embryonic stem cell-like characteristics and are resistant to conventional chemotherapy treatments.
[0004] It has been hypothesized that CSCs which have not been completely eliminated by the initial therapy regime regrow to form the tumor and are responsible for recurrence of tumours in patients who initially respond to therapy.
[0005] As an example, in epithelial ovarian cancer which is one of the most lethal gynecological malignancies, previous attempts to selectively eradicate ovarian CSCs by inhibiting reported ovarian CSC surface markers such as ABCB l and CD133 have been largely unsuccessful. Failure of the study involving ABCB 1 surface markers could have been attributed to pharmacokinetic interactions between the chemotherapeutic agent and the ABCB l inhibitor as well as the presence of additional transporters, such as ABCCl and ABCG2, which were not targeted by inhibitors. A separate study showed that the CD133 marker is similarly expressed in both stem cell-like and differentiated epithelial cells, while CD133-negative cancer cells also have the ability to initiate tumors. Thus, it is unsurprising that therapeutics against these reported ovarian CSC surface markers have failed to specifically target ovarian CSCs for subsequent eradication of the cancer. [0006] In recent years, monoclonal antibodies (mAbs) developed against several growth factor receptors have been shown to exert therapeutic efficacy in the treatment of solid tumors, such as ovarian cancer. Notably, clinical trials of bevacizumab, a potent angiogenesis inhibitor, have shown activity in ovarian cancer by improving progression-free survival. However, mAbs such as bevacizumab do not target CSC markers and therefore fail to demonstrate clinically significant effects on overall survival in cancer.
[0007] There is therefore a need to identify a novel surface antigen specific to CSCs, such as ovarian CSCs, by generating antibodies against this subpopulation to target and eradicate these subpopulations to provide effective long-term remission. Novel antibodies that are able to detect CSC subpopulations may also be important as prognostic or predictive biomarkers.
SUMMARY OF THE INVENTION
[0008] In one aspect, there is provided an antigen-binding protein, or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GFSLSRYGVY; a VHCDR2 having the amino acid sequence VIW A VGS TN YNS ALMS , and a VHCDR3 having the amino acid sequence DREYGYGLAY; and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence SASSSVSYIH, a VLCDR2 having the amino acid sequence DTSNLAS, and a VLCDR3 having the amino acid sequence FQGSGYPLT.
[0009] In one aspect, there is provided an antigen-binding protein, or an antigen-binding fragment thereof, or an antigen-binding fragment thereof, that competes with the antigen binding protein as described herein for binding to clathrin heavy chain 1 (CHC1).
[0010] In one aspect, there is provided an antigen-binding protein, or an antigen-binding fragment thereof, as described herein, comprising a radioisotope or a cytotoxin conjugated thereto.
[0011] In one aspect, there is provided a composition comprising a physiologically acceptable carrier and a therapeutically effective amount of the antigen-binding protein, or an antigen-binding fragment thereof as described herein.
[0012] In one aspect, there is provided the use of an antigen-binding protein, or an antigen-binding fragment thereof as described herein, in the manufacture of a medicament for treating cancer. [0013] In one aspect, there is provided a method for detecting cancer in a subject, the method comprising: contacting a sample obtained from the subject with an antigen-binding protein, or an antigen-binding fragment thereof as described herein in vitro; detecting the binding of the antigen-binding protein, or an antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample is indicative of cancer.
[0014] In one aspect, there is provided a method for treating cancer in a subject comprising administering a therapeutically effective amount of an antigen-binding protein, or an antigen-binding fragment thereof as described herein to a subject in need thereof.
[0015] In one aspect, there is provided a kit when used in the method as described herein, comprising an antigen-binding protein, or an antigen-binding fragment thereof as described herein, together with instructions for use. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0017] Fig. 1. Identification of stem cell-like subpopulations in ovarian cancer cell lines. A, flow cytometry analysis displaying a representative diagram of the SP in IGROV1, following staining with Hoechst 33342 dye (right). Effect of the transporter blocker, verapamil, on the SP subset (left). Hoechst "blue" represents the 450 BP filter, the standard analysis wavelength for Hoechst 33342 analysis for DNA content. Hoechst "red" was detected at 675 nm. B, flow cytometry analysis displaying a representative diagram of Aldefluor-positive cells in IGROV1 when cells were incubated with the Aldefluor substrate, BAAA (right). The specific inhibitor of ALDH, DEAB, was used to establish the baseline fluorescence of the cells (left).
[0018] Fig. 2. Characterization of stem cell-like subpopulations in the IGROV1 ovarian cancer cell line. A, RT-qPCR analysis. Mean mRNA expression levels of stem cell markers in SP (■) in relation to NSP (;¾«). B, RT-qPCR analysis. Mean mRNA expression levels of stem-cell markers in Aldefluor-positive populations (■) in relation to Aldefluor-negative populations (¾¾). Expression of the endogenous gene, GAPDH, was taken as a control for RT- qPCR experiments (n=3). C-D, in-house colony assay comparing the numbers and sizes of colonies formed in detected subpopulations (n=3). E-F, invasion assay comparing invasiveness between detected subpopulations (n=3). All experiments were performed using the IGROVl ovarian cancer cell line. Error bars represent mean + SEM. * P < 0.05; ** P < 0.01.
[0019] Fig. 3. Identification of mAbs which fulfilled the selection criteria. A, representative flow cytometry analyses displaying reactivity of a positive antibody clone, TAG-OCS l. MAbs were screened against IGROVl Aldefluor-positive cells and positive antibody clones were then tested against five cell lines - IGROVl, PEA1, hESC, IMR90 and HEK293. (:¾) represent the control samples while (■) represent samples incubated with the TAG-OCS l. B, representative immunocytochemistry data showing binding of TAG-OCS l to subpopulations of cells in the IGROVl cell line. Scale bar: 20 μιη.
[0020] Fig. 4. Reactivity of TAG-OCS l towards cell populations. A, flow cytometry analysis of IGROVl cells which were co-stained with TAG-OCS l and Hoechst dye. B, flow cytometry analyses displaying reactivity of TAG-OCS l to hESC and hESC-derived EBs. C, immunocytochemistry images showing binding of TAG-OCS l to hESCs. HESCs stained with Oct4 served as controls. Scale bar: 200μιη. D, flow cytometry analyses displaying reactivity of TAG-OCS l towards cells from the normal ovarian cell lines, OSEC2 and IOSE21.
[0021] Fig. 5. Characterization of ovarian tumour subpopulations detected by TAG- OCS l. A, mean mRNA expression levels by RT-qPCR of stem cell markers in IGROVl TAG-OCS l -positive populations (■) in relation to TAG-OCS l -negative populations (¾¾¾). B, mean mRNA expression levels by RT-qPCR of stem cell markers in HEYA8 TAG-OCS 1- positive populations (■) in relation to TAG-OCS l -negative populations (¾¾). Expression of the endogenous gene, GAPDH, was taken as a control for RT-qPCR experiments (n=3). C, in-house colony assay comparing the numbers and sizes of colonies formed in detected IGROVl subpopulations (n=3). D, invasion assay comparing invasiveness between detected IGROVl subpopulations (n=3). E, in vivo experiment showing tumor formation efficiency after injecting 100 cells of each IGROVl subpopulation into the mammary fat pad of NOD/SCID mice (n=8). Error bars represent mean + SEM. * P < 0.05; ** P < 0.01.
[0022] Fig. 6. Validating the target antigen of TAG-OCS l. A, validation of mass spectrometry results by immunoprecipitation and subsequent Western blotting. Immunoprecipitated eluate (IP) and membrane protein extracts (Lysate) using TAG-OCS l were subjected to Western blot and probed with rnAb to human CHC1 (mAb-CHCl, left). To confirm this result, immunoprecipitated eluate using human CHC1 was subjected to Western blot and probed with TAG-OCS l (right). Human CHC1 antibody and TAG-OCS l served as negative controls. B, RT-qPCR analysis. Mean mRNA expression levels of CHC1 in TAG- OCS l-positive populations (■) in relation to TAG-OCS l -negative populations (;¾) from the IGROV1 and HEYA8 ovarian cancer cell lines (n=3). Expression of the endogenous gene, GAPDH, was taken as a control for RT-qPCR experiments (n=3). Error bars represent mean + SEM. C, top right, staining of IGROV1 ovarian cancer cells with commercial human CHC1 antibody. Bottom right, staining of IGROV1 ovarian cancer cells with TAG-OCS l. Scale bar: 200μιη. * P < 0.05; ** P < 0.01. D & E show staining of clinical samples by TAG-OCS l. D, immunofluorescence staining showing EpCam-positive patient ovarian ascites stained positively by TAG-OCS l and patient ovarian tumour sections were positively-stained by TAG-OCS l. E, immunohistochemistry showing patient ovarian tumour sections stained positively by TAG-OCS l. F, differential staining in normal and ovarian patient tumour microarray (TMA) sections. Patient TMA sections stained positively by TAG-OCS l while normal ovary sections did not exhibit any staining by TAG-OCS l.
[0023] Fig. 7. Effect of TAG-OCS l on cells in vitro. A, left, Alamar Blue assay measuring viability of IGROV1 ovarian cancer cells after addition of TAG-OCS l compared to the buffer control. Right, xCELLigence experiment measuring cell indexes of IGROV1 ovarian cancer cells after addition of TAG-OCS l (■) compared to the buffer control (;;¾¾). B, left, microscopic images of IGROV1 cells after a 72 hours incubation period with buffer. Right, microscopic images of IGROV1 cells after a 72 hours incubation period with TAG- OCS l. Scale bar: 500 μιη. C, left, Alamar Blue assay measuring viability of CHI ovarian cancer cells after addition of TAG-OCSl compared to the buffer control. Right, xCELLigence experiment measuring cell indexes of CHI ovarian cancer cells after addition of TAG-OCS l (■) compared to the buffer control (;¾;). D, flow cytometry experiments showed that TAG-OCS l binds and kills MCF7 breast cancer cells. E, flow cytometry experiments showed that TAG-OCS l binds to 15% of the IGROV1 ovarian cancer cell line. The mAb also binds to 87.5% of 786-0 cells (kidney cancer cell line) and 92.1% of MCF7 cells (breast cancer cell line). Furthermore, TAG-OCS l confers cytotoxicity towards MCF7 cells. F, CDC assay showing percentage cytotoxicity of IGROV1 cells after incubation with complement or inactivated complement. G, CDC assay showing percentage cytotoxicity of 786-0 (kidney cancer) cells after incubation with complement or inactivated complement. H, CDC assay showing percentage cytotoxicity of MCF7 (breast cancer) cells after incubation with complement or inactivated complement. I, ADC assay showing luminescence levels of viable cells after IGROV1 cells were incubated with buffer, ZAP, mAb controls or mAb- ZAP. J, ADC assay showing luminescence levels of viable cells after MCF7 cells were incubated with buffer, ZAP, mAb controls or mAb-ZAP.
[0024] Fig. 8. TAG-OCS 1 -positive cells formed increased sizes and numbers of colonies when compared to their counterparts as well as to unseparated cells.
[0025] Fig. 9. Viability of IMR90 cells was not affected by the addition of TAG-OCS 1.
[0026] Fig. 10. TAG-OCS 1 mediates CDC activity and is successful as an ADC in PEA1 cells.
[0027] Fig. 11. TAG-OCS 1 heavy and light chain amino acid sequence alignment to the encoding nucleic acid sequence.
[0028] Fig. 12. A and B, flow cytometry experiments show that chimeric TAG-OCS 1 successfully binds to 786-0 kidney cancer cell line (A) and the MCF7 breast cancer cell line (B) at a level which is comparable to the original IgM molecule. Chimeric TAG-OCS 1 also convers cytotoxicity towards MCF7 cells. C, ADC assay showing luminescence levels of viable cells after IGROV1 cells were incubated with buffer, ZAP, mAb controls or mAb- ZAP. D, ADC assay showing luminescence levels of viable cells after PEA1 cells were incubated with buffer, ZAP, mAb controls or mAb-ZAP.
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0029] The present invention relates to antigen-binding proteins, or an antigen-binding fragments thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GFSLSRYGVY; a VHCDR2 having the amino acid sequence VIWAVGSTNYNSALMS, and a VHCDR3 having the amino acid sequence DREYGYGLAY; and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence SASSSVSYIH, a VLCDR2 having the amino acid sequence DTSNLAS, and a VLCDR3 having the amino acid sequence FQGSGYPLT.
[0030] In order that the present invention may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description. [0031] As used herein, the term "antigen binding protein" refers to antibodies, antibody fragments and other protein constructs, such as domains, which are capable of binding to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding fragment" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment, which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
[0032] The term "fragment" as used herein includes a reference to a nucleic acid or polypeptide molecule that encodes a constituent or is a constituent of a particular polypeptide / nucleic acid or variant thereof. In terms of the polypeptide, the fragment possesses qualitative biological activity in common with the polypeptide in question. However, fragments of a nucleic acid sequence, do not necessarily need to encode polypeptides which retain biological activity, for example, hybridisation probes or PCR primers. Alternatively, a fragment of a nucleic acid sequence encodes a polypeptide which retains qualitative biological activity of the polypeptide. The fragment may be physically derived from the full- length polypeptide / nucleic acid or alternatively may be synthesised by some other means, for example chemical synthesis.
[0033] The term "antibody" is used herein in the broadest sense to refer to molecules with an immunoglobulin-like domain and includes monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, diabodies, Tandabs™.
[0034] Accordingly, it will generally be understood that the term "antibody" as referred to herein includes whole antibodies and any antigen-binding fragment (i.e., "antigen -binding portion") or single chains thereof. An "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, or an antigen-binding portion thereof. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CHI, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
[0035] "CDRs" are defined as the complementarity determining region amino acid sequences of an antigen binding protein. These are the hypervariable regions of immunoglobulin heavy and light chains. There are three heavy chains and three light chain CDRs (or CDR regions) in the variable portion of an immunoglobulin. Thus, "CDRs" as used herein refers to all three heavy chain CDRs, all three light chain CDRs, all heavy and light chain CDRs, or at least two CDRs.
[0036] An antigen binding fragment may be provided by means of arrangement of one or more CDRs on non-antibody protein scaffolds such as a domain. The domain may be a domain antibody or may be a domain which is a derivative of a scaffold selected from the group consisting of CTLA-4, lipocalin, SpA, an Affibody, an avimer, GroEl, transferrin, GroES and fibronectin/adnectin, which has been subjected to protein engineering in order to obtain binding to an antigen, other than the natural ligand.
[0037] An antigen binding fragment or an immunologically effective fragment may comprise partial heavy or light chain variable sequences. Fragments are at least 5, 6, 8 or 10 amino acids in length. Alternatively the fragments are at least 15, at least 20, at least 50, at least 75, or at least 100 amino acids in length.
[0038] The phrase "single variable domain" refers to an antigen binding protein variable domain (for example, VH, VHH, VL) that specifically binds an antigen or epitope independently of a different variable region or domain. A "domain antibody" or "dAb" may be considered the same as a "single variable domain" which is capable of binding to an antigen. A single variable domain may be a human antibody variable domain, but also includes single antibody variable domains from other species such as rodent, nurse shark and Camelid VHH dAbs. Camelid VHH are immunoglobulin single variable domain polypeptides that are derived from species including camel, llama, alpaca, dromedary, and guanaco, which produce heavy chain antibodies naturally devoid of light chains. Such VHH domains may be humanised according to standard techniques available in the art, and such domains are considered to be "domain antibodies". As used herein VH includes camelid VHH domains.
[0039] As used herein the term "domain" refers to a folded protein structure which has tertiary structure independent of the rest of the protein. Generally, domains are responsible for discrete functional properties of proteins, and in many cases may be added, removed or transferred to other proteins without loss of function of the remainder of the protein and/or of the domain.
[0040] A "single variable domain" is a folded polypeptide domain comprising sequences characteristic of antibody variable domains. It therefore includes complete antibody variable domains and modified variable domains, for example, in which one or more loops have been replaced by sequences which are not characteristic of antibody variable domains, or antibody variable domains which have been truncated or comprise N- or C-terminal extensions, as well as folded fragments of variable domains which retain at least the binding activity and specificity of the full-length domain. A domain can bind an antigen or epitope independently of a different variable region or domain.
[0041] The term "specifically binds" as used throughout the present specification in relation to antigen binding proteins means that the antigen binding protein binds to its antigen, for example, clathrin or clathrin heavy chain 1 (CHC1) with no or insignificant binding to other proteins. The term however does not exclude the fact that the antigen binding proteins may also be cross -reactive with closely related molecules. The antigen binding proteins described herein may bind to its antigen with at least 2, 5, 10, 50, 100, or 1000 fold greater affinity than they bind to closely related molecules.
[0042] The antigen-binding proteins or antigen-binding fragments thereof of the invention are characterized by particular functional features or properties. For example, the antibodies bind specifically to clathrin (e.g., bind to human clathrin and may cross-react with clathrin from other species, such as cynomolgus monkey). Preferably, an antibody of the invention binds to clathrin with high affinity, for example with a KD of 1x10" M or less. [0043] Standard assays to evaluate the binding ability of the antigen-binding proteins or antigen -binding fragments toward the antigen of interest, e.g. CHC1, are known in the art, including for example, ELISAs, Western blots and RIAs. The binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis. Suitable assays for evaluating any of the above-described characteristics are described in detail in the Examples.
[0044] In one embodiment, the heavy chain variable region comprises the amino acid sequence set forth in SEQ ID NO: l.
[0045] In one embodiment, the light chain variable region comprises the amino acid sequence set forth in SEQ ID NO:2
[0046] It will be understood to one of skill in the art that the amino acid sequences disclosed in the present invention are encoded by nucleic acid sequences. It will also be understood to one of skill in the art that nucleic acid codons encoding each amino acid are degenerate. Accordingly, there may be more than one nucleic acid sequence for a given amino acid sequence and the alternative sequences may be determined by one of skill in the art.
[0047] The amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are provided in Table 1. SEQ ID NO: 3 is one possible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 1. Similarly, SEQ ID NO: 4 is one possible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2.
[0048] Table 1. Amino acid and nucleic acid sequences of the antigen-binding proteins of the invention.
SEQ ID NO: 1 Q V K L Q Q S G P G L V A P S Q S L S I
T C T V S G F S L S R Y G V Y w V R Q P
P G K G L E W L G V I A V G s T N Y N s A L M S R L S I s K D K s K s Q V F L
K M N S L Q T D D T A M Y Y c A R D R Ξ
Y G Y G L A Y W G Q G T T V T V S S
SEQ ID NO: 2 D I E L T Q s P A I M S A s P G E K V T
M T C S A s s S V s Y I H w Y Q Q K S S
T s P K L w I Y D T s N L A s G V P G R F
S G S G S G N s Y s L T I s s M E A E D
V A T Y Y C F Q G s G Y P L T F G A G T
K L E L K
SEQ ID NO: 3 CAGGTCAAACTGCAGCAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATC
ACTTGCACTGTCTCTGGATTTTCATTAAGCAGATATGGTGTATATTGGGTTCGCCAGCCT
CCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGCGGTTGGAAGCACAAATTATAAT
TCGGCTCT CAT GT C C AGAC T GAG CAT C AG C AAAGAC AAGT C C AAGAGT C AAGT T T T C T T A
AAAAT GAACAGT CT GCAAACT GAT GAC AC AG C CAT GT AC TACTGTGCCC GAGAT AGAGAG TACGGCTACGGGCTTGCTTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
SEQ ID NO: 4 GAC AT TGAGCT C AC C G AGT CTC GAG C AAT' CAT GT C T G CAT' G T C GAG G G G AAAAG G T GAC C
ATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATACACTGGTACCAGCAGAAGTCAAGC ACCTCCCGCAAACTCTGGATTTA.TGACACATGCAACCTGGGTTCTGGA.GTCCCAGGTCGC TTCAGTGGCAGTGGGTCTGGAAAGTCTTACTGTCTCACGATCAGCAGCATGGAGGCTGAA GATGTTGCCACTTATTACTGTTTTCAGGGGAGTGGGTACCCGCTCACGTTCGGTGCTGGG AC GAAG C T G GAG C T GrAAAC
[0049] It will be understood that an antigen-binding protein, or antigen-binding fragment thereof of the present invention may comprise heavy and light chain variable regions comprising amino acid sequences that are homologous to the amino acid sequences of the preferred antibodies described herein, and wherein the antibodies retain the desired functional properties of the antigen-binding protein, or antigen-binding fragment of the invention.
[0050] In some embodiments, the antigen-binding protein, or an antigen-binding fragment thereof, comprises heavy and light chain CDR regions that are about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65% and 60% identical to the heavy and light chain CDR regions of (i) and (ii).
[0051] In a preferred embodiment, the antigen-binding protein, or an antigen-binding fragment thereof, comprises heavy and light chain CDR regions that are about 80% identical to the heavy and light chain CDR regions of (i) and (ii). In another preferred embodiment, the antigen-binding protein, or an antigen-binding fragment thereof comprises a heavy chain variable region which comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: l. In another preferred embodiment, the antigen-binding protein, or an antigen-binding fragment thereof comprises a light chain variable region which comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO:2.
[0052] As used herein, the percent homology between two amino acid sequences is equivalent to the percent identity between the two sequences. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology=# of identical positions/total # of positions xlOO), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0053] In some embodiments, the antigen-binding protein, or an antigen-binding fragment thereof is a monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, a single chain antibody, a univalent antibody lacking a hinge region, a minibody, diabodies, and Tandabs™.
[0054] The terms "monoclonal antibody" or "monoclonal antibody composition" as used herein refer to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
[0055] The terms "polyclonal antibody" or "polyclonal antibody composition" as used herein refer to a preparation of a collection of antibody molecules, each identifying a different epitope of a specific antigen. A polyclonal antibody composition displays a single binding specificity and affinity for different epitopes.
[0056] The term "humanized antibody" is intended to refer to antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences. Additional framework region modifications may be made within the human framework sequences.
[0057] The term "chimeric antibody" is intended to refer to antibodies in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as an antibody in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody.
[0058] The term "recombinant antibody" refers to antibodies or fragments which have been produced using recombinant DNA techniques. For example, antibodies having an antigen binding site at least part of which is derived from a different antibody, such as those in which hypervariable or complementarity determining regions of one antibody have been grafted into variable framework regions of a second, different, and preferably human, antibody; recombinant antibodies or fragments wherein non-Fv sequences have been substituted by non-Fv sequences from other, different antibodies; or recombinant antibodies or fragments possessing substantially the structure of a natural immunoglobulin but wherein the hinge region has a different number of cysteine residues from that found in the natural immunoglobulin, or wherein one or more cysteine residues in a surface pocket of the recombinant antibody of fragment is in the place of another amino acid residue present in the natural immunoglobulin. [0059] The term "bispecific antibody" refers to antibodies or fragments thereof that can bind with at least two different antigens. Bispecific antibodies may be mono-, tetra- or multivalent. Methods of generating bispecific antibodies are known in the art. For example, chemical reassociation of monovalent L and H fragments, hybrid hybridoma, or engineering knobs-into-holes complementarity into both H-chains. Tetravalent bispecific antibodies can be created by chemical crosslinking of two monoclonal antibodies (Bs(lgG)2). Using F(ab)' fragments as building blocks, multivalent bispecific antibodies can also be created by chemical crosslinking of two or more Fab' molecules (Bs(Fab')2). A genetically controlled heterodimerization of a Bs(Fab')2 molecule was previously described, where the F(ab')- molecules were fused to a fos and a jun heterodimerization domain.
[0060] The term "heteroconjugate antibody" refers to an antibody or fragment thereof comprising two or more covalently linked monoclonal antibodies or fragments thereof with different specificities.
[0061] The term "single chain antibody" or "single chain variable fragment (scFv)" refers to antibodies or fragments thereof wherein the heavy chain variable domain and light chain variable domain of an antigen binding protein or antigen binding fragment thereof are linked to form a single chain. Linkage may be by a linker peptide. Single chain antibodies or single chain Fvs may be linked to form bivalent scFvs or dimerized to form diabodies.
[0062] The term "diabody" refers to bivalent and bispecific antibodies or fragments thereof which comprise a heavy chain variable domain connected to a light chain variable domain by a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain to create two antigen-binding sites.
[0063] The term "univalent antibody" refers to antibodies or fragments thereof that have one antigen-binding site. Accordingly, the term "univalent antibody lacking a hinge region" refers to antibodies or fragments thereof that have one antigen-binding site and that lack the hinge region between the CHI and DH2 domains.
[0064] The term "minibody" refers to antibodies or fragments thereof comprising the variable heavy and variable light chain domains of an antigen binding protein or antigen binding fragment thereof fused to the hinge region and to the CH3 domain of the immunoglobulin molecule. [0065] In a preferred embodiment, the antigen-binding protein, or an antigen-binding fragment thereof is a monoclonal antibody. In a further preferred embodiment, the monoclonal antibody is TAG-OCS 1. In yet another preferred embodiment, the monoclonal antibody is humanised.
[0066] In another aspect, the present invention features an antigen-binding fragment thereof, or antigen-binding protein that binds to clathrin. Clathrin plays a major role in the formation of coated vesicles and is involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. Clathrin protein is composed of three heavy chains and three light chains. There are two forms of clathrin heavy chains, denoted clathrin heavy chain 1 (CHCl) and clathrin heavy chain 2 (CHC2), while there are two forms of clathrin light chains, denoted clathrin light chain A and clathrin light chain B.
[0067] In a preferred embodiment, the antigen-binding fragment thereof, or antigen- binding protein binds to clathrin heavy chain 1 (CHCl).
[0068] In another aspect, the present invention features an antigen-binding fragment thereof, or antigen-binding protein that competes with the antigen binding protein or fragment thereof as disclosed herein for binding to CHCl.
[0069] As used herein, the term "competes with" in reference to binding of an antigen- binding fragment thereof, or antigen-binding protein refers to an antigen-binding fragment thereof, or antigen-binding protein that has a similar or higher binding affinity to an antigen than the antigen-binding fragments thereof, or antigen-binding proteins of the present invention. Binding of the antigen-binding fragment thereof, or antigen-binding protein to the target antigen inhibits binding of the antigen by the antigen-binding protein or fragments thereof of the present invention.
[0070] In another aspect, the present invention features antigen-binding protein or antigen- binding fragment thereof, for example an antigen-binding protein or fragment thereof that binds to clathrin, conjugated to a therapeutic moiety, such as a cytotoxin, a drug (e.g., an immunosuppressant) or a radioisotope. A cytotoxin or cytotoxic agent includes any agent that is detrimental to (e.g., kills) cells. Examples include saporin, mertansine (DM1), monomethyl auristatin E (MMAE), taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1- dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents also include, for example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine).
[0071] Other examples of therapeutic cytotoxins that can be conjugated to an antibody of the invention include duocarmycins, calicheamicins, maytansines and auristatins, and derivatives thereof.
[0072] Examples of preferred cytotoxins include saporin, mertansine (DM1) and monomethyl auristatin E (MMAE).
[0073] Cytoxins can be conjugated to antibodies of the invention using linker technology available in the art. Examples of linker types that have been used to conjugate a cytotoxin to an antibody include, but are not limited to, hydrazones, thioethers, esters, disulfides and peptide-containing linkers.
[0074] Antibodies of the present invention also can be conjugated to a radioactive isotope, or radioisotope to generate cytotoxic radiopharmaceuticals, also referred to as radioimmunoconjugates. Examples of radioactive isotopes that can be conjugated to antibodies for use diagnostically or therapeutically include, but are not limited to, iodine 131 , indium111, yttrium90 and lutetium177. Methods for preparing radioimmunconjugates are established in the art. Examples of radioimmunoconjugates are commercially available, including Zevalin™ (IDEC Pharmaceuticals) and Bexxar™ (Corixa Pharmaceuticals), and similar methods can be used to prepare radioimmunoconjugates using the antibodies of the invention.
[0075] In a preferred embodiment, the radioisotope is yttrium90.
[0076] The antibody conjugates of the invention can be used to modify a given biological response, and the drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor or interferon-. gamma.; or, biological response modifiers such as, for example, lymphokines, interleukin-1 ("IL-1 "), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.
[0077] In another aspect, the present invention provides a composition, e.g., a pharmaceutical composition, comprising a physiologically acceptable carrier and a therapeutically effect amount of the antigen-binding protein, or antigen-binding fragment thereof of the present invention. Such compositions may include one or a combination of (e.g., two or more different) antigen-binding proteins or antigen-binding fragments thereof of the invention. For example, a pharmaceutical composition of the invention can comprise a combination of antibodies that bind to different epitopes on the target antigen or that have complementary activities.
[0078] Compositions of the invention also can be administered in combination therapy, i.e., combined with other agents or pharmaceutical ingredients. For example, the combination therapy can include an antigen-binding protein or antigen-binding fragment of the present invention (e.g., TAG-OCS 1) combined with at least one other chemo therapeutic, antiinflammatory or immunosuppressant agent. Examples of therapeutic agents that can be used in combination therapy include but are not limited to infliximab, bevacizumab, trastuzumab, carboplatin, cisplatin, oxaliplatin and paclitaxel.
[0079] In a preferred embodiment, the compositions of the invention are administered in combination with one or more of bevacizumab, carboplatin or paclitaxel.
[0080] When the compositions of the invention are administered together with another pharmaceutical agent, the other pharmaceutical agent may be administered separately, simultaneously or sequentially.
[0081] As used herein the terms "therapeutically effective amount" or "therapeutically effective dosage" include within its meaning a non-toxic but sufficient amount of an agent or compound to provide the desired therapeutic effect, such as, a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. For example, for the treatment of tumors, a "therapeutically effective dosage" preferably inhibits cell growth or tumor growth by at least about 20%, more preferably by at least about 40%, even more preferably by at least about 60%, and still more preferably by at least about 80% relative to untreated subjects. The ability of a compound to inhibit tumor growth can be evaluated in an animal model system predictive of efficacy in human tumors. Alternatively, this property of a composition can be evaluated by examining the ability of the compound to inhibit, such inhibition in vitro by assays known to the skilled practitioner. A therapeutically effective amount of a therapeutic compound can decrease tumor size, or otherwise ameliorate symptoms in a subject. Accordingly, the exact amount required will vary from subject to subject depending on factors such as the species being treated, the age and general condition of the subject, the severity of the condition being treated, the particular agent being administered and the mode of administration and so forth. Thus, it is not possible to specify an exact "effective amount". However, for any given case, one of ordinary skill in the art would be able to determine such amounts based on such factors as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected and an appropriate "effective amount" may be determined by one of ordinary skill in the art using only routine experimentation.
[0082] As used herein, "pharmaceutically acceptable carrier" or "physiologically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active compound, i.e., antigen-binding fragment, antigen-binding protein or antibody may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
[0083] The pharmaceutical compounds of the invention may include one or more pharmaceutically acceptable salts. A "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like. Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as Ν,Ν'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.
[0084] A pharmaceutical composition of the invention also may include a pharmaceutically acceptable anti-oxidant. Examples of pharmaceutically acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil- soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
[0085] Examples of suitable aqueous and nonaqueous carriers that may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
[0086] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
[0087] Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0088] Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
[0089] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0090] The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.01 percent to about ninety-nine percent of active ingredient, preferably from about 0.1 percent to about 70 percent, most preferably from about 1 percent to about 30 percent of active ingredient in combination with a pharmaceutically acceptable carrier. [0091] Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
[0092] For administration of the antibody, the dosage ranges from about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg, of the host body weight. For example dosages can be 0.3 mg/kg body weight, 1 mg/kg body weight, 3 mg/kg body weight, 5 mg/kg body weight or 10 mg/kg body weight or within the range of 1-10 mg/kg. An exemplary treatment regime entails administration once per week, once every two weeks, once every three weeks, once every four weeks, once a month, once every 3 months or once every three to 6 months. Preferred dosage regimens for an antibody of the invention (e.g. TAG-OCS 1) include 1 mg/kg body weight or 3 mg/kg body weight via intravenous administration, with the antibody being given using one of the following dosing schedules: (i) every four weeks for six dosages, then every three months; (ii) every three weeks; (iii) 3 mg/kg body weight once followed by 1 mg/kg body weight every three weeks.
[0093] Alternatively, the antigen-binding protein, fragment thereof or antibody can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the antibody in the patient. In general, human antibodies show the longest half -life, followed by humanized antibodies, chimeric antibodies, and nonhuman antibodies. The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, a relatively low dosage is administered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and preferably until the patient shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.
[0094] Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
[0095] The antigen-binding proteins, fragments thereof, antibodies, antibody compositions and methods of the present invention have numerous in vitro and in vivo utilities involving, for example, binding to CHClor detecting CHC1 on the surface of CSCs, such as ovarian CSCs.
[0096] For example, these molecules can be administered to cells in culture, in vitro or ex vivo, or to human subjects, e.g., in vivo, to enhance immunity in a variety of situations. Accordingly, in one aspect, the invention provides a use of an antigen-binding protein, or fragment thereof of the present invention in the manufacture of a medicament for treating cancer.
[0097] Preferred cancers which may be treated using the antibodies of the invention include cancers typically responsive to immunotherapy. Non-limiting examples of preferred cancers for treatment include melanoma (e.g., metastatic malignant melanoma), renal cancer (e.g. clear cell carcinoma), prostate cancer (e.g. hormone refractory prostate adenocarcinoma), breast cancer, colon cancer, liver cancer (e.g. hepatocellular carcinoma, cholangiocarcinoma, fibrolamellar carcinoma, angiosarcoma and hepatoblastoma) and lung cancer (e.g. non-small cell lung cancer). Additionally, the invention includes refractory or recurrent malignancies whose growth may be inhibited using the antibodies of the invention. [0098] Examples of other cancers that may be treated using the methods of the invention include bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin's lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemias including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, and combinations of said cancers. The present invention is also useful for treatment of metastatic cancers.
[0099] In a preferred embodiment, cancers that may be treated with the antigen -binding proteins or fragments of the present invention (e.g. TAG-OCS l) include kidney, breast or ovarian cancer.
[00100] The compositions or medicaments of the present invention can be administered via one or more routes of administration using one or more of a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. Preferred routes of administration for antibodies of the invention include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal or other parenteral routes of administration, for example by injection or infusion. The phrase "parenteral administration" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. [00101] Alternatively, an antigen-binding protein, fragment thereof or antibody of the invention can be administered via a non-parenteral route, such as a topical, epidermal or mucosal route of administration, for example, intranasally, orally, vaginally, rectally, sublingually or topically.
[00102] The active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art.
[00103] Therapeutic compositions can be administered with medical devices known in the art.
[00104] In another aspect, the present invention also provides a method for detecting cancer in a subject, the method comprising: contacting a sample obtained from the subject with an antigen-binding protein, or an antigen-binding fragment thereof of the present invention in vitro; detecting the binding of the antigen-binding protein, or an antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample is indicative of cancer.
[00105] As used herein, the terms "detecting" or "detection" refer to the determination of the presence or absence of binding of the antigen-binding protein or antigen-binding fragments thereof of the present invention to the target antigen in a sample. The terms "detecting" or "detection" may also refer to the measurement of relative levels of binding of the antigen-binding protein or antigen-binding fragments thereof of the present invention to a target antigen in a sample relative to another sample or control sample.
[00106] In one embodiment, the control sample is from the same subject. In another embodiment, the control sample is from a different subject. The control sample may from the same type of sample, or from a different type of sample.
[00107] As used herein, the term "sample" refers to a biological sample obtained from a subject and includes but is not limited to blood, blood plasma, serum, buccal smear, amniotic fluid, prenatal tissue, sweat, nasal swab or urine, organs, tissues, fractions, and cells isolated from mammals including humans. A sample may also include sections of the biological sample including tissues (for example, sectional portions of an organ or tissue), extracts from a biological sample, for example, an antigen from a biological fluid (for example, blood or urine).
[00108] As used herein, the term "subject" is intended to include human and non-human animals. Non-human animals includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles, although mammals are preferred, such as non-human primates, sheep, dogs, cats, cows and horses. Except when noted, the terms "patient" or "subject" are used interchangeably. Preferred subjects include human patients in need of cancer treatment.
[00109] In one embodiment, the antigen -binding protein, or antigen -binding fragment thereof comprises a detectable label. Detectable labels include fluorescent, chemiluminescent, bioluminescent, radioisotopes and enzyme labels. Non-limiting examples include FITC, TRITC, GFP, phycobilliproteins, luciferase ds Red, alkaline phosphatase, horseradish peroxidase, glucose oxidase, PE, Cy Dyes, biotin-strepavidin and Qdots®. In a preferred embodiment, the detectable label is biotin, alkaline phosphatase, horseradish peroxidase, FITC, PE or Cy Dyes.
[00110] Detection of the detectable label may be achieved by conventional means in the art. For example, the detectable label may be detected using flow cytometry, immunohistochemistry and in tissue sections.
[00111] In another aspect, the instant disclosure provides a kit of parts comprising an antigen-binding protein or antigen-binding fragment thereof as described herein. The kit may also further comprise instructions for use. In another embodiment, the antigen-binding protein or antigen-binding fragment thereof is packaged in unit dosage form.
[00112] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[00113] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[00114] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
EXPERIMENTAL SECTION
[00115] MATERIALS AND METHODS
[00116] Identifying ovarian CSCs
[00117] The side population (SP) was defined as described in Goodell et al. (15). After which, cells were resuspended in phosphate -buffered saline (PBS) and maintained at 4°C until analysis/sorting. The Aldefluor kit (STEMCELL Technologies Inc., #01700) was used to isolate CSC populations with a high aldehyde enzymatic activity according to the manufacturer's instructions.
[00118] Generation of monoclonal antibodies
[00119] Two 6-week old female BALB/c mice received six consecutive weekly immunizations of lxlO6 isolated Aldefluor-positive IGROV1 cells suspended in monophosphoryl-lipid A + trehalose dicorynomycolate (MPL+TDM) adjuvant (Sigma- Genosys, #M6536) in the intraperitoneal cavity. Subsequent steps are as previously described.
[00120] Immunocytochemistry
[00121] IGROV1 cells were fixed in 4% paraformaldehyde for 30 minutes at room temperature and thereafter incubated with TAG-OCS 1 culture supernatant or commercial CHC1 antibody (1: 1000 dilution; Lifespan Biosciences, #LS-C22246-100) overnight at 4°C. Binding of the antibody to the cell surface was then visualized using goat a-mouse antibody conjugated with phycoerythrin (PE; 1:500 dilution; DAKO, #R0480). Finally, mounting media (Vector Laboratories, #H1200) containing DAPI was used to counterstain cell nuclei. The same procedure was performed on hESCs with an additional permeabilisation step using Triton X- 100 for the detection of intracellular antigens.
[00122] Cell proliferation studies
[00123] In-house 3D to 2D colony assays involved gating and sorting (2500 cells/well) detected subpopulations into separate wells in non-adherent 6 well plates (Sigma-Aldrich, #CLS3471) containing DMEM supplemented with 10% FBS, 1% penicillin/streptomycin and 2 mmol/L L-Glutamine. Cells were incubated for 18 days in a 37°C incubator. After which, 10% of the media/cells were transferred to adherent 6 well plates (Sigma-Aldrich #CLS3506). Media was changed 24 hours after plating onto adherent plates and cells were allowed to grow for up to 12 days. Thereafter, colonies were fixed for 15 minutes in 3.8% formaldehyde and stained in 1% w/v Rhodamine B (Sigma-Aldrich #R6626). Finally, stained cells were washed with several changes of tap water and air dried overnight at room temperature. The size and number of colonies formed were determined using a microscope (1X70 Olympus) and a commercially available image-analysis software package, Image-Pro.
[00124] Invasion assay
[00125] Detected subpopulations were separated by sorting as described. Each subpopulation was then subjected to an invasion assay (Chemicon, #ECM554) according to the manufacturer's instructions.
[00126] In vivo grafts
[00127] IGROV1 subpopulations detected by TAG-OCS 1 were isolated by flow cytometry as described and resuspended in ice cold 50% Matrigel (BD Biosciences, #356234) in RPMI1640 at 50 μΙ_, per xenograft. Thereafter, 100 cells were injected into the mammary fat pad of 10 week-old NOD/SCID mice (n=8; Charles River, France) and allowed to grow for up to 12 weeks. Up to 1000 unsorted cells were grafted as a positive control for cell viability and graft take. Tumor size was monitored by caliper measurements across 2 diameters (d) at regular intervals to calculate tumor volume (cm 3 ) = 4/3π [(dl+d2)/4] 3.
[00128] Cell culture
[00129] The ovarian cancer cell lines, IGROV1, HEYA8, PEA1, and the normal immortalized ovarian cell lines, OSEC2 and IOSE21, were all maintained in RPMI 1640 medium (Invitrogen, #11875-093) containing 10% fetal bovine serum (FBS). IGROV1, PEA1 and OSEC2 were obtained from Ovarian Cancer Action, Imperial College, London, UK, while IOSE21 was obtained from Professor Frances Balkwill, Institute of Cancer, Centre for Cancer and Inflammation, Barts and The London School of Medicine and Dentistry, London. HEYA8 was obtained from Professor Jean Paul Thiery, Institute of Molecular and Cell Biology, A*STAR, Singapore.
[00130] The human embryonic stem cell line, HES-3, was obtained from ES Cell International (ESI, Singapore) and cultured on matrigel coated organ culture dishes supplemented with conditioned medium from mouse feeders. Differentiation of hESC in vitro was induced as previously described.
[00131] The human embryonic kidney cell line (HEK293) and lung fibroblast cell line (IMR90) were obtained from the American Type Culture Collection (ATCC; Rockville, USA) and maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin and 2 mmol/L L-glutamine.
[00132] All cell lines were cultured at 37°C in a 5% CO2 incubator apart from the OSEC2 cell line which was kept at 33°C. The cell lines, IGROV1, PEA1, OSEC2 and IOSE21, were shown to be identical to those received based on DNA methylation pattern analyzed within one month of use and the methylation patterns showed close similarity between samples from the same patient. Otherwise, no other authentication was carried out.
[00133] Analysis and isolation of ovarian CSCs by FACS
[00134] All flow cytometric experiments were conducted on a FACS Aria fluorescence- activated cell sorter (Becton Dickinson, UK or FACS Calibur and analyzed using the Flowjo software (Tree Star, Inc., Ashland, USA). The SP cells were detected as previously described while Aldefluor-positive and -negative cells were detected as described in the manufacturer's instructions (STEMCELL Technologies Inc. ,#01700). For characterization of mAb clones, cells were incubated for 30 minutes with each mAb clone (150 μΐ^ culture supernatant or 5 μg purified mAb in 200 1% BS A/PBS) or with mAb against human clathrin (CHCl; BD Transduction Laboratories, #610499). Cells were then further incubated for 15 minutes with a 1:500 dilution of goat a-mouse antibody fluorescein isothiocyanate (FITC)-conjugated (DAKO, #F0479). 1.25 mg/mL propidium iodide (PI) was added 5 minutes before analysis/sorting. As a negative control, cells were stained with secondary FITC-conjugated antibody only. All incubations for characterization studies were performed at 4°C. For co- staining of cells with TAG-OCS 1 and the Hoechst dye, Hoechst labeling was performed first, followed by labeling with TAG-OCS 1 as described earlier. Once stained, cells were maintained at 4°C until analysis (within 1 hour). Compensation was carried out by analyzing singly stained samples using the Flowjo software.
[00135] Quantitative real time polymerase chain reaction analysis (RT-qPCR)
[00136] Total RNA was isolated using the RNeasy Mini kit (Qiagen, #74104). 2 μg RNA was then reverse transcribed using oligo(dT) primers and MMLV RT (Invitrogen, #28025- 013) to obtain cDNA. Thereafter, the SYBR® Green reagent or Taqman primers were added according to the manufacturers' instructions. (Gene assay IDs in Tables 2 and 3). All RT- qPCR experiments were performed on an AB 1-7000 Real Time PCR machine according to the manufacturers' instructions. The expressions of the abovementioned genes were normalized using the endogenous gene, GAPDH.
[00137] Table 2. Primers for CHC1 gene
Figure imgf000030_0001
[00138] Table 3. Gene expression assays for the TaqMan system. The gene expression assays were selected from the Applied Biosystems website (http ://www . appliedbiosy stems .com. sg/) .
Gene TaqMan gene expression assay ID
PIAS2 Hs00915227_m1
SOS2 Hs0018331 1_m1
BMI1 Hs0018041 1_m1
ABCB1 Hs01067802_m1 ALDH1 A1 Hs00167445_m1
CD133 Hs01009261_m1
18S Hs03928990_g1
GAPDH Hs99999905_m1
[00139] Immunoprecipitation
[00140] IGROV1 membrane protein extracts were obtained using the ProteoJET Membrane Protein Extraction Kit (Fermentas Inc., #K0321) according to the manufacturer's instructions and thereafter used for immunoprecipitation (IP). Briefly, rabbit antibody conjugated with biotin was captured onto a Streptavidin Phytip column (5 μΐ. of resin beads). The column was functionalized with either TAG-OCS 1 or the commercially-available CHC1 antibody (BD Transduction Laboratories, #610499). Clarified membrane protein extracts were then passed through the column. After washing away unbound proteins with Wash Buffer I (10 mM NaH2PO4/140 mM NaCl pH 7.4), bound proteins were eluted at low pH with Elution Buffer (200 mM NaH2PO4/140 mM NaCl pH 2.5) and neutralized immediately with 1 M Tris-Cl pH 9.0. IP of the antigen was carried out using the automated Phynexus MEA system (Phynexus, Inc., San Jose, CA,) according to the manufacturer's instructions.
[00141 ] SDS PA GE, Western Blot analysis
[00142] SDS-PAGE and Western blotting were performed by the methods of Laemmli and Towbin respectively. The membrane was immunoblotted overnight at 4°C with TAG-OCS 1 culture supernatant or mouse mAb to human CHC1 followed by horseradish peroxidase- conjugated goat anti-mouse antibodies (1:10000 dilution, DAKO). Binding of HRP- conjugated secondary antibodies was visualized by Immobilon Western Chemiluminescent HRP Substrate (Millipore, #WBKLS0500). Silver staining was performed using SilverQuest silver staining kit (Life technologies, #LC6070) according to the manufacturer's instructions and the protein band corresponding to the band on the Western Blot was manually excised for mass spectrometry (MS) analysis.
[00143] In-gel digestion and MS analysis
[00144] Excised protein bands were treated before MS analysis. Briefly, the bands were soaked overnight at 4°C in washing solution (2.5 mM ammonium bicarbonate in 50% acetonitrile) followed by a 20 minute incubation at 37°C after a change of wash solution. They were then dried, reduced with dithiothreitol and alkylated with iodoacetamide before trypsin digestion. The extracted peptides were analyzed using QSTAR quadrupole-time of flight tandem MS (ABI/MDS-Sciex). Proteins were identified by searching raw files against the human subset of UniProt database (EBI) using the Mascot search engine (Matrix Science). Only protein identities with 95% probability matches and 2 matched peptide fragments were considered.
[00145] Alamar Blue assay
[00146] AlamarBlue® dye (Invitrogen, #DAL1025) was purchased commercially and the assay was performed according to the manufacturer's instructions (9,10). Briefly, 5000 cells were seeded in each well of a 96-well plate in their appropriate growth culture medium as described earlier and allowed to attach overnight. 30
Figure imgf000032_0001
of purified mAb at a final concentration of 200 μg was then added to each well. At the end of 72 hours, 10 μΐ^ of alamarBlue® was added to each well. The plate was further incubated at 37°C for 30 minutes and subsequently analyzed using a fluorescence plate reader (TECAN Infinite M200; Tecan Group Ltd.) at an excitation wavelength of 545nm and emission wavelength of 590nm.
[00147] XCELLigence
[00148] Experiments involving the xCELLigence system (Roche Applied Science) was performed according to the manufacturer's instructions. Briefly, 80 iL of cell culture media at room temperature was added into each well of an E-plate 96. The E-plate 96 was then connected to the system and placed in the cell culture incubator for proper electrical-contacts as well as measurement of background impedance. Thereafter, 100 μΐ^ of each cell suspension at 12500 cells/mL was added to the medium-containing wells on the E-plate 96. After seeding, proliferation, attachment and spreading of the cells were monitored every 15 minutes by the xCELLigence system. Approximately 24, 96 and 168 hours after seeding, 20 μL· of purified TAG-OCS 1 at a final concentration of 100 μg was added to the cells at each time point. Cell culture media only were added to controls. All experiments were run for 180 hours. The electrical impedance, which provides quantitative information about the biological status of the cells, was measured by the RTCA-integrated software of the xCELLigence system as a dimensionless parameter termed cell index (CI).
[00149] CDC experiments [00150] 5000 cells in 90 μΐ^ of non -phenol red culture media per well were plated onto a 96-well plate. Thereafter, increasing concentrations of TAG-OCS 1 were added to wells which contained either active or heat-inactivated human serum (Quidel, #A100). 100 μΐ^ of culture media served as background control for this experiment. Thereafter, lactate dehydrogenase (LDH) activity in all the wells was measured to determine cell viability using a CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, #G1780), according to the manufacturer's instructions. All conditions were performed in triplicates.
[00151] ADC experiments
[00152] 5000 cells in 90
Figure imgf000033_0001
of culture media per well were plated onto opaque-walled 96- well plates and allowed to attach to the wells overnight. Thereafter, 0.1
Figure imgf000033_0002
of TAG-OCS 1 (1 mg/mL) and anti-M-ZAP (0.27 mg/mL) (Cat No. IT-30 Advanced Targeting Systems, San Diego, USA) were added to the test wells. The plate was then incubated for 72 hours before cytotoxicity assays were performed using the Cell Titer-Glo Luminescent Cell Viability Assay (Promega, #G757) according to the manufacturer's instructions. Controls for this experiment were buffer only, anti-M-ZAP only, and TAG-OCS 1 only. All conditions were performed in triplicates.
[00153] Statistics
[00154] Statistical analyses were performed using 2-tailed Student's t test. Error bars represent standard error of mean unless otherwise stated. P < 0.05 was considered significant.
[00155] Study approval
[00156] Animal experiments were performed in accordance with The National Advisory Committee for Laboratory Animal Research guidelines (Biopolis Institutional Animal Care and Use Committee approval 050,049). [00157] EXAMPLE 1
[00158] Isolation of ovarian CSCs displaying stem cell-like characteristics
[00159] Two functional methods, Hoechst dye and Aldefluor activity assay, were used in our study for the detection of putative stem cell populations in the ovarian cancer cell lines, IGROVl, HEYA8 and PEAl. Both methods were successful in detecting subpopulations of cells in all three cell lines (Table 4). As shown in Figure 1A (right), Hoechst 33342 labeling of IGROVl identified a 'tail' of side population (SP) cells, with Hoechst efflux characteristics identical to SP cells previously defined as hematopoietic stem cells. The presence of this SP population was completely abolished by the transporter blocker, verapamil (Fig. 1A, left). Similarly, the Aldefluor activity assay yielded Aldefluor-positive populations which showed up distinctively on flow cytometry plots. Incubation of cells with BAAA in the absence of the enzyme inhibitor, DEAB, induced a shift in BAAA fluorescence, defining the Aldefluor-positive population (Fig. IB, right), while addition of DEAB abolished this effect (Fig. IB, left).
Table 4. Both functional assays were successful in detecting subpopulations of all three ovarian cancer cell lines.
Figure imgf000034_0001
[00161] The newly identified subpopulations in the IGROV1 ovarian cancer cell line detected using both the Hoechst and Aldefluor assays were then sorted and tested for their CSC properties, including the expression of reported stem cell markers, proliferative behavior, and invasive capabilities. As shown in Figure 2A, RT-qPCR analyses demonstrated the upregulated mRNA expression of reported stem cell markers, specifically PIAS2, SOS2, KI67, BMI1, ABCG2, and CD133, in SP cells when compared to non-SP NSP cells. Among investigated stem cell markers, the ABCBl mRNA expression level showed the largest increase of 41.25-fold, as would be expected by the Hoechst dye uptake selection assay. Similarly, mRNA expression of stem cell markers were upregulated in Aldefluor-positive populations, with CD133 showing the highest extent of upregulation (5-fold increase) in its expression level (Fig. 2B). Anchorage-independent colony forming spheroid assays showed increased numbers and sizes of spheroid in the SP (Fig. 2C) and Aldefluor-positive populations (Fig. 2D) when compared to their respective counterparts. It was further observed that the largest colonies (>64 cells) were more abundantly formed in the SP and Aldefluor- positive populations. Finally, SP cells demonstrated a 7-fold increase in invasiveness when compared to NSP (Fig. 2E) while the Aldefluor-positive cells were 4-fold more invasive compared to the Aldefluor-negative cells (Fig. 2F). Based on these results, it was concluded that both the Hoechst and Aldefluor assay methods were able to convincingly detect distinct subpopulations of cells with CSC characteristics in the IGROV1 ovarian cancer cell line.
[00162] EXAMPLE 2
[00163] Generation ofmAbs specific to ovarian CSCs
[00164] As there have been a number of studies describing potential toxicity and gene expression effects with the Hoechst dye, IGROV1 ovarian CSCs were chosen for isolation using the Aldefluor activity assay for the generation of mAbs. Isolated populations of Aldefluor-positive ovarian tumor IGROV1 cells were first injected into female BALB/c mice. Subsequently, a two-step screening process was carried out to select for mAbs which showed reactivity towards subpopulations of cells in the ovarian cancer and hESC cell lines but not towards the differentiated IMR90 and HEK293 cell lines. In the first step of screening, generated in-house mAbs were tested by flow cytometry analysis for their reactivity towards isolated Aldefluor-positive cells from the IGROV1 cell line. Identified positive antibody clones were then taken through to the secondary step of screening where they were tested for their reactivity towards the IGROV1 unsorted cell line and four other control cell lines - PEA1, human embryonic stem cell (hESC), IMR90 and HEK293. An example of a positive clone, TAG-OCS l, is shown in Figure 3 A. Further immunocytochemistry experiments showed reactivity of TAG-OCS l towards subpopulations of IGROV1 cells, thereby confirming flow cytometry results (Fig. 3B). In total, 34 clones which fulfilled our selection criteria were identified.
[00165] Interestingly, it was observed that co-labeling of one of the positive antibody clones, TAG-OCS l, with Hoechst dye, revealed a population of SP and TAG-OCS l -positive cells (Fig. 4A) in flow cytometry experiments. It was previously reported that SP cells were found to overlap with the Aldefluor-positive cell population in human cord blood and bone marrow cells. Thus, cells isolated by a combination of Hoechst dye and TAG-OCS l could similarly represent a specific distinct subset of stem cells. Also, while TAG-OCS l showed strong reactivity to hESCs, this reactivity was absent in differentiated hESC-derived embryoid bodies (EBs) (Fig. 4B). This strong reactivity of TAG-OCS l towards hESCs was further confirmed by immunocytochemistry experiments (Fig. 4C), which suggests that the antibody may be targeting pluripotent cell types. Furthermore, TAG-OCS l did not react with cells from the normal ovarian cell lines, OSEC2 and IOSE21 (Fig. 4D). Together, the data showed that TAG-OCS l recognizes a CSC subpopulation and we sought to further characterize TAG-OCS l and the subpopulation of cells detected by TAG-OCS l in ovarian tumor cells. [00166] EXAMPLE 3
[00167] TAG-OCSl detects subpopulations which exhibit tumor stem cell-like characteristics
[00168] The mRNA expression of ABCB1 and CD133 in TAG-OCS l -selected cells was first examined (Fig. 5A), as these have been previously reported as markers of ovarian CSCs. The mRNA expression of both stem cell markers were upregulated (n=3) in TAG-OCS 1- positive populations by 10.8-fold and 2.8-fold respectively. It has previously been shown that ABCB1 was consistently overexpressed in SP compared to NSP from patients' tumor cells. Furthermore, a higher percentage SP was observed in ascites from ovarian cancer patients that have relapsed following chemotherapy compared to chemonaive patients. Other studies performed in vitro have also attributed resistance to chemotherapeutic drugs to an overexpression of ABCB1. Hence, it is possible that TAG-OCS l -positive cells exert a drug- resistance mechanism which may in part be mediated by expression of various ATP-binding cassette (ABC) transporters. The CD133 marker had previously been found to be present on cells which possess cancer-initiating cell characteristics in ovarian tissues. CD133 expression in ovarian cancer has also been found to be directly regulated by epigenetic modifications. Furthermore, methylation of the CD 133 promoter may be representative of epigenetic repression of other pluripotency-associated genes. These studies support our findings where the CD133 marker may demarcate TAG-OCSl -positive cells as a CSC population in ovarian cancer.
[00169] As the initial panel of mAbs was raised against Aldefluor-positive cells, mRNA expression levels of the ALDH1A1 gene between TAG-OCS l -positive and -negative populations was also tested. As shown in Figure 5A, ALDH1A1 was highly upregulated (65.5-fold) in TAG-OCS l -positive populations. RT-qPCR experiments were repeated on the HEYA8 ovarian cancer cell line where upregulation of all 3 stem cell markers was again observed (Fig.5B). Furthermore, anchorage independent spheroid assays revealed increased sizes and numbers of colonies in TAG-OCS l -positive IGROV1 populations (Fig. 5C; Fig. 8). These observations are in line with CSCs in malignant brain tumors which were reported as having more proliferative capacity than stem/progenitor cells in benign brain tumors. Moreover, TAG-OCS l -positive cells demonstrated a 3.9-fold increase in invasiveness compared to the TAG-OCS l -negative cells from the IGROVl ovarian cancer cell line (Fig. 5D). This increased invasiveness of CSCs possibly relates to aggressiveness in tumors, as suggested by a previous study where putative ovarian CSCs were found to form more aggressive tumor xenografts at a lower inoculum compared to their non CSC-progeny.
[00170] Although the in vitro experiments established CSC characteristics of the TAG- OCS l-positive population, validation of a CSC tumor-initiating cell population involves growth from low cell numbers of the human tumor in an immunodeficient mouse. Therefore, TAG-OCS l -positive and -negative cells were isolated and injected at low cell doses into the mammary fat pad of NOD/SCID mice. As shown in Figure 5E, differential tumor formation was observed where IGROVl TAG-OCS l -positive cells produced larger tumors over the duration of the experiment when compared to the TAG-OCS l -negative cells. Therefore, populations detected by TAG-OCS l fulfilled accepted criteria as ovarian tumor- initiating cells.
[00171] EXAMPLE 4
[00172] Target antigen of TAG-OCSl is determined as clathrin heavy chain
[00173] Immunoprecipitation (IP) of membrane protein extracts from IGROVl cells and subsequent Western blotting with TAG-OCS l revealed an antigen band of ~180kDa (data not shown). The corresponding band on a silver- stained gel was isolated and identified by mass spectrometry. From protein database search with the peptides obtained, the antigen band was identified as clathrin heavy chain (CHC1; Accession No 000592) (Table 5). In order to validate that the antigen target was indeed CHC1, immunoprecipitation (IP) with TAG-OCS l was repeated and the eluate from the column was probed with a commercially-available mAb to CHC1 (mAb-CHCl). Conversely, IP eluates of the commercial CHC1 antibody were resolved by SDS-PAGE and then probed with TAG-OCS l. As shown in Figure 6A, target antigen bands of identical sizes (~180kDa) were detected using both TAG-OCS l and the commercially-available mAb-CHCl, thereby confirming CHC1 as the target antigen of TAG- OCS 1. Further evidence was obtained from RT-qPCR experiments where CHC1 was upregulated in the TAG-OCS l -positive populations of two ovarian cancer cell lines. As shown in Figure 6B, CHC1 was upregulated by 6.9-fold and 2.9-fold in the IGROVl and HEYA8 TAG-OCS l -positive subpopulations respectively, compared to their TAG-OCS 1- negative counterparts.
[00174] Table 5. Mass spectrometry identification of the target antigen
Figure imgf000038_0001
[00175] Previously, CHC1 had only been detected in the cytoplasm and nucleus. However, since the in-house mAbs was raised against surface antigens, it was speculated that TAG- OCS l was detecting a novel epitope on the CHC1 molecule which was present on cell surfaces. This result was confirmed by immunocytochemistry experiments with TAG-OCS l and a commercial CHC1 antibody. As shown in Figure 6C (top), the commercial antibody appeared to stain intracellular CHC1 while TAG-OCSl detected cell surface CHC1 (bottom). Taken together with the earlier findings that cell subpopulations detected by TAG-OCS l demonstrate stem cell-like characteristics, it is highly possible that TAG-OCS l detects a novel epitope of CHC1 which is expressed on the cell surface of ovarian CSCs.
[00176] CHC1 is an essential component of the clathrin molecule which mediates a major endocytosis pathway. Interestingly, endocytic mechanisms are exhibited by both tumor- initiating and metastasizing cells where vesicular trafficking and subsequent degradation or re-assembly takes place after the disassembly of signaling and adhesion complexes. Thus, it has been suggested that factors involved in endocytosis possibly represent crucial targets of the processes driving tumor initiation and progression.
[00177] Furthermore, CHC1 overexpression has been observed in primary tumors of hepatocellular carcinoma (HCC) patients where immunostaining revealed strong and scattered staining throughout the cytoplasm and plasma membranes. Based on this study, it is believed that TAG-OCS l could potentially be useful in distinguishing early ovarian cancer from benign tumors as well as enable the early diagnosis of ovarian cancer for improved prognosis. This was confirmed by staining of ovarian clinical samples by TAG-OCS l (Figure 6D to 6F). EpCAM-positive patient ascites and patient ovarian tumour sections showed positive staining by TAG-OCS l (Figure 6D and 6E). In addition, patient tumour microarray (TMA) sections showed positive staining by TAG-OCS l while normal ovary sections did not exhibit any staining by TAG-OCS l (Figure 6F). TMA sections were stained with 2 μg/mL TAG-OCS l for 10 minutes. Incubation was with 2% H2O2, with a buffer of pH6 and a 30 minute serum blocking step.
[00178] A number of reports have also indicated the significance of deregulated CHCl expression in tumorigenesis. The presence of CHCl has been linked with the hallmarks of cancer such as apoptosis where overexpression of CHCl potentially hinders the activation of caspases via competition, thereby allowing the evasion of apoptosis by cancer cells. Other studies suggest the involvement of CHCl in the absorption of certain molecules such as integrins which results in increased carcinoma cell motility and invasion. Therefore, CHCl is likely to be involved in activating proliferation and invasion pathways, which in turn contributes to increased tumor aggressiveness. The data support these observations in that ovarian CSCs detected by TAG-OCS l demonstrated increased proliferative and invasive properties (Fig. 5C and D). Other groups have reported the increased expression of CHCl in drug-resistant cancer cell lines. For example, compared to their drug-susceptible parental cell line, a higher abundance of CHCl was observed in the basolateral membranes of mitroxantrone-resistant MCF7 cells. CHCl was also significantly increased in paclitaxel- resistant ovarian cancer cells, where a role for this protein in the prediction of drug resistance was suggested. Furthermore, in a taxol-resistant head and neck cancer cell line which overexpressed ABCB 1, increased levels of CHCl were speculated to contribute to chemoresistance processes through clathrin-mediated endocytosis and recycling of ABCB 1. As the findings show that populations detected by TAG-OCS l similarly overexpress ABCB 1, the upregulation of CHCl in these populations may therefore imply increased chemoresistance in ovarian cancer.
[00179] Although intracellular CHCl has been reported to be ubiquitously expressed by eukaryotic cells, the TAG-OCS l antibody recognizes a novel epitope of CHCl which resides on the surface of ovarian CSCs. The earlier data also showed that TAG-OCS l did not bind to cells in normal ovarian cell lines (Fig. 4D). Thus, it is possible that CSCs in tumor tissues express both surface and intracellular CHCl while normal tissues express the antigen intracellularly only. [00180] EXAMPLE 5
[00181] TAG-OCSl alone exhibits in vitro cytotoxicity
[00182] Cell viability assays were performed using both the Alamar Blue reagent and the xCELLigence system to investigate possible cytotoxic effects of TAG-OCS l towards different cells, including IGROVl ovarian cancer cells, CHI ovarian cancer cells, EVIR90 lung fibroblast cells, MCF7 breast cancer cells and 786-0 kidney cancer cells. Data obtained showed that incubation of cells with TAG-OCS l resulted in a decrease in cell viability of IGROVl cells in both the Alamar Blue and xCELLigence experiments (Fig. 7A). In support of this finding, microscopic images revealed fewer IGROVl cells in wells which contained TAG-OCS l compared to the control wells (Fig. 7B). The IMR90 lung fibroblast cell line which TAG-OCS l did not bind to in FACS experiments (Fig. 3A) was used as a negative control. As shown in Fig. 9, viability of IMR90 cells was not affected by the addition of TAG-OCS l. Data obtained showed that incubation of cells with TAG-OCS l did not result in a decrease in cell viability of CHI ovarian cancer cells in both the Alamar Blue and xCELLigence experiments (Fig. 7C). Data obtained from flow cytometry experiments revealed that TAG-OCS l binds and kills MCF7 breast cancer cells (Fig. 7D) while flow cytometry experiments show that TAG-OCS l binds to 15% of the IGROVl ovarian cancer cell line, 87.5% of 786-0 cells (kidney cancer cell line) and 92.1% of MCF7 cells (breast cancer cell line). Furthermore, TAG-OCS l confers cytotoxicity towards MCF7 cells (Fig. 7E).
[00183] EXAMPLE 6
[00184] TAG-OCSl mediates CDC and functions as an ADC
[00185] As complement is one of the most potent cell killing systems, this study also sought to investigate whether TAG-OCS l was effective in complement-mediated cell killing. As shown in Figure 6C, at a concentration of as low as 1 μg/mL, TAG-OCS l mediated CDC of around 72% and 64% in IGROVl and PEA1 cells respectively. Maximum CDC achieved in IGROVl and PEA1 cells were 75.5% and 73% respectively. Finally, since conjugation to cytotoxic agents can enhance the antitumor activity of antibodies and improve the selectivity of chemotherapy, the efficiency of TAG-OCS l when used as a vehicle for the specific delivery of toxins, such as the ribosome-inactivating protein, saporin, to CHC1 -expressing ovarian cancer cells was determined. Compared to controls, the mAb-ZAP complex exhibited specific cytotoxicity towards IGROV1 and PEA1 ovarian tumor cells (Fig. 7F, 71, Fig. 10), as well as towards 786-0 kidney cancer cells (Fig. 7G) and MCF7 breast cancer cells (Fig. 7H, 7J). It is important to note that, as shown earlier in Figures 7A and 7B, TAG-OCS 1 possesses independent cytotoxic effects in vitro, but only at concentrations higher than those used in this assay. In view of this finding, developing TAG-OCS 1 into a cytotoxic antibody-drug conjugate (ADC) in future may result in the elimination of cells which express CHC1 on the surface while sparing normal cells which express intracellular CHC1. Moreover, a baseline level of target antigen expression in normal tissues may be tolerable and resultant potential toxicities may depend on the relative ratio between tumor and normal expression levels. Successful examples of similar ADCs include ado-trastuzumab emtansine and Brentuximab vedotin, a CD30-specific ADC. Therefore, it was speculated that surface membrane overexpression of CHC1 in tumor cells provides an opportunity to deliver the appropriate dose of a cytotoxic TAG-OCS 1 ADC such that only ovarian tumor cells are targeted and killed while leaving normal cells unharmed. Furthermore, it may be possible to potentiate the cytotoxic properties of TAG-OCS 1 on target cells by linking it to other drugs such as paclitaxel, which will aid in bypassing multiple drug resistance mediated by the p- glycoprotein pumps. [00186] EXAMPLE 7
[00187] The monoclonal antibody TAG-OCS 1 described thus far is an IgM antibody. However, a chimeric TAG-OCS 1 (IgG) antibody was also generated using general methods known in the art and analysed. Briefly, the variable region of the antibody was cloned from the mouse hybridoma, then cloned into a construct (protein expression vector) with the constant region of a human IgGl. The chimeric TAG-OCS 1 was then expressed in a CHO cell line (in house) and purified.
[00188] Flow cytometry experiments show that chimeric TAG-OCS 1 successfully binds to the 786-0 kidney cancer cell line and MCF7 breast cancer cell line at a level which is comparable to the original IgM molecule (Fig. 12A and 12B). Chimeric TAG-OCS 1 also confers cytotoxicity towards MCF7 cells. [00189] Through the antibody-drug conjugate (ADC) assay, chimeric TAG-OCS 1 (at levels of lOOng/well and 200ng/well) is shown to exhibit ADC cytotoxicity towards IGROV1 (Fig. 12C) and PEA1 (Fig. 12D) ovarian cancer cells, after an incubation time of 72 hrs.
[00190] This is the first report of an antibody targeting CHC1 on the surface membrane of ovarian CSCs with drug-resistant and stem cell-like characteristics. TAG-OCS 1 may be used to directly detect CHC1, either alone or in combination with other cancer markers, thereby allowing for the screening of early stage ovarian cancer at mass level. MAb also mediates CDC in vitro and further development of TAG-OCS 1 as an ADC could prove to be highly valuable for immunotherapy of recurrent, chemoresistant disease. Taken together, our findings show that TAG-OCS 1 represents a novel diagnostic and possible therapeutic agent with enhanced specificity against CSCs in ovarian cancer.

Claims

Claims
1 An antigen-binding protein, or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GFSLSRYGVY (SEQ ID NO: 5); a VHCDR2 having the amino acid sequence VIWAVGSTNYNSALMS (SEQ ID NO: 6), and a VHCDR3 having the amino acid sequence DREYGYGLAY (SEQ ID NO: 7); and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence SASSSVSYIH (SEQ ID NO: 8), a VLCDR2 having the amino acid sequence DTSNLAS (SEQ ID NO: 9), and a VLCDR3 having the amino acid sequence FQGSGYPLT (SEQ ID NO: 10).
2, The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 1, comprising heavy and light chain CDR regions that are about 80% identical to the heavy and light chain CDR regions of (i) and (ii).
3, The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 1, wherein the heavy chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 1.
4 The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 3, comprising a heavy chain variable region which comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: l.
5, The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 1, wherein the light chain variable region comprises the amino acid sequence set forth in SEQ ID NO:2.
6 The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 5, comprising a light chain variable region which comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO:2.
7. The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in any one of claims 1 to 6, wherein the antigen binding protein is selected from the group consisting of monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, a single chain antibody, a univalent antibody lacking a hinge region, a minibody, diabodies, and Tandabs™.
8. The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 7, wherein the binding protein is a monoclonal antibody.
9. The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 8, wherein the monoclonal antibody is TAG-OCS 1.
10. The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 8 or claim 9, wherein the monoclonal antibody is humanised.
11. The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in any one of claims 1 to 10, wherein the antigen-binding protein, or an antigen-binding fragment thereof, binds to clathrin.
12. The antigen-binding protein, or an antigen-binding fragment thereof, as claimed in claim 11, wherein the antigen-binding protein, or an antigen-binding fragment thereof binds to clathrin heavy chain 1 (CHC1).
13. An antigen-binding protein, or an antigen-binding fragment thereof, or an antigen- binding fragment thereof, that competes with the antigen binding protein as claimed in any one of claims 1 to 12 for binding to CHC1.
14. An antigen-binding protein, or an antigen-binding fragment thereof, as claimed in any one of claims 1 to 13, comprising a radioisotope or a cytotoxin conjugated thereto.
15. The antigen -binding protein, or an antigen-binding fragment thereof, as claimed in claim 14, wherein the antibody is conjugated with 90Y, saporin, mertansine (DM1), or monomethyl auristatin E (MMAE).
16. A composition comprising a physiologically acceptable carrier and a therapeutically effective amount of the antigen-binding protein, or an antigen-binding fragment thereof, as claimed in any one of claims 1 to 15.
17. The composition as claimed in claim 16, wherein the composition comprises a further active pharmaceutical ingredient selected from bevacizumab, carboplatin or paclitaxel.
18. Use of an antigen -binding protein, or an antigen-binding fragment thereof, as claimed in any one of claims 1 to 15, in the manufacture of a medicament for treating cancer.
19. Use of claim 18, wherein the cancer is selected from kidney, breast or ovarian cancer.
20. Use of claims 18 or 19, wherein the medicament is to be administered with a further active pharmaceutical ingredient.
21. Use of claim 20, wherein the further pharmaceutical ingredient is to be administered separately, simultaneously or sequentially.
22. A method for detecting cancer in a subject, the method comprising: contacting a sample obtained from the subject with an antigen-binding protein, or an antigen- binding fragment thereof as claimed in any one of claims 1 to 15 in vitro; detecting the binding of the antigen-binding protein, or an antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample is indicative of cancer.
23. The method according to claim 22, wherein the control sample is from the same subject.
24. The method according to claim 22, wherein the control sample is from a different subject.
25. The method according to any one of claims 22 to 24, wherein the antigen-binding protein, or an antigen-binding fragment thereof, binds CHC1.
26. The method according to any one of claims 22 to 25, wherein the antigen-binding protein, or an antigen-binding fragment thereof, comprises a detectable label.
27. The method according to claim 26, wherein the detectable label is selected from biotin, alkaline phosphatase, horseradish peroxidase, FITC, PE or Cy Dyes.
28. The method according to claims 26 or 27, wherein the detectable label is detected in an assay selected from flow cytometry, tissue section or immunohistochemistry.
29. The method as claimed in any one of claims 22 to 28, wherein the cancer is selected from kidney, breast or ovarian cancer.
30. A method for treating cancer in a subject comprising administering a therapeutically effective amount of an antigen-binding protein, or an antigen-binding fragment thereof as claimed in any one of claims 1 to 15 to a subject in need thereof.
31. The method of claim 30, wherein the cancer is selected from kidney, breast or ovarian cancer.
32. A kit when used in the method of any one of claims 22 to 31, comprising an antigen- binding protein, or an antigen-binding fragment thereof as claimed in any one of claims 1 to 15, together with instructions for use.
PCT/SG2016/050032 2015-01-23 2016-01-25 Cancer specific antigen-binding proteins Ceased WO2016118090A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG10201500571P 2015-01-23
SG10201500571P 2015-01-23

Publications (1)

Publication Number Publication Date
WO2016118090A1 true WO2016118090A1 (en) 2016-07-28

Family

ID=56417485

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2016/050032 Ceased WO2016118090A1 (en) 2015-01-23 2016-01-25 Cancer specific antigen-binding proteins

Country Status (1)

Country Link
WO (1) WO2016118090A1 (en)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018039274A1 (en) * 2016-08-22 2018-03-01 CHO Pharma Inc. Antibodies, binding fragments, and methods of use
US9975965B2 (en) 2015-01-16 2018-05-22 Academia Sinica Compositions and methods for treatment and detection of cancers
US9981030B2 (en) 2013-06-27 2018-05-29 Academia Sinica Glycan conjugates and use thereof
US9982041B2 (en) 2014-01-16 2018-05-29 Academia Sinica Compositions and methods for treatment and detection of cancers
US10005847B2 (en) 2014-05-27 2018-06-26 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
US10023892B2 (en) 2014-05-27 2018-07-17 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10086054B2 (en) 2013-06-26 2018-10-02 Academia Sinica RM2 antigens and use thereof
US10087236B2 (en) 2009-12-02 2018-10-02 Academia Sinica Methods for modifying human antibodies by glycan engineering
US10111951B2 (en) 2013-09-06 2018-10-30 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US10118969B2 (en) 2014-05-27 2018-11-06 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10119972B2 (en) 2014-03-27 2018-11-06 Academia Sinica Reactive labelling compounds and uses thereof
US10130714B2 (en) 2012-04-14 2018-11-20 Academia Sinica Enhanced anti-influenza agents conjugated with anti-inflammatory activity
US10150818B2 (en) 2014-01-16 2018-12-11 Academia Sinica Compositions and methods for treatment and detection of cancers
US10214765B2 (en) 2012-08-18 2019-02-26 Academia Sinica Cell-permeable probes for identification and imaging of sialidases
US10274488B2 (en) 2008-07-15 2019-04-30 Academia Sinica Glycan arrays on PTFE-like aluminum coated glass slides and related methods
US10317393B2 (en) 2007-03-23 2019-06-11 Academia Sinica Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells
US10336784B2 (en) 2016-03-08 2019-07-02 Academia Sinica Methods for modular synthesis of N-glycans and arrays thereof
US10338069B2 (en) 2010-04-12 2019-07-02 Academia Sinica Glycan arrays for high throughput screening of viruses
US10495645B2 (en) 2015-01-16 2019-12-03 Academia Sinica Cancer markers and methods of use thereof
US10533034B2 (en) 2014-09-08 2020-01-14 Academia Sinica Human iNKT cell activation using glycolipids
US11332523B2 (en) 2014-05-28 2022-05-17 Academia Sinica Anti-TNF-alpha glycoantibodies and uses thereof
US11377485B2 (en) 2009-12-02 2022-07-05 Academia Sinica Methods for modifying human antibodies by glycan engineering

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130084298A1 (en) * 2011-10-04 2013-04-04 Academia Sinica Novel anti-clathrin heavy chain monoclonal antibody for inhibition of tumor angiogenesis and growth and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130084298A1 (en) * 2011-10-04 2013-04-04 Academia Sinica Novel anti-clathrin heavy chain monoclonal antibody for inhibition of tumor angiogenesis and growth and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BRODSKY F.M.: "Clathrin structure characterized with monoclonal antibodies. I. Analysis of multiple antigenic sites.", J CELL BIOL, vol. 101, no. 6, 1 December 1985 (1985-12-01), pages 2047 - 2054 *
LOUVARD D. ET AL.: "A monoclonal antibody to the heavy chain of clathrin.", EMBO J, vol. 2, no. 10, 1983, pages 1655 - 1664 *
SEIMIYA M. ET AL.: "Identification of novel immunohistochemical tumor markers for primary hepatocellular carcinoma; clathrin heavy chain and formiminotransferase cyclodeaminase.", HEPATOLOGY, vol. 48, no. 2, 15 April 2008 (2008-04-15), pages 519 - 530 *
TUNG K-H. ET AL.: "CHC promotes tumor growth and angiogenesis through regulation of HIF-1 alpha and VEGF signaling.", CANCER LETT, vol. 331, no. 1, 7 December 2012 (2012-12-07), pages 58 - 67 *

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10317393B2 (en) 2007-03-23 2019-06-11 Academia Sinica Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells
US10274488B2 (en) 2008-07-15 2019-04-30 Academia Sinica Glycan arrays on PTFE-like aluminum coated glass slides and related methods
US10087236B2 (en) 2009-12-02 2018-10-02 Academia Sinica Methods for modifying human antibodies by glycan engineering
US11377485B2 (en) 2009-12-02 2022-07-05 Academia Sinica Methods for modifying human antibodies by glycan engineering
US11267870B2 (en) 2009-12-02 2022-03-08 Academia Sinica Methods for modifying human antibodies by glycan engineering
US10338069B2 (en) 2010-04-12 2019-07-02 Academia Sinica Glycan arrays for high throughput screening of viruses
US10130714B2 (en) 2012-04-14 2018-11-20 Academia Sinica Enhanced anti-influenza agents conjugated with anti-inflammatory activity
US10214765B2 (en) 2012-08-18 2019-02-26 Academia Sinica Cell-permeable probes for identification and imaging of sialidases
US10086054B2 (en) 2013-06-26 2018-10-02 Academia Sinica RM2 antigens and use thereof
US9981030B2 (en) 2013-06-27 2018-05-29 Academia Sinica Glycan conjugates and use thereof
US10918714B2 (en) 2013-09-06 2021-02-16 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US10111951B2 (en) 2013-09-06 2018-10-30 Academia Sinica Human iNKT cell activation using glycolipids with altered glycosyl groups
US10150818B2 (en) 2014-01-16 2018-12-11 Academia Sinica Compositions and methods for treatment and detection of cancers
US9982041B2 (en) 2014-01-16 2018-05-29 Academia Sinica Compositions and methods for treatment and detection of cancers
US10119972B2 (en) 2014-03-27 2018-11-06 Academia Sinica Reactive labelling compounds and uses thereof
US11319567B2 (en) 2014-05-27 2022-05-03 Academia Sinica Fucosidase from bacteroides and methods using the same
US10618973B2 (en) 2014-05-27 2020-04-14 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
US10005847B2 (en) 2014-05-27 2018-06-26 Academia Sinica Anti-HER2 glycoantibodies and uses thereof
US10118969B2 (en) 2014-05-27 2018-11-06 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US10023892B2 (en) 2014-05-27 2018-07-17 Academia Sinica Compositions and methods relating to universal glycoforms for enhanced antibody efficacy
US11332523B2 (en) 2014-05-28 2022-05-17 Academia Sinica Anti-TNF-alpha glycoantibodies and uses thereof
US10533034B2 (en) 2014-09-08 2020-01-14 Academia Sinica Human iNKT cell activation using glycolipids
US10495645B2 (en) 2015-01-16 2019-12-03 Academia Sinica Cancer markers and methods of use thereof
US9975965B2 (en) 2015-01-16 2018-05-22 Academia Sinica Compositions and methods for treatment and detection of cancers
US10336784B2 (en) 2016-03-08 2019-07-02 Academia Sinica Methods for modular synthesis of N-glycans and arrays thereof
US10538592B2 (en) 2016-08-22 2020-01-21 Cho Pharma, Inc. Antibodies, binding fragments, and methods of use
WO2018039274A1 (en) * 2016-08-22 2018-03-01 CHO Pharma Inc. Antibodies, binding fragments, and methods of use
TWI764917B (en) * 2016-08-22 2022-05-21 醣基生醫股份有限公司 Antibodies, binding fragments, and methods of use
CN109963868A (en) * 2016-08-22 2019-07-02 醣基生医股份有限公司 Antibodies, Binding Fragments and Methods of Use
CN109963868B (en) * 2016-08-22 2023-11-14 醣基生医股份有限公司 Antibodies, binding fragments and methods of use

Similar Documents

Publication Publication Date Title
WO2016118090A1 (en) Cancer specific antigen-binding proteins
US10836831B2 (en) Anti-PTK7 antibodies and methods of use
US9969798B2 (en) Modulators and methods of use
KR20240105455A (en) Combination therapy of claudin 18.2 antagonists and PD-1/PD-L1 axis inhibitors
US11306153B2 (en) Anti-AXL tyrosine kinase receptor antibodies and uses thereof
WO2017196263A1 (en) Anti-erbb-2 antibodies and uses thereof
HK40044653A (en) Novel modulators and methods of use
HK1234068A (en) Novel modulators and methods of use
HK1234068A1 (en) Novel modulators and methods of use
HK1191031A (en) Novel modulators and methods of use
HK1191031B (en) Novel modulators and methods of use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16740487

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16740487

Country of ref document: EP

Kind code of ref document: A1